Structure and hydrodynamic properties of plectin molecules.
Foisner, R; Wiche, G
1987-12-05
Plectin is a cytoskeletal, high molecular weight protein of widespread and abundant occurrence in cultured cells and tissues. To study its molecular structure, the protein was purified from rat glioma C6 cells and subjected to chemical and biophysical analyses. Plectin's polypeptide chains have an apparent molecular weight of 300,000, as shown by one-dimensional sodium dodecyl sulfate/polyacrylamide electrophoresis. Cross-linking of non-denatured plectin in solution with dimethyl suberimidate and electrophoretic analyses on sodium dodecyl sulfate/agarose gels revealed that the predominant soluble plectin species was a molecule of 1200 X 10(3) Mr consisting of four 300 X 10(3) Mr polypeptide chains. Hydrodynamic properties of plectin in solution were obtained by sedimentation velocity centrifugation and high-pressure liquid chromatography analysis yielding a sedimentation coefficient of 10 S and a Stokes radius of 27 nm. The high f/fmin ratio of 4.0 indicated a very elongated shape of plectin molecules and an axial ratio of about 50. Shadowing and negative staining electron microscopy of plectin molecules revealed multiple domains: a rigid rod of 184 nm in length and 2 nm in diameter, and two globular heads of 9 nm diameter at each end of the rod. Circular dichroism spectra suggested a composition of 30% alpha-helix, 9% beta-structure and 61% random coil or aperiodic structure. The rod-like shape, the alpha-helix content as well as the thermal transition within a midpoint of 45 degrees C and the transition enthalpy (168 kJ/mol) of secondary structure suggested a double-stranded, alpha-helical coiled coil rod domain. Based on the available data, we favor a model of native plectin as a dumb-bell-like association of four 300 X 10(3) Mr polypeptide chains. Electron microscopy and turbidity measurements showed that plectin molecules self-associate into various oligomeric states in solutions of nearly physiological ionic strength. These interactions apparently involved
The Atom in a Molecule: Implications for Molecular Structure and Properties
2016-05-23
Briefing Charts 3. DATES COVERED (From - To) 01 February 2016 – 23 May 2016 4. TITLE AND SUBTITLE The atom in a molecule: Implications for molecular...For presentation at American Physical Society - Division of Atomic , Molecular, and Optical Physics (May 2016) PA Case Number: #16075; Clearance Date...10 Energy (eV) R C--H (au) R C--H(au) The Atom in a Molecule: Implications for Molecular Structures and Properties P. W. Langhoff, Chemistry
Dwyer, Mirjana Dimitrijev; He, Lizhong; James, Michael; Nelson, Andrew; Middelberg, Anton P. J.
2013-01-01
Mixtures of a large, structured protein with a smaller, unstructured component are inherently complex and hard to characterize at interfaces, leading to difficulties in understanding their interfacial behaviours and, therefore, formulation optimization. Here, we investigated interfacial properties of such a mixed system. Simplicity was achieved using designed sequences in which chemical differences had been eliminated to isolate the effect of molecular size and structure, namely a short unstructured peptide (DAMP1) and its longer structured protein concatamer (DAMP4). Interfacial tension measurements suggested that the size and bulk structuring of the larger molecule led to much slower adsorption kinetics. Neutron reflectometry at equilibrium revealed that both molecules adsorbed as a monolayer to the air–water interface (indicating unfolding of DAMP4 to give a chain of four connected DAMP1 molecules), with a concentration ratio equal to that in the bulk. This suggests the overall free energy of adsorption is equal despite differences in size and bulk structure. At small interfacial extensional strains, only molecule packing influenced the stress response. At larger strains, the effect of size became apparent, with DAMP4 registering a higher stress response and interfacial elasticity. When both components were present at the interface, most stress-dissipating movement was achieved by DAMP1. This work thus provides insights into the role of proteins' molecular size and structure on their interfacial properties, and the designed sequences introduced here can serve as effective tools for interfacial studies of proteins and polymers. PMID:23303222
The effect of spatial confinement on the noble-gas HArF molecule: structure and electric properties
International Nuclear Information System (INIS)
Kozłowska, Justyna; Bartkowiak, Wojciech
2014-01-01
Highlights: • The structure and electrical properties of HArF in spatial confinement are analyzed. • Orbital compression leads to decrease of bond lengths in the HArF molecule. • Spatial restriction causes a drop of the molecular (hyper)polarizabilities. • Spatial confinement reduces the electron correlation contribution to μ, α and β. - Abstract: A systematic study on the dipole moment and (hyper)polarizabilities of argon fluorohydride under spatial restriction was performed. Detailed analysis of the confinement induced changes in the structure of HArF is also presented. In order to render the influence of chemical compression on the properties in question a two-dimensional harmonic oscillator potential, mimicking a cylindrical confinement, was applied. Through the comparison of the results obtained for HArF with those of HF the effect of Ar insertion on the above properties was discussed. A hierarchy of ab initio methods including HF, MP2, CCSD and CCSD(T), has been employed to investigate the effect of orbital compression on the electron correlation contribution to the studied electric properties. It was observed that the external confining potential modifies the electronic contributions to the dipole moment and (hyper)polarizabilities of HArF. In particular, the first hyperpolarizability of HArF is remarkably smaller than that of the unconfined HArF molecule
The effect of spatial confinement on the noble-gas HArF molecule: structure and electric properties
Energy Technology Data Exchange (ETDEWEB)
Kozłowska, Justyna; Bartkowiak, Wojciech, E-mail: wojciech.bartkowiak@pwr.edu.pl
2014-09-30
Highlights: • The structure and electrical properties of HArF in spatial confinement are analyzed. • Orbital compression leads to decrease of bond lengths in the HArF molecule. • Spatial restriction causes a drop of the molecular (hyper)polarizabilities. • Spatial confinement reduces the electron correlation contribution to μ, α and β. - Abstract: A systematic study on the dipole moment and (hyper)polarizabilities of argon fluorohydride under spatial restriction was performed. Detailed analysis of the confinement induced changes in the structure of HArF is also presented. In order to render the influence of chemical compression on the properties in question a two-dimensional harmonic oscillator potential, mimicking a cylindrical confinement, was applied. Through the comparison of the results obtained for HArF with those of HF the effect of Ar insertion on the above properties was discussed. A hierarchy of ab initio methods including HF, MP2, CCSD and CCSD(T), has been employed to investigate the effect of orbital compression on the electron correlation contribution to the studied electric properties. It was observed that the external confining potential modifies the electronic contributions to the dipole moment and (hyper)polarizabilities of HArF. In particular, the first hyperpolarizability of HArF is remarkably smaller than that of the unconfined HArF molecule.
Structural and electronic properties of single molecules and organic layers on surfaces
Sotthewes, Kai
2016-01-01
Single molecules and organic layers on well-defined solid surfaces have attracted tremendous attention owing to their interesting physical and chemical properties. The ultimate utility of single molecules or self-assembled monolayers (SAMs) for potential applications is critically dependent on the
Nakano, Miki; Tateishi-Karimata, Hisae; Tanaka, Shigenori; Tama, Florence; Miyashita, Osamu; Nakano, Shu-ichi; Sugimoto, Naoki
2015-01-01
In conditions that mimic those of the living cell, where various biomolecules and other components are present, DNA strands can adopt many structures in addition to the canonical B-form duplex. Previous studies in the presence of cosolutes that induce molecular crowding showed that thermal stabilities of DNA structures are associated with the properties of the water molecules around the DNAs. To understand how cosolutes, such as ethylene glycol, affect the thermal stability of DNA structures, we investigated the thermodynamic properties of water molecules around a hairpin duplex and a G-quadruplex using grid inhomogeneous solvation theory (GIST) with or without cosolutes. Our analysis indicated that (i) cosolutes increased the free energy of water molecules around DNA by disrupting water–water interactions, (ii) ethylene glycol more effectively disrupted water–water interactions around Watson–Crick base pairs than those around G-quartets or non-paired bases, (iii) due to the negative electrostatic potential there was a thicker hydration shell around G-quartets than around Watson–Crick-paired bases. Our findings suggest that the thermal stability of the hydration shell around DNAs is one factor that affects the thermal stabilities of DNA structures under the crowding conditions. PMID:26538600
Robust Magnetic Properties of a Sublimable Single-Molecule Magnet.
Kiefl, Evan; Mannini, Matteo; Bernot, Kevin; Yi, Xiaohui; Amato, Alex; Leviant, Tom; Magnani, Agnese; Prokscha, Thomas; Suter, Andreas; Sessoli, Roberta; Salman, Zaher
2016-06-28
The organization of single-molecule magnets (SMMs) on surfaces via thermal sublimation is a prerequisite for the development of future devices for spintronics exploiting the richness of properties offered by these magnetic molecules. However, a change in the SMM properties due to the interaction with specific surfaces is usually observed. Here we present a rare example of an SMM system that can be thermally sublimated on gold surfaces while maintaining its intact chemical structure and magnetic properties. Muon spin relaxation and ac susceptibility measurements are used to demonstrate that, unlike other SMMs, the magnetic properties of this system in thin films are very similar to those in the bulk, throughout the full volume of the film, including regions near the metal and vacuum interfaces. These results exhibit the robustness of chemical and magnetic properties of this complex and provide important clues for the development of nanostructures based on SMMs.
Structural characterization of some substituted azolidine molecules
International Nuclear Information System (INIS)
Andreocci, M.V.; Bossa, M.; Furlani, C.; Mattogno, G.; Zanoni, R.; Consiglio Nazionale delle Ricerche, Rome; Devillanova, F.A.; Verani, G.
1981-01-01
The electronic structure of a series of organic molecules of general formula RN - (CH 2 ) 2 - X - C = Y, which are also of interest in inorganic chemistry because of their properties as ligands towards metals, have been investigated by X-ray photoelectron spectroscopy. The results suggest a general picture of atomic charge distribution within the investigated molecules, and allow an assessment of the effect of the different substituent groups X, Y, R (X = NR', O, S, CH 2 ; Y = O, S, Se; R, R' = H, alkyl) on the electronic structure of the ligands. Satisfactory correlation is found between experimental binding energies and computed CNDO/2 atomic charges, after correction for intramolecular Madelung potentials. (orig.)
Chen, Chen-Peng; Chen, Chan-Cheng; Huang, Chia-Wen; Chang, Yen-Ching
2018-04-15
The skin permeability ( Kp ) defines the rate of a chemical penetrating across the stratum corneum. This value is widely used to quantitatively describe the transport of molecules in the outermost layer of epidermal skin and indicate the significance of skin absorption. This study defined a Kp quantitative structure-activity relationship (QSAR) based on 106 chemical substances of Kp measured using human skin and interpreted the molecular interactions underlying transport behavior of small molecules in the stratum corneum. The Kp QSAR developed in this study identified four molecular descriptors that described the molecular cyclicity in the molecule reflecting local geometrical environments, topological distances between pairs of oxygen and chlorine atoms, lipophilicity, and similarity to antineoplastics in molecular properties. This Kp QSAR considered the octanol-water partition coefficient to be a direct influence on transdermal movement of molecules. Moreover, the Kp QSAR identified a sub-domain of molecular properties initially defined to describe the antineoplastic resemblance of a compound as a significant factor in affecting transdermal permeation of solutes. This finding suggests that the influence of molecular size on the chemical's skin-permeating capability should be interpreted with other relevant physicochemical properties rather than being represented by molecular weight alone.
Directory of Open Access Journals (Sweden)
Chen-Peng Chen
2018-04-01
Full Text Available The skin permeability (Kp defines the rate of a chemical penetrating across the stratum corneum. This value is widely used to quantitatively describe the transport of molecules in the outermost layer of epidermal skin and indicate the significance of skin absorption. This study defined a Kp quantitative structure-activity relationship (QSAR based on 106 chemical substances of Kp measured using human skin and interpreted the molecular interactions underlying transport behavior of small molecules in the stratum corneum. The Kp QSAR developed in this study identified four molecular descriptors that described the molecular cyclicity in the molecule reflecting local geometrical environments, topological distances between pairs of oxygen and chlorine atoms, lipophilicity, and similarity to antineoplastics in molecular properties. This Kp QSAR considered the octanol-water partition coefficient to be a direct influence on transdermal movement of molecules. Moreover, the Kp QSAR identified a sub-domain of molecular properties initially defined to describe the antineoplastic resemblance of a compound as a significant factor in affecting transdermal permeation of solutes. This finding suggests that the influence of molecular size on the chemical’s skin-permeating capability should be interpreted with other relevant physicochemical properties rather than being represented by molecular weight alone.
Study of the electronic properties of organic molecules within a metal-molecule-metal junction
International Nuclear Information System (INIS)
Lambert, Mathieu
2003-01-01
This ph-D thesis is about electronic transport through organic molecules inserted in a metal molecule-metal junction. We describe first a simple process to prepare sub-3 nm gaps by controllable breakage (under an electrical stress) of gold wires lithographed on a SiO 2 Si substrate at low temperature (4.2 K). We show that the involved mechanism is thermally assisted electromigration. We observe that current-voltage (I-V) characteristics of resulting electrodes are stable up to ∼5 V. which gives access to the well-known Fowler-Nordheim regime in the I-V, allowing an accurate characterisation of the gap size. The average gap is found lo be between 1.5 nm in width and 2.5 eV in height. Molecules and nanoparticles have then been inserted in the junction in the case of nanoparticles for example. The resulting IV clearly shows the suppression of electrical current at low bias known as Coulomb blockade. Characteristic of single-electron tunnelling through nanometer-sized structures, finally we fabricated a single-electron tunneling device based on Au nanoparticles connected to the electrodes via terthiophene (T3) molecule. We use the silicon substrate, separated from the planar structure by a silicon oxide of 200 nm, as an electrostatic gate and observed clear current modulation with possible signature of the transport properties of the terthiophene molecules. (author) [fr
QSPR Study of the Retention/release Property of Odorant Molecules in Water Using Statistical Methods
Directory of Open Access Journals (Sweden)
Assia Belhassan
2017-10-01
Full Text Available An integrated approach physicochemistry and structures property relationships has been carried out to study the odorant molecules retention/release phenomenon in the water. This study aimed to identify the molecular properties (molecular descriptors that govern this phenomenon assuming that modifying the structure leads automatically to a change in the retention/release property of odorant molecules. ACD/ChemSketch, MarvinSketch, and ChemOffice programs were used to calculate several molecular descriptors of 51 odorant molecules (15 alcohols, 11 aldehydes, 9 ketones and 16 esters. A total of 37 molecules (2/3 of the data set were placed in the training set to build the QSPR models, whereas the remaining, 14 molecules (1/3 of the data set constitute the test set. The best descriptors were selected to establish the quantitative structure property relationship (QSPR of the retention/release property of odorant molecules in water using multiple linear regression (MLR, multiple non-linear regression (MNLR and an artificial neural network (ANN methods. We propose a quantitative model according to these analyses. The models were used to predict the retention/release property of the test set compounds, and agreement between the experimental and predicted values was verified. The descriptors showed by QSPR study are used for study and designing of new compounds. The statistical results indicate that the predicted values are in good agreement with the experimental results. To validate the predictive power of the resulting models, external validation multiple correlation coefficient was calculated and has both in addition to a performant prediction power, a favorable estimation of stability. DOI: http://dx.doi.org/10.17807/orbital.v9i4.978
Chakraborty, Sumana; Routh, Swati; Krishnappa, Madhu
2015-01-01
In this work, we have focused on microsolvation of isopropyl cyanide (i-PrCN) as isopropyl cyanide has been recently detected in interstellar space and is of great importance from the astrochemical and bio-chemical point of view for its branching carbon chains. Such branches are needed for many molecules crucial to life, such as the amino acids that build proteins. The phenomenon of the formation of hydrogen bond affects structure, energetic and electric properties of microhydrated isopropyl ...
Electronic and transport properties of Cobalt-based valence tautomeric molecules and polymers
Chen, Yifeng; Calzolari, Arrigo; Buongiorno Nardelli, Marco
2011-03-01
The advancement of molecular spintronics requires further understandings of the fundamental electronic structures and transport properties of prototypical spintronics molecules and polymers. Here we present a density functional based theoretical study of the electronic structures of Cobalt-based valence tautomeric molecules Co III (SQ)(Cat)L Co II (SQ)2 L and their polymers, where SQ refers to the semiquinone ligand, and Cat the catecholate ligand, while L is a redox innocent backbone ligand. The conversion from low-spin Co III ground state to high-spin Co II excited state is realized by imposing an on-site potential U on the Co atom and elongating the Co-N bond. Transport properties are subsequently calculated by extracting electronic Wannier functions from these systems and computing the charge transport in the ballistic regime using a Non-Equilibrium Green's Function (NEGF) approach. Our transport results show distinct charge transport properties between low-spin ground state and high-spin excited state, hence suggesting potential spintronics devices from these molecules and polymers such as spin valves.
Structure of deformable diatomic molecules: a modified n-butane liquid
International Nuclear Information System (INIS)
Jang, Seanea; Kim, Soonchul; Lee, Songhi
2005-01-01
The density functional approximation for polyatomic molecules, which is based on the bridge function of the intermolecular interaction, was developed and applied to investigate the thermodynamic and the structural properties of deformable diatomic molecules. The Percus trick was employed to calculate the uniform structure of modified n-butane. The calculated static correlation functions were used to predict the density behaviors of a modified n-butane liquid at liquid-solid interfaces. The theoretical results show that (i) at low densities, the hypernetted-chain (HNC) equation compares with the density functional approximation based on the bridge function and that (ii) the relative population between the gauche and the trans states strongly affects the liquid structure at liquid-solid interfaces.
Kazama, Misato; Fujikawa, Takashi; Kishimoto, Naoki; Mizuno, Tomoya; Adachi, Jun-ichi; Yagishita, Akira
2013-06-01
We provide a molecular structure determination method, based on multiple-scattering x-ray photoelectron diffraction (XPD) calculations. This method is applied to our XPD data on several molecules having different equilibrium geometries. Then it is confirmed that, by our method, bond lengths and bond angles can be determined with a resolution of less than 0.1 Å and 10∘, respectively. Differently from any other scenario of ultrafast structure determination, we measure the two- or three-dimensional XPD of aligned or oriented molecules in the energy range from 100 to 200 eV with a 4π detection velocity map imaging spectrometer. Thanks to the intense and ultrashort pulse properties of x-ray free-electron lasers, our approach exhibits the most probable method for obtaining ultrafast real-time structural information on small to medium-sized molecules consisting of light elements, i.e., a “molecular movie.”
Directory of Open Access Journals (Sweden)
Peter A. Ajibade
2017-02-01
Full Text Available We report the synthesis and structural studies of copper sulfide nanocrystals from copper (II dithiocarbamate single molecule precursors. The precursors were thermolysed in hexadecylamine (HDA to prepare HDA-capped CuS nanocrystals. The optical properties of the nanocrystals studied using UV–visible and photoluminescence spectroscopy showed absorption band edges at 287 nm that are blue shifted, and the photoluminescence spectra show emission curves that are red-shifted with respect to the absorption band edges. These shifts are as a result of the small crystallite sizes of the nanoparticles leading to quantum size effects. The structural studies were carried out using powder X-ray diffraction (XRD, transmission electron microscopy (TEM, scanning electron microscopy (SEM, energy dispersive X-ray spectroscopy (EDS, and atomic force microscopy. The XRD patterns indicates that the CuS nanocrystals are in hexagonal covellite crystalline phases with estimated particles sizes of 17.3–18.6 nm. The TEM images showed particles with almost spherical or rod shapes, with average crystallite sizes of 3–9.8 nm. SEM images showed morphology with ball-like microspheres on the surfaces, and EDS spectra confirmed the presence of CuS nanoparticles.
Electronic properties of single-molecule junction: Effect of the molecular distortion
International Nuclear Information System (INIS)
Gao, W.; Zhao, M.; Jiang, Q.
2009-01-01
For a model system consisting of a benzenedithio (BDT) molecule sandwiched between two Au plates, the electronic properties as a function of different BDT geometry are investigated using density functional theory. The distorted BDT structures are got through stretching the electrode distance. The corresponding electronic properties, including the spatial distribution of the frontier orbits, the gap between the highest occupied molecular orbital and the lowest unoccupied molecular orbital levels and density of states at the Fermi energy are determined. It reveals that the molecular distortion essentially determines electronic structures. The result should be beneficial to understand the stress-dependent or structure-dependent transport mechanism of electrons of the BDT junction.
Structures of water molecules in carbon nanotubes under electric fields
International Nuclear Information System (INIS)
Winarto,; Takaiwa, Daisuke; Yamamoto, Eiji; Yasuoka, Kenji
2015-01-01
Carbon nanotubes (CNTs) are promising for water transport through membranes and for use as nano-pumps. The development of CNT-based nanofluidic devices, however, requires a better understanding of the properties of water molecules in CNTs because they can be very different from those in the bulk. Using all-atom molecular dynamics simulations, we investigate the effect of axial electric fields on the structure of water molecules in CNTs having diameters ranging from (7,7) to (10,10). The water dipole moments were aligned parallel to the electric field, which increases the density of water inside the CNTs and forms ordered ice-like structures. The electric field induces the transition from liquid to ice nanotubes in a wide range of CNT diameters. Moreover, we found an increase in the lifetime of hydrogen bonds for water structures in the CNTs. Fast librational motion breaks some hydrogen bonds, but the molecular pairs do not separate and the hydrogen bonds reform. Thus, hydrogen bonds maintain the water structure in the CNTs, and the water molecules move collectively, decreasing the axial diffusion coefficient and permeation rate
Tuning the Electronic and Dynamical Properties of a Molecule by Atom Trapping Chemistry.
Pham, Van Dong; Repain, Vincent; Chacon, Cyril; Bellec, Amandine; Girard, Yann; Rousset, Sylvie; Abad, Enrique; Dappe, Yannick J; Smogunov, Alexander; Lagoute, Jérôme
2017-11-28
The ability to trap adatoms with an organic molecule on a surface has been used to obtain a range of molecular functionalities controlled by the choice of the molecular trapping site and local deprotonation. The tetraphenylporphyrin molecule used in this study contains three types of trapping sites: two carbon rings (phenyl and pyrrole) and the center of a macrocycle. Catching a gold adatom on the carbon rings leads to an electronic doping of the molecule, whereas trapping the adatom at the macrocycle center with single deprotonation leads to a molecular rotor and a second deprotonation leads to a molecular jumper. We call "atom trapping chemistry" the control of the structure, electronic, and dynamical properties of a molecule achieved by trapping metallic atoms with a molecule on a surface. In addition to the examples previously described, we show that more complex structures can be envisaged.
Spin Properties of Transition-Metallorganic Self-Assembled Molecules
International Nuclear Information System (INIS)
Yu, Zhi Gang
2010-01-01
This report summarizes SRI's accomplishments on the project, 'Spin Properties of Transition-Metallorganic Self-Assembled Molecules' funded by the Office of Basic Energy Sciences, US Department of Energy. We have successfully carried out all tasks identified in our proposal and gained significant knowledge and understanding of spin-polarized electronic structure, spin relaxation, and spin-dependent transport in transition-metallorganic molecules and enhohedral fullerenes. These molecules contain integrated spin and charge components and will enable us to achieve sophisticated functions in spintronics and quantum computing at molecular level with simple circuitry and easy fabrication. We have developed microscopic theories that describe the underlying mechanisms of spin-dependent porcesses and constructed quantitative modeling tools that compute several important spin properties. These results represent the basic principles governing the spin-dependent behaviors in nanostructures containing such molecules. Based on these results we have shown that novel device functions, such as electrically controlled g-factor and noninvasive electrical detection of spin dynamics, can be achieved in these nanostructures. Some of our results have been published in peer-reviewed journals and presented at professional conferences. In addition, we have established a close collaboration with experimentalists at Oxford University, UK (Dr. J. Morton and Prof. G. Briggs), Princeton University (Dr. A. Tyryshkin and Prof. S. Lyon), University of Delaware (Prof. E. Nowak), and University of California (Profs. R. Kawakami and J. Shi), who have been studying related systems and supplying us with new experimental data. We have provided our understanding and physical insights to the experimentalists and helped analyze their experimental measurements. The collaboration with experimentalists has also broadened our research scope and helped us focus on the most relevant issues concerning these
Tezuka, Kyoichi; Taguchi, Tatsuhiko; Alavi, Saman; Sum, Amadeu K.; Ohmura, Ryo
2012-01-01
This paper report analyses of thermodynamic stability of structure-H clathrate hydrates formed with methane and large guest molecules in terms of their gas phase molecular sizes and molar masses for the selection of a large guest molecule providing better hydrate stability. We investigated the correlation among the gas phase molecular sizes, the molar masses of large molecule guest substances, and the equilibrium pressures. The results suggest that there exists a molecular-size value for the ...
On structure of some laminated crystals with organic molecules
International Nuclear Information System (INIS)
Volodina, G.F.; Ivanova, V.Ya.; Malinovskij, T.I.
1982-01-01
A survey is made of papers dealing with intercalation of organic molecules into crystals of dihalcogenides of some transition metals (TaS 2 , TiS 2 , NbS 2 , ZrS 2 , TaSe 2 ), variation of their structure and physical properties. Among the used intercalates ammonia, pyridine, aniline and other aromatic amines proved to be most satisfactory from the viewpoint of reaction rate and product stability. A possibility is discussed of intercalation into PbI 2 and CdI 2 crystals that are of the same structural type as dihalcogenides
Spin Properties of Transition-Metallorganic Self-Assembled Molecules
Energy Technology Data Exchange (ETDEWEB)
Zhi Gang Yu
2010-06-30
This report summarizes SRI's accomplishments on the project, 'Spin Properties of Transition-Metallorganic Self-Assembled Molecules' funded by the Office of Basic Energy Sciences, US Department of Energy. We have successfully carried out all tasks identified in our proposal and gained significant knowledge and understanding of spin-polarized electronic structure, spin relaxation, and spin-dependent transport in transition-metallorganic molecules and enhohedral fullerenes. These molecules contain integrated spin and charge components and will enable us to achieve sophisticated functions in spintronics and quantum computing at molecular level with simple circuitry and easy fabrication. We have developed microscopic theories that describe the underlying mechanisms of spin-dependent porcesses and constructed quantitative modeling tools that compute several important spin properties. These results represent the basic principles governing the spin-dependent behaviors in nanostructures containing such molecules. Based on these results we have shown that novel device functions, such as electrically controlled g-factor and noninvasive electrical detection of spin dynamics, can be achieved in these nanostructures. Some of our results have been published in peer-reviewed journals and presented at professional conferences. In addition, we have established a close collaboration with experimentalists at Oxford University, UK (Dr. J. Morton and Prof. G. Briggs), Princeton University (Dr. A. Tyryshkin and Prof. S. Lyon), University of Delaware (Prof. E. Nowak), and University of California (Profs. R. Kawakami and J. Shi), who have been studying related systems and supplying us with new experimental data. We have provided our understanding and physical insights to the experimentalists and helped analyze their experimental measurements. The collaboration with experimentalists has also broadened our research scope and helped us focus on the most relevant issues
DEFF Research Database (Denmark)
Hukkerikar, Amol Shivajirao; Sarup, Bent; Sin, Gürkan
2013-01-01
models. To make the property-data-model analysis fast and efficient, an approach based on the “molecular structure similarity criteria” to identify molecules (mono-functional, bi-functional, etc.) containing specified set of structural parameters (that is, groups) is employed. The method has been applied...
Goings, Joshua James
Time-dependent electronic structure theory has the power to predict and probe the ways electron dynamics leads to useful phenomena and spectroscopic data. Here we report several advances and extensions of broken-symmetry time-dependent electronic structure theory in order to capture the flexibility required to describe non-equilibrium spin dynamics, as well as electron dynamics for chiroptical properties and vibrational effects. In the first half, we begin by discussing the generalization of self-consistent field methods to the so-called two-component structure in order to capture non-collinear spin states. This means that individual electrons are allowed to take a superposition of spin-1/2 projection states, instead of being constrained to either spin-up or spin-down. The system is no longer a spin eigenfunction, and is known a a spin-symmetry broken wave function. This flexibility to break spin symmetry may lead to variational instabilities in the approximate wave function, and we discuss how these may be overcome. With a stable non-collinear wave function in hand, we then discuss how to obtain electronic excited states from the non-collinear reference, along with associated challenges in their physical interpretation. Finally, we extend the two-component methods to relativistic Hamiltonians, which is the proper setting for describing spin-orbit driven phenomena. We describe the first implementation of the explicit time propagation of relativistic two-component methods and how this may be used to capture spin-forbidden states in electronic absorption spectra. In the second half, we describe the extension of explicitly time-propagated wave functions to the simulation of chiroptical properties, namely circular dichroism (CD) spectra of chiral molecules. Natural circular dichroism, that is, CD in the absence of magnetic fields, originates in the broken parity symmetry of chiral molecules. This proves to be an efficient method for computing circular dichroism spectra
Komoto, Yuki; Isshiki, Yuji; Fujii, Shintaro; Nishino, Tomoaki; Kiguchi, Manabu
2017-02-16
The electronic structure of molecular junctions has a significant impact on their transport properties. Despite the decisive role of the electronic structure, a complete characterization of the electronic structure remains a challenge. This is because there is no straightforward way of measuring electron spectroscopy for an individual molecule trapped in a nanoscale gap between two metal electrodes. Herein, a comprehensive approach to obtain a detailed description of the electronic structure in single-molecule junctions based on the analysis of current-voltage (I-V) and thermoelectric characteristics is described. It is shown that the electronic structure of the prototypical C 60 single-molecule junction can be resolved by analyzing complementary results of the I-V and thermoelectric measurement. This combined approach confirmed that the C 60 single-molecule junction was highly conductive with molecular electronic conductances of 0.033 and 0.003 G 0 and a molecular Seebeck coefficient of -12 μV K -1 . In addition, we revealed that charge transport was mediated by a LUMO whose energy level was located 0.5≈0.6 eV above the Fermi level of the Au electrode. © 2017 Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim.
Elastic Properties of Nucleic Acids by Single-Molecule Force Spectroscopy.
Camunas-Soler, Joan; Ribezzi-Crivellari, Marco; Ritort, Felix
2016-07-05
We review the current knowledge on the use of single-molecule force spectroscopy techniques to extrapolate the elastic properties of nucleic acids. We emphasize the lesser-known elastic properties of single-stranded DNA. We discuss the importance of accurately determining the elastic response in pulling experiments, and we review the simplest models used to rationalize the experimental data as well as the experimental approaches used to pull single-stranded DNA. Applications used to investigate DNA conformational transitions and secondary structure formation are also highlighted. Finally, we provide an overview of the effects of salt and temperature and briefly discuss the effects of contour length and sequence dependence.
Relation between rheological and structural properties of suspensions
Energy Technology Data Exchange (ETDEWEB)
Barcal, M; Sebor, G; Volsicky, Z
1982-01-01
The paper discusses results of investigations into separation processes for coal and kaolin suspensions. Effects of potassium chlorides and methanol additives on electrostatic potential of solid particles and on sedimentation rate are analyzed. Investigation results are shown in 5 diagrams. The relation between rheological and structural properties of coal and clay suspensions is investigated. Investigations show that the non-Newtonian behavior of suspensions cannot be attributed exclusively to the electrostatic and mechanical action of the solid phase particles. It is also caused by structure of the liquid phase, particularly on the surface of the solid particles, which depends mostly on hydrogen bonds. The internal structure of the liquid phase influences differential viscosity much more than the electrical surface properties of the solid phase. Bonds between the molecules of water and methanol are much stronger than bonds between water molecules alone. (9 refs.)
Measurement of the conductance properties of single organic molecules using gold nanoparticles
Gordin, Yoav
conduct more than an order of magnitude less than those that are fully conjugated. A distinct feature of the conjugated molecule is the appearance of pronounced peaks in its conductance at certain voltage values. We have shown that these peaks can be gated randomly by the electrostatic environment, but the peak spectrum is reproducible among the different samples of the same molecular species that we studied. To properly study and understand the peak structure we developed the ability to add gate dependent measurements to our system. Unfortunately the backdrop of this was a drastic reduction in the yield of good samples for measurement. We focused on four different conjugated molecules to attempt to understand the effect of the molecular structure on the properties of the peak spectra. We have been able to measure three of these molecules, and obtained SET diamond plots reminiscent of those seen for the single particles. The molecular diamonds have a larger energy gap than that found in single particles, as can be expected from their smaller size. We do not yet have enough data on this issue to make any definite statements on the influence of the molecular structure on the peak structure. Another topic investigated in this work is the physics of the two gold nanoparticles, giving rise to double quantum dot (DQD) phenomena. This physics is observed in dimers that do not exhibit "molecular" (high energy) features, or at low voltages before the appearance of the molecular peaks. We have used these phenomena to fully characterize the properties of our system and understand better the role the molecule plays in transport at low bias (below the voltage of the first peak). I begin this thesis with an introduction to the field of molecular electronics; I briefly review the theoretical approaches and the experimental methods used. I then describe in detail the dimer method, whose development took up a major part of this work, relaying in detail the relevant issues and
Interactions of molecules and the properties of crystals
McConnell, Thomas Daniel Leigh
In this thesis the basic theory of the lattice dynamics of molecular crystals is considered, with particular reference to the specific case of linear molecules. The objective is to carry out a critical investigation of a number of empirical potentials as models for real systems. Suitable coordinates are introduced, in particular vibrational coordinates which are used to describe the translational and rotational modes of the free molecule. The Taylor expansion of the intermolecular potential is introduced and its terms considered, in particular the (first-order) equilibrium conditions for such a system and the (second-order) lattice vibrations. The elastic properties are also considered, in particular with reference to the specific case of rhombohedral crystals. The compressibility and a number of conditions for elastic stability are introduced. The total intermolecular interaction potential is divided into three components using perturbation methods, the electrostatic energy, the repulsion energy and the dispersion energy. A number of models are introduced for these various components. The induction energy is neglected. The electrostatic interaction is represented by atomic multipole and molecular multipole models. The repulsion and dispersion energies are modelled together in a central interaction potential, either the Lennard-Jones atom-atom potential or the anisotropic Berne-Pechukas molecule-molecule potential. In each case, the Taylor expansion coefficients, used to calculate the various molecular properties, are determined. An algorithm is described which provides a relatively simple method for calculating cartesian tensors, which are found in the Taylor expansion coefficients of the multipolar potentials. This proves to be particularly useful from a computational viewpoint, both in terms of programming and calculating efficiency. The model system carbonyl sulphide is introduced and its lattice properties are described. Suitable parameters for potentials used
Zhang, Kecong; Song, Jiancheng; Wang, Min; Fang, Changshui; Lu, Mengkai
1987-04-01
TGS crystals doped with aniline-family dipolar molecules (aniline, 2-aminobenzoic acid, 3-aminobenzoic acid, 3-aminobenzene-sulphonic acid, 4-aminobenzenesulphonic acid and 4-nitroraniline) have been grown by the slow-cooling solution method. The influence of these dopants on the growth habits, crystal morphology pyroelectric properties, and structure parameters of TGS crystals has been systematically investigated. The effects of the domain structure of the seed crystal on the pyroelectric properties of the doped crystals have been studied. It is found that the spontaneous polarization (P), pyroelectric coefficient (lambda), and internal bias field of the doped crystals are slightly higher than those of the pure TGS, and the larger the dipole moment of the dopant molecule, the higher the P and lambda of the doped TGS crystal.
International Nuclear Information System (INIS)
Ehvarestov, R.A.; Panin, A.I.; Bandura, A.V.
2008-01-01
Account of relativistic effects on the properties of uranium hexafluoride is testified. Detailed comparison of single electron energies spectrum revealed in nonrelativistic (by Hartree-Fock method), relativistic (by Dirac-Fock method), and scalar-relativistic (using relativistic potential of atomic uranium frame) has been conducted. Optimization procedures of atomic basis in LCAO calculations of molecules and crystals permissive taking into account distortion of atomic orbitals when chemical bonding are discussed, and optimization effect of atomic basis on the results of scalar-relativistic calculations of UF 6 molecule properties is analyzed. Calculations of electronic structure and properties of UO 2 crystal having relativistic and nonrelativistic pseudopotentials have been realized [ru
Directory of Open Access Journals (Sweden)
Grigory E. Brill
2014-09-01
Full Text Available Purpose — to investigate the effects of low-intensity electromagnetic radiation on the process of dehydration selforganization of bacterial lipopolysaccharide (LPS. Material and Methods — The method of wedge dehydration has been used to study the structure formation of bacterial LPS. Image-phases analysis included their qualitative characteristics, as well as the calculation of quantitative indicators, followed by statistical analysis. Results — Low-intensity ultra high frequency (UHF radiation (1 GHz, 0.1 μW/cm2, 10 min has led to the changes in the suspension system of the LPS-saline reflected in the kinetics of structure formation. Conclusion — 1 GHz corresponds to the natural frequency of oscillation of water clusters and, presumably, the effect of UHF on structure of LPS mediates through the changes in water-salt environment. Under these conditions, properties of water molecules of hydration and possibly the properties of hydrophobic and hydrophilic regions in the molecule of LPS, which can affect the ability of toxin molecules to form aggregates change. Therefore the LPS structure modification may result in the change of its toxic properties.
Directory of Open Access Journals (Sweden)
Assia Belhassan
2017-11-01
Full Text Available The ACD/ChemSketch, MarvinSketch, and ChemOffice programmes were used to calculate several molecular descriptors of 51 odorant molecules (15 alcohols, 11 aldehydes, 9 ketones and 16 esters. The best descriptors were selected to establish the Quantitative Structure-Property Relationship (QSPR of the retention/release property of odorant molecules in pectin gels using Principal Components Analysis (PCA, Multiple Linear Regression (MLR, Multiple Non-linear Regression (MNLR and Artificial Neural Network (ANN methods We propose a quantitative model based on these analyses. PCA has been used to select descriptors that exhibit high correlation with the retention/release property. The MLR method yielded correlation coefficients of 0.960 and 0.958 for PG-0.4 (pectin concentration: 0.4% w/w and PG-0.8 (pectin concentration: 0.8% w/w media, respectively. Internal and external validations were used to determine the statistical quality of the QSPR of the two MLR models. The MNLR method, considering the relevant descriptors obtained from the MLR, yielded correlation coefficients of 0.978 and 0.975 for PG-0.4 and PG-0.8 media, respectively. The applicability domain of MLR models was investigated using simple and leverage approaches to detect outliers and outside compounds. The effects of different descriptors on the retention/release property are described, and these descriptors were used to study and design new compounds with higher and lower values of the property than the existing ones. Keywords: Odorant Molecules, Retention/Release, Pectin Gels, Quantitative Structure Property Relationship, Multiple Linear Regression, Artificial Neural Network
Prediction of Physicochemical Properties of Organic Molecules Using Semi-Empirical Methods
International Nuclear Information System (INIS)
Kim, Chan Kyung; Kim, Chang Kon; Kim, Miri; Lee, Hai Whang; Cho, Soo Gyeong
2013-01-01
Prediction of physicochemical properties of organic molecules is an important process in chemistry and chemical engineering. The MSEP approach developed in our lab calculates the molecular surface electrostatic potential (ESP) on van der Waals (vdW) surfaces of molecules. This approach includes geometry optimization and frequency calculation using hybrid density functional theory, B3LYP, at the 6-31G(d) basis set to find minima on the potential energy surface, and is known to give satisfactory QSPR results for various properties of organic molecules. However, this MSEP method is not applicable to screen large database because geometry optimization and frequency calculation require considerable computing time. To develop a fast but yet reliable approach, we have re-examined our previous work on organic molecules using two semi-empirical methods, AM1 and PM3. This new approach can be an efficient protocol in designing new molecules with improved properties
Krzton-Maziopa, Anna; Pesko, Edyta; Puzniak, Roman
2018-06-01
Layered iron-based superconducting chalcogenides intercalated with molecular species are the subject of intensive studies, especially in the field of solid state chemistry and condensed matter physics, because of their intriguing chemistry and tunable electric and magnetic properties. Considerable progress in the research, revealing superconducting inorganic–organic hybrid materials with transition temperatures to superconducting state, T c, up to 46 K, has been brought in recent years. These novel materials are synthesized by low-temperature intercalation of molecular species, such as solvates of alkali metals and nitrogen-containing donor compounds, into layered FeSe-type structure. Both the chemical nature as well as orientation of organic molecules between the layers of inorganic host, play an important role in structural modifications and may be used for fine tuning of superconducting properties. Furthermore, a variety of donor species compatible with alkali metals, as well as the possibility of doping also in the host structure (either on Fe or Se sites), makes this system quite flexible and gives a vast array of new materials with tunable electric and magnetic properties. In this review, the main aspects of intercalation chemistry are discussed with a particular attention paid to the influence of the unique nature of intercalating species on the crystal structure and physical properties of the hybrid inorganic–organic materials. To get a full picture of these materials, a comprehensive description of the most effective chemical and electrochemical methods, utilized for synthesis of intercalated species, with critical evaluation of their strong and weak points, related to feasibility of synthesis, phase purity, crystal size and morphology of final products, is included as well.
The study of electronic structure and properties of silicene for gas sensor application
Energy Technology Data Exchange (ETDEWEB)
Wella, Sasfan A.; Syaputra, Marhamni; Wungu, Triati D. K., E-mail: triati@fi.itb.ac.id; Suprijadi [Department of Physics, Faculty of Mathematics and Natural Sciences, Institut Teknologi Bandung Jl. Ganesha 10 Bandung 40132, West Java (Indonesia)
2016-03-11
In this study, we investigated the adsorption of gas molecules (H{sub 2}S, CO) on pristine silicene using first principles calculation. The structure, electronic properties, and adsorption energy of H{sub 2}S,CO/silicene are discussed thoroughly. We found that the pristine silicenewith low buckling structure is the most stable as compared with planar and high buckling structures. Silicene was able to detect a gas molecule which can be observed according tothe density of states analysis. Though a gas molecule adsorbed weakly, the electronic properties of the low buckling pristine silicene changed from semi-metal (zero band gap) to semiconductor. The adsorption energy of H{sub 2}S and CO on silicene is 0.075 eV and 0.06 eV, respectively.
Large Molecule Structures by Broadband Fourier Transform Molecular Rotational Spectroscopy
Evangelisti, Luca; Seifert, Nathan A.; Spada, Lorenzo; Pate, Brooks
2016-06-01
Fourier transform molecular rotational resonance spectroscopy (FT-MRR) using pulsed jet molecular beam sources is a high-resolution spectroscopy technique that can be used for chiral analysis of molecules with multiple chiral centers. The sensitivity of the molecular rotational spectrum pattern to small changes in the three dimensional structure makes it possible to identify diastereomers without prior chemical separation. For larger molecules, there is the additional challenge that different conformations of each diastereomer may be present and these need to be differentiated from the diastereomers in the spectral analysis. Broadband rotational spectra of several larger molecules have been measured using a chirped-pulse FT-MRR spectrometer. Measurements of nootkatone (C15H22O), cedrol (C15H26O), ambroxide (C16H28O) and sclareolide (C16H26O2) are presented. These spectra are measured with high sensitivity (signal-to-noise ratio near 1,000:1) and permit structure determination of the most populated isomers using isotopic analysis of the 13C and 18O isotopologues in natural abundance. The accuracy of quantum chemistry calculations to identify diastereomers and conformers and to predict the dipole moment properties needed for three wave mixing measurements is examined.
Energy Technology Data Exchange (ETDEWEB)
Katoch, Neha, E-mail: nehakatoch2@gmail.com; Kapoor, Pooja; Sharma, Munish; Ahluwalia, P. K. [Physics Department, Himachal Pradesh University, Shimla, Himachal Pradesh, India 171005 (India); Kumar, Ashok [Center for Physical Sciences, School of Basic and Applied Sciences, Central University of Punjab, Bathinda, India, 151001 (India)
2016-05-23
We report stability and electronic properties of benzene molecule adsorbed on the Au atomic layer within the framework of density function theory (DFT). Horizontal configuration of benzene on the top site of Au monolayer prefers energetically over other studied configurations. On the adsorption of benzene, the ballistic conductance of Au monolayer is found to decrease from 4G{sub 0} to 2G{sub 0} suggesting its applications for the fabrications of organic sensor devices based on the Au atomic layers.
Structure/property relationships in non-linear optical materials
Energy Technology Data Exchange (ETDEWEB)
Cole, J M [Institut Max von Laue - Paul Langevin (ILL), 38 - Grenoble (France); [Durham Univ. (United Kingdom); Howard, J A.K. [Durham Univ. (United Kingdom); McIntyre, G J [Institut Max von Laue - Paul Langevin (ILL), 38 - Grenoble (France)
1997-04-01
The application of neutrons to the study of structure/property relationships in organic non-linear optical materials (NLOs) is described. In particular, charge-transfer effects and intermolecular interactions are investigated. Charge-transfer effects are studied by charge-density analysis and an example of one such investigation is given. The study of intermolecular interactions concentrates on the effects of hydrogen-bonding and an example is given of two structurally similar molecules with very disparate NLO properties, as a result of different types of hydrogen-bonding. (author). 3 refs.
Isshiki, Yuji; Fujii, Shintaro; Nishino, Tomoaki; Kiguchi, Manabu
2018-03-14
Structural and electronic detail at the metal-molecule interface has a significant impact on the charge transport across the molecular junctions, but its precise understanding and control still remain elusive. On the single-molecule scale, the metal-molecule interface structures and relevant charge transport properties are subject to fluctuation, which contain the fundamental science of single-molecule transport and implication for manipulability of the transport properties in electronic devices. Here, we present a comprehensive approach to investigate the fluctuation in the metal-molecule interface in single-molecule junctions, based on current-voltage ( I- V) measurements in combination with first-principles simulation. Contrary to conventional molecular conductance studies, this I- V approach provides a correlated statistical description of both the degree of electronic coupling across the metal-molecule interface and the molecular orbital energy level. This statistical approach was employed to study fluctuation in single-molecule junctions of 1,4-butanediamine (DAB), pyrazine (PY), 4,4'-bipyridine (BPY), and fullerene (C 60 ). We demonstrate that molecular-dependent fluctuation of σ-, π-, and π-plane-type interfaces can be captured by analyzing the molecular orbital (MO) energy level under mechanical perturbation. While the MO level of DAB with the σ-type interface shows weak distance dependence and fluctuation, the MO level of PY, BPY, and C 60 features unique distance dependence and molecular-dependent fluctuation against the mechanical perturbation. The MO level of PY and BPY with the σ+π-type interface increases with the increase in the stretch distance. In contrast, the MO level of C 60 with the π-plane-type interface decreases with the increase in the stretching perturbation. This study provides an approach to resolve the structural and electronic fluctuation in the single-molecule junctions and insight into the molecular-dependent fluctuation in
Prediction of RNA secondary structures: from theory to models and real molecules
International Nuclear Information System (INIS)
Schuster, Peter
2006-01-01
RNA secondary structures are derived from RNA sequences, which are strings built form the natural four letter nucleotide alphabet, {AUGC}. These coarse-grained structures, in turn, are tantamount to constrained strings over a three letter alphabet. Hence, the secondary structures are discrete objects and the number of sequences always exceeds the number of structures. The sequences built from two letter alphabets form perfect structures when the nucleotides can form a base pair, as is the case with {GC} or {AU}, but the relation between the sequences and structures differs strongly from the four letter alphabet. A comprehensive theory of RNA structure is presented, which is based on the concepts of sequence space and shape space, being a space of structures. It sets the stage for modelling processes in ensembles of RNA molecules like evolutionary optimization or kinetic folding as dynamical phenomena guided by mappings between the two spaces. The number of minimum free energy (mfe) structures is always smaller than the number of sequences, even for two letter alphabets. Folding of RNA molecules into mfe energy structures constitutes a non-invertible mapping from sequence space onto shape space. The preimage of a structure in sequence space is defined as its neutral network. Similarly the set of suboptimal structures is the preimage of a sequence in shape space. This set represents the conformation space of a given sequence. The evolutionary optimization of structures in populations is a process taking place in sequence space, whereas kinetic folding occurs in molecular ensembles that optimize free energy in conformation space. Efficient folding algorithms based on dynamic programming are available for the prediction of secondary structures for given sequences. The inverse problem, the computation of sequences for predefined structures, is an important tool for the design of RNA molecules with tailored properties. Simultaneous folding or cofolding of two or more RNA
Diffusion and infrared properties of molecules in ice mantles
International Nuclear Information System (INIS)
Schmitt, B.; Grim, R.; Greenberg, J.M.
1989-01-01
Within dense molecular clouds the formation of frozen icy mantles on interstellar dust grains is thought to be the result of various growth conditions. The molecules, which make up the ice mantles are probably completely mixed. To study the physical properties of such ice mixtures the experiments were performed on the evaporation processes and on the spectroscopic properties of CO, CO2, and CH4 in water rich ices. The decrease in concentration of volatile molecules in ice samples deposited at 10 K and subsequently heated is found to occur essentially in two steps. The first one, corresponding to an evaporation of part of the volatile molecules, starts at about 25 K for CO, 32 K for CH4, and 70 K for CO2. During the crystallization of H2O ice at temperatures greater than 120 K a second evaporation occurs leading to the complete disappearance of the volatile molecules in the solid phase. The main astrophysical implications of the diffusion and spectroscopic behaviors are presented. The possible effects of a heating source on the fraction of volatile molecules, such as CO trapped in grain mantles, are discussed
Effects of Electric Field on the Valence-Bond Property of an Electron in a Quantum-Dot Molecule
Institute of Scientific and Technical Information of China (English)
王立民; 罗莹; 马本堃
2002-01-01
The electronic structure of the quantum-dot molecules in an electric field is investigated by the finite element method with the effective mass approximation. The numerical calculation results show that the valence bond of the quantum-dot molecule alternates between covalent bonds and ionic bonds as the electric field increases. The valence-bond property can be reflected by the oscillator strength of the intraband transition. The bound state with the highest energy level in the quantum-dot molecule gradually changes into a quasibound state when the electric field increases.
Evaluation of the Kinetic Property of Single-Molecule Junctions by Tunneling Current Measurements.
Harashima, Takanori; Hasegawa, Yusuke; Kiguchi, Manabu; Nishino, Tomoaki
2018-01-01
We investigated the formation and breaking of single-molecule junctions of two kinds of dithiol molecules by time-resolved tunneling current measurements in a metal nanogap. The resulting current trajectory was statistically analyzed to determine the single-molecule conductance and, more importantly, to reveal the kinetic property of the single-molecular junction. These results suggested that combining a measurement of the single-molecule conductance and statistical analysis is a promising method to uncover the kinetic properties of the single-molecule junction.
Near-unity mass accommodation coefficient of organic molecules of varying structure.
Julin, Jan; Winkler, Paul M; Donahue, Neil M; Wagner, Paul E; Riipinen, Ilona
2014-10-21
Atmospheric aerosol particles have a significant effect on global climate, air quality, and consequently human health. Condensation of organic vapors is a key process in the growth of nanometer-sized particles to climate relevant sizes. This growth is very sensitive to the mass accommodation coefficient α, a quantity describing the vapor uptake ability of the particles, but knowledge on α of atmospheric organics is lacking. In this work, we have determined α for four organic molecules with diverse structural properties: adipic acid, succinic acid, naphthalene, and nonane. The coefficients are studied using molecular dynamics simulations, complemented with expansion chamber measurements. Our results are consistent with α = 1 (indicating nearly perfect accommodation), regardless of the molecular structural properties, the phase state of the bulk condensed phase, or surface curvature. The results highlight the need for experimental techniques capable of resolving the internal structure of nanoparticles to better constrain the accommodation of atmospheric organics.
Energy Technology Data Exchange (ETDEWEB)
Choi, Charina L; Alivisatos, A Paul
2009-10-20
Quantum dots, which have found widespread use in fields such as biomedicine, photovoltaics, and electronics, are often called artificial atoms due to their size-dependent physical properties. Here this analogy is extended to consider artificial nanocrystal molecules, formed from well-defined groupings of plasmonically or electronically coupled single nanocrystals. Just as a hydrogen molecule has properties distinct from two uncoupled hydrogen atoms, a key feature of nanocrystal molecules is that they exhibit properties altered from those of the component nanoparticles due to coupling. The nature of the coupling between nanocrystal atoms and its response to vibrations and deformations of the nanocrystal molecule bonds are of particular interest. We discuss synthetic approaches, predicted and observed physical properties, and prospects and challenges toward this new class of materials.
Schaller, Chris P.; Graham, Kate J.; Johnson, Brian J.; Jakubowski, Henry V.; McKenna, Anna G.; McIntee, Edward J.; Jones, T. Nicholas; Fazal, M. A.; Peterson, Alicia A.
2015-01-01
A one-semester, introductory chemistry course is described that develops a primarily qualitative understanding of structure-property relationships. Starting from an atoms-first approach, the course examines the properties and three-dimensional structure of metallic and ionic solids before expanding into a thorough investigation of molecules. In…
Contrasting bonding behavior of thiol molecules on carbon fullerene structures
International Nuclear Information System (INIS)
Mixteco-Sanchez, J.C.; Guirado-Lopez, R.A.
2003-01-01
We have performed semiempirical as well as ab initio density-functional theory (DFT) calculations at T=0 to analyze the equilibrium configurations and electronic properties of spheroidal C 60 as well as of cylindrical armchair (5,5) and (8,8) fullerenes passivated with SCH 3 and S(CH 2 ) 2 CH 3 thiols. Our structural results reveal that the lowest-energy configurations of the adsorbates strongly depend on their chain length and on the structure of the underlying substrate. In the low-coverage regime, both SCH 3 and S(CH 2 ) 2 CH 3 molecules prefer to organize into a molecular cluster on one side of the C 60 surface, providing thus a less protective organic coating for the carbon structure. However, with increasing the number of adsorbed thiols, a transition to a more uniform distribution is obtained, which actually takes place for six and eight adsorbed molecules when using S(CH 2 ) 2 CH 3 and SCH 3 chains, respectively. In contrast, for the tubelike arrangements at the low-coverage regime, a quasi-one-dimensional zigzag organization of the adsorbates along the tubes is always preferred. The sulfur-fullerene bond is considerably strong and is at the origin of outward and lateral displacements of the carbon atoms, leading to the stabilization of three-membered rings on the surface (spheroidal structures) as well as to sizable nonuniform radial deformations (cylindrical configurations). The electronic spectrum of our thiol-passivated fullerenes shows strong variations in the energy difference between the highest occupied and lowest unoccupied molecular orbitals as a function of the number and distribution of adsorbed thiols, opening thus the possibility to manipulate the transport properties of these compounds by means of selective adsorption mechanisms
Phase space structure of triatomic molecules
International Nuclear Information System (INIS)
Lu, Z.; Kellman, M.E.
1997-01-01
The bifurcation structure is investigated for a Hamiltonian for the three coupled nonlinear vibrations of a highly excited triatomic molecule. The starting point is a quantum Hamiltonian used to fit experimental spectra. This Hamiltonian includes 1:1 Darling endash Dennison resonance coupling between the stretches, and 2:1 Fermi resonance coupling between the stretches and bend. A classical Hamiltonian is obtained using the Heisenberg correspondence principle. Surfaces of section show a pronounced degree of chaos at high energies, with a mixture of chaotic and regular dynamics. The large-scale bifurcation structure is found semianalytically, without recourse to numerical solution of Hamilton close-quote s equations, by taking advantage of the fact that the spectroscopic Hamiltonian has a conserved polyad quantum number, corresponding to an approximate constant of the motion of the molecule. Bifurcation diagrams are analyzed for a number of molecules including H 2 O, D 2 O, NO 2 , ClO 2 , O 3 , and H 2 S. copyright 1997 American Institute of Physics
Murrell, Daniel S; Cortes-Ciriano, Isidro; van Westen, Gerard J P; Stott, Ian P; Bender, Andreas; Malliavin, Thérèse E; Glen, Robert C
2015-01-01
In silico predictive models have proved to be valuable for the optimisation of compound potency, selectivity and safety profiles in the drug discovery process. camb is an R package that provides an environment for the rapid generation of quantitative Structure-Property and Structure-Activity models for small molecules (including QSAR, QSPR, QSAM, PCM) and is aimed at both advanced and beginner R users. camb's capabilities include the standardisation of chemical structure representation, computation of 905 one-dimensional and 14 fingerprint type descriptors for small molecules, 8 types of amino acid descriptors, 13 whole protein sequence descriptors, filtering methods for feature selection, generation of predictive models (using an interface to the R package caret), as well as techniques to create model ensembles using techniques from the R package caretEnsemble). Results can be visualised through high-quality, customisable plots (R package ggplot2). Overall, camb constitutes an open-source framework to perform the following steps: (1) compound standardisation, (2) molecular and protein descriptor calculation, (3) descriptor pre-processing and model training, visualisation and validation, and (4) bioactivity/property prediction for new molecules. camb aims to speed model generation, in order to provide reproducibility and tests of robustness. QSPR and proteochemometric case studies are included which demonstrate camb's application.Graphical abstractFrom compounds and data to models: a complete model building workflow in one package.
A Structural Perspective on the Modulation of Protein-Protein Interactions with Small Molecules.
Demirel, Habibe Cansu; Dogan, Tunca; Tuncbag, Nurcan
2018-05-31
Protein-protein interactions (PPIs) are the key components in many cellular processes including signaling pathways, enzymatic reactions and epigenetic regulation. Abnormal interactions of some proteins may be pathogenic and cause various disorders including cancer and neurodegenerative diseases. Although inhibiting PPIs with small molecules is a challenging task, it gained an increasing interest because of its strong potential for drug discovery and design. The knowledge of the interface as well as the structural and chemical characteristics of the PPIs and their roles in the cellular pathways are necessary for a rational design of small molecules to modulate PPIs. In this study, we review the recent progress in the field and detail the physicochemical properties of PPIs including binding hot spots with a focus on structural methods. Then, we review recent approaches for structural prediction of PPIs. Finally, we revisit the concept of targeting PPIs in a systems biology perspective and we refer to the non-structural approaches, usually employed when the structural information is not present. Copyright© Bentham Science Publishers; For any queries, please email at epub@benthamscience.org.
Machine learning properties of materials and molecules with entropy-regularized kernels
Ceriotti, Michele; Bartók, Albert; CsáNyi, GáBor; de, Sandip
Application of machine-learning methods to physics, chemistry and materials science is gaining traction as a strategy to obtain accurate predictions of the properties of matter at a fraction of the typical cost of quantum mechanical electronic structure calculations. In this endeavor, one can leverage general-purpose frameworks for supervised-learning. It is however very important that the input data - for instance the positions of atoms in a molecule or solid - is processed into a form that reflects all the underlying physical symmetries of the problem, and that possesses the regularity properties that are required by machine-learning algorithms. Here we introduce a general strategy to build a representation of this kind. We will start from existing approaches to compare local environments (basically, groups of atoms), and combine them using techniques borrowed from optimal transport theory, discussing the relation between this idea and additive energy decompositions. We will present a few examples demonstrating the potential of this approach as a tool to predict molecular and materials' properties with an accuracy on par with state-of-the-art electronic structure methods. MARVEL NCCR (Swiss National Science Foundation) and ERC StG HBMAP (European Research Council, G.A. 677013).
Gorrasi, Giuliana; Bugatti, Valeria; Vittoria, Vittoria
2012-06-05
Nanohybrids of layered double hydroxide (LDH) with intercalated active molecules: benzoate, 2,4-dichlorobenzoate, para-hydroxybenzoate and ortho-hydroxybenzoate, were incorporated into pectins from apples through high energy ball milling in the presence of water. Cast films were obtained and analysed. X-ray diffraction analysis showed a complete destructuration of all nanohybrids in the pectin matrix. Thermogravimetric analysis showed a better thermal resistance of pectin in the presence of fillers, especially para-hydroxybenzoate and ortho-hydroxybenzoate. Mechanical properties showed an improvement of elastic modulus in particular for LDH-para-hydroxybenzoate nanohybrid, due probably to a better interaction between pectin matrix and nanohybrid layers. Barrier properties (sorption and diffusion) to water vapour showed improvement in the dependence on the intercalated active molecule, the best improvement was achieved for composites containing para-hydroxybenzoate molecules, suggesting that the interaction between the filler phase and the polymer plays an important role in sorption and diffusion phenomena. Incorporation of these active molecules gave antimicrobial properties to the composite films giving opportunities in the field of active packaging. Copyright © 2012 Elsevier Ltd. All rights reserved.
Vibrational properties of water molecules adsorbed in different zeolitic frameworks
International Nuclear Information System (INIS)
Crupi, V; Longo, F; Majolino, D; Venuti, V
2006-01-01
The perturbation of water 'sorbed' in samples of zeolites of different structural type, genesis, and cation composition (K-, Na-, Mg- and Ca-rich zeolites), namely the CHA framework of a synthetic K-chabazite, the LTA framework of synthetic Na-A and Mg50-A zeolites, and the NAT framework of a natural scolecite, has been studied by FTIR-ATR spectroscopy, in the -10 to +80 o C temperature range. The aim was to show how differences in the chemical composition and/or in the topology of the zeolite framework and, in particular, the possibility for the guest water molecules to develop guest-guest and/or host-guest interactions, lead to substantial differences in their vibrational dynamical properties. The spectra, collected in the O-H stretching and H 2 O bending mode regions, are complex, with multiple bands being observed. As far as water in the CHA and LTA frameworks is concerned, whose behaviour is governed by the balance of water-water, water-framework and water-extra-framework cations interactions, the assignment of the resolved components of the O-H stretching band has been discussed by fitting the band shapes into individual components attributed to H 2 O molecules engaged in different degrees of hydrogen bonding. A detailed quantitative picture of the connectivity pattern of water, as a function of temperature and according to the chemical and topological properties of the environment, is furnished. The H 2 O bending vibrational bands give additional information that perfectly agrees with the results obtained from the analysis of the O-H stretching spectral region. In the case of scolecite, a small-pored zeolite where water-water interactions are eliminated, the increased complexity observed in the infrared spectra in the O-H stretching and H 2 O bending regions was explained as due to the hydrogen bonding between the water molecules and the network, and also with the extra-framework cation. Furthermore, these observations have been correlated with the different
Organic molecules with abnormal geometric parameters
International Nuclear Information System (INIS)
Komarov, Igor V
2001-01-01
Organic molecules, the structural parameters of which (carbon-carbon bond lengths, bond and torsion angles) differ appreciably from the typical most frequently encountered values, are discussed. Using many examples of 'record-breaking' molecules, the limits of structural distortions in carbon compounds and their unusual chemical properties are demonstrated. Particular attention is devoted to strained compounds not yet synthesised whose properties have been predicted using quantum-chemical calculations. Factors that ensure the stability of such compounds are outlined. The bibliography includes 358 references.
Wang, Yan-Ning; Huo, Qi-Sheng; Zhang, Ping; Yu, Jie-Hui; Xu, Ji-Qing
2016-10-01
By utilizing the hydrothermal in situ acylation of organic acids with N2H4, three acylhydrazidate-coordinated compounds [Mn(L1)2(H2O)2] (L1 = 2,3-quinolinedicarboxylhydrazidate; HL1 = 2,3-dihydropyridazino[4,5-b] quinoline-1,4-dione) 1, [Mn2(ox)(L2)2(H2O)6]·2H2O (L2 = benzimidazolate-5,6-dicarboxylhydrazide; HL2 = 6,7-dihydro-1H-imidazo[4,5-g]phthalazine-5,8-dione; ox = oxalate) 2, and [Cd(HL3)(bpy)] (L3 = 4,5-di(3‧-carboxylphenyl)phthalhydrazidate; H3L3 = 6,7-dihydro-1H-imidazo[4,5-g]phthalazine-5,8-dione; bpy = 2,2‧-bipyridine) 3, as well as two acylhydrazide molecules L4 (L4 = oxepino[2,3,4-de:7,6,5-d‧e‧]diphthalazine-4,10(5H,9H)-dione) 4 and L5 (L5 = 4,5-dibromophthalhydrazide; L5 = 6,7-dibromo-2,3-dihydrophthalazine-1,4-dione) 5 were obtained. X-ray single-crystal diffraction analysis reveals that (i) 1 only possesses a mononuclear structure, but it self-assembles into a 2-D supramolecular network via the Nhydrazinesbnd H ⋯ Nhydrazine and Owsbnd H ⋯ Ohydroxylimino interactions; (ii) 2 exhibits a dinuclear structure. Ox acts as the linker, while L2 just serves as a terminal ligand; (iii) In 3, L3 acts as a 3-connected node to propagate the 7-coordinated Cd2 + centers into a 1-D double-chain structure; (iv) 4 is a special acylhydrazide molecule. Two sbnd OH groups for the intermediates 3,3‧-biphthalhydrazide further lose one water molecule to form 4; (v) 5 is a common monoacylhydrazide molecule. Via the Nhydrazinesbnd H ⋯ Ohydrazine, Ohydroxyliminosbnd H ⋯ Oacylamino and the π ⋯ π interactions, it self-assembles into a 2-D supramolecular network. The photoluminescence analysis reveals that 4 emits light with the maxima at 510 nm.
Electrical properties and mechanical stability of anchoring groups for single-molecule electronics
Directory of Open Access Journals (Sweden)
Riccardo Frisenda
2015-07-01
Full Text Available We report on an experimental investigation of transport through single molecules, trapped between two gold nano-electrodes fabricated with the mechanically controlled break junction (MCBJ technique. The four molecules studied share the same core structure, namely oligo(phenylene ethynylene (OPE3, while having different aurophilic anchoring groups: thiol (SAc, methyl sulfide (SMe, pyridyl (Py and amine (NH2. The focus of this paper is on the combined characterization of the electrical and mechanical properties determined by the anchoring groups. From conductance histograms we find that thiol anchored molecules provide the highest conductance; a single-level model fit to current–voltage characteristics suggests that SAc groups exhibit a higher electronic coupling to the electrodes, together with better level alignment than the other three groups. An analysis of the mechanical stability, recording the lifetime in a self-breaking method, shows that Py and SAc yield the most stable junctions while SMe form short-lived junctions. Density functional theory combined with non-equlibrium Green’s function calculations help in elucidating the experimental findings.
Structure and properties of cell membranes. Volume 3: Methodology and properties of membranes
International Nuclear Information System (INIS)
Benga, G.
1985-01-01
This book covers the topics: Quantum chemical approach to study the mechanisms of proton translocation across membranes through protein molecules; monomolecular films as biomembrane models; planar lipid bilayers in relation to biomembranes; relation of liposomes to cell membranes; reconstitution of membrane transport systems; structure-function relationships in cell membranes as revealed by X-ray techniques; structure-function relationships in cell membranes as revealed by spin labeling ESR; structure and dynamics of cell membranes as revealed by NMR techniques; the effect of dietary lipids on the composition and properties of biological membranes and index
Kiener, Joos
2013-12-11
Research in organic chemistry generates samples of novel chemicals together with their properties and other related data. The involved scientists must be able to store this data and search it by chemical structure. There are commercial solutions for common needs like chemical registration systems or electronic lab notebooks. However for specific requirements of in-house databases and processes no such solutions exist. Another issue is that commercial solutions have the risk of vendor lock-in and may require an expensive license of a proprietary relational database management system. To speed up and simplify the development for applications that require chemical structure search capabilities, I have developed Molecule Database Framework. The framework abstracts the storing and searching of chemical structures into method calls. Therefore software developers do not require extensive knowledge about chemistry and the underlying database cartridge. This decreases application development time. Molecule Database Framework is written in Java and I created it by integrating existing free and open-source tools and frameworks. The core functionality includes:•Support for multi-component compounds (mixtures)•Import and export of SD-files•Optional security (authorization)For chemical structure searching Molecule Database Framework leverages the capabilities of the Bingo Cartridge for PostgreSQL and provides type-safe searching, caching, transactions and optional method level security. Molecule Database Framework supports multi-component chemical compounds (mixtures).Furthermore the design of entity classes and the reasoning behind it are explained. By means of a simple web application I describe how the framework could be used. I then benchmarked this example application to create some basic performance expectations for chemical structure searches and import and export of SD-files. By using a simple web application it was shown that Molecule Database Framework
Structural and electronic properties of L-amino acids
Tulip, P. R.; Clark, S. J.
2005-05-01
The structural and electronic properties of four L-amino acids alanine, leucine, isoleucine, and valine have been investigated using density functional theory (DFT) and the generalized gradient approximation. Within the crystals, it is found that the constituent molecules adopt zwitterionic configurations, in agreement with experimental work. Lattice constants are found to be in good agreement with experimentally determined values, although certain discrepancies do exist due to the description of van der Waals interactions. We find that these materials possess wide DFT band gaps in the region of 5 eV, with electrons highly localized to the constituent molecules. It is found that the main mechanisms behind crystal formation are dipolar interactions and hydrogen bonding of a primarily electrostatic character, in agreement with current biochemical understanding of these systems. The electronic structure suggests that the amine and carboxy functional groups are dominant in determining band structure.
Studies of G-quadruplex DNA structures at the single molecule level
DEFF Research Database (Denmark)
Kragh, Sofie Louise
2015-01-01
Folding of G-quaduplex structures adopted by the human telomeric repeat is here studied by single molecule FRET microscopy. This method allows for the investigation of G-quadruplex structures and their conformational dynamic. Telomeres are located at the ends of our chromosomes and end in a single...... with human telomeric repeat adopt several different G-quadruplex conformations in the presence of K+ ions. G-quadruplexes inhibit telomerase activity and are therefore potential targets for anti-cancer drugs, which can be small molecule ligands capable of stabilizing G-quadruplex structures. Understanding...... range. FRET spectroscopy can be performed on an ensemble of molecules, or on the single molecule level. In single molecule FRET experiments it is possible to follow the behaviour in time for each molecule independently, allowing insight into both dynamically and statistically heterogeneous molecular...
Atomistic theory of excitonic fine structure in InAs/InP nanowire quantum dot molecules
Świderski, M.; Zieliński, M.
2017-03-01
Nanowire quantum dots have peculiar electronic and optical properties. In this work we use atomistic tight binding to study excitonic spectra of artificial molecules formed by a double nanowire quantum dot. We demonstrate a key role of atomistic symmetry and nanowire substrate orientation rather than cylindrical shape symmetry of a nanowire and a molecule. In particular for [001 ] nanowire orientation we observe a nonvanishing bright exciton splitting for a quasimolecule formed by two cylindrical quantum dots of different heights. This effect is due to interdot coupling that effectively reduces the overall symmetry, whereas single uncoupled [001 ] quantum dots have zero fine structure splitting. We found that the same double quantum dot system grown on [111 ] nanowire reveals no excitonic fine structure for all considered quantum dot distances and individual quantum dot heights. Further we demonstrate a pronounced, by several orders of magnitude, increase of the dark exciton optical activity in a quantum dot molecule as compared to a single quantum dot. For [111 ] systems we also show spontaneous localization of single particle states in one of nominally identical quantum dots forming a molecule, which is mediated by strain and origins from the lack of the vertical inversion symmetry in [111 ] nanostructures of overall C3 v symmetry. Finally, we study lowering of symmetry due to alloy randomness that triggers nonzero excitonic fine structure and the dark exciton optical activity in realistic nanowire quantum dot molecules of intermixed composition.
Shedding Light on Protein Folding, Structural and Functional Dynamics by Single Molecule Studies
Directory of Open Access Journals (Sweden)
Krutika Bavishi
2014-11-01
Full Text Available The advent of advanced single molecule measurements unveiled a great wealth of dynamic information revolutionizing our understanding of protein dynamics and behavior in ways unattainable by conventional bulk assays. Equipped with the ability to record distribution of behaviors rather than the mean property of a population, single molecule measurements offer observation and quantification of the abundance, lifetime and function of multiple protein states. They also permit the direct observation of the transient and rarely populated intermediates in the energy landscape that are typically averaged out in non-synchronized ensemble measurements. Single molecule studies have thus provided novel insights about how the dynamic sampling of the free energy landscape dictates all aspects of protein behavior; from its folding to function. Here we will survey some of the state of the art contributions in deciphering mechanisms that underlie protein folding, structural and functional dynamics by single molecule fluorescence microscopy techniques. We will discuss a few selected examples highlighting the power of the emerging techniques and finally discuss the future improvements and directions.
Structure and Structure-activity Relationship of Functional Organic Molecules
Institute of Scientific and Technical Information of China (English)
2011-01-01
@@ Research theme The group is made up of junior scientists from the State Key Laboratory of Elemento-organic Chemistry, Nankai University.The scientists focus their studis on the structure and structure-activity relationship of functional organic molecules not only because it has been the basis of their research, but also because the functional study of organic compounds is now a major scientific issue for organic chemists around the world.
Madsen, Lars Bojer; Jensen, Frank; Dnestryan, Andrey I.; Tolstikhin, Oleg I.
2017-07-01
In the leading-order approximation of the weak-field asymptotic theory (WFAT), the dependence of the tunneling ionization rate of a molecule in an electric field on its orientation with respect to the field is determined by the structure factor of the ionizing molecular orbital. The WFAT yields an expression for the structure factor in terms of a local property of the orbital in the asymptotic region. However, in general quantum chemistry approaches molecular orbitals are expanded in a Gaussian basis which does not reproduce their asymptotic behavior correctly. This hinders the application of the WFAT to polyatomic molecules, which are attracting increasing interest in strong-field physics. Recently, an integral-equation approach to the WFAT for tunneling ionization of one electron from an arbitrary potential has been developed. The structure factor is expressed in an integral form as a matrix element involving the ionizing orbital. The integral is not sensitive to the asymptotic behavior of the orbital, which resolves the difficulty mentioned above. Here, we extend the integral representation for the structure factor to many-electron systems treated within the Hartree-Fock method and show how it can be implemented on the basis of standard quantum chemistry software packages. We validate the methodology by considering noble-gas atoms and the CO molecule, for which accurate structure factors exist in the literature. We also present benchmark results for CO2 and for NH3 in the pyramidal and planar geometries.
Yumura, Takashi; Yamamoto, Wataru
2017-09-20
We employed density functional theory (DFT) calculations with dispersion corrections to investigate energetically preferred alignments of certain p,p'-dimethylaminonitrostilbene (DANS) molecules inside an armchair (m,m) carbon nanotube (n × DANS@(m,m)), where the number of inner molecules (n) is no greater than 3. Here, three types of alignments of DANS are considered: a linear alignment in a parallel fashion and stacking alignments in parallel and antiparallel fashions. According to DFT calculations, a threshold tube diameter for containing DANS molecules in linear or stacking alignments was found to be approximately 1.0 nm. Nanotubes with diameters smaller than 1.0 nm result in the selective formation of linearly aligned DANS molecules due to strong confinement effects within the nanotubes. By contrast, larger diameter nanotubes allow DANS molecules to align in a stacking and linear fashion. The type of alignment adopted by the DANS molecules inside a nanotube is responsible for their second-order non-linear optical properties represented by their static hyperpolarizability (β 0 values). In fact, we computed β 0 values of DANS assemblies taken from optimized n × DANS@(m,m) structures, and their values were compared with those of a single DANS molecule. DFT calculations showed that β 0 values of DANS molecules depend on their alignment, which decrease in the following order: linear alignment > parallel stacking alignment > antiparallel stacking alignment. In particular, a linear alignment has a β 0 value more significant than that of the same number of isolated molecules. Therefore, the linear alignment of DANS molecules, which is only allowed inside smaller diameter nanotubes, can strongly enhance their second-order non-linear optical properties. Since the nanotube confinement determines the alignment of DANS molecules, a restricted nanospace can be utilized to control their second-order non-linear optical properties. These DFT findings can assist in the
Tunable optical absorption in silicene molecules
Mokkath, Junais Habeeb; Schwingenschlö gl, Udo
2016-01-01
Two-dimensional materials with a tunable band gap that covers a wide range of the solar spectrum hold great promise for sunlight harvesting. For this reason, we investigate the structural, electronic, and optical properties of silicene molecules using time dependent density functional theory. We address the influence of the molecular size, buckling, and charge state as well as that of a dielectric environment. Unlike planar graphene molecules, silicene molecules prefer to form low-buckled structures with strong visible to ultraviolet optical response. We also identify molecular plasmons.
Tunable optical absorption in silicene molecules
Mokkath, Junais Habeeb
2016-07-13
Two-dimensional materials with a tunable band gap that covers a wide range of the solar spectrum hold great promise for sunlight harvesting. For this reason, we investigate the structural, electronic, and optical properties of silicene molecules using time dependent density functional theory. We address the influence of the molecular size, buckling, and charge state as well as that of a dielectric environment. Unlike planar graphene molecules, silicene molecules prefer to form low-buckled structures with strong visible to ultraviolet optical response. We also identify molecular plasmons.
Tamaki, Takashi; Ogawa, Takuji
2017-09-05
This review highlights molecular design for nonlinear and nonsymmetric single-molecule electronic properties such as rectification, negative differential resistance, and switching, which are important components of future single-molecule information processing devices. Perspectives on integrated "molecular circuits" are also provided. Nonlinear and nonsymmetric single-molecule electronics can be designed by utilizing (1) asymmetric molecular cores, (2) asymmetric anchoring groups, (3) an asymmetric junction environment, and (4) asymmetric electrode materials. This review mainly focuses on the design of molecular cores.
Organization of extracting molecules of the diamide type: link with the extracting properties?
International Nuclear Information System (INIS)
Meridiano, Y.
2009-02-01
The aim of these studies is to establish a link between the different organizations of diamide extractants (used in the DIAMEX process) and their extracting properties. The effects of the key parameters leading the liquid-liquid extraction (concentration of extractant, nature of solute, activity of the aqueous phase, nature of the diluent and temperature) are studied: 1) at the supramolecular scale, with the characterization of the extractant organizations by vapor-pressure osmometry (VPO) and small angle neutron and X-ray scattering (SANS/SAXS) experiments; 2) at the molecular scale, with the quantification of the extracted solutes (water, nitric acid, metal nitrate) and the determination of extracted complexes stoichiometries by electro-spray mass spectrometry (ESI-MS) experiments. The DMDOHEMA molecule acts as a classical surfactant and forms aggregates of the reverse micelle type. Taking into account the established supramolecular diagrams, a quantitative link between the extractants structures and their extracting properties has been brought to light. To model the europium nitrate extraction, two approaches have been developed: - an approach based on mass action laws. Extractions equilibria have been proposed taking into account the supramolecular speciation; - an innovative approach considering the extracted ions as adsorbed on a specific surface of the extractant molecule which depends on the extractant organization state. The ion extraction can be considered as a sum of isotherms corresponding to the different states of organization. This approach allows to compare the extraction efficiency of an extracting molecule as a function of its organization state. (author)
Hahn, David K; RaghuVeer, Krishans S; Ortiz, J V
2011-08-04
The CBS-QB3 and G4 thermochemical models have been used to generate energetic, structural, and spectroscopic data on a set of molecules with trivalent or pentavalent phosphorus atoms that can serve as simulants of chemical warfare agents. Based on structural data, the conformational stabilities of these molecules are explained in terms of the anomeric interaction within the OPOC and OPSC fragments. For those cases where experimental data are available, comparisons have been made between calculated and previously reported vibrational frequencies. All varieties of bond dissociation energies have been examined except those for C-H and P═O bonds. In trivalent phosphorus molecules, the O-C and S-C bonds have the lowest dissociation energies. In the pentavalent phosphorus set, the S-C bonds, followed by P-S bonds, have the lowest dissociation energies. In the fluorinated simulant molecules, the P-F bond is strongest, and the P-C or O-C bonds are weakest. © 2011 American Chemical Society
Weiss, Emily A
2013-11-19
In order to achieve efficient and reliable technology that can harness solar energy, the behavior of electrons and energy at interfaces between different types or phases of materials must be understood. Conversion of light to chemical or electrical potential in condensed phase systems requires gradients in free energy that allow the movement of energy or charge carriers and facilitate redox reactions and dissociation of photoexcited states (excitons) into free charge carriers. Such free energy gradients are present at interfaces between solid and liquid phases or between inorganic and organic materials. Nanostructured materials have a higher density of these interfaces than bulk materials. Nanostructured materials, however, have a structural and chemical complexity that does not exist in bulk materials, which presents a difficult challenge: to lower or eliminate energy barriers to electron and energy flux that inevitably result from forcing different materials to meet in a spatial region of atomic dimensions. Chemical functionalization of nanostructured materials is perhaps the most versatile and powerful strategy for controlling the potential energy landscape of their interfaces and for minimizing losses in energy conversion efficiency due to interfacial structural and electronic defects. Colloidal quantum dots are semiconductor nanocrystals synthesized with wet-chemical methods and coated in organic molecules. Chemists can use these model systems to study the effects of chemical functionalization of nanoscale organic/inorganic interfaces on the optical and electronic properties of a nanostructured material, and the behavior of electrons and energy at interfaces. The optical and electronic properties of colloidal quantum dots have an intense sensitivity to their surface chemistry, and their organic adlayers make them dispersible in solvent. This allows researchers to use high signal-to-noise solution-phase spectroscopy to study processes at interfaces. In this
Hu, Yiwei; Long, Linbo; Mao, Yuliang; Zhong, Jianxin
2018-06-01
Using first-principles methods, we have studied the adsorption of gas molecules (CO2, CH4, H2S, H2 and NH3) on two dimensional Ge2Li2 monolayer. The adsorption geometries, adsorption energies, charge transfer, and band structures of above mentioned gas molecules adsorption on Ge2Li2 monolayer are analyzed. It is found that the adsorption of CO2 on Ge2Li2 monolayer is a kind of strong chemisorption, while other gas molecules such as CH4, H2S, H2 and NH3 are physisorption. The strong covalent binding is formed between the CO2 molecule and the nearest Ge atom in Ge2Li2 monolayer. This adsorption of CO2 molecule on Ge2Li2 monolayer leads to a direct energy gap of 0.304 eV. Other gas molecules exhibit mainly ionic binding to the nearest Li atoms in Ge2Li2 monolayer, which leads to indirect energy gap after adsorptions. Furthermore, it is found that the work function of Ge2Li2 monolayer is sensitive with the variation of adsorbents. Our results reveal that the Ge2Li2 monolayer can be used as a kind of nano device for gas molecules sensor.
Public epitopes and the antigenic structure of the HLA molecules.
Rodey, G E; Fuller, T C
1987-01-01
Simplified procedures for determining amino acid sequences in proteins and nucleotide sequences in DNA have rapidly expanded the number of MHC molecules for which primary amino acid structure is known. These molecules will be especially valuable as tools to study the structure-function relationships of globular proteins because of the extensive polymorphism of genes coding the MHC genes products. The general three-dimensional structure of class I MHC molecules was recently deduced, but the more subtle topographical microconformations are still undefined. Definition and topographical mapping of epitopes, defined by serological or cellular immune effector products, will be critical probes for these three-dimensional studies. Comparative studies of amino acid sequences among various MHC and molecules have revealed distinct regions of hypervariability in the alpha-1 and -2 domains of class I heavy chains and the alpha-1 and beta-1 domains of most class II molecules. Mutant MHC molecules that differ from each other by no more than one to three amino acids can have structural changes which may result in a loss of the private epitopes that defined the allelic gene product. On the basis of these studies, the private epitopes are thought to be determined by one or more of the hypervariable regions. Similar studies of the relationships between specific regions of the molecule and public epitopes are not fully explored. Because public epitopes are partially conserved structures, one might expect that their structure is not principally determined by hypervariable region. In fact, however, some public epitopes, such as A2/B17 and BW4/Bw6, do map to diversity regions. Epitope mapping as a means of identifying specific topographic sites and relating these sites to specific functional regions of the molecule will be difficult unless the epitopes themselves are better defined. Thus, the capacity to distinguish spatially distinct public epitopes from cross-reactive homologous
Molecules and Models The molecular structures of main group element compounds
Haaland, Arne
2008-01-01
This book provides a systematic description of the molecular structures and bonding in simple compounds of the main group elements with particular emphasis on bond distances, bond energies and coordination geometries. The description includes the structures of hydrogen, halogen and methyl derivatives of the elements in each group, some of these molecules are ionic, some polar covalent. The survey of molecules whose structures conform to well-established trends is followed byrepresentative examples of molecules that do not conform. We also describe electron donor-acceptor and hydrogen bonded co
Structural properties of water around uncharged and charged carbon nanotubes
International Nuclear Information System (INIS)
Dezfoli, Amir Reza Ansari; Mehrabian, Mozaffar Ali; Rafsanjani, Hassan Hashemipour
2013-01-01
Studying the structural properties of water molecules around the carbon nanotubes is very important in a wide variety of carbon nanotubes applications. We studied the number of hydrogen bonds, oxygen and hydrogen density distributions, and water orientation around carbon nanotubes. The water density distribution for all carbon nanotubes was observed to have the same feature. In water-carbon nanotubes interface, a high-density region of water molecules exists around carbon nanotubes. The results reveal that the water orientation around carbon nanotubes is roughly dependent on carbon nanotubes surface charge. The water molecules in close distances to carbon nanotubes were found to make an HOH plane nearly perpendicular to the water-carbon nanotubes interface for carbon nanotubes with negative surface charge. For uncharged carbon nanotubes and carbon nanotubes with positive surface charge, the HOH plane was in tangential orientation with water-carbon nanotubes interface. There was also a significant reduction in hydrogen bond of water region around carbon nanotubes as compared with hydrogen bond in bulk water. This reduction was very obvious for carbon nanotubes with positive surface charge. In addition, the calculation of dynamic properties of water molecules in water-CNT interface revealed that there is a direct relation between the number of Hbonds and self-diffusion coefficient of water molecules
Spin fine structure of optically excited quantum dot molecules
Scheibner, M.; Doty, M. F.; Ponomarev, I. V.; Bracker, A. S.; Stinaff, E. A.; Korenev, V. L.; Reinecke, T. L.; Gammon, D.
2007-06-01
The interaction between spins in coupled quantum dots is revealed in distinct fine structure patterns in the measured optical spectra of InAs/GaAs double quantum dot molecules containing zero, one, or two excess holes. The fine structure is explained well in terms of a uniquely molecular interplay of spin-exchange interactions, Pauli exclusion, and orbital tunneling. This knowledge is critical for converting quantum dot molecule tunneling into a means of optically coupling not just orbitals but also spins.
Structure and transport properties of atomic chains and molecules
DEFF Research Database (Denmark)
Strange, Mikkel
2008-01-01
general in the literature, a set of benchmark calculations for the Kohn-Sham elastic transmission function of representative single-molecule junctions has been performed. The transmission functions are calculated using two different density functional theory methods, namely an ultrasoft pseudopotential...... by direct visualization of Kohn-Sham eigenchannel states. The possibility of non-carbon based nanotubes is also discussed. Both calculations of the strain energy of infinite PtO2 nanotubes that this material could be a candidate for non-carbon based nanotubes, as was recently suggested [6]....
Synthesis of Large Molecules in Cometary Ice Analogs: Physical Properties
Dworkin, Jason; Sandford, S. A.; Allamandola, L. J.; Deamer, D. W.; Gillette, S. J.; Zare, R. N.
Comets and carbonaceous micrometeorites may have been important sources of volatiles on the early Earth; their organic composition may therefore be related to the origin of life. Ices on grains in molecular clouds contain a variety of simple molecules. Within the cloud and especially the presolar nebula, these icy grains would have been photoprocessed by ultraviolet light to produce more complex molecules. We are investigating the molecules that could have been generated in precometary ices. Experiments were conducted by forming a realistic interstellar ice (H_2^O, CH_3H, NH_3 and CO) at ~10 K under high vacuum irradiated UV by a hydrogen plasma lamp. The residue remaining after warming to room temperature was analyzed by HPLC and by several mass spectrometric methods. This material contains a variety of complex compounds with MS profiles resembling those found in IDPs and meteorites. Surface tension measurements show that an amphiphilic component is also present. These species do not appear in various controls or in unphotolyzed samples. In other experiments, the residues were dispersed in aqueous media for microscopy. The organic material forms 10-40 micrometer droplets that fluoresce (300-450 nm) under UV excitation and appear strikingly similar to those produced by extracts of the Murchison meteorite. Together, these results suggest a link between organic material synthesized on cold grains photochemically and compounds that may have contributed to the organic inventory of the primitive Earth. The amphiphilic properties of such compounds permit self-assembly into the membranous boundary structures required for the first forms of cellular life.
Directory of Open Access Journals (Sweden)
Grant Dubois
2012-04-01
Full Text Available The structure activity relationship between the C16-C17 methylene double bond on the aglycone of steviol glycosides and the corresponding impact on their sweet taste has been reported here for the first time. It has been observed that converting stevioside and rebaudioside A to their corresponding ketones by switching the doubly bonded methylene on C-17 for a ketone group actually removes the sweet taste properties of these molecules completely. Regenerating the original molecules tends to restore the sweet taste of both the steviol glycosides. Thus this C16-C17 methylene double bond in rebaudioside A and stevioside can be regarded as a pharmacophore essential for the sweetness property of these molecules.
Gowda, Srivardhan Shivappa
Molecular electronics has recently spawned a considerable amount of interest with several molecules possessing charge-conduction and charge-storage properties proposed for use in electronic devices. Hybrid silicon-molecular technology has the promise of augmenting the current silicon technology and provide for a transitional path to future molecule-only technology. The focus of this dissertation work has been on developing a class of hybrid silicon-molecular electronic devices for DRAM and Flash memory applications utilizing redox-active molecules. This work exploits the ability of molecules to store charges with single-electron precision at room temperature. The hybrid devices are fabricated by forming self-assembled monolayers of redox-active molecules on Si and oxide (SiO2 and HfO2) surfaces via formation of covalent linkages. The molecules possess discrete quantum states from which electrons can tunnel to the Si substrate at discrete applied voltages (oxidation process, cell write), leaving behind a positively charged layer of molecules. The reduction (erase) process, which is the process of electrons tunneling back from Si to the molecules, neutralizes the positively charged molecular monolayer. Hybrid silicon-molecular capacitor test structures were electrically characterized with an electrolyte gate using cyclic voltammetry (CyV) and impedance spectroscopy (CV) techniques. The redox voltages, kinetics (write/erase speeds) and charge-retention characteristics were found to be strongly dependent on the Si doping type and densities, and ambient light. It was also determined that the redox energy states in the molecules communicate with the valence band of the Si substrate. This allows tuning of write and read states by modulating minority carriers in n- and p-Si substrates. Ultra-thin dielectric tunnel barriers (SiO2, HfO2) were placed between the molecules and the Si substrate to augment charge-retention for Flash memory applications. The redox response was
Strategy to discover diverse optimal molecules in the small molecule universe.
Rupakheti, Chetan; Virshup, Aaron; Yang, Weitao; Beratan, David N
2015-03-23
The small molecule universe (SMU) is defined as a set of over 10(60) synthetically feasible organic molecules with molecular weight less than ∼500 Da. Exhaustive enumerations and evaluation of all SMU molecules for the purpose of discovering favorable structures is impossible. We take a stochastic approach and extend the ACSESS framework ( Virshup et al. J. Am. Chem. Soc. 2013 , 135 , 7296 - 7303 ) to develop diversity oriented molecular libraries that can generate a set of compounds that is representative of the small molecule universe and that also biases the library toward favorable physical property values. We show that the approach is efficient compared to exhaustive enumeration and to existing evolutionary algorithms for generating such libraries by testing in the NKp fitness landscape model and in the fully enumerated GDB-9 chemical universe containing 3 × 10(5) molecules.
Evangelisti, Luca; Pate, Brooks
2017-06-01
A study of the minimally exciting topic of agreement between experimental and measured rotational constants of molecules was performed on a set of large molecules with 16-18 heavy atoms (carbon and oxygen). The molecules are: nootkatone (C_{15}H_{22}O), cedrol (C_{15}H_{26}O), ambroxide (C_{16}H_{28}O), sclareolide (C_{16}H_{22}O_{2}), and dihydroartemisinic acid (C_{15}H_{24}O_{2}). For this set of molecules we obtained 13C-subsitution structures for six molecules (this includes two conformers of nootkatone). A comparison of theoretical structures and experimental substitution structures was performed in the spirit of the recent work of Grimme and Steinmetz.[1] Our analysis focused the center-of-mass distance of the carbon atoms in the molecules. Four different computational methods were studied: standard DFT (B3LYP), dispersion corrected DFT (B3LYP-D3BJ), hybrid DFT with dispersion correction (B2PLYP-D3), and MP2. A significant difference in these theories is how they handle medium range correlation of electrons that produce dispersion forces. For larger molecules, these dispersion forces produce an overall contraction of the molecule around the center-of-mass. DFT poorly treats this effect and produces structures that are too expanded. MP2 calculations overestimate the correction and produce structures that are too compact. Both dispersion corrected DFT methods produce structures in excellent agreement with experiment. The analysis shows that the difference in computational methods can be described by a linear error in the center-of-mass distance. This makes it possible to correct poorer performing calculations with a single scale factor. We also reexamine the issue of the "Costain error" in substitution structures and show that it is significantly larger in these systems than in the smaller molecules used by Costain to establish the error limits. [1] Stefan Grimme and Marc Steinmetz, "Effects of London dispersion correction in density functional theory on
Equilibrium Structure of Manganese Trifluoride (MnF3) Molecule
International Nuclear Information System (INIS)
Caliskan, M.
2004-01-01
The symmetry lowering in manganese trifluoride molecule due to Jahn-Teller distortion was demonstrated in both the experimental and computational results. The molecule does not have D 3 h (or C 3 v) symmetry, rather it has C 2 v symmetry it has been shown from electron-diffraction measurements, that even a molecule of D 3 h symmetry in its equilibrium geometry would appear as having C 3 v symmetry. The manganese trifluoride molecular structures is an example of concerted applications of electron diffraction experiment and computation. It was found two lower energy structures with C 2 v symmetry, one corresponding to the ground state and another corresponding to the transition state. In this work we have calculate the equilibrium structure of the MnF 3 in the C 2 v configuration using the Interionic Force Model. We have compared our results for equilibrium bond lengths and bond angles with measured values from electron diffraction and with the results of quantum chemical calculations. The agreement can be considered as very reasonable
Organizing and addressing magnetic molecules.
Gatteschi, Dante; Cornia, Andrea; Mannini, Matteo; Sessoli, Roberta
2009-04-20
Magnetic molecules ranging from simple organic radicals to single-molecule magnets (SMMs) are intensively investigated for their potential applications in molecule-based information storage and processing. The goal of this Article is to review recent achievements in the organization of magnetic molecules on surfaces and in their individual probing and manipulation. We stress that the inherent fragility and redox sensitivity of most SMM complexes, combined with the noninnocent role played by the substrate, ask for a careful evaluation of the structural and electronic properties of deposited molecules going beyond routine methods for surface analysis. Detailed magnetic information can be directly obtained using X-ray magnetic circular dichroism or newly emerging scanning probe techniques with magnetic detection capabilities.
Zero-mode waveguide nanophotonic structures for single molecule characterization
Crouch, Garrison M.; Han, Donghoon; Bohn, Paul W.
2018-05-01
Single-molecule characterization has become a crucial research tool in the chemical and life sciences, but limitations, such as limited concentration range, inability to control molecular distributions in space, and intrinsic phenomena, such as photobleaching, present significant challenges. Recent developments in non-classical optics and nanophotonics offer promising routes to mitigating these restrictions, such that even low affinity (K D ~ mM) biomolecular interactions can be studied. Here we introduce and review specific nanophotonic devices used to support single molecule studies. Optical nanostructures, such as zero-mode waveguides (ZMWs), are usually fabricated in thin gold or aluminum films and serve to confine the observation volume of optical microspectroscopy to attoliter to zeptoliter volumes. These simple nanostructures allow individual molecules to be isolated for optical and electrochemical analysis, even when the molecules of interest are present at high concentration (µM–mM) in bulk solution. Arrays of ZMWs may be combined with optical probes such as single molecule fluorescence, single molecule fluorescence resonance energy transfer, and fluorescence correlation spectroscopy for distributed analysis of large numbers of single-molecule reactions or binding events in parallel. Furthermore, ZMWs may be used as multifunctional devices, for example by combining optical and electrochemical functions in a single discrete architecture to achieve electrochemical ZMWs. In this review, we will describe the optical properties, fabrication, and applications of ZMWs for single-molecule studies, as well as the integration of ZMWs into systems for chemical and biochemical analysis.
Directory of Open Access Journals (Sweden)
Jiun-Wei Hu
2016-01-01
Full Text Available A new white-light-emitting molecule (1 was synthesized and characterized by NMR spectroscopy, high resolution mass spectrometry, and single-crystal X-ray diffraction. Compound 1 crystallizes in the orthorhombic space group Pnma, with a = 12.6814(6, b = 7.0824(4, c = 17.4628(9 Å, α = 90°, β = 90°, γ = 90°. In the crystal, molecules are linked by weak intermolecular C-H···O hydrogen bonds, forming an infinite chain along [100], generating a C(10 motif. Compound 1 possesses an intramolecular six-membered-ring hydrogen bond, from which excited-state intramolecular proton transfer (ESIPT takes place from the phenolic proton to the carbonyl oxygen, resulting in a tautomer that is in equilibrium with the normal species, exhibiting a dual emission that covers almost all of the visible spectrum and consequently generates white light. It exhibits one irreversible one-electron oxidation and two irreversible one-electron reductions in dichloromethane at modest potentials. Furthermore, the geometric structures, frontier molecular orbitals (MOs, and the potential energy curves (PECs for 1 in the ground and the first singlet excited state were fully rationalized by density functional theory (DFT and time-dependent DFT calculations. The results demonstrate that the forward and backward ESIPT may happen on a similar timescale, enabling the excited-state equilibrium to be established.
Galván, Jorge E.; Gil, Diego M.; Lanús, Hernán E.; Altabef, Aida Ben
2015-02-01
The fourth member of the series of compounds of the type POX3 with X = I was synthesized and characterized by infrared spectroscopy. The geometrical parameters and vibrational properties of POX3 (X = F, Cl, Br, I) molecules were investigated theoretically by means DFT and ab initio methods. Available geometrical and vibrational data were used together with theoretical calculations in order to obtain a set of scaled force constants. The observed trends in geometrical parameters are analyzed and compared with those obtained in a previous work for the VOX3 (X = F, Cl, Br, I) series of compounds. NBO analysis was performed in order to know the hyper-conjugative interactions that favor one structure over another. The molecular properties such as ionization potential, electron affinity, electronegativity, chemical potential, chemical hardness, softness and global electrophilicity index have been deduced from HOMO-LUMO analysis.
Guessing unknown and disordered solvent molecules with squeeze in the structure validation platon
International Nuclear Information System (INIS)
Weng, S.
2014-01-01
This report describes the assignment of the nature and number of solvent molecules in the refinement of several solvated crystal structures without a prior knowledge of the solvent system used for crystallization for the cases when the solvent molecule cannot be properly modeled. The solvent molecules can be assigned even for twinned crystal structures. (author)
Bouarab, Lynda; Maherani, Behnoush; Kheirolomoom, Azadeh; Hasan, Mahmoud; Aliakbarian, Bahar; Linder, Michel; Arab-Tehrany, Elmira
2014-03-01
In this work, we studied the effect of nanoliposome composition based on phospholipids of docosahexaenoic acid (PL-DHA), salmon and soya lecithin, on physico-chemical characterization of vector. Cinnamic acid was encapsulated as a hydrophobic molecule in nanoliposomes made of three different lipid sources. The aim was to evaluate the influence of membrane lipid structure and composition on entrapment efficiency and membrane permeability of cinnamic acid. These properties are important for active molecule delivery. In addition, size, electrophoretic mobility, phase transition temperature, elasticity and membrane fluidity were measured before and after encapsulation. The results showed a correlation between the size of the nanoliposome and the entrapment. The entrapment efficiency of cinnamic acid was found to be the highest in liposomes prepared from salmon lecithin. The nanoliposomes composed of salmon lecithin presented higher capabilities as a carrier for cinnamic acid encapsulation. These vesicles also showed a high stability which in turn increases the membrane rigidity of nanoliposome as evaluated by their elastic properties, membrane fluidity and phase transition temperature. Copyright © 2013 Elsevier B.V. All rights reserved.
Single Molecule Spectroscopy of Electron Transfer
International Nuclear Information System (INIS)
Holman, Michael; Zang, Ling; Liu, Ruchuan; Adams, David M.
2009-01-01
The objectives of this research are threefold: (1) to develop methods for the study electron transfer processes at the single molecule level, (2) to develop a series of modifiable and structurally well defined molecular and nanoparticle systems suitable for detailed single molecule/particle and bulk spectroscopic investigation, (3) to relate experiment to theory in order to elucidate the dependence of electron transfer processes on molecular and electronic structure, coupling and reorganization energies. We have begun the systematic development of single molecule spectroscopy (SMS) of electron transfer and summaries of recent studies are shown. There is a tremendous need for experiments designed to probe the discrete electronic and molecular dynamic fluctuations of single molecules near electrodes and at nanoparticle surfaces. Single molecule spectroscopy (SMS) has emerged as a powerful method to measure properties of individual molecules which would normally be obscured in ensemble-averaged measurement. Fluctuations in the fluorescence time trajectories contain detailed molecular level statistical and dynamical information of the system. The full distribution of a molecular property is revealed in the stochastic fluctuations, giving information about the range of possible behaviors that lead to the ensemble average. In the case of electron transfer, this level of understanding is particularly important to the field of molecular and nanoscale electronics: from a device-design standpoint, understanding and controlling this picture of the overall range of possible behaviors will likely prove to be as important as designing ia the ideal behavior of any given molecule.
Directory of Open Access Journals (Sweden)
J. J. Schwab
2012-07-01
Full Text Available The polyhedral oligomeric silsesquioxane (POSS additivated polystyrene (PS based nanocomposites were prepared by melt processing and the structure-properties relationships of the POSS-PS systems were compared to those of the neat PS. In order to investigate the effect of these structural parameters on the final properties of the polymer nanocomposites, five different kinds of POSS samples were used, in particular, POSS with different inorganic cage and with different organic pendent groups. The rheological investigation suggests clearly that the POSS acts as a plasticizer and that the processability of the PS was positively modified. The affinity between the POSS samples and the PS matrix was estimated by the calculated theoretical solubility parameters, considering the Hoy’s method and by morphology analysis. Minor difference between the solubility parameter of POSS and the matrix means better compatibility and no aggregation tendency. Furthermore, the POSS loading leads to a decrease of the rigidity, of the glass transition temperature and of the damping factor of the nanocomposite systems. The loading of different POSS molecules with open cage leads to a more pronounced effect on all the investigated properties that the loading of the POSS molecules with closed cage. Moreover, the melt properties are significantly influenced by the type of inorganic framework, by the type of the pendent organic groups and by the interaction between the POSS organic groups and the host matrix, while, the solid state properties appears to be influenced more by the kind of cage.
Hoster, Harry E; Roos, Matthias; Breitruck, Achim; Meier, Christoph; Tonigold, Katrin; Waldmann, Thomas; Ziener, Ulrich; Landfester, Katharina; Behm, R Jürgen
2007-11-06
The influence of the substrate and the deposition conditions-vapor deposition versus deposition from solution-on the structures formed upon self-assembly of deposited bis(terpyridine) derivative (2,4'-BTP) monolayers on different hexagonal substrates, including highly oriented pyrolytic graphite (HOPG), Au(111), and (111)-oriented Ag thin films, was investigated by high-resolution scanning tunneling microscopy and by model calculations of the intermolecular energies and the lateral corrugation of the substrate-adsorbate interaction. Similar quasi-quadratic network structures with almost the same lattice constants obtained on all substrates are essentially identical to the optimum configuration expected from an optimization of the adlayer structure with C-H...N-type bridging bonds as a structure-determining factor, which underlines a key role of the intermolecular interactions in adlayer order. Slight distortions from the optimum values to form commensurate adlayer structures on the metal substrates and the preferential orientation of the adlayer with respect to the substrate are attributed to the substrate-adsorbate interactions, specifically, the lateral corrugation in the substrate-adsorbate interaction upon lateral displacement and rotation of the adsorbed BTP molecules. The fact that similar adlayer structures are obtained on HOPG under ultrahigh vacuum conditions (solid|gas interface) and on HOPG in trichlorobenzene (solid|liquid interface) indicates that the intermolecular interactions are not severely affected by the solvent.
Indian Academy of Sciences (India)
structure and properties (includingreactivt'ty) - both static (independent of time) and ... Furthermore, since the energy of H2 + in the ground state must be lower than that of .... (Figure 2b); note also that dp is positive in parts of the antibinding regions behind the two ... But, now both the sizes and shapes of molecules enter into.
Structural Dependence of Electronic Properties in A-A-D-A-A-Type Organic Solar Cell Material
Directory of Open Access Journals (Sweden)
Ram S. Bhatta
2015-01-01
Full Text Available Small conjugated molecules (SCMs are promising candidates for organic photovoltaic (OPV devices because of their structural simplicity, well control over synthetic reproducibility, and low purification cost. However, industrial development of SCM-based OPV devices requires improving their performance, which in turn relies on the fundamental understanding of structural dependence of electronic properties of SCMs. Herein, we report the structural and electronic properties of the BCNDTS molecule as a model system for acceptor-acceptor-donor-acceptor-acceptor (A-A-D-A-A type SCMs, using density functional theory (DFT and time-dependent DFT methods. Systematic calculations of two-dimensional potential energy surfaces, molecular electrostatic potential surfaces, ground state frontier molecular orbital energies, and the vertical excitation energies are performed. We found that the lowest energy conformation of the BCNDTS molecule is planar. The planar conformation favors the lowest ground state and the excited state energies as well as the strongest oscillator strength. The present results suggest that SCMs containing central dithienosilole cores connected with 2,1,3-benzothiadiazole groups have potential to be an efficient electron donor for OPV devices.
Trilling, A.K.; Harmsen, M.M.; Ruigrok, V.J.; Zuilhof, H.; Beekwilder, J.
2013-01-01
Uniform orientation of capture molecules on biosensors has been reported to increase sensitivity. Here it is investigated which analyte properties contribute to sensitivity by orientation. Orientation of capture molecules on biosensors was investigated using variable domains of llama heavy-chain
Alcohol molecules adsorption on graphane nanosheets - A first-principles investigation
Nagarajan, V.; Chandiramouli, R.
2018-05-01
The geometric structure, electronic and adsorption properties of methanol, ethanol and 1-propanol molecules on hydrogenated graphene (graphane) were investigated using first-principles calculations. The stability of graphane base material is confirmed using formation energy and phonon band structures. The adsorption of alcohol molecules on bare graphane and hydrogen vacant graphane nanosheet is found to be prominent and the selectivity of alcohol molecules can be achieved using bare or hydrogen vacant graphane nanosheet. Moreover, the interaction of alcohol molecules on bare and hydrogen vacant graphane nanosheets is studied using the adsorption energy, energy band gap variation, Bader charge transfer and average energy band gap variation. The adsorption energy ranges from -0.149 to -0.383 eV upon alcohol adsorption. The energy gap varies from 4.71 to 2.62 eV for bare graphane and from 4.02 to 3.60 eV for hydrogen vacant graphane nanosheets upon adsorption of alcohol molecules. The adsorption properties of alcohol molecules provide useful information for the possible application of graphane nanosheet as a base material for the detection of alcohol molecules.
Small-molecule kinase inhibitors: an analysis of FDA-approved drugs
DEFF Research Database (Denmark)
Wu, Peng; Nielsen, Thomas Eiland; Clausen, Mads Hartvig
2016-01-01
Small-molecule kinase inhibitors (SMKIs), 28 of which are approved by the US Food and Drug Administration (FDA), have been actively pursued as promising targeted therapeutics. Here, we assess the key structural and physicochemical properties, target selectivity and mechanism of function, and ther......Small-molecule kinase inhibitors (SMKIs), 28 of which are approved by the US Food and Drug Administration (FDA), have been actively pursued as promising targeted therapeutics. Here, we assess the key structural and physicochemical properties, target selectivity and mechanism of function...
Molecular Wring Resonances in Chain Molecules
DEFF Research Database (Denmark)
Bohr, Henrik; Brunak, Søren; Bohr, Jakob
1997-01-01
It is shown that the eigenfrequency of collective twist excitations in chain molecules can be in the megahertz and gigahertz range. Accordingly, resonance states can be obtained at specific frequencies, and phenomena that involve structural properties can take place. Chain molecules can alter the...... their conformation and their ability to function, and a breaking of the chain can result. It is suggested that this phenomenon forms the basis for effects caused by the interaction of microwaves and biomolecules, e.g. microwave assisted hydrolysis of chain molecules....
Syntheses, structural analyses and luminescent property of four alkaline-earth coordination polymers
International Nuclear Information System (INIS)
Zhang, Sheng; Qu, Xiao-Ni; Xie, Gang; Wei, Qing; Chen, San-Ping
2014-01-01
Four alkaline-earth coordination polymers, [Ba(Pzdc)(H 2 O)] n (1), [Ba(Pzdc)] n (2), [AgSr(Pzdc)(NO 3 )(H 2 O)] n (3), [Ag 2 Ca(Pzdc) 2 (H 2 O)] n (4) (H 2 Pzdc=2, 3-pyrazinedicarboxylic acid) have been synthesized and characterized by single-crystal X-ray diffraction. Compounds 1 and 2 afford 2D layer networks generated by one-dimensional chains containing the [Ba 2 O 11 N] units. Compound 3 is of 2D mixed-metal coordination network formed by one-dimensional chain units, while 4 is of a 3D heterometallic framework. Interestingly, 1 and 2 can undergo reversible SCSC structural transformation upon dehydration/rehydration of coordinated water molecules. In addition, the π–π stacking interactions dominate fluorescent properties of compounds 1 and 2. - Graphical abstract: Four new coordination polymers [Ba(Pzdc)(H 2 O)] n (1), [Ba(Pzdc)] n (2), [AgSr(Pzdc)(NO 3 )(H 2 O)] n (3), [Ag 2 Ca(Pzdc) 2 (H 2 O)] n (4) (H 2 Pzdc=2, 3-pyrazinedicarboxylic acid) have been synthesized. Compounds 1–3 display 2D topology structures and compound 4 exhibits a 3D topology structure. Fortunately, 1 and 2 undergo reversible dehydration/rehydration of coordinated water molecules. Display Omitted - Highlights: • All structures are generated by 1D chains. • 1 and 2 show reversible dehydration/rehydration of coordinated water molecules. • The π–π stacking interactions dominate fluorescent properties of compounds 1 and 2
Abe, Yuichiro
2017-08-15
Donor-acceptor type molecules based on fused ladder thienoarenes, indacenodithiophene (IDT) and dithienocyclopenta-thienothiophene (DTCTT), coupled with benzothiadiazole, are prepared and their solid-state structures are investigated. They display a rich variety of solid phases ranging from amorphous glass states to crystalline states, upon changes in the central aromatic core and side group structures. Most notably, the DTCTT-based derivatives showed reversible crystal-to-crystal phase transitions in heating and cooling cycles. Unlike what has been seen in π−conjugated molecules variable temperature XRD revealed that structural change occurs continuously during the transition. A columnar self-assembled structure with slip-stacked π−π interaction is proposed to be involved in the solid-state. This research provides the evidence of unique structural behavior of the DTCTT-based molecules through the detailed structural analysis. This unique structural transition paves the way for these materials to have self-healing of crystal defects, leading to improved optoelectronic properties.
Abe, Yuichiro; Savikhin, Victoria; Yin, Jun; Grimsdale, Andrew C.; Soci, Cesare; Toney, Michael F.; Lam, Yeng Ming
2017-01-01
Donor-acceptor type molecules based on fused ladder thienoarenes, indacenodithiophene (IDT) and dithienocyclopenta-thienothiophene (DTCTT), coupled with benzothiadiazole, are prepared and their solid-state structures are investigated. They display a rich variety of solid phases ranging from amorphous glass states to crystalline states, upon changes in the central aromatic core and side group structures. Most notably, the DTCTT-based derivatives showed reversible crystal-to-crystal phase transitions in heating and cooling cycles. Unlike what has been seen in π−conjugated molecules variable temperature XRD revealed that structural change occurs continuously during the transition. A columnar self-assembled structure with slip-stacked π−π interaction is proposed to be involved in the solid-state. This research provides the evidence of unique structural behavior of the DTCTT-based molecules through the detailed structural analysis. This unique structural transition paves the way for these materials to have self-healing of crystal defects, leading to improved optoelectronic properties.
International Nuclear Information System (INIS)
Li Zongliang; Zou Bin; Wang Chuankui; Luo Yi
2006-01-01
Influences of electrode distances on geometric structure of molecule and on electronic transport properties of molecular junctions have been investigated by means of a generalized quantum chemical approach based on the elastic scattering Green's function method. Numerical results show that, for organic molecule 4,4'-bipyridine, the geometric structure of the molecule especially the dihedral angle between the two pyridine rings is sensitive to the distances between the two electrodes. The currents of the molecular junction are taken nonlinearly increase with the increase of the bias. Shortening the distance of the metallic electrodes will result in stronger coupling and larger conductance
A theoretical study of structural and electronic properties of pentacene/Al(100) interface.
Saranya, G; Nair, Shiny; Natarajan, V; Kolandaivel, P; Senthilkumar, K
2012-09-01
The first principle calculations within the framework of density functional theory have been performed for the pentacene molecule deposited on the aluminum Al(100) substrate to study the structural and electronic properties of the pentacene/Al(100) interface. The most stable configuration was found at bridge site with 45° rotation of the pentacene molecule on Al(100) surface with a vertical distance of 3.4 Å within LDA and 3.8 Å within GGA functionals. The calculated adsorption energy reveals that the adsorption of pentacene molecule on Al(100) surface is physisorption. For the stable adsorption geometry the electronic properties such as density of states (DOS), partial density of states (PDOS), Mulliken population analysis and Schottky barrier height are studied. The analysis of atomic charge, DOS and PDOS show that the charge is transferred from the Al(100) surface to pentacene molecule, and the transferred charge is about -0.05 electrons. For the adsorbed system, the calculated Schottky barrier height for hole and electron transport is 0.27 and 1.55 eV, respectively. Copyright © 2012 Elsevier Inc. All rights reserved.
RNA secondary structure diagrams for very large molecules: RNAfdl
DEFF Research Database (Denmark)
Hecker, Nikolai; Wiegels, Tim; Torda, Andrew E.
2013-01-01
There are many programs that can read the secondary structure of an RNA molecule and draw a diagram, but hardly any that can cope with 10 3 bases. RNAfdl is slow but capable of producing intersection-free diagrams for ribosome-sized structures, has a graphical user interface for adjustments...
Single-Molecule Transport at a Rectifying GaAs Contact.
Vezzoli, Andrea; Brooke, Richard J; Ferri, Nicolò; Higgins, Simon J; Schwarzacher, Walther; Nichols, Richard J
2017-02-08
In most single- or few-molecule devices, the contact electrodes are simple ohmic resistors. Here we describe a new type of single-molecule device in which metal and semiconductor contact electrodes impart a function, namely, current rectification, which is then modified by a molecule bridging the gap. We study junctions with the structure Au STM tip/X/n-GaAs substrate, where "X" is either a simple alkanedithiol or a conjugated unit bearing thiol/methylthiol contacts, and we detect current jumps corresponding to the attachment and detachment of single molecules. From the magnitudes of the current jumps we can deduce values for the conductance decay constant with molecule length that agree well with values determined from Au/molecule/Au junctions. The ability to impart functionality to a single-molecule device through the properties of the contacts as well as through the properties of the molecule represents a significant extension of the single-molecule electronics "tool-box".
Electronic structure and optical properties of metal doped tetraphenylporphyrins
Shah, Esha V.; Roy, Debesh R.
2018-05-01
A density functional scrutiny on the structure, electronic and optical properties of metal doped tetraphenylporphyrins MTPP (M=Fe, Co, Ni) is performed. The structural stability of the molecules is evaluated based on the electronic parameters like HOMO-LUMO gap (HLG), chemical hardness (η) and binding energy of the central metal atom to the molecular frame etc. The computed UltraViolet-Visible (UV-Vis) optical absorption spectra for all the compounds are also compared. The molecular structures reported are the lowest energy configurations. The entire calculations are carried out with a widely reliable functional, viz. B3LYP with a popular basis set which includes a scaler relativistic effect, viz. LANL2DZ.
Wang, Xiao Hua; Wang, Da Wei; Yang, Ai Jun; Koratkar, Nikhil; Chu, Ji Feng; Lv, Pin Lei; Rong, Ming Zhe
2018-02-07
Tellurene is a new member of the two-dimensional (2D) materials' family, whose existence has been recently confirmed by first principles calculation and experimental work. Tellurene is also the first 2D mono-elemental material of group-VI predicted by scientists, and investigations of its basic properties are still in their infancy. In this study, we use first principles calculation based on density functional theory to investigate the adsorption of nineteen typical adatoms (Li, Na, K, Ca, Fe, Co, Ni, Cu, Zn, Ag, Au, Pd, Pt, B, N, O, Si, Cl, and Al), and five typical gas molecules (H 2 , O 2 , H 2 O, NO 2 , and NH 3 ) on α-phase as well as β-phase tellurene sheets. Our calculations shows that most adatoms are chemisorbed on tellurene sheets with large adsorption energies. Moreover, some of the adatoms are observed to give rise to distinct structural deformations and even local reconstructions. We report that a variety of electronic states are induced by the adatoms, which implies that different electronic structures can be engineered by the adsorption of adatoms. In fact, n-type doping, p-type doping, half-metal, and spin-gapless semiconductor features can be acquired by doping adatoms on tellurene sheets. Our calculations also show that the five gas molecules are all physisorbed on tellurene sheets, and no splitting behaviors are observed. Therefore, the adsorption of the five gas molecules has a weak effect on the electronic properties of tellurene. To conclude, our results indicate that adatom engineering may be used to greatly expand the potential applications of 2D tellurene.
Synthesis, structure and some properties of a manganese(II) benzoate containing diimine
Paul, Pranajit; Roy, Subhadip; Sarkar, Sanjoy; Chowdhury, Shubhamoy; Purkayastha, R. N. Dutta; Raghavaiah, Pallepogu; McArdle, Patrick; Deb, Lokesh; Devi, Sarangthem Indira
2015-12-01
A new monomeric manganese(II) benzoate complex containing nitrogen donor 2,2‧-bipyridine, [Mn(OBz)2(bipy)(H2O)] (OBz = benzoate, bipy = 2,2‧-bipyridine) has been synthesized from aqueous methanol medium and characterized by analytical, spectroscopic and single crystal X-ray diffraction studies. The compound exhibits moderate to appreciable antimicrobial activity. The complex crystallizes in space group P21/n. Mn(II) atom is ligated by two N atoms of bipyridine, three O atoms from a monodentate and a bidentate benzoate ligand and a water molecule forming distorted octahedral structure. The coordinated water molecule forms intramolecular hydrogen bonds and links the monomer molecules into hydrogen bonded dimer. The hydrogen bonded dimers are involved in intermolecular C-H···O and π-π stacking interactions. Density functional theory (DFT) computation was carried out to compute the frequencies of relevant vibrational modes and electronic properties, the results are in compliance with the experimentally obtained structural and spectral data.
Wang, Wen-Min; Zhao, Xiao-Yu; Qiao, Hui; Bai, Li; Han, Hong-Fei; Fang, Ming; Wu, Zhi-Lei; Zou, Ji-Yong
2017-09-01
In search of simple approaches to rationally modulate the single-molecule magnet behaviour in polynuclear lanthanide compound, a new system containing two structurally closely related dinuclear dysprosium complexes, namely [Dy2(hfac)4L2] (1) and [Dy2(hfac)4L‧2] (2) (hfac = hexafluoroacetylacetonate, HL = 2-[4-methylaniline-imino]methyl]-8-hydroxyquinoline and HL' = 2-[(3,4-dimethylaniline)-imino]methyl]-8-hydroxyquinoline), are successfully synthesized and the structure-dependent magnetic properties are investigated. The two Dy2 compounds display only slight variations in the coordination geometries of the center Dy(III) ion but display remarkably different single-molecule magnet behaviors with the anisotropic barriers (ΔE/kB) of 9.91 K for 1 and 20.57 K for 2. The different magnetic relaxation behaviors of the two Dy2 complexes mainly originate from the different chemical environments of the central DyIII ions.
Gamma radiation-induced structural changes in triglyceride molecules in pork fat
International Nuclear Information System (INIS)
Salkova, Z.; Koman, V.
1976-01-01
In the structure of associated and individual triglyceride pork fat molecules, some changes take place under the effect of ionizing radiation. Due to the irradiation of the fat the amount of the di- and tri-unsaturated (UUU, UUS, USU) triglyceride molecules decreases. The occurrence of the unsatured fatty acids on sites 1,3 decreases and the percentage of the individual triglyceride molecules having on their extreme sites C-1,3 unsaturated fatty acids decreases in all combinations. It can be assumed that hydrogenation and pre-esterification occurs in the triglyceride molecules. (author)
Ab initio study of structural and mechanical property of solid molecular hydrogens
Ye, Yingting; Yang, Li; Yang, Tianle; Nie, Jinlan; Peng, Shuming; Long, Xinggui; Zu, Xiaotao; Du, Jincheng
2015-06-01
Ab initio calculations based on density functional theory (DFT) were performed to investigate the structural and the elastic properties of solid molecular hydrogens (H2). The influence of molecular axes of H2 on structural relative stabilities of hexagonal close-packed (hcp) and face-centered cubic (fcc) structured hydrogen molecular crystals were systematically investigated. Our results indicate that for hcp structures, disordered hydrogen molecule structure is more stable, while for fcc structures, Pa3 hydrogen molecular crystal is most stable. The cohesive energy of fcc H2 crystal was found to be lower than hcp. The mechanical properties of fcc and hcp hydrogen molecular crystals were obtained, with results consistent with previous theoretical calculations. In addition, the effects of zero point energy (ZPE) and van der Waals (vdW) correction on the cohesive energy and the stability of hydrogen molecular crystals were systematically studied and discussed.
Structure factors for tunneling ionization rates of molecules
DEFF Research Database (Denmark)
Madsen, L.B.; Jensen, F.; Tolstikhin, O.I.
2013-01-01
Within the weak-field asymptotic theory, the dependence of the tunneling ionization rate of a molecule in a static electric field on its orientation with respect to the field is determined by the structure factor for the highest occupied molecular orbital (HOMO). An accurate determination...
Syntheses, structural analyses and luminescent property of four alkaline-earth coordination polymers
Energy Technology Data Exchange (ETDEWEB)
Zhang, Sheng; Qu, Xiao-Ni; Xie, Gang; Wei, Qing; Chen, San-Ping, E-mail: sanpingchen@126.com
2014-02-15
Four alkaline-earth coordination polymers, [Ba(Pzdc)(H{sub 2}O)]{sub n} (1), [Ba(Pzdc)]{sub n} (2), [AgSr(Pzdc)(NO{sub 3})(H{sub 2}O)]{sub n} (3), [Ag{sub 2}Ca(Pzdc){sub 2}(H{sub 2}O)]{sub n} (4) (H{sub 2}Pzdc=2, 3-pyrazinedicarboxylic acid) have been synthesized and characterized by single-crystal X-ray diffraction. Compounds 1 and 2 afford 2D layer networks generated by one-dimensional chains containing the [Ba{sub 2}O{sub 11}N] units. Compound 3 is of 2D mixed-metal coordination network formed by one-dimensional chain units, while 4 is of a 3D heterometallic framework. Interestingly, 1 and 2 can undergo reversible SCSC structural transformation upon dehydration/rehydration of coordinated water molecules. In addition, the π–π stacking interactions dominate fluorescent properties of compounds 1 and 2. - Graphical abstract: Four new coordination polymers [Ba(Pzdc)(H{sub 2}O)]{sub n} (1), [Ba(Pzdc)]{sub n} (2), [AgSr(Pzdc)(NO{sub 3})(H{sub 2}O)]{sub n} (3), [Ag{sub 2}Ca(Pzdc){sub 2}(H{sub 2}O)]{sub n} (4) (H{sub 2}Pzdc=2, 3-pyrazinedicarboxylic acid) have been synthesized. Compounds 1–3 display 2D topology structures and compound 4 exhibits a 3D topology structure. Fortunately, 1 and 2 undergo reversible dehydration/rehydration of coordinated water molecules. Display Omitted - Highlights: • All structures are generated by 1D chains. • 1 and 2 show reversible dehydration/rehydration of coordinated water molecules. • The π–π stacking interactions dominate fluorescent properties of compounds 1 and 2.
International Nuclear Information System (INIS)
Huang Feng; Wang Xue-Jin; Liu Yan-Hong; Ye Mao-Fu; Wang Long
2010-01-01
Structures and dynamics of two-dimensional dust lattices with and without Coulomb molecules in plasmas are investigated. The experimental results show that the lattices have the crystal-like hexagonal structures, i.e. most particles have six nearest-neighboring particles. However, the lattice points can be occupied by the individual particles or by a pair of particles called Coulomb molecules. The pair correlation function is used to compare the structures between the lattices with or without the Coulomb molecules. In the experiments, the Coulomb molecules can also decompose and recombine with another individual particle to form a new molecule. (physics of gases, plasmas, and electric discharges)
Magnetic properties of dendrimer structures with different coordination numbers: A Monte Carlo study
Masrour, R.; Jabar, A.
2016-11-01
We investigate the magnetic properties of Cayley trees of large molecules with dendrimer structure using Monte Carlo simulations. The thermal magnetization and magnetic susceptibility of a dendrimer structure are given with different coordination numbers, Z=3, 4, 5 and different generations g=3 and 2. The variation of magnetizations with the exchange interactions and crystal fields have been given of this system. The magnetic hysteresis cycles have been established.
Small Molecules Affect Human Dental Pulp Stem Cell Properties Via Multiple Signaling Pathways
Al-Habib, Mey; Yu, Zongdong
2013-01-01
One fundamental issue regarding stem cells for regenerative medicine is the maintenance of stem cell stemness. The purpose of the study was to test whether small molecules can enhance stem cell properties of mesenchymal stem cells (MSCs) derived from human dental pulp (hDPSCs), which have potential for multiple clinical applications. We identified the effects of small molecules (Pluripotin (SC1), 6-bromoindirubin-3-oxime and rapamycin) on the maintenance of hDPSC properties in vitro and the mechanisms involved in exerting the effects. Primary cultures of hDPSCs were exposed to optimal concentrations of these small molecules. Treated hDPSCs were analyzed for their proliferation, the expression levels of pluripotent and MSC markers, differentiation capacities, and intracellular signaling activations. We found that small molecule treatments decreased cell proliferation and increased the expression of STRO-1, NANOG, OCT4, and SOX2, while diminishing cell differentiation into odonto/osteogenic, adipogenic, and neurogenic lineages in vitro. These effects involved Ras-GAP-, ERK1/2-, and mTOR-signaling pathways, which may preserve the cell self-renewal capacity, while suppressing differentiation. We conclude that small molecules appear to enhance the immature state of hDPSCs in culture, which may be used as a strategy for adult stem cell maintenance and extend their capacity for regenerative applications. PMID:23573877
Energy Technology Data Exchange (ETDEWEB)
Waddell, Paul G.; Liu, Xiaogang; Zhao, Teng; Cole, Jacqueline M.
2015-05-01
The absorption and fluorescence properties of six boron dipyrromethene (BODIPY) laser dyes with simple non-aromatic substituents are rationalized by relating them to observable structural perturbations within the molecules of the dyes. An empirical relationship involving the structure and the optical properties is derived using a combination of single-crystal X-ray diffraction data, quantum chemical calculations and electronic constants: i.e. the tendency of the pyrrole bond lengths towards aromaticity and the UV-vis absorption and fluorescence wavelengths correlating with the electron-donor properties of the substituents. The effect of molecular conformation on the solid-state optical properties of the dyes is also discussed. The findings in this study also demonstrate the usefulness and limitations of using crystal structure data to develop structure-property relationships in this class of optical materials, contributing to the growing effort to design optoelectronic materials with tunable properties via molecular engineering.
Quasi continuum vibrational of molecules and isotopic selectivity properties induced by collisions
International Nuclear Information System (INIS)
Angelie, Christian
1990-01-01
This research thesis proposes an overview of knowledge on vibrationally highly excited states of molecules. The author shows that the statistic quasi-continuum formed by these states is preceded by a quasi continuum of weak transitions with a lower energy, and that these transitions remain structured and very narrow up to the dissociation energy and beyond. Collisions between molecules excited in their quasi continuum are then studied. The author particularly analyses a new phenomenon of isotopic selectivity which is important for the dissociation of a molecule colliding another molecule. It appears that this selectivity regarding selectivity is due to a selectivity of transferred energy which paradoxically increases with the molecule vibrational content because of a resonance phenomenon of energies transferred by dipole-dipole interaction [fr
Noori Tahneh, Akram; Bagheri Novir, Samaneh; Balali, Ebrahim
2017-11-25
The geometrical structure, electronic and optical properties, electronic absorption spectra, vibrational frequencies, natural charge distribution, MEP analysis and thermodynamic properties of the trans and cis structures of the drug thiothixene were investigated using density functional theory (DFT) and time-dependent DFT (TDDFT) methods with the B3LYP hybrid functional and 6-311 + G(d,p) basis set. The results of the calculations demonstrate that the cis structure of thiothixene has appropriate quantum properties that can act as an active medicine. The relative energies of trans and cis structures of thiothixene shows that the cis structure is more stable than the trans structure, with a small energy difference. TDDFT calculations show that the cis structure of thiothixene has the best absorption properties. The calculated NLO properties show that the NLO properties of the cis structure of thiothixene are higher than the trans structure, and the fact that the chemical hardness of the cis structure is lower than that of the trans structure that indicates that the reactivity and charge transfer of the cis isomer of thiothixene is higher than that of trans thiothixene. The molecular electrostatic potential (MEP) maps of both structures of thiothixene demonstrate that the oxygen atoms of the molecule are appropriate areas for electrophilic reactions. The vibrational frequencies of the two conformations of thiothixene demonstrate that both structures of thiothixene have almost similar modes of vibrations. The calculated thermodynamic parameters show that these quantities increase with enhancing temperature due to the enhancement of molecular vibrational intensities with temperature. Graphical abstract Trans/Cis isomerization of thiothixene drug.
Structure of molecules and internal rotation
Mizushima, San-Ichiro
1954-01-01
Structure of Molecules and Internal Rotation reviews early studies on dihalogenoethanes. This book is organized into two parts encompassing 8 chapters that evaluate the Raman effect in ethane derivatives, the energy difference between rotational isomers, and the infrared absorption of ethane derivatives. Some of the topics covered in the book are the potential barrier to internal rotation; nature of the hindering potential; entropy difference between the rotational isomers; internal rotation in butane, pentane, and hexane; and internal rotation in long chain n-paraffins. Other chapters deal wi
Structural requirements for the interaction between class II MHC molecules and peptide antigens
DEFF Research Database (Denmark)
Sette, A; Buus, S; Appella, E
1990-01-01
of binding, it is possible to define certain structural features of peptides that are associated with the capacity to bind to a particular MHC specificity (IA(d) or IE(d)); 3) IA(d) and IE(d) molecules recognize different and independent structures on the antigen molecule; 4) only about 10% of the single...... IA(d) and IE(d) molecules and their peptide ligands, we found that some structural characteristics apply to both antigen-MHC interactions. In particular, we found: 1) each MHC molecule is capable of binding many unrelated peptides through the same peptide-binding site; 2) despite this permissiveness...... amino acid substitutions tested on two IA(d)- and IE(d)-binding peptides had significant effect on their MHC-binding capacities, while over 80% of these substitutions significantly impaired T cell recognition of the Ia-peptide complex; 5) based on the segregation between residues that are crucial for T...
A Pareto Algorithm for Efficient De Novo Design of Multi-functional Molecules.
Daeyaert, Frits; Deem, Micheal W
2017-01-01
We have introduced a Pareto sorting algorithm into Synopsis, a de novo design program that generates synthesizable molecules with desirable properties. We give a detailed description of the algorithm and illustrate its working in 2 different de novo design settings: the design of putative dual and selective FGFR and VEGFR inhibitors, and the successful design of organic structure determining agents (OSDAs) for the synthesis of zeolites. We show that the introduction of Pareto sorting not only enables the simultaneous optimization of multiple properties but also greatly improves the performance of the algorithm to generate molecules with hard-to-meet constraints. This in turn allows us to suggest approaches to address the problem of false positive hits in de novo structure based drug design by introducing structural and physicochemical constraints in the designed molecules, and by forcing essential interactions between these molecules and their target receptor. © 2017 Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim.
Structural Analysis of ‘key’ Interactions in Functional RNA Molecules
Chawla, Mohit
2018-04-01
The main objective of the thesis is to carry out structural bioinformatics study along with usage of advanced quantum chemical methods to look at the structural stability and energetics of RNA building blocks. The main focus of the work described here lies on understanding the reasons behind the intrinsic stability of key interactions in nucleic acids. Crystal structures of RNA molecules exhibit fascinating variety of non-covalent interactions, which play an important role in maintaining the three dimensional structures. An accurate atomic level description of these interactions in the structural building blocks of RNA is a key to understand the structure-function relationship in these molecules. An effort has been made to link the conclusions drawn from quantum chemical computations on RNA base pairs in wide biochemical context of their occurrence in RNA structures. The initial attention was on the impact of natural and non-natural modifications of the nucleic acid bases on the structure and stability of base pairs that they are involved in. In the remaining sections we cover other molecular interactions shaping nucleic acids, as the interaction between ribose and the bases, and the fluoride sensing riboswitch system in order to investigate structure and dynamics of nucleic acids at the atomic level and to gain insight into the physical chemistry behind.
Structural Analysis of ‘key’ Interactions in Functional RNA Molecules
Chawla, Mohit
2018-01-01
The main objective of the thesis is to carry out structural bioinformatics study along with usage of advanced quantum chemical methods to look at the structural stability and energetics of RNA building blocks. The main focus of the work described here lies on understanding the reasons behind the intrinsic stability of key interactions in nucleic acids. Crystal structures of RNA molecules exhibit fascinating variety of non-covalent interactions, which play an important role in maintaining the three dimensional structures. An accurate atomic level description of these interactions in the structural building blocks of RNA is a key to understand the structure-function relationship in these molecules. An effort has been made to link the conclusions drawn from quantum chemical computations on RNA base pairs in wide biochemical context of their occurrence in RNA structures. The initial attention was on the impact of natural and non-natural modifications of the nucleic acid bases on the structure and stability of base pairs that they are involved in. In the remaining sections we cover other molecular interactions shaping nucleic acids, as the interaction between ribose and the bases, and the fluoride sensing riboswitch system in order to investigate structure and dynamics of nucleic acids at the atomic level and to gain insight into the physical chemistry behind.
Counteracting chemical chaperone effects on the single-molecule α-synuclein structural landscape
Ferreon, Allan Chris M.; Moosa, Mahdi Muhammad; Gambin, Yann; Deniz, Ashok A.
2012-01-01
Protein structure and function depend on a close interplay between intrinsic folding energy landscapes and the chemistry of the protein environment. Osmolytes are small-molecule compounds that can act as chemical chaperones by altering the environment in a cellular context. Despite their importance, detailed studies on the role of these chemical chaperones in modulating structure and dimensions of intrinsically disordered proteins have been limited. Here, we used single-molecule Förster reson...
International Nuclear Information System (INIS)
Sharma, G. D.
2011-01-01
Solution processed bulk heterojunction (BHJ) organic solar cells (OSCs) have gained wide interest in past few years and are established as one of the leading next generation photovoltaic technologies for low cost power production. Power conversion efficiencies up to 6% and 6.5% have been reported in the literature for single layer and tandem solar cells, respectively using conjugated polymers. A recent record efficiency about 8.13% with active area of 1.13 cm 2 has been reported. However Solution processable small molecules have been widely applied for photovoltaic (PV) devices in recent years because they show strong absorption properties, and they can be easily purified and deposited onto flexible substrates at low cost. Introducing different donor and acceptor groups to construct donor--acceptor (D--A) structure small molecules has proved to be an efficient way to improve the properties of organic solar cells (OSCs). The power conversion efficiency about 4.4 % has been reported for OSCs based on the small molecules. This review deals with the recent progress of solution processable D--A structure small molecules and discusses the key factors affecting the properties of OSCs based on D--A structure small molecules: sunlight absorption, charge transport and the energy level of the molecules.
Energy Technology Data Exchange (ETDEWEB)
Chakraborty, Kaushik; Bandyopadhyay, Sanjoy, E-mail: sanjoy@chem.iitkgp.ernet.in [Molecular Modeling Laboratory, Department of Chemistry, Indian Institute of Technology, Kharagpur 721302 (India)
2015-07-28
Single-stranded DNA (ss-DNA) binding proteins specifically bind to the single-stranded regions of the DNA and protect it from premature annealing, thereby stabilizing the DNA structure. We have carried out atomistic molecular dynamics simulations of the aqueous solutions of two DNA binding K homology (KH) domains (KH3 and KH4) of the far upstream element binding protein complexed with two short ss-DNA segments. Attempts have been made to explore the influence of the formation of such complex structures on the microscopic dynamics and hydrogen bond properties of the interfacial water molecules. It is found that the water molecules involved in bridging the ss-DNA segments and the protein domains form a highly constrained thin layer with extremely retarded mobility. These water molecules play important roles in freezing the conformational oscillations of the ss-DNA oligomers and thereby forming rigid complex structures. Further, it is demonstrated that the effect of complexation on the slow long-time relaxations of hydrogen bonds at the interface is correlated with hindered motions of the surrounding water molecules. Importantly, it is observed that the highly restricted motions of the water molecules bridging the protein and the DNA components in the complexed forms originate from more frequent hydrogen bond reformations.
Kumari, Pratibha; Kaur, Supreet; Sharma, Shobha; Kashyap, Hemant K.
2018-04-01
Modulation of lipid membrane properties due to the permeation of amphiphiles is an important biological process pertaining to many applications in the field of pharmaceutics, toxicology, and biotechnology. Sphingolipids are both structural and functional lipids that constitute an important component of mechanically stable and chemically resistant outer leaflets of plasma membranes. Here, we present an atomistic molecular dynamics simulation study to appreciate the concentration-dependent effects of small amphiphilic molecules, such as ethanol, acetone, and dimethyl sulfoxide (DMSO), on the structure and stability of a fully hydrated homogeneous N-palmitoyl-sphingomyelin (PSM) bilayer. The study reveals an increase in the lateral expansion of the bilayer along with disordering of the hydrophobic lipid tails on increasing the concentration of ethanol. At higher concentrations of ethanol, rupturing of the bilayer is quite evident through the analysis of partial electron density profiles and lipid tail order parameters. For ethanol containing systems, permeation of water molecules in the hydrophobic part of the bilayer is allowed through local defects made due to the entry of ethanol molecules via ethanol-ethanol and ethanol-PSM hydrogen bonds. Moreover, the extent of PSM-PSM hydrogen bonding decreases with increasing ethanol concentration. On the other hand, acetone and DMSO exhibit minimal effects on the stability of the PSM bilayer at their lower concentrations, but at higher concentrations they tend to enhance the stability of the bilayer. The simulated potential of mean force (PMF) profiles for the translocation of the three solutes studied reveal that the free-energy of transfer of an ethanol molecule across the PSM lipid head region is lower than that for acetone and DMSO molecules. However, highest free-energy rise in the core hydrophobic part of the bilayer is observed for the DMSO molecule, whereas the ethanol and acetone PMF profiles show a lower barrier in
Mapping small molecule binding data to structural domains.
Kruger, Felix A; Rostom, Raghd; Overington, John P
2012-01-01
Large-scale bioactivity/SAR Open Data has recently become available, and this has allowed new analyses and approaches to be developed to help address the productivity and translational gaps of current drug discovery. One of the current limitations of these data is the relative sparsity of reported interactions per protein target, and complexities in establishing clear relationships between bioactivity and targets using bioinformatics tools. We detail in this paper the indexing of targets by the structural domains that bind (or are likely to bind) the ligand within a full-length protein. Specifically, we present a simple heuristic to map small molecule binding to Pfam domains. This profiling can be applied to all proteins within a genome to give some indications of the potential pharmacological modulation and regulation of all proteins. In this implementation of our heuristic, ligand binding to protein targets from the ChEMBL database was mapped to structural domains as defined by profiles contained within the Pfam-A database. Our mapping suggests that the majority of assay targets within the current version of the ChEMBL database bind ligands through a small number of highly prevalent domains, and conversely the majority of Pfam domains sampled by our data play no currently established role in ligand binding. Validation studies, carried out firstly against Uniprot entries with expert binding-site annotation and secondly against entries in the wwPDB repository of crystallographic protein structures, demonstrate that our simple heuristic maps ligand binding to the correct domain in about 90 percent of all assessed cases. Using the mappings obtained with our heuristic, we have assembled ligand sets associated with each Pfam domain. Small molecule binding has been mapped to Pfam-A domains of protein targets in the ChEMBL bioactivity database. The result of this mapping is an enriched annotation of small molecule bioactivity data and a grouping of activity classes
Energy Technology Data Exchange (ETDEWEB)
Karacuban, Hatice
2010-01-28
In this work, the growth of the archetype molecules CuPc and PTCDA was investigated on Cu(111). PTCDA was also studied on NaCl/Cu(111). The main experiments were carried out with a scanning tunneling microscope. Structural analysis of CuPc on Cu (111) is only possible at low temperatures, since at room temperature the molecules exhibit a high surface mobility. For the investigation of these structures and especially to enable scanning tunneling spectroscopy, a low-temperature scanning tunneling microscope was developed. Using this home built STM the experiments could be carried out at about 10 K. After the adsorption of CuPc on Cu (111) a substrate-induced symmetry reduction of the molecules can be observed in scanning tunneling microscopy. When the occupied states of the molecules are imaged, a switching between two distinct levels is found. These modifications are determined by the adsorption geometry of the molecules. Based on high resolution STM data, an on-top adsorption geometry of the CuPc-molecules on Cu (111)-substrate can be deducted. At low temperatures, two new superstructures of PTCDA on Cu(111) are observed. The molecules within these superstructures are tilted with respect to the substrate. Intermolecular interactions may be the crucial factor for the realignment of the molecules. If PTCDA molecules are adsorbed on a NaCl/Cu (111) substrate, at room temperature, also two new superstructures on the copper substrate were found. They indicate the formation of a metall-organic-complex. On top of the NaCl layer the molecules exclusively grow at polar NaCl step edges. This is an indication for electrostatic interaction between the PTCDA molecules and the NaCl layer. When the molecule density is further increased, a Vollmer-Weber growth sets in. If both molecules PTCDA and CuPc are present on the sample at the same time, local spectroscopy provides information on the metal-organic interface in direct comparison. The STS-results of CuPc/PTCDA on Cu (111
Structure and linear spectroscopic properties of near IR polymethine dyes
International Nuclear Information System (INIS)
Webster, Scott; Padilha, Lazaro A.; Hu Honghua; Przhonska, Olga V.; Hagan, David J.; Van Stryland, Eric W.; Bondar, Mikhail V.; Davydenko, Iryna G.; Slominsky, Yuriy L.; Kachkovski, Alexei D.
2008-01-01
We performed a detailed experimental investigation and quantum-chemical analysis of a new series of near IR polymethine dyes with 5-butyl-7,8-dihydrobenzo[cd]furo[2,3-f]indolium terminal groups. We also synthesized and studied two neutral dyes, squaraine and tetraone, with the same terminal groups and performed a comparison of the spectroscopic properties of this set of 'near IR' dyes (polymethine, squaraine, and tetraone) with an analogous set of 'visible' dyes with simpler benzo[e]indolium terminal groups. From these measurements, we find that the dyes with dihydrobenzo[cd]furo[2,3-f]indolium terminal groups are characterized by a remarkably large shift ∼300 nm (∼200 nm for tetraone) of their absorption bands towards the red region. We discuss the difference in electronic structure for these molecules and show that the 'near IR' dyes are characterized by an additional weak fluorescence band from the higher lying excited states connected with the terminal groups. Absorption spectra for the longest polymethines are solvent-dependent and are characterized by a broadening of the main band in polar solvents, which is explained by ground state symmetry breaking and reduced charge delocalization within the polymethine chromophore. The results of these experiments combined with the agreement of quantum chemical calculations moves us closer to a predictive capability for structure-property relations in cyanine-like molecules
Switching behavior of double-decker single molecule magnets on a metal surface
Energy Technology Data Exchange (ETDEWEB)
Fu, Yingshuang; Schwoebel, Joerg; Hoffmann, Germar; Brede, Jens; Wiesendanger, Roland [University of Hamburg, Hamburg (Germany); Dillulo, Andrew [Ohio University, Athens (United States); Klyatskaya, Svetlana [Karlsruhe Institute of Technology, Karlsruhe (Germany); Ruben, Mario [Karlsruhe Institute of Technology, Karlsruhe (Germany); Universite de Strasbourg, Strasbourg (France)
2011-07-01
Single molecule magnets (SMM) are most promising materials for spin based molecular electronics. Due to their large magnetic anisotropy stabilized by inside chemical bonds, SMM can potentially be used for information storage at the single molecule level. For applications, it is of importance to adsorb the SMM onto surfaces and to study their subsequent conformational, electronic and magnetic properties. We have investigated the adsorption behavior of Tb and Dy based double-decker SMM on an Ir(111) surface with low temperature scanning tunneling microscopy and spectroscopy. It is found that Tb double-decker molecules bind tightly to the Ir(111) surface. By resonantly injecting tunneling electrons into its LUMO or HOMO state, the Tb double-decker molecule can be switched from a four-lobed structure to an eight-lobed structure. After switching, energy positions of the HOMO and LUMO states both shift closer to the Fermi level. Dy double-decker molecules also exhibit the same switching properties on the Ir(111) surface. The switching behavior of the molecules is tentatively attributed to a conformational change of the double-decker molecular frame.
Structure and physical properties of bio membranes and model membranes
International Nuclear Information System (INIS)
Tibor Hianik
2006-01-01
Bio membranes belong to the most important structures of the cell and the cell organelles. They play not only structural role of the barrier separating the external and internal part of the membrane but contain also various functional molecules, like receptors, ionic channels, carriers and enzymes. The cell membrane also preserves non-equilibrium state in a cell which is crucial for maintaining its excitability and other signaling functions. The growing interest to the bio membranes is also due to their unique physical properties. From physical point of view the bio membranes, that are composed of lipid bilayer into which are incorporated integral proteins and on their surface are anchored peripheral proteins and polysaccharides, represent liquid s crystal of smectic type. The bio membranes are characterized by anisotropy of structural and physical properties. The complex structure of bio membranes makes the study of their physical properties rather difficult. Therefore several model systems that mimic the structure of bio membranes were developed. Among them the lipid monolayers at an air-water interphase, bilayer lipid membranes, supported bilayer lipid membranes and liposomes are most known. This work is focused on the introduction into the physical word of the bio membranes and their models. After introduction to the membrane structure and the history of its establishment, the physical properties of the bio membranes and their models are stepwise presented. The most focus is on the properties of lipid monolayers, bilayer lipid membranes, supported bilayer lipid membranes and liposomes that were most detailed studied. This lecture has tutorial character that may be useful for undergraduate and graduate students in the area of biophysics, biochemistry, molecular biology and bioengineering, however it contains also original work of the author and his co-worker and PhD students, that may be useful also for specialists working in the field of bio membranes and model
Structure and intensities of microwave lines in the spectra of diatomic molecules
International Nuclear Information System (INIS)
Tatum, J.B.
1986-01-01
The structure of the rotational levels in a diatomic molecule, and the intensities of microwave transitions between them, are reviewed. Attention is given to the statistical weights of levels that may have hyperfine structure on account of one or two nuclear spins, in the case of heteronuclear molecules and of homonuclear molecules. A new treatment is given, involving the concept of energy surfaces in a ternary diagram in the form of a triangular prism, in which the three vertices represent three limiting cases, while the interior of the prism displays energy levels where all three intermediate coupling parameters are of comparable magnitude. An example is given of a simple J = 2 to J = 1 transition in a molecule with nuclear spins 3/2 and 1, showing the 56 hyperhyperfine components into which the rotational line is split, and a movie film is described which shows how the resulting ''fingerprint'' varies with the relative strengths of the interactions between the nuclear and electronic angular momenta
Kim, Seonah; Orendt, Anita M; Ferraro, Marta B; Facelli, Julio C
2009-10-01
This article describes the application of our distributed computing framework for crystal structure prediction (CSP) the modified genetic algorithms for crystal and cluster prediction (MGAC), to predict the crystal structure of flexible molecules using the general Amber force field (GAFF) and the CHARMM program. The MGAC distributed computing framework includes a series of tightly integrated computer programs for generating the molecule's force field, sampling crystal structures using a distributed parallel genetic algorithm and local energy minimization of the structures followed by the classifying, sorting, and archiving of the most relevant structures. Our results indicate that the method can consistently find the experimentally known crystal structures of flexible molecules, but the number of missing structures and poor ranking observed in some crystals show the need for further improvement of the potential. Copyright 2009 Wiley Periodicals, Inc.
Directory of Open Access Journals (Sweden)
Kasper Winther Jørgensen
2010-12-01
Full Text Available Major Histocompatibility class II (MHC-II molecules sample peptides from the extracellular space allowing the immune system to detect the presence of foreign microbes from this compartment. Prediction of MHC class II ligands is complicated by the open binding cleft of the MHC class II molecule, allowing binding of peptides extending out of the binding groove. Furthermore, only a few HLA-DR alleles have been characterized with a sufficient number of peptides (100-200 peptides per allele to derive accurate description of their binding motif. Little work has been performed characterizing structural properties of MHC class II ligands. Here, we perform one such large-scale analysis. A large set of SYFPEITHI MHC class II ligands covering more than 20 different HLA-DR molecules was analyzed in terms of their secondary structure and surface exposure characteristics in the context of the native structure of the corresponding source protein. We demonstrated that MHC class II ligands are significantly more exposed and have significantly more coil content than other peptides in the same protein with similar predicted binding affinity. We next exploited this observation to derive an improved prediction method for MHC class II ligands by integrating prediction of MHC- peptide binding with prediction of surface exposure and protein secondary structure. This combined prediction method was shown to significantly outperform the state-of-the-art MHC class II peptide binding prediction method when used to identify MHC class II ligands. We also tried to integrate N- and O-glycosylation in our prediction methods but this additional information was found not to improve prediction performance. In summary, these findings strongly suggest that local structural properties influence antigen processing and/or the accessibility of peptides to the MHC class II molecule.
Loos, J.; Schimanski, T.
2005-01-01
Structure, morphology, and mechanical properties of melt-spun and postdrawn isotactic polypropylene (iPP) tapes are analyzed to study the effect of postdraw temperature applied. For affine drawing conditions, i.e., no effective relaxation of the molecules occurs during postdrawing, the Young's
Single Fluorescent Molecules as Nano-Illuminators for Biological Structure and Function
Moerner, W. E.
2011-03-01
Since the first optical detection and spectroscopy of a single molecule in a solid (Phys. Rev. Lett. {62}, 2535 (1989)), much has been learned about the ability of single molecules to probe local nanoenvironments and individual behavior in biological and nonbiological materials in the absence of ensemble averaging that can obscure heterogeneity. Because each single fluorophore acts a light source roughly 1 nm in size, microscopic imaging of individual fluorophores leads naturally to superlocalization, or determination of the position of the molecule with precision beyond the optical diffraction limit, simply by digitization of the point-spread function from the single emitter. For example, the shape of single filaments in a living cell can be extracted simply by allowing a single molecule to move through the filament (PNAS {103}, 10929 (2006)). The addition of photoinduced control of single-molecule emission allows imaging beyond the diffraction limit (super-resolution) and a new array of acronyms (PALM, STORM, F-PALM etc.) and advances have appeared. We have used the native blinking and switching of a common yellow-emitting variant of green fluorescent protein (EYFP) reported more than a decade ago (Nature {388}, 355 (1997)) to achieve sub-40 nm super-resolution imaging of several protein structures in the bacterium Caulobacter crescentus: the quasi-helix of the actin-like protein MreB (Nat. Meth. {5}, 947 (2008)), the cellular distribution of the DNA binding protein HU (submitted), and the recently discovered division spindle composed of ParA filaments (Nat. Cell Biol. {12}, 791 (2010)). Even with these advances, better emitters would provide more photons and improved resolution, and a new photoactivatable small-molecule emitter has recently been synthesized and targeted to specific structures in living cells to provide super-resolution images (JACS {132}, 15099 (2010)). Finally, a new optical method for extracting three-dimensional position information based on
Ren, He
Molecular architectures and topologies are found contributing to the formation of supramolecular structures of giant molecules. Dr. Cheng's research group developed a diverse of giant molecules via precisely controlled chemistry synthetic routes. These giant molecules can be categorized into several different families, namely giant surfactants, giant shape amphiphiles and giant polyhedron. By analyzing the hierarchical structures of these carefully designed and precisely synthesized giant molecules, the structural factors which affect, or even dominates, in some cases, the formation of supramolecular structures are revealed in these intensive researches. The results will further contribute to the understanding of dependence of supramolecular structures on molecular designs as well as molecular topology, and providing a practical solution to the scaling up of microscopic molecular functionalities to macroscopic material properties. Molecular Nano Particles (MNPs), including fullerene (C60), POSS, Polyoxometalate (POM) and proteins etc., is defined and applied as a specific type of building blocks in the design and synthesis of giant molecules. The persistence in shape and symmetry is considered as one of the major properties of MNPs. This persistence will support the construction of giant molecules for further supramolecular structures' study by introducing specific shapes, or precisely located side groups which will facilitate self-assembling behaviors with pre-programmed secondary interactions. Dictating material physical properties by its chemical composition is an attractive yet currently failed approach in the study of materials. However, the pursuit of determining material properties by microscopic molecular level properties is never seized, and found its solution when the idea of crystal engineering is raised: should each atom in the material is located exactly where it is designed to be and is properly bonded, the property of the material is hence determined
International Nuclear Information System (INIS)
Lin, Jau-Wen
2014-01-01
This study investigated the structuring of water molecules in a nanoscale Couette flow with the upper plate subjected to lateral forces with various magnitudes and water slipping against a metal wall. It was found that when the upper plate is subjected to a force, the water body deforms into a parallelepiped. Water molecules in the channel are then gradually arranged into lattice positions, creating a layered structure. The structural arrangement of water molecules is caused by the water molecules accommodating themselves to the increase in energy under the application of a lateral force on the moving plate. The ordering arrangement of water molecules increases the rotational degree of freedom, allowing the molecules to increase their Coulomb potential energy through polar rotation that accounts for the energy input through the upper plate. With a force continuously applied to the upper plate, the water molecules in contact with the upper plate move forward until slip between the water and upper plate occurs. The relation between the structural arrangement of water molecules, slip at the wall, and the shear force is studied. The relation between the slip and the locking/unlocking of water molecules to metal atoms is also studied
Directory of Open Access Journals (Sweden)
Michaeli Shulamit
2007-10-01
Full Text Available Abstract Background In recent years, RNA molecules that are not translated into proteins (ncRNAs have drawn a great deal of attention, as they were shown to be involved in many cellular functions. One of the most important computational problems regarding ncRNA is to predict the secondary structure of a molecule from its sequence. In particular, we attempted to predict the secondary structure for a set of unaligned ncRNA molecules that are taken from the same family, and thus presumably have a similar structure. Results We developed the RNAspa program, which comparatively predicts the secondary structure for a set of ncRNA molecules in linear time in the number of molecules. We observed that in a list of several hundred suboptimal minimal free energy (MFE predictions, as provided by the RNAsubopt program of the Vienna package, it is likely that at least one suggested structure would be similar to the true, correct one. The suboptimal solutions of each molecule are represented as a layer of vertices in a graph. The shortest path in this graph is the basis for structural predictions for the molecule. We also show that RNA secondary structures can be compared very rapidly by a simple string Edit-Distance algorithm with a minimal loss of accuracy. We show that this approach allows us to more deeply explore the suboptimal structure space. Conclusion The algorithm was tested on three datasets which include several ncRNA families taken from the Rfam database. These datasets allowed for comparison of the algorithm with other methods. In these tests, RNAspa performed better than four other programs.
International Nuclear Information System (INIS)
Koeseoglu, Y.
2004-01-01
In this work, the productivity (temporal characteristics) of the so-called Electron Topological Method (ETM) proposed for the structure-activity relationships (SAR) investigation is studied. The method is standing aside the methods proposed for quantitative SAR (QSAR) studies because of the essential difference in the languages chosen for the compound structures description. ETM uses Electron Topological Matrices of Contiguity (ETMC) that include the most comprehensive data on the electronic structure of compounds and their topology. The flexibility of real molecules is taken into account in terms of two parameters, Δ 1 and Δ 2 , that characterise the accuracy allowed for atomic properties (diagonal matrix elements) and for bonds (non-diagonal ones). The dependence of the feature realisation on different values of Δ 1 and Δ 2 is studied and its graphical representation is given
The calculation of thermodynamic properties of molecules
DEFF Research Database (Denmark)
van Speybroeck, Veronique; Gani, Rafiqul; Meier, Robert Johan
2010-01-01
Thermodynamic data are key in the understanding and design of chemical processes. Next to the experimental evaluation of such data, computational methods are valuable and sometimes indispensable tools in obtaining heats of formation and Gibbs free energies. The major toolboxes to obtain such quan......Thermodynamic data are key in the understanding and design of chemical processes. Next to the experimental evaluation of such data, computational methods are valuable and sometimes indispensable tools in obtaining heats of formation and Gibbs free energies. The major toolboxes to obtain...... molecules the combination of group contribution methods with group additive values that are determined with the best available computational ab initio methods seems to be a viable alternative to obtain thermodynamic properties near chemical accuracy. New developments and full use of existing tools may lead...
Er, Süleyman; Suh, Changwon; Marshak, Michael P.
2015-01-01
Inspired by the electron transfer properties of quinones in biological systems, we recently showed that quinones are also very promising electroactive materials for stationary energy storage applications. Due to the practically infinite chemical space of organic molecules, the discovery of additional quinones or other redox-active organic molecules for energy storage applications is an open field of inquiry. Here, we introduce a high-throughput computational screening approach that we applied to an accelerated study of a total of 1710 quinone (Q) and hydroquinone (QH2) (i.e., two-electron two-proton) redox couples. We identified the promising candidates for both the negative and positive sides of organic-based aqueous flow batteries, thus enabling an all-quinone battery. To further aid the development of additional interesting electroactive small molecules we also provide emerging quantitative structure-property relationships. PMID:29560173
Modulating Pathways for Electron and Energy Transfer Through Molecules
DEFF Research Database (Denmark)
Pirrotta, Alessandro
Energy transport efficiency and electric conductance are molecular properties that motivates the development of optoelectronic materials, energy storage, and electronic devices. Several experimental techniques allow measurement of these properties and regularly, modeling is employed to find...... correlations between chemical structure and molecular properties. This dissertation discusses the interplay between modeling and experiments toward the assessment of new relations between the molecular structure and properties. In particular, it has been shown how simulations can push the development of new...... experimental techniques, demonstrate the potential of already established techniques, and work in synergy with experiments. It is demonstrated how the use of modeling can expand our understanding of how chemical structure affects molecular properties, which will enable us to design molecules with specific...
Glycomics: revealing the dynamic ecology and evolution of sugar molecules.
Springer, Stevan A; Gagneux, Pascal
2016-03-01
Sugars are the most functionally and structurally diverse molecules in the biological world. Glycan structures range from tiny single monosaccharide units to giant chains thousands of units long. Some glycans are branched, their monosaccharides linked together in many different combinations and orientations. Some exist as solitary molecules; others are conjugated to proteins and lipids and alter their collective functional properties. In addition to structural and storage roles, glycan molecules participate in and actively regulate physiological and developmental processes. Glycans also mediate cellular interactions within and between individuals. Their roles in ecology and evolution are pivotal, but not well studied because glycan biochemistry requires different methods than standard molecular biology practice. The properties of glycans are in some ways convenient, and in others challenging. Glycans vary on organismal timescales, and in direct response to physiological and ecological conditions. Their mature structures are physical records of both genetic and environmental influences during maturation. We describe the scope of natural glycan variation and discuss how studying glycans will allow researchers to further integrate the fields of ecology and evolution. Copyright © 2015 Elsevier B.V. All rights reserved.
DNA-Based Single-Molecule Electronics: From Concept to Function
2018-01-01
Beyond being the repository of genetic information, DNA is playing an increasingly important role as a building block for molecular electronics. Its inherent structural and molecular recognition properties render it a leading candidate for molecular electronics applications. The structural stability, diversity and programmability of DNA provide overwhelming freedom for the design and fabrication of molecular-scale devices. In the past two decades DNA has therefore attracted inordinate amounts of attention in molecular electronics. This review gives a brief survey of recent experimental progress in DNA-based single-molecule electronics with special focus on single-molecule conductance and I–V characteristics of individual DNA molecules. Existing challenges and exciting future opportunities are also discussed. PMID:29342091
DNA-Based Single-Molecule Electronics: From Concept to Function.
Wang, Kun
2018-01-17
Beyond being the repository of genetic information, DNA is playing an increasingly important role as a building block for molecular electronics. Its inherent structural and molecular recognition properties render it a leading candidate for molecular electronics applications. The structural stability, diversity and programmability of DNA provide overwhelming freedom for the design and fabrication of molecular-scale devices. In the past two decades DNA has therefore attracted inordinate amounts of attention in molecular electronics. This review gives a brief survey of recent experimental progress in DNA-based single-molecule electronics with special focus on single-molecule conductance and I-V characteristics of individual DNA molecules. Existing challenges and exciting future opportunities are also discussed.
Electronic and structural properties of TiB2: Bulk, surface, and nanoscale effects
International Nuclear Information System (INIS)
Volonakis, George; Tsetseris, Leonidas; Logothetidis, Stergios
2011-01-01
Titanium diboride (TiB 2 ), is a widely used hard material that comprises graphene-like layers of B and intercalated Ti atoms. Here we report the results of extensive first-principles calculations on key properties of bulk TiB 2 , TiB 2 surfaces, and TiB 2 nanocrystals (NCs). The computational approach is first validated based on the agreement between calculated structural and electronic properties of bulk TiB 2 and available experimental and theoretical data. We then obtain the formation energies for several surface cuts and use these values to construct TiB 2 NCs based on the Wulff theorem. Finally, we demonstrate by studying the adsorption of small molecules that hydrogen and oxygen adatoms can be attached through strongly exothermic chemisorption reactions on TiB 2 surfaces. Likewise, water molecules bind on various TiB 2 surfaces and NC facets, with an energetic preference for the latter. The results are relevant to applications that depend on reactivity-related TiB 2 properties, for example resistance to corrosion and interactions with water-based solutions.
Magnetic properties of dendrimer structures with different coordination numbers: A Monte Carlo study
International Nuclear Information System (INIS)
Masrour, R.; Jabar, A.
2016-01-01
We investigate the magnetic properties of Cayley trees of large molecules with dendrimer structure using Monte Carlo simulations. The thermal magnetization and magnetic susceptibility of a dendrimer structure are given with different coordination numbers, Z=3, 4, 5 and different generations g=3 and 2. The variation of magnetizations with the exchange interactions and crystal fields have been given of this system. The magnetic hysteresis cycles have been established. - Highlights: • The dendrimer structure is investigated using Monte Carlo simulations. • The transition temperatures are obtained for different coordination numbers and generations. • The magnetic hysteresis cycle has been established. • The dendrimer structure exhibit the superparamagnetic behavior.
Magnetic properties of dendrimer structures with different coordination numbers: A Monte Carlo study
Energy Technology Data Exchange (ETDEWEB)
Masrour, R., E-mail: rachidmasrour@hotmail.com; Jabar, A.
2016-11-01
We investigate the magnetic properties of Cayley trees of large molecules with dendrimer structure using Monte Carlo simulations. The thermal magnetization and magnetic susceptibility of a dendrimer structure are given with different coordination numbers, Z=3, 4, 5 and different generations g=3 and 2. The variation of magnetizations with the exchange interactions and crystal fields have been given of this system. The magnetic hysteresis cycles have been established. - Highlights: • The dendrimer structure is investigated using Monte Carlo simulations. • The transition temperatures are obtained for different coordination numbers and generations. • The magnetic hysteresis cycle has been established. • The dendrimer structure exhibit the superparamagnetic behavior.
International Nuclear Information System (INIS)
Xi, L.; Du, J.H.; Ma, J.H.; Wang, Z.; Zuo, Y.L.; Xue, D.S.
2013-01-01
Highlights: ► Spin-dependent transport property of LSMO/oleic acid nanoparticles is investigated. ► Transport properties and MR measured by Cu/nanoparticle assembly/elargol device. ► Non-linear I–V curve indicates a tunneling type transport properties. ► Tunnel barrier height around 1.3 ± 0.15 eV was obtained by fitting I–V curves. ► LFMR of LSMO/oleic acid molecules value reaches −18% with current of 0.1 μA at 10 K. - Abstract: Spin-dependent transport property through molecules is investigated using a monolayer of oleic acid molecule self-assembled half metallic La 0.7 Sr 0.3 MnO 3 (LSMO) nanoparticles, which was synthesized using a coprecipitation method. Fourier transform infrared spectroscopy was used to confirm that one-monolayer oleic acid molecules chemically bond to the LSMO nanoparticles. The transport properties and magnetoresistance (MR) effect of the oleic acid molecule coated LSMO nanoparticles were measured by a direct current four probes method using a Cu/nanoparticle assembly/elargol electrode sandwich device with various temperatures and bias voltages. The non-linear I–V curve indicates a tunneling type transport properties. The tunnel barrier height around 1.3 ± 0.15 eV was obtained by fitting the I–V curve according to the Simmons equation. The magnetoresistance curves can be divided to high-field MR and low-field MR (LFMR) parts. The former is ascribed to the influence of spin disorder or canting within the LSMO nanoparticle surface and the latter one with strong bias dependence is attributed to the spin-dependent tunneling effect through the insulating surface layer of LSMO and oleic acid molecules. The enhanced LFMR effect for oleic acid coated LSMO with respect to the bare LSMO was attributed to the enhanced tunneling transport and weak spin scattering in oleic acid molecule barrier.
Vortex-ring-fractal Structure of Atom and Molecule
International Nuclear Information System (INIS)
Osmera, Pavel
2010-01-01
This chapter is an attempt to attain a new and profound model of the nature's structure using a vortex-ring-fractal theory (VRFT). Scientists have been trying to explain some phenomena in Nature that have not been explained so far. The aim of this paper is the vortex-ring-fractal modeling of elements in the Mendeleev's periodic table, which is not in contradiction to the known laws of nature. We would like to find some acceptable structure model of the hydrogen as a vortex-fractal-coil structure of the proton and a vortex-fractal-ring structure of the electron. It is known that planetary model of the hydrogen atom is not right, the classical quantum model is too abstract. Our imagination is that the hydrogen is a levitation system of the proton and the electron. Structures of helium, oxygen, and carbon atoms and a hydrogen molecule are presented too.
Era, Paavai; Jauhar, RO. MU.; Vinitha, G.; Murugakoothan, P.
2018-05-01
An organic nonlinear optical material, guanidinium tosylate was synthesized adopting slow evaporation method and the crystals were harvested from aqueous methanolic medium with dimensions 13 × 9 × 3 mm3. Constitution of crystalline material was confirmed by single crystal X-ray diffraction study. The title compound crystallizes in the monoclinic crystal system with space group P21/c. The UV-vis-NIR spectral study of the grown crystal exhibits high transparency of 80% in the entire visible region with lower cut-off wavelength at 282 nm. Optimized molecular geometry of the grown crystal was obtained using density functional theory (DFT) and the frontier energy gaps calculated from the DFT aids to understand the charge transfer taking place in the molecule. The dielectric properties were studied as a function of temperature and frequency to find the charge distribution within the crystal. The titular compound is thermally stable up to 230 °C assessed by thermogravimetric and differential thermal analysis. Anisotropy in the mechanical behavior was observed while measuring for individual planes. The laser induced surface damage threshold of the grown crystal was measured to be 0.344 GW/cm2 for 1064 nm Nd:YAG laser radiation. Z-scan technique confirms the third-order nonlinear optical property with the ascertained nonlinear refractive index (n2), nonlinear absorption coefficient (β) and third order nonlinear susceptibility (χ(3)). Optical limiting study divulges that the transmitted output power step-up linearly with the increase of the input power at lower power realms and saturates from the threshold 24.95 mW/cm2 and amplitude 0.23 mW/cm2.
Ly, Sonny
Generation of quantum optical states from ultrashort laser-molecule interactions have led to fascinating discoveries in physics and chemistry. In recent years, these interactions have been extended to probe phenomena in single molecule biophysics. Photons emitted from a single fluorescent molecule contains important properties about how the molecule behave and function in that particular environment. Analysis of the second order coherence function through fluorescence correlation spectroscopy plays a pivotal role in quantum optics. At very short nanosecond timescales, the coherence function predicts photon antibunching, a purely quantum optical phenomena which states that a single molecule can only emit one photon at a time. Photon antibunching is the only direct proof of single molecule emission. From the nanosecond to microsecond timescale, the coherence function gives information about rotational diffusion coefficients, and at longer millisecond timescales, gives information regarding the translational diffusion coefficients. In addition, energy transfer between molecules from dipole-dipole interaction results in FRET, a highly sensitive method to probe conformational dynamics at nanometer distances. Here I apply the quantum optical techniques of photon antibunching, fluorescence correlation spectroscopy and FRET to probe how lipid nanodiscs form and function at the single molecule level. Lipid nanodiscs are particles that contain two apolipoprotein (apo) A-I circumventing a lipid bilayer in a belt conformation. From a technological point of view, nanodiscs mimics a patch of cell membrane that have recently been used to reconstitute a variety of membrane proteins including cytochrome P450 and bacteriorhodopsin. They are also potential drug transport vehicles due to its small and stable 10nm diameter size. Biologically, nanodiscs resemble to high degree, high density lipoproteins (HDL) in our body and provides a model platform to study lipid-protein interactions
Tao, Yunwen; Zou, Wenli; Cremer, Dieter; Kraka, Elfi
2018-03-05
Using catastrophe theory and the concept of a mutation path, an algorithm is developed that leads to the direct correlation of the normal vibrational modes of two structurally related molecules. The mutation path is defined by weighted incremental changes in mass and geometry of the molecules in question, which are successively applied to mutate a molecule into a structurally related molecule and thus continuously converting their normal vibrational spectra from one into the other. Correlation diagrams are generated that accurately relate the normal vibrational modes to each other by utilizing mode-mode overlap criteria and resolving allowed and avoided crossings of vibrational eigenstates. The limitations of normal mode correlation, however, foster the correlation of local vibrational modes, which offer a novel vibrational measure of similarity. It will be shown how this will open new avenues for chemical studies. © 2017 Wiley Periodicals, Inc. © 2017 Wiley Periodicals, Inc.
Energy Technology Data Exchange (ETDEWEB)
Cai, Linlin; Tian, Yanli; Yuan, Xiaobo; Hu, Guichao; Ren, Junfeng, E-mail: renjf@sdnu.edu.cn
2016-12-15
Highlights: • Thiophene molecule could be spin polarized when adsorbed at Co(001), Fe(100), and Ni(111) surfaces. • The biggest spin polarization will be obtained when the thiophene molecule adsorbed at the Fe(100) surface. • The spin polarization is originated from the interfacial orbital hybridizations between the 3d orbital of ferromagnetic electrodes and the 2p orbital of the thiophene molecule. - Abstract: First principles calculations are adopted to study the spin polarization properties of thiophene molecule which adsorbed at the Co, Fe, and Ni electrode surfaces. The density of states, spin-polarized density distributions as well as the differential charge density distributions are obtained. It is found that the p orbital of the thiophene molecule will interact with the d orbital of the ferromagnetic electrodes, which will generate new spin coupling states and lead to obvious spin polarization in the thiophene molecule. Different electrodes induce different spin polarization properties, and in which the Fe electrode will bring the biggest spin polarization of the thiophene molecule. People can selectively and efficiently inject spin polarized electrons into molecules by choosing suitable ferromagnetic electrodes in organic spintronic devices.
Structure-Based Drug Design of Small Molecule Peptide Deformylase Inhibitors to Treat Cancer
Directory of Open Access Journals (Sweden)
Jian Gao
2016-03-01
Full Text Available Human peptide deformylase (HsPDF is an important target for anticancer drug discovery. In view of the limited HsPDF, inhibitors were reported, and high-throughput virtual screening (HTVS studies based on HsPDF for developing new PDF inhibitors remain to be reported. We reported here on diverse small molecule inhibitors with excellent anticancer activities designed based on HTVS and molecular docking studies using the crystal structure of HsPDF. The compound M7594_0037 exhibited potent anticancer activities against HeLa, A549 and MCF-7 cell lines with IC50s of 35.26, 29.63 and 24.63 μM, respectively. Molecular docking studies suggested that M7594_0037 and its three derivatives could interact with HsPDF by several conserved hydrogen bonds. Moreover, the pharmacokinetic and toxicity properties of M7594_0037 and its derivatives were predicted using the OSIRIS property explorer. Thus, M7594_0037 and its derivatives might represent a promising scaffold for the further development of novel anticancer drugs.
Modulation of intermolecular interactions in single-molecule magnets
Heroux, Katie Jeanne
Polynuclear manganese clusters exhibiting interesting magnetic and quantum properties have been an area of intense research since the discovery of the first single-molecule magnet (SMM) in 1993. These molecules, below their blocking temperature, function as single-domain magnetic particles which exhibit classical macroscale magnetic properties as well as quantum mechanical phenomena such as quantum tunnelling of magnetization (QTM) and quantum phase interference. The union of classical and quantum behavior in these nanomaterials makes SMMs ideal candidates for high-density information storage and quantum computing. However, environmental coupling factors (nuclear spins, phonons, neighboring molecules) must be minimized if such applications are ever to be fully realized. The focus of this work is making small structural changes in well-known manganese SMMs in order to drastically enhance the overall magnetic and quantum properties of the system. Well-isolated molecules of high crystalline quality should lead to well-defined energetic and spectral properties as well. An advantage of SMMs over bulk magnetic materials is that they can be chemically altered from a "bottom-up" approach providing a synthetic tool for tuning magnetic properties. This systematic approach is utilized in the work presented herein by incorporating bulky ligands and/or counterions to "isolate" the magnetic core of [Mn4] dicubane SMMs. Reducing intermolecular interactions in the crystal lattice (neighboring molecules, solvate molecules, dipolar interactions) is an important step toward developing viable quantum computing devices. Detailed bulk magnetic studies as well as single crystal magnetization hysteresis and high-frequency EPR studies on these sterically-isolated complexes show enhanced, and sometimes even unexpected, quantum dynamics. The importance of intra- and intermolecular interactions remains a common theme throughout this work, extending to other SMMs of various topology including
Counteracting chemical chaperone effects on the single-molecule α-synuclein structural landscape.
Ferreon, Allan Chris M; Moosa, Mahdi Muhammad; Gambin, Yann; Deniz, Ashok A
2012-10-30
Protein structure and function depend on a close interplay between intrinsic folding energy landscapes and the chemistry of the protein environment. Osmolytes are small-molecule compounds that can act as chemical chaperones by altering the environment in a cellular context. Despite their importance, detailed studies on the role of these chemical chaperones in modulating structure and dimensions of intrinsically disordered proteins have been limited. Here, we used single-molecule Förster resonance energy transfer to test the counteraction hypothesis of counterbalancing effects between the protecting osmolyte trimethylamine-N-oxide (TMAO) and denaturing osmolyte urea for the case of α-synuclein, a Parkinson's disease-linked protein whose monomer exhibits significant disorder. The single-molecule experiments, which avoid complications from protein aggregation, do not exhibit clear solvent-induced cooperative protein transitions for these osmolytes, unlike results from previous studies on globular proteins. Our data demonstrate the ability of TMAO and urea to shift α-synuclein structures towards either more compact or expanded average dimensions. Strikingly, the experiments directly reveal that a 21 [urea][TMAO] ratio has a net neutral effect on the protein's dimensions, a result that holds regardless of the absolute osmolyte concentrations. Our findings shed light on a surprisingly simple aspect of the interplay between urea and TMAO on α-synuclein in the context of intrinsically disordered proteins, with potential implications for the biological roles of such chemical chaperones. The results also highlight the strengths of single-molecule experiments in directly probing the chemical physics of protein structure and disorder in more chemically complex environments.
Counteracting chemical chaperone effects on the single-molecule α-synuclein structural landscape
Ferreon, Allan Chris M.; Moosa, Mahdi Muhammad; Deniz, Ashok A.
2012-01-01
Protein structure and function depend on a close interplay between intrinsic folding energy landscapes and the chemistry of the protein environment. Osmolytes are small-molecule compounds that can act as chemical chaperones by altering the environment in a cellular context. Despite their importance, detailed studies on the role of these chemical chaperones in modulating structure and dimensions of intrinsically disordered proteins have been limited. Here, we used single-molecule Förster resonance energy transfer to test the counteraction hypothesis of counterbalancing effects between the protecting osmolyte trimethylamine-N-oxide (TMAO) and denaturing osmolyte urea for the case of α-synuclein, a Parkinson’s disease-linked protein whose monomer exhibits significant disorder. The single-molecule experiments, which avoid complications from protein aggregation, do not exhibit clear solvent-induced cooperative protein transitions for these osmolytes, unlike results from previous studies on globular proteins. Our data demonstrate the ability of TMAO and urea to shift α-synuclein structures towards either more compact or expanded average dimensions. Strikingly, the experiments directly reveal that a 2∶1 [urea]∶[TMAO] ratio has a net neutral effect on the protein’s dimensions, a result that holds regardless of the absolute osmolyte concentrations. Our findings shed light on a surprisingly simple aspect of the interplay between urea and TMAO on α-synuclein in the context of intrinsically disordered proteins, with potential implications for the biological roles of such chemical chaperones. The results also highlight the strengths of single-molecule experiments in directly probing the chemical physics of protein structure and disorder in more chemically complex environments. PMID:22826265
Structural and dynamical properties of water confined between two hydrophilic surfaces
Energy Technology Data Exchange (ETDEWEB)
Di Napoli, Solange, E-mail: dinapoli@tandar.cnea.gov.a [Depto. de Fisica - CAC, Comision Nacional de Energia Atomica, Av. Gral Paz 1499, (1650) San Martin, Buenos Aires (Argentina); Consejo Nacional de Investigaciones Cientificas y Tecnicas (Argentina); Gamba, Zulema, E-mail: gamba@tandar.cnea.gov.a [Depto. de Fisica - CAC, Comision Nacional de Energia Atomica, Av. Gral Paz 1499, (1650) San Martin, Buenos Aires (Argentina)
2009-10-01
The properties of water in the vicinity of surfaces and under confinement have been extensively studied because of the relevance of a quantitative understanding of many processes that not only take place in biological systems, like cells, membranes and microemulsions, but also in many others such as confined water in rocks, ionic channels and interestellar matter. In this work we perform molecular dynamic calculations of the nanoscopic structure of TIP5P model water confined between two hydrophilic surfaces. We calculate the diffusion coefficients and the atomic density profile of water molecules and polar ions in the system as a function of the number of water molecules per amphiphilic (n{sub W}). We also study the dependence of the water layer thickness and the profiles of water dipole orientation with this parameter.
Structural and dynamical properties of water confined between two hydrophilic surfaces
International Nuclear Information System (INIS)
Di Napoli, Solange; Gamba, Zulema
2009-01-01
The properties of water in the vicinity of surfaces and under confinement have been extensively studied because of the relevance of a quantitative understanding of many processes that not only take place in biological systems, like cells, membranes and microemulsions, but also in many others such as confined water in rocks, ionic channels and interestellar matter. In this work we perform molecular dynamic calculations of the nanoscopic structure of TIP5P model water confined between two hydrophilic surfaces. We calculate the diffusion coefficients and the atomic density profile of water molecules and polar ions in the system as a function of the number of water molecules per amphiphilic (n W ). We also study the dependence of the water layer thickness and the profiles of water dipole orientation with this parameter.
Enoki, Toshiaki; Kiguchi, Manabu
2018-03-01
Interest in utilizing organic molecules to fabricate electronic materials has existed ever since organic (molecular) semiconductors were first discovered in the 1950s. Since then, scientists have devoted serious effort to the creation of various molecule-based electronic systems, such as molecular metals and molecular superconductors. Single-molecule electronics and the associated basic science have emerged over the past two decades and provided hope for the development of highly integrated molecule-based electronic devices in the future (after the Si-based technology era has ended). Here, nanographenes (nano-sized graphene) with atomically precise structures are among the most promising molecules that can be utilized for electronic/spintronic devices. To manipulate single small molecules for an electronic device, a single molecular junction has been developed. It is a powerful tool that allows even small molecules to be utilized. External electric, magnetic, chemical, and mechanical perturbations can change the physical and chemical properties of molecules in a way that is different from bulk materials. Therefore, the various functionalities of molecules, along with changes induced by external perturbations, allows us to create electronic devices that we cannot create using current top-down Si-based technology. Future challenges that involve the incorporation of condensed matter physics, quantum chemistry calculations, organic synthetic chemistry, and electronic device engineering are expected to open a new era in single-molecule device electronic technology.
Electronic structure of molecules using relativistic effective core potentials
International Nuclear Information System (INIS)
Hay, P.J.
1981-01-01
Starting with one-component Cowan-Griffin relativistic Hartree-Fock orbitals, which successfully incorporate the mass-velocity and Darwin terms present in more complicated wavefunctions such as Dirac-Hartree-Fock, one can derive relativistic effective core potentials (RECP's) to carry out molecular calculations. These potentials implicitly include the dominant relativistic terms for molecules while allowing one to use the traditional quantum chemical techniques for studying the electronic structure of molecules. The effects of spin-orbit coupling can then be included using orbitals from such calculations using an effective 1-electron, 1-center spin-orbit operator. Applications to molecular systems involving heavy atoms, show good agreement with available spectroscopic data on molecular geometries and excitation energies
Structural Ordering of Semiconducting Polymers and Small-Molecules for Organic Electronics
O'Hara, Kathryn Allison
Semiconducting polymers and small-molecules can be readily incorporated into electronic devices such as organic photovoltaics (OPVs), thermoelectrics (OTEs), organic light emitting diodes (OLEDs), and organic thin film transistors (OTFTs). Organic materials offer the advantage of being processable from solution to form flexible and lightweight thin films. The molecular design, processing, and resulting thin film morphology of semiconducting polymers drastically affect the optical and electronic properties. Charge transport within films of semiconducting polymers relies on the nanoscale organization to ensure electronic coupling through overlap of molecular orbitals and to provide continuous transport pathways. While the angstrom-scale packing details can be studied using X-ray scattering methods, an understanding of the mesoscale, or the length scale over which smaller ordered regions connect, is much harder to achieve. Grain boundaries play an important role in semiconducting polymer thin films where the average grain size is much smaller than the total distance which charges must traverse in order to reach the electrodes in a device. The majority of semiconducting polymers adopt a lamellar packing structure in which the conjugated backbones align in parallel pi-stacks separated by the alkyl side-chains. Only two directions of transport are possible--along the conjugated backbone and in the pi-stacking direction. Currently, the discussion of transport between crystallites is centered around the idea of tie-chains, or "bridging" polymer chains connecting two ordered regions. However, as molecular structures become increasingly complex with the development of new donor-acceptor copolymers, additional forms of connectivity between ordered domains should be considered. High resolution transmission electron microscopy (HRTEM) is a powerful tool for directly imaging the crystalline grain boundaries in polymer and small-molecule thin films. Recently, structures
Structural properties of glucose-dimethylsulfoxide solutions probed by Raman spectroscopy
Paolantoni, Marco; Gallina, Maria Elena; Sassi, Paola; Morresi, Assunta
2009-04-01
Raman spectroscopy was employed to achieve a molecular level description of solvation properties in glucose-dimethylsulfoxide (DMSO) solutions. The analysis of Raman spectra confirms the importance of the dipole-dipole interaction in determining structural properties of pure DMSO; the overall intermolecular structure is maintained in the whole 20-75 °C temperature range investigated. The blueshift of the CH stretching modes observed at higher temperatures points out that CH3⋯O contacts contribute to the cohesive energy of the DMSO liquid system. The addition of glucose perturbs the intermolecular ordering of DMSO owing to the formation of stable solute-solvent hydrogen bonds. The average number of OH⋯OS contacts (3.2±0.3) and their corresponding energy (˜20 kJ/mol) were estimated. Besides, the concentration dependence of the CH stretching bands and the behavior of the noncoincidence effect on the SO band, suggest that the dipole-dipole and CH3⋯O interactions among DMSO molecules are disfavored within the glucose solvation layer. These findings contribute to improve our understanding about the microscopic origin of solvent properties of DMSO toward more complex biomolecular systems.
Phase Structure of Strong-Field Tunneling Wave Packets from Molecules.
Liu, Ming-Ming; Li, Min; Wu, Chengyin; Gong, Qihuang; Staudte, André; Liu, Yunquan
2016-04-22
We study the phase structure of the tunneling wave packets from strong-field ionization of molecules and present a molecular quantum-trajectory Monte Carlo model to describe the laser-driven dynamics of photoelectron momentum distributions of molecules. Using our model, we reproduce and explain the alignment-dependent molecular frame photoelectron spectra of strong-field tunneling ionization of N_{2} reported by M. Meckel et al. [Nat. Phys. 10, 594 (2014)]. In addition to modeling the low-energy photoelectron angular distributions quantitatively, we extract the phase structure of strong-field molecular tunneling wave packets, shedding light on its physical origin. The initial phase of the tunneling wave packets at the tunnel exit depends on both the initial transverse momentum distribution and the molecular internuclear distance. We further show that the ionizing molecular orbital has a critical effect on the initial phase of the tunneling wave packets. The phase structure of the photoelectron wave packet is a key ingredient for modeling strong-field molecular photoelectron holography, high-harmonic generation, and molecular orbital imaging.
Characterization of Structural and Configurational Properties of DNA by Atomic Force Microscopy.
Meroni, Alice; Lazzaro, Federico; Muzi-Falconi, Marco; Podestà, Alessandro
2018-01-01
We describe a method to extract quantitative information on DNA structural and configurational properties from high-resolution topographic maps recorded by atomic force microscopy (AFM). DNA molecules are deposited on mica surfaces from an aqueous solution, carefully dehydrated, and imaged in air in Tapping Mode. Upon extraction of the spatial coordinates of the DNA backbones from AFM images, several parameters characterizing DNA structure and configuration can be calculated. Here, we explain how to obtain the distribution of contour lengths, end-to-end distances, and gyration radii. This modular protocol can be also used to characterize other statistical parameters from AFM topographies.
Structure and optical properties of water covered Cu(110) surfaces
International Nuclear Information System (INIS)
Baghbanpourasl, A.
2014-01-01
In this thesis structural and optical properties of the water covered Cu(110) surface is studied using density functional theory within independent particle approximation. Several stable adsorption structures are studied such as water clusters (monomer, dimer, trimer, tetramer and pentamer), different hexagonal monolayers, partially dissociated water monolayers and three different types of chains among them a chain that consists of pentagon rings. For a copper surface in contact with water vapor, the energetically stable H 2 O/OH adsorbed structures are compared thermodynamically using adsorption free energy (change of free energy due to adsorption). Several phase diagrams with respect to temperature and pressure are calculated. It is found that among the large number of energetically stable structures (i.e. structures with positive adsorption energy ) only limited number of them are thermodynamically stable. These thermodynamically stable structures are the class of almost energetically degenerate hexagonal overlayers, one type of partially dissociated water structure that contains Bjerrum defect in the hydrogen bond network and pentagon chain. Since hydrogen atoms are light weight their vibrational effects can be considerable. Zero point vibration decreases the adsorption energy up to 0.1 eV and free energy of adsorbed molecules arising from vibrational degree of freedom can go up to -0.2 eV per adsorbed molecule at 500 Kelvin. However zero point energy and vibrational free energy of adsorbed molecules do not alter relative stability of the adsorbed structures. To account for the long range van der Waals interactions, a semi-empirical scheme is applied. Reflectance Anisotropy Spectroscopy (RAS) is a fast and non destructive optical method that can be used to prob the surface in different conditions such as vacuum and electro-chemical environment. Elasto-optic coeficients of bulk are calculated from first principles and the change of the RA spectrum of the bare Cu
Electronic and magnetic properties of Mn{sub 12} single-molecule magnets on the Au(111) surface
Energy Technology Data Exchange (ETDEWEB)
Voss, Soenke; Burgert, Michael; Fonin, Mikhail; Groth, Ulrich; Ruediger, Ulrich [Universitaet Konstanz (Germany); Michaelis, Christian; Brihuega, Ivan; Kern, Klaus [Max-Planck-Institut fuer Festkoerperforschung, Stuttgart (Germany); Dedkov, Yury S. [Institut fuer Festkoerperphysik, Technische Universitaet Dresden (Germany)
2008-07-01
The paramount interest in single-molecule magnets (SMMs) like Mn{sub 12}-acetate and its derivatives was inspired by numerous experimental and theoretical insights indicating the feasibility of addressing quantum effects of magnetism on a molecular scale. Due to its relatively high blocking temperature ({proportional_to}3 K) combined with the ability to identify well-defined spin states, Mn{sub 12} still remains the most favoured SMM possibly allowing the detection of magnetic fingerprints in transport properties of a single molecule. In this work, the electronic properties of Mn{sub 12} molecules chemically grafted on Au(111) surfaces have been studied by means of low temperature as well as room temperature scanning tunneling microscopy and spectroscopy (STS), X-ray absorption spectroscopy and photoelectron spectroscopy. The results revealed signatures from most probably intact Mn{sub 12} molecules while STS measurements in magnetic fields indicate the possibility to identify magnetic fingerprints in scanning tunneling spectra. The results will be discussed with respect to previous attempts to perform transport measurements on Mn{sub 12} SMMs.
Li, