WorldWideScience

Sample records for molecules structures properties

  1. Structure and hydrodynamic properties of plectin molecules.

    Science.gov (United States)

    Foisner, R; Wiche, G

    1987-12-05

    Plectin is a cytoskeletal, high molecular weight protein of widespread and abundant occurrence in cultured cells and tissues. To study its molecular structure, the protein was purified from rat glioma C6 cells and subjected to chemical and biophysical analyses. Plectin's polypeptide chains have an apparent molecular weight of 300,000, as shown by one-dimensional sodium dodecyl sulfate/polyacrylamide electrophoresis. Cross-linking of non-denatured plectin in solution with dimethyl suberimidate and electrophoretic analyses on sodium dodecyl sulfate/agarose gels revealed that the predominant soluble plectin species was a molecule of 1200 X 10(3) Mr consisting of four 300 X 10(3) Mr polypeptide chains. Hydrodynamic properties of plectin in solution were obtained by sedimentation velocity centrifugation and high-pressure liquid chromatography analysis yielding a sedimentation coefficient of 10 S and a Stokes radius of 27 nm. The high f/fmin ratio of 4.0 indicated a very elongated shape of plectin molecules and an axial ratio of about 50. Shadowing and negative staining electron microscopy of plectin molecules revealed multiple domains: a rigid rod of 184 nm in length and 2 nm in diameter, and two globular heads of 9 nm diameter at each end of the rod. Circular dichroism spectra suggested a composition of 30% alpha-helix, 9% beta-structure and 61% random coil or aperiodic structure. The rod-like shape, the alpha-helix content as well as the thermal transition within a midpoint of 45 degrees C and the transition enthalpy (168 kJ/mol) of secondary structure suggested a double-stranded, alpha-helical coiled coil rod domain. Based on the available data, we favor a model of native plectin as a dumb-bell-like association of four 300 X 10(3) Mr polypeptide chains. Electron microscopy and turbidity measurements showed that plectin molecules self-associate into various oligomeric states in solutions of nearly physiological ionic strength. These interactions apparently involved

  2. Structure and transport properties of atomic chains and molecules

    DEFF Research Database (Denmark)

    Strange, Mikkel

    2008-01-01

    general in the literature, a set of benchmark calculations for the Kohn-Sham elastic transmission function of representative single-molecule junctions has been performed. The transmission functions are calculated using two different density functional theory methods, namely an ultrasoft pseudopotential...... by direct visualization of Kohn-Sham eigenchannel states. The possibility of non-carbon based nanotubes is also discussed. Both calculations of the strain energy of infinite PtO2 nanotubes that this material could be a candidate for non-carbon based nanotubes, as was recently suggested [6]....

  3. The Atom in a Molecule: Implications for Molecular Structure and Properties

    Science.gov (United States)

    2016-05-23

    Briefing Charts 3. DATES COVERED (From - To) 01 February 2016 – 23 May 2016 4. TITLE AND SUBTITLE The atom in a molecule: Implications for molecular...For presentation at American Physical Society - Division of Atomic , Molecular, and Optical Physics (May 2016) PA Case Number: #16075; Clearance Date...10 Energy (eV) R C--H (au) R C--H(au) The Atom in a Molecule: Implications for Molecular Structures and Properties P. W. Langhoff, Chemistry

  4. Insights into the role of protein molecule size and structure on interfacial properties using designed sequences

    Science.gov (United States)

    Dwyer, Mirjana Dimitrijev; He, Lizhong; James, Michael; Nelson, Andrew; Middelberg, Anton P. J.

    2013-01-01

    Mixtures of a large, structured protein with a smaller, unstructured component are inherently complex and hard to characterize at interfaces, leading to difficulties in understanding their interfacial behaviours and, therefore, formulation optimization. Here, we investigated interfacial properties of such a mixed system. Simplicity was achieved using designed sequences in which chemical differences had been eliminated to isolate the effect of molecular size and structure, namely a short unstructured peptide (DAMP1) and its longer structured protein concatamer (DAMP4). Interfacial tension measurements suggested that the size and bulk structuring of the larger molecule led to much slower adsorption kinetics. Neutron reflectometry at equilibrium revealed that both molecules adsorbed as a monolayer to the air–water interface (indicating unfolding of DAMP4 to give a chain of four connected DAMP1 molecules), with a concentration ratio equal to that in the bulk. This suggests the overall free energy of adsorption is equal despite differences in size and bulk structure. At small interfacial extensional strains, only molecule packing influenced the stress response. At larger strains, the effect of size became apparent, with DAMP4 registering a higher stress response and interfacial elasticity. When both components were present at the interface, most stress-dissipating movement was achieved by DAMP1. This work thus provides insights into the role of proteins' molecular size and structure on their interfacial properties, and the designed sequences introduced here can serve as effective tools for interfacial studies of proteins and polymers. PMID:23303222

  5. Structural and electronic properties of single molecules and organic layers on surfaces

    NARCIS (Netherlands)

    Sotthewes, Kai

    2016-01-01

    Single molecules and organic layers on well-defined solid surfaces have attracted tremendous attention owing to their interesting physical and chemical properties. The ultimate utility of single molecules or self-assembled monolayers (SAMs) for potential applications is critically dependent on the

  6. Thermodynamic Stability of Structure H Hydrates Based on the Molecular Properties of Large Guest Molecules

    OpenAIRE

    Tezuka, Kyoichi; Taguchi, Tatsuhiko; Alavi, Saman; Sum, Amadeu K.; Ohmura, Ryo

    2012-01-01

    This paper report analyses of thermodynamic stability of structure-H clathrate hydrates formed with methane and large guest molecules in terms of their gas phase molecular sizes and molar masses for the selection of a large guest molecule providing better hydrate stability. We investigated the correlation among the gas phase molecular sizes, the molar masses of large molecule guest substances, and the equilibrium pressures. The results suggest that there exists a molecular-size value for the ...

  7. Synthesis, Optical and Structural Properties of Copper Sulfide Nanocrystals from Single Molecule Precursors

    Directory of Open Access Journals (Sweden)

    Peter A. Ajibade

    2017-02-01

    Full Text Available We report the synthesis and structural studies of copper sulfide nanocrystals from copper (II dithiocarbamate single molecule precursors. The precursors were thermolysed in hexadecylamine (HDA to prepare HDA-capped CuS nanocrystals. The optical properties of the nanocrystals studied using UV–visible and photoluminescence spectroscopy showed absorption band edges at 287 nm that are blue shifted, and the photoluminescence spectra show emission curves that are red-shifted with respect to the absorption band edges. These shifts are as a result of the small crystallite sizes of the nanoparticles leading to quantum size effects. The structural studies were carried out using powder X-ray diffraction (XRD, transmission electron microscopy (TEM, scanning electron microscopy (SEM, energy dispersive X-ray spectroscopy (EDS, and atomic force microscopy. The XRD patterns indicates that the CuS nanocrystals are in hexagonal covellite crystalline phases with estimated particles sizes of 17.3–18.6 nm. The TEM images showed particles with almost spherical or rod shapes, with average crystallite sizes of 3–9.8 nm. SEM images showed morphology with ball-like microspheres on the surfaces, and EDS spectra confirmed the presence of CuS nanoparticles.

  8. Stability, structural and electronic properties of benzene molecule adsorbed on free standing Au layer

    Energy Technology Data Exchange (ETDEWEB)

    Katoch, Neha, E-mail: nehakatoch2@gmail.com; Kapoor, Pooja; Sharma, Munish; Ahluwalia, P. K. [Physics Department, Himachal Pradesh University, Shimla, Himachal Pradesh, India 171005 (India); Kumar, Ashok [Center for Physical Sciences, School of Basic and Applied Sciences, Central University of Punjab, Bathinda, India, 151001 (India)

    2016-05-23

    We report stability and electronic properties of benzene molecule adsorbed on the Au atomic layer within the framework of density function theory (DFT). Horizontal configuration of benzene on the top site of Au monolayer prefers energetically over other studied configurations. On the adsorption of benzene, the ballistic conductance of Au monolayer is found to decrease from 4G{sub 0} to 2G{sub 0} suggesting its applications for the fabrications of organic sensor devices based on the Au atomic layers.

  9. Microhydration effect on structural, energetic and light scattering properties of first branched interstellar molecule ( i-PrCN)

    OpenAIRE

    Chakraborty, Sumana; Routh, Swati; Krishnappa, Madhu

    2015-01-01

    In this work, we have focused on microsolvation of isopropyl cyanide (i-PrCN) as isopropyl cyanide has been recently detected in interstellar space and is of great importance from the astrochemical and bio-chemical point of view for its branching carbon chains. Such branches are needed for many molecules crucial to life, such as the amino acids that build proteins. The phenomenon of the formation of hydrogen bond affects structure, energetic and electric properties of microhydrated isopropyl ...

  10. Synthesis, X-ray Structure, Optical, and Electrochemical Properties of a White-Light-Emitting Molecule

    Directory of Open Access Journals (Sweden)

    Jiun-Wei Hu

    2016-01-01

    Full Text Available A new white-light-emitting molecule (1 was synthesized and characterized by NMR spectroscopy, high resolution mass spectrometry, and single-crystal X-ray diffraction. Compound 1 crystallizes in the orthorhombic space group Pnma, with a = 12.6814(6, b = 7.0824(4, c = 17.4628(9 Å, α = 90°, β = 90°, γ = 90°. In the crystal, molecules are linked by weak intermolecular C-H···O hydrogen bonds, forming an infinite chain along [100], generating a C(10 motif. Compound 1 possesses an intramolecular six-membered-ring hydrogen bond, from which excited-state intramolecular proton transfer (ESIPT takes place from the phenolic proton to the carbonyl oxygen, resulting in a tautomer that is in equilibrium with the normal species, exhibiting a dual emission that covers almost all of the visible spectrum and consequently generates white light. It exhibits one irreversible one-electron oxidation and two irreversible one-electron reductions in dichloromethane at modest potentials. Furthermore, the geometric structures, frontier molecular orbitals (MOs, and the potential energy curves (PECs for 1 in the ground and the first singlet excited state were fully rationalized by density functional theory (DFT and time-dependent DFT calculations. The results demonstrate that the forward and backward ESIPT may happen on a similar timescale, enabling the excited-state equilibrium to be established.

  11. The effect of spatial confinement on the noble-gas HArF molecule: structure and electric properties

    International Nuclear Information System (INIS)

    Kozłowska, Justyna; Bartkowiak, Wojciech

    2014-01-01

    Highlights: • The structure and electrical properties of HArF in spatial confinement are analyzed. • Orbital compression leads to decrease of bond lengths in the HArF molecule. • Spatial restriction causes a drop of the molecular (hyper)polarizabilities. • Spatial confinement reduces the electron correlation contribution to μ, α and β. - Abstract: A systematic study on the dipole moment and (hyper)polarizabilities of argon fluorohydride under spatial restriction was performed. Detailed analysis of the confinement induced changes in the structure of HArF is also presented. In order to render the influence of chemical compression on the properties in question a two-dimensional harmonic oscillator potential, mimicking a cylindrical confinement, was applied. Through the comparison of the results obtained for HArF with those of HF the effect of Ar insertion on the above properties was discussed. A hierarchy of ab initio methods including HF, MP2, CCSD and CCSD(T), has been employed to investigate the effect of orbital compression on the electron correlation contribution to the studied electric properties. It was observed that the external confining potential modifies the electronic contributions to the dipole moment and (hyper)polarizabilities of HArF. In particular, the first hyperpolarizability of HArF is remarkably smaller than that of the unconfined HArF molecule

  12. The effect of spatial confinement on the noble-gas HArF molecule: structure and electric properties

    Energy Technology Data Exchange (ETDEWEB)

    Kozłowska, Justyna; Bartkowiak, Wojciech, E-mail: wojciech.bartkowiak@pwr.edu.pl

    2014-09-30

    Highlights: • The structure and electrical properties of HArF in spatial confinement are analyzed. • Orbital compression leads to decrease of bond lengths in the HArF molecule. • Spatial restriction causes a drop of the molecular (hyper)polarizabilities. • Spatial confinement reduces the electron correlation contribution to μ, α and β. - Abstract: A systematic study on the dipole moment and (hyper)polarizabilities of argon fluorohydride under spatial restriction was performed. Detailed analysis of the confinement induced changes in the structure of HArF is also presented. In order to render the influence of chemical compression on the properties in question a two-dimensional harmonic oscillator potential, mimicking a cylindrical confinement, was applied. Through the comparison of the results obtained for HArF with those of HF the effect of Ar insertion on the above properties was discussed. A hierarchy of ab initio methods including HF, MP2, CCSD and CCSD(T), has been employed to investigate the effect of orbital compression on the electron correlation contribution to the studied electric properties. It was observed that the external confining potential modifies the electronic contributions to the dipole moment and (hyper)polarizabilities of HArF. In particular, the first hyperpolarizability of HArF is remarkably smaller than that of the unconfined HArF molecule.

  13. Synthesis, growth, structural modeling and physio-chemical properties of a charge transfer molecule: Guanidinium tosylate

    Science.gov (United States)

    Era, Paavai; Jauhar, RO. MU.; Vinitha, G.; Murugakoothan, P.

    2018-05-01

    An organic nonlinear optical material, guanidinium tosylate was synthesized adopting slow evaporation method and the crystals were harvested from aqueous methanolic medium with dimensions 13 × 9 × 3 mm3. Constitution of crystalline material was confirmed by single crystal X-ray diffraction study. The title compound crystallizes in the monoclinic crystal system with space group P21/c. The UV-vis-NIR spectral study of the grown crystal exhibits high transparency of 80% in the entire visible region with lower cut-off wavelength at 282 nm. Optimized molecular geometry of the grown crystal was obtained using density functional theory (DFT) and the frontier energy gaps calculated from the DFT aids to understand the charge transfer taking place in the molecule. The dielectric properties were studied as a function of temperature and frequency to find the charge distribution within the crystal. The titular compound is thermally stable up to 230 °C assessed by thermogravimetric and differential thermal analysis. Anisotropy in the mechanical behavior was observed while measuring for individual planes. The laser induced surface damage threshold of the grown crystal was measured to be 0.344 GW/cm2 for 1064 nm Nd:YAG laser radiation. Z-scan technique confirms the third-order nonlinear optical property with the ascertained nonlinear refractive index (n2), nonlinear absorption coefficient (β) and third order nonlinear susceptibility (χ(3)). Optical limiting study divulges that the transmitted output power step-up linearly with the increase of the input power at lower power realms and saturates from the threshold 24.95 mW/cm2 and amplitude 0.23 mW/cm2.

  14. Breaking Symmetry in Time-Dependent Electronic Structure Theory to Describe Spectroscopic Properties of Non-Collinear and Chiral Molecules

    Science.gov (United States)

    Goings, Joshua James

    Time-dependent electronic structure theory has the power to predict and probe the ways electron dynamics leads to useful phenomena and spectroscopic data. Here we report several advances and extensions of broken-symmetry time-dependent electronic structure theory in order to capture the flexibility required to describe non-equilibrium spin dynamics, as well as electron dynamics for chiroptical properties and vibrational effects. In the first half, we begin by discussing the generalization of self-consistent field methods to the so-called two-component structure in order to capture non-collinear spin states. This means that individual electrons are allowed to take a superposition of spin-1/2 projection states, instead of being constrained to either spin-up or spin-down. The system is no longer a spin eigenfunction, and is known a a spin-symmetry broken wave function. This flexibility to break spin symmetry may lead to variational instabilities in the approximate wave function, and we discuss how these may be overcome. With a stable non-collinear wave function in hand, we then discuss how to obtain electronic excited states from the non-collinear reference, along with associated challenges in their physical interpretation. Finally, we extend the two-component methods to relativistic Hamiltonians, which is the proper setting for describing spin-orbit driven phenomena. We describe the first implementation of the explicit time propagation of relativistic two-component methods and how this may be used to capture spin-forbidden states in electronic absorption spectra. In the second half, we describe the extension of explicitly time-propagated wave functions to the simulation of chiroptical properties, namely circular dichroism (CD) spectra of chiral molecules. Natural circular dichroism, that is, CD in the absence of magnetic fields, originates in the broken parity symmetry of chiral molecules. This proves to be an efficient method for computing circular dichroism spectra

  15. First-principles study on the structure and electronic property of gas molecules adsorption on Ge2Li2 monolayer

    Science.gov (United States)

    Hu, Yiwei; Long, Linbo; Mao, Yuliang; Zhong, Jianxin

    2018-06-01

    Using first-principles methods, we have studied the adsorption of gas molecules (CO2, CH4, H2S, H2 and NH3) on two dimensional Ge2Li2 monolayer. The adsorption geometries, adsorption energies, charge transfer, and band structures of above mentioned gas molecules adsorption on Ge2Li2 monolayer are analyzed. It is found that the adsorption of CO2 on Ge2Li2 monolayer is a kind of strong chemisorption, while other gas molecules such as CH4, H2S, H2 and NH3 are physisorption. The strong covalent binding is formed between the CO2 molecule and the nearest Ge atom in Ge2Li2 monolayer. This adsorption of CO2 molecule on Ge2Li2 monolayer leads to a direct energy gap of 0.304 eV. Other gas molecules exhibit mainly ionic binding to the nearest Li atoms in Ge2Li2 monolayer, which leads to indirect energy gap after adsorptions. Furthermore, it is found that the work function of Ge2Li2 monolayer is sensitive with the variation of adsorbents. Our results reveal that the Ge2Li2 monolayer can be used as a kind of nano device for gas molecules sensor.

  16. New in situ generated acylhydrazidate-coordinated complexes and acylhydrazide molecules: Synthesis, structural characterization and photoluminescence property

    Science.gov (United States)

    Wang, Yan-Ning; Huo, Qi-Sheng; Zhang, Ping; Yu, Jie-Hui; Xu, Ji-Qing

    2016-10-01

    By utilizing the hydrothermal in situ acylation of organic acids with N2H4, three acylhydrazidate-coordinated compounds [Mn(L1)2(H2O)2] (L1 = 2,3-quinolinedicarboxylhydrazidate; HL1 = 2,3-dihydropyridazino[4,5-b] quinoline-1,4-dione) 1, [Mn2(ox)(L2)2(H2O)6]·2H2O (L2 = benzimidazolate-5,6-dicarboxylhydrazide; HL2 = 6,7-dihydro-1H-imidazo[4,5-g]phthalazine-5,8-dione; ox = oxalate) 2, and [Cd(HL3)(bpy)] (L3 = 4,5-di(3‧-carboxylphenyl)phthalhydrazidate; H3L3 = 6,7-dihydro-1H-imidazo[4,5-g]phthalazine-5,8-dione; bpy = 2,2‧-bipyridine) 3, as well as two acylhydrazide molecules L4 (L4 = oxepino[2,3,4-de:7,6,5-d‧e‧]diphthalazine-4,10(5H,9H)-dione) 4 and L5 (L5 = 4,5-dibromophthalhydrazide; L5 = 6,7-dibromo-2,3-dihydrophthalazine-1,4-dione) 5 were obtained. X-ray single-crystal diffraction analysis reveals that (i) 1 only possesses a mononuclear structure, but it self-assembles into a 2-D supramolecular network via the Nhydrazinesbnd H ⋯ Nhydrazine and Owsbnd H ⋯ Ohydroxylimino interactions; (ii) 2 exhibits a dinuclear structure. Ox acts as the linker, while L2 just serves as a terminal ligand; (iii) In 3, L3 acts as a 3-connected node to propagate the 7-coordinated Cd2 + centers into a 1-D double-chain structure; (iv) 4 is a special acylhydrazide molecule. Two sbnd OH groups for the intermediates 3,3‧-biphthalhydrazide further lose one water molecule to form 4; (v) 5 is a common monoacylhydrazide molecule. Via the Nhydrazinesbnd H ⋯ Ohydrazine, Ohydroxyliminosbnd H ⋯ Oacylamino and the π ⋯ π interactions, it self-assembles into a 2-D supramolecular network. The photoluminescence analysis reveals that 4 emits light with the maxima at 510 nm.

  17. Evaluating Molecular Properties Involved in Transport of Small Molecules in Stratum Corneum: A Quantitative Structure-Activity Relationship for Skin Permeability

    Directory of Open Access Journals (Sweden)

    Chen-Peng Chen

    2018-04-01

    Full Text Available The skin permeability (Kp defines the rate of a chemical penetrating across the stratum corneum. This value is widely used to quantitatively describe the transport of molecules in the outermost layer of epidermal skin and indicate the significance of skin absorption. This study defined a Kp quantitative structure-activity relationship (QSAR based on 106 chemical substances of Kp measured using human skin and interpreted the molecular interactions underlying transport behavior of small molecules in the stratum corneum. The Kp QSAR developed in this study identified four molecular descriptors that described the molecular cyclicity in the molecule reflecting local geometrical environments, topological distances between pairs of oxygen and chlorine atoms, lipophilicity, and similarity to antineoplastics in molecular properties. This Kp QSAR considered the octanol-water partition coefficient to be a direct influence on transdermal movement of molecules. Moreover, the Kp QSAR identified a sub-domain of molecular properties initially defined to describe the antineoplastic resemblance of a compound as a significant factor in affecting transdermal permeation of solutes. This finding suggests that the influence of molecular size on the chemical’s skin-permeating capability should be interpreted with other relevant physicochemical properties rather than being represented by molecular weight alone.

  18. Evaluating Molecular Properties Involved in Transport of Small Molecules in Stratum Corneum: A Quantitative Structure-Activity Relationship for Skin Permeability.

    Science.gov (United States)

    Chen, Chen-Peng; Chen, Chan-Cheng; Huang, Chia-Wen; Chang, Yen-Ching

    2018-04-15

    The skin permeability ( Kp ) defines the rate of a chemical penetrating across the stratum corneum. This value is widely used to quantitatively describe the transport of molecules in the outermost layer of epidermal skin and indicate the significance of skin absorption. This study defined a Kp quantitative structure-activity relationship (QSAR) based on 106 chemical substances of Kp measured using human skin and interpreted the molecular interactions underlying transport behavior of small molecules in the stratum corneum. The Kp QSAR developed in this study identified four molecular descriptors that described the molecular cyclicity in the molecule reflecting local geometrical environments, topological distances between pairs of oxygen and chlorine atoms, lipophilicity, and similarity to antineoplastics in molecular properties. This Kp QSAR considered the octanol-water partition coefficient to be a direct influence on transdermal movement of molecules. Moreover, the Kp QSAR identified a sub-domain of molecular properties initially defined to describe the antineoplastic resemblance of a compound as a significant factor in affecting transdermal permeation of solutes. This finding suggests that the influence of molecular size on the chemical's skin-permeating capability should be interpreted with other relevant physicochemical properties rather than being represented by molecular weight alone.

  19. Thermodynamic properties of water molecules in the presence of cosolute depend on DNA structure: a study using grid inhomogeneous solvation theory

    Science.gov (United States)

    Nakano, Miki; Tateishi-Karimata, Hisae; Tanaka, Shigenori; Tama, Florence; Miyashita, Osamu; Nakano, Shu-ichi; Sugimoto, Naoki

    2015-01-01

    In conditions that mimic those of the living cell, where various biomolecules and other components are present, DNA strands can adopt many structures in addition to the canonical B-form duplex. Previous studies in the presence of cosolutes that induce molecular crowding showed that thermal stabilities of DNA structures are associated with the properties of the water molecules around the DNAs. To understand how cosolutes, such as ethylene glycol, affect the thermal stability of DNA structures, we investigated the thermodynamic properties of water molecules around a hairpin duplex and a G-quadruplex using grid inhomogeneous solvation theory (GIST) with or without cosolutes. Our analysis indicated that (i) cosolutes increased the free energy of water molecules around DNA by disrupting water–water interactions, (ii) ethylene glycol more effectively disrupted water–water interactions around Watson–Crick base pairs than those around G-quartets or non-paired bases, (iii) due to the negative electrostatic potential there was a thicker hydration shell around G-quartets than around Watson–Crick-paired bases. Our findings suggest that the thermal stability of the hydration shell around DNAs is one factor that affects the thermal stabilities of DNA structures under the crowding conditions. PMID:26538600

  20. Structure and properties of Al-MIL-53-ADP, a breathing MOF based on the aliphatic linker molecule adipic acid.

    Science.gov (United States)

    Reinsch, Helge; Pillai, Renjith S; Siegel, Renée; Senker, Jürgen; Lieb, Alexandra; Maurin, Guillaume; Stock, Norbert

    2016-03-14

    The new aluminium based metal-organic framework [Al(OH)(O2C-C4H8-CO2)]·H2O denoted as Al-MIL-53-ADP-lp (lp stands for large pore) was synthesised under solvothermal conditions. This solid is an analogue of the archetypical aluminium terephthalate Al-MIL-53 based on the aliphatic single-chain linker molecule adipic acid (H2ADP, hexanedioic acid). In contrast to its aromatic counterparts, Al-MIL-53-ADP exhibits a structural breathing behaviour solely upon dehydration/rehydration. The crystal structure of the anhydrous compound denoted as Al-MIL-53-ADP-np (np stands for narrow pore) was determined by a combination of forcefield-based computations and Rietveld refinement of the powder X-ray diffraction data while the structure of the hydrated form Al-MIL-53-ADP-lp was derived computationally by a combination of force field based methods and Density Functional Theory calculations. Both structures were further supported by (1)H, (13)C and (27)Al high-resolution NMR MAS 1D data coupled again with simulations. Al-MIL-53-ADP was further characterised by means of vibrational spectroscopy, elemental analysis, thermogravimetry and water vapour sorption.

  1. Halide salts and their structural properties in presence of secondary amine based molecule: A combined experimental and theoretical analysis

    Science.gov (United States)

    Ghosh, Pritam; Hazra, Abhijit; Ghosh, Meenakshi; Chandra Murmu, Naresh; Banerjee, Priyabrata

    2018-04-01

    Biologically relevant halide salts and its solution state structural properties are always been significant. In general, exposure of halide salts into polar solution medium results in solvation which in turn separates the cationic and anionic part of the salt. However, the conventional behaviour of salts might alter in presence of any secondary amine based compound, i.e.; moderately strong Lewis acid. In its consequence, to investigate the effect of secondary amine based compound in the salt solution, novel (E)-2-(4-bromobenzylidene)-1-(perfluorophenyl) hydrazine has been synthesized and used as secondary amine source. The secondary amine compound interestingly shows a drastic color change upon exposure to fluoride salts owing to hydrogen bonding interaction. Several experimental methods, e.g.; SCXRD, UV-Vis, FT-IR, ESI-MS and DLS together with modern DFT (i.e.; DFT-D3) have been performed to explore the structural properties of the halide salts upon exposure to secondary amine based compound. The effect of counter cation of the fluoride salt in binding with secondary amine source has also been investigated.

  2. Importance of thiol-functionalized molecules for the structure and properties of compression-molded glassy wheat gluten bioplastics.

    Science.gov (United States)

    Jansens, Koen J A; Lagrain, Bert; Brijs, Kristof; Goderis, Bart; Smet, Mario; Delcour, Jan A

    2013-11-06

    High-temperature compression molding of wheat gluten at low water levels yields a rigid plastic-like material. We performed a systematic study to determine the effect of additives with multiple thiol (SH) groups on gluten network formation during processing and investigate the impact of the resulting gluten network on the mechanical properties of the glassy end product. To this end, a fraction of the hydroxyl groups of different polyols was converted into SH functionalities by esterifying with 3-mercaptopropionic acid (MPA). The monofunctional additive MPA was evaluated as well. During low-temperature mixing SH-containing additives decreased the gluten molecular weight, whereas protein cross-linking occurred during high-temperature compression molding. The extent of both processes depended on the molecular architecture of the additives and their concentration. After molding, the material strength and failure strain increased without affecting the modulus, provided the additive concentration was low. The strength decreased again at too high concentrations for polyols with low SH functionalization. Attributing these effects solely to the interplay of plasticization and the SH-facilitated introduction of cross-links is inadequate, since an improvement in both strength and failure strain was also observed in the presence of high levels of MPA. It is hypothesized that, regardless of the molecular structure of the additive, the presence of SH-containing groups induces conformational changes which contribute to the mechanical properties of glassy gluten materials.

  3. Structural characterization of some substituted azolidine molecules

    International Nuclear Information System (INIS)

    Andreocci, M.V.; Bossa, M.; Furlani, C.; Mattogno, G.; Zanoni, R.; Consiglio Nazionale delle Ricerche, Rome; Devillanova, F.A.; Verani, G.

    1981-01-01

    The electronic structure of a series of organic molecules of general formula RN - (CH 2 ) 2 - X - C = Y, which are also of interest in inorganic chemistry because of their properties as ligands towards metals, have been investigated by X-ray photoelectron spectroscopy. The results suggest a general picture of atomic charge distribution within the investigated molecules, and allow an assessment of the effect of the different substituent groups X, Y, R (X = NR', O, S, CH 2 ; Y = O, S, Se; R, R' = H, alkyl) on the electronic structure of the ligands. Satisfactory correlation is found between experimental binding energies and computed CNDO/2 atomic charges, after correction for intramolecular Madelung potentials. (orig.)

  4. Theoretical study on the molecular structure and vibrational properties, NBO and HOMO-LUMO analysis of the POX3 (X = F, Cl, Br, I) series of molecules

    Science.gov (United States)

    Galván, Jorge E.; Gil, Diego M.; Lanús, Hernán E.; Altabef, Aida Ben

    2015-02-01

    The fourth member of the series of compounds of the type POX3 with X = I was synthesized and characterized by infrared spectroscopy. The geometrical parameters and vibrational properties of POX3 (X = F, Cl, Br, I) molecules were investigated theoretically by means DFT and ab initio methods. Available geometrical and vibrational data were used together with theoretical calculations in order to obtain a set of scaled force constants. The observed trends in geometrical parameters are analyzed and compared with those obtained in a previous work for the VOX3 (X = F, Cl, Br, I) series of compounds. NBO analysis was performed in order to know the hyper-conjugative interactions that favor one structure over another. The molecular properties such as ionization potential, electron affinity, electronegativity, chemical potential, chemical hardness, softness and global electrophilicity index have been deduced from HOMO-LUMO analysis.

  5. Robust Magnetic Properties of a Sublimable Single-Molecule Magnet.

    Science.gov (United States)

    Kiefl, Evan; Mannini, Matteo; Bernot, Kevin; Yi, Xiaohui; Amato, Alex; Leviant, Tom; Magnani, Agnese; Prokscha, Thomas; Suter, Andreas; Sessoli, Roberta; Salman, Zaher

    2016-06-28

    The organization of single-molecule magnets (SMMs) on surfaces via thermal sublimation is a prerequisite for the development of future devices for spintronics exploiting the richness of properties offered by these magnetic molecules. However, a change in the SMM properties due to the interaction with specific surfaces is usually observed. Here we present a rare example of an SMM system that can be thermally sublimated on gold surfaces while maintaining its intact chemical structure and magnetic properties. Muon spin relaxation and ac susceptibility measurements are used to demonstrate that, unlike other SMMs, the magnetic properties of this system in thin films are very similar to those in the bulk, throughout the full volume of the film, including regions near the metal and vacuum interfaces. These results exhibit the robustness of chemical and magnetic properties of this complex and provide important clues for the development of nanostructures based on SMMs.

  6. Simulant molecules with trivalent or pentavalent phosphorus atoms: bond dissociation energies and other thermodynamic and structural properties from quantum chemical models.

    Science.gov (United States)

    Hahn, David K; RaghuVeer, Krishans S; Ortiz, J V

    2011-08-04

    The CBS-QB3 and G4 thermochemical models have been used to generate energetic, structural, and spectroscopic data on a set of molecules with trivalent or pentavalent phosphorus atoms that can serve as simulants of chemical warfare agents. Based on structural data, the conformational stabilities of these molecules are explained in terms of the anomeric interaction within the OPOC and OPSC fragments. For those cases where experimental data are available, comparisons have been made between calculated and previously reported vibrational frequencies. All varieties of bond dissociation energies have been examined except those for C-H and P═O bonds. In trivalent phosphorus molecules, the O-C and S-C bonds have the lowest dissociation energies. In the pentavalent phosphorus set, the S-C bonds, followed by P-S bonds, have the lowest dissociation energies. In the fluorinated simulant molecules, the P-F bond is strongest, and the P-C or O-C bonds are weakest. © 2011 American Chemical Society

  7. Study of the electronic properties of organic molecules within a metal-molecule-metal junction

    International Nuclear Information System (INIS)

    Lambert, Mathieu

    2003-01-01

    This ph-D thesis is about electronic transport through organic molecules inserted in a metal molecule-metal junction. We describe first a simple process to prepare sub-3 nm gaps by controllable breakage (under an electrical stress) of gold wires lithographed on a SiO 2 Si substrate at low temperature (4.2 K). We show that the involved mechanism is thermally assisted electromigration. We observe that current-voltage (I-V) characteristics of resulting electrodes are stable up to ∼5 V. which gives access to the well-known Fowler-Nordheim regime in the I-V, allowing an accurate characterisation of the gap size. The average gap is found lo be between 1.5 nm in width and 2.5 eV in height. Molecules and nanoparticles have then been inserted in the junction in the case of nanoparticles for example. The resulting IV clearly shows the suppression of electrical current at low bias known as Coulomb blockade. Characteristic of single-electron tunnelling through nanometer-sized structures, finally we fabricated a single-electron tunneling device based on Au nanoparticles connected to the electrodes via terthiophene (T3) molecule. We use the silicon substrate, separated from the planar structure by a silicon oxide of 200 nm, as an electrostatic gate and observed clear current modulation with possible signature of the transport properties of the terthiophene molecules. (author) [fr

  8. Superconducting selenides intercalated with organic molecules: synthesis, crystal structure, electric and magnetic properties, superconducting properties, and phase separation in iron based-chalcogenides and hybrid organic-inorganic superconductors

    Science.gov (United States)

    Krzton-Maziopa, Anna; Pesko, Edyta; Puzniak, Roman

    2018-06-01

    Layered iron-based superconducting chalcogenides intercalated with molecular species are the subject of intensive studies, especially in the field of solid state chemistry and condensed matter physics, because of their intriguing chemistry and tunable electric and magnetic properties. Considerable progress in the research, revealing superconducting inorganic–organic hybrid materials with transition temperatures to superconducting state, T c, up to 46 K, has been brought in recent years. These novel materials are synthesized by low-temperature intercalation of molecular species, such as solvates of alkali metals and nitrogen-containing donor compounds, into layered FeSe-type structure. Both the chemical nature as well as orientation of organic molecules between the layers of inorganic host, play an important role in structural modifications and may be used for fine tuning of superconducting properties. Furthermore, a variety of donor species compatible with alkali metals, as well as the possibility of doping also in the host structure (either on Fe or Se sites), makes this system quite flexible and gives a vast array of new materials with tunable electric and magnetic properties. In this review, the main aspects of intercalation chemistry are discussed with a particular attention paid to the influence of the unique nature of intercalating species on the crystal structure and physical properties of the hybrid inorganic–organic materials. To get a full picture of these materials, a comprehensive description of the most effective chemical and electrochemical methods, utilized for synthesis of intercalated species, with critical evaluation of their strong and weak points, related to feasibility of synthesis, phase purity, crystal size and morphology of final products, is included as well.

  9. The calculation of thermodynamic properties of molecules

    DEFF Research Database (Denmark)

    van Speybroeck, Veronique; Gani, Rafiqul; Meier, Robert Johan

    2010-01-01

    Thermodynamic data are key in the understanding and design of chemical processes. Next to the experimental evaluation of such data, computational methods are valuable and sometimes indispensable tools in obtaining heats of formation and Gibbs free energies. The major toolboxes to obtain such quan......Thermodynamic data are key in the understanding and design of chemical processes. Next to the experimental evaluation of such data, computational methods are valuable and sometimes indispensable tools in obtaining heats of formation and Gibbs free energies. The major toolboxes to obtain...... molecules the combination of group contribution methods with group additive values that are determined with the best available computational ab initio methods seems to be a viable alternative to obtain thermodynamic properties near chemical accuracy. New developments and full use of existing tools may lead...

  10. Synthesis and structural and photoswitchable properties of novel chiral host molecules: axis chiral 2,2'-dihydroxy-1,1'-binaphthyl-appended stiff-stilbene.

    Science.gov (United States)

    Shimasaki, Toshiaki; Kato, Shin-ichiro; Ideta, Keiko; Goto, Kenta; Shinmyozu, Teruo

    2007-02-16

    Novel photoswitchable chiral hosts having an axis chiral 2,2'-dihydroxy-1,1'-binaphthyl (BINOL)-appended stiff-stilbene, trans-(R,R)- and -(S,S)-1, were synthesized by palladium-catalyzed Suzuki-Miyaura coupling and low-valence titanium-catalyzed McMurry coupling as key steps, and they were fully characterized by various NMR spectral techniques. The enantiomers of trans-1 showed almost complete mirror images in the CD spectra, where two split Cotton effects (exciton coupling) were observed in the beta-transitions of the naphthyl chromophore at 222 and 235 nm, but no Cotton effect was observed in the stiff-stilbene chromophore at 365 nm. The structures of (R)-10 and trans-(R,R)-1 were confirmed by X-ray structural analysis. The optimized structure of cis-1 by MO calculations has a wide chiral cavity of 7-8 A in diameter, whereas trans-1 cannot form an intramolecular cavity based on the X-ray data. Irradiation of (R,R)-trans-1 with black light (lambda = 365 nm) in CH3CN or benzene at 23 degrees C led to the conversion to the corresponding cis-isomer, as was monitored by 1H NMR, UV-vis, and CD spectra. At the photostationary state, the cis-1/trans-1 ratio was 86/14 in benzene or 75/25 in CH3CN. On the other hand, irradiation of the cis-1/trans-1 (75/25) mixture in CH3CN with an ultra-high-pressure Hg lamp at 23 degrees C (lambda = 410 nm) led to the photostationary state, where the cis-1/trans-1 ratio was estimated to be 9/91 on the basis of the 1H NMR spectra. The cis-trans and trans-cis interconversions could be repeated 10 times without decomposition of the C=C double bond. Thus, a new type of photoswitchable molecule has been developed, and trans-1 and cis-1 were quite durable under irradiation conditions. The guest binding properties of the BINOL moieties of trans- and cis-(R,R)-1 with F-, Cl-, and H2PO4- were examined by 1H NMR titration in CDCl3. Similar interaction with F- and Cl- was observed in trans-1 (host/guest = 1/1, Kassoc = (1.0 +/- 0.13) x 103 for F

  11. Relaxation of structural parameters and potential coefficients of nonrigid molecules. General symmetry properties and application to ab initio study of 1,2-difluoroethane

    Science.gov (United States)

    Ha, T.-K.; Günthard, H. H.

    1989-07-01

    Structural parameters like bond length, bond angles, etc. and harmonic and anharmonic potential coefficients of molecules with internal rotation, inversion or puckering modes are generally assumed to vary with the large amplitude internal coordinates in a concerted manner (relaxation). Taking the coordinate vectors of the nuclear configuration of semirigid molecules with relaxation (SRMRs) as functions of relaxing structural parameters and finite amplitude internal coordinate, the isometric group of SRMRs is discussed and the irreducible representations of the latter are shown to classify into engendered and nonengendered ones. On this basis a concept of equivalent sets of nuclei SRMRs is introduced and an analytical expression is derived which defines the most general functional form of relaxation increments of all common types of structural parameters compatible with isometric symmetry. This formula is shown to be a close analog of an analytical expression defining the transformations induced by the isometric group of infinitesimal internal coordinates associated with typical structural parameters. Furthermore analogous formulae are given for the most general form of the relaxation of harmonic potential coefficients as a function of finite internal coordinates. The general relations are illustrated by ab initio calculations for 1,2-difluoroethane at the MP4/DZP//HF/4-31G* level for twelve values of the dihedral angle including complete structure optimization. The potential to internal rotation is found to be in essential agreement with experimentally derived data. For a complete set of ab initio structural parameters the associated relaxation increments are represented as Fourier series, which are shown to confirm the form predicted by the general formula and the isometric group of 1,2-difluoroethane. Depending on type of the structural parameters (bond length, bond angles, etc.), the associated relaxation increments appear to follow some simple rules. Similarly

  12. Phase space structure of triatomic molecules

    International Nuclear Information System (INIS)

    Lu, Z.; Kellman, M.E.

    1997-01-01

    The bifurcation structure is investigated for a Hamiltonian for the three coupled nonlinear vibrations of a highly excited triatomic molecule. The starting point is a quantum Hamiltonian used to fit experimental spectra. This Hamiltonian includes 1:1 Darling endash Dennison resonance coupling between the stretches, and 2:1 Fermi resonance coupling between the stretches and bend. A classical Hamiltonian is obtained using the Heisenberg correspondence principle. Surfaces of section show a pronounced degree of chaos at high energies, with a mixture of chaotic and regular dynamics. The large-scale bifurcation structure is found semianalytically, without recourse to numerical solution of Hamilton close-quote s equations, by taking advantage of the fact that the spectroscopic Hamiltonian has a conserved polyad quantum number, corresponding to an approximate constant of the motion of the molecule. Bifurcation diagrams are analyzed for a number of molecules including H 2 O, D 2 O, NO 2 , ClO 2 , O 3 , and H 2 S. copyright 1997 American Institute of Physics

  13. Micropipet manipulation of lipid membranes: Direct measurement of the material properties of a cohesive structure that is only two molecules thick

    Science.gov (United States)

    Needham, David

    1993-01-01

    The objectives are to demonstrate how we can make direct measurements of the mechanical properties of a special structure in biology, namely the lipid bilayer membrane, using a micromanipulation technique, and how these properties compare and contrast with 'more traditional' technological/engineering materials. Given that the investment in equipment and expertise to carry out these experiments is probably beyond the scope of most teaching labs, the described experiment is not intended as one that can actually be demonstrated in a student laboratory class. The intention behind presenting this work is to begin to raise awareness in the Material Science community about the material properties of biological material that form a new (to us) category of soft engineering materials that have dimensions on the nanoscale.

  14. Vibrational, structural and electronic properties investigation by DFT calculations and molecular docking studies with DNA topoisomerase II of strychnobrasiline type alkaloids: A theoretical approach for potentially bioactive molecules

    Science.gov (United States)

    Costa, Renyer A.; Oliveira, Kelson M. T.; Costa, Emmanoel Vilaça; Pinheiro, Maria L. B.

    2017-10-01

    A combined experimental and theoretical DFT study of the structural, vibrational and electronic properties of strychnobrasiline and 12-hydroxy-10,11-dimethoxystrychnobrasiline is presented using the Becke three-parameter Lee-Yang-Parr function (B3LYP) and 6-311G(2d,p) basis set. The theoretical geometry optimization data were compared with the X-ray data for a similar structure in the associated literature, showing close values. The calculated HOMO-LUMO gap values showed that the presence of substituents in the benzene ring influences the quantum properties which are directly related to the reactive properties. Theoretical UV spectra agreed well with the measured experimental data, with bands assigned. In addition, Natural Bond Orbitals (NBOs), Mapped molecular electrostatic potential surface (MEPS) and NLO calculations were also performed at the same theory level. The theoretical vibrational analysis revealed several characteristic vibrations that may be used as a diagnostic tool for other strychnobrasiline type alkaloids, simplifying their identification and structural characterization. Molecular docking calculations with DNA Topoisomerase II-DNA complex showed binding free energies values of -8.0 and -9.5 kcal/mol for strychnobrasiline and 12-hydroxy-10,11-dimethoxystrychnobrasiline respectively, while for amsacrine, used for the treatment of leukemia, the binding free energy ΔG presented a value of -10.0 kcal/mol, suggesting that strychnobrasiline derivative alkaloids might exhibit an antineoplastic activity.

  15. Structure of molecules and internal rotation

    CERN Document Server

    Mizushima, San-Ichiro

    1954-01-01

    Structure of Molecules and Internal Rotation reviews early studies on dihalogenoethanes. This book is organized into two parts encompassing 8 chapters that evaluate the Raman effect in ethane derivatives, the energy difference between rotational isomers, and the infrared absorption of ethane derivatives. Some of the topics covered in the book are the potential barrier to internal rotation; nature of the hindering potential; entropy difference between the rotational isomers; internal rotation in butane, pentane, and hexane; and internal rotation in long chain n-paraffins. Other chapters deal wi

  16. Long-range correlations, geometrical structure, and transport properties of macromolecular solutions. The equivalence of configurational statistics and geometrodynamics of large molecules.

    Science.gov (United States)

    Mezzasalma, Stefano A

    2007-12-04

    A special theory of Brownian relativity was previously proposed to describe the universal picture arising in ideal polymer solutions. In brief, it redefines a Gaussian macromolecule in a 4-dimensional diffusive spacetime, establishing a (weak) Lorentz-Poincaré invariance between liquid and polymer Einstein's laws for Brownian movement. Here, aimed at inquiring into the effect of correlations, we deepen the extension of the special theory to a general formulation. The previous statistical equivalence, for dynamic trajectories of liquid molecules and static configurations of macromolecules, and rather obvious in uncorrelated systems, is enlarged by a more general principle of equivalence, for configurational statistics and geometrodynamics. Accordingly, the three geodesic motion, continuity, and field equations could be rewritten, and a number of scaling behaviors were recovered in a spacetime endowed with general static isotropic metric (i.e., for equilibrium polymer solutions). We also dealt with universality in the volume fraction and, unexpectedly, found that a hyperscaling relation of the form, (average size) x (diffusivity) x (viscosity)1/2 ~f(N0, phi0) is fulfilled in several regimes, both in the chain monomer number (N) and polymer volume fraction (phi). Entangled macromolecular dynamics was treated as a geodesic light deflection, entaglements acting in close analogy to the field generated by a spherically symmetric mass source, where length fluctuations of the chain primitive path behave as azimuth fluctuations of its shape. Finally, the general transformation rule for translational and diffusive frames gives a coordinate gauge invariance, suggesting a widened Lorentz-Poincaré symmetry for Brownian statistics. We expect this approach to find effective applications to solutions of arbitrarily large molecules displaying a variety of structures, where the effect of geometry is more explicit and significant in itself (e.g., surfactants, lipids, proteins).

  17. Structure formation in bis(terpyridine) derivative adlayers: molecule-substrate versus molecule-molecule interactions.

    Science.gov (United States)

    Hoster, Harry E; Roos, Matthias; Breitruck, Achim; Meier, Christoph; Tonigold, Katrin; Waldmann, Thomas; Ziener, Ulrich; Landfester, Katharina; Behm, R Jürgen

    2007-11-06

    The influence of the substrate and the deposition conditions-vapor deposition versus deposition from solution-on the structures formed upon self-assembly of deposited bis(terpyridine) derivative (2,4'-BTP) monolayers on different hexagonal substrates, including highly oriented pyrolytic graphite (HOPG), Au(111), and (111)-oriented Ag thin films, was investigated by high-resolution scanning tunneling microscopy and by model calculations of the intermolecular energies and the lateral corrugation of the substrate-adsorbate interaction. Similar quasi-quadratic network structures with almost the same lattice constants obtained on all substrates are essentially identical to the optimum configuration expected from an optimization of the adlayer structure with C-H...N-type bridging bonds as a structure-determining factor, which underlines a key role of the intermolecular interactions in adlayer order. Slight distortions from the optimum values to form commensurate adlayer structures on the metal substrates and the preferential orientation of the adlayer with respect to the substrate are attributed to the substrate-adsorbate interactions, specifically, the lateral corrugation in the substrate-adsorbate interaction upon lateral displacement and rotation of the adsorbed BTP molecules. The fact that similar adlayer structures are obtained on HOPG under ultrahigh vacuum conditions (solid|gas interface) and on HOPG in trichlorobenzene (solid|liquid interface) indicates that the intermolecular interactions are not severely affected by the solvent.

  18. Spin Properties of Transition-Metallorganic Self-Assembled Molecules

    International Nuclear Information System (INIS)

    Yu, Zhi Gang

    2010-01-01

    This report summarizes SRI's accomplishments on the project, 'Spin Properties of Transition-Metallorganic Self-Assembled Molecules' funded by the Office of Basic Energy Sciences, US Department of Energy. We have successfully carried out all tasks identified in our proposal and gained significant knowledge and understanding of spin-polarized electronic structure, spin relaxation, and spin-dependent transport in transition-metallorganic molecules and enhohedral fullerenes. These molecules contain integrated spin and charge components and will enable us to achieve sophisticated functions in spintronics and quantum computing at molecular level with simple circuitry and easy fabrication. We have developed microscopic theories that describe the underlying mechanisms of spin-dependent porcesses and constructed quantitative modeling tools that compute several important spin properties. These results represent the basic principles governing the spin-dependent behaviors in nanostructures containing such molecules. Based on these results we have shown that novel device functions, such as electrically controlled g-factor and noninvasive electrical detection of spin dynamics, can be achieved in these nanostructures. Some of our results have been published in peer-reviewed journals and presented at professional conferences. In addition, we have established a close collaboration with experimentalists at Oxford University, UK (Dr. J. Morton and Prof. G. Briggs), Princeton University (Dr. A. Tyryshkin and Prof. S. Lyon), University of Delaware (Prof. E. Nowak), and University of California (Profs. R. Kawakami and J. Shi), who have been studying related systems and supplying us with new experimental data. We have provided our understanding and physical insights to the experimentalists and helped analyze their experimental measurements. The collaboration with experimentalists has also broadened our research scope and helped us focus on the most relevant issues concerning these

  19. Spin Properties of Transition-Metallorganic Self-Assembled Molecules

    Energy Technology Data Exchange (ETDEWEB)

    Zhi Gang Yu

    2010-06-30

    This report summarizes SRI's accomplishments on the project, 'Spin Properties of Transition-Metallorganic Self-Assembled Molecules' funded by the Office of Basic Energy Sciences, US Department of Energy. We have successfully carried out all tasks identified in our proposal and gained significant knowledge and understanding of spin-polarized electronic structure, spin relaxation, and spin-dependent transport in transition-metallorganic molecules and enhohedral fullerenes. These molecules contain integrated spin and charge components and will enable us to achieve sophisticated functions in spintronics and quantum computing at molecular level with simple circuitry and easy fabrication. We have developed microscopic theories that describe the underlying mechanisms of spin-dependent porcesses and constructed quantitative modeling tools that compute several important spin properties. These results represent the basic principles governing the spin-dependent behaviors in nanostructures containing such molecules. Based on these results we have shown that novel device functions, such as electrically controlled g-factor and noninvasive electrical detection of spin dynamics, can be achieved in these nanostructures. Some of our results have been published in peer-reviewed journals and presented at professional conferences. In addition, we have established a close collaboration with experimentalists at Oxford University, UK (Dr. J. Morton and Prof. G. Briggs), Princeton University (Dr. A. Tyryshkin and Prof. S. Lyon), University of Delaware (Prof. E. Nowak), and University of California (Profs. R. Kawakami and J. Shi), who have been studying related systems and supplying us with new experimental data. We have provided our understanding and physical insights to the experimentalists and helped analyze their experimental measurements. The collaboration with experimentalists has also broadened our research scope and helped us focus on the most relevant issues

  20. On structure of some laminated crystals with organic molecules

    International Nuclear Information System (INIS)

    Volodina, G.F.; Ivanova, V.Ya.; Malinovskij, T.I.

    1982-01-01

    A survey is made of papers dealing with intercalation of organic molecules into crystals of dihalcogenides of some transition metals (TaS 2 , TiS 2 , NbS 2 , ZrS 2 , TaSe 2 ), variation of their structure and physical properties. Among the used intercalates ammonia, pyridine, aniline and other aromatic amines proved to be most satisfactory from the viewpoint of reaction rate and product stability. A possibility is discussed of intercalation into PbI 2 and CdI 2 crystals that are of the same structural type as dihalcogenides

  1. Structure and Structure-activity Relationship of Functional Organic Molecules

    Institute of Scientific and Technical Information of China (English)

    2011-01-01

    @@ Research theme The group is made up of junior scientists from the State Key Laboratory of Elemento-organic Chemistry, Nankai University.The scientists focus their studis on the structure and structure-activity relationship of functional organic molecules not only because it has been the basis of their research, but also because the functional study of organic compounds is now a major scientific issue for organic chemists around the world.

  2. Structures of water molecules in carbon nanotubes under electric fields

    International Nuclear Information System (INIS)

    Winarto,; Takaiwa, Daisuke; Yamamoto, Eiji; Yasuoka, Kenji

    2015-01-01

    Carbon nanotubes (CNTs) are promising for water transport through membranes and for use as nano-pumps. The development of CNT-based nanofluidic devices, however, requires a better understanding of the properties of water molecules in CNTs because they can be very different from those in the bulk. Using all-atom molecular dynamics simulations, we investigate the effect of axial electric fields on the structure of water molecules in CNTs having diameters ranging from (7,7) to (10,10). The water dipole moments were aligned parallel to the electric field, which increases the density of water inside the CNTs and forms ordered ice-like structures. The electric field induces the transition from liquid to ice nanotubes in a wide range of CNT diameters. Moreover, we found an increase in the lifetime of hydrogen bonds for water structures in the CNTs. Fast librational motion breaks some hydrogen bonds, but the molecular pairs do not separate and the hydrogen bonds reform. Thus, hydrogen bonds maintain the water structure in the CNTs, and the water molecules move collectively, decreasing the axial diffusion coefficient and permeation rate

  3. Vibrational properties of water molecules adsorbed in different zeolitic frameworks

    International Nuclear Information System (INIS)

    Crupi, V; Longo, F; Majolino, D; Venuti, V

    2006-01-01

    The perturbation of water 'sorbed' in samples of zeolites of different structural type, genesis, and cation composition (K-, Na-, Mg- and Ca-rich zeolites), namely the CHA framework of a synthetic K-chabazite, the LTA framework of synthetic Na-A and Mg50-A zeolites, and the NAT framework of a natural scolecite, has been studied by FTIR-ATR spectroscopy, in the -10 to +80 o C temperature range. The aim was to show how differences in the chemical composition and/or in the topology of the zeolite framework and, in particular, the possibility for the guest water molecules to develop guest-guest and/or host-guest interactions, lead to substantial differences in their vibrational dynamical properties. The spectra, collected in the O-H stretching and H 2 O bending mode regions, are complex, with multiple bands being observed. As far as water in the CHA and LTA frameworks is concerned, whose behaviour is governed by the balance of water-water, water-framework and water-extra-framework cations interactions, the assignment of the resolved components of the O-H stretching band has been discussed by fitting the band shapes into individual components attributed to H 2 O molecules engaged in different degrees of hydrogen bonding. A detailed quantitative picture of the connectivity pattern of water, as a function of temperature and according to the chemical and topological properties of the environment, is furnished. The H 2 O bending vibrational bands give additional information that perfectly agrees with the results obtained from the analysis of the O-H stretching spectral region. In the case of scolecite, a small-pored zeolite where water-water interactions are eliminated, the increased complexity observed in the infrared spectra in the O-H stretching and H 2 O bending regions was explained as due to the hydrogen bonding between the water molecules and the network, and also with the extra-framework cation. Furthermore, these observations have been correlated with the different

  4. Large Molecule Structures by Broadband Fourier Transform Molecular Rotational Spectroscopy

    Science.gov (United States)

    Evangelisti, Luca; Seifert, Nathan A.; Spada, Lorenzo; Pate, Brooks

    2016-06-01

    Fourier transform molecular rotational resonance spectroscopy (FT-MRR) using pulsed jet molecular beam sources is a high-resolution spectroscopy technique that can be used for chiral analysis of molecules with multiple chiral centers. The sensitivity of the molecular rotational spectrum pattern to small changes in the three dimensional structure makes it possible to identify diastereomers without prior chemical separation. For larger molecules, there is the additional challenge that different conformations of each diastereomer may be present and these need to be differentiated from the diastereomers in the spectral analysis. Broadband rotational spectra of several larger molecules have been measured using a chirped-pulse FT-MRR spectrometer. Measurements of nootkatone (C15H22O), cedrol (C15H26O), ambroxide (C16H28O) and sclareolide (C16H26O2) are presented. These spectra are measured with high sensitivity (signal-to-noise ratio near 1,000:1) and permit structure determination of the most populated isomers using isotopic analysis of the 13C and 18O isotopologues in natural abundance. The accuracy of quantum chemistry calculations to identify diastereomers and conformers and to predict the dipole moment properties needed for three wave mixing measurements is examined.

  5. Synthesis of Large Molecules in Cometary Ice Analogs: Physical Properties

    Science.gov (United States)

    Dworkin, Jason; Sandford, S. A.; Allamandola, L. J.; Deamer, D. W.; Gillette, S. J.; Zare, R. N.

    Comets and carbonaceous micrometeorites may have been important sources of volatiles on the early Earth; their organic composition may therefore be related to the origin of life. Ices on grains in molecular clouds contain a variety of simple molecules. Within the cloud and especially the presolar nebula, these icy grains would have been photoprocessed by ultraviolet light to produce more complex molecules. We are investigating the molecules that could have been generated in precometary ices. Experiments were conducted by forming a realistic interstellar ice (H_2^O, CH_3H, NH_3 and CO) at ~10 K under high vacuum irradiated UV by a hydrogen plasma lamp. The residue remaining after warming to room temperature was analyzed by HPLC and by several mass spectrometric methods. This material contains a variety of complex compounds with MS profiles resembling those found in IDPs and meteorites. Surface tension measurements show that an amphiphilic component is also present. These species do not appear in various controls or in unphotolyzed samples. In other experiments, the residues were dispersed in aqueous media for microscopy. The organic material forms 10-40 micrometer droplets that fluoresce (300-450 nm) under UV excitation and appear strikingly similar to those produced by extracts of the Murchison meteorite. Together, these results suggest a link between organic material synthesized on cold grains photochemically and compounds that may have contributed to the organic inventory of the primitive Earth. The amphiphilic properties of such compounds permit self-assembly into the membranous boundary structures required for the first forms of cellular life.

  6. Photoelectron diffraction from single oriented molecules: Towards ultrafast structure determination of molecules using x-ray free-electron lasers

    Science.gov (United States)

    Kazama, Misato; Fujikawa, Takashi; Kishimoto, Naoki; Mizuno, Tomoya; Adachi, Jun-ichi; Yagishita, Akira

    2013-06-01

    We provide a molecular structure determination method, based on multiple-scattering x-ray photoelectron diffraction (XPD) calculations. This method is applied to our XPD data on several molecules having different equilibrium geometries. Then it is confirmed that, by our method, bond lengths and bond angles can be determined with a resolution of less than 0.1 Å and 10∘, respectively. Differently from any other scenario of ultrafast structure determination, we measure the two- or three-dimensional XPD of aligned or oriented molecules in the energy range from 100 to 200 eV with a 4π detection velocity map imaging spectrometer. Thanks to the intense and ultrashort pulse properties of x-ray free-electron lasers, our approach exhibits the most probable method for obtaining ultrafast real-time structural information on small to medium-sized molecules consisting of light elements, i.e., a “molecular movie.”

  7. Contrasting bonding behavior of thiol molecules on carbon fullerene structures

    International Nuclear Information System (INIS)

    Mixteco-Sanchez, J.C.; Guirado-Lopez, R.A.

    2003-01-01

    We have performed semiempirical as well as ab initio density-functional theory (DFT) calculations at T=0 to analyze the equilibrium configurations and electronic properties of spheroidal C 60 as well as of cylindrical armchair (5,5) and (8,8) fullerenes passivated with SCH 3 and S(CH 2 ) 2 CH 3 thiols. Our structural results reveal that the lowest-energy configurations of the adsorbates strongly depend on their chain length and on the structure of the underlying substrate. In the low-coverage regime, both SCH 3 and S(CH 2 ) 2 CH 3 molecules prefer to organize into a molecular cluster on one side of the C 60 surface, providing thus a less protective organic coating for the carbon structure. However, with increasing the number of adsorbed thiols, a transition to a more uniform distribution is obtained, which actually takes place for six and eight adsorbed molecules when using S(CH 2 ) 2 CH 3 and SCH 3 chains, respectively. In contrast, for the tubelike arrangements at the low-coverage regime, a quasi-one-dimensional zigzag organization of the adsorbates along the tubes is always preferred. The sulfur-fullerene bond is considerably strong and is at the origin of outward and lateral displacements of the carbon atoms, leading to the stabilization of three-membered rings on the surface (spheroidal structures) as well as to sizable nonuniform radial deformations (cylindrical configurations). The electronic spectrum of our thiol-passivated fullerenes shows strong variations in the energy difference between the highest occupied and lowest unoccupied molecular orbitals as a function of the number and distribution of adsorbed thiols, opening thus the possibility to manipulate the transport properties of these compounds by means of selective adsorption mechanisms

  8. Tuning the Electronic and Dynamical Properties of a Molecule by Atom Trapping Chemistry.

    Science.gov (United States)

    Pham, Van Dong; Repain, Vincent; Chacon, Cyril; Bellec, Amandine; Girard, Yann; Rousset, Sylvie; Abad, Enrique; Dappe, Yannick J; Smogunov, Alexander; Lagoute, Jérôme

    2017-11-28

    The ability to trap adatoms with an organic molecule on a surface has been used to obtain a range of molecular functionalities controlled by the choice of the molecular trapping site and local deprotonation. The tetraphenylporphyrin molecule used in this study contains three types of trapping sites: two carbon rings (phenyl and pyrrole) and the center of a macrocycle. Catching a gold adatom on the carbon rings leads to an electronic doping of the molecule, whereas trapping the adatom at the macrocycle center with single deprotonation leads to a molecular rotor and a second deprotonation leads to a molecular jumper. We call "atom trapping chemistry" the control of the structure, electronic, and dynamical properties of a molecule achieved by trapping metallic atoms with a molecule on a surface. In addition to the examples previously described, we show that more complex structures can be envisaged.

  9. Diffusion and infrared properties of molecules in ice mantles

    International Nuclear Information System (INIS)

    Schmitt, B.; Grim, R.; Greenberg, J.M.

    1989-01-01

    Within dense molecular clouds the formation of frozen icy mantles on interstellar dust grains is thought to be the result of various growth conditions. The molecules, which make up the ice mantles are probably completely mixed. To study the physical properties of such ice mixtures the experiments were performed on the evaporation processes and on the spectroscopic properties of CO, CO2, and CH4 in water rich ices. The decrease in concentration of volatile molecules in ice samples deposited at 10 K and subsequently heated is found to occur essentially in two steps. The first one, corresponding to an evaporation of part of the volatile molecules, starts at about 25 K for CO, 32 K for CH4, and 70 K for CO2. During the crystallization of H2O ice at temperatures greater than 120 K a second evaporation occurs leading to the complete disappearance of the volatile molecules in the solid phase. The main astrophysical implications of the diffusion and spectroscopic behaviors are presented. The possible effects of a heating source on the fraction of volatile molecules, such as CO trapped in grain mantles, are discussed

  10. QSPR Study of the Retention/release Property of Odorant Molecules in Water Using Statistical Methods

    Directory of Open Access Journals (Sweden)

    Assia Belhassan

    2017-10-01

    Full Text Available An integrated approach physicochemistry and structures property relationships has been carried out to study the odorant molecules retention/release phenomenon in the water. This study aimed to identify the molecular properties (molecular descriptors that govern this phenomenon assuming that modifying the structure leads automatically to a change in the retention/release property of odorant molecules. ACD/ChemSketch, MarvinSketch, and ChemOffice programs were used to calculate several molecular descriptors of 51 odorant molecules (15 alcohols, 11 aldehydes, 9 ketones and 16 esters. A total of 37 molecules (2/3 of the data set were placed in the training set to build the QSPR models, whereas the remaining, 14 molecules (1/3 of the data set constitute the test set. The best descriptors were selected to establish the quantitative structure property relationship (QSPR of the retention/release property of odorant molecules in water using multiple linear regression (MLR, multiple non-linear regression (MNLR and an artificial neural network (ANN methods. We propose a quantitative model according to these analyses. The models were used to predict the retention/release property of the test set compounds, and agreement between the experimental and predicted values was verified. The descriptors showed by QSPR study are used for study and designing of new compounds. The statistical results indicate that the predicted values are in good agreement with the experimental results. To validate the predictive power of the resulting models, external validation multiple correlation coefficient was calculated and has both in addition to a performant prediction power, a favorable estimation of stability. DOI: http://dx.doi.org/10.17807/orbital.v9i4.978 

  11. Spin fine structure of optically excited quantum dot molecules

    Science.gov (United States)

    Scheibner, M.; Doty, M. F.; Ponomarev, I. V.; Bracker, A. S.; Stinaff, E. A.; Korenev, V. L.; Reinecke, T. L.; Gammon, D.

    2007-06-01

    The interaction between spins in coupled quantum dots is revealed in distinct fine structure patterns in the measured optical spectra of InAs/GaAs double quantum dot molecules containing zero, one, or two excess holes. The fine structure is explained well in terms of a uniquely molecular interplay of spin-exchange interactions, Pauli exclusion, and orbital tunneling. This knowledge is critical for converting quantum dot molecule tunneling into a means of optically coupling not just orbitals but also spins.

  12. Zero-mode waveguide nanophotonic structures for single molecule characterization

    Science.gov (United States)

    Crouch, Garrison M.; Han, Donghoon; Bohn, Paul W.

    2018-05-01

    Single-molecule characterization has become a crucial research tool in the chemical and life sciences, but limitations, such as limited concentration range, inability to control molecular distributions in space, and intrinsic phenomena, such as photobleaching, present significant challenges. Recent developments in non-classical optics and nanophotonics offer promising routes to mitigating these restrictions, such that even low affinity (K D ~ mM) biomolecular interactions can be studied. Here we introduce and review specific nanophotonic devices used to support single molecule studies. Optical nanostructures, such as zero-mode waveguides (ZMWs), are usually fabricated in thin gold or aluminum films and serve to confine the observation volume of optical microspectroscopy to attoliter to zeptoliter volumes. These simple nanostructures allow individual molecules to be isolated for optical and electrochemical analysis, even when the molecules of interest are present at high concentration (µM–mM) in bulk solution. Arrays of ZMWs may be combined with optical probes such as single molecule fluorescence, single molecule fluorescence resonance energy transfer, and fluorescence correlation spectroscopy for distributed analysis of large numbers of single-molecule reactions or binding events in parallel. Furthermore, ZMWs may be used as multifunctional devices, for example by combining optical and electrochemical functions in a single discrete architecture to achieve electrochemical ZMWs. In this review, we will describe the optical properties, fabrication, and applications of ZMWs for single-molecule studies, as well as the integration of ZMWs into systems for chemical and biochemical analysis.

  13. Calculations of electronic structure of UF6 molecule and crystal UO2 with relativistic pseudopotential

    International Nuclear Information System (INIS)

    Ehvarestov, R.A.; Panin, A.I.; Bandura, A.V.

    2008-01-01

    Account of relativistic effects on the properties of uranium hexafluoride is testified. Detailed comparison of single electron energies spectrum revealed in nonrelativistic (by Hartree-Fock method), relativistic (by Dirac-Fock method), and scalar-relativistic (using relativistic potential of atomic uranium frame) has been conducted. Optimization procedures of atomic basis in LCAO calculations of molecules and crystals permissive taking into account distortion of atomic orbitals when chemical bonding are discussed, and optimization effect of atomic basis on the results of scalar-relativistic calculations of UF 6 molecule properties is analyzed. Calculations of electronic structure and properties of UO 2 crystal having relativistic and nonrelativistic pseudopotentials have been realized [ru

  14. Electronic properties of single-molecule junction: Effect of the molecular distortion

    International Nuclear Information System (INIS)

    Gao, W.; Zhao, M.; Jiang, Q.

