Tuning the Electronic and Dynamical Properties of a Molecule by Atom Trapping Chemistry.

Science.gov (United States)

Pham, Van Dong; Repain, Vincent; Chacon, Cyril; Bellec, Amandine; Girard, Yann; Rousset, Sylvie; Abad, Enrique; Dappe, Yannick J; Smogunov, Alexander; Lagoute, Jérôme

2017-11-28

The ability to trap adatoms with an organic molecule on a surface has been used to obtain a range of molecular functionalities controlled by the choice of the molecular trapping site and local deprotonation. The tetraphenylporphyrin molecule used in this study contains three types of trapping sites: two carbon rings (phenyl and pyrrole) and the center of a macrocycle. Catching a gold adatom on the carbon rings leads to an electronic doping of the molecule, whereas trapping the adatom at the macrocycle center with single deprotonation leads to a molecular rotor and a second deprotonation leads to a molecular jumper. We call "atom trapping chemistry" the control of the structure, electronic, and dynamical properties of a molecule achieved by trapping metallic atoms with a molecule on a surface. In addition to the examples previously described, we show that more complex structures can be envisaged.

Spin Properties of Transition-Metallorganic Self-Assembled Molecules

International Nuclear Information System (INIS)

Yu, Zhi Gang

2010-01-01

This report summarizes SRI's accomplishments on the project, 'Spin Properties of Transition-Metallorganic Self-Assembled Molecules' funded by the Office of Basic Energy Sciences, US Department of Energy. We have successfully carried out all tasks identified in our proposal and gained significant knowledge and understanding of spin-polarized electronic structure, spin relaxation, and spin-dependent transport in transition-metallorganic molecules and enhohedral fullerenes. These molecules contain integrated spin and charge components and will enable us to achieve sophisticated functions in spintronics and quantum computing at molecular level with simple circuitry and easy fabrication. We have developed microscopic theories that describe the underlying mechanisms of spin-dependent porcesses and constructed quantitative modeling tools that compute several important spin properties. These results represent the basic principles governing the spin-dependent behaviors in nanostructures containing such molecules. Based on these results we have shown that novel device functions, such as electrically controlled g-factor and noninvasive electrical detection of spin dynamics, can be achieved in these nanostructures. Some of our results have been published in peer-reviewed journals and presented at professional conferences. In addition, we have established a close collaboration with experimentalists at Oxford University, UK (Dr. J. Morton and Prof. G. Briggs), Princeton University (Dr. A. Tyryshkin and Prof. S. Lyon), University of Delaware (Prof. E. Nowak), and University of California (Profs. R. Kawakami and J. Shi), who have been studying related systems and supplying us with new experimental data. We have provided our understanding and physical insights to the experimentalists and helped analyze their experimental measurements. The collaboration with experimentalists has also broadened our research scope and helped us focus on the most relevant issues concerning these

Thermodynamic Stability of Structure H Hydrates Based on the Molecular Properties of Large Guest Molecules

OpenAIRE

Tezuka, Kyoichi; Taguchi, Tatsuhiko; Alavi, Saman; Sum, Amadeu K.; Ohmura, Ryo

2012-01-01

This paper report analyses of thermodynamic stability of structure-H clathrate hydrates formed with methane and large guest molecules in terms of their gas phase molecular sizes and molar masses for the selection of a large guest molecule providing better hydrate stability. We investigated the correlation among the gas phase molecular sizes, the molar masses of large molecule guest substances, and the equilibrium pressures. The results suggest that there exists a molecular-size value for the ...

On structure of some laminated crystals with organic molecules

International Nuclear Information System (INIS)

Volodina, G.F.; Ivanova, V.Ya.; Malinovskij, T.I.

1982-01-01

A survey is made of papers dealing with intercalation of organic molecules into crystals of dihalcogenides of some transition metals (TaS 2 , TiS 2 , NbS 2 , ZrS 2 , TaSe 2 ), variation of their structure and physical properties. Among the used intercalates ammonia, pyridine, aniline and other aromatic amines proved to be most satisfactory from the viewpoint of reaction rate and product stability. A possibility is discussed of intercalation into PbI 2 and CdI 2 crystals that are of the same structural type as dihalcogenides

Spin Properties of Transition-Metallorganic Self-Assembled Molecules

Energy Technology Data Exchange (ETDEWEB)

Zhi Gang Yu

2010-06-30

This report summarizes SRI's accomplishments on the project, 'Spin Properties of Transition-Metallorganic Self-Assembled Molecules' funded by the Office of Basic Energy Sciences, US Department of Energy. We have successfully carried out all tasks identified in our proposal and gained significant knowledge and understanding of spin-polarized electronic structure, spin relaxation, and spin-dependent transport in transition-metallorganic molecules and enhohedral fullerenes. These molecules contain integrated spin and charge components and will enable us to achieve sophisticated functions in spintronics and quantum computing at molecular level with simple circuitry and easy fabrication. We have developed microscopic theories that describe the underlying mechanisms of spin-dependent porcesses and constructed quantitative modeling tools that compute several important spin properties. These results represent the basic principles governing the spin-dependent behaviors in nanostructures containing such molecules. Based on these results we have shown that novel device functions, such as electrically controlled g-factor and noninvasive electrical detection of spin dynamics, can be achieved in these nanostructures. Some of our results have been published in peer-reviewed journals and presented at professional conferences. In addition, we have established a close collaboration with experimentalists at Oxford University, UK (Dr. J. Morton and Prof. G. Briggs), Princeton University (Dr. A. Tyryshkin and Prof. S. Lyon), University of Delaware (Prof. E. Nowak), and University of California (Profs. R. Kawakami and J. Shi), who have been studying related systems and supplying us with new experimental data. We have provided our understanding and physical insights to the experimentalists and helped analyze their experimental measurements. The collaboration with experimentalists has also broadened our research scope and helped us focus on the most relevant issues

Molecular structure based property modeling: Development/ improvement of property models through a systematic property-data-model analysis

DEFF Research Database (Denmark)

Hukkerikar, Amol Shivajirao; Sarup, Bent; Sin, Gürkan

2013-01-01

models. To make the property-data-model analysis fast and efficient, an approach based on the “molecular structure similarity criteria” to identify molecules (mono-functional, bi-functional, etc.) containing specified set of structural parameters (that is, groups) is employed. The method has been applied...

Breaking Symmetry in Time-Dependent Electronic Structure Theory to Describe Spectroscopic Properties of Non-Collinear and Chiral Molecules

Science.gov (United States)

Goings, Joshua James

Time-dependent electronic structure theory has the power to predict and probe the ways electron dynamics leads to useful phenomena and spectroscopic data. Here we report several advances and extensions of broken-symmetry time-dependent electronic structure theory in order to capture the flexibility required to describe non-equilibrium spin dynamics, as well as electron dynamics for chiroptical properties and vibrational effects. In the first half, we begin by discussing the generalization of self-consistent field methods to the so-called two-component structure in order to capture non-collinear spin states. This means that individual electrons are allowed to take a superposition of spin-1/2 projection states, instead of being constrained to either spin-up or spin-down. The system is no longer a spin eigenfunction, and is known a a spin-symmetry broken wave function. This flexibility to break spin symmetry may lead to variational instabilities in the approximate wave function, and we discuss how these may be overcome. With a stable non-collinear wave function in hand, we then discuss how to obtain electronic excited states from the non-collinear reference, along with associated challenges in their physical interpretation. Finally, we extend the two-component methods to relativistic Hamiltonians, which is the proper setting for describing spin-orbit driven phenomena. We describe the first implementation of the explicit time propagation of relativistic two-component methods and how this may be used to capture spin-forbidden states in electronic absorption spectra. In the second half, we describe the extension of explicitly time-propagated wave functions to the simulation of chiroptical properties, namely circular dichroism (CD) spectra of chiral molecules. Natural circular dichroism, that is, CD in the absence of magnetic fields, originates in the broken parity symmetry of chiral molecules. This proves to be an efficient method for computing circular dichroism spectra

Evaluation of the Electronic Structure of Single-Molecule Junctions Based on Current-Voltage and Thermopower Measurements: Application to C60 Single-Molecule Junction.

Science.gov (United States)

Komoto, Yuki; Isshiki, Yuji; Fujii, Shintaro; Nishino, Tomoaki; Kiguchi, Manabu

2017-02-16

The electronic structure of molecular junctions has a significant impact on their transport properties. Despite the decisive role of the electronic structure, a complete characterization of the electronic structure remains a challenge. This is because there is no straightforward way of measuring electron spectroscopy for an individual molecule trapped in a nanoscale gap between two metal electrodes. Herein, a comprehensive approach to obtain a detailed description of the electronic structure in single-molecule junctions based on the analysis of current-voltage (I-V) and thermoelectric characteristics is described. It is shown that the electronic structure of the prototypical C 60 single-molecule junction can be resolved by analyzing complementary results of the I-V and thermoelectric measurement. This combined approach confirmed that the C 60 single-molecule junction was highly conductive with molecular electronic conductances of 0.033 and 0.003 G 0 and a molecular Seebeck coefficient of -12 μV K -1 . In addition, we revealed that charge transport was mediated by a LUMO whose energy level was located 0.5≈0.6 eV above the Fermi level of the Au electrode. © 2017 Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim.

Elastic Properties of Nucleic Acids by Single-Molecule Force Spectroscopy.

Science.gov (United States)

Camunas-Soler, Joan; Ribezzi-Crivellari, Marco; Ritort, Felix

2016-07-05

We review the current knowledge on the use of single-molecule force spectroscopy techniques to extrapolate the elastic properties of nucleic acids. We emphasize the lesser-known elastic properties of single-stranded DNA. We discuss the importance of accurately determining the elastic response in pulling experiments, and we review the simplest models used to rationalize the experimental data as well as the experimental approaches used to pull single-stranded DNA. Applications used to investigate DNA conformational transitions and secondary structure formation are also highlighted. Finally, we provide an overview of the effects of salt and temperature and briefly discuss the effects of contour length and sequence dependence.

Relation between rheological and structural properties of suspensions

Energy Technology Data Exchange (ETDEWEB)

Barcal, M; Sebor, G; Volsicky, Z

1982-01-01

The paper discusses results of investigations into separation processes for coal and kaolin suspensions. Effects of potassium chlorides and methanol additives on electrostatic potential of solid particles and on sedimentation rate are analyzed. Investigation results are shown in 5 diagrams. The relation between rheological and structural properties of coal and clay suspensions is investigated. Investigations show that the non-Newtonian behavior of suspensions cannot be attributed exclusively to the electrostatic and mechanical action of the solid phase particles. It is also caused by structure of the liquid phase, particularly on the surface of the solid particles, which depends mostly on hydrogen bonds. The internal structure of the liquid phase influences differential viscosity much more than the electrical surface properties of the solid phase. Bonds between the molecules of water and methanol are much stronger than bonds between water molecules alone. (9 refs.)

Measurement of the conductance properties of single organic molecules using gold nanoparticles

Science.gov (United States)

Gordin, Yoav

conduct more than an order of magnitude less than those that are fully conjugated. A distinct feature of the conjugated molecule is the appearance of pronounced peaks in its conductance at certain voltage values. We have shown that these peaks can be gated randomly by the electrostatic environment, but the peak spectrum is reproducible among the different samples of the same molecular species that we studied. To properly study and understand the peak structure we developed the ability to add gate dependent measurements to our system. Unfortunately the backdrop of this was a drastic reduction in the yield of good samples for measurement. We focused on four different conjugated molecules to attempt to understand the effect of the molecular structure on the properties of the peak spectra. We have been able to measure three of these molecules, and obtained SET diamond plots reminiscent of those seen for the single particles. The molecular diamonds have a larger energy gap than that found in single particles, as can be expected from their smaller size. We do not yet have enough data on this issue to make any definite statements on the influence of the molecular structure on the peak structure. Another topic investigated in this work is the physics of the two gold nanoparticles, giving rise to double quantum dot (DQD) phenomena. This physics is observed in dimers that do not exhibit "molecular" (high energy) features, or at low voltages before the appearance of the molecular peaks. We have used these phenomena to fully characterize the properties of our system and understand better the role the molecule plays in transport at low bias (below the voltage of the first peak). I begin this thesis with an introduction to the field of molecular electronics; I briefly review the theoretical approaches and the experimental methods used. I then describe in detail the dimer method, whose development took up a major part of this work, relaying in detail the relevant issues and

Interactions of molecules and the properties of crystals

Science.gov (United States)

McConnell, Thomas Daniel Leigh

In this thesis the basic theory of the lattice dynamics of molecular crystals is considered, with particular reference to the specific case of linear molecules. The objective is to carry out a critical investigation of a number of empirical potentials as models for real systems. Suitable coordinates are introduced, in particular vibrational coordinates which are used to describe the translational and rotational modes of the free molecule. The Taylor expansion of the intermolecular potential is introduced and its terms considered, in particular the (first-order) equilibrium conditions for such a system and the (second-order) lattice vibrations. The elastic properties are also considered, in particular with reference to the specific case of rhombohedral crystals. The compressibility and a number of conditions for elastic stability are introduced. The total intermolecular interaction potential is divided into three components using perturbation methods, the electrostatic energy, the repulsion energy and the dispersion energy. A number of models are introduced for these various components. The induction energy is neglected. The electrostatic interaction is represented by atomic multipole and molecular multipole models. The repulsion and dispersion energies are modelled together in a central interaction potential, either the Lennard-Jones atom-atom potential or the anisotropic Berne-Pechukas molecule-molecule potential. In each case, the Taylor expansion coefficients, used to calculate the various molecular properties, are determined. An algorithm is described which provides a relatively simple method for calculating cartesian tensors, which are found in the Taylor expansion coefficients of the multipolar potentials. This proves to be particularly useful from a computational viewpoint, both in terms of programming and calculating efficiency. The model system carbonyl sulphide is introduced and its lattice properties are described. Suitable parameters for potentials used

Study of the growth and pyroelectric properties of TGS crystals doped with aniline-family dipolar molecules

Science.gov (United States)

Zhang, Kecong; Song, Jiancheng; Wang, Min; Fang, Changshui; Lu, Mengkai

1987-04-01

TGS crystals doped with aniline-family dipolar molecules (aniline, 2-aminobenzoic acid, 3-aminobenzoic acid, 3-aminobenzene-sulphonic acid, 4-aminobenzenesulphonic acid and 4-nitroraniline) have been grown by the slow-cooling solution method. The influence of these dopants on the growth habits, crystal morphology pyroelectric properties, and structure parameters of TGS crystals has been systematically investigated. The effects of the domain structure of the seed crystal on the pyroelectric properties of the doped crystals have been studied. It is found that the spontaneous polarization (P), pyroelectric coefficient (lambda), and internal bias field of the doped crystals are slightly higher than those of the pure TGS, and the larger the dipole moment of the dopant molecule, the higher the P and lambda of the doped TGS crystal.

Calculations of electronic structure of UF6 molecule and crystal UO2 with relativistic pseudopotential

International Nuclear Information System (INIS)

Ehvarestov, R.A.; Panin, A.I.; Bandura, A.V.

2008-01-01

Account of relativistic effects on the properties of uranium hexafluoride is testified. Detailed comparison of single electron energies spectrum revealed in nonrelativistic (by Hartree-Fock method), relativistic (by Dirac-Fock method), and scalar-relativistic (using relativistic potential of atomic uranium frame) has been conducted. Optimization procedures of atomic basis in LCAO calculations of molecules and crystals permissive taking into account distortion of atomic orbitals when chemical bonding are discussed, and optimization effect of atomic basis on the results of scalar-relativistic calculations of UF 6 molecule properties is analyzed. Calculations of electronic structure and properties of UO 2 crystal having relativistic and nonrelativistic pseudopotentials have been realized [ru

Effect of low-intensity electromagnetic radiation on structurization properties of bacterial lipopolysaccharide

Directory of Open Access Journals (Sweden)

Grigory E. Brill

2014-09-01

Full Text Available Purpose — to investigate the effects of low-intensity electromagnetic radiation on the process of dehydration selforganization of bacterial lipopolysaccharide (LPS. Material and Methods — The method of wedge dehydration has been used to study the structure formation of bacterial LPS. Image-phases analysis included their qualitative characteristics, as well as the calculation of quantitative indicators, followed by statistical analysis. Results — Low-intensity ultra high frequency (UHF radiation (1 GHz, 0.1 μW/cm2, 10 min has led to the changes in the suspension system of the LPS-saline reflected in the kinetics of structure formation. Conclusion — 1 GHz corresponds to the natural frequency of oscillation of water clusters and, presumably, the effect of UHF on structure of LPS mediates through the changes in water-salt environment. Under these conditions, properties of water molecules of hydration and possibly the properties of hydrophobic and hydrophilic regions in the molecule of LPS, which can affect the ability of toxin molecules to form aggregates change. Therefore the LPS structure modification may result in the change of its toxic properties.

QSPR study of the retention/release property of odorant molecules in pectin gels using statistical methods

Directory of Open Access Journals (Sweden)

Assia Belhassan

2017-11-01

Full Text Available The ACD/ChemSketch, MarvinSketch, and ChemOffice programmes were used to calculate several molecular descriptors of 51 odorant molecules (15 alcohols, 11 aldehydes, 9 ketones and 16 esters. The best descriptors were selected to establish the Quantitative Structure-Property Relationship (QSPR of the retention/release property of odorant molecules in pectin gels using Principal Components Analysis (PCA, Multiple Linear Regression (MLR, Multiple Non-linear Regression (MNLR and Artificial Neural Network (ANN methods We propose a quantitative model based on these analyses. PCA has been used to select descriptors that exhibit high correlation with the retention/release property. The MLR method yielded correlation coefficients of 0.960 and 0.958 for PG-0.4 (pectin concentration: 0.4% w/w and PG-0.8 (pectin concentration: 0.8% w/w media, respectively. Internal and external validations were used to determine the statistical quality of the QSPR of the two MLR models. The MNLR method, considering the relevant descriptors obtained from the MLR, yielded correlation coefficients of 0.978 and 0.975 for PG-0.4 and PG-0.8 media, respectively. The applicability domain of MLR models was investigated using simple and leverage approaches to detect outliers and outside compounds. The effects of different descriptors on the retention/release property are described, and these descriptors were used to study and design new compounds with higher and lower values of the property than the existing ones. Keywords: Odorant Molecules, Retention/Release, Pectin Gels, Quantitative Structure Property Relationship, Multiple Linear Regression, Artificial Neural Network

Prediction of Physicochemical Properties of Organic Molecules Using Semi-Empirical Methods

International Nuclear Information System (INIS)

Kim, Chan Kyung; Kim, Chang Kon; Kim, Miri; Lee, Hai Whang; Cho, Soo Gyeong

2013-01-01

Prediction of physicochemical properties of organic molecules is an important process in chemistry and chemical engineering. The MSEP approach developed in our lab calculates the molecular surface electrostatic potential (ESP) on van der Waals (vdW) surfaces of molecules. This approach includes geometry optimization and frequency calculation using hybrid density functional theory, B3LYP, at the 6-31G(d) basis set to find minima on the potential energy surface, and is known to give satisfactory QSPR results for various properties of organic molecules. However, this MSEP method is not applicable to screen large database because geometry optimization and frequency calculation require considerable computing time. To develop a fast but yet reliable approach, we have re-examined our previous work on organic molecules using two semi-empirical methods, AM1 and PM3. This new approach can be an efficient protocol in designing new molecules with improved properties

Superconducting selenides intercalated with organic molecules: synthesis, crystal structure, electric and magnetic properties, superconducting properties, and phase separation in iron based-chalcogenides and hybrid organic-inorganic superconductors

Science.gov (United States)

Krzton-Maziopa, Anna; Pesko, Edyta; Puzniak, Roman

2018-06-01

Layered iron-based superconducting chalcogenides intercalated with molecular species are the subject of intensive studies, especially in the field of solid state chemistry and condensed matter physics, because of their intriguing chemistry and tunable electric and magnetic properties. Considerable progress in the research, revealing superconducting inorganic–organic hybrid materials with transition temperatures to superconducting state, T c, up to 46 K, has been brought in recent years. These novel materials are synthesized by low-temperature intercalation of molecular species, such as solvates of alkali metals and nitrogen-containing donor compounds, into layered FeSe-type structure. Both the chemical nature as well as orientation of organic molecules between the layers of inorganic host, play an important role in structural modifications and may be used for fine tuning of superconducting properties. Furthermore, a variety of donor species compatible with alkali metals, as well as the possibility of doping also in the host structure (either on Fe or Se sites), makes this system quite flexible and gives a vast array of new materials with tunable electric and magnetic properties. In this review, the main aspects of intercalation chemistry are discussed with a particular attention paid to the influence of the unique nature of intercalating species on the crystal structure and physical properties of the hybrid inorganic–organic materials. To get a full picture of these materials, a comprehensive description of the most effective chemical and electrochemical methods, utilized for synthesis of intercalated species, with critical evaluation of their strong and weak points, related to feasibility of synthesis, phase purity, crystal size and morphology of final products, is included as well.

The study of electronic structure and properties of silicene for gas sensor application

Energy Technology Data Exchange (ETDEWEB)

Wella, Sasfan A.; Syaputra, Marhamni; Wungu, Triati D. K., E-mail: triati@fi.itb.ac.id; Suprijadi [Department of Physics, Faculty of Mathematics and Natural Sciences, Institut Teknologi Bandung Jl. Ganesha 10 Bandung 40132, West Java (Indonesia)

2016-03-11

In this study, we investigated the adsorption of gas molecules (H{sub 2}S, CO) on pristine silicene using first principles calculation. The structure, electronic properties, and adsorption energy of H{sub 2}S,CO/silicene are discussed thoroughly. We found that the pristine silicenewith low buckling structure is the most stable as compared with planar and high buckling structures. Silicene was able to detect a gas molecule which can be observed according tothe density of states analysis. Though a gas molecule adsorbed weakly, the electronic properties of the low buckling pristine silicene changed from semi-metal (zero band gap) to semiconductor. The adsorption energy of H{sub 2}S and CO on silicene is 0.075 eV and 0.06 eV, respectively.

Large Molecule Structures by Broadband Fourier Transform Molecular Rotational Spectroscopy

Science.gov (United States)

Evangelisti, Luca; Seifert, Nathan A.; Spada, Lorenzo; Pate, Brooks

2016-06-01

Fourier transform molecular rotational resonance spectroscopy (FT-MRR) using pulsed jet molecular beam sources is a high-resolution spectroscopy technique that can be used for chiral analysis of molecules with multiple chiral centers. The sensitivity of the molecular rotational spectrum pattern to small changes in the three dimensional structure makes it possible to identify diastereomers without prior chemical separation. For larger molecules, there is the additional challenge that different conformations of each diastereomer may be present and these need to be differentiated from the diastereomers in the spectral analysis. Broadband rotational spectra of several larger molecules have been measured using a chirped-pulse FT-MRR spectrometer. Measurements of nootkatone (C15H22O), cedrol (C15H26O), ambroxide (C16H28O) and sclareolide (C16H26O2) are presented. These spectra are measured with high sensitivity (signal-to-noise ratio near 1,000:1) and permit structure determination of the most populated isomers using isotopic analysis of the 13C and 18O isotopologues in natural abundance. The accuracy of quantum chemistry calculations to identify diastereomers and conformers and to predict the dipole moment properties needed for three wave mixing measurements is examined.

Stability, structural and electronic properties of benzene molecule adsorbed on free standing Au layer

Energy Technology Data Exchange (ETDEWEB)

Katoch, Neha, E-mail: nehakatoch2@gmail.com; Kapoor, Pooja; Sharma, Munish; Ahluwalia, P. K. [Physics Department, Himachal Pradesh University, Shimla, Himachal Pradesh, India 171005 (India); Kumar, Ashok [Center for Physical Sciences, School of Basic and Applied Sciences, Central University of Punjab, Bathinda, India, 151001 (India)

2016-05-23

We report stability and electronic properties of benzene molecule adsorbed on the Au atomic layer within the framework of density function theory (DFT). Horizontal configuration of benzene on the top site of Au monolayer prefers energetically over other studied configurations. On the adsorption of benzene, the ballistic conductance of Au monolayer is found to decrease from 4G{sub 0} to 2G{sub 0} suggesting its applications for the fabrications of organic sensor devices based on the Au atomic layers.

Structure/property relationships in non-linear optical materials

Energy Technology Data Exchange (ETDEWEB)

Cole, J M [Institut Max von Laue - Paul Langevin (ILL), 38 - Grenoble (France); [Durham Univ. (United Kingdom); Howard, J A.K. [Durham Univ. (United Kingdom); McIntyre, G J [Institut Max von Laue - Paul Langevin (ILL), 38 - Grenoble (France)

1997-04-01

The application of neutrons to the study of structure/property relationships in organic non-linear optical materials (NLOs) is described. In particular, charge-transfer effects and intermolecular interactions are investigated. Charge-transfer effects are studied by charge-density analysis and an example of one such investigation is given. The study of intermolecular interactions concentrates on the effects of hydrogen-bonding and an example is given of two structurally similar molecules with very disparate NLO properties, as a result of different types of hydrogen-bonding. (author). 3 refs.

Fluctuation in Interface and Electronic Structure of Single-Molecule Junctions Investigated by Current versus Bias Voltage Characteristics.

Science.gov (United States)

Isshiki, Yuji; Fujii, Shintaro; Nishino, Tomoaki; Kiguchi, Manabu

2018-03-14

Structural and electronic detail at the metal-molecule interface has a significant impact on the charge transport across the molecular junctions, but its precise understanding and control still remain elusive. On the single-molecule scale, the metal-molecule interface structures and relevant charge transport properties are subject to fluctuation, which contain the fundamental science of single-molecule transport and implication for manipulability of the transport properties in electronic devices. Here, we present a comprehensive approach to investigate the fluctuation in the metal-molecule interface in single-molecule junctions, based on current-voltage ( I- V) measurements in combination with first-principles simulation. Contrary to conventional molecular conductance studies, this I- V approach provides a correlated statistical description of both the degree of electronic coupling across the metal-molecule interface and the molecular orbital energy level. This statistical approach was employed to study fluctuation in single-molecule junctions of 1,4-butanediamine (DAB), pyrazine (PY), 4,4'-bipyridine (BPY), and fullerene (C 60 ). We demonstrate that molecular-dependent fluctuation of σ-, π-, and π-plane-type interfaces can be captured by analyzing the molecular orbital (MO) energy level under mechanical perturbation. While the MO level of DAB with the σ-type interface shows weak distance dependence and fluctuation, the MO level of PY, BPY, and C 60 features unique distance dependence and molecular-dependent fluctuation against the mechanical perturbation. The MO level of PY and BPY with the σ+π-type interface increases with the increase in the stretch distance. In contrast, the MO level of C 60 with the π-plane-type interface decreases with the increase in the stretching perturbation. This study provides an approach to resolve the structural and electronic fluctuation in the single-molecule junctions and insight into the molecular-dependent fluctuation in

Prediction of RNA secondary structures: from theory to models and real molecules

International Nuclear Information System (INIS)

Schuster, Peter

2006-01-01

RNA secondary structures are derived from RNA sequences, which are strings built form the natural four letter nucleotide alphabet, {AUGC}. These coarse-grained structures, in turn, are tantamount to constrained strings over a three letter alphabet. Hence, the secondary structures are discrete objects and the number of sequences always exceeds the number of structures. The sequences built from two letter alphabets form perfect structures when the nucleotides can form a base pair, as is the case with {GC} or {AU}, but the relation between the sequences and structures differs strongly from the four letter alphabet. A comprehensive theory of RNA structure is presented, which is based on the concepts of sequence space and shape space, being a space of structures. It sets the stage for modelling processes in ensembles of RNA molecules like evolutionary optimization or kinetic folding as dynamical phenomena guided by mappings between the two spaces. The number of minimum free energy (mfe) structures is always smaller than the number of sequences, even for two letter alphabets. Folding of RNA molecules into mfe energy structures constitutes a non-invertible mapping from sequence space onto shape space. The preimage of a structure in sequence space is defined as its neutral network. Similarly the set of suboptimal structures is the preimage of a sequence in shape space. This set represents the conformation space of a given sequence. The evolutionary optimization of structures in populations is a process taking place in sequence space, whereas kinetic folding occurs in molecular ensembles that optimize free energy in conformation space. Efficient folding algorithms based on dynamic programming are available for the prediction of secondary structures for given sequences. The inverse problem, the computation of sequences for predefined structures, is an important tool for the design of RNA molecules with tailored properties. Simultaneous folding or cofolding of two or more RNA

Diffusion and infrared properties of molecules in ice mantles

International Nuclear Information System (INIS)

Schmitt, B.; Grim, R.; Greenberg, J.M.

1989-01-01

Within dense molecular clouds the formation of frozen icy mantles on interstellar dust grains is thought to be the result of various growth conditions. The molecules, which make up the ice mantles are probably completely mixed. To study the physical properties of such ice mixtures the experiments were performed on the evaporation processes and on the spectroscopic properties of CO, CO2, and CH4 in water rich ices. The decrease in concentration of volatile molecules in ice samples deposited at 10 K and subsequently heated is found to occur essentially in two steps. The first one, corresponding to an evaporation of part of the volatile molecules, starts at about 25 K for CO, 32 K for CH4, and 70 K for CO2. During the crystallization of H2O ice at temperatures greater than 120 K a second evaporation occurs leading to the complete disappearance of the volatile molecules in the solid phase. The main astrophysical implications of the diffusion and spectroscopic behaviors are presented. The possible effects of a heating source on the fraction of volatile molecules, such as CO trapped in grain mantles, are discussed

Effects of Electric Field on the Valence-Bond Property of an Electron in a Quantum-Dot Molecule

Institute of Scientific and Technical Information of China (English)

王立民; 罗莹; 马本堃

2002-01-01

The electronic structure of the quantum-dot molecules in an electric field is investigated by the finite element method with the effective mass approximation. The numerical calculation results show that the valence bond of the quantum-dot molecule alternates between covalent bonds and ionic bonds as the electric field increases. The valence-bond property can be reflected by the oscillator strength of the intraband transition. The bound state with the highest energy level in the quantum-dot molecule gradually changes into a quasibound state when the electric field increases.

Evaluation of the Kinetic Property of Single-Molecule Junctions by Tunneling Current Measurements.

Science.gov (United States)

Harashima, Takanori; Hasegawa, Yusuke; Kiguchi, Manabu; Nishino, Tomoaki

2018-01-01

We investigated the formation and breaking of single-molecule junctions of two kinds of dithiol molecules by time-resolved tunneling current measurements in a metal nanogap. The resulting current trajectory was statistically analyzed to determine the single-molecule conductance and, more importantly, to reveal the kinetic property of the single-molecular junction. These results suggested that combining a measurement of the single-molecule conductance and statistical analysis is a promising method to uncover the kinetic properties of the single-molecule junction.

Near-unity mass accommodation coefficient of organic molecules of varying structure.

Science.gov (United States)

Julin, Jan; Winkler, Paul M; Donahue, Neil M; Wagner, Paul E; Riipinen, Ilona

2014-10-21

Atmospheric aerosol particles have a significant effect on global climate, air quality, and consequently human health. Condensation of organic vapors is a key process in the growth of nanometer-sized particles to climate relevant sizes. This growth is very sensitive to the mass accommodation coefficient α, a quantity describing the vapor uptake ability of the particles, but knowledge on α of atmospheric organics is lacking. In this work, we have determined α for four organic molecules with diverse structural properties: adipic acid, succinic acid, naphthalene, and nonane. The coefficients are studied using molecular dynamics simulations, complemented with expansion chamber measurements. Our results are consistent with α = 1 (indicating nearly perfect accommodation), regardless of the molecular structural properties, the phase state of the bulk condensed phase, or surface curvature. The results highlight the need for experimental techniques capable of resolving the internal structure of nanoparticles to better constrain the accommodation of atmospheric organics.

From Artificial Atoms to Nanocrystal Molecules: Preparation and Properties of More Complex Nanostructures

Energy Technology Data Exchange (ETDEWEB)

Choi, Charina L; Alivisatos, A Paul

2009-10-20

Quantum dots, which have found widespread use in fields such as biomedicine, photovoltaics, and electronics, are often called artificial atoms due to their size-dependent physical properties. Here this analogy is extended to consider artificial nanocrystal molecules, formed from well-defined groupings of plasmonically or electronically coupled single nanocrystals. Just as a hydrogen molecule has properties distinct from two uncoupled hydrogen atoms, a key feature of nanocrystal molecules is that they exhibit properties altered from those of the component nanoparticles due to coupling. The nature of the coupling between nanocrystal atoms and its response to vibrations and deformations of the nanocrystal molecule bonds are of particular interest. We discuss synthetic approaches, predicted and observed physical properties, and prospects and challenges toward this new class of materials.

Chemical Structure and Properties: A Modified Atoms-First, One-Semester Introductory Chemistry Course

Science.gov (United States)

Schaller, Chris P.; Graham, Kate J.; Johnson, Brian J.; Jakubowski, Henry V.; McKenna, Anna G.; McIntee, Edward J.; Jones, T. Nicholas; Fazal, M. A.; Peterson, Alicia A.

2015-01-01

A one-semester, introductory chemistry course is described that develops a primarily qualitative understanding of structure-property relationships. Starting from an atoms-first approach, the course examines the properties and three-dimensional structure of metallic and ionic solids before expanding into a thorough investigation of molecules. In…

Contrasting bonding behavior of thiol molecules on carbon fullerene structures

International Nuclear Information System (INIS)

Mixteco-Sanchez, J.C.; Guirado-Lopez, R.A.

2003-01-01

We have performed semiempirical as well as ab initio density-functional theory (DFT) calculations at T=0 to analyze the equilibrium configurations and electronic properties of spheroidal C 60 as well as of cylindrical armchair (5,5) and (8,8) fullerenes passivated with SCH 3 and S(CH 2 ) 2 CH 3 thiols. Our structural results reveal that the lowest-energy configurations of the adsorbates strongly depend on their chain length and on the structure of the underlying substrate. In the low-coverage regime, both SCH 3 and S(CH 2 ) 2 CH 3 molecules prefer to organize into a molecular cluster on one side of the C 60 surface, providing thus a less protective organic coating for the carbon structure. However, with increasing the number of adsorbed thiols, a transition to a more uniform distribution is obtained, which actually takes place for six and eight adsorbed molecules when using S(CH 2 ) 2 CH 3 and SCH 3 chains, respectively. In contrast, for the tubelike arrangements at the low-coverage regime, a quasi-one-dimensional zigzag organization of the adsorbates along the tubes is always preferred. The sulfur-fullerene bond is considerably strong and is at the origin of outward and lateral displacements of the carbon atoms, leading to the stabilization of three-membered rings on the surface (spheroidal structures) as well as to sizable nonuniform radial deformations (cylindrical configurations). The electronic spectrum of our thiol-passivated fullerenes shows strong variations in the energy difference between the highest occupied and lowest unoccupied molecular orbitals as a function of the number and distribution of adsorbed thiols, opening thus the possibility to manipulate the transport properties of these compounds by means of selective adsorption mechanisms

Phase space structure of triatomic molecules

International Nuclear Information System (INIS)

Lu, Z.; Kellman, M.E.

1997-01-01

The bifurcation structure is investigated for a Hamiltonian for the three coupled nonlinear vibrations of a highly excited triatomic molecule. The starting point is a quantum Hamiltonian used to fit experimental spectra. This Hamiltonian includes 1:1 Darling endash Dennison resonance coupling between the stretches, and 2:1 Fermi resonance coupling between the stretches and bend. A classical Hamiltonian is obtained using the Heisenberg correspondence principle. Surfaces of section show a pronounced degree of chaos at high energies, with a mixture of chaotic and regular dynamics. The large-scale bifurcation structure is found semianalytically, without recourse to numerical solution of Hamilton close-quote s equations, by taking advantage of the fact that the spectroscopic Hamiltonian has a conserved polyad quantum number, corresponding to an approximate constant of the motion of the molecule. Bifurcation diagrams are analyzed for a number of molecules including H 2 O, D 2 O, NO 2 , ClO 2 , O 3 , and H 2 S. copyright 1997 American Institute of Physics

Chemically Aware Model Builder (camb): an R package for property and bioactivity modelling of small molecules.

Science.gov (United States)

Murrell, Daniel S; Cortes-Ciriano, Isidro; van Westen, Gerard J P; Stott, Ian P; Bender, Andreas; Malliavin, Thérèse E; Glen, Robert C

2015-01-01

In silico predictive models have proved to be valuable for the optimisation of compound potency, selectivity and safety profiles in the drug discovery process. camb is an R package that provides an environment for the rapid generation of quantitative Structure-Property and Structure-Activity models for small molecules (including QSAR, QSPR, QSAM, PCM) and is aimed at both advanced and beginner R users. camb's capabilities include the standardisation of chemical structure representation, computation of 905 one-dimensional and 14 fingerprint type descriptors for small molecules, 8 types of amino acid descriptors, 13 whole protein sequence descriptors, filtering methods for feature selection, generation of predictive models (using an interface to the R package caret), as well as techniques to create model ensembles using techniques from the R package caretEnsemble). Results can be visualised through high-quality, customisable plots (R package ggplot2). Overall, camb constitutes an open-source framework to perform the following steps: (1) compound standardisation, (2) molecular and protein descriptor calculation, (3) descriptor pre-processing and model training, visualisation and validation, and (4) bioactivity/property prediction for new molecules. camb aims to speed model generation, in order to provide reproducibility and tests of robustness. QSPR and proteochemometric case studies are included which demonstrate camb's application.Graphical abstractFrom compounds and data to models: a complete model building workflow in one package.

A Structural Perspective on the Modulation of Protein-Protein Interactions with Small Molecules.

Science.gov (United States)

Demirel, Habibe Cansu; Dogan, Tunca; Tuncbag, Nurcan

2018-05-31

Protein-protein interactions (PPIs) are the key components in many cellular processes including signaling pathways, enzymatic reactions and epigenetic regulation. Abnormal interactions of some proteins may be pathogenic and cause various disorders including cancer and neurodegenerative diseases. Although inhibiting PPIs with small molecules is a challenging task, it gained an increasing interest because of its strong potential for drug discovery and design. The knowledge of the interface as well as the structural and chemical characteristics of the PPIs and their roles in the cellular pathways are necessary for a rational design of small molecules to modulate PPIs. In this study, we review the recent progress in the field and detail the physicochemical properties of PPIs including binding hot spots with a focus on structural methods. Then, we review recent approaches for structural prediction of PPIs. Finally, we revisit the concept of targeting PPIs in a systems biology perspective and we refer to the non-structural approaches, usually employed when the structural information is not present. Copyright© Bentham Science Publishers; For any queries, please email at epub@benthamscience.org.

Machine learning properties of materials and molecules with entropy-regularized kernels

Science.gov (United States)

Ceriotti, Michele; Bartók, Albert; CsáNyi, GáBor; de, Sandip

Application of machine-learning methods to physics, chemistry and materials science is gaining traction as a strategy to obtain accurate predictions of the properties of matter at a fraction of the typical cost of quantum mechanical electronic structure calculations. In this endeavor, one can leverage general-purpose frameworks for supervised-learning. It is however very important that the input data - for instance the positions of atoms in a molecule or solid - is processed into a form that reflects all the underlying physical symmetries of the problem, and that possesses the regularity properties that are required by machine-learning algorithms. Here we introduce a general strategy to build a representation of this kind. We will start from existing approaches to compare local environments (basically, groups of atoms), and combine them using techniques borrowed from optimal transport theory, discussing the relation between this idea and additive energy decompositions. We will present a few examples demonstrating the potential of this approach as a tool to predict molecular and materials' properties with an accuracy on par with state-of-the-art electronic structure methods. MARVEL NCCR (Swiss National Science Foundation) and ERC StG HBMAP (European Research Council, G.A. 677013).

Pectins filled with LDH-antimicrobial molecules: preparation, characterization and physical properties.

Science.gov (United States)

Gorrasi, Giuliana; Bugatti, Valeria; Vittoria, Vittoria

2012-06-05

Nanohybrids of layered double hydroxide (LDH) with intercalated active molecules: benzoate, 2,4-dichlorobenzoate, para-hydroxybenzoate and ortho-hydroxybenzoate, were incorporated into pectins from apples through high energy ball milling in the presence of water. Cast films were obtained and analysed. X-ray diffraction analysis showed a complete destructuration of all nanohybrids in the pectin matrix. Thermogravimetric analysis showed a better thermal resistance of pectin in the presence of fillers, especially para-hydroxybenzoate and ortho-hydroxybenzoate. Mechanical properties showed an improvement of elastic modulus in particular for LDH-para-hydroxybenzoate nanohybrid, due probably to a better interaction between pectin matrix and nanohybrid layers. Barrier properties (sorption and diffusion) to water vapour showed improvement in the dependence on the intercalated active molecule, the best improvement was achieved for composites containing para-hydroxybenzoate molecules, suggesting that the interaction between the filler phase and the polymer plays an important role in sorption and diffusion phenomena. Incorporation of these active molecules gave antimicrobial properties to the composite films giving opportunities in the field of active packaging. Copyright © 2012 Elsevier Ltd. All rights reserved.

Vibrational properties of water molecules adsorbed in different zeolitic frameworks

International Nuclear Information System (INIS)

Crupi, V; Longo, F; Majolino, D; Venuti, V

2006-01-01

The perturbation of water 'sorbed' in samples of zeolites of different structural type, genesis, and cation composition (K-, Na-, Mg- and Ca-rich zeolites), namely the CHA framework of a synthetic K-chabazite, the LTA framework of synthetic Na-A and Mg50-A zeolites, and the NAT framework of a natural scolecite, has been studied by FTIR-ATR spectroscopy, in the -10 to +80 o C temperature range. The aim was to show how differences in the chemical composition and/or in the topology of the zeolite framework and, in particular, the possibility for the guest water molecules to develop guest-guest and/or host-guest interactions, lead to substantial differences in their vibrational dynamical properties. The spectra, collected in the O-H stretching and H 2 O bending mode regions, are complex, with multiple bands being observed. As far as water in the CHA and LTA frameworks is concerned, whose behaviour is governed by the balance of water-water, water-framework and water-extra-framework cations interactions, the assignment of the resolved components of the O-H stretching band has been discussed by fitting the band shapes into individual components attributed to H 2 O molecules engaged in different degrees of hydrogen bonding. A detailed quantitative picture of the connectivity pattern of water, as a function of temperature and according to the chemical and topological properties of the environment, is furnished. The H 2 O bending vibrational bands give additional information that perfectly agrees with the results obtained from the analysis of the O-H stretching spectral region. In the case of scolecite, a small-pored zeolite where water-water interactions are eliminated, the increased complexity observed in the infrared spectra in the O-H stretching and H 2 O bending regions was explained as due to the hydrogen bonding between the water molecules and the network, and also with the extra-framework cation. Furthermore, these observations have been correlated with the different

Organic molecules with abnormal geometric parameters

International Nuclear Information System (INIS)

Komarov, Igor V

2001-01-01

Organic molecules, the structural parameters of which (carbon-carbon bond lengths, bond and torsion angles) differ appreciably from the typical most frequently encountered values, are discussed. Using many examples of 'record-breaking' molecules, the limits of structural distortions in carbon compounds and their unusual chemical properties are demonstrated. Particular attention is devoted to strained compounds not yet synthesised whose properties have been predicted using quantum-chemical calculations. Factors that ensure the stability of such compounds are outlined. The bibliography includes 358 references.

New in situ generated acylhydrazidate-coordinated complexes and acylhydrazide molecules: Synthesis, structural characterization and photoluminescence property

Science.gov (United States)

Wang, Yan-Ning; Huo, Qi-Sheng; Zhang, Ping; Yu, Jie-Hui; Xu, Ji-Qing

2016-10-01

By utilizing the hydrothermal in situ acylation of organic acids with N2H4, three acylhydrazidate-coordinated compounds [Mn(L1)2(H2O)2] (L1 = 2,3-quinolinedicarboxylhydrazidate; HL1 = 2,3-dihydropyridazino[4,5-b] quinoline-1,4-dione) 1, [Mn2(ox)(L2)2(H2O)6]·2H2O (L2 = benzimidazolate-5,6-dicarboxylhydrazide; HL2 = 6,7-dihydro-1H-imidazo[4,5-g]phthalazine-5,8-dione; ox = oxalate) 2, and [Cd(HL3)(bpy)] (L3 = 4,5-di(3‧-carboxylphenyl)phthalhydrazidate; H3L3 = 6,7-dihydro-1H-imidazo[4,5-g]phthalazine-5,8-dione; bpy = 2,2‧-bipyridine) 3, as well as two acylhydrazide molecules L4 (L4 = oxepino[2,3,4-de:7,6,5-d‧e‧]diphthalazine-4,10(5H,9H)-dione) 4 and L5 (L5 = 4,5-dibromophthalhydrazide; L5 = 6,7-dibromo-2,3-dihydrophthalazine-1,4-dione) 5 were obtained. X-ray single-crystal diffraction analysis reveals that (i) 1 only possesses a mononuclear structure, but it self-assembles into a 2-D supramolecular network via the Nhydrazinesbnd H ⋯ Nhydrazine and Owsbnd H ⋯ Ohydroxylimino interactions; (ii) 2 exhibits a dinuclear structure. Ox acts as the linker, while L2 just serves as a terminal ligand; (iii) In 3, L3 acts as a 3-connected node to propagate the 7-coordinated Cd2 + centers into a 1-D double-chain structure; (iv) 4 is a special acylhydrazide molecule. Two sbnd OH groups for the intermediates 3,3‧-biphthalhydrazide further lose one water molecule to form 4; (v) 5 is a common monoacylhydrazide molecule. Via the Nhydrazinesbnd H ⋯ Ohydrazine, Ohydroxyliminosbnd H ⋯ Oacylamino and the π ⋯ π interactions, it self-assembles into a 2-D supramolecular network. The photoluminescence analysis reveals that 4 emits light with the maxima at 510 nm.

Electrical properties and mechanical stability of anchoring groups for single-molecule electronics

Directory of Open Access Journals (Sweden)

Riccardo Frisenda

2015-07-01

Full Text Available We report on an experimental investigation of transport through single molecules, trapped between two gold nano-electrodes fabricated with the mechanically controlled break junction (MCBJ technique. The four molecules studied share the same core structure, namely oligo(phenylene ethynylene (OPE3, while having different aurophilic anchoring groups: thiol (SAc, methyl sulfide (SMe, pyridyl (Py and amine (NH2. The focus of this paper is on the combined characterization of the electrical and mechanical properties determined by the anchoring groups. From conductance histograms we find that thiol anchored molecules provide the highest conductance; a single-level model fit to current–voltage characteristics suggests that SAc groups exhibit a higher electronic coupling to the electrodes, together with better level alignment than the other three groups. An analysis of the mechanical stability, recording the lifetime in a self-breaking method, shows that Py and SAc yield the most stable junctions while SMe form short-lived junctions. Density functional theory combined with non-equlibrium Green’s function calculations help in elucidating the experimental findings.

Structure and properties of cell membranes. Volume 3: Methodology and properties of membranes

International Nuclear Information System (INIS)

Benga, G.

1985-01-01

This book covers the topics: Quantum chemical approach to study the mechanisms of proton translocation across membranes through protein molecules; monomolecular films as biomembrane models; planar lipid bilayers in relation to biomembranes; relation of liposomes to cell membranes; reconstitution of membrane transport systems; structure-function relationships in cell membranes as revealed by X-ray techniques; structure-function relationships in cell membranes as revealed by spin labeling ESR; structure and dynamics of cell membranes as revealed by NMR techniques; the effect of dietary lipids on the composition and properties of biological membranes and index

Molecule database framework: a framework for creating database applications with chemical structure search capability.

Science.gov (United States)

Kiener, Joos

2013-12-11

Research in organic chemistry generates samples of novel chemicals together with their properties and other related data. The involved scientists must be able to store this data and search it by chemical structure. There are commercial solutions for common needs like chemical registration systems or electronic lab notebooks. However for specific requirements of in-house databases and processes no such solutions exist. Another issue is that commercial solutions have the risk of vendor lock-in and may require an expensive license of a proprietary relational database management system. To speed up and simplify the development for applications that require chemical structure search capabilities, I have developed Molecule Database Framework. The framework abstracts the storing and searching of chemical structures into method calls. Therefore software developers do not require extensive knowledge about chemistry and the underlying database cartridge. This decreases application development time. Molecule Database Framework is written in Java and I created it by integrating existing free and open-source tools and frameworks. The core functionality includes:•Support for multi-component compounds (mixtures)•Import and export of SD-files•Optional security (authorization)For chemical structure searching Molecule Database Framework leverages the capabilities of the Bingo Cartridge for PostgreSQL and provides type-safe searching, caching, transactions and optional method level security. Molecule Database Framework supports multi-component chemical compounds (mixtures).Furthermore the design of entity classes and the reasoning behind it are explained. By means of a simple web application I describe how the framework could be used. I then benchmarked this example application to create some basic performance expectations for chemical structure searches and import and export of SD-files. By using a simple web application it was shown that Molecule Database Framework

Structural and electronic properties of L-amino acids

Science.gov (United States)

Tulip, P. R.; Clark, S. J.

2005-05-01

The structural and electronic properties of four L-amino acids alanine, leucine, isoleucine, and valine have been investigated using density functional theory (DFT) and the generalized gradient approximation. Within the crystals, it is found that the constituent molecules adopt zwitterionic configurations, in agreement with experimental work. Lattice constants are found to be in good agreement with experimentally determined values, although certain discrepancies do exist due to the description of van der Waals interactions. We find that these materials possess wide DFT band gaps in the region of 5 eV, with electrons highly localized to the constituent molecules. It is found that the main mechanisms behind crystal formation are dipolar interactions and hydrogen bonding of a primarily electrostatic character, in agreement with current biochemical understanding of these systems. The electronic structure suggests that the amine and carboxy functional groups are dominant in determining band structure.

Studies of G-quadruplex DNA structures at the single molecule level

DEFF Research Database (Denmark)

Kragh, Sofie Louise

2015-01-01

Folding of G-quaduplex structures adopted by the human telomeric repeat is here studied by single molecule FRET microscopy. This method allows for the investigation of G-quadruplex structures and their conformational dynamic. Telomeres are located at the ends of our chromosomes and end in a single...... with human telomeric repeat adopt several different G-quadruplex conformations in the presence of K+ ions. G-quadruplexes inhibit telomerase activity and are therefore potential targets for anti-cancer drugs, which can be small molecule ligands capable of stabilizing G-quadruplex structures. Understanding...... range. FRET spectroscopy can be performed on an ensemble of molecules, or on the single molecule level. In single molecule FRET experiments it is possible to follow the behaviour in time for each molecule independently, allowing insight into both dynamically and statistically heterogeneous molecular...

Atomistic theory of excitonic fine structure in InAs/InP nanowire quantum dot molecules

Science.gov (United States)

Świderski, M.; Zieliński, M.

2017-03-01

Nanowire quantum dots have peculiar electronic and optical properties. In this work we use atomistic tight binding to study excitonic spectra of artificial molecules formed by a double nanowire quantum dot. We demonstrate a key role of atomistic symmetry and nanowire substrate orientation rather than cylindrical shape symmetry of a nanowire and a molecule. In particular for [001 ] nanowire orientation we observe a nonvanishing bright exciton splitting for a quasimolecule formed by two cylindrical quantum dots of different heights. This effect is due to interdot coupling that effectively reduces the overall symmetry, whereas single uncoupled [001 ] quantum dots have zero fine structure splitting. We found that the same double quantum dot system grown on [111 ] nanowire reveals no excitonic fine structure for all considered quantum dot distances and individual quantum dot heights. Further we demonstrate a pronounced, by several orders of magnitude, increase of the dark exciton optical activity in a quantum dot molecule as compared to a single quantum dot. For [111 ] systems we also show spontaneous localization of single particle states in one of nominally identical quantum dots forming a molecule, which is mediated by strain and origins from the lack of the vertical inversion symmetry in [111 ] nanostructures of overall C3 v symmetry. Finally, we study lowering of symmetry due to alloy randomness that triggers nonzero excitonic fine structure and the dark exciton optical activity in realistic nanowire quantum dot molecules of intermixed composition.

Shedding Light on Protein Folding, Structural and Functional Dynamics by Single Molecule Studies

Directory of Open Access Journals (Sweden)

Krutika Bavishi

2014-11-01

Full Text Available The advent of advanced single molecule measurements unveiled a great wealth of dynamic information revolutionizing our understanding of protein dynamics and behavior in ways unattainable by conventional bulk assays. Equipped with the ability to record distribution of behaviors rather than the mean property of a population, single molecule measurements offer observation and quantification of the abundance, lifetime and function of multiple protein states. They also permit the direct observation of the transient and rarely populated intermediates in the energy landscape that are typically averaged out in non-synchronized ensemble measurements. Single molecule studies have thus provided novel insights about how the dynamic sampling of the free energy landscape dictates all aspects of protein behavior; from its folding to function. Here we will survey some of the state of the art contributions in deciphering mechanisms that underlie protein folding, structural and functional dynamics by single molecule fluorescence microscopy techniques. We will discuss a few selected examples highlighting the power of the emerging techniques and finally discuss the future improvements and directions.

Structure and Structure-activity Relationship of Functional Organic Molecules

Institute of Scientific and Technical Information of China (English)

2011-01-01

@@ Research theme The group is made up of junior scientists from the State Key Laboratory of Elemento-organic Chemistry, Nankai University.The scientists focus their studis on the structure and structure-activity relationship of functional organic molecules not only because it has been the basis of their research, but also because the functional study of organic compounds is now a major scientific issue for organic chemists around the world.

Structure factors for tunneling ionization rates of molecules: General Hartree-Fock-based integral representation

Science.gov (United States)

Madsen, Lars Bojer; Jensen, Frank; Dnestryan, Andrey I.; Tolstikhin, Oleg I.

2017-07-01

In the leading-order approximation of the weak-field asymptotic theory (WFAT), the dependence of the tunneling ionization rate of a molecule in an electric field on its orientation with respect to the field is determined by the structure factor of the ionizing molecular orbital. The WFAT yields an expression for the structure factor in terms of a local property of the orbital in the asymptotic region. However, in general quantum chemistry approaches molecular orbitals are expanded in a Gaussian basis which does not reproduce their asymptotic behavior correctly. This hinders the application of the WFAT to polyatomic molecules, which are attracting increasing interest in strong-field physics. Recently, an integral-equation approach to the WFAT for tunneling ionization of one electron from an arbitrary potential has been developed. The structure factor is expressed in an integral form as a matrix element involving the ionizing orbital. The integral is not sensitive to the asymptotic behavior of the orbital, which resolves the difficulty mentioned above. Here, we extend the integral representation for the structure factor to many-electron systems treated within the Hartree-Fock method and show how it can be implemented on the basis of standard quantum chemistry software packages. We validate the methodology by considering noble-gas atoms and the CO molecule, for which accurate structure factors exist in the literature. We also present benchmark results for CO2 and for NH3 in the pyramidal and planar geometries.

Importance of the alignment of polar π conjugated molecules inside carbon nanotubes in determining second-order non-linear optical properties.

Science.gov (United States)

Yumura, Takashi; Yamamoto, Wataru

2017-09-20

We employed density functional theory (DFT) calculations with dispersion corrections to investigate energetically preferred alignments of certain p,p'-dimethylaminonitrostilbene (DANS) molecules inside an armchair (m,m) carbon nanotube (n × DANS@(m,m)), where the number of inner molecules (n) is no greater than 3. Here, three types of alignments of DANS are considered: a linear alignment in a parallel fashion and stacking alignments in parallel and antiparallel fashions. According to DFT calculations, a threshold tube diameter for containing DANS molecules in linear or stacking alignments was found to be approximately 1.0 nm. Nanotubes with diameters smaller than 1.0 nm result in the selective formation of linearly aligned DANS molecules due to strong confinement effects within the nanotubes. By contrast, larger diameter nanotubes allow DANS molecules to align in a stacking and linear fashion. The type of alignment adopted by the DANS molecules inside a nanotube is responsible for their second-order non-linear optical properties represented by their static hyperpolarizability (β 0 values). In fact, we computed β 0 values of DANS assemblies taken from optimized n × DANS@(m,m) structures, and their values were compared with those of a single DANS molecule. DFT calculations showed that β 0 values of DANS molecules depend on their alignment, which decrease in the following order: linear alignment > parallel stacking alignment > antiparallel stacking alignment. In particular, a linear alignment has a β 0 value more significant than that of the same number of isolated molecules. Therefore, the linear alignment of DANS molecules, which is only allowed inside smaller diameter nanotubes, can strongly enhance their second-order non-linear optical properties. Since the nanotube confinement determines the alignment of DANS molecules, a restricted nanospace can be utilized to control their second-order non-linear optical properties. These DFT findings can assist in the

Tunable optical absorption in silicene molecules

KAUST Repository

Mokkath, Junais Habeeb; Schwingenschlö gl, Udo

2016-01-01

Two-dimensional materials with a tunable band gap that covers a wide range of the solar spectrum hold great promise for sunlight harvesting. For this reason, we investigate the structural, electronic, and optical properties of silicene molecules using time dependent density functional theory. We address the influence of the molecular size, buckling, and charge state as well as that of a dielectric environment. Unlike planar graphene molecules, silicene molecules prefer to form low-buckled structures with strong visible to ultraviolet optical response. We also identify molecular plasmons.

Tunable optical absorption in silicene molecules

KAUST Repository

Mokkath, Junais Habeeb

2016-07-13

Two-dimensional materials with a tunable band gap that covers a wide range of the solar spectrum hold great promise for sunlight harvesting. For this reason, we investigate the structural, electronic, and optical properties of silicene molecules using time dependent density functional theory. We address the influence of the molecular size, buckling, and charge state as well as that of a dielectric environment. Unlike planar graphene molecules, silicene molecules prefer to form low-buckled structures with strong visible to ultraviolet optical response. We also identify molecular plasmons.

Nonlinear and Nonsymmetric Single-Molecule Electronic Properties Towards Molecular Information Processing.

Science.gov (United States)

Tamaki, Takashi; Ogawa, Takuji

2017-09-05

This review highlights molecular design for nonlinear and nonsymmetric single-molecule electronic properties such as rectification, negative differential resistance, and switching, which are important components of future single-molecule information processing devices. Perspectives on integrated "molecular circuits" are also provided. Nonlinear and nonsymmetric single-molecule electronics can be designed by utilizing (1) asymmetric molecular cores, (2) asymmetric anchoring groups, (3) an asymmetric junction environment, and (4) asymmetric electrode materials. This review mainly focuses on the design of molecular cores.

Organization of extracting molecules of the diamide type: link with the extracting properties?

International Nuclear Information System (INIS)

Meridiano, Y.

2009-02-01

The aim of these studies is to establish a link between the different organizations of diamide extractants (used in the DIAMEX process) and their extracting properties. The effects of the key parameters leading the liquid-liquid extraction (concentration of extractant, nature of solute, activity of the aqueous phase, nature of the diluent and temperature) are studied: 1) at the supramolecular scale, with the characterization of the extractant organizations by vapor-pressure osmometry (VPO) and small angle neutron and X-ray scattering (SANS/SAXS) experiments; 2) at the molecular scale, with the quantification of the extracted solutes (water, nitric acid, metal nitrate) and the determination of extracted complexes stoichiometries by electro-spray mass spectrometry (ESI-MS) experiments. The DMDOHEMA molecule acts as a classical surfactant and forms aggregates of the reverse micelle type. Taking into account the established supramolecular diagrams, a quantitative link between the extractants structures and their extracting properties has been brought to light. To model the europium nitrate extraction, two approaches have been developed: - an approach based on mass action laws. Extractions equilibria have been proposed taking into account the supramolecular speciation; - an innovative approach considering the extracted ions as adsorbed on a specific surface of the extractant molecule which depends on the extractant organization state. The ion extraction can be considered as a sum of isotherms corresponding to the different states of organization. This approach allows to compare the extraction efficiency of an extracting molecule as a function of its organization state. (author)

Simulant molecules with trivalent or pentavalent phosphorus atoms: bond dissociation energies and other thermodynamic and structural properties from quantum chemical models.

Science.gov (United States)

Hahn, David K; RaghuVeer, Krishans S; Ortiz, J V

2011-08-04

The CBS-QB3 and G4 thermochemical models have been used to generate energetic, structural, and spectroscopic data on a set of molecules with trivalent or pentavalent phosphorus atoms that can serve as simulants of chemical warfare agents. Based on structural data, the conformational stabilities of these molecules are explained in terms of the anomeric interaction within the OPOC and OPSC fragments. For those cases where experimental data are available, comparisons have been made between calculated and previously reported vibrational frequencies. All varieties of bond dissociation energies have been examined except those for C-H and P═O bonds. In trivalent phosphorus molecules, the O-C and S-C bonds have the lowest dissociation energies. In the pentavalent phosphorus set, the S-C bonds, followed by P-S bonds, have the lowest dissociation energies. In the fluorinated simulant molecules, the P-F bond is strongest, and the P-C or O-C bonds are weakest. © 2011 American Chemical Society

Organic molecules as tools to control the growth, surface structure, and redox activity of colloidal quantum dots.

Science.gov (United States)

Weiss, Emily A

2013-11-19

In order to achieve efficient and reliable technology that can harness solar energy, the behavior of electrons and energy at interfaces between different types or phases of materials must be understood. Conversion of light to chemical or electrical potential in condensed phase systems requires gradients in free energy that allow the movement of energy or charge carriers and facilitate redox reactions and dissociation of photoexcited states (excitons) into free charge carriers. Such free energy gradients are present at interfaces between solid and liquid phases or between inorganic and organic materials. Nanostructured materials have a higher density of these interfaces than bulk materials. Nanostructured materials, however, have a structural and chemical complexity that does not exist in bulk materials, which presents a difficult challenge: to lower or eliminate energy barriers to electron and energy flux that inevitably result from forcing different materials to meet in a spatial region of atomic dimensions. Chemical functionalization of nanostructured materials is perhaps the most versatile and powerful strategy for controlling the potential energy landscape of their interfaces and for minimizing losses in energy conversion efficiency due to interfacial structural and electronic defects. Colloidal quantum dots are semiconductor nanocrystals synthesized with wet-chemical methods and coated in organic molecules. Chemists can use these model systems to study the effects of chemical functionalization of nanoscale organic/inorganic interfaces on the optical and electronic properties of a nanostructured material, and the behavior of electrons and energy at interfaces. The optical and electronic properties of colloidal quantum dots have an intense sensitivity to their surface chemistry, and their organic adlayers make them dispersible in solvent. This allows researchers to use high signal-to-noise solution-phase spectroscopy to study processes at interfaces. In this

First-principles study on the structure and electronic property of gas molecules adsorption on Ge2Li2 monolayer

Science.gov (United States)

Hu, Yiwei; Long, Linbo; Mao, Yuliang; Zhong, Jianxin

2018-06-01

Using first-principles methods, we have studied the adsorption of gas molecules (CO2, CH4, H2S, H2 and NH3) on two dimensional Ge2Li2 monolayer. The adsorption geometries, adsorption energies, charge transfer, and band structures of above mentioned gas molecules adsorption on Ge2Li2 monolayer are analyzed. It is found that the adsorption of CO2 on Ge2Li2 monolayer is a kind of strong chemisorption, while other gas molecules such as CH4, H2S, H2 and NH3 are physisorption. The strong covalent binding is formed between the CO2 molecule and the nearest Ge atom in Ge2Li2 monolayer. This adsorption of CO2 molecule on Ge2Li2 monolayer leads to a direct energy gap of 0.304 eV. Other gas molecules exhibit mainly ionic binding to the nearest Li atoms in Ge2Li2 monolayer, which leads to indirect energy gap after adsorptions. Furthermore, it is found that the work function of Ge2Li2 monolayer is sensitive with the variation of adsorbents. Our results reveal that the Ge2Li2 monolayer can be used as a kind of nano device for gas molecules sensor.

Public epitopes and the antigenic structure of the HLA molecules.

Science.gov (United States)

Rodey, G E; Fuller, T C

1987-01-01

Simplified procedures for determining amino acid sequences in proteins and nucleotide sequences in DNA have rapidly expanded the number of MHC molecules for which primary amino acid structure is known. These molecules will be especially valuable as tools to study the structure-function relationships of globular proteins because of the extensive polymorphism of genes coding the MHC genes products. The general three-dimensional structure of class I MHC molecules was recently deduced, but the more subtle topographical microconformations are still undefined. Definition and topographical mapping of epitopes, defined by serological or cellular immune effector products, will be critical probes for these three-dimensional studies. Comparative studies of amino acid sequences among various MHC and molecules have revealed distinct regions of hypervariability in the alpha-1 and -2 domains of class I heavy chains and the alpha-1 and beta-1 domains of most class II molecules. Mutant MHC molecules that differ from each other by no more than one to three amino acids can have structural changes which may result in a loss of the private epitopes that defined the allelic gene product. On the basis of these studies, the private epitopes are thought to be determined by one or more of the hypervariable regions. Similar studies of the relationships between specific regions of the molecule and public epitopes are not fully explored. Because public epitopes are partially conserved structures, one might expect that their structure is not principally determined by hypervariable region. In fact, however, some public epitopes, such as A2/B17 and BW4/Bw6, do map to diversity regions. Epitope mapping as a means of identifying specific topographic sites and relating these sites to specific functional regions of the molecule will be difficult unless the epitopes themselves are better defined. Thus, the capacity to distinguish spatially distinct public epitopes from cross-reactive homologous

Molecules and Models The molecular structures of main group element compounds

CERN Document Server

Haaland, Arne

2008-01-01

This book provides a systematic description of the molecular structures and bonding in simple compounds of the main group elements with particular emphasis on bond distances, bond energies and coordination geometries. The description includes the structures of hydrogen, halogen and methyl derivatives of the elements in each group, some of these molecules are ionic, some polar covalent. The survey of molecules whose structures conform to well-established trends is followed byrepresentative examples of molecules that do not conform. We also describe electron donor-acceptor and hydrogen bonded co

Structural properties of water around uncharged and charged carbon nanotubes

International Nuclear Information System (INIS)

Dezfoli, Amir Reza Ansari; Mehrabian, Mozaffar Ali; Rafsanjani, Hassan Hashemipour

2013-01-01

Studying the structural properties of water molecules around the carbon nanotubes is very important in a wide variety of carbon nanotubes applications. We studied the number of hydrogen bonds, oxygen and hydrogen density distributions, and water orientation around carbon nanotubes. The water density distribution for all carbon nanotubes was observed to have the same feature. In water-carbon nanotubes interface, a high-density region of water molecules exists around carbon nanotubes. The results reveal that the water orientation around carbon nanotubes is roughly dependent on carbon nanotubes surface charge. The water molecules in close distances to carbon nanotubes were found to make an HOH plane nearly perpendicular to the water-carbon nanotubes interface for carbon nanotubes with negative surface charge. For uncharged carbon nanotubes and carbon nanotubes with positive surface charge, the HOH plane was in tangential orientation with water-carbon nanotubes interface. There was also a significant reduction in hydrogen bond of water region around carbon nanotubes as compared with hydrogen bond in bulk water. This reduction was very obvious for carbon nanotubes with positive surface charge. In addition, the calculation of dynamic properties of water molecules in water-CNT interface revealed that there is a direct relation between the number of Hbonds and self-diffusion coefficient of water molecules

Spin fine structure of optically excited quantum dot molecules

Science.gov (United States)

Scheibner, M.; Doty, M. F.; Ponomarev, I. V.; Bracker, A. S.; Stinaff, E. A.; Korenev, V. L.; Reinecke, T. L.; Gammon, D.

2007-06-01

The interaction between spins in coupled quantum dots is revealed in distinct fine structure patterns in the measured optical spectra of InAs/GaAs double quantum dot molecules containing zero, one, or two excess holes. The fine structure is explained well in terms of a uniquely molecular interplay of spin-exchange interactions, Pauli exclusion, and orbital tunneling. This knowledge is critical for converting quantum dot molecule tunneling into a means of optically coupling not just orbitals but also spins.

Structure and transport properties of atomic chains and molecules

DEFF Research Database (Denmark)

Strange, Mikkel

2008-01-01

general in the literature, a set of benchmark calculations for the Kohn-Sham elastic transmission function of representative single-molecule junctions has been performed. The transmission functions are calculated using two different density functional theory methods, namely an ultrasoft pseudopotential...... by direct visualization of Kohn-Sham eigenchannel states. The possibility of non-carbon based nanotubes is also discussed. Both calculations of the strain energy of infinite PtO2 nanotubes that this material could be a candidate for non-carbon based nanotubes, as was recently suggested [6]....

Synthesis of Large Molecules in Cometary Ice Analogs: Physical Properties

Science.gov (United States)

Dworkin, Jason; Sandford, S. A.; Allamandola, L. J.; Deamer, D. W.; Gillette, S. J.; Zare, R. N.

Comets and carbonaceous micrometeorites may have been important sources of volatiles on the early Earth; their organic composition may therefore be related to the origin of life. Ices on grains in molecular clouds contain a variety of simple molecules. Within the cloud and especially the presolar nebula, these icy grains would have been photoprocessed by ultraviolet light to produce more complex molecules. We are investigating the molecules that could have been generated in precometary ices. Experiments were conducted by forming a realistic interstellar ice (H_2^O, CH_3H, NH_3 and CO) at ~10 K under high vacuum irradiated UV by a hydrogen plasma lamp. The residue remaining after warming to room temperature was analyzed by HPLC and by several mass spectrometric methods. This material contains a variety of complex compounds with MS profiles resembling those found in IDPs and meteorites. Surface tension measurements show that an amphiphilic component is also present. These species do not appear in various controls or in unphotolyzed samples. In other experiments, the residues were dispersed in aqueous media for microscopy. The organic material forms 10-40 micrometer droplets that fluoresce (300-450 nm) under UV excitation and appear strikingly similar to those produced by extracts of the Murchison meteorite. Together, these results suggest a link between organic material synthesized on cold grains photochemically and compounds that may have contributed to the organic inventory of the primitive Earth. The amphiphilic properties of such compounds permit self-assembly into the membranous boundary structures required for the first forms of cellular life.

Synthetic Study on the Relationship Between Structure and Sweet Taste Properties of Steviol Glycosides

Directory of Open Access Journals (Sweden)

Grant Dubois

2012-04-01

Full Text Available The structure activity relationship between the C16-C17 methylene double bond on the aglycone of steviol glycosides and the corresponding impact on their sweet taste has been reported here for the first time. It has been observed that converting stevioside and rebaudioside A to their corresponding ketones by switching the doubly bonded methylene on C-17 for a ketone group actually removes the sweet taste properties of these molecules completely. Regenerating the original molecules tends to restore the sweet taste of both the steviol glycosides. Thus this C16-C17 methylene double bond in rebaudioside A and stevioside can be regarded as a pharmacophore essential for the sweetness property of these molecules.

Investigation of multi-state charge-storage properties of redox-active organic molecules in silicon-molecular hybrid devices for DRAM and Flash applications

Science.gov (United States)

Gowda, Srivardhan Shivappa

Molecular electronics has recently spawned a considerable amount of interest with several molecules possessing charge-conduction and charge-storage properties proposed for use in electronic devices. Hybrid silicon-molecular technology has the promise of augmenting the current silicon technology and provide for a transitional path to future molecule-only technology. The focus of this dissertation work has been on developing a class of hybrid silicon-molecular electronic devices for DRAM and Flash memory applications utilizing redox-active molecules. This work exploits the ability of molecules to store charges with single-electron precision at room temperature. The hybrid devices are fabricated by forming self-assembled monolayers of redox-active molecules on Si and oxide (SiO2 and HfO2) surfaces via formation of covalent linkages. The molecules possess discrete quantum states from which electrons can tunnel to the Si substrate at discrete applied voltages (oxidation process, cell write), leaving behind a positively charged layer of molecules. The reduction (erase) process, which is the process of electrons tunneling back from Si to the molecules, neutralizes the positively charged molecular monolayer. Hybrid silicon-molecular capacitor test structures were electrically characterized with an electrolyte gate using cyclic voltammetry (CyV) and impedance spectroscopy (CV) techniques. The redox voltages, kinetics (write/erase speeds) and charge-retention characteristics were found to be strongly dependent on the Si doping type and densities, and ambient light. It was also determined that the redox energy states in the molecules communicate with the valence band of the Si substrate. This allows tuning of write and read states by modulating minority carriers in n- and p-Si substrates. Ultra-thin dielectric tunnel barriers (SiO2, HfO2) were placed between the molecules and the Si substrate to augment charge-retention for Flash memory applications. The redox response was

Strategy to discover diverse optimal molecules in the small molecule universe.

Science.gov (United States)

Rupakheti, Chetan; Virshup, Aaron; Yang, Weitao; Beratan, David N

2015-03-23

The small molecule universe (SMU) is defined as a set of over 10(60) synthetically feasible organic molecules with molecular weight less than ∼500 Da. Exhaustive enumerations and evaluation of all SMU molecules for the purpose of discovering favorable structures is impossible. We take a stochastic approach and extend the ACSESS framework ( Virshup et al. J. Am. Chem. Soc. 2013 , 135 , 7296 - 7303 ) to develop diversity oriented molecular libraries that can generate a set of compounds that is representative of the small molecule universe and that also biases the library toward favorable physical property values. We show that the approach is efficient compared to exhaustive enumeration and to existing evolutionary algorithms for generating such libraries by testing in the NKp fitness landscape model and in the fully enumerated GDB-9 chemical universe containing 3 × 10(5) molecules.

Substitution Structures of Large Molecules and Medium Range Correlations in Quantum Chemistry Calculations

Science.gov (United States)

Evangelisti, Luca; Pate, Brooks

2017-06-01

A study of the minimally exciting topic of agreement between experimental and measured rotational constants of molecules was performed on a set of large molecules with 16-18 heavy atoms (carbon and oxygen). The molecules are: nootkatone (C_{15}H_{22}O), cedrol (C_{15}H_{26}O), ambroxide (C_{16}H_{28}O), sclareolide (C_{16}H_{22}O_{2}), and dihydroartemisinic acid (C_{15}H_{24}O_{2}). For this set of molecules we obtained 13C-subsitution structures for six molecules (this includes two conformers of nootkatone). A comparison of theoretical structures and experimental substitution structures was performed in the spirit of the recent work of Grimme and Steinmetz.[1] Our analysis focused the center-of-mass distance of the carbon atoms in the molecules. Four different computational methods were studied: standard DFT (B3LYP), dispersion corrected DFT (B3LYP-D3BJ), hybrid DFT with dispersion correction (B2PLYP-D3), and MP2. A significant difference in these theories is how they handle medium range correlation of electrons that produce dispersion forces. For larger molecules, these dispersion forces produce an overall contraction of the molecule around the center-of-mass. DFT poorly treats this effect and produces structures that are too expanded. MP2 calculations overestimate the correction and produce structures that are too compact. Both dispersion corrected DFT methods produce structures in excellent agreement with experiment. The analysis shows that the difference in computational methods can be described by a linear error in the center-of-mass distance. This makes it possible to correct poorer performing calculations with a single scale factor. We also reexamine the issue of the "Costain error" in substitution structures and show that it is significantly larger in these systems than in the smaller molecules used by Costain to establish the error limits. [1] Stefan Grimme and Marc Steinmetz, "Effects of London dispersion correction in density functional theory on

Equilibrium Structure of Manganese Trifluoride (MnF3) Molecule

International Nuclear Information System (INIS)

Caliskan, M.

2004-01-01

The symmetry lowering in manganese trifluoride molecule due to Jahn-Teller distortion was demonstrated in both the experimental and computational results. The molecule does not have D 3 h (or C 3 v) symmetry, rather it has C 2 v symmetry it has been shown from electron-diffraction measurements, that even a molecule of D 3 h symmetry in its equilibrium geometry would appear as having C 3 v symmetry. The manganese trifluoride molecular structures is an example of concerted applications of electron diffraction experiment and computation. It was found two lower energy structures with C 2 v symmetry, one corresponding to the ground state and another corresponding to the transition state. In this work we have calculate the equilibrium structure of the MnF 3 in the C 2 v configuration using the Interionic Force Model. We have compared our results for equilibrium bond lengths and bond angles with measured values from electron diffraction and with the results of quantum chemical calculations. The agreement can be considered as very reasonable

Organizing and addressing magnetic molecules.

Science.gov (United States)

Gatteschi, Dante; Cornia, Andrea; Mannini, Matteo; Sessoli, Roberta

2009-04-20

Magnetic molecules ranging from simple organic radicals to single-molecule magnets (SMMs) are intensively investigated for their potential applications in molecule-based information storage and processing. The goal of this Article is to review recent achievements in the organization of magnetic molecules on surfaces and in their individual probing and manipulation. We stress that the inherent fragility and redox sensitivity of most SMM complexes, combined with the noninnocent role played by the substrate, ask for a careful evaluation of the structural and electronic properties of deposited molecules going beyond routine methods for surface analysis. Detailed magnetic information can be directly obtained using X-ray magnetic circular dichroism or newly emerging scanning probe techniques with magnetic detection capabilities.

Zero-mode waveguide nanophotonic structures for single molecule characterization

Science.gov (United States)

Crouch, Garrison M.; Han, Donghoon; Bohn, Paul W.

2018-05-01

Single-molecule characterization has become a crucial research tool in the chemical and life sciences, but limitations, such as limited concentration range, inability to control molecular distributions in space, and intrinsic phenomena, such as photobleaching, present significant challenges. Recent developments in non-classical optics and nanophotonics offer promising routes to mitigating these restrictions, such that even low affinity (K D ~ mM) biomolecular interactions can be studied. Here we introduce and review specific nanophotonic devices used to support single molecule studies. Optical nanostructures, such as zero-mode waveguides (ZMWs), are usually fabricated in thin gold or aluminum films and serve to confine the observation volume of optical microspectroscopy to attoliter to zeptoliter volumes. These simple nanostructures allow individual molecules to be isolated for optical and electrochemical analysis, even when the molecules of interest are present at high concentration (µM–mM) in bulk solution. Arrays of ZMWs may be combined with optical probes such as single molecule fluorescence, single molecule fluorescence resonance energy transfer, and fluorescence correlation spectroscopy for distributed analysis of large numbers of single-molecule reactions or binding events in parallel. Furthermore, ZMWs may be used as multifunctional devices, for example by combining optical and electrochemical functions in a single discrete architecture to achieve electrochemical ZMWs. In this review, we will describe the optical properties, fabrication, and applications of ZMWs for single-molecule studies, as well as the integration of ZMWs into systems for chemical and biochemical analysis.

Synthesis, X-ray Structure, Optical, and Electrochemical Properties of a White-Light-Emitting Molecule

Directory of Open Access Journals (Sweden)

Jiun-Wei Hu

2016-01-01

Full Text Available A new white-light-emitting molecule (1 was synthesized and characterized by NMR spectroscopy, high resolution mass spectrometry, and single-crystal X-ray diffraction. Compound 1 crystallizes in the orthorhombic space group Pnma, with a = 12.6814(6, b = 7.0824(4, c = 17.4628(9 Å, α = 90°, β = 90°, γ = 90°. In the crystal, molecules are linked by weak intermolecular C-H···O hydrogen bonds, forming an infinite chain along [100], generating a C(10 motif. Compound 1 possesses an intramolecular six-membered-ring hydrogen bond, from which excited-state intramolecular proton transfer (ESIPT takes place from the phenolic proton to the carbonyl oxygen, resulting in a tautomer that is in equilibrium with the normal species, exhibiting a dual emission that covers almost all of the visible spectrum and consequently generates white light. It exhibits one irreversible one-electron oxidation and two irreversible one-electron reductions in dichloromethane at modest potentials. Furthermore, the geometric structures, frontier molecular orbitals (MOs, and the potential energy curves (PECs for 1 in the ground and the first singlet excited state were fully rationalized by density functional theory (DFT and time-dependent DFT calculations. The results demonstrate that the forward and backward ESIPT may happen on a similar timescale, enabling the excited-state equilibrium to be established.

Theoretical study on the molecular structure and vibrational properties, NBO and HOMO-LUMO analysis of the POX3 (X = F, Cl, Br, I) series of molecules

Science.gov (United States)

Galván, Jorge E.; Gil, Diego M.; Lanús, Hernán E.; Altabef, Aida Ben

2015-02-01

The fourth member of the series of compounds of the type POX3 with X = I was synthesized and characterized by infrared spectroscopy. The geometrical parameters and vibrational properties of POX3 (X = F, Cl, Br, I) molecules were investigated theoretically by means DFT and ab initio methods. Available geometrical and vibrational data were used together with theoretical calculations in order to obtain a set of scaled force constants. The observed trends in geometrical parameters are analyzed and compared with those obtained in a previous work for the VOX3 (X = F, Cl, Br, I) series of compounds. NBO analysis was performed in order to know the hyper-conjugative interactions that favor one structure over another. The molecular properties such as ionization potential, electron affinity, electronegativity, chemical potential, chemical hardness, softness and global electrophilicity index have been deduced from HOMO-LUMO analysis.

Guessing unknown and disordered solvent molecules with squeeze in the structure validation platon

International Nuclear Information System (INIS)

Weng, S.

2014-01-01

This report describes the assignment of the nature and number of solvent molecules in the refinement of several solvated crystal structures without a prior knowledge of the solvent system used for crystallization for the cases when the solvent molecule cannot be properly modeled. The solvent molecules can be assigned even for twinned crystal structures. (author)

Influence of lecithin-lipid composition on physico-chemical properties of nanoliposomes loaded with a hydrophobic molecule.

Science.gov (United States)

Bouarab, Lynda; Maherani, Behnoush; Kheirolomoom, Azadeh; Hasan, Mahmoud; Aliakbarian, Bahar; Linder, Michel; Arab-Tehrany, Elmira

2014-03-01

In this work, we studied the effect of nanoliposome composition based on phospholipids of docosahexaenoic acid (PL-DHA), salmon and soya lecithin, on physico-chemical characterization of vector. Cinnamic acid was encapsulated as a hydrophobic molecule in nanoliposomes made of three different lipid sources. The aim was to evaluate the influence of membrane lipid structure and composition on entrapment efficiency and membrane permeability of cinnamic acid. These properties are important for active molecule delivery. In addition, size, electrophoretic mobility, phase transition temperature, elasticity and membrane fluidity were measured before and after encapsulation. The results showed a correlation between the size of the nanoliposome and the entrapment. The entrapment efficiency of cinnamic acid was found to be the highest in liposomes prepared from salmon lecithin. The nanoliposomes composed of salmon lecithin presented higher capabilities as a carrier for cinnamic acid encapsulation. These vesicles also showed a high stability which in turn increases the membrane rigidity of nanoliposome as evaluated by their elastic properties, membrane fluidity and phase transition temperature. Copyright © 2013 Elsevier B.V. All rights reserved.

Single Molecule Spectroscopy of Electron Transfer

International Nuclear Information System (INIS)

Holman, Michael; Zang, Ling; Liu, Ruchuan; Adams, David M.

2009-01-01

The objectives of this research are threefold: (1) to develop methods for the study electron transfer processes at the single molecule level, (2) to develop a series of modifiable and structurally well defined molecular and nanoparticle systems suitable for detailed single molecule/particle and bulk spectroscopic investigation, (3) to relate experiment to theory in order to elucidate the dependence of electron transfer processes on molecular and electronic structure, coupling and reorganization energies. We have begun the systematic development of single molecule spectroscopy (SMS) of electron transfer and summaries of recent studies are shown. There is a tremendous need for experiments designed to probe the discrete electronic and molecular dynamic fluctuations of single molecules near electrodes and at nanoparticle surfaces. Single molecule spectroscopy (SMS) has emerged as a powerful method to measure properties of individual molecules which would normally be obscured in ensemble-averaged measurement. Fluctuations in the fluorescence time trajectories contain detailed molecular level statistical and dynamical information of the system. The full distribution of a molecular property is revealed in the stochastic fluctuations, giving information about the range of possible behaviors that lead to the ensemble average. In the case of electron transfer, this level of understanding is particularly important to the field of molecular and nanoscale electronics: from a device-design standpoint, understanding and controlling this picture of the overall range of possible behaviors will likely prove to be as important as designing ia the ideal behavior of any given molecule.

Structure-properties relationships of polyhedral oligomeric silsesquioxane (POSS filled PS nanocomposites

Directory of Open Access Journals (Sweden)

J. J. Schwab

2012-07-01

Full Text Available The polyhedral oligomeric silsesquioxane (POSS additivated polystyrene (PS based nanocomposites were prepared by melt processing and the structure-properties relationships of the POSS-PS systems were compared to those of the neat PS. In order to investigate the effect of these structural parameters on the final properties of the polymer nanocomposites, five different kinds of POSS samples were used, in particular, POSS with different inorganic cage and with different organic pendent groups. The rheological investigation suggests clearly that the POSS acts as a plasticizer and that the processability of the PS was positively modified. The affinity between the POSS samples and the PS matrix was estimated by the calculated theoretical solubility parameters, considering the Hoy’s method and by morphology analysis. Minor difference between the solubility parameter of POSS and the matrix means better compatibility and no aggregation tendency. Furthermore, the POSS loading leads to a decrease of the rigidity, of the glass transition temperature and of the damping factor of the nanocomposite systems. The loading of different POSS molecules with open cage leads to a more pronounced effect on all the investigated properties that the loading of the POSS molecules with closed cage. Moreover, the melt properties are significantly influenced by the type of inorganic framework, by the type of the pendent organic groups and by the interaction between the POSS organic groups and the host matrix, while, the solid state properties appears to be influenced more by the kind of cage.

Structure formation in bis(terpyridine) derivative adlayers: molecule-substrate versus molecule-molecule interactions.

Science.gov (United States)

Hoster, Harry E; Roos, Matthias; Breitruck, Achim; Meier, Christoph; Tonigold, Katrin; Waldmann, Thomas; Ziener, Ulrich; Landfester, Katharina; Behm, R Jürgen

2007-11-06

The influence of the substrate and the deposition conditions-vapor deposition versus deposition from solution-on the structures formed upon self-assembly of deposited bis(terpyridine) derivative (2,4'-BTP) monolayers on different hexagonal substrates, including highly oriented pyrolytic graphite (HOPG), Au(111), and (111)-oriented Ag thin films, was investigated by high-resolution scanning tunneling microscopy and by model calculations of the intermolecular energies and the lateral corrugation of the substrate-adsorbate interaction. Similar quasi-quadratic network structures with almost the same lattice constants obtained on all substrates are essentially identical to the optimum configuration expected from an optimization of the adlayer structure with C-H...N-type bridging bonds as a structure-determining factor, which underlines a key role of the intermolecular interactions in adlayer order. Slight distortions from the optimum values to form commensurate adlayer structures on the metal substrates and the preferential orientation of the adlayer with respect to the substrate are attributed to the substrate-adsorbate interactions, specifically, the lateral corrugation in the substrate-adsorbate interaction upon lateral displacement and rotation of the adsorbed BTP molecules. The fact that similar adlayer structures are obtained on HOPG under ultrahigh vacuum conditions (solid|gas interface) and on HOPG in trichlorobenzene (solid|liquid interface) indicates that the intermolecular interactions are not severely affected by the solvent.

Electrons in Molecules

Indian Academy of Sciences (India)

structure and properties (includingreactivt'ty) - both static (independent of time) and ... Furthermore, since the energy of H2 + in the ground state must be lower than that of .... (Figure 2b); note also that dp is positive in parts of the antibinding regions behind the two ... But, now both the sizes and shapes of molecules enter into.

Structural Dependence of Electronic Properties in A-A-D-A-A-Type Organic Solar Cell Material

Directory of Open Access Journals (Sweden)

Ram S. Bhatta

2015-01-01

Full Text Available Small conjugated molecules (SCMs are promising candidates for organic photovoltaic (OPV devices because of their structural simplicity, well control over synthetic reproducibility, and low purification cost. However, industrial development of SCM-based OPV devices requires improving their performance, which in turn relies on the fundamental understanding of structural dependence of electronic properties of SCMs. Herein, we report the structural and electronic properties of the BCNDTS molecule as a model system for acceptor-acceptor-donor-acceptor-acceptor (A-A-D-A-A type SCMs, using density functional theory (DFT and time-dependent DFT methods. Systematic calculations of two-dimensional potential energy surfaces, molecular electrostatic potential surfaces, ground state frontier molecular orbital energies, and the vertical excitation energies are performed. We found that the lowest energy conformation of the BCNDTS molecule is planar. The planar conformation favors the lowest ground state and the excited state energies as well as the strongest oscillator strength. The present results suggest that SCMs containing central dithienosilole cores connected with 2,1,3-benzothiadiazole groups have potential to be an efficient electron donor for OPV devices.

The effect of uniform capture molecule orientation on biosensor sensitivity : dependence on analyte properties

NARCIS (Netherlands)

Trilling, A.K.; Harmsen, M.M.; Ruigrok, V.J.; Zuilhof, H.; Beekwilder, J.

2013-01-01

Uniform orientation of capture molecules on biosensors has been reported to increase sensitivity. Here it is investigated which analyte properties contribute to sensitivity by orientation. Orientation of capture molecules on biosensors was investigated using variable domains of llama heavy-chain

Alcohol molecules adsorption on graphane nanosheets - A first-principles investigation

Science.gov (United States)

Nagarajan, V.; Chandiramouli, R.

2018-05-01

The geometric structure, electronic and adsorption properties of methanol, ethanol and 1-propanol molecules on hydrogenated graphene (graphane) were investigated using first-principles calculations. The stability of graphane base material is confirmed using formation energy and phonon band structures. The adsorption of alcohol molecules on bare graphane and hydrogen vacant graphane nanosheet is found to be prominent and the selectivity of alcohol molecules can be achieved using bare or hydrogen vacant graphane nanosheet. Moreover, the interaction of alcohol molecules on bare and hydrogen vacant graphane nanosheets is studied using the adsorption energy, energy band gap variation, Bader charge transfer and average energy band gap variation. The adsorption energy ranges from -0.149 to -0.383 eV upon alcohol adsorption. The energy gap varies from 4.71 to 2.62 eV for bare graphane and from 4.02 to 3.60 eV for hydrogen vacant graphane nanosheets upon adsorption of alcohol molecules. The adsorption properties of alcohol molecules provide useful information for the possible application of graphane nanosheet as a base material for the detection of alcohol molecules.

Small-molecule kinase inhibitors: an analysis of FDA-approved drugs

DEFF Research Database (Denmark)

Wu, Peng; Nielsen, Thomas Eiland; Clausen, Mads Hartvig

2016-01-01

Small-molecule kinase inhibitors (SMKIs), 28 of which are approved by the US Food and Drug Administration (FDA), have been actively pursued as promising targeted therapeutics. Here, we assess the key structural and physicochemical properties, target selectivity and mechanism of function, and ther......Small-molecule kinase inhibitors (SMKIs), 28 of which are approved by the US Food and Drug Administration (FDA), have been actively pursued as promising targeted therapeutics. Here, we assess the key structural and physicochemical properties, target selectivity and mechanism of function...

Molecular Wring Resonances in Chain Molecules

DEFF Research Database (Denmark)

Bohr, Henrik; Brunak, Søren; Bohr, Jakob

1997-01-01

It is shown that the eigenfrequency of collective twist excitations in chain molecules can be in the megahertz and gigahertz range. Accordingly, resonance states can be obtained at specific frequencies, and phenomena that involve structural properties can take place. Chain molecules can alter the...... their conformation and their ability to function, and a breaking of the chain can result. It is suggested that this phenomenon forms the basis for effects caused by the interaction of microwaves and biomolecules, e.g. microwave assisted hydrolysis of chain molecules....

Syntheses, structural analyses and luminescent property of four alkaline-earth coordination polymers

International Nuclear Information System (INIS)

Zhang, Sheng; Qu, Xiao-Ni; Xie, Gang; Wei, Qing; Chen, San-Ping

2014-01-01

Four alkaline-earth coordination polymers, [Ba(Pzdc)(H 2 O)] n (1), [Ba(Pzdc)] n (2), [AgSr(Pzdc)(NO 3 )(H 2 O)] n (3), [Ag 2 Ca(Pzdc) 2 (H 2 O)] n (4) (H 2 Pzdc=2, 3-pyrazinedicarboxylic acid) have been synthesized and characterized by single-crystal X-ray diffraction. Compounds 1 and 2 afford 2D layer networks generated by one-dimensional chains containing the [Ba 2 O 11 N] units. Compound 3 is of 2D mixed-metal coordination network formed by one-dimensional chain units, while 4 is of a 3D heterometallic framework. Interestingly, 1 and 2 can undergo reversible SCSC structural transformation upon dehydration/rehydration of coordinated water molecules. In addition, the π–π stacking interactions dominate fluorescent properties of compounds 1 and 2. - Graphical abstract: Four new coordination polymers [Ba(Pzdc)(H 2 O)] n (1), [Ba(Pzdc)] n (2), [AgSr(Pzdc)(NO 3 )(H 2 O)] n (3), [Ag 2 Ca(Pzdc) 2 (H 2 O)] n (4) (H 2 Pzdc=2, 3-pyrazinedicarboxylic acid) have been synthesized. Compounds 1–3 display 2D topology structures and compound 4 exhibits a 3D topology structure. Fortunately, 1 and 2 undergo reversible dehydration/rehydration of coordinated water molecules. Display Omitted - Highlights: • All structures are generated by 1D chains. • 1 and 2 show reversible dehydration/rehydration of coordinated water molecules. • The π–π stacking interactions dominate fluorescent properties of compounds 1 and 2

Unique Reversible Crystal-to-Crystal Phase Transition – Structural and Functional Properties of Fused Ladder Thienoarenes

KAUST Repository

Abe, Yuichiro

2017-08-15

Donor-acceptor type molecules based on fused ladder thienoarenes, indacenodithiophene (IDT) and dithienocyclopenta-thienothiophene (DTCTT), coupled with benzothiadiazole, are prepared and their solid-state structures are investigated. They display a rich variety of solid phases ranging from amorphous glass states to crystalline states, upon changes in the central aromatic core and side group structures. Most notably, the DTCTT-based derivatives showed reversible crystal-to-crystal phase transitions in heating and cooling cycles. Unlike what has been seen in π−conjugated molecules variable temperature XRD revealed that structural change occurs continuously during the transition. A columnar self-assembled structure with slip-stacked π−π interaction is proposed to be involved in the solid-state. This research provides the evidence of unique structural behavior of the DTCTT-based molecules through the detailed structural analysis. This unique structural transition paves the way for these materials to have self-healing of crystal defects, leading to improved optoelectronic properties.

Unique Reversible Crystal-to-Crystal Phase Transition – Structural and Functional Properties of Fused Ladder Thienoarenes

KAUST Repository

Abe, Yuichiro; Savikhin, Victoria; Yin, Jun; Grimsdale, Andrew C.; Soci, Cesare; Toney, Michael F.; Lam, Yeng Ming

2017-01-01

Donor-acceptor type molecules based on fused ladder thienoarenes, indacenodithiophene (IDT) and dithienocyclopenta-thienothiophene (DTCTT), coupled with benzothiadiazole, are prepared and their solid-state structures are investigated. They display a rich variety of solid phases ranging from amorphous glass states to crystalline states, upon changes in the central aromatic core and side group structures. Most notably, the DTCTT-based derivatives showed reversible crystal-to-crystal phase transitions in heating and cooling cycles. Unlike what has been seen in π−conjugated molecules variable temperature XRD revealed that structural change occurs continuously during the transition. A columnar self-assembled structure with slip-stacked π−π interaction is proposed to be involved in the solid-state. This research provides the evidence of unique structural behavior of the DTCTT-based molecules through the detailed structural analysis. This unique structural transition paves the way for these materials to have self-healing of crystal defects, leading to improved optoelectronic properties.

Effects of Electrode Distances on Geometric Structure and Electronic Transport Properties of Molecular 4,4'-Bipyridine Junction

International Nuclear Information System (INIS)

Li Zongliang; Zou Bin; Wang Chuankui; Luo Yi

2006-01-01

Influences of electrode distances on geometric structure of molecule and on electronic transport properties of molecular junctions have been investigated by means of a generalized quantum chemical approach based on the elastic scattering Green's function method. Numerical results show that, for organic molecule 4,4'-bipyridine, the geometric structure of the molecule especially the dihedral angle between the two pyridine rings is sensitive to the distances between the two electrodes. The currents of the molecular junction are taken nonlinearly increase with the increase of the bias. Shortening the distance of the metallic electrodes will result in stronger coupling and larger conductance

A theoretical study of structural and electronic properties of pentacene/Al(100) interface.

Science.gov (United States)

Saranya, G; Nair, Shiny; Natarajan, V; Kolandaivel, P; Senthilkumar, K

2012-09-01

The first principle calculations within the framework of density functional theory have been performed for the pentacene molecule deposited on the aluminum Al(100) substrate to study the structural and electronic properties of the pentacene/Al(100) interface. The most stable configuration was found at bridge site with 45° rotation of the pentacene molecule on Al(100) surface with a vertical distance of 3.4 Å within LDA and 3.8 Å within GGA functionals. The calculated adsorption energy reveals that the adsorption of pentacene molecule on Al(100) surface is physisorption. For the stable adsorption geometry the electronic properties such as density of states (DOS), partial density of states (PDOS), Mulliken population analysis and Schottky barrier height are studied. The analysis of atomic charge, DOS and PDOS show that the charge is transferred from the Al(100) surface to pentacene molecule, and the transferred charge is about -0.05 electrons. For the adsorbed system, the calculated Schottky barrier height for hole and electron transport is 0.27 and 1.55 eV, respectively. Copyright © 2012 Elsevier Inc. All rights reserved.

RNA secondary structure diagrams for very large molecules: RNAfdl

DEFF Research Database (Denmark)

Hecker, Nikolai; Wiegels, Tim; Torda, Andrew E.

2013-01-01

There are many programs that can read the secondary structure of an RNA molecule and draw a diagram, but hardly any that can cope with 10 3 bases. RNAfdl is slow but capable of producing intersection-free diagrams for ribosome-sized structures, has a graphical user interface for adjustments...

Single-Molecule Transport at a Rectifying GaAs Contact.

Science.gov (United States)

Vezzoli, Andrea; Brooke, Richard J; Ferri, Nicolò; Higgins, Simon J; Schwarzacher, Walther; Nichols, Richard J

2017-02-08

In most single- or few-molecule devices, the contact electrodes are simple ohmic resistors. Here we describe a new type of single-molecule device in which metal and semiconductor contact electrodes impart a function, namely, current rectification, which is then modified by a molecule bridging the gap. We study junctions with the structure Au STM tip/X/n-GaAs substrate, where "X" is either a simple alkanedithiol or a conjugated unit bearing thiol/methylthiol contacts, and we detect current jumps corresponding to the attachment and detachment of single molecules. From the magnitudes of the current jumps we can deduce values for the conductance decay constant with molecule length that agree well with values determined from Au/molecule/Au junctions. The ability to impart functionality to a single-molecule device through the properties of the contacts as well as through the properties of the molecule represents a significant extension of the single-molecule electronics "tool-box".

Electronic structure and optical properties of metal doped tetraphenylporphyrins

Science.gov (United States)

Shah, Esha V.; Roy, Debesh R.

2018-05-01

A density functional scrutiny on the structure, electronic and optical properties of metal doped tetraphenylporphyrins MTPP (M=Fe, Co, Ni) is performed. The structural stability of the molecules is evaluated based on the electronic parameters like HOMO-LUMO gap (HLG), chemical hardness (η) and binding energy of the central metal atom to the molecular frame etc. The computed UltraViolet-Visible (UV-Vis) optical absorption spectra for all the compounds are also compared. The molecular structures reported are the lowest energy configurations. The entire calculations are carried out with a widely reliable functional, viz. B3LYP with a popular basis set which includes a scaler relativistic effect, viz. LANL2DZ.

Effects of adatom and gas molecule adsorption on the physical properties of tellurene: a first principles investigation.

Science.gov (United States)

Wang, Xiao Hua; Wang, Da Wei; Yang, Ai Jun; Koratkar, Nikhil; Chu, Ji Feng; Lv, Pin Lei; Rong, Ming Zhe

2018-02-07

Tellurene is a new member of the two-dimensional (2D) materials' family, whose existence has been recently confirmed by first principles calculation and experimental work. Tellurene is also the first 2D mono-elemental material of group-VI predicted by scientists, and investigations of its basic properties are still in their infancy. In this study, we use first principles calculation based on density functional theory to investigate the adsorption of nineteen typical adatoms (Li, Na, K, Ca, Fe, Co, Ni, Cu, Zn, Ag, Au, Pd, Pt, B, N, O, Si, Cl, and Al), and five typical gas molecules (H 2 , O 2 , H 2 O, NO 2 , and NH 3 ) on α-phase as well as β-phase tellurene sheets. Our calculations shows that most adatoms are chemisorbed on tellurene sheets with large adsorption energies. Moreover, some of the adatoms are observed to give rise to distinct structural deformations and even local reconstructions. We report that a variety of electronic states are induced by the adatoms, which implies that different electronic structures can be engineered by the adsorption of adatoms. In fact, n-type doping, p-type doping, half-metal, and spin-gapless semiconductor features can be acquired by doping adatoms on tellurene sheets. Our calculations also show that the five gas molecules are all physisorbed on tellurene sheets, and no splitting behaviors are observed. Therefore, the adsorption of the five gas molecules has a weak effect on the electronic properties of tellurene. To conclude, our results indicate that adatom engineering may be used to greatly expand the potential applications of 2D tellurene.

Synthesis, structure and some properties of a manganese(II) benzoate containing diimine

Science.gov (United States)

Paul, Pranajit; Roy, Subhadip; Sarkar, Sanjoy; Chowdhury, Shubhamoy; Purkayastha, R. N. Dutta; Raghavaiah, Pallepogu; McArdle, Patrick; Deb, Lokesh; Devi, Sarangthem Indira

2015-12-01

A new monomeric manganese(II) benzoate complex containing nitrogen donor 2,2‧-bipyridine, [Mn(OBz)2(bipy)(H2O)] (OBz = benzoate, bipy = 2,2‧-bipyridine) has been synthesized from aqueous methanol medium and characterized by analytical, spectroscopic and single crystal X-ray diffraction studies. The compound exhibits moderate to appreciable antimicrobial activity. The complex crystallizes in space group P21/n. Mn(II) atom is ligated by two N atoms of bipyridine, three O atoms from a monodentate and a bidentate benzoate ligand and a water molecule forming distorted octahedral structure. The coordinated water molecule forms intramolecular hydrogen bonds and links the monomer molecules into hydrogen bonded dimer. The hydrogen bonded dimers are involved in intermolecular C-H···O and π-π stacking interactions. Density functional theory (DFT) computation was carried out to compute the frequencies of relevant vibrational modes and electronic properties, the results are in compliance with the experimentally obtained structural and spectral data.

Modulating the single-molecule magnet behaviour in phenoxo-O bridged Dy2 systems via subtle structural variations

Science.gov (United States)

Wang, Wen-Min; Zhao, Xiao-Yu; Qiao, Hui; Bai, Li; Han, Hong-Fei; Fang, Ming; Wu, Zhi-Lei; Zou, Ji-Yong

2017-09-01

In search of simple approaches to rationally modulate the single-molecule magnet behaviour in polynuclear lanthanide compound, a new system containing two structurally closely related dinuclear dysprosium complexes, namely [Dy2(hfac)4L2] (1) and [Dy2(hfac)4L‧2] (2) (hfac = hexafluoroacetylacetonate, HL = 2-[4-methylaniline-imino]methyl]-8-hydroxyquinoline and HL' = 2-[(3,4-dimethylaniline)-imino]methyl]-8-hydroxyquinoline), are successfully synthesized and the structure-dependent magnetic properties are investigated. The two Dy2 compounds display only slight variations in the coordination geometries of the center Dy(III) ion but display remarkably different single-molecule magnet behaviors with the anisotropic barriers (ΔE/kB) of 9.91 K for 1 and 20.57 K for 2. The different magnetic relaxation behaviors of the two Dy2 complexes mainly originate from the different chemical environments of the central DyIII ions.

Gamma radiation-induced structural changes in triglyceride molecules in pork fat

International Nuclear Information System (INIS)

Salkova, Z.; Koman, V.

1976-01-01

In the structure of associated and individual triglyceride pork fat molecules, some changes take place under the effect of ionizing radiation. Due to the irradiation of the fat the amount of the di- and tri-unsaturated (UUU, UUS, USU) triglyceride molecules decreases. The occurrence of the unsatured fatty acids on sites 1,3 decreases and the percentage of the individual triglyceride molecules having on their extreme sites C-1,3 unsaturated fatty acids decreases in all combinations. It can be assumed that hydrogenation and pre-esterification occurs in the triglyceride molecules. (author)

Ab initio study of structural and mechanical property of solid molecular hydrogens

Science.gov (United States)

Ye, Yingting; Yang, Li; Yang, Tianle; Nie, Jinlan; Peng, Shuming; Long, Xinggui; Zu, Xiaotao; Du, Jincheng

2015-06-01

Ab initio calculations based on density functional theory (DFT) were performed to investigate the structural and the elastic properties of solid molecular hydrogens (H2). The influence of molecular axes of H2 on structural relative stabilities of hexagonal close-packed (hcp) and face-centered cubic (fcc) structured hydrogen molecular crystals were systematically investigated. Our results indicate that for hcp structures, disordered hydrogen molecule structure is more stable, while for fcc structures, Pa3 hydrogen molecular crystal is most stable. The cohesive energy of fcc H2 crystal was found to be lower than hcp. The mechanical properties of fcc and hcp hydrogen molecular crystals were obtained, with results consistent with previous theoretical calculations. In addition, the effects of zero point energy (ZPE) and van der Waals (vdW) correction on the cohesive energy and the stability of hydrogen molecular crystals were systematically studied and discussed.

Structure factors for tunneling ionization rates of molecules

DEFF Research Database (Denmark)

Madsen, L.B.; Jensen, F.; Tolstikhin, O.I.

2013-01-01

Within the weak-field asymptotic theory, the dependence of the tunneling ionization rate of a molecule in a static electric field on its orientation with respect to the field is determined by the structure factor for the highest occupied molecular orbital (HOMO). An accurate determination...

Syntheses, structural analyses and luminescent property of four alkaline-earth coordination polymers

Energy Technology Data Exchange (ETDEWEB)

Zhang, Sheng; Qu, Xiao-Ni; Xie, Gang; Wei, Qing; Chen, San-Ping, E-mail: sanpingchen@126.com

2014-02-15

Four alkaline-earth coordination polymers, [Ba(Pzdc)(H{sub 2}O)]{sub n} (1), [Ba(Pzdc)]{sub n} (2), [AgSr(Pzdc)(NO{sub 3})(H{sub 2}O)]{sub n} (3), [Ag{sub 2}Ca(Pzdc){sub 2}(H{sub 2}O)]{sub n} (4) (H{sub 2}Pzdc=2, 3-pyrazinedicarboxylic acid) have been synthesized and characterized by single-crystal X-ray diffraction. Compounds 1 and 2 afford 2D layer networks generated by one-dimensional chains containing the [Ba{sub 2}O{sub 11}N] units. Compound 3 is of 2D mixed-metal coordination network formed by one-dimensional chain units, while 4 is of a 3D heterometallic framework. Interestingly, 1 and 2 can undergo reversible SCSC structural transformation upon dehydration/rehydration of coordinated water molecules. In addition, the π–π stacking interactions dominate fluorescent properties of compounds 1 and 2. - Graphical abstract: Four new coordination polymers [Ba(Pzdc)(H{sub 2}O)]{sub n} (1), [Ba(Pzdc)]{sub n} (2), [AgSr(Pzdc)(NO{sub 3})(H{sub 2}O)]{sub n} (3), [Ag{sub 2}Ca(Pzdc){sub 2}(H{sub 2}O)]{sub n} (4) (H{sub 2}Pzdc=2, 3-pyrazinedicarboxylic acid) have been synthesized. Compounds 1–3 display 2D topology structures and compound 4 exhibits a 3D topology structure. Fortunately, 1 and 2 undergo reversible dehydration/rehydration of coordinated water molecules. Display Omitted - Highlights: • All structures are generated by 1D chains. • 1 and 2 show reversible dehydration/rehydration of coordinated water molecules. • The π–π stacking interactions dominate fluorescent properties of compounds 1 and 2.

Structures and Dynamics of Two-Dimensional Dust Lattices with and without Coulomb Molecules in Plasmas

International Nuclear Information System (INIS)

Huang Feng; Wang Xue-Jin; Liu Yan-Hong; Ye Mao-Fu; Wang Long

2010-01-01

Structures and dynamics of two-dimensional dust lattices with and without Coulomb molecules in plasmas are investigated. The experimental results show that the lattices have the crystal-like hexagonal structures, i.e. most particles have six nearest-neighboring particles. However, the lattice points can be occupied by the individual particles or by a pair of particles called Coulomb molecules. The pair correlation function is used to compare the structures between the lattices with or without the Coulomb molecules. In the experiments, the Coulomb molecules can also decompose and recombine with another individual particle to form a new molecule. (physics of gases, plasmas, and electric discharges)

Magnetic properties of dendrimer structures with different coordination numbers: A Monte Carlo study

Science.gov (United States)

Masrour, R.; Jabar, A.

2016-11-01

We investigate the magnetic properties of Cayley trees of large molecules with dendrimer structure using Monte Carlo simulations. The thermal magnetization and magnetic susceptibility of a dendrimer structure are given with different coordination numbers, Z=3, 4, 5 and different generations g=3 and 2. The variation of magnetizations with the exchange interactions and crystal fields have been given of this system. The magnetic hysteresis cycles have been established.

Small Molecules Affect Human Dental Pulp Stem Cell Properties Via Multiple Signaling Pathways

Science.gov (United States)

Al-Habib, Mey; Yu, Zongdong

2013-01-01

One fundamental issue regarding stem cells for regenerative medicine is the maintenance of stem cell stemness. The purpose of the study was to test whether small molecules can enhance stem cell properties of mesenchymal stem cells (MSCs) derived from human dental pulp (hDPSCs), which have potential for multiple clinical applications. We identified the effects of small molecules (Pluripotin (SC1), 6-bromoindirubin-3-oxime and rapamycin) on the maintenance of hDPSC properties in vitro and the mechanisms involved in exerting the effects. Primary cultures of hDPSCs were exposed to optimal concentrations of these small molecules. Treated hDPSCs were analyzed for their proliferation, the expression levels of pluripotent and MSC markers, differentiation capacities, and intracellular signaling activations. We found that small molecule treatments decreased cell proliferation and increased the expression of STRO-1, NANOG, OCT4, and SOX2, while diminishing cell differentiation into odonto/osteogenic, adipogenic, and neurogenic lineages in vitro. These effects involved Ras-GAP-, ERK1/2-, and mTOR-signaling pathways, which may preserve the cell self-renewal capacity, while suppressing differentiation. We conclude that small molecules appear to enhance the immature state of hDPSCs in culture, which may be used as a strategy for adult stem cell maintenance and extend their capacity for regenerative applications. PMID:23573877

Rationalizing the photophysical properties of BODIPY laser dyes via aromaticity and electron-donor-based structural perturbations

Energy Technology Data Exchange (ETDEWEB)

Waddell, Paul G.; Liu, Xiaogang; Zhao, Teng; Cole, Jacqueline M.

2015-05-01

The absorption and fluorescence properties of six boron dipyrromethene (BODIPY) laser dyes with simple non-aromatic substituents are rationalized by relating them to observable structural perturbations within the molecules of the dyes. An empirical relationship involving the structure and the optical properties is derived using a combination of single-crystal X-ray diffraction data, quantum chemical calculations and electronic constants: i.e. the tendency of the pyrrole bond lengths towards aromaticity and the UV-vis absorption and fluorescence wavelengths correlating with the electron-donor properties of the substituents. The effect of molecular conformation on the solid-state optical properties of the dyes is also discussed. The findings in this study also demonstrate the usefulness and limitations of using crystal structure data to develop structure-property relationships in this class of optical materials, contributing to the growing effort to design optoelectronic materials with tunable properties via molecular engineering.

Quasi continuum vibrational of molecules and isotopic selectivity properties induced by collisions

International Nuclear Information System (INIS)

Angelie, Christian

1990-01-01

This research thesis proposes an overview of knowledge on vibrationally highly excited states of molecules. The author shows that the statistic quasi-continuum formed by these states is preceded by a quasi continuum of weak transitions with a lower energy, and that these transitions remain structured and very narrow up to the dissociation energy and beyond. Collisions between molecules excited in their quasi continuum are then studied. The author particularly analyses a new phenomenon of isotopic selectivity which is important for the dissociation of a molecule colliding another molecule. It appears that this selectivity regarding selectivity is due to a selectivity of transferred energy which paradoxically increases with the molecule vibrational content because of a resonance phenomenon of energies transferred by dipole-dipole interaction [fr

Density functional theory study of structural and electronic properties of trans and cis structures of thiothixene as a nano-drug.

Science.gov (United States)

Noori Tahneh, Akram; Bagheri Novir, Samaneh; Balali, Ebrahim

2017-11-25

The geometrical structure, electronic and optical properties, electronic absorption spectra, vibrational frequencies, natural charge distribution, MEP analysis and thermodynamic properties of the trans and cis structures of the drug thiothixene were investigated using density functional theory (DFT) and time-dependent DFT (TDDFT) methods with the B3LYP hybrid functional and 6-311 + G(d,p) basis set. The results of the calculations demonstrate that the cis structure of thiothixene has appropriate quantum properties that can act as an active medicine. The relative energies of trans and cis structures of thiothixene shows that the cis structure is more stable than the trans structure, with a small energy difference. TDDFT calculations show that the cis structure of thiothixene has the best absorption properties. The calculated NLO properties show that the NLO properties of the cis structure of thiothixene are higher than the trans structure, and the fact that the chemical hardness of the cis structure is lower than that of the trans structure that indicates that the reactivity and charge transfer of the cis isomer of thiothixene is higher than that of trans thiothixene. The molecular electrostatic potential (MEP) maps of both structures of thiothixene demonstrate that the oxygen atoms of the molecule are appropriate areas for electrophilic reactions. The vibrational frequencies of the two conformations of thiothixene demonstrate that both structures of thiothixene have almost similar modes of vibrations. The calculated thermodynamic parameters show that these quantities increase with enhancing temperature due to the enhancement of molecular vibrational intensities with temperature. Graphical abstract Trans/Cis isomerization of thiothixene drug.

Structure of molecules and internal rotation

CERN Document Server

Mizushima, San-Ichiro

1954-01-01

Structure of Molecules and Internal Rotation reviews early studies on dihalogenoethanes. This book is organized into two parts encompassing 8 chapters that evaluate the Raman effect in ethane derivatives, the energy difference between rotational isomers, and the infrared absorption of ethane derivatives. Some of the topics covered in the book are the potential barrier to internal rotation; nature of the hindering potential; entropy difference between the rotational isomers; internal rotation in butane, pentane, and hexane; and internal rotation in long chain n-paraffins. Other chapters deal wi

Structural requirements for the interaction between class II MHC molecules and peptide antigens

DEFF Research Database (Denmark)

Sette, A; Buus, S; Appella, E

1990-01-01

of binding, it is possible to define certain structural features of peptides that are associated with the capacity to bind to a particular MHC specificity (IA(d) or IE(d)); 3) IA(d) and IE(d) molecules recognize different and independent structures on the antigen molecule; 4) only about 10% of the single...... IA(d) and IE(d) molecules and their peptide ligands, we found that some structural characteristics apply to both antigen-MHC interactions. In particular, we found: 1) each MHC molecule is capable of binding many unrelated peptides through the same peptide-binding site; 2) despite this permissiveness...... amino acid substitutions tested on two IA(d)- and IE(d)-binding peptides had significant effect on their MHC-binding capacities, while over 80% of these substitutions significantly impaired T cell recognition of the Ia-peptide complex; 5) based on the segregation between residues that are crucial for T...

A Pareto Algorithm for Efficient De Novo Design of Multi-functional Molecules.

Science.gov (United States)

Daeyaert, Frits; Deem, Micheal W

2017-01-01

We have introduced a Pareto sorting algorithm into Synopsis, a de novo design program that generates synthesizable molecules with desirable properties. We give a detailed description of the algorithm and illustrate its working in 2 different de novo design settings: the design of putative dual and selective FGFR and VEGFR inhibitors, and the successful design of organic structure determining agents (OSDAs) for the synthesis of zeolites. We show that the introduction of Pareto sorting not only enables the simultaneous optimization of multiple properties but also greatly improves the performance of the algorithm to generate molecules with hard-to-meet constraints. This in turn allows us to suggest approaches to address the problem of false positive hits in de novo structure based drug design by introducing structural and physicochemical constraints in the designed molecules, and by forcing essential interactions between these molecules and their target receptor. © 2017 Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim.

Structural Analysis of ‘key’ Interactions in Functional RNA Molecules

KAUST Repository

Chawla, Mohit

2018-04-01

The main objective of the thesis is to carry out structural bioinformatics study along with usage of advanced quantum chemical methods to look at the structural stability and energetics of RNA building blocks. The main focus of the work described here lies on understanding the reasons behind the intrinsic stability of key interactions in nucleic acids. Crystal structures of RNA molecules exhibit fascinating variety of non-covalent interactions, which play an important role in maintaining the three dimensional structures. An accurate atomic level description of these interactions in the structural building blocks of RNA is a key to understand the structure-function relationship in these molecules. An effort has been made to link the conclusions drawn from quantum chemical computations on RNA base pairs in wide biochemical context of their occurrence in RNA structures. The initial attention was on the impact of natural and non-natural modifications of the nucleic acid bases on the structure and stability of base pairs that they are involved in. In the remaining sections we cover other molecular interactions shaping nucleic acids, as the interaction between ribose and the bases, and the fluoride sensing riboswitch system in order to investigate structure and dynamics of nucleic acids at the atomic level and to gain insight into the physical chemistry behind.

Structural Analysis of ‘key’ Interactions in Functional RNA Molecules

KAUST Repository

Chawla, Mohit

2018-01-01

The main objective of the thesis is to carry out structural bioinformatics study along with usage of advanced quantum chemical methods to look at the structural stability and energetics of RNA building blocks. The main focus of the work described here lies on understanding the reasons behind the intrinsic stability of key interactions in nucleic acids. Crystal structures of RNA molecules exhibit fascinating variety of non-covalent interactions, which play an important role in maintaining the three dimensional structures. An accurate atomic level description of these interactions in the structural building blocks of RNA is a key to understand the structure-function relationship in these molecules. An effort has been made to link the conclusions drawn from quantum chemical computations on RNA base pairs in wide biochemical context of their occurrence in RNA structures. The initial attention was on the impact of natural and non-natural modifications of the nucleic acid bases on the structure and stability of base pairs that they are involved in. In the remaining sections we cover other molecular interactions shaping nucleic acids, as the interaction between ribose and the bases, and the fluoride sensing riboswitch system in order to investigate structure and dynamics of nucleic acids at the atomic level and to gain insight into the physical chemistry behind.

Counteracting chemical chaperone effects on the single-molecule α-synuclein structural landscape

OpenAIRE

Ferreon, Allan Chris M.; Moosa, Mahdi Muhammad; Gambin, Yann; Deniz, Ashok A.

2012-01-01

Protein structure and function depend on a close interplay between intrinsic folding energy landscapes and the chemistry of the protein environment. Osmolytes are small-molecule compounds that can act as chemical chaperones by altering the environment in a cellular context. Despite their importance, detailed studies on the role of these chemical chaperones in modulating structure and dimensions of intrinsically disordered proteins have been limited. Here, we used single-molecule Förster reson...

Solution processable organic polymers and small molecules for bulk-heterojunction solar cells: A review

International Nuclear Information System (INIS)

Sharma, G. D.

2011-01-01

Solution processed bulk heterojunction (BHJ) organic solar cells (OSCs) have gained wide interest in past few years and are established as one of the leading next generation photovoltaic technologies for low cost power production. Power conversion efficiencies up to 6% and 6.5% have been reported in the literature for single layer and tandem solar cells, respectively using conjugated polymers. A recent record efficiency about 8.13% with active area of 1.13 cm 2 has been reported. However Solution processable small molecules have been widely applied for photovoltaic (PV) devices in recent years because they show strong absorption properties, and they can be easily purified and deposited onto flexible substrates at low cost. Introducing different donor and acceptor groups to construct donor--acceptor (D--A) structure small molecules has proved to be an efficient way to improve the properties of organic solar cells (OSCs). The power conversion efficiency about 4.4 % has been reported for OSCs based on the small molecules. This review deals with the recent progress of solution processable D--A structure small molecules and discusses the key factors affecting the properties of OSCs based on D--A structure small molecules: sunlight absorption, charge transport and the energy level of the molecules.

Dynamics of water around the complex structures formed between the KH domains of far upstream element binding protein and single-stranded DNA molecules

Energy Technology Data Exchange (ETDEWEB)

Chakraborty, Kaushik; Bandyopadhyay, Sanjoy, E-mail: sanjoy@chem.iitkgp.ernet.in [Molecular Modeling Laboratory, Department of Chemistry, Indian Institute of Technology, Kharagpur 721302 (India)

2015-07-28

Single-stranded DNA (ss-DNA) binding proteins specifically bind to the single-stranded regions of the DNA and protect it from premature annealing, thereby stabilizing the DNA structure. We have carried out atomistic molecular dynamics simulations of the aqueous solutions of two DNA binding K homology (KH) domains (KH3 and KH4) of the far upstream element binding protein complexed with two short ss-DNA segments. Attempts have been made to explore the influence of the formation of such complex structures on the microscopic dynamics and hydrogen bond properties of the interfacial water molecules. It is found that the water molecules involved in bridging the ss-DNA segments and the protein domains form a highly constrained thin layer with extremely retarded mobility. These water molecules play important roles in freezing the conformational oscillations of the ss-DNA oligomers and thereby forming rigid complex structures. Further, it is demonstrated that the effect of complexation on the slow long-time relaxations of hydrogen bonds at the interface is correlated with hindered motions of the surrounding water molecules. Importantly, it is observed that the highly restricted motions of the water molecules bridging the protein and the DNA components in the complexed forms originate from more frequent hydrogen bond reformations.

Impact of amphiphilic molecules on the structure and stability of homogeneous sphingomyelin bilayer: Insights from atomistic simulations

Science.gov (United States)

Kumari, Pratibha; Kaur, Supreet; Sharma, Shobha; Kashyap, Hemant K.

2018-04-01

Modulation of lipid membrane properties due to the permeation of amphiphiles is an important biological process pertaining to many applications in the field of pharmaceutics, toxicology, and biotechnology. Sphingolipids are both structural and functional lipids that constitute an important component of mechanically stable and chemically resistant outer leaflets of plasma membranes. Here, we present an atomistic molecular dynamics simulation study to appreciate the concentration-dependent effects of small amphiphilic molecules, such as ethanol, acetone, and dimethyl sulfoxide (DMSO), on the structure and stability of a fully hydrated homogeneous N-palmitoyl-sphingomyelin (PSM) bilayer. The study reveals an increase in the lateral expansion of the bilayer along with disordering of the hydrophobic lipid tails on increasing the concentration of ethanol. At higher concentrations of ethanol, rupturing of the bilayer is quite evident through the analysis of partial electron density profiles and lipid tail order parameters. For ethanol containing systems, permeation of water molecules in the hydrophobic part of the bilayer is allowed through local defects made due to the entry of ethanol molecules via ethanol-ethanol and ethanol-PSM hydrogen bonds. Moreover, the extent of PSM-PSM hydrogen bonding decreases with increasing ethanol concentration. On the other hand, acetone and DMSO exhibit minimal effects on the stability of the PSM bilayer at their lower concentrations, but at higher concentrations they tend to enhance the stability of the bilayer. The simulated potential of mean force (PMF) profiles for the translocation of the three solutes studied reveal that the free-energy of transfer of an ethanol molecule across the PSM lipid head region is lower than that for acetone and DMSO molecules. However, highest free-energy rise in the core hydrophobic part of the bilayer is observed for the DMSO molecule, whereas the ethanol and acetone PMF profiles show a lower barrier in

Mapping small molecule binding data to structural domains.

Science.gov (United States)

Kruger, Felix A; Rostom, Raghd; Overington, John P

2012-01-01

Large-scale bioactivity/SAR Open Data has recently become available, and this has allowed new analyses and approaches to be developed to help address the productivity and translational gaps of current drug discovery. One of the current limitations of these data is the relative sparsity of reported interactions per protein target, and complexities in establishing clear relationships between bioactivity and targets using bioinformatics tools. We detail in this paper the indexing of targets by the structural domains that bind (or are likely to bind) the ligand within a full-length protein. Specifically, we present a simple heuristic to map small molecule binding to Pfam domains. This profiling can be applied to all proteins within a genome to give some indications of the potential pharmacological modulation and regulation of all proteins. In this implementation of our heuristic, ligand binding to protein targets from the ChEMBL database was mapped to structural domains as defined by profiles contained within the Pfam-A database. Our mapping suggests that the majority of assay targets within the current version of the ChEMBL database bind ligands through a small number of highly prevalent domains, and conversely the majority of Pfam domains sampled by our data play no currently established role in ligand binding. Validation studies, carried out firstly against Uniprot entries with expert binding-site annotation and secondly against entries in the wwPDB repository of crystallographic protein structures, demonstrate that our simple heuristic maps ligand binding to the correct domain in about 90 percent of all assessed cases. Using the mappings obtained with our heuristic, we have assembled ligand sets associated with each Pfam domain. Small molecule binding has been mapped to Pfam-A domains of protein targets in the ChEMBL bioactivity database. The result of this mapping is an enriched annotation of small molecule bioactivity data and a grouping of activity classes

Interface properties of organic molecules on metal surfaces; Grenzflaecheneigenschaften organischer Molekuele auf Metalloberflaechen

Energy Technology Data Exchange (ETDEWEB)

Karacuban, Hatice

2010-01-28

In this work, the growth of the archetype molecules CuPc and PTCDA was investigated on Cu(111). PTCDA was also studied on NaCl/Cu(111). The main experiments were carried out with a scanning tunneling microscope. Structural analysis of CuPc on Cu (111) is only possible at low temperatures, since at room temperature the molecules exhibit a high surface mobility. For the investigation of these structures and especially to enable scanning tunneling spectroscopy, a low-temperature scanning tunneling microscope was developed. Using this home built STM the experiments could be carried out at about 10 K. After the adsorption of CuPc on Cu (111) a substrate-induced symmetry reduction of the molecules can be observed in scanning tunneling microscopy. When the occupied states of the molecules are imaged, a switching between two distinct levels is found. These modifications are determined by the adsorption geometry of the molecules. Based on high resolution STM data, an on-top adsorption geometry of the CuPc-molecules on Cu (111)-substrate can be deducted. At low temperatures, two new superstructures of PTCDA on Cu(111) are observed. The molecules within these superstructures are tilted with respect to the substrate. Intermolecular interactions may be the crucial factor for the realignment of the molecules. If PTCDA molecules are adsorbed on a NaCl/Cu (111) substrate, at room temperature, also two new superstructures on the copper substrate were found. They indicate the formation of a metall-organic-complex. On top of the NaCl layer the molecules exclusively grow at polar NaCl step edges. This is an indication for electrostatic interaction between the PTCDA molecules and the NaCl layer. When the molecule density is further increased, a Vollmer-Weber growth sets in. If both molecules PTCDA and CuPc are present on the sample at the same time, local spectroscopy provides information on the metal-organic interface in direct comparison. The STS-results of CuPc/PTCDA on Cu (111

Structure and linear spectroscopic properties of near IR polymethine dyes

International Nuclear Information System (INIS)

Webster, Scott; Padilha, Lazaro A.; Hu Honghua; Przhonska, Olga V.; Hagan, David J.; Van Stryland, Eric W.; Bondar, Mikhail V.; Davydenko, Iryna G.; Slominsky, Yuriy L.; Kachkovski, Alexei D.

2008-01-01

We performed a detailed experimental investigation and quantum-chemical analysis of a new series of near IR polymethine dyes with 5-butyl-7,8-dihydrobenzo[cd]furo[2,3-f]indolium terminal groups. We also synthesized and studied two neutral dyes, squaraine and tetraone, with the same terminal groups and performed a comparison of the spectroscopic properties of this set of 'near IR' dyes (polymethine, squaraine, and tetraone) with an analogous set of 'visible' dyes with simpler benzo[e]indolium terminal groups. From these measurements, we find that the dyes with dihydrobenzo[cd]furo[2,3-f]indolium terminal groups are characterized by a remarkably large shift ∼300 nm (∼200 nm for tetraone) of their absorption bands towards the red region. We discuss the difference in electronic structure for these molecules and show that the 'near IR' dyes are characterized by an additional weak fluorescence band from the higher lying excited states connected with the terminal groups. Absorption spectra for the longest polymethines are solvent-dependent and are characterized by a broadening of the main band in polar solvents, which is explained by ground state symmetry breaking and reduced charge delocalization within the polymethine chromophore. The results of these experiments combined with the agreement of quantum chemical calculations moves us closer to a predictive capability for structure-property relations in cyanine-like molecules

Switching behavior of double-decker single molecule magnets on a metal surface

Energy Technology Data Exchange (ETDEWEB)

Fu, Yingshuang; Schwoebel, Joerg; Hoffmann, Germar; Brede, Jens; Wiesendanger, Roland [University of Hamburg, Hamburg (Germany); Dillulo, Andrew [Ohio University, Athens (United States); Klyatskaya, Svetlana [Karlsruhe Institute of Technology, Karlsruhe (Germany); Ruben, Mario [Karlsruhe Institute of Technology, Karlsruhe (Germany); Universite de Strasbourg, Strasbourg (France)

2011-07-01

Single molecule magnets (SMM) are most promising materials for spin based molecular electronics. Due to their large magnetic anisotropy stabilized by inside chemical bonds, SMM can potentially be used for information storage at the single molecule level. For applications, it is of importance to adsorb the SMM onto surfaces and to study their subsequent conformational, electronic and magnetic properties. We have investigated the adsorption behavior of Tb and Dy based double-decker SMM on an Ir(111) surface with low temperature scanning tunneling microscopy and spectroscopy. It is found that Tb double-decker molecules bind tightly to the Ir(111) surface. By resonantly injecting tunneling electrons into its LUMO or HOMO state, the Tb double-decker molecule can be switched from a four-lobed structure to an eight-lobed structure. After switching, energy positions of the HOMO and LUMO states both shift closer to the Fermi level. Dy double-decker molecules also exhibit the same switching properties on the Ir(111) surface. The switching behavior of the molecules is tentatively attributed to a conformational change of the double-decker molecular frame.

Structure and physical properties of bio membranes and model membranes

International Nuclear Information System (INIS)

Tibor Hianik

2006-01-01

Bio membranes belong to the most important structures of the cell and the cell organelles. They play not only structural role of the barrier separating the external and internal part of the membrane but contain also various functional molecules, like receptors, ionic channels, carriers and enzymes. The cell membrane also preserves non-equilibrium state in a cell which is crucial for maintaining its excitability and other signaling functions. The growing interest to the bio membranes is also due to their unique physical properties. From physical point of view the bio membranes, that are composed of lipid bilayer into which are incorporated integral proteins and on their surface are anchored peripheral proteins and polysaccharides, represent liquid s crystal of smectic type. The bio membranes are characterized by anisotropy of structural and physical properties. The complex structure of bio membranes makes the study of their physical properties rather difficult. Therefore several model systems that mimic the structure of bio membranes were developed. Among them the lipid monolayers at an air-water interphase, bilayer lipid membranes, supported bilayer lipid membranes and liposomes are most known. This work is focused on the introduction into the physical word of the bio membranes and their models. After introduction to the membrane structure and the history of its establishment, the physical properties of the bio membranes and their models are stepwise presented. The most focus is on the properties of lipid monolayers, bilayer lipid membranes, supported bilayer lipid membranes and liposomes that were most detailed studied. This lecture has tutorial character that may be useful for undergraduate and graduate students in the area of biophysics, biochemistry, molecular biology and bioengineering, however it contains also original work of the author and his co-worker and PhD students, that may be useful also for specialists working in the field of bio membranes and model

Structure and intensities of microwave lines in the spectra of diatomic molecules

International Nuclear Information System (INIS)

Tatum, J.B.

1986-01-01

The structure of the rotational levels in a diatomic molecule, and the intensities of microwave transitions between them, are reviewed. Attention is given to the statistical weights of levels that may have hyperfine structure on account of one or two nuclear spins, in the case of heteronuclear molecules and of homonuclear molecules. A new treatment is given, involving the concept of energy surfaces in a ternary diagram in the form of a triangular prism, in which the three vertices represent three limiting cases, while the interior of the prism displays energy levels where all three intermediate coupling parameters are of comparable magnitude. An example is given of a simple J = 2 to J = 1 transition in a molecule with nuclear spins 3/2 and 1, showing the 56 hyperhyperfine components into which the rotational line is split, and a movie film is described which shows how the resulting ''fingerprint'' varies with the relative strengths of the interactions between the nuclear and electronic angular momenta

Crystal structure prediction of flexible molecules using parallel genetic algorithms with a standard force field.

Science.gov (United States)

Kim, Seonah; Orendt, Anita M; Ferraro, Marta B; Facelli, Julio C

2009-10-01

This article describes the application of our distributed computing framework for crystal structure prediction (CSP) the modified genetic algorithms for crystal and cluster prediction (MGAC), to predict the crystal structure of flexible molecules using the general Amber force field (GAFF) and the CHARMM program. The MGAC distributed computing framework includes a series of tightly integrated computer programs for generating the molecule's force field, sampling crystal structures using a distributed parallel genetic algorithm and local energy minimization of the structures followed by the classifying, sorting, and archiving of the most relevant structures. Our results indicate that the method can consistently find the experimentally known crystal structures of flexible molecules, but the number of missing structures and poor ranking observed in some crystals show the need for further improvement of the potential. Copyright 2009 Wiley Periodicals, Inc.

Structural properties of MHC class II ligands, implications for the prediction of MHC class II epitopes.

Directory of Open Access Journals (Sweden)

Kasper Winther Jørgensen

2010-12-01

Full Text Available Major Histocompatibility class II (MHC-II molecules sample peptides from the extracellular space allowing the immune system to detect the presence of foreign microbes from this compartment. Prediction of MHC class II ligands is complicated by the open binding cleft of the MHC class II molecule, allowing binding of peptides extending out of the binding groove. Furthermore, only a few HLA-DR alleles have been characterized with a sufficient number of peptides (100-200 peptides per allele to derive accurate description of their binding motif. Little work has been performed characterizing structural properties of MHC class II ligands. Here, we perform one such large-scale analysis. A large set of SYFPEITHI MHC class II ligands covering more than 20 different HLA-DR molecules was analyzed in terms of their secondary structure and surface exposure characteristics in the context of the native structure of the corresponding source protein. We demonstrated that MHC class II ligands are significantly more exposed and have significantly more coil content than other peptides in the same protein with similar predicted binding affinity. We next exploited this observation to derive an improved prediction method for MHC class II ligands by integrating prediction of MHC- peptide binding with prediction of surface exposure and protein secondary structure. This combined prediction method was shown to significantly outperform the state-of-the-art MHC class II peptide binding prediction method when used to identify MHC class II ligands. We also tried to integrate N- and O-glycosylation in our prediction methods but this additional information was found not to improve prediction performance. In summary, these findings strongly suggest that local structural properties influence antigen processing and/or the accessibility of peptides to the MHC class II molecule.

Effect of postdrawing temperature on structure, morphology and mechanical properties of melt-spun isotactic polypropylene tapes

NARCIS (Netherlands)

Loos, J.; Schimanski, T.

2005-01-01

Structure, morphology, and mechanical properties of melt-spun and postdrawn isotactic polypropylene (iPP) tapes are analyzed to study the effect of postdraw temperature applied. For affine drawing conditions, i.e., no effective relaxation of the molecules occurs during postdrawing, the Young's

Single Fluorescent Molecules as Nano-Illuminators for Biological Structure and Function

Science.gov (United States)

Moerner, W. E.

2011-03-01

Since the first optical detection and spectroscopy of a single molecule in a solid (Phys. Rev. Lett. {62}, 2535 (1989)), much has been learned about the ability of single molecules to probe local nanoenvironments and individual behavior in biological and nonbiological materials in the absence of ensemble averaging that can obscure heterogeneity. Because each single fluorophore acts a light source roughly 1 nm in size, microscopic imaging of individual fluorophores leads naturally to superlocalization, or determination of the position of the molecule with precision beyond the optical diffraction limit, simply by digitization of the point-spread function from the single emitter. For example, the shape of single filaments in a living cell can be extracted simply by allowing a single molecule to move through the filament (PNAS {103}, 10929 (2006)). The addition of photoinduced control of single-molecule emission allows imaging beyond the diffraction limit (super-resolution) and a new array of acronyms (PALM, STORM, F-PALM etc.) and advances have appeared. We have used the native blinking and switching of a common yellow-emitting variant of green fluorescent protein (EYFP) reported more than a decade ago (Nature {388}, 355 (1997)) to achieve sub-40 nm super-resolution imaging of several protein structures in the bacterium Caulobacter crescentus: the quasi-helix of the actin-like protein MreB (Nat. Meth. {5}, 947 (2008)), the cellular distribution of the DNA binding protein HU (submitted), and the recently discovered division spindle composed of ParA filaments (Nat. Cell Biol. {12}, 791 (2010)). Even with these advances, better emitters would provide more photons and improved resolution, and a new photoactivatable small-molecule emitter has recently been synthesized and targeted to specific structures in living cells to provide super-resolution images (JACS {132}, 15099 (2010)). Finally, a new optical method for extracting three-dimensional position information based on

Crystal engineering of giant molecules based on perylene diimide conjugated polyhedral oligomeric silsesquioxane nano-atom

Science.gov (United States)

Ren, He

Molecular architectures and topologies are found contributing to the formation of supramolecular structures of giant molecules. Dr. Cheng's research group developed a diverse of giant molecules via precisely controlled chemistry synthetic routes. These giant molecules can be categorized into several different families, namely giant surfactants, giant shape amphiphiles and giant polyhedron. By analyzing the hierarchical structures of these carefully designed and precisely synthesized giant molecules, the structural factors which affect, or even dominates, in some cases, the formation of supramolecular structures are revealed in these intensive researches. The results will further contribute to the understanding of dependence of supramolecular structures on molecular designs as well as molecular topology, and providing a practical solution to the scaling up of microscopic molecular functionalities to macroscopic material properties. Molecular Nano Particles (MNPs), including fullerene (C60), POSS, Polyoxometalate (POM) and proteins etc., is defined and applied as a specific type of building blocks in the design and synthesis of giant molecules. The persistence in shape and symmetry is considered as one of the major properties of MNPs. This persistence will support the construction of giant molecules for further supramolecular structures' study by introducing specific shapes, or precisely located side groups which will facilitate self-assembling behaviors with pre-programmed secondary interactions. Dictating material physical properties by its chemical composition is an attractive yet currently failed approach in the study of materials. However, the pursuit of determining material properties by microscopic molecular level properties is never seized, and found its solution when the idea of crystal engineering is raised: should each atom in the material is located exactly where it is designed to be and is properly bonded, the property of the material is hence determined

Shear-stress-induced structural arrangement of water molecules in nanoscale Couette flow with slipping at wall boundary

International Nuclear Information System (INIS)

Lin, Jau-Wen

2014-01-01

This study investigated the structuring of water molecules in a nanoscale Couette flow with the upper plate subjected to lateral forces with various magnitudes and water slipping against a metal wall. It was found that when the upper plate is subjected to a force, the water body deforms into a parallelepiped. Water molecules in the channel are then gradually arranged into lattice positions, creating a layered structure. The structural arrangement of water molecules is caused by the water molecules accommodating themselves to the increase in energy under the application of a lateral force on the moving plate. The ordering arrangement of water molecules increases the rotational degree of freedom, allowing the molecules to increase their Coulomb potential energy through polar rotation that accounts for the energy input through the upper plate. With a force continuously applied to the upper plate, the water molecules in contact with the upper plate move forward until slip between the water and upper plate occurs. The relation between the structural arrangement of water molecules, slip at the wall, and the shear force is studied. The relation between the slip and the locking/unlocking of water molecules to metal atoms is also studied

RNAspa: a shortest path approach for comparative prediction of the secondary structure of ncRNA molecules

Directory of Open Access Journals (Sweden)

Michaeli Shulamit

2007-10-01

Full Text Available Abstract Background In recent years, RNA molecules that are not translated into proteins (ncRNAs have drawn a great deal of attention, as they were shown to be involved in many cellular functions. One of the most important computational problems regarding ncRNA is to predict the secondary structure of a molecule from its sequence. In particular, we attempted to predict the secondary structure for a set of unaligned ncRNA molecules that are taken from the same family, and thus presumably have a similar structure. Results We developed the RNAspa program, which comparatively predicts the secondary structure for a set of ncRNA molecules in linear time in the number of molecules. We observed that in a list of several hundred suboptimal minimal free energy (MFE predictions, as provided by the RNAsubopt program of the Vienna package, it is likely that at least one suggested structure would be similar to the true, correct one. The suboptimal solutions of each molecule are represented as a layer of vertices in a graph. The shortest path in this graph is the basis for structural predictions for the molecule. We also show that RNA secondary structures can be compared very rapidly by a simple string Edit-Distance algorithm with a minimal loss of accuracy. We show that this approach allows us to more deeply explore the suboptimal structure space. Conclusion The algorithm was tested on three datasets which include several ncRNA families taken from the Rfam database. These datasets allowed for comparison of the algorithm with other methods. In these tests, RNAspa performed better than four other programs.

The use of semiempirical quantum chemical methods in studying the properties of large series of biologically active molecules

International Nuclear Information System (INIS)

Koeseoglu, Y.

2004-01-01

In this work, the productivity (temporal characteristics) of the so-called Electron Topological Method (ETM) proposed for the structure-activity relationships (SAR) investigation is studied. The method is standing aside the methods proposed for quantitative SAR (QSAR) studies because of the essential difference in the languages chosen for the compound structures description. ETM uses Electron Topological Matrices of Contiguity (ETMC) that include the most comprehensive data on the electronic structure of compounds and their topology. The flexibility of real molecules is taken into account in terms of two parameters, Δ 1 and Δ 2 , that characterise the accuracy allowed for atomic properties (diagonal matrix elements) and for bonds (non-diagonal ones). The dependence of the feature realisation on different values of Δ 1 and Δ 2 is studied and its graphical representation is given

The calculation of thermodynamic properties of molecules

DEFF Research Database (Denmark)

van Speybroeck, Veronique; Gani, Rafiqul; Meier, Robert Johan

2010-01-01

Thermodynamic data are key in the understanding and design of chemical processes. Next to the experimental evaluation of such data, computational methods are valuable and sometimes indispensable tools in obtaining heats of formation and Gibbs free energies. The major toolboxes to obtain such quan......Thermodynamic data are key in the understanding and design of chemical processes. Next to the experimental evaluation of such data, computational methods are valuable and sometimes indispensable tools in obtaining heats of formation and Gibbs free energies. The major toolboxes to obtain...... molecules the combination of group contribution methods with group additive values that are determined with the best available computational ab initio methods seems to be a viable alternative to obtain thermodynamic properties near chemical accuracy. New developments and full use of existing tools may lead...

Computational design of molecules for an all-quinone redox flow battery† †Electronic supplementary information (ESI) available: The list of computationally predicted candidate quinone molecules with interesting redox properties. See DOI: 10.1039/c4sc03030c Click here for additional data file.

Science.gov (United States)

Er, Süleyman; Suh, Changwon; Marshak, Michael P.

2015-01-01

Inspired by the electron transfer properties of quinones in biological systems, we recently showed that quinones are also very promising electroactive materials for stationary energy storage applications. Due to the practically infinite chemical space of organic molecules, the discovery of additional quinones or other redox-active organic molecules for energy storage applications is an open field of inquiry. Here, we introduce a high-throughput computational screening approach that we applied to an accelerated study of a total of 1710 quinone (Q) and hydroquinone (QH2) (i.e., two-electron two-proton) redox couples. We identified the promising candidates for both the negative and positive sides of organic-based aqueous flow batteries, thus enabling an all-quinone battery. To further aid the development of additional interesting electroactive small molecules we also provide emerging quantitative structure-property relationships. PMID:29560173

Modulating Pathways for Electron and Energy Transfer Through Molecules

DEFF Research Database (Denmark)

Pirrotta, Alessandro

Energy transport efficiency and electric conductance are molecular properties that motivates the development of optoelectronic materials, energy storage, and electronic devices. Several experimental techniques allow measurement of these properties and regularly, modeling is employed to find...... correlations between chemical structure and molecular properties. This dissertation discusses the interplay between modeling and experiments toward the assessment of new relations between the molecular structure and properties. In particular, it has been shown how simulations can push the development of new...... experimental techniques, demonstrate the potential of already established techniques, and work in synergy with experiments. It is demonstrated how the use of modeling can expand our understanding of how chemical structure affects molecular properties, which will enable us to design molecules with specific...

Glycomics: revealing the dynamic ecology and evolution of sugar molecules.

Science.gov (United States)

Springer, Stevan A; Gagneux, Pascal

2016-03-01

Sugars are the most functionally and structurally diverse molecules in the biological world. Glycan structures range from tiny single monosaccharide units to giant chains thousands of units long. Some glycans are branched, their monosaccharides linked together in many different combinations and orientations. Some exist as solitary molecules; others are conjugated to proteins and lipids and alter their collective functional properties. In addition to structural and storage roles, glycan molecules participate in and actively regulate physiological and developmental processes. Glycans also mediate cellular interactions within and between individuals. Their roles in ecology and evolution are pivotal, but not well studied because glycan biochemistry requires different methods than standard molecular biology practice. The properties of glycans are in some ways convenient, and in others challenging. Glycans vary on organismal timescales, and in direct response to physiological and ecological conditions. Their mature structures are physical records of both genetic and environmental influences during maturation. We describe the scope of natural glycan variation and discuss how studying glycans will allow researchers to further integrate the fields of ecology and evolution. Copyright © 2015 Elsevier B.V. All rights reserved.

DNA-Based Single-Molecule Electronics: From Concept to Function

Science.gov (United States)

2018-01-01

Beyond being the repository of genetic information, DNA is playing an increasingly important role as a building block for molecular electronics. Its inherent structural and molecular recognition properties render it a leading candidate for molecular electronics applications. The structural stability, diversity and programmability of DNA provide overwhelming freedom for the design and fabrication of molecular-scale devices. In the past two decades DNA has therefore attracted inordinate amounts of attention in molecular electronics. This review gives a brief survey of recent experimental progress in DNA-based single-molecule electronics with special focus on single-molecule conductance and I–V characteristics of individual DNA molecules. Existing challenges and exciting future opportunities are also discussed. PMID:29342091

DNA-Based Single-Molecule Electronics: From Concept to Function.

Science.gov (United States)

Wang, Kun

2018-01-17

Beyond being the repository of genetic information, DNA is playing an increasingly important role as a building block for molecular electronics. Its inherent structural and molecular recognition properties render it a leading candidate for molecular electronics applications. The structural stability, diversity and programmability of DNA provide overwhelming freedom for the design and fabrication of molecular-scale devices. In the past two decades DNA has therefore attracted inordinate amounts of attention in molecular electronics. This review gives a brief survey of recent experimental progress in DNA-based single-molecule electronics with special focus on single-molecule conductance and I-V characteristics of individual DNA molecules. Existing challenges and exciting future opportunities are also discussed.

Electronic and structural properties of TiB2: Bulk, surface, and nanoscale effects

International Nuclear Information System (INIS)

Volonakis, George; Tsetseris, Leonidas; Logothetidis, Stergios

2011-01-01

Titanium diboride (TiB 2 ), is a widely used hard material that comprises graphene-like layers of B and intercalated Ti atoms. Here we report the results of extensive first-principles calculations on key properties of bulk TiB 2 , TiB 2 surfaces, and TiB 2 nanocrystals (NCs). The computational approach is first validated based on the agreement between calculated structural and electronic properties of bulk TiB 2 and available experimental and theoretical data. We then obtain the formation energies for several surface cuts and use these values to construct TiB 2 NCs based on the Wulff theorem. Finally, we demonstrate by studying the adsorption of small molecules that hydrogen and oxygen adatoms can be attached through strongly exothermic chemisorption reactions on TiB 2 surfaces. Likewise, water molecules bind on various TiB 2 surfaces and NC facets, with an energetic preference for the latter. The results are relevant to applications that depend on reactivity-related TiB 2 properties, for example resistance to corrosion and interactions with water-based solutions.

Magnetic properties of dendrimer structures with different coordination numbers: A Monte Carlo study

International Nuclear Information System (INIS)

Masrour, R.; Jabar, A.

2016-01-01

We investigate the magnetic properties of Cayley trees of large molecules with dendrimer structure using Monte Carlo simulations. The thermal magnetization and magnetic susceptibility of a dendrimer structure are given with different coordination numbers, Z=3, 4, 5 and different generations g=3 and 2. The variation of magnetizations with the exchange interactions and crystal fields have been given of this system. The magnetic hysteresis cycles have been established. - Highlights: • The dendrimer structure is investigated using Monte Carlo simulations. • The transition temperatures are obtained for different coordination numbers and generations. • The magnetic hysteresis cycle has been established. • The dendrimer structure exhibit the superparamagnetic behavior.

Magnetic properties of dendrimer structures with different coordination numbers: A Monte Carlo study

Energy Technology Data Exchange (ETDEWEB)

Masrour, R., E-mail: rachidmasrour@hotmail.com; Jabar, A.

2016-11-01

We investigate the magnetic properties of Cayley trees of large molecules with dendrimer structure using Monte Carlo simulations. The thermal magnetization and magnetic susceptibility of a dendrimer structure are given with different coordination numbers, Z=3, 4, 5 and different generations g=3 and 2. The variation of magnetizations with the exchange interactions and crystal fields have been given of this system. The magnetic hysteresis cycles have been established. - Highlights: • The dendrimer structure is investigated using Monte Carlo simulations. • The transition temperatures are obtained for different coordination numbers and generations. • The magnetic hysteresis cycle has been established. • The dendrimer structure exhibit the superparamagnetic behavior.

Spin-dependent transport properties of oleic acid molecule self-assembled La0.7Sr0.3MnO3 nanoparticles

International Nuclear Information System (INIS)

Xi, L.; Du, J.H.; Ma, J.H.; Wang, Z.; Zuo, Y.L.; Xue, D.S.

2013-01-01

Highlights: ► Spin-dependent transport property of LSMO/oleic acid nanoparticles is investigated. ► Transport properties and MR measured by Cu/nanoparticle assembly/elargol device. ► Non-linear I–V curve indicates a tunneling type transport properties. ► Tunnel barrier height around 1.3 ± 0.15 eV was obtained by fitting I–V curves. ► LFMR of LSMO/oleic acid molecules value reaches −18% with current of 0.1 μA at 10 K. - Abstract: Spin-dependent transport property through molecules is investigated using a monolayer of oleic acid molecule self-assembled half metallic La 0.7 Sr 0.3 MnO 3 (LSMO) nanoparticles, which was synthesized using a coprecipitation method. Fourier transform infrared spectroscopy was used to confirm that one-monolayer oleic acid molecules chemically bond to the LSMO nanoparticles. The transport properties and magnetoresistance (MR) effect of the oleic acid molecule coated LSMO nanoparticles were measured by a direct current four probes method using a Cu/nanoparticle assembly/elargol electrode sandwich device with various temperatures and bias voltages. The non-linear I–V curve indicates a tunneling type transport properties. The tunnel barrier height around 1.3 ± 0.15 eV was obtained by fitting the I–V curve according to the Simmons equation. The magnetoresistance curves can be divided to high-field MR and low-field MR (LFMR) parts. The former is ascribed to the influence of spin disorder or canting within the LSMO nanoparticle surface and the latter one with strong bias dependence is attributed to the spin-dependent tunneling effect through the insulating surface layer of LSMO and oleic acid molecules. The enhanced LFMR effect for oleic acid coated LSMO with respect to the bare LSMO was attributed to the enhanced tunneling transport and weak spin scattering in oleic acid molecule barrier.

Vortex-ring-fractal Structure of Atom and Molecule

International Nuclear Information System (INIS)

Osmera, Pavel

2010-01-01

This chapter is an attempt to attain a new and profound model of the nature's structure using a vortex-ring-fractal theory (VRFT). Scientists have been trying to explain some phenomena in Nature that have not been explained so far. The aim of this paper is the vortex-ring-fractal modeling of elements in the Mendeleev's periodic table, which is not in contradiction to the known laws of nature. We would like to find some acceptable structure model of the hydrogen as a vortex-fractal-coil structure of the proton and a vortex-fractal-ring structure of the electron. It is known that planetary model of the hydrogen atom is not right, the classical quantum model is too abstract. Our imagination is that the hydrogen is a levitation system of the proton and the electron. Structures of helium, oxygen, and carbon atoms and a hydrogen molecule are presented too.

Synthesis, growth, structural modeling and physio-chemical properties of a charge transfer molecule: Guanidinium tosylate

Science.gov (United States)

Era, Paavai; Jauhar, RO. MU.; Vinitha, G.; Murugakoothan, P.

2018-05-01

An organic nonlinear optical material, guanidinium tosylate was synthesized adopting slow evaporation method and the crystals were harvested from aqueous methanolic medium with dimensions 13 × 9 × 3 mm3. Constitution of crystalline material was confirmed by single crystal X-ray diffraction study. The title compound crystallizes in the monoclinic crystal system with space group P21/c. The UV-vis-NIR spectral study of the grown crystal exhibits high transparency of 80% in the entire visible region with lower cut-off wavelength at 282 nm. Optimized molecular geometry of the grown crystal was obtained using density functional theory (DFT) and the frontier energy gaps calculated from the DFT aids to understand the charge transfer taking place in the molecule. The dielectric properties were studied as a function of temperature and frequency to find the charge distribution within the crystal. The titular compound is thermally stable up to 230 °C assessed by thermogravimetric and differential thermal analysis. Anisotropy in the mechanical behavior was observed while measuring for individual planes. The laser induced surface damage threshold of the grown crystal was measured to be 0.344 GW/cm2 for 1064 nm Nd:YAG laser radiation. Z-scan technique confirms the third-order nonlinear optical property with the ascertained nonlinear refractive index (n2), nonlinear absorption coefficient (β) and third order nonlinear susceptibility (χ(3)). Optical limiting study divulges that the transmitted output power step-up linearly with the increase of the input power at lower power realms and saturates from the threshold 24.95 mW/cm2 and amplitude 0.23 mW/cm2.

The Use of Ultrashort Picosecond Laser Pulses to Generate Quantum Optical Properties of Single Molecules in Biophysics

Science.gov (United States)

Ly, Sonny

Generation of quantum optical states from ultrashort laser-molecule interactions have led to fascinating discoveries in physics and chemistry. In recent years, these interactions have been extended to probe phenomena in single molecule biophysics. Photons emitted from a single fluorescent molecule contains important properties about how the molecule behave and function in that particular environment. Analysis of the second order coherence function through fluorescence correlation spectroscopy plays a pivotal role in quantum optics. At very short nanosecond timescales, the coherence function predicts photon antibunching, a purely quantum optical phenomena which states that a single molecule can only emit one photon at a time. Photon antibunching is the only direct proof of single molecule emission. From the nanosecond to microsecond timescale, the coherence function gives information about rotational diffusion coefficients, and at longer millisecond timescales, gives information regarding the translational diffusion coefficients. In addition, energy transfer between molecules from dipole-dipole interaction results in FRET, a highly sensitive method to probe conformational dynamics at nanometer distances. Here I apply the quantum optical techniques of photon antibunching, fluorescence correlation spectroscopy and FRET to probe how lipid nanodiscs form and function at the single molecule level. Lipid nanodiscs are particles that contain two apolipoprotein (apo) A-I circumventing a lipid bilayer in a belt conformation. From a technological point of view, nanodiscs mimics a patch of cell membrane that have recently been used to reconstitute a variety of membrane proteins including cytochrome P450 and bacteriorhodopsin. They are also potential drug transport vehicles due to its small and stable 10nm diameter size. Biologically, nanodiscs resemble to high degree, high density lipoproteins (HDL) in our body and provides a model platform to study lipid-protein interactions

Correlating the vibrational spectra of structurally related molecules: A spectroscopic measure of similarity.

Science.gov (United States)

Tao, Yunwen; Zou, Wenli; Cremer, Dieter; Kraka, Elfi

2018-03-05

Using catastrophe theory and the concept of a mutation path, an algorithm is developed that leads to the direct correlation of the normal vibrational modes of two structurally related molecules. The mutation path is defined by weighted incremental changes in mass and geometry of the molecules in question, which are successively applied to mutate a molecule into a structurally related molecule and thus continuously converting their normal vibrational spectra from one into the other. Correlation diagrams are generated that accurately relate the normal vibrational modes to each other by utilizing mode-mode overlap criteria and resolving allowed and avoided crossings of vibrational eigenstates. The limitations of normal mode correlation, however, foster the correlation of local vibrational modes, which offer a novel vibrational measure of similarity. It will be shown how this will open new avenues for chemical studies. © 2017 Wiley Periodicals, Inc. © 2017 Wiley Periodicals, Inc.

Electronic structures of spinterface for thiophene molecule adsorbed at Co, Fe, and Ni electrode: First principles calculations

Energy Technology Data Exchange (ETDEWEB)

Cai, Linlin; Tian, Yanli; Yuan, Xiaobo; Hu, Guichao; Ren, Junfeng, E-mail: renjf@sdnu.edu.cn

2016-12-15

Highlights: • Thiophene molecule could be spin polarized when adsorbed at Co(001), Fe(100), and Ni(111) surfaces. • The biggest spin polarization will be obtained when the thiophene molecule adsorbed at the Fe(100) surface. • The spin polarization is originated from the interfacial orbital hybridizations between the 3d orbital of ferromagnetic electrodes and the 2p orbital of the thiophene molecule. - Abstract: First principles calculations are adopted to study the spin polarization properties of thiophene molecule which adsorbed at the Co, Fe, and Ni electrode surfaces. The density of states, spin-polarized density distributions as well as the differential charge density distributions are obtained. It is found that the p orbital of the thiophene molecule will interact with the d orbital of the ferromagnetic electrodes, which will generate new spin coupling states and lead to obvious spin polarization in the thiophene molecule. Different electrodes induce different spin polarization properties, and in which the Fe electrode will bring the biggest spin polarization of the thiophene molecule. People can selectively and efficiently inject spin polarized electrons into molecules by choosing suitable ferromagnetic electrodes in organic spintronic devices.

Structure-Based Drug Design of Small Molecule Peptide Deformylase Inhibitors to Treat Cancer

Directory of Open Access Journals (Sweden)

Jian Gao

2016-03-01

Full Text Available Human peptide deformylase (HsPDF is an important target for anticancer drug discovery. In view of the limited HsPDF, inhibitors were reported, and high-throughput virtual screening (HTVS studies based on HsPDF for developing new PDF inhibitors remain to be reported. We reported here on diverse small molecule inhibitors with excellent anticancer activities designed based on HTVS and molecular docking studies using the crystal structure of HsPDF. The compound M7594_0037 exhibited potent anticancer activities against HeLa, A549 and MCF-7 cell lines with IC50s of 35.26, 29.63 and 24.63 μM, respectively. Molecular docking studies suggested that M7594_0037 and its three derivatives could interact with HsPDF by several conserved hydrogen bonds. Moreover, the pharmacokinetic and toxicity properties of M7594_0037 and its derivatives were predicted using the OSIRIS property explorer. Thus, M7594_0037 and its derivatives might represent a promising scaffold for the further development of novel anticancer drugs.

Modulation of intermolecular interactions in single-molecule magnets

Science.gov (United States)

Heroux, Katie Jeanne

Polynuclear manganese clusters exhibiting interesting magnetic and quantum properties have been an area of intense research since the discovery of the first single-molecule magnet (SMM) in 1993. These molecules, below their blocking temperature, function as single-domain magnetic particles which exhibit classical macroscale magnetic properties as well as quantum mechanical phenomena such as quantum tunnelling of magnetization (QTM) and quantum phase interference. The union of classical and quantum behavior in these nanomaterials makes SMMs ideal candidates for high-density information storage and quantum computing. However, environmental coupling factors (nuclear spins, phonons, neighboring molecules) must be minimized if such applications are ever to be fully realized. The focus of this work is making small structural changes in well-known manganese SMMs in order to drastically enhance the overall magnetic and quantum properties of the system. Well-isolated molecules of high crystalline quality should lead to well-defined energetic and spectral properties as well. An advantage of SMMs over bulk magnetic materials is that they can be chemically altered from a "bottom-up" approach providing a synthetic tool for tuning magnetic properties. This systematic approach is utilized in the work presented herein by incorporating bulky ligands and/or counterions to "isolate" the magnetic core of [Mn4] dicubane SMMs. Reducing intermolecular interactions in the crystal lattice (neighboring molecules, solvate molecules, dipolar interactions) is an important step toward developing viable quantum computing devices. Detailed bulk magnetic studies as well as single crystal magnetization hysteresis and high-frequency EPR studies on these sterically-isolated complexes show enhanced, and sometimes even unexpected, quantum dynamics. The importance of intra- and intermolecular interactions remains a common theme throughout this work, extending to other SMMs of various topology including

Counteracting chemical chaperone effects on the single-molecule α-synuclein structural landscape.

Science.gov (United States)

Ferreon, Allan Chris M; Moosa, Mahdi Muhammad; Gambin, Yann; Deniz, Ashok A

2012-10-30

Protein structure and function depend on a close interplay between intrinsic folding energy landscapes and the chemistry of the protein environment. Osmolytes are small-molecule compounds that can act as chemical chaperones by altering the environment in a cellular context. Despite their importance, detailed studies on the role of these chemical chaperones in modulating structure and dimensions of intrinsically disordered proteins have been limited. Here, we used single-molecule Förster resonance energy transfer to test the counteraction hypothesis of counterbalancing effects between the protecting osmolyte trimethylamine-N-oxide (TMAO) and denaturing osmolyte urea for the case of α-synuclein, a Parkinson's disease-linked protein whose monomer exhibits significant disorder. The single-molecule experiments, which avoid complications from protein aggregation, do not exhibit clear solvent-induced cooperative protein transitions for these osmolytes, unlike results from previous studies on globular proteins. Our data demonstrate the ability of TMAO and urea to shift α-synuclein structures towards either more compact or expanded average dimensions. Strikingly, the experiments directly reveal that a 21 [urea][TMAO] ratio has a net neutral effect on the protein's dimensions, a result that holds regardless of the absolute osmolyte concentrations. Our findings shed light on a surprisingly simple aspect of the interplay between urea and TMAO on α-synuclein in the context of intrinsically disordered proteins, with potential implications for the biological roles of such chemical chaperones. The results also highlight the strengths of single-molecule experiments in directly probing the chemical physics of protein structure and disorder in more chemically complex environments.

Counteracting chemical chaperone effects on the single-molecule α-synuclein structural landscape

Science.gov (United States)

Ferreon, Allan Chris M.; Moosa, Mahdi Muhammad; Deniz, Ashok A.

2012-01-01

Protein structure and function depend on a close interplay between intrinsic folding energy landscapes and the chemistry of the protein environment. Osmolytes are small-molecule compounds that can act as chemical chaperones by altering the environment in a cellular context. Despite their importance, detailed studies on the role of these chemical chaperones in modulating structure and dimensions of intrinsically disordered proteins have been limited. Here, we used single-molecule Förster resonance energy transfer to test the counteraction hypothesis of counterbalancing effects between the protecting osmolyte trimethylamine-N-oxide (TMAO) and denaturing osmolyte urea for the case of α-synuclein, a Parkinson’s disease-linked protein whose monomer exhibits significant disorder. The single-molecule experiments, which avoid complications from protein aggregation, do not exhibit clear solvent-induced cooperative protein transitions for these osmolytes, unlike results from previous studies on globular proteins. Our data demonstrate the ability of TMAO and urea to shift α-synuclein structures towards either more compact or expanded average dimensions. Strikingly, the experiments directly reveal that a 2∶1 [urea]∶[TMAO] ratio has a net neutral effect on the protein’s dimensions, a result that holds regardless of the absolute osmolyte concentrations. Our findings shed light on a surprisingly simple aspect of the interplay between urea and TMAO on α-synuclein in the context of intrinsically disordered proteins, with potential implications for the biological roles of such chemical chaperones. The results also highlight the strengths of single-molecule experiments in directly probing the chemical physics of protein structure and disorder in more chemically complex environments. PMID:22826265

Structural and dynamical properties of water confined between two hydrophilic surfaces

Energy Technology Data Exchange (ETDEWEB)

Di Napoli, Solange, E-mail: dinapoli@tandar.cnea.gov.a [Depto. de Fisica - CAC, Comision Nacional de Energia Atomica, Av. Gral Paz 1499, (1650) San Martin, Buenos Aires (Argentina); Consejo Nacional de Investigaciones Cientificas y Tecnicas (Argentina); Gamba, Zulema, E-mail: gamba@tandar.cnea.gov.a [Depto. de Fisica - CAC, Comision Nacional de Energia Atomica, Av. Gral Paz 1499, (1650) San Martin, Buenos Aires (Argentina)

2009-10-01

The properties of water in the vicinity of surfaces and under confinement have been extensively studied because of the relevance of a quantitative understanding of many processes that not only take place in biological systems, like cells, membranes and microemulsions, but also in many others such as confined water in rocks, ionic channels and interestellar matter. In this work we perform molecular dynamic calculations of the nanoscopic structure of TIP5P model water confined between two hydrophilic surfaces. We calculate the diffusion coefficients and the atomic density profile of water molecules and polar ions in the system as a function of the number of water molecules per amphiphilic (n{sub W}). We also study the dependence of the water layer thickness and the profiles of water dipole orientation with this parameter.

Structural and dynamical properties of water confined between two hydrophilic surfaces

International Nuclear Information System (INIS)

Di Napoli, Solange; Gamba, Zulema

2009-01-01

The properties of water in the vicinity of surfaces and under confinement have been extensively studied because of the relevance of a quantitative understanding of many processes that not only take place in biological systems, like cells, membranes and microemulsions, but also in many others such as confined water in rocks, ionic channels and interestellar matter. In this work we perform molecular dynamic calculations of the nanoscopic structure of TIP5P model water confined between two hydrophilic surfaces. We calculate the diffusion coefficients and the atomic density profile of water molecules and polar ions in the system as a function of the number of water molecules per amphiphilic (n W ). We also study the dependence of the water layer thickness and the profiles of water dipole orientation with this parameter.

Challenges for single molecule electronic devices with nanographene and organic molecules. Do single molecules offer potential as elements of electronic devices in the next generation?

Science.gov (United States)

Enoki, Toshiaki; Kiguchi, Manabu

2018-03-01

Interest in utilizing organic molecules to fabricate electronic materials has existed ever since organic (molecular) semiconductors were first discovered in the 1950s. Since then, scientists have devoted serious effort to the creation of various molecule-based electronic systems, such as molecular metals and molecular superconductors. Single-molecule electronics and the associated basic science have emerged over the past two decades and provided hope for the development of highly integrated molecule-based electronic devices in the future (after the Si-based technology era has ended). Here, nanographenes (nano-sized graphene) with atomically precise structures are among the most promising molecules that can be utilized for electronic/spintronic devices. To manipulate single small molecules for an electronic device, a single molecular junction has been developed. It is a powerful tool that allows even small molecules to be utilized. External electric, magnetic, chemical, and mechanical perturbations can change the physical and chemical properties of molecules in a way that is different from bulk materials. Therefore, the various functionalities of molecules, along with changes induced by external perturbations, allows us to create electronic devices that we cannot create using current top-down Si-based technology. Future challenges that involve the incorporation of condensed matter physics, quantum chemistry calculations, organic synthetic chemistry, and electronic device engineering are expected to open a new era in single-molecule device electronic technology.

Electronic structure of molecules using relativistic effective core potentials

International Nuclear Information System (INIS)

Hay, P.J.

1981-01-01

Starting with one-component Cowan-Griffin relativistic Hartree-Fock orbitals, which successfully incorporate the mass-velocity and Darwin terms present in more complicated wavefunctions such as Dirac-Hartree-Fock, one can derive relativistic effective core potentials (RECP's) to carry out molecular calculations. These potentials implicitly include the dominant relativistic terms for molecules while allowing one to use the traditional quantum chemical techniques for studying the electronic structure of molecules. The effects of spin-orbit coupling can then be included using orbitals from such calculations using an effective 1-electron, 1-center spin-orbit operator. Applications to molecular systems involving heavy atoms, show good agreement with available spectroscopic data on molecular geometries and excitation energies

Structural Ordering of Semiconducting Polymers and Small-Molecules for Organic Electronics

Science.gov (United States)

O'Hara, Kathryn Allison

Semiconducting polymers and small-molecules can be readily incorporated into electronic devices such as organic photovoltaics (OPVs), thermoelectrics (OTEs), organic light emitting diodes (OLEDs), and organic thin film transistors (OTFTs). Organic materials offer the advantage of being processable from solution to form flexible and lightweight thin films. The molecular design, processing, and resulting thin film morphology of semiconducting polymers drastically affect the optical and electronic properties. Charge transport within films of semiconducting polymers relies on the nanoscale organization to ensure electronic coupling through overlap of molecular orbitals and to provide continuous transport pathways. While the angstrom-scale packing details can be studied using X-ray scattering methods, an understanding of the mesoscale, or the length scale over which smaller ordered regions connect, is much harder to achieve. Grain boundaries play an important role in semiconducting polymer thin films where the average grain size is much smaller than the total distance which charges must traverse in order to reach the electrodes in a device. The majority of semiconducting polymers adopt a lamellar packing structure in which the conjugated backbones align in parallel pi-stacks separated by the alkyl side-chains. Only two directions of transport are possible--along the conjugated backbone and in the pi-stacking direction. Currently, the discussion of transport between crystallites is centered around the idea of tie-chains, or "bridging" polymer chains connecting two ordered regions. However, as molecular structures become increasingly complex with the development of new donor-acceptor copolymers, additional forms of connectivity between ordered domains should be considered. High resolution transmission electron microscopy (HRTEM) is a powerful tool for directly imaging the crystalline grain boundaries in polymer and small-molecule thin films. Recently, structures

Structural properties of glucose-dimethylsulfoxide solutions probed by Raman spectroscopy

Science.gov (United States)

Paolantoni, Marco; Gallina, Maria Elena; Sassi, Paola; Morresi, Assunta

2009-04-01

Raman spectroscopy was employed to achieve a molecular level description of solvation properties in glucose-dimethylsulfoxide (DMSO) solutions. The analysis of Raman spectra confirms the importance of the dipole-dipole interaction in determining structural properties of pure DMSO; the overall intermolecular structure is maintained in the whole 20-75 °C temperature range investigated. The blueshift of the CH stretching modes observed at higher temperatures points out that CH3⋯O contacts contribute to the cohesive energy of the DMSO liquid system. The addition of glucose perturbs the intermolecular ordering of DMSO owing to the formation of stable solute-solvent hydrogen bonds. The average number of OH⋯OS contacts (3.2±0.3) and their corresponding energy (˜20 kJ/mol) were estimated. Besides, the concentration dependence of the CH stretching bands and the behavior of the noncoincidence effect on the SO band, suggest that the dipole-dipole and CH3⋯O interactions among DMSO molecules are disfavored within the glucose solvation layer. These findings contribute to improve our understanding about the microscopic origin of solvent properties of DMSO toward more complex biomolecular systems.

Phase Structure of Strong-Field Tunneling Wave Packets from Molecules.

Science.gov (United States)

Liu, Ming-Ming; Li, Min; Wu, Chengyin; Gong, Qihuang; Staudte, André; Liu, Yunquan

2016-04-22

We study the phase structure of the tunneling wave packets from strong-field ionization of molecules and present a molecular quantum-trajectory Monte Carlo model to describe the laser-driven dynamics of photoelectron momentum distributions of molecules. Using our model, we reproduce and explain the alignment-dependent molecular frame photoelectron spectra of strong-field tunneling ionization of N_{2} reported by M. Meckel et al. [Nat. Phys. 10, 594 (2014)]. In addition to modeling the low-energy photoelectron angular distributions quantitatively, we extract the phase structure of strong-field molecular tunneling wave packets, shedding light on its physical origin. The initial phase of the tunneling wave packets at the tunnel exit depends on both the initial transverse momentum distribution and the molecular internuclear distance. We further show that the ionizing molecular orbital has a critical effect on the initial phase of the tunneling wave packets. The phase structure of the photoelectron wave packet is a key ingredient for modeling strong-field molecular photoelectron holography, high-harmonic generation, and molecular orbital imaging.

Characterization of Structural and Configurational Properties of DNA by Atomic Force Microscopy.

Science.gov (United States)

Meroni, Alice; Lazzaro, Federico; Muzi-Falconi, Marco; Podestà, Alessandro

2018-01-01

We describe a method to extract quantitative information on DNA structural and configurational properties from high-resolution topographic maps recorded by atomic force microscopy (AFM). DNA molecules are deposited on mica surfaces from an aqueous solution, carefully dehydrated, and imaged in air in Tapping Mode. Upon extraction of the spatial coordinates of the DNA backbones from AFM images, several parameters characterizing DNA structure and configuration can be calculated. Here, we explain how to obtain the distribution of contour lengths, end-to-end distances, and gyration radii. This modular protocol can be also used to characterize other statistical parameters from AFM topographies.

Structure and optical properties of water covered Cu(110) surfaces

International Nuclear Information System (INIS)

Baghbanpourasl, A.

2014-01-01

In this thesis structural and optical properties of the water covered Cu(110) surface is studied using density functional theory within independent particle approximation. Several stable adsorption structures are studied such as water clusters (monomer, dimer, trimer, tetramer and pentamer), different hexagonal monolayers, partially dissociated water monolayers and three different types of chains among them a chain that consists of pentagon rings. For a copper surface in contact with water vapor, the energetically stable H 2 O/OH adsorbed structures are compared thermodynamically using adsorption free energy (change of free energy due to adsorption). Several phase diagrams with respect to temperature and pressure are calculated. It is found that among the large number of energetically stable structures (i.e. structures with positive adsorption energy ) only limited number of them are thermodynamically stable. These thermodynamically stable structures are the class of almost energetically degenerate hexagonal overlayers, one type of partially dissociated water structure that contains Bjerrum defect in the hydrogen bond network and pentagon chain. Since hydrogen atoms are light weight their vibrational effects can be considerable. Zero point vibration decreases the adsorption energy up to 0.1 eV and free energy of adsorbed molecules arising from vibrational degree of freedom can go up to -0.2 eV per adsorbed molecule at 500 Kelvin. However zero point energy and vibrational free energy of adsorbed molecules do not alter relative stability of the adsorbed structures. To account for the long range van der Waals interactions, a semi-empirical scheme is applied. Reflectance Anisotropy Spectroscopy (RAS) is a fast and non destructive optical method that can be used to prob the surface in different conditions such as vacuum and electro-chemical environment. Elasto-optic coeficients of bulk are calculated from first principles and the change of the RA spectrum of the bare Cu

Electronic and magnetic properties of Mn{sub 12} single-molecule magnets on the Au(111) surface

Energy Technology Data Exchange (ETDEWEB)

Voss, Soenke; Burgert, Michael; Fonin, Mikhail; Groth, Ulrich; Ruediger, Ulrich [Universitaet Konstanz (Germany); Michaelis, Christian; Brihuega, Ivan; Kern, Klaus [Max-Planck-Institut fuer Festkoerperforschung, Stuttgart (Germany); Dedkov, Yury S. [Institut fuer Festkoerperphysik, Technische Universitaet Dresden (Germany)

2008-07-01

The paramount interest in single-molecule magnets (SMMs) like Mn{sub 12}-acetate and its derivatives was inspired by numerous experimental and theoretical insights indicating the feasibility of addressing quantum effects of magnetism on a molecular scale. Due to its relatively high blocking temperature ({proportional_to}3 K) combined with the ability to identify well-defined spin states, Mn{sub 12} still remains the most favoured SMM possibly allowing the detection of magnetic fingerprints in transport properties of a single molecule. In this work, the electronic properties of Mn{sub 12} molecules chemically grafted on Au(111) surfaces have been studied by means of low temperature as well as room temperature scanning tunneling microscopy and spectroscopy (STS), X-ray absorption spectroscopy and photoelectron spectroscopy. The results revealed signatures from most probably intact Mn{sub 12} molecules while STS measurements in magnetic fields indicate the possibility to identify magnetic fingerprints in scanning tunneling spectra. The results will be discussed with respect to previous attempts to perform transport measurements on Mn{sub 12} SMMs.

Is the regulation of the electronic properties of organic molecules by polynuclear superhalogens more effective than that by mononuclear superhalogens? A high-level ab initio case study.

Science.gov (United States)

Li, Miao-Miao; Li, Jin-Feng; Bai, Hongcun; Sun, Yin-Yin; Li, Jian-Li; Yin, Bing

2015-08-21

The regulation of the electronic properties of organic molecules induced by polynuclear superhalogens is theoretically explored here for sixteen composite structures. It is clearly indicated by the higher vertical electron detachment energy (VDE) that polynuclear superhalogens are more effective in regulating the electronic properties than mononuclear structures. However, this enhanced regulation is not only determined by superhalogens themselves but also related to the distribution of the extra electron of the final composites. The composites, in which the extra electron is mainly aggregated into the superhalogen moiety, will possess higher VDE values, as reported in the case of C1', 7.12 eV at the CCSD(T) level. This is probably due to the fact that, compared with organic molecules, superhalogens possess stronger attraction towards the extra electron and thus should lead to lower energies of the extra electrons and to higher VDE values eventually. Compared with CCSD(T), the Outer Valence Green's Function (OVGF) method fails completely for composite structures containing Cl atoms, while MP2 results are generally consistent in terms of the relative order of VDEs. Actually if the extra electron distribution of the systems could be approximated by the HOMO, the results at the OVGF level will be consistent with the CCSD(T) results. Conversely, the difference in VDEs between OVGF and CCSD(T) is significantly large. Besides superhalogen properties, the structures, relative stabilities and thermodynamic stabilities with respect to various fragmentation channels were also investigated for all the composite structures.

Single-molecule force-conductance spectroscopy of hydrogen-bonded complexes

Science.gov (United States)

Pirrotta, Alessandro; De Vico, Luca; Solomon, Gemma C.; Franco, Ignacio

2017-03-01

The emerging ability to study physical properties at the single-molecule limit highlights the disparity between what is observable in an ensemble of molecules and the heterogeneous contributions of its constituent parts. A particularly convenient platform for single-molecule studies are molecular junctions where forces and voltages can be applied to individual molecules, giving access to a series of electromechanical observables that can form the basis of highly discriminating multidimensional single-molecule spectroscopies. Here, we computationally examine the ability of force and conductance to inform about molecular recognition events at the single-molecule limit. For this, we consider the force-conductance characteristics of a prototypical class of hydrogen bonded bimolecular complexes sandwiched between gold electrodes. The complexes consist of derivatives of a barbituric acid and a Hamilton receptor that can form up to six simultaneous hydrogen bonds. The simulations combine classical molecular dynamics of the mechanical deformation of the junction with non-equilibrium Green's function computations of the electronic transport. As shown, in these complexes hydrogen bonds mediate transport either by directly participating as a possible transport pathway or by stabilizing molecular conformations with enhanced conductance properties. Further, we observe that force-conductance correlations can be very sensitive to small changes in the chemical structure of the complexes and provide detailed information about the behavior of single molecules that cannot be gleaned from either measurement alone. In fact, there are regions during the elongation that are only mechanically active, others that are only conductance active, and regions where both force and conductance changes as the complex is mechanically manipulated. The implication is that force and conductance provide complementary information about the evolution of molecules in junctions that can be used to

1H NMR study of the solvent THF concerning their structural and dynamical properties in chemically Li-intercalated SWNT

KAUST Repository

Schmid, Marc R.

2011-09-01

Structural and dynamical properties of the THF solvent in single-walled carbon nanotubes intercalated with lithium are investigated by NMR. 1H NMR experiments reveal the existence of two types of inequivalent THF solvent molecules with different chemical environments and dynamical behavior. At low temperatures THF molecules perpendicularly arranged in between adjacent SWNT presumably exhibit a restricted rotation around their dipolar axis. At higher temperatures THF molecules are isotropically rotating and diffusing along the interstitial channels of the SWNT bundles. © 2011 Elsevier B.V. All rights reserved.

1H NMR study of the solvent THF concerning their structural and dynamical properties in chemically Li-intercalated SWNT

KAUST Repository

Schmid, Marc R.; Goze-Bac, Christophe; Bouhrara, Mohamed; Saih, Youssef; Mehring, Michael; Abou-Hamad, Edy

2011-01-01

Structural and dynamical properties of the THF solvent in single-walled carbon nanotubes intercalated with lithium are investigated by NMR. 1H NMR experiments reveal the existence of two types of inequivalent THF solvent molecules with different chemical environments and dynamical behavior. At low temperatures THF molecules perpendicularly arranged in between adjacent SWNT presumably exhibit a restricted rotation around their dipolar axis. At higher temperatures THF molecules are isotropically rotating and diffusing along the interstitial channels of the SWNT bundles. © 2011 Elsevier B.V. All rights reserved.

On the role of hydrogel structure and degradation in controlling the transport of cell-secreted matrix molecules for engineered cartilage.

Science.gov (United States)

Dhote, Valentin; Skaalure, Stacey; Akalp, Umut; Roberts, Justine; Bryant, Stephanie J; Vernerey, Franck J

2013-03-01

Damage to cartilage caused by injury or disease can lead to pain and loss of mobility, diminishing one's quality of life. Because cartilage has a limited capacity for self-repair, tissue engineering strategies, such as cells encapsulated in synthetic hydrogels, are being investigated as a means to restore the damaged cartilage. However, strategies to date are suboptimal in part because designing degradable hydrogels is complicated by structural and temporal complexities of the gel and evolving tissue along multiple length scales. To address this problem, this study proposes a multi-scale mechanical model using a triphasic formulation (solid, fluid, unbound matrix molecules) based on a single chondrocyte releasing extracellular matrix molecules within a degrading hydrogel. This model describes the key players (cells, proteoglycans, collagen) of the biological system within the hydrogel encompassing different length scales. Two mechanisms are included: temporal changes of bulk properties due to hydrogel degradation, and matrix transport. Numerical results demonstrate that the temporal change of bulk properties is a decisive factor in the diffusion of unbound matrix molecules through the hydrogel. Transport of matrix molecules in the hydrogel contributes both to the development of the pericellular matrix and the extracellular matrix and is dependent on the relative size of matrix molecules and the hydrogel mesh. The numerical results also demonstrate that osmotic pressure, which leads to changes in mesh size, is a key parameter for achieving a larger diffusivity for matrix molecules in the hydrogel. The numerical model is confirmed with experimental results of matrix synthesis by chondrocytes in biodegradable poly(ethylene glycol)-based hydrogels. This model may ultimately be used to predict key hydrogel design parameters towards achieving optimal cartilage growth. Copyright © 2012 Elsevier Ltd. All rights reserved.

DFT calculations on spectroscopic and structural properties of a NLO chromophore

Science.gov (United States)

Altürk, Sümeyye; Avci, Davut; Tamer, Ömer; Atalay, Yusuf

2016-03-01

The molecular geometry optimization, vibrational frequencies and gauge including atomic orbital (GIAO) 1H and 13C NMR chemical shift values of 2-(1'-(4'''-Methoxyphenyl)-5'-(thien-2″-yl)pyrrol-2'-yl)-1,3-benzothiazole as potential nonlinear optical (NLO) material were calculated using density functional theory (DFT) HSEh1PBE method with 6-311G(d,p) basis set. The best of our knowledge, this study have not been reported to date. Additionally, a detailed vibrational study was performed on the basis of potential energy distribution (PED) using VEDA program. It is noteworthy that NMR chemical shifts are quite useful for understanding the relationship between the molecular structure and electronic properties of molecules. The computed IR and NMR spectra were used to determine the types of the experimental bands observed. Predicted values of structural and spectroscopic parameters of the chromophore were compared with each other so as to display the effects of the different substituents on the spectroscopic and structural properties. Obtained data showed that there is an agreement between the predicted and experimental data.

Relaxation of structural parameters and potential coefficients of nonrigid molecules. General symmetry properties and application to ab initio study of 1,2-difluoroethane

Science.gov (United States)

Ha, T.-K.; Günthard, H. H.

1989-07-01

Structural parameters like bond length, bond angles, etc. and harmonic and anharmonic potential coefficients of molecules with internal rotation, inversion or puckering modes are generally assumed to vary with the large amplitude internal coordinates in a concerted manner (relaxation). Taking the coordinate vectors of the nuclear configuration of semirigid molecules with relaxation (SRMRs) as functions of relaxing structural parameters and finite amplitude internal coordinate, the isometric group of SRMRs is discussed and the irreducible representations of the latter are shown to classify into engendered and nonengendered ones. On this basis a concept of equivalent sets of nuclei SRMRs is introduced and an analytical expression is derived which defines the most general functional form of relaxation increments of all common types of structural parameters compatible with isometric symmetry. This formula is shown to be a close analog of an analytical expression defining the transformations induced by the isometric group of infinitesimal internal coordinates associated with typical structural parameters. Furthermore analogous formulae are given for the most general form of the relaxation of harmonic potential coefficients as a function of finite internal coordinates. The general relations are illustrated by ab initio calculations for 1,2-difluoroethane at the MP4/DZP//HF/4-31G* level for twelve values of the dihedral angle including complete structure optimization. The potential to internal rotation is found to be in essential agreement with experimentally derived data. For a complete set of ab initio structural parameters the associated relaxation increments are represented as Fourier series, which are shown to confirm the form predicted by the general formula and the isometric group of 1,2-difluoroethane. Depending on type of the structural parameters (bond length, bond angles, etc.), the associated relaxation increments appear to follow some simple rules. Similarly

Temperature-dependent interaction potential between NF3 molecules and thermophysical properties of gaseous NF3

International Nuclear Information System (INIS)

Damyanova, M; Balabanova, E; Hohm, U

2014-01-01

A temperature-dependent effective intermolecular interaction potential is applied to describe the interaction between two nitrogen fluoride (NF 3 ) molecules in gas phase. To this end, a spherically-symmetric (n-6) Lennard-Jones temperature-dependent potential (LJTDP) is used. The (n-6) LJTDP takes into account the influence of vibrational excitation of the molecules on the potential parameters, namely, the equilibrium distance r m and the potential well depth ε. The potential parameters at T = 0 K were obtained from the very small amount of existing thermophysical equilibrium and transport properties of low-density NF 3 gas. Fitting formulae are tabulated for a fast and reliable prediction of the thermophysical properties and potential parameters in the temperature range between 200 K and 1200 K. A comparison is also presented between our estimates for some thermophysical properties of the NF 3 gas with the available experimental and calculated data.

Electronic structure and physicochemical properties of selected penicillins

Science.gov (United States)

Soriano-Correa, Catalina; Ruiz, Juan F. Sánchez; Raya, A.; Esquivel, Rodolfo O.

Traditionally, penicillins have been used as antibacterial agents due to their characteristics and widespread applications with few collateral effects, which have motivated several theoretical and experimental studies. Despite the latter, their mechanism of biological action has not been completely elucidated. We present a theoretical study at the Hartree-Fock and density functional theory (DFT) levels of theory of a selected group of penicillins such as the penicillin-G, amoxicillin, ampicillin, dicloxacillin, and carbenicillin molecules, to systematically determine the electron structure of full ?-lactam antibiotics. Our results allow us to analyze the electronic properties of the pharmacophore group, the aminoacyl side-chain, and the influence of the substituents (R and X) attached to the aminoacyl side-chain at 6? (in contrast with previous studies focused at the 3? substituents), and to corroborate the results of previous studies performed at the semiempirical level, solely on the ?-lactam ring of penicillins. Besides, several density descriptors are determined with the purpose of analyzing their link to the antibacterial activity of these penicillin compounds. Our results for the atomic charges (fitted to the electrostatic potential), the bond orders, and several global reactivity descriptors, such as the dipole moments, ionization potential, hardness, and the electrophilicity index, led us to characterize: the active sites, the effect of the electron-attracting substituent properties and their physicochemical features, which altogether, might be important to understand the biological activity of these type of molecules.

Expert systems for structure elucidation of organic molecules by spectral methods

International Nuclear Information System (INIS)

Elyashberg, Mikhail E

1999-01-01

The state-of-the-art of the investigations aimed at creating expert systems for establishing the structure of organic molecules from IR, 1 H and 13 C NMR spectra is analysed. Computer methods used for identification of molecular fragments, generation of their structure and spectra prediction are considered. Principles of the creation of modern expert systems and general strategy of solving structural problems are discussed. The bibliography includes 174 references.

Polarization properties of below-threshold harmonics from aligned molecules H2+ in linearly polarized laser fields.

Science.gov (United States)

Dong, Fulong; Tian, Yiqun; Yu, Shujuan; Wang, Shang; Yang, Shiping; Chen, Yanjun

2015-07-13

We investigate the polarization properties of below-threshold harmonics from aligned molecules in linearly polarized laser fields numerically and analytically. We focus on lower-order harmonics (LOHs). Our simulations show that the ellipticity of below-threshold LOHs depends strongly on the orientation angle and differs significantly for different harmonic orders. Our analysis reveals that this LOH ellipticity is closely associated with resonance effects and the axis symmetry of the molecule. These results shed light on the complex generation mechanism of below-threshold harmonics from aligned molecules.

Adsorption of methanol molecule on graphene: Experimental results and first-principles calculations

Science.gov (United States)

Zhao, X. W.; Tian, Y. L.; Yue, W. W.; Chen, M. N.; Hu, G. C.; Ren, J. F.; Yuan, X. B.

2018-04-01

Adsorption properties of methanol molecule on graphene surface are studied both theoretically and experimentally. The adsorption geometrical structures, adsorption energies, band structures, density of states and the effective masses are obtained by means of first-principles calculations. It is found that the electronic characteristics and conductivity of graphene are sensitive to the methanol molecule adsorption. After adsorption of methanol molecule, bandgap appears. With the increasing of the adsorption distance, the bandgap, adsorption energy and effective mass of the adsorption system decreased, hence the resistivity of the system decreases gradually, these results are consistent with the experimental results. All these calculations and experiments indicate that the graphene-based sensors have a wide range of applications in detecting particular molecules.

Regulation of metabolic networks by small molecule metabolites

Directory of Open Access Journals (Sweden)

Kanehisa Minoru

2007-03-01

Full Text Available Abstract Background The ability to regulate metabolism is a fundamental process in living systems. We present an analysis of one of the mechanisms by which metabolic regulation occurs: enzyme inhibition and activation by small molecules. We look at the network properties of this regulatory system and the relationship between the chemical properties of regulatory molecules. Results We find that many features of the regulatory network, such as the degree and clustering coefficient, closely match those of the underlying metabolic network. While these global features are conserved across several organisms, we do find local differences between regulation in E. coli and H. sapiens which reflect their different lifestyles. Chemical structure appears to play an important role in determining a compounds suitability for use in regulation. Chemical structure also often determines how groups of similar compounds can regulate sets of enzymes. These groups of compounds and the enzymes they regulate form modules that mirror the modules and pathways of the underlying metabolic network. We also show how knowledge of chemical structure and regulation could be used to predict regulatory interactions for drugs. Conclusion The metabolic regulatory network shares many of the global properties of the metabolic network, but often varies at the level of individual compounds. Chemical structure is a key determinant in deciding how a compound is used in regulation and for defining modules within the regulatory system.

Revival structures of linear molecules in a field-free alignment condition as probed by high-order harmonic generation

International Nuclear Information System (INIS)

Lee, G. H.; Kim, H. T.; Park, J. Y.; Nam, C. H.; Kim, T. K.; Lee, J. H.; Ihee, H.

2006-01-01

Revival structures (rotational coherence) of three linear molecules (N 2 , O 2 , and CO 2 ) in a field free alignment condition have been investigated using high-order harmonic generation. The harmonic yields of these molecules were measured in a pump-probe manner by using a weak femtosecond (fs) laser pulse for field-free alignment of molecules and another intense fs laser pulse for harmonic generation. The harmonic intensities from 23rd to 29th order with respect to the time delay between the pump and the probe pulses showed revival structures in the condition of a field-free alignment of molecules. While the revival structure of a N 2 molecule had one-fourth the period of the full revival time and different degrees of modulation among different fractional revival times, the revival structures of O 2 and CO 2 molecules showed one-eighth the periods of the full revival time and similar degrees of modulation among all fractional revival times. The revival structures could be interpreted in terms of the nature of the highest occupied molecular orbital and the total nuclear spin.

Waved graphene: Unique structure for the adsorption of small molecules

International Nuclear Information System (INIS)

Pan, Hui

2017-01-01

We propose waved graphenes for the strong adsorption of molecules and investigate their potential applications. We find that the physical adsorption of molecules on waved graphene is greatly enhanced by compression. At optimal compression, the physical adsorption energies of H_2, N_2, NO, and CO are increased by 6–9 times, and that for O_2 is more than 2 times. We show that the energy for their chemical adsorption on waved graphene decreases dramatically with the increment of compression. The energy of dissociation of H_2 on flat graphene is 1.63 eV and reduced to 0.06 eV (96% reduction) on waved graphene at a compression of 50%, respectively. The energy for chemical adsorption of O_2 on waved graphenes is extremely reduced from 0.98 eV to −0.57 eV as with compression increasing from 0 to 50%, indicating the transition of endothermic chemical adsorption to exothermic. We further show that the electronic properties of waved graphenes are modified, leading to the change of electrical characters. We see that the waved graphenes may find applications in gas storage, sensor and catalyst because of enhanced physical and chemical adsorption and the induced change of electronic properties. - Highlights: • Adsorption of small molecules on waved graphene is greatly enhanced. • Strong physical adsorption in the trough of waved graphene can be achieved by tuning the curvature. • Chemical adsorption is on the crest of waved graphene. • Exothermic dissociation of H2 and O2 can be realized on waved graphene under high compression. • Wave graphene can be candidates as catalysts and gas storage/sensor.

Waved graphene: Unique structure for the adsorption of small molecules

Energy Technology Data Exchange (ETDEWEB)

Pan, Hui, E-mail: huipan@umac.mo

2017-03-01

We propose waved graphenes for the strong adsorption of molecules and investigate their potential applications. We find that the physical adsorption of molecules on waved graphene is greatly enhanced by compression. At optimal compression, the physical adsorption energies of H{sub 2}, N{sub 2}, NO, and CO are increased by 6–9 times, and that for O{sub 2} is more than 2 times. We show that the energy for their chemical adsorption on waved graphene decreases dramatically with the increment of compression. The energy of dissociation of H{sub 2} on flat graphene is 1.63 eV and reduced to 0.06 eV (96% reduction) on waved graphene at a compression of 50%, respectively. The energy for chemical adsorption of O{sub 2} on waved graphenes is extremely reduced from 0.98 eV to −0.57 eV as with compression increasing from 0 to 50%, indicating the transition of endothermic chemical adsorption to exothermic. We further show that the electronic properties of waved graphenes are modified, leading to the change of electrical characters. We see that the waved graphenes may find applications in gas storage, sensor and catalyst because of enhanced physical and chemical adsorption and the induced change of electronic properties. - Highlights: • Adsorption of small molecules on waved graphene is greatly enhanced. • Strong physical adsorption in the trough of waved graphene can be achieved by tuning the curvature. • Chemical adsorption is on the crest of waved graphene. • Exothermic dissociation of H2 and O2 can be realized on waved graphene under high compression. • Wave graphene can be candidates as catalysts and gas storage/sensor.

Relation between structure and organisation properties of new amphiphilic cyclodextrins

International Nuclear Information System (INIS)

Moutard, Stephane

2003-01-01

Since a number of years, special attention and efforts have been made to prepare amphiphilic cyclodextrins (CDs) with the objective to use them to obtain supramolecular assemblies as such or in the presence of preformed lipidic structures. The aim of these investigation is in both cases to combine the size specificity of cyclodextrins for guests and the transport properties of phospho-lipidic structures. The final objects could be of importance to transport or target biologically relevant molecules such as drugs using new galenic formulations. In a first step, a new family of amphiphilic CDs was prepared from a pure phospholipids (DMPE) onto cyclodextrins or methylated derivatives through a spacing arm. The afforded compounds (phospholipidyl-cyclodextrins) were fully characterized by high field NMR and high resolution mass spectrometry. The methylated derivatives were shown to self-organize in water with low CMC to form fluctuating micellar fibers retaining the inclusion capacity of the cyclodextrin cavities. The interactions of these compounds with membrane systems were investigated as black films using X-ray reflectivity and by evaluation of their detergent power towards model DMPC liposomes. Their ability to cross over the Blood Brain Barrier was evidenced by a new approach making use of novel immuno-enzymatic assays. In a second step, a new class of amphiphilic cyclodextrins was considered (peptidolipidyl-cyclodextrins). Although they are structurally similar to phospholipidyl-CDs, their preparation overcomes the tedious steps of the later and lead to a considerable versatility in terms of the number of possible molecules to be prepared. Moreover, the stability problems encountered with phospholipids are avoided. Several examples have been prepared, fully characterized and their organization properties investigated by the determination of CMC and by deuterium NMR on a pure and homogeneous mixed peptidolipidyl-CD / DMPC lamellar phase. This novel class of

Contact-Engineered Electrical Properties of MoS2 Field-Effect Transistors via Selectively Deposited Thiol-Molecules.

Science.gov (United States)

Cho, Kyungjune; Pak, Jinsu; Kim, Jae-Keun; Kang, Keehoon; Kim, Tae-Young; Shin, Jiwon; Choi, Barbara Yuri; Chung, Seungjun; Lee, Takhee

2018-05-01

Although 2D molybdenum disulfide (MoS 2 ) has gained much attention due to its unique electrical and optical properties, the limited electrical contact to 2D semiconductors still impedes the realization of high-performance 2D MoS 2 -based devices. In this regard, many studies have been conducted to improve the carrier-injection properties by inserting functional paths, such as graphene or hexagonal boron nitride, between the electrodes and 2D semiconductors. The reported strategies, however, require relatively time-consuming and low-yield transfer processes on sub-micrometer MoS 2 flakes. Here, a simple contact-engineering method is suggested, introducing chemically adsorbed thiol-molecules as thin tunneling barriers between the metal electrodes and MoS 2 channels. The selectively deposited thiol-molecules via the vapor-deposition process provide additional tunneling paths at the contact regions, improving the carrier-injection properties with lower activation energies in MoS 2 field-effect transistors. Additionally, by inserting thiol-molecules at the only one contact region, asymmetric carrier-injection is feasible depending on the temperature and gate bias. © 2018 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

Properties of cellulase as template molecule on chitosan—methyl methacrylate membrane

Science.gov (United States)

Lian, Qi; Zheng, Xuefang; Wu, Haixia; Song, Shitao; Wang, Dongjun

2015-12-01

In this study, a novel molecular imprinting membrane made of chitosan and methyl methacrylate (MMA) was fabricated with cellulase as template molecule and the thermal response to cellulase was characterized. The film was characterized by infrared spectroscopy (IR), X-ray diffraction (XRD), scanning electron microscopy (SEM) and the permeation experiment. The results showed that the space structure of the film was as similar as the cellulase. Moreover, the membrane had advanced molecular imprinting capability to cellulase comparing to pepsin and pectinase at any temperature and the film had excellent ability to identify specific template molecule (cellulase) at the synthesis temperature compared to other temperatures.

Theoretical studies on CH+ ion molecule using configuration interaction method and its spectroscopic properties

International Nuclear Information System (INIS)

Machado, F.B.C.

1985-01-01

The use of the configuration (CI) method for the calculation of very accurate potential energy curves and dipole moment functions, and then their use in the comprehension of spectroscopic properties of diatomic molecules is presented. The spectroscopic properties of CH + and CD + such as: vibrational levels, spectroscopic constants, averaged dipole moments for all vibrational levels, radiative transition probabilities for emission and absorption, and radiative lifetimes are verificated. (M.J.C.) [pt

Anti-trypanosomal activities and structural chemical properties of selected compound classes.

Science.gov (United States)

Ponte-Sucre, Alicia; Bruhn, Heike; Schirmeister, Tanja; Cecil, Alexander; Albert, Christian R; Buechold, Christian; Tischer, Maximilian; Schlesinger, Susanne; Goebel, Tim; Fuß, Antje; Mathein, Daniela; Merget, Benjamin; Sotriffer, Christoph A; Stich, August; Krohne, Georg; Engstler, Markus; Bringmann, Gerhard; Holzgrabe, Ulrike

2015-02-01

Potent compounds do not necessarily make the best drugs in the market. Consequently, with the aim to describe tools that may be fundamental for refining the screening of candidates for animal and preclinical studies and further development, molecules of different structural classes synthesized within the frame of a broad screening platform were evaluated for their trypanocidal activities, cytotoxicities against murine macrophages J774.1 and selectivity indices, as well as for their ligand efficiencies and structural chemical properties. To advance into their modes of action, we also describe the morphological and ultrastructural changes exerted by selected members of each compound class on the parasite Trypanosoma brucei. Our data suggest that the potential organelles targeted are either the flagellar pocket (compound 77, N-Arylpyridinium salt; 15, amino acid derivative with piperazine moieties), the endoplasmic reticulum membrane systems (37, bisquaternary bisnaphthalimide; 77, N-Arylpyridinium salt; 68, piperidine derivative), or mitochondria and kinetoplasts (88, N-Arylpyridinium salt; 68, piperidine derivative). Amino acid derivatives with fumaric acid and piperazine moieties (4, 15) weakly inhibiting cysteine proteases seem to preferentially target acidic compartments. Our results suggest that ligand efficiency indices may be helpful to learn about the relationship between potency and chemical characteristics of the compounds. Interestingly, the correlations found between the physico-chemical parameters of the selected compounds and those of commercial molecules that target specific organelles indicate that our rationale might be helpful to drive compound design toward high activities and acceptable pharmacokinetic properties for all compound families.

Influence of the aggregate state on band structure and optical properties of C60 computed with different methods

Science.gov (United States)

Pal, Amrita; Arabnejad, Saeid; Yamashita, Koichi; Manzhos, Sergei

2018-05-01

C60 and C60 based molecules are efficient acceptors and electron transport layers for planar perovskite solar cells. While properties of these molecules are well studied by ab initio methods, those of solid C60, specifically its optical absorption properties, are not. We present a combined density functional theory-Density Functional Tight Binding (DFTB) study of the effect of solid state packing on the band structure and optical absorption of C60. The valence and conduction band edge energies of solid C60 differ on the order of 0.1 eV from single molecule frontier orbital energies. We show that calculations of optical properties using linear response time dependent-DFT(B) or the imaginary part of the dielectric constant (dipole approximation) can result in unrealistically large redshifts in the presence of intermolecular interactions compared to available experimental data. We show that optical spectra computed from the frequency-dependent real polarizability can better reproduce the effect of C60 aggregation on optical absorption, specifically with a generalized gradient approximation functional, and may be more suited to study effects of molecular aggregation.

Ab Initio Calculations of the Electronic Structures and Biological Functions of Protein Molecules

Science.gov (United States)

Zheng, Haoping

2003-04-01

The self-consistent cluster-embedding (SCCE) calculation method reduces the computational effort from M3 to about M1 (M is the number of atoms in the system) with unchanged calculation precision. So the ab initio, all-electron calculation of the electronic structure and biological function of protein molecule becomes a reality, which will promote new proteomics considerably. The calculated results of two real protein molecules, the trypsin inhibitor from the seeds of squash Cucurbita maxima (CMTI-I, 436 atoms) and the Ascaris trypsin inhibitor (912 atoms, two three-dimensional structures), are presented. The reactive sites of the inhibitors are determined and explained. The precision of structure determination of inhibitors are tested theoretically.

Understanding and modulating the high-energy properties of noble-gas hydrides from their long-bonding: an NBO/NRT investigation on HNgCO+/CS+/OSi+ and HNgCN/NC (Ng = He, Ar, Kr, Xe, Rn) molecules.

Science.gov (United States)

Zhang, Guiqiu; Song, Junjie; Fu, Lei; Tang, Kongshuang; Su, Yue; Chen, Dezhan

2018-04-18

The noble-gas hydrides, HNgX (X is an electronegative atom or fragment), represent potential high-energy materials because their two-body decomposition process, HNgX → Ng + HX, is strongly exoergic. Our previous studies have shown that each member of the HNgX (X = halogen atom or CN/NC fragment) molecules is composed of three leading resonance structures: two ω-bonding structures (H-Ng+ :X- and H:- Ng+-X) and one long-bonding structure (H∧X). The last one paints a novel [small sigma, Greek, circumflex]-type long-bonding picture. The present study focuses on the relationship between this novel bonding motif and the unusual energetic properties. We chose HNgCO+/CS+/OSi+/CN/NC, with the formula HNgAB (Ng = He, Ar, Kr, Xe, Rn; AB = CO+/CS+/OSi+/CN/NC) as the research system. We first investigated the bonding of HNgCO+ and its analogous HNgCS+/OSi+ species using NBO/NRT methods, and quantitatively compared the bonding with that in HNgCN/NC molecules. NBO/NRT results showed that each of the HNgCO+/CS+/OSi+ molecules could be better represented as a resonance hybrid of ω-bonding and long-bonding structures, but the long-bonding is much weaker than that in HNgCN/NC molecules. Furthermore, we introduced the long-bonding concept into the rationalization of the high-energy properties, and found a good correlation between the highly exothermic two-body dissociation channel and the long-bond order, bH-A. We also found that the long-bond order is highly tunable for these noble-gas hydrides due to its dependence on the nature of the electronegative AB fragments or the central noble-gas atoms, Ng. On the basis of these results, we could optimize the energetic properties by changing the long-bonding motif of our studied molecules. Overall, this study shows that the long-bonding model provides an easy way to rationalize and modulate the unusual energy properties of noble-gas hydrides, and that it is helpful to predict some noble-gas hydrides as potential energetic materials.

Structural Arrangement of Water Molecules around Highly Charged Nanoparticles: Molecular Dynamics Simulation

International Nuclear Information System (INIS)

Kim, Eunae; Yeom, Min Sun

2014-01-01

Molecular dynamics simulations were performed to understand the structural arrangement of water molecules around highly charged nanoparticles under aqueous conditions. The effect of two highly charged nanoparticles on the solvation charge asymmetry has been examined. We calculated the radial distribution functions of the components of water molecules around nanoparticles which have four charge types at two different salt concentrations. Even though the distributions of water molecules surrounding a sodium ion and a chloride ion are hardly affected by the charges of nanoparticles and the salt concentrations, those around highly charged nanoparticles are strongly influenced by the charges of nanoparticles, but hardly by the charges of nanoparticles and salt concentrations. We find that the distributions of hydrogen atoms in water molecules around one highly charged nanoparticle are dependent on the magnitude of the nanoparticle charge

PHYSICOCHEMICAL PROPERTY CALCULATIONS

Science.gov (United States)

Computer models have been developed to estimate a wide range of physical-chemical properties from molecular structure. The SPARC modeling system approaches calculations as site specific reactions (pKa, hydrolysis, hydration) and `whole molecule' properties (vapor pressure, boilin...

[Relationships between microscope structure and thermodynamic properties

International Nuclear Information System (INIS)

Wu, R.S.; Lee, L.L.; Cochran, D.

1990-01-01

This paper exhibits on the molecular level, the relationships between the microscopic structure and thermodynamic properties of dilute supercritical solutions by application of the integral equation theories for molecular distribution functions. To solve the integral equations, the authors use Baxter's Wiener-Hopf factorization of the Ornstein-Zernike equations and then apply this method to binary Lennard-Jones mixtures. A number of closure relations have been used: such as the Percus-Yevick (PY), the reference hypernetted chain (RHNC), the hybrid mean spherical approximation (HMSA), and the reference interaction-site (RISM) methods. The authors examine the microstructures of several important classes of supercritical mixtures, including the usual attractive-type and the less known repulsive-type solutions. The clustering of solvent molecules for solvent-solute structures in the attractive mixtures and, correspondingly, the solvent cavitation in the repulsive mixtures are clearly demonstrated. These are shown to be responsible for the large negative growth of the solute partial molar volumes in the attractive case and the positive growth in the repulsive case

Environmental effects on molecules immersed in liquids

International Nuclear Information System (INIS)

Sese, L.M.

1990-01-01

A methodology to study environmental effects is thoroughly discussed. It combines molecular quantum mechanics and classical statistical mechanics of molecular fluids. Pair distribution functions collecting statistical information appear quite naturally in the quantum equations describing a single molecule. As well as allowing the computation of any individual molecular property in a liquid phase, this approach satisfies a number of theoretical requirements (dependence on density and temperature, validity in the thermodynamic limit). In a sense, it can be regarded as a useful alternative to the well-known Monte Carlo averaging processes for calculating molecular properties. Numerical applications studying liquid carbon disulphide and liquid carbon tetrachloride at several state points are given. Results cover typical RHF information (CNDO/2) on molecules, and show the sensitivity of the presented methodology to structural changes in liquids. (orig.)

Second rank direction cosine spherical tensor operators and the nuclear electric quadrupole hyperfine structure Hamiltonian of rotating molecules

Science.gov (United States)

di Lauro, C.

2018-03-01

Transformations of vector or tensor properties from a space-fixed to a molecule-fixed axis system are often required in the study of rotating molecules. Spherical components λμ,ν of a first rank irreducible tensor can be obtained from the direction cosines between the two axis systems, and a second rank tensor with spherical components λμ,ν(2) can be built from the direct product λ × λ. It is shown that the treatment of the interaction between molecular rotation and the electric quadrupole of a nucleus is greatly simplified, if the coefficients in the axis-system transformation of the gradient of the electric field of the outer charges at the coupled nucleus are arranged as spherical components λμ,ν(2). Then the reduced matrix elements of the field gradient operators in a symmetric top eigenfunction basis, including their dependence on the molecule-fixed z-angular momentum component k, can be determined from the knowledge of those of λ(2) . The hyperfine structure Hamiltonian Hq is expressed as the sum of terms characterized each by a value of the molecule-fixed index ν, whose matrix elements obey the rule Δk = ν. Some of these terms may vanish because of molecular symmetry, and the specific cases of linear and symmetric top molecules, orthorhombic molecules, and molecules with symmetry lower than orthorhombic are considered. Each ν-term consists of a contraction of the rotational tensor λ(2) and the nuclear quadrupole tensor in the space-fixed frame, and its matrix elements in the rotation-nuclear spin coupled representation can be determined by the standard spherical tensor methods.

Tuning the electronic structure and transport properties of graphene by noncovalent functionalization: effects of organic donor, acceptor and metal atoms

International Nuclear Information System (INIS)

Zhang Yonghui; Zhou Kaige; Xie Kefeng; Zeng Jing; Zhang Haoli; Peng Yong

2010-01-01

Using density functional theory and nonequilibrium Green's function (NEGF) formalism, we have theoretically investigated the binding of organic donor, acceptor and metal atoms on graphene sheets, and revealed the effects of the different noncovalent functionalizations on the electronic structure and transport properties of graphene. The adsorptions of 2,3-dichloro-5,6-dicyano-1,4-benzoquinone (DDQ) and tetrathiafulvalene (TTF) induce hybridization between the molecular levels and the graphene valence bands, and transform the zero-gap semiconducting graphene into a metallic graphene. However, the current versus voltage (I-V) simulation indicates that the noncovalent modifications by organic molecules are not sufficient to significantly alter the transport property of the graphene for sensing applications. We found that the molecule/graphene interaction could be dramatically enhanced by introducing metal atoms to construct molecule/metal/graphene sandwich structures. A chemical sensor based on iron modified graphene shows a sensitivity two orders of magnitude higher than that of pristine graphene. The results of this work could help to design novel graphene-based sensing or switching devices.

Pro-aromatic and anti-aromatic π-conjugated molecules: an irresistible wish to be diradicals

KAUST Repository

Zeng, Zebing

2015-01-01

© 2015 The Royal Society of Chemistry. Aromaticity is an important concept to understand the stability and physical properties of π-conjugated molecules. Recent studies on pro-aromatic and anti-aromatic molecules revealed their irresistible tendency to become diradicals in the ground state. Diradical character thus becomes another very important concept and it is fundamentally correlated to the physical (optical, electronic and magnetic) properties and chemical reactivity of most of the organic optoelectronic materials. Molecules with distinctive diradical character show unique properties which are very different from those of traditional closed-shell π-conjugated systems, and thus they have many potential applications in organic electronics, spintronics, non-linear optics and energy storage. This critical review first introduces the fundamental electronic structure of Kekulé diradicals within the concepts of anti-aromaticity and pro-aromaticity in the context of Hückel aromaticity and diradical character. Then recent research studies on various stable/persistent diradicaloids based on pro-aromatic and anti-aromatic compounds are summarized and discussed with regard to their synthetic chemistry, physical properties, structure-property relationships and potential material applications. A summary and personal perspective is given at the end.

Structure and properties of Al-MIL-53-ADP, a breathing MOF based on the aliphatic linker molecule adipic acid.

Science.gov (United States)

Reinsch, Helge; Pillai, Renjith S; Siegel, Renée; Senker, Jürgen; Lieb, Alexandra; Maurin, Guillaume; Stock, Norbert

2016-03-14

The new aluminium based metal-organic framework [Al(OH)(O2C-C4H8-CO2)]·H2O denoted as Al-MIL-53-ADP-lp (lp stands for large pore) was synthesised under solvothermal conditions. This solid is an analogue of the archetypical aluminium terephthalate Al-MIL-53 based on the aliphatic single-chain linker molecule adipic acid (H2ADP, hexanedioic acid). In contrast to its aromatic counterparts, Al-MIL-53-ADP exhibits a structural breathing behaviour solely upon dehydration/rehydration. The crystal structure of the anhydrous compound denoted as Al-MIL-53-ADP-np (np stands for narrow pore) was determined by a combination of forcefield-based computations and Rietveld refinement of the powder X-ray diffraction data while the structure of the hydrated form Al-MIL-53-ADP-lp was derived computationally by a combination of force field based methods and Density Functional Theory calculations. Both structures were further supported by (1)H, (13)C and (27)Al high-resolution NMR MAS 1D data coupled again with simulations. Al-MIL-53-ADP was further characterised by means of vibrational spectroscopy, elemental analysis, thermogravimetry and water vapour sorption.

Acenes, Heteroacenes and Analogous Molecules for Organic Photovoltaic and Field Effect Transistor Applications

Science.gov (United States)

Granger, Devin Benjamin

Polycyclic aromatic hydrocarbons composed of benzenoid rings fused in a linear fashion comprise the class of compounds known as acenes. The structures containing three to six ring fusions are brightly colored and possess band gaps and charge transport efficiencies sufficient for semiconductor applications. These molecules have been investigated throughout the past several decades to assess their optoelectronic properties. The absorption, emission and charge transport properties of this series of molecules has been studied extensively to elucidate structure-property relationships. A wide variety of analogous molecules, incorporating heterocycles in place of benzenoid rings, demonstrate similar properties to the parent compounds and have likewise been investigated. Functionalization of acene compounds by placement of groups around the molecule affects the way in which molecules interact in the solid state, in addition to the energetics of the molecule. The use of electron donating or electron withdrawing groups affects the frontier molecular orbitals and thus affects the optical and electronic gaps of the molecules. The use of bulky side groups such as alkylsilylethynyl groups allows for crystal engineering of molecular aggregates, and changing the volume and dimensions of the alkylsilyl groups affects the intermolecular interactions and thus changes the packing motif. In chapter 2, a series of tetracene and pentacene molecules with strongly electron withdrawing groups is described. The investigation focuses on the change in energetics of the frontier molecular orbitals between the base acene and the nitrile and dicyanovinyl derivatives as well as the differences between the pentacene and tetracene molecules. The differences in close packing motifs through use of bulky alkylsilylethynyl groups is also discussed in relation to electron acceptor material design and bulk heterojunction organic photovoltaic characteristics. Chapter 3 focuses on molecular acceptor and

The Relation between Structure and Quantum Interference in Single Molecule Junctions

DEFF Research Database (Denmark)

Markussen, Troels; Stadler, Robert; Thygesen, Kristian Sommer

2010-01-01

Quantum interference (QI) of electron pathways has recently attracted increased interest as an enabling tool for single-molecule electronic devices. Although various molecular systems have been shown to exhibit QI effects and a number of methods have been proposed for its analysis, simple...... guidelines linking the molecular structure to QI effects in the phase-coherent transport regime have until now been lacking. In the present work we demonstrate that QI in aromatic molecules is intimately related to the topology of the molecule’s π system and establish a simple graphical scheme to predict...

Effect of pressure on the solution structure and hydrogen bond properties of aqueous N-methylacetamide

International Nuclear Information System (INIS)

Sarma, Rahul; Paul, Sandip

2012-01-01

Highlights: ► NMA molecules are associated mostly through their hydrophobic methyl groups. ► High pressure reduces association propensity causing dispersion of these moieties. ► Orientational polarization of vicinal water molecules near O and H atoms of NMA. ► NMA prefers to be a H-bond acceptor rather than a donor in interaction with water. ► Energy of these hydrogen bonds reduces slightly at high pressure. -- Abstract: Effects of high pressure on hydrophobic and hydrogen bonding interactions are investigated by employing molecular dynamics (MD) simulations of aqueous N-methylacetamide (NMA) solutions. Such systems are of interest mainly because high pressure causes protein denaturation and NMA is a computationally effective model to understand the atomic-level picture of pressure-induced structural transitions of protein. Simulations are performed for five different pressure values ranging from 1 atm to 8000 atm. We find that NMA molecules are associated mostly through their hydrophobic methyl groups and high pressure reduces this association propensity, causing dispersion of these moieties. At high pressure, structural void decreases and the packing efficiency of water molecules around NMA molecules increases. Hydrogen bond properties calculations show favorable NMA–NMA hydrogen bonds as compared to those of NMA–water hydrogen bonds and preference of NMA to be a hydrogen bond acceptor rather than a donor in interaction with water.

Modification of the properties of porous silicon on adsorption of iodine molecules

International Nuclear Information System (INIS)

Vorontsov, A. S.; Osminkina, L. A.; Tkachenko, A. E.; Konstantinova, E. A.; Elenskii, V. G.; Timoshenko, V. Yu.; Kashkarov, P. K.

2007-01-01

Infrared spectroscopy and electron spin resonance measurements are used to study the properties of porous silicon layers on adsorption of the I 2 iodine molecules. The layers are formed on the p-an n-Si single-crystal wafers. It is established that, in the atmosphere of I 2 molecules, the charge-carrier concentration in the layers produced on the p-type wafers can be noticeably increased: the concentration of holes can attain values on the order of ∼10 18 -10 19 cm -3 . In porous silicon layers formed on the n-type wafers, the adsorption-induced inversion of the type of charge carriers and the partial substitution of silicon-hydrogen bonds by silicon-iodine bonds are observed. A decrease in the concentration of surface paramagnetic defects, P b centers, is observed in the samples with adsorbed iodine. The experimental data are interpreted in the context of the model in which it is assumed that both deep and shallow acceptor states are formed at the surface of silicon nanocrystals upon the adsorption of I 2 molecules

Novel polymeric potassium complex: Its synthesis, structural characterization, photoluminescence and electrochemical properties

Energy Technology Data Exchange (ETDEWEB)

Ceyhan, Goekhan [Chemistry Department, K.Maras Suetcue Imam University, 46100 K.Maras (Turkey); Tuemer, Mehmet, E-mail: mtumer@ksu.edu.tr [Chemistry Department, K.Maras Suetcue Imam University, 46100 K.Maras (Turkey); Koese, Muhammet; McKee, Vickie [Chemistry Department, Loughborough University, LE11 3TU Leicestershire (United Kingdom)

2012-03-15

In this paper, we obtained a novel poly(vanillinato potassium) complex (PVP) as a single crystal and characterized by analytical and spectroscopic methods. A single crystal of the PVP was obtained from the acetone solution. X-ray structural data show that crystals contain polymeric K{sup +} complex of vanillin. Each potassium ion in the polymeric structure is identical and seven-coordinate, bonded to two methoxy, two phenoxy and three aldehyde oxygen atoms from four vaniline molecules. Two aldehyde oxygen atoms are bridging between potassium ions. It crystallizes in the monoclinic system, space group P2{sub 1}/c, with lattice parameters a=9.6215(10) A, b=17.4139(19) A, c=9.6119(10) A, {beta}=100.457(2) Degree-Sign and Z=4. Thermal properties of the PVP were investigated by TGA, DTA and DSC methods. The electrochemical properties of the complex were studied in different solvents and at various scan rates. The luminescence properties of the complex in different solvents and at different pH values have been investigated. The results show that the complex exhibits more efficient luminescence property in CH{sub 3}CN and n-butanol. - Highlights: Black-Right-Pointing-Pointer Novel polymeric potassium complex was prepared and fully characterized. Black-Right-Pointing-Pointer X-ray crystal structure of complex was reported. Black-Right-Pointing-Pointer Electrochemical properties of compound were investigated. Black-Right-Pointing-Pointer Thermal and DSC measurements of complex were examined.

Metallic behavior and negative differential resistance properties of (InAs)n (n = 2 − 4) molecule cluster junctions via a combined non–equilibrium Green's function and density functional theory study

International Nuclear Information System (INIS)

Wang, Qi; Li, Rong; Xu, Yuanlan; Zhang, Jianbing; Miao, Xiangshui; Zhang, Daoli

2014-01-01

In this present work, the geometric structures and electronic transport properties of (InAs) n (n = 2, 3, 4) molecule cluster junctions are comparatively investigated using NEGF combined with DFT. Results indicate that all (InAs) n molecule cluster junctions present metallic behavior at the low applied biases ([−2V, 2V]), while NDR appears at a certain high bias range. Our calculation shows that the current of (InAs) 4 molecule cluster–based junction is almost the largest at any bias. The mechanisms of the current–voltage characteristics of all the three molecule cluster junctions are proposed.

Relation between the development of structure and the properties of network polymers

International Nuclear Information System (INIS)

Williams, D.R.G.; Allen, P.E.M.; Simon, G.P.

1989-01-01

It was shown by various techniques that the development of structure in the early stages of cure determines the final structure and properties of glassy three-dimensional networks. Solid state [ 13 C]-nuclear magnetic resonance (NMR) techniques identified the structure groupings and the extent of heterogeneity soon after the commencement of polymerization through to the glassy state. Observations of the changes in mobility of groups during cure were correlated with the development of bulk properties such as the glass transition and compressive strength. Computer simulation of the kinetics of the polymerization based on a three-dimensional lattice closely followed the trends observed by experiment and provided insight into the formation of clusters of reacted polymer surrounded by pools of unreacted monomer. The difficulty in obtaining full cure was clearly associated with the presence of trapped reactive centres within the cluster. Observation of the behaviour of small probe or tracer molecules by NMR was shown to be a potent technique for investigating the organization of networks. 28 refs., 12 figs

Adsorption behavior of Co anchored on graphene sheets toward NO, SO2, NH3, CO and HCN molecules

International Nuclear Information System (INIS)

Tang, Yanan; Chen, Weiguang; Li, Chenggang; Pan, Lijun; Dai, Xianqi; Ma, Dongwei

2015-01-01

Graphical abstract: - Highlights: • In contrast to the pristine graphene, a vacancy defect in graphene strongly stabilizes the Co atom. • The positively charged of Co atom on graphene can regulate the stability of gas molecules. • Different gas molecules can modulate the electronic structure of Co–graphene systems. • The adsorbed NO on Co–graphene can effectively regulate the magnetic properties of systems. - Abstract: Based on the first-principles of density-functional theory (DFT), the effects of gas adsorption on the change in geometric stability, electronic structure and magnetic properties of graphene with anchored Co (Co–graphene) systems were investigated. A single Co adatom interacts much weaker with pristine graphene (Co/pri–graphene) than with the graphene containing a single vacancy (Co/SV–graphene). The Co dopant provides more electrons to the dangling bonds of carbon atom at defective site and exhibits more positive charges, which makes Co/SV–graphene less prone to be adsorbed by gas molecules in comparison to Co/pri–graphene. It is found that the electronic structure and magnetic properties of Co–graphene systems can be modulated by adsorbing gas molecules. Except the NH 3 molecule, the adsorbed NO, SO 2 , CO or HCN as electron acceptors on the Co/pri–graphene can exhibit semiconducting properties. Among the gas molecules, the strong adsorption of NO molecule can effectively regulate the magnetic properties of Co–graphene systems. Moreover, the stable configuration of Co/SV–graphene is more likely to be the gas sensor for detecting NO and SO 2 . The results validate that the reactivity of atomic-scale catalyst is supported on graphene sheets, which is expected to be potentially efficient in the gas sensors and electronic device

Structural and energetic properties of La3+ in water/DMSO mixtures

Science.gov (United States)

Montagna, Maria; Spezia, Riccardo; Bodo, Enrico

2017-11-01

By using molecular dynamics based on a custom polarizable force field, we have studied the solvation of La3+ in an equimolar mixture of dimethylsulfoxide (DMSO) with water. An extended structural analysis has been performed to provide a complete picture of the physical properties at the basis of the interaction of La3+ with both solvents. Through our simulations we found that, very likely, the first solvation shell in the mixture is not unlike the one found in pure water or pure DMSO and contains 9 solvent molecules. We have also found that the solvation is preferentially due to DMSO molecules with the water initially present in first shell quickly leaving to the bulk. The dehydration process of the first shell has been analyzed by both plain MD simulations and a constrained dynamics approach; the free energy profiles for the extraction of water from first shell have also been computed.

Shedding light on protein folding, structural and functional dynamics by single molecule studies

DEFF Research Database (Denmark)

Bavishi, Krutika; Hatzakis, Nikos

2014-01-01

property of a population, single molecule measurements offer observation and quantification of the abundance, lifetime and function of multiple protein states. They also permit the direct observation of the transient and rarely populated intermediates in the energy landscape that are typically averaged out...

Surface structure and properties of functionalized nanodiamonds: a first-principles study

International Nuclear Information System (INIS)

Datta, Aditi; Kirca, Mesut; Fu Yao; To, Albert C

2011-01-01

The goal of this work is to gain fundamental understanding of the surface and internal structure of functionalized detonation nanodiamonds (NDs) using quantum mechanics based density functional theory (DFT) calculations. The unique structure of ND assists in the binding of different functional groups to its surface which in turn facilitates binding with drug molecules. The ability to comprehensively model the surface properties, as well as drug-ND interactions during functionalization, is a challenge and is the problem of our interest. First, the structure of NDs of technologically relevant size (∼5 nm) was optimized using classical mechanics based molecular mechanics simulations. Quantum mechanics based density functional theory (DFT) was then employed to analyse the properties of smaller relevant parts of the optimized cluster further to address the effect of functionalization on the stability of the cluster and reactivity at its surface. It is found that functionalization is preferred over reconstruction at the (100) surface and promotes graphitization in the (111) surface for NDs functionalized with the carbonyl oxygen (C = O) group. It is also seen that the edges of ND are the preferred sites for functionalization with the carboxyl group (-COOH) vis-a-vis the corners of ND.

Surface structure and properties of functionalized nanodiamonds: a first-principles study

Energy Technology Data Exchange (ETDEWEB)

Datta, Aditi; Kirca, Mesut; Fu Yao; To, Albert C, E-mail: albertto@pitt.edu [Department of Mechanical Engineering and Materials Science and Department of Civil and Environmental Engineering, University of Pittsburgh, Pittsburgh, PA 15261 (United States)

2011-02-11

The goal of this work is to gain fundamental understanding of the surface and internal structure of functionalized detonation nanodiamonds (NDs) using quantum mechanics based density functional theory (DFT) calculations. The unique structure of ND assists in the binding of different functional groups to its surface which in turn facilitates binding with drug molecules. The ability to comprehensively model the surface properties, as well as drug-ND interactions during functionalization, is a challenge and is the problem of our interest. First, the structure of NDs of technologically relevant size ({approx}5 nm) was optimized using classical mechanics based molecular mechanics simulations. Quantum mechanics based density functional theory (DFT) was then employed to analyse the properties of smaller relevant parts of the optimized cluster further to address the effect of functionalization on the stability of the cluster and reactivity at its surface. It is found that functionalization is preferred over reconstruction at the (100) surface and promotes graphitization in the (111) surface for NDs functionalized with the carbonyl oxygen (C = O) group. It is also seen that the edges of ND are the preferred sites for functionalization with the carboxyl group (-COOH) vis-a-vis the corners of ND.

Vibronic coupling in ionized organic molecules: structural distortions and chemical reactions

International Nuclear Information System (INIS)

Williams, Ffrancon

2003-01-01

Ionized organic molecules (radical cations) in radiation chemistry are liable to undergo vibronic coupling whenever there is a relatively small energy gap (∼0.5-1.5 eV) between their ground and excited states. As a result of this mixing, the force constant for the symmetry-allowed vibrational mode that couples these states is lowered in the ground state of the radical cation so that deformation can take place more easily along this specific mode. This pseudo-Jahn-Teller effect can then result in a permanent structural distortion of the radical cation relative to the symmetry of the parent neutral molecule. It can also bring about an energetically favored pathway for a facile chemical rearrangement along a reaction coordinate defined by the coupling mode. Examples taken from matrix-isolation studies are used to illustrate these dramatic consequences of vibronic coupling in radical cations. Thus, the bicyclo[2.2.2]oct-2-ene and tetramethylurea radical cations are found to have twisted structures departing from the C 2v symmetry of their parent molecules, while the oxirane and bicyclo[1.1.1]pentane radical cations undergo ring-opening rearrangements along reaction coordinates that correspond to the deformational modes predicted by the pseudo-Jahn-Teller effect

Correlating substituent parameter values to electron transport properties of molecules

International Nuclear Information System (INIS)

Vedova-Brook, Natalie; Matsunaga, Nikita; Sohlberg, Karl

2004-01-01

There are a vast number of organic compounds that could be considered for use in molecular electronics. Because of this, the need for efficient and economical screening tools has emerged. We demonstrate that the substituent parameter values (σ), commonly found in advanced organic chemistry textbooks, correlate strongly with features of the charge migration process, establishing them as useful indicators of electronic properties. Specifically, we report that ab initio derived electronic charge transfer values for 16 different substituted aromatic molecules for molecular junctions correlate to the σ values with a correlation coefficient squared (R 2 ) of 0.863

FlavorDB: a database of flavor molecules.

Science.gov (United States)

Garg, Neelansh; Sethupathy, Apuroop; Tuwani, Rudraksh; Nk, Rakhi; Dokania, Shubham; Iyer, Arvind; Gupta, Ayushi; Agrawal, Shubhra; Singh, Navjot; Shukla, Shubham; Kathuria, Kriti; Badhwar, Rahul; Kanji, Rakesh; Jain, Anupam; Kaur, Avneet; Nagpal, Rashmi; Bagler, Ganesh

2018-01-04

Flavor is an expression of olfactory and gustatory sensations experienced through a multitude of chemical processes triggered by molecules. Beyond their key role in defining taste and smell, flavor molecules also regulate metabolic processes with consequences to health. Such molecules present in natural sources have been an integral part of human history with limited success in attempts to create synthetic alternatives. Given their utility in various spheres of life such as food and fragrances, it is valuable to have a repository of flavor molecules, their natural sources, physicochemical properties, and sensory responses. FlavorDB (http://cosylab.iiitd.edu.in/flavordb) comprises of 25,595 flavor molecules representing an array of tastes and odors. Among these 2254 molecules are associated with 936 natural ingredients belonging to 34 categories. The dynamic, user-friendly interface of the resource facilitates exploration of flavor molecules for divergent applications: finding molecules matching a desired flavor or structure; exploring molecules of an ingredient; discovering novel food pairings; finding the molecular essence of food ingredients; associating chemical features with a flavor and more. Data-driven studies based on FlavorDB can pave the way for an improved understanding of flavor mechanisms. © The Author(s) 2017. Published by Oxford University Press on behalf of Nucleic Acids Research.

The structure of small molecules with the Coulomb Explosion method

International Nuclear Information System (INIS)

Vager, Z.; Kanter, E.P.

1987-01-01

The content of this paper is divided into two parts: (1) achievements of the last two years in studying molecular ion structure with the aid of the newly developed Coulomb-Explosion (CE) method, and (2) the understanding of the modern CE data in terms of an invariant density of nuclear coordinates of the studied molecule

Structure of human farnesyl pyrophosphate synthase in complex with an aminopyridine bisphosphonate and two molecules of inorganic phosphate

Energy Technology Data Exchange (ETDEWEB)

Park, Jaeok [McGill University, 3655 Promenade Sir William Osler, Montreal, QC H3G 1Y6 (Canada); Lin, Yih-Shyan [McGill University, 801 Rue Sherbrooke Ouest, Montreal, QC H3A 0B8 (Canada); Tsantrizos, Youla S. [McGill University, 3655 Promenade Sir William Osler, Montreal, QC H3G 1Y6 (Canada); McGill University, 801 Rue Sherbrooke Ouest, Montreal, QC H3A 0B8 (Canada); McGill University, 3649 Promenade Sir William Osler, Montreal, QC H3G 0B1 (Canada); Berghuis, Albert M., E-mail: albert.berghuis@mcgill.ca [McGill University, 3655 Promenade Sir William Osler, Montreal, QC H3G 1Y6 (Canada); McGill University, 3649 Promenade Sir William Osler, Montreal, QC H3G 0B1 (Canada); McGill University, 3775 Rue University, Montreal, QC H3A 2B4 (Canada)

2014-02-19

A co-crystal structure of human farnesyl pyrophosphate synthase in complex with an aminopyridine bisphosphonate, YS0470, and two molecules of inorganic phosphate has been determined. The identity of the phosphate ligands was confirmed by anomalous diffraction data. Human farnesyl pyrophosphate synthase (hFPPS) produces farnesyl pyrophos@@phate, an isoprenoid essential for a variety of cellular processes. The enzyme has been well established as the molecular target of the nitrogen-containing bisphosphonates (N-BPs), which are best known for their antiresorptive effects in bone but are also known for their anticancer properties. Crystal structures of hFPPS in ternary complexes with a novel bisphosphonate, YS0470, and the secondary ligands inorganic phosphate (P{sub i}), inorganic pyrophosphate (PP{sub i}) and isopentenyl pyrophosphate (IPP) have recently been reported. Only the co-binding of the bisphosphonate with either PP{sub i} or IPP resulted in the full closure of the C-@@terminal tail of the enzyme, a conformational change that is required for catalysis and that is also responsible for the potent in vivo efficacy of N-BPs. In the present communication, a co-crystal structure of hFPPS in complex with YS0470 and two molecules of P{sub i} is reported. The unusually close proximity between these ligands, which was confirmed by anomalous diffraction data, suggests that they interact with one another, with their anionic charges neutralized in their bound state. The structure also showed the tail of the enzyme to be fully disordered, indicating that simultaneous binding of two P{sub i} molecules with a bisphosphonate cannot induce the tail-closing conformational change in hFPPS. Examination of homologous FPPSs suggested that this ligand-dependent tail closure is only conserved in the mammalian proteins. The prevalence of P{sub i}-bound hFPPS structures in the PDB raises a question regarding the in vivo relevance of P{sub i} binding to the function of the enzyme.

Design and synthesis of hyperstructured molecules based on cyclophosphazene core for multiphoton absorption

International Nuclear Information System (INIS)

Naik, K. Praveen Kumar; Sreeramulu, V.; Ramya, E.; Muralidharan, K.; Rao, D. Narayana

2016-01-01

Cyclophosphazene based hyperstructured molecules were synthesized through simple nucleophilic substitution reactions. All these molecules were characterized by multinuclear NMR, MALDI and HRMS spectral data. Third order nonlinear optical properties of the hyperstructured molecules were measured using Z-scan technique with 532 nm, picosecond (ps) laser and 800 nm, femtosecond (fs) laser pulses. The molecules showed reverse saturable absorption on excitation at both 532 nm and 800 nm, which could be attributed to the two-photon absorption (2 PA) and three-photon absorption (3 PA), respectively. The 2 PA and 3 PA cross section values exhibited by the molecules based on cyclophosphazene are as high as 527 GM and 1.86 × 10"−"7"6 cm"−"6 s"2 photon"−"1, respectively. The 2PA, 3PA coefficients and optical limiting properties make them suitable candidates for nonlinear optical devices in the visible and near IR range. - Graphical abstract: The hyperstructured molecules based on cyclophosphazene core were synthesized and used for multiphoton absorption. Open aperture Z-scan curves of hyper structured molecules at the excitation of (a) picosecond laser and (b) femtosecond laser representing multiphoton absorption properties are reported. - Highlights: • Two hyperstructured molecules based on cyclophosphazene core are designed for multiphoton absorption. • NLO properties are measured using Z-scan technique at 532 nm and 800 nm wavelengths. • The molecules were tested for the optical limiting applications at 532 nm and 800 nm laser pulses.

Design and synthesis of hyperstructured molecules based on cyclophosphazene core for multiphoton absorption

Energy Technology Data Exchange (ETDEWEB)

Naik, K. Praveen Kumar [School of Chemistry, University of Hyderabad, Hyderabad 500046 India (India); Sreeramulu, V. [School of Physics, University of Hyderabad, Hyderabad 500046 India (India); CNR-IFN CSMFO Laboratory, Via alla Cascata, 56/C Povo, Trento (Italy); Ramya, E. [School of Physics, University of Hyderabad, Hyderabad 500046 India (India); Muralidharan, K., E-mail: murali@uohyd.ac.in [School of Chemistry, University of Hyderabad, Hyderabad 500046 India (India); Rao, D. Narayana [School of Physics, University of Hyderabad, Hyderabad 500046 India (India)

2016-09-01

Cyclophosphazene based hyperstructured molecules were synthesized through simple nucleophilic substitution reactions. All these molecules were characterized by multinuclear NMR, MALDI and HRMS spectral data. Third order nonlinear optical properties of the hyperstructured molecules were measured using Z-scan technique with 532 nm, picosecond (ps) laser and 800 nm, femtosecond (fs) laser pulses. The molecules showed reverse saturable absorption on excitation at both 532 nm and 800 nm, which could be attributed to the two-photon absorption (2 PA) and three-photon absorption (3 PA), respectively. The 2 PA and 3 PA cross section values exhibited by the molecules based on cyclophosphazene are as high as 527 GM and 1.86 × 10{sup −76} cm{sup −6} s{sup 2} photon{sup −1}, respectively. The 2PA, 3PA coefficients and optical limiting properties make them suitable candidates for nonlinear optical devices in the visible and near IR range. - Graphical abstract: The hyperstructured molecules based on cyclophosphazene core were synthesized and used for multiphoton absorption. Open aperture Z-scan curves of hyper structured molecules at the excitation of (a) picosecond laser and (b) femtosecond laser representing multiphoton absorption properties are reported. - Highlights: • Two hyperstructured molecules based on cyclophosphazene core are designed for multiphoton absorption. • NLO properties are measured using Z-scan technique at 532 nm and 800 nm wavelengths. • The molecules were tested for the optical limiting applications at 532 nm and 800 nm laser pulses.

Adsorption studies of alcohol molecules on monolayer MoS_2 nanosheet—A first-principles insights

International Nuclear Information System (INIS)

Nagarajan, V.; Chandiramouli, R.

2017-01-01

Highlights: • The adsorption of methanol, ethanol & 1-propanol on MoS_2 nanosheet are studied. • The PDOS & band structure confirms adsorption of alcohol vapors on MoS_2 nanosheet. • The adsorption of 1-propanol vapor on MoS_2 nanosheet is more favorable. • The alcohol molecules adsorption on MoS_2 nanosheet is explored in atomistic level. - Abstract: The electronic and adsorption properties of three different alcohol molecules namely methanol, ethanol and 1-propanol vapors on MoS_2 nanosheet is investigated using DFT method. The structural stability of MoS_2 nanosheet is ascertained with formation energy. The adsorption properties of alcohol molecules on MoS_2 base material is discussed in terms of average energy gap variation, Mulliken charge transfer, energy band gap and adsorption energy. The prominent adsorption sites of methanol, ethanol and 1-propanol vapors on MoS_2 nanosheet are studied in atomistic level. The projected density of states (PDOS) spectrum gives the clear insights on the electronic properties of MoS_2 nanosheet. The PDOS and energy band structure confirmed the adsorption of alcohol vapors on MoS_2 nanosheet. The variation in the band structure and PDOS is noticed upon adsorption of methanol, ethanol and 1-propanol molecules on MoS_2 nanosheet. The PDOS spectrum also reveals the variation in peak maxima owing to transfer of electron between alcohol molecules and MoS_2 base material. The adsorption of 1-propanol vapor on MoS_2 nanosheet is observed to be more favorable than other alcohol molecules. The findings confirm that monolayer MoS_2 nanosheet can be used to detect the presence of alcohol vapors in the environment.

The growth and electronic structure of azobenzene-based functional molecules on layered crystals

International Nuclear Information System (INIS)

Iwicki, J; Ludwig, E; Buck, J; Kalläne, M; Kipp, L; Rossnagel, K; Köhler, F; Herges, R

2012-01-01

In situ ultraviolet photoelectron spectroscopy is used to study the growth of ultrathin films of azobenzene-based functional molecules (azobenzene, Disperse Orange 3 and a triazatriangulenium platform with an attached functional azo-group) on the layered metal TiTe 2 and on the layered semiconductor HfS 2 at liquid nitrogen temperatures. Effects of intermolecular interactions, of the substrate electronic structure, and of the thermal energy of the sublimated molecules on the growth process and on the adsorbate electronic structure are identified and discussed. A weak adsorbate-substrate interaction is particularly observed for the layered semiconducting substrate, holding the promise of efficient molecular photoswitching.

Theoretical conformational analysis of the bovine adrenal medulla 12 residue peptide molecule

Science.gov (United States)

Akhmedov, N. A.; Tagiyev, Z. H.; Hasanov, E. M.; Akverdieva, G. A.

2003-02-01

The spatial structure and conformational properties of the bovine adrenal medulla 12 residue peptide Tyr1-Gly2-Gly3-Phe4-Met5-Arg6-Arg7-Val8-Gly9-Arg10-Pro11-Glu12 (BAM-12P) molecule were studied by theoretical conformational analysis. It is revealed that this molecule can exist in several stable states. The energy and geometrical parameters for the low-energy conformations are obtained. The conformationally rigid and labile segments of this molecule were revealed.

Preparation of three terbium complexes with p-aminobenzoic acid and investigation of crystal structure influence on luminescence property

International Nuclear Information System (INIS)

Ye Chaohong; Sun Haoling; Wang Xinyi; Li Junran; Nie Daobo; Fu Wenfu; Gao Song

2004-01-01

Three new rare earth p-aminobenzoic acid complexes, [Tb 2 L 6 (H 2 O) 2 ] n (1), [Tb 2 L 6 (H 2 O) 4 ].2H 2 O (2) and [Tb(phen) 2 L 2 (H 2 O) 2 ](phen)L·4H 2 O (3) (HL: p-aminobenzoic acid; phen: 1, 10-phenanthroline), with different structural forms are reported in this paper. Complex 1 is a polymolecule with a two-dimensional plane structure. Compound 2 is a binuclear molecule, and 3 appears to be a mononuclear complex. The fluorescence intensity, the fluorescence life-time and emission quantum yield of 2, which has two coordination water molecules, is better than those of 1, which has only one coordination water molecule. This is an unusual phenomenon for general fluorescent rare earth complexes. The fluorescence performance of 3 is the most unsatisfactory among the three complexes. Their crystal structures show that the coordination mode of the ligand is an important factor influencing the luminescence properties of a fluorescent rare earth complex

Interfacial assembly structures and nanotribological properties of saccharic acids.

Science.gov (United States)

Shi, Hongyu; Liu, Yuhong; Zeng, Qingdao; Yang, Yanlian; Wang, Chen; Lu, Xinchun

2017-01-04

Saccharides have been recognized as potential bio-lubricants because of their good hydration ability. However, the interfacial structures of saccharides and their derivatives are rarely studied and the molecular details of interaction mechanisms have not been well understood. In this paper, the supramolecular assembly structures of saccharic acids (including galactaric acid and lactobionic acid), mediated by hydrogen bonds O-HN and O-HO, were successfully constructed on a highly oriented pyrolytic graphite (HOPG) surface by introducing pyridine modulators and were explicitly revealed by using scanning tunneling microscopy (STM). Furthermore, friction forces were measured in the saccharic acid/pyridine co-assembled system by atomic force microscopy (AFM), revealing a larger value than a pristine saccharic acid system, which could be attributed to the stronger tip-assembled molecule interactions that lead to the higher potential energy barrier needed to overcome. The effort on saccharide-related supramolecular self-assembly and nanotribological behavior could provide a novel and promising pathway to explore the interaction mechanisms underlying friction and reveal the structure-property relationship at the molecular level.

Selective small-molecule inhibition of an RNA structural element

Energy Technology Data Exchange (ETDEWEB)

Howe, John A.; Wang, Hao; Fischmann, Thierry O.; Balibar, Carl J.; Xiao, Li; Galgoci, Andrew M.; Malinverni, Juliana C.; Mayhood, Todd; Villafania, Artjohn; Nahvi, Ali; Murgolo, Nicholas; Barbieri, Christopher M.; Mann, Paul A.; Carr, Donna; Xia, Ellen; Zuck, Paul; Riley, Dan; Painter, Ronald E.; Walker, Scott S.; Sherborne, Brad; de Jesus, Reynalda; Pan, Weidong; Plotkin, Michael A.; Wu, Jin; Rindgen, Diane; Cummings, John; Garlisi, Charles G.; Zhang, Rumin; Sheth, Payal R.; Gill, Charles J.; Tang, Haifeng; Roemer , Terry (Merck)

2015-09-30

Riboswitches are non-coding RNA structures located in messenger RNAs that bind endogenous ligands, such as a specific metabolite or ion, to regulate gene expression. As such, riboswitches serve as a novel, yet largely unexploited, class of emerging drug targets. Demonstrating this potential, however, has proven difficult and is restricted to structurally similar antimetabolites and semi-synthetic analogues of their cognate ligand, thus greatly restricting the chemical space and selectivity sought for such inhibitors. Here we report the discovery and characterization of ribocil, a highly selective chemical modulator of bacterial riboflavin riboswitches, which was identified in a phenotypic screen and acts as a structurally distinct synthetic mimic of the natural ligand, flavin mononucleotide, to repress riboswitch-mediated ribB gene expression and inhibit bacterial cell growth. Our findings indicate that non-coding RNA structural elements may be more broadly targeted by synthetic small molecules than previously expected.

Structures and potential energy functions of Pu3 molecule

International Nuclear Information System (INIS)

Meng Daqiao; Jiang Gang; Liu Xiaoya; Luo Deli; Zhu Zhenghe

2001-01-01

Density functional (B3LYP) method with relativistic effective core potential (RECP) has been used to optimize the structures of Pu 2 and Pu 3 molecules. The results show that the ground states of Pu 2 and Pu 3 molecules are of D ∞h and D 3h symmetry, and of 13 and 19 fold, respectively. The spectral constants of Pu 2 , ω e = 52.3845 cm -1 and ω e x e = 0.0201 cm -1 , and the harmonic frequencies of Pu 3 , ν 1 = 56.9007 cm -1 , ν 2 = 57.1816 cm - '1 and ν 3 = 64.0785 cm -1 , have also been obtained on the B3LYP/RECP level. The potential energy functions of Pu 2 and Pu 3 have been derived, for the first time so far as known, from normal equation fitting and the many-body expansion theory

Organic molecules deposited on graphene: A computational investigation of self-assembly and electronic structure

International Nuclear Information System (INIS)

Oliveira, I. S. S. de; Miwa, R. H.

2015-01-01

We use ab initio simulations to investigate the adsorption and the self-assembly processes of tetracyanoquinodimethane (TCNQ), tetrafluoro-tetracyanoquinodimethane (F4-TCNQ), and tetrasodium 1,3,6,8-pyrenetetrasulfonic acid (TPA) on the graphene surface. We find that there are no chemical bonds at the molecule–graphene interface, even at the presence of grain boundaries on the graphene surface. The molecules bond to graphene through van der Waals interactions. In addition to the molecule–graphene interaction, we performed a detailed study of the role played by the (lateral) molecule–molecule interaction in the formation of the, experimentally verified, self-assembled layers of TCNQ and TPA on graphene. Regarding the electronic properties, we calculate the electronic charge transfer from the graphene sheet to the TCNQ and F4-TCNQ molecules, leading to a p-doping of graphene. Meanwhile, such charge transfer is reduced by an order of magnitude for TPA molecules on graphene. In this case, it is not expected a significant doping process upon the formation of self-assembled layer of TPA molecules on the graphene sheet

Cold Rydberg molecules

Science.gov (United States)

Raithel, Georg; Zhao, Jianming

2017-04-01

Cold atomic systems have opened new frontiers at the interface of atomic and molecular physics. These include research on novel types of Rydberg molecules. Three types of molecules will be reviewed. Long-range, homonuclear Rydberg molecules, first predicted in [1] and observed in [2], are formed via low-energy electron scattering of the Rydberg electron from a ground-state atom within the Rydberg atom's volume. The binding mostly arises from S- and P-wave triplet scattering. We use a Fermi model that includes S-wave and P-wave singlet and triplet scattering, the fine structure coupling of the Rydberg atom and the hyperfine structure coupling of the 5S1/2 atom (in rubidium [3]). The hyperfine structure gives rise to mixed singlet-triplet potentials for both low-L and high-L Rydberg molecules [3]. A classification into Hund's cases [3, 4, 5] will be discussed. The talk further includes results on adiabatic potentials and adiabatic states of Rydberg-Rydberg molecules in Rb and Cs. These molecules, which have even larger bonding length than Rydberg-ground molecules, are formed via electrostatic multipole interactions. The leading interaction term of neutral Rydberg-Rydberg molecules is between two dipoles, while for ionic Rydberg molecules it is between a dipole and a monopole. NSF (PHY-1506093), NNSF of China (61475123).

SerpentinaDB: a database of plant-derived molecules of Rauvolfia serpentina.

Science.gov (United States)

Pathania, Shivalika; Ramakrishnan, Sai Mukund; Randhawa, Vinay; Bagler, Ganesh

2015-08-04

Plant-derived molecules (PDMs) are known to be a rich source of diverse scaffolds that could serve as a basis for rational drug design. Structured compilation of phytochemicals from traditional medicinal plants can facilitate prospection for novel PDMs and their analogs as therapeutic agents. Rauvolfia serpentina is an important medicinal plant, endemic to Himalayan mountain ranges of Indian subcontinent, reported to be of immense therapeutic value against various diseases. We present SerpentinaDB, a structured compilation of 147 R. serpentina PDMs, inclusive of their plant part source, chemical classification, IUPAC, SMILES, physicochemical properties, and 3D chemical structures with associated references. It also provides refined search option for identification of analogs of natural molecules against ZINC database at user-defined cut-off. SerpentinaDB is an exhaustive resource of R. serpentina molecules facilitating prospection for therapeutic molecules from a medicinally important source of natural products. It also provides refined search option to explore the neighborhood of chemical space against ZINC database to identify analogs of natural molecules obtained as leads. In a previous study, we have demonstrated the utility of this resource by identifying novel aldose reductase inhibitors towards intervention of complications of diabetes.

Luminescence of Rubrene and DCJTB molecules in organic light-emitting devices

Energy Technology Data Exchange (ETDEWEB)

Moon, Chang-Bum, E-mail: cbmoon@hoseo.edu [Department of Display Engineering, Hoseo University, Sechul-Ri 160, Baebang, Asan, Chung-Nam 336-795 (Korea, Republic of); Department of Engineering Physics, McMaster University, Hamilton, Ontario, Canada L8S4L7 (Canada); Song, Wook; Meng, Mei; Kim, Nam Ho; Yoon, Ju-An [Department of Display Engineering, Hoseo University, Sechul-Ri 160, Baebang, Asan, Chung-Nam 336-795 (Korea, Republic of); Kim, Woo Young, E-mail: wykim@hoseo.edu [Department of Display Engineering, Hoseo University, Sechul-Ri 160, Baebang, Asan, Chung-Nam 336-795 (Korea, Republic of); Wood, Richard; Mascher, Peter [Department of Engineering Physics, McMaster University, Hamilton, Ontario, Canada L8S4L7 (Canada)

2014-02-15

We investigated the optical properties of light emission based on the resonance energy transfer mechanism between two molecules in the host–dopant systems. For this purpose, we fabricated the organic light-emitting devices with the different doped emissive layers. The host matrices were made of 4,4′,4″-tris(carbasol-l-nyl)triphenylamine (TCTA) and 2-methyl-9,10-di(2-naphthyl)anthracene (MADN) molecules and the doped molecules were 5,6,11,12-tetraphenylnaphtacene (Rubrene) and 4-(Dicyanomethylene)-2-tert-butyl-6- (1,1,7,7-tetramethyljulolidin-4-yl-vinyl)-4H-pyran (DCJTB). The concentrations of the doped molecules were 0.1%, 0.3%, 0.5%, and 0.8%. Through spectroscopic analysis using multi-peak fits with a Gaussian function to the emission spectra, we obtained the relative light intensity of the two dopants according to the doping concentrations and examined the relations between the molecular excited energy states and the nature of energy transfer in the host and dopant systems. We show that the luminous efficiency of the devices has a strong correlation between the energy transfer owing to the individual molecular intrinsic properties and the electrical characteristics associated with the bulky properties in the devices. -- Highlights: • Fabrication and characterization of the OLEDs with a host–dopant system in the emissive layer. • Investigation of the optical properties of light emission based on the resonance energy transfer mechanism between the dopant molecules. • EL and PL spectroscopic study for the structure of the molecular energy levels in the dopant molecules.

ChemNet: A Transferable and Generalizable Deep Neural Network for Small-Molecule Property Prediction

Energy Technology Data Exchange (ETDEWEB)

Goh, Garrett B.; Siegel, Charles M.; Vishnu, Abhinav; Hodas, Nathan O.

2017-12-08

With access to large datasets, deep neural networks through representation learning have been able to identify patterns from raw data, achieving human-level accuracy in image and speech recognition tasks. However, in chemistry, availability of large standardized and labelled datasets is scarce, and with a multitude of chemical properties of interest, chemical data is inherently small and fragmented. In this work, we explore transfer learning techniques in conjunction with the existing Chemception CNN model, to create a transferable and generalizable deep neural network for small-molecule property prediction. Our latest model, ChemNet learns in a semi-supervised manner from inexpensive labels computed from the ChEMBL database. When fine-tuned to the Tox21, HIV and FreeSolv dataset, which are 3 separate chemical tasks that ChemNet was not originally trained on, we demonstrate that ChemNet exceeds the performance of existing Chemception models, contemporary MLP models that trains on molecular fingerprints, and it matches the performance of the ConvGraph algorithm, the current state-of-the-art. Furthermore, as ChemNet has been pre-trained on a large diverse chemical database, it can be used as a universal “plug-and-play” deep neural network, which accelerates the deployment of deep neural networks for the prediction of novel small-molecule chemical properties.

Antiaromatic bisindeno-[n]thienoacenes with small singlet biradical characters: Syntheses, structures and chain length dependent physical properties

KAUST Repository

Shi, Xueliang

2014-01-01

Recent studies demonstrated that aromaticity and biradical character play important roles in determining the ground-state structures and physical properties of quinoidal polycyclic hydrocarbons and oligothiophenes, a kind of molecular materials showing promising applications for organic electronics, photonics and spintronics. In this work, we designed and synthesized a new type of hybrid system, the so-called bisindeno-[n]thienoacenes (n = 1-4), by annulation of quinoidal fused α-oligothiophenes with two indene units. The obtained molecules can be regarded as antiaromatic systems containing 4n π electrons with small singlet biradical character (y0). Their ground-state geometry and electronic structures were studied by X-ray crystallographic analysis, NMR, ESR and Raman spectroscopy, assisted by density functional theory calculations. With extension of the chain length, the molecules showed a gradual increase of the singlet biradical character accompanied by decreased antiaromaticity, finally leading to a highly reactive bisindeno[4]thienoacene (S4-TIPS) which has a singlet biradical ground state (y0= 0.202). Their optical and electronic properties in the neutral and charged states were systematically investigated by one-photon absorption, two-photon absorption, transient absorption spectroscopy, cyclic voltammetry and spectroelectrochemistry, which could be correlated to the chain length dependent antiaromaticity and biradical character. Our detailed studies revealed a clear structure-aromaticity-biradical character-physical properties-reactivity relationship, which is of importance for tailored material design in the future. This journal is

Charge transport properties of DNA aperiodic molecule: The role of interbase hopping in Watson-Crick base pair

Science.gov (United States)

Sinurat, E. N.; Yudiarsah, E.

2017-07-01

The charge transport properties of DNA aperiodic molecule has been studied by considering various interbase hopping parameter on Watson-Crick base pair. 32 base pairs long double-stranded DNA aperiodic model with sequence GCTAGTACGTGACGTAGCTAGGATATGCCTGA on one chain and its complement on the other chain is used. Transfer matrix method has been used to calculate transmission probabilities, for determining I-V characteristic using Landauer Büttiker formula. DNA molecule is modeled using tight binding hamiltonian combined with the theory of Slater-Koster. The result show, the increment of Watson-Crick hopping value leads to the transmission probabilities and current of DNA aperiodic molecule increases.

The mechanism and properties of bio-photon emission and absorption in protein molecules in living systems

Science.gov (United States)

Pang, Xiao-feng

2012-05-01

The mechanism and properties of bio-photon emission and absorption in bio-tissues were studied using Pang's theory of bio-energy transport, in which the energy spectra of protein molecules are obtained from the discrete dynamic equation. From the energy spectra, it was determined that the protein molecules could both radiate and absorb bio-photons with wavelengths of energy level transitions of the excitons. These results were consistent with the experimental data; this consisted of infrared absorption data from collagen, bovine serum albumin, the protein-like molecule acetanilide, plasma, and a person's finger, and the laser-Raman spectra of acidity I-type collagen in the lungs of a mouse, and metabolically active Escherichia coli. We further elucidated the mechanism responsible for the non-thermal biological effects produced by the infrared light absorbed by the bio-tissues, using the above results. No temperature rise was observed; instead, the absorbed infrared light promoted the vibrations of amides as well the transport of the bio-energy from one place to other in the protein molecules, which changed their conformations. These experimental results, therefore, not only confirmed the validity of the mechanism of bio-photon emission, and the newly developed theory of bio-energy transport mentioned above, but also explained the mechanism and properties of the non-thermal biological effects produced by the absorption of infrared light by the living systems.

Charge transport properties of a twisted DNA molecule: A renormalization approach

Energy Technology Data Exchange (ETDEWEB)

Almeida, M.L. de; Ourique, G.S.; Fulco, U.L. [Departamento de Biofísica e Farmacologia, Universidade Federal do Rio Grande do Norte, 59072-970 Natal-RN (Brazil); Albuquerque, E.L., E-mail: eudenilson@gmail.com [Departamento de Biofísica e Farmacologia, Universidade Federal do Rio Grande do Norte, 59072-970 Natal-RN (Brazil); Moura, F.A.B.F. de; Lyra, M.L. [Instituto de Física, Universidade Federal de Alagoas, 57072-900 Maceió-AL (Brazil)

2016-10-20

In this work we study the charge transport properties of a nanodevice consisting of a finite segment of the DNA molecule sandwiched between two metallic electrodes. Our model takes into account a nearest-neighbor tight-binding Hamiltonian considering the nucleobases twist motion, whose solutions make use of a two-steps renormalization process to simplify the algebra, which can be otherwise quite involved. The resulting variations of the charge transport efficiency are analyzed by numerically computing the main features of the electron transmittance spectra as well as their I × V characteristic curves.

NMR-study of dynamic structural transtions in RNA-molecules

OpenAIRE

Fürtig, Boris

2007-01-01

The following thesis is concerned with the elucidation of structural changes of RNA molecules during the time course of dynamic processes that are commonly denoted as folding reactions. In contrast to the field of protein folding, the concept of RNA folding comprises not only folding reactions itself but also refolding- or conformational switching- and assembly processes (see chapter III). The method in this thesis to monitor these diverse processes is high resolution liquid-state NMR spectro...

Adsorption studies of alcohol molecules on monolayer MoS{sub 2} nanosheet—A first-principles insights

Energy Technology Data Exchange (ETDEWEB)

Nagarajan, V.; Chandiramouli, R., E-mail: rcmoulii@gmail.com

2017-08-15

Highlights: • The adsorption of methanol, ethanol & 1-propanol on MoS{sub 2} nanosheet are studied. • The PDOS & band structure confirms adsorption of alcohol vapors on MoS{sub 2} nanosheet. • The adsorption of 1-propanol vapor on MoS{sub 2} nanosheet is more favorable. • The alcohol molecules adsorption on MoS{sub 2} nanosheet is explored in atomistic level. - Abstract: The electronic and adsorption properties of three different alcohol molecules namely methanol, ethanol and 1-propanol vapors on MoS{sub 2} nanosheet is investigated using DFT method. The structural stability of MoS{sub 2} nanosheet is ascertained with formation energy. The adsorption properties of alcohol molecules on MoS{sub 2} base material is discussed in terms of average energy gap variation, Mulliken charge transfer, energy band gap and adsorption energy. The prominent adsorption sites of methanol, ethanol and 1-propanol vapors on MoS{sub 2} nanosheet are studied in atomistic level. The projected density of states (PDOS) spectrum gives the clear insights on the electronic properties of MoS{sub 2} nanosheet. The PDOS and energy band structure confirmed the adsorption of alcohol vapors on MoS{sub 2} nanosheet. The variation in the band structure and PDOS is noticed upon adsorption of methanol, ethanol and 1-propanol molecules on MoS{sub 2} nanosheet. The PDOS spectrum also reveals the variation in peak maxima owing to transfer of electron between alcohol molecules and MoS{sub 2} base material. The adsorption of 1-propanol vapor on MoS{sub 2} nanosheet is observed to be more favorable than other alcohol molecules. The findings confirm that monolayer MoS{sub 2} nanosheet can be used to detect the presence of alcohol vapors in the environment.

Dielectric relaxation of guest molecules in a clathrate structure of syndiotactic polystyrene.

Science.gov (United States)

Urakawa, Osamu; Kaneko, Fumitoshi; Kobayashi, Hideo

2012-12-13

Structure and dynamics of semicrystalline polymer films composed of syndiotactic polystyrene (sPS) and 2-butanone were examined through X-ray diffraction, polarized FTIR, and dielectric relaxation measurements. The X-ray and FTIR measurements revealed its crystal structure to be δ-clathrate containing 2-butanone molecules inside. The carbonyl group of 2-butanone in the crystal was found to orient preferentially parallel to the ac plane of the crystal through the polarized ATR FTIR measurements. Dielectric measurements were also conducted on these film samples to see only the relaxation dynamics of 2-butanone thanks to the high dielectric intensity of 2-butanone compared to sPS. Two relaxation modes denoted by slow and fast modes appeared. The former was assigned to the motion of 2-butanone molecules entrapped in the cavities of the crystalline (δ-form) and the latter to those in the amorphous region. We focused on the slow mode in order to elucidate the specific dynamics of the guest molecule confined in the crystalline region. The relaxation time of the slow mode was about 4 orders of magnitude longer than that of liquid 2-butanone. This suggests that the dynamics of guest molecules is highly restricted due to the high barrier to conformational and/or orientational change of the guest molecule in the cavity of δ-crystal. Furthermore, the dielectric intensity Δε of the slow mode was much smaller than the one calculated from that of bulk liquid 2-butanone and the guest concentration in the crystalline region (the intensity was only 10% of the estimated value from the bulk liquid data). This result also indicates that the free rotational motion of 2-butanone molecules is restricted inside the crystal. This will be consistently related to the weak uniplanar orientation of the carbonyl group of 2-butanone parallel to the ac plane revealed by the X-ray and polarized ATR FTIR measurements.

Molecular electronics: the single molecule switch and transistor

NARCIS (Netherlands)

Sotthewes, Kai; Geskin, Victor; Heimbuch, Rene; Kumar, Avijit; Zandvliet, Henricus J.W.

2014-01-01

In order to design and realize single-molecule devices it is essential to have a good understanding of the properties of an individual molecule. For electronic applications, the most important property of a molecule is its conductance. Here we show how a single octanethiol molecule can be connected

Hydrothermal synthesis, crystal structure, luminescent and magnetic properties of a new mononuclear GdIII coordination complex

Science.gov (United States)

Coban, Mustafa Burak

2018-06-01

A new GdIII coordination complex, {[Gd(2-stp)2(H2O)6].2(4,4'-bipy).4(H2O)}, complex 1, (2-stp = 2-sulfoterephthalate anion and 4,4'-bipy = 4,4'-bipyridine), has been synthesized by hydrothermal method and characterized by elemental analysis, solid state UV-Vis and FT-IR spectroscopy, single-crystal X-ray diffraction, solid state photoluminescence and variable-temperature magnetic measurements. The crystal structure determination shows that GdIII ions are eight coordinated and adopt a distorted square-antiprismatic geometry. Molecules interacting through intra- and intermolecular (O-H⋯O, O-H⋯N) hydrogen bonds in complex 1, give rise to 3D hydrogen bonded structure and the discrete lattice 4,4'-bipy molecules occupy the channel of the 3D structure. π-π stacking interactions also exist 4,4'-bipy-4,4'-bipy and 4,4'-bipy-2-stp molecule rings in 3D structures. Additionally, solid state photoluminescence properties of complex 1 at room temperature have been investigated. Under the excitation of UV light (at 349 nm), the complex 1 exhibited green emissions (at 505 nm) of GdIII ion in the visible region. Furthermore, Variable-temperature magnetic susceptibility and isothermal magnetization as function of external magnetic field studies reveal that complex 1 displays possible antiferromagnetic interaction.

Adsorption behavior of Co anchored on graphene sheets toward NO, SO{sub 2}, NH{sub 3}, CO and HCN molecules

Energy Technology Data Exchange (ETDEWEB)

Tang, Yanan, E-mail: yntang2010@hotmail.com [College of Physics and Electronic Engineering, Zhengzhou Normal University, Zhengzhou, Henan 450044 (China); Quantum Materials Research Center, Zhengzhou Normal University, Henan 450044 (China); Chen, Weiguang; Li, Chenggang; Pan, Lijun [College of Physics and Electronic Engineering, Zhengzhou Normal University, Zhengzhou, Henan 450044 (China); Quantum Materials Research Center, Zhengzhou Normal University, Henan 450044 (China); Dai, Xianqi, E-mail: xqdai@henannu.edu.cn [College of Physics and Electronic Engineering, Zhengzhou Normal University, Zhengzhou, Henan 450044 (China); Quantum Materials Research Center, Zhengzhou Normal University, Henan 450044 (China); Ma, Dongwei [College of Physics and Electrical Engineering, Anyang Normal University, Anyang, Henan 455000 (China)

2015-07-01

Graphical abstract: - Highlights: • In contrast to the pristine graphene, a vacancy defect in graphene strongly stabilizes the Co atom. • The positively charged of Co atom on graphene can regulate the stability of gas molecules. • Different gas molecules can modulate the electronic structure of Co–graphene systems. • The adsorbed NO on Co–graphene can effectively regulate the magnetic properties of systems. - Abstract: Based on the first-principles of density-functional theory (DFT), the effects of gas adsorption on the change in geometric stability, electronic structure and magnetic properties of graphene with anchored Co (Co–graphene) systems were investigated. A single Co adatom interacts much weaker with pristine graphene (Co/pri–graphene) than with the graphene containing a single vacancy (Co/SV–graphene). The Co dopant provides more electrons to the dangling bonds of carbon atom at defective site and exhibits more positive charges, which makes Co/SV–graphene less prone to be adsorbed by gas molecules in comparison to Co/pri–graphene. It is found that the electronic structure and magnetic properties of Co–graphene systems can be modulated by adsorbing gas molecules. Except the NH{sub 3} molecule, the adsorbed NO, SO{sub 2}, CO or HCN as electron acceptors on the Co/pri–graphene can exhibit semiconducting properties. Among the gas molecules, the strong adsorption of NO molecule can effectively regulate the magnetic properties of Co–graphene systems. Moreover, the stable configuration of Co/SV–graphene is more likely to be the gas sensor for detecting NO and SO{sub 2}. The results validate that the reactivity of atomic-scale catalyst is supported on graphene sheets, which is expected to be potentially efficient in the gas sensors and electronic device.

Solid state proton spin-lattice relaxation in four structurally related organic molecules

International Nuclear Information System (INIS)

Beckmann, Peter A.; Burbank, Kendra S.; Lau, Matty M.W.; Ree, Jessica N.; Weber, Tracy L.

2003-01-01

We report and interpret the temperature dependence of the proton spin-lattice relaxation rate at 8.50 and 22.5 MHz in four polycrystalline solids composed of structurally related molecules: 2-ethylanthracene, 2-t-butylanthracene, 2-ethylanthraquinone, and 2-t-butylanthraquinone. We have been unable to grow single crystals and therefore do not know the crystal structures. Hence, we use the NMR relaxometry data to make predictions about the solid state structures. As expected, we are able to conclude that the ethyl groups do not reorient in the solid state but that the t-butyl groups do. The anthraquinones have a ''simpler'' structure than the anthracenes. The best dynamical models suggest that there is a unique crystallographic site for the t-butyl groups in 2-t-butylanthraquinone and two sites, each with half the molecules, for the ethyl groups in 2-ethylanthraquinone. There are also two sites in 2-ethylanthracene, but with unequal weights, suggesting four sites in the unit cell with lower symmetry than the two anthraquinones. Finally, the observed relaxation rate data in 2-t-butylanthracene is very complex and its interpretation demonstrates the uniqueness problem that arises in interpreting relaxometry data without the knowledge of the crystal structure

Possible B{sup (*)} anti K hadronic molecule state

Energy Technology Data Exchange (ETDEWEB)

Xiao, Cheng-Jian [Chinese Academy of Sciences, Institute of Modern Physics, Lanzhou (China); University of Chinese Academy of Sciences, Beijing (China); Chen, Dian-Yong [Southeast University, School of Physics, Nanjing (China)

2017-06-15

In the present work, the possibility of the observed structure X(5568) or X(5616) as a hadronic molecule is investigated via its decay properties. Our estimations of the strong decay mode indicate that the hadronic molecule interpretation cannot be excluded since the determined parameter value is located in the empirical region. However, the unnatural large coupling constants indicate the molecular interpretation may be questionable. In addition, the radiative decays of the neutral partners of the X(5568) and X(5616) are estimated, which can be a test of the molecular interpretation in the future experiments. (orig.)

The mechanism of 2-dimensional manipulation of DNA molecules by water and ethanol flows

International Nuclear Information System (INIS)

Shen Zigang; Huang Yibo; Li Bin; Zhang Yi

2007-01-01

Due to its unique physical and chemical properties, DNA has recently become a promising material for building blocks in nanofabrication. Many researches focus on how to use DNA molecules as a template for nanowires. Molecular Combing technique is one of important methods to manipulate DNA molecules by using a water meniscus and form specific DNA nano-structures on surfaces. In this paper, by employing a modified molecular combing technique, special patterns of DNA molecules was formed, and the interaction between liquid flows or meniscus and DNA molecules was analyzed, and the mechanism of manipulating DNA molecules by liquid was studied. (authors)

Structural and vibrational study of a neurotransmitter molecule: Dopamine [4-(2-aminoethyl) benzene-1,2-diol].

Science.gov (United States)

Jha, Omkant; Yadav, T K; Yadav, R A

2018-01-15

Structural and vibrational studies for the most stable conformer of dopamine {4-(2-Aminoethyl) benzene-1, 2-diol} have been carried out at the DFT/B3LYP/6-311++G** level using the Gaussian 09 software. The IR and Raman spectra have been recorded and analyzed in light of the computed vibrational parameters using the DFT and the PEDs computed with the help of the GAR2PED software. Some of the fundamentals have considerably changed frequencies in going from benzene to dopamine. Except the rocking and wagging modes of the NH 2 group the other four modes are pure group modes. The rocking and wagging modes of the NH 2 group show mixing with the other modes. The two OH stretching vibrations are highly localized modes. The Kekule phenyl ring stretching mode is found to remain almost unchanged. The HOMO-LUMO study suggests the existence of charge transfer within the molecule and the energy gap supports the pharmacological active property of the dopamine molecule. The NBO analysis has been carried out to understand the proper and improper hydrogen bonding. Copyright © 2017. Published by Elsevier B.V.

Computational design of molecules for an all-quinone redox flow battery.

Science.gov (United States)

Er, Süleyman; Suh, Changwon; Marshak, Michael P; Aspuru-Guzik, Alán

2015-02-01

Inspired by the electron transfer properties of quinones in biological systems, we recently showed that quinones are also very promising electroactive materials for stationary energy storage applications. Due to the practically infinite chemical space of organic molecules, the discovery of additional quinones or other redox-active organic molecules for energy storage applications is an open field of inquiry. Here, we introduce a high-throughput computational screening approach that we applied to an accelerated study of a total of 1710 quinone (Q) and hydroquinone (QH 2 ) ( i.e. , two-electron two-proton) redox couples. We identified the promising candidates for both the negative and positive sides of organic-based aqueous flow batteries, thus enabling an all-quinone battery. To further aid the development of additional interesting electroactive small molecules we also provide emerging quantitative structure-property relationships.

Single molecule DNA detection with an atomic vapor notch filter

Energy Technology Data Exchange (ETDEWEB)

Uhland, Denis; Rendler, Torsten; Widmann, Matthias; Lee, Sang-Yun [University of Stuttgart and Stuttgart Research Center of Photonic Engineering (SCoPE) and IQST, 3rd Physics Institute, Stuttgart (Germany); Wrachtrup, Joerg; Gerhardt, Ilja [University of Stuttgart and Stuttgart Research Center of Photonic Engineering (SCoPE) and IQST, 3rd Physics Institute, Stuttgart (Germany); Max Planck Institute for Solid State Research, Stuttgart (Germany)

2015-12-01

The detection of single molecules has facilitated many advances in life- and material-science. Commonly the fluorescence of dye molecules is detected, which are attached to a non-fluorescent structure under study. For fluorescence microscopy one desires to maximize the detection efficiency together with an efficient suppression of undesired laser leakage. Here we present the use of the narrow-band filtering properties of hot atomic sodium vapor to selectively filter the excitation light from the red-shifted fluorescence of dye labeled single-stranded DNA molecules. A statistical analysis proves an enhancement in detection efficiency of more than 15% in a confocal and in a wide-field configuration. (orig.)

Investigation of gas molecules adsorption on carbon nano tubes electric properties in tight binding model

International Nuclear Information System (INIS)

Moradian, R.; Mohammadi, Y.

2007-01-01

Based on tight binding model we investigated effects of bi-atomic molecules gas(in the general form denoted by X 2 )on single-walled carbon nano tubes electronic properties. We found for some specified values of hopping integrals and random on-site energies, adsorbed molecules bound states located inside of the (10,0) single-walled carbon nano tubes energy gap, where it is similar to the reported experimental results for O 2 adsorption while for other values there is no bound states inside of energy gap. This is similar to the N 2 adsorption on semiconductor single-walled carbon nano tubes.

Structure and properties of molecular and ionic clusters in vapour over caesium fluoride

Science.gov (United States)

Mwanga, Stanley F.; Pogrebnaya, Tatiana P.; Pogrebnoi, Alexander M.

2015-06-01

The properties of neutral molecules Cs2F2, Cs3F3, and Cs4F4, and positive and negative cluster ions Cs2F+, CsF2-, Cs3F2+, Cs2F3-, Cs4F3+, and Cs5F4+ were studied by several of quantum chemical methods implementing density function theory and Möller-Plesset perturbation theory of second and fourth orders. For all species, the equilibrium geometrical structure and vibrational spectra were determined. Different isomers have been revealed for the trimer neutral molecule Cs3F3; pentaatomic, both positive and negative, Cs3F2+, Cs2F3-; and heptaatomic Cs4F3+ ions. The most abundant isomers in the saturated vapour were determined. Enthalpies of dissociation reactions and enthalpies of formation of the species were obtained.

Effects of sub-lethal high-pressure homogenization treatment on the outermost cellular structures and the volatile-molecule profiles of two strains of probiotic lactobacilli.

Science.gov (United States)

Tabanelli, Giulia; Vernocchi, Pamela; Patrignani, Francesca; Del Chierico, Federica; Putignani, Lorenza; Vinderola, Gabriel; Reinheimer, Jorge A; Gardini, Fausto; Lanciotti, Rosalba

2015-01-01

Applying sub-lethal levels of high-pressure homogenization (HPH) to lactic acid bacteria has been proposed as a method of enhancing some of their functional properties. Because the principal targets of HPH are the cell-surface structures, the aim of this study was to examine the effect of sub-lethal HPH treatment on the outermost cellular structures and the proteomic profiles of two known probiotic bacterial strains. Moreover, the effect of HPH treatment on the metabolism of probiotic cells within a dairy product during its refrigerated storage was investigated using SPME-GC-MS. Transmission electron microscopy was used to examine the microstructural changes in the outermost cellular structures due to HPH treatment. These alterations may be involved in the changes in some of the technological and functional properties of the strains that were observed after pressure treatment. Moreover, the proteomic profiles of the probiotic strains treated with HPH and incubated at 37°C for various periods showed different peptide patterns compared with those of the untreated cells. In addition, there were differences in the peaks that were observed in the low-mass spectral region (2000-3000 Da) of the spectral profiles of the control and treated samples. Due to pressure treatment, the volatile-molecule profiles of buttermilk inoculated with treated or control cells and stored at 4°C for 30 days exhibited overall changes in the aroma profile and in the production of molecules that improved its sensory profile, although the two different species imparted specific fingerprints to the product. The results of this study will contribute to understanding the changes that occur in the outermost cellular structures and the metabolism of LAB in response to HPH treatment. The findings of this investigation may contribute to elucidating the relationships between these changes and the alterations of the technological and functional properties of LAB induced by pressure treatment.

Magnetic field modification of ultracold molecule-molecule collisions

International Nuclear Information System (INIS)

Tscherbul, T V; Suleimanov, Yu V; Aquilanti, V; Krems, R V

2009-01-01

We present an accurate quantum mechanical study of molecule-molecule collisions in the presence of a magnetic field. The work focuses on the analysis of elastic scattering and spin relaxation in collisions of O 2 ( 3 Σ g - ) molecules at cold (∼0.1 K) and ultracold (∼10 -6 K) temperatures. Our calculations show that magnetic spin relaxation in molecule-molecule collisions is extremely efficient except at magnetic fields below 1 mT. The rate constant for spin relaxation at T=0.1 K and a magnetic field of 0.1 T is found to be as large as 6.1x10 -11 cm -3 s -1 . The magnetic field dependence of elastic and inelastic scattering cross sections at ultracold temperatures is dominated by a manifold of Feshbach resonances with the density of ∼100 resonances per Tesla for collisions of molecules in the absolute ground state. This suggests that the scattering length of ultracold molecules in the absolute ground state can be effectively tuned in a very wide range of magnetic fields. Our calculations demonstrate that the number and properties of the magnetic Feshbach resonances are dramatically different for molecules in the absolute ground and excited spin states. The density of Feshbach resonances for molecule-molecule scattering in the low-field-seeking Zeeman state is reduced by a factor of 10.

Measurement and control of detailed electronic properties in a single molecule break junction.

Science.gov (United States)

Wang, Kun; Hamill, Joseph; Zhou, Jianfeng; Guo, Cunlan; Xu, Bingqian

2014-01-01

The lack of detailed experimental controls has been one of the major obstacles hindering progress in molecular electronics. While large fluctuations have been occurring in the experimental data, specific details, related mechanisms, and data analysis techniques are in high demand to promote our physical understanding at the single-molecule level. A series of modulations we recently developed, based on traditional scanning probe microscopy break junctions (SPMBJs), have helped to discover significant properties in detail which are hidden in the contact interfaces of a single-molecule break junction (SMBJ). For example, in the past we have shown that the correlated force and conductance changes under the saw tooth modulation and stretch-hold mode of PZT movement revealed inherent differences in the contact geometries of a molecular junction. In this paper, using a bias-modulated SPMBJ and utilizing emerging data analysis techniques, we report on the measurement of the altered alignment of the HOMO of benzene molecules with changing the anchoring group which coupled the molecule to metal electrodes. Further calculations based on Landauer fitting and transition voltage spectroscopy (TVS) demonstrated the effects of modulated bias on the location of the frontier molecular orbitals. Understanding the alignment of the molecular orbitals with the Fermi level of the electrodes is essential for understanding the behaviour of SMBJs and for the future design of more complex devices. With these modulations and analysis techniques, fruitful information has been found about the nature of the metal-molecule junction, providing us insightful clues towards the next step for in-depth study.

Porous Materials - Structure and Properties

DEFF Research Database (Denmark)

Nielsen, Anders

1997-01-01

The paper presents some viewpoints on the description of the pore structure and the modelling of the properties of the porous building materials. Two examples are given , where it has been possible to connect the pore structure to the properties: Shrinkage of autoclaved aerated concrete...

Energy effects on the structure and thermodynamic properties of nanoconfined fluids (a density functional theory study).

Science.gov (United States)

Keshavarzi, Ezat; Kamalvand, Mohammad

2009-04-23

The structure and properties of fluids confined in nanopores may show a dramatic departure from macroscopic bulk fluids. The main reason for this difference lies in the influence of system walls. In addition to the entropic wall effect, system walls can significantly change the energy of the confined fluid compared to macroscopic bulk fluids. The energy effect of the walls on a nanoconfined fluid appears in two forms. The first effect is the cutting off of the intermolecular interactions by the walls, which appears for example in the integrals for calculation of the thermodynamic properties. The second wall effect involves the wall-molecule interactions. In such confined fluids, the introduction of wall forces and the competition between fluid-wall and fluid-fluid forces could lead to interesting thermodynamic properties, including new kinds of phase transitions not observed in the macroscopic fluid systems. In this article, we use the perturbative fundamental measure density functional theory to study energy effects on the structure and properties of a hard core two-Yukawa fluid confined in a nanoslit. Our results show the changes undergone by the structure and phase transition of the nanoconfined fluids as a result of energy effects.

Adsorption of organic molecules on mineral surfaces studied by first-principle calculations: A review.

Science.gov (United States)

Zhao, Hongxia; Yang, Yong; Shu, Xin; Wang, Yanwei; Ran, Qianping

2018-04-09

First-principle calculations, especially by the density functional theory (DFT) methods, are becoming a power technique to study molecular structure and properties of organic/inorganic interfaces. This review introduces some recent examples on the study of adsorption models of organic molecules or oligomers on mineral surfaces and interfacial properties obtained from first-principles calculations. The aim of this contribution is to inspire scientists to benefit from first-principle calculations and to apply the similar strategies when studying and tailoring interfacial properties at the atomistic scale, especially for those interested in the design and development of new molecules and new products. Copyright © 2017. Published by Elsevier B.V.

Impact of Dendrimers on Solubility of Hydrophobic Drug Molecules

Directory of Open Access Journals (Sweden)

Sonam Choudhary

2017-05-01

Full Text Available Adequate aqueous solubility has been one of the desired properties while selecting drug molecules and other bio-actives for product development. Often solubility of a drug determines its pharmaceutical and therapeutic performance. Majority of newly synthesized drug molecules fail or are rejected during the early phases of drug discovery and development due to their limited solubility. Sufficient permeability, aqueous solubility and physicochemical stability of the drug are important for achieving adequate bioavailability and therapeutic outcome. A number of different approaches including co-solvency, micellar solubilization, micronization, pH adjustment, chemical modification, and solid dispersion have been explored toward improving the solubility of various poorly aqueous-soluble drugs. Dendrimers, a new class of polymers, possess great potential for drug solubility improvement, by virtue of their unique properties. These hyper-branched, mono-dispersed molecules have the distinct ability to bind the drug molecules on periphery as well as to encapsulate these molecules within the dendritic structure. There are numerous reported studies which have successfully used dendrimers to enhance the solubilization of poorly soluble drugs. These promising outcomes have encouraged the researchers to design, synthesize, and evaluate various dendritic polymers for their use in drug delivery and product development. This review will discuss the aspects and role of dendrimers in the solubility enhancement of poorly soluble drugs. The review will also highlight the important and relevant properties of dendrimers which contribute toward drug solubilization. Finally, hydrophobic drugs which have been explored for dendrimer assisted solubilization, and the current marketing status of dendrimers will be discussed.

Individual Magnetic Molecules on Ultrathin Insulating Surfaces

Science.gov (United States)

El Hallak, Fadi; Warner, Ben; Hirjibehedin, Cyrus

2012-02-01

Single molecule magnets have attracted ample interest because of their exciting magnetic and quantum properties. Recent studies have demonstrated that some of these molecules can be evaporated on surfaces without losing their magnetic properties [M. Mannini et al., Nature 468, 417, (2010)]. This remarkable progress enhances the chances of real world applications for these molecules. We present STM imaging and spectroscopy data on iron phthalocyanine molecules deposited on Cu(100) and on a Cu2N ultrathin insulating surface. These molecules have been shown to display a large magnetic anisotropy on another thin insulating surface, oxidized Cu(110) [N. Tsukahara et al., Phys. Rev. Lett. 102, 167203 (2009)]. By using a combination of elastic and inelastic electron tunnelling spectroscopy, we investigate the binding of the molecules to the surface and the impact that the surface has on their electronic and magnetic properties.

Modeling molecule-plasmon interactions using quantized radiation fields within time-dependent electronic structure theory

Energy Technology Data Exchange (ETDEWEB)

Nascimento, Daniel R.; DePrince, A. Eugene, E-mail: deprince@chem.fsu.edu [Department of Chemistry and Biochemistry, Florida State University, Tallahassee, Florida 32306-4390 (United States)

2015-12-07

We present a combined cavity quantum electrodynamics/ab initio electronic structure approach for simulating plasmon-molecule interactions in the time domain. The simple Jaynes-Cummings-type model Hamiltonian typically utilized in such simulations is replaced with one in which the molecular component of the coupled system is treated in a fully ab initio way, resulting in a computationally efficient description of general plasmon-molecule interactions. Mutual polarization effects are easily incorporated within a standard ground-state Hartree-Fock computation, and time-dependent simulations carry the same formal computational scaling as real-time time-dependent Hartree-Fock theory. As a proof of principle, we apply this generalized method to the emergence of a Fano-like resonance in coupled molecule-plasmon systems; this feature is quite sensitive to the nanoparticle-molecule separation and the orientation of the molecule relative to the polarization of the external electric field.

Raman scattering in semiconductor structures based on monophthalocyanine and triphthalocyanine molecules incorporating erbium ions

International Nuclear Information System (INIS)

Belogorokhov, I. A.; Tikhonov, E. V.; Breusova, M. O.; Pushkarev, V. E.; Zoteev, A. V.; Tomilova, L. G.; Khokhlov, D. R.

2007-01-01

Semiconductor structures of the type of butyl-substituted erbium monophthalocyanine and triphthalocyanine are studied by Raman spectroscopy. It is shown that, when the sandwich-like structure of the molecule incorporating two complexing atoms between the ligands is considered instead of the planar molecular structure with one ligand and one metal atom, a series of lines appears in the Raman spectrum. In this series, the wave numbers of the lines represent an arithmetic progression with the arithmetical ratio ∼80 cm -1 . It is suggested that this feature is due to the larger number of organic molecules per metal atom in the triphthalocyanine complex, and the four Raman peaks at the frequencies 122, 208, 280, and 362 cm -1 are the manifestation of slight out-of-plane vibrations of the phthalocyanine ligands

Characterizing and engineering tunable spin functionality inside indium arsenide/gallium arsenide quantum dot molecules

Science.gov (United States)

Liu, Weiwen

The continual downsizing of the basic functional units used in the electronics industry has motivated the study of the quantum computation and related topics. To overcome the limitations of classical physics and engineering, some unique quantum mechanical features, especially entanglement and superpositions have begun to be considered as important properties for future bits. Including these quantum mechanical features is attractive because the ability to utilize quantum mechanics can dramatically enhance computational power. Among the various ways of constructing the basic building blocks for quantum computation, we are particularly interested in using spins inside epitaxially grown InAs/GaAs quantum dot molecules as quantum bits (qubits). The ability to design and engineer nanostructures with tailored quantum properties is critical to engineering quantum computers and other novel electro-optical devices and is one of the key challenges for scaling up new ideas for device application. In this thesis, we will focus on how the structure and composition of quantum dot molecules can be used to control spin properties and charge interactions. Tunable spin and charge properties can enable new, more scalable, methods of initializing and manipulating quantum information. In this thesis, we demonstrate one method to enable electric-field tunability of Zeeman splitting for a single electron spin inside a quantum dot molecules by using heterostructure engineering techniques to modify the barrier that separates quantum dots. We describe how these structural changes to the quantum dot molecules also change charge interactions and propose ways to use this effect to enable accurate measurement of coulomb interactions and possibly charge occupancy inside these complicated quantum dot molecules.

Structural characterization of chiral molecules using vibrational circular dichroism spectroscopy

DEFF Research Database (Denmark)

Lassen, Peter Rygaard

2006-01-01

comparison of experimental and calculated spectra. Theoretical structures of the sample molecules were constructed and optimized using molecular mechanical force fields followed by the quantum mechanical method density functional theory (DFT). Calculations of IR absorption and VCD spectra were then carried...... out using the same DFT methods. Here, VCD has the advantage over CD that time-independent DFT calculations are sufficient. During the course of this project, the above methodology has been applied to a range of molecules. Some of them (nyasol, curcuphenol dimers and ginkgolide) are purely organic...... or as flexible as the curcuphenol dimer with 11 variable dihedral angles. This illustrates the capabilities of the method, which are primarily limited by the duration of DFT calculations. In the case of metal complexes, they have only recently become within reach of DFT, which opens new possibilities...

Data mining for materials design: A computational study of single molecule magnet

Energy Technology Data Exchange (ETDEWEB)

Dam, Hieu Chi [Japan Advanced Institute of Science and Technology, 1-1 Asahidai, Nomi, Ishikawa 923-1292 (Japan); Faculty of Physics, Vietnam National University, 334 Nguyen Trai, Hanoi (Viet Nam); Pham, Tien Lam; Ho, Tu Bao [Japan Advanced Institute of Science and Technology, 1-1 Asahidai, Nomi, Ishikawa 923-1292 (Japan); Nguyen, Anh Tuan [Faculty of Physics, Vietnam National University, 334 Nguyen Trai, Hanoi (Viet Nam); Nguyen, Viet Cuong [HPC Systems, Inc., 3-9-15 Kaigan, Minato-ku, Tokyo 108-0022 (Japan)

2014-01-28

We develop a method that combines data mining and first principles calculation to guide the designing of distorted cubane Mn{sup 4+} Mn {sub 3}{sup 3+} single molecule magnets. The essential idea of the method is a process consisting of sparse regressions and cross-validation for analyzing calculated data of the materials. The method allows us to demonstrate that the exchange coupling between Mn{sup 4+} and Mn{sup 3+} ions can be predicted from the electronegativities of constituent ligands and the structural features of the molecule by a linear regression model with high accuracy. The relations between the structural features and magnetic properties of the materials are quantitatively and consistently evaluated and presented by a graph. We also discuss the properties of the materials and guide the material design basing on the obtained results.

Amino Acid-Assisted Incorporation of Dye Molecules within Calcite Crystals.

Science.gov (United States)

Marzec, Bartosz; Green, David C; Holden, Mark A; Coté, Alexander S; Ihli, Johannes; Khalid, Saba; Kulak, Alexander; Walker, Daniel; Tang, Chiu; Duffy, Dorothy M; Kim, Yi-Yeoun; Meldrum, Fiona C

2018-05-23

Biomineralisation processes invariably occur in the presence of multiple organic additives, which act in combination to give exceptional control over structures and properties. However, few synthetic studies have investigated the cooperative effects of soluble additives. This work addresses this challenge and focuses on the combined effects of amino acids and coloured dye molecules. The experiments demonstrate that strongly coloured calcite crystals only form in the presence of Brilliant Blue R (BBR) and four of the seventeen soluble amino acids, as compared with almost colourless crystals using the dye alone. The active amino acids are identified as those which themselves effectively occlude in calcite, suggesting a mechanism where they can act as chaperones for individual molecules or even aggregates of dyes molecules. These results provide new insight into crystal-additive interactions and suggest a novel strategy for generating materials with target properties. © 2018 Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim.

Curvature contributions to the static electrical properties of push-pull molecules

International Nuclear Information System (INIS)

Squitieri, Emilio

2005-01-01

Calculations of the curvature contribution to the diagonals components of the static dipole moment (μ), polarizability (α), first (β) and second (γ) hyperpolarizability of push-pull molecules are presented. This contribution was obtained from the analytical evaluation of electrical properties method using the harmonic zero-point energy. The valence-bond charge-transfer model was employed to obtain the field-dependent force constant and their derivates with respect to electric field. Our results show a relationship between the curvature and electronic contributions. We have also found that the curvature contribution is important in a numerical estimation of β and γ

Hydrogen-Bonded Polymer-Small Molecule Complexes with Tunable Mechanical Properties.

Science.gov (United States)

Liu, Tianqi; Peng, Xin; Chen, Ya-Nan; Bai, Qing-Wen; Shang, Cong; Zhang, Lin; Wang, Huiliang

2018-03-13

A novel type of polymeric material with tunable mechanical properties is fabricated from polymers and small molecules that can form hydrogen-bonded intermolecular complexes (IMCs). In this work, poly(vinyl alcohol) (PVA)-glycerol hydrogels are first prepared, and then they are dried to form IMCs. The tensile strengths and moduli of IMCs decrease dramatically with increasing glycerol content, while the elongations increase gradually. The mechanical properties are comparable with or even superior to those of common engineering plastics and rubbers. The IMCs with high glycerol content also show excellent flexibility and cold-resistance at subzero temperatures. Cyclic tensile and stress relaxation tests prove that there is an effective energy dissipation mechanism in IMCs and dynamic mechanical analysis confirms their physical crosslinking nature. FTIR and NMR characterizations prove the existence of hydrogen bonding between glycerol and PVA chains, which suppresses the crystallization of PVA from X-ray diffraction measurement. These PVA-glycerol IMCs may find potential applications in barrier films, biomedical packaging, etc., in the future. © 2018 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

Crystal structure of the Ig1 domain of the neural cell adhesion molecule NCAM2 displays domain swapping

DEFF Research Database (Denmark)

Rasmussen, Kim Krighaar; Kulahin, Nikolaj; Kristensen, Ole

2008-01-01

The crystal structure of the first immunoglobulin (Ig1) domain of neural cell adhesion molecule 2 (NCAM2/OCAM/RNCAM) is presented at a resolution of 2.7 A. NCAM2 is a member of the immunoglobulin superfamily of cell adhesion molecules (IgCAMs). In the structure, two Ig domains interact by domain...

Valence electronic structure of the indene molecule: Experiment vs. GW calculations

Energy Technology Data Exchange (ETDEWEB)

Umari, P.; Stenuit, G. [CNR-IOM DEMOCRITOS Theory Elettra Group, Basovizza, Trieste (Italy); Castellarin-Cudia, C.; Feyer, V.; Di Santo, G.; Goldoni, A. [Sincrotrone Trieste S.C.p.A., Basovizza, Trieste (Italy); Borghetti, P.; Sangaletti, L. [Dipartimento di Matematica e Fisica, Universita Cattolica del Sacro Cuore, Brescia (Italy)

2011-04-15

We investigate the valence electronic properties in the gas phase of the indene molecule, which is one of the simplest polycyclic aromatic hydrocarbons, with photoemission spectroscopy using synchrotron light and through first-principles calculations using a many-body perturbation theory GW approach. We found an excellent agreement between theory and experiment. This allows us to assign to the peaks appearing in the photoemission spectrum the calculated molecular orbitals. (Copyright copyright 2011 WILEY-VCH Verlag GmbH and Co. KGaA, Weinheim)

Adsorption of xylene para- and meta- isomers in NaX and BaX zeolites. Study of properties-structure relations; Adsorption des isomeres para- et meta- du xylene dans les zeolithes NaX et BaX. Etude des relations proprietes-structure

Energy Technology Data Exchange (ETDEWEB)

Descours, A.

1997-02-14

The separation of para-xylene from C8 aromatics is performed industrially bu adsorption process on zeolitic molecular sieves. The sorption properties of these zeolites are strongly linked to their structure, and their comprehension require an accurate knowledge of the interactions between sorbate molecules and zeolitic structure. The aim of this work is to characterise from a structural point of view the adsorption of para- and meta-xylenes in BaX and NaX zeolites. The former is selective for para-xylene, and the latter has not selective properties for para- and meta-isomers of xylene. For each zeolite, the adsorption of pure para-xylene and meta-xylene or a mixture of the two isomers, is investigated as a function of coverage. Powder neutron diffraction is used to determine the crystalline structure of these zeolites and the different crystallographic adsorption sites of the molecules. The influence of coverage on sorbate-sorbent and sorbate-sorbate interactions is investigated. Infrared spectroscopy allows to determine the chemical environment of the sorbate molecules at low coverage or when the coverage increases, and is particularly effective for the study of the binary mixture of xylenes. This study is performed by sorbing a mixture of xylene isomers, or by sorbing these isomers successively. Infrared studies and crystallographic analysis are compared in order to get a consistent description of adsorption mechanism of xylene isomers for both zeolites as a function of coverage. The role of coverage, of cation type, an the presence of the two xylene isomers is the super-cages is essential. For both zeolites, the increase of coverage actually leads to steric hindrances between sorbed molecules and molecular rearrangements. These reorganizations are connected to the cationic distribution of NaX and BaX zeolites. The sorbed molecules are connected to the cationic distribution of NaX and BaX zeolites. The sorbed molecules are particularly confined in BaX zeolite

Handbook of Single-Molecule Biophysics

CERN Document Server

Hinterdorfer, Peter

2009-01-01

The last decade has seen the development of a number of novel biophysical methods that allow the manipulation and study of individual biomolecules. The ability to monitor biological processes at this fundamental level of sensitivity has given rise to an improved understanding of the underlying molecular mechanisms. Through the removal of ensemble averaging, distributions and fluctuations of molecular properties can be characterized, transient intermediates identified, and catalytic mechanisms elucidated. By applying forces on biomolecules while monitoring their activity, important information can be obtained on how proteins couple function to structure. The Handbook of Single-Molecule Biophysics provides an introduction to these techniques and presents an extensive discussion of the new biological insights obtained from them. Coverage includes: Experimental techniques to monitor and manipulate individual biomolecules The use of single-molecule techniques in super-resolution and functional imaging Single-molec...

Electronic structure of molecules of substituted benzenes by x-ray spectroscopy. I. Nitrobenzene

International Nuclear Information System (INIS)

Yumatov, V.D.; Murakhtanov, V.V.; Salakhutdinov, N.F.; Okotrub, A.V.; Mazalov, L.N.; Logunova, L.G.; Koptyug, V.A.; Furin, G.G.

1988-01-01

The electronic structure of the nitrobenzene molecule has been studied by x-ray spectroscopy with the aid of quantum-chemical calculations. The structure of the molecular orbitals of nitrobenzene has been compared with the structure of benzene and nitrogen dioxide. It has been shown in the framework of a fragment-by-fragment analysis that the interaction of the highest occupied π orbitals of the benzene ring and the nitro group is weak

Structural Design Principle of Small-Molecule Organic Semiconductors for Metal-Free, Visible-Light-Promoted Photocatalysis.

Science.gov (United States)

Wang, Lei; Huang, Wei; Li, Run; Gehrig, Dominik; Blom, Paul W M; Landfester, Katharina; Zhang, Kai A I

2016-08-08

Herein, we report on the structural design principle of small-molecule organic semiconductors as metal-free, pure organic and visible light-active photocatalysts. Two series of electron-donor and acceptor-type organic semiconductor molecules were synthesized to meet crucial requirements, such as 1) absorption range in the visible region, 2) sufficient photoredox potential, and 3) long lifetime of photogenerated excitons. The photocatalytic activity was demonstrated in the intermolecular C-H functionalization of electron-rich heteroaromates with malonate derivatives. A mechanistic study of the light-induced electron transport between the organic photocatalyst, substrate, and the sacrificial agent are described. With their tunable absorption range and defined energy-band structure, the small-molecule organic semiconductors could offer a new class of metal-free and visible light-active photocatalysts for chemical reactions. © 2016 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

Single Molecule Conductance of Oligothiophene Derivatives

Science.gov (United States)

Dell, Emma J.

This thesis studies the electronic properties of small organic molecules based on the thiophene motif. If we are to build next-generation devices, advanced materials must be designed which possess requisite electronic functionality. Molecules present attractive candidates for these ad- vanced materials since nanoscale devices are particularly sought after. However, selecting a molecule that is suited to a certain electronic function remains a challenge, and characterization of electronic behavior is therefore critical. Single molecule conductance measurements are a powerful tool to determine properties on the nanoscale and, as such, can be used to investigate novel building blocks that may fulfill the design requirements of next-generation devices. Combining these conductance results with strategic chemical synthesis allows for the development of new families of molecules that show attractive properties for future electronic devices. Since thiophene rings are the fruitflies of organic semiconductors on the bulk scale, they present an intriguing starting point for building functional materials on the nanoscale, and therefore form the structural basis of all molecules studied herein. First, the single-molecule conductance of a family of bithiophene derivatives was measured. A broad distribution in the single-molecule conductance of bithiophene was found compared with that of a biphenyl. This increased breadth in the conductance distribution was shown to be explained by the difference in 5-fold symmetry of thiophene rings as compared to the 6-fold symmetry of benzene rings. The reduced symmetry of thiophene rings results in a restriction on the torsion angle space available to these molecules when bound between two metal electrodes in a junction, causing each molecular junction to sample a different set of conformers in the conductance measurements. By contrast, the rotations of biphenyl are essentially unimpeded by junction binding, allowing each molecular junction

NMR structure calculation for all small molecule ligands and non-standard residues from the PDB Chemical Component Dictionary

Energy Technology Data Exchange (ETDEWEB)

Yilmaz, Emel Maden; Güntert, Peter, E-mail: guentert@em.uni-frankfurt.de [Goethe University Frankfurt am Main, Center for Biomolecular Magnetic Resonance, Institute of Biophysical Chemistry (Germany)

2015-09-15

An algorithm, CYLIB, is presented for converting molecular topology descriptions from the PDB Chemical Component Dictionary into CYANA residue library entries. The CYANA structure calculation algorithm uses torsion angle molecular dynamics for the efficient computation of three-dimensional structures from NMR-derived restraints. For this, the molecules have to be represented in torsion angle space with rotations around covalent single bonds as the only degrees of freedom. The molecule must be given a tree structure of torsion angles connecting rigid units composed of one or several atoms with fixed relative positions. Setting up CYANA residue library entries therefore involves, besides straightforward format conversion, the non-trivial step of defining a suitable tree structure of torsion angles, and to re-order the atoms in a way that is compatible with this tree structure. This can be done manually for small numbers of ligands but the process is time-consuming and error-prone. An automated method is necessary in order to handle the large number of different potential ligand molecules to be studied in drug design projects. Here, we present an algorithm for this purpose, and show that CYANA structure calculations can be performed with almost all small molecule ligands and non-standard amino acid residues in the PDB Chemical Component Dictionary.

Single molecule tools for enzymology, structural biology, systems biology and nanotechnology: an update

Science.gov (United States)

Widom, Julia R.; Dhakal, Soma; Heinicke, Laurie A.; Walter, Nils G.

2015-01-01

Toxicology is the highly interdisciplinary field studying the adverse effects of chemicals on living organisms. It requires sensitive tools to detect such effects. After their initial implementation during the 1990s, single-molecule fluorescence detection tools were quickly recognized for their potential to contribute greatly to many different areas of scientific inquiry. In the intervening time, technical advances in the field have generated ever-improving spatial and temporal resolution, and have enabled the application of single-molecule fluorescence to increasingly complex systems, such as live cells. In this review, we give an overview of the optical components necessary to implement the most common versions of single-molecule fluorescence detection. We then discuss current applications to enzymology and structural studies, systems biology, and nanotechnology, presenting the technical considerations that are unique to each area of study, along with noteworthy recent results. We also highlight future directions that have the potential to revolutionize these areas of study by further exploiting the capabilities of single-molecule fluorescence microscopy. PMID:25212907

The Molecule Cloud - compact visualization of large collections of molecules

Directory of Open Access Journals (Sweden)

Ertl Peter

2012-07-01

Full Text Available Abstract Background Analysis and visualization of large collections of molecules is one of the most frequent challenges cheminformatics experts in pharmaceutical industry are facing. Various sophisticated methods are available to perform this task, including clustering, dimensionality reduction or scaffold frequency analysis. In any case, however, viewing and analyzing large tables with molecular structures is necessary. We present a new visualization technique, providing basic information about the composition of molecular data sets at a single glance. Summary A method is presented here allowing visual representation of the most common structural features of chemical databases in a form of a cloud diagram. The frequency of molecules containing particular substructure is indicated by the size of respective structural image. The method is useful to quickly perceive the most prominent structural features present in the data set. This approach was inspired by popular word cloud diagrams that are used to visualize textual information in a compact form. Therefore we call this approach “Molecule Cloud”. The method also supports visualization of additional information, for example biological activity of molecules containing this scaffold or the protein target class typical for particular scaffolds, by color coding. Detailed description of the algorithm is provided, allowing easy implementation of the method by any cheminformatics toolkit. The layout algorithm is available as open source Java code. Conclusions Visualization of large molecular data sets using the Molecule Cloud approach allows scientists to get information about the composition of molecular databases and their most frequent structural features easily. The method may be used in the areas where analysis of large molecular collections is needed, for example processing of high throughput screening results, virtual screening or compound purchasing. Several example visualizations of large

Difficulties in applying pure Kohn-Sham density functional theory electronic structure methods to protein molecules

Science.gov (United States)

Rudberg, Elias

2012-02-01

Self-consistency-based Kohn-Sham density functional theory (KS-DFT) electronic structure calculations with Gaussian basis sets are reported for a set of 17 protein-like molecules with geometries obtained from the Protein Data Bank. It is found that in many cases such calculations do not converge due to vanishing HOMO-LUMO gaps. A sequence of polyproline I helix molecules is also studied and it is found that self-consistency calculations using pure functionals fail to converge for helices longer than six proline units. Since the computed gap is strongly correlated to the fraction of Hartree-Fock exchange, test calculations using both pure and hybrid density functionals are reported. The tested methods include the pure functionals BLYP, PBE and LDA, as well as Hartree-Fock and the hybrid functionals BHandHLYP, B3LYP and PBE0. The effect of including solvent molecules in the calculations is studied, and it is found that the inclusion of explicit solvent molecules around the protein fragment in many cases gives a larger gap, but that convergence problems due to vanishing gaps still occur in calculations with pure functionals. In order to achieve converged results, some modeling of the charge distribution of solvent water molecules outside the electronic structure calculation is needed. Representing solvent water molecules by a simple point charge distribution is found to give non-vanishing HOMO-LUMO gaps for the tested protein-like systems also for pure functionals.

Difficulties in applying pure Kohn-Sham density functional theory electronic structure methods to protein molecules

International Nuclear Information System (INIS)

Rudberg, Elias

2012-01-01

Self-consistency-based Kohn-Sham density functional theory (KS-DFT) electronic structure calculations with Gaussian basis sets are reported for a set of 17 protein-like molecules with geometries obtained from the Protein Data Bank. It is found that in many cases such calculations do not converge due to vanishing HOMO-LUMO gaps. A sequence of polyproline I helix molecules is also studied and it is found that self-consistency calculations using pure functionals fail to converge for helices longer than six proline units. Since the computed gap is strongly correlated to the fraction of Hartree-Fock exchange, test calculations using both pure and hybrid density functionals are reported. The tested methods include the pure functionals BLYP, PBE and LDA, as well as Hartree-Fock and the hybrid functionals BHandHLYP, B3LYP and PBE0. The effect of including solvent molecules in the calculations is studied, and it is found that the inclusion of explicit solvent molecules around the protein fragment in many cases gives a larger gap, but that convergence problems due to vanishing gaps still occur in calculations with pure functionals. In order to achieve converged results, some modeling of the charge distribution of solvent water molecules outside the electronic structure calculation is needed. Representing solvent water molecules by a simple point charge distribution is found to give non-vanishing HOMO-LUMO gaps for the tested protein-like systems also for pure functionals. (fast track communication)

Detecting and characterizing N-acyl-homoserine lactone signal molecules by thin-layer chromatography

Science.gov (United States)

Shaw, Paul D.; Ping, Gao; Daly, Sean L.; Cha, Chung; Cronan, John E.; Rinehart, Kenneth L.; Farrand, Stephen K.

1997-01-01

Many Gram-negative bacteria regulate gene expression in response to their population size by sensing the level of acyl-homoserine lactone signal molecules which they produce and liberate to the environment. We have developed an assay for these signals that couples separation by thin-layer chromatography with detection using Agrobacterium tumefaciens harboring lacZ fused to a gene that is regulated by autoinduction. With the exception of N-butanoyl-l-homoserine lactone, the reporter detected acyl-homoserine lactones with 3-oxo-, 3-hydroxy-, and 3-unsubstituted side chains of all lengths tested. The intensity of the response was proportional to the amount of the signal molecule chromatographed. Each of the 3-oxo- and the 3-unsubstituted derivatives migrated with a unique mobility. Using the assay, we showed that some bacteria produce as many as five detectable signal molecules. Structures could be assigned tentatively on the basis of mobility and spot shape. The dominant species produced by Pseudomonas syringae pv. tabaci chromatographed with the properties of N-(3-oxohexanoyl)-l-homoserine lactone, a structure that was confirmed by mass spectrometry. An isolate of Pseudomonas fluorescens produced five detectable species, three of which had novel chromatographic properties. These were identified as the 3-hydroxy- forms of N-hexanoyl-, N-octanoyl-, and N-decanoyl-l-homoserine lactone. The assay can be used to screen cultures of bacteria for acyl-homoserine lactones, for quantifying the amounts of these molecules produced, and as an analytical and preparative aid in determining the structures of these signal molecules. PMID:9177164

Fine structure and optical properties of biological polarizers in crustaceans and cephalopods

Science.gov (United States)

Chiou, Tsyr-Huei; Caldwell, Roy L.; Hanlon, Roger T.; Cronin, Thomas W.

2008-04-01

The lighting of the underwater environment is constantly changing due to attenuation by water, scattering by suspended particles, as well as the refraction and reflection caused by the surface waves. These factors pose a great challenge for marine animals which communicate through visual signals, especially those based on color. To escape this problem, certain cephalopod mollusks and stomatopod crustaceans utilize the polarization properties of light. While the mechanisms behind the polarization vision of these two animal groups are similar, several distinctive types of polarizers (i.e. the structure producing the signal) have been found in these animals. To gain a better knowledge of how these polarizers function, we studied the relationships between fine structures and optical properties of four types of polarizers found in cephalopods and stomatopods. Although all the polarizers share a somewhat similar spectral range, around 450- 550 nm, the reflectance properties of the signals and the mechanisms used to produce them have dramatic differences. In cephalopods, stack-plates polarizers produce the polarization patterns found on the arms and around their eyes. In stomatopods, we have found one type of beam-splitting polarizer based on photonic structures and two absorptive polarizer types based on dichroic molecules. These stomatopod polarizers may be found on various appendages, and on the cuticle covering dorsal or lateral sides of the animal. Since the efficiencies of all these polarizer types are somewhat sensitive to the change of illumination and viewing angle, how these animals compensate with different behaviors or fine structural features of the polarizer also varies.

Structural flexibility of the sulfur mustard molecule at finite temperature from Car-Parrinello molecular dynamics simulations.

Science.gov (United States)

Lach, Joanna; Goclon, Jakub; Rodziewicz, Pawel

2016-04-05

Sulfur mustard (SM) is one of the most dangerous chemical compounds used against humans, mostly at war conditions but also in terrorist attacks. Even though the sulfur mustard has been synthesized over a hundred years ago, some of its molecular properties are not yet resolved. We investigate the structural flexibility of the SM molecule in the gas phase by Car-Parrinello molecular dynamics simulations. Thorough conformation analysis of 81 different SM configurations using density functional theory is performed to analyze the behavior of the system at finite temperature. The conformational diversity is analyzed with respect to the formation of intramolecular blue-shifting CH⋯S and CH⋯Cl hydrogen bonds. Molecular dynamics simulations indicate that all structural rearrangements between SM local minima are realized either in direct or non-direct way, including the intermediate structure in the last case. We study the lifetime of the SM conformers and perform the population analysis. Additionally, we provide the anharmonic dynamical finite temperature IR spectrum from the Fourier Transform of the dipole moment autocorrelation function to mimic the missing experimental IR spectrum. Copyright © 2015 Elsevier B.V. All rights reserved.

Chemical wiring and soldering toward all-molecule electronic circuitry.

Science.gov (United States)

Okawa, Yuji; Mandal, Swapan K; Hu, Chunping; Tateyama, Yoshitaka; Goedecker, Stefan; Tsukamoto, Shigeru; Hasegawa, Tsuyoshi; Gimzewski, James K; Aono, Masakazu

2011-06-01

Key to single-molecule electronics is connecting functional molecules to each other using conductive nanowires. This involves two issues: how to create conductive nanowires at designated positions, and how to ensure chemical bonding between the nanowires and functional molecules. Here, we present a novel method that solves both issues. Relevant functional molecules are placed on a self-assembled monolayer of diacetylene compound. A probe tip of a scanning tunneling microscope is then positioned on the molecular row of the diacetylene compound to which the functional molecule is adsorbed, and a conductive polydiacetylene nanowire is fabricated by initiating chain polymerization by stimulation with the tip. Since the front edge of chain polymerization necessarily has a reactive chemical species, the created polymer nanowire forms chemical bonding with an encountered molecular element. We name this spontaneous reaction "chemical soldering". First-principles theoretical calculations are used to investigate the structures and electronic properties of the connection. We demonstrate that two conductive polymer nanowires are connected to a single phthalocyanine molecule. A resonant tunneling diode formed by this method is discussed. © 2011 American Chemical Society

Structures and Spectroscopic Properties of F-(H2O) n with n = 1-10 Clusters from a Global Search Based On Density Functional Theory.

Science.gov (United States)

Shi, Ruili; Wang, Pengju; Tang, Lingli; Huang, Xiaoming; Chen, Yonggang; Su, Yan; Zhao, Jijun

2018-04-05

Using a genetic algorithm incorporated in density functional theory, we explore the ground state structures of fluoride anion-water clusters F - (H 2 O) n with n = 1-10. The F - (H 2 O) n clusters prefer structures in which the F - anion remains at the surface of the structure and coordinates with four water molecules, as the F - (H 2 O) n clusters have strong F - -H 2 O interactions as well as strong hydrogen bonds between H 2 O molecules. The strong interaction between the F - anion and adjacent H 2 O molecule leads to a longer O-H distance in the adjacent molecule than in an individual water molecule. The simulated infrared (IR) spectra of the F - (H 2 O) 1-5 clusters obtained via second-order vibrational perturbation theory (VPT2) and including anharmonic effects reproduce the experimental results quite well. The strong interaction between the F - anion and water molecules results in a large redshift (600-2300 cm -1 ) of the adjacent O-H stretching mode. Natural bond orbital (NBO) analysis of the lowest-energy structures of the F - (H 2 O) 1-10 clusters illustrates that charge transfer from the lone pair electron orbital of F - to the antibonding orbital of the adjacent O-H is mainly responsible for the strong interaction between the F - anion and water molecules, which leads to distinctly different geometric and vibrational properties compared with neutral water clusters.

In situ STM imaging of the structures of pentacene molecules adsorbed on Au(111).

Science.gov (United States)

Pong, Ifan; Yau, Shuehlin; Huang, Peng-Yi; Chen, Ming-Chou; Hu, Tarng-Shiang; Yang, Yawchia; Lee, Yuh-Lang

2009-09-01

In situ scanning tunneling microscope (STM) was used to examine the spatial structures of pentacene molecules adsorbed onto a Au(111) single-crystal electrode from a benzene dosing solution containing 16-400 microM pentacene. Molecular-resolution STM imaging conducted in 0.1 M HClO(4) revealed highly ordered pentacene structures of ( radical31 x radical31)R8.9 degrees , (3 x 10), ( radical31 x 10), and ( radical7 x 2 radical7)R19.1 degrees adsorbed on the reconstructed Au(111) electrode dosed with different pentacene solutions. These pentacene structures and the reconstructed Au(111) substrate were stable between 0.2 and 0.8 V [vs reversible hydrogen electrode, RHE]. Increasing the potential to E > 0.8 V lifted the reconstructed Au(111) surface and disrupted the ordered pentacene adlattices simultaneously. Ordered pentacene structures could be restored by applying potentials negative enough to reinforce the reconstructed Au(111). At potentials negative of 0.2 V, the adsorption of protons became increasingly important to displace adsorbed pentacene admolecules. Although the reconstructed Au(111) structure was not essential to produce ordered pentacene adlayers, it seemed to help the adsorption of pentacene molecules in a long-range ordered pattern. At room temperature (25 degrees C), approximately 100 pentacene molecules seen in STM images could rotate and align themselves to a neighboring domain in 10 s, suggesting that pentacene admolecules could be mobile on Au(111) under the STM imaging conditions of -150 mV in bias voltage and 1 nA in feedback current.

Synthesis, electrochemistry, STM investigation of oligothiophene self-assemblies with superior structural order and electronic properties

Energy Technology Data Exchange (ETDEWEB)

Kuo, Cheng-Yu [C-PCS, Chemistry Division, Los Alamos National Laboratory, Los Alamos, NM 87545 (United States); Liu, Yinghao; Yarotski, Dmitry [Center of Integrated Nanotechnologies, Materials Physics and Application Division, Los Alamos National Laboratory, Los Alamos, NM 87545 (United States); Li, Hao [Theory Division, Los Alamos National Laboratory, Los Alamos, NM 87545 (United States); Xu, Ping; Yen, Hung-Ju [C-PCS, Chemistry Division, Los Alamos National Laboratory, Los Alamos, NM 87545 (United States); Tretiak, Sergei, E-mail: serg@lanl.gov [Theory Division, Los Alamos National Laboratory, Los Alamos, NM 87545 (United States); Wang, Hsing-Lin, E-mail: hwang@lanl.gov [C-PCS, Chemistry Division, Los Alamos National Laboratory, Los Alamos, NM 87545 (United States)

2016-12-20

Graphical abstract: STM imaging reveals differently oriented domains of self-assembled tetrathiophene molecules. - Highlights: • Optical and redox properties of oligothiophene derivatives are studied. • Packing pattern of self-assembly monolayer depends on the conjugation length. • Strong electronic coupling and three redox couples in cyclic voltamogram are observed in the hierarchical self-assembly. - Abstract: Three oligothiophene (terthiophene, tetrathiophene and pentathiophene) derivatives are synthesized and their monolayer self-assemblies on gold (Au) are prepared via Au–S covalent bond. Our UV–Vis experimental characterization of solution reveals the dependence of the optical properties on the conjugation length of the oligothiophenes, which compares well with Time-Dependent Density Functional Theory (TDDFT) simulations of spectra of individual chromophores. Photoluminescent spectra of thin films show pronounced red shifts compared to that of solutions, suggesting strong inter-oligomer interactions. The comparative studies of cyclic voltammograms of tetrathiophene from solution, cast film and self-assembled monolayer (SAM) indicate presence of one, two, and three oxidized species in these samples, respectively, suggesting a very strong electronic coupling between tetrathiophene molecules in the SAM. Scanning tunneling microscopy (STM) imaging of SAMs of the tetrathiophene on an atomically flat Au surface exhibits formation of monolayer assemblies with molecular order, and the molecular packing appears to show an overlay of oligothiophene molecules on top of another one. In contrast, the trimer and pentamer images show only aggregated species lacking long-range order on the molecular level. Such trends in going from disordered–ordered–disordered monolayer assemblies are mainly due to a delicate balance between inter-chromophore π–π couplings, hydrophobic interaction and the propensity to form Au–S covalent bond. Such hypothesis has been

Formation of clusters composed of C60 molecules via self-assembly in critical fluids

International Nuclear Information System (INIS)

Fukuda, Takahiro; Ishii, Koji; Kurosu, Shunji; Whitby, Raymond; Maekawa, Toru

2007-01-01

Fullerenes are promising candidates for intelligent, functional nanomaterials because of their unique mechanical, electronic and chemical properties. However, it is necessary to invent some efficient but relatively simple methods of producing structures composed of fullerenes for the development of nanomechatronic, nanoelectronic and biochemical devices and sensors. In this paper, we show that various structures such as straight fibres, networks formed by fibres, wide sheets and helical structures, which are composed of C 60 molecules, are created by placing C 60 -crystals in critical ethane, carbon dioxide and xenon even though C 60 molecules do not dissolve or disperse in the above fluids. It is supposed, judging by the intermolecular potentials between C 60 and C 60 , between C 60 and ethane, and between ethane and ethane, that C 60 -clusters grow with the assistance of solvent molecules, which are trapped between C 60 molecules under critical conditions. This room-temperature self-assembly cluster growth process in critical fluids may open up a new methodology of forming structures built up with fullerenes without the need for any ultra-fine processing technologies

Structure, processing, and properties of potatoes

Science.gov (United States)

Lloyd, Isabel K.; Kolos, Kimberly R.; Menegaux, Edmond C.; Luo, Huy; McCuen, Richard H.; Regan, Thomas M.

1992-06-01

The objective of this experiment and lesson intended for high school students in an engineering or materials science course or college freshmen is to demonstrate the relation between processing, structure, and thermodynamic and physical properties. The specific objectives are to show the effect of structure and structural changes on thermodynamic properties (specific heat) and physical properties (compressive strength); to illustrate the first law of thermodynamics; to compare boiling a potato in water with cooking it in a microwave in terms of the rate of structural change and the energy consumed to 'process' the potato; and to demonstrate compression testing.

Structure, processing, and properties of potatoes

Science.gov (United States)

Lloyd, Isabel K.; Kolos, Kimberly R.; Menegaux, Edmond C.; Luo, Huy; Mccuen, Richard H.; Regan, Thomas M.

1992-01-01

The objective of this experiment and lesson intended for high school students in an engineering or materials science course or college freshmen is to demonstrate the relation between processing, structure, and thermodynamic and physical properties. The specific objectives are to show the effect of structure and structural changes on thermodynamic properties (specific heat) and physical properties (compressive strength); to illustrate the first law of thermodynamics; to compare boiling a potato in water with cooking it in a microwave in terms of the rate of structural change and the energy consumed to 'process' the potato; and to demonstrate compression testing.

The ''GAPHYOR'' system: A computerized retrieval system of the properties of atoms, molecules, gases and plasmas

International Nuclear Information System (INIS)

Delcroix, J.L.

1977-08-01

GAPHYOR (GAz PHYsique ORsay) is a retrieval system of the simple properties of atoms and molecules (energy levels, lifetimes, dipole moments, polarizability etc.), of the interaction properties between these particles (cross-sections, reaction rates etc.) and of the macroscopic properties of the corresponding gases (viscosity, electronic and ion mobility, thermodynamic functions etc.). The chemical systems described must be based on a small number of elements (1 to 4 in the most recent version) and composed of molecules having 8 atoms at the most. In the present article the fundamental principles of GAPHYOR are described and by means of a few simple statistics the present state of the bank after five years of operation is analysed. On 1.11.76 the file contained more than 33,000 lines, and these increase by about 10,000 per year. The information comes from about 300 periodicals, although 45% of the results are taken from 4 principal journals. Geographical analysis of the file provides useful information about the scientific work of the various research centres and the scientific publishing policies of the different countries. Finally, the qualities, difficulties and possible improvements of GAPHYOR are analysed

Cleavage and Cell Adhesion Properties of Human Epithelial Cell Adhesion Molecule (HEPCAM)*

Science.gov (United States)

Tsaktanis, Thanos; Kremling, Heidi; Pavšič, Miha; von Stackelberg, Ricarda; Mack, Brigitte; Fukumori, Akio; Steiner, Harald; Vielmuth, Franziska; Spindler, Volker; Huang, Zhe; Jakubowski, Jasmine; Stoecklein, Nikolas H.; Luxenburger, Elke; Lauber, Kirsten; Lenarčič, Brigita; Gires, Olivier

2015-01-01

Human epithelial cell adhesion molecule (HEPCAM) is a tumor-associated antigen frequently expressed in carcinomas, which promotes proliferation after regulated intramembrane proteolysis. Here, we describe extracellular shedding of HEPCAM at two α-sites through a disintegrin and metalloprotease (ADAM) and at one β-site through BACE1. Transmembrane cleavage by γ-secretase occurs at three γ-sites to generate extracellular Aβ-like fragments and at two ϵ-sites to release human EPCAM intracellular domain HEPICD, which is efficiently degraded by the proteasome. Mapping of cleavage sites onto three-dimensional structures of HEPEX cis-dimer predicted conditional availability of α- and β-sites. Endocytosis of HEPCAM warrants acidification in cytoplasmic vesicles to dissociate protein cis-dimers required for cleavage by BACE1 at low pH values. Intramembrane cleavage sites are accessible and not part of the structurally important transmembrane helix dimer crossing region. Surprisingly, neither chemical inhibition of cleavage nor cellular knock-out of HEPCAM using CRISPR-Cas9 technology impacted the adhesion of carcinoma cell lines. Hence, a direct function of HEPCAM as an adhesion molecule in carcinoma cells is not supported and appears to be questionable. PMID:26292218

Layers of Cold Dipolar Molecules in the Harmonic Approximation

DEFF Research Database (Denmark)

R. Armstrong, J.; Zinner, Nikolaj Thomas; V. Fedorov, D.

2012-01-01

We consider the N-body problem in a layered geometry containing cold polar molecules with dipole moments that are polarized perpendicular to the layers. A harmonic approximation is used to simplify the hamiltonian and bound state properties of the two-body inter-layer dipolar potential are used...... to adjust this effective interaction. To model the intra-layer repulsion of the polar molecules, we introduce a repulsive inter-molecule potential that can be parametrically varied. Single chains containing one molecule in each layer, as well as multi-chain structures in many layers are discussed...... and their energies and radii determined. We extract the normal modes of the various systems as measures of their volatility and eventually of instability, and compare our findings to the excitations in crystals. We find modes that can be classified as either chains vibrating in phase or as layers vibrating against...

Comparative study of electronic and magnetic properties of Pc ( = Fe, Co) molecules physisorbed on 2D MoS and graphene

KAUST Repository

Haldar, Soumyajyoti

2017-09-13

In this paper, we have done a comparative study of electronic and magnetic properties of iron phthalocyanine (FePc) and cobalt phthalocyanine (CoPc) molecules physisorbed on monolayer of MoS$_2$ and graphene by using density functional theory. Various different types of physisorption sites have been considered for both surfaces. Our calculations reveal that the $M$Pc molecules prefer the S-top position on MoS$_2$. However, on graphene, FePc molecule prefers the bridge position while CoPc molecule prefers the top position. The $M$Pc molecules are physisorbed strongly on the MoS$_2$ surface than the graphene ($\\\\sim$ 2.5 eV higher physisorption energy). Analysis of magnetic properties indicates the presence of strong spin dipole moment opposite to the spin moment and hence a huge reduction of effective spin moment can be observed. Our calculations of magnetic anisotropy energies using both variational approach and $2^{nd}$ order perturbation approach indicate no significant changes after physisorption. In case of FePc, an out-of-plane easy axis and in case of CoPc, an in-plane easy axis can be seen. Calculations of work function indicate a reduction of MoS$_2$ work function $\\\\sim$ 1 eV due to physisorption of $M$Pc molecules while it does not change significantly in case of graphene.

Laser spectroscopic and theoretical studies of the structures and encapsulation motifs of functional molecules

Energy Technology Data Exchange (ETDEWEB)

Ebata, Takayuki; Kusaka, Ryoji [Department of Chemistry, Graduate School of Science, Hiroshima University, Kagamiyama 1-3-1, Higashi-Hiroshima, 739-8526 (Japan); Xantheas, Sotiris S. [Chemical and Materials Sciences Division, Pacific Northwest National Laboratory, 902 Battelle Boulevard, P.O. Box 999, MS K1-83, Richland, WA 99352 (United States)

2015-01-22

Extensive laser spectroscopic and theoretical studies have been recently carried out with the aim to reveal the structure and dynamics of encapsulation complexes in the gas phase. The characteristics of the encapsulation complexes are governed by the fact that (i) most of the host molecules are flexible and (ii) the complexes form high dimensional structures by using weak non-covalent interactions. These characteristics result in the possibility of the coexistence of many conformers in close energetic proximity. The combination of supersonic jet/laser spectroscopy and high level quantum chemical calculations is essential in tackling these challenging problems. In this report we describe our recent studies on the structures and dynamics of the encapsulation complexes formed by calix[4]arene (C4A), dibenzo-18-crown-6-ether (DB18C6), and benzo-18-crown-6-ether (B18C6) 'hosts' interacting with N{sub 2}, acetylene, water, and ammonia 'guest' molecules. The gaseous host-guest complexes are generated under jet-cooled conditions. We apply various laser spectroscopic methods to obtain the conformer- and isomer-specified electronic and IR spectra. The experimental results are complemented with quantum chemical calculations ranging from density functional theory to high level first principles calculations at the MP2 and CCSD(T) levels of theory. We discuss the possible conformations of the bare host molecules, the structural changes they undergo upon complexation, and the key interactions that are responsible in stabilizing the specific complexes.

Structure, reactivity and electronic properties of Mn doped Ni13 clusters

International Nuclear Information System (INIS)

Banerjee, Radhashyam; Datta, Soumendu; Mookerjee, Abhijit

2013-01-01

In this work we have studied the structural and magnetic properties of Ni 13 cluster mono- and bi-doped with Mn atoms. We have noted their tendency of being reactive toward the H 2 molecule. We have found unusually enhanced stability in the mono-doped cluster (i.e. of the Ni 12 Mn) and the diminished stability of the corresponding chemisorbed cluster, Ni 12 MnH 2 . Our analysis of the stability and HOMO–LUMO gap explains this unusual behavior. Interestingly, we have also seen the quenching in the net magnetic moment upon H 2 absorption in the doped Ni 13−m Mn m alloy clusters. This has been reported earlier for smaller Ni n clusters [1

Structure, reactivity and electronic properties of Mn doped Ni13 clusters

Science.gov (United States)

Banerjee, Radhashyam; Datta, Soumendu; Mookerjee, Abhijit

2013-06-01

In this work we have studied the structural and magnetic properties of Ni13 cluster mono- and bi-doped with Mn atoms. We have noted their tendency of being reactive toward the H2 molecule. We have found unusually enhanced stability in the mono-doped cluster (i.e. of the Ni12Mn) and the diminished stability of the corresponding chemisorbed cluster, Ni12MnH2. Our analysis of the stability and HOMO-LUMO gap explains this unusual behavior. Interestingly, we have also seen the quenching in the net magnetic moment upon H2 absorption in the doped NiMnm alloy clusters. This has been reported earlier for smaller Nin clusters [1].

Dynamic covalent gels assembled from small molecules:from discrete gelators to dynamic covalent polymers

Institute of Scientific and Technical Information of China (English)

Jian-Yong Zhang; Li-Hua Zeng; Juan Feng

2017-01-01

Dynamic covalent chemistry has emerged recently to be a powerful tool to construct functional materials.This article reviews the progress in the research and development of dynamic covalent chemistry in gels assembled from small molecules.First dynamic covalent reactions used in gels are reviewed to understand the dynamic covalent bonding.Afterwards the catalogues of dynamic covalent gels are reviewed according to the nature of gelators and the interactions between gelators.Dynamic covalent bonding can be involved to form low molecular weight gelators.Low molecular weight molecules with multiple functional groups react to form dynamic covalent cross-linked polymers and act as gelators.Two catalogues of gels show different properties arising from their different structures.This review aims to illustrate the structure-property relationships of these dynamic covalent gels.

Hydration effect on the electronic transport properties of oligomeric phenylene ethynylene molecular junctions

International Nuclear Information System (INIS)

Zong-Liang, Li; Huai-Zhi, Li; Yong, Ma; Guang-Ping, Zhang; Chuan-Kui, Wang

2010-01-01

A first-principles computational method based on the hybrid density functional theory is developed to simulate the electronic transport properties of oligomeric phenylene ethynylene molecular junctions with H 2 O molecules accumulated in the vicinity as recently reported by Na et al. [Nanotechnology 18 424001 (2007)]. The numerical results show that the hydrogen bonds between the oxygen atoms of the oligomeric phenylene ethynylene molecule and H 2 O molecules result in the localisation of the molecular orbitals and lead to the lower transition peaks. The H 2 O molecular chains accumulated in the vicinity of the molecular junction can not only change the electronic structure of the molecular junctions, but also open additional electronic transport pathways. The obvious influence of H 2 O molecules on the electronic structure of the molecular junction and its electronic transport properties is thus demonstrated. (condensed matter: electronic structure, electrical, magnetic, and optical properties)

Why Do Simple Molecules with "Isolated" Phenyl Rings Emit Visible Light?

Science.gov (United States)

Zhang, Haoke; Zheng, Xiaoyan; Xie, Ni; He, Zikai; Liu, Junkai; Leung, Nelson L C; Niu, Yingli; Huang, Xuhui; Wong, Kam Sing; Kwok, Ryan T K; Sung, Herman H Y; Williams, Ian D; Qin, Anjun; Lam, Jacky W Y; Tang, Ben Zhong

2017-11-15

π-Bonds connected with aromatic rings were generally believed as the standard structures for constructing highly efficient fluorophores. Materials without these typical structures, however, exhibited only low fluorescence quantum yields and emitted in the ultraviolet spectral region. In this work, three molecules, namely bis(2,4,5-trimethylphenyl)methane, 1,1,2,2-tetrakis(2,4,5-trimethylphenyl)ethane, and 1,1,2,2-tetraphenylethane, with nonconjugated structures and isolated phenyl rings were synthesized and their photophysical properties were systematically investigated. Interestingly, the emission spectra of these three molecules could be well extended to 600 nm with high solid-state quantum yields of up to 70%. Experimental and theoretical analyses proved that intramolecular through-space conjugation between the "isolated" phenyl rings played an important role for this abnormal phenomenon.

Halide salts and their structural properties in presence of secondary amine based molecule: A combined experimental and theoretical analysis

Science.gov (United States)

Ghosh, Pritam; Hazra, Abhijit; Ghosh, Meenakshi; Chandra Murmu, Naresh; Banerjee, Priyabrata

2018-04-01

Biologically relevant halide salts and its solution state structural properties are always been significant. In general, exposure of halide salts into polar solution medium results in solvation which in turn separates the cationic and anionic part of the salt. However, the conventional behaviour of salts might alter in presence of any secondary amine based compound, i.e.; moderately strong Lewis acid. In its consequence, to investigate the effect of secondary amine based compound in the salt solution, novel (E)-2-(4-bromobenzylidene)-1-(perfluorophenyl) hydrazine has been synthesized and used as secondary amine source. The secondary amine compound interestingly shows a drastic color change upon exposure to fluoride salts owing to hydrogen bonding interaction. Several experimental methods, e.g.; SCXRD, UV-Vis, FT-IR, ESI-MS and DLS together with modern DFT (i.e.; DFT-D3) have been performed to explore the structural properties of the halide salts upon exposure to secondary amine based compound. The effect of counter cation of the fluoride salt in binding with secondary amine source has also been investigated.

Wide-gap layered oxychalcogenide semiconductors: Materials, electronic structures and optoelectronic properties

International Nuclear Information System (INIS)

Ueda, Kazushige; Hiramatsu, Hidenori; Hirano, Masahiro; Kamiya, Toshio; Hosono, Hideo

2006-01-01

Applying the concept of materials design for transparent conductive oxides to layered oxychalcogenides, several p-type and n-type layered oxychalcogenides were proposed as wide-gap semiconductors and their basic optical and electrical properties were examined. The layered oxychalcogenides are composed of ionic oxide layers and covalent chalcogenide layers, which bring wide-gap and conductive properties to these materials, respectively. The electronic structures of the materials were examined by normal/inverse photoemission spectroscopy and energy band calculations. The results of the examinations suggested that these materials possess unique features more than simple wide-gap semiconductors. Namely, the layered oxychalcogenides are considered to be extremely thin quantum wells composed of the oxide and chalcogenide layers or 2D chalcogenide crystals/molecules embedded in an oxide matrix. Observation of step-like absorption edges, large band gap energy and large exciton binding energy demonstrated these features originating from 2D density of states and quantum size effects in these layered materials

Photophysical properties of novel small acceptor molecules and their application in hybrid small-molecular/polymeric organic solar cells

Energy Technology Data Exchange (ETDEWEB)

Inal, Sahika; Castellani, Mauro; Neher, Dieter [Universitaet Potsdam, Institut fuer Physik und Astronomie, Potsdam-Golm (Germany); Sellinger, Alan [Institute of Materials Research and Engineering, Singapore (Singapore)

2009-07-01

Recent experimental investigations revealed that the photovoltaic properties of our devices are related to the balance between recombination and field-induced dissociation of interfacial excited states such as exciplexes or geminate polaron pairs. This balance was shown to be affected by the nanomorphology at the heterojunction. We have analyzed the photophysical properties of a new materials couple comprising an electron-donating PPV copolymer and a vinazene-based small molecule acceptor. Steady state and time-resolved photoluminescence (PL) spectroscopy in solution and in the solid state showed the formation of excimers within the acceptor. The associated long-range diffusion promise efficient energy harvesting at the heterojunction. On the other hand, blends of the PPV-derivative and the small molecule revealed strong exciplex formation. Therefore, bilayered hybrid small-molecular/polymeric solar cells have been fabricated by consequently spin-coating the macromolecular donor and the small molecule acceptor from two different solvents. The bilayer architecture limits recombination processes enabling high FFs of around 44% and a technologically important open circuit voltage of 1Volt.

Structure and properties of hydrocarbon radical cations in low-temperature matrices as studied by a combination of EPR and IR spectroscopy

International Nuclear Information System (INIS)

Feldman, V.I.

1997-01-01

Use of IR spectroscopy (as a supplement to EPR) may provide new insight into the problem of analysis of structure and properties of organic radical cations. In this work, the results of combined EPR/IR studies of the formation, structure and properties of hydrocarbon radical cations in halocarbon and solid rare gas matrices are discussed. Both IR and EPR studies were carried out with matrix deposited samples irradiated with fast electrons at 15 or 77 K. IR spectroscopic data were found to be helpful in three aspects: (i) characterization of the conformation and association and molecule-matrix interactions of the parent molecules; (ii) identification of diamagnetic products of the reactions of radical cations in ground and excited states; (iii) determining the characteristics of vibrational spectra of the radical cations, which are of primary interest for analysis of chemical bonding and reactivity of the radical cations. The applications of the combined approach are illustrated with examples of studies of several alkenes in Freon matrices and alkanes in solid rare gas matrices. The matrix effects on trapping and degradation of radical cations were interpreted as the result of variations in matrix electronic characteristics (IP, polarizability) and molecule-matrix interactions. (au) 48 refs

OMG: Open Molecule Generator.

Science.gov (United States)

Peironcely, Julio E; Rojas-Chertó, Miguel; Fichera, Davide; Reijmers, Theo; Coulier, Leon; Faulon, Jean-Loup; Hankemeier, Thomas

2012-09-17

Computer Assisted Structure Elucidation has been used for decades to discover the chemical structure of unknown compounds. In this work we introduce the first open source structure generator, Open Molecule Generator (OMG), which for a given elemental composition produces all non-isomorphic chemical structures that match that elemental composition. Furthermore, this structure generator can accept as additional input one or multiple non-overlapping prescribed substructures to drastically reduce the number of possible chemical structures. Being open source allows for customization and future extension of its functionality. OMG relies on a modified version of the Canonical Augmentation Path, which grows intermediate chemical structures by adding bonds and checks that at each step only unique molecules are produced. In order to benchmark the tool, we generated chemical structures for the elemental formulas and substructures of different metabolites and compared the results with a commercially available structure generator. The results obtained, i.e. the number of molecules generated, were identical for elemental compositions having only C, O and H. For elemental compositions containing C, O, H, N, P and S, OMG produces all the chemically valid molecules while the other generator produces more, yet chemically impossible, molecules. The chemical completeness of the OMG results comes at the expense of being slower than the commercial generator. In addition to being open source, OMG clearly showed the added value of constraining the solution space by using multiple prescribed substructures as input. We expect this structure generator to be useful in many fields, but to be especially of great importance for metabolomics, where identifying unknown metabolites is still a major bottleneck.

OMG: Open Molecule Generator

Directory of Open Access Journals (Sweden)

Peironcely Julio E

2012-09-01

Full Text Available Abstract Computer Assisted Structure Elucidation has been used for decades to discover the chemical structure of unknown compounds. In this work we introduce the first open source structure generator, Open Molecule Generator (OMG, which for a given elemental composition produces all non-isomorphic chemical structures that match that elemental composition. Furthermore, this structure generator can accept as additional input one or multiple non-overlapping prescribed substructures to drastically reduce the number of possible chemical structures. Being open source allows for customization and future extension of its functionality. OMG relies on a modified version of the Canonical Augmentation Path, which grows intermediate chemical structures by adding bonds and checks that at each step only unique molecules are produced. In order to benchmark the tool, we generated chemical structures for the elemental formulas and substructures of different metabolites and compared the results with a commercially available structure generator. The results obtained, i.e. the number of molecules generated, were identical for elemental compositions having only C, O and H. For elemental compositions containing C, O, H, N, P and S, OMG produces all the chemically valid molecules while the other generator produces more, yet chemically impossible, molecules. The chemical completeness of the OMG results comes at the expense of being slower than the commercial generator. In addition to being open source, OMG clearly showed the added value of constraining the solution space by using multiple prescribed substructures as input. We expect this structure generator to be useful in many fields, but to be especially of great importance for metabolomics, where identifying unknown metabolites is still a major bottleneck.

Synthesis, crystal structures, and optical properties of the π-π interacting pyrrolo[2,3-b]quinoxaline derivatives containing 2-thienyl substituent

Science.gov (United States)

Goszczycki, Piotr; Stadnicka, Katarzyna; Brela, Mateusz Z.; Grolik, Jarosław; Ostrowska, Katarzyna

2017-10-01

Three (E/Z)-diastereoisomers, based on pyrrolo[2,3-b]quinoxaline system as fluorophore and containing: 2-thienylmethyl (1), bis(2-thienylmethyl)-2-aminoethyl (3a), bis(2-thienylmethyl)-3-aminopropyl (3b) groups as substituents, were synthesized and characterized by X-ray structural analysis, PXRD, NMR, UV-Vis as well as fluorescence. These compounds are non-fluorescent in acetonitrile solution, however, they exhibit aggregation induced emission enhancement (AIEE) upon water addition and in solid state. X-ray structural analysis revealed that molecules with 2-thienylmethyl and bis(2-thienylmethyl)-2-aminoethyl groups form dimers and π-stacks through π-π interactions between anitiparallel oriented pyrroloquinoxaline cores with interplanar distances 3.45 Å and 3.20 Å, respectively. Conformation of bis(2-thienylmethyl)-3-aminopropyl group is imposed by incorporated DMSO-d6 solvent molecule and weak intermolecular S-π and CH-π interactions, that prevents π-π interaction between fluorophore cores. The correlation between crystal structure and fluorescent properties of synthesized molecules was discussed. The DFT calculations were performed to rationalize the differences between considered systems.

GARN2: coarse-grained prediction of 3D structure of large RNA molecules by regret minimization.

Science.gov (United States)

Boudard, Mélanie; Barth, Dominique; Bernauer, Julie; Denise, Alain; Cohen, Johanne

2017-08-15

Predicting the 3D structure of RNA molecules is a key feature towards predicting their functions. Methods which work at atomic or nucleotide level are not suitable for large molecules. In these cases, coarse-grained prediction methods aim to predict a shape which could be refined later by using more precise methods on smaller parts of the molecule. We developed a complete method for sampling 3D RNA structure at a coarse-grained model, taking a secondary structure as input. One of the novelties of our method is that a second step extracts two best possible structures close to the native, from a set of possible structures. Although our method benefits from the first version of GARN, some of the main features on GARN2 are very different. GARN2 is much faster than the previous version and than the well-known methods of the state-of-art. Our experiments show that GARN2 can also provide better structures than the other state-of-the-art methods. GARN2 is written in Java. It is freely distributed and available at http://garn.lri.fr/. melanie.boudard@lri.fr or johanne.cohen@lri.fr. Supplementary data are available at Bioinformatics online. © The Author (2017). Published by Oxford University Press. All rights reserved. For Permissions, please email: journals.permissions@oup.com

Quantitative structure-property relationships for octanol-water partition coefficients of polybrominated diphenyl ethers.

Science.gov (United States)

Li, Linnan; Xie, Shaodong; Cai, Hao; Bai, Xuetao; Xue, Zhao

2008-08-01

Theoretical molecular descriptors were tested against logK(OW) values for polybrominated diphenyl ethers (PBDEs) using the Partial Least-Squares Regression method which can be used to analyze data with many variables and few observations. A quantitative structure-property relationship (QSPR) model was successfully developed with a high cross-validated value (Q(cum)(2)) of 0.961, indicating a good predictive ability and stability of the model. The predictive power of the QSPR model was further cross-validated. The values of logK(OW) for PBDEs are mainly governed by molecular surface area, energy of the lowest unoccupied molecular orbital and the net atomic charges on the oxygen atom. All these descriptors have been discussed to interpret the partitioning mechanism of PBDE chemicals. The bulk property of the molecules represented by molecular surface area is the leading factor, and K(OW) values increase with the increase of molecular surface area. Higher energy of the lowest unoccupied molecular orbital and higher net atomic charge on the oxygen atom of PBDEs result in smaller K(OW). The energy of the lowest unoccupied molecular orbital and the net atomic charge on PBDEs oxygen also play important roles in affecting the partition of PBDEs between octanol and water by influencing the interactions between PBDEs and solvent molecules.

Structural and electronic properties of OsB2 : A hard metallic material

Science.gov (United States)

Chen, Z. Y.; Xiang, H. J.; Yang, Jinlong; Hou, J. G.; Zhu, Qingshi

2006-07-01

We calculate the structural and electronic properties of OsB2 using density functional theory with or without taking into account the spin-orbit (SO) interaction. Our results show that the bulk modulus with and without SO interactions are 364 and 365GPa , respectively, both are in good agreement with experiment (365-395GPa) . The evidence of covalent bonding of Os-B, which plays an important role to form a hard material, is indicated both in charge density, atoms in molecules analysis, and density of states analysis. The good metallicity and hardness of OsB2 might suggest its potential application as hard conductors.

Small molecules make big differences: molecular doping effects on electronic and optical properties of phosphorene

International Nuclear Information System (INIS)

Jing, Yu; Tang, Qing; He, Peng; Zhou, Zhen; Shen, Panwen

2015-01-01

Systematical computations on the density functional theory were performed to investigate the adsorption of three typical organic molecules, tetracyanoquinodimethane (TCNQ), tetracyanoethylene (TCNE) and tetrathiafulvalene (TTF), on the surface of phosphorene monolayers and thicker layers. There exist considerable charge transfer and strong non-covalent interaction between these molecules and phosphorene. In particular, the band gap of phosphorene decreases dramatically due to the molecular modification and can be further tuned by applying an external electric field. Meanwhile, surface molecular modification has proven to be an effective way to enhance the light harvesting of phosphorene in different directions. Our results predict a flexible method toward modulating the electronic and optical properties of phosphorene and shed light on its experimental applications. (paper)

Electron-excited molecule interactions

International Nuclear Information System (INIS)

Christophorou, L.G.; Tennessee Univ., Knoxville, TN

1991-01-01

In this paper the limited but significant knowledge to date on electron scattering from vibrationally/rotationally excited molecules and electron scattering from and electron impact ionization of electronically excited molecules is briefly summarized and discussed. The profound effects of the internal energy content of a molecule on its electron attachment properties are highlighted focusing in particular on electron attachment to vibrationally/rotationally and to electronically excited molecules. The limited knowledge to date on electron-excited molecule interactions clearly shows that the cross sections for certain electron-molecule collision processes can be very different from those involving ground state molecules. For example, optically enhanced electron attachment studies have shown that electron attachment to electronically excited molecules can occur with cross sections 10 6 to 10 7 times larger compared to ground state molecules. The study of electron-excited molecule interactions offers many experimental and theoretical challenges and opportunities and is both of fundamental and technological significance. 54 refs., 15 figs

Structural studies on proton/protonation of the protein molecule

International Nuclear Information System (INIS)

Morimoto, Yukio; Kida, Akiko; Chatake, Toshiyuki; Yamaguchi, Hiroshi; Hosokawa, Keiichi; Murakami, Takuto; Umino, Masaaki; Tanaka, Ichiro; Hisatome, Ichiro; Yanagisawa, Yasutake; Fujiwara, Satoshi; Hidaka, Yuji; Shimamoto, Shigeru; Fujiwara, Mitsutoshi; Nakanishi, Takeyoshi

2015-01-01

This paper reports three studies involved in the analysis of protons and protonation at physiologically active sites in protein molecules. (1) 'Elucidation of the higher-order structure formation and activity performing mechanism of yeast proteasome.' With an aim to apply to anti-cancer drugs, this study performed the shape analysis of the total structure of 26S proteasome using small-angle X-ray scattering to clarify the complex form where controlling elements bonded to the both ends of 20S catalyst body, and analyzed the complex structure between the active sites of 20S and inhibitor (drug). (2) 'Basic study on the neutron experiment of biomolecules such as physiologically active substances derived from Natto-bacteria.' This study conducted the purification, crystallization, and X-ray analysis experiment of nattokinase; high-grade purification and solution experiment of vitamin K2 (menaquinone-7); and Z-DNA crystal structure study related to the neutron crystal analysis of DNA as another biomolecule structure study. (3) 'Functional evaluation on digestive enzymes derived from Nephila clavata.' As an Alzheimer's disease-related amyloid fibril formation model, this study carried out elucidation on the fibrosis and fiber-forming mechanism of the traction fiber of Nephila clavata, and the functional analysis of its degrading enzyme. (A.O.)

Detecting and identifying small molecules in a nanopore flux capacitor

International Nuclear Information System (INIS)

Bearden, Samuel; Zhang, Guigen; McClure, Ethan

2016-01-01

A new method of molecular detection in a metallic-semiconductor nanopore was developed and evaluated with experimental and computational methods. Measurements were made of the charging potential of the electrical double layer (EDL) capacitance as charge-carrying small molecules translocated the nanopore. Signals in the charging potential were found to be correlated to the physical properties of analyte molecules. From the measured signals, we were able to distinguish molecules with different valence charge or similar valence charge but different size. The relative magnitude of the signals from different analytes was consistent over a wide range of experimental conditions, suggesting that the detected signals are likely due to single molecules. Computational modeling of the nanopore system indicated that the double layer potential signal may be described in terms of disruption of the EDL structure due to the size and charge of the analyte molecule, in agreement with Huckel and Debye’s analysis of the electrical atmosphere of electrolyte solutions. (paper)

Covalent lanthanide(III) macrocyclic complexes: the bonding nature and optical properties of a promising single antenna molecule.

Science.gov (United States)

Rabanal-León, Walter A; Páez-Hernández, Dayán; Arratia-Pérez, Ramiro

2014-12-21

The present work is focused on the elucidation of the electronic structure, bonding nature and optical properties of a series of low symmetry (C2) coordination compounds of type [Ln(III)HAM](3+), where "Ln(III)" are the trivalent lanthanide ions: La(3+), Ce(3+), Eu(3+) and Lu(3+), while "HAM" is the neutral six-nitrogen donor macrocyclic ligand [C22N6H26]. This systematic study has been performed in the framework of the Relativistic Density Functional Theory (R-DFT) and also using a multi-reference approach via the Complete Active Space (CAS) wavefunction treatment with the aim of analyzing their ground state and excited state electronic structures as well as electronic correlation. Furthermore, the use of the energy decomposition scheme proposed by Morokuma-Ziegler and the electron localization function (ELF) allows us to characterize the bonding between the lanthanide ions and the macrocyclic ligand, obtaining as a result a dative-covalent interaction. Due to a great deal of lanthanide optical properties and their technological applications, the absorption spectra of this set of coordination compounds were calculated using the time-dependent density functional theory (TD-DFT), where the presence of the intense Ligand to Metal Charge Transfer (LMCT) bands in the ultraviolet and visible region and the inherent f-f electronic transitions in the Near-Infra Red (NIR) region for some lanthanide ions allow us to propose these systems as "single antenna molecules" with potential applications in NIR technologies.

Structure and spectra of a confined HeH molecule

International Nuclear Information System (INIS)

Lo, J M H; Klobukowski, M; Bielinska-Wacz, D; Schreiner, E W S; Diercksen, G H F

2006-01-01

The influence of spatial confinement on the structure and spectra of the Rydberg HeH molecule is analysed at the level of the variational full configuration interaction approach. The confining potential is assumed to have cylindrical symmetry, with the symmetry axis of the potential overlapping with the molecular bond. In the direction perpendicular to the axis quadratic dependence of the potential on the electron coordinates is assumed. The influence of the confining potential on the form of the potential energy curves (in particular on the bond lengths), on the electronic spectra and on the ionization due to the confinement is studied in detail

Computational Study of the Structure and Mechanical Properties of the Molecular Crystal RDX

Science.gov (United States)

2012-11-01

basic equilibrium properties of and transitions to and from the α and γ polymorphs in crystalline RDX based on the SB potential (17). Atomic-level...elastic constants, polymorph transitions , cleavage properties, and energy barriers to slip. The energy barriers to slip are determined through the... RDX molecule containing three R2N-NO2 groups, where each R=CH2; and (c) HMX molecule containing four R2N-NO2 groups with R=CH2

Incorporation of local structure into kriging models for the prediction of atomistic properties in the water decamer.

Science.gov (United States)

Davie, Stuart J; Di Pasquale, Nicodemo; Popelier, Paul L A

2016-10-15

Machine learning algorithms have been demonstrated to predict atomistic properties approaching the accuracy of quantum chemical calculations at significantly less computational cost. Difficulties arise, however, when attempting to apply these techniques to large systems, or systems possessing excessive conformational freedom. In this article, the machine learning method kriging is applied to predict both the intra-atomic and interatomic energies, as well as the electrostatic multipole moments, of the atoms of a water molecule at the center of a 10 water molecule (decamer) cluster. Unlike previous work, where the properties of small water clusters were predicted using a molecular local frame, and where training set inputs (features) were based on atomic index, a variety of feature definitions and coordinate frames are considered here to increase prediction accuracy. It is shown that, for a water molecule at the center of a decamer, no single method of defining features or coordinate schemes is optimal for every property. However, explicitly accounting for the structure of the first solvation shell in the definition of the features of the kriging training set, and centring the coordinate frame on the atom-of-interest will, in general, return better predictions than models that apply the standard methods of feature definition, or a molecular coordinate frame. © 2016 The Authors. Journal of Computational Chemistry Published by Wiley Periodicals, Inc. © 2016 The Authors. Journal of Computational Chemistry Published by Wiley Periodicals, Inc.

Investigation on Single-Molecule Junctions Based on Current–Voltage Characteristics

Directory of Open Access Journals (Sweden)

Yuji Isshiki

2018-02-01

Full Text Available The relationship between the current through an electronic device and the voltage across its terminals is a current–voltage characteristic (I–V that determine basic device performance. Currently, I–V measurement on a single-molecule scale can be performed using break junction technique, where a single molecule junction can be prepared by trapping a single molecule into a nanogap between metal electrodes. The single-molecule I–Vs provide not only the device performance, but also reflect information on energy dispersion of the electronic state and the electron-molecular vibration coupling in the junction. This mini review focuses on recent representative studies on I–Vs of the single molecule junctions that cover investigation on the single-molecule diode property, the molecular vibration, and the electronic structure as a form of transmission probability, and electronic density of states, including the spin state of the single-molecule junctions. In addition, thermoelectronic measurements based on I–Vs and identification of the charged carriers (i.e., electrons or holes are presented. The analysis in the single-molecule I–Vs provides fundamental and essential information for a better understanding of the single-molecule science, and puts the single molecule junction to more practical use in molecular devices.

Ocean acidification affects marine chemical communication by changing structure and function of peptide signalling molecules.

Science.gov (United States)

Roggatz, Christina C; Lorch, Mark; Hardege, Jörg D; Benoit, David M

2016-12-01

Ocean acidification is a global challenge that faces marine organisms in the near future with a predicted rapid drop in pH of up to 0.4 units by the end of this century. Effects of the change in ocean carbon chemistry and pH on the development, growth and fitness of marine animals are well documented. Recent evidence also suggests that a range of chemically mediated behaviours and interactions in marine fish and invertebrates will be affected. Marine animals use chemical cues, for example, to detect predators, for settlement, homing and reproduction. But, while effects of high CO 2 conditions on these behaviours are described across many species, little is known about the underlying mechanisms, particularly in invertebrates. Here, we investigate the direct influence of future oceanic pH conditions on the structure and function of three peptide signalling molecules with an interdisciplinary combination of methods. NMR spectroscopy and quantum chemical calculations were used to assess the direct molecular influence of pH on the peptide cues, and we tested the functionality of the cues in different pH conditions using behavioural bioassays with shore crabs (Carcinus maenas) as a model system. We found that peptide signalling cues are susceptible to protonation in future pH conditions, which will alter their overall charge. We also show that structure and electrostatic properties important for receptor binding differ significantly between the peptide forms present today and the protonated signalling peptides likely to be dominating in future oceans. The bioassays suggest an impaired functionality of the signalling peptides at low pH. Physiological changes due to high CO 2 conditions were found to play a less significant role in influencing the investigated behaviour. From our results, we conclude that the change of charge, structure and consequently function of signalling molecules presents one possible mechanism to explain altered behaviour under future oceanic p

Low-Dimensional Material: Structure-Property Relationship and Applications in Energy and Environmental Engineering

Science.gov (United States)

Xiao, Hang

properties of P2S3 structure can be tuned by stacking into multilayer P2S3 structures, forming P2S3 nanoribbons or rolling into P2S3 nanotubes, expanding its potential applications for the emerging field of 2D electronics. Then we showed that the hydrolysis reaction is strongly affected by relative humidity. The hydrolysis of CO32- with n = 1-8 water molecules was investigated by ab initio method. For n = 1-5 water molecules, all the reactants follow a stepwise pathway to the transition state. For n = 6-8 water molecules, all the reactants undergo a direct proton transfer to the transition state with overall lower activation free energy. The activation free energy of the reaction is dramatically reduced from 10.4 to 2.4 kcal/mol as the number of water molecules increases from 1 to 6. Meanwhile, the degree of the hydrolysis of CO32- is significantly increased compared to the bulk water solution scenario. The incomplete hydration shells facilitate the hydrolysis of CO3 2- with few water molecules to be not only thermodynamically favorable but also kinetically favorable. We showed that the chemical kinetics is not likely to constrain the speed of CO2 air capture driven by the humidity-swing. (Abstract shortened by ProQuest.).

Coherent interaction of single molecules and plasmonic nanowires

Science.gov (United States)

Gerhardt, Ilja; Grotz, Bernhard; Siyushev, Petr; Wrachtrup, Jörg

2017-09-01

Quantum plasmonics opens the option to integrate complex quantum optical circuitry onto chip scale devices. In the past, often external light sources were used and nonclassical light was coupled in and out of plasmonic structures, such as hole arrays or waveguide structures. Another option to launch single plasmonic excitations is the coupling of single emitters in the direct proximity of, e.g., a silver or gold nanostructure. Here, we present our attempts to integrate the research of single emitters with wet-chemically grown silver nanowires. The emitters of choice are single organic dye molecules under cryogenic conditions, which are known to act as high-brightness and extremely narrow-band single photon sources. Another advantage is their high optical nonlinearity, such that they might mediate photon-photon interactions on the nanoscale. We report on the coupling of a single molecule fluorescence emission through the wire over the length of several wavelengths. The transmission of coherently emitted photons is proven by an extinction type experiment. As for influencing the spectral properties of a single emitter, we are able to show a remote change of the line-width of a single terrylene molecule, which is in close proximity to the nanowire.

Electronic, structural, and substrate effect properties of single-layer covalent organic frameworks

International Nuclear Information System (INIS)

Liang, Liangbo; Zhu, Pan; Meunier, Vincent

2015-01-01

Recently synthesized two-dimensional covalent organic frameworks (COFs) exhibit high surface area, large pore size, and unique structural architectures, making them promising materials for various energy applications. Here, a total of nine COFs structures, including two deposited on a hexagonal boron nitride substrate, are investigated using density functional theory, quasi-particle many-body theory within the GW approximation, and an image charge model. The structures considered belong to two major families (thiophene-based COF-n (T-COF-n) and tetrakis (4-aminophenyl) porphyrin-x (TAPP-x)) differing from the presence of B—O or C=N linkers. While T-COF-n structures are shown to constitute planar networks, TAPP-x systems can display non-negligible corrugation due to the out-of-plane rotation of phenyl rings. We find that the electronic properties do not differ significantly when altering the chain molecules within each family. Many-body effects are shown to lead to large band-gap increase while the presence of the substrate yields appreciable reductions of the gaps, due to substrate polarization effects

Identification of a cytotoxic molecule in heat-modified citrus pectin.

Science.gov (United States)

Leclere, Lionel; Fransolet, Maude; Cambier, Pierre; El Bkassiny, Sandy; Tikad, Abdellatif; Dieu, Marc; Vincent, Stéphane P; Van Cutsem, Pierre; Michiels, Carine

2016-02-10

Modified forms of citrus pectin possess anticancer properties. However, their mechanism of action and the structural features involved remain unclear. Here, we showed that citrus pectin modified by heat treatment displayed cytotoxic effects in cancer cells. A fractionation approach was used aiming to identify active molecules. Dialysis and ethanol precipitation followed by HPLC analysis evidenced that most of the activity was related to molecules with molecular weight corresponding to low degree of polymerization oligogalacturonic acid. Heat-treatment of galacturonic acid also generated cytotoxic molecules. Furthermore, heat-modified galacturonic acid and heat-fragmented pectin contained the same molecule that induced cell death when isolated by HPLC separation. Mass spectrometry analyses revealed that 4,5-dihydroxy-2-cyclopenten-1-one was one cytotoxic molecule present in heat-treated pectin. Finally, we synthesized the enantiopure (4R,5R)-4,5-dihydroxy-2-cyclopenten-1-one and demonstrated that this molecule was cytotoxic and induced a similar pattern of apoptotic-like features than heat-modified pectin. Copyright © 2015 Elsevier Ltd. All rights reserved.

Preparation and antimicrobial action of three tryptic digested functional molecules of bovine lactoferrin.

Directory of Open Access Journals (Sweden)

Nilisha Rastogi

Full Text Available Lactoferrin is an 80 kDa bilobal, iron binding glycoprotein which is primarily antimicrobial in nature. The hydrolysis of lactoferrin by various proteases in the gut produces several functional fragments of lactoferrin which have varying molecular sizes and properties. Here, bovine lactoferrin has been hydrolyzed by trypsin, the major enzyme present in the gut, to produce three functional molecules of sizes approximately 21 kDa, 38 kDa and 45 kDa. The molecules have been purified using ion exchange and gel filtration chromatography and identified using N-terminal sequencing, which reveals that while the 21 kDa molecule corresponds to the N2 domain (21LF, the 38 kDa represents the whole C-lobe (38LF and the 45 kDa is a portion of N1 domain of N-lobe attached to the C-lobe (45LF. The iron binding and release properties of 21LF, 38LF and 45LF have been studied and compared. The sequence and structure analysis of the portions of the excision sites of LF from various species have been done. The antibacterial properties of these three molecules against bacterial strains, Streptococcus pyogenes, Escherichia coli, Yersinia enterocolitica and Listeria monocytogenes were investigated. The antifungal action of the molecules was also evaluated against Candida albicans. This is the first report on the antimicrobial actions of the trypsin cleaved functional molecules of lactoferrin from any species.

Mixing of alcohol and water molecules studied by neutron probe. Structure and dynamics

International Nuclear Information System (INIS)

Yoshida, Koji

2001-01-01

Structure of water/alcohol mixing solution was studied by three methods such as an isotope-exchanged neutron scattering method, RISM (Reference Interaction Site Model) integral equation and a neutron spin echo method. The principle of methods, experiments and results were reported. The results of experiments of water/tert-butyl alcohol (TBA) solution by the isotope-exchange neutron scattering method showed TBA molecule associated with each other through end methyl group. Especially this effect was the largest at x TBA = 0.06 and decreased with increasing the concentration of TBA. However, hydrogen bonding of TBA was very rare at x TBA = 0.06. By the partial radial distribution function obtained from RISM integral equation, it indicated that the structure of pure TBA became chain structure by hydrogen bond but changed to the structure contacted directly each hydrophobic group with increasing the concentration of water. Water/2-butoxyethanol (BE) mixing solution was measured by a neutron spin echo method. The activation energy of the diffusion coefficients obtained agreed to the energy of hydrogen bonding. The temperature response of diffusion coefficients showed the inverse of the experimental results obtained by the dynamic light scattering method. The difference between two measurement methods was different time scale and space scale. Namely, the object of the neutron scattering method is nano meter and nano second, but one of light scattering method many times over. It was proved from the above results that there was the cluster consisted of the same kind of molecule in the homogeneous two components solution, but the cluster was not stable and constantly exchanged with molecule, where the production and decay of the cluster is repeated at about nano sec. (S.Y.)

In-situ Evaluation of Soil Organic Molecules: Functional Group Chemistry Aggregate Structures, Metal and Surface Complexation Using Soft X-Ray

International Nuclear Information System (INIS)

Myneni, Satish C.

2008-01-01

Organic molecules are common in all Earth surface environments, and their composition and chemistry play an important role in a variety of biogeochemical reactions, such as mineral weathering, nutrient cycling and the solubility and transport of contaminants. However, most of what we know about the chemistry of these molecules comes from spectroscopy and microscopy studies of organic molecules extracted from different natural systems using either inorganic or organic solvents. Although all these methods gave us clues about the composition of these molecules, their composition and structure change with the extraction and the type of ex-situ analysis, their true behavior is less well understood. The goal of this project is to develop synchrotron instrumentation for studying natural organics, and to apply these recently developed synchrotron X-ray spectroscopy and microscopy techniques for understanding the: (1) functional group composition of naturally occurring organic molecules; (2) macromolecular structures of organic molecules; and (3) the nature of interactions of organic molecules with mineral surfaces in different environmental conditions.

Functional materials discovery using energy-structure-function maps.

Science.gov (United States)

Pulido, Angeles; Chen, Linjiang; Kaczorowski, Tomasz; Holden, Daniel; Little, Marc A; Chong, Samantha Y; Slater, Benjamin J; McMahon, David P; Bonillo, Baltasar; Stackhouse, Chloe J; Stephenson, Andrew; Kane, Christopher M; Clowes, Rob; Hasell, Tom; Cooper, Andrew I; Day, Graeme M

2017-03-30

Molecular crystals cannot be designed in the same manner as macroscopic objects, because they do not assemble according to simple, intuitive rules. Their structures result from the balance of many weak interactions, rather than from the strong and predictable bonding patterns found in metal-organic frameworks and covalent organic frameworks. Hence, design strategies that assume a topology or other structural blueprint will often fail. Here we combine computational crystal structure prediction and property prediction to build energy-structure-function maps that describe the possible structures and properties that are available to a candidate molecule. Using these maps, we identify a highly porous solid, which has the lowest density reported for a molecular crystal so far. Both the structure of the crystal and its physical properties, such as methane storage capacity and guest-molecule selectivity, are predicted using the molecular structure as the only input. More generally, energy-structure-function maps could be used to guide the experimental discovery of materials with any target function that can be calculated from predicted crystal structures, such as electronic structure or mechanical properties.

Structural Basis for Selective Small Molecule Kinase Inhibition of Activated c-Met

Energy Technology Data Exchange (ETDEWEB)

Rickert, Keith W.; Patel, Sangita B.; Allison, Timothy J.; Byrne, Noel J.; Darke, Paul L.; Ford, Rachael E.; Guerin, David J.; Hall, Dawn L.; Kornienko, Maria; Lu, Jun; Munshi, Sanjeev K.; Reid, John C.; Shipman, Jennifer M.; Stanton, Elizabeth F.; Wilson, Kevin J.; Young, Jonathon R.; Soisson, Stephen M.; Lumb, Kevin J. (Merck)

2012-03-15

The receptor tyrosine kinase c-Met is implicated in oncogenesis and is the target for several small molecule and biologic agents in clinical trials for the treatment of cancer. Binding of the hepatocyte growth factor to the cell surface receptor of c-Met induces activation via autophosphorylation of the kinase domain. Here we describe the structural basis of c-Met activation upon autophosphorylation and the selective small molecule inhibiton of autophosphorylated c-Met. MK-2461 is a potent c-Met inhibitor that is selective for the phosphorylated state of the enzyme. Compound 1 is an MK-2461 analog with a 20-fold enthalpy-driven preference for the autophosphorylated over unphosphorylated c-Met kinase domain. The crystal structure of the unbound kinase domain phosphorylated at Tyr-1234 and Tyr-1235 shows that activation loop phosphorylation leads to the ejection and disorder of the activation loop and rearrangement of helix {alpha}C and the G loop to generate a viable active site. Helix {alpha}C adopts a orientation different from that seen in activation loop mutants. The crystal structure of the complex formed by the autophosphorylated c-Met kinase domain and compound 1 reveals a significant induced fit conformational change of the G loop and ordering of the activation loop, explaining the selectivity of compound 1 for the autophosphorylated state. The results highlight the role of structural plasticity within the kinase domain in imparting the specificity of ligand binding and provide the framework for structure-guided design of activated c-Met inhibitors.

Structural and mechanical properties of glassy water in nanoscale confinement.

Science.gov (United States)

Lombardo, Thomas G; Giovambattista, Nicolás; Debenedetti, Pablo G

2009-01-01

We investigate the structure and mechanical properties of glassy water confined between silica-based surfaces with continuously tunable hydrophobicity and hydrophilicity by computing and analyzing minimum energy, mechanically stable configurations (inherent structures). The structured silica substrate imposes long-range order on the first layer of water molecules under hydrophobic confinement at high density (p > or = 1.0 g cm(-3)). This proximal layer is also structured in hydrophilic confinement at very low density (p approximately 0.4 g cm(-3)). The ordering of water next to the hydrophobic surface greatly enhances the mechanical strength of thin films (0.8 nm). This leads to a substantial stress anisotropy; the transverse strength of the film exceeds the normal strength by 500 MPa. The large transverse strength results in a minimum in the equation of state of the energy landscape that does not correspond to a mechanical instability, but represents disruption of the ordered layer of water next to the wall. In addition, we find that the mode of mechanical failure is dependent on the type of confinement. Under large lateral strain, water confined by hydrophilic surfaces preferentially forms voids in the middle of the film and fails cohesively. In contrast, water under hydrophobic confinement tends to form voids near the walls and fails by loss of adhesion.

Transport mirages in single-molecule devices

Science.gov (United States)

Gaudenzi, R.; Misiorny, M.; Burzurí, E.; Wegewijs, M. R.; van der Zant, H. S. J.

2017-03-01

Molecular systems can exhibit a complex, chemically tailorable inner structure which allows for targeting of specific mechanical, electronic, and optical properties. At the single-molecule level, two major complementary ways to explore these properties are molecular quantum-dot structures and scanning probes. This article outlines comprehensive principles of electron-transport spectroscopy relevant to both these approaches and presents a new, high-resolution experiment on a high-spin single-molecule junction exemplifying these principles. Such spectroscopy plays a key role in further advancing our understanding of molecular and atomic systems, in particular, the relaxation of their spin. In this joint experimental and theoretical analysis, particular focus is put on the crossover between the resonant regime [single-electron tunneling] and the off-resonant regime [inelastic electron (co)tunneling spectroscopy (IETS)]. We show that the interplay of these two processes leads to unexpected mirages of resonances not captured by either of the two pictures alone. Although this turns out to be important in a large fraction of the possible regimes of level positions and bias voltages, it has been given little attention in molecular transport studies. Combined with nonequilibrium IETS—four-electron pump-probe excitations—these mirages provide crucial information on the relaxation of spin excitations. Our encompassing physical picture is supported by a master-equation approach that goes beyond weak coupling. The present work encourages the development of a broader connection between the fields of molecular quantum-dot and scanning probe spectroscopy.

Structure of the Buried Metal-Molecule Interface in Organic Thin Film Devices

DEFF Research Database (Denmark)

Hansen, Christian Rein; Sørensen, Thomas Just; Glyvradal, Magni

2009-01-01

By use of specular X-ray reflectivity (XR) the structure of a metal-covered organic thin film device is measured with angstrom resolution. The model system is a Langmuir-Blodgett (LB) film, sandwiched between a silicon substrate and a top electrode consisting of 25 Å titanium and 100 Å aluminum....... By comparison of XR data for the five-layer Pb2+ arachidate LB film before and after vapor deposition of the Ti/Al top electrode, a detailed account of the structural damage to the organic film at the buried metal-molecule interface is obtained. We find that the organized structure of the two topmost LB layers...

Pulse gas chromatographic study of adsorption of substituted aromatics and heterocyclic molecules on MIL-47 at zero coverage.

Science.gov (United States)

Duerinck, Tim; Couck, Sarah; Vermoortele, Frederik; De Vos, Dirk E; Baron, Gino V; Denayer, Joeri F M

2012-10-02

The low coverage adsorptive properties of the MIL-47 metal organic framework toward aromatic and heterocyclic molecules are reported in this paper. The effect of molecular functionality and size on Henry adsorption constants and adsorption enthalpies of alkyl and heteroatom functionalized benzene derivates and heterocyclic molecules was studied using pulse gas chromatography. By means of statistical analysis, experimental data was analyzed and modeled using principal component analysis and partial least-squares regression. Structure-property relationships were established, revealing and confirming several trends. Among the molecular properties governing the adsorption process, vapor pressure, mean polarizability, and dipole moment play a determining role.

A procedure to analyze surface profiles of the protein molecules visualized by quick-freeze deep-etch replica electron microscopy

Energy Technology Data Exchange (ETDEWEB)

Kimori, Yoshitaka [Division of Biomolecular Imaging, Institute of Medical Science, The University of Tokyo, Minato-ku, Tokyo 108-8639 (Japan); Department of Bioscience and Bioinformatics, Kyushu Institute of Technology, Iizuka, Fukuoka 820-8502 (Japan); Oguchi, Yosuke [Department of Electric Engineering, Kogakuin University, Hachioji, Tokyo 192-0015 (Japan); Ichise, Norihiko [Department of Visual Communication, Komazawa Women' s University, Inagi, Tokyo 206-8511 (Japan); Baba, Norio [Department of Electric Engineering, Kogakuin University, Hachioji, Tokyo 192-0015 (Japan); Katayama, Eisaku [Division of Biomolecular Imaging, Institute of Medical Science, The University of Tokyo, Minato-ku, Tokyo 108-8639 (Japan)]. E-mail: ekatayam@ims.u-tokyo.ac.jp

2007-01-15

Quick-freeze deep-etch replica electron microscopy gives high contrast snapshots of individual protein molecules under physiological conditions in vitro or in situ. The images show delicate internal pattern, possibly reflecting the rotary-shadowed surface profile of the molecule. As a step to build the new system for the 'Structural analysis of single molecules', we propose a procedure to quantitatively characterize the structural property of individual molecules; e.g. conformational type and precise view-angle of the molecules, if the crystallographic structure of the target molecule is available. This paper presents a framework to determine the observed face of the protein molecule by analyzing the surface profile of individual molecules visualized in freeze-replica specimens. A comprehensive set of rotary-shadowed views of the protein molecule was artificially generated from the available atomic coordinates using light-rendering software. Exploiting new mathematical morphology-based image filter, characteristic features were extracted from each image and stored as template. Similar features were extracted from the true replica image and the most likely projection angle and the conformation of the observed particle were determined by quantitative comparison with a set of archived images. The performance and the robustness of the procedure were examined with myosin head structure in defined configuration for actual application.

A procedure to analyze surface profiles of the protein molecules visualized by quick-freeze deep-etch replica electron microscopy

International Nuclear Information System (INIS)

Kimori, Yoshitaka; Oguchi, Yosuke; Ichise, Norihiko; Baba, Norio; Katayama, Eisaku

2007-01-01

Quick-freeze deep-etch replica electron microscopy gives high contrast snapshots of individual protein molecules under physiological conditions in vitro or in situ. The images show delicate internal pattern, possibly reflecting the rotary-shadowed surface profile of the molecule. As a step to build the new system for the 'Structural analysis of single molecules', we propose a procedure to quantitatively characterize the structural property of individual molecules; e.g. conformational type and precise view-angle of the molecules, if the crystallographic structure of the target molecule is available. This paper presents a framework to determine the observed face of the protein molecule by analyzing the surface profile of individual molecules visualized in freeze-replica specimens. A comprehensive set of rotary-shadowed views of the protein molecule was artificially generated from the available atomic coordinates using light-rendering software. Exploiting new mathematical morphology-based image filter, characteristic features were extracted from each image and stored as template. Similar features were extracted from the true replica image and the most likely projection angle and the conformation of the observed particle were determined by quantitative comparison with a set of archived images. The performance and the robustness of the procedure were examined with myosin head structure in defined configuration for actual application

Structural, Spectroscopic (FT-IR, Raman and NMR, Non-linear Optical (NLO, HOMO-LUMO and Theoretical (DFT/CAM-B3LYP Analyses of N-Benzyloxycarbonyloxy-5-Norbornene-2,3-Dicarboximide Molecule

Directory of Open Access Journals (Sweden)

Nuri ÖZTÜRK

2018-02-01

Full Text Available The experimental spectroscopic investigation of N-benzyloxycarbonyloxy-5-norbornene-2,3-dicarboximide (C17H15NO5 molecule has been done using 1H and 13C NMR chemical shifts, FT-IR and Raman spectroscopies. Conformational forms have been determined depending on orientation of N-benzyloxycarbonyloxy and 5-norbornene-2,3-dicarboximide (NDI groups of the title compound. The structural geometric optimizations, vibrational wavenumbers, NMR chemical shifts (in vacuum and chloroform and HOMO-LUMO analyses for all conformers of the title molecule have been done with DFT/CAM-B3LYP method at the 6-311++G(d,p basis set. Additionally, based on the calculated HOMO and LUMO energy values, some molecular properties such as ionization potential (I, electron affinity (A, electronegativity (χ, chemical hardness (h, chemical softness (z, chemical potential (μ and electrophilicity index (w parameters are determined for all conformers. The non-linear optical (NLO properties have been studied for the title molecule. We can say that the experimental spectral data are in accordance with calculated values.

Structure and dynamics of water and lipid molecules in charged anionic DMPG lipid bilayer membranes

International Nuclear Information System (INIS)

Rønnest, A. K.; Peters, G. H.; Hansen, F. Y.; Taub, H.; Miskowiec, A.

2016-01-01

Molecular dynamics simulations have been used to investigate the influence of the valency of counter-ions on the structure of freestanding bilayer membranes of the anionic 1,2-dimyristoyl-sn-glycero-3-phosphoglycerol (DMPG) lipid at 310 K and 1 atm. At this temperature, the membrane is in the fluid phase with a monovalent counter-ion and in the gel phase with a divalent counter-ion. The diffusion constant of water as a function of its depth in the membrane has been determined from mean-square-displacement calculations. Also, calculated incoherent quasielastic neutron scattering functions have been compared to experimental results and used to determine an average diffusion constant for all water molecules in the system. On extrapolating the diffusion constants inferred experimentally to a temperature of 310 K, reasonable agreement with the simulations is obtained. However, the experiments do not have the sensitivity to confirm the diffusion of a small component of water bound to the lipids as found in the simulations. In addition, the orientation of the dipole moment of the water molecules has been determined as a function of their depth in the membrane. Previous indirect estimates of the electrostatic potential within phospholipid membranes imply an enormous electric field of 10 8 –10 9 V m −1 , which is likely to have great significance in controlling the conformation of translocating membrane proteins and in the transfer of ions and molecules across the membrane. We have calculated the membrane potential for DMPG bilayers and found ∼1 V (∼2 ⋅ 10 8 V m −1 ) when in the fluid phase with a monovalent counter-ion and ∼1.4 V (∼2.8 ⋅ 10 8 V m −1 ) when in the gel phase with a divalent counter-ion. The number of water molecules for a fully hydrated DMPG membrane has been estimated to be 9.7 molecules per lipid in the gel phase and 17.5 molecules in the fluid phase, considerably smaller than inferred experimentally for 1,2-dimyristoyl-sn-glycero-3

Structure and dynamics of water and lipid molecules in charged anionic DMPG lipid bilayer membranes

Energy Technology Data Exchange (ETDEWEB)

Rønnest, A. K.; Peters, G. H.; Hansen, F. Y., E-mail: flemming@kemi.dtu.dk [Department of Chemistry, Technical University of Denmark, IK 207 DTU, DK-2800 Lyngby (Denmark); Taub, H.; Miskowiec, A. [Department of Physics and Astronomy and the University of Missouri Research Reactor,University of Missouri, Columbia, Missouri 65211 (United States)

2016-04-14

Molecular dynamics simulations have been used to investigate the influence of the valency of counter-ions on the structure of freestanding bilayer membranes of the anionic 1,2-dimyristoyl-sn-glycero-3-phosphoglycerol (DMPG) lipid at 310 K and 1 atm. At this temperature, the membrane is in the fluid phase with a monovalent counter-ion and in the gel phase with a divalent counter-ion. The diffusion constant of water as a function of its depth in the membrane has been determined from mean-square-displacement calculations. Also, calculated incoherent quasielastic neutron scattering functions have been compared to experimental results and used to determine an average diffusion constant for all water molecules in the system. On extrapolating the diffusion constants inferred experimentally to a temperature of 310 K, reasonable agreement with the simulations is obtained. However, the experiments do not have the sensitivity to confirm the diffusion of a small component of water bound to the lipids as found in the simulations. In addition, the orientation of the dipole moment of the water molecules has been determined as a function of their depth in the membrane. Previous indirect estimates of the electrostatic potential within phospholipid membranes imply an enormous electric field of 10{sup 8}–10{sup 9} V m{sup −1}, which is likely to have great significance in controlling the conformation of translocating membrane proteins and in the transfer of ions and molecules across the membrane. We have calculated the membrane potential for DMPG bilayers and found ∼1 V (∼2 ⋅ 10{sup 8} V m{sup −1}) when in the fluid phase with a monovalent counter-ion and ∼1.4 V (∼2.8 ⋅ 10{sup 8} V m{sup −1}) when in the gel phase with a divalent counter-ion. The number of water molecules for a fully hydrated DMPG membrane has been estimated to be 9.7 molecules per lipid in the gel phase and 17.5 molecules in the fluid phase, considerably smaller than inferred experimentally for 1

Effects of a donor on the bond property of quantum-dot molecules

Institute of Scientific and Technical Information of China (English)

Wang Li-Min; Luo Ying; Ma Ben-Kun; Duan Su-Qing; Zhao Xian-Geng

2004-01-01

Within the framework of effective mass approximation, we have calculated the electronic structure of the two laterally coupled quantum dots with a donor by the finite element method. The calculated results show that the bond states of quantum-dot molecules are quite sensitive to the donor positions. By varying the donor position, the transition from covalent to ionic bond state is realized for some electronic states. Some extreme cases are also discussed for comparison.

Physics of Complex Polymeric Molecules

Science.gov (United States)

Kelly, Joshua Walter

The statistical physics of complex polymers with branches and circuits is the topic of this dissertation. An important motivation are large, single-stranded (ss) RNA molecules. Such molecules form complex ``secondary" and ``tertiary" structures that can be represented as branched polymers with circuits. Such structures are in part directly determined by the nucleotide sequence and in part subject to thermal fluctuations. The polymer physics literature on molecules in this class has mostly focused on randomly branched polymers without circuits while there has been minimal research on polymers with specific structures and on polymers that contain circuits. The dissertation is composed of three parts: Part I studies branched polymers with thermally fluctuating structure confined to a potential well as a simple model for the encapsidation of viral RNA. Excluded volume interactions were ignored. In Part II, I apply Flory theory to the study of the encapsidation of viral ss RNA molecules with specific branched structures, but without circuits, in the presence of excluded volume interaction. In Part III, I expand on Part II and consider complex polymers with specific structure including both branching and circuits. I introduce a method based on the mathematics of Laplacian matrices that allows me to calculate density profiles for such molecules, which was not possible within Flory theory.

Cellulose nanomaterials review: structure, properties and nanocomposites

Science.gov (United States)

Robert J. Moon; Ashlie Martini; John Nairn; John Simonsen; Jeff Youngblood

2011-01-01

This critical review provides a processing-structure-property perspective on recent advances in cellulose nanoparticles and composites produced from them. It summarizes cellulose nanoparticles in terms of particle morphology, crystal structure, and properties. Also described are the self-assembly and rheological properties of cellulose nanoparticle suspensions. The...

Conserved water molecules in bacterial serine hydroxymethyltransferases.

Science.gov (United States)

Milano, Teresa; Di Salvo, Martino Luigi; Angelaccio, Sebastiana; Pascarella, Stefano

2015-10-01

Water molecules occurring in the interior of protein structures often are endowed with key structural and functional roles. We report the results of a systematic analysis of conserved water molecules in bacterial serine hydroxymethyltransferases (SHMTs). SHMTs are an important group of pyridoxal-5'-phosphate-dependent enzymes that catalyze the reversible conversion of l-serine and tetrahydropteroylglutamate to glycine and 5,10-methylenetetrahydropteroylglutamate. The approach utilized in this study relies on two programs, ProACT2 and WatCH. The first software is able to categorize water molecules in a protein crystallographic structure as buried, positioned in clefts or at the surface. The other program finds, in a set of superposed homologous proteins, water molecules that occur approximately in equivalent position in each of the considered structures. These groups of molecules are referred to as 'clusters' and represent structurally conserved water molecules. Several conserved clusters of buried or cleft water molecules were found in the set of 11 bacterial SHMTs we took into account for this work. The majority of these clusters were not described previously. Possible structural and functional roles for the conserved water molecules are envisaged. This work provides a map of the conserved water molecules helpful for deciphering SHMT mechanism and for rational design of molecular engineering experiments. © The Author 2015. Published by Oxford University Press. All rights reserved. For Permissions, please e-mail: journals.permissions@oup.com.

Fabrication of Au/graphene oxide/Ag sandwich structure thin film and its tunable energetics and tailorable optical properties

Directory of Open Access Journals (Sweden)

Ruijin Hong

2017-01-01

Full Text Available Au/graphene oxide/Ag sandwich structure thin film was fabricated. The effects of graphene oxide (GO and bimetal on the structure and optical properties of metal silver films were investigated by X-ray diffraction (XRD, optical absorption, and Raman intensity measurements, respectively. Compared to silver thin film, Au/graphene oxide/Ag sandwich structure composite thin films were observed with wider optical absorption peak and enhanced absorption intensity. The Raman signal for Rhodamine B molecules based on the Au/graphene oxide/Ag sandwich nanostructure substrate were obviously enhanced due to the bimetal layer and GO layer with tunable absorption intensity and fluorescence quenching effects.

Relative orientation of collagen molecules within a fibril: a homology model for homo sapiens type I collagen.

Science.gov (United States)

Collier, Thomas A; Nash, Anthony; Birch, Helen L; de Leeuw, Nora H

2018-02-15

Type I collagen is an essential extracellular protein that plays an important structural role in tissues that require high tensile strength. However, owing to the molecule's size, to date no experimental structural data are available for the Homo sapiens species. Therefore, there is a real need to develop a reliable homology model and a method to study the packing of the collagen molecules within the fibril. Through the use of the homology model and implementation of a novel simulation technique, we have ascertained the orientations of the collagen molecules within a fibril, which is currently below the resolution limit of experimental techniques. The longitudinal orientation of collagen molecules within a fibril has a significant effect on the mechanical and biological properties of the fibril, owing to the different amino acid side chains available at the interface between the molecules.

Structures and anti-inflammatory properties of 4-halogenated -mofebutazones

Science.gov (United States)

Reichelt, Hendrik; Paradies, Henrich H.

2018-02-01

The crystal structures of the 4-halogenated (hal: F, Cl, Br)-4-butyl-1-phenyl-1,3-pyrolidine-dione (mofebutazone) are determined, and compared with their solution structures. The racemic 4-halogenated mofebutazone approximants crystallize in a monoclinic space group with four molecules in the unit cell. The 4-hal-mofebutazone molecules reveal strong hydrogen bonding between the hydrogen atom located at the N-2 nitrogen atom and a carbonyl oxygen atom of an adjacent 4-hal-mofebutazone molecule. The hydrogen bond angle for 4-Br-mifebutazone N (2)sbnd H (1)⋯O (1) is 173(3) °, so that the hydrogen bond is essentially linear indicating an infinite chain hydrogen bond network. The 3d and 2d structures are stabilized by π-π and σ-π interactions, short intermolecular distances, and apolar forces between adjacently stacked phenyl rings. Small-angle-X-ray scattering (SAXS) experiments and osmometric measurements reveal the presence of dimers for the 4-hal-mofebutazone molecules. Molecular simulations indicate similar solution structure factors for the 4-hal-mofebutazones solutions, S(Q), and in the solid state. There is a strong indication that the [1,1,0], [1,0,0], and [1,0,0] periodicities of the 4-Brsbnd , 4-Clsbnd and 4-F-mofebutazone in the crystalline solid state were also present in the solution phase. The biochemical and cellular activities of the different 4-hal-mofebutazones were monitored by the magnitude of their inhibition of the PGE2 biosynthesis through the cyclo-oxygenase (COX-1) in macrophages, and on the inhibition of LTD4 (5-lipoxygenase) in polymorphonuclear leukocytes.

A single-molecule diode

Science.gov (United States)

Elbing, Mark; Ochs, Rolf; Koentopp, Max; Fischer, Matthias; von Hänisch, Carsten; Weigend, Florian; Evers, Ferdinand; Weber, Heiko B.; Mayor, Marcel

2005-06-01

We have designed and synthesized a molecular rod that consists of two weakly coupled electronic π -systems with mutually shifted energy levels. The asymmetry thus implied manifests itself in a current-voltage characteristic with pronounced dependence on the sign of the bias voltage, which makes the molecule a prototype for a molecular diode. The individual molecules were immobilized by sulfur-gold bonds between both electrodes of a mechanically controlled break junction, and their electronic transport properties have been investigated. The results indeed show diode-like current-voltage characteristics. In contrast to that, control experiments with symmetric molecular rods consisting of two identical π -systems did not show significant asymmetries in the transport properties. To investigate the underlying transport mechanism, phenomenological arguments are combined with calculations based on density functional theory. The theoretical analysis suggests that the bias dependence of the polarizability of the molecule feeds back into the current leading to an asymmetric shape of the current-voltage characteristics, similar to the phenomena in a semiconductor diode. Author contributions: F.E., H.B.W., and M.M. designed research; M.E., R.O., M.K., M.F., F.E., H.B.W., and M.M. performed research; M.E., R.O., M.K., M.F., C.v.H., F.W., F.E., H.B.W., and M.M. contributed new reagents/analytic tools; M.E., R.O., M.K., C.v.H., F.E., H.B.W., and M.M. analyzed data; and F.E., H.B.W., and M.M. wrote the paper.This paper was submitted directly (Track II) to the PNAS office.Abbreviations: A, acceptor; D, donor; MCB, mechanically controlled break junction.Data deposition: The atomic coordinates have been deposited in the Cambridge Structural Database, Cambridge Crystallographic Data Centre, Cambridge CB2 1EZ, United Kingdom (CSD reference no. 241632).

Mechanical response of collagen molecule under hydrostatic compression

International Nuclear Information System (INIS)

Saini, Karanvir; Kumar, Navin

2015-01-01

Proteins like collagen are the basic building blocks of various body tissues (soft and hard). Collagen molecules find their presence in the skeletal system of the body where they bear mechanical loads from different directions, either individually or along with hydroxy-apatite crystals. Therefore, it is very important to understand the mechanical behavior of the collagen molecule which is subjected to multi-axial state of loading. The estimation of strains of collagen molecule along different directions resulting from the changes in hydrostatic pressure magnitude, can provide us new insights into its mechanical behavior. In the present work, full atomistic simulations have been used to study global (volumetric) as well as local (along different directions) mechanical properties of the hydrated collagen molecule which is subjected to different hydrostatic pressure magnitudes. To estimate the local mechanical properties, the strains of collagen molecule along its longitudinal and transverse directions have been acquired at different hydrostatic pressure magnitudes. In spite of non-homogeneous distribution of atoms within the collagen molecule, the calculated values of local mechanical properties have been found to carry the same order of magnitude along the longitudinal and transverse directions. It has been demonstrated that the values of global mechanical properties like compressibility, bulk modulus, etc. as well as local mechanical properties like linear compressibility, linear elastic modulus, etc. are functions of magnitudes of applied hydrostatic pressures. The mechanical characteristics of collagen molecule based on the atomistic model have also been compared with that of the continuum model in the present work. The comparison showed up orthotropic material behavior for the collagen molecule. The information on collagen molecule provided in the present study can be very helpful in designing the future bio-materials.

Mechanical response of collagen molecule under hydrostatic compression.

Science.gov (United States)

Saini, Karanvir; Kumar, Navin

2015-04-01

Proteins like collagen are the basic building blocks of various body tissues (soft and hard). Collagen molecules find their presence in the skeletal system of the body where they bear mechanical loads from different directions, either individually or along with hydroxy-apatite crystals. Therefore, it is very important to understand the mechanical behavior of the collagen molecule which is subjected to multi-axial state of loading. The estimation of strains of collagen molecule along different directions resulting from the changes in hydrostatic pressure magnitude, can provide us new insights into its mechanical behavior. In the present work, full atomistic simulations have been used to study global (volumetric) as well as local (along different directions) mechanical properties of the hydrated collagen molecule which is subjected to different hydrostatic pressure magnitudes. To estimate the local mechanical properties, the strains of collagen molecule along its longitudinal and transverse directions have been acquired at different hydrostatic pressure magnitudes. In spite of non-homogeneous distribution of atoms within the collagen molecule, the calculated values of local mechanical properties have been found to carry the same order of magnitude along the longitudinal and transverse directions. It has been demonstrated that the values of global mechanical properties like compressibility, bulk modulus, etc. as well as local mechanical properties like linear compressibility, linear elastic modulus, etc. are functions of magnitudes of applied hydrostatic pressures. The mechanical characteristics of collagen molecule based on the atomistic model have also been compared with that of the continuum model in the present work. The comparison showed up orthotropic material behavior for the collagen molecule. The information on collagen molecule provided in the present study can be very helpful in designing the future bio-materials. Copyright © 2015 Elsevier B.V. All rights

Mechanical response of collagen molecule under hydrostatic compression

Energy Technology Data Exchange (ETDEWEB)

Saini, Karanvir, E-mail: karans@iitrpr.ac.in; Kumar, Navin

2015-04-01

Proteins like collagen are the basic building blocks of various body tissues (soft and hard). Collagen molecules find their presence in the skeletal system of the body where they bear mechanical loads from different directions, either individually or along with hydroxy-apatite crystals. Therefore, it is very important to understand the mechanical behavior of the collagen molecule which is subjected to multi-axial state of loading. The estimation of strains of collagen molecule along different directions resulting from the changes in hydrostatic pressure magnitude, can provide us new insights into its mechanical behavior. In the present work, full atomistic simulations have been used to study global (volumetric) as well as local (along different directions) mechanical properties of the hydrated collagen molecule which is subjected to different hydrostatic pressure magnitudes. To estimate the local mechanical properties, the strains of collagen molecule along its longitudinal and transverse directions have been acquired at different hydrostatic pressure magnitudes. In spite of non-homogeneous distribution of atoms within the collagen molecule, the calculated values of local mechanical properties have been found to carry the same order of magnitude along the longitudinal and transverse directions. It has been demonstrated that the values of global mechanical properties like compressibility, bulk modulus, etc. as well as local mechanical properties like linear compressibility, linear elastic modulus, etc. are functions of magnitudes of applied hydrostatic pressures. The mechanical characteristics of collagen molecule based on the atomistic model have also been compared with that of the continuum model in the present work. The comparison showed up orthotropic material behavior for the collagen molecule. The information on collagen molecule provided in the present study can be very helpful in designing the future bio-materials.

Structure and conformational dynamics of molecules in the excited electronic states: theory and experiment

International Nuclear Information System (INIS)

Godunov, I.A.; Bataev, V.A.; Maslov, D.V.; Yakovlev, N.N.

2017-01-01

The structure of conformational non-rigid molecules in the excited electronic states are investigated by joint theoretical and experimental methods. The theoretical part of work consist of two stages. In first stage the ab initio quantum-chemical calculations are carried out using high level methods. In second stage the vibrational problems of the various dimensions are solved by variational method for vibrations of large amplitude. In experimental part of work the vibronic spectra are investigated: gas-phase absorption and also, fluorescence excitation spectra of jet-cooled molecules. Some examples are considered.

Strain-induced formation of fourfold symmetric SiGe quantum dot molecules.

Science.gov (United States)

Zinovyev, V A; Dvurechenskii, A V; Kuchinskaya, P A; Armbrister, V A

2013-12-27

The strain field distribution at the surface of a multilayer structure with disklike SiGe nanomounds formed by heteroepitaxy is exploited to arrange the symmetric quantum dot molecules typically consisting of four elongated quantum dots ordered along the [010] and [100] directions. The morphological transition from fourfold quantum dot molecules to continuous fortresslike quantum rings with an increasing amount of deposited Ge is revealed. We examine key mechanisms underlying the formation of lateral quantum dot molecules by using scanning tunneling microscopy and numerical calculations of the strain energy distribution on the top of disklike SiGe nanomounds. Experimental data are well described by a simple thermodynamic model based on the accurate evaluation of the strain dependent part of the surface chemical potential. The spatial arrangement of quantum dots inside molecules is attributed to the effect of elastic property anisotropy.

Electronic structure of molecular Rydberg states of some small molecules and molecular ion

International Nuclear Information System (INIS)

Sun Biao; Li Jiaming

1993-01-01

Based on an independent-particle-approximation (i.e. the multiple scattering self-consistent-field theory), the electronic structures of Rydberg states of the small diatomic molecules H 2 , He 2 and the He 2 + molecular ion were studied. The principal quantum number of the first state of the Rydberg series is determined from a convention of the limit of the molecular electronic configuration. The dynamics of the excited molecules and molecular ion has been elucidated. The theoretical results are in fair agreement with the existing experimental measurements, thus they can serve as a reliable basis for future refined treatment such as the configuration interaction calculation

Controllable Negative Differential Resistance Behavior of an Azobenzene Molecular Device Induced by Different Molecule-Electrode Distances

International Nuclear Information System (INIS)

Fan Zhi-Qiang; Zhang Zhen-Hua; Qiu Ming; Deng Xiao-Qing; Tang Gui-Ping

2012-01-01

We report the ab initio calculations of transport behaviors of an azobenzene molecular device which is similar to the experimental configurations. The calculated results show that the transport behaviors of the device are sensitive to the molecule-electrode distance and the currents will drop rapidly when the molecule-electrode distance changes from 1.7 Å to 2.0 Å. More interestingly, the negative differential resistance behavior can be found in our device. Nevertheless, it is not the inherent property of an azobenzene molecular device but an effect of the molecule-electrode distance. Detailed analyses of the molecular projected self-consistent Hamiltonian states and the transmission spectra of the system reveal the physical mechanism of these behaviors. (condensed matter: electronic structure, electrical, magnetic, and optical properties)

Secondary structure of 5S RNA: NMR experiments on RNA molecules partially labeled with Nitrogen-15

International Nuclear Information System (INIS)

Gewirth, D.T.; Abo, S.R.; Leontis, N.B.; Moore, P.B.

1987-01-01

A method has been found for reassembling fragment 1 of Escherichia coli 5S RNA from mixtures containing strand III (bases 69-87) and the complex consisting of strand II (bases 89-120) and strand IV (bases 1-11). The reassembled molecule is identical with unreconstituted fragment 1. With this technique, fragment 1 molecules have been constructed 15 N-labeled either in strand III or in the strand II-strand IV complex. Spectroscopic data obtained with these partially labeled molecules show that the terminal helix of 5S RNA includes the GU and GC base pairs at positions 9 and 10 which the standard model for 5S secondary structure predicts but that these base pairs are unstable both in the fragment and in native 5S RNA. The data also assign three resonances to the helix V region of the molecule (bases 70-77 and 99-106). None of these resonances has a normal chemical shift even though two of them correspond to AU or GU base pairs in the standard model. The implications of these findings for the authors understanding of the structure of 5S RNA and its complex with ribosomal protein L25 are discussed

Structural Approaches to Sequence Evolution Molecules, Networks, Populations

CERN Document Server

Bastolla, Ugo; Roman, H. Eduardo; Vendruscolo, Michele

2007-01-01

Structural requirements constrain the evolution of biological entities at all levels, from macromolecules to their networks, right up to populations of biological organisms. Classical models of molecular evolution, however, are focused at the level of the symbols - the biological sequence - rather than that of their resulting structure. Now recent advances in understanding the thermodynamics of macromolecules, the topological properties of gene networks, the organization and mutation capabilities of genomes, and the structure of populations make it possible to incorporate these key elements into a broader and deeply interdisciplinary view of molecular evolution. This book gives an account of such a new approach, through clear tutorial contributions by leading scientists specializing in the different fields involved.

Structure, Electronic and Nonlinear Optical Properties of Furyloxazoles and Thienyloxazoles

International Nuclear Information System (INIS)

Dagli, Ozlem; Gok, Rabia; Bahat, Mehmet; Ozbay, Akif

2016-01-01

Geometry optimization, electronic and nonlinear optical properties of isomers of furyloxazole and thienyloxazole molecules are carried out at the B3LYP/6-311++G(2d,p) level. The conformational analysis of 12 compounds have been studied as a function of torsional angle between rings. Electronic and NLO properties such as dipole moment, energy gap, polarizability and first hyperpolarizability were also calculated. (paper)

Structure of a Pheromone Receptor-Associated Mhc Molecule With An Open And Empty Groove

Energy Technology Data Exchange (ETDEWEB)

Olson, R.; Huey-Tubman, K.E.; Dulac, C.; Bjorkman, P.J.; /Caltech /Harvard U.

2006-10-06

Neurons in the murine vomeronasal organ (VNO) express a family of class Ib major histocompatibility complex (MHC) proteins (M10s) that interact with the V2R class of VNO receptors. This interaction may play a direct role in the detection of pheromonal cues that initiate reproductive and territorial behaviors. The crystal structure of M10.5, an M10 family member, is similar to that of classical MHC molecules. However, the M10.5 counterpart of the MHC peptide-binding groove is open and unoccupied, revealing the first structure of an empty class I MHC molecule. Similar to empty MHC molecules, but unlike peptide-filled MHC proteins and non-peptide-binding MHC homologs, M10.5 is thermally unstable, suggesting that its groove is normally occupied. However, M10.5 does not bind endogenous peptides when expressed in mammalian cells or when offered a mixture of class I-binding peptides. The F pocket side of the M10.5 groove is open, suggesting that ligands larger than 8-10-mer class I-binding peptides could fit by extending out of the groove. Moreover, variable residues point up from the groove helices, rather than toward the groove as in classical MHC structures. These data suggest that M10s are unlikely to provide specific recognition of class I MHC-binding peptides, but are consistent with binding to other ligands, including proteins such as the V2Rs.

Structure of a pheromone receptor-associated MHC molecule with an open and empty groove.

Directory of Open Access Journals (Sweden)

2005-08-01

Full Text Available Neurons in the murine vomeronasal organ (VNO express a family of class Ib major histocompatibility complex (MHC proteins (M10s that interact with the V2R class of VNO receptors. This interaction may play a direct role in the detection of pheromonal cues that initiate reproductive and territorial behaviors. The crystal structure of M10.5, an M10 family member, is similar to that of classical MHC molecules. However, the M10.5 counterpart of the MHC peptide-binding groove is open and unoccupied, revealing the first structure of an empty class I MHC molecule. Similar to empty MHC molecules, but unlike peptide-filled MHC proteins and non-peptide-binding MHC homologs, M10.5 is thermally unstable, suggesting that its groove is normally occupied. However, M10.5 does not bind endogenous peptides when expressed in mammalian cells or when offered a mixture of class I-binding peptides. The F pocket side of the M10.5 groove is open, suggesting that ligands larger than 8-10-mer class I-binding peptides could fit by extending out of the groove. Moreover, variable residues point up from the groove helices, rather than toward the groove as in classical MHC structures. These data suggest that M10s are unlikely to provide specific recognition of class I MHC-binding peptides, but are consistent with binding to other ligands, including proteins such as the V2Rs.

Hyperfine-Structure-Induced Depolarization of Impulsively Aligned I2 Molecules

Science.gov (United States)

Thomas, Esben F.; Søndergaard, Anders A.; Shepperson, Benjamin; Henriksen, Niels E.; Stapelfeldt, Henrik

2018-04-01

A moderately intense 450 fs laser pulse is used to create rotational wave packets in gas phase I2 molecules. The ensuing time-dependent alignment, measured by Coulomb explosion imaging with a delayed probe pulse, exhibits the characteristic revival structures expected for rotational wave packets but also a complex nonperiodic substructure and decreasing mean alignment not observed before. A quantum mechanical model attributes the phenomena to coupling between the rotational angular momenta and the nuclear spins through the electric quadrupole interaction. The calculated alignment trace agrees very well with the experimental results.

Spin-orbit-coupled Bose-Einstein condensates of rotating polar molecules

Science.gov (United States)

Deng, Y.; You, L.; Yi, S.

2018-05-01

An experimental proposal for realizing spin-orbit (SO) coupling of pseudospin 1 in the ground manifold 1Σ (υ =0 ) of (bosonic) bialkali polar molecules is presented. The three spin components are composed of the ground rotational state and two substates from the first excited rotational level. Using hyperfine resolved Raman processes through two select excited states resonantly coupled by a microwave, an effective coupling between the spin tensor and linear momentum is realized. The properties of Bose-Einstein condensates for such SO-coupled molecules exhibiting dipolar interactions are further explored. In addition to the SO-coupling-induced stripe structures, the singly and doubly quantized vortex phases are found to appear, implicating exciting opportunities for exploring novel quantum physics using SO-coupled rotating polar molecules with dipolar interactions.

Structural, energetic and electrical properties of boron nitride nanotubes interacting with DMMP chemical agent

Energy Technology Data Exchange (ETDEWEB)

Ganji, M. Darvish, E-mail: ganji_md@yahoo.com [Nanotechnology Research Institute, Faculty of Chemical Engineering, Babol Noshirvani University of Technology, Babol (Iran, Islamic Republic of); Gholian, M.; Mohammadzadeh, S. [Department of Chemistry, Qaemshahr Branch, Islamic Azad University, Qaemshahr (Iran, Islamic Republic of)

2014-09-30

Highlights: • ab initio DFT calculations were used for interaction of DMMP with BNNTs. • Full structural optimization was performed for several possible active sites. • Electronic structure of the energetically favorable complexes was analyzed. • The stability of the most stable complex was evaluated at ambient condition. • First-principles calculations showed that DMMP is strongly bound to the small diameter BNNTs. - Abstract: The adsorption of DMMP as an intoxicating chemical warfare agent onto the boron nitride nanotube has been investigated by using density functional theory calculations. Several active sites were considered for both interacting systems and full structural optimization was performed to accurately find the energetically favorable state. It is found that DMMP molecule prefers to be adsorbed strongly on the top site above the B atom of a (5, 0) BNNT with a binding energy of about −103.24 kJ mol{sup −1} and an O–B binding distance of 1.641 Å. We have performed a comparative investigation of BNNTs with different diameters and the results indicate that the DMMP adsorption ability for the side wall of the tubes significantly decreases for higher diameters BNNTs. Furthermore, the adsorption properties of DMMP molecule onto the BNNT have been investigated using the ab initio MD simulation at room temperature. Our result showed that BNNTs facilitates the DMMP detection at ambient conditions for practical applications.

Atomic-level structure and structure-property relationship in metallic glass

Science.gov (United States)

Cheng, Yongqiang

One of the key tasks in material science is to understand the structure and structure-property relationship. The recently emerging bulk metallic glasses (BMGs) have demonstrated unique properties, especially intriguing mechanical properties such as their high strength and high propensity to localize deformation in shear bands. However, a comprehensive understanding of the structure of BMGs has been hindered by the complexity of these amorphous materials. Even more challenging is the structure-property correlation, which has been well established in crystals but has been seriously lacking for BMGs. This thesis presents a systematic study of the atomic-level structures of two representative BMGs, Cu-Zr and Cu-Zr-Al. The interpenetrating Cu-centered icosahedral clusters have been identified to be the primary structural feature. The fraction of icosahedra increases with increasing Cu or Al contents, and with decreasing cooling rate. The effect of Al in improving the icosahedral order is two-fold: the geometric effect due to the atomic-size mismatch and the chemical effect originated from the Cu-Al bond shortening. The resolved structure is used to study the structure-property relationship. The full icosahedra are found to be responsible for the dynamical slowdown of the supercooled liquid, which underlies the non-Arrhenius behavior, and explains the composition dependence of glass transition temperature, glass forming ability, and the room temperature strength. By simulated deformation, the initiation of plasticity and tendency for strain localization are also investigated. The full icosahedra are found to be the most rigid and resistant cluster with solid-like character, while the unstable clusters with liquid-like character serve as the fertile sites for initiating shear transformations. In addition, the elastic moduli are calculated and analyzed, and the origins of the different configurational dependence of shear modulus (G) and bulk modulus ( B) are explained. The

Electrical transport through a metal-molecule-metal junction; Transport electrique a travers une jonction metal-molecule-metal

Energy Technology Data Exchange (ETDEWEB)

Kergueris, Ch

1998-12-17

We investigate the electrical transport through a very few molecules connected to metallic electrodes at room temperature. First, the state of the art in molecular electronics is outlined. We present the most convincing molecular devices reported so far in the literature and the theoretical tools available to analyze the electron transport mechanism through a molecular junction. Second, we describe the use of mechanically controllable break junctions to investigate the electron transport properties through a metal-molecule-metal junction. Two kindsof molecules were adsorbed on the two facing gold electrodes, dodecane-thiol (DT) and bis-thiol-ter-thiophene ({alpha},{omega} T3), that are basically expected to behave as an insulator and as a molecular wire, respectively. In the latter case, we study the chemical reactivity of the molecule and show that {alpha},{omega} T3 is chemically adsorbed on gold electrodes. Current-voltage characteristics of the junction were observed at room temperature. The Gold-DT-Gold junction behaves as a simple metal-insulator-metal junction. On the other hand, the electron transport through a Gold-{alpha},{omega} T3-Gold junction explicitly involves the electronic structure of the molecule which gives rise to step-like features in the current-voltage characteristics. The measured zero bias conductance is interpreted using the scattering theory. At high bias, we discuss two different models: a coherent model where the electron has no time to be completely re-localized in the molecule and a sequential model where the electron is localized in the molecule during the transfer. Finally, we show that the mechanical action of decreasing the inter-electrodes spacing can be used to induce a strong modification of the current-voltage characteristics. (author)

The study of the valence bond property in a two-different-quantum-dot molecule

Institute of Scientific and Technical Information of China (English)

王立民; 罗莹; 马本堃

2002-01-01

The electronic energy spectrum and wavefunction of a quantum-dot molecule are studied by means of the finite-element solution of the single electron Schrodinger equation. We find that the nature of the coupling can be covalent,two dots, the height of potential barrier, matching of the energies and parities of the orbital localized on each dot. Thebond property can be used to explain the experimental result obtained by Oosterkamp et al. (1998 Nature 395 873).

Structure of radicals produced by γ radiolysis. Part 4. Adamantane matrices doped with various 5-membered heterocyclic molecules

International Nuclear Information System (INIS)

Winters, D.L.; Ling, A.C.

1976-01-01

The effects of γ-radiolysis at room temperature on adamantane and adamantane-d 16 matrices doped with 5-membered heterocyclic molecules has been examined by X-band electron spin resonance (esr) spectrometry. Radical structures formed from heterocyclic solute molecules are discussed and tentative assignments made. Discussion of possible radical structures derived from selected heterocyclic compounds is included, but unambiguous assignmens of structure cannot be made for these compounds from the esr data obtained. It was noted that perdeuterated adamantane matrices provided superior resolution for esr spectra derived from radicals with a delocalized spin center such as allyl or allenyl species. (author)

Controlled Bioactive Molecules Delivery Strategies for Tendon and Ligament Tissue Engineering using Polymeric Nanofibers.

Science.gov (United States)

Hiong Teh, Thomas Kok; Hong Goh, James Cho; Toh, Siew Lok

2015-01-01

The interest in polymeric nanofibers has escalated over the past decade given its promise as tissue engineering scaffolds that can mimic the nanoscale structure of the native extracellular matrix. With functionalization of the polymeric nanofibers using bioactive molecules, localized signaling moieties can be established for the attached cells, to stimulate desired biological effects and direct cellular or tissue response. The inherently high surface area per unit mass of polymeric nanofibers can enhance cell adhesion, bioactive molecules loading and release efficiencies, and mass transfer properties. In this review article, the application of polymeric nanofibers for controlled bioactive molecules delivery will be discussed, with a focus on tendon and ligament tissue engineering. Various polymeric materials of different mechanical and degradation properties will be presented along with the nanofiber fabrication techniques explored. The bioactive molecules of interest for tendon and ligament tissue engineering, including growth factors and small molecules, will also be reviewed and compared in terms of their nanofiber incorporation strategies and release profiles. This article will also highlight and compare various innovative strategies to control the release of bioactive molecules spatiotemporally and explore an emerging tissue engineering strategy involving controlled multiple bioactive molecules sequential release. Finally, the review article concludes with challenges and future trends in the innovation and development of bioactive molecules delivery using polymeric nanofibers for tendon and ligament tissue engineering.

Structure determination by photoelectron diffraction of small molecules on surfaces

International Nuclear Information System (INIS)

Booth, N.A.

1998-05-01

The synchrotron radiation based technique of Photoelectron Diffraction (PhD) has been applied to three adsorption systems. Structure determinations, are presented for each system which involve the adsorption of small molecules on the low index {110} plane of single crystal Cu and Ni substrates. For the NH 3 -Cu(110) system PhD was successful in determining a N-Cu bondlength of 2.05 ± 0.03 A as well as values for the anisotropic vibrational amplitudes of the N and an expansion of the 1st to 2nd Cu substrate layer spacing from the bulk value of 0.08 ± 0.08 A. The most significant and surprising structural parameter determined for this system was that the N atom occupies an asymmetric adsorption site. Rather than being situated in the expected high symmetry atop site the N atom was found to be offset parallel to the surface by 0.37 ± 0.12 A in the [001] azimuth. In studying the glycine-Cu(110) system the adsorption structure of an amino-acid has been quantified. The local adsorption geometries of all the atoms involved in the molecule to surface bond have been determined. The glycine molecule is found to be bonded to the surface via both its amino and carboxylate functional groups. The molecule straddles two [11-bar0] rows of the Cu substrate. The two O atoms are found to be in identical sites both approximately atop Cu atoms on the [11-bar0] rows offset parallel to the surface by 0.80 ± 0.05 A in the [001] azimuth, the O-Cu bondlength was found to be 2.03 ± 0.05 A. The N atom was also found to adsorb in an approximately atop geometry but offset parallel to the surface by 0.24 ± 0.10A in the [11-bar0] direction, the N-Cu bondlength was found to be 2.05± 0.05 A. PhD was unsuccessful in determining the positions of the two C atoms that form a bridge between the two functional groups bonded to the surface due to difficulties in separating the two inequivalent contributions to the final intensity modulation function. For the CN-Ni(110) system both PhD and Near Edge

Tertiary Structures of the Escherichia coli and Human Chromosome 21 Molecules of DNA

Czech Academy of Sciences Publication Activity Database

Hanzálek, Petr; Kypr, Jaroslav

2001-01-01

Roč. 283, č. 1 (2001), s. 219-223 ISSN 0006-291X R&D Projects: GA AV ČR IAA5004802 Institutional research plan: CEZ:AV0Z5004920 Keywords : DNA crystal structures * phosphorus atom representation * genomic DNA molecules Subject RIV: BO - Biophysics Impact factor: 2.946, year: 2001

Effects of Magnetic Field on the Valence Bond Property of the Double-Quantum-Dot Molecule

Institute of Scientific and Technical Information of China (English)

王立民; 罗莹; 马本堃

2002-01-01

The effects of the magnetic field on the valence bond property of the double-quantum-dot molecule are numerically studied by the finite element method and perturbation approach because of the absence of cylindrical symmetry in the horizontally coupled dots. The calculation results show that the energy value of the ground state changes differently from that of the first excited state with increasing magnetic field strength, and they cross under a certain magnetic field. The increasing magnetic field makes the covalent bond state change into an ionic bond state, which agrees qualitatively with experimental results and makes ionic bond states remain. The oscillator strength of transition between covalent bond states decreases distinctly with the increasing magnetic field strength, when the molecule is irradiated by polarized light. Such a phenomenon is possibly useful for actual applications.

Micropipet manipulation of lipid membranes: Direct measurement of the material properties of a cohesive structure that is only two molecules thick

Science.gov (United States)

Needham, David

1993-01-01

The objectives are to demonstrate how we can make direct measurements of the mechanical properties of a special structure in biology, namely the lipid bilayer membrane, using a micromanipulation technique, and how these properties compare and contrast with 'more traditional' technological/engineering materials. Given that the investment in equipment and expertise to carry out these experiments is probably beyond the scope of most teaching labs, the described experiment is not intended as one that can actually be demonstrated in a student laboratory class. The intention behind presenting this work is to begin to raise awareness in the Material Science community about the material properties of biological material that form a new (to us) category of soft engineering materials that have dimensions on the nanoscale.

Using nonlinearity and spatiotemporal property modulation to control effective structural properties: dynamic rods

DEFF Research Database (Denmark)

Thomsen, Jon Juel; Blekhman, Iliya I.

2007-01-01

What are the effective properties of a generally nonlinear material or structure, whose local properties are modulated in both space and time? It has been suggested to use spatiotemporal modulation of structural properties to create materials and structures with adjustable effective properties......, and to call these dynamic materials or spatiotemporal composites. Also, according to theoretical predictions, structural nonlinearity enhances the possibilities of achieving specific effective properties. For example, with an elastic rod having cubical elastic nonlinearities, it seems possible to control......, and exemplified. Then simple approximate analytical expressions are derived for the effective wave speed and natural frequencies for one-dimensional wave propagation in a nonlinear elastic rod, where the spatiotemporal modulation is imposed as a high-frequency standing wave, supposed to be given. Finally the more...

Understanding the relationships between molecule structure and imprinting effect of two acetyl-nitrogen heterocyclic compounds.

Science.gov (United States)

Wang, Jian; Dong, Xiao; Xue, Min; Dong, Xuemin; Xu, Zhibin; Meng, Zihui; Luo, Jun

2016-06-01

The molecularly imprinted polymers (MIPs) for two structural analogs, 1,3,5-triacetyl-1,3,5-triazacyclohexane (TRAT) and 1,3,5,7-tetraacetyl-1,3,5,7-tetraazacyclooctane (TAT), have been synthesized respectively under the same conditions. The TAT-MIP showed excellent imprinting effect, whereas the TRAT-MIP did not. To understand the different imprinting effects of the MIPs prepared from these two templates, the geometric structures and energetic properties of complexes formed around TAT and TRAT were studied computationally. The results indicate that in liquid phase, for the complexes formed with TAT and its nearest neighbor molecules, the magnitude of the binding energy increases with the number of surrounding TAT, methacrylic acid, and acetonitrile (ACT), whereas for the cases of TRAT, the magnitude of the binding energy increases with the number of surrounding TRAT and trimethylolpropane trimethacrylate. The studied systems form stronger and thus more stable networks encapsulating TAT than with TRAT. ACT may also play an important role in the polymerization phase in stabilizing the shapes of the cavities that TATs reside in. We propose these as the major factors that affect the different imprinting effects of the two MIPs. Copyright © 2016 John Wiley & Sons, Ltd. Copyright © 2016 John Wiley & Sons, Ltd.

Structure Property Relationships in Organic Conjugated Systems

OpenAIRE

O'Neill, Luke; Lynch, Patrick; McNamara, Mary

2005-01-01

A series of π conjugated oligomers were studied by absorption and photoluminescence spectroscopy. A linear relationship between the positioning of the absorption and photoluminescence maxima plotted against inverse conjugation length is observed. The relationships are in good agreement with the simple particle in a box method, one of the earliest descriptions of the properties of one-dimensional organic molecules. In addition to the electronic transition energies, it was observed that the Sto...

Statistical Exploration of Electronic Structure of Molecules from Quantum Monte-Carlo Simulations

Energy Technology Data Exchange (ETDEWEB)

Prabhat, Mr; Zubarev, Dmitry; Lester, Jr., William A.

2010-12-22

In this report, we present results from analysis of Quantum Monte Carlo (QMC) simulation data with the goal of determining internal structure of a 3N-dimensional phase space of an N-electron molecule. We are interested in mining the simulation data for patterns that might be indicative of the bond rearrangement as molecules change electronic states. We examined simulation output that tracks the positions of two coupled electrons in the singlet and triplet states of an H2 molecule. The electrons trace out a trajectory, which was analyzed with a number of statistical techniques. This project was intended to address the following scientific questions: (1) Do high-dimensional phase spaces characterizing electronic structure of molecules tend to cluster in any natural way? Do we see a change in clustering patterns as we explore different electronic states of the same molecule? (2) Since it is hard to understand the high-dimensional space of trajectories, can we project these trajectories to a lower dimensional subspace to gain a better understanding of patterns? (3) Do trajectories inherently lie in a lower-dimensional manifold? Can we recover that manifold? After extensive statistical analysis, we are now in a better position to respond to these questions. (1) We definitely see clustering patterns, and differences between the H2 and H2tri datasets. These are revealed by the pamk method in a fairly reliable manner and can potentially be used to distinguish bonded and non-bonded systems and get insight into the nature of bonding. (2) Projecting to a lower dimensional subspace ({approx}4-5) using PCA or Kernel PCA reveals interesting patterns in the distribution of scalar values, which can be related to the existing descriptors of electronic structure of molecules. Also, these results can be immediately used to develop robust tools for analysis of noisy data obtained during QMC simulations (3) All dimensionality reduction and estimation techniques that we tried seem to

Silicene-terminated surface of calcium and strontium disilicides: properties and comparison with bulk structures by computational methods

Science.gov (United States)

Brázda, Petr; Mutombo, Pingo; Ondráček, Martin; Corrêa, Cinthia Antunes; Kopeček, Jaromír; Palatinus, Lukáš

2018-05-01

The bulk and surface structures of calcium and strontium disilicides are investigated by computational methods using density functional theory. The investigated structures are R6, R3 and P1-CaSi2 and P1-SrSi2. The investigated properties are the cleavage energy at the silicene sheet, buckling of the bulk and surface silicene layers, charge transfer from calcium to silicon, band structure of bulk and surface-terminated structures and adsorption energies on H atoms and H2 molecules on the silicene-terminated surface of the R3 phase. The cleavage energy at the silicene surface is low in all cases. Structures P1-CaSi2 and R3-CaSi2 contain silicene sheets with different coordination to Ca, while R6-CaSi2 contains both types of the sheets. It is shown that the properties of the two types of silicene-like sheets in R6-CaSi2 are similar to those of the corresponding sheets in P1-CaSi2 and R3-CaSi2, and the thermodynamically stable R6 phase is a good candidate for experimental investigation of silicene-terminated surface in calcium disilicide.

Photonic Molecule Lasers Revisited

Science.gov (United States)

Gagnon, Denis; Dumont, Joey; Déziel, Jean-Luc; Dubé, Louis J.

2014-05-01

Photonic molecules (PMs) formed by coupling two or more optical resonators are ideal candidates for the fabrication of integrated microlasers, photonic molecule lasers. Whereas most calculations on PM lasers have been based on cold-cavity (passive) modes, i.e. quasi-bound states, a recently formulated steady-state ab initio laser theory (SALT) offers the possibility to take into account the spectral properties of the underlying gain transition, its position and linewidth, as well as incorporating an arbitrary pump profile. We will combine two theoretical approaches to characterize the lasing properties of PM lasers: for two-dimensional systems, the generalized Lorenz-Mie theory will obtain the resonant modes of the coupled molecules in an active medium described by SALT. Not only is then the theoretical description more complete, the use of an active medium provides additional parameters to control, engineer and harness the lasing properties of PM lasers for ultra-low threshold and directional single-mode emission. We will extend our recent study and present new results for a number of promising geometries. The authors acknowledge financial support from NSERC (Canada) and the CERC in Photonic Innovations of Y. Messaddeq.

Monodentate Schiff base ligands: their structural characterization, photoluminescence, anticancer, electrochemical and sensor properties.

Science.gov (United States)

Köse, Muhammet; Ceyhan, Gökhan; Tümer, Mehmet; Demirtaş, Ibrahim; Gönül, İlyas; McKee, Vickie

2015-02-25

Two Schiff base compounds, N,N'-bis(2-methoxy phenylidene)-1,5-diamino naphthalene (L(1)) and N,N'-bis(3,4,5-trimethoxy phenylidene)-1,5-diamino naphthalene (L(2)) were synthesized and characterized by the analytical and spectroscopic methods. The electrochemical and photoluminescence properties of the Schiff bases were investigated in the different conditions. The compounds L(1) and L(2) show the reversible redox processes at some potentials. The sensor properties of the Schiff bases were examined and color changes were observed upon addition of the metal cations, such as Hg(II), Cu(II), Co(II) and Al(III). The Schiff base compounds show the bathochromic shift from 545 to 585 nm. The single crystals of the compounds (L(1)) and (L(2)) were obtained from the methanol solution and characterized structurally by the X-ray crystallography technique. The molecule L(2) is centrosymmetric whereas the L(1) has no crystallographically imposed molecular symmetry. However, the molecular structures for these compounds are quite similar, differing principally in the conformation about methoxy groups and the dihedral angle between the two aromatic rings and diamine naphthalene. Copyright © 2014 Elsevier B.V. All rights reserved.

Polarization effects on the electric properties of urea and thiourea molecules in solid phase

International Nuclear Information System (INIS)

Santos, O. L.; Fonseca, T. L.; Sabino, J. R.; Georg, H. C.; Castro, M. A.

2015-01-01

We present theoretical results for the dipole moment, linear polarizability, and first hyperpolarizability of the urea and thiourea molecules in solid phase. The in-crystal electric properties were determined by applying a supermolecule approach in combination with an iterative electrostatic scheme, in which the surrounding molecules are represented by point charges. It is found for both urea and thiourea molecules that the influence of the polarization effects is mild for the linear polarizability, but it is marked for the dipole moment and first hyperpolarizability. The replacement of oxygen atoms by sulfur atoms increases, in general, the electric responses. Our second-order Møller–Plesset perturbation theory based iterative scheme predicts for the in-crystal dipole moment of urea and thiourea the values of 7.54 and 9.19 D which are, respectively, increased by 61% and 58%, in comparison with the corresponding isolated values. The result for urea is in agreement with the available experimental result of 6.56 D. In addition, we present an estimate of macroscopic quantities considering explicit unit cells of urea and thiourea crystals including environment polarization effects. These supermolecule calculations take into account partially the exchange and dispersion effects. The results illustrate the role played by the electrostatic interactions on the static second-order nonlinear susceptibility of the urea crystal

Small molecule solution-processed bulk heterojunction solar cells with inverted structure using porphyrin donor

Science.gov (United States)

Yamamoto, Takaki; Hatano, Junichi; Nakagawa, Takafumi; Yamaguchi, Shigeru; Matsuo, Yutaka

2013-01-01

Utilizing tetraethynyl porphyrin derivative (TE-Por) as a small molecule donor material, we fabricated a small molecule solution-processed bulk heterojunction (BHJ) solar cell with inverted structure, which exhibited 1.6% power conversion efficiency (JSC (short-circuit current) = 4.6 mA/cm2, VOC (open-circuit voltage) = 0.90 V, and FF (fill factor) = 0.39) in the device configuration indium tin oxide/TiOx (titanium sub-oxide)/[6,6]-phenyl-C61-butyric acid methyl ester:TE-Por (5:1)/MoOx (molybdenum sub-oxide)/Au under AM1.5 G illumination at 100 mW/cm2. Without encapsulation, the small molecule solution-processed inverted BHJ solar cell also showed remarkable durability to air, where it kept over 73% of its initial power conversion efficiency after storage for 28 days under ambient atmosphere in the dark.

Smectite flocculation structure modified by Al13 macro-molecules--as revealed by the transmission X-ray microscopy (TXM).

Science.gov (United States)

Zbik, Marek S; Martens, Wayde N; Frost, Ray L; Song, Yen-Fang; Chen, Yi-Ming; Chen, Jian-Hua

2010-05-01

The aggregate structure which occurs in aqueous smectitic suspensions is responsible for poor water clarification, difficulties in sludge dewatering and the unusual rheological behaviour of smectite rich soils. These macroscopic properties are dictated by the 3D structural arrangement of smectite finest fraction within flocculated aggregates. Here, we report results from a relatively new technique, transmission X-ray microscopy (TXM), which makes it possible to investigate the internal structure and 3D tomographic reconstruction of the smectite clay aggregates modified by Al(13) Keggin macro-molecule [Al(13)(O)(4)(OH)(24)(H(2)O)(12)](7+). Three different treatment methods were shown resulted in three different micro-structural environments of the resulting flocculation. In case of smectite sample prepared in Methods 1 and 3 particles fall into the primary minimum where Van der Waals forces act between FF oriented smectite flakes and aggregates become approach irreversible flocculation. In case of sample prepared using Method 2, particles contacting by edges (EE) and edge to face (EF) orientation fell into secondary minimum and weak flocculation resulted in severe gelation and formation of the micelle-like texture in fringe superstructure, which was first time observed in smectite based gel. Copyright 2010 Elsevier Inc. All rights reserved.

Structure and Properties of Compressed Borate Glasses

DEFF Research Database (Denmark)

Smedskjær, Morten Mattrup; Bauer, U.; Behrens, H.

While the influence of thermal history on the structure and properties of glasses has been thoroughly studied in the past century, the influence of pressure history has received considerably less attention. In this study, we investigate the pressure-induced changes in structure and properties in ......, hardness and crack formation from nanoindentation experiments, and overshoot in isobaric heat capacity from DSC experiments at ambient pressure. The influence of the initial boron speciation on the degree of changes in structure and properties will also be discussed....

The effect of hot multistage drawing on molecular structure and optical properties of polyethylene terephthalate fibers

Directory of Open Access Journals (Sweden)

Aminoddin Haji

2012-08-01

Full Text Available In this work, mechanical and structural parameters related to the optical properties of polyethylene terephthalate (PET fibers drawn at hot multistage have been investigated. The changes in optical parameters upon changing draw ratio are used to obtain the mechanical orientation factors and , various orientation functions f2(θ, f4(θ and f6(θ, and amorphous and crystalline orientation functions (f a and f c. Also, the numbers of random links between the network junction points (N1, the average optical orientation (Fav, and the distribution function of segment ω(cos θ were calculated. In addition, an empirical formula was suggested to correlate changes in the birefringence with the draw ratio and its constants were determined. The study demonstrated change on the molecular orientation functions and structural parameters upon hot multistage drawing. Significant variations in the characteristic properties of the drawn PET fibers were due to reorientation of the molecules caused by applied heat and external tension.

Single-molecule detection of dihydroazulene photo-thermal reaction using break junction technique

Science.gov (United States)

Huang, Cancan; Jevric, Martyn; Borges, Anders; Olsen, Stine T.; Hamill, Joseph M.; Zheng, Jue-Ting; Yang, Yang; Rudnev, Alexander; Baghernejad, Masoud; Broekmann, Peter; Petersen, Anne Ugleholdt; Wandlowski, Thomas; Mikkelsen, Kurt V.; Solomon, Gemma C.; Brøndsted Nielsen, Mogens; Hong, Wenjing

2017-05-01

Charge transport by tunnelling is one of the most ubiquitous elementary processes in nature. Small structural changes in a molecular junction can lead to significant difference in the single-molecule electronic properties, offering a tremendous opportunity to examine a reaction on the single-molecule scale by monitoring the conductance changes. Here, we explore the potential of the single-molecule break junction technique in the detection of photo-thermal reaction processes of a photochromic dihydroazulene/vinylheptafulvene system. Statistical analysis of the break junction experiments provides a quantitative approach for probing the reaction kinetics and reversibility, including the occurrence of isomerization during the reaction. The product ratios observed when switching the system in the junction does not follow those observed in solution studies (both experiment and theory), suggesting that the junction environment was perturbing the process significantly. This study opens the possibility of using nano-structured environments like molecular junctions to tailor product ratios in chemical reactions.

A first-principles study of gas molecule adsorption on borophene

Directory of Open Access Journals (Sweden)

Tingting Liu

2017-12-01

Full Text Available Borophene, a new two-dimensional material, was recently synthesized. The unique anisotropic structure and excellent properties of borophene have attracted considerable research interest. This paper presents a first-principles study of the adsorption of gas molecules (CO, CO2, NH3, NO, NO2 and CH4 on borophene. The adsorption configurations, adsorption energies and electronic properties of the gas molecules absorpted on borophene are determined, and the mechanisms of the interactions between the gas molecules and borophene are evaluated. We find that CO, CO2, NH3, NO and NO2 are chemisorbed on borophene, while CH4 is physisorbed on borophene. Furthermore, our calculation also indicate that CO and CO2 are chemisorbed on borophene with moderate adsorption energy and NO, NO2 and NH3 are chemisorbed on borophene via strong covalent bonds. Moreover, CO is found as an electron donor, while CO2 an electron acceptor. The chemisorption of CO and CO2 on borophene increases the electrical conductivity, so It seems that borophene has the potential to be used in high-sensitivity CO and CO2 gas sensors.

A semantic web ontology for small molecules and their biological targets.

Science.gov (United States)

Choi, Jooyoung; Davis, Melissa J; Newman, Andrew F; Ragan, Mark A

2010-05-24

A wide range of data on sequences, structures, pathways, and networks of genes and gene products is available for hypothesis testing and discovery in biological and biomedical research. However, data describing the physical, chemical, and biological properties of small molecules have not been well-integrated with these resources. Semantically rich representations of chemical data, combined with Semantic Web technologies, have the potential to enable the integration of small molecule and biomolecular data resources, expanding the scope and power of biomedical and pharmacological research. We employed the Semantic Web technologies Resource Description Framework (RDF) and Web Ontology Language (OWL) to generate a Small Molecule Ontology (SMO) that represents concepts and provides unique identifiers for biologically relevant properties of small molecules and their interactions with biomolecules, such as proteins. We instanced SMO using data from three public data sources, i.e., DrugBank, PubChem and UniProt, and converted to RDF triples. Evaluation of SMO by use of predetermined competency questions implemented as SPARQL queries demonstrated that data from chemical and biomolecular data sources were effectively represented and that useful knowledge can be extracted. These results illustrate the potential of Semantic Web technologies in chemical, biological, and pharmacological research and in drug discovery.

Quantum interference experiments with complex organic molecules

International Nuclear Information System (INIS)

Eibenberger, S. I.

2015-01-01

Matter-wave interference with complex particles is a thriving field in experimental quantum physics. The quest for testing the quantum superposition principle with highly complex molecules has motivated the development of the Kapitza-Dirac-Talbot-Lau interferometer (KDTLI). This interferometer has enabled quantum interference with large organic molecules in an unprecedented mass regime. In this doctoral thesis I describe quantum superposition experiments which we were able to successfully realize with molecules of masses beyond 10 000 amu and consisting of more than 800 atoms. The typical de Broglie wavelengths of all particles in this thesis are in the order of 0.3-5 pm. This is significantly smaller than any molecular extension (nanometers) or the delocalization length in our interferometer (hundreds of nanometers). Many vibrational and rotational states are populated since the molecules are thermally highly excited (300-1000 K). And yet, high-contrast quantum interference patterns could be observed. The visibility and position of these matter-wave interference patterns is highly sensitive to external perturbations. This sensitivity has opened the path to extensive studies of the influence of internal molecular properties on the coherence of their associated matter waves. In addition, it enables a new approach to quantum-assisted metrology. Quantum interference imprints a high-contrast nano-structured density pattern onto the molecular beam which allows us to resolve tiny shifts and dephasing of the molecular beam. I describe how KDTL interferometry can be used to investigate a number of different molecular properties. We have studied vibrationally-induced conformational changes of floppy molecules and permanent electric dipole moments using matter-wave deflectometry in an external electric field. We have developed a new method for optical absorption spectroscopy which uses the recoil of the molecules upon absorption of individual photons. This allows us to

Redox properties of structural Fe in clay minerals: 3. Relationships between smectite redox and structural properties.

Science.gov (United States)

Gorski, Christopher A; Klüpfel, Laura E; Voegelin, Andreas; Sander, Michael; Hofstetter, Thomas B

2013-01-01

Structural Fe in clay minerals is an important redox-active species in many pristine and contaminated environments as well as in engineered systems. Understanding the extent and kinetics of redox reactions involving Fe-bearing clay minerals has been challenging due to the inability to relate structural Fe(2+)/Fe(total) fractions to fundamental redox properties, such as reduction potentials (EH). Here, we overcame this challenge by using mediated electrochemical reduction (MER) and oxidation (MEO) to characterize the fraction of redox-active structural Fe (Fe(2+)/Fe(total)) in smectites over a wide range of applied EH-values (-0.6 V to +0.6 V). We examined Fe(2+)/Fe(total )- EH relationships of four natural Fe-bearing smectites (SWy-2, SWa-1, NAu-1, NAu-2) in their native, reduced, and reoxidized states and compared our measurements with spectroscopic observations and a suite of mineralogical properties. All smectites exhibited unique Fe(2+)/Fe(total) - EH relationships, were redox active over wide EH ranges, and underwent irreversible electron transfer induced structural changes that were observable with X-ray absorption spectroscopy. Variations among the smectite Fe(2+)/Fe(total) - EH relationships correlated well with both bulk and molecular-scale properties, including Fe(total) content, layer charge, and quadrupole splitting values, suggesting that multiple structural parameters determined the redox properties of smectites. The Fe(2+)/Fe(total) - EH relationships developed for these four commonly studied clay minerals may be applied to future studies interested in relating the extent of structural Fe reduction or oxidation to EH-values.

Quantitative structure-property relationship study of n-octanol-water partition coefficients of some of diverse drugs using multiple linear regression

International Nuclear Information System (INIS)

Ghasemi, Jahanbakhsh; Saaidpour, Saadi

2007-01-01

A quantitative structure-property relationship (QSPR) study was performed to develop models those relate the structures of 150 drug organic compounds to their n-octanol-water partition coefficients (log P o/w ). Molecular descriptors derived solely from 3D structures of the molecular drugs. A genetic algorithm was also applied as a variable selection tool in QSPR analysis. The models were constructed using 110 molecules as training set, and predictive ability tested using 40 compounds. Modeling of log P o/w of these compounds as a function of the theoretically derived descriptors was established by multiple linear regression (MLR). Four descriptors for these compounds molecular volume (MV) (geometrical), hydrophilic-lipophilic balance (HLB) (constitutional), hydrogen bond forming ability (HB) (electronic) and polar surface area (PSA) (electrostatic) are taken as inputs for the model. The use of descriptors calculated only from molecular structure eliminates the need for experimental determination of properties for use in the correlation and allows for the estimation of log P o/w for molecules not yet synthesized. Application of the developed model to a testing set of 40 drug organic compounds demonstrates that the model is reliable with good predictive accuracy and simple formulation. The prediction results are in good agreement with the experimental value. The root mean square error of prediction (RMSEP) and square correlation coefficient (R 2 ) for MLR model were 0.22 and 0.99 for the prediction set log P o/w

Dynamics, Miscibility, and Morphology in Polymer-Molecule Blends: The Impact of Chemical Functionality

KAUST Repository

Do, Khanh

2015-10-22

In the quest to improve the performance of organic bulk-heterojunction solar cells, many recent efforts have focused on developing molecular and polymer alternatives to commonly used fullerene acceptors. Here, molecular dynamics simulations are used to investigate polymer-molecule blends comprised of the polymer donor poly(3-hexylthiophene) (P3HT) with a series of acceptors based on trialkylsilylethynyl-substituted pentacene. A matrix of nine pentacene derivatives, consisting of systematic chemical variation both in the nature of the alkyl groups and electron-withdrawing moieties appended to the acene, is used to draw connections between the chemical structure of the acene acceptor and the nanoscale properties of the polymer-molecule blend. These connections include polymer and molecular diffusivity, donor-acceptor packing and interfacial (contact) area, and miscibility. The results point to the very significant role that seemingly modest changes in chemical structure play during the formation of polymer-molecule blend morphologies.

Dynamics, Miscibility, and Morphology in Polymer-Molecule Blends: The Impact of Chemical Functionality

KAUST Repository

Do, Khanh; Risko, Chad; Anthony, John E; Amassian, Aram; Bredas, Jean-Luc

2015-01-01

In the quest to improve the performance of organic bulk-heterojunction solar cells, many recent efforts have focused on developing molecular and polymer alternatives to commonly used fullerene acceptors. Here, molecular dynamics simulations are used to investigate polymer-molecule blends comprised of the polymer donor poly(3-hexylthiophene) (P3HT) with a series of acceptors based on trialkylsilylethynyl-substituted pentacene. A matrix of nine pentacene derivatives, consisting of systematic chemical variation both in the nature of the alkyl groups and electron-withdrawing moieties appended to the acene, is used to draw connections between the chemical structure of the acene acceptor and the nanoscale properties of the polymer-molecule blend. These connections include polymer and molecular diffusivity, donor-acceptor packing and interfacial (contact) area, and miscibility. The results point to the very significant role that seemingly modest changes in chemical structure play during the formation of polymer-molecule blend morphologies.

Cavity mutants of Savinase. Crystal structures and differential scanning calorimetry experiments give hints of the function of the buried water molecules in subtilisins.

Science.gov (United States)

Pedersen, J T; Olsen, O H; Betzel, C; Eschenburg, S; Branner, S; Hastrup, S

1994-09-23

The subtilisin molecule possesses several internal water molecules, which may be characterised as an integral part of the protein structure. We have introduced specific mutations (T71I, T71S, T71V, T71A and T71G) at position 71 in the subtilisin variant Savinase from Bacillus lentus. This position is involved in a hydrogen bonded network with several internal water molecules, forming a water channel. The water channel and most of the other internal water molecules are positioned in the interface between two half-domains of the subtilisin molecule. The data presented here indicate that the internal water molecules are structural, and may be the result of trapping during the folding process.

Composition-structure-property relation of oxide glasses

DEFF Research Database (Denmark)

Hermansen, Christian

also increases such properties. Yet, these rules are not strictly followed even for the simplest binary oxide glasses, such as alkali silicates, borates and phosphates. In this thesis it is argued that the missing link between composition and properties is the glass structure. Structural models...... are proposed based on topological selection rules and experimentally verified. The relation between structure and properties is evaluated using topological constraint theory, which in its essence is a theory that quantifies the two intuitions of the glass scientist. The end result is a quantitative model...

RaptorX-Property: a web server for protein structure property prediction.

Science.gov (United States)

Wang, Sheng; Li, Wei; Liu, Shiwang; Xu, Jinbo

2016-07-08

RaptorX Property (http://raptorx2.uchicago.edu/StructurePropertyPred/predict/) is a web server predicting structure property of a protein sequence without using any templates. It outperforms other servers, especially for proteins without close homologs in PDB or with very sparse sequence profile (i.e. carries little evolutionary information). This server employs a powerful in-house deep learning model DeepCNF (Deep Convolutional Neural Fields) to predict secondary structure (SS), solvent accessibility (ACC) and disorder regions (DISO). DeepCNF not only models complex sequence-structure relationship by a deep hierarchical architecture, but also interdependency between adjacent property labels. Our experimental results show that, tested on CASP10, CASP11 and the other benchmarks, this server can obtain ∼84% Q3 accuracy for 3-state SS, ∼72% Q8 accuracy for 8-state SS, ∼66% Q3 accuracy for 3-state solvent accessibility, and ∼0.89 area under the ROC curve (AUC) for disorder prediction. © The Author(s) 2016. Published by Oxford University Press on behalf of Nucleic Acids Research.

Nonadiabatic dynamics of electron injection into organic molecules

International Nuclear Information System (INIS)

Zhu Li-Ping; Qiu Yu; Tong Guo-Ping

2012-01-01

We numerically investigate the injection process of electrons from metal electrodes to one-dimensional organic molecules by combining the extended Su—Schrieffer—Heeger (SSH) model with a nonadiabatic dynamics method. It is found that a match between the Fermi level of electrodes and the highest occupied molecular orbital (HOMO) or the lowest unoccupied molecular orbital (LUMO) of organic molecules can be greatly affected by the length of the organic chains, which has a great impact on electron injection. The correlation between oligomers and electrodes is found to open more efficient channels for electron injection as compared with that in polymer/electrode structures. For oligomer/electrode structures, we show that the Schottky barrier essentially does not affect the electron injection as the electrode work function is smaller than a critical value. This means that the Schottky barrier is pinned for a small work-function electrode. For polymer/electrode structures, we find that it is possible for the Fermi level of electrodes to be pinned to the polaronic level. The condition under which the Fermi level of electrodes exceeds the polaronic level of polymers is shown to not always lead to spontaneous electron transfer from electrodes to polymers. (condensed matter: electronic structure, electrical, magnetic, and optical properties)

Influence of residual composition on the structure and properties of extracellular matrix derived hydrogels.

Science.gov (United States)

Claudio-Rizo, Jesús A; Rangel-Argote, Magdalena; Castellano, Laura E; Delgado, Jorge; Mata-Mata, José L; Mendoza-Novelo, Birzabith

2017-10-01

In this work, hydrolysates of extracellular matrix (hECM) were obtained from rat tail tendon (TR), bovine Achilles tendon (TAB), porcine small intestinal submucosa (SIS) and bovine pericardium (PB), and they were polymerized to generate ECM hydrogels. The composition of hECM was evaluated by quantifying the content of sulphated glycosaminoglycans (sGAG), fibronectin and laminin. The polymerization process, structure, physicochemical properties, in vitro degradation and biocompatibility were studied and related to their composition. The results indicated that the hECM derived from SIS and PB were significantly richer in sGAG, fibronectin and laminin, than those derived from TAB and TR. These differences in hECM composition influenced the polymerization and the structural characteristics of the fibrillar gel network. Consequently, the swelling, mechanics and degradation of the hydrogels showed a direct relationship with the remaining composition. Moreover, the cytocompatibility and the secretion of transforming growth factor beta-1 (TGF-β1) by macrophages were enhanced in hydrogels with the highest residual content of ECM biomolecules. The results of this work evidenced the role of the ECM molecules remaining after both decellularization and hydrolysis steps to produce tissue derived hydrogels with structure and properties tailored to enhance their performance in tissue engineering and regenerative medicine applications. Copyright © 2017 Elsevier B.V. All rights reserved.

The nano-science of C60 molecule

International Nuclear Information System (INIS)

Rafii-Tabar, H.

2002-01-01

Over the past few years, nano-science and its associated nano-technology have emerged into prominence in research institutions across the world. They have brought about new scientific and engineering paradigms, allowing for the manipulation of single atoms and molecules, designing and fabricating new materials, atom-by-atom, and devices that operate on significantly reduced time and length scales. One important area of research in nano-science and nano technology is carbon-based physics in the form of fullerene physics. The C 6 0 molecule, and other cage-like fullerenes, together with carbon nano tubes provide objects that can be combined to generate three-dimensional functional structures for use in the anticipated nano-technology of future. The unique properties of C 6 0 can also be exploited in designing nano-phase thin films with applications in nano-scope device technology and processes such as nano-lithography. This requires a deep understanding of the highly complex process of adsorption of this molecule on a variety of substrates. We review the field of nano-scale nucleation and growth of C 6 0 molecules on some of the technologically important substrates. In addition to experimental results, the results of a set of highly accurate computational simulations are also reported

Quantum dot molecules

CERN Document Server

Wu, Jiang

2014-01-01

This book reviews recent advances in the exciting and rapidly growing field of quantum dot molecules (QDMs). It offers state-of-the-art coverage of novel techniques and connects fundamental physical properties with device design.

Electronic structure of the Fe2 molecule in the local-spin-density approximation

International Nuclear Information System (INIS)

Dhar, S.; Kestner, N.R.

1988-01-01

Ab initio self-consistent all-electron spin-polarized calculations have been performed for the ground-state properties of the Fe 2 molecule using the local-spin-density approximation. A Gaussian orbital basis is employed and all the two-electron integrals are evaluated analytically. The matrix elements of the exchange-correlation potential are computed numerically. The total energy, the binding energy, the equilibrium distance, vibrational frequency, and the ground-state configurations are reported and compared with other calculations and experimental results

Assembling Metal Ions Induced Cyanide-Bridged Heterometallic 1D and Ion-Pair Complexes: Synthesis, Crystal Structures and Magnetic Properties

International Nuclear Information System (INIS)

Kong, Lingqian; Zhao, Zengdian; Chen, Kexun; Wang, Ping; Zhang, Daopeng

2013-01-01

We obtained a heterobimetallic one-dimensional cyanide-bridged Mn(II)-Ni(II) complex and an Co(III)-Ni(II) ion-pair complex with [Ni(CN) 4 ] 2- as building block and M(II)-phenanthroline (M = Mn, Co) compounds as assembling segment. The different structural types of complexes 1 and 2 indicate that the property of the metal ions the assembling segment contained have obvious influence on the structure of the cyanide-bridged complex. Investigation over the magnetic properties of complex 1 reveals an overall weak antiferromagnetic coupling between the adjacent Mn(II) ions bridged by the antiferromagnetic [-NC-Ni-CN-] unit. Among of all the molecular magnetism systems, for the well known reasons, cyanide-containing complexes have been widely employed as bridges to assemble homo/hetero-metallic molecular magnetic materials by using the cyanide bridge transferring magnetic coupling between the neighboring paramagnetic ions, in whichsome showed interesting magnetic properties, such as high-Tc magnets, spin crossover materials, single-molecule magnets (SMMs) and single-chain magnets (SCMs)

The [Fe(III)[Fe(III)(L1)2]3] star-type single-molecule magnet.

Science.gov (United States)

Saalfrank, Rolf W; Scheurer, Andreas; Bernt, Ingo; Heinemann, Frank W; Postnikov, Andrei V; Schünemann, Volker; Trautwein, Alfred X; Alam, Mohammad S; Rupp, Holger; Müller, Paul

2006-06-21

Star-shaped complex [Fe(III)[Fe(III)(L1)2]3] (3) was synthesized starting from N-methyldiethanolamine H2L1 (1) and ferric chloride in the presence of sodium hydride. For 3, two different high-spin iron(III) ion sites were confirmed by Mössbauer spectroscopy at 77 K. Single-crystal X-ray structure determination revealed that 3 crystallizes with four molecules of chloroform, but, with only three molecules of dichloromethane. The unit cell of 3.4CHCl3 contains the enantiomers (delta)-[(S,S)(R,R)(R,R)] and (lambda)-[(R,R)(S,S)(S,S)], whereas in case of 3.3CH2Cl2 four independent molecules, forming pairs of the enantiomers [lambda-(R,R)(R,R)(R,R)]-3 and [lambda-(S,S)(S,S)(S,S)]-3, were observed in the unit cell. According to SQUID measurements, the antiferromagnetic intramolecular coupling of the iron(III) ions in 3 results in a S = 10/2 ground state multiplet. The anisotropy is of the easy-axis type. EPR measurements enabled an accurate determination of the ligand-field splitting parameters. The ferric star 3 is a single-molecule magnet (SMM) and shows hysteretic magnetization characteristics below a blocking temperature of about 1.2 K. However, weak intermolecular couplings, mediated in a chainlike fashion via solvent molecules, have a strong influence on the magnetic properties. Scanning tunneling microscopy (STM) and scanning tunneling spectroscopy (STS) were used to determine the structural and electronic properties of star-type tetranuclear iron(III) complex 3. The molecules were deposited onto highly ordered pyrolytic graphite (HOPG). Small, regular molecule clusters, two-dimensional monolayers as well as separated single molecules were observed. In our STS measurements we found a rather large contrast at the expected locations of the metal centers of the molecules. This direct addressing of the metal centers was confirmed by DFT calculations.