    2009-01-01

    For a model system consisting of a benzenedithio (BDT) molecule sandwiched between two Au plates, the electronic properties as a function of different BDT geometry are investigated using density functional theory. The distorted BDT structures are got through stretching the electrode distance. The corresponding electronic properties, including the spatial distribution of the frontier orbits, the gap between the highest occupied molecular orbital and the lowest unoccupied molecular orbital levels and density of states at the Fermi energy are determined. It reveals that the molecular distortion essentially determines electronic structures. The result should be beneficial to understand the stress-dependent or structure-dependent transport mechanism of electrons of the BDT junction.

  15. Structures and Analysis of Carotenoid Molecules.

    Science.gov (United States)

    Rodriguez-Amaya, Delia B

    Modifications of the usual C40 linear and symmetrical carotenoid skeleton give rise to a wide array of structures of carotenes and xanthophylls in plant tissues. These include acyclic, monocyclic and dicyclic carotenoids, along with hydroxy and epoxy xanthophylls and apocarotenoids. Carotenols can be unesterified or esterified (monoester) in one or two (diester) hydroxyl groups with fatty acids. E-Z isomerization increases the array of possible plant carotenoids even further. Screening and especially quantitative analysis are being carried out worldwide. Visible absorption spectrometry and near infrared reflectance spectroscopy have been used for the initial estimation of the total carotenoid content or the principal carotenoid content when large numbers of samples needed to be analyzed within a short time, as would be the case in breeding programs. Although inherently difficult, quantitative analysis of the individual carotenoids is essential. Knowledge of the sources of errors and means to avoid them has led to a large body of reliable quantitative compositional data on carotenoids. Reverse-phase HPLC with a photodiode array detector has been the preferred analytical technique, but UHPLC is increasingly employed. HPLC-MS has been used mainly for identification and NMR has been useful in unequivocally identifying geometric isomers.

  16. RNA secondary structure diagrams for very large molecules: RNAfdl

    DEFF Research Database (Denmark)

    Hecker, Nikolai; Wiegels, Tim; Torda, Andrew E.

    2013-01-01

    There are many programs that can read the secondary structure of an RNA molecule and draw a diagram, but hardly any that can cope with 10 3 bases. RNAfdl is slow but capable of producing intersection-free diagrams for ribosome-sized structures, has a graphical user interface for adjustments...

  17. Interactions of molecules and the properties of crystals

    Science.gov (United States)

    McConnell, Thomas Daniel Leigh

    In this thesis the basic theory of the lattice dynamics of molecular crystals is considered, with particular reference to the specific case of linear molecules. The objective is to carry out a critical investigation of a number of empirical potentials as models for real systems. Suitable coordinates are introduced, in particular vibrational coordinates which are used to describe the translational and rotational modes of the free molecule. The Taylor expansion of the intermolecular potential is introduced and its terms considered, in particular the (first-order) equilibrium conditions for such a system and the (second-order) lattice vibrations. The elastic properties are also considered, in particular with reference to the specific case of rhombohedral crystals. The compressibility and a number of conditions for elastic stability are introduced. The total intermolecular interaction potential is divided into three components using perturbation methods, the electrostatic energy, the repulsion energy and the dispersion energy. A number of models are introduced for these various components. The induction energy is neglected. The electrostatic interaction is represented by atomic multipole and molecular multipole models. The repulsion and dispersion energies are modelled together in a central interaction potential, either the Lennard-Jones atom-atom potential or the anisotropic Berne-Pechukas molecule-molecule potential. In each case, the Taylor expansion coefficients, used to calculate the various molecular properties, are determined. An algorithm is described which provides a relatively simple method for calculating cartesian tensors, which are found in the Taylor expansion coefficients of the multipolar potentials. This proves to be particularly useful from a computational viewpoint, both in terms of programming and calculating efficiency. The model system carbonyl sulphide is introduced and its lattice properties are described. Suitable parameters for potentials used

  18. Correlating substituent parameter values to electron transport properties of molecules

    International Nuclear Information System (INIS)

    Vedova-Brook, Natalie; Matsunaga, Nikita; Sohlberg, Karl

    2004-01-01

    There are a vast number of organic compounds that could be considered for use in molecular electronics. Because of this, the need for efficient and economical screening tools has emerged. We demonstrate that the substituent parameter values (σ), commonly found in advanced organic chemistry textbooks, correlate strongly with features of the charge migration process, establishing them as useful indicators of electronic properties. Specifically, we report that ab initio derived electronic charge transfer values for 16 different substituted aromatic molecules for molecular junctions correlate to the σ values with a correlation coefficient squared (R 2 ) of 0.863

  19. Public epitopes and the antigenic structure of the HLA molecules.

    Science.gov (United States)

    Rodey, G E; Fuller, T C

    1987-01-01

    Simplified procedures for determining amino acid sequences in proteins and nucleotide sequences in DNA have rapidly expanded the number of MHC molecules for which primary amino acid structure is known. These molecules will be especially valuable as tools to study the structure-function relationships of globular proteins because of the extensive polymorphism of genes coding the MHC genes products. The general three-dimensional structure of class I MHC molecules was recently deduced, but the more subtle topographical microconformations are still undefined. Definition and topographical mapping of epitopes, defined by serological or cellular immune effector products, will be critical probes for these three-dimensional studies. Comparative studies of amino acid sequences among various MHC and molecules have revealed distinct regions of hypervariability in the alpha-1 and -2 domains of class I heavy chains and the alpha-1 and beta-1 domains of most class II molecules. Mutant MHC molecules that differ from each other by no more than one to three amino acids can have structural changes which may result in a loss of the private epitopes that defined the allelic gene product. On the basis of these studies, the private epitopes are thought to be determined by one or more of the hypervariable regions. Similar studies of the relationships between specific regions of the molecule and public epitopes are not fully explored. Because public epitopes are partially conserved structures, one might expect that their structure is not principally determined by hypervariable region. In fact, however, some public epitopes, such as A2/B17 and BW4/Bw6, do map to diversity regions. Epitope mapping as a means of identifying specific topographic sites and relating these sites to specific functional regions of the molecule will be difficult unless the epitopes themselves are better defined. Thus, the capacity to distinguish spatially distinct public epitopes from cross-reactive homologous

  20. The structure of small molecules with the Coulomb Explosion method

    International Nuclear Information System (INIS)

    Vager, Z.; Kanter, E.P.

    1987-01-01

    The content of this paper is divided into two parts: (1) achievements of the last two years in studying molecular ion structure with the aid of the newly developed Coulomb-Explosion (CE) method, and (2) the understanding of the modern CE data in terms of an invariant density of nuclear coordinates of the studied molecule

  1. Structure factors for tunneling ionization rates of molecules

    DEFF Research Database (Denmark)

    Madsen, L.B.; Jensen, F.; Tolstikhin, O.I.

    2013-01-01

    Within the weak-field asymptotic theory, the dependence of the tunneling ionization rate of a molecule in a static electric field on its orientation with respect to the field is determined by the structure factor for the highest occupied molecular orbital (HOMO). An accurate determination...

  2. Adsorption properties of the molecule resveratrol on CNT(8,0-10) nanotube: Geometry optimization, molecular structure, spectroscopic (NMR, UV/Vis, excited state), FMO, MEP and HOMO-LUMO investigations

    Science.gov (United States)

    Sheikhi, Masoome; Shahab, Siyamak; Khaleghian, Mehrnoosh; Hajikolaee, Fatemeh Haji; Balakhanava, Iryna; Alnajjar, Radwan

    2018-05-01

    In the present work the adsorption properties of the molecule Resveratrol (RSV) (trans-3,5,4‧-Trihydroxystilbene) on CNT(8,0-10) nanotube was investigated by Density Functional Theory (DFT) in the gaseous phase for the first time. The non-bonded interaction effects of compounds RSV and CNT(8,0-10) nanotube on the electronic properties, chemical shift tensors and natural charge were determined and discussed. The electronic spectra of the RSV and the complex CNT(8,0-10)/RSV in the gaseous phase were calculated by Time Dependent Density Functional Theory (TD-DFT) for investigation of the maximum wavelength value of the RSV before and after the non-bonded interaction with the CNT(8,0-10) nanotube and molecular orbitals involved in the formation of absorption spectrum of the complex RSV at maximum wavelength.

  3. Elastic Properties of Nucleic Acids by Single-Molecule Force Spectroscopy.

    Science.gov (United States)

    Camunas-Soler, Joan; Ribezzi-Crivellari, Marco; Ritort, Felix

    2016-07-05

    We review the current knowledge on the use of single-molecule force spectroscopy techniques to extrapolate the elastic properties of nucleic acids. We emphasize the lesser-known elastic properties of single-stranded DNA. We discuss the importance of accurately determining the elastic response in pulling experiments, and we review the simplest models used to rationalize the experimental data as well as the experimental approaches used to pull single-stranded DNA. Applications used to investigate DNA conformational transitions and secondary structure formation are also highlighted. Finally, we provide an overview of the effects of salt and temperature and briefly discuss the effects of contour length and sequence dependence.

  4. Electronic and transport properties of Cobalt-based valence tautomeric molecules and polymers

    Science.gov (United States)

    Chen, Yifeng; Calzolari, Arrigo; Buongiorno Nardelli, Marco

    2011-03-01

    The advancement of molecular spintronics requires further understandings of the fundamental electronic structures and transport properties of prototypical spintronics molecules and polymers. Here we present a density functional based theoretical study of the electronic structures of Cobalt-based valence tautomeric molecules Co III (SQ)(Cat)L Co II (SQ)2 L and their polymers, where SQ refers to the semiquinone ligand, and Cat the catecholate ligand, while L is a redox innocent backbone ligand. The conversion from low-spin Co III ground state to high-spin Co II excited state is realized by imposing an on-site potential U on the Co atom and elongating the Co-N bond. Transport properties are subsequently calculated by extracting electronic Wannier functions from these systems and computing the charge transport in the ballistic regime using a Non-Equilibrium Green's Function (NEGF) approach. Our transport results show distinct charge transport properties between low-spin ground state and high-spin excited state, hence suggesting potential spintronics devices from these molecules and polymers such as spin valves.

  5. Chemically Aware Model Builder (camb): an R package for property and bioactivity modelling of small molecules.

    Science.gov (United States)

    Murrell, Daniel S; Cortes-Ciriano, Isidro; van Westen, Gerard J P; Stott, Ian P; Bender, Andreas; Malliavin, Thérèse E; Glen, Robert C

    2015-01-01

    In silico predictive models have proved to be valuable for the optimisation of compound potency, selectivity and safety profiles in the drug discovery process. camb is an R package that provides an environment for the rapid generation of quantitative Structure-Property and Structure-Activity models for small molecules (including QSAR, QSPR, QSAM, PCM) and is aimed at both advanced and beginner R users. camb's capabilities include the standardisation of chemical structure representation, computation of 905 one-dimensional and 14 fingerprint type descriptors for small molecules, 8 types of amino acid descriptors, 13 whole protein sequence descriptors, filtering methods for feature selection, generation of predictive models (using an interface to the R package caret), as well as techniques to create model ensembles using techniques from the R package caretEnsemble). Results can be visualised through high-quality, customisable plots (R package ggplot2). Overall, camb constitutes an open-source framework to perform the following steps: (1) compound standardisation, (2) molecular and protein descriptor calculation, (3) descriptor pre-processing and model training, visualisation and validation, and (4) bioactivity/property prediction for new molecules. camb aims to speed model generation, in order to provide reproducibility and tests of robustness. QSPR and proteochemometric case studies are included which demonstrate camb's application.Graphical abstractFrom compounds and data to models: a complete model building workflow in one package.

  6. Equilibrium Structure of Manganese Trifluoride (MnF3) Molecule

    International Nuclear Information System (INIS)

    Caliskan, M.

    2004-01-01

    The symmetry lowering in manganese trifluoride molecule due to Jahn-Teller distortion was demonstrated in both the experimental and computational results. The molecule does not have D 3 h (or C 3 v) symmetry, rather it has C 2 v symmetry it has been shown from electron-diffraction measurements, that even a molecule of D 3 h symmetry in its equilibrium geometry would appear as having C 3 v symmetry. The manganese trifluoride molecular structures is an example of concerted applications of electron diffraction experiment and computation. It was found two lower energy structures with C 2 v symmetry, one corresponding to the ground state and another corresponding to the transition state. In this work we have calculate the equilibrium structure of the MnF 3 in the C 2 v configuration using the Interionic Force Model. We have compared our results for equilibrium bond lengths and bond angles with measured values from electron diffraction and with the results of quantum chemical calculations. The agreement can be considered as very reasonable

  7. Vortex-ring-fractal Structure of Atom and Molecule

    International Nuclear Information System (INIS)

    Osmera, Pavel

    2010-01-01

    This chapter is an attempt to attain a new and profound model of the nature's structure using a vortex-ring-fractal theory (VRFT). Scientists have been trying to explain some phenomena in Nature that have not been explained so far. The aim of this paper is the vortex-ring-fractal modeling of elements in the Mendeleev's periodic table, which is not in contradiction to the known laws of nature. We would like to find some acceptable structure model of the hydrogen as a vortex-fractal-coil structure of the proton and a vortex-fractal-ring structure of the electron. It is known that planetary model of the hydrogen atom is not right, the classical quantum model is too abstract. Our imagination is that the hydrogen is a levitation system of the proton and the electron. Structures of helium, oxygen, and carbon atoms and a hydrogen molecule are presented too.

  8. Fundamental properties of molecules on surfaces. Molecular switching and interaction of magnetic molecules with superconductors

    Energy Technology Data Exchange (ETDEWEB)

    Hatter, Nino

    2016-12-14

    In this thesis, we investigate individual molecular switches and metal-organic complexes on surfaces with scanning tunneling microscopy (STM) and spectroscopy (STS) at low temperatures. One focus addresses the switching ability and mechanism of diarylethene on Ag(111). The other focus lies on resolving and tuning magnetic interactions of individual molecules with superconductors. 4,4'-(4,4'-(perfluorocyclopent-1-ene-1,2-diyl)bis (5-methylthiophene-4,2-diyl)dip yridine (PDTE) is a prototypical photochromic switch. We can induce a structural change of individual PDTE molecules on Ag(111) with the STM tip. This change is accompanied by a reduction of the energy gap between the occupied and unoccupied molecular orbitals. Density functional theory (DFT) calculations reveal that the induced switching corresponds to a ring-closing reaction from an open isomer in a flat adsorption configuration to a ring-closed isomer with its methyl groups in a cis configuration. The final product is thermodynamically stabilized by strong dispersion interactions with the surface. A linear dependence of the switching threshold with the tip-sample distance with a minimal threshold of 1.4 V is found, which we assign to a combination of an electric-field induced process and a tunneling-electron contribution. DFT calculations suggest a large activation barrier for a ring-closing reaction from the open flat configuration into the closed cis configuration. The interaction of magnetic molecules with superconductors is studied on manganese phthalocyanine (MnPc) adsorbed on Pb(111). We find triplets of Shiba states inside the superconducting gap. Different adsorption sites of MnPc provide a large variety of exchange coupling strengths, which lead to a collective energy shift of the Shiba triplets. We can assign the splitting of the Shiba states to be an effect of magnetic anisotropy in the system. A quantum phase transition from a ''Kondo screened'' to a &apos

  9. Selective small-molecule inhibition of an RNA structural element

    Energy Technology Data Exchange (ETDEWEB)

    Howe, John A.; Wang, Hao; Fischmann, Thierry O.; Balibar, Carl J.; Xiao, Li; Galgoci, Andrew M.; Malinverni, Juliana C.; Mayhood, Todd; Villafania, Artjohn; Nahvi, Ali; Murgolo, Nicholas; Barbieri, Christopher M.; Mann, Paul A.; Carr, Donna; Xia, Ellen; Zuck, Paul; Riley, Dan; Painter, Ronald E.; Walker, Scott S.; Sherborne, Brad; de Jesus, Reynalda; Pan, Weidong; Plotkin, Michael A.; Wu, Jin; Rindgen, Diane; Cummings, John; Garlisi, Charles G.; Zhang, Rumin; Sheth, Payal R.; Gill, Charles J.; Tang, Haifeng; Roemer , Terry (Merck)

    2015-09-30

    Riboswitches are non-coding RNA structures located in messenger RNAs that bind endogenous ligands, such as a specific metabolite or ion, to regulate gene expression. As such, riboswitches serve as a novel, yet largely unexploited, class of emerging drug targets. Demonstrating this potential, however, has proven difficult and is restricted to structurally similar antimetabolites and semi-synthetic analogues of their cognate ligand, thus greatly restricting the chemical space and selectivity sought for such inhibitors. Here we report the discovery and characterization of ribocil, a highly selective chemical modulator of bacterial riboflavin riboswitches, which was identified in a phenotypic screen and acts as a structurally distinct synthetic mimic of the natural ligand, flavin mononucleotide, to repress riboswitch-mediated ribB gene expression and inhibit bacterial cell growth. Our findings indicate that non-coding RNA structural elements may be more broadly targeted by synthetic small molecules than previously expected.

  10. Electronic structure of molecules using relativistic effective core potentials

    International Nuclear Information System (INIS)

    Hay, P.J.

    1981-01-01

    Starting with one-component Cowan-Griffin relativistic Hartree-Fock orbitals, which successfully incorporate the mass-velocity and Darwin terms present in more complicated wavefunctions such as Dirac-Hartree-Fock, one can derive relativistic effective core potentials (RECP's) to carry out molecular calculations. These potentials implicitly include the dominant relativistic terms for molecules while allowing one to use the traditional quantum chemical techniques for studying the electronic structure of molecules. The effects of spin-orbit coupling can then be included using orbitals from such calculations using an effective 1-electron, 1-center spin-orbit operator. Applications to molecular systems involving heavy atoms, show good agreement with available spectroscopic data on molecular geometries and excitation energies

  11. Structures and potential energy functions of Pu3 molecule

    International Nuclear Information System (INIS)

    Meng Daqiao; Jiang Gang; Liu Xiaoya; Luo Deli; Zhu Zhenghe

    2001-01-01

    Density functional (B3LYP) method with relativistic effective core potential (RECP) has been used to optimize the structures of Pu 2 and Pu 3 molecules. The results show that the ground states of Pu 2 and Pu 3 molecules are of D ∞h and D 3h symmetry, and of 13 and 19 fold, respectively. The spectral constants of Pu 2 , ω e = 52.3845 cm -1 and ω e x e = 0.0201 cm -1 , and the harmonic frequencies of Pu 3 , ν 1 = 56.9007 cm -1 , ν 2 = 57.1816 cm - '1 and ν 3 = 64.0785 cm -1 , have also been obtained on the B3LYP/RECP level. The potential energy functions of Pu 2 and Pu 3 have been derived, for the first time so far as known, from normal equation fitting and the many-body expansion theory

  12. Structural characterization of chiral molecules using vibrational circular dichroism spectroscopy

    DEFF Research Database (Denmark)

    Lassen, Peter Rygaard

    2006-01-01

    comparison of experimental and calculated spectra. Theoretical structures of the sample molecules were constructed and optimized using molecular mechanical force fields followed by the quantum mechanical method density functional theory (DFT). Calculations of IR absorption and VCD spectra were then carried...... out using the same DFT methods. Here, VCD has the advantage over CD that time-independent DFT calculations are sufficient. During the course of this project, the above methodology has been applied to a range of molecules. Some of them (nyasol, curcuphenol dimers and ginkgolide) are purely organic...... or as flexible as the curcuphenol dimer with 11 variable dihedral angles. This illustrates the capabilities of the method, which are primarily limited by the duration of DFT calculations. In the case of metal complexes, they have only recently become within reach of DFT, which opens new possibilities...

  13. Porous Materials - Structure and Properties

    DEFF Research Database (Denmark)

    Nielsen, Anders

    1997-01-01

    The paper presents some viewpoints on the description of the pore structure and the modelling of the properties of the porous building materials. Two examples are given , where it has been possible to connect the pore structure to the properties: Shrinkage of autoclaved aerated concrete...

  14. Atomistic theory of excitonic fine structure in InAs/InP nanowire quantum dot molecules

    Science.gov (United States)

    Świderski, M.; Zieliński, M.

    2017-03-01

    Nanowire quantum dots have peculiar electronic and optical properties. In this work we use atomistic tight binding to study excitonic spectra of artificial molecules formed by a double nanowire quantum dot. We demonstrate a key role of atomistic symmetry and nanowire substrate orientation rather than cylindrical shape symmetry of a nanowire and a molecule. In particular for [001 ] nanowire orientation we observe a nonvanishing bright exciton splitting for a quasimolecule formed by two cylindrical quantum dots of different heights. This effect is due to interdot coupling that effectively reduces the overall symmetry, whereas single uncoupled [001 ] quantum dots have zero fine structure splitting. We found that the same double quantum dot system grown on [111 ] nanowire reveals no excitonic fine structure for all considered quantum dot distances and individual quantum dot heights. Further we demonstrate a pronounced, by several orders of magnitude, increase of the dark exciton optical activity in a quantum dot molecule as compared to a single quantum dot. For [111 ] systems we also show spontaneous localization of single particle states in one of nominally identical quantum dots forming a molecule, which is mediated by strain and origins from the lack of the vertical inversion symmetry in [111 ] nanostructures of overall C3 v symmetry. Finally, we study lowering of symmetry due to alloy randomness that triggers nonzero excitonic fine structure and the dark exciton optical activity in realistic nanowire quantum dot molecules of intermixed composition.

  15. Waved graphene: Unique structure for the adsorption of small molecules

    International Nuclear Information System (INIS)

    Pan, Hui

    2017-01-01

    We propose waved graphenes for the strong adsorption of molecules and investigate their potential applications. We find that the physical adsorption of molecules on waved graphene is greatly enhanced by compression. At optimal compression, the physical adsorption energies of H_2, N_2, NO, and CO are increased by 6–9 times, and that for O_2 is more than 2 times. We show that the energy for their chemical adsorption on waved graphene decreases dramatically with the increment of compression. The energy of dissociation of H_2 on flat graphene is 1.63 eV and reduced to 0.06 eV (96% reduction) on waved graphene at a compression of 50%, respectively. The energy for chemical adsorption of O_2 on waved graphenes is extremely reduced from 0.98 eV to −0.57 eV as with compression increasing from 0 to 50%, indicating the transition of endothermic chemical adsorption to exothermic. We further show that the electronic properties of waved graphenes are modified, leading to the change of electrical characters. We see that the waved graphenes may find applications in gas storage, sensor and catalyst because of enhanced physical and chemical adsorption and the induced change of electronic properties. - Highlights: • Adsorption of small molecules on waved graphene is greatly enhanced. • Strong physical adsorption in the trough of waved graphene can be achieved by tuning the curvature. • Chemical adsorption is on the crest of waved graphene. • Exothermic dissociation of H2 and O2 can be realized on waved graphene under high compression. • Wave graphene can be candidates as catalysts and gas storage/sensor.

  16. Waved graphene: Unique structure for the adsorption of small molecules

    Energy Technology Data Exchange (ETDEWEB)

    Pan, Hui, E-mail: huipan@umac.mo

    2017-03-01

    We propose waved graphenes for the strong adsorption of molecules and investigate their potential applications. We find that the physical adsorption of molecules on waved graphene is greatly enhanced by compression. At optimal compression, the physical adsorption energies of H{sub 2}, N{sub 2}, NO, and CO are increased by 6–9 times, and that for O{sub 2} is more than 2 times. We show that the energy for their chemical adsorption on waved graphene decreases dramatically with the increment of compression. The energy of dissociation of H{sub 2} on flat graphene is 1.63 eV and reduced to 0.06 eV (96% reduction) on waved graphene at a compression of 50%, respectively. The energy for chemical adsorption of O{sub 2} on waved graphenes is extremely reduced from 0.98 eV to −0.57 eV as with compression increasing from 0 to 50%, indicating the transition of endothermic chemical adsorption to exothermic. We further show that the electronic properties of waved graphenes are modified, leading to the change of electrical characters. We see that the waved graphenes may find applications in gas storage, sensor and catalyst because of enhanced physical and chemical adsorption and the induced change of electronic properties. - Highlights: • Adsorption of small molecules on waved graphene is greatly enhanced. • Strong physical adsorption in the trough of waved graphene can be achieved by tuning the curvature. • Chemical adsorption is on the crest of waved graphene. • Exothermic dissociation of H2 and O2 can be realized on waved graphene under high compression. • Wave graphene can be candidates as catalysts and gas storage/sensor.

  17. Structure and spectra of a confined HeH molecule

    International Nuclear Information System (INIS)

    Lo, J M H; Klobukowski, M; Bielinska-Wacz, D; Schreiner, E W S; Diercksen, G H F

    2006-01-01

    The influence of spatial confinement on the structure and spectra of the Rydberg HeH molecule is analysed at the level of the variational full configuration interaction approach. The confining potential is assumed to have cylindrical symmetry, with the symmetry axis of the potential overlapping with the molecular bond. In the direction perpendicular to the axis quadratic dependence of the potential on the electron coordinates is assumed. The influence of the confining potential on the form of the potential energy curves (in particular on the bond lengths), on the electronic spectra and on the ionization due to the confinement is studied in detail

  18. Evaluation of the Kinetic Property of Single-Molecule Junctions by Tunneling Current Measurements.

    Science.gov (United States)

    Harashima, Takanori; Hasegawa, Yusuke; Kiguchi, Manabu; Nishino, Tomoaki

    2018-01-01

    We investigated the formation and breaking of single-molecule junctions of two kinds of dithiol molecules by time-resolved tunneling current measurements in a metal nanogap. The resulting current trajectory was statistically analyzed to determine the single-molecule conductance and, more importantly, to reveal the kinetic property of the single-molecular junction. These results suggested that combining a measurement of the single-molecule conductance and statistical analysis is a promising method to uncover the kinetic properties of the single-molecule junction.

  19. Effects of Electric Field on the Valence-Bond Property of an Electron in a Quantum-Dot Molecule

    Institute of Scientific and Technical Information of China (English)

    王立民; 罗莹; 马本堃

    2002-01-01

    The electronic structure of the quantum-dot molecules in an electric field is investigated by the finite element method with the effective mass approximation. The numerical calculation results show that the valence bond of the quantum-dot molecule alternates between covalent bonds and ionic bonds as the electric field increases. The valence-bond property can be reflected by the oscillator strength of the intraband transition. The bound state with the highest energy level in the quantum-dot molecule gradually changes into a quasibound state when the electric field increases.

  20. Mapping small molecule binding data to structural domains.

    Science.gov (United States)

    Kruger, Felix A; Rostom, Raghd; Overington, John P

    2012-01-01

    Large-scale bioactivity/SAR Open Data has recently become available, and this has allowed new analyses and approaches to be developed to help address the productivity and translational gaps of current drug discovery. One of the current limitations of these data is the relative sparsity of reported interactions per protein target, and complexities in establishing clear relationships between bioactivity and targets using bioinformatics tools. We detail in this paper the indexing of targets by the structural domains that bind (or are likely to bind) the ligand within a full-length protein. Specifically, we present a simple heuristic to map small molecule binding to Pfam domains. This profiling can be applied to all proteins within a genome to give some indications of the potential pharmacological modulation and regulation of all proteins. In this implementation of our heuristic, ligand binding to protein targets from the ChEMBL database was mapped to structural domains as defined by profiles contained within the Pfam-A database. Our mapping suggests that the majority of assay targets within the current version of the ChEMBL database bind ligands through a small number of highly prevalent domains, and conversely the majority of Pfam domains sampled by our data play no currently established role in ligand binding. Validation studies, carried out firstly against Uniprot entries with expert binding-site annotation and secondly against entries in the wwPDB repository of crystallographic protein structures, demonstrate that our simple heuristic maps ligand binding to the correct domain in about 90 percent of all assessed cases. Using the mappings obtained with our heuristic, we have assembled ligand sets associated with each Pfam domain. Small molecule binding has been mapped to Pfam-A domains of protein targets in the ChEMBL bioactivity database. The result of this mapping is an enriched annotation of small molecule bioactivity data and a grouping of activity classes

  1. Structure of deformable diatomic molecules: a modified n-butane liquid

    International Nuclear Information System (INIS)

    Jang, Seanea; Kim, Soonchul; Lee, Songhi

    2005-01-01

    The density functional approximation for polyatomic molecules, which is based on the bridge function of the intermolecular interaction, was developed and applied to investigate the thermodynamic and the structural properties of deformable diatomic molecules. The Percus trick was employed to calculate the uniform structure of modified n-butane. The calculated static correlation functions were used to predict the density behaviors of a modified n-butane liquid at liquid-solid interfaces. The theoretical results show that (i) at low densities, the hypernetted-chain (HNC) equation compares with the density functional approximation based on the bridge function and that (ii) the relative population between the gauche and the trans states strongly affects the liquid structure at liquid-solid interfaces.

  2. Radiation - induced changes in the optical properties of hemoglobin molecule

    International Nuclear Information System (INIS)

    Selim, N.S; El-Marakby, S.M.

    2009-01-01

    Adult male albino rats were exposed to different doses of gamma radiation from Cs-137 source. Hemoglobin samples were analyzed 24 hrs after irradiation. The UV-visible spectrum of hemoglobin molecule was measured in the range 200 to 700 nm. The overall spectrum of the hemoglobin molecule showed hypochromicity that increased with dose increase. To investigate the effect of radiation on the hemoglobin molecule, different parameters of the spectrum were calculated: molar absorption coefficient, absorption cross section, transition dipole moment , dipole length, the optical energy gap and activation energy for each characteristic peak. The obtained results revealed that the radiation effect can induce rearrangement of the transition dipole moments and change molecular energy levels of the hemoglobin molecule

  3. Organization of extracting molecules of the diamide type: link with the extracting properties?

    International Nuclear Information System (INIS)

    Meridiano, Y.

    2009-02-01

    The aim of these studies is to establish a link between the different organizations of diamide extractants (used in the DIAMEX process) and their extracting properties. The effects of the key parameters leading the liquid-liquid extraction (concentration of extractant, nature of solute, activity of the aqueous phase, nature of the diluent and temperature) are studied: 1) at the supramolecular scale, with the characterization of the extractant organizations by vapor-pressure osmometry (VPO) and small angle neutron and X-ray scattering (SANS/SAXS) experiments; 2) at the molecular scale, with the quantification of the extracted solutes (water, nitric acid, metal nitrate) and the determination of extracted complexes stoichiometries by electro-spray mass spectrometry (ESI-MS) experiments. The DMDOHEMA molecule acts as a classical surfactant and forms aggregates of the reverse micelle type. Taking into account the established supramolecular diagrams, a quantitative link between the extractants structures and their extracting properties has been brought to light. To model the europium nitrate extraction, two approaches have been developed: - an approach based on mass action laws. Extractions equilibria have been proposed taking into account the supramolecular speciation; - an innovative approach considering the extracted ions as adsorbed on a specific surface of the extractant molecule which depends on the extractant organization state. The ion extraction can be considered as a sum of isotherms corresponding to the different states of organization. This approach allows to compare the extraction efficiency of an extracting molecule as a function of its organization state. (author)

  4. Measurement of the conductance properties of single organic molecules using gold nanoparticles

    Science.gov (United States)

    Gordin, Yoav

    conduct more than an order of magnitude less than those that are fully conjugated. A distinct feature of the conjugated molecule is the appearance of pronounced peaks in its conductance at certain voltage values. We have shown that these peaks can be gated randomly by the electrostatic environment, but the peak spectrum is reproducible among the different samples of the same molecular species that we studied. To properly study and understand the peak structure we developed the ability to add gate dependent measurements to our system. Unfortunately the backdrop of this was a drastic reduction in the yield of good samples for measurement. We focused on four different conjugated molecules to attempt to understand the effect of the molecular structure on the properties of the peak spectra. We have been able to measure three of these molecules, and obtained SET diamond plots reminiscent of those seen for the single particles. The molecular diamonds have a larger energy gap than that found in single particles, as can be expected from their smaller size. We do not yet have enough data on this issue to make any definite statements on the influence of the molecular structure on the peak structure. Another topic investigated in this work is the physics of the two gold nanoparticles, giving rise to double quantum dot (DQD) phenomena. This physics is observed in dimers that do not exhibit "molecular" (high energy) features, or at low voltages before the appearance of the molecular peaks. We have used these phenomena to fully characterize the properties of our system and understand better the role the molecule plays in transport at low bias (below the voltage of the first peak). I begin this thesis with an introduction to the field of molecular electronics; I briefly review the theoretical approaches and the experimental methods used. I then describe in detail the dimer method, whose development took up a major part of this work, relaying in detail the relevant issues and

  5. Structural studies on proton/protonation of the protein molecule

    International Nuclear Information System (INIS)

    Morimoto, Yukio; Kida, Akiko; Chatake, Toshiyuki; Yamaguchi, Hiroshi; Hosokawa, Keiichi; Murakami, Takuto; Umino, Masaaki; Tanaka, Ichiro; Hisatome, Ichiro; Yanagisawa, Yasutake; Fujiwara, Satoshi; Hidaka, Yuji; Shimamoto, Shigeru; Fujiwara, Mitsutoshi; Nakanishi, Takeyoshi

    2015-01-01

    This paper reports three studies involved in the analysis of protons and protonation at physiologically active sites in protein molecules. (1) 'Elucidation of the higher-order structure formation and activity performing mechanism of yeast proteasome.' With an aim to apply to anti-cancer drugs, this study performed the shape analysis of the total structure of 26S proteasome using small-angle X-ray scattering to clarify the complex form where controlling elements bonded to the both ends of 20S catalyst body, and analyzed the complex structure between the active sites of 20S and inhibitor (drug). (2) 'Basic study on the neutron experiment of biomolecules such as physiologically active substances derived from Natto-bacteria.' This study conducted the purification, crystallization, and X-ray analysis experiment of nattokinase; high-grade purification and solution experiment of vitamin K2 (menaquinone-7); and Z-DNA crystal structure study related to the neutron crystal analysis of DNA as another biomolecule structure study. (3) 'Functional evaluation on digestive enzymes derived from Nephila clavata.' As an Alzheimer's disease-related amyloid fibril formation model, this study carried out elucidation on the fibrosis and fiber-forming mechanism of the traction fiber of Nephila clavata, and the functional analysis of its degrading enzyme. (A.O.)

  6. Structural Properties of Ferroelectric Perovskites

    National Research Council Canada - National Science Library

    Vanderbilt, David

    1998-01-01

    Under this research grant, we carried out realistic first-principles computer calculations of the ground-state and finite-temperature structural and dielectric properties of cubic perovskite materials...

  7. Structure factors for tunneling ionization rates of molecules: General Hartree-Fock-based integral representation

    Science.gov (United States)

    Madsen, Lars Bojer; Jensen, Frank; Dnestryan, Andrey I.; Tolstikhin, Oleg I.

    2017-07-01

    In the leading-order approximation of the weak-field asymptotic theory (WFAT), the dependence of the tunneling ionization rate of a molecule in an electric field on its orientation with respect to the field is determined by the structure factor of the ionizing molecular orbital. The WFAT yields an expression for the structure factor in terms of a local property of the orbital in the asymptotic region. However, in general quantum chemistry approaches molecular orbitals are expanded in a Gaussian basis which does not reproduce their asymptotic behavior correctly. This hinders the application of the WFAT to polyatomic molecules, which are attracting increasing interest in strong-field physics. Recently, an integral-equation approach to the WFAT for tunneling ionization of one electron from an arbitrary potential has been developed. The structure factor is expressed in an integral form as a matrix element involving the ionizing orbital. The integral is not sensitive to the asymptotic behavior of the orbital, which resolves the difficulty mentioned above. Here, we extend the integral representation for the structure factor to many-electron systems treated within the Hartree-Fock method and show how it can be implemented on the basis of standard quantum chemistry software packages. We validate the methodology by considering noble-gas atoms and the CO molecule, for which accurate structure factors exist in the literature. We also present benchmark results for CO2 and for NH3 in the pyramidal and planar geometries.

  8. Structure determination by photoelectron diffraction of small molecules on surfaces

    International Nuclear Information System (INIS)

    Booth, N.A.

    1998-05-01

    The synchrotron radiation based technique of Photoelectron Diffraction (PhD) has been applied to three adsorption systems. Structure determinations, are presented for each system which involve the adsorption of small molecules on the low index {110} plane of single crystal Cu and Ni substrates. For the NH 3 -Cu(110) system PhD was successful in determining a N-Cu bondlength of 2.05 ± 0.03 A as well as values for the anisotropic vibrational amplitudes of the N and an expansion of the 1st to 2nd Cu substrate layer spacing from the bulk value of 0.08 ± 0.08 A. The most significant and surprising structural parameter determined for this system was that the N atom occupies an asymmetric adsorption site. Rather than being situated in the expected high symmetry atop site the N atom was found to be offset parallel to the surface by 0.37 ± 0.12 A in the [001] azimuth. In studying the glycine-Cu(110) system the adsorption structure of an amino-acid has been quantified. The local adsorption geometries of all the atoms involved in the molecule to surface bond have been determined. The glycine molecule is found to be bonded to the surface via both its amino and carboxylate functional groups. The molecule straddles two [11-bar0] rows of the Cu substrate. The two O atoms are found to be in identical sites both approximately atop Cu atoms on the [11-bar0] rows offset parallel to the surface by 0.80 ± 0.05 A in the [001] azimuth, the O-Cu bondlength was found to be 2.03 ± 0.05 A. The N atom was also found to adsorb in an approximately atop geometry but offset parallel to the surface by 0.24 ± 0.10A in the [11-bar0] direction, the N-Cu bondlength was found to be 2.05± 0.05 A. PhD was unsuccessful in determining the positions of the two C atoms that form a bridge between the two functional groups bonded to the surface due to difficulties in separating the two inequivalent contributions to the final intensity modulation function. For the CN-Ni(110) system both PhD and Near Edge

  9. Adsorption property of volatile molecules on ZnO nanowires ...

    Indian Academy of Sciences (India)

    2018-02-02

    Feb 2, 2018 ... 2Centre for Fire Explosive and Environment Safety, Defence Research and Development Organisation, Ministry ... present work, Zn site was chosen as an adsorption site for a ... Virtual NanoLab [18] software was utilized to construct the ..... In reality, there will be plenty of vapour molecules that interact over.

  10. Evaluation of the Electronic Structure of Single-Molecule Junctions Based on Current-Voltage and Thermopower Measurements: Application to C60 Single-Molecule Junction.

    Science.gov (United States)

    Komoto, Yuki; Isshiki, Yuji; Fujii, Shintaro; Nishino, Tomoaki; Kiguchi, Manabu

    2017-02-16

    The electronic structure of molecular junctions has a significant impact on their transport properties. Despite the decisive role of the electronic structure, a complete characterization of the electronic structure remains a challenge. This is because there is no straightforward way of measuring electron spectroscopy for an individual molecule trapped in a nanoscale gap between two metal electrodes. Herein, a comprehensive approach to obtain a detailed description of the electronic structure in single-molecule junctions based on the analysis of current-voltage (I-V) and thermoelectric characteristics is described. It is shown that the electronic structure of the prototypical C 60 single-molecule junction can be resolved by analyzing complementary results of the I-V and thermoelectric measurement. This combined approach confirmed that the C 60 single-molecule junction was highly conductive with molecular electronic conductances of 0.033 and 0.003 G 0 and a molecular Seebeck coefficient of -12 μV K -1 . In addition, we revealed that charge transport was mediated by a LUMO whose energy level was located 0.5≈0.6 eV above the Fermi level of the Au electrode. © 2017 Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim.

  11. Near-unity mass accommodation coefficient of organic molecules of varying structure.

    Science.gov (United States)

    Julin, Jan; Winkler, Paul M; Donahue, Neil M; Wagner, Paul E; Riipinen, Ilona

    2014-10-21

    Atmospheric aerosol particles have a significant effect on global climate, air quality, and consequently human health. Condensation of organic vapors is a key process in the growth of nanometer-sized particles to climate relevant sizes. This growth is very sensitive to the mass accommodation coefficient α, a quantity describing the vapor uptake ability of the particles, but knowledge on α of atmospheric organics is lacking. In this work, we have determined α for four organic molecules with diverse structural properties: adipic acid, succinic acid, naphthalene, and nonane. The coefficients are studied using molecular dynamics simulations, complemented with expansion chamber measurements. Our results are consistent with α = 1 (indicating nearly perfect accommodation), regardless of the molecular structural properties, the phase state of the bulk condensed phase, or surface curvature. The results highlight the need for experimental techniques capable of resolving the internal structure of nanoparticles to better constrain the accommodation of atmospheric organics.

  12. Electrical properties and mechanical stability of anchoring groups for single-molecule electronics

    Directory of Open Access Journals (Sweden)

    Riccardo Frisenda

    2015-07-01

    Full Text Available We report on an experimental investigation of transport through single molecules, trapped between two gold nano-electrodes fabricated with the mechanically controlled break junction (MCBJ technique. The four molecules studied share the same core structure, namely oligo(phenylene ethynylene (OPE3, while having different aurophilic anchoring groups: thiol (SAc, methyl sulfide (SMe, pyridyl (Py and amine (NH2. The focus of this paper is on the combined characterization of the electrical and mechanical properties determined by the anchoring groups. From conductance histograms we find that thiol anchored molecules provide the highest conductance; a single-level model fit to current–voltage characteristics suggests that SAc groups exhibit a higher electronic coupling to the electrodes, together with better level alignment than the other three groups. An analysis of the mechanical stability, recording the lifetime in a self-breaking method, shows that Py and SAc yield the most stable junctions while SMe form short-lived junctions. Density functional theory combined with non-equlibrium Green’s function calculations help in elucidating the experimental findings.

  13. Guessing unknown and disordered solvent molecules with squeeze in the structure validation platon

    International Nuclear Information System (INIS)

    Weng, S.

    2014-01-01

    This report describes the assignment of the nature and number of solvent molecules in the refinement of several solvated crystal structures without a prior knowledge of the solvent system used for crystallization for the cases when the solvent molecule cannot be properly modeled. The solvent molecules can be assigned even for twinned crystal structures. (author)

  14. Structural Approaches to Sequence Evolution Molecules, Networks, Populations

    CERN Document Server

    Bastolla, Ugo; Roman, H. Eduardo; Vendruscolo, Michele

    2007-01-01

    Structural requirements constrain the evolution of biological entities at all levels, from macromolecules to their networks, right up to populations of biological organisms. Classical models of molecular evolution, however, are focused at the level of the symbols - the biological sequence - rather than that of their resulting structure. Now recent advances in understanding the thermodynamics of macromolecules, the topological properties of gene networks, the organization and mutation capabilities of genomes, and the structure of populations make it possible to incorporate these key elements into a broader and deeply interdisciplinary view of molecular evolution. This book gives an account of such a new approach, through clear tutorial contributions by leading scientists specializing in the different fields involved.

  15. Molecule database framework: a framework for creating database applications with chemical structure search capability.

    Science.gov (United States)

    Kiener, Joos

    2013-12-11

    Research in organic chemistry generates samples of novel chemicals together with their properties and other related data. The involved scientists must be able to store this data and search it by chemical structure. There are commercial solutions for common needs like chemical registration systems or electronic lab notebooks. However for specific requirements of in-house databases and processes no such solutions exist. Another issue is that commercial solutions have the risk of vendor lock-in and may require an expensive license of a proprietary relational database management system. To speed up and simplify the development for applications that require chemical structure search capabilities, I have developed Molecule Database Framework. The framework abstracts the storing and searching of chemical structures into method calls. Therefore software developers do not require extensive knowledge about chemistry and the underlying database cartridge. This decreases application development time. Molecule Database Framework is written in Java and I created it by integrating existing free and open-source tools and frameworks. The core functionality includes:•Support for multi-component compounds (mixtures)•Import and export of SD-files•Optional security (authorization)For chemical structure searching Molecule Database Framework leverages the capabilities of the Bingo Cartridge for PostgreSQL and provides type-safe searching, caching, transactions and optional method level security. Molecule Database Framework supports multi-component chemical compounds (mixtures).Furthermore the design of entity classes and the reasoning behind it are explained. By means of a simple web application I describe how the framework could be used. I then benchmarked this example application to create some basic performance expectations for chemical structure searches and import and export of SD-files. By using a simple web application it was shown that Molecule Database Framework

  16. Nonlinear and Nonsymmetric Single-Molecule Electronic Properties Towards Molecular Information Processing.

    Science.gov (United States)

    Tamaki, Takashi; Ogawa, Takuji

    2017-09-05

    This review highlights molecular design for nonlinear and nonsymmetric single-molecule electronic properties such as rectification, negative differential resistance, and switching, which are important components of future single-molecule information processing devices. Perspectives on integrated "molecular circuits" are also provided. Nonlinear and nonsymmetric single-molecule electronics can be designed by utilizing (1) asymmetric molecular cores, (2) asymmetric anchoring groups, (3) an asymmetric junction environment, and (4) asymmetric electrode materials. This review mainly focuses on the design of molecular cores.

  17. Prediction of Physicochemical Properties of Organic Molecules Using Semi-Empirical Methods

    International Nuclear Information System (INIS)

    Kim, Chan Kyung; Kim, Chang Kon; Kim, Miri; Lee, Hai Whang; Cho, Soo Gyeong

    2013-01-01

    Prediction of physicochemical properties of organic molecules is an important process in chemistry and chemical engineering. The MSEP approach developed in our lab calculates the molecular surface electrostatic potential (ESP) on van der Waals (vdW) surfaces of molecules. This approach includes geometry optimization and frequency calculation using hybrid density functional theory, B3LYP, at the 6-31G(d) basis set to find minima on the potential energy surface, and is known to give satisfactory QSPR results for various properties of organic molecules. However, this MSEP method is not applicable to screen large database because geometry optimization and frequency calculation require considerable computing time. To develop a fast but yet reliable approach, we have re-examined our previous work on organic molecules using two semi-empirical methods, AM1 and PM3. This new approach can be an efficient protocol in designing new molecules with improved properties

  18. The effect of uniform capture molecule orientation on biosensor sensitivity : dependence on analyte properties

    NARCIS (Netherlands)

    Trilling, A.K.; Harmsen, M.M.; Ruigrok, V.J.; Zuilhof, H.; Beekwilder, J.

    2013-01-01

    Uniform orientation of capture molecules on biosensors has been reported to increase sensitivity. Here it is investigated which analyte properties contribute to sensitivity by orientation. Orientation of capture molecules on biosensors was investigated using variable domains of llama heavy-chain

  19. Molecular structure based property modeling: Development/ improvement of property models through a systematic property-data-model analysis

    DEFF Research Database (Denmark)

    Hukkerikar, Amol Shivajirao; Sarup, Bent; Sin, Gürkan

    2013-01-01

    models. To make the property-data-model analysis fast and efficient, an approach based on the “molecular structure similarity criteria” to identify molecules (mono-functional, bi-functional, etc.) containing specified set of structural parameters (that is, groups) is employed. The method has been applied...

  20. From Artificial Atoms to Nanocrystal Molecules: Preparation and Properties of More Complex Nanostructures

    Energy Technology Data Exchange (ETDEWEB)

    Choi, Charina L; Alivisatos, A Paul

    2009-10-20

    Quantum dots, which have found widespread use in fields such as biomedicine, photovoltaics, and electronics, are often called artificial atoms due to their size-dependent physical properties. Here this analogy is extended to consider artificial nanocrystal molecules, formed from well-defined groupings of plasmonically or electronically coupled single nanocrystals. Just as a hydrogen molecule has properties distinct from two uncoupled hydrogen atoms, a key feature of nanocrystal molecules is that they exhibit properties altered from those of the component nanoparticles due to coupling. The nature of the coupling between nanocrystal atoms and its response to vibrations and deformations of the nanocrystal molecule bonds are of particular interest. We discuss synthetic approaches, predicted and observed physical properties, and prospects and challenges toward this new class of materials.

  1. Machine learning properties of materials and molecules with entropy-regularized kernels

    Science.gov (United States)

    Ceriotti, Michele; Bartók, Albert; CsáNyi, GáBor; de, Sandip

    Application of machine-learning methods to physics, chemistry and materials science is gaining traction as a strategy to obtain accurate predictions of the properties of matter at a fraction of the typical cost of quantum mechanical electronic structure calculations. In this endeavor, one can leverage general-purpose frameworks for supervised-learning. It is however very important that the input data - for instance the positions of atoms in a molecule or solid - is processed into a form that reflects all the underlying physical symmetries of the problem, and that possesses the regularity properties that are required by machine-learning algorithms. Here we introduce a general strategy to build a representation of this kind. We will start from existing approaches to compare local environments (basically, groups of atoms), and combine them using techniques borrowed from optimal transport theory, discussing the relation between this idea and additive energy decompositions. We will present a few examples demonstrating the potential of this approach as a tool to predict molecular and materials' properties with an accuracy on par with state-of-the-art electronic structure methods. MARVEL NCCR (Swiss National Science Foundation) and ERC StG HBMAP (European Research Council, G.A. 677013).

  2. Shedding Light on Protein Folding, Structural and Functional Dynamics by Single Molecule Studies

    Directory of Open Access Journals (Sweden)

    Krutika Bavishi

    2014-11-01

    Full Text Available The advent of advanced single molecule measurements unveiled a great wealth of dynamic information revolutionizing our understanding of protein dynamics and behavior in ways unattainable by conventional bulk assays. Equipped with the ability to record distribution of behaviors rather than the mean property of a population, single molecule measurements offer observation and quantification of the abundance, lifetime and function of multiple protein states. They also permit the direct observation of the transient and rarely populated intermediates in the energy landscape that are typically averaged out in non-synchronized ensemble measurements. Single molecule studies have thus provided novel insights about how the dynamic sampling of the free energy landscape dictates all aspects of protein behavior; from its folding to function. Here we will survey some of the state of the art contributions in deciphering mechanisms that underlie protein folding, structural and functional dynamics by single molecule fluorescence microscopy techniques. We will discuss a few selected examples highlighting the power of the emerging techniques and finally discuss the future improvements and directions.

  3. Structures and Dynamics of Two-Dimensional Dust Lattices with and without Coulomb Molecules in Plasmas

    International Nuclear Information System (INIS)

    Huang Feng; Wang Xue-Jin; Liu Yan-Hong; Ye Mao-Fu; Wang Long

    2010-01-01

    Structures and dynamics of two-dimensional dust lattices with and without Coulomb molecules in plasmas are investigated. The experimental results show that the lattices have the crystal-like hexagonal structures, i.e. most particles have six nearest-neighboring particles. However, the lattice points can be occupied by the individual particles or by a pair of particles called Coulomb molecules. The pair correlation function is used to compare the structures between the lattices with or without the Coulomb molecules. In the experiments, the Coulomb molecules can also decompose and recombine with another individual particle to form a new molecule. (physics of gases, plasmas, and electric discharges)

  4. Fluctuation in Interface and Electronic Structure of Single-Molecule Junctions Investigated by Current versus Bias Voltage Characteristics.

    Science.gov (United States)

    Isshiki, Yuji; Fujii, Shintaro; Nishino, Tomoaki; Kiguchi, Manabu

    2018-03-14

    Structural and electronic detail at the metal-molecule interface has a significant impact on the charge transport across the molecular junctions, but its precise understanding and control still remain elusive. On the single-molecule scale, the metal-molecule interface structures and relevant charge transport properties are subject to fluctuation, which contain the fundamental science of single-molecule transport and implication for manipulability of the transport properties in electronic devices. Here, we present a comprehensive approach to investigate the fluctuation in the metal-molecule interface in single-molecule junctions, based on current-voltage ( I- V) measurements in combination with first-principles simulation. Contrary to conventional molecular conductance studies, this I- V approach provides a correlated statistical description of both the degree of electronic coupling across the metal-molecule interface and the molecular orbital energy level. This statistical approach was employed to study fluctuation in single-molecule junctions of 1,4-butanediamine (DAB), pyrazine (PY), 4,4'-bipyridine (BPY), and fullerene (C 60 ). We demonstrate that molecular-dependent fluctuation of σ-, π-, and π-plane-type interfaces can be captured by analyzing the molecular orbital (MO) energy level under mechanical perturbation. While the MO level of DAB with the σ-type interface shows weak distance dependence and fluctuation, the MO level of PY, BPY, and C 60 features unique distance dependence and molecular-dependent fluctuation against the mechanical perturbation. The MO level of PY and BPY with the σ+π-type interface increases with the increase in the stretch distance. In contrast, the MO level of C 60 with the π-plane-type interface decreases with the increase in the stretching perturbation. This study provides an approach to resolve the structural and electronic fluctuation in the single-molecule junctions and insight into the molecular-dependent fluctuation in

  5. A Structural Perspective on the Modulation of Protein-Protein Interactions with Small Molecules.

    Science.gov (United States)

    Demirel, Habibe Cansu; Dogan, Tunca; Tuncbag, Nurcan

    2018-05-31

    Protein-protein interactions (PPIs) are the key components in many cellular processes including signaling pathways, enzymatic reactions and epigenetic regulation. Abnormal interactions of some proteins may be pathogenic and cause various disorders including cancer and neurodegenerative diseases. Although inhibiting PPIs with small molecules is a challenging task, it gained an increasing interest because of its strong potential for drug discovery and design. The knowledge of the interface as well as the structural and chemical characteristics of the PPIs and their roles in the cellular pathways are necessary for a rational design of small molecules to modulate PPIs. In this study, we review the recent progress in the field and detail the physicochemical properties of PPIs including binding hot spots with a focus on structural methods. Then, we review recent approaches for structural prediction of PPIs. Finally, we revisit the concept of targeting PPIs in a systems biology perspective and we refer to the non-structural approaches, usually employed when the structural information is not present. Copyright© Bentham Science Publishers; For any queries, please email at epub@benthamscience.org.

  6. Prediction of RNA secondary structures: from theory to models and real molecules

    International Nuclear Information System (INIS)

    Schuster, Peter

    2006-01-01

    RNA secondary structures are derived from RNA sequences, which are strings built form the natural four letter nucleotide alphabet, {AUGC}. These coarse-grained structures, in turn, are tantamount to constrained strings over a three letter alphabet. Hence, the secondary structures are discrete objects and the number of sequences always exceeds the number of structures. The sequences built from two letter alphabets form perfect structures when the nucleotides can form a base pair, as is the case with {GC} or {AU}, but the relation between the sequences and structures differs strongly from the four letter alphabet. A comprehensive theory of RNA structure is presented, which is based on the concepts of sequence space and shape space, being a space of structures. It sets the stage for modelling processes in ensembles of RNA molecules like evolutionary optimization or kinetic folding as dynamical phenomena guided by mappings between the two spaces. The number of minimum free energy (mfe) structures is always smaller than the number of sequences, even for two letter alphabets. Folding of RNA molecules into mfe energy structures constitutes a non-invertible mapping from sequence space onto shape space. The preimage of a structure in sequence space is defined as its neutral network. Similarly the set of suboptimal structures is the preimage of a sequence in shape space. This set represents the conformation space of a given sequence. The evolutionary optimization of structures in populations is a process taking place in sequence space, whereas kinetic folding occurs in molecular ensembles that optimize free energy in conformation space. Efficient folding algorithms based on dynamic programming are available for the prediction of secondary structures for given sequences. The inverse problem, the computation of sequences for predefined structures, is an important tool for the design of RNA molecules with tailored properties. Simultaneous folding or cofolding of two or more RNA

  7. Single Molecules as Optical Probes for Structure and Dynamics

    Science.gov (United States)

    Orrit, Michel

    Single molecules and single nanoparticles are convenient links between the nanoscale world and the laboratory. We discuss the limits for their optical detection by three different methods: fluorescence, direct absorption, and photothermal detection. We briefly review some recent illustrations of qualitatively new information gathered from single-molecule signals: intermittency of the fluorescence intensity, acoustic vibrations of nanoparticles (1-100 GHz) or of extended defects in molecular crystals (0.1-1 MHz), and dynamical heterogeneity in glass-forming molecular liquids. We conclude with an outlook of future uses of single-molecule methods in physical chemistry, soft matter, and material science.

  8. Study of the growth and pyroelectric properties of TGS crystals doped with aniline-family dipolar molecules

    Science.gov (United States)

    Zhang, Kecong; Song, Jiancheng; Wang, Min; Fang, Changshui; Lu, Mengkai

    1987-04-01

    TGS crystals doped with aniline-family dipolar molecules (aniline, 2-aminobenzoic acid, 3-aminobenzoic acid, 3-aminobenzene-sulphonic acid, 4-aminobenzenesulphonic acid and 4-nitroraniline) have been grown by the slow-cooling solution method. The influence of these dopants on the growth habits, crystal morphology pyroelectric properties, and structure parameters of TGS crystals has been systematically investigated. The effects of the domain structure of the seed crystal on the pyroelectric properties of the doped crystals have been studied. It is found that the spontaneous polarization (P), pyroelectric coefficient (lambda), and internal bias field of the doped crystals are slightly higher than those of the pure TGS, and the larger the dipole moment of the dopant molecule, the higher the P and lambda of the doped TGS crystal.

  9. Structural properties of matrix metalloproteinases.

    Science.gov (United States)

    Bode, W; Fernandez-Catalan, C; Tschesche, H; Grams, F; Nagase, H; Maskos, K

    1999-04-01

    Matrix metalloproteinases (MMPs) are involved in extracellular matrix degradation. Their proteolytic activity must be precisely regulated by their endogenous protein inhibitors, the tissue inhibitors of metalloproteinases (TIMPs). Disruption of this balance results in serious diseases such as arthritis, tumour growth and metastasis. Knowledge of the tertiary structures of the proteins involved is crucial for understanding their functional properties and interference with associated dysfunctions. Within the last few years, several three-dimensional MMP and MMP-TIMP structures became available, showing the domain organization, polypeptide fold and main specificity determinants. Complexes of the catalytic MMP domains with various synthetic inhibitors enabled the structure-based design and improvement of high-affinity ligands, which might be elaborated into drugs. A multitude of reviews surveying work done on all aspects of MMPs have appeared in recent years, but none of them has focused on the three-dimensional structures. This review was written to close the gap.

  10. Adsorption property of volatile molecules on ZnO nanowires ...

    Indian Academy of Sciences (India)

    7

    Keywords: ZnO; interaction; ammonia; band structure; density of states. 1. 2. 3 .... Virtual NanoLab [18] software was utilized to construct the ZnO nanowires with 24 Zn ..... But in reality, the ZnO NWs shows a better response (80.2) towards NH3.

  11. Grain boundary structure and properties

    International Nuclear Information System (INIS)

    Balluffi, R.W.

    1979-01-01

    An attempt is made to distinguish those fundamental aspects of grain boundaries which should be relevant to the problem of the time dependent fracture of high temperature structural materials. These include the basic phenomena which are thought to be associated with cavitation and cracking at grain boundaries during service and with the more general microstructural changes which occur during both processing and service. A very brief discussion of the current state of our knowledge of these fundamentals is given. Included are the following: (1) structure of ideal perfect boundaries; (2) defect structure of grain boundaries; (3) diffusion at grain boundaries; (4) grain boundaries as sources/sinks for point defects; (5) grain boundary migration; (6) dislocation phenomena at grain boundaries; (7) atomic bonding and cohesion at grain boundaries; (8) non-equilibrium properties of grain boundaries; and (9) techniques for studying grain boundaries

  12. Quasicrystals Structure and Physical Properties

    CERN Document Server

    Trebin, Hans-Rainer

    2003-01-01

    A comprehensive and up-to-date review, covering the broad range of this outstanding class of materials among intermetallic alloys. Starting with metallurgy and characterization, the authors continue on to structure and mathematical modeling. They use this basis to move on to dealing with electronic, magnetic, thermal, dynamic and mechanical properties, before finally providing an insight into surfaces and thin films. The authors belong to a research program on quasicrystals, sponsored by the German Research Society and managed by Hans-Rainer Trebin, such that most of the latest results are pre

  13. Studies of G-quadruplex DNA structures at the single molecule level

    DEFF Research Database (Denmark)

    Kragh, Sofie Louise

    2015-01-01

    Folding of G-quaduplex structures adopted by the human telomeric repeat is here studied by single molecule FRET microscopy. This method allows for the investigation of G-quadruplex structures and their conformational dynamic. Telomeres are located at the ends of our chromosomes and end in a single...... with human telomeric repeat adopt several different G-quadruplex conformations in the presence of K+ ions. G-quadruplexes inhibit telomerase activity and are therefore potential targets for anti-cancer drugs, which can be small molecule ligands capable of stabilizing G-quadruplex structures. Understanding...... range. FRET spectroscopy can be performed on an ensemble of molecules, or on the single molecule level. In single molecule FRET experiments it is possible to follow the behaviour in time for each molecule independently, allowing insight into both dynamically and statistically heterogeneous molecular...

  14. Interface properties of organic molecules on metal surfaces; Grenzflaecheneigenschaften organischer Molekuele auf Metalloberflaechen

    Energy Technology Data Exchange (ETDEWEB)

    Karacuban, Hatice

    2010-01-28

    In this work, the growth of the archetype molecules CuPc and PTCDA was investigated on Cu(111). PTCDA was also studied on NaCl/Cu(111). The main experiments were carried out with a scanning tunneling microscope. Structural analysis of CuPc on Cu (111) is only possible at low temperatures, since at room temperature the molecules exhibit a high surface mobility. For the investigation of these structures and especially to enable scanning tunneling spectroscopy, a low-temperature scanning tunneling microscope was developed. Using this home built STM the experiments could be carried out at about 10 K. After the adsorption of CuPc on Cu (111) a substrate-induced symmetry reduction of the molecules can be observed in scanning tunneling microscopy. When the occupied states of the molecules are imaged, a switching between two distinct levels is found. These modifications are determined by the adsorption geometry of the molecules. Based on high resolution STM data, an on-top adsorption geometry of the CuPc-molecules on Cu (111)-substrate can be deducted. At low temperatures, two new superstructures of PTCDA on Cu(111) are observed. The molecules within these superstructures are tilted with respect to the substrate. Intermolecular interactions may be the crucial factor for the realignment of the molecules. If PTCDA molecules are adsorbed on a NaCl/Cu (111) substrate, at room temperature, also two new superstructures on the copper substrate were found. They indicate the formation of a metall-organic-complex. On top of the NaCl layer the molecules exclusively grow at polar NaCl step edges. This is an indication for electrostatic interaction between the PTCDA molecules and the NaCl layer. When the molecule density is further increased, a Vollmer-Weber growth sets in. If both molecules PTCDA and CuPc are present on the sample at the same time, local spectroscopy provides information on the metal-organic interface in direct comparison. The STS-results of CuPc/PTCDA on Cu (111

  15. Quasi continuum vibrational of molecules and isotopic selectivity properties induced by collisions

    International Nuclear Information System (INIS)

    Angelie, Christian

    1990-01-01

    This research thesis proposes an overview of knowledge on vibrationally highly excited states of molecules. The author shows that the statistic quasi-continuum formed by these states is preceded by a quasi continuum of weak transitions with a lower energy, and that these transitions remain structured and very narrow up to the dissociation energy and beyond. Collisions between molecules excited in their quasi continuum are then studied. The author particularly analyses a new phenomenon of isotopic selectivity which is important for the dissociation of a molecule colliding another molecule. It appears that this selectivity regarding selectivity is due to a selectivity of transferred energy which paradoxically increases with the molecule vibrational content because of a resonance phenomenon of energies transferred by dipole-dipole interaction [fr

  16. QSPR study of the retention/release property of odorant molecules in pectin gels using statistical methods

    Directory of Open Access Journals (Sweden)

    Assia Belhassan

    2017-11-01

    Full Text Available The ACD/ChemSketch, MarvinSketch, and ChemOffice programmes were used to calculate several molecular descriptors of 51 odorant molecules (15 alcohols, 11 aldehydes, 9 ketones and 16 esters. The best descriptors were selected to establish the Quantitative Structure-Property Relationship (QSPR of the retention/release property of odorant molecules in pectin gels using Principal Components Analysis (PCA, Multiple Linear Regression (MLR, Multiple Non-linear Regression (MNLR and Artificial Neural Network (ANN methods We propose a quantitative model based on these analyses. PCA has been used to select descriptors that exhibit high correlation with the retention/release property. The MLR method yielded correlation coefficients of 0.960 and 0.958 for PG-0.4 (pectin concentration: 0.4% w/w and PG-0.8 (pectin concentration: 0.8% w/w media, respectively. Internal and external validations were used to determine the statistical quality of the QSPR of the two MLR models. The MNLR method, considering the relevant descriptors obtained from the MLR, yielded correlation coefficients of 0.978 and 0.975 for PG-0.4 and PG-0.8 media, respectively. The applicability domain of MLR models was investigated using simple and leverage approaches to detect outliers and outside compounds. The effects of different descriptors on the retention/release property are described, and these descriptors were used to study and design new compounds with higher and lower values of the property than the existing ones. Keywords: Odorant Molecules, Retention/Release, Pectin Gels, Quantitative Structure Property Relationship, Multiple Linear Regression, Artificial Neural Network

  17. Structure and dynamics of water and lipid molecules in charged anionic DMPG lipid bilayer membranes

    International Nuclear Information System (INIS)

    Rønnest, A. K.; Peters, G. H.; Hansen, F. Y.; Taub, H.; Miskowiec, A.

    2016-01-01

    Molecular dynamics simulations have been used to investigate the influence of the valency of counter-ions on the structure of freestanding bilayer membranes of the anionic 1,2-dimyristoyl-sn-glycero-3-phosphoglycerol (DMPG) lipid at 310 K and 1 atm. At this temperature, the membrane is in the fluid phase with a monovalent counter-ion and in the gel phase with a divalent counter-ion. The diffusion constant of water as a function of its depth in the membrane has been determined from mean-square-displacement calculations. Also, calculated incoherent quasielastic neutron scattering functions have been compared to experimental results and used to determine an average diffusion constant for all water molecules in the system. On extrapolating the diffusion constants inferred experimentally to a temperature of 310 K, reasonable agreement with the simulations is obtained. However, the experiments do not have the sensitivity to confirm the diffusion of a small component of water bound to the lipids as found in the simulations. In addition, the orientation of the dipole moment of the water molecules has been determined as a function of their depth in the membrane. Previous indirect estimates of the electrostatic potential within phospholipid membranes imply an enormous electric field of 10 8 –10 9 V m −1 , which is likely to have great significance in controlling the conformation of translocating membrane proteins and in the transfer of ions and molecules across the membrane. We have calculated the membrane potential for DMPG bilayers and found ∼1 V (∼2 ⋅ 10 8 V m −1 ) when in the fluid phase with a monovalent counter-ion and ∼1.4 V (∼2.8 ⋅ 10 8 V m −1 ) when in the gel phase with a divalent counter-ion. The number of water molecules for a fully hydrated DMPG membrane has been estimated to be 9.7 molecules per lipid in the gel phase and 17.5 molecules in the fluid phase, considerably smaller than inferred experimentally for 1,2-dimyristoyl-sn-glycero-3

  18. Structure and dynamics of water and lipid molecules in charged anionic DMPG lipid bilayer membranes

    Energy Technology Data Exchange (ETDEWEB)

    Rønnest, A. K.; Peters, G. H.; Hansen, F. Y., E-mail: flemming@kemi.dtu.dk [Department of Chemistry, Technical University of Denmark, IK 207 DTU, DK-2800 Lyngby (Denmark); Taub, H.; Miskowiec, A. [Department of Physics and Astronomy and the University of Missouri Research Reactor,University of Missouri, Columbia, Missouri 65211 (United States)

    2016-04-14

    Molecular dynamics simulations have been used to investigate the influence of the valency of counter-ions on the structure of freestanding bilayer membranes of the anionic 1,2-dimyristoyl-sn-glycero-3-phosphoglycerol (DMPG) lipid at 310 K and 1 atm. At this temperature, the membrane is in the fluid phase with a monovalent counter-ion and in the gel phase with a divalent counter-ion. The diffusion constant of water as a function of its depth in the membrane has been determined from mean-square-displacement calculations. Also, calculated incoherent quasielastic neutron scattering functions have been compared to experimental results and used to determine an average diffusion constant for all water molecules in the system. On extrapolating the diffusion constants inferred experimentally to a temperature of 310 K, reasonable agreement with the simulations is obtained. However, the experiments do not have the sensitivity to confirm the diffusion of a small component of water bound to the lipids as found in the simulations. In addition, the orientation of the dipole moment of the water molecules has been determined as a function of their depth in the membrane. Previous indirect estimates of the electrostatic potential within phospholipid membranes imply an enormous electric field of 10{sup 8}–10{sup 9} V m{sup −1}, which is likely to have great significance in controlling the conformation of translocating membrane proteins and in the transfer of ions and molecules across the membrane. We have calculated the membrane potential for DMPG bilayers and found ∼1 V (∼2 ⋅ 10{sup 8} V m{sup −1}) when in the fluid phase with a monovalent counter-ion and ∼1.4 V (∼2.8 ⋅ 10{sup 8} V m{sup −1}) when in the gel phase with a divalent counter-ion. The number of water molecules for a fully hydrated DMPG membrane has been estimated to be 9.7 molecules per lipid in the gel phase and 17.5 molecules in the fluid phase, considerably smaller than inferred experimentally for 1

  19. Relation between rheological and structural properties of suspensions

    Energy Technology Data Exchange (ETDEWEB)

    Barcal, M; Sebor, G; Volsicky, Z

    1982-01-01

    The paper discusses results of investigations into separation processes for coal and kaolin suspensions. Effects of potassium chlorides and methanol additives on electrostatic potential of solid particles and on sedimentation rate are analyzed. Investigation results are shown in 5 diagrams. The relation between rheological and structural properties of coal and clay suspensions is investigated. Investigations show that the non-Newtonian behavior of suspensions cannot be attributed exclusively to the electrostatic and mechanical action of the solid phase particles. It is also caused by structure of the liquid phase, particularly on the surface of the solid particles, which depends mostly on hydrogen bonds. The internal structure of the liquid phase influences differential viscosity much more than the electrical surface properties of the solid phase. Bonds between the molecules of water and methanol are much stronger than bonds between water molecules alone. (9 refs.)

  20. Single-molecule magnets: structure and properties of [Mn18O14(O2CMe)18(hep)4(hepH)2(H2O)2](ClO4)2 with spin S = 13.

    Science.gov (United States)

    Brechin, E K; Sañudo, E C; Wernsdorfer, W; Boskovic, C; Yoo, J; Hendrickson, D N; Yamaguchi, A; Ishimoto, H; Concolino, T E; Rheingold, A L; Christou, G

    2005-02-07

    The reaction of 2-(hydroxyethyl)pyridine (hepH) with a 2:1 molar mixture of [Mn3O(O2CMe)6(py)3]ClO4 and [Mn3O(O2CMe)6(py)3] in MeCN afforded the new mixed-valent (16Mn(III), 2Mn(II)), octadecanuclear complex [Mn18O14(O2CMe)18(hep)4(hepH)2(H2O)2](ClO4)2 (1) in 20% yield. Complex 1 crystallizes in the triclinic space group P. Direct current magnetic susceptibility studies in a 1.0 T field in the 5.0-300 K range, and variable-temperature variable-field dc magnetization studies in the 2.0-4.0 K and 2.0-5.0 T ranges were obtained on polycrystalline samples. Fitting of magnetization data established that complex 1 possesses a ground-state spin of S = 13 and D = -0.18 K. This was confirmed by the value of the in-phase ac magnetic susceptibility signal. Below 3 K, the complex exhibits a frequency-dependent drop in the in-phase signal, and a concomitant increase in the out-of-phase signal, consistent with slow magnetization relaxation on the ac time scale. This suggests the complex is a single-molecule magnet (SMM), and this was confirmed by hysteresis loops below 1 K in magnetization versus dc field sweeps on a single crystal. Alternating current and direct current magnetization data were combined to yield an Arrhenius plot from which was obtained the effective barrier (U(eff)) for magnetization reversal of 21.3 K. Below 0.2 K, the relaxation becomes temperature-independent, consistent with relaxation only by quantum tunneling of the magnetization (QTM) through the anisotropy barrier via the lowest-energy MS = +/-13 levels of the S = 13 spin manifold. Complex 1 is thus the SMM with the largest ground-state spin to display QTM.

  1. Importance of the alignment of polar π conjugated molecules inside carbon nanotubes in determining second-order non-linear optical properties.

    Science.gov (United States)

    Yumura, Takashi; Yamamoto, Wataru

    2017-09-20

    We employed density functional theory (DFT) calculations with dispersion corrections to investigate energetically preferred alignments of certain p,p'-dimethylaminonitrostilbene (DANS) molecules inside an armchair (m,m) carbon nanotube (n × DANS@(m,m)), where the number of inner molecules (n) is no greater than 3. Here, three types of alignments of DANS are considered: a linear alignment in a parallel fashion and stacking alignments in parallel and antiparallel fashions. According to DFT calculations, a threshold tube diameter for containing DANS molecules in linear or stacking alignments was found to be approximately 1.0 nm. Nanotubes with diameters smaller than 1.0 nm result in the selective formation of linearly aligned DANS molecules due to strong confinement effects within the nanotubes. By contrast, larger diameter nanotubes allow DANS molecules to align in a stacking and linear fashion. The type of alignment adopted by the DANS molecules inside a nanotube is responsible for their second-order non-linear optical properties represented by their static hyperpolarizability (β 0 values). In fact, we computed β 0 values of DANS assemblies taken from optimized n × DANS@(m,m) structures, and their values were compared with those of a single DANS molecule. DFT calculations showed that β 0 values of DANS molecules depend on their alignment, which decrease in the following order: linear alignment > parallel stacking alignment > antiparallel stacking alignment. In particular, a linear alignment has a β 0 value more significant than that of the same number of isolated molecules. Therefore, the linear alignment of DANS molecules, which is only allowed inside smaller diameter nanotubes, can strongly enhance their second-order non-linear optical properties. Since the nanotube confinement determines the alignment of DANS molecules, a restricted nanospace can be utilized to control their second-order non-linear optical properties. These DFT findings can assist in the

  2. Electronic structure of molecules using relativistic effective core potentials

    International Nuclear Information System (INIS)

    Hay, P.J.

    1983-01-01

    In this review an approach is outlined for studying molecules containing heavy atoms with the use of relativistic effective core potentials (RECP's). These potentials play the dual roles of (1) replacing the chemically-inert core electrons and (2) incorporating the mass velocity and Darwin term into a one-electron effective potential. This reduces the problem to a valence-electron problem and avoids computation of additional matrix elements involving relativistic operators. The spin-orbit effects are subsequently included using the molecular orbitals derived from the RECP calculation as a basis

  3. Theoretical studies on CH+ ion molecule using configuration interaction method and its spectroscopic properties

    International Nuclear Information System (INIS)

    Machado, F.B.C.

    1985-01-01

    The use of the configuration (CI) method for the calculation of very accurate potential energy curves and dipole moment functions, and then their use in the comprehension of spectroscopic properties of diatomic molecules is presented. The spectroscopic properties of CH + and CD + such as: vibrational levels, spectroscopic constants, averaged dipole moments for all vibrational levels, radiative transition probabilities for emission and absorption, and radiative lifetimes are verificated. (M.J.C.) [pt

  4. Structure/property relationships in non-linear optical materials

    Energy Technology Data Exchange (ETDEWEB)

    Cole, J M [Institut Max von Laue - Paul Langevin (ILL), 38 - Grenoble (France); [Durham Univ. (United Kingdom); Howard, J A.K. [Durham Univ. (United Kingdom); McIntyre, G J [Institut Max von Laue - Paul Langevin (ILL), 38 - Grenoble (France)

    1997-04-01

    The application of neutrons to the study of structure/property relationships in organic non-linear optical materials (NLOs) is described. In particular, charge-transfer effects and intermolecular interactions are investigated. Charge-transfer effects are studied by charge-density analysis and an example of one such investigation is given. The study of intermolecular interactions concentrates on the effects of hydrogen-bonding and an example is given of two structurally similar molecules with very disparate NLO properties, as a result of different types of hydrogen-bonding. (author). 3 refs.

  5. Molecules and Models The molecular structures of main group element compounds

    CERN Document Server

    Haaland, Arne

    2008-01-01

    This book provides a systematic description of the molecular structures and bonding in simple compounds of the main group elements with particular emphasis on bond distances, bond energies and coordination geometries. The description includes the structures of hydrogen, halogen and methyl derivatives of the elements in each group, some of these molecules are ionic, some polar covalent. The survey of molecules whose structures conform to well-established trends is followed byrepresentative examples of molecules that do not conform. We also describe electron donor-acceptor and hydrogen bonded co

  6. [Relationships between microscope structure and thermodynamic properties

    International Nuclear Information System (INIS)

    Wu, R.S.; Lee, L.L.; Cochran, D.

    1990-01-01

    This paper exhibits on the molecular level, the relationships between the microscopic structure and thermodynamic properties of dilute supercritical solutions by application of the integral equation theories for molecular distribution functions. To solve the integral equations, the authors use Baxter's Wiener-Hopf factorization of the Ornstein-Zernike equations and then apply this method to binary Lennard-Jones mixtures. A number of closure relations have been used: such as the Percus-Yevick (PY), the reference hypernetted chain (RHNC), the hybrid mean spherical approximation (HMSA), and the reference interaction-site (RISM) methods. The authors examine the microstructures of several important classes of supercritical mixtures, including the usual attractive-type and the less known repulsive-type solutions. The clustering of solvent molecules for solvent-solute structures in the attractive mixtures and, correspondingly, the solvent cavitation in the repulsive mixtures are clearly demonstrated. These are shown to be responsible for the large negative growth of the solute partial molar volumes in the attractive case and the positive growth in the repulsive case

  7. Small Molecules Affect Human Dental Pulp Stem Cell Properties Via Multiple Signaling Pathways

    Science.gov (United States)

    Al-Habib, Mey; Yu, Zongdong

    2013-01-01

    One fundamental issue regarding stem cells for regenerative medicine is the maintenance of stem cell stemness. The purpose of the study was to test whether small molecules can enhance stem cell properties of mesenchymal stem cells (MSCs) derived from human dental pulp (hDPSCs), which have potential for multiple clinical applications. We identified the effects of small molecules (Pluripotin (SC1), 6-bromoindirubin-3-oxime and rapamycin) on the maintenance of hDPSC properties in vitro and the mechanisms involved in exerting the effects. Primary cultures of hDPSCs were exposed to optimal concentrations of these small molecules. Treated hDPSCs were analyzed for their proliferation, the expression levels of pluripotent and MSC markers, differentiation capacities, and intracellular signaling activations. We found that small molecule treatments decreased cell proliferation and increased the expression of STRO-1, NANOG, OCT4, and SOX2, while diminishing cell differentiation into odonto/osteogenic, adipogenic, and neurogenic lineages in vitro. These effects involved Ras-GAP-, ERK1/2-, and mTOR-signaling pathways, which may preserve the cell self-renewal capacity, while suppressing differentiation. We conclude that small molecules appear to enhance the immature state of hDPSCs in culture, which may be used as a strategy for adult stem cell maintenance and extend their capacity for regenerative applications. PMID:23573877

  8. Gamma radiation-induced structural changes in triglyceride molecules in pork fat

    International Nuclear Information System (INIS)

    Salkova, Z.; Koman, V.

    1976-01-01

    In the structure of associated and individual triglyceride pork fat molecules, some changes take place under the effect of ionizing radiation. Due to the irradiation of the fat the amount of the di- and tri-unsaturated (UUU, UUS, USU) triglyceride molecules decreases. The occurrence of the unsatured fatty acids on sites 1,3 decreases and the percentage of the individual triglyceride molecules having on their extreme sites C-1,3 unsaturated fatty acids decreases in all combinations. It can be assumed that hydrogenation and pre-esterification occurs in the triglyceride molecules. (author)

  9. Temperature-dependent interaction potential between NF3 molecules and thermophysical properties of gaseous NF3

    International Nuclear Information System (INIS)

    Damyanova, M; Balabanova, E; Hohm, U

    2014-01-01

    A temperature-dependent effective intermolecular interaction potential is applied to describe the interaction between two nitrogen fluoride (NF 3 ) molecules in gas phase. To this end, a spherically-symmetric (n-6) Lennard-Jones temperature-dependent potential (LJTDP) is used. The (n-6) LJTDP takes into account the influence of vibrational excitation of the molecules on the potential parameters, namely, the equilibrium distance r m and the potential well depth ε. The potential parameters at T = 0 K were obtained from the very small amount of existing thermophysical equilibrium and transport properties of low-density NF 3 gas. Fitting formulae are tabulated for a fast and reliable prediction of the thermophysical properties and potential parameters in the temperature range between 200 K and 1200 K. A comparison is also presented between our estimates for some thermophysical properties of the NF 3 gas with the available experimental and calculated data.

  10. Pectins filled with LDH-antimicrobial molecules: preparation, characterization and physical properties.

    Science.gov (United States)

    Gorrasi, Giuliana; Bugatti, Valeria; Vittoria, Vittoria

    2012-06-05

    Nanohybrids of layered double hydroxide (LDH) with intercalated active molecules: benzoate, 2,4-dichlorobenzoate, para-hydroxybenzoate and ortho-hydroxybenzoate, were incorporated into pectins from apples through high energy ball milling in the presence of water. Cast films were obtained and analysed. X-ray diffraction analysis showed a complete destructuration of all nanohybrids in the pectin matrix. Thermogravimetric analysis showed a better thermal resistance of pectin in the presence of fillers, especially para-hydroxybenzoate and ortho-hydroxybenzoate. Mechanical properties showed an improvement of elastic modulus in particular for LDH-para-hydroxybenzoate nanohybrid, due probably to a better interaction between pectin matrix and nanohybrid layers. Barrier properties (sorption and diffusion) to water vapour showed improvement in the dependence on the intercalated active molecule, the best improvement was achieved for composites containing para-hydroxybenzoate molecules, suggesting that the interaction between the filler phase and the polymer plays an important role in sorption and diffusion phenomena. Incorporation of these active molecules gave antimicrobial properties to the composite films giving opportunities in the field of active packaging. Copyright © 2012 Elsevier Ltd. All rights reserved.

  11. Investigation of gas molecules adsorption on carbon nano tubes electric properties in tight binding model

    International Nuclear Information System (INIS)

    Moradian, R.; Mohammadi, Y.

    2007-01-01

    Based on tight binding model we investigated effects of bi-atomic molecules gas(in the general form denoted by X 2 )on single-walled carbon nano tubes electronic properties. We found for some specified values of hopping integrals and random on-site energies, adsorbed molecules bound states located inside of the (10,0) single-walled carbon nano tubes energy gap, where it is similar to the reported experimental results for O 2 adsorption while for other values there is no bound states inside of energy gap. This is similar to the N 2 adsorption on semiconductor single-walled carbon nano tubes.

  12. The Use of Ultrashort Picosecond Laser Pulses to Generate Quantum Optical Properties of Single Molecules in Biophysics

    Science.gov (United States)

    Ly, Sonny

    Generation of quantum optical states from ultrashort laser-molecule interactions have led to fascinating discoveries in physics and chemistry. In recent years, these interactions have been extended to probe phenomena in single molecule biophysics. Photons emitted from a single fluorescent molecule contains important properties about how the molecule behave and function in that particular environment. Analysis of the second order coherence function through fluorescence correlation spectroscopy plays a pivotal role in quantum optics. At very short nanosecond timescales, the coherence function predicts photon antibunching, a purely quantum optical phenomena which states that a single molecule can only emit one photon at a time. Photon antibunching is the only direct proof of single molecule emission. From the nanosecond to microsecond timescale, the coherence function gives information about rotational diffusion coefficients, and at longer millisecond timescales, gives information regarding the translational diffusion coefficients. In addition, energy transfer between molecules from dipole-dipole interaction results in FRET, a highly sensitive method to probe conformational dynamics at nanometer distances. Here I apply the quantum optical techniques of photon antibunching, fluorescence correlation spectroscopy and FRET to probe how lipid nanodiscs form and function at the single molecule level. Lipid nanodiscs are particles that contain two apolipoprotein (apo) A-I circumventing a lipid bilayer in a belt conformation. From a technological point of view, nanodiscs mimics a patch of cell membrane that have recently been used to reconstitute a variety of membrane proteins including cytochrome P450 and bacteriorhodopsin. They are also potential drug transport vehicles due to its small and stable 10nm diameter size. Biologically, nanodiscs resemble to high degree, high density lipoproteins (HDL) in our body and provides a model platform to study lipid-protein interactions

  13. Cellulose nanomaterials review: structure, properties and nanocomposites

    Science.gov (United States)

    Robert J. Moon; Ashlie Martini; John Nairn; John Simonsen; Jeff Youngblood

    2011-01-01

    This critical review provides a processing-structure-property perspective on recent advances in cellulose nanoparticles and composites produced from them. It summarizes cellulose nanoparticles in terms of particle morphology, crystal structure, and properties. Also described are the self-assembly and rheological properties of cellulose nanoparticle suspensions. The...

  14. Crystal structure prediction of flexible molecules using parallel genetic algorithms with a standard force field.

    Science.gov (United States)

    Kim, Seonah; Orendt, Anita M; Ferraro, Marta B; Facelli, Julio C

    2009-10-01

    This article describes the application of our distributed computing framework for crystal structure prediction (CSP) the modified genetic algorithms for crystal and cluster prediction (MGAC), to predict the crystal structure of flexible molecules using the general Amber force field (GAFF) and the CHARMM program. The MGAC distributed computing framework includes a series of tightly integrated computer programs for generating the molecule's force field, sampling crystal structures using a distributed parallel genetic algorithm and local energy minimization of the structures followed by the classifying, sorting, and archiving of the most relevant structures. Our results indicate that the method can consistently find the experimentally known crystal structures of flexible molecules, but the number of missing structures and poor ranking observed in some crystals show the need for further improvement of the potential. Copyright 2009 Wiley Periodicals, Inc.

  15. Ocean acidification affects marine chemical communication by changing structure and function of peptide signalling molecules.

    Science.gov (United States)

    Roggatz, Christina C; Lorch, Mark; Hardege, Jörg D; Benoit, David M

    2016-12-01

    Ocean acidification is a global challenge that faces marine organisms in the near future with a predicted rapid drop in pH of up to 0.4 units by the end of this century. Effects of the change in ocean carbon chemistry and pH on the development, growth and fitness of marine animals are well documented. Recent evidence also suggests that a range of chemically mediated behaviours and interactions in marine fish and invertebrates will be affected. Marine animals use chemical cues, for example, to detect predators, for settlement, homing and reproduction. But, while effects of high CO 2 conditions on these behaviours are described across many species, little is known about the underlying mechanisms, particularly in invertebrates. Here, we investigate the direct influence of future oceanic pH conditions on the structure and function of three peptide signalling molecules with an interdisciplinary combination of methods. NMR spectroscopy and quantum chemical calculations were used to assess the direct molecular influence of pH on the peptide cues, and we tested the functionality of the cues in different pH conditions using behavioural bioassays with shore crabs (Carcinus maenas) as a model system. We found that peptide signalling cues are susceptible to protonation in future pH conditions, which will alter their overall charge. We also show that structure and electrostatic properties important for receptor binding differ significantly between the peptide forms present today and the protonated signalling peptides likely to be dominating in future oceans. The bioassays suggest an impaired functionality of the signalling peptides at low pH. Physiological changes due to high CO 2 conditions were found to play a less significant role in influencing the investigated behaviour. From our results, we conclude that the change of charge, structure and consequently function of signalling molecules presents one possible mechanism to explain altered behaviour under future oceanic p

  16. Counteracting chemical chaperone effects on the single-molecule α-synuclein structural landscape

    OpenAIRE

    Ferreon, Allan Chris M.; Moosa, Mahdi Muhammad; Gambin, Yann; Deniz, Ashok A.

    2012-01-01

    Protein structure and function depend on a close interplay between intrinsic folding energy landscapes and the chemistry of the protein environment. Osmolytes are small-molecule compounds that can act as chemical chaperones by altering the environment in a cellular context. Despite their importance, detailed studies on the role of these chemical chaperones in modulating structure and dimensions of intrinsically disordered proteins have been limited. Here, we used single-molecule Förster reson...

  17. Synthesis of Large Molecules in Cometary Ice Analogs: Physical Properties Related to Self-Assembly Processes

    Science.gov (United States)

    Dworkin, Jason P.; Sandford, Scott A.; Deamer, David W.; Gillette, J. Seb; Zare, Richard N.; Allamandola, Louis J. (Technical Monitor)

    1999-01-01

    The combination of realistic laboratory simulations and infrared observations have revolutionized our understanding of interstellar dust and ice-the main component of comets. Since comets and carbonaceous micrometeorites may have been important sources of volatiles and carbon compounds on the early Earth, their organic composition may be related to the origin of life. Ices on grains in molecular clouds contain a variety of simple molecules. The D/H ratios of the comets Hale-Bopp and Hyakutake are consistent with a primarily interstellar ice mixture. Within the cloud and especially in the presolar nebula through the early solar system, these icy grains would have been photoprocessed by the ultraviolet producing more complex species such as hexamethylenetetramine, polyoxymethylenes, and simple keones. We reported at the 1999 Bioastronomy meeting laboratory simulations studied to identify the types of molecules which could have been generated in pre-cometary ices. Experiments were conducted by forming a realistic interstellar mixed-molecular ice (H2O, CH3OH, NH3 and CO) at approximately 10 K under high vacuum irradiated with UV light from a hydrogen plasma lamp. The gas mixture was typically 100:50:1:1, however when different ratios were used material with similar characteristics was still produced. The residue that remained after warming to room temperature was analyzed by HPLC, and by several mass spectrometric methods. This material contains a rich mixture of complex compounds with mass spectral profiles resembling those found in IDPs and meteorites. Surface tension measurements show that an amphiphilic component is also present. These species do not appear in various controls or in unphotolyzed samples. Residues from the simulations were also dispersed in aqueous media for microscopy. The organic material forms 10-40 gm diameter droplets that fluoresce at 300-450 nm under UV excitation. These droplets have a morphology and internal structure which appear

  18. Structural properties of water around uncharged and charged carbon nanotubes

    International Nuclear Information System (INIS)

    Dezfoli, Amir Reza Ansari; Mehrabian, Mozaffar Ali; Rafsanjani, Hassan Hashemipour

    2013-01-01

    Studying the structural properties of water molecules around the carbon nanotubes is very important in a wide variety of carbon nanotubes applications. We studied the number of hydrogen bonds, oxygen and hydrogen density distributions, and water orientation around carbon nanotubes. The water density distribution for all carbon nanotubes was observed to have the same feature. In water-carbon nanotubes interface, a high-density region of water molecules exists around carbon nanotubes. The results reveal that the water orientation around carbon nanotubes is roughly dependent on carbon nanotubes surface charge. The water molecules in close distances to carbon nanotubes were found to make an HOH plane nearly perpendicular to the water-carbon nanotubes interface for carbon nanotubes with negative surface charge. For uncharged carbon nanotubes and carbon nanotubes with positive surface charge, the HOH plane was in tangential orientation with water-carbon nanotubes interface. There was also a significant reduction in hydrogen bond of water region around carbon nanotubes as compared with hydrogen bond in bulk water. This reduction was very obvious for carbon nanotubes with positive surface charge. In addition, the calculation of dynamic properties of water molecules in water-CNT interface revealed that there is a direct relation between the number of Hbonds and self-diffusion coefficient of water molecules

  19. The importance of correct tautomeric structures for biological molecules

    DEFF Research Database (Denmark)

    Hansen, Poul Erik; Mortensen, John; Kamounah, Fadhil S.

    2015-01-01

    The structures of usnic acid and tetracycline are determined using deuterium isotope effects on 13C chemical shifts in a water environment. In case of usnic acid this is achieved by synthesizing a more water soluble usnic acid with a PEG linker. In the usnic acid case an enolic b-triketone (C-1, ...

  20. Structural requirements for the interaction between class II MHC molecules and peptide antigens

    DEFF Research Database (Denmark)

    Sette, A; Buus, S; Appella, E

    1990-01-01

    of binding, it is possible to define certain structural features of peptides that are associated with the capacity to bind to a particular MHC specificity (IA(d) or IE(d)); 3) IA(d) and IE(d) molecules recognize different and independent structures on the antigen molecule; 4) only about 10% of the single...... IA(d) and IE(d) molecules and their peptide ligands, we found that some structural characteristics apply to both antigen-MHC interactions. In particular, we found: 1) each MHC molecule is capable of binding many unrelated peptides through the same peptide-binding site; 2) despite this permissiveness...... amino acid substitutions tested on two IA(d)- and IE(d)-binding peptides had significant effect on their MHC-binding capacities, while over 80% of these substitutions significantly impaired T cell recognition of the Ia-peptide complex; 5) based on the segregation between residues that are crucial for T...

  1. Chemical Structure and Properties: A Modified Atoms-First, One-Semester Introductory Chemistry Course

    Science.gov (United States)

    Schaller, Chris P.; Graham, Kate J.; Johnson, Brian J.; Jakubowski, Henry V.; McKenna, Anna G.; McIntee, Edward J.; Jones, T. Nicholas; Fazal, M. A.; Peterson, Alicia A.

    2015-01-01

    A one-semester, introductory chemistry course is described that develops a primarily qualitative understanding of structure-property relationships. Starting from an atoms-first approach, the course examines the properties and three-dimensional structure of metallic and ionic solids before expanding into a thorough investigation of molecules. In…

  2. Calculation of hyperfine structure constants of small molecules using

    Indian Academy of Sciences (India)

    The Z-vector method in the relativistic coupled-cluster framework is employed to calculate the parallel and perpendicular components of the magnetic hyperfine structure constant of a few small alkaline earth hydrides (BeH, MgH, and CaH) and fluorides (MgF and CaF). We have compared our Z-vector results with the values ...

  3. Structural and electronic properties of L-amino acids

    Science.gov (United States)

    Tulip, P. R.; Clark, S. J.

    2005-05-01

    The structural and electronic properties of four L-amino acids alanine, leucine, isoleucine, and valine have been investigated using density functional theory (DFT) and the generalized gradient approximation. Within the crystals, it is found that the constituent molecules adopt zwitterionic configurations, in agreement with experimental work. Lattice constants are found to be in good agreement with experimentally determined values, although certain discrepancies do exist due to the description of van der Waals interactions. We find that these materials possess wide DFT band gaps in the region of 5 eV, with electrons highly localized to the constituent molecules. It is found that the main mechanisms behind crystal formation are dipolar interactions and hydrogen bonding of a primarily electrostatic character, in agreement with current biochemical understanding of these systems. The electronic structure suggests that the amine and carboxy functional groups are dominant in determining band structure.

  4. Properties of cellulase as template molecule on chitosan—methyl methacrylate membrane

    Science.gov (United States)

    Lian, Qi; Zheng, Xuefang; Wu, Haixia; Song, Shitao; Wang, Dongjun

    2015-12-01

    In this study, a novel molecular imprinting membrane made of chitosan and methyl methacrylate (MMA) was fabricated with cellulase as template molecule and the thermal response to cellulase was characterized. The film was characterized by infrared spectroscopy (IR), X-ray diffraction (XRD), scanning electron microscopy (SEM) and the permeation experiment. The results showed that the space structure of the film was as similar as the cellulase. Moreover, the membrane had advanced molecular imprinting capability to cellulase comparing to pepsin and pectinase at any temperature and the film had excellent ability to identify specific template molecule (cellulase) at the synthesis temperature compared to other temperatures.

  5. The study of the valence bond property in a two-different-quantum-dot molecule

    Institute of Scientific and Technical Information of China (English)

    王立民; 罗莹; 马本堃

    2002-01-01

    The electronic energy spectrum and wavefunction of a quantum-dot molecule are studied by means of the finite-element solution of the single electron Schrodinger equation. We find that the nature of the coupling can be covalent,two dots, the height of potential barrier, matching of the energies and parities of the orbital localized on each dot. Thebond property can be used to explain the experimental result obtained by Oosterkamp et al. (1998 Nature 395 873).

  6. Structure-Based Drug Design of Small Molecule Peptide Deformylase Inhibitors to Treat Cancer

    Directory of Open Access Journals (Sweden)

    Jian Gao

    2016-03-01

    Full Text Available Human peptide deformylase (HsPDF is an important target for anticancer drug discovery. In view of the limited HsPDF, inhibitors were reported, and high-throughput virtual screening (HTVS studies based on HsPDF for developing new PDF inhibitors remain to be reported. We reported here on diverse small molecule inhibitors with excellent anticancer activities designed based on HTVS and molecular docking studies using the crystal structure of HsPDF. The compound M7594_0037 exhibited potent anticancer activities against HeLa, A549 and MCF-7 cell lines with IC50s of 35.26, 29.63 and 24.63 μM, respectively. Molecular docking studies suggested that M7594_0037 and its three derivatives could interact with HsPDF by several conserved hydrogen bonds. Moreover, the pharmacokinetic and toxicity properties of M7594_0037 and its derivatives were predicted using the OSIRIS property explorer. Thus, M7594_0037 and its derivatives might represent a promising scaffold for the further development of novel anticancer drugs.

  7. The use of semiempirical quantum chemical methods in studying the properties of large series of biologically active molecules

    International Nuclear Information System (INIS)

    Koeseoglu, Y.

    2004-01-01

    In this work, the productivity (temporal characteristics) of the so-called Electron Topological Method (ETM) proposed for the structure-activity relationships (SAR) investigation is studied. The method is standing aside the methods proposed for quantitative SAR (QSAR) studies because of the essential difference in the languages chosen for the compound structures description. ETM uses Electron Topological Matrices of Contiguity (ETMC) that include the most comprehensive data on the electronic structure of compounds and their topology. The flexibility of real molecules is taken into account in terms of two parameters, Δ 1 and Δ 2 , that characterise the accuracy allowed for atomic properties (diagonal matrix elements) and for bonds (non-diagonal ones). The dependence of the feature realisation on different values of Δ 1 and Δ 2 is studied and its graphical representation is given

  8. Modeling molecule-plasmon interactions using quantized radiation fields within time-dependent electronic structure theory

    Energy Technology Data Exchange (ETDEWEB)

    Nascimento, Daniel R.; DePrince, A. Eugene, E-mail: deprince@chem.fsu.edu [Department of Chemistry and Biochemistry, Florida State University, Tallahassee, Florida 32306-4390 (United States)

    2015-12-07

    We present a combined cavity quantum electrodynamics/ab initio electronic structure approach for simulating plasmon-molecule interactions in the time domain. The simple Jaynes-Cummings-type model Hamiltonian typically utilized in such simulations is replaced with one in which the molecular component of the coupled system is treated in a fully ab initio way, resulting in a computationally efficient description of general plasmon-molecule interactions. Mutual polarization effects are easily incorporated within a standard ground-state Hartree-Fock computation, and time-dependent simulations carry the same formal computational scaling as real-time time-dependent Hartree-Fock theory. As a proof of principle, we apply this generalized method to the emergence of a Fano-like resonance in coupled molecule-plasmon systems; this feature is quite sensitive to the nanoparticle-molecule separation and the orientation of the molecule relative to the polarization of the external electric field.

  9. Modulating the single-molecule magnet behaviour in phenoxo-O bridged Dy2 systems via subtle structural variations

    Science.gov (United States)

    Wang, Wen-Min; Zhao, Xiao-Yu; Qiao, Hui; Bai, Li; Han, Hong-Fei; Fang, Ming; Wu, Zhi-Lei; Zou, Ji-Yong

    2017-09-01

    In search of simple approaches to rationally modulate the single-molecule magnet behaviour in polynuclear lanthanide compound, a new system containing two structurally closely related dinuclear dysprosium complexes, namely [Dy2(hfac)4L2] (1) and [Dy2(hfac)4L‧2] (2) (hfac = hexafluoroacetylacetonate, HL = 2-[4-methylaniline-imino]methyl]-8-hydroxyquinoline and HL' = 2-[(3,4-dimethylaniline)-imino]methyl]-8-hydroxyquinoline), are successfully synthesized and the structure-dependent magnetic properties are investigated. The two Dy2 compounds display only slight variations in the coordination geometries of the center Dy(III) ion but display remarkably different single-molecule magnet behaviors with the anisotropic barriers (ΔE/kB) of 9.91 K for 1 and 20.57 K for 2. The different magnetic relaxation behaviors of the two Dy2 complexes mainly originate from the different chemical environments of the central DyIII ions.

  10. Structural property of platinum mononitride

    International Nuclear Information System (INIS)

    Yu, L.H.; Yao, K.L.; Liu, Z.L.; Zhang, Y.S.

    2007-01-01

    The structural stability and pressure-induced structural phase transition of platinum mononitride (PtN), as well as its electronic structure, were studied using the full potential augmented plane wave plus local orbitals method with the generalized gradient approximation (GGA) exchange-correlation functional. The total energy calculations show that the optimized wurtzite structure is most stable energetically among four structures: zinc blende, rocksalt, CsCl and wurtzite, which reveals the platinum mononitride PtN perhaps crystallizes in the wurtzite structure; the pressure of phase transition from wurtzite to rocksalt is predicted to be 41.4 GPa.The calculated bulk modulus of the wurtzite structure is 99.41 GPa, which is smaller than that of the other three structures and face-centered cubic Pt. The band structure calculations show wurtzite PtN is metallic

  11. Substitution Structures of Large Molecules and Medium Range Correlations in Quantum Chemistry Calculations

    Science.gov (United States)

    Evangelisti, Luca; Pate, Brooks

    2017-06-01

    A study of the minimally exciting topic of agreement between experimental and measured rotational constants of molecules was performed on a set of large molecules with 16-18 heavy atoms (carbon and oxygen). The molecules are: nootkatone (C_{15}H_{22}O), cedrol (C_{15}H_{26}O), ambroxide (C_{16}H_{28}O), sclareolide (C_{16}H_{22}O_{2}), and dihydroartemisinic acid (C_{15}H_{24}O_{2}). For this set of molecules we obtained 13C-subsitution structures for six molecules (this includes two conformers of nootkatone). A comparison of theoretical structures and experimental substitution structures was performed in the spirit of the recent work of Grimme and Steinmetz.[1] Our analysis focused the center-of-mass distance of the carbon atoms in the molecules. Four different computational methods were studied: standard DFT (B3LYP), dispersion corrected DFT (B3LYP-D3BJ), hybrid DFT with dispersion correction (B2PLYP-D3), and MP2. A significant difference in these theories is how they handle medium range correlation of electrons that produce dispersion forces. For larger molecules, these dispersion forces produce an overall contraction of the molecule around the center-of-mass. DFT poorly treats this effect and produces structures that are too expanded. MP2 calculations overestimate the correction and produce structures that are too compact. Both dispersion corrected DFT methods produce structures in excellent agreement with experiment. The analysis shows that the difference in computational methods can be described by a linear error in the center-of-mass distance. This makes it possible to correct poorer performing calculations with a single scale factor. We also reexamine the issue of the "Costain error" in substitution structures and show that it is significantly larger in these systems than in the smaller molecules used by Costain to establish the error limits. [1] Stefan Grimme and Marc Steinmetz, "Effects of London dispersion correction in density functional theory on

  12. Structure and properties of cell membranes. Volume 3: Methodology and properties of membranes

    International Nuclear Information System (INIS)

    Benga, G.

    1985-01-01

    This book covers the topics: Quantum chemical approach to study the mechanisms of proton translocation across membranes through protein molecules; monomolecular films as biomembrane models; planar lipid bilayers in relation to biomembranes; relation of liposomes to cell membranes; reconstitution of membrane transport systems; structure-function relationships in cell membranes as revealed by X-ray techniques; structure-function relationships in cell membranes as revealed by spin labeling ESR; structure and dynamics of cell membranes as revealed by NMR techniques; the effect of dietary lipids on the composition and properties of biological membranes and index

  13. Second rank direction cosine spherical tensor operators and the nuclear electric quadrupole hyperfine structure Hamiltonian of rotating molecules

    Science.gov (United States)

    di Lauro, C.

    2018-03-01

    Transformations of vector or tensor properties from a space-fixed to a molecule-fixed axis system are often required in the study of rotating molecules. Spherical components λμ,ν of a first rank irreducible tensor can be obtained from the direction cosines between the two axis systems, and a second rank tensor with spherical components λμ,ν(2) can be built from the direct product λ × λ. It is shown that the treatment of the interaction between molecular rotation and the electric quadrupole of a nucleus is greatly simplified, if the coefficients in the axis-system transformation of the gradient of the electric field of the outer charges at the coupled nucleus are arranged as spherical components λμ,ν(2). Then the reduced matrix elements of the field gradient operators in a symmetric top eigenfunction basis, including their dependence on the molecule-fixed z-angular momentum component k, can be determined from the knowledge of those of λ(2) . The hyperfine structure Hamiltonian Hq is expressed as the sum of terms characterized each by a value of the molecule-fixed index ν, whose matrix elements obey the rule Δk = ν. Some of these terms may vanish because of molecular symmetry, and the specific cases of linear and symmetric top molecules, orthorhombic molecules, and molecules with symmetry lower than orthorhombic are considered. Each ν-term consists of a contraction of the rotational tensor λ(2) and the nuclear quadrupole tensor in the space-fixed frame, and its matrix elements in the rotation-nuclear spin coupled representation can be determined by the standard spherical tensor methods.

  14. Correlating the vibrational spectra of structurally related molecules: A spectroscopic measure of similarity.

    Science.gov (United States)

    Tao, Yunwen; Zou, Wenli; Cremer, Dieter; Kraka, Elfi

    2018-03-05

    Using catastrophe theory and the concept of a mutation path, an algorithm is developed that leads to the direct correlation of the normal vibrational modes of two structurally related molecules. The mutation path is defined by weighted incremental changes in mass and geometry of the molecules in question, which are successively applied to mutate a molecule into a structurally related molecule and thus continuously converting their normal vibrational spectra from one into the other. Correlation diagrams are generated that accurately relate the normal vibrational modes to each other by utilizing mode-mode overlap criteria and resolving allowed and avoided crossings of vibrational eigenstates. The limitations of normal mode correlation, however, foster the correlation of local vibrational modes, which offer a novel vibrational measure of similarity. It will be shown how this will open new avenues for chemical studies. © 2017 Wiley Periodicals, Inc. © 2017 Wiley Periodicals, Inc.

  15. Understanding the relationships between molecule structure and imprinting effect of two acetyl-nitrogen heterocyclic compounds.

    Science.gov (United States)

    Wang, Jian; Dong, Xiao; Xue, Min; Dong, Xuemin; Xu, Zhibin; Meng, Zihui; Luo, Jun

    2016-06-01

    The molecularly imprinted polymers (MIPs) for two structural analogs, 1,3,5-triacetyl-1,3,5-triazacyclohexane (TRAT) and 1,3,5,7-tetraacetyl-1,3,5,7-tetraazacyclooctane (TAT), have been synthesized respectively under the same conditions. The TAT-MIP showed excellent imprinting effect, whereas the TRAT-MIP did not. To understand the different imprinting effects of the MIPs prepared from these two templates, the geometric structures and energetic properties of complexes formed around TAT and TRAT were studied computationally. The results indicate that in liquid phase, for the complexes formed with TAT and its nearest neighbor molecules, the magnitude of the binding energy increases with the number of surrounding TAT, methacrylic acid, and acetonitrile (ACT), whereas for the cases of TRAT, the magnitude of the binding energy increases with the number of surrounding TRAT and trimethylolpropane trimethacrylate. The studied systems form stronger and thus more stable networks encapsulating TAT than with TRAT. ACT may also play an important role in the polymerization phase in stabilizing the shapes of the cavities that TATs reside in. We propose these as the major factors that affect the different imprinting effects of the two MIPs. Copyright © 2016 John Wiley & Sons, Ltd. Copyright © 2016 John Wiley & Sons, Ltd.

  16. Impact of amphiphilic molecules on the structure and stability of homogeneous sphingomyelin bilayer: Insights from atomistic simulations

    Science.gov (United States)

    Kumari, Pratibha; Kaur, Supreet; Sharma, Shobha; Kashyap, Hemant K.

    2018-04-01

    Modulation of lipid membrane properties due to the permeation of amphiphiles is an important biological process pertaining to many applications in the field of pharmaceutics, toxicology, and biotechnology. Sphingolipids are both structural and functional lipids that constitute an important component of mechanically stable and chemically resistant outer leaflets of plasma membranes. Here, we present an atomistic molecular dynamics simulation study to appreciate the concentration-dependent effects of small amphiphilic molecules, such as ethanol, acetone, and dimethyl sulfoxide (DMSO), on the structure and stability of a fully hydrated homogeneous N-palmitoyl-sphingomyelin (PSM) bilayer. The study reveals an increase in the lateral expansion of the bilayer along with disordering of the hydrophobic lipid tails on increasing the concentration of ethanol. At higher concentrations of ethanol, rupturing of the bilayer is quite evident through the analysis of partial electron density profiles and lipid tail order parameters. For ethanol containing systems, permeation of water molecules in the hydrophobic part of the bilayer is allowed through local defects made due to the entry of ethanol molecules via ethanol-ethanol and ethanol-PSM hydrogen bonds. Moreover, the extent of PSM-PSM hydrogen bonding decreases with increasing ethanol concentration. On the other hand, acetone and DMSO exhibit minimal effects on the stability of the PSM bilayer at their lower concentrations, but at higher concentrations they tend to enhance the stability of the bilayer. The simulated potential of mean force (PMF) profiles for the translocation of the three solutes studied reveal that the free-energy of transfer of an ethanol molecule across the PSM lipid head region is lower than that for acetone and DMSO molecules. However, highest free-energy rise in the core hydrophobic part of the bilayer is observed for the DMSO molecule, whereas the ethanol and acetone PMF profiles show a lower barrier in

  17. Structural and dynamical properties of Yukawa balls

    International Nuclear Information System (INIS)

    Block, D; Kroll, M; Arp, O; Piel, A; Kaeding, S; Ivanov, Y; Melzer, A; Henning, C; Baumgartner, H; Ludwig, P; Bonitz, M

    2007-01-01

    To study the structural and dynamical properties of finite 3D dust clouds (Yukawa balls) new diagnostic tools have been developed. This contribution describes the progress towards 3D diagnostics for measuring the particle positions. It is shown that these diagnostics are capable of investigating the structural and dynamical properties of Yukawa balls and gaining insight into their basic construction principles

  18. Structural relaxation: low temperature properties

    International Nuclear Information System (INIS)

    Cruz, F. de la

    1984-01-01

    We discuss the changes in transport and superconducting properties of amorphous Zr 70 Cu 30 , induced by thermal relaxation. The experimental results are used to investigate the relation between the microscopic parameters and the observed physical properties. It is shown that the density of eletronic states determines the shift Tc as well as the variation of the electrical resistivity. It is necessary to assume strong hybridization between s and d bands to understand the eletrodynamic response of the superconductor. (Author) [pt

  19. Structure Property Relationships in Organic Conjugated Systems

    OpenAIRE

    O'Neill, Luke; Lynch, Patrick; McNamara, Mary

    2005-01-01

    A series of π conjugated oligomers were studied by absorption and photoluminescence spectroscopy. A linear relationship between the positioning of the absorption and photoluminescence maxima plotted against inverse conjugation length is observed. The relationships are in good agreement with the simple particle in a box method, one of the earliest descriptions of the properties of one-dimensional organic molecules. In addition to the electronic transition energies, it was observed that the Sto...

  20. Structure, processing, and properties of potatoes

    Science.gov (United States)

    Lloyd, Isabel K.; Kolos, Kimberly R.; Menegaux, Edmond C.; Luo, Huy; McCuen, Richard H.; Regan, Thomas M.

    1992-06-01

    The objective of this experiment and lesson intended for high school students in an engineering or materials science course or college freshmen is to demonstrate the relation between processing, structure, and thermodynamic and physical properties. The specific objectives are to show the effect of structure and structural changes on thermodynamic properties (specific heat) and physical properties (compressive strength); to illustrate the first law of thermodynamics; to compare boiling a potato in water with cooking it in a microwave in terms of the rate of structural change and the energy consumed to 'process' the potato; and to demonstrate compression testing.

  1. Structure, processing, and properties of potatoes

    Science.gov (United States)

    Lloyd, Isabel K.; Kolos, Kimberly R.; Menegaux, Edmond C.; Luo, Huy; Mccuen, Richard H.; Regan, Thomas M.

    1992-01-01

    The objective of this experiment and lesson intended for high school students in an engineering or materials science course or college freshmen is to demonstrate the relation between processing, structure, and thermodynamic and physical properties. The specific objectives are to show the effect of structure and structural changes on thermodynamic properties (specific heat) and physical properties (compressive strength); to illustrate the first law of thermodynamics; to compare boiling a potato in water with cooking it in a microwave in terms of the rate of structural change and the energy consumed to 'process' the potato; and to demonstrate compression testing.

  2. Shedding light on protein folding, structural and functional dynamics by single molecule studies

    DEFF Research Database (Denmark)

    Bavishi, Krutika; Hatzakis, Nikos

    2014-01-01

    property of a population, single molecule measurements offer observation and quantification of the abundance, lifetime and function of multiple protein states. They also permit the direct observation of the transient and rarely populated intermediates in the energy landscape that are typically averaged out...

  3. Effects of adatom and gas molecule adsorption on the physical properties of tellurene: a first principles investigation.

    Science.gov (United States)

    Wang, Xiao Hua; Wang, Da Wei; Yang, Ai Jun; Koratkar, Nikhil; Chu, Ji Feng; Lv, Pin Lei; Rong, Ming Zhe

    2018-02-07

    Tellurene is a new member of the two-dimensional (2D) materials' family, whose existence has been recently confirmed by first principles calculation and experimental work. Tellurene is also the first 2D mono-elemental material of group-VI predicted by scientists, and investigations of its basic properties are still in their infancy. In this study, we use first principles calculation based on density functional theory to investigate the adsorption of nineteen typical adatoms (Li, Na, K, Ca, Fe, Co, Ni, Cu, Zn, Ag, Au, Pd, Pt, B, N, O, Si, Cl, and Al), and five typical gas molecules (H 2 , O 2 , H 2 O, NO 2 , and NH 3 ) on α-phase as well as β-phase tellurene sheets. Our calculations shows that most adatoms are chemisorbed on tellurene sheets with large adsorption energies. Moreover, some of the adatoms are observed to give rise to distinct structural deformations and even local reconstructions. We report that a variety of electronic states are induced by the adatoms, which implies that different electronic structures can be engineered by the adsorption of adatoms. In fact, n-type doping, p-type doping, half-metal, and spin-gapless semiconductor features can be acquired by doping adatoms on tellurene sheets. Our calculations also show that the five gas molecules are all physisorbed on tellurene sheets, and no splitting behaviors are observed. Therefore, the adsorption of the five gas molecules has a weak effect on the electronic properties of tellurene. To conclude, our results indicate that adatom engineering may be used to greatly expand the potential applications of 2D tellurene.

  4. An Enantiomer of an Oral Small-Molecule TSH Receptor Agonist Exhibits Improved Pharmacologic Properties.

    Science.gov (United States)

    Neumann, Susanne; Padia, Umesh; Cullen, Mary Jane; Eliseeva, Elena; Nir, Eshel A; Place, Robert F; Morgan, Sarah J; Gershengorn, Marvin C

    2016-01-01

    We are developing an orally available small-molecule, allosteric TSH receptor (TSHR) agonist for follow-up diagnostics of patients with thyroid cancer. The agonist C2 (NCGC00161870) that we have studied so far is a racemic mixture containing equal amounts of two enantiomers, E1 and E2. As enantiomers of many drugs exhibit different pharmacologic properties, we assessed the properties of E1 and E2. We separated the two enantiomers by chiral chromatography and determined E2 as the (S)-(+) isomer via crystal structure analysis. E1 and E2 were shown to bind differently to a homology model of the transmembrane domain of TSHR in which E2 was calculated to exhibit lower binding energy than E1 and was, therefore, predicted to be more potent than E1. In HEK293 cells expressing human TSHRs, C2, E1, and E2 were equally efficacious in stimulating cAMP production, but their potencies were different. E2 was more potent (EC50 = 18 nM) than C2 (EC50 = 46 nM), which was more potent than E1 (EC50 = 217 nM). In primary cultures of human thyrocytes, C2, E1, and E2 stimulated increases in thyroperoxidase mRNA of 92-, 55-, and 137-fold and in sodium-iodide symporter mRNA of 20-, 4-, and 121-fold above basal levels, respectively. In mice, C2 stimulated an increase in radioactive iodine uptake of 1.5-fold and E2 of 2.8-fold above basal level, whereas E1 did not have an effect. C2 stimulated an increase in serum T4 of 2.4-fold, E1 of 1.9-fold, and E2 of 5.6-fold above basal levels, and a 5-day oral dosing regimen of E2 increased serum T4 levels comparable to recombinant human TSH (rhTSH, Thyrogen(®)). Thus, E2 is more effective than either C2 or E1 in stimulating thyroid function and as efficacious as rhTSH in vivo. E2 represents the next step toward developing an oral drug for patients with thyroid cancer.

  5. An Enantiomer of an Oral Small Molecule TSH Receptor Agonist Exhibits Improved Pharmacologic Properties

    Directory of Open Access Journals (Sweden)

    Susanne Neumann

    2016-07-01

    Full Text Available We are developing an orally available small molecule, allosteric TSH receptor (TSHR agonist for follow up diagnostics of patients with thyroid cancer. The agonist C2 (NCGC00161870 that we have studied so far is a racemic mixture containing equal amounts of two enantiomers, E1 and E2. As enantiomers of many drugs exhibit different pharmacologic properties, we assessed the properties of E1 and E2. We separated the two enantiomers by chiral chromatography and determined E2 as the (S-(+ isomer via crystal structure analysis. E1 and E2 were shown to bind differently to a homology model of the transmembrane domain of TSHR in which E2 was calculated to exhibit lower binding energy than E1 and was therefore predicted to be more potent than E1. In HEK293 cells expressing human TSHRs, C2, E1, and E2 were equally efficacious in stimulating cAMP production, but their potencies were different. E2 was more potent (EC50 = 18 nM than C2 (EC50 = 46 nM which was more potent than E1 (EC50 = 217 nM. In primary cultures of human thyrocytes, C2, E1, and E2 stimulated increases in thyroperoxidase mRNA of 92-, 55-, and 137-fold and in sodium-iodide symporter mRNA of 20-fold, 4-fold and 121-fold above basal levels, respectively. In mice, C2 stimulated an increase in radioactive iodine uptake of 1.5-fold and E2 of 2.8-fold above basal level, whereas E1 did not have an effect. C2 stimulated an increase in serum T4 of 2.4-fold, E1 of 1.9-fold, and E2 of 5.6-fold above basal levels, and a 5 day oral dosing regimen of E2 increased serum T4 levels comparable to recombinant human TSH (rhTSH, Thyrogen®. Thus, E2 is more effective than either C2 or E1 in stimulating thyroid function and as efficacious as rhTSH in vivo. E2 represents the next step toward developing an oral drug for patients with thyroid cancer.

  6. Effects of a donor on the bond property of quantum-dot molecules

    Institute of Scientific and Technical Information of China (English)

    Wang Li-Min; Luo Ying; Ma Ben-Kun; Duan Su-Qing; Zhao Xian-Geng

    2004-01-01

    Within the framework of effective mass approximation, we have calculated the electronic structure of the two laterally coupled quantum dots with a donor by the finite element method. The calculated results show that the bond states of quantum-dot molecules are quite sensitive to the donor positions. By varying the donor position, the transition from covalent to ionic bond state is realized for some electronic states. Some extreme cases are also discussed for comparison.

  7. Intermetallics structures, properties, and statistics

    CERN Document Server

    Steurer, Walter

    2016-01-01

    The focus of this book is clearly on the statistics, topology, and geometry of crystal structures and crystal structure types. This allows one to uncover important structural relationships and to illustrate the relative simplicity of most of the general structural building principles. It also allows one to show that a large variety of actual structures can be related to a rather small number of aristotypes. It is important that this book is readable and beneficial in the one way or another for everyone interested in intermetallic phases, from graduate students to experts in solid-state chemistry/physics/materials science. For that purpose it avoids using an enigmatic abstract terminology for the classification of structures. The focus on the statistical analysis of structures and structure types should be seen as an attempt to draw the background of the big picture of intermetallics, and to point to the white spots in it, which could be worthwhile exploring. This book was not planned as a textbook; rather, it...

  8. Structures and properties of spatially distorted porphyrins

    International Nuclear Information System (INIS)

    Golubchikov, Oleg A; Kuvshinova, Elizaveta M; Pukhovskaya, Svetlana G

    2005-01-01

    The published data on the structures and properties of porphyrins with distorted aromatic macrocycles are generalised and analysed. Data on the crystal structures, spectra and kinetics of formation and dissociation of their coordination derivatives are summarised. It is demonstrated that the distortion of the planar structure of the tetrapyrrole core is one of the most efficient means of controlling spectral, physicochemical and coordination properties of these compounds.

  9. Effects of Magnetic Field on the Valence Bond Property of the Double-Quantum-Dot Molecule

    Institute of Scientific and Technical Information of China (English)

    王立民; 罗莹; 马本堃

    2002-01-01

    The effects of the magnetic field on the valence bond property of the double-quantum-dot molecule are numerically studied by the finite element method and perturbation approach because of the absence of cylindrical symmetry in the horizontally coupled dots. The calculation results show that the energy value of the ground state changes differently from that of the first excited state with increasing magnetic field strength, and they cross under a certain magnetic field. The increasing magnetic field makes the covalent bond state change into an ionic bond state, which agrees qualitatively with experimental results and makes ionic bond states remain. The oscillator strength of transition between covalent bond states decreases distinctly with the increasing magnetic field strength, when the molecule is irradiated by polarized light. Such a phenomenon is possibly useful for actual applications.

  10. Small molecules make big differences: molecular doping effects on electronic and optical properties of phosphorene

    International Nuclear Information System (INIS)

    Jing, Yu; Tang, Qing; He, Peng; Zhou, Zhen; Shen, Panwen

    2015-01-01

    Systematical computations on the density functional theory were performed to investigate the adsorption of three typical organic molecules, tetracyanoquinodimethane (TCNQ), tetracyanoethylene (TCNE) and tetrathiafulvalene (TTF), on the surface of phosphorene monolayers and thicker layers. There exist considerable charge transfer and strong non-covalent interaction between these molecules and phosphorene. In particular, the band gap of phosphorene decreases dramatically due to the molecular modification and can be further tuned by applying an external electric field. Meanwhile, surface molecular modification has proven to be an effective way to enhance the light harvesting of phosphorene in different directions. Our results predict a flexible method toward modulating the electronic and optical properties of phosphorene and shed light on its experimental applications. (paper)

  11. Measurement and control of detailed electronic properties in a single molecule break junction.

    Science.gov (United States)

    Wang, Kun; Hamill, Joseph; Zhou, Jianfeng; Guo, Cunlan; Xu, Bingqian

    2014-01-01

    The lack of detailed experimental controls has been one of the major obstacles hindering progress in molecular electronics. While large fluctuations have been occurring in the experimental data, specific details, related mechanisms, and data analysis techniques are in high demand to promote our physical understanding at the single-molecule level. A series of modulations we recently developed, based on traditional scanning probe microscopy break junctions (SPMBJs), have helped to discover significant properties in detail which are hidden in the contact interfaces of a single-molecule break junction (SMBJ). For example, in the past we have shown that the correlated force and conductance changes under the saw tooth modulation and stretch-hold mode of PZT movement revealed inherent differences in the contact geometries of a molecular junction. In this paper, using a bias-modulated SPMBJ and utilizing emerging data analysis techniques, we report on the measurement of the altered alignment of the HOMO of benzene molecules with changing the anchoring group which coupled the molecule to metal electrodes. Further calculations based on Landauer fitting and transition voltage spectroscopy (TVS) demonstrated the effects of modulated bias on the location of the frontier molecular orbitals. Understanding the alignment of the molecular orbitals with the Fermi level of the electrodes is essential for understanding the behaviour of SMBJs and for the future design of more complex devices. With these modulations and analysis techniques, fruitful information has been found about the nature of the metal-molecule junction, providing us insightful clues towards the next step for in-depth study.

  12. Difficulties in applying pure Kohn-Sham density functional theory electronic structure methods to protein molecules

    Science.gov (United States)

    Rudberg, Elias

    2012-02-01

    Self-consistency-based Kohn-Sham density functional theory (KS-DFT) electronic structure calculations with Gaussian basis sets are reported for a set of 17 protein-like molecules with geometries obtained from the Protein Data Bank. It is found that in many cases such calculations do not converge due to vanishing HOMO-LUMO gaps. A sequence of polyproline I helix molecules is also studied and it is found that self-consistency calculations using pure functionals fail to converge for helices longer than six proline units. Since the computed gap is strongly correlated to the fraction of Hartree-Fock exchange, test calculations using both pure and hybrid density functionals are reported. The tested methods include the pure functionals BLYP, PBE and LDA, as well as Hartree-Fock and the hybrid functionals BHandHLYP, B3LYP and PBE0. The effect of including solvent molecules in the calculations is studied, and it is found that the inclusion of explicit solvent molecules around the protein fragment in many cases gives a larger gap, but that convergence problems due to vanishing gaps still occur in calculations with pure functionals. In order to achieve converged results, some modeling of the charge distribution of solvent water molecules outside the electronic structure calculation is needed. Representing solvent water molecules by a simple point charge distribution is found to give non-vanishing HOMO-LUMO gaps for the tested protein-like systems also for pure functionals.

  13. Difficulties in applying pure Kohn-Sham density functional theory electronic structure methods to protein molecules

    International Nuclear Information System (INIS)

    Rudberg, Elias

    2012-01-01

    Self-consistency-based Kohn-Sham density functional theory (KS-DFT) electronic structure calculations with Gaussian basis sets are reported for a set of 17 protein-like molecules with geometries obtained from the Protein Data Bank. It is found that in many cases such calculations do not converge due to vanishing HOMO-LUMO gaps. A sequence of polyproline I helix molecules is also studied and it is found that self-consistency calculations using pure functionals fail to converge for helices longer than six proline units. Since the computed gap is strongly correlated to the fraction of Hartree-Fock exchange, test calculations using both pure and hybrid density functionals are reported. The tested methods include the pure functionals BLYP, PBE and LDA, as well as Hartree-Fock and the hybrid functionals BHandHLYP, B3LYP and PBE0. The effect of including solvent molecules in the calculations is studied, and it is found that the inclusion of explicit solvent molecules around the protein fragment in many cases gives a larger gap, but that convergence problems due to vanishing gaps still occur in calculations with pure functionals. In order to achieve converged results, some modeling of the charge distribution of solvent water molecules outside the electronic structure calculation is needed. Representing solvent water molecules by a simple point charge distribution is found to give non-vanishing HOMO-LUMO gaps for the tested protein-like systems also for pure functionals. (fast track communication)

  14. "Switching on" the properties of single-molecule magnetism in triangular manganese(III) complexes.

    Science.gov (United States)

    Stamatatos, Theocharis C; Foguet-Albiol, Dolos; Lee, Sheng-Chiang; Stoumpos, Constantinos C; Raptopoulou, Catherine P; Terzis, Aris; Wernsdorfer, Wolfgang; Hill, Stephen O; Perlepes, Spyros P; Christou, George

    2007-08-01

    The reaction between oxide-centered, triangular [MnIII3O(O2CR)6(py)3](ClO4) (R = Me (1), Et (2), Ph (3)) compounds and methyl 2-pyridyl ketone oxime (mpkoH) affords a new family of Mn/carboxylato/oximato complexes, [MnIII3O(O2CR)3(mpko)3](ClO4) [R = Me (4), Et (5), and Ph (6)]. As in 1-3, the cations of 4-6 contain an [MnIII3(mu3-O)]7+ triangular core, but with each Mn2 edge now bridged by an eta1:eta1:mu-RCO2- and an eta1:eta1:eta1:mu-mpko- group. The tridentate binding mode of the latter causes a buckling of the formerly planar [MnIII3(mu3-O)]7+ core, resulting in a relative twisting of the three MnIII octahedra and the central O2- ion now lying approximately 0.3 A above the Mn3 plane. This structural distortion leads to ferromagnetic exchange interactions within the molecule and a resulting S = 6 ground state. Fits of dc magnetization data for 4-6 collected in the 1.8-10.0 K and 10-70 kG ranges confirmed S = 6 ground states, and gave the following D and g values: -0.34 cm(-1) and 1.92 for 4, -0.34 cm(-1) and 1.93 for 5, and -0.35 cm(-1) and 1.99 for 6, where D is the axial zero-field splitting (anisotropy) parameter. Complexes 4-6 all exhibit frequency-dependent out-of-phase (chi" M) ac susceptibility signals suggesting them possibly to be single-molecule magnets (SMMs). Relaxation rate vs T data for complex 4 down to 1.8 K obtained from the chi" M vs T studies were supplemented with rate vs T data measured to 0.04 K via magnetization vs time decay studies, and these were used to construct Arrhenius plots from which was obtained the effective barrier to relaxation (Ueff) of 10.9 K. Magnetization vs dc field sweeps on single-crystals of 4.3CH2Cl2 displayed hysteresis loops exhibiting steps due to quantum tunneling of magnetization (QTM). The loops were essentially temperature-independent below approximately 0.3 K, indicating only ground-state QTM between the lowest-lying Ms = +/-6 levels. Complexes 4-6 are thus confirmed as the first triangular SMMs. High

  15. Electronic structure of molecules of substituted benzenes by x-ray spectroscopy. I. Nitrobenzene

    International Nuclear Information System (INIS)

    Yumatov, V.D.; Murakhtanov, V.V.; Salakhutdinov, N.F.; Okotrub, A.V.; Mazalov, L.N.; Logunova, L.G.; Koptyug, V.A.; Furin, G.G.

    1988-01-01

    The electronic structure of the nitrobenzene molecule has been studied by x-ray spectroscopy with the aid of quantum-chemical calculations. The structure of the molecular orbitals of nitrobenzene has been compared with the structure of benzene and nitrogen dioxide. It has been shown in the framework of a fragment-by-fragment analysis that the interaction of the highest occupied π orbitals of the benzene ring and the nitro group is weak

  16. Expert systems for structure elucidation of organic molecules by spectral methods

    International Nuclear Information System (INIS)

    Elyashberg, Mikhail E

    1999-01-01

    The state-of-the-art of the investigations aimed at creating expert systems for establishing the structure of organic molecules from IR, 1 H and 13 C NMR spectra is analysed. Computer methods used for identification of molecular fragments, generation of their structure and spectra prediction are considered. Principles of the creation of modern expert systems and general strategy of solving structural problems are discussed. The bibliography includes 174 references.

  17. Silicon nanowires: structure and properties

    International Nuclear Information System (INIS)

    Nezhdanov, A.V.; Mashin, A.I.; Razuvaev, A.G.; Ershov, A.V.; Ignatov, S.K.

    2006-01-01

    An attempt to grow silicon nanowires has been made by electron beam evaporation on highly oriented pyrolytic substrate. Needle-like objects are located along the normal to a substrate (density 2 x 10 11 cm -2 ). For modeling quasi-one-dimensional objects calculations of nuclear structure and energy spectra have been accomplished. A fullerene-like structure Si 24 is proposed as a basic atomic configuration of silicon nanowires [ru

  18. Structural Arrangement of Water Molecules around Highly Charged Nanoparticles: Molecular Dynamics Simulation

    International Nuclear Information System (INIS)

    Kim, Eunae; Yeom, Min Sun

    2014-01-01

    Molecular dynamics simulations were performed to understand the structural arrangement of water molecules around highly charged nanoparticles under aqueous conditions. The effect of two highly charged nanoparticles on the solvation charge asymmetry has been examined. We calculated the radial distribution functions of the components of water molecules around nanoparticles which have four charge types at two different salt concentrations. Even though the distributions of water molecules surrounding a sodium ion and a chloride ion are hardly affected by the charges of nanoparticles and the salt concentrations, those around highly charged nanoparticles are strongly influenced by the charges of nanoparticles, but hardly by the charges of nanoparticles and salt concentrations. We find that the distributions of hydrogen atoms in water molecules around one highly charged nanoparticle are dependent on the magnitude of the nanoparticle charge

  19. The growth and electronic structure of azobenzene-based functional molecules on layered crystals

    International Nuclear Information System (INIS)

    Iwicki, J; Ludwig, E; Buck, J; Kalläne, M; Kipp, L; Rossnagel, K; Köhler, F; Herges, R

    2012-01-01

    In situ ultraviolet photoelectron spectroscopy is used to study the growth of ultrathin films of azobenzene-based functional molecules (azobenzene, Disperse Orange 3 and a triazatriangulenium platform with an attached functional azo-group) on the layered metal TiTe 2 and on the layered semiconductor HfS 2 at liquid nitrogen temperatures. Effects of intermolecular interactions, of the substrate electronic structure, and of the thermal energy of the sublimated molecules on the growth process and on the adsorbate electronic structure are identified and discussed. A weak adsorbate-substrate interaction is particularly observed for the layered semiconducting substrate, holding the promise of efficient molecular photoswitching.

  20. ChemNet: A Transferable and Generalizable Deep Neural Network for Small-Molecule Property Prediction

    Energy Technology Data Exchange (ETDEWEB)

    Goh, Garrett B.; Siegel, Charles M.; Vishnu, Abhinav; Hodas, Nathan O.

    2017-12-08

    With access to large datasets, deep neural networks through representation learning have been able to identify patterns from raw data, achieving human-level accuracy in image and speech recognition tasks. However, in chemistry, availability of large standardized and labelled datasets is scarce, and with a multitude of chemical properties of interest, chemical data is inherently small and fragmented. In this work, we explore transfer learning techniques in conjunction with the existing Chemception CNN model, to create a transferable and generalizable deep neural network for small-molecule property prediction. Our latest model, ChemNet learns in a semi-supervised manner from inexpensive labels computed from the ChEMBL database. When fine-tuned to the Tox21, HIV and FreeSolv dataset, which are 3 separate chemical tasks that ChemNet was not originally trained on, we demonstrate that ChemNet exceeds the performance of existing Chemception models, contemporary MLP models that trains on molecular fingerprints, and it matches the performance of the ConvGraph algorithm, the current state-of-the-art. Furthermore, as ChemNet has been pre-trained on a large diverse chemical database, it can be used as a universal “plug-and-play” deep neural network, which accelerates the deployment of deep neural networks for the prediction of novel small-molecule chemical properties.

  1. The ''GAPHYOR'' system: A computerized retrieval system of the properties of atoms, molecules, gases and plasmas

    International Nuclear Information System (INIS)

    Delcroix, J.L.

    1977-08-01

    GAPHYOR (GAz PHYsique ORsay) is a retrieval system of the simple properties of atoms and molecules (energy levels, lifetimes, dipole moments, polarizability etc.), of the interaction properties between these particles (cross-sections, reaction rates etc.) and of the macroscopic properties of the corresponding gases (viscosity, electronic and ion mobility, thermodynamic functions etc.). The chemical systems described must be based on a small number of elements (1 to 4 in the most recent version) and composed of molecules having 8 atoms at the most. In the present article the fundamental principles of GAPHYOR are described and by means of a few simple statistics the present state of the bank after five years of operation is analysed. On 1.11.76 the file contained more than 33,000 lines, and these increase by about 10,000 per year. The information comes from about 300 periodicals, although 45% of the results are taken from 4 principal journals. Geographical analysis of the file provides useful information about the scientific work of the various research centres and the scientific publishing policies of the different countries. Finally, the qualities, difficulties and possible improvements of GAPHYOR are analysed

  2. Structure and Properties of Compressed Borate Glasses

    DEFF Research Database (Denmark)

    Smedskjær, Morten Mattrup; Bauer, U.; Behrens, H.

    While the influence of thermal history on the structure and properties of glasses has been thoroughly studied in the past century, the influence of pressure history has received considerably less attention. In this study, we investigate the pressure-induced changes in structure and properties in ......, hardness and crack formation from nanoindentation experiments, and overshoot in isobaric heat capacity from DSC experiments at ambient pressure. The influence of the initial boron speciation on the degree of changes in structure and properties will also be discussed....

  3. Influence of lecithin-lipid composition on physico-chemical properties of nanoliposomes loaded with a hydrophobic molecule.

    Science.gov (United States)

    Bouarab, Lynda; Maherani, Behnoush; Kheirolomoom, Azadeh; Hasan, Mahmoud; Aliakbarian, Bahar; Linder, Michel; Arab-Tehrany, Elmira

    2014-03-01

    In this work, we studied the effect of nanoliposome composition based on phospholipids of docosahexaenoic acid (PL-DHA), salmon and soya lecithin, on physico-chemical characterization of vector. Cinnamic acid was encapsulated as a hydrophobic molecule in nanoliposomes made of three different lipid sources. The aim was to evaluate the influence of membrane lipid structure and composition on entrapment efficiency and membrane permeability of cinnamic acid. These properties are important for active molecule delivery. In addition, size, electrophoretic mobility, phase transition temperature, elasticity and membrane fluidity were measured before and after encapsulation. The results showed a correlation between the size of the nanoliposome and the entrapment. The entrapment efficiency of cinnamic acid was found to be the highest in liposomes prepared from salmon lecithin. The nanoliposomes composed of salmon lecithin presented higher capabilities as a carrier for cinnamic acid encapsulation. These vesicles also showed a high stability which in turn increases the membrane rigidity of nanoliposome as evaluated by their elastic properties, membrane fluidity and phase transition temperature. Copyright © 2013 Elsevier B.V. All rights reserved.

  4. Charge transport properties of a twisted DNA molecule: A renormalization approach

    Energy Technology Data Exchange (ETDEWEB)

    Almeida, M.L. de; Ourique, G.S.; Fulco, U.L. [Departamento de Biofísica e Farmacologia, Universidade Federal do Rio Grande do Norte, 59072-970 Natal-RN (Brazil); Albuquerque, E.L., E-mail: eudenilson@gmail.com [Departamento de Biofísica e Farmacologia, Universidade Federal do Rio Grande do Norte, 59072-970 Natal-RN (Brazil); Moura, F.A.B.F. de; Lyra, M.L. [Instituto de Física, Universidade Federal de Alagoas, 57072-900 Maceió-AL (Brazil)

    2016-10-20

    In this work we study the charge transport properties of a nanodevice consisting of a finite segment of the DNA molecule sandwiched between two metallic electrodes. Our model takes into account a nearest-neighbor tight-binding Hamiltonian considering the nucleobases twist motion, whose solutions make use of a two-steps renormalization process to simplify the algebra, which can be otherwise quite involved. The resulting variations of the charge transport efficiency are analyzed by numerically computing the main features of the electron transmittance spectra as well as their I × V characteristic curves.

  5. Curvature contributions to the static electrical properties of push-pull molecules

    International Nuclear Information System (INIS)

    Squitieri, Emilio

    2005-01-01

    Calculations of the curvature contribution to the diagonals components of the static dipole moment (μ), polarizability (α), first (β) and second (γ) hyperpolarizability of push-pull molecules are presented. This contribution was obtained from the analytical evaluation of electrical properties method using the harmonic zero-point energy. The valence-bond charge-transfer model was employed to obtain the field-dependent force constant and their derivates with respect to electric field. Our results show a relationship between the curvature and electronic contributions. We have also found that the curvature contribution is important in a numerical estimation of β and γ

  6. Polarization effects on the electric properties of urea and thiourea molecules in solid phase

    International Nuclear Information System (INIS)

    Santos, O. L.; Fonseca, T. L.; Sabino, J. R.; Georg, H. C.; Castro, M. A.

    2015-01-01

    We present theoretical results for the dipole moment, linear polarizability, and first hyperpolarizability of the urea and thiourea molecules in solid phase. The in-crystal electric properties were determined by applying a supermolecule approach in combination with an iterative electrostatic scheme, in which the surrounding molecules are represented by point charges. It is found for both urea and thiourea molecules that the influence of the polarization effects is mild for the linear polarizability, but it is marked for the dipole moment and first hyperpolarizability. The replacement of oxygen atoms by sulfur atoms increases, in general, the electric responses. Our second-order Møller–Plesset perturbation theory based iterative scheme predicts for the in-crystal dipole moment of urea and thiourea the values of 7.54 and 9.19 D which are, respectively, increased by 61% and 58%, in comparison with the corresponding isolated values. The result for urea is in agreement with the available experimental result of 6.56 D. In addition, we present an estimate of macroscopic quantities considering explicit unit cells of urea and thiourea crystals including environment polarization effects. These supermolecule calculations take into account partially the exchange and dispersion effects. The results illustrate the role played by the electrostatic interactions on the static second-order nonlinear susceptibility of the urea crystal

  7. A polychromatic turbidity microplate assay to distinguish discovery stage drug molecules with beneficial precipitation properties.

    Science.gov (United States)

    Morrison, John; Nophsker, Michelle; Elzinga, Paul; Donoso, Maria; Park, Hyunsoo; Haskell, Roy

    2017-10-05

    A material sparing microplate screening assay was developed to evaluate and compare the precipitation of discovery stage drug molecules as a function of time, concentration and media composition. Polychromatic turbidity time course profiles were collected for cinnarizine, probucol, dipyridamole as well as BMS-932481, and compared with turbidity profiles of monodisperse particle size standards. Precipitation for select sample conditions were further characterized at several time points by size, morphology, amount and form via laser diffraction, microscopy, size based particle counting and X-ray diffraction respectively. Wavelength dependent turbidity was found indicative of nanoprecipitate, while wavelength independent turbidity was consistent with larger microprecipitate formation. A transition from wavelength dependent to wavelength independent turbidity occurred for nanoparticle to microparticle growth, and a decrease in wavelength independent turbidity correlated with continued growth in size of microparticles. Other sudden changes in turbidity signal over time such as rapid fluctuation, a decrease in slope or a sharp inversion were correlated with very large or aggregated macro-precipitates exceeding 100μm in diameter, a change in the rate of precipitate formation or an amorphous to crystalline form conversion respectively. The assay provides an effective method to efficiently monitor and screen the precipitation fates of drug molecules, even during the early stages of discovery with limited amounts of available material. This capability highlights molecules with beneficial precipitation properties that are able to generate and maintain solubility enabling amorphous or nanoparticle precipitates. Copyright © 2017 Elsevier B.V. All rights reserved.

  8. Modification of the properties of porous silicon on adsorption of iodine molecules

    International Nuclear Information System (INIS)

    Vorontsov, A. S.; Osminkina, L. A.; Tkachenko, A. E.; Konstantinova, E. A.; Elenskii, V. G.; Timoshenko, V. Yu.; Kashkarov, P. K.

    2007-01-01

    Infrared spectroscopy and electron spin resonance measurements are used to study the properties of porous silicon layers on adsorption of the I 2 iodine molecules. The layers are formed on the p-an n-Si single-crystal wafers. It is established that, in the atmosphere of I 2 molecules, the charge-carrier concentration in the layers produced on the p-type wafers can be noticeably increased: the concentration of holes can attain values on the order of ∼10 18 -10 19 cm -3 . In porous silicon layers formed on the n-type wafers, the adsorption-induced inversion of the type of charge carriers and the partial substitution of silicon-hydrogen bonds by silicon-iodine bonds are observed. A decrease in the concentration of surface paramagnetic defects, P b centers, is observed in the samples with adsorbed iodine. The experimental data are interpreted in the context of the model in which it is assumed that both deep and shallow acceptor states are formed at the surface of silicon nanocrystals upon the adsorption of I 2 molecules

  9. Structural Ordering of Semiconducting Polymers and Small-Molecules for Organic Electronics

    Science.gov (United States)

    O'Hara, Kathryn Allison

    Semiconducting polymers and small-molecules can be readily incorporated into electronic devices such as organic photovoltaics (OPVs), thermoelectrics (OTEs), organic light emitting diodes (OLEDs), and organic thin film transistors (OTFTs). Organic materials offer the advantage of being processable from solution to form flexible and lightweight thin films. The molecular design, processing, and resulting thin film morphology of semiconducting polymers drastically affect the optical and electronic properties. Charge transport within films of semiconducting polymers relies on the nanoscale organization to ensure electronic coupling through overlap of molecular orbitals and to provide continuous transport pathways. While the angstrom-scale packing details can be studied using X-ray scattering methods, an understanding of the mesoscale, or the length scale over which smaller ordered regions connect, is much harder to achieve. Grain boundaries play an important role in semiconducting polymer thin films where the average grain size is much smaller than the total distance which charges must traverse in order to reach the electrodes in a device. The majority of semiconducting polymers adopt a lamellar packing structure in which the conjugated backbones align in parallel pi-stacks separated by the alkyl side-chains. Only two directions of transport are possible--along the conjugated backbone and in the pi-stacking direction. Currently, the discussion of transport between crystallites is centered around the idea of tie-chains, or "bridging" polymer chains connecting two ordered regions. However, as molecular structures become increasingly complex with the development of new donor-acceptor copolymers, additional forms of connectivity between ordered domains should be considered. High resolution transmission electron microscopy (HRTEM) is a powerful tool for directly imaging the crystalline grain boundaries in polymer and small-molecule thin films. Recently, structures

  10. Structural Properties of Barium Stannate.

    Energy Technology Data Exchange (ETDEWEB)

    Phelan, D.; Han, F.; Lopez-Bezanilla, A.; Krogstad, M. J.; Gim, Y.; Rong, Y.; Zhang, J.; Parshall, D.; Zheng, H.; Cooper, S. L.; Feygenson, M.; Yang, Wenge; Chen, Yu-Sheng

    2018-06-01

    BaSnO3 has attracted attention as a transparent conducting oxide with high room temperature carrier mobility. We report a series of measurements that were carried out to assess the structure of BaSnO3 over a variety of length scales. Measurements included single crystal neutron and x-ray diffraction, Rietveld and pair distribution analysis of neutron powder diffraction, Raman scattering, and high-pressure x-ray diffraction. Results from the various diffraction probes indicate that both the long-range and local structures are consistent with the cubic symmetry. The diffraction data under pressure was consistent with a robustly cubic phase up to 48.9 GPa, which is supported by density functional calculations. Additionally, transverse phonon velocities were determined from measured dispersion of the transverse acoustic phonon branches, the results of which are in good agreement with previous theoretical estimates and ultrasound measurements.

  11. Grain boundary structure and properties

    International Nuclear Information System (INIS)

    Balluffi, R.W.

    1979-05-01

    An attempt is made to distinguish those fundamental aspects of grain boundaries which should be relevant to the problem of the time dependent fracture of high temperature structural materials. These include the basic phenomena which are thought to be associated with cavitation and cracking at grain boundaries during service and with the more general microstructural changes which occur during both processing and service. A very brief discussion of the current state of knowledge of these fundamentals is given

  12. Structures, Bonding, and Energetics of Potential Triatomic Circumstellar Molecules Containing Group 15 and 16 Elements.

    Science.gov (United States)

    Turner, Walter E; Agarwal, Jay; Schaefer, Henry F

    2015-12-03

    The recent discovery of PN in the oxygen-rich shell of the supergiant star VY Canis Majoris points to the formation of several triatomic molecules involving oxygen, nitrogen, and phosphorus; these are also intriguing targets for main-group synthetic inorganic chemistry. In this research, high-level ab initio electronic structure computations were conducted on the potential circumstellar molecule OPN and several of its heavier group 15 and 16 congeners (SPN, SePN, TePN, OPP, OPAs, and OPSb). For each congener, four isomers were examined. Optimized geometries were obtained with coupled cluster theory [CCSD(T)] using large Dunning basis sets [aug-cc-pVQZ, aug-cc-pV(Q+d)Z, and aug-cc-pVQZ-PP], and relative energies were determined at the complete basis set limit of CCSDT(Q) from focal point analyses. The linear phosphorus-centered molecules were consistently the lowest in energy of the group 15 congeners by at least 6 kcal mol(-1), resulting from double-triple and single-double bond resonances within the molecule. The linear nitrogen-centered molecules were consistently the lowest in energy of the group 16 congeners by at least 5 kcal mol(-1), due to the electronegative central nitrogen atom encouraging electron delocalization throughout the molecule. For OPN, OPP, and SPN, anharmonic vibrational frequencies and vibrationally corrected rotational constants are predicted; good agreement with available experimental data is observed.

  13. Structure and properties of metals

    CERN Document Server

    Kurzydlowski, K J

    1999-01-01

    Metals are one of the most widely used types of engineering materials. Some of their properties, e.g. elastic constants, can be directly related to the nature of the metallic bonds between the atoms. On the other hand, macro- and $9 microstructural features of metals, such as point defects, dislocations, grain boundaries, and second phase particles, control their yield, flow, and fracture stress. Images of microstructural elements can be obtained by modern $9 imaging techniques. Modern computer aided methods can be further used to obtain a quantitative description of these microstructures. These methods take advantage of the progress made in recent years in the field of image processing, $9 mathematical morphology and quantitative stereology. Quantitative description of the microstructures are used for modeling processes taking place under the action of applied load at a given temperature and test (service) environment. $9 These model considerations can be illustrated on the example of an austenitic stainless...

  14. Ground-State Gas-Phase Structures of Inorganic Molecules Predicted by Density Functional Theory Methods

    KAUST Repository

    Minenkov, Yury; Cavallo, Luigi

    2017-01-01

    -GGA approximations with B3PW91, APF, TPSSh, mPW1PW91, PBE0, mPW1PBE, B972, and B98 functionals, resulting in lowest errors. We recommend using these methods to predict accurate three-dimensional structures of inorganic molecules when intramolecular dispersion

  15. Tertiary Structures of the Escherichia coli and Human Chromosome 21 Molecules of DNA

    Czech Academy of Sciences Publication Activity Database

    Hanzálek, Petr; Kypr, Jaroslav

    2001-01-01

    Roč. 283, č. 1 (2001), s. 219-223 ISSN 0006-291X R&D Projects: GA AV ČR IAA5004802 Institutional research plan: CEZ:AV0Z5004920 Keywords : DNA crystal structures * phosphorus atom representation * genomic DNA molecules Subject RIV: BO - Biophysics Impact factor: 2.946, year: 2001

  16. Integrated view of genome structure and sequence of a single DNA molecule in a nanofluidic device

    DEFF Research Database (Denmark)

    Marie, Rodolphe; Pedersen, Jonas Nyvold; L. V. Bauer, David

    2013-01-01

    as well as unique structural variation. Following its mapping, a molecule of interest was rescued fromthe chip;amplified and localized to a chromosome by FISH; and interrogated down to 1-bp resolution with a commercial sequencer, thereby reconciling haplotype-phased chromosome substructure with sequence....

  17. Organic molecules as tools to control the growth, surface structure, and redox activity of colloidal quantum dots.

    Science.gov (United States)

    Weiss, Emily A

    2013-11-19

    In order to achieve efficient and reliable technology that can harness solar energy, the behavior of electrons and energy at interfaces between different types or phases of materials must be understood. Conversion of light to chemical or electrical potential in condensed phase systems requires gradients in free energy that allow the movement of energy or charge carriers and facilitate redox reactions and dissociation of photoexcited states (excitons) into free charge carriers. Such free energy gradients are present at interfaces between solid and liquid phases or between inorganic and organic materials. Nanostructured materials have a higher density of these interfaces than bulk materials. Nanostructured materials, however, have a structural and chemical complexity that does not exist in bulk materials, which presents a difficult challenge: to lower or eliminate energy barriers to electron and energy flux that inevitably result from forcing different materials to meet in a spatial region of atomic dimensions. Chemical functionalization of nanostructured materials is perhaps the most versatile and powerful strategy for controlling the potential energy landscape of their interfaces and for minimizing losses in energy conversion efficiency due to interfacial structural and electronic defects. Colloidal quantum dots are semiconductor nanocrystals synthesized with wet-chemical methods and coated in organic molecules. Chemists can use these model systems to study the effects of chemical functionalization of nanoscale organic/inorganic interfaces on the optical and electronic properties of a nanostructured material, and the behavior of electrons and energy at interfaces. The optical and electronic properties of colloidal quantum dots have an intense sensitivity to their surface chemistry, and their organic adlayers make them dispersible in solvent. This allows researchers to use high signal-to-noise solution-phase spectroscopy to study processes at interfaces. In this

  18. Organic molecules deposited on graphene: A computational investigation of self-assembly and electronic structure

    International Nuclear Information System (INIS)

    Oliveira, I. S. S. de; Miwa, R. H.

    2015-01-01

    We use ab initio simulations to investigate the adsorption and the self-assembly processes of tetracyanoquinodimethane (TCNQ), tetrafluoro-tetracyanoquinodimethane (F4-TCNQ), and tetrasodium 1,3,6,8-pyrenetetrasulfonic acid (TPA) on the graphene surface. We find that there are no chemical bonds at the molecule–graphene interface, even at the presence of grain boundaries on the graphene surface. The molecules bond to graphene through van der Waals interactions. In addition to the molecule–graphene interaction, we performed a detailed study of the role played by the (lateral) molecule–molecule interaction in the formation of the, experimentally verified, self-assembled layers of TCNQ and TPA on graphene. Regarding the electronic properties, we calculate the electronic charge transfer from the graphene sheet to the TCNQ and F4-TCNQ molecules, leading to a p-doping of graphene. Meanwhile, such charge transfer is reduced by an order of magnitude for TPA molecules on graphene. In this case, it is not expected a significant doping process upon the formation of self-assembled layer of TPA molecules on the graphene sheet

  19. PAREMD: A parallel program for the evaluation of momentum space properties of atoms and molecules

    Science.gov (United States)

    Meena, Deep Raj; Gadre, Shridhar R.; Balanarayan, P.

    2018-03-01

    The present work describes a code for evaluating the electron momentum density (EMD), its moments and the associated Shannon information entropy for a multi-electron molecular system. The code works specifically for electronic wave functions obtained from traditional electronic structure packages such as GAMESS and GAUSSIAN. For the momentum space orbitals, the general expression for Gaussian basis sets in position space is analytically Fourier transformed to momentum space Gaussian basis functions. The molecular orbital coefficients of the wave function are taken as an input from the output file of the electronic structure calculation. The analytic expressions of EMD are evaluated over a fine grid and the accuracy of the code is verified by a normalization check and a numerical kinetic energy evaluation which is compared with the analytic kinetic energy given by the electronic structure package. Apart from electron momentum density, electron density in position space has also been integrated into this package. The program is written in C++ and is executed through a Shell script. It is also tuned for multicore machines with shared memory through OpenMP. The program has been tested for a variety of molecules and correlated methods such as CISD, Møller-Plesset second order (MP2) theory and density functional methods. For correlated methods, the PAREMD program uses natural spin orbitals as an input. The program has been benchmarked for a variety of Gaussian basis sets for different molecules showing a linear speedup on a parallel architecture.

  20. The Relation between Structure and Quantum Interference in Single Molecule Junctions

    DEFF Research Database (Denmark)

    Markussen, Troels; Stadler, Robert; Thygesen, Kristian Sommer

    2010-01-01

    Quantum interference (QI) of electron pathways has recently attracted increased interest as an enabling tool for single-molecule electronic devices. Although various molecular systems have been shown to exhibit QI effects and a number of methods have been proposed for its analysis, simple...... guidelines linking the molecular structure to QI effects in the phase-coherent transport regime have until now been lacking. In the present work we demonstrate that QI in aromatic molecules is intimately related to the topology of the molecule’s π system and establish a simple graphical scheme to predict...

  1. Structure and conformational dynamics of molecules in the excited electronic states: theory and experiment

    International Nuclear Information System (INIS)

    Godunov, I.A.; Bataev, V.A.; Maslov, D.V.; Yakovlev, N.N.

    2017-01-01

    The structure of conformational non-rigid molecules in the excited electronic states are investigated by joint theoretical and experimental methods. The theoretical part of work consist of two stages. In first stage the ab initio quantum-chemical calculations are carried out using high level methods. In second stage the vibrational problems of the various dimensions are solved by variational method for vibrations of large amplitude. In experimental part of work the vibronic spectra are investigated: gas-phase absorption and also, fluorescence excitation spectra of jet-cooled molecules. Some examples are considered.

  2. X-ray diffraction studies of the structure and orientations of thiophene and fluorenone based molecule

    International Nuclear Information System (INIS)

    Porzio, William; Pasini, Mariacecilia; Destri, Silvia; Giovanella, Umberto; Fontaine, Philippe

    2006-01-01

    The crystal structure of a conjugated molecule containing thiophene and fluorenone residues has been determined from powder X-ray diffraction (XRD). Thin films ( -5 Pa) onto oxidized silicon substrates, are oriented along with different crystallographic directions. A comparison of XRD in both Grazing Incidence and Bragg-Brentano geometries allowed to perform a quantitative analysis of the various orientations. This approach is generally applicable in the case of multi-oriented films. The results fully account for the poor performance of this molecule in p-type field effect transistor devices

  3. Electronic structure of molecular Rydberg states of some small molecules and molecular ion

    International Nuclear Information System (INIS)

    Sun Biao; Li Jiaming

    1993-01-01

    Based on an independent-particle-approximation (i.e. the multiple scattering self-consistent-field theory), the electronic structures of Rydberg states of the small diatomic molecules H 2 , He 2 and the He 2 + molecular ion were studied. The principal quantum number of the first state of the Rydberg series is determined from a convention of the limit of the molecular electronic configuration. The dynamics of the excited molecules and molecular ion has been elucidated. The theoretical results are in fair agreement with the existing experimental measurements, thus they can serve as a reliable basis for future refined treatment such as the configuration interaction calculation

  4. Structure and optical properties of water covered Cu(110) surfaces

    International Nuclear Information System (INIS)

    Baghbanpourasl, A.

    2014-01-01

    In this thesis structural and optical properties of the water covered Cu(110) surface is studied using density functional theory within independent particle approximation. Several stable adsorption structures are studied such as water clusters (monomer, dimer, trimer, tetramer and pentamer), different hexagonal monolayers, partially dissociated water monolayers and three different types of chains among them a chain that consists of pentagon rings. For a copper surface in contact with water vapor, the energetically stable H 2 O/OH adsorbed structures are compared thermodynamically using adsorption free energy (change of free energy due to adsorption). Several phase diagrams with respect to temperature and pressure are calculated. It is found that among the large number of energetically stable structures (i.e. structures with positive adsorption energy ) only limited number of them are thermodynamically stable. These thermodynamically stable structures are the class of almost energetically degenerate hexagonal overlayers, one type of partially dissociated water structure that contains Bjerrum defect in the hydrogen bond network and pentagon chain. Since hydrogen atoms are light weight their vibrational effects can be considerable. Zero point vibration decreases the adsorption energy up to 0.1 eV and free energy of adsorbed molecules arising from vibrational degree of freedom can go up to -0.2 eV per adsorbed molecule at 500 Kelvin. However zero point energy and vibrational free energy of adsorbed molecules do not alter relative stability of the adsorbed structures. To account for the long range van der Waals interactions, a semi-empirical scheme is applied. Reflectance Anisotropy Spectroscopy (RAS) is a fast and non destructive optical method that can be used to prob the surface in different conditions such as vacuum and electro-chemical environment. Elasto-optic coeficients of bulk are calculated from first principles and the change of the RA spectrum of the bare Cu

  5. STRUCTURAL AND THERMOPHYSICAL PROPERTIES OF HARDENING CONCRETE

    Directory of Open Access Journals (Sweden)

    L. Krasulina

    2012-01-01

    Full Text Available Structural and thermophysical properties of thermally treated concrete have been studied in the paper. The paper demonstrates regularities of changes in structural and thermophysical properties of concrete during heat treatment process. It is established that stabilization of coefficient values for heat- and temperature conductivity of concrete corresponds to completion of the process pertaining to intensive formation of the material pore structure and indicates the possibility of transition from the stage of isothermal extraction to the stage of temperature decrease. The obtained results are confirmed by studies of strength growth kinetics of concrete samples.

  6. Small molecule solution-processed bulk heterojunction solar cells with inverted structure using porphyrin donor

    Science.gov (United States)

    Yamamoto, Takaki; Hatano, Junichi; Nakagawa, Takafumi; Yamaguchi, Shigeru; Matsuo, Yutaka

    2013-01-01

    Utilizing tetraethynyl porphyrin derivative (TE-Por) as a small molecule donor material, we fabricated a small molecule solution-processed bulk heterojunction (BHJ) solar cell with inverted structure, which exhibited 1.6% power conversion efficiency (JSC (short-circuit current) = 4.6 mA/cm2, VOC (open-circuit voltage) = 0.90 V, and FF (fill factor) = 0.39) in the device configuration indium tin oxide/TiOx (titanium sub-oxide)/[6,6]-phenyl-C61-butyric acid methyl ester:TE-Por (5:1)/MoOx (molybdenum sub-oxide)/Au under AM1.5 G illumination at 100 mW/cm2. Without encapsulation, the small molecule solution-processed inverted BHJ solar cell also showed remarkable durability to air, where it kept over 73% of its initial power conversion efficiency after storage for 28 days under ambient atmosphere in the dark.

  7. Structural Analysis of ‘key’ Interactions in Functional RNA Molecules

    KAUST Repository

    Chawla, Mohit

    2018-04-01

    The main objective of the thesis is to carry out structural bioinformatics study along with usage of advanced quantum chemical methods to look at the structural stability and energetics of RNA building blocks. The main focus of the work described here lies on understanding the reasons behind the intrinsic stability of key interactions in nucleic acids. Crystal structures of RNA molecules exhibit fascinating variety of non-covalent interactions, which play an important role in maintaining the three dimensional structures. An accurate atomic level description of these interactions in the structural building blocks of RNA is a key to understand the structure-function relationship in these molecules. An effort has been made to link the conclusions drawn from quantum chemical computations on RNA base pairs in wide biochemical context of their occurrence in RNA structures. The initial attention was on the impact of natural and non-natural modifications of the nucleic acid bases on the structure and stability of base pairs that they are involved in. In the remaining sections we cover other molecular interactions shaping nucleic acids, as the interaction between ribose and the bases, and the fluoride sensing riboswitch system in order to investigate structure and dynamics of nucleic acids at the atomic level and to gain insight into the physical chemistry behind.

  8. Structural Analysis of ‘key’ Interactions in Functional RNA Molecules

    KAUST Repository

    Chawla, Mohit

    2018-01-01

    The main objective of the thesis is to carry out structural bioinformatics study along with usage of advanced quantum chemical methods to look at the structural stability and energetics of RNA building blocks. The main focus of the work described here lies on understanding the reasons behind the intrinsic stability of key interactions in nucleic acids. Crystal structures of RNA molecules exhibit fascinating variety of non-covalent interactions, which play an important role in maintaining the three dimensional structures. An accurate atomic level description of these interactions in the structural building blocks of RNA is a key to understand the structure-function relationship in these molecules. An effort has been made to link the conclusions drawn from quantum chemical computations on RNA base pairs in wide biochemical context of their occurrence in RNA structures. The initial attention was on the impact of natural and non-natural modifications of the nucleic acid bases on the structure and stability of base pairs that they are involved in. In the remaining sections we cover other molecular interactions shaping nucleic acids, as the interaction between ribose and the bases, and the fluoride sensing riboswitch system in order to investigate structure and dynamics of nucleic acids at the atomic level and to gain insight into the physical chemistry behind.

  9. Ab Initio Calculations of the Electronic Structures and Biological Functions of Protein Molecules

    Science.gov (United States)

    Zheng, Haoping

    2003-04-01

    The self-consistent cluster-embedding (SCCE) calculation method reduces the computational effort from M3 to about M1 (M is the number of atoms in the system) with unchanged calculation precision. So the ab initio, all-electron calculation of the electronic structure and biological function of protein molecule becomes a reality, which will promote new proteomics considerably. The calculated results of two real protein molecules, the trypsin inhibitor from the seeds of squash Cucurbita maxima (CMTI-I, 436 atoms) and the Ascaris trypsin inhibitor (912 atoms, two three-dimensional structures), are presented. The reactive sites of the inhibitors are determined and explained. The precision of structure determination of inhibitors are tested theoretically.

  10. Raman scattering in semiconductor structures based on monophthalocyanine and triphthalocyanine molecules incorporating erbium ions

    International Nuclear Information System (INIS)

    Belogorokhov, I. A.; Tikhonov, E. V.; Breusova, M. O.; Pushkarev, V. E.; Zoteev, A. V.; Tomilova, L. G.; Khokhlov, D. R.

    2007-01-01

    Semiconductor structures of the type of butyl-substituted erbium monophthalocyanine and triphthalocyanine are studied by Raman spectroscopy. It is shown that, when the sandwich-like structure of the molecule incorporating two complexing atoms between the ligands is considered instead of the planar molecular structure with one ligand and one metal atom, a series of lines appears in the Raman spectrum. In this series, the wave numbers of the lines represent an arithmetic progression with the arithmetical ratio ∼80 cm -1 . It is suggested that this feature is due to the larger number of organic molecules per metal atom in the triphthalocyanine complex, and the four Raman peaks at the frequencies 122, 208, 280, and 362 cm -1 are the manifestation of slight out-of-plane vibrations of the phthalocyanine ligands

  11. Dielectric relaxation of guest molecules in a clathrate structure of syndiotactic polystyrene.

    Science.gov (United States)

    Urakawa, Osamu; Kaneko, Fumitoshi; Kobayashi, Hideo

    2012-12-13

    Structure and dynamics of semicrystalline polymer films composed of syndiotactic polystyrene (sPS) and 2-butanone were examined through X-ray diffraction, polarized FTIR, and dielectric relaxation measurements. The X-ray and FTIR measurements revealed its crystal structure to be δ-clathrate containing 2-butanone molecules inside. The carbonyl group of 2-butanone in the crystal was found to orient preferentially parallel to the ac plane of the crystal through the polarized ATR FTIR measurements. Dielectric measurements were also conducted on these film samples to see only the relaxation dynamics of 2-butanone thanks to the high dielectric intensity of 2-butanone compared to sPS. Two relaxation modes denoted by slow and fast modes appeared. The former was assigned to the motion of 2-butanone molecules entrapped in the cavities of the crystalline (δ-form) and the latter to those in the amorphous region. We focused on the slow mode in order to elucidate the specific dynamics of the guest molecule confined in the crystalline region. The relaxation time of the slow mode was about 4 orders of magnitude longer than that of liquid 2-butanone. This suggests that the dynamics of guest molecules is highly restricted due to the high barrier to conformational and/or orientational change of the guest molecule in the cavity of δ-crystal. Furthermore, the dielectric intensity Δε of the slow mode was much smaller than the one calculated from that of bulk liquid 2-butanone and the guest concentration in the crystalline region (the intensity was only 10% of the estimated value from the bulk liquid data). This result also indicates that the free rotational motion of 2-butanone molecules is restricted inside the crystal. This will be consistently related to the weak uniplanar orientation of the carbonyl group of 2-butanone parallel to the ac plane revealed by the X-ray and polarized ATR FTIR measurements.

  12. Study of the Adsorption of Atoms and Molecules on Silicon Surfaces: Crystallographics and Electronic Structure

    International Nuclear Information System (INIS)

    Bengio, Silvina

    2003-01-01

    This thesis work has been concerned with adsorption properties of silicon surfaces.The atomic and electronic structure of molecules and atoms adsorbed on Si has been investigated by means of photoemission experiments combined with synchrotron radiation.The quantitative atomic structure determination was held applying the photoelectron diffraction technique.This technique is sensible to the local structure of a reference atomic specie and has elemental and chemical-state specificity.This approach has been applied to three quite different systems with different degrees of complexity, Sb/Si(111) √3x √3R30 0 , H 2 O/Si(100)2x1 and NH 3 /Si(111)7x7.Our results show that Sb which forms a ( √3√3)R30 0 phase produces a bulklike-terminated Si(111)1x1 substrate free of stacking faults.Regarding the atomic structure of its interface, this study strongly favours the T4-site milkstool model over the H3 one.An important aspect regarding the H 2 O/Si(100)(2x1) system was establishing the limits of precision with which one can determine not only the location of the adsorbed hydroxyl (OH) species, but also the extent to which this adsorption modifes the asymmetric dimers of the clean surface to which it is bonded.On the Si(111)(7x7) surface the problem is particularly complex because there are several different potentially active sites for NH3 adsorption and fragmentation.The application of the PhD method, however, has shown that the majority of the N atoms are on so-called 'rest atom' sites when deposited at RT.This is consistent with the N in the NH2 chemical state.This investigation represents the first quantitative structural study of any molecular adsorbate on the complex Si(111)(7x7) surface.This atomic structures determination shows the PhD is a powerful tool for the atomic structure determination.The molecular systems interacting with the active sites of the substrate fragments producing a short-range order surface.This long-range disorder is produced by the

  13. Structure and physical properties of bio membranes and model membranes

    International Nuclear Information System (INIS)

    Tibor Hianik

    2006-01-01

    Bio membranes belong to the most important structures of the cell and the cell organelles. They play not only structural role of the barrier separating the external and internal part of the membrane but contain also various functional molecules, like receptors, ionic channels, carriers and enzymes. The cell membrane also preserves non-equilibrium state in a cell which is crucial for maintaining its excitability and other signaling functions. The growing interest to the bio membranes is also due to their unique physical properties. From physical point of view the bio membranes, that are composed of lipid bilayer into which are incorporated integral proteins and on their surface are anchored peripheral proteins and polysaccharides, represent liquid s crystal of smectic type. The bio membranes are characterized by anisotropy of structural and physical properties. The complex structure of bio membranes makes the study of their physical properties rather difficult. Therefore several model systems that mimic the structure of bio membranes were developed. Among them the lipid monolayers at an air-water interphase, bilayer lipid membranes, supported bilayer lipid membranes and liposomes are most known. This work is focused on the introduction into the physical word of the bio membranes and their models. After introduction to the membrane structure and the history of its establishment, the physical properties of the bio membranes and their models are stepwise presented. The most focus is on the properties of lipid monolayers, bilayer lipid membranes, supported bilayer lipid membranes and liposomes that were most detailed studied. This lecture has tutorial character that may be useful for undergraduate and graduate students in the area of biophysics, biochemistry, molecular biology and bioengineering, however it contains also original work of the author and his co-worker and PhD students, that may be useful also for specialists working in the field of bio membranes and model

  14. Cleavage and Cell Adhesion Properties of Human Epithelial Cell Adhesion Molecule (HEPCAM)*

    Science.gov (United States)

    Tsaktanis, Thanos; Kremling, Heidi; Pavšič, Miha; von Stackelberg, Ricarda; Mack, Brigitte; Fukumori, Akio; Steiner, Harald; Vielmuth, Franziska; Spindler, Volker; Huang, Zhe; Jakubowski, Jasmine; Stoecklein, Nikolas H.; Luxenburger, Elke; Lauber, Kirsten; Lenarčič, Brigita; Gires, Olivier

    2015-01-01

    Human epithelial cell adhesion molecule (HEPCAM) is a tumor-associated antigen frequently expressed in carcinomas, which promotes proliferation after regulated intramembrane proteolysis. Here, we describe extracellular shedding of HEPCAM at two α-sites through a disintegrin and metalloprotease (ADAM) and at one β-site through BACE1. Transmembrane cleavage by γ-secretase occurs at three γ-sites to generate extracellular Aβ-like fragments and at two ϵ-sites to release human EPCAM intracellular domain HEPICD, which is efficiently degraded by the proteasome. Mapping of cleavage sites onto three-dimensional structures of HEPEX cis-dimer predicted conditional availability of α- and β-sites. Endocytosis of HEPCAM warrants acidification in cytoplasmic vesicles to dissociate protein cis-dimers required for cleavage by BACE1 at low pH values. Intramembrane cleavage sites are accessible and not part of the structurally important transmembrane helix dimer crossing region. Surprisingly, neither chemical inhibition of cleavage nor cellular knock-out of HEPCAM using CRISPR-Cas9 technology impacted the adhesion of carcinoma cell lines. Hence, a direct function of HEPCAM as an adhesion molecule in carcinoma cells is not supported and appears to be questionable. PMID:26292218

  15. Electronic structure and optical properties of metal doped tetraphenylporphyrins

    Science.gov (United States)

    Shah, Esha V.; Roy, Debesh R.

    2018-05-01

    A density functional scrutiny on the structure, electronic and optical properties of metal doped tetraphenylporphyrins MTPP (M=Fe, Co, Ni) is performed. The structural stability of the molecules is evaluated based on the electronic parameters like HOMO-LUMO gap (HLG), chemical hardness (η) and binding energy of the central metal atom to the molecular frame etc. The computed UltraViolet-Visible (UV-Vis) optical absorption spectra for all the compounds are also compared. The molecular structures reported are the lowest energy configurations. The entire calculations are carried out with a widely reliable functional, viz. B3LYP with a popular basis set which includes a scaler relativistic effect, viz. LANL2DZ.

  16. Influence of the replacement of alkoxyl with alkylthienyl on photovoltaic properties of two small molecule donors for organic solar cells

    Institute of Scientific and Technical Information of China (English)

    Shaoqing Zhang; Liyan Yang; Delong Liu; Chang He; Jianqi Zhang; Yun Zhang; Jianhui Hou

    2017-01-01

    Two benzo[1,2-b:4,5-b']dithiophene (BDT)-based small molecule (SM) donor materials with identical conjugated backbones but different substitution groups,named as DRTB-O and DRTB-T,were well explored to demonstrate the influence of the replacement of alkoxy with alkylthienyl on their photovoltaic properties in fullerene-based and fullerene-free organic solar cells (OSCs).The study shows that the two SM donors possess similar absorption spectra and energy levels but different crystalline structures in solid films.The carrier transport property and phase separation morphologies of the blend films have also been fully investigated.By employing PC71BM as the acceptor,the power conversion efficiency (PCE) of DRTB-O:PC71BM and DRTB-T:PC71BM based devices were 4.91% and 7.08%,respectively.However,by blending with IDIC,the two SM donors exhibited distinctly different photovoltaic properties in fullerene-free OSCs,and the PCE of DRTB-O:IDIC and DRTB-T:IDIC based devices were 0.15% and 9.06%,respectively.These results indicate that the replacement of alkoxyl with alkylthienyl in designing SM donor materials plays an important role in the application of fullerene-free OSCs.

  17. Covalent lanthanide(III) macrocyclic complexes: the bonding nature and optical properties of a promising single antenna molecule.

    Science.gov (United States)

    Rabanal-León, Walter A; Páez-Hernández, Dayán; Arratia-Pérez, Ramiro

    2014-12-21

    The present work is focused on the elucidation of the electronic structure, bonding nature and optical properties of a series of low symmetry (C2) coordination compounds of type [Ln(III)HAM](3+), where "Ln(III)" are the trivalent lanthanide ions: La(3+), Ce(3+), Eu(3+) and Lu(3+), while "HAM" is the neutral six-nitrogen donor macrocyclic ligand [C22N6H26]. This systematic study has been performed in the framework of the Relativistic Density Functional Theory (R-DFT) and also using a multi-reference approach via the Complete Active Space (CAS) wavefunction treatment with the aim of analyzing their ground state and excited state electronic structures as well as electronic correlation. Furthermore, the use of the energy decomposition scheme proposed by Morokuma-Ziegler and the electron localization function (ELF) allows us to characterize the bonding between the lanthanide ions and the macrocyclic ligand, obtaining as a result a dative-covalent interaction. Due to a great deal of lanthanide optical properties and their technological applications, the absorption spectra of this set of coordination compounds were calculated using the time-dependent density functional theory (TD-DFT), where the presence of the intense Ligand to Metal Charge Transfer (LMCT) bands in the ultraviolet and visible region and the inherent f-f electronic transitions in the Near-Infra Red (NIR) region for some lanthanide ions allow us to propose these systems as "single antenna molecules" with potential applications in NIR technologies.

  18. Structure of the Buried Metal-Molecule Interface in Organic Thin Film Devices

    DEFF Research Database (Denmark)

    Hansen, Christian Rein; Sørensen, Thomas Just; Glyvradal, Magni

    2009-01-01

    By use of specular X-ray reflectivity (XR) the structure of a metal-covered organic thin film device is measured with angstrom resolution. The model system is a Langmuir-Blodgett (LB) film, sandwiched between a silicon substrate and a top electrode consisting of 25 Å titanium and 100 Å aluminum....... By comparison of XR data for the five-layer Pb2+ arachidate LB film before and after vapor deposition of the Ti/Al top electrode, a detailed account of the structural damage to the organic film at the buried metal-molecule interface is obtained. We find that the organized structure of the two topmost LB layers...

  19. Structural investigations on differently sized monodisperse iron oxide nanoparticles synthesized by remineralization of apoferritin molecules

    International Nuclear Information System (INIS)

    Ullrich, Aladin; Horn, Siegfried

    2013-01-01

    We have investigated the structure of iron oxide nanoparticles produced by remineralization and thermal treatment of horse spleen apoferritin molecules. The described procedure allows to synthesize particles with diameters ranging from 4 to 7 nm in size. Atomic force microscopy and transmission electron microscopy (TEM) investigations were performed for shape and size determination, whereas energy-dispersive X-ray (TEM-EDX), high-resolution TEM, and electron diffraction measurements revealed the chemical composition and crystal structure of the particles. We found predominantly single crystalline nanoparticles with a hematite-like (α-Fe 2 O 3 ) structure

  20. Secondary structure of 5S RNA: NMR experiments on RNA molecules partially labeled with Nitrogen-15

    International Nuclear Information System (INIS)

    Gewirth, D.T.; Abo, S.R.; Leontis, N.B.; Moore, P.B.

    1987-01-01

    A method has been found for reassembling fragment 1 of Escherichia coli 5S RNA from mixtures containing strand III (bases 69-87) and the complex consisting of strand II (bases 89-120) and strand IV (bases 1-11). The reassembled molecule is identical with unreconstituted fragment 1. With this technique, fragment 1 molecules have been constructed 15 N-labeled either in strand III or in the strand II-strand IV complex. Spectroscopic data obtained with these partially labeled molecules show that the terminal helix of 5S RNA includes the GU and GC base pairs at positions 9 and 10 which the standard model for 5S secondary structure predicts but that these base pairs are unstable both in the fragment and in native 5S RNA. The data also assign three resonances to the helix V region of the molecule (bases 70-77 and 99-106). None of these resonances has a normal chemical shift even though two of them correspond to AU or GU base pairs in the standard model. The implications of these findings for the authors understanding of the structure of 5S RNA and its complex with ribosomal protein L25 are discussed

  1. Structure and intensities of microwave lines in the spectra of diatomic molecules

    International Nuclear Information System (INIS)

    Tatum, J.B.

    1986-01-01

    The structure of the rotational levels in a diatomic molecule, and the intensities of microwave transitions between them, are reviewed. Attention is given to the statistical weights of levels that may have hyperfine structure on account of one or two nuclear spins, in the case of heteronuclear molecules and of homonuclear molecules. A new treatment is given, involving the concept of energy surfaces in a ternary diagram in the form of a triangular prism, in which the three vertices represent three limiting cases, while the interior of the prism displays energy levels where all three intermediate coupling parameters are of comparable magnitude. An example is given of a simple J = 2 to J = 1 transition in a molecule with nuclear spins 3/2 and 1, showing the 56 hyperhyperfine components into which the rotational line is split, and a movie film is described which shows how the resulting ''fingerprint'' varies with the relative strengths of the interactions between the nuclear and electronic angular momenta

  2. Data base on structural materials aging properties

    International Nuclear Information System (INIS)

    Oland, C.B.

    1992-01-01

    The US Nuclear Regulatory Commission has initiated a Structural Aging Program at the Oak Ridge National Laboratory to identify potential structural safety issues related to continued service of nuclear power plants and to establish criteria for evaluating and resolving these issues. One of the tasks in this program focuses on the establishment of a Structural Materials Information Center where long-term and environment-dependent properties of concretes and other structural materials are being collected and assembled into a data base. These properties will be used to evaluate the current condition of critical structural components in nuclear power plants and to estimate the future performance of these materials during the continued service period

  3. Laser spectroscopic and theoretical studies of the structures and encapsulation motifs of functional molecules

    Energy Technology Data Exchange (ETDEWEB)

    Ebata, Takayuki; Kusaka, Ryoji [Department of Chemistry, Graduate School of Science, Hiroshima University, Kagamiyama 1-3-1, Higashi-Hiroshima, 739-8526 (Japan); Xantheas, Sotiris S. [Chemical and Materials Sciences Division, Pacific Northwest National Laboratory, 902 Battelle Boulevard, P.O. Box 999, MS K1-83, Richland, WA 99352 (United States)

    2015-01-22

    Extensive laser spectroscopic and theoretical studies have been recently carried out with the aim to reveal the structure and dynamics of encapsulation complexes in the gas phase. The characteristics of the encapsulation complexes are governed by the fact that (i) most of the host molecules are flexible and (ii) the complexes form high dimensional structures by using weak non-covalent interactions. These characteristics result in the possibility of the coexistence of many conformers in close energetic proximity. The combination of supersonic jet/laser spectroscopy and high level quantum chemical calculations is essential in tackling these challenging problems. In this report we describe our recent studies on the structures and dynamics of the encapsulation complexes formed by calix[4]arene (C4A), dibenzo-18-crown-6-ether (DB18C6), and benzo-18-crown-6-ether (B18C6) 'hosts' interacting with N{sub 2}, acetylene, water, and ammonia 'guest' molecules. The gaseous host-guest complexes are generated under jet-cooled conditions. We apply various laser spectroscopic methods to obtain the conformer- and isomer-specified electronic and IR spectra. The experimental results are complemented with quantum chemical calculations ranging from density functional theory to high level first principles calculations at the MP2 and CCSD(T) levels of theory. We discuss the possible conformations of the bare host molecules, the structural changes they undergo upon complexation, and the key interactions that are responsible in stabilizing the specific complexes.

  4. Structural properties of the Hugoniot curve

    International Nuclear Information System (INIS)

    Chaisse, F.

    2002-01-01

    This report is devoted to the structural properties analysis of the HUGONIOT curve, independently of the equation of state (E 0 S) display. The general properties so coming out are applied to the shock waves interacting studies. When phase transitions are present we investigate the splitting of shock waves and also the rarefaction waves. To end with, we present the shock instabilities and the non-uniqueness of solutions when specific E 0 S are present. (author)

  5. Metallic behavior and negative differential resistance properties of (InAs)n (n = 2 − 4) molecule cluster junctions via a combined non–equilibrium Green's function and density functional theory study

    International Nuclear Information System (INIS)

    Wang, Qi; Li, Rong; Xu, Yuanlan; Zhang, Jianbing; Miao, Xiangshui; Zhang, Daoli

    2014-01-01

    In this present work, the geometric structures and electronic transport properties of (InAs) n (n = 2, 3, 4) molecule cluster junctions are comparatively investigated using NEGF combined with DFT. Results indicate that all (InAs) n molecule cluster junctions present metallic behavior at the low applied biases ([−2V, 2V]), while NDR appears at a certain high bias range. Our calculation shows that the current of (InAs) 4 molecule cluster–based junction is almost the largest at any bias. The mechanisms of the current–voltage characteristics of all the three molecule cluster junctions are proposed.

  6. Structure and linear spectroscopic properties of near IR polymethine dyes

    International Nuclear Information System (INIS)

    Webster, Scott; Padilha, Lazaro A.; Hu Honghua; Przhonska, Olga V.; Hagan, David J.; Van Stryland, Eric W.; Bondar, Mikhail V.; Davydenko, Iryna G.; Slominsky, Yuriy L.; Kachkovski, Alexei D.

    2008-01-01

    We performed a detailed experimental investigation and quantum-chemical analysis of a new series of near IR polymethine dyes with 5-butyl-7,8-dihydrobenzo[cd]furo[2,3-f]indolium terminal groups. We also synthesized and studied two neutral dyes, squaraine and tetraone, with the same terminal groups and performed a comparison of the spectroscopic properties of this set of 'near IR' dyes (polymethine, squaraine, and tetraone) with an analogous set of 'visible' dyes with simpler benzo[e]indolium terminal groups. From these measurements, we find that the dyes with dihydrobenzo[cd]furo[2,3-f]indolium terminal groups are characterized by a remarkably large shift ∼300 nm (∼200 nm for tetraone) of their absorption bands towards the red region. We discuss the difference in electronic structure for these molecules and show that the 'near IR' dyes are characterized by an additional weak fluorescence band from the higher lying excited states connected with the terminal groups. Absorption spectra for the longest polymethines are solvent-dependent and are characterized by a broadening of the main band in polar solvents, which is explained by ground state symmetry breaking and reduced charge delocalization within the polymethine chromophore. The results of these experiments combined with the agreement of quantum chemical calculations moves us closer to a predictive capability for structure-property relations in cyanine-like molecules

  7. Single Fluorescent Molecules as Nano-Illuminators for Biological Structure and Function

    Science.gov (United States)

    Moerner, W. E.

    2011-03-01

    Since the first optical detection and spectroscopy of a single molecule in a solid (Phys. Rev. Lett. {62}, 2535 (1989)), much has been learned about the ability of single molecules to probe local nanoenvironments and individual behavior in biological and nonbiological materials in the absence of ensemble averaging that can obscure heterogeneity. Because each single fluorophore acts a light source roughly 1 nm in size, microscopic imaging of individual fluorophores leads naturally to superlocalization, or determination of the position of the molecule with precision beyond the optical diffraction limit, simply by digitization of the point-spread function from the single emitter. For example, the shape of single filaments in a living cell can be extracted simply by allowing a single molecule to move through the filament (PNAS {103}, 10929 (2006)). The addition of photoinduced control of single-molecule emission allows imaging beyond the diffraction limit (super-resolution) and a new array of acronyms (PALM, STORM, F-PALM etc.) and advances have appeared. We have used the native blinking and switching of a common yellow-emitting variant of green fluorescent protein (EYFP) reported more than a decade ago (Nature {388}, 355 (1997)) to achieve sub-40 nm super-resolution imaging of several protein structures in the bacterium Caulobacter crescentus: the quasi-helix of the actin-like protein MreB (Nat. Meth. {5}, 947 (2008)), the cellular distribution of the DNA binding protein HU (submitted), and the recently discovered division spindle composed of ParA filaments (Nat. Cell Biol. {12}, 791 (2010)). Even with these advances, better emitters would provide more photons and improved resolution, and a new photoactivatable small-molecule emitter has recently been synthesized and targeted to specific structures in living cells to provide super-resolution images (JACS {132}, 15099 (2010)). Finally, a new optical method for extracting three-dimensional position information based on

  8. Optical properties of the semiconductor quantum structure

    International Nuclear Information System (INIS)

    Haratizadeh, H.; Holtz, P.O.; Monemar, B.; Karlsoon, K.F.; Moskalenko, E.S.; Amano, H.; Akasaki, I.; Schoenfeld, W.V.; Garcia, J.M.; Petroff, P.M.

    2004-01-01

    Optical properties of the quantum structures have been discussed with emphasize of the AlGaN/GaN multiple quantum wells and InAs/GaAs quantum dot structures. We report on a detailed study of low temperature photoluminescence in Al 0 .07Ga 0 .93 N/GaN multiple quantum wells. The structures were nominally undoped multiple quantum well grown on sapphire substrate. The structure from discrete well width variations is here resolved in photoluminescence spectra. The results demonstrate that the theoretically estimated fields in this work are consistent with the experimental spectra

  9. Crystal structure of the Ig1 domain of the neural cell adhesion molecule NCAM2 displays domain swapping

    DEFF Research Database (Denmark)

    Rasmussen, Kim Krighaar; Kulahin, Nikolaj; Kristensen, Ole

    2008-01-01

    The crystal structure of the first immunoglobulin (Ig1) domain of neural cell adhesion molecule 2 (NCAM2/OCAM/RNCAM) is presented at a resolution of 2.7 A. NCAM2 is a member of the immunoglobulin superfamily of cell adhesion molecules (IgCAMs). In the structure, two Ig domains interact by domain...

  10. Counteracting chemical chaperone effects on the single-molecule α-synuclein structural landscape.

    Science.gov (United States)

    Ferreon, Allan Chris M; Moosa, Mahdi Muhammad; Gambin, Yann; Deniz, Ashok A

    2012-10-30

    Protein structure and function depend on a close interplay between intrinsic folding energy landscapes and the chemistry of the protein environment. Osmolytes are small-molecule compounds that can act as chemical chaperones by altering the environment in a cellular context. Despite their importance, detailed studies on the role of these chemical chaperones in modulating structure and dimensions of intrinsically disordered proteins have been limited. Here, we used single-molecule Förster resonance energy transfer to test the counteraction hypothesis of counterbalancing effects between the protecting osmolyte trimethylamine-N-oxide (TMAO) and denaturing osmolyte urea for the case of α-synuclein, a Parkinson's disease-linked protein whose monomer exhibits significant disorder. The single-molecule experiments, which avoid complications from protein aggregation, do not exhibit clear solvent-induced cooperative protein transitions for these osmolytes, unlike results from previous studies on globular proteins. Our data demonstrate the ability of TMAO and urea to shift α-synuclein structures towards either more compact or expanded average dimensions. Strikingly, the experiments directly reveal that a 21 [urea][TMAO] ratio has a net neutral effect on the protein's dimensions, a result that holds regardless of the absolute osmolyte concentrations. Our findings shed light on a surprisingly simple aspect of the interplay between urea and TMAO on α-synuclein in the context of intrinsically disordered proteins, with potential implications for the biological roles of such chemical chaperones. The results also highlight the strengths of single-molecule experiments in directly probing the chemical physics of protein structure and disorder in more chemically complex environments.

  11. NMR-study of dynamic structural transtions in RNA-molecules

    OpenAIRE

    Fürtig, Boris

    2007-01-01

    The following thesis is concerned with the elucidation of structural changes of RNA molecules during the time course of dynamic processes that are commonly denoted as folding reactions. In contrast to the field of protein folding, the concept of RNA folding comprises not only folding reactions itself but also refolding- or conformational switching- and assembly processes (see chapter III). The method in this thesis to monitor these diverse processes is high resolution liquid-state NMR spectro...

  12. Benzofuranone derivatives as effective small molecules related to insulin amyloid fibrillation: a structure-function study

    DEFF Research Database (Denmark)

    Rabiee, Atefeh; Ebrahim-Habibi, Azadeh; Navidpour, Latifeh

    2011-01-01

    amyloid fibrils under slightly destabilizing conditions in vitro and may form amyloid structures when subcutaneously injected into patients with diabetes. There is a great deal of interest in developing novel small molecule inhibitors of amyloidogenic processes, as potential therapeutic compounds...... of the five tested compounds was observed to enhance amyloid fibrillation, while the others inhibited the process when used at micromolar concentrations, which could make them interesting potential lead compounds for the design of therapeutic antiamyloidogenic compounds....

  13. Counteracting chemical chaperone effects on the single-molecule α-synuclein structural landscape

    Science.gov (United States)

    Ferreon, Allan Chris M.; Moosa, Mahdi Muhammad; Deniz, Ashok A.

    2012-01-01

    Protein structure and function depend on a close interplay between intrinsic folding energy landscapes and the chemistry of the protein environment. Osmolytes are small-molecule compounds that can act as chemical chaperones by altering the environment in a cellular context. Despite their importance, detailed studies on the role of these chemical chaperones in modulating structure and dimensions of intrinsically disordered proteins have been limited. Here, we used single-molecule Förster resonance energy transfer to test the counteraction hypothesis of counterbalancing effects between the protecting osmolyte trimethylamine-N-oxide (TMAO) and denaturing osmolyte urea for the case of α-synuclein, a Parkinson’s disease-linked protein whose monomer exhibits significant disorder. The single-molecule experiments, which avoid complications from protein aggregation, do not exhibit clear solvent-induced cooperative protein transitions for these osmolytes, unlike results from previous studies on globular proteins. Our data demonstrate the ability of TMAO and urea to shift α-synuclein structures towards either more compact or expanded average dimensions. Strikingly, the experiments directly reveal that a 2∶1 [urea]∶[TMAO] ratio has a net neutral effect on the protein’s dimensions, a result that holds regardless of the absolute osmolyte concentrations. Our findings shed light on a surprisingly simple aspect of the interplay between urea and TMAO on α-synuclein in the context of intrinsically disordered proteins, with potential implications for the biological roles of such chemical chaperones. The results also highlight the strengths of single-molecule experiments in directly probing the chemical physics of protein structure and disorder in more chemically complex environments. PMID:22826265

  14. Multiphase composite coatings: structure and properties

    International Nuclear Information System (INIS)

    Yurov, V M; Guchenko, S A; Platonova, E S; Syzdykova, A Sh; Lysenko, E N

    2015-01-01

    The paper discusses the results of the research into the formation of ion-plasma multiphase coatings. The types of the formed structures are found to be not so diverse, as those formed, for example, in alloy crystallization. The structures observed are basically of globular type and, more rarely, of unclosed dissipative and cellular structures. It is shown that the properties of the coating formed in deposition are largely determined by its surface energy or surface tension. Since the magnitude of the surface tension (surface energy) in most cases is an additive quantity, each of the elements of the coating composition contributes to the total surface energy. In case of simultaneous sputtering of multiphase cathodes, high entropy coatings with an ordered cellular structure and improved mechanical properties are formed. (paper)

  15. Charge transport properties of DNA aperiodic molecule: The role of interbase hopping in Watson-Crick base pair

    Science.gov (United States)

    Sinurat, E. N.; Yudiarsah, E.

    2017-07-01

    The charge transport properties of DNA aperiodic molecule has been studied by considering various interbase hopping parameter on Watson-Crick base pair. 32 base pairs long double-stranded DNA aperiodic model with sequence GCTAGTACGTGACGTAGCTAGGATATGCCTGA on one chain and its complement on the other chain is used. Transfer matrix method has been used to calculate transmission probabilities, for determining I-V characteristic using Landauer Büttiker formula. DNA molecule is modeled using tight binding hamiltonian combined with the theory of Slater-Koster. The result show, the increment of Watson-Crick hopping value leads to the transmission probabilities and current of DNA aperiodic molecule increases.

  16. Polarization properties of below-threshold harmonics from aligned molecules H2+ in linearly polarized laser fields.

    Science.gov (United States)

    Dong, Fulong; Tian, Yiqun; Yu, Shujuan; Wang, Shang; Yang, Shiping; Chen, Yanjun

    2015-07-13

    We investigate the polarization properties of below-threshold harmonics from aligned molecules in linearly polarized laser fields numerically and analytically. We focus on lower-order harmonics (LOHs). Our simulations show that the ellipticity of below-threshold LOHs depends strongly on the orientation angle and differs significantly for different harmonic orders. Our analysis reveals that this LOH ellipticity is closely associated with resonance effects and the axis symmetry of the molecule. These results shed light on the complex generation mechanism of below-threshold harmonics from aligned molecules.

  17. Structure of a Pheromone Receptor-Associated Mhc Molecule With An Open And Empty Groove

    Energy Technology Data Exchange (ETDEWEB)

    Olson, R.; Huey-Tubman, K.E.; Dulac, C.; Bjorkman, P.J.; /Caltech /Harvard U.

    2006-10-06

    Neurons in the murine vomeronasal organ (VNO) express a family of class Ib major histocompatibility complex (MHC) proteins (M10s) that interact with the V2R class of VNO receptors. This interaction may play a direct role in the detection of pheromonal cues that initiate reproductive and territorial behaviors. The crystal structure of M10.5, an M10 family member, is similar to that of classical MHC molecules. However, the M10.5 counterpart of the MHC peptide-binding groove is open and unoccupied, revealing the first structure of an empty class I MHC molecule. Similar to empty MHC molecules, but unlike peptide-filled MHC proteins and non-peptide-binding MHC homologs, M10.5 is thermally unstable, suggesting that its groove is normally occupied. However, M10.5 does not bind endogenous peptides when expressed in mammalian cells or when offered a mixture of class I-binding peptides. The F pocket side of the M10.5 groove is open, suggesting that ligands larger than 8-10-mer class I-binding peptides could fit by extending out of the groove. Moreover, variable residues point up from the groove helices, rather than toward the groove as in classical MHC structures. These data suggest that M10s are unlikely to provide specific recognition of class I MHC-binding peptides, but are consistent with binding to other ligands, including proteins such as the V2Rs.

  18. Structure of a pheromone receptor-associated MHC molecule with an open and empty groove.

    Directory of Open Access Journals (Sweden)

    2005-08-01

    Full Text Available Neurons in the murine vomeronasal organ (VNO express a family of class Ib major histocompatibility complex (MHC proteins (M10s that interact with the V2R class of VNO receptors. This interaction may play a direct role in the detection of pheromonal cues that initiate reproductive and territorial behaviors. The crystal structure of M10.5, an M10 family member, is similar to that of classical MHC molecules. However, the M10.5 counterpart of the MHC peptide-binding groove is open and unoccupied, revealing the first structure of an empty class I MHC molecule. Similar to empty MHC molecules, but unlike peptide-filled MHC proteins and non-peptide-binding MHC homologs, M10.5 is thermally unstable, suggesting that its groove is normally occupied. However, M10.5 does not bind endogenous peptides when expressed in mammalian cells or when offered a mixture of class I-binding peptides. The F pocket side of the M10.5 groove is open, suggesting that ligands larger than 8-10-mer class I-binding peptides could fit by extending out of the groove. Moreover, variable residues point up from the groove helices, rather than toward the groove as in classical MHC structures. These data suggest that M10s are unlikely to provide specific recognition of class I MHC-binding peptides, but are consistent with binding to other ligands, including proteins such as the V2Rs.

  19. Effect of geometry structure on critical properties

    Science.gov (United States)

    Jiang, Qing; Jiang, Xue-fan

    1997-02-01

    The effective-field renormalization group (EFRG) scheme is utilized to compute critical properties of the transverse Ising model (TIM) in a quantum-spin system. We distinguish differences between lattices of the same coordination number but of different structures and take effects of the first fluctuation correction into account. The improved results for the critical transverse field are obtained for several lattice structures even by considering the smallest possible cluster, which is in good agreement with series results.

  20. Is the regulation of the electronic properties of organic molecules by polynuclear superhalogens more effective than that by mononuclear superhalogens? A high-level ab initio case study.

    Science.gov (United States)

    Li, Miao-Miao; Li, Jin-Feng; Bai, Hongcun; Sun, Yin-Yin; Li, Jian-Li; Yin, Bing

    2015-08-21

    The regulation of the electronic properties of organic molecules induced by polynuclear superhalogens is theoretically explored here for sixteen composite structures. It is clearly indicated by the higher vertical electron detachment energy (VDE) that polynuclear superhalogens are more effective in regulating the electronic properties than mononuclear structures. However, this enhanced regulation is not only determined by superhalogens themselves but also related to the distribution of the extra electron of the final composites. The composites, in which the extra electron is mainly aggregated into the superhalogen moiety, will possess higher VDE values, as reported in the case of C1', 7.12 eV at the CCSD(T) level. This is probably due to the fact that, compared with organic molecules, superhalogens possess stronger attraction towards the extra electron and thus should lead to lower energies of the extra electrons and to higher VDE values eventually. Compared with CCSD(T), the Outer Valence Green's Function (OVGF) method fails completely for composite structures containing Cl atoms, while MP2 results are generally consistent in terms of the relative order of VDEs. Actually if the extra electron distribution of the systems could be approximated by the HOMO, the results at the OVGF level will be consistent with the CCSD(T) results. Conversely, the difference in VDEs between OVGF and CCSD(T) is significantly large. Besides superhalogen properties, the structures, relative stabilities and thermodynamic stabilities with respect to various fragmentation channels were also investigated for all the composite structures.

  1. Structural, photophysical, and theoretical studies of imidazole-based excited-state intramolecular proton transfer molecules

    Science.gov (United States)

    Somasundaram, Sivaraman; Kamaraj, Eswaran; Hwang, Su Jin; Park, Sanghyuk

    2018-02-01

    Imidazole-based excited state intramolecular proton transfer (ESIPT) blue fluorescent molecules, 2-(1-(4-chlorophenyl)-4,5-diphenyl-1H-imidazol-2-yl)phenol (BHPI-Cl) and 2-(1-(4-bromophenyl)-4,5-diphenyl-1H-imidazol-2-yl)phenol (BHPI-Br) were designed and synthesized by Debus-Radziszewski method through a one-pot multicomponent reaction in high yield. The synthesized compounds were fully characterized by 1H NMR, 13C NMR, FT-IR, FT-Raman, GC-Mass, and elemental analysis. The molecular structures in single crystal lattice were studied by X-ray crystallographic analysis. Because of the intramolecular hydrogen bonding, hydroxyphenyl group is planar to the central imidazole ring, while the other phenyl rings gave distorted conformations to the central heterocyclic ring. BHPI-Cl and BHPI-Br molecules showed intense ESIPT fluorescence at 480 nm, because the two twisted phenyl rings on 4- and 5-positions have reduced intermolecular interaction between adjacent molecules in each crystal through a head-to-tail packing manner. Quantum chemical calculations of energies were carried out by (TD-)DFT using B3LYP/6-31G(d, p) basis set to predict the electronic absorption spectra of the compounds, and they showed good agreement between the computational and the experimental values. The thermal analyses of the synthesized molecules were also carried out by TGA/DSC method.

  2. Single molecule tools for enzymology, structural biology, systems biology and nanotechnology: an update

    Science.gov (United States)

    Widom, Julia R.; Dhakal, Soma; Heinicke, Laurie A.; Walter, Nils G.

    2015-01-01

    Toxicology is the highly interdisciplinary field studying the adverse effects of chemicals on living organisms. It requires sensitive tools to detect such effects. After their initial implementation during the 1990s, single-molecule fluorescence detection tools were quickly recognized for their potential to contribute greatly to many different areas of scientific inquiry. In the intervening time, technical advances in the field have generated ever-improving spatial and temporal resolution, and have enabled the application of single-molecule fluorescence to increasingly complex systems, such as live cells. In this review, we give an overview of the optical components necessary to implement the most common versions of single-molecule fluorescence detection. We then discuss current applications to enzymology and structural studies, systems biology, and nanotechnology, presenting the technical considerations that are unique to each area of study, along with noteworthy recent results. We also highlight future directions that have the potential to revolutionize these areas of study by further exploiting the capabilities of single-molecule fluorescence microscopy. PMID:25212907

  3. Hydrogen-Bonded Polymer-Small Molecule Complexes with Tunable Mechanical Properties.

    Science.gov (United States)

    Liu, Tianqi; Peng, Xin; Chen, Ya-Nan; Bai, Qing-Wen; Shang, Cong; Zhang, Lin; Wang, Huiliang

    2018-03-13

    A novel type of polymeric material with tunable mechanical properties is fabricated from polymers and small molecules that can form hydrogen-bonded intermolecular complexes (IMCs). In this work, poly(vinyl alcohol) (PVA)-glycerol hydrogels are first prepared, and then they are dried to form IMCs. The tensile strengths and moduli of IMCs decrease dramatically with increasing glycerol content, while the elongations increase gradually. The mechanical properties are comparable with or even superior to those of common engineering plastics and rubbers. The IMCs with high glycerol content also show excellent flexibility and cold-resistance at subzero temperatures. Cyclic tensile and stress relaxation tests prove that there is an effective energy dissipation mechanism in IMCs and dynamic mechanical analysis confirms their physical crosslinking nature. FTIR and NMR characterizations prove the existence of hydrogen bonding between glycerol and PVA chains, which suppresses the crystallization of PVA from X-ray diffraction measurement. These PVA-glycerol IMCs may find potential applications in barrier films, biomedical packaging, etc., in the future. © 2018 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  4. Organogels thermodynamics, structure, solvent role, and properties

    CERN Document Server

    Guenet, Jean-Michel

    2016-01-01

    This book provides a physics-oriented introduction to organogels with a comparison to polymer thermoreversible gels whenever relevant. The past decade has seen the development of a wide variety of newly-synthesized molecules that can spontaneously self-assemble or crystallize from their organic or aqueous solutions to produce fibrillar networks, namely organogels, with potential applications in organic electronics, light harvesting, bio-imaging, non-linear optics, and the like. This compact volume presents a detailed outlook of these novel molecular systems with special emphasis upon their thermodynamics, morphology, molecular structure, and rheology. The definition of these complex systems is also tackled, as well as the role of the solvent. The text features numerous temperature-phase diagrams for a variety of organogels as well as illustrations of their structures at the microscopic, mesoscopic and macroscopic level. A review of some potential applications is provided including hybrid functional materials ...

  5. Structure and properties of interfaces in ceramics

    International Nuclear Information System (INIS)

    Bonnell, D.; Ruehle, M.; Chowdhry, U.

    1995-01-01

    The motivation for the symposium was the observation that interfaces in crystallographically and compositionally complex systems often dictate the performance and reliability of devices that utilize functional ceramics. The current level of understanding of interface-property relations in silicon-based devices required over 30 years of intensive research. Similar issues influence the relationship between atomic bonding at interfaces and properties in functional ceramic systems. The current understanding of these complex interfaces does not allow correlation between atomic structure and interface properties, in spite of their importance to a number of emerging technologies (wireless communications, radar-based positioning systems, sensors, etc.). The objective of this symposium was to focus attention on these fundamental issues by featuring recent theoretical and experimental work from various disciplines that impact the understanding of interface chemistry, structure, and properties. The emphasis was on relating properties of surfaces and interfaces to structure through an understanding of atomic level phenomena. Interfaces of interest include metal/ceramic, ceramic/ceramic, ceramic/vapor, etc., in electronic, magnetic, optical, ferroelectric, piezoelectric, and dielectric applications. Sixty one papers have been processed separately for inclusion on the data base

  6. Structural properties of Cd–Co ferrites

    Indian Academy of Sciences (India)

    36, No. 5, October 2013, pp. 919–922. c Indian Academy of Sciences. Structural properties of Cd–Co ferrites. S P DALAWAIa,∗. , T J SHINDEb, A B GADKARIc and P N VASAMBEKARa. aDepartment of Electronics, Shivaji University, Kolhapur 416 004, India. bDepartment of Physics, KRP Kanya Mahavidyalaya, Islampur ...

  7. Structural stability properties of Friedman cosmology

    International Nuclear Information System (INIS)

    Szydlowski, M.; Heller, M.; Pontificial Academy of Cracow, Krakow; Golda, Z.

    1984-01-01

    A dynamical system with Robertson-Walker symmetries and the equation of the state p = γepsilon, O <= γ <= 1, considered both as a conservative and nonconservative system, is studied with respect to its structural properties. Different cases are shown and analyzed on the phase space (x = Rsup(D), γ = (dx/dt)). (author)

  8. Diamond nanowires: fabrication, structure, properties, and applications.

    Science.gov (United States)

    Yu, Yuan; Wu, Liangzhuan; Zhi, Jinfang

    2014-12-22

    C(sp(3) )C-bonded diamond nanowires are wide band gap semiconductors that exhibit a combination of superior properties such as negative electron affinity, chemical inertness, high Young's modulus, the highest hardness, and room-temperature thermal conductivity. The creation of 1D diamond nanowires with their giant surface-to-volume ratio enhancements makes it possible to control and enhance the fundamental properties of diamond. Although theoretical comparisons with carbon nanotubes have shown that diamond nanowires are energetically and mechanically viable structures, reproducibly synthesizing the crystalline diamond nanowires has remained challenging. We present a comprehensive, up-to-date review of diamond nanowires, including a discussion of their synthesis along with their structures, properties, and applications. © 2014 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  9. Semiexperimental equilibrium structures for building blocks of organic and biological molecules: the B2PLYP route.

    Science.gov (United States)

    Penocchio, Emanuele; Piccardo, Matteo; Barone, Vincenzo

    2015-10-13

    The B2PLYP double hybrid functional, coupled with the correlation-consistent triple-ζ cc-pVTZ (VTZ) basis set, has been validated in the framework of the semiexperimental (SE) approach for deriving accurate equilibrium structures of molecules containing up to 15 atoms. A systematic comparison between new B2PLYP/VTZ results and several equilibrium SE structures previously determined at other levels, in particular B3LYP/SNSD and CCSD(T) with various basis sets, has put in evidence the accuracy and the remarkable stability of such model chemistry for both equilibrium structures and vibrational corrections. New SE equilibrium structures for phenylacetylene, pyruvic acid, peroxyformic acid, and phenyl radical are discussed and compared with literature data. Particular attention has been devoted to the discussion of systems for which lack of sufficient experimental data prevents a complete SE determination. In order to obtain an accurate equilibrium SE structure for these situations, the so-called templating molecule approach is discussed and generalized with respect to our previous work. Important applications are those involving biological building blocks, like uracil and thiouracil. In addition, for more general situations the linear regression approach has been proposed and validated.

  10. Solid state proton spin-lattice relaxation in four structurally related organic molecules

    International Nuclear Information System (INIS)

    Beckmann, Peter A.; Burbank, Kendra S.; Lau, Matty M.W.; Ree, Jessica N.; Weber, Tracy L.

    2003-01-01

    We report and interpret the temperature dependence of the proton spin-lattice relaxation rate at 8.50 and 22.5 MHz in four polycrystalline solids composed of structurally related molecules: 2-ethylanthracene, 2-t-butylanthracene, 2-ethylanthraquinone, and 2-t-butylanthraquinone. We have been unable to grow single crystals and therefore do not know the crystal structures. Hence, we use the NMR relaxometry data to make predictions about the solid state structures. As expected, we are able to conclude that the ethyl groups do not reorient in the solid state but that the t-butyl groups do. The anthraquinones have a ''simpler'' structure than the anthracenes. The best dynamical models suggest that there is a unique crystallographic site for the t-butyl groups in 2-t-butylanthraquinone and two sites, each with half the molecules, for the ethyl groups in 2-ethylanthraquinone. There are also two sites in 2-ethylanthracene, but with unequal weights, suggesting four sites in the unit cell with lower symmetry than the two anthraquinones. Finally, the observed relaxation rate data in 2-t-butylanthracene is very complex and its interpretation demonstrates the uniqueness problem that arises in interpreting relaxometry data without the knowledge of the crystal structure

  11. Electronic structure of the Fe2 molecule in the local-spin-density approximation

    International Nuclear Information System (INIS)

    Dhar, S.; Kestner, N.R.

    1988-01-01

    Ab initio self-consistent all-electron spin-polarized calculations have been performed for the ground-state properties of the Fe 2 molecule using the local-spin-density approximation. A Gaussian orbital basis is employed and all the two-electron integrals are evaluated analytically. The matrix elements of the exchange-correlation potential are computed numerically. The total energy, the binding energy, the equilibrium distance, vibrational frequency, and the ground-state configurations are reported and compared with other calculations and experimental results

  12. Valence electronic structure of the indene molecule: Experiment vs. GW calculations

    Energy Technology Data Exchange (ETDEWEB)

    Umari, P.; Stenuit, G. [CNR-IOM DEMOCRITOS Theory Elettra Group, Basovizza, Trieste (Italy); Castellarin-Cudia, C.; Feyer, V.; Di Santo, G.; Goldoni, A. [Sincrotrone Trieste S.C.p.A., Basovizza, Trieste (Italy); Borghetti, P.; Sangaletti, L. [Dipartimento di Matematica e Fisica, Universita Cattolica del Sacro Cuore, Brescia (Italy)

    2011-04-15

    We investigate the valence electronic properties in the gas phase of the indene molecule, which is one of the simplest polycyclic aromatic hydrocarbons, with photoemission spectroscopy using synchrotron light and through first-principles calculations using a many-body perturbation theory GW approach. We found an excellent agreement between theory and experiment. This allows us to assign to the peaks appearing in the photoemission spectrum the calculated molecular orbitals. (Copyright copyright 2011 WILEY-VCH Verlag GmbH and Co. KGaA, Weinheim)

  13. In situ STM imaging of the structures of pentacene molecules adsorbed on Au(111).

    Science.gov (United States)

    Pong, Ifan; Yau, Shuehlin; Huang, Peng-Yi; Chen, Ming-Chou; Hu, Tarng-Shiang; Yang, Yawchia; Lee, Yuh-Lang

    2009-09-01

    In situ scanning tunneling microscope (STM) was used to examine the spatial structures of pentacene molecules adsorbed onto a Au(111) single-crystal electrode from a benzene dosing solution containing 16-400 microM pentacene. Molecular-resolution STM imaging conducted in 0.1 M HClO(4) revealed highly ordered pentacene structures of ( radical31 x radical31)R8.9 degrees , (3 x 10), ( radical31 x 10), and ( radical7 x 2 radical7)R19.1 degrees adsorbed on the reconstructed Au(111) electrode dosed with different pentacene solutions. These pentacene structures and the reconstructed Au(111) substrate were stable between 0.2 and 0.8 V [vs reversible hydrogen electrode, RHE]. Increasing the potential to E > 0.8 V lifted the reconstructed Au(111) surface and disrupted the ordered pentacene adlattices simultaneously. Ordered pentacene structures could be restored by applying potentials negative enough to reinforce the reconstructed Au(111). At potentials negative of 0.2 V, the adsorption of protons became increasingly important to displace adsorbed pentacene admolecules. Although the reconstructed Au(111) structure was not essential to produce ordered pentacene adlayers, it seemed to help the adsorption of pentacene molecules in a long-range ordered pattern. At room temperature (25 degrees C), approximately 100 pentacene molecules seen in STM images could rotate and align themselves to a neighboring domain in 10 s, suggesting that pentacene admolecules could be mobile on Au(111) under the STM imaging conditions of -150 mV in bias voltage and 1 nA in feedback current.

  14. The study of electronic structure and properties of silicene for gas sensor application

    Energy Technology Data Exchange (ETDEWEB)

    Wella, Sasfan A.; Syaputra, Marhamni; Wungu, Triati D. K., E-mail: triati@fi.itb.ac.id; Suprijadi [Department of Physics, Faculty of Mathematics and Natural Sciences, Institut Teknologi Bandung Jl. Ganesha 10 Bandung 40132, West Java (Indonesia)

    2016-03-11

    In this study, we investigated the adsorption of gas molecules (H{sub 2}S, CO) on pristine silicene using first principles calculation. The structure, electronic properties, and adsorption energy of H{sub 2}S,CO/silicene are discussed thoroughly. We found that the pristine silicenewith low buckling structure is the most stable as compared with planar and high buckling structures. Silicene was able to detect a gas molecule which can be observed according tothe density of states analysis. Though a gas molecule adsorbed weakly, the electronic properties of the low buckling pristine silicene changed from semi-metal (zero band gap) to semiconductor. The adsorption energy of H{sub 2}S and CO on silicene is 0.075 eV and 0.06 eV, respectively.

  15. The Relationship Between Low-Frequency Motions and Community Structure of Residue Network in Protein Molecules.

    Science.gov (United States)

    Sun, Weitao

    2018-01-01

    The global shape of a protein molecule is believed to be dominant in determining low-frequency deformational motions. However, how structure dynamics relies on residue interactions remains largely unknown. The global residue community structure and the local residue interactions are two important coexisting factors imposing significant effects on low-frequency normal modes. In this work, an algorithm for community structure partition is proposed by integrating Miyazawa-Jernigan empirical potential energy as edge weight. A sensitivity parameter is defined to measure the effect of local residue interaction on low-frequency movement. We show that community structure is a more fundamental feature of residue contact networks. Moreover, we surprisingly find that low-frequency normal mode eigenvectors are sensitive to some local critical residue interaction pairs (CRIPs). A fair amount of CRIPs act as bridges and hold distributed structure components into a unified tertiary structure by bonding nearby communities. Community structure analysis and CRIP detection of 116 catalytic proteins reveal that breaking up of a CRIP can cause low-frequency allosteric movement of a residue at the far side of protein structure. The results imply that community structure and CRIP may be the structural basis for low-frequency motions.

  16. Vibronic coupling in ionized organic molecules: structural distortions and chemical reactions

    International Nuclear Information System (INIS)

    Williams, Ffrancon

    2003-01-01

    Ionized organic molecules (radical cations) in radiation chemistry are liable to undergo vibronic coupling whenever there is a relatively small energy gap (∼0.5-1.5 eV) between their ground and excited states. As a result of this mixing, the force constant for the symmetry-allowed vibrational mode that couples these states is lowered in the ground state of the radical cation so that deformation can take place more easily along this specific mode. This pseudo-Jahn-Teller effect can then result in a permanent structural distortion of the radical cation relative to the symmetry of the parent neutral molecule. It can also bring about an energetically favored pathway for a facile chemical rearrangement along a reaction coordinate defined by the coupling mode. Examples taken from matrix-isolation studies are used to illustrate these dramatic consequences of vibronic coupling in radical cations. Thus, the bicyclo[2.2.2]oct-2-ene and tetramethylurea radical cations are found to have twisted structures departing from the C 2v symmetry of their parent molecules, while the oxirane and bicyclo[1.1.1]pentane radical cations undergo ring-opening rearrangements along reaction coordinates that correspond to the deformational modes predicted by the pseudo-Jahn-Teller effect

  17. Silver Matrix Composites - Structure and Properties

    Directory of Open Access Journals (Sweden)

    Wieczorek J.

    2016-03-01

    Full Text Available Phase compositions of composite materials determine their performance as well as physical and mechanical properties. Depending on the type of applied matrix and the kind, amount and morphology of the matrix reinforcement, it is possible to shape the material properties so that they meet specific operational requirements. In the paper, results of investigations on silver alloy matrix composites reinforced with ceramic particles are presented. The investigations enabled evaluation of hardness, tribological and mechanical properties as well as the structure of produced materials. The matrix of composite material was an alloy of silver and aluminium, magnesium and silicon. As the reinforcing phase, 20-60 μm ceramic particles (SiC, SiO2, Al2O3 and Cs were applied. The volume fraction of the reinforcing phase in the composites was 10%. The composites were produced using the liquid phase (casting technology, followed by plastic work (the KOBO method. The mechanical and tribological properties were analysed for plastic work-subjected composites. The mechanical properties were assessed based on a static tensile and hardness tests. The tribological properties were investigated under dry sliding conditions. The analysis of results led to determination of effects of the composite production technology on their performance. Moreover, a relationship between the type of reinforcing phase and the mechanical and tribological properties was established.

  18. Shear-stress-induced structural arrangement of water molecules in nanoscale Couette flow with slipping at wall boundary

    International Nuclear Information System (INIS)

    Lin, Jau-Wen

    2014-01-01

    This study investigated the structuring of water molecules in a nanoscale Couette flow with the upper plate subjected to lateral forces with various magnitudes and water slipping against a metal wall. It was found that when the upper plate is subjected to a force, the water body deforms into a parallelepiped. Water molecules in the channel are then gradually arranged into lattice positions, creating a layered structure. The structural arrangement of water molecules is caused by the water molecules accommodating themselves to the increase in energy under the application of a lateral force on the moving plate. The ordering arrangement of water molecules increases the rotational degree of freedom, allowing the molecules to increase their Coulomb potential energy through polar rotation that accounts for the energy input through the upper plate. With a force continuously applied to the upper plate, the water molecules in contact with the upper plate move forward until slip between the water and upper plate occurs. The relation between the structural arrangement of water molecules, slip at the wall, and the shear force is studied. The relation between the slip and the locking/unlocking of water molecules to metal atoms is also studied

  19. Structure and potential energy function investigation on UH and UH2 molecules

    International Nuclear Information System (INIS)

    Luo Deli; Liu Xiaoya; Jiang Gang; Meng Daqiao; Zhu Zhenghe

    2001-01-01

    Density functional (B3LYP) method with Relativistic Effective Core Potential (RECP) have been used to optimize the structures and to calculate the potential energy function both for the ground and excited states of UH and UH 2 molecules. Results show that the ground state of UH and UH 2 molecules are X 4 II and X 3 A 2 , which belongs to C2v symmetry, and the disassociation energies are 2.886 eV and 5.249 ev respectively, and the spectral data of UH and UH 2 have also been derived both for the ground and excited state. The potential energy function of UH and UH 2 have been derived based on normal equation fitting method and the many-body expansion theory. The information is useful to mechanism analysis of the aging effect of the hydrogen storage material

  20. Structure and dynamics of water and lipid molecules in charged anionic DMPG lipid bilayer membranes

    DEFF Research Database (Denmark)

    Rønnest, A. K.; Peters, Günther H.J.; Hansen, Flemming Yssing

    2016-01-01

    Molecular dynamics simulations have been used to investigate the influence of the valency of counter-ions on the structure of freestanding bilayer membranes of the anionic 1,2-dimyristoyl-sn-glycero-3-phosphoglycerol (DMPG) lipid at 310 K and 1 atm. At this temperature, the membrane is in the fluid...... compared to experimental results and used to determine an average diffusion constant for all water molecules in the system. On extrapolating the diffusion constants inferred experimentally to a temperature of 310 K, reasonable agreement with the simulations is obtained. However, the experiments do not have...... the sensitivity to confirm the diffusion of a small component of water bound to the lipids as found in the simulations. In addition, the orientation of the dipole moment of the water molecules has been determined as a function of their depth in the membrane. Previous indirect estimates of the electrostatic...

  1. Electronic structure and physicochemical properties of selected penicillins

    Science.gov (United States)

    Soriano-Correa, Catalina; Ruiz, Juan F. Sánchez; Raya, A.; Esquivel, Rodolfo O.

    Traditionally, penicillins have been used as antibacterial agents due to their characteristics and widespread applications with few collateral effects, which have motivated several theoretical and experimental studies. Despite the latter, their mechanism of biological action has not been completely elucidated. We present a theoretical study at the Hartree-Fock and density functional theory (DFT) levels of theory of a selected group of penicillins such as the penicillin-G, amoxicillin, ampicillin, dicloxacillin, and carbenicillin molecules, to systematically determine the electron structure of full ?-lactam antibiotics. Our results allow us to analyze the electronic properties of the pharmacophore group, the aminoacyl side-chain, and the influence of the substituents (R and X) attached to the aminoacyl side-chain at 6? (in contrast with previous studies focused at the 3? substituents), and to corroborate the results of previous studies performed at the semiempirical level, solely on the ?-lactam ring of penicillins. Besides, several density descriptors are determined with the purpose of analyzing their link to the antibacterial activity of these penicillin compounds. Our results for the atomic charges (fitted to the electrostatic potential), the bond orders, and several global reactivity descriptors, such as the dipole moments, ionization potential, hardness, and the electrophilicity index, led us to characterize: the active sites, the effect of the electron-attracting substituent properties and their physicochemical features, which altogether, might be important to understand the biological activity of these type of molecules.

  2. Dynamics of water around the complex structures formed between the KH domains of far upstream element binding protein and single-stranded DNA molecules

    Energy Technology Data Exchange (ETDEWEB)

    Chakraborty, Kaushik; Bandyopadhyay, Sanjoy, E-mail: sanjoy@chem.iitkgp.ernet.in [Molecular Modeling Laboratory, Department of Chemistry, Indian Institute of Technology, Kharagpur 721302 (India)

    2015-07-28

    Single-stranded DNA (ss-DNA) binding proteins specifically bind to the single-stranded regions of the DNA and protect it from premature annealing, thereby stabilizing the DNA structure. We have carried out atomistic molecular dynamics simulations of the aqueous solutions of two DNA binding K homology (KH) domains (KH3 and KH4) of the far upstream element binding protein complexed with two short ss-DNA segments. Attempts have been made to explore the influence of the formation of such complex structures on the microscopic dynamics and hydrogen bond properties of the interfacial water molecules. It is found that the water molecules involved in bridging the ss-DNA segments and the protein domains form a highly constrained thin layer with extremely retarded mobility. These water molecules play important roles in freezing the conformational oscillations of the ss-DNA oligomers and thereby forming rigid complex structures. Further, it is demonstrated that the effect of complexation on the slow long-time relaxations of hydrogen bonds at the interface is correlated with hindered motions of the surrounding water molecules. Importantly, it is observed that the highly restricted motions of the water molecules bridging the protein and the DNA components in the complexed forms originate from more frequent hydrogen bond reformations.

  3. Mixing of alcohol and water molecules studied by neutron probe. Structure and dynamics

    International Nuclear Information System (INIS)

    Yoshida, Koji

    2001-01-01

    Structure of water/alcohol mixing solution was studied by three methods such as an isotope-exchanged neutron scattering method, RISM (Reference Interaction Site Model) integral equation and a neutron spin echo method. The principle of methods, experiments and results were reported. The results of experiments of water/tert-butyl alcohol (TBA) solution by the isotope-exchange neutron scattering method showed TBA molecule associated with each other through end methyl group. Especially this effect was the largest at x TBA = 0.06 and decreased with increasing the concentration of TBA. However, hydrogen bonding of TBA was very rare at x TBA = 0.06. By the partial radial distribution function obtained from RISM integral equation, it indicated that the structure of pure TBA became chain structure by hydrogen bond but changed to the structure contacted directly each hydrophobic group with increasing the concentration of water. Water/2-butoxyethanol (BE) mixing solution was measured by a neutron spin echo method. The activation energy of the diffusion coefficients obtained agreed to the energy of hydrogen bonding. The temperature response of diffusion coefficients showed the inverse of the experimental results obtained by the dynamic light scattering method. The difference between two measurement methods was different time scale and space scale. Namely, the object of the neutron scattering method is nano meter and nano second, but one of light scattering method many times over. It was proved from the above results that there was the cluster consisted of the same kind of molecule in the homogeneous two components solution, but the cluster was not stable and constantly exchanged with molecule, where the production and decay of the cluster is repeated at about nano sec. (S.Y.)

  4. Structural properties of small rhodium clusters

    Energy Technology Data Exchange (ETDEWEB)

    Soon, Yee Yeen; Yoon, Tiem Leong [School of Physics, Universiti Sains Malaysia, 11800 USM, Penang (Malaysia); Lim, Thong Leng [Faculty of Engineering and Technology, Multimedia University, Melaka Campus, 75450 Melaka (Malaysia)

    2015-04-24

    We report a systematic study of the structural properties of rhodium clusters at the atomistic level. A novel global-minimum search algorithm, known as parallel tempering multicanonical basin hopping plus genetic algorithm (PTMBHGA), is used to obtain the geometrical structures with lowest minima at the semi-empirical level where Gupta potential is used to describe the atomic interaction among the rhodium atoms. These structures are then re-optimized at the density functional theory (DFT) level with exchange-correlation energy approximated by Perdew-Burke-Ernzerhof (PBE) generalized gradient approximation (GGA). The structures are optimized for different spin multiplicities. The ones with lowest energies will be taken as ground-state structures. In most cases, we observe only minor changes in the geometry and bond length of the clusters as a result of DFT-level re-optimization. Only in some limited cases, the initial geometries obtained from the PTMBHGA are modified by the re-optimization. The variation of structural properties, such as ground-state geometry, symmetry and binding energy, with respect to the cluster size is studied and agreed well with other results available in the literature.

  5. Nucleon structure and properties of dense matter

    International Nuclear Information System (INIS)

    Kutschera, M.; Pethick, C.J.; Illinois Univ., Urbana, IL

    1988-01-01

    We consider the properties of dense matter in a framework of the Skyrme soliton model and the chiral bag model. The influence of the nucleon structure on the equation of state of dense matter is emphasized. We find that in both models the energy per unit volume is proportional to n 4/3 , n being the baryon number density. We discuss the properties of neutron stars with a derived equation of state. The role of many-body effects is investigated. The effect of including higher order terms in the chiral lagrangian is examined. The phase transition to quark matter is studied. 29 refs., 6 figs. (author)

  6. Definition and properties of ideal amorphous structures

    International Nuclear Information System (INIS)

    Stachurski, Z.H.

    2002-01-01

    Full text: Amorphous structure is usually defined by what it is not (ie, no crystalline peaks in XRS, no bond correlation in NMR), rather than by what it is. The interest in defining the structure of non-crystalline materials is long standing; packing geometry of spheres, molecular structure of glassy SiO 2 , or the structure of atactic polymers are prime examples. The earliest definitions of amorphous structure were in terms of a microcrystallite model of Valenkov, or continuous random network by Zachariasen. The random close packing of spheres of equal size, and an amorphous structure, composed of freely jointed linear chains of hard spheres, has been described mathematically in terms of a linear homogeneous Poisson process. This paper aims to describe some geometrical, kinematic, and topological properties of these two ideal amorphous structures, which belong to the same amorphous class. The geometry of packing is elucidated, and the use of Voronoi tessellation method for measuring the structures is described. The ideal amorphous solid has no symmetry elements; its volume can not be divided into identical unit cells. However, there is a volume element small enough to allow the distinction of its nanoscopic inhomogeneities, and sufficiently large enough to represent, accurately the overall behaviour. We define this volume element, the representative volume element. Suitable boundary conditions must be prescribed for a choice of RVE, and satisfy certain requirements. Topologically, a catchment region on the Born-Oppenheimer potential energy surface over nuclear configuration space, is defined by Mezey and Bader as an energetically stable geometry of the open region of R 3 traversed by all the trajectories which terminate at a local maximum. Two topological properties will be described: (i) the boundaries of the catchment region as a direct geometrical correspondence to the Voronoi polyhedron for a given atom in a given structure, and (ii) the constriction points

  7. Ground-State Gas-Phase Structures of Inorganic Molecules Predicted by Density Functional Theory Methods

    KAUST Repository

    Minenkov, Yury

    2017-11-29

    We tested a battery of density functional theory (DFT) methods ranging from generalized gradient approximation (GGA) via meta-GGA to hybrid meta-GGA schemes as well as Møller–Plesset perturbation theory of the second order and a single and double excitation coupled-cluster (CCSD) theory for their ability to reproduce accurate gas-phase structures of di- and triatomic molecules derived from microwave spectroscopy. We obtained the most accurate molecular structures using the hybrid and hybrid meta-GGA approximations with B3PW91, APF, TPSSh, mPW1PW91, PBE0, mPW1PBE, B972, and B98 functionals, resulting in lowest errors. We recommend using these methods to predict accurate three-dimensional structures of inorganic molecules when intramolecular dispersion interactions play an insignificant role. The structures that the CCSD method predicts are of similar quality although at considerably larger computational cost. The structures that GGA and meta-GGA schemes predict are less accurate with the largest absolute errors detected with BLYP and M11-L, suggesting that these methods should not be used if accurate three-dimensional molecular structures are required. Because of numerical problems related to the integration of the exchange–correlation part of the functional and large scattering of errors, most of the Minnesota models tested, particularly MN12-L, M11, M06-L, SOGGA11, and VSXC, are also not recommended for geometry optimization. When maintaining a low computational budget is essential, the nonseparable gradient functional N12 might work within an acceptable range of error. As expected, the DFT-D3 dispersion correction had a negligible effect on the internuclear distances when combined with the functionals tested on nonweakly bonded di- and triatomic inorganic molecules. By contrast, the dispersion correction for the APF-D functional has been found to shorten the bonds significantly, up to 0.064 Å (AgI), in Ag halides, BaO, BaS, BaF, BaCl, Cu halides, and Li and

  8. Relation between structure and organisation properties of new amphiphilic cyclodextrins

    International Nuclear Information System (INIS)

    Moutard, Stephane

    2003-01-01

    Since a number of years, special attention and efforts have been made to prepare amphiphilic cyclodextrins (CDs) with the objective to use them to obtain supramolecular assemblies as such or in the presence of preformed lipidic structures. The aim of these investigation is in both cases to combine the size specificity of cyclodextrins for guests and the transport properties of phospho-lipidic structures. The final objects could be of importance to transport or target biologically relevant molecules such as drugs using new galenic formulations. In a first step, a new family of amphiphilic CDs was prepared from a pure phospholipids (DMPE) onto cyclodextrins or methylated derivatives through a spacing arm. The afforded compounds (phospholipidyl-cyclodextrins) were fully characterized by high field NMR and high resolution mass spectrometry. The methylated derivatives were shown to self-organize in water with low CMC to form fluctuating micellar fibers retaining the inclusion capacity of the cyclodextrin cavities. The interactions of these compounds with membrane systems were investigated as black films using X-ray reflectivity and by evaluation of their detergent power towards model DMPC liposomes. Their ability to cross over the Blood Brain Barrier was evidenced by a new approach making use of novel immuno-enzymatic assays. In a second step, a new class of amphiphilic cyclodextrins was considered (peptidolipidyl-cyclodextrins). Although they are structurally similar to phospholipidyl-CDs, their preparation overcomes the tedious steps of the later and lead to a considerable versatility in terms of the number of possible molecules to be prepared. Moreover, the stability problems encountered with phospholipids are avoided. Several examples have been prepared, fully characterized and their organization properties investigated by the determination of CMC and by deuterium NMR on a pure and homogeneous mixed peptidolipidyl-CD / DMPC lamellar phase. This novel class of

  9. Enhancement of charge transport properties of small molecule semiconductors by controlling fluorine substitution and effects on photovoltaic properties of organic solar cells and perovskite solar cells.

    Science.gov (United States)

    Yun, Jae Hoon; Park, Sungmin; Heo, Jin Hyuck; Lee, Hyo-Sang; Yoon, Seongwon; Kang, Jinback; Im, Sang Hyuk; Kim, Hyunjung; Lee, Wonmok; Kim, BongSoo; Ko, Min Jae; Chung, Dae Sung; Son, Hae Jung

    2016-11-01

    We prepared a series of small molecules based on 7,7'-(4,4-bis(2-ethylhexyl)-4 H -silolo[3,2- b :4,5- b ']dithiophene-2,6-diyl)bis(4-(5'-hexyl-[2,2'-bithiophene]-5-yl)benzo[ c ][1,2,5]thiadiazole) with different fluorine substitution patterns ( 0F-4F ). Depending on symmetricity and numbers of fluorine atoms incorporated in the benzo[ c ][1,2,5]thiadiazole unit, they show very different optical and morphological properties in a film. 2F and 4F , which featured symmetric and even-numbered fluorine substitution patterns, display improved molecular packing structures and higher crystalline properties in a film compared with 1F and 3F and thus, 2F achieved the highest OTFT mobility, which is followed by 4F . In the bulk heterojunction solar cell fabricated with PC 71 BM, 2F achieves the highest photovoltaic performance with an 8.14% efficiency and 0F shows the lowest efficiency of 1.28%. Moreover, the planar-type perovskite solar cell (PSC) prepared with 2F as a dopant-free hole transport material shows a high power conversion efficiency of 14.5% due to its high charge transporting properties, which were significantly improved compared with the corresponding PSC device obtained from 0F (8.5%). From the studies, it is demonstrated that low variation in the local dipole moment and the narrow distribution of 2F conformers make intermolecular interactions favorable, which may effectively drive crystal formations in the solid state and thus, higher charge transport properties compared with 1F and 3F .

  10. Structure investigation of organic molecules on Au(111) surfaces; Strukturuntersuchung organischer Molekuele auf Au(111)-Oberflaechen

    Energy Technology Data Exchange (ETDEWEB)

    Kazempoor, Michel

    2009-02-02

    The present work covers two topics namely the coadsorption of formic acid and water on Au(111) and the structure of biphenylalkanthiole SAMs on Au(111) surfaces. The coadsorption of formic acid and water on Au(111) surfaces has been investigated by means of vibrational and photoelectron spectroscopy (HREELS, XPS). Formic acid adsorbs at 90 K molecularly with vibrational modes characteristic for flat lying zig-zag chains in the mono- and multilayer regime, like in solid formic acid. The structure of the flat lying formic acid chains was determined by low energy electron diffraction (LEED) as a (2r3 x r19) unit cell. Annealing results in a complete desorption at 190 K. Sequential adsorption of formic acid and water at 90 K shows no significant chemical interaction. Upon annealing the coadsorbed layer to 140 K a hydrogenbonded cyclic complex of formic acid with one water molecule could be identified using isotopically labelled adsorbates. Upon further annealing this complex decomposes leaving molecularly adsorbed formic acid on the surface at 160 K, accompanied by a proton exchange between formic acid and water. The influence of the alkane spacer chain length on the structure of biphenylalkanethiols on Au(111) surfaces was investigated as well. A systematic study was done on BPn-SAMs deposited from the gas phase. For every chain length a structure was found by LEED. Furthermore the influence of temperature on the structure was investigated in the range from room temperature up to about 400 K. To obviate influences from different preparation methods BP3 and BP4 was deposited from gas phase and from solution. No LEED spots were observed on BP4 SAMs deposited from solution. For BP3 an influence of the preparation could be excluded. For all BPn-SAMs a good agreement between LEED and STM data's was found. Nevertheless different unit cells were determined by LEED and STM consistent structures could be suggested considering the unit cell size given by LEED and the

  11. Monte Carlo study of the honeycomb structure of anthraquinone molecules on Cu(111)

    Science.gov (United States)

    Kim, Kwangmoo; Einstein, T. L.

    2011-06-01

    Using Monte Carlo calculations of the two-dimensional (2D) triangular lattice gas model, we demonstrate a mechanism for the spontaneous formation of honeycomb structure of anthraquinone (AQ) molecules on a Cu(111) plane. In our model long-range attractions play an important role, in addition to the long-range repulsions and short-range attractions proposed by Pawin, Wong, Kwon, and Bartels [ScienceSCIEAS0036-807510.1126/science.1129309 313, 961 (2006)]. We provide a global account of the possible combinations of long-range attractive coupling constants which lead to a honeycomb superstructure. We also provide the critical temperature of disruption of the honeycomb structure and compare the critical local coverage rate of AQ’s where the honeycomb structure starts to form with the experimental observations.

  12. Structure Analysis and Properties of Unleaded Brasses

    Directory of Open Access Journals (Sweden)

    Rzadkosz S.

    2015-04-01

    Full Text Available The analysis of brasses regarding their microstructure, mechanical properties and ecological characteristics has been presented. The influence of characteristic alloying elements contained in the brasses and the possibilities of replacing them with other elements have been assessed. The paper contains the results of studies on the influence of chosen additional elements shaping the structure and properties of unleaded alloys based on Cu-Zn system as the matrix. The research aimed at determining the mechanism and the intensity of influence of such additives as tellurium and bismuth. The microstructures were investigated with the help of light microscopy and scanning electron microscopy with X-ray microanalysis (SEM-EDS for determining significant changes of the properties.

  13. Structural and tunneling properties of Si nanowires

    KAUST Repository

    Montes Muñoz, Enrique

    2013-12-06

    We investigate the electronic structure and electron transport properties of Si nanowires attached to Au electrodes from first principles using density functional theory and the nonequilibrium Green\\'s function method. We systematically study the dependence of the transport properties on the diameter of the nanowires, on the growth direction, and on the length. At the equilibrium Au-nanowire distance we find strong electronic coupling between the electrodes and nanowires, which results in a low contact resistance. With increasing nanowire length we study the transition from metallic to tunneling conductance for small applied bias. For the tunneling regime we investigate the decay of the conductance with the nanowire length and rationalize the results using the complex band structure of the pristine nanowires. The conductance is found to depend strongly on the growth direction, with nanowires grown along the ⟨110⟩ direction showing the smallest decay with length and the largest conductance and current.

  14. Structural and tunneling properties of Si nanowires

    KAUST Repository

    Montes Muñ oz, Enrique; Gkionis, Konstantinos; Rungger, Ivan; Sanvito, Stefano; Schwingenschlö gl, Udo

    2013-01-01

    We investigate the electronic structure and electron transport properties of Si nanowires attached to Au electrodes from first principles using density functional theory and the nonequilibrium Green's function method. We systematically study the dependence of the transport properties on the diameter of the nanowires, on the growth direction, and on the length. At the equilibrium Au-nanowire distance we find strong electronic coupling between the electrodes and nanowires, which results in a low contact resistance. With increasing nanowire length we study the transition from metallic to tunneling conductance for small applied bias. For the tunneling regime we investigate the decay of the conductance with the nanowire length and rationalize the results using the complex band structure of the pristine nanowires. The conductance is found to depend strongly on the growth direction, with nanowires grown along the ⟨110⟩ direction showing the smallest decay with length and the largest conductance and current.

  15. Microstructure mechanical properties relationship in bainitic structures

    International Nuclear Information System (INIS)

    Altuna, M. A.; Gutierrez, I.

    2005-01-01

    In the present work, the microstructures and their mechanical properties have been studies in different bainitic structures. therefore, different bainitic morphologies have been produced by isothermal treatments carried out at different temperatures. For these steels, 400-450 degree centigree is the optimum range of temperatures in order to obtain bainitic structures. If the Temperature is higher, perlite is also formed and if it is lower, martensite is obtained during quenching. SEM and EBSD/OIM techniques were applied in order to study the microstructure. Tensile tests were carried out for mechanical characterization. (Author) 20 refs

  16. Structural and electronic properties of thallium compounds

    International Nuclear Information System (INIS)

    Paliwal, Neetu; Srivastava, Vipul

    2016-01-01

    The tight binding linear muffin-tin-orbital (TB-LMTO) method within the local density approximation (LDA has been used to calculate structural and electronic properties of thallium pnictides TlX (X=Sb, Bi) at high pressure. As a function of volume, the total energy is evaluated. Apart from this, the lattice parameter (a_0), bulk modulus (B_0), band structure (BS) and density of states (DOS) are calculated. From energy band diagram we observed metallic behaviour in TlSb and TlBi compounds. The values of equilibrium lattice constants and bulk modulus are agreed well with the available data.

  17. Structural and electronic properties of thallium compounds

    Energy Technology Data Exchange (ETDEWEB)

    Paliwal, Neetu, E-mail: neetumanish@gmail.com [Department of Physics, AISECT University Bhopal, 464993 (India); Srivastava, Vipul [Department of Engineering Physics, NRI Institute of Research & Technology, Raisen Road, Bhopal, 462021 (India)

    2016-05-06

    The tight binding linear muffin-tin-orbital (TB-LMTO) method within the local density approximation (LDA has been used to calculate structural and electronic properties of thallium pnictides TlX (X=Sb, Bi) at high pressure. As a function of volume, the total energy is evaluated. Apart from this, the lattice parameter (a{sub 0}), bulk modulus (B{sub 0}), band structure (BS) and density of states (DOS) are calculated. From energy band diagram we observed metallic behaviour in TlSb and TlBi compounds. The values of equilibrium lattice constants and bulk modulus are agreed well with the available data.

  18. Chiral Molecule-Enhanced Extinction Ratios of Quantum Dots Coupled to Random Plasmonic Structures.

    Science.gov (United States)

    Bezen, Lior; Yochelis, Shira; Jayarathna, Dilhara; Bhunia, Dinesh; Achim, Catalina; Paltiel, Yossi

    2018-03-06

    Devices based on self-assembled hybrid colloidal quantum dots (CQDs) coupled with specific organic linker molecules are a promising way to simply realize room-temperature, spectrally tunable light detectors. Nevertheless, this type of devices usually has low quantum efficiency. Plasmonics has been shown as an efficient tool in guiding and confining light at nanoscale dimensions. As plasmonic modes exhibit highly confined fields, they locally increase light-matter interactions and consequently enhance the performance of CQD-based photodetectors. Recent publications presented experimental results of large extinction enhancement from a monolayer of CQDs coupled to random gold nanoislands using a monolayer of organic alkyl linkers. We report here that a twofold larger extinction enhancement in the visible spectrum is observed when a monolayer of helical chiral molecules connects the CQDs to the gold structure instead of a monolayer of achiral linkers. We also show that this effect provides insight into the chirality of the molecules within the monolayer. In future work, we plan to evaluate the potential of these results to be used in the construction of a more efficient and sensitive photon detector based on surface QDs, as well as to supply a simple way to map the chirality of a single chiral monolayer.

  19. Phase Structure of Strong-Field Tunneling Wave Packets from Molecules.

    Science.gov (United States)

    Liu, Ming-Ming; Li, Min; Wu, Chengyin; Gong, Qihuang; Staudte, André; Liu, Yunquan

    2016-04-22

    We study the phase structure of the tunneling wave packets from strong-field ionization of molecules and present a molecular quantum-trajectory Monte Carlo model to describe the laser-driven dynamics of photoelectron momentum distributions of molecules. Using our model, we reproduce and explain the alignment-dependent molecular frame photoelectron spectra of strong-field tunneling ionization of N_{2} reported by M. Meckel et al. [Nat. Phys. 10, 594 (2014)]. In addition to modeling the low-energy photoelectron angular distributions quantitatively, we extract the phase structure of strong-field molecular tunneling wave packets, shedding light on its physical origin. The initial phase of the tunneling wave packets at the tunnel exit depends on both the initial transverse momentum distribution and the molecular internuclear distance. We further show that the ionizing molecular orbital has a critical effect on the initial phase of the tunneling wave packets. The phase structure of the photoelectron wave packet is a key ingredient for modeling strong-field molecular photoelectron holography, high-harmonic generation, and molecular orbital imaging.

  20. The structural properties of sustainable, continuous change

    DEFF Research Database (Denmark)

    Håkonsson, Dorthe Døjbak; Klaas, Johann Peter; Carroll, Timothy

    2013-01-01

    this relationship by exploring what structural properties enable continuous change in inertia-generating organizations and what their performance consequences are in dynamic environments. The article has three main findings: First, employing managers who anticipate change is not enough to generate continuous change......; it is also necessary to raise both the rate of responsiveness and desired performance. Second, continuous change increases average organizational performance and reduces its variation. Third, organizations’ capacity for continuous change is counterintuitively limited by the organizations’ capacity to build...

  1. Hyperfine-Structure-Induced Depolarization of Impulsively Aligned I2 Molecules

    Science.gov (United States)

    Thomas, Esben F.; Søndergaard, Anders A.; Shepperson, Benjamin; Henriksen, Niels E.; Stapelfeldt, Henrik

    2018-04-01

    A moderately intense 450 fs laser pulse is used to create rotational wave packets in gas phase I2 molecules. The ensuing time-dependent alignment, measured by Coulomb explosion imaging with a delayed probe pulse, exhibits the characteristic revival structures expected for rotational wave packets but also a complex nonperiodic substructure and decreasing mean alignment not observed before. A quantum mechanical model attributes the phenomena to coupling between the rotational angular momenta and the nuclear spins through the electric quadrupole interaction. The calculated alignment trace agrees very well with the experimental results.

  2. Structure of human farnesyl pyrophosphate synthase in complex with an aminopyridine bisphosphonate and two molecules of inorganic phosphate

    Energy Technology Data Exchange (ETDEWEB)

    Park, Jaeok [McGill University, 3655 Promenade Sir William Osler, Montreal, QC H3G 1Y6 (Canada); Lin, Yih-Shyan [McGill University, 801 Rue Sherbrooke Ouest, Montreal, QC H3A 0B8 (Canada); Tsantrizos, Youla S. [McGill University, 3655 Promenade Sir William Osler, Montreal, QC H3G 1Y6 (Canada); McGill University, 801 Rue Sherbrooke Ouest, Montreal, QC H3A 0B8 (Canada); McGill University, 3649 Promenade Sir William Osler, Montreal, QC H3G 0B1 (Canada); Berghuis, Albert M., E-mail: albert.berghuis@mcgill.ca [McGill University, 3655 Promenade Sir William Osler, Montreal, QC H3G 1Y6 (Canada); McGill University, 3649 Promenade Sir William Osler, Montreal, QC H3G 0B1 (Canada); McGill University, 3775 Rue University, Montreal, QC H3A 2B4 (Canada)

    2014-02-19

    A co-crystal structure of human farnesyl pyrophosphate synthase in complex with an aminopyridine bisphosphonate, YS0470, and two molecules of inorganic phosphate has been determined. The identity of the phosphate ligands was confirmed by anomalous diffraction data. Human farnesyl pyrophosphate synthase (hFPPS) produces farnesyl pyrophos@@phate, an isoprenoid essential for a variety of cellular processes. The enzyme has been well established as the molecular target of the nitrogen-containing bisphosphonates (N-BPs), which are best known for their antiresorptive effects in bone but are also known for their anticancer properties. Crystal structures of hFPPS in ternary complexes with a novel bisphosphonate, YS0470, and the secondary ligands inorganic phosphate (P{sub i}), inorganic pyrophosphate (PP{sub i}) and isopentenyl pyrophosphate (IPP) have recently been reported. Only the co-binding of the bisphosphonate with either PP{sub i} or IPP resulted in the full closure of the C-@@terminal tail of the enzyme, a conformational change that is required for catalysis and that is also responsible for the potent in vivo efficacy of N-BPs. In the present communication, a co-crystal structure of hFPPS in complex with YS0470 and two molecules of P{sub i} is reported. The unusually close proximity between these ligands, which was confirmed by anomalous diffraction data, suggests that they interact with one another, with their anionic charges neutralized in their bound state. The structure also showed the tail of the enzyme to be fully disordered, indicating that simultaneous binding of two P{sub i} molecules with a bisphosphonate cannot induce the tail-closing conformational change in hFPPS. Examination of homologous FPPSs suggested that this ligand-dependent tail closure is only conserved in the mammalian proteins. The prevalence of P{sub i}-bound hFPPS structures in the PDB raises a question regarding the in vivo relevance of P{sub i} binding to the function of the enzyme.

  3. Toxic properties of specific radiation determinant molecules, derived from radiated species

    Science.gov (United States)

    Popov, Dmitri; Maliev, Vecheslav; Kedar, Prasad; Casey, Rachael; Jones, Jeffrey

    variety of animals. Lymphatic fluid was collected from the thoracic ducts of bovine species exposed to lethal doses of gamma radiation, and the SRDs were separated by size exclusion gel filtration and high-performance liquid chromatography. We compared the toxicity of isolated radiation toxins in a variety of animals. The clinical characteristics of ARS induced by intravenous or intra-muscular injections of radiation toxins were observed. Results: In radiation-na¨ animals (rats, rabbits, and sheep), toxicity was defined ıve by observing the timing and rate of lethality following injections with extracted radiation toxins (SRDs). Preparations of SRD-1 were injected intra-muscularly in doses of 5 or 10 mg/kg body weight. We observed the development of cerebrovascular ARS with 100% lethality at 10-30 minutes after injection. Analysis of the toxicity of different forms of radiation toxins showed that cerebrovascular neurotoxins possess the highest toxicity compared with other forms of radiation toxins. The other SRD's were also injected into radiation-naive animals and observed for subsequent toxicity/lethality, with the other SRDs producing less virulent forms of ARS. However, both the SRD-2- and SRD-3-injected animals also suffered lethality between 2 and 30 days post-injection. Conclusions: We have observed that radiation toxins are transported from the cells and tissues of irradiated organisms to the interstitial blood and lymphatic fluids, and that this migration of radiation toxins occurs hours after irradiation. Upon analysis of the results of our research and literature sources, we postulate that radiation toxins arise from the radiation-induced chemical modification of macromolecules resident in cell membranes and other cellular structures. Furthermore, we postulate that these altered macromolecules are not processed by antigen processing cells, but instead bind to class II MHC molecules and TCR-beta chains. This causes nonspecific activation of T cells, pro

  4. Electronic structures of spinterface for thiophene molecule adsorbed at Co, Fe, and Ni electrode: First principles calculations

    Energy Technology Data Exchange (ETDEWEB)

    Cai, Linlin; Tian, Yanli; Yuan, Xiaobo; Hu, Guichao; Ren, Junfeng, E-mail: renjf@sdnu.edu.cn

    2016-12-15

    Highlights: • Thiophene molecule could be spin polarized when adsorbed at Co(001), Fe(100), and Ni(111) surfaces. • The biggest spin polarization will be obtained when the thiophene molecule adsorbed at the Fe(100) surface. • The spin polarization is originated from the interfacial orbital hybridizations between the 3d orbital of ferromagnetic electrodes and the 2p orbital of the thiophene molecule. - Abstract: First principles calculations are adopted to study the spin polarization properties of thiophene molecule which adsorbed at the Co, Fe, and Ni electrode surfaces. The density of states, spin-polarized density distributions as well as the differential charge density distributions are obtained. It is found that the p orbital of the thiophene molecule will interact with the d orbital of the ferromagnetic electrodes, which will generate new spin coupling states and lead to obvious spin polarization in the thiophene molecule. Different electrodes induce different spin polarization properties, and in which the Fe electrode will bring the biggest spin polarization of the thiophene molecule. People can selectively and efficiently inject spin polarized electrons into molecules by choosing suitable ferromagnetic electrodes in organic spintronic devices.

  5. Investigation of multi-state charge-storage properties of redox-active organic molecules in silicon-molecular hybrid devices for DRAM and Flash applications

    Science.gov (United States)

    Gowda, Srivardhan Shivappa

    Molecular electronics has recently spawned a considerable amount of interest with several molecules possessing charge-conduction and charge-storage properties proposed for use in electronic devices. Hybrid silicon-molecular technology has the promise of augmenting the current silicon technology and provide for a transitional path to future molecule-only technology. The focus of this dissertation work has been on developing a class of hybrid silicon-molecular electronic devices for DRAM and Flash memory applications utilizing redox-active molecules. This work exploits the ability of molecules to store charges with single-electron precision at room temperature. The hybrid devices are fabricated by forming self-assembled monolayers of redox-active molecules on Si and oxide (SiO2 and HfO2) surfaces via formation of covalent linkages. The molecules possess discrete quantum states from which electrons can tunnel to the Si substrate at discrete applied voltages (oxidation process, cell write), leaving behind a positively charged layer of molecules. The reduction (erase) process, which is the process of electrons tunneling back from Si to the molecules, neutralizes the positively charged molecular monolayer. Hybrid silicon-molecular capacitor test structures were electrically characterized with an electrolyte gate using cyclic voltammetry (CyV) and impedance spectroscopy (CV) techniques. The redox voltages, kinetics (write/erase speeds) and charge-retention characteristics were found to be strongly dependent on the Si doping type and densities, and ambient light. It was also determined that the redox energy states in the molecules communicate with the valence band of the Si substrate. This allows tuning of write and read states by modulating minority carriers in n- and p-Si substrates. Ultra-thin dielectric tunnel barriers (SiO2, HfO2) were placed between the molecules and the Si substrate to augment charge-retention for Flash memory applications. The redox response was

  6. Smectite flocculation structure modified by Al13 macro-molecules--as revealed by the transmission X-ray microscopy (TXM).

    Science.gov (United States)

    Zbik, Marek S; Martens, Wayde N; Frost, Ray L; Song, Yen-Fang; Chen, Yi-Ming; Chen, Jian-Hua

    2010-05-01

    The aggregate structure which occurs in aqueous smectitic suspensions is responsible for poor water clarification, difficulties in sludge dewatering and the unusual rheological behaviour of smectite rich soils. These macroscopic properties are dictated by the 3D structural arrangement of smectite finest fraction within flocculated aggregates. Here, we report results from a relatively new technique, transmission X-ray microscopy (TXM), which makes it possible to investigate the internal structure and 3D tomographic reconstruction of the smectite clay aggregates modified by Al(13) Keggin macro-molecule [Al(13)(O)(4)(OH)(24)(H(2)O)(12)](7+). Three different treatment methods were shown resulted in three different micro-structural environments of the resulting flocculation. In case of smectite sample prepared in Methods 1 and 3 particles fall into the primary minimum where Van der Waals forces act between FF oriented smectite flakes and aggregates become approach irreversible flocculation. In case of sample prepared using Method 2, particles contacting by edges (EE) and edge to face (EF) orientation fell into secondary minimum and weak flocculation resulted in severe gelation and formation of the micelle-like texture in fringe superstructure, which was first time observed in smectite based gel. Copyright 2010 Elsevier Inc. All rights reserved.

  7. Structural and vibrational study of a neurotransmitter molecule: Dopamine [4-(2-aminoethyl) benzene-1,2-diol].

    Science.gov (United States)

    Jha, Omkant; Yadav, T K; Yadav, R A

    2018-01-15

    Structural and vibrational studies for the most stable conformer of dopamine {4-(2-Aminoethyl) benzene-1, 2-diol} have been carried out at the DFT/B3LYP/6-311++G** level using the Gaussian 09 software. The IR and Raman spectra have been recorded and analyzed in light of the computed vibrational parameters using the DFT and the PEDs computed with the help of the GAR2PED software. Some of the fundamentals have considerably changed frequencies in going from benzene to dopamine. Except the rocking and wagging modes of the NH 2 group the other four modes are pure group modes. The rocking and wagging modes of the NH 2 group show mixing with the other modes. The two OH stretching vibrations are highly localized modes. The Kekule phenyl ring stretching mode is found to remain almost unchanged. The HOMO-LUMO study suggests the existence of charge transfer within the molecule and the energy gap supports the pharmacological active property of the dopamine molecule. The NBO analysis has been carried out to understand the proper and improper hydrogen bonding. Copyright © 2017. Published by Elsevier B.V.

  8. Electrons in Molecules

    Indian Academy of Sciences (India)

    structure and properties (includingreactivt'ty) - both static (independent of time) and ... Furthermore, since the energy of H2 + in the ground state must be lower than that of .... (Figure 2b); note also that dp is positive in parts of the antibinding regions behind the two ... But, now both the sizes and shapes of molecules enter into.

  9. Structural analysis on mutation residues and interfacial water molecules for human TIM disease understanding

    Science.gov (United States)

    2013-01-01

    Background Human triosephosphate isomerase (HsTIM) deficiency is a genetic disease caused often by the pathogenic mutation E104D. This mutation, located at the side of an abnormally large cluster of water in the inter-subunit interface, reduces the thermostability of the enzyme. Why and how these water molecules are directly related to the excessive thermolability of the mutant have not been investigated in structural biology. Results This work compares the structure of the E104D mutant with its wild type counterparts. It is found that the water topology in the dimer interface of HsTIM is atypical, having a "wet-core-dry-rim" distribution with 16 water molecules tightly packed in a small deep region surrounded by 22 residues including GLU104. These water molecules are co-conserved with their surrounding residues in non-archaeal TIMs (dimers) but not conserved across archaeal TIMs (tetramers), indicating their importance in preserving the overall quaternary structure. As the structural permutation induced by the mutation is not significant, we hypothesize that the excessive thermolability of the E104D mutant is attributed to the easy propagation of atoms' flexibility from the surface into the core via the large cluster of water. It is indeed found that the B factor increment in the wet region is higher than other regions, and, more importantly, the B factor increment in the wet region is maintained in the deeply buried core. Molecular dynamics simulations revealed that for the mutant structure at normal temperature, a clear increase of the root-mean-square deviation is observed for the wet region contacting with the large cluster of interfacial water. Such increase is not observed for other interfacial regions or the whole protein. This clearly suggests that, in the E104D mutant, the large water cluster is responsible for the subunit interface flexibility and overall thermolability, and it ultimately leads to the deficiency of this enzyme. Conclusions Our study

  10. Structural Basis for Selective Small Molecule Kinase Inhibition of Activated c-Met

    Energy Technology Data Exchange (ETDEWEB)

    Rickert, Keith W.; Patel, Sangita B.; Allison, Timothy J.; Byrne, Noel J.; Darke, Paul L.; Ford, Rachael E.; Guerin, David J.; Hall, Dawn L.; Kornienko, Maria; Lu, Jun; Munshi, Sanjeev K.; Reid, John C.; Shipman, Jennifer M.; Stanton, Elizabeth F.; Wilson, Kevin J.; Young, Jonathon R.; Soisson, Stephen M.; Lumb, Kevin J. (Merck)

    2012-03-15

    The receptor tyrosine kinase c-Met is implicated in oncogenesis and is the target for several small molecule and biologic agents in clinical trials for the treatment of cancer. Binding of the hepatocyte growth factor to the cell surface receptor of c-Met induces activation via autophosphorylation of the kinase domain. Here we describe the structural basis of c-Met activation upon autophosphorylation and the selective small molecule inhibiton of autophosphorylated c-Met. MK-2461 is a potent c-Met inhibitor that is selective for the phosphorylated state of the enzyme. Compound 1 is an MK-2461 analog with a 20-fold enthalpy-driven preference for the autophosphorylated over unphosphorylated c-Met kinase domain. The crystal structure of the unbound kinase domain phosphorylated at Tyr-1234 and Tyr-1235 shows that activation loop phosphorylation leads to the ejection and disorder of the activation loop and rearrangement of helix {alpha}C and the G loop to generate a viable active site. Helix {alpha}C adopts a orientation different from that seen in activation loop mutants. The crystal structure of the complex formed by the autophosphorylated c-Met kinase domain and compound 1 reveals a significant induced fit conformational change of the G loop and ordering of the activation loop, explaining the selectivity of compound 1 for the autophosphorylated state. The results highlight the role of structural plasticity within the kinase domain in imparting the specificity of ligand binding and provide the framework for structure-guided design of activated c-Met inhibitors.

  11. Some fundamental properties of the ground state of atoms and molecules

    International Nuclear Information System (INIS)

    Lieb, E.H.

    1986-01-01

    This paper studies the ground states of atoms and molecules in quantum mechanics and reports on some mathematically rigourous results pertaining to the matter. The non-relativistic Hamiltonian for a molecule in the static nucleus approximation is presented along with notations

  12. Exploring charge transport properties and functionality of molecule-nanoparticle ensembles

    NARCIS (Netherlands)

    Devid, Edwin Johan

    2015-01-01

    For more than 65 years, scientists have been fascinated by the idea to miniaturize electrical circuits toward the smallest length scales. One particular way is inspired by nature itself, specifically to assemble electrical components and switches from atoms and molecules. The molecules typically

  13. Translocation of "rod-coil" polymers: probing the structure of single molecules within nanopores.

    Science.gov (United States)

    de Haan, Hendrick W; Slater, Gary W

    2013-01-25

    Using simulation and analytical techniques, we demonstrate that it is possible to extract structural information about biological molecules by monitoring the dynamics as they translocate through nanopores. From Langevin dynamics simulations of polymers exhibiting discrete changes in flexibility (rod-coil polymers), distinct plateaus are observed in the progression towards complete translocation. Characterizing these dynamics via an incremental mean first passage approach, the large steps are shown to correspond to local barriers preventing the passage of the coils while the rods translocate relatively easily. Analytical replication of the results provides insight into the corrugated nature of the free energy landscape as well as the dependence of the effective barrier heights on the length of the coil sections. Narrowing the width of the pore or decreasing the charge on either the rod or the coil segments are both shown to enhance the resolution of structural details. The special case of a single rod confined within a nanopore is also studied. Here, sufficiently long flexible sections attached to either end are demonstrated to act as entropic anchors which can effectively trap the rod within the pore for an extended period of time. Both sets of results suggest new experimental approaches for the control and study of biological molecules within nanopores.

  14. New tools to study biophysical properties of single molecules and single cells

    Directory of Open Access Journals (Sweden)

    Márcio S. Rocha

    2007-03-01

    Full Text Available We present a review on two new tools to study biophysical properties of single molecules and single cells. A laser incident through a high numerical aperture microscope objective can trap small dielectric particles near the focus. This arrangement is named optical tweezers. This technique has the advantage to permit manipulation of a single individual object. We use optical tweezers to measure the entropic elasticity of a single DNA molecule and its interaction with the drug Psoralen. Optical tweezers are also used to hold a kidney cell MDCK away from the substrate to allow precise volume measurements of this single cell during an osmotic shock. This procedure allows us to obtain information about membrane water permeability and regulatory volume increase. Defocusing microscopy is a recent technique invented in our laboratory, which allows the observation of transparent objects, by simply defocusing the microscope in a controlled way. Our physical model of a defocused microscope shows that the image contrast observed in this case is proportional to the defocus distance and to the curvature of the transparent object. Defocusing microscopy is very useful to study motility and mechanical properties of cells. We show here the application of defocusing microscopy to measurements of macrophage surface fluctuations and their influence on phagocytosis.Apresentamos uma revisão de duas novas técnicas para estudar propriedades biofísicas de moléculas únicas e células únicas. Um laser incidindo em uma objetiva de microscópio de grande abertura numérica é capaz de aprisionar pequenas partículas dielétricas na região próxima ao foco. Este aparato é chamado de pinça óptica. Esta técnica tem a grande vantagem de permitir a manipulação de um objeto individual. Usamos a pinça óptica para medir a elasticidade entrópica de uma molécula única de DNA em sua interação com o fármaco Psoralen. A pinça óptica também é usada para segurar

  15. Statistical Exploration of Electronic Structure of Molecules from Quantum Monte-Carlo Simulations

    Energy Technology Data Exchange (ETDEWEB)

    Prabhat, Mr; Zubarev, Dmitry; Lester, Jr., William A.

    2010-12-22

    In this report, we present results from analysis of Quantum Monte Carlo (QMC) simulation data with the goal of determining internal structure of a 3N-dimensional phase space of an N-electron molecule. We are interested in mining the simulation data for patterns that might be indicative of the bond rearrangement as molecules change electronic states. We examined simulation output that tracks the positions of two coupled electrons in the singlet and triplet states of an H2 molecule. The electrons trace out a trajectory, which was analyzed with a number of statistical techniques. This project was intended to address the following scientific questions: (1) Do high-dimensional phase spaces characterizing electronic structure of molecules tend to cluster in any natural way? Do we see a change in clustering patterns as we explore different electronic states of the same molecule? (2) Since it is hard to understand the high-dimensional space of trajectories, can we project these trajectories to a lower dimensional subspace to gain a better understanding of patterns? (3) Do trajectories inherently lie in a lower-dimensional manifold? Can we recover that manifold? After extensive statistical analysis, we are now in a better position to respond to these questions. (1) We definitely see clustering patterns, and differences between the H2 and H2tri datasets. These are revealed by the pamk method in a fairly reliable manner and can potentially be used to distinguish bonded and non-bonded systems and get insight into the nature of bonding. (2) Projecting to a lower dimensional subspace ({approx}4-5) using PCA or Kernel PCA reveals interesting patterns in the distribution of scalar values, which can be related to the existing descriptors of electronic structure of molecules. Also, these results can be immediately used to develop robust tools for analysis of noisy data obtained during QMC simulations (3) All dimensionality reduction and estimation techniques that we tried seem to

  16. Exchange-correlation energy in the orbital occupancy method: electronic structure of organic molecules

    International Nuclear Information System (INIS)

    Oszwaldowski, R; Vazquez, H; Pou, P; Ortega, J; Perez, R; Flores, F

    2003-01-01

    A new DF-LCAO (density functional with local combination of atomic orbitals) method is used to calculate the electronic properties of 3,4,9,10 perylenetetracarboxylic dianhydride (PTCDA), C 6 H 6 , CH 4 , and CO. The method, called the OO (orbital occupancy) method, is a DF-based theory, which uses the OOs instead of ρ(r) to calculate the exchange and correlation energies. In our calculations, we compare the OO method with the conventional local density approximation approach. Our results show that, using a minimal basis set, we obtain equilibrium bond lengths and binding energies for PTCDA, C 6 H 6 , and CH 4 which are respectively within 6, and 10-15% of the experimental values. We have also calculated the affinity and ionization levels, as well as the optical gap, for benzene and PTCDA and have found that a variant of Koopmans' theorem works well for these molecules. Using this theorem we calculate the Koopmans relaxation energies of the σ- and π-orbitals for PTCDA and have obtained this molecule's density of states which compares well with experimental evidence

  17. Structural material properties for fusion application

    Energy Technology Data Exchange (ETDEWEB)

    Tavassoli, A-A. F.

    2008-10-15

    Materials properties requirements for structural applications in the forthcoming and future fusion machines are analyzed with emphasis on safety requirements. It is shown that type 316L(N) used in the main structural components of ITER is code qualified and together with limits imposed on its service conditions and neutron radiation levels, can adequately satisfy ITER vacuum vessel licensing requirements. For the in-vessel components, where nonconventional fabrication methods, such as HIPing, are used, design through materials properties, data is combined with tests on representative mockups to meet the requirements. For divertor parts, where the operating conditions are too severe for components to last throughout the reactor life, replacement of most exposed parts is envisaged. DEMO operating conditions require extension of ITER design criteria to high temperature and high neutron dose rules, as well as to compatibility with cooling and tritium breeding media, depending on the blanket concept retained. The structural material favoured in EU is Eurofer steel, low activation martensitic steel with good ductility and excellent resistance to radiation swelling. However, this material, like other ferritic / martensitic steels, requires post-weld annealing and is sensitive to low temperature irradiation embrittlement. Furthermore, it shows cyclic softening during fatigue, complicating design against fatigue and creep-fatigue. (au)

  18. Structural and mechanical properties of glassy water in nanoscale confinement.

    Science.gov (United States)

    Lombardo, Thomas G; Giovambattista, Nicolás; Debenedetti, Pablo G

    2009-01-01

    We investigate the structure and mechanical properties of glassy water confined between silica-based surfaces with continuously tunable hydrophobicity and hydrophilicity by computing and analyzing minimum energy, mechanically stable configurations (inherent structures). The structured silica substrate imposes long-range order on the first layer of water molecules under hydrophobic confinement at high density (p > or = 1.0 g cm(-3)). This proximal layer is also structured in hydrophilic confinement at very low density (p approximately 0.4 g cm(-3)). The ordering of water next to the hydrophobic surface greatly enhances the mechanical strength of thin films (0.8 nm). This leads to a substantial stress anisotropy; the transverse strength of the film exceeds the normal strength by 500 MPa. The large transverse strength results in a minimum in the equation of state of the energy landscape that does not correspond to a mechanical instability, but represents disruption of the ordered layer of water next to the wall. In addition, we find that the mode of mechanical failure is dependent on the type of confinement. Under large lateral strain, water confined by hydrophilic surfaces preferentially forms voids in the middle of the film and fails cohesively. In contrast, water under hydrophobic confinement tends to form voids near the walls and fails by loss of adhesion.

  19. Synthesis, Structure and Properties of Various Molecules Based on the 4,8,12-trioxa-4,8,12,12c-tetrahydrodibenzo[cd,mn]pyrene System With an Evaluation of the Effect Differing Molecular Substitution Patterns Has on the Space Group Symmetry

    DEFF Research Database (Denmark)

    Faldt, André; Krebs, Frederik C; Thorup, Niels

    1997-01-01

    of opposite chirality are present within the unit cell, Finally compound 13 crystallises in a centrosymmetric space group. The room temperature pyroelectric coefficient of 3 has been determined, The spatial extent of the trioxatriangulene ground system has been perturbed by chemical substitution......4,8,12-Trioxa-4,8,12,12c-tetrahydrodibenzo [cd,mn]pyrene (3),2,6,10-tri-tert-butyl-4,8,12 -trioxa-4,8,12,12c-tetrahydrodibenzo [cd,mn]pyrene (11) and 2,6,10-tri-tert-butyl-4,8,12-trioxa-12c -methyl-4,8,12,12c -tetrahydrodibenzo[cd,mn]pyrene (12)have been synthesised and their crystal structures...... and the effect: of the substitutions upon the space group symmetry of the chemical derivative has been uncovered by X-ray structural resolution, The non-centrosymmetric point group symmetry of the molecules is reflected in a non-centrosymmetric space group symmetry whenever the spatial perturbations do...

  20. Structural flexibility of the sulfur mustard molecule at finite temperature from Car-Parrinello molecular dynamics simulations.

    Science.gov (United States)

    Lach, Joanna; Goclon, Jakub; Rodziewicz, Pawel

    2016-04-05

    Sulfur mustard (SM) is one of the most dangerous chemical compounds used against humans, mostly at war conditions but also in terrorist attacks. Even though the sulfur mustard has been synthesized over a hundred years ago, some of its molecular properties are not yet resolved. We investigate the structural flexibility of the SM molecule in the gas phase by Car-Parrinello molecular dynamics simulations. Thorough conformation analysis of 81 different SM configurations using density functional theory is performed to analyze the behavior of the system at finite temperature. The conformational diversity is analyzed with respect to the formation of intramolecular blue-shifting CH⋯S and CH⋯Cl hydrogen bonds. Molecular dynamics simulations indicate that all structural rearrangements between SM local minima are realized either in direct or non-direct way, including the intermediate structure in the last case. We study the lifetime of the SM conformers and perform the population analysis. Additionally, we provide the anharmonic dynamical finite temperature IR spectrum from the Fourier Transform of the dipole moment autocorrelation function to mimic the missing experimental IR spectrum. Copyright © 2015 Elsevier B.V. All rights reserved.

  1. Structure and properties of microcrystalline chitosan

    International Nuclear Information System (INIS)

    Pighinelli, Luciano; Guimaraes, Fernando Machado; Paz, Luan Rios; Zanin, Gabrielle Brehm; Kmiec, Marzena; Tedesco, Felipe Melleu; Reis, Victoria Oliva dos; Silva, Matheus Machado; Becker, Cristiane Miotto; Zehetmeyer, Gislene; Rasia, Gisele

    2016-01-01

    Full text: The microcrystalline chitosan is a modified form of chitosan; it has been elaborated from obtaining method of chitosan salts. It is characterized by special properties of the initial chitosan such as biocompatibility, bioactivity, non-toxic, biodegradability [1]. The objective of this study is to develop a different method to obtain the microcrystalline chitosan and the following characterization of the initial chitosan and MCCh. The material was characterized by FTIR, scanning of electron microscopy, SEM, nuclear magnetic resonance, NMR, and x-ray diffraction. The results indicate that the process to obtain MCCh, did not change the structure of the initial chitosan. The MCCh shows the same functional groups of the initial chitosan. The NMR results shows the acetylated and deacetylated groups. The morphology shows a homogeneous structure of surface. The X-ray diffraction shows the reduction of the crystallinity in the MCCh, indicating a bigger amorphous structure of the MCCh. The chitosan and its derivatives are polymers with excellent properties to be used in regenerative medicine because of ensure efficiency in healing process. This polysaccharide has a great potential to develop a new generation of biomaterials that can be used in regenerative medicine and tissue engineering [2]. References: [1]. LI, Q. et al. Applications and properties of chitosan. In: GOOSEN, M. F. A. (Ed.). Applications of chitin and chitosan. Basel: Technomic, 1997. p. 3-29; [2]. Luciano Pighinelli, Magdalena Kucharska, Dariuz Wawro. Preparation of Microcrystalline chitosan: (MCCh0/tricalcium phosphate complex with Hydroxyapatite in sponge and fibre from for hard tissue regeneration. (author)

  2. Structure and properties of microcrystalline chitosan

    Energy Technology Data Exchange (ETDEWEB)

    Pighinelli, Luciano; Guimaraes, Fernando Machado; Paz, Luan Rios; Zanin, Gabrielle Brehm; Kmiec, Marzena; Tedesco, Felipe Melleu; Reis, Victoria Oliva dos; Silva, Matheus Machado, E-mail: lpighinelli@hotmail.com [Universidade Luterana, Sao Paulo, SP (Brazil); Becker, Cristiane Miotto; Zehetmeyer, Gislene; Rasia, Gisele [Centro Universitario SENAI CIMATEC, Salvador, BA (Brazil). Instituto de Engenharia de Materiais Polimericos

    2016-07-01

    Full text: The microcrystalline chitosan is a modified form of chitosan; it has been elaborated from obtaining method of chitosan salts. It is characterized by special properties of the initial chitosan such as biocompatibility, bioactivity, non-toxic, biodegradability [1]. The objective of this study is to develop a different method to obtain the microcrystalline chitosan and the following characterization of the initial chitosan and MCCh. The material was characterized by FTIR, scanning of electron microscopy, SEM, nuclear magnetic resonance, NMR, and x-ray diffraction. The results indicate that the process to obtain MCCh, did not change the structure of the initial chitosan. The MCCh shows the same functional groups of the initial chitosan. The NMR results shows the acetylated and deacetylated groups. The morphology shows a homogeneous structure of surface. The X-ray diffraction shows the reduction of the crystallinity in the MCCh, indicating a bigger amorphous structure of the MCCh. The chitosan and its derivatives are polymers with excellent properties to be used in regenerative medicine because of ensure efficiency in healing process. This polysaccharide has a great potential to develop a new generation of biomaterials that can be used in regenerative medicine and tissue engineering [2]. References: [1]. LI, Q. et al. Applications and properties of chitosan. In: GOOSEN, M. F. A. (Ed.). Applications of chitin and chitosan. Basel: Technomic, 1997. p. 3-29; [2]. Luciano Pighinelli, Magdalena Kucharska, Dariuz Wawro. Preparation of Microcrystalline chitosan: (MCCh0/tricalcium phosphate complex with Hydroxyapatite in sponge and fibre from for hard tissue regeneration. (author)

  3. Magnetic properties of dendrimer structures with different coordination numbers: A Monte Carlo study

    Science.gov (United States)

    Masrour, R.; Jabar, A.

    2016-11-01

    We investigate the magnetic properties of Cayley trees of large molecules with dendrimer structure using Monte Carlo simulations. The thermal magnetization and magnetic susceptibility of a dendrimer structure are given with different coordination numbers, Z=3, 4, 5 and different generations g=3 and 2. The variation of magnetizations with the exchange interactions and crystal fields have been given of this system. The magnetic hysteresis cycles have been established.

  4. Synthesis, structure, and properties of azatriangulenium salts

    DEFF Research Database (Denmark)

    Laursen, B.W.; Krebs, Frederik C

    2001-01-01

    amines and, by virtue of its stepwise and irreversible nature, provides a powerful tool for the preparation of a wide variety of new heterocyclic carbenium salts. Several derivatives of the three new oxygen- and/or nitrogen-bridged triangulenium salts, azadioxa- (6), diazaoxa- (7......), and triazatriangulenium (4), have been synthesized and their physicochemical properties have been investigated. Crystal structures for compounds 2 b-PF6: 2d-PF6, 4b-BF4, 4c-BF4, 6e-BF4, and 8 are reported. The different packing modes found for the triazatriagulenium salts are discussed in relation to the electrostatic...

  5. Technological properties and structure of titanate melts

    International Nuclear Information System (INIS)

    Morozov, A.A.

    2002-01-01

    Power substantiation of existence of tough stream of complex anion ([TiO 6 ] 8- ) as a prevalent unit in titanate melts is given on the base of up-to-date knowledge about structure of metallurgical slags and results of investigations of thermophysical properties of these melts. It is shown that high crystallization ability of titanate melts at technological temperatures is determined by heterogeneity of liquid state - by presence up to 30 % of dispersed particles of solid phase solutions in matrix liquid [ru

  6. Fabrication and Properties of Multilayer Structures

    Science.gov (United States)

    1983-09-01

    according to both the high x-ray count and a Read camera pattern which showed only the 111 8 SiC reflection in a tight ± 30 distribution about the substrate...structural rearrangement. X-ray analysis of the deposited films at the composition of Pd2 Si using a Read camera indicated strong texturing. The...Phys. 35, 547 (1964). 11. C.A. Neubauer and J.R. Randen, Proc. IEEE 52, 1234 (1964). 12. W.A. Tiller, "Fabrication and Properties of Multilayer

  7. Effect of molecular structure on fragmentation of isolated organic molecules in solid rare gas matrices

    International Nuclear Information System (INIS)

    Kobrazenko, A.V.; Sukhov, F.F.; Orlov, A.Yu.; Kovalev, G.V.; Baranova, I.A.; Feldman, V.I.

    2011-01-01

    Complete text of publication follows. Elucidation of high-energy reaction pathways in the condensed phase is an important issue for basic understanding of the radiation stability of complex organic molecules. As was shown previously, organic radical cations (RC) may undergo fragmentation or rearrangement in solid matrices due to excess energy. The probability of this process depends on both ionization potential (IP) of the molecule and molecular structure. In the present work we have studied the role of 'hot' ionic reaction channels for RC of some bifunctional compounds and alkynes. The effect of excess energy was simulated by matrix isolation method as described in detail earlier. The formation of fragmentation products was monitored by EPR and FTIR spectroscopy. In the present work it was shown that the RC of bifunctional compounds (CH 3 OCH 2 COCH 3 , CH 3 CO(CH 2 ) n COCH 3 , n 0/2) dissociated efficiently producing · CH 3 radicals upon irradiation in solid argon matrix at T ≤ 16 K. The probability of fragmentation decreases with decrease of excess energy by switching from Ar to Xe. It is worth noting that acetone RC does not show fragmentation under these conditions. Thus, bifunctional molecules were found to be less stable to 'hot' ionic fragmentation in low-temperature solids in comparison with simple prototype carbonyl compounds. In the case of alkynes of the R-C ≡ CH type, a noticeable yield of fragmentation products was observed when R = -C(CH 3 ) 3 , but it was negligible for R = -CH 3 . It means that the presence of triple bond stabilizes the molecular skeleton of linear alkynes toward 'hot' fragmentation, similarly as it was shown for alkenes. The mechanisms of 'hot' reactions and excess energy relaxation are discussed. This work was supported by the Russian Foundation for Basic Research (project 09-03-00848a).

  8. Revival structures of linear molecules in a field-free alignment condition as probed by high-order harmonic generation

    International Nuclear Information System (INIS)

    Lee, G. H.; Kim, H. T.; Park, J. Y.; Nam, C. H.; Kim, T. K.; Lee, J. H.; Ihee, H.

    2006-01-01

    Revival structures (rotational coherence) of three linear molecules (N 2 , O 2 , and CO 2 ) in a field free alignment condition have been investigated using high-order harmonic generation. The harmonic yields of these molecules were measured in a pump-probe manner by using a weak femtosecond (fs) laser pulse for field-free alignment of molecules and another intense fs laser pulse for harmonic generation. The harmonic intensities from 23rd to 29th order with respect to the time delay between the pump and the probe pulses showed revival structures in the condition of a field-free alignment of molecules. While the revival structure of a N 2 molecule had one-fourth the period of the full revival time and different degrees of modulation among different fractional revival times, the revival structures of O 2 and CO 2 molecules showed one-eighth the periods of the full revival time and similar degrees of modulation among all fractional revival times. The revival structures could be interpreted in terms of the nature of the highest occupied molecular orbital and the total nuclear spin.

  9. Mechanical properties and the evolution of matrix molecules in PTFE upon irradiation with MeV alpha particles

    International Nuclear Information System (INIS)

    Fisher, Gregory L.; Lakis, Rollin E.; Davis, Charles C.; Szakal, Christopher; Swadener, John G.; Wetteland, Christopher J.; Winograd, Nicholas

    2006-01-01

    The morphology, chemical composition, and mechanical properties in the surface region of α-irradiated polytetrafluoroethylene (PTFE) have been examined and compared to unirradiated specimens. Samples were irradiated with 5.5 MeV 4 He 2+ ions from a tandem accelerator to doses between 1 x 10 6 and 5 x 10 10 Rad. Static time-of-flight secondary ion mass spectrometry (ToF-SIMS), using a 20 keV C 60 + source, was employed to probe chemical changes as a function of α dose. Chemical images and high resolution spectra were collected and analyzed to reveal the effects of α particle radiation on the chemical structure. Residual gas analysis (RGA) was utilized to monitor the evolution of volatile species during vacuum irradiation of the samples. Scanning electron microscopy (SEM) was used to observe the morphological variation of samples with increasing α particle dose, and nanoindentation was engaged to determine the hardness and elastic modulus as a function of α dose. The data show that PTFE nominally retains its innate chemical structure and morphology at α doses 9 Rad. At α doses ≥10 9 Rad the polymer matrix experiences increased chemical degradation and morphological roughening which are accompanied by increased hardness and declining elasticity. At α doses >10 10 Rad the polymer matrix suffers severe chemical degradation and material loss. Chemical degradation is observed in ToF-SIMS by detection of ions that are indicative of fragmentation, unsaturation, and functionalization of molecules in the PTFE matrix. The mass spectra also expose the subtle trends of crosslinking within the α-irradiated polymer matrix. ToF-SIMS images support the assertion that chemical degradation is the result of α particle irradiation and show morphological roughening of the sample with increased α dose. High resolution SEM images more clearly illustrate the morphological roughening and the mass loss that accompanies high doses of α particles. RGA confirms the supposition that

  10. Planetary ring systems properties, structures, and evolution

    CERN Document Server

    Murray, Carl D

    2018-01-01

    Planetary rings are among the most intriguing structures of our solar system and have fascinated generations of astronomers. Collating emerging knowledge in the field, this volume reviews our current understanding of ring systems with reference to the rings of Saturn, Uranus, Neptune, and more. Written by leading experts, the history of ring research and the basics of ring–particle orbits is followed by a review of the known planetary ring systems. All aspects of ring system science are described in detail, including specific dynamical processes, types of structures, thermal properties and their origins, and investigations using computer simulations and laboratory experiments. The concluding chapters discuss the prospects of future missions to planetary rings, the ways in which ring science informs and is informed by the study of other astrophysical disks, and a perspective on the field's future. Researchers of all levels will benefit from this thorough and engaging presentation.

  11. Properties of multilayer nonuniform holographic structures

    International Nuclear Information System (INIS)

    Pen, E F; Rodionov, Mikhail Yu

    2010-01-01

    Experimental results and analysis of properties of multilayer nonuniform holographic structures formed in photopolymer materials are presented. The theoretical hypotheses is proved that the characteristics of angular selectivity for the considered structures have a set of local maxima, whose number and width are determined by the thicknesses of intermediate layers and deep holograms and that the envelope of the maxima coincides with the selectivity contour of a single holographic array. It is also experimentally shown that hologram nonuniformities substantially distort shapes of selectivity characteristics: they become asymmetric, the local maxima differ in size and the depths of local minima reduce. The modelling results are made similar to experimental data by appropriately choosing the nonuniformity parameters. (imaging and image processing. holography)

  12. Extraordinary electronic properties in uncommon structure types

    Science.gov (United States)

    Ali, Mazhar Nawaz

    In this thesis I present the results of explorations into several uncommon structure types. In Chapter 1 I go through the underlying idea of how we search for new compounds with exotic properties in solid state chemistry. The ideas of exploring uncommon structure types, building up from the simple to the complex, using chemical intuition and thinking by analogy are discussed. Also, the history and basic concepts of superconductivity, Dirac semimetals, and magnetoresistance are briefly reviewed. In chapter 2, the 1s-InTaS2 structural family is introduced along with the discovery of a new member of the family, Ag0:79VS2; the synthesis, structure, and physical properties of two different polymorphs of the material are detailed. Also in this chapter, we report the observation of superconductivity in another 1s structure, PbTaSe2. This material is especially interesting due to it being very heavy (resulting in very strong spin orbit coulping (SOC)), layered, and noncentrosymmetric. Electronic structure calculations reveal the presence of a bulk 3D Dirac cone (very similar to graphene) that is gapped by SOC originating from the hexagonal Pb layer. In Chapter 3 we show the re-investigation of the crystal structure of the 3D Dirac semimetal, Cd3As2. It is found to be centrosymmetric, rather than noncentrosymmetric, and as such all bands are spin degenerate and there is a 4-fold degenerate bulk Dirac point at the Fermi level, making Cd3As2 a 3D electronic analog to graphene. Also, for the first time, scanning tunneling microscopy experiments identify a 2x2 surface reconstruction in what we identify as the (112) cleavage plane of single crystals; needle crystals grow with a [110] long axis direction. Lastly, in chapter 4 we report the discovery of "titanic" (sadly dubbed ⪉rge, nonsaturating" by Nature editors and given the acronym XMR) magnetoresistance (MR) in the non-magnetic, noncentrosymmetric, layered transition metal dichalcogenide WTe2; over 13 million% at 0.53 K in

  13. Combination of structured illumination and single molecule localization microscopy in one setup

    International Nuclear Information System (INIS)

    Rossberger, Sabrina; Best, Gerrit; Birk, Udo; Cremer, Christoph; Baddeley, David; Heintzmann, Rainer; Dithmar, Stefan

    2013-01-01

    Understanding the positional and structural aspects of biological nanostructures simultaneously is as much a challenge as a desideratum. In recent years, highly accurate (20 nm) positional information of optically isolated targets down to the nanometer range has been obtained using single molecule localization microscopy (SMLM), while highly resolved (100 nm) spatial information has been achieved using structured illumination microscopy (SIM). In this paper, we present a high-resolution fluorescence microscope setup which combines the advantages of SMLM with SIM in order to provide high-precision localization and structural information in a single setup. Furthermore, the combination of the wide-field SIM image with the SMLM data allows us to identify artifacts produced during the visualization process of SMLM data, and potentially also during the reconstruction process of SIM images. We describe the SMLM–SIM combo and software, and apply the instrument in a first proof-of-principle to the same region of H3K293 cells to achieve SIM images with high structural resolution (in the 100 nm range) in overlay with the highly accurate position information of localized single fluorophores. Thus, with its robust control software, efficient switching between the SMLM and SIM mode, fully automated and user-friendly acquisition and evaluation software, the SMLM–SIM combo is superior over existing solutions. (special issue article)

  14. Combination of structured illumination and single molecule localization microscopy in one setup

    Science.gov (United States)

    Rossberger, Sabrina; Best, Gerrit; Baddeley, David; Heintzmann, Rainer; Birk, Udo; Dithmar, Stefan; Cremer, Christoph

    2013-09-01

    Understanding the positional and structural aspects of biological nanostructures simultaneously is as much a challenge as a desideratum. In recent years, highly accurate (20 nm) positional information of optically isolated targets down to the nanometer range has been obtained using single molecule localization microscopy (SMLM), while highly resolved (100 nm) spatial information has been achieved using structured illumination microscopy (SIM). In this paper, we present a high-resolution fluorescence microscope setup which combines the advantages of SMLM with SIM in order to provide high-precision localization and structural information in a single setup. Furthermore, the combination of the wide-field SIM image with the SMLM data allows us to identify artifacts produced during the visualization process of SMLM data, and potentially also during the reconstruction process of SIM images. We describe the SMLM-SIM combo and software, and apply the instrument in a first proof-of-principle to the same region of H3K293 cells to achieve SIM images with high structural resolution (in the 100 nm range) in overlay with the highly accurate position information of localized single fluorophores. Thus, with its robust control software, efficient switching between the SMLM and SIM mode, fully automated and user-friendly acquisition and evaluation software, the SMLM-SIM combo is superior over existing solutions.

  15. RNAspa: a shortest path approach for comparative prediction of the secondary structure of ncRNA molecules

    Directory of Open Access Journals (Sweden)

    Michaeli Shulamit

    2007-10-01

    Full Text Available Abstract Background In recent years, RNA molecules that are not translated into proteins (ncRNAs have drawn a great deal of attention, as they were shown to be involved in many cellular functions. One of the most important computational problems regarding ncRNA is to predict the secondary structure of a molecule from its sequence. In particular, we attempted to predict the secondary structure for a set of unaligned ncRNA molecules that are taken from the same family, and thus presumably have a similar structure. Results We developed the RNAspa program, which comparatively predicts the secondary structure for a set of ncRNA molecules in linear time in the number of molecules. We observed that in a list of several hundred suboptimal minimal free energy (MFE predictions, as provided by the RNAsubopt program of the Vienna package, it is likely that at least one suggested structure would be similar to the true, correct one. The suboptimal solutions of each molecule are represented as a layer of vertices in a graph. The shortest path in this graph is the basis for structural predictions for the molecule. We also show that RNA secondary structures can be compared very rapidly by a simple string Edit-Distance algorithm with a minimal loss of accuracy. We show that this approach allows us to more deeply explore the suboptimal structure space. Conclusion The algorithm was tested on three datasets which include several ncRNA families taken from the Rfam database. These datasets allowed for comparison of the algorithm with other methods. In these tests, RNAspa performed better than four other programs.

  16. Prediction of small molecule binding property of protein domains with Bayesian classifiers based on Markov chains.

    Science.gov (United States)

    Bulashevska, Alla; Stein, Martin; Jackson, David; Eils, Roland

    2009-12-01

    Accurate computational methods that can help to predict biological function of a protein from its sequence are of great interest to research biologists and pharmaceutical companies. One approach to assume the function of proteins is to predict the interactions between proteins and other molecules. In this work, we propose a machine learning method that uses a primary sequence of a domain to predict its propensity for interaction with small molecules. By curating the Pfam database with respect to the small molecule binding ability of its component domains, we have constructed a dataset of small molecule binding and non-binding domains. This dataset was then used as training set to learn a Bayesian classifier, which should distinguish members of each class. The domain sequences of both classes are modelled with Markov chains. In a Jack-knife test, our classification procedure achieved the predictive accuracies of 77.2% and 66.7% for binding and non-binding classes respectively. We demonstrate the applicability of our classifier by using it to identify previously unknown small molecule binding domains. Our predictions are available as supplementary material and can provide very useful information to drug discovery specialists. Given the ubiquitous and essential role small molecules play in biological processes, our method is important for identifying pharmaceutically relevant components of complete proteomes. The software is available from the author upon request.

  17. Effect of molecular structure on fragmentation of isolated organic molecules in solid rare gas matrices

    International Nuclear Information System (INIS)

    Kobzarenko, A.V.; Sukhov, F.F.; Orlov, A.Yu.; Kovalev, G.V.; Baranova, I.A.; Feldman, V.I.

    2012-01-01

    The effect of excess energy on the primary radical cations of bifunctional carbonyl compounds and aliphatic alkynes was simulated by matrix isolation method using rare gas matrices with various ionization potentials. The formation of fragmentation products was monitored by EPR and FTIR spectroscopy. It was shown that the radical cations of bifunctional compounds (CH 3 OCH 2 COCH 3 and CH 3 COCOCH 3 ) dissociated effectively yielding · CH 3 radicals upon irradiation in solid argon matrix at T≤16 K. In addition to isolated methyl radicals, the radical pairs consisting of two methyl radicals separated by two CO molecules were detected in the case of diacetyl. The probability of fragmentation decreases with the decreasing excess energy by switching from Ar to Xe. In general, bifunctional molecules were found to be less stable to “hot” ionic fragmentation in low-temperature solids in comparison with simple prototype compounds. In the case of alkynes of the R--C≡CH type, a noticeable yield of fragmentation products was observed when R=–C(CH 3 ) 3 , but it was negligible for R=–CH 3 . The mechanisms of “hot” reactions and excess energy relaxation are discussed. - Highlights: ► Radiolysis of bifunctional organic compounds and alkynes. ► Dependence of “hot” fragmentation probability from molecular structure. ► Ions of bifunctional compounds are less stable than those of monofunctional ones. ► Alkynes are rather stable to “hot” fragmentation.

  18. The mechanism and properties of bio-photon emission and absorption in protein molecules in living systems

    Science.gov (United States)

    Pang, Xiao-feng

    2012-05-01

    The mechanism and properties of bio-photon emission and absorption in bio-tissues were studied using Pang's theory of bio-energy transport, in which the energy spectra of protein molecules are obtained from the discrete dynamic equation. From the energy spectra, it was determined that the protein molecules could both radiate and absorb bio-photons with wavelengths of energy level transitions of the excitons. These results were consistent with the experimental data; this consisted of infrared absorption data from collagen, bovine serum albumin, the protein-like molecule acetanilide, plasma, and a person's finger, and the laser-Raman spectra of acidity I-type collagen in the lungs of a mouse, and metabolically active Escherichia coli. We further elucidated the mechanism responsible for the non-thermal biological effects produced by the infrared light absorbed by the bio-tissues, using the above results. No temperature rise was observed; instead, the absorbed infrared light promoted the vibrations of amides as well the transport of the bio-energy from one place to other in the protein molecules, which changed their conformations. These experimental results, therefore, not only confirmed the validity of the mechanism of bio-photon emission, and the newly developed theory of bio-energy transport mentioned above, but also explained the mechanism and properties of the non-thermal biological effects produced by the absorption of infrared light by the living systems.

  19. Electronic and magnetic properties of Mn{sub 12} single-molecule magnets on the Au(111) surface

    Energy Technology Data Exchange (ETDEWEB)

    Voss, Soenke; Burgert, Michael; Fonin, Mikhail; Groth, Ulrich; Ruediger, Ulrich [Universitaet Konstanz (Germany); Michaelis, Christian; Brihuega, Ivan; Kern, Klaus [Max-Planck-Institut fuer Festkoerperforschung, Stuttgart (Germany); Dedkov, Yury S. [Institut fuer Festkoerperphysik, Technische Universitaet Dresden (Germany)

    2008-07-01

    The paramount interest in single-molecule magnets (SMMs) like Mn{sub 12}-acetate and its derivatives was inspired by numerous experimental and theoretical insights indicating the feasibility of addressing quantum effects of magnetism on a molecular scale. Due to its relatively high blocking temperature ({proportional_to}3 K) combined with the ability to identify well-defined spin states, Mn{sub 12} still remains the most favoured SMM possibly allowing the detection of magnetic fingerprints in transport properties of a single molecule. In this work, the electronic properties of Mn{sub 12} molecules chemically grafted on Au(111) surfaces have been studied by means of low temperature as well as room temperature scanning tunneling microscopy and spectroscopy (STS), X-ray absorption spectroscopy and photoelectron spectroscopy. The results revealed signatures from most probably intact Mn{sub 12} molecules while STS measurements in magnetic fields indicate the possibility to identify magnetic fingerprints in scanning tunneling spectra. The results will be discussed with respect to previous attempts to perform transport measurements on Mn{sub 12} SMMs.

  20. Structure and Properties of LENRA/ Silica Composite

    International Nuclear Information System (INIS)

    Mahathir Mohamed; Dahlan Mohd

    2010-01-01

    The sol-gel reaction using tetra ethoxysilane (TEOS) was conducted for modified natural rubber (NR) matrix to obtain in situ generated NR/ silica composite. The present of acrylate group in the modified NR chain turns the composite into radiation-curable. The maximum amount of silica generated in the matrix was 50 p hr by weight. During the sol-gel process the inorganic mineral was deposited in the rubber matrix forming hydrogen bonding between organic and inorganic phases. The composites obtained were characterized by various techniques including thermogravimetric analysis and infrared spectrometry to study their molecular structure. The increase in mechanical properties was observed for low silica contents ( 30 p hr) where more silica were generated, agglomerations were observed at the expense of the mechanical properties. From the DMTA data, it shows an increase of the interaction between the rubber and silica phases up to 30 p hr TEOS. Structure and morphology of the heterogeneous system were analyzed by transmission electron microscopy. The average particle sizes of between 150 nm to 300 nm were achieved for the composites that contain less than 20 p hr of TEOS. (author)

  1. Retrieving transient conformational molecular structure information from inner-shell photoionization of laser-aligned molecules

    Science.gov (United States)

    Wang, Xu; Le, Anh-Thu; Yu, Chao; Lucchese, R. R.; Lin, C. D.

    2016-01-01

    We discuss a scheme to retrieve transient conformational molecular structure information using photoelectron angular distributions (PADs) that have averaged over partial alignments of isolated molecules. The photoelectron is pulled out from a localized inner-shell molecular orbital by an X-ray photon. We show that a transient change in the atomic positions from their equilibrium will lead to a sensitive change in the alignment-averaged PADs, which can be measured and used to retrieve the former. Exploiting the experimental convenience of changing the photon polarization direction, we show that it is advantageous to use PADs obtained from multiple photon polarization directions. A simple single-scattering model is proposed and benchmarked to describe the photoionization process and to do the retrieval using a multiple-parameter fitting method. PMID:27025410

  2. On the role of hydrogel structure and degradation in controlling the transport of cell-secreted matrix molecules for engineered cartilage.

    Science.gov (United States)

    Dhote, Valentin; Skaalure, Stacey; Akalp, Umut; Roberts, Justine; Bryant, Stephanie J; Vernerey, Franck J

    2013-03-01

    Damage to cartilage caused by injury or disease can lead to pain and loss of mobility, diminishing one's quality of life. Because cartilage has a limited capacity for self-repair, tissue engineering strategies, such as cells encapsulated in synthetic hydrogels, are being investigated as a means to restore the damaged cartilage. However, strategies to date are suboptimal in part because designing degradable hydrogels is complicated by structural and temporal complexities of the gel and evolving tissue along multiple length scales. To address this problem, this study proposes a multi-scale mechanical model using a triphasic formulation (solid, fluid, unbound matrix molecules) based on a single chondrocyte releasing extracellular matrix molecules within a degrading hydrogel. This model describes the key players (cells, proteoglycans, collagen) of the biological system within the hydrogel encompassing different length scales. Two mechanisms are included: temporal changes of bulk properties due to hydrogel degradation, and matrix transport. Numerical results demonstrate that the temporal change of bulk properties is a decisive factor in the diffusion of unbound matrix molecules through the hydrogel. Transport of matrix molecules in the hydrogel contributes both to the development of the pericellular matrix and the extracellular matrix and is dependent on the relative size of matrix molecules and the hydrogel mesh. The numerical results also demonstrate that osmotic pressure, which leads to changes in mesh size, is a key parameter for achieving a larger diffusivity for matrix molecules in the hydrogel. The numerical model is confirmed with experimental results of matrix synthesis by chondrocytes in biodegradable poly(ethylene glycol)-based hydrogels. This model may ultimately be used to predict key hydrogel design parameters towards achieving optimal cartilage growth. Copyright © 2012 Elsevier Ltd. All rights reserved.

  3. Interfacial assembly structures and nanotribological properties of saccharic acids.

    Science.gov (United States)

    Shi, Hongyu; Liu, Yuhong; Zeng, Qingdao; Yang, Yanlian; Wang, Chen; Lu, Xinchun

    2017-01-04

    Saccharides have been recognized as potential bio-lubricants because of their good hydration ability. However, the interfacial structures of saccharides and their derivatives are rarely studied and the molecular details of interaction mechanisms have not been well understood. In this paper, the supramolecular assembly structures of saccharic acids (including galactaric acid and lactobionic acid), mediated by hydrogen bonds O-HN and O-HO, were successfully constructed on a highly oriented pyrolytic graphite (HOPG) surface by introducing pyridine modulators and were explicitly revealed by using scanning tunneling microscopy (STM). Furthermore, friction forces were measured in the saccharic acid/pyridine co-assembled system by atomic force microscopy (AFM), revealing a larger value than a pristine saccharic acid system, which could be attributed to the stronger tip-assembled molecule interactions that lead to the higher potential energy barrier needed to overcome. The effort on saccharide-related supramolecular self-assembly and nanotribological behavior could provide a novel and promising pathway to explore the interaction mechanisms underlying friction and reveal the structure-property relationship at the molecular level.

  4. Synthetic Study on the Relationship Between Structure and Sweet Taste Properties of Steviol Glycosides

    Directory of Open Access Journals (Sweden)

    Grant Dubois

    2012-04-01

    Full Text Available The structure activity relationship between the C16-C17 methylene double bond on the aglycone of steviol glycosides and the corresponding impact on their sweet taste has been reported here for the first time. It has been observed that converting stevioside and rebaudioside A to their corresponding ketones by switching the doubly bonded methylene on C-17 for a ketone group actually removes the sweet taste properties of these molecules completely. Regenerating the original molecules tends to restore the sweet taste of both the steviol glycosides. Thus this C16-C17 methylene double bond in rebaudioside A and stevioside can be regarded as a pharmacophore essential for the sweetness property of these molecules.

  5. Rotational and fine structure of open-shell molecules in nearly degenerate electronic states

    Science.gov (United States)

    Liu, Jinjun

    2018-03-01

    An effective Hamiltonian without symmetry restriction has been developed to model the rotational and fine structure of two nearly degenerate electronic states of an open-shell molecule. In addition to the rotational Hamiltonian for an asymmetric top, this spectroscopic model includes the energy separation between the two states due to difference potential and zero-point energy difference, as well as the spin-orbit (SO), Coriolis, and electron spin-molecular rotation (SR) interactions. Hamiltonian matrices are computed using orbitally and fully symmetrized case (a) and case (b) basis sets. Intensity formulae and selection rules for rotational transitions between a pair of nearly degenerate states and a nondegenerate state have also been derived using all four basis sets. It is demonstrated using real examples of free radicals that the fine structure of a single electronic state can be simulated with either a SR tensor or a combination of SO and Coriolis constants. The related molecular constants can be determined precisely only when all interacting levels are simulated simultaneously. The present study suggests that analysis of rotational and fine structure can provide quantitative insights into vibronic interactions and related effects.

  6. Probing Zeolite Crystal Architecture and Structural Imperfections using Differently Sized Fluorescent Organic Probe Molecules.

    Science.gov (United States)

    Hendriks, Frank C; Schmidt, Joel E; Rombouts, Jeroen A; Lammertsma, Koop; Bruijnincx, Pieter C A; Weckhuysen, Bert M

    2017-05-05

    A micro-spectroscopic method has been developed to probe the accessibility of zeolite crystals using a series of fluorescent 4-(4-diethylaminostyryl)-1-methylpyridinium iodide (DAMPI) probes of increasing molecular size. Staining large zeolite crystals with MFI (ZSM-5) topology and subsequent mapping of the resulting fluorescence using confocal fluorescence microscopy reveal differences in structural integrity: the 90° intergrowth sections of MFI crystals are prone to develop structural imperfections, which act as entrance routes for the probes into the zeolite crystal. Polarization-dependent measurements provide evidence for the probe molecule's alignment within the MFI zeolite pore system. The developed method was extended to BEA (Beta) crystals, showing that the previously observed hourglass pattern is a general feature of BEA crystals with this morphology. Furthermore, the probes can accurately identify at which crystal faces of BEA straight or sinusoidal pores open to the surface. The results show this method can spatially resolve the architecture-dependent internal pore structure of microporous materials, which is difficult to assess using other characterization techniques such as X-ray diffraction. © 2017 The Authors. Published by Wiley-VCH Verlag GmbH & Co. KGaA.

  7. Vibronic coupling in ionized organic molecules. Structural distortions and chemical reactions

    International Nuclear Information System (INIS)

    Williams, F.

    2002-01-01

    Complete text of publication follows. Ionized organic molecules (radical cations, RC) are prone to undergo vibronic coupling whenever there is a relatively small energy gap ( 2v point group of the neutral parent molecule by twisting at the olefinic π bond to the lower C 2 symmetry in the RC (Chem. Eur. J. 2002, 8, 1074). These experiments clearly revealed a double minimum in the potential energy surface along the a 2 torsional mode. This is in accord with the coupling of the 2 B 1 and 2 B 2 Born-Oppenheimer states in C 2v symmetry, this mixing of the 2 B 1 π-ionized ground state and the 2 B 2 δ-ionized excited state being facilitated by the low (∼ 1.0 eV) gap between these states, as estimated from photoelectron spectroscopy. Turning to the second class of RC where unimolecular rearrangement reactions are promoted by vibronic interaction, several cases have emerged where the rearrangement would not be expected if it were based only on the ground-state properties of the RC. It was found (Chem. Phy. Lett. 1988, 143, 521) that the ethylene oxide RC undergoes C-C ring opening to the oxallyl species despite the fact that the ground state corresponds to ionization from the nonbonding oxygen π lone-pair orbital. The reaction develops excited-state character as a result of the vibronic mixing so that the activation barrier to ring opening is lowered. We will discuss the unusual rearrangements of the bicyclo[1.1.1.]pentane and [1.1.1]propellane RC from a similar perspective, emphasis being placed on the decisive role of symmetry in predicting the course of these rearrangements. We illustrate how this approach can reconcile conflicting considerations on some of the 'unexpected' reaction pathways followed by highly strained organic RC

  8. Contact-Engineered Electrical Properties of MoS2 Field-Effect Transistors via Selectively Deposited Thiol-Molecules.

    Science.gov (United States)

    Cho, Kyungjune; Pak, Jinsu; Kim, Jae-Keun; Kang, Keehoon; Kim, Tae-Young; Shin, Jiwon; Choi, Barbara Yuri; Chung, Seungjun; Lee, Takhee

    2018-05-01

    Although 2D molybdenum disulfide (MoS 2 ) has gained much attention due to its unique electrical and optical properties, the limited electrical contact to 2D semiconductors still impedes the realization of high-performance 2D MoS 2 -based devices. In this regard, many studies have been conducted to improve the carrier-injection properties by inserting functional paths, such as graphene or hexagonal boron nitride, between the electrodes and 2D semiconductors. The reported strategies, however, require relatively time-consuming and low-yield transfer processes on sub-micrometer MoS 2 flakes. Here, a simple contact-engineering method is suggested, introducing chemically adsorbed thiol-molecules as thin tunneling barriers between the metal electrodes and MoS 2 channels. The selectively deposited thiol-molecules via the vapor-deposition process provide additional tunneling paths at the contact regions, improving the carrier-injection properties with lower activation energies in MoS 2 field-effect transistors. Additionally, by inserting thiol-molecules at the only one contact region, asymmetric carrier-injection is feasible depending on the temperature and gate bias. © 2018 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  9. Binding of peptides to HLA-DQ molecules: peptide binding properties of the disease-associated HLA-DQ(alpha 1*0501, beta 1*0201) molecule

    DEFF Research Database (Denmark)

    Johansen, B H; Buus, S; Vartdal, F

    1994-01-01

    Peptide binding to DQ molecules has not previously been described. Here we report a biochemical peptide-binding assay specific for the DQ2 [i.e. DQ(alpha 1*0501, beta 1*0201)] molecule. This molecule was chosen since it shows a strong association to diseases such as celiac disease and insulin...

  10. X-ray structure analyses of biological molecules and particles in Japan. A brief history and future prospect

    International Nuclear Information System (INIS)

    Nakasako, Masayoshi; Yamamoto, Masaki

    2015-01-01

    In Japan, X-ray structure analyses of molecules and particles from biology started in the 1970s. The structure analysis methods have been developed through the innovation of various techniques in advance, and have contributed for understanding the elementary and microscopic processes in life. Here we summarize briefly the history of X-ray structure analyses for structural biology in Japan and think about the prospect. (author)

  11. Structure of radicals produced by γ radiolysis. Part 4. Adamantane matrices doped with various 5-membered heterocyclic molecules

    International Nuclear Information System (INIS)

    Winters, D.L.; Ling, A.C.

    1976-01-01

    The effects of γ-radiolysis at room temperature on adamantane and adamantane-d 16 matrices doped with 5-membered heterocyclic molecules has been examined by X-band electron spin resonance (esr) spectrometry. Radical structures formed from heterocyclic solute molecules are discussed and tentative assignments made. Discussion of possible radical structures derived from selected heterocyclic compounds is included, but unambiguous assignmens of structure cannot be made for these compounds from the esr data obtained. It was noted that perdeuterated adamantane matrices provided superior resolution for esr spectra derived from radicals with a delocalized spin center such as allyl or allenyl species. (author)

  12. A Comprehensive Analysis in Terms of Molecule-Intrinsic, Quasi-Atomic Orbitals. III. The Covalent Bonding Structure of Urea.

    Science.gov (United States)

    West, Aaron C; Schmidt, Michael W; Gordon, Mark S; Ruedenberg, Klaus

    2015-10-15

    The analysis of molecular electron density matrices in terms of quasi-atomic orbitals, which was developed in previous investigations, is quantitatively exemplified by a detailed application to the urea molecule. The analysis is found to identify strong and weak covalent bonding interactions as well as intramolecular charge transfers. It yields a qualitative as well as quantitative ab initio description of the bonding structure of this molecule, which raises questions regarding some traditional rationalizations.

  13. Effects of Electrode Distances on Geometric Structure and Electronic Transport Properties of Molecular 4,4'-Bipyridine Junction

    International Nuclear Information System (INIS)

    Li Zongliang; Zou Bin; Wang Chuankui; Luo Yi

    2006-01-01

    Influences of electrode distances on geometric structure of molecule and on electronic transport properties of molecular junctions have been investigated by means of a generalized quantum chemical approach based on the elastic scattering Green's function method. Numerical results show that, for organic molecule 4,4'-bipyridine, the geometric structure of the molecule especially the dihedral angle between the two pyridine rings is sensitive to the distances between the two electrodes. The currents of the molecular junction are taken nonlinearly increase with the increase of the bias. Shortening the distance of the metallic electrodes will result in stronger coupling and larger conductance

  14. Computer system for structure recognition of polyatomic molecules by i. r. , n. m. r. , u. v. and m. s. methods

    Energy Technology Data Exchange (ETDEWEB)

    Gribov, L A; Elyashberg, M E; Serov, V V [USSR Academy of Sciences, Moscow (USSR). V.I. Vernadsky Institute of Geochemistry and Analytical Chemistry

    1977-12-15

    A system of algorithms and programs for the recognition of the structures of polyatomic molecules by means of i.r., n.m.r., u.v. and mass spectra is described. Examples of structures identified are cited. The results are promising and suggest that the system could be used for the identification of complex organic compounds.

  15. Magnetic properties of dendrimer structures with different coordination numbers: A Monte Carlo study

    International Nuclear Information System (INIS)

    Masrour, R.; Jabar, A.

    2016-01-01

    We investigate the magnetic properties of Cayley trees of large molecules with dendrimer structure using Monte Carlo simulations. The thermal magnetization and magnetic susceptibility of a dendrimer structure are given with different coordination numbers, Z=3, 4, 5 and different generations g=3 and 2. The variation of magnetizations with the exchange interactions and crystal fields have been given of this system. The magnetic hysteresis cycles have been established. - Highlights: • The dendrimer structure is investigated using Monte Carlo simulations. • The transition temperatures are obtained for different coordination numbers and generations. • The magnetic hysteresis cycle has been established. • The dendrimer structure exhibit the superparamagnetic behavior.

  16. Magnetic properties of dendrimer structures with different coordination numbers: A Monte Carlo study

    Energy Technology Data Exchange (ETDEWEB)

    Masrour, R., E-mail: rachidmasrour@hotmail.com; Jabar, A.

    2016-11-01

    We investigate the magnetic properties of Cayley trees of large molecules with dendrimer structure using Monte Carlo simulations. The thermal magnetization and magnetic susceptibility of a dendrimer structure are given with different coordination numbers, Z=3, 4, 5 and different generations g=3 and 2. The variation of magnetizations with the exchange interactions and crystal fields have been given of this system. The magnetic hysteresis cycles have been established. - Highlights: • The dendrimer structure is investigated using Monte Carlo simulations. • The transition temperatures are obtained for different coordination numbers and generations. • The magnetic hysteresis cycle has been established. • The dendrimer structure exhibit the superparamagnetic behavior.

  17. Structure Property Studies for Additively Manufactured Parts

    Energy Technology Data Exchange (ETDEWEB)

    Milenski, Helen M [Univ. of Mexico, Los Alamos, NM (United States); Schmalzer, Andrew Michael [Los Alamos National Lab. (LANL), Los Alamos, NM (United States); Kelly, Daniel [Los Alamos National Lab. (LANL), Los Alamos, NM (United States)

    2015-08-17

    Since the invention of modern Additive Manufacturing (AM) processes engineers and designers have worked hard to capitalize on the unique building capabilities that AM allows. By being able to customize the interior fill of parts it is now possible to design components with a controlled density and customized internal structure. The creation of new polymers and polymer composites allow for even greater control over the mechanical properties of AM parts. One of the key reasons to explore AM, is to bring about a new paradigm in part design, where materials can be strategically optimized in a way that conventional subtractive methods cannot achieve. The two processes investigated in my research were the Fused Deposition Modeling (FDM) process and the Direct Ink Write (DIW) process. The objectives of the research were to determine the impact of in-fill density and morphology on the mechanical properties of FDM parts, and to determine if DIW printed samples could be produced where the filament diameter was varied while the overall density remained constant.

  18. Scaling properties of adsorption energies for hydrogen-containing molecules on transition-metal surfaces

    DEFF Research Database (Denmark)

    Abild-Pedersen, Frank; Greeley, Jeffrey Philip; Studt, Felix

    2007-01-01

    Density functional theory calculations are presented for CHx, x=0,1,2,3, NHx, x=0,1,2, OHx, x=0,1, and SHx, x=0,1 adsorption on a range of close-packed and stepped transition-metal surfaces. We find that the adsorption energy of any of the molecules considered scales approximately with the adsorp...

  19. Redox properties of structural Fe in clay minerals: 3. Relationships between smectite redox and structural properties.

    Science.gov (United States)

    Gorski, Christopher A; Klüpfel, Laura E; Voegelin, Andreas; Sander, Michael; Hofstetter, Thomas B

    2013-01-01

    Structural Fe in clay minerals is an important redox-active species in many pristine and contaminated environments as well as in engineered systems. Understanding the extent and kinetics of redox reactions involving Fe-bearing clay minerals has been challenging due to the inability to relate structural Fe(2+)/Fe(total) fractions to fundamental redox properties, such as reduction potentials (EH). Here, we overcame this challenge by using mediated electrochemical reduction (MER) and oxidation (MEO) to characterize the fraction of redox-active structural Fe (Fe(2+)/Fe(total)) in smectites over a wide range of applied EH-values (-0.6 V to +0.6 V). We examined Fe(2+)/Fe(total )- EH relationships of four natural Fe-bearing smectites (SWy-2, SWa-1, NAu-1, NAu-2) in their native, reduced, and reoxidized states and compared our measurements with spectroscopic observations and a suite of mineralogical properties. All smectites exhibited unique Fe(2+)/Fe(total) - EH relationships, were redox active over wide EH ranges, and underwent irreversible electron transfer induced structural changes that were observable with X-ray absorption spectroscopy. Variations among the smectite Fe(2+)/Fe(total) - EH relationships correlated well with both bulk and molecular-scale properties, including Fe(total) content, layer charge, and quadrupole splitting values, suggesting that multiple structural parameters determined the redox properties of smectites. The Fe(2+)/Fe(total) - EH relationships developed for these four commonly studied clay minerals may be applied to future studies interested in relating the extent of structural Fe reduction or oxidation to EH-values.

  20. Effect of low-intensity electromagnetic radiation on structurization properties of bacterial lipopolysaccharide

    Directory of Open Access Journals (Sweden)

    Grigory E. Brill

    2014-09-01

    Full Text Available Purpose — to investigate the effects of low-intensity electromagnetic radiation on the process of dehydration selforganization of bacterial lipopolysaccharide (LPS. Material and Methods — The method of wedge dehydration has been used to study the structure formation of bacterial LPS. Image-phases analysis included their qualitative characteristics, as well as the calculation of quantitative indicators, followed by statistical analysis. Results — Low-intensity ultra high frequency (UHF radiation (1 GHz, 0.1 μW/cm2, 10 min has led to the changes in the suspension system of the LPS-saline reflected in the kinetics of structure formation. Conclusion — 1 GHz corresponds to the natural frequency of oscillation of water clusters and, presumably, the effect of UHF on structure of LPS mediates through the changes in water-salt environment. Under these conditions, properties of water molecules of hydration and possibly the properties of hydrophobic and hydrophilic regions in the molecule of LPS, which can affect the ability of toxin molecules to form aggregates change. Therefore the LPS structure modification may result in the change of its toxic properties.

  1. Photophysical properties of novel small acceptor molecules and their application in hybrid small-molecular/polymeric organic solar cells

    Energy Technology Data Exchange (ETDEWEB)

    Inal, Sahika; Castellani, Mauro; Neher, Dieter [Universitaet Potsdam, Institut fuer Physik und Astronomie, Potsdam-Golm (Germany); Sellinger, Alan [Institute of Materials Research and Engineering, Singapore (Singapore)

    2009-07-01

    Recent experimental investigations revealed that the photovoltaic properties of our devices are related to the balance between recombination and field-induced dissociation of interfacial excited states such as exciplexes or geminate polaron pairs. This balance was shown to be affected by the nanomorphology at the heterojunction. We have analyzed the photophysical properties of a new materials couple comprising an electron-donating PPV copolymer and a vinazene-based small molecule acceptor. Steady state and time-resolved photoluminescence (PL) spectroscopy in solution and in the solid state showed the formation of excimers within the acceptor. The associated long-range diffusion promise efficient energy harvesting at the heterojunction. On the other hand, blends of the PPV-derivative and the small molecule revealed strong exciplex formation. Therefore, bilayered hybrid small-molecular/polymeric solar cells have been fabricated by consequently spin-coating the macromolecular donor and the small molecule acceptor from two different solvents. The bilayer architecture limits recombination processes enabling high FFs of around 44% and a technologically important open circuit voltage of 1Volt.

  2. Ab initio study of structural and mechanical property of solid molecular hydrogens

    Science.gov (United States)

    Ye, Yingting; Yang, Li; Yang, Tianle; Nie, Jinlan; Peng, Shuming; Long, Xinggui; Zu, Xiaotao; Du, Jincheng

    2015-06-01

    Ab initio calculations based on density functional theory (DFT) were performed to investigate the structural and the elastic properties of solid molecular hydrogens (H2). The influence of molecular axes of H2 on structural relative stabilities of hexagonal close-packed (hcp) and face-centered cubic (fcc) structured hydrogen molecular crystals were systematically investigated. Our results indicate that for hcp structures, disordered hydrogen molecule structure is more stable, while for fcc structures, Pa3 hydrogen molecular crystal is most stable. The cohesive energy of fcc H2 crystal was found to be lower than hcp. The mechanical properties of fcc and hcp hydrogen molecular crystals were obtained, with results consistent with previous theoretical calculations. In addition, the effects of zero point energy (ZPE) and van der Waals (vdW) correction on the cohesive energy and the stability of hydrogen molecular crystals were systematically studied and discussed.

  3. NMR structure calculation for all small molecule ligands and non-standard residues from the PDB Chemical Component Dictionary

    Energy Technology Data Exchange (ETDEWEB)

    Yilmaz, Emel Maden; Güntert, Peter, E-mail: guentert@em.uni-frankfurt.de [Goethe University Frankfurt am Main, Center for Biomolecular Magnetic Resonance, Institute of Biophysical Chemistry (Germany)

    2015-09-15

    An algorithm, CYLIB, is presented for converting molecular topology descriptions from the PDB Chemical Component Dictionary into CYANA residue library entries. The CYANA structure calculation algorithm uses torsion angle molecular dynamics for the efficient computation of three-dimensional structures from NMR-derived restraints. For this, the molecules have to be represented in torsion angle space with rotations around covalent single bonds as the only degrees of freedom. The molecule must be given a tree structure of torsion angles connecting rigid units composed of one or several atoms with fixed relative positions. Setting up CYANA residue library entries therefore involves, besides straightforward format conversion, the non-trivial step of defining a suitable tree structure of torsion angles, and to re-order the atoms in a way that is compatible with this tree structure. This can be done manually for small numbers of ligands but the process is time-consuming and error-prone. An automated method is necessary in order to handle the large number of different potential ligand molecules to be studied in drug design projects. Here, we present an algorithm for this purpose, and show that CYANA structure calculations can be performed with almost all small molecule ligands and non-standard amino acid residues in the PDB Chemical Component Dictionary.

  4. Manipulating ultracold polar molecules with microwave radiation: The influence of hyperfine structure

    International Nuclear Information System (INIS)

    Aldegunde, J.; Hutson, Jeremy M.; Ran Hong

    2009-01-01

    We calculate the microwave spectra of ultracold 40 K 87 Rb alkali-metal dimers, including hyperfine interactions and in the presence of electric and magnetic fields. We show that microwave transitions may be used to transfer molecules between different hyperfine states, but only because of the presence of nuclear quadrupole interactions. Hyperfine splittings may also complicate the use of ultracold molecules for quantum computing. The spectrum of molecules oriented in electric fields may be simplified dramatically by applying a simultaneous magnetic field.

  5. Hyperfine structure of 2Σ molecules containing alkaline-earth-metal atoms

    Science.gov (United States)

    Aldegunde, Jesus; Hutson, Jeremy M.

    2018-04-01

    Ultracold molecules with both electron spin and an electric dipole moment offer new possibilities in quantum science. We use density-functional theory to calculate hyperfine coupling constants for a selection of molecules important in this area, including RbSr, LiYb, RbYb, CaF, and SrF. We find substantial hyperfine coupling constants for the fermionic isotopes of the alkaline-earth-metal and Yb atoms. We discuss the hyperfine level patterns and Zeeman splittings expected for these molecules. The results will be important both to experiments aimed at forming ultracold open-shell molecules and to their applications.

  6. Structure and properties of carbon black particles

    Science.gov (United States)

    Xu, Wei

    Structure and properties of carbon black particles were investigated using atomic force microscopy, gas adsorption, Raman spectroscopy, and X-ray diffraction. Supplementary information was obtained using TEM and neutron scattering. The AFM imaging of carbon black aggregates provided qualitative visual information on their morphology, complementary to that obtained by 3-D modeling based on TEM images. Our studies showed that carbon black aggregates were relatively flat. The surface of all untreated carbon black particles was found to be rough and its fractal dimension was 2.2. Heating reduced the roughness and fractal dimension for all samples heat treated at above 1300 K to 2.0. Once the samples were heat treated rapid cooling did not affect the surface roughness. However, rapid cooling reduced crystallite sizes, and different Raman spectra were obtained for carbon blacks of various history of heat treatment. By analyzing the Raman spectra we determined the crystallite sizes and identified amorphous carbon. The concentration of amorphous carbon depends on hydrogen content. Once hydrogen was liberated at increased temperature, the concentration of amorphous carbon was reduced and crystallites started to grow. Properties of carbon blacks at high pressure were also studied. Hydrostatic pressure did not affect the size of the crystallites in carbon black particles. The pressure induced shift in Raman frequency of the graphitic component was a result of increased intermolecular forces and not smaller crystallites. Two methods of determining the fractal dimension, the FHH model and the yardstick technique based on the BET theory were used in the literature. Our study proved that the FHH model is sensitive to numerous assumptions and leads to wrong conclusions. On the other hand the yardstick method gave correct results, which agreed with the AFM results.

  7. Computational design of molecules for an all-quinone redox flow battery† †Electronic supplementary information (ESI) available: The list of computationally predicted candidate quinone molecules with interesting redox properties. See DOI: 10.1039/c4sc03030c Click here for additional data file.

    Science.gov (United States)

    Er, Süleyman; Suh, Changwon; Marshak, Michael P.

    2015-01-01

    Inspired by the electron transfer properties of quinones in biological systems, we recently showed that quinones are also very promising electroactive materials for stationary energy storage applications. Due to the practically infinite chemical space of organic molecules, the discovery of additional quinones or other redox-active organic molecules for energy storage applications is an open field of inquiry. Here, we introduce a high-throughput computational screening approach that we applied to an accelerated study of a total of 1710 quinone (Q) and hydroquinone (QH2) (i.e., two-electron two-proton) redox couples. We identified the promising candidates for both the negative and positive sides of organic-based aqueous flow batteries, thus enabling an all-quinone battery. To further aid the development of additional interesting electroactive small molecules we also provide emerging quantitative structure-property relationships. PMID:29560173

  8. Excitation energies and properties of open-shell singlet molecules applications to a new class of molecules for nonlinear optics and singlet fission

    CERN Document Server

    Nakano, Masayoshi

    2014-01-01

    This brief investigates the diradical character, which is one of the ground-state chemical indices for 'bond weakness' or 'electron correlation' and which allows researchers to explore the origins of the electron-correlation-driven physico-chemical phenomena concerned with electronic, optical and magnetic properties as well as to control them in the broad fields of physics and chemistry. It then provides the theoretical fundamentals of ground and excited electronic structures of symmetric and asymmetric open-shell molecular systems by using model molecular systems. Moreover, it presents the th

  9. Structure, Electronic and Nonlinear Optical Properties of Furyloxazoles and Thienyloxazoles

    International Nuclear Information System (INIS)

    Dagli, Ozlem; Gok, Rabia; Bahat, Mehmet; Ozbay, Akif

    2016-01-01

    Geometry optimization, electronic and nonlinear optical properties of isomers of furyloxazole and thienyloxazole molecules are carried out at the B3LYP/6-311++G(2d,p) level. The conformational analysis of 12 compounds have been studied as a function of torsional angle between rings. Electronic and NLO properties such as dipole moment, energy gap, polarizability and first hyperpolarizability were also calculated. (paper)

  10. Structures and physicochemical properties of molecular aggregates of lipids

    International Nuclear Information System (INIS)

    Iwahashi, Makio

    2005-01-01

    Structures and physicochemical properties of lipids such as fatty acids, alcohols, acylglycerols and steroids in their two- or three-dimensional states were studied through the measurements of surface pressure (π), surface-molecular area (A), vapor-pressure osmosis, radioactivity (R), self-diffusion coefficient (D), density, viscosity, near-infrared spectroscopy (NIR), 13 C-NMR spin-lattice relaxation time (T 1 ), ESR, SEM, DSC, X-ray diffraction and small-angle neutron scattering (SANS). Following results are obtained: (1) π-A and R-A relationships indicate that the explanation, being widely believed, of the reaction occurred in the oleic acid or the trioleylglycerol monolayer on the aqueous KMnO 4 solution is incorrect. (2) By using the LB film of 3 H-labelled fatty acid, the upper limit of the neutrino mass was determined. In addition, by using the LB film of 14 C-labelled fatty acid, a new type of crystal-transformation process was found, in which fatty-acid crystal transforms from its unstable state to its stable one by the transfer of the fatty acid molecules through the vapor phase. (3) Fatty acids always exist as their dimers in their liquid state and mostly in non-polar solvents; the dimers are the units of the molecular movements in the molten liquid and in solvents. T 1 results clearly showed the internal molecular movements of the dimers. In addition, D and SANS results indicated that two different kinds of fatty acids in their binary mixture make only each homodimers. (4) Furthermore, the study on the liquid structure of fatty acids such as cis-6-, cis-9-, cis-11-, trans-9-octadecenoic acids and stearic acid indicated that these fatty-acid dimers construct the clusters resemble to the smectic-liquid crystal in the liquid state. The clusters determine the physicochemical properties of the liquid of the fatty acid. (author)

  11. Elucidating the role of surface passivating ligand structural parameters in hole wave function delocalization in semiconductor cluster molecules.

    Science.gov (United States)

    Teunis, Meghan B; Nagaraju, Mulpuri; Dutta, Poulami; Pu, Jingzhi; Muhoberac, Barry B; Sardar, Rajesh; Agarwal, Mangilal

    2017-09-28

    This article describes the mechanisms underlying electronic interactions between surface passivating ligands and (CdSe) 34 semiconductor cluster molecules (SCMs) that facilitate band-gap engineering through the delocalization of hole wave functions without altering their inorganic core. We show here both experimentally and through density functional theory calculations that the expansion of the hole wave function beyond the SCM boundary into the ligand monolayer depends not only on the pre-binding energetic alignment of interfacial orbitals between the SCM and surface passivating ligands but is also strongly influenced by definable ligand structural parameters such as the extent of their π-conjugation [π-delocalization energy; pyrene (Py), anthracene (Anth), naphthalene (Naph), and phenyl (Ph)], binding mode [dithiocarbamate (DTC, -NH-CS 2 - ), carboxylate (-COO - ), and amine (-NH 2 )], and binding head group [-SH, -SeH, and -TeH]. We observe an unprecedentedly large ∼650 meV red-shift in the lowest energy optical absorption band of (CdSe) 34 SCMs upon passivating their surface with Py-DTC ligands and the trend is found to be Ph- wave function delocalization rather than carrier trapping and/or phonon-mediated relaxation. Taken together, knowledge of how ligands electronically interact with the SCM surface is crucial to semiconductor nanomaterial research in general because it allows the tuning of electronic properties of nanomaterials for better charge separation and enhanced charge transfer, which in turn will increase optoelectronic device and photocatalytic efficiencies.

  12. Structure and phase behavior of a confined nanodroplet composed of the flexible chain molecules.

    Science.gov (United States)

    Kim, Soon-Chul; Kim, Eun-Young; Seong, Baek-Seok

    2011-04-28

    A polymer density functional theory has been employed for investigating the structure and phase behaviors of the chain polymer, which is modelled as the tangentially connected sphere chain with an attractive interaction, inside the nanosized pores. The excess free energy of the chain polymer has been approximated as the modified fundamental measure-theory for the hard spheres, the Wertheim's first-order perturbation for the chain connectivity, and the mean-field approximation for the van der Waals contribution. For the value of the chemical potential corresponding to a stable liquid phase in the bulk system and a metastable vapor phase, the flexible chain molecules undergo the liquid-vapor transition as the pore size is reduced; the vapor is the stable phase at small volume, whereas the liquid is the stable phase at large volume. The wide liquid-vapor coexistence curve, which explains the wide range of metastable liquid-vapor states, is observed at low temperature. The increase of temperature and decrease of pore size result in a narrowing of liquid-vapor coexistence curves. The increase of chain length leads to a shift of the liquid-vapor coexistence curve towards lower values of chemical potential. The coexistence curves for the confined phase diagram are contained within the corresponding bulk liquid-vapor coexistence curve. The equilibrium capillary phase transition occurs at a higher chemical potential than in the bulk phase.

  13. Structural and functional properties of designed globins

    Indian Academy of Sciences (India)

    De novo design of artificial proteins is an essential approach to elucidate the principles of protein architecture and to understand specific functions of natural proteins and also to yield novel molecules for medical and industrial aims. We have designed artificial sequences of 153 amino acids to fit the main-chain framework of ...

  14. The synthesis and properties of linear A-π-D-π-A type organic small molecule containing diketopyrrolopyrrole terminal units

    Science.gov (United States)

    Zhang, Shanshan; Niu, Qingfen; Sun, Tao; Li, Yang; Li, Tianduo; Liu, Haixia

    2017-08-01

    A novel linear A-π-D-π-A-type organic small molecule Ph2(PDPP)2 consisting diketopyrrolopyrrole (DPP) as acceptor unit, biphenylene as donor unit and acetylene unit as π-linkage has been successfully designed and synthesized. Its corresponding thermal, photophysical and electrochemical properties as well as the photoinduced charge-separation process were investigated. Ph2(PDPP)2 exhibits high thermal stability and it can be soluble in common organic solvents such as chloroform and tetrahydrofuran. The photophysical properties show that DPP2Ph2 harvests sunlight over the entire visible spectrum range in the thin-film state (300-800 nm). DPP2Ph2 has lower band gaps and appropriate energy levels to satisfy the requirement of solution-processable organic solar cells. The efficient photoinduced charge separation process was clearly observed between DPP2Ph2 with PC61BM and the Ksv value was found to be as high as 2.13 × 104 M- 1. Therefore, these excellent properties demonstrate that the designed A-π-D-π-A-type small molecule Ph2(PDPP)2 is the prospective candidate as donor material for organic photovoltaic material.

  15. Synthesis route and structural properties of nanoferrites

    Energy Technology Data Exchange (ETDEWEB)

    Zaharieva, Katerina; Cherkezova-Zheleva, Zara; Kunev, Boris; Shopska, Maya; Mitov, Ivan [Institute of Catalysis, Bulgarian Academy of Sciences, Sofia (Bulgaria)

    2013-07-01

    The nano dimensional magnesium ferrite materials Mg{sub 0.25}Fe{sub 2.75}O{sub 4} , Mg{sub 0.5}Fe{sub 2.5}O{sub 4} and MgFe{sub 2}O{sub 4} with different stoichiometry were prepared by co-precipitation procedure using MgCl{sub 2} •6H{sub 2}O, FeCl{sub 2} •4H{sub 2}O and FeCl{sub 3} •6H{sub 2}O and NaOH as precipitant. The physicochemical methods - X-ray diffraction analysis, Moessbauer spectroscopy and FTIR spectroscopy were performed to investigate the structural properties of obtained nano size magnesium ferrite type samples. The registered experimental data were determined the presence of spinel ferrites and additional precursor phases as iron oxihydroxides and double layered hydroxides in ferrite materials MgxFe{sub 3-x}O{sub 4} (x=0.5;1). In the case of magnesium ferrite sample Mg{sub x}Fe{sub 3-x}O{sub 4} (x=0.25) the existence of non-stoichiometric spinel ferrite and intermediate phase - iron oxihydroxides were observed only. Key words: magnesium ferrites, co-precipitation, physicochemical methods.

  16. Structure and properties of hybrid coatings

    International Nuclear Information System (INIS)

    Pogrebnjak, A.D.; Vasilyuk, V.V.; Kravchenko, Yu.A.; Tyurin, Yu.N.; Alontseva, D.L.; Ponaryadov, V.V.; Ruzimov, Sh.M.

    2004-01-01

    Full text: This review report presents both the results obtained by the authors and those of other authors concerning investigations of structure and properties of hybrid coatings. Examples of such coatings as Al 2 O 3 /Cr/TiN/steel, TiC; TiN/Ti-V-Al; NiCr/steel; CrNiBSi/steel and others before and after electron beam irradiation had been considered. In these coatings the thickest layer was deposited using the high-velocity pulsed plasma jet, all others being deposited in vacuum by the vacuum-arc source or implanter. Advantages of the high-velocity pulsed plasma jet in comparison with other technologies had been demonstrated. A wide spectrum of analyzing methods had been applied for analyses: TEM, SEM with EDS, RBS, NRA, SIMS, XRD, tests for corrosion, wear, adhesion and hardness. The works had been funded by the Project 2M/03 54-2003 of the Ministry of Science and Education of Ukraine and STCU Project N3078

  17. Synthesis route and structural properties of nanoferrites

    International Nuclear Information System (INIS)

    Zaharieva, Katerina; Cherkezova-Zheleva, Zara; Kunev, Boris; Shopska, Maya; Mitov, Ivan

    2013-01-01

    The nano dimensional magnesium ferrite materials Mg 0.25 Fe 2.75 O 4 , Mg 0.5 Fe 2.5 O 4 and MgFe 2 O 4 with different stoichiometry were prepared by co-precipitation procedure using MgCl 2 •6H 2 O, FeCl 2 •4H 2 O and FeCl 3 •6H 2 O and NaOH as precipitant. The physicochemical methods - X-ray diffraction analysis, Moessbauer spectroscopy and FTIR spectroscopy were performed to investigate the structural properties of obtained nano size magnesium ferrite type samples. The registered experimental data were determined the presence of spinel ferrites and additional precursor phases as iron oxihydroxides and double layered hydroxides in ferrite materials MgxFe 3-x O 4 (x=0.5;1). In the case of magnesium ferrite sample Mg x Fe 3-x O 4 (x=0.25) the existence of non-stoichiometric spinel ferrite and intermediate phase - iron oxihydroxides were observed only. Key words: magnesium ferrites, co-precipitation, physicochemical methods

  18. Influence of the crystallographic structure of the electrode surface on the structure of the electrical double layer and adsorption of organic molecules

    International Nuclear Information System (INIS)

    Kochorovski, Z.; Zagorska, I.; Pruzhkovska-Drakhal, R.; Trasatti, S.

    1995-01-01

    The results of systematic investigation of influence of crystal structure of Bi-, Sb- and Cd-electrode surfaces on regularities of double electric layer structure in aqueous and nonaqueous solutions of surface-nonactive electrolyte are given. Influence of electrode surface characteristics on adsorptive behaviour of different organic molecules has been studied. General regularities of of chemical nature influence and surface crystallographic structure on the double layer structure and on organic compounds adsorption have been established. 57 refs., 7 figs., 4 tabs

  19. Structural Design Principle of Small-Molecule Organic Semiconductors for Metal-Free, Visible-Light-Promoted Photocatalysis.

    Science.gov (United States)

    Wang, Lei; Huang, Wei; Li, Run; Gehrig, Dominik; Blom, Paul W M; Landfester, Katharina; Zhang, Kai A I

    2016-08-08

    Herein, we report on the structural design principle of small-molecule organic semiconductors as metal-free, pure organic and visible light-active photocatalysts. Two series of electron-donor and acceptor-type organic semiconductor molecules were synthesized to meet crucial requirements, such as 1) absorption range in the visible region, 2) sufficient photoredox potential, and 3) long lifetime of photogenerated excitons. The photocatalytic activity was demonstrated in the intermolecular C-H functionalization of electron-rich heteroaromates with malonate derivatives. A mechanistic study of the light-induced electron transport between the organic photocatalyst, substrate, and the sacrificial agent are described. With their tunable absorption range and defined energy-band structure, the small-molecule organic semiconductors could offer a new class of metal-free and visible light-active photocatalysts for chemical reactions. © 2016 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  20. Phase relations, crystal structures and physical properties of nuclear fuels

    International Nuclear Information System (INIS)

    Tagawa, Hiroaki; Fujino, Takeo; Tateno, Jun

    1975-07-01

    Phase relations, crystal structures and physical properties of the compounds for nuclear fuels are presented, including melting point, thermal expansion, diffusion and magnetic and electric properties. Emphasis is on oxides, carbides and nitrides of thorium, uranium and plutonium. (auth.)

  1. Surface morphology, structural and electrical properties of RF ...

    Indian Academy of Sciences (India)

    2018-05-19

    May 19, 2018 ... ITO thin films; sputtering; structure; electrical properties; AFM; Hall effect. 1. Introduction ... ness range (61–768 nm) and to see if this system present properties that .... using the Bragg equation, and the relation linking the inter-.

  2. Correlation of electrochemical properties of expanded pyridinium compounds with their single molecule conductance

    Czech Academy of Sciences Publication Activity Database

    Nováková Lachmanová, Štěpánka; Šebera, Jakub; Kolivoška, Viliam; Gasior, Jindřich; Mészáros, G.; Dupeyre, G.; Lainé, P. P.; Hromadová, Magdaléna

    Roč. 301, FEB 2018 ( 2018 ), s. 301-311 ISSN 0013-4686 R&D Projects: GA ČR GA18-04682S; GA ČR GJ16-07460Y; GA MŠk(CZ) 7AMB15FR027 Grant - others:AV ČR(CZ) MTA-16-02 Program:Bilaterální spolupráce Institutional support: RVO:61388955 Keywords : Expanded pyridinium * Electron transfer and electron transport * Single molecule conductance Subject RIV: CG - Electrochemistry OBOR OECD: Physical chemistry Impact factor: 4.798, year: 2016

  3. Electronic properties and assambly of DNA-based molecules on gold surfaces

    DEFF Research Database (Denmark)

    Salvatore, Princia

    , highly base specific voltammetric peak in the presence of spermidine ions. A capacitive origin was attributed to this peak, and a novel route to detection of hybridization and base pair mismatches proposed on the basis of the high sensitivity to base pair mismatches showed by such ON-based monolayers...... as widely employed as Au(111) surfaces). In particular, SERS offered a valuable and rapid way ofcharacterising interactions between the DNA-based molecules and the NP surface, with no need for complex sample preparation....

  4. Solution of problem of determining spin properties of molecules in unitary formalism of quantum chemistry

    International Nuclear Information System (INIS)

    Klimko, G.T.; Luzanov, A.V.

    1988-01-01

    An analysis has been made of the problem of calculating one- and two-particle spin densities, which are needed in calculations of spin-orbit and spin-spin coupling. The proposed solution is oriented toward the application of computational algorithms using unitary group representations; the solution consists of explicit expressions for the matrix elements of spin density operators in terms of the means of products of spin-free generators. This has eliminated a serious problem encountered previously in determining spin characteristics of molecules within the framework of unitary formalism

  5. The controllable assembly of nanorods, nanowires and microwires of a perylenediimide molecule with photoswitching property

    Energy Technology Data Exchange (ETDEWEB)

    Ma, Ying, E-mail: yingma@imr.ac.cn [School of Materials Science and Engineering, Shenyang Jianzhu University, Shenyang 110168 (China); Shenyang National Laboratory for Materials Science, Institute of Metal Research, Chinese Academy of Science (China); An, Boxing; Wang, Meng; Shi, Fangxiao; Wang, Qing; Gu, Yaxin; Niu, Wanyang; Fan, Zhaorong [School of Materials Science and Engineering, Shenyang Jianzhu University, Shenyang 110168 (China); Shang, Yanli [College of Chemistry and Environmental Science, Hebei University, Baoding 071002 (China); Wang, Dan; Zhao, Cong [School of Materials Science and Engineering, Shenyang Jianzhu University, Shenyang 110168 (China)

    2015-07-15

    By using an electron donor–acceptor molecule that consists of a perylenediimide (PDI) core bonded with two ferrocene (Fc) units, well-defined nanorods, nanowires and microwires of PDI-Fc were formed through simply adjusting the initial concentration of PDI-Fc in dichloromethane or CH{sub 2}Cl{sub 2}. Moreover, the two-ended devices based on individual microwire were fabricated. Highly reproducible and sensitive photo response characteristics were demonstrated in the microwire through controlling the white light on and off with different light intensities. The assembly strategy via complementary donors and acceptors is of significance for constructing photoconductive systems and developing novel functional devices. - Graphical abstract: The two-ended devices based on individual microwire were fabricated. Highly reproducible and sensitive photo response characteristics were observed by controlling the white light on and off with different light intensities. - Highlights: • An electron donor–acceptor molecule (PDI-Fc) was synthesized. • Well-defined nanorods, nanowires and microwires of PDI-Fc were formed. • The two-ended devices based on individual microwire were fabricated. • Highly reproducible and sensitive photo response characteristics were observed.

  6. Effect of pressure on the solution structure and hydrogen bond properties of aqueous N-methylacetamide

    International Nuclear Information System (INIS)

    Sarma, Rahul; Paul, Sandip

    2012-01-01

    Highlights: ► NMA molecules are associated mostly through their hydrophobic methyl groups. ► High pressure reduces association propensity causing dispersion of these moieties. ► Orientational polarization of vicinal water molecules near O and H atoms of NMA. ► NMA prefers to be a H-bond acceptor rather than a donor in interaction with water. ► Energy of these hydrogen bonds reduces slightly at high pressure. -- Abstract: Effects of high pressure on hydrophobic and hydrogen bonding interactions are investigated by employing molecular dynamics (MD) simulations of aqueous N-methylacetamide (NMA) solutions. Such systems are of interest mainly because high pressure causes protein denaturation and NMA is a computationally effective model to understand the atomic-level picture of pressure-induced structural transitions of protein. Simulations are performed for five different pressure values ranging from 1 atm to 8000 atm. We find that NMA molecules are associated mostly through their hydrophobic methyl groups and high pressure reduces this association propensity, causing dispersion of these moieties. At high pressure, structural void decreases and the packing efficiency of water molecules around NMA molecules increases. Hydrogen bond properties calculations show favorable NMA–NMA hydrogen bonds as compared to those of NMA–water hydrogen bonds and preference of NMA to be a hydrogen bond acceptor rather than a donor in interaction with water.

  7. Self-organized structures in a superorganism: do ants “behave” like molecules?

    Science.gov (United States)

    Detrain, Claire; Deneubourg, Jean-Louis

    2006-09-01

    While the striking structures (e.g. nest architecture, trail networks) of insect societies may seem familiar to many of us, the understanding of pattern formation still constitutes a challenging problem. Over the last two decades, self-organization has dramatically changed our view on how collective decision-making and structures may emerge out of a population of ant workers having each their own individuality as well as a limited access to information. A variety of collective behaviour spontaneously outcome from multiple interactions between nestmates, even when there is no directing influence imposed by an external template, a pacemaker or a leader. By focussing this review on foraging structures, we show that ant societies display some properties which are usually considered in physico-chemical systems, as typical signatures of self-organization. We detail the key role played by feed-back loops, fluctuations, number of interacting units and sensitivity to environmental factors in the emergence of a structured collective behaviour. Nonetheless, going beyond simple analogies with non-living self-organized patterns, we stress on the specificities of social structures made of complex living units of which the biological features have been selected throughout the evolution depending on their adaptive value. In particular, we consider the ability of each ant individual to process information about environmental and social parameters, to accordingly tune its interactions with nestmates and ultimately to determine the final pattern emerging at the collective level. We emphasize on the parsimony and simplicity of behavioural rules at the individual level which allow an efficient processing of information, energy and matter within the whole colony.

  8. Structural and Interfacial Properties of Hyperbranched-Linear Polymer Surfactant.

    Science.gov (United States)

    Qiang, Taotao; Bu, Qiaoqiao; Huang, Zhaofeng; Wang, Xuechuan

    2014-01-01

    With oleic acid grafting modification, a series of hyperbranched-linear polymer surfactants (HLPS) were prepared by hydroxyl-terminated hyperbranched polymer (HBP), which was gained through a step synthesis method using trimethylolpropane and AB 2 monomer. The AB 2 monomers were obtained through the Michael addition reaction of methyl acrylate and diethanol amine. The structures of HLPS were characterised by Fourier transform infrared spectrophotometer and nuclear magnetic resonance (NMR), which indicated that HBP was successfully modified by oleic acid. Furthermore, the properties of surface tension and critical micelle concentration of HLPS solution showed that HLPS can significantly reduce the surface tension of water. The morphology of the HLPS solution was characterised by dynamic light scattering, which revealed that HLPS exhibited a nonmonotonic appearance in particle size at different scattering angles owing to the different replaced linear portions. The relationships of the surface pressure to monolayer area and time were measured using the Langmuir-Blodgett instrument, which showed that the surface tension of monolayer molecules increased with the increasing of hydrophobic groups. In addition, the interface conditions of different replaced HLPS solutions were simulated.

  9. 1H NMR study of the solvent THF concerning their structural and dynamical properties in chemically Li-intercalated SWNT

    KAUST Repository

    Schmid, Marc R.

    2011-09-01

    Structural and dynamical properties of the THF solvent in single-walled carbon nanotubes intercalated with lithium are investigated by NMR. 1H NMR experiments reveal the existence of two types of inequivalent THF solvent molecules with different chemical environments and dynamical behavior. At low temperatures THF molecules perpendicularly arranged in between adjacent SWNT presumably exhibit a restricted rotation around their dipolar axis. At higher temperatures THF molecules are isotropically rotating and diffusing along the interstitial channels of the SWNT bundles. © 2011 Elsevier B.V. All rights reserved.

  10. 1H NMR study of the solvent THF concerning their structural and dynamical properties in chemically Li-intercalated SWNT

    KAUST Repository

    Schmid, Marc R.; Goze-Bac, Christophe; Bouhrara, Mohamed; Saih, Youssef; Mehring, Michael; Abou-Hamad, Edy

    2011-01-01

    Structural and dynamical properties of the THF solvent in single-walled carbon nanotubes intercalated with lithium are investigated by NMR. 1H NMR experiments reveal the existence of two types of inequivalent THF solvent molecules with different chemical environments and dynamical behavior. At low temperatures THF molecules perpendicularly arranged in between adjacent SWNT presumably exhibit a restricted rotation around their dipolar axis. At higher temperatures THF molecules are isotropically rotating and diffusing along the interstitial channels of the SWNT bundles. © 2011 Elsevier B.V. All rights reserved.

  11. Structure and magnetic properties of Alnico ribbons

    Science.gov (United States)

    Zhang, Ce; Li, Ying; Han, Xu-Hao; Du, Shuai-long; Sun, Ji-bing; Zhang, Ying

    2018-04-01

    Al-Ni-Co alloy has been widely applied in various industrial fields due to its excellent thermal and magnetic stability. In this paper, new Al-Ni-Co ribbons are prepared by simple processes combining melt-spinning with annealing, and their phase transition, microstructure and magnetic properties are studied. The results show that after as-spun ribbons are annealed, the grain size of ribbons increases from 1.1 ± 0.3 μm to 4.8 ± 0.8 μm, but still much smaller than that of the bulk Al-Ni-Co alloy manufactured by traditional technologies. In addition, some rod-like Al70Co20Ni10-type, Al9Co2-type and Fe2Nb-type phases are precipitated at grain boundaries; simultaneously, the distinct spinodal decomposition microstructure with periodic ingredient variation is thoroughly formed in all grains by the reaction of α → α1 + α2. Furthermore, the α1 and α2 distribute alternately like a maze, the Fe-Co-rich α1 phase holds 35.9-47.3 vol%, while the Al-Ni-rich α2 phase occupies the rest. Finally, the coercivity of annealed ribbons can reach to 485.3 ± 76.6 Oe. If the annealed ribbons are further aged at 560 °C, their Hc even increases to 738.1 ± 81.0 Oe. The coercivity mechanism is discussed by the combination of microstructure and domain structure.

  12. Interactions Between Charged Macroions Mediated by Molecules with Rod-like Charged Structures

    Directory of Open Access Journals (Sweden)

    Bohinc, K.

    2014-03-01

    Full Text Available A short review of recent theoretical advances in studies of the interaction between highly charged systems embedded in a solution of rod-like molecules is presented. The system is theoretically described by the functional density theory, where the correlations within the rod-like molecules are accounted for. We show that for sufficiently long molecules and large surface charge densities, an attractive force between like-charged surfaces arises due to the spatially distributed charges within the molecules. The added salt has an influence on the condition for the attractive force between like-charged surfaces. The theoretical results are compared with Monte Carlo simulations. Many phenomena motivate the study of the interaction between like-charged surfaces (DNA condensation, virus aggregation, yeast flocculation, cohesion of cement paste.

  13. GARN2: coarse-grained prediction of 3D structure of large RNA molecules by regret minimization.

    Science.gov (United States)

    Boudard, Mélanie; Barth, Dominique; Bernauer, Julie; Denise, Alain; Cohen, Johanne

    2017-08-15

    Predicting the 3D structure of RNA molecules is a key feature towards predicting their functions. Methods which work at atomic or nucleotide level are not suitable for large molecules. In these cases, coarse-grained prediction methods aim to predict a shape which could be refined later by using more precise methods on smaller parts of the molecule. We developed a complete method for sampling 3D RNA structure at a coarse-grained model, taking a secondary structure as input. One of the novelties of our method is that a second step extracts two best possible structures close to the native, from a set of possible structures. Although our method benefits from the first version of GARN, some of the main features on GARN2 are very different. GARN2 is much faster than the previous version and than the well-known methods of the state-of-art. Our experiments show that GARN2 can also provide better structures than the other state-of-the-art methods. GARN2 is written in Java. It is freely distributed and available at http://garn.lri.fr/. melanie.boudard@lri.fr or johanne.cohen@lri.fr. Supplementary data are available at Bioinformatics online. © The Author (2017). Published by Oxford University Press. All rights reserved. For Permissions, please email: journals.permissions@oup.com

  14. Crystal engineering of ibuprofen compounds: From molecule to crystal structure to morphology prediction by computational simulation and experimental study

    Science.gov (United States)

    Zhang, Min; Liang, Zuozhong; Wu, Fei; Chen, Jian-Feng; Xue, Chunyu; Zhao, Hong

    2017-06-01

    We selected the crystal structures of ibuprofen with seven common space groups (Cc, P21/c, P212121, P21, Pbca, Pna21, and Pbcn), which was generated from ibuprofen molecule by molecular simulation. The predicted crystal structures of ibuprofen with space group P21/c has the lowest total energy and the largest density, which is nearly indistinguishable with experimental result. In addition, the XRD patterns for predicted crystal structure are highly consistent with recrystallization from solvent of ibuprofen. That indicates that the simulation can accurately predict the crystal structure of ibuprofen from the molecule. Furthermore, based on this crystal structure, we predicted the crystal habit in vacuum using the attachment energy (AE) method and considered solvent effects in a systematic way using the modified attachment energy (MAE) model. The simulation can accurately construct a complete process from molecule to crystal structure to morphology prediction. Experimentally, we observed crystal morphologies in four different polarity solvents compounds (ethanol, acetonitrile, ethyl acetate, and toluene). We found that the aspect ratio decreases of crystal habits in this ibuprofen system were found to vary with increasing solvent relative polarity. Besides, the modified crystal morphologies are in good agreement with the observed experimental morphologies. Finally, this work may guide computer-aided design of the desirable crystal morphology.

  15. The electronic structure of molecules by a many-body approach. Pt. 1

    International Nuclear Information System (INIS)

    Niessen, W. von; Cederbaum, L.S.; Kraemer, W.P.

    1976-01-01

    The ionization potentials of benzene are studied by an ab initio many-body approach which includes the effects of electron correlation and reorganization beyond the one-particle approximation. The calculations confirm the assignment of the photoelectron spectrum experimentally proposed by Jonsson and Lindholm: 1esub(1g)(π), 2esub(2g), 1asub(2u)(π), 2esub(1u), 1bsub(2u), 1bsub(1u), 2asub(1g), 1esub(2g) in order of increasing binding energy. To definitely establish the ordering of the ionization potentials in the second band, which has been very controversial, the corresponding vibrational structure has been calculated. A number of one-electron properties are calculated in the one-particle approximation and compared to experimental work and other theoretical calculations. (orig.) [de

  16. Directional ratio based on parabolic molecules and its application to the analysis of tubular structures

    Science.gov (United States)

    Labate, Demetrio; Negi, Pooran; Ozcan, Burcin; Papadakis, Manos

    2015-09-01

    As advances in imaging technologies make more and more data available for biomedical applications, there is an increasing need to develop efficient quantitative algorithms for the analysis and processing of imaging data. In this paper, we introduce an innovative multiscale approach called Directional Ratio which is especially effective to distingush isotropic from anisotropic structures. This task is especially useful in the analysis of images of neurons, the main units of the nervous systems which consist of a main cell body called the soma and many elongated processes called neurites. We analyze the theoretical properties of our method on idealized models of neurons and develop a numerical implementation of this approach for analysis of fluorescent images of cultured neurons. We show that this algorithm is very effective for the detection of somas and the extraction of neurites in images of small circuits of neurons.

  17. Fast and General Method To Predict the Physicochemical Properties of Druglike Molecules Using the Integral Equation Theory of Molecular Liquids.

    Science.gov (United States)

    Palmer, David S; Mišin, Maksim; Fedorov, Maxim V; Llinas, Antonio

    2015-09-08

    We report a method to predict physicochemical properties of druglike molecules using a classical statistical mechanics based solvent model combined with machine learning. The RISM-MOL-INF method introduced here provides an accurate technique to characterize solvation and desolvation processes based on solute-solvent correlation functions computed by the 1D reference interaction site model of the integral equation theory of molecular liquids. These functions can be obtained in a matter of minutes for most small organic and druglike molecules using existing software (RISM-MOL) (Sergiievskyi, V. P.; Hackbusch, W.; Fedorov, M. V. J. Comput. Chem. 2011, 32, 1982-1992). Predictions of caco-2 cell permeability and hydration free energy obtained using the RISM-MOL-INF method are shown to be more accurate than the state-of-the-art tools for benchmark data sets. Due to the importance of solvation and desolvation effects in biological systems, it is anticipated that the RISM-MOL-INF approach will find many applications in biophysical and biomedical property prediction.

  18. Rationalizing the photophysical properties of BODIPY laser dyes via aromaticity and electron-donor-based structural perturbations

    Energy Technology Data Exchange (ETDEWEB)

    Waddell, Paul G.; Liu, Xiaogang; Zhao, Teng; Cole, Jacqueline M.

    2015-05-01

    The absorption and fluorescence properties of six boron dipyrromethene (BODIPY) laser dyes with simple non-aromatic substituents are rationalized by relating them to observable structural perturbations within the molecules of the dyes. An empirical relationship involving the structure and the optical properties is derived using a combination of single-crystal X-ray diffraction data, quantum chemical calculations and electronic constants: i.e. the tendency of the pyrrole bond lengths towards aromaticity and the UV-vis absorption and fluorescence wavelengths correlating with the electron-donor properties of the substituents. The effect of molecular conformation on the solid-state optical properties of the dyes is also discussed. The findings in this study also demonstrate the usefulness and limitations of using crystal structure data to develop structure-property relationships in this class of optical materials, contributing to the growing effort to design optoelectronic materials with tunable properties via molecular engineering.

  19. Structural, dielectric and electrical properties of ...

    Indian Academy of Sciences (India)

    Administrator

    Detailed studies of dielectric properties of the compound as a function of temperature at ... Microscope (Jeol, JSM-840), operated at 20 kV. The sin- tered pellet was .... grain boundaries, and provides the true picture of the electrical properties of ...

  20. Effects of sub-lethal high-pressure homogenization treatment on the outermost cellular structures and the volatile-molecule profiles of two strains of probiotic lactobacilli.

    Science.gov (United States)

    Tabanelli, Giulia; Vernocchi, Pamela; Patrignani, Francesca; Del Chierico, Federica; Putignani, Lorenza; Vinderola, Gabriel; Reinheimer, Jorge A; Gardini, Fausto; Lanciotti, Rosalba

    2015-01-01

    Applying sub-lethal levels of high-pressure homogenization (HPH) to lactic acid bacteria has been proposed as a method of enhancing some of their functional properties. Because the principal targets of HPH are the cell-surface structures, the aim of this study was to examine the effect of sub-lethal HPH treatment on the outermost cellular structures and the proteomic profiles of two known probiotic bacterial strains. Moreover, the effect of HPH treatment on the metabolism of probiotic cells within a dairy product during its refrigerated storage was investigated using SPME-GC-MS. Transmission electron microscopy was used to examine the microstructural changes in the outermost cellular structures due to HPH treatment. These alterations may be involved in the changes in some of the technological and functional properties of the strains that were observed after pressure treatment. Moreover, the proteomic profiles of the probiotic strains treated with HPH and incubated at 37°C for various periods showed different peptide patterns compared with those of the untreated cells. In addition, there were differences in the peaks that were observed in the low-mass spectral region (2000-3000 Da) of the spectral profiles of the control and treated samples. Due to pressure treatment, the volatile-molecule profiles of buttermilk inoculated with treated or control cells and stored at 4°C for 30 days exhibited overall changes in the aroma profile and in the production of molecules that improved its sensory profile, although the two different species imparted specific fingerprints to the product. The results of this study will contribute to understanding the changes that occur in the outermost cellular structures and the metabolism of LAB in response to HPH treatment. The findings of this investigation may contribute to elucidating the relationships between these changes and the alterations of the technological and functional properties of LAB induced by pressure treatment.

  1. Hydroxyl and water molecule orientations in trypsin: Comparison to molecular dynamics structures

    Energy Technology Data Exchange (ETDEWEB)

    McDowell, R.S.; Kossiakoff, A.A. [Genentech, Inc., South San Francisco, CA (United States)

    1994-12-31

    A comparison is presented of experimentally observed hydroxyl and water hydrogens in trypsin determined from neutron density maps with the results of a 140ps molecular dynamics (MD) simulation. Experimental determination of hydrogen and deuterium atom positions in molecules as large as proteins is a unique capability of neutron diffraction. The comparison addresses the degree to which a standard force-field approach can adequately describe the local electrostatic and van der Waals forces that determine the orientations of these hydrogens. Neutron densities, derived from 2.1{Angstrom} D{sub 2}O-H{sub 2}O difference Fourier maps, provide a database of 27 well-ordered hydroxyl hydrogens. Most of the simulated hydroxyl orientations are within a standard deviation of the experimentally-observed positions, including several examples in which both the simulation and the neutron density indicate that a hydroxyl group is shifted from a {open_quote}standard{close_quote} rotamer. For the most highly ordered water molecules, the hydrogen distributions calculated from the trajectory were in good agreement with neutron density; simulated water molecules that displayed multiple hydrogen bonding networks had correspondingly broadened neutron density profiles. This comparison was facilitated by development of a method to construct a pseudo 2{Angstrom} density map based on the hydrogen atom distributions from the simulation. The degree of disorder of internal water molecules is shown to result primarily from the electrostatic environment surrounding that water molecule as opposed to the cavity size available to the molecule. A method is presented for comparing the discrete observations sampled in a dynamics trajectory with the time- averaged data obtained from X-ray or neutron diffraction studies. This method is particularly useful for statically-disordered water molecules, in which the average location assigned from a trajectory may represent a site of relatively low occupancy.

  2. Post-Spaceflight (STS-135 Mouse Splenocytes Demonstrate Altered Activation Properties and Surface Molecule Expression.

    Directory of Open Access Journals (Sweden)

    Shen-An Hwang

    Full Text Available Alterations in immune function have been documented during or post-spaceflight and in ground based models of microgravity. Identification of immune parameters that are dysregulated during spaceflight is an important step in mitigating crew health risks during deep space missions. The in vitro analysis of leukocyte activity post-spaceflight in both human and animal species is primarily focused on lymphocytic function. This report completes a broader spectrum analysis of mouse lymphocyte and monocyte changes post 13 days orbital flight (mission STS-135. Analysis includes an examination in surface markers for cell activation, and antigen presentation and co-stimulatory molecules. Cytokine production was measured after stimulation with T-cell mitogen or TLR-2, TLR-4, or TLR-5 agonists. Splenocyte surface marker analysis immediate post-spaceflight and after in vitro culture demonstrated unique changes in phenotypic populations between the flight mice and matched treatment ground controls. Post-spaceflight splenocytes (flight splenocytes had lower expression intensity of CD4+CD25+ and CD8+CD25+ cells, lower percentage of CD11c+MHC II+ cells, and higher percentage of CD11c+MHC I+ populations compared to ground controls. The flight splenocytes demonstrated an increase in phagocytic activity. Stimulation with ConA led to decrease in CD4+ population but increased CD4+CD25+ cells compared to ground controls. Culturing with TLR agonists led to a decrease in CD11c+ population in splenocytes isolated from flight mice compared to ground controls. Consequently, flight splenocytes with or without TLR-agonist stimulation showed a decrease in CD11c+MHC I+, CD11c+MHC II+, and CD11c+CD86+ cells compared to ground controls. Production of IFN-γ was decreased and IL-2 was increased from ConA stimulated flight splenocytes. This study demonstrated that expression of surface molecules can be affected by conditions of spaceflight and impaired responsiveness persists under

  3. Effect of postdrawing temperature on structure, morphology and mechanical properties of melt-spun isotactic polypropylene tapes

    NARCIS (Netherlands)

    Loos, J.; Schimanski, T.

    2005-01-01

    Structure, morphology, and mechanical properties of melt-spun and postdrawn isotactic polypropylene (iPP) tapes are analyzed to study the effect of postdraw temperature applied. For affine drawing conditions, i.e., no effective relaxation of the molecules occurs during postdrawing, the Young's

  4. Structural properties of MHC class II ligands, implications for the prediction of MHC class II epitopes.

    Directory of Open Access Journals (Sweden)

    Kasper Winther Jørgensen

    2010-12-01

    Full Text Available Major Histocompatibility class II (MHC-II molecules sample peptides from the extracellular space allowing the immune system to detect the presence of foreign microbes from this compartment. Prediction of MHC class II ligands is complicated by the open binding cleft of the MHC class II molecule, allowing binding of peptides extending out of the binding groove. Furthermore, only a few HLA-DR alleles have been characterized with a sufficient number of peptides (100-200 peptides per allele to derive accurate description of their binding motif. Little work has been performed characterizing structural properties of MHC class II ligands. Here, we perform one such large-scale analysis. A large set of SYFPEITHI MHC class II ligands covering more than 20 different HLA-DR molecules was analyzed in terms of their secondary structure and surface exposure characteristics in the context of the native structure of the corresponding source protein. We demonstrated that MHC class II ligands are significantly more exposed and have significantly more coil content than other peptides in the same protein with similar predicted binding affinity. We next exploited this observation to derive an improved prediction method for MHC class II ligands by integrating prediction of MHC- peptide binding with prediction of surface exposure and protein secondary structure. This combined prediction method was shown to significantly outperform the state-of-the-art MHC class II peptide binding prediction method when used to identify MHC class II ligands. We also tried to integrate N- and O-glycosylation in our prediction methods but this additional information was found not to improve prediction performance. In summary, these findings strongly suggest that local structural properties influence antigen processing and/or the accessibility of peptides to the MHC class II molecule.

  5. Structure-properties relationships of polyhedral oligomeric silsesquioxane (POSS filled PS nanocomposites

    Directory of Open Access Journals (Sweden)

    J. J. Schwab

    2012-07-01

    Full Text Available The polyhedral oligomeric silsesquioxane (POSS additivated polystyrene (PS based nanocomposites were prepared by melt processing and the structure-properties relationships of the POSS-PS systems were compared to those of the neat PS. In order to investigate the effect of these structural parameters on the final properties of the polymer nanocomposites, five different kinds of POSS samples were used, in particular, POSS with different inorganic cage and with different organic pendent groups. The rheological investigation suggests clearly that the POSS acts as a plasticizer and that the processability of the PS was positively modified. The affinity between the POSS samples and the PS matrix was estimated by the calculated theoretical solubility parameters, considering the Hoy’s method and by morphology analysis. Minor difference between the solubility parameter of POSS and the matrix means better compatibility and no aggregation tendency. Furthermore, the POSS loading leads to a decrease of the rigidity, of the glass transition temperature and of the damping factor of the nanocomposite systems. The loading of different POSS molecules with open cage leads to a more pronounced effect on all the investigated properties that the loading of the POSS molecules with closed cage. Moreover, the melt properties are significantly influenced by the type of inorganic framework, by the type of the pendent organic groups and by the interaction between the POSS organic groups and the host matrix, while, the solid state properties appears to be influenced more by the kind of cage.

  6. Organizing and addressing magnetic molecules.

    Science.gov (United States)

    Gatteschi, Dante; Cornia, Andrea; Mannini, Matteo; Sessoli, Roberta

    2009-04-20

    Magnetic molecules ranging from simple organic radicals to single-molecule magnets (SMMs) are intensively investigated for their potential applications in molecule-based information storage and processing. The goal of this Article is to review recent achievements in the organization of magnetic molecules on surfaces and in their individual probing and manipulation. We stress that the inherent fragility and redox sensitivity of most SMM complexes, combined with the noninnocent role played by the substrate, ask for a careful evaluation of the structural and electronic properties of deposited molecules going beyond routine methods for surface analysis. Detailed magnetic information can be directly obtained using X-ray magnetic circular dichroism or newly emerging scanning probe techniques with magnetic detection capabilities.

  7. Properties of clusters in the gas phase: V. Complexes of neutral molecules onto negative ions

    International Nuclear Information System (INIS)

    Keesee, R.G.; Lee, N.; Castleman, A.W. Jr.

    1980-01-01

    Ion--molecules association reactions of the form A - (B)/sub n1/-+B=A - (B)/sub n/ were studied over a range of temperatures in the gas phase using high pressure mass spectrometry. Enthalpy and entropy changes were determined for the stepwise clustering reactions of (1) sulfur dioxide onto Cl - , I - , and NO 2 - with n ranging from one to three or four, and onto SO 2 - and SO 3 - with n equal to one; and (2) carbon dioxide onto Cl - , I - , NO 2 - , CO 3 - , and SO 3 - with n equal to one. From these data and earlier hydration results, the order of the magnitude of the enthalpy changes on the association of the first neutral for a series of negative ions was found to parallel the gas-phase basicity of those anions. For any given ion, the relative order of the addition enthalpies among the neutrals was found to be dependent on the polarizabilities of the neutrals and on the covalency in the ion-neutral bond. Dispersion of charge via covalent bonding was found to affect significantly the succeeding clustering steps

  8. Neuroprotective Properties of Mildronate, a Small Molecule, in a Rat Model of Parkinson’s Disease

    Directory of Open Access Journals (Sweden)

    Harry V. Vinters

    2010-11-01

    Full Text Available Previously, we have found that mildronate [3-(2,2,2-trimethylhydrazinium propionate dihydrate], a small molecule with charged nitrogen and oxygen atoms, protects mitochondrial metabolism that is altered by inhibitors of complex I and has neuroprotective effects in an azidothymidine-neurotoxicity mouse model. In the present study, we investigated the effects of mildronate in a rat model of Parkinson’s disease (PD that was generated via a unilateral intrastriatal injection of the neurotoxin 6-hydroxydopamine (6‑OHDA. We assessed the expression of cell biomarkers that are involved in signaling cascades and provide neural and glial integration: the neuronal marker TH (tyrosine hydroxylase; ubiquitin (a regulatory peptide involved in the ubiquitin-proteasome degradation system; Notch-3 (a marker of progenitor cells; IBA-1 (a marker of microglial cells; glial fibrillary acidic protein, GFAP (a marker of astrocytes; and inducible nitric oxide synthase, iNOS (a marker of inflammation. The data show that in the 6-OHDA-lesioned striatum, mildronate completely prevented the loss of TH, stimulated Notch-3 expression and decreased the expression of ubiquitin, GFAP and iNOS. These results provide evidence for the ability of mildronate to control the expression of an array of cellular proteins and, thus, impart multi-faceted homeostatic mechanisms in neurons and glial cells in a rat model of PD. We suggest that the use of mildronate provides a protective effect during the early stages of PD that can delay or halt the progression of this neurodegenerative disease.

  9. Tools to Understand Structural Property Relationships for Wood Cell Walls

    Science.gov (United States)

    Joseph E. Jakes; Daniel J. Yelle; Charles R. Frihart

    2011-01-01

    Understanding structure-property relationships for wood cell walls has been hindered by the complex polymeric structures comprising these cell walls and the difficulty in assessing meaningful mechanical property measurements of individual cell walls. To help overcome these hindrances, we have developed two experimental methods: 1) two-dimensional solution state nuclear...

  10. Flexible Nanocellulose - Nanoparticle Composites: Structures and Properties

    OpenAIRE

    UTHPALA MANAVI GARUSINGHE

    2018-01-01

    Nanocellulose is biodegradable and renewable and has many attractive properties of technological interest. Therefore, nanocellulose can be converted into thin films, which is used in wide range of applications. However, the property range achievable with nanocellulose by itself still has limitations. This thesis focuses on the production of nanocellulose-inorganic nanoparticle composites to combine the advantage associated with both individual components together to extend the range of proper...

  11. Observation of helix associations for insertion of a retinal molecule and distortions of helix structures in bacteriorhodopsin

    Science.gov (United States)

    Urano, Ryo; Okamoto, Yuko

    2015-12-01

    We applied a newly proposed prediction method for membrane protein structures to bacteriorhodopsin that has distorted transmembrane helices in the native structure. This method uses an implicit membrane model, which restricts sampling space during folding in a membrane region, and includes helix bending. Replica-exchange simulations were performed with seven transmembrane helices only without a retinal molecule. Obtained structures were classified into clusters of similar structures, which correspond to local-minimum free energy states. The two lowest free energy states corresponded to a native-like structure with the correct empty space for retinal and a structure with this empty space filled with a helix. Previous experiments of bacteriorhodopsin suggested that association of transmembrane helices enables them to make a room for insertion of a retinal. Our results are consistent with these results. Moreover, distortions of helices in the native-like structures were successfully reproduced. In the distortions, whereas the locations of kinks for all helices were similar to those of Protein Data Bank's data, the amount of bends was more similar for helices away from the retinal than for those close to the retinal in the native structure. This suggests a hypothesis that the amino-acid sequence specifies the location of kinks in transmembrane helices and that the amount of distortions depends on the interactions with the surrounding molecules such as neighboring helices, lipids, and retinal.

  12. Characterization of Structural and Configurational Properties of DNA by Atomic Force Microscopy.

    Science.gov (United States)

    Meroni, Alice; Lazzaro, Federico; Muzi-Falconi, Marco; Podestà, Alessandro

    2018-01-01

    We describe a method to extract quantitative information on DNA structural and configurational properties from high-resolution topographic maps recorded by atomic force microscopy (AFM). DNA molecules are deposited on mica surfaces from an aqueous solution, carefully dehydrated, and imaged in air in Tapping Mode. Upon extraction of the spatial coordinates of the DNA backbones from AFM images, several parameters characterizing DNA structure and configuration can be calculated. Here, we explain how to obtain the distribution of contour lengths, end-to-end distances, and gyration radii. This modular protocol can be also used to characterize other statistical parameters from AFM topographies.

  13. Organic bulk heterojunction photovoltaic structures: design, morphology and properties

    International Nuclear Information System (INIS)

    Bulavko, G V; Ishchenko, A A

    2014-01-01

    Main approaches to the design of organic bulk heterojunction photovoltaic structures are generalized and systematized. Novel photovoltaic materials based on fullerenes, organic dyes and related compounds, graphene, conjugated polymers and dendrimers are considered. The emphasis is placed on correlations between the chemical structure and properties of materials. The effect of morphology of the photoactive layer on the photovoltaic properties of devices is analyzed. Main methods of optimization of the photovoltaic properties are outlined. The bibliography includes 338 references

  14. Electronic structure and properties of rare earth and actinide intermetallics

    International Nuclear Information System (INIS)

    Kirchmayr, H.R.

    1984-01-01

    There are 188 contributions, experimental and theoretical, a few on rare earth and actinide elements but mostly on rare earth and actinide intermetallic compounds and alloys. The properties dealt with include 1) crystal structure, 2) magnetic properties and magnetic structure, 3) magnetic phase transformations and valence fluctuations, 4) electrical properties and superconductivity and their temperature, pressure and magnetic field dependence. A few papers deal with crystal growth and novel measuring methods. (G.Q.)

  15. A theoretical study of structural and electronic properties of pentacene/Al(100) interface.

    Science.gov (United States)

    Saranya, G; Nair, Shiny; Natarajan, V; Kolandaivel, P; Senthilkumar, K

    2012-09-01

    The first principle calculations within the framework of density functional theory have been performed for the pentacene molecule deposited on the aluminum Al(100) substrate to study the structural and electronic properties of the pentacene/Al(100) interface. The most stable configuration was found at bridge site with 45° rotation of the pentacene molecule on Al(100) surface with a vertical distance of 3.4 Å within LDA and 3.8 Å within GGA functionals. The calculated adsorption energy reveals that the adsorption of pentacene molecule on Al(100) surface is physisorption. For the stable adsorption geometry the electronic properties such as density of states (DOS), partial density of states (PDOS), Mulliken population analysis and Schottky barrier height are studied. The analysis of atomic charge, DOS and PDOS show that the charge is transferred from the Al(100) surface to pentacene molecule, and the transferred charge is about -0.05 electrons. For the adsorbed system, the calculated Schottky barrier height for hole and electron transport is 0.27 and 1.55 eV, respectively. Copyright © 2012 Elsevier Inc. All rights reserved.

  16. Nanostructured Silver Substrates With Stable and Universal SERS Properties: Application to Organic Molecules and Semiconductor Nanoparticles

    Directory of Open Access Journals (Sweden)

    Waurisch C

    2009-01-01

    Full Text Available Abstract Nanostructured silver films have been prepared by thermal deposition on silicon, and their properties as SERS substrates investigated. The optimal conditions of the post-growth annealing of the substrates were established. Atomic force microscopy study revealed that the silver films with relatively dense and homogeneous arrays of 60–80-nm high pyramidal nanoislands are the most efficient for SERS of both organic dye and inorganic nanoparticles analytes. The noticeable enhancement of the Raman signal from colloidal nanoparticles with the help of silver island films is reported for the first time.

  17. The effect of H- and J-aggregation on the photophysical and photovoltaic properties of small Thiophene–Pyridine–DPP molecules for bulk-heterojunction solar cells

    NARCIS (Netherlands)

    Más-Montoya, M.; Janssen, R.A.J.

    2017-01-01

    The performance of organic semiconductors in optoelectronic devices depends on the functional properties of the individual molecules and their mutual orientations when they are in the solid state. The effect of H- and J-aggregation on the photophysical properties and photovoltaic behavior of four

  18. Theoretical prediction of thermodynamic properties of tritiated beryllium molecules and application to ITER source term

    Energy Technology Data Exchange (ETDEWEB)

    Virot, F., E-mail: francois.virot@irsn.fr; Barrachin, M.; Souvi, S.; Cantrel, L.

    2014-10-15

    Highlights: • Standard enthalpies of formation of BeH, BeH{sub 2}, BeOH, Be(OH){sub 2} have been calculated. • The impact of hydrogen isotopy on thermodynamic properties has been shown. • Speciation in the vacuum vessel shows that the main tritiated species is tritiated steam. • Beryllium hydroxide and hydride could exist during an accidental event. - Abstract: By quantum chemistry calculations, we have evaluated the standard enthalpies of formation of some gaseous species of the Be-O-H chemical system: BeH, BeH{sub 2}, BeOH, Be(OH){sub 2} for which the values in the referenced thermodynamic databases (NIST-JANAF [1] or COACH [2]) were, due to the lack of experimental data, estimated or reported with a large uncertainty. Comparison between post-HF, DFT approaches and available experimental data allows validation of the ability of an accurate exchange-correlation functional, VSXC, to predict the thermo-chemical properties of the beryllium species of interest. Deviation of enthalpy of formation induced by changes in hydrogen isotopy has been also calculated. From these new theoretically determinated data, we have calculated the chemical speciation in conditions simulating an accident of water ingress in the vacuum vessel of ITER.

  19. Foundations of compositional models: structural properties

    Czech Academy of Sciences Publication Activity Database

    Jiroušek, Radim; Kratochvíl, Václav

    2015-01-01

    Roč. 44, č. 1 (2015), s. 2-25 ISSN 0308-1079 R&D Projects: GA ČR GA13-20012S Grant - others:GA ČR(CZ) GAP403/12/2175 Program:GA Institutional support: RVO:67985556 Keywords : multidimensional distribution * conditional independence * composition * semigraphoid properties * running intersection property Subject RIV: BA - General Mathematics Impact factor: 1.677, year: 2015 http://library.utia.cas.cz/separaty/2015/MTR/jirousek-0442412.pdf

  20. Structure, reactivity, and biological properties of hidantoines

    International Nuclear Information System (INIS)

    Oliveira, Silvania Maria de; Silva, Joao Bosco Paraiso da; Hernandes, Marcelo Zaldini; Lima, Maria do Carmo Alves de; Galdino, Suely Lins; Pitta, Ivan da Rocha

    2008-01-01

    Hydantoin (imidazolidine-2,4-dione) is a 2,4-diketotetrahydroimidazole discovered by Baeyer in 1861. Thiohydantoins and derivatives were prepared, having chemical properties similar to the corresponding carbonyl compounds. Some biological activities (antimicrobial, anticonvulsant, schistosomicidal) are attributed to the chemical reactivity and consequent affinity of hydantoinic rings towards biomacromolecules. Therefore, knowledge about the chemistry of hydantoins has increased enormously. In this review, we present important aspects such as reactivity of hydantoins, acidity of hydantoins, spectroscopy and crystallographic properties, and biological activities of hydantoin and its derivatives. (author)

  1. The influence of molecule size and structure on the lubricity of liquids: An experimental study

    DEFF Research Database (Denmark)

    Sivebæk, Ion Marius; Sorenson, Spencer C

    2002-01-01

    to stay liquid. Recently a lubricity test capable of handling DME was developed [1], as well as a volatile fuel viscometer [2]. As a result of this development it has become possible to test the lubricity of small hydrocarbons such as propane and butane as well as liquids with larger molecules...

  2. On the identification techniques for ionizing radiation structure breaks in the DNA molecule

    International Nuclear Information System (INIS)

    Kamluk, A.N.; Shirko, A.V.; Zhavarankau, I.S.

    2012-01-01

    In this paper, we propose a theoretical method for evaluation of the number and locations of single-strand breaks in DNA using a change in the passage of a longitudinal wave along the double helix. A linear chain of n interacting particles connected by a pair of springs is taken as a model of the DNA molecule. (authors)

  3. Local functional derivative of the total energy and the shell structure in atoms and molecules

    NARCIS (Netherlands)

    Pino, R.; Markvoort, Albert. J.; Santen, van R.A.; Hilbers, P.A.J.

    2003-01-01

    The full and local Thomas–Fermi–Dirac energy functional derivatives are evaluated at Hartree–Fock densities for several atoms and molecules. These functions are interpreted as local chemical potentials and related mainly to kinetic energy functional derivatives. They are able to reveal the shell

  4. Imaging Molecular Structure through Femtosecond Photoelectron Diffraction on Aligned and Oriented Gas-Phase Molecules

    DEFF Research Database (Denmark)

    Boll, Rebecca; Rouzee, Arnaud; Adolph, Marcus

    2014-01-01

    This paper gives an account of our progress towards performing femtosecond time-resolved photoelectron diffraction on gas-phase molecules in a pump-probe setup combining optical lasers and an X-ray Free-Electron Laser. We present results of two experiments aimed at measuring photoelectron angular...

  5. Spectroscopic and electric properties of the LiCs molecule: a coupled cluster study including higher excitations

    Science.gov (United States)

    Sørensen, L. K.; Fleig, T.; Olsen, J.

    2009-08-01

    Aimed at obtaining complete and highly accurate potential energy surfaces for molecules containing heavy elements, we present a new general-order coupled cluster method which can be applied in the framework of the spin-free Dirac formalism. As an initial application we present a systematic study of electron correlation and relativistic effects on the spectroscopic and electric properties of the LiCs molecule in its electronic ground state. In particular, we closely investigate the importance of excitations higher than coupled cluster doubles, spin-free and spin-dependent relativistic effects and the correlation of outer-core electrons on the equilibrium bond length, the harmonic vibrational frequency, the dissociation energy, the dipole moment and the static electric dipole polarizability. We demonstrate that our new implementation allows for highly accurate calculations not only in the bonding region but also along the complete potential curve. The quality of our results is demonstrated by a vibrational analysis where an almost complete set of vibrational levels has been calculated accurately.

  6. Spectroscopic and electric properties of the LiCs molecule: a coupled cluster study including higher excitations

    International Nuclear Information System (INIS)

    Soerensen, L K; Fleig, T; Olsen, J

    2009-01-01

    Aimed at obtaining complete and highly accurate potential energy surfaces for molecules containing heavy elements, we present a new general-order coupled cluster method which can be applied in the framework of the spin-free Dirac formalism. As an initial application we present a systematic study of electron correlation and relativistic effects on the spectroscopic and electric properties of the LiCs molecule in its electronic ground state. In particular, we closely investigate the importance of excitations higher than coupled cluster doubles, spin-free and spin-dependent relativistic effects and the correlation of outer-core electrons on the equilibrium bond length, the harmonic vibrational frequency, the dissociation energy, the dipole moment and the static electric dipole polarizability. We demonstrate that our new implementation allows for highly accurate calculations not only in the bonding region but also along the complete potential curve. The quality of our results is demonstrated by a vibrational analysis where an almost complete set of vibrational levels has been calculated accurately.

  7. Structural Characteristics and Physical Properties of Tectonically Deformed Coals

    OpenAIRE

    Yiwen Ju; Zhifeng Yan; Xiaoshi Li; Quanlin Hou; Wenjing Zhang; Lizhi Fang; Liye Yu; Mingming Wei

    2012-01-01

    Different mechanisms of deformation could make different influence on inner structure and physical properties of tectonically deformed coal (TDC) reservoirs. This paper discusses the relationship between macromolecular structure and physical properties of the Huaibei-Huainan coal mine areas in southern North China. The macromolecular structure and pore characteristics are systematically investigated by using techniques such as X-ray diffraction (XRD), high-resolution transmission electron mic...

  8. PDMS Network Structure-Property Relationships: Influence of Molecular Architecture on Mechanical and Wetting Properties

    Science.gov (United States)

    Melillo, Matthew Joseph

    Poly(dimethylsiloxane) (PDMS) is one of the most common elastomers, with applications ranging from sealants and marine-antifouling coatings to medical devices and absorbents for water treatment. Fundamental understanding of how liquids spread on the surface of and absorb into and leach out of PDMS networks is of critical importance for the design and use in another application - microfluidic devices. The growing use of PDMS in microfluidic devices raises the concern that some researchers may use this material without fully understanding all of its advantages, drawbacks, and intricacies. The primary goal of this Ph.D. dissertation is to elucidate PDMS network molecular structure to macroscopic property relationships and to demonstrate how molecular architecture can alter dynamic mechanical and wetting characteristics. We prepare PDMS materials by using vinyl/ tetrakis(dimethylsiloxy)silane (TDSS) and silanol/ tetraethylorthosilicate (TEOS) combinations of PDMS end-groups and crosslinkers as two model systems. Under constant curing conditions, we systematically study the effects of polymer molecular weight, loading of crosslinker, and end-group chemical functionality on the extent of gelation and the dynamic mechanical and water wetting properties of end-linked PDMS networks. The extent of the gelation reaction is determined using the Soxhlet extraction to quantify the amount of material that did and did not participate in the crosslinking reactions, termed the gel and sol fractions, respectively. We use the Miller-Macosko model in conjunction with the gel fraction and precise chemical composition (i.e., stoichiometric ratio and molecular weight) to determine the fractions of elastic and pendant material, the molecular weight between chemical crosslinks, and the average effective functionality of the crosslinker molecule. Based on dynamic mechanical testing, we find that the maximum storage moduli are achieved at optimal stoichiometric conditions in the vinyl

  9. Molecules in motion: influences of diffusion on metabolic structure and function in skeletal muscle.

    Science.gov (United States)

    Kinsey, Stephen T; Locke, Bruce R; Dillaman, Richard M

    2011-01-15

    Metabolic processes are often represented as a group of metabolites that interact through enzymatic reactions, thus forming a network of linked biochemical pathways. Implicit in this view is that diffusion of metabolites to and from enzymes is very fast compared with reaction rates, and metabolic fluxes are therefore almost exclusively dictated by catalytic properties. However, diffusion may exert greater control over the rates of reactions through: (1) an increase in reaction rates; (2) an increase in diffusion distances; or (3) a decrease in the relevant diffusion coefficients. It is therefore not surprising that skeletal muscle fibers have long been the focus of reaction-diffusion analyses because they have high and variable rates of ATP turnover, long diffusion distances, and hindered metabolite diffusion due to an abundance of intracellular barriers. Examination of the diversity of skeletal muscle fiber designs found in animals provides insights into the role that diffusion plays in governing both rates of metabolic fluxes and cellular organization. Experimental measurements of metabolic fluxes, diffusion distances and diffusion coefficients, coupled with reaction-diffusion mathematical models in a range of muscle types has started to reveal some general principles guiding muscle structure and metabolic function. Foremost among these is that metabolic processes in muscles do, in fact, appear to be largely reaction controlled and are not greatly limited by diffusion. However, the influence of diffusion is apparent in patterns of fiber growth and metabolic organization that appear to result from selective pressure to maintain reaction control of metabolism in muscle.

  10. Applications of the quasi-elastic light scattering to the study of dynamic properties of charged macro-molecules

    International Nuclear Information System (INIS)

    Gouesin-Menez, Renee

    1979-01-01

    The object of this research thesis is to study the modifications of dynamic properties of a macromolecule under the influence of variations of its medium, by using a frequency analysis of the spectrum of light scattered by a solution of particles. Thus, an important part of this thesis addresses the study and development of the scattering method and of its analysis by 'photon pulses', and the development and adjustment of an electrophoretic device to study light scattering by molecules submitted to an electric field. Then, hydrodynamic characteristics of some macromolecules have been measured with or without electric field. The studied molecular systems have been: calibrated spheres of latex polystyrene, a globular protein (bovine serum albumin), a polysaccharide (under the form of a rigid short stick), a flexible linear polyelectrolyte (polymethacrylate), and two DNA samples

  11. New STO(II-3Gmag family basis sets for the calculations of the molecules magnetic properties

    Directory of Open Access Journals (Sweden)

    Karina Kapusta

    2015-10-01

    Full Text Available An efficient approach for construction of physically justified STO(II-3Gmag family basis sets for calculation of molecules magnetic properties has been proposed. The procedure of construction based upon the taken into account the second order of perturbation theory in the magnetic field case. Analytical form of correction functions has been obtained using the closed representation of the Green functions by the solution of nonhomogeneous Schrödinger equation for the model problem of "one-electron atom in the external uniform magnetic field". Their performance has been evaluated for the DFT level calculations carried out with a number of functionals. The test calculations of magnetic susceptibility and 1H nuclear magnetic shielding tensors demonstrated a good agreement of the calculated values with the experimental data.

  12. Biokinetic data of various radioactive cationic molecules. An attempt at evaluation of significant chemical properties of myotropic agents

    International Nuclear Information System (INIS)

    Munze, R.; Kretzschmar, M.; Syhre, R.; Kampf, G.; Klotzer, D.; Guthert, I.; Bergmann, R.

    1986-01-01

    Research on lipophilic cationic radiopharmaceuticals has been established as an important field of modern radiopharmacology and experimental nuclear medicine. The present state is best demonstrated by scintigrams obtained with Tc-TBI (TBI = tertiary butylisocyanide). These images clearly reveal the advantage of these compounds, namely high information density, which resulted in an excellent delineation of activity accumulations, as well as the lasting drawback represented by partial overlapping of the right lobe of the liver in a certain region of the inferior wall of the heart. Current research is mainly focused on overcoming this disadvantage by synthesizing appropriate compounds with higher heart/liver uptake in man. A more sophisticated rationale than cationic charge and lipophilicity would be much appreciated. This paper deals with possible correlations between the biodistribution and biokinetics of such compounds, though not exclusively for technetium cations, and their important chemical properties such as composition, size, and polar regions within the lipophilic molecule, which are considered significant parameters

  13. Characterizing agosticity using the quantum theory of atoms in molecules: bond critical points and their local properties.

    Science.gov (United States)

    Tognetti, Vincent; Joubert, Laurent; Raucoules, Roman; De Bruin, Theodorus; Adamo, Carlo

    2012-06-07

    In this paper, we extend the work of Popelier and Logothetis [J. Organomet. Chem. 1998, 555, 101] on the characterization of agosticity by considerably enlarging the set of the studied organometallic molecules. To this aim, 23 representative complexes have been considered, including all first line transition metals at various oxidation states and exhibiting four types of agosticity (α, β, γ, and δ). From these examples, the concepts of agostic atom, agostic bond, and agostic interaction are defined and discussed, notably by advocating Bader's analysis of the electron density. The nature and the local properties of the bond critical points are then investigated, and the relationships with the main geometric parameters of the complexes are particularly examined. Moreover, new local descriptors based on kinetic energy densities are developed in order to provide new tools for bond characterization.

  14. Structural and elastic properties of porous silicon

    Energy Technology Data Exchange (ETDEWEB)

    Matthai, C C [Department of Physics and Astronomy, University of Wales College of Cardiff, Cardiff CF2 3YB (United Kingdom); Gavartin, J L [Department of Physics and Astronomy, University of Wales College of Cardiff, Cardiff CF2 3YB (United Kingdom); Cafolla, A A [Department of Physics, Dublin City University, Dublin (Ireland)

    1995-01-15

    We have implemented a modified diffusion-limited aggregation model to simulate the porous silicon structure obtained by electrochemical dissolution. The resulting fractal structures were fully equilibrated using the molecular dynamics method. An analysis of the relaxed structure shows it to be quite stable with the presence of one-, two- and three-coordinated atoms as well as the four-coordinated atoms found in bulk silicon. It is suggested that the different substructures or nanocrystals might be responsible for the observed photoluminescence. ((orig.))

  15. Adhesion molecules

    CERN Document Server

    Preedy, Victor R

    2016-01-01

    This book covers the structure and classification of adhesion molecules in relation to signaling pathways and gene expression. It discusses immunohistochemical localization, neutrophil migration, and junctional, functional, and inflammatory adhesion molecules in pathologies such as leukocyte decompression sickness and ischemia reperfusion injury. Highlighting the medical applications of current research, chapters cover diabetes, obesity, and metabolic syndrome; hypoxia; kidney disease; smoking, atrial fibrillation, and heart disease, the brain and dementia; and tumor proliferation. Finally, it looks at molecular imaging and bioinformatics, high-throughput technologies, and chemotherapy.

  16. Hydrothermal synthesis, crystal structure and luminescence property ...

    Indian Academy of Sciences (India)

    The design and construction of ... dination polymers. It is difficult to design coordination .... The first endotherm at about 180 ... graphic data for coordination polymer 1. ... Sheldrick G M 1997 SHELXS-97: Program for solution of crystal structures ...

  17. Electronic structure and optical properties of AIN under high pressure

    International Nuclear Information System (INIS)

    Li Zetao; Dang Suihu; Li Chunxia

    2011-01-01

    We have calculated the electronic structure and optical properties of Wurtzite structure AIN under different high pressure with generalized gradient approximation (GGA) in this paper. The total energy, density of state, energy band structure and optical absorption and reflection properties under high pressure are calculated. By comparing the changes of the energy band structure, we obtained AIN phase transition pressure for 16.7 GPa, which is a direct band structure transforming to an indirect band structure. Meanwhile, according to the density of states distribution and energy band structure, we analyzed the optical properties of AIN under high-pressure, the results showed that the absorption spectra moved from low-energy to high-energy. (authors)

  18. On some fundamental properties of structural topology optimization problems

    DEFF Research Database (Denmark)

    Stolpe, Mathias

    2010-01-01

    We study some fundamental mathematical properties of discretized structural topology optimization problems. Either compliance is minimized with an upper bound on the volume of the structure, or volume is minimized with an upper bound on the compliance. The design variables are either continuous o....... The presented examples can be used as teaching material in graduate and undergraduate courses on structural topology optimization....

  19. Structural and electrochemical properties of polythiophene

    Energy Technology Data Exchange (ETDEWEB)

    Senthilkumar, B.; Thenamirtham, P. [Solid State Ionics and Energy Devices Laboratory, Department of Physics, Bharathiar University, Coimbatore 641 046 (India); Kalai Selvan, R., E-mail: selvankram@buc.edu.in [Solid State Ionics and Energy Devices Laboratory, Department of Physics, Bharathiar University, Coimbatore 641 046 (India)

    2011-08-15

    Polythiophenes (PTs) were prepared by chemical oxidative polymerization method in presence and absence of three different (cationic - CTAB, anionic - SDS and non-ionic - Triton X-100) surfactants using FeCl{sub 3} as oxidant. The prepared PTs were characterized by FT-IR, UV-Vis, XRD, SEM and cyclic voltammetry studies. The FT-IR spectra inferred the polymerization of thiophene and elucidate the corresponding functional groups of PTs. Our results on the UV-Vis spectra demonstrate the n-{pi}* electronic transition of the conjugated molecules. Further the red shift in the absorption peak confirms the longer conjugation length of PTs. The amorphous nature of the PTs was inferred from the XRD pattern. The PTs prepared with surfactant exhibited different morphology compared to PT prepared without surfactant. The specific capacitances (SC) of the prepared PTs were calculated using cyclic voltammetry technique, the PT prepared with TRITRON X-100 exhibited higher SC of 117 F/g compared to SC of surfactant free PT (78 F/g). Hence, the PTs prepared with surfactants were found to be suitable electrode materials for redox supercapacitors.

  20. Structure-function-property-design interplay in biopolymers: spider silk.

    Science.gov (United States)

    Tokareva, Olena; Jacobsen, Matthew; Buehler, Markus; Wong, Joyce; Kaplan, David L

    2014-04-01

    Spider silks have been a focus of research for almost two decades due to their outstanding mechanical and biophysical properties. Recent advances in genetic engineering have led to the synthesis of recombinant spider silks, thus helping to unravel a fundamental understanding of structure-function-property relationships. The relationships between molecular composition, secondary structures and mechanical properties found in different types of spider silks are described, along with a discussion of artificial spinning of these proteins and their bioapplications, including the role of silks in biomineralization and fabrication of biomaterials with controlled properties. Copyright © 2013 Acta Materialia Inc. Published by Elsevier Ltd. All rights reserved.

  1. New membrane structures with proton conducting properties

    DEFF Research Database (Denmark)

    Nørgaard, Casper Frydendal

    if higher operating temperature is enabled. One approach to obtain improved membranes in the aspects of applicable operating temperature and methanol permeability, which has attracted considerable attention, is the formation of composites by distributing inorganic fillers into Nafion or alternative polymers...... temperature and high relative humidity can cause excessive swelling of the membranes, yielding insufficient mechanical properties and breakdown of membrane function. Moreover, in the case of the Direct Methanol Fuel Cell (DMFC), their significant methanol permeability causes loss of efficiency. Higher...

  2. Meteorite Unit Models for Structural Properties

    Science.gov (United States)

    Agrawal, Parul; Carlozzi, Alexander A.; Karajeh, Zaid S.; Bryson, Kathryn L.

    2017-10-01

    To assess the threat posed by an asteroid entering Earth’s atmosphere, one must predict if, when, and how it fragments during entry. A comprehensive understanding of the asteroid material properties is needed to achieve this objective. At present, the meteorite material found on earth are the only objects from an entering asteroid that can be used as representative material and be tested inside a laboratory. Due to complex composition, it is challenging and expensive to obtain reliable material properties by means of laboratory test for a family of meteorites. In order to circumvent this challenge, meteorite unit models are developed to determine the effective material properties including Young’s modulus, compressive and tensile strengths and Poisson’s ratio, that in turn would help deduce the properties of asteroids. The meteorite unit model is a representative volume that accounts for diverse minerals, porosity, cracks and matrix composition.The Young’s Modulus and Poisson’s Ratio in the meteorite units are calculated by performing several hundreds of Monte Carlo simulations by randomly distributing the various phases inside these units. Once these values are obtained, cracks are introduced in these units. The size, orientation and distribution of cracks are derived by CT-scans and visual scans of various meteorites. Subsequently, simulations are performed to attain stress-strain relations, strength and effective modulus values in the presence of these cracks. The meteorite unit models are presented for H, L and LL ordinary chondrites, as well as for terrestrial basalt. In the case of the latter, data from the simulations is compared with experimental data to validate the methodology. These meteorite unit models will be subsequently used in fragmentation modeling of full scale asteroids.

  3. Nanoemulsions: formation, structure, and physical properties

    International Nuclear Information System (INIS)

    Mason, T G; Wilking, J N; Meleson, K; Chang, C B; Graves, S M

    2006-01-01

    We summarize procedures for producing 'nanoemulsions' comprised of nanoscale droplets, or 'nanoemulsions', methods for controlling the droplet size distribution and composition, and interesting physical properties of nanoemulsions. In contrast to more common microscale emulsions, nanoemulsions exhibit optical transparency at high droplet volume fractions, φ, surprisingly strong elasticity at low φ, and enhanced diffusive transport and shelf stability. For these reasons, nanoemulsions have great potential in a wide range of industries including pharmaceuticals, foods, and personal care products. (topical review)

  4. Environmental effects on properties of structural alloys

    International Nuclear Information System (INIS)

    Chopra, O.K.; Smith, D.L.

    1984-01-01

    Corrosion data are presented for several austenitic and ferritic steels exposed at temperatures between 700 and 755 K in flowing lithium and Pb-17Li environments. The results indicate that dissolution rates for both steels are an order of magnitude greater in Pb-Li than in lithium. Tensile data for cold-worked type 316 stainless steel show that a flowing environment has no effect on the tensile properties of type 316 stainless steel at temperatures between 473 and 773 K

  5. Structure Property Relationships in Organic Conjugated Systems

    OpenAIRE

    O'Neill, Luke

    2008-01-01

    A series of pi(п) conjugated oligomers containing 1 to 6 monomer units were studied by absorption and photoluminescence spectroscopies. The results are discussed and examined with regard to the variation of the optical properties with the increase of effective conjugation length. It was found that there was a linear relationship between the positioning of the absorption and photoluminescence maxima plotted against inverse conjugation length. The relationships are in good agreement with the si...

  6. Electron beam crosslinked PVC : structure property relationships

    International Nuclear Information System (INIS)

    Gupta, Neeraj K.; Sabharwal, Sunil

    2001-01-01

    PVC is used extensively for its insulating properties for the manufacture of wires and cables and for other applications. Its gradual degradation, oxidation and even dehydro chlorination restricts use for long lasting period in installations such as high temperature zones, underground cables, communication systems, electro-nuclear facilities, etc. The technological properties and performance characteristics of PVC based insulation can be improved via crosslinking by high-energy electrons. PVC is however a polymer, which on irradiation predominantly undergoes degradation. To avoid degradation, it needs to be compounded with sensitizing agents or multifunctional monomers so that crosslinking is the predominant reaction. Radiation cross linkable formulations are complex mixtures of resin and various additives incorporated for achieving desired technological and performance characteristics, ease of processing and improving quality. The proper choice of additives and sensitizing agents enable low dose requirements for efficient crosslinking and improvements in various technological properties. The purposes of this work was to investigate the effect of using a binary sensitizer blend of a trifunctional monomer and a rubber in PVC, and develop suitable electron beam cross linkable formulations for wire insulation. This paper presents some aspects of the investigations and development of insulation demonstrated at industrial scale

  7. Antiandrogenic properties of parabens and other phenolic containing small molecules in personal care products

    Energy Technology Data Exchange (ETDEWEB)

    Jiangang, Chen [Center for Health and the Environment, University of California, Davis, CA 95616 (United States); Ahn, Ki Chang [Department of Entomology, University of California, Davis, CA 95616 (United States); Gee, Nancy A [Center for Health and the Environment, University of California, Davis, CA 95616 (United States); California National Primate Research Center, University of California, Davis, CA 95616 (United States); Gee, Shirley J [Department of Entomology, University of California, Davis, CA 95616 (United States); Hammock, Bruce D [Department of Entomology, University of California, Davis, CA 95616 (United States); Cancer Research Center, University of California, Davis, CA 95616 (United States); Lasley, Bill L [Center for Health and the Environment, University of California, Davis, CA 95616 (United States) and California National Primate Research Center, University of California, Davis, CA 95616 (United States)

    2007-06-15

    To identify the androgenic potency of commonly used antimicrobials, an in vitro androgen receptor-mediated transcriptional activity assay was employed to evaluate the androgenic/antiandrogenic activity of parabens and selected other antimicrobials containing a phenolic moiety. This cell-based assay utilizes a stably transfected cell line that lacks critical steroid metabolizing enzymes and is formatted in a 96-well format. At a concentration of 10 {mu}M, methyl-, propyl- and butyl-4-hydroxybenzoate (parabens) inhibited testosterone (T)-induced transcriptional activity by 40%, 33% and 19%, respectively (P < 0.05), while 4-hydroxybenzoic acid, the major metabolite of parabens, had no effect on T-induced transcriptional activity. Triclosan inhibited transcriptional activity induced by T by more than 92% at a concentration of 10 {mu}M, and 38.8% at a concentration of 1.0 {mu}M (P < 0.05). Thirty-four percent of T-induced transcriptional activity was inhibited by thymol at 10 {mu}M (P < 0.05). Cell proliferation and/or cytotoxicity were not observed in any of the treatments. None of the compounds appeared to be androgenic when tested individually without T. The data presented in this report demonstrate that some widely used antimicrobial compounds have antiandrogenic properties and warrant further investigation to fully understand their potential impact on human reproductive health.

  8. Antiandrogenic properties of parabens and other phenolic containing small molecules in personal care products

    International Nuclear Information System (INIS)

    Chen Jiangang; Ahn, Ki Chang; Gee, Nancy A.; Gee, Shirley J.; Hammock, Bruce D.; Lasley, Bill L.

    2007-01-01

    To identify the androgenic potency of commonly used antimicrobials, an in vitro androgen receptor-mediated transcriptional activity assay was employed to evaluate the androgenic/antiandrogenic activity of parabens and selected other antimicrobials containing a phenolic moiety. This cell-based assay utilizes a stably transfected cell line that lacks critical steroid metabolizing enzymes and is formatted in a 96-well format. At a concentration of 10 μM, methyl-, propyl- and butyl-4-hydroxybenzoate (parabens) inhibited testosterone (T)-induced transcriptional activity by 40%, 33% and 19%, respectively (P < 0.05), while 4-hydroxybenzoic acid, the major metabolite of parabens, had no effect on T-induced transcriptional activity. Triclosan inhibited transcriptional activity induced by T by more than 92% at a concentration of 10 μM, and 38.8% at a concentration of 1.0 μM (P < 0.05). Thirty-four percent of T-induced transcriptional activity was inhibited by thymol at 10 μM (P < 0.05). Cell proliferation and/or cytotoxicity were not observed in any of the treatments. None of the compounds appeared to be androgenic when tested individually without T. The data presented in this report demonstrate that some widely used antimicrobial compounds have antiandrogenic properties and warrant further investigation to fully understand their potential impact on human reproductive health

  9. Structure and properties of diamond and diamond-like films

    Energy Technology Data Exchange (ETDEWEB)

    Clausing, R.E. [Oak Ridge National Lab., TN (United States)

    1993-01-01

    This section is broken into four parts: (1) introduction, (2) natural IIa diamond, (3) importance of structure and composition, and (4) control of structure and properties. Conclusions of this discussion are that properties of chemical vapor deposited diamond films can compare favorably with natural diamond, that properties are anisotropic and are a strong function of structure and crystal perfection, that crystal perfection and morphology are functions of growth conditions and can be controlled, and that the manipulation of texture and thereby surface morphology and internal crystal perfection is an important step in optimizing chemically deposited diamond films for applications.

  10. Composition-structure-property relation of oxide glasses

    DEFF Research Database (Denmark)

    Hermansen, Christian

    also increases such properties. Yet, these rules are not strictly followed even for the simplest binary oxide glasses, such as alkali silicates, borates and phosphates. In this thesis it is argued that the missing link between composition and properties is the glass structure. Structural models...... are proposed based on topological selection rules and experimentally verified. The relation between structure and properties is evaluated using topological constraint theory, which in its essence is a theory that quantifies the two intuitions of the glass scientist. The end result is a quantitative model...

  11. Molecular structure and vibrational spectra of 6-methylquinoline and 8-methylquinoline molecules by quantum mechanical methods

    International Nuclear Information System (INIS)

    Kurt, M.

    2005-01-01

    The molecular geometry and vibrational frequencies of 6-methylquinoline(6MQ) and 8-methylquinolines(8MQ) in the ground state have been calculated by using the Hartree-Fock and density functional methods (B3LYP and BLYP) with 6-31G (d) as the basis set. The optimized geometric bond lengths obtained by using B3LYP and bond angles obtained by BLYP were given corresponding experimental values of similar molecule. Comparison of the observed fundamental vibrational frequencies of these molecules and calculated results by density functional B3LYP, BLYP and Hartree-Fock methods indicates that B3LYP is superior to the scaled Hartree- Fock and BLYP approach for molecular vibrational problems

  12. Structural elucidation of antihemorrhage drug molecule Diethylammonium 2,5-dihydroxybenzene sulfonate - an insilico approach

    Science.gov (United States)

    Kumar, S. Anil; Bhaskar, BL

    2018-02-01

    Ab-initio computational study of antihemorrhage drug molecule diethylammonium 2,5-dihydroxybenzene sulfonate, popularly known as ethamsylate, has been attempted using Gaussian 09. The optimized molecular geometry has been envisaged using density functional theory method at B3LYP/6-311 basis set. Different geometrical parameters like bond lengths and bond angles were computed and compared against the experimental results available in literature. Fourier transform infrared scanning of the title molecule was performed and vibrational frequencies were also computed using Gaussian software. The presence of O-H---O hydrogen bonds between C6H5O5S- anions and N-H---O hydrogen bonds between anion and cation is evident in the computational studies also. In general, satisfactory agreement of concordance has been observed between computational and experimental results.

  13. Interlayer Structure of Bioactive Molecule, 2-Aminoethanesulfonate, Intercalated into Calcium-Containing Layered Double Hydroxides

    Directory of Open Access Journals (Sweden)

    Tae-Hyun Kim

    2012-01-01

    Full Text Available We have successfully intercalated 2-aminoethanesulfonate, a well-known biomolecule taurine, into calcium-containing layered double hydroxides via optimized solid phase intercalation. According to X-ray diffraction patterns and infrared spectroscopy, it was revealed that the intercalated taurine molecules were each directly coordinated to other calcium cation and arranged in a zig-zag pattern. Scanning electron microscopy showed that the particle size and morphology of the LDHs were not affected by the solid phase intercalation, and the surface of intercalates was covered by organic moieties. From ninhydrin amine detection tests, we confirmed that most of the taurine molecules were well stabilized between the calcium-containing LDH layers.

  14. Structure and Magnetic Properties of Lanthanide Nanocrystals

    Energy Technology Data Exchange (ETDEWEB)

    Dickerson, James Henry [Vanderbilt Univ., Nashville, TN (United States)

    2014-06-01

    We have had considerable success on this project, particularly in the understanding of the relationship between nanostructure and magnetic properties in lanthanide nanocrystals. We also have successfully facilitated the doctoral degrees of Dr. Suseela Somarajan, in the Department of Physics and Astronomy, and Dr. Melissa Harrison, in the Materials Science Program. The following passages summarize the various accomplishments that were featured in 9 publications that were generated based on support from this grant. We thank the Department of Energy for their generous support of our research efforts in this area of materials science, magnetism, and electron microscopy.

  15. Electronic structure and properties of superheavy elements

    International Nuclear Information System (INIS)

    Pershina, V.

    2015-01-01

    Spectacular developments in the relativistic quantum theory and computational algorithms in the last few decades allowed for accurate calculations of properties of the superheavy elements (SHE) and their compounds. Often conducted in a close link to the experimental research, these investigations helped predict and interpret an outcome of sophisticated and expensive experiments with single atoms. Most of the works, particularly those related to the experimental studies, are overviewed in this publication. The role of relativistic effects being of paramount importance for the heaviest elements is elucidated.

  16. Study of the electronic structure at the interface between fluorene-1-carboxylic acid molecules and Cu(110)

    International Nuclear Information System (INIS)

    Song Fei; Mao Hongying; Guan Dandan; Dou Weidong; Zhang Hanjie; Li Haiyang; He Pimo; Bao Shining; Hofmann, Philip

    2009-01-01

    The interface electronic properties of fluorene-1-carboxylic acid (FC-1) adsorbed on Cu(110) have been studied by ultraviolet photoemission spectroscopy (UPS) and first-principles calculations. Both the molecular orbitals and the Cu valence band are significantly modified upon adsorption. FC-1 is chemically bonded to Cu(110) through charge donation and back donation involving the lowest unoccupied molecular orbital (LUMO) and the highest occupied molecular orbital (HOMO) of the molecule. An observed reduction of the work function can be attributed to the adsorption induced charge redistribution, and the positive interface dipole.

  17. Coronary plaque property evaluation by coronary CTA and its correlation with inflammatory molecules and MMPs/TIMPs

    Directory of Open Access Journals (Sweden)

    Wen-Bing Yang

    2017-11-01

    Full Text Available Objective: To study the evaluation value of coronary CTA for coronary plaque properties and its correlation with inflammatory molecules and MMPs/TIMPs. Methods: Patients who were diagnosed with acute coronary syndrome in Renmin Hospital of Wuhan University between August 2014 and December 2016 were selected as the ACS group of the research, patients who were diagnosed with stable angina pectoris were selected as the SAP group of the research, and healthy subjects who received physical examination during the same period were selected as the control group of the research. Coronary CTA was done to determine the coronary plaque properties of ACS group, and serum was collected from the three groups of subjects to determine the contents of inflammatory molecules and MMPs/TIMPs collagen metabolites. Results: Serum MIP-1α, MCP-1, sFGL-2, sCD14, CXCL5, I-CTP, III-CTP and EMMPRIN contents of ACS group and SAP group were higher than those of control group while TIMP1, TIMP2 contents were lower than those of control group; serum MIP-1α, MCP-1, sFGL-2, sCD14, CXCL5, I-CTP, III-CTP and EMMPRIN contents of ACS group were higher than those of SAP group while TIMP1 and TIMP2 contents were lower than those of SAP group. Serum MIP-1α, MCP-1, sFGL-2, sCD14, CXCL5, I-CTP, III-CTP and EMMPRIN contents of ACS patients with soft plaque and fibrous plaque were higher than those of ACS patients with calcified plaque while TIMP1 and TIMP2 contents were lower than those of ACS patients with calcified plaque; serum MIP-1α, MCP-1, sFGL-2, sCD14, CXCL5, I-CTP, III-CTP and EMMPRIN contents of ACS patients with soft plaque were higher than those of ACS patients with fibrous plaque while TIMP1, TIMP2 contents were lower than those of ACS patients with fibrous plaque. Conclusion: The coronary plaque property evaluation by coronary CTA is closely related to the changes of inflammatory response and MMPs/TIMPs collagen metabolism.

  18. The Structure and Flexural Properties of Typha Leaves

    Directory of Open Access Journals (Sweden)

    Jingjing Liu

    2017-01-01

    Full Text Available The Typha leaf has a structure of lightweight cantilever beam, exhibiting excellent mechanical properties with low density. Especially, the leaf blade evolved high strength and low density with high porosity. In this paper, the structure of Typha leaf was characterized by microcomputed tomography (Micro-CT and scanning electron microscopy (SEM, and the relationship with flexural properties was analyzed. The three-point bending test was performed on leaves to examine flexural properties, which indicated that the flexural properties vary from the base to the apex in gradient. The cross-sectional geometry shape of the leaf blade presented a strong influence on the optimized flexural stiffness. The load carrying capacity of the leaf depended on the development level of the epidermal tissue, the vascular bundle, the mechanical tissue, and the geometric properties. The investigation can be the basis for lightweight structure design and the application in the bionic engineering field.

  19. Fused aromatic thienopyrazines: structure, properties and function

    KAUST Repository

    Mondal, Rajib

    2010-01-01

    Recent development of a fused aromatic thieno[3.4-b]pyrazine system and their application in optoelectronic devices are reviewed. Introduction of a fused aromatic unit followed by side chain engineering, dramatically enhanced the charge carrier mobility in thin film transistor devices and mobilities up to 0.2 cm2/Vs were achieved. The optoelectronic properties of these fused aromatic thienopyrazine polymers (Eg = 1.3 to 1.6 eV, HOMO = -4.9 to -5.2 V) were tuned by introduction of various fused aromatic rings within thienopyrazine. By balancing the fundamental properties of these polymers, both high charge carrier mobilities and moderate PCEs in solar cells were achieved. Further, effects of copolymerizing units are discussed. Low band gap semiconducting polymer (Eg ∼ 1 eV) with high field effect mobility (0.044 cm2/Vs) was obtained using cyclopentadithiophene as copolymerizing unit. Finally, a molecular design approach to enhance the absorption coefficients is discussed, which resulted in improved power conversion efficiency in bulk heterojunction solar cells. © 2010 The Royal Society of Chemistry.

  20. Structures and anti-inflammatory properties of 4-halogenated -mofebutazones

    Science.gov (United States)

    Reichelt, Hendrik; Paradies, Henrich H.

    2018-02-01

    The crystal structures of the 4-halogenated (hal: F, Cl, Br)-4-butyl-1-phenyl-1,3-pyrolidine-dione (mofebutazone) are determined, and compared with their solution structures. The racemic 4-halogenated mofebutazone approximants crystallize in a monoclinic space group with four molecules in the unit cell. The 4-hal-mofebutazone molecules reveal strong hydrogen bonding between the hydrogen atom located at the N-2 nitrogen atom and a carbonyl oxygen atom of an adjacent 4-hal-mofebutazone molecule. The hydrogen bond angle for 4-Br-mifebutazone N (2)sbnd H (1)⋯O (1) is 173(3) °, so that the hydrogen bond is essentially linear indicating an infinite chain hydrogen bond network. The 3d and 2d structures are stabilized by π-π and σ-π interactions, short intermolecular distances, and apolar forces between adjacently stacked phenyl rings. Small-angle-X-ray scattering (SAXS) experiments and osmometric measurements reveal the presence of dimers for the 4-hal-mofebutazone molecules. Molecular simulations indicate similar solution structure factors for the 4-hal-mofebutazones solutions, S(Q), and in the solid state. There is a strong indication that the [1,1,0], [1,0,0], and [1,0,0] periodicities of the 4-Brsbnd , 4-Clsbnd and 4-F-mofebutazone in the crystalline solid state were also present in the solution phase. The biochemical and cellular activities of the different 4-hal-mofebutazones were monitored by the magnitude of their inhibition of the PGE2 biosynthesis through the cyclo-oxygenase (COX-1) in macrophages, and on the inhibition of LTD4 (5-lipoxygenase) in polymorphonuclear leukocytes.

  1. Open challenges in structure-based virtual screening: Receptor modeling, target flexibility consideration and active site water molecules description.

    Science.gov (United States)

    Spyrakis, Francesca; Cavasotto, Claudio N

    2015-10-01

    Structure-based virtual screening is currently an established tool in drug lead discovery projects. Although in the last years the field saw an impressive progress in terms of algorithm development, computational performance, and retrospective and prospective applications in ligand identification, there are still long-standing challenges where further improvement is needed. In this review, we consider the conceptual frame, state-of-the-art and recent developments of three critical "structural" issues in structure-based drug lead discovery: the use of homology modeling to accurately model the binding site when no experimental structures are available, the necessity of accounting for the dynamics of intrinsically flexible systems as proteins, and the importance of considering active site water molecules in lead identification and optimization campaigns. Copyright © 2015 Elsevier Inc. All rights reserved.

  2. Molecular structure determination from x-ray scattering patterns of laser-aligned symmetric-top molecules

    International Nuclear Information System (INIS)

    Ho, P. J.; Starodub, D.; Saldin, D. K.; Shneerson, V. L.; Ourmazd, A.; Santra, R.

    2009-01-01

    We investigate the molecular structure information contained in the x-ray diffraction patterns of an ensemble of rigid CF 3 Br molecules aligned by an intense laser pulse at finite rotational temperature. The diffraction patterns are calculated at an x-ray photon energy of 20 keV to probe molecular structure at angstrom-scale resolution. We find that a structural reconstruction algorithm based on iterative phase retrieval fails to extract a reliable structure. However, the high atomic number of Br compared with C or F allows each diffraction pattern to be treated as a hologram. Using this approach, the azimuthal projection of the molecular electron density about the alignment axis may be retrieved.

  3. Structural, optical and electrical properties of chemically deposited ...

    Indian Academy of Sciences (India)

    Structural, optical and electrical properties of chemically deposited nonstoichiometric copper ... One of these compounds, CuInSe2, with its optical absorption .... is clear from SEM images that the number of grains goes on increasing with the ...

  4. Structural properties of carbon nanotubes derived from 13C NMR

    KAUST Repository

    Abou-Hamad, E.; Babaa, M.-R.; Bouhrara, M.; Kim, Y.; Saih, Y.; Dennler, S.; Mauri, F.; Basset, Jean-Marie; Goze-Bac, C.; Wå gberg, T.

    2011-01-01

    We present a detailed experimental and theoretical study on how structural properties of carbon nanotubes can be derived from 13C NMR investigations. Magic angle spinning solid state NMR experiments have been performed on single- and multiwalled

  5. Thermodynamical properties and thermoelastic coupling of complex macroscopic structure

    International Nuclear Information System (INIS)

    Fabbri, M.; Sacripanti, A.

    1996-11-01

    Gross qualitative/quantitative analysis about thermodynamical properties and thermoelastic coupling (or elastocaloric effect) of complex macroscopic structure (running shoes) is performed by infrared camera. The experimental results showed the achievability of a n industrial research project

  6. Detonation-synthesis nanodiamonds: synthesis, structure, properties and applications

    Energy Technology Data Exchange (ETDEWEB)

    Dolmatov, Valerii Yu [Federal State Unitary Enterprise Special Design-Technology Bureau (FSUE SDTB) ' ' Tekhnolog' ' at the St Petersburg State Institute of Technology (Technical University) (Russian Federation)

    2007-04-30

    The review outlines the theoretical foundations and industrial implementations of modern detonation synthesis of nanodiamonds and chemical purification of the nanodiamonds thus obtained. The structure, key properties and promising fields of application of detonation-synthesis nanodiamonds are considered.

  7. Detonation-synthesis nanodiamonds: synthesis, structure, properties and applications

    International Nuclear Information System (INIS)

    Dolmatov, Valerii Yu

    2007-01-01

    The review outlines the theoretical foundations and industrial implementations of modern detonation synthesis of nanodiamonds and chemical purification of the nanodiamonds thus obtained. The structure, key properties and promising fields of application of detonation-synthesis nanodiamonds are considered.

  8. Manganites in Perovskite Superlattices: Structural and Electronic Properties

    KAUST Repository

    Jiwuer, Jilili

    2016-01-01

    Perovskite manganites are widely investigated compounds due to the discovery of the colossal magnetoresistance effect in 1994. They have a broad range of structural, electronic, magnetic properties and potential device applications in sensors

  9. Unveiling DNA structural properties of promoter regions of ...

    Indian Academy of Sciences (India)

    Aditya Kumar

    Unveiling DNA structural properties of promoter regions of prokaryotic transcriptome and their role in gene expression. Aditya Kumar. Assistant Professor. Molecular Biology & Biotechnology. Tezpur University. Tezpur – 784028, Assam ...

  10. Structure, health benefits, antioxidant property and processing and ...

    African Journals Online (AJOL)

    Structure, health benefits, antioxidant property and processing and storage of carotenoids. ... It is sensitive to heat, light and oxygen. Enzymatic ... Thermal treatment and freezing increases the extractability of b-carotene from the food matrices.

  11. Effect of spin polarization on the structural properties and bond ...

    Indian Academy of Sciences (India)

    ties such as structural, hardness, Young modulus and frac- ture toughness ... measurements showed that hardness ranged between 14.5 and 19GPa ... the relative binding forces, is a useful fundamental property. ..... strength [36,39]. Zhang et ...

  12. Ground state structures and properties of small hydrogenated silicon

    Indian Academy of Sciences (India)

    Unknown

    To understand the structural evolutions and properties of silicon cluster due to hydrogenation ... partly due to the growing importance of these systems in applications like .... of the system. Using the Lagrangian (1), equations of motions for the.

  13. Medicinal chemistry of small molecule CCR5 antagonists for blocking HIV-1 entry: a review of structural evolution.

    Science.gov (United States)

    Tian, Ye; Zhang, Dujuan; Zhan, Peng; Liu, Xinyong

    2014-01-01

    CCR5, a member of G protein-coupled receptors superfamily, plays an important role in the HIV-1 entry process. Antagonism of this receptor finally leads to the inhibition of R5 strains of HIV entry into the human cells. The identification of CCR5 antagonists as antiviral agents will provide more option for HAART. Now, more than a decade after the first small molecule CCR5 inhibitor was discovered, great achievements have been made. In this article, we will give a brief introduction of several series of small molecule CCR5 antagonists, focused on their appealing structure evolution, essential SAR information and thereof the enlightenment of strategies on CCR5 inhibitors design.

  14. Cavity mutants of Savinase. Crystal structures and differential scanning calorimetry experiments give hints of the function of the buried water molecules in subtilisins.

    Science.gov (United States)

    Pedersen, J T; Olsen, O H; Betzel, C; Eschenburg, S; Branner, S; Hastrup, S

    1994-09-23

    The subtilisin molecule possesses several internal water molecules, which may be characterised as an integral part of the protein structure. We have introduced specific mutations (T71I, T71S, T71V, T71A and T71G) at position 71 in the subtilisin variant Savinase from Bacillus lentus. This position is involved in a hydrogen bonded network with several internal water molecules, forming a water channel. The water channel and most of the other internal water molecules are positioned in the interface between two half-domains of the subtilisin molecule. The data presented here indicate that the internal water molecules are structural, and may be the result of trapping during the folding process.

  15. Structure-Property Relationships in Polycyanurate / Graphene Networks

    Science.gov (United States)

    2015-12-12

    Briefing Charts 3. DATES COVERED (From - To) 17 Nov 2015 – 12 Dec 2015 4. TITLE AND SUBTITLE Structure-Property Relationships in Polycyanurate...ANSI Std. 239.18 1 DISTRIBUTION STATEMENT A. Approved for public release; distribution is unlimited. Structure-Property Relationships in...the attractive processing characteristics of LECy are retained in graphene oxide / LECy mixtures. Impurities, such as aryl phenols and transition metals

  16. Mechanical properties along interfaces of bonded structures in fusion reactors

    International Nuclear Information System (INIS)

    Hassan, M.H.; Kulcinski, G.L.

    1993-01-01

    Proper assessment of the mechanical properties along interfaces of bonded structures currently used in many fusion reactor designs is essential to compare the different fabrication techniques. A Mechanical Properties Microprobe (MPM) was used to measure hardness and Young's modules along the interfaces of Be/Cu bonded structure. The MPM was able to distinguish different fabrication techniques by a direct measurement of the hardness, Young's modules, and H/E 2 which reflects the ability of deformation of the interfacial region

  17. Molecular Properties by Quantum Monte Carlo: An Investigation on the Role of the Wave Function Ansatz and the Basis Set in the Water Molecule

    Science.gov (United States)

    Zen, Andrea; Luo, Ye; Sorella, Sandro; Guidoni, Leonardo

    2014-01-01

    Quantum Monte Carlo methods are accurate and promising many body techniques for electronic structure calculations which, in the last years, are encountering a growing interest thanks to their favorable scaling with the system size and their efficient parallelization, particularly suited for the modern high performance computing facilities. The ansatz of the wave function and its variational flexibility are crucial points for both the accurate description of molecular properties and the capabilities of the method to tackle large systems. In this paper, we extensively analyze, using different variational ansatzes, several properties of the water molecule, namely, the total energy, the dipole and quadrupole momenta, the ionization and atomization energies, the equilibrium configuration, and the harmonic and fundamental frequencies of vibration. The investigation mainly focuses on variational Monte Carlo calculations, although several lattice regularized diffusion Monte Carlo calculations are also reported. Through a systematic study, we provide a useful guide to the choice of the wave function, the pseudopotential, and the basis set for QMC calculations. We also introduce a new method for the computation of forces with finite variance on open systems and a new strategy for the definition of the atomic orbitals involved in the Jastrow-Antisymmetrised Geminal power wave function, in order to drastically reduce the number of variational parameters. This scheme significantly improves the efficiency of QMC energy minimization in case of large basis sets. PMID:24526929

  18. High-performance ceramics. Fabrication, structure, properties

    International Nuclear Information System (INIS)

    Petzow, G.; Tobolski, J.; Telle, R.

    1996-01-01

    The program ''Ceramic High-performance Materials'' pursued the objective to understand the chaining of cause and effect in the development of high-performance ceramics. This chain of problems begins with the chemical reactions for the production of powders, comprises the characterization, processing, shaping and compacting of powders, structural optimization, heat treatment, production and finishing, and leads to issues of materials testing and of a design appropriate to the material. The program ''Ceramic High-performance Materials'' has resulted in contributions to the understanding of fundamental interrelationships in terms of materials science, which are summarized in the present volume - broken down into eight special aspects. (orig./RHM)

  19. Structural and energetic properties of La3+ in water/DMSO mixtures

    Science.gov (United States)

    Montagna, Maria; Spezia, Riccardo; Bodo, Enrico

    2017-11-01

    By using molecular dynamics based on a custom polarizable force field, we have studied the solvation of La3+ in an equimolar mixture of dimethylsulfoxide (DMSO) with water. An extended structural analysis has been performed to provide a complete picture of the physical properties at the basis of the interaction of La3+ with both solvents. Through our simulations we found that, very likely, the first solvation shell in the mixture is not unlike the one found in pure water or pure DMSO and contains 9 solvent molecules. We have also found that the solvation is preferentially due to DMSO molecules with the water initially present in first shell quickly leaving to the bulk. The dehydration process of the first shell has been analyzed by both plain MD simulations and a constrained dynamics approach; the free energy profiles for the extraction of water from first shell have also been computed.

  20. Structural and dynamical properties of water confined between two hydrophilic surfaces

    Energy Technology Data Exchange (ETDEWEB)

    Di Napoli, Solange, E-mail: dinapoli@tandar.cnea.gov.a [Depto. de Fisica - CAC, Comision Nacional de Energia Atomica, Av. Gral Paz 1499, (1650) San Martin, Buenos Aires (Argentina); Consejo Nacional de Investigaciones Cientificas y Tecnicas (Argentina); Gamba, Zulema, E-mail: gamba@tandar.cnea.gov.a [Depto. de Fisica - CAC, Comision Nacional de Energia Atomica, Av. Gral Paz 1499, (1650) San Martin, Buenos Aires (Argentina)

    2009-10-01

    The properties of water in the vicinity of surfaces and under confinement have been extensively studied because of the relevance of a quantitative understanding of many processes that not only take place in biological systems, like cells, membranes and microemulsions, but also in many others such as confined water in rocks, ionic channels and interestellar matter. In this work we perform molecular dynamic calculations of the nanoscopic structure of TIP5P model water confined between two hydrophilic surfaces. We calculate the diffusion coefficients and the atomic density profile of water molecules and polar ions in the system as a function of the number of water molecules per amphiphilic (n{sub W}). We also study the dependence of the water layer thickness and the profiles of water dipole orientation with this parameter.

  1. Structural and dynamical properties of water confined between two hydrophilic surfaces

    International Nuclear Information System (INIS)

    Di Napoli, Solange; Gamba, Zulema

    2009-01-01

    The properties of water in the vicinity of surfaces and under confinement have been extensively studied because of the relevance of a quantitative understanding of many processes that not only take place in biological systems, like cells, membranes and microemulsions, but also in many others such as confined water in rocks, ionic channels and interestellar matter. In this work we perform molecular dynamic calculations of the nanoscopic structure of TIP5P model water confined between two hydrophilic surfaces. We calculate the diffusion coefficients and the atomic density profile of water molecules and polar ions in the system as a function of the number of water molecules per amphiphilic (n W ). We also study the dependence of the water layer thickness and the profiles of water dipole orientation with this parameter.

  2. Structure and properties of molecular and ionic clusters in vapour over caesium fluoride

    Science.gov (United States)

    Mwanga, Stanley F.; Pogrebnaya, Tatiana P.; Pogrebnoi, Alexander M.

    2015-06-01

    The properties of neutral molecules Cs2F2, Cs3F3, and Cs4F4, and positive and negative cluster ions Cs2F+, CsF2-, Cs3F2+, Cs2F3-, Cs4F3+, and Cs5F4+ were studied by several of quantum chemical methods implementing density function theory and Möller-Plesset perturbation theory of second and fourth orders. For all species, the equilibrium geometrical structure and vibrational spectra were determined. Different isomers have been revealed for the trimer neutral molecule Cs3F3; pentaatomic, both positive and negative, Cs3F2+, Cs2F3-; and heptaatomic Cs4F3+ ions. The most abundant isomers in the saturated vapour were determined. Enthalpies of dissociation reactions and enthalpies of formation of the species were obtained.

  3. Determining the Mechanical Properties of Lattice Block Structures

    Science.gov (United States)

    Wilmoth, Nathan

    2013-01-01

    Lattice block structures and shape memory alloys possess several traits ideal for solving intriguing new engineering problems in industries such as aerospace, military, and transportation. Recent testing at the NASA Glenn Research Center has investigated the material properties of lattice block structures cast from a conventional aerospace titanium alloy as well as lattice block structures cast from nickel-titanium shape memory alloy. The lattice block structures for both materials were sectioned into smaller subelements for tension and compression testing. The results from the cast conventional titanium material showed that the expected mechanical properties were maintained. The shape memory alloy material was found to be extremely brittle from the casting process and only compression testing was completed. Future shape memory alloy lattice block structures will utilize an adjusted material composition that will provide a better quality casting. The testing effort resulted in baseline mechanical property data from the conventional titanium material for comparison to shape memory alloy materials once suitable castings are available.

  4. Using nonlinearity and spatiotemporal property modulation to control effective structural properties: dynamic rods

    DEFF Research Database (Denmark)

    Thomsen, Jon Juel; Blekhman, Iliya I.

    2007-01-01

    What are the effective properties of a generally nonlinear material or structure, whose local properties are modulated in both space and time? It has been suggested to use spatiotemporal modulation of structural properties to create materials and structures with adjustable effective properties......, and to call these dynamic materials or spatiotemporal composites. Also, according to theoretical predictions, structural nonlinearity enhances the possibilities of achieving specific effective properties. For example, with an elastic rod having cubical elastic nonlinearities, it seems possible to control......, and exemplified. Then simple approximate analytical expressions are derived for the effective wave speed and natural frequencies for one-dimensional wave propagation in a nonlinear elastic rod, where the spatiotemporal modulation is imposed as a high-frequency standing wave, supposed to be given. Finally the more...

  5. The effect of hot multistage drawing on molecular structure and optical properties of polyethylene terephthalate fibers

    Directory of Open Access Journals (Sweden)

    Aminoddin Haji

    2012-08-01

    Full Text Available In this work, mechanical and structural parameters related to the optical properties of polyethylene terephthalate (PET fibers drawn at hot multistage have been investigated. The changes in optical parameters upon changing draw ratio are used to obtain the mechanical orientation factors and , various orientation functions f2(θ, f4(θ and f6(θ, and amorphous and crystalline orientation functions (f a and f c. Also, the numbers of random links between the network junction points (N1, the average optical orientation (Fav, and the distribution function of segment ω(cos θ were calculated. In addition, an empirical formula was suggested to correlate changes in the birefringence with the draw ratio and its constants were determined. The study demonstrated change on the molecular orientation functions and structural parameters upon hot multistage drawing. Significant variations in the characteristic properties of the drawn PET fibers were due to reorientation of the molecules caused by applied heat and external tension.

  6. Novel polymeric potassium complex: Its synthesis, structural characterization, photoluminescence and electrochemical properties

    Energy Technology Data Exchange (ETDEWEB)

    Ceyhan, Goekhan [Chemistry Department, K.Maras Suetcue Imam University, 46100 K.Maras (Turkey); Tuemer, Mehmet, E-mail: mtumer@ksu.edu.tr [Chemistry Department, K.Maras Suetcue Imam University, 46100 K.Maras (Turkey); Koese, Muhammet; McKee, Vickie [Chemistry Department, Loughborough University, LE11 3TU Leicestershire (United Kingdom)

    2012-03-15

    In this paper, we obtained a novel poly(vanillinato potassium) complex (PVP) as a single crystal and characterized by analytical and spectroscopic methods. A single crystal of the PVP was obtained from the acetone solution. X-ray structural data show that crystals contain polymeric K{sup +} complex of vanillin. Each potassium ion in the polymeric structure is identical and seven-coordinate, bonded to two methoxy, two phenoxy and three aldehyde oxygen atoms from four vaniline molecules. Two aldehyde oxygen atoms are bridging between potassium ions. It crystallizes in the monoclinic system, space group P2{sub 1}/c, with lattice parameters a=9.6215(10) A, b=17.4139(19) A, c=9.6119(10) A, {beta}=100.457(2) Degree-Sign and Z=4. Thermal properties of the PVP were investigated by TGA, DTA and DSC methods. The electrochemical properties of the complex were studied in different solvents and at various scan rates. The luminescence properties of the complex in different solvents and at different pH values have been investigated. The results show that the complex exhibits more efficient luminescence property in CH{sub 3}CN and n-butanol. - Highlights: Black-Right-Pointing-Pointer Novel polymeric potassium complex was prepared and fully characterized. Black-Right-Pointing-Pointer X-ray crystal structure of complex was reported. Black-Right-Pointing-Pointer Electrochemical properties of compound were investigated. Black-Right-Pointing-Pointer Thermal and DSC measurements of complex were examined.

  7. Structure and electronic properties of azadirachtin.

    Science.gov (United States)

    de Castro, Elton A S; de Oliveira, Daniel A B; Farias, Sergio A S; Gargano, Ricardo; Martins, João B L

    2014-02-01

    We performed a combined DFT and Monte Carlo (13)C NMR chemical-shift study of azadirachtin A, a triterpenoid that acts as a natural insect antifeedant. A conformational search using a Monte Carlo technique based on the RM1 semiempirical method was carried out in order to establish its preferred structure. The B3LYP/6-311++G(d,p), wB97XD/6-311++G(d,p), M06/6-311++G(d,p), M06-2X/6-311++G(d,p), and CAM-B3LYP/6-311++G(d,p) levels of theory were used to predict NMR chemical shifts. A Monte Carlo population-weighted average spectrum was produced based on the predicted Boltzmann contributions. In general, good agreement between experimental and theoretical data was obtained using both methods, and the (13)C NMR chemical shifts were predicted highly accurately. The geometry was optimized at the semiempirical level and used to calculate the NMR chemical shifts at the DFT level, and these shifts showed only minor deviations from those obtained following structural optimization at the DFT level, and incurred a much lower computational cost. The theoretical ultraviolet spectrum showed a maximum absorption peak that was mainly contributed by the tiglate group.

  8. Pathways to Structure-Property Relationships of Peptide-Materials Interfaces: Challenges in Predicting Molecular Structures.

    Science.gov (United States)

    Walsh, Tiffany R

    2017-07-18

    An in-depth appreciation of how to manipulate the molecular-level recognition between peptides and aqueous materials interfaces, including nanoparticles, will advance technologies based on self-organized metamaterials for photonics and plasmonics, biosensing, catalysis, energy generation and harvesting, and nanomedicine. Exploitation of the materials-selective binding of biomolecules is pivotal to success in these areas and may be particularly key to producing new hierarchically structured biobased materials. These applications could be accomplished by realizing preferential adsorption of a given biomolecule onto one materials composition over another, one surface facet over another, or one crystalline polymorph over another. Deeper knowledge of the aqueous abiotic-biotic interface, to establish clear structure-property relationships in these systems, is needed to meet this goal. In particular, a thorough structural characterization of the surface-adsorbed peptides is essential for establishing these relationships but can often be challenging to accomplish via experimental approaches alone. In addition to myriad existing challenges associated with determining the detailed molecular structure of any molecule adsorbed at an aqueous interface, experimental characterization of materials-binding peptides brings new, complex challenges because many materials-binding peptides are thought to be intrinsically disordered. This means that these peptides are not amenable to experimental techniques that rely on the presence of well-defined secondary structure in the peptide when in the adsorbed state. To address this challenge, and in partnership with experiment, molecular simulations at the atomistic level can bring complementary and critical insights into the origins of this abiotic/biotic recognition and suggest routes for manipulating this phenomenon to realize new types of hybrid materials. For the reasons outlined above, molecular simulation approaches also face

  9. The peptide-receptive transition state of MHC-1 molecules: Insight from structure and molecular dynamics

    Energy Technology Data Exchange (ETDEWEB)

    Robinson H.; Mage, M.; Dolan, M.; Wang, R.; Boyd, L.; Revilleza, M.; Natarajan, K.; Myers, N.; Hansen, T.; Margulies, D.

    2012-05-01

    MHC class I (MHC-I) proteins of the adaptive immune system require antigenic peptides for maintenance of mature conformation and immune function via specific recognition by MHC-I-restricted CD8(+) T lymphocytes. New MHC-I molecules in the endoplasmic reticulum are held by chaperones in a peptide-receptive (PR) transition state pending release by tightly binding peptides. In this study, we show, by crystallographic, docking, and molecular dynamics methods, dramatic movement of a hinged unit containing a conserved 3(10) helix that flips from an exposed 'open' position in the PR transition state to a 'closed' position with buried hydrophobic side chains in the peptide-loaded mature molecule. Crystallography of hinged unit residues 46-53 of murine H-2L(d) MHC-I H chain, complexed with mAb 64-3-7, demonstrates solvent exposure of these residues in the PR conformation. Docking and molecular dynamics predict how this segment moves to help form the A and B pockets crucial for the tight peptide binding needed for stability of the mature peptide-loaded conformation, chaperone dissociation, and Ag presentation.

  10. Fast electron transfer through a single molecule natively structured redox protein

    DEFF Research Database (Denmark)

    Della Pia, Eduardo Antonio; Chi, Qijin; Macdonald, J. Emyr

    2012-01-01

    The electron transfer properties of proteins are normally measured as molecularly averaged ensembles. Through these and related measurements, proteins are widely regarded as macroscopically insulating materials. Using scanning tunnelling microscopy (STM), we present new measurements of the conduc...

  11. Structural and electronic properties of OsB2 : A hard metallic material

    Science.gov (United States)

    Chen, Z. Y.; Xiang, H. J.; Yang, Jinlong; Hou, J. G.; Zhu, Qingshi

    2006-07-01

    We calculate the structural and electronic properties of OsB2 using density functional theory with or without taking into account the spin-orbit (SO) interaction. Our results show that the bulk modulus with and without SO interactions are 364 and 365GPa , respectively, both are in good agreement with experiment (365-395GPa) . The evidence of covalent bonding of Os-B, which plays an important role to form a hard material, is indicated both in charge density, atoms in molecules analysis, and density of states analysis. The good metallicity and hardness of OsB2 might suggest its potential application as hard conductors.

  12. Optical properties of arbuscular mycorrhizal fungal structures

    International Nuclear Information System (INIS)

    Perez, Adverdi; V-Hernandez, Alejandra; Rudamas, Carlos; Dreyer, Beatriz

    2008-01-01

    It was already reported by B. Dreyer at al. [1] that all fungal structures, both intra- and extra-radical fluoresced under blue light excitation regardless of their state (dead or alive). The source of the so called autofluorescence appears to be localized in the fungal cell wall. This supports the use of photoluminescence for the evaluation of AM colonization. However, the interpretation of these results is still in discussion [1-4]. In this work, arbuscular mycorrhizal spores were isolated from the rhizosphere of mango (Mangifera indica L.) plants by the method of wet sieving and decanting of Gerdemann and Nicolson [5] and studied by photoluminescence spectroscopy. Our experimental setup consists of an epifluorescence microscope (EM) coupled to a CCD-spectrometer through an arrangement of a home-made-telescope + fiber optic. This experimental setup allows the capture of images of the mycorrhizal structures (as usual in a standard epifluorescence microscope) combined with measurements of their corresponding emission bands. The preliminary results based on images obtained by standard EM do not clearly show that the emission is originated in the fungal cell walls as reported in Ref. 1. On the other hand, a very broad emission band in the visible part of the electromagnetic spectrum was observed in these spores by exciting at 450-490 nm and 300- 380 nm. We obtain a Full Width at Half Maximum (FWHM) of around 200 nm for this emission band whichis centered at 515 nm. This broad band seems to be composed of two narrower bands peaked around 494 and 547 nm and with FWHM of 50 nm and 150 nm, respectively. The profile of the observed emission band is in good agreement with the bands reported in Ref. 1 for vesicles, arbuscules and spores measured using the λ-Scan of a confocal laser scanning microscope. However, our results for spores show that the maxima of the narrower bands are shifted to higher energies in comparison to the corresponding bands observed in Ref. 1

  13. Optical properties of semiconductors quantum microcavity structures

    International Nuclear Information System (INIS)

    Afshar, A.M.

    1996-12-01

    The principal phenomenon investigated in this thesis is vacuum Rabi coupling in semiconductor microcavity structures. In these structures quantum well excitons are embedded in a Fabry - Perot like cavity, defined by two semiconductor dielectric mirrors. In such a system the coupled exciton and cavity photon mode form a mixed - mode polariton, where on - resonance there are two branches, each having 50% exciton and 50% photon character. The separation between the upper and lower branches is a measure of the coupling strength where the strength is dependent on the exciton oscillator strength. This interaction is known as vacuum Rabi coupling, and clear anticrossing is seen when the exciton is tuned through the cavity. In our reflectivity experiments we demonstrate control of the coupling between the cavity mode and the exciton by varying temperature, applied electric or magnetic field. Modelling of the reflectivity spectra and the tuning was done using a Transfer Matrix Reflectivity (TMR) model or a linear dispersion model, where in both cases the excitons are treated as Lorentz oscillators. Temperature tuning is achieved because exciton energy decreases with temperature at a much faster rate than the cavity mode. We have demonstrated vacuum Rabi coupling of the cavity mode with both the heavy - hole and light - hole excitons. Electric field tuning is achieved via the quantum confined Stark effect which decreases the exciton energy with increasing field, whilst at the same time the cavity mode energy remains constant. A study of how the electric field reduction of exciton oscillator strength reduces the vacuum Rabi coupling strength is performed. We report the first observation in a semiconductor structure of motional narrowing, seen in both electric field and in temperature tuning experiments at high magnetic field. In magnetic field studies we show how magnetic field induced increase in exciton oscillator strength affects the vacuum Rabi coupling. We also show by

  14. The Adsorption Geometry and Electronic Structure of Organic Dye Molecule on TiO2(101 Surface from First Principles Calculations

    Directory of Open Access Journals (Sweden)

    Niu Mang

    2017-01-01

    Full Text Available Using density functional theory (DFT, we have investigated the structural and electronic properties of dye-sensitized solar cells (DSSCs comprised of I-doped anatase TiO2(101 surface sensitized with NKX-2554 dye. The calculation results indicate that the cyanoacrylic acid anchoring group in NKX-2554 has a strong binding to the TiO2(101 surface. The dissociative and bidentate bridging type was found to be the most favorable adsorption configuration. On the other hand, the incorporations of I dopant can reduce the band gap of TiO2 photoanode and improve the of NKX-2554 dye, which can improve the visible-light absorption of anatase TiO2 and can also facilitate the electron injection from the dye molecule to the TiO2 substrate. As a result, the I doping can significantly enhance the incident photon-to-current conversion efficiency (IPCE of DSSCs.

  15. Structural phase transition and elastic properties of samarium monopnictides

    International Nuclear Information System (INIS)

    Pagare, Gitanjali; Chouhan, Sunil Singh; Soni, Pooja; Sanyal, Sankar P.

    2011-01-01

    In recent years the monopnictides and monochalcogenides of the rare-earth elements with rocksalt structure (B 1 ) have aroused intensive interest due to the presence of strongly correlated f electrons in them. Under pressure, the nature of f-electrons of these compounds can be changed from localized to itinerant leading to significant changes in physical and chemical properties. These unusual structural, electronic, and high-pressure properties make them candidates for advanced industrial applications. For these applications they provide unique physical properties which cannot be achieved with other materials

  16. Composition-Structure-Property Relationships in Boroaluminosilicate Glasses

    DEFF Research Database (Denmark)

    Zheng, Qiuju; Potuzak, M.; Mauro, J.C.

    2012-01-01

    boroaluminosilicate glasses from peralkaline to peraluminous compositions by substituting Al2O3 for SiO2. Our results reveal a pronounced change in all the measured physical properties (density, elastic moduli, hardness, glass transition temperature, and liquid fragility) around [Al2O3]–[Na2O]=0. The structural......The complicated structural speciation in boroaluminosilicate glasses leads to a mixed network former effect yielding nonlinear variation in many macroscopic properties as a function of chemical composition. Here we study the composition–structure–property relationships in a series of sodium...

  17. Structured epitaxial graphene: growth and properties

    International Nuclear Information System (INIS)

    Hu Yike; Ruan Ming; Guo Zelei; Dong Rui; Palmer, James; Hankinson, John; Berger, Claire; Heer, Walt A de

    2012-01-01

    Graphene is generally considered to be a strong candidate to succeed silicon as an electronic material. However, to date, it actually has not yet demonstrated capabilities that exceed standard semiconducting materials. Currently demonstrated viable graphene devices are essentially limited to micrometre-sized ultrahigh-frequency analogue field effect transistors and quantum Hall effect devices for metrology. Nanoscopically patterned graphene tends to have disordered edges that severely reduce mobilities thereby obviating its advantage over other materials. Here we show that graphene grown on structured silicon carbide surfaces overcomes the edge roughness and promises to provide an inroad into nanoscale patterning of graphene. We show that high-quality ribbons and rings can be made using this technique. We also report on the progress towards high-mobility graphene monolayers on silicon carbide for device applications. (paper)

  18. Effects of Structural Correlations on Electronic Properties

    International Nuclear Information System (INIS)

    Pastawski, H.M.; Weisz, J.F.

    1984-01-01

    A one dimensional alloy model is treated in the nearest neighbour tight binding approximation in which the correlation of the atoms can be adjusted. The correlation can be changed from a situation in which there is a tendency for atoms to alternate to a situation in which the atoms are randomly located, consistent with a fixed concentration c for A c B 1-c . The results show that when there is short range order, at certain energies there is a tendency for localized states and formation of structure induced minimum in the density of states. The results for the ordered case are similar to those of Charge Density Wave (CDW). A smooth transition is carried out between this case and the randomly disordered case which behaves like the Anderson model for uncorrelated disorder. (M.W.O.) [pt

  19. Structures and properties of anionic clay minerals

    International Nuclear Information System (INIS)

    Koch, Chr. Bender

    1998-01-01

    The Moessbauer spectra of pyroaurite-sjoegrenite-type compounds (PTC) (layered anion exchangers) are discussed with reference to the crystal structure, cation order, and crystallite morphology. It is shown that cation-ordered layers are produced in the synthesis of carbonate and sulphate types of green rust. In contrast, synthetic and natural pyroaurite only occurs as disordered types. The redox chemistry of Fe(III) within the metal hydroxide layer is illustrated with examples of electrochemical oxidation and reversible reduction by boiling glycerol. The chemistry of iron in the interlayer is exemplified by the intercalation of Fe-cyanide complexes in hydrotalcite. This reaction may be used as a probe for the charge distribution in the interlayer

  20. PHYSICOCHEMICAL PROPERTY CALCULATIONS

    Science.gov (United States)

    Computer models have been developed to estimate a wide range of physical-chemical properties from molecular structure. The SPARC modeling system approaches calculations as site specific reactions (pKa, hydrolysis, hydration) and `whole molecule' properties (vapor pressure, boilin...

  1. Comparative study of electronic and magnetic properties of Pc ( = Fe, Co) molecules physisorbed on 2D MoS and graphene

    KAUST Repository

    Haldar, Soumyajyoti

    2017-09-13

    In this paper, we have done a comparative study of electronic and magnetic properties of iron phthalocyanine (FePc) and cobalt phthalocyanine (CoPc) molecules physisorbed on monolayer of MoS$_2$ and graphene by using density functional theory. Various different types of physisorption sites have been considered for both surfaces. Our calculations reveal that the $M$Pc molecules prefer the S-top position on MoS$_2$. However, on graphene, FePc molecule prefers the bridge position while CoPc molecule prefers the top position. The $M$Pc molecules are physisorbed strongly on the MoS$_2$ surface than the graphene ($\\\\sim$ 2.5 eV higher physisorption energy). Analysis of magnetic properties indicates the presence of strong spin dipole moment opposite to the spin moment and hence a huge reduction of effective spin moment can be observed. Our calculations of magnetic anisotropy energies using both variational approach and $2^{nd}$ order perturbation approach indicate no significant changes after physisorption. In case of FePc, an out-of-plane easy axis and in case of CoPc, an in-plane easy axis can be seen. Calculations of work function indicate a reduction of MoS$_2$ work function $\\\\sim$ 1 eV due to physisorption of $M$Pc molecules while it does not change significantly in case of graphene.

  2. Theoretical study of stability and charge-transport properties of coronene molecule and some of its halogenated derivatives: A path to ambipolar organic-based materials?

    Energy Technology Data Exchange (ETDEWEB)

    Sancho-García, J. C., E-mail: jc.sancho@ua.es; Pérez-Jiménez, A. J., E-mail: aj.perez@ua.es [Departamento de Química Física, Universidad de Alicante, E-03080 Alicante (Spain)

    2014-10-07

    We have carefully investigated the structural and electronic properties of coronene and some of its fluorinated and chlorinated derivatives, including full periphery substitution, as well as the preferred orientation of the non-covalent dimer structures subsequently formed. We have paid particular attention to a set of methodological details, to first obtain single-molecule magnitudes as accurately as possible, including next the use of modern dispersion-corrected methods to tackle the corresponding non-covalently bound dimers. Generally speaking, this class of compounds is expected to self-assembly in neighboring π-stacks with dimer stabilization energies ranging from –20 to –30 kcal mol{sup −1} at close distances around 3.0–3.3 Å. Then, in a further step, we have also calculated hole and electron transfer rates of some suitable candidates for ambipolar materials, and corresponding charge mobility values, which are known to critically depend on the supramolecular organization of the samples. For coronene and per-fluorinated coronene, we have found high values for their hopping rates, although slightly smaller for the latter due to an increase (decrease) of the reorganization energies (electronic couplings)

  3. Syntheses, structural analyses and luminescent property of four alkaline-earth coordination polymers

    International Nuclear Information System (INIS)

    Zhang, Sheng; Qu, Xiao-Ni; Xie, Gang; Wei, Qing; Chen, San-Ping

    2014-01-01

    Four alkaline-earth coordination polymers, [Ba(Pzdc)(H 2 O)] n (1), [Ba(Pzdc)] n (2), [AgSr(Pzdc)(NO 3 )(H 2 O)] n (3), [Ag 2 Ca(Pzdc) 2 (H 2 O)] n (4) (H 2 Pzdc=2, 3-pyrazinedicarboxylic acid) have been synthesized and characterized by single-crystal X-ray diffraction. Compounds 1 and 2 afford 2D layer networks generated by one-dimensional chains containing the [Ba 2 O 11 N] units. Compound 3 is of 2D mixed-metal coordination network formed by one-dimensional chain units, while 4 is of a 3D heterometallic framework. Interestingly, 1 and 2 can undergo reversible SCSC structural transformation upon dehydration/rehydration of coordinated water molecules. In addition, the π–π stacking interactions dominate fluorescent properties of compounds 1 and 2. - Graphical abstract: Four new coordination polymers [Ba(Pzdc)(H 2 O)] n (1), [Ba(Pzdc)] n (2), [AgSr(Pzdc)(NO 3 )(H 2 O)] n (3), [Ag 2 Ca(Pzdc) 2 (H 2 O)] n (4) (H 2 Pzdc=2, 3-pyrazinedicarboxylic acid) have been synthesized. Compounds 1–3 display 2D topology structures and compound 4 exhibits a 3D topology structure. Fortunately, 1 and 2 undergo reversible dehydration/rehydration of coordinated water molecules. Display Omitted - Highlights: • All structures are generated by 1D chains. • 1 and 2 show reversible dehydration/rehydration of coordinated water molecules. • The π–π stacking interactions dominate fluorescent properties of compounds 1 and 2

  4. Syntheses, structural analyses and luminescent property of four alkaline-earth coordination polymers

    Energy Technology Data Exchange (ETDEWEB)

    Zhang, Sheng; Qu, Xiao-Ni; Xie, Gang; Wei, Qing; Chen, San-Ping, E-mail: sanpingchen@126.com

    2014-02-15

    Four alkaline-earth coordination polymers, [Ba(Pzdc)(H{sub 2}O)]{sub n} (1), [Ba(Pzdc)]{sub n} (2), [AgSr(Pzdc)(NO{sub 3})(H{sub 2}O)]{sub n} (3), [Ag{sub 2}Ca(Pzdc){sub 2}(H{sub 2}O)]{sub n} (4) (H{sub 2}Pzdc=2, 3-pyrazinedicarboxylic acid) have been synthesized and characterized by single-crystal X-ray diffraction. Compounds 1 and 2 afford 2D layer networks generated by one-dimensional chains containing the [Ba{sub 2}O{sub 11}N] units. Compound 3 is of 2D mixed-metal coordination network formed by one-dimensional chain units, while 4 is of a 3D heterometallic framework. Interestingly, 1 and 2 can undergo reversible SCSC structural transformation upon dehydration/rehydration of coordinated water molecules. In addition, the π–π stacking interactions dominate fluorescent properties of compounds 1 and 2. - Graphical abstract: Four new coordination polymers [Ba(Pzdc)(H{sub 2}O)]{sub n} (1), [Ba(Pzdc)]{sub n} (2), [AgSr(Pzdc)(NO{sub 3})(H{sub 2}O)]{sub n} (3), [Ag{sub 2}Ca(Pzdc){sub 2}(H{sub 2}O)]{sub n} (4) (H{sub 2}Pzdc=2, 3-pyrazinedicarboxylic acid) have been synthesized. Compounds 1–3 display 2D topology structures and compound 4 exhibits a 3D topology structure. Fortunately, 1 and 2 undergo reversible dehydration/rehydration of coordinated water molecules. Display Omitted - Highlights: • All structures are generated by 1D chains. • 1 and 2 show reversible dehydration/rehydration of coordinated water molecules. • The π–π stacking interactions dominate fluorescent properties of compounds 1 and 2.

  5. Mechanical Properties for Reliability Analysis of Structures in Glassy Carbon

    CERN Document Server

    Garion, Cédric

    2014-01-01

    Despite its good physical properties, the glassy carbon material is not widely used, especially for structural applications. Nevertheless, its transparency to particles and temperature resistance are interesting properties for the applications to vacuum chambers and components in high energy physics. For example, it has been proposed for fast shutter valve in particle accelerator [1] [2]. The mechanical properties have to be carefully determined to assess the reliability of structures in such a material. In this paper, mechanical tests have been carried out to determine the elastic parameters, the strength and toughness on commercial grades. A statistical approach, based on the Weibull’s distribution, is used to characterize the material both in tension and compression. The results are compared to the literature and the difference of properties for these two loading cases is shown. Based on a Finite Element analysis, a statistical approach is applied to define the reliability of a structural component in gl...

  6. Comparative study of the physiochemical and structural properties of ...

    African Journals Online (AJOL)

    A comparative analysis of some physiochemical and structural parameters of brown (mature) and green (immature) coconut fibre as adsorbents was studied. The physiochemical and structural properties evaluated were surface area, moisture content, pH, bulk density, pore volume, porosity, ash content, tortuocity and metal ...

  7. Effect of annealing time on structural and magnetic properties of ...

    Indian Academy of Sciences (India)

    We studied the effects on the structural and magnetic properties of Fe3O4 thin films. The films have been characterized by X-ray diffraction (XRD), scanning electron microscopy (SEM) and vibrating sample magnetometry (VSM). XRD studies showed pure single phase spinel cubic structure of Fe3O4 with a preferential [111] ...

  8. Structure, composition and mechanical properties of the silk fibres of ...

    Indian Academy of Sciences (India)

    The silk egg case and orb web of spiders are elaborate structures that are assembled from a number of components. We analysed the structure, the amino acid and fibre compositions, and the tensile properties of the silk fibres of the egg case of Nephila clavata. SEM shows that the outer and inner covers of the egg case ...

  9. Thermodynamic and structural properties in complexing media

    International Nuclear Information System (INIS)

    Di Giandomenico, M.V.

    2007-10-01

    Protactinium is experiencing a renewal of interest in the frame of long-term energy production. Modelling the behaviour of this element in the geosphere requires thermodynamic and structural data relevant to environmental conditions. Now deep clayey formation are considered for the disposal of radioactive waste and high values of natural sulphate contents have been determined in pore water in equilibrium with clay surface. Because of its tendency to polymerisation, hydrolysis and sorption on all solid supports, the equilibria constants relative to monomer species were determined at tracer scale (ca. 10 - 12 M) with 233 Pa. The complexation constants of Pa(V) and sulphate ions were calculated starting from a systematic study of the apparent distribution coefficient D in the system TTA/Toluene/H 2 O/Na 2 SO 4 /HClO 4 /NaClO 4 and as a function of ionic strength, temperature, free sulphate, protons and chelatant concentration. First of all, the interaction between free species H + , SO 4 - , Na + leads to the formation of HSO 4 - and NaSO 4 - , for which concentrations depend upon the related thermodynamic constants. For this purpose a computer code was developed in order to determine all free species concentration. This iterative code takes into account the influence of temperature and ionic strength (SIT modelling) on thermodynamic constants. The direct measure of Pa(V) in the organic and aqueous phase by g-spectrometry had conducted to estimate the apparent distribution coefficient D as function of free sulphate ions. Complexation constants have been determined after a mathematical treatment of D. The extrapolation of these constants at zero ionic strength have been realized by SIT modelling at different temperatures. Besides, enthalpy and entropy values were calculated. Parallelly, the structural study of Pa(V) was performed using 231 Pa. XANES and EXAFS spectra show unambiguously the absence of the trans di-oxo bond that characterizes the other early actinide

  10. Phase properties of elastic waves in systems constituted of adsorbed diatomic molecules on the (001) surface of a simple cubic crystal

    Science.gov (United States)

    Deymier, P. A.; Runge, K.

    2018-03-01

    A Green's function-based numerical method is developed to calculate the phase of scattered elastic waves in a harmonic model of diatomic molecules adsorbed on the (001) surface of a simple cubic crystal. The phase properties of scattered waves depend on the configuration of the molecules. The configurations of adsorbed molecules on the crystal surface such as parallel chain-like arrays coupled via kinks are used to demonstrate not only linear but also non-linear dependency of the phase on the number of kinks along the chains. Non-linear behavior arises for scattered waves with frequencies in the vicinity of a diatomic molecule resonance. In the non-linear regime, the variation in phase with the number of kinks is formulated mathematically as unitary matrix operations leading to an analogy between phase-based elastic unitary operations and quantum gates. The advantage of elastic based unitary operations is that they are easily realizable physically and measurable.

  11. Molecular properties of metal difluorides and their interactions with CO2 and H2O molecules: a DFT investigation.

    Science.gov (United States)

    Arokiyanathan, Agnes Lincy; Lakshmipathi, Senthilkumar

    2017-11-18

    A computational study of metal difluorides (MF 2 ; M = Ca to Zn) and their interactions with carbon dioxide and water molecules was performed. The structural parameter values obtained and the results of AIM analysis and energy decomposition analysis indicated that the Ca-F bond is weaker and less ionic than the bonds in the transition metal difluorides. A deformation density plot revealed the stablizing influence of the Jahn-Teller effect in nonlinear MF 2 molecules (e.g., where M= Sc, Ti, Cr). An anaysis of the metal K-edge peaks of the difluorides showed that shifts in the edge energy were due to the combined effects of the ionicity, effective nuclear charge, and the spin state of the metal. The interactions of CO 2 with ScF 2 (Scc3 geometry) and TiF 2 (Tic2 geometry) caused CO 2 to shift from its usual linear geometry to a bent geometry (η 2 (C=O) binding mode), while it retained its linear geometry (η 1 (O) binding mode) when it interacted with the other metal difluorides. Energy decomposition analysis showed that, among the various geometries considered, the Scc3 and Tic2 geometries possessed the highest interaction energies and orbital interaction energies. Heavier transition metal difluorides showed stronger affinities for H 2 O, whereas the lighter transition metal (Sc and Ti) difluorides preferred CO 2 . Overall, the results of this study suggest that fluorides of lighter transition metals with partially filled d orbitals (e.g., Sc and Ti) could be used for CO 2 capture under moist conditions. Graphical abstract Interaction of metal difluorides with carbon dioxide and water.

  12. Observing Structure and Motion in Molecules with Ultrafast Strong Field and Short Wavelength Laser Radiation

    Energy Technology Data Exchange (ETDEWEB)

    Bucksbaum, Philip H

    2011-04-13

    The term "molecular movie" has come to describe efforts to track and record Angstrom-scale coherent atomic and electronic motion in a molecule. The relevant time scales for this range cover several orders of magnitude, from sub-femtosecond motion associated with electron-electron correlations, to 100-fs internal vibrations, to multi-picosecond motion associated with the dispersion and quantum revivals of molecular reorientation. Conventional methods of cinematography do not work well in this ultrafast and ultrasmall regime, but stroboscopic "pump and probe" techniques can reveal this motion with high fidelity. This talk will describe some of the methods and recent progress in exciting and controlling this motion, using both laboratory lasers and the SLAC Linac Coherent Light Source x-ray free electron laser, and will further try to relate the date to the goal of molecular movies.

  13. Nuclear magnetic resonance study of the structure of simple molecules adsorbed on metal surfaces: acetylene on platinum

    International Nuclear Information System (INIS)

    Wang, P.K.

    1984-01-01

    We have used NMR to determine the structure of acetylene (HC - CH) adsorbed at room temperature on small platinum particles by studying the 13 C- 13 C, 13 C- 1 H, and 1 H- 1 H dipolar interactions among the nuclei in the adsorbed molecules. We find a model of 77% CCH 2 and 23% HCCH to be the only one consistent with all of our data. The C-C bond length of the majority species, CCH 2 , is determined as 1.44 +- 0.02 A, midway between a single and double bond, suggesting that both carbon atoms bond to the surface. 36 references, 29 figures, 1 table

  14. Charge trapping at organic/self-assembly molecule interfaces studied by electrical switching behaviour in a crosspoint structure

    International Nuclear Information System (INIS)

    Li Yun; Pan Lijia; Pu Lin; Shi Yi; Liu Chuan; Tsukagoshi, Kazuhito

    2012-01-01

    Charge trapping at organic/self-assembly molecule (SAM) interfaces is studied by the electrical switching behaviour in a crosspoint structure, where interfacial charge trapping tunes the potential barrier of the SAM layer. The sample with rubrene exhibits the write-once read-many-times memory effect, which is due to the interfacial charges trapped at deep states. On the other hand, the sample with 2-amino-4,5-dicyanoimidazole presents recyclable conduction transition, which results from the trapped charges distributed at shallow states. Moreover, the percentage of the charges trapped at shallow states can be estimated from electrical transition levels. (paper)

  15. Charge trapping at organic/self-assembly molecule interfaces studied by electrical switching behaviour in a crosspoint structure

    Science.gov (United States)

    Li, Yun; Liu, Chuan; Pan, Lijia; Pu, Lin; Tsukagoshi, Kazuhito; Shi, Yi

    2012-01-01

    Charge trapping at organic/self-assembly molecule (SAM) interfaces is studied by the electrical switching behaviour in a crosspoint structure, where interfacial charge trapping tunes the potential barrier of the SAM layer. The sample with rubrene exhibits the write-once read-many-times memory effect, which is due to the interfacial charges trapped at deep states. On the other hand, the sample with 2-amino-4,5-dicyanoimidazole presents recyclable conduction transition, which results from the trapped charges distributed at shallow states. Moreover, the percentage of the charges trapped at shallow states can be estimated from electrical transition levels.

  16. The structural heterogeneity and optical properties in chalcogenide glass films

    International Nuclear Information System (INIS)

    Shurgalin, Max; Fuflyigin, Vladimir N; Anderson, Emilia G

    2005-01-01

    The microscopic structure and optical properties of glassy films prepared by vapour phase deposition process from the germanium-arsenic-selenium family of chalcogenide glasses have been studied. A number of different molecular clusters or domains that can exist in the glass structure are found to play a significant role in determining the absorption characteristics and refractive index of the glass films. Modifications of the glass structure can be described by a variation of relative concentrations of the clusters and can be effected by modifications of film chemical composition and deposition conditions. Changes in absorption spectra are directly correlated with variation in relative concentrations of the structural fragments with different electronic bandgap properties. Experimental results suggest structural heterogeneity and support validity of the cluster structural model for the chalcogenide glasses

  17. The Effect of Bedding Structure on Mechanical Property of Coal

    Directory of Open Access Journals (Sweden)

    Zetian Zhang

    2014-01-01

    Full Text Available The mechanical property of coal, influencing mining activity considerably, is significantly determined by the natural fracture distributed within coal mass. In order to study the effecting mechanism of bedding structure on mechanical property of coal, a series of uniaxial compression tests and mesoscopic tests have been conducted. The experimental results show that the distribution characteristic of calcite particles, which significantly influences the growth of cracks and the macroscopic mechanical properties of coal, is obviously affected by the bedding structure. Specifically, the uniaxial compression strength of coal sample is mainly controlled by bedding structure, and the average peak stress of specimens with axes perpendicular to the bedding planes is 20.00 MPa, which is 2.88 times the average amount of parallel ones. The test results also show a close relationship between the bedding structure and the whole deformation process under uniaxial loading.

  18. Structure and transport properties of nanostructured materials.

    Science.gov (United States)

    Sonwane, C G; Li, Q

    2005-03-31

    In the present manuscript, we have presented the simulation of nanoporous aluminum oxide using a molecular-dynamics approach with recently developed dynamic charge transfer potential using serial/parallel programming techniques (Streitz and Mintmire Phys. Rev. B 1994, 50, 11996). The structures resembling recently invented ordered nanoporous crystalline material, MCM-41/SBA-15 (Kresge et al. Nature 1992, 359, 710), and inverted porous solids (hollow nanospheres) with up to 10 000 atoms were fabricated and studied in the present work. These materials have been used for separation of gases and catalysis. On several occasions including the design of the reactor, the knowledge of surface diffusion is necessary. In the present work, a new method for estimating surface transport of gases based on a hybrid Monte Carlo method with unbiased random walk of tracer atom on the pore surface has been introduced. The nonoverlapping packings used in the present work were fabricated using an algorithm of very slowly settling rigid spheres from a dilute suspension into a randomly packed bed. The algorithm was modified to obtain unimodal, homogeneous Gaussian and segregated bimodal porous solids. The porosity of these solids was varied by densification using an arbitrary function or by coarsening from a highly densified pellet. The surface tortuosity for the densified solids indicated an inverted bell shape curve consistent with the fact that at very high porosities there is a reduction in the connectivity while at low porosities the pores become inaccessible or dead-end. The first passage time distribution approach was found to be more efficient in terms of computation time (fewer tracer atoms needed for the linearity of Einstein's plot). Results by hybrid discrete-continuum simulations were close to the discrete simulations for a boundary layer thickness of 5lambda.

  19. Using small molecule reagents to help distinguish among prion structural models

    Science.gov (United States)

    The only demonstrated difference between infectious prions (PrPSc) and the isosequential normal cellular prion protein (PrPC) is conformation. The structure of PrPC has been determined by a variety of instrumental techniques. The structure of prions remains uncertain. Recent instrumental analysis h...

  20. Structural basis of small-molecule inhibition of human multidrug transporter ABCG2

    DEFF Research Database (Denmark)

    Jackson, Scott M; Manolaridis, Ioannis; Kowal, Julia

    2018-01-01

    requires high-resolution structural insight. Here, we present cryo-EM structures of human ABCG2 bound to synthetic derivatives of the fumitremorgin C-related inhibitor Ko143 or the multidrug resistance modulator tariquidar. Both compounds are bound to the central, inward-facing cavity of ABCG2, blocking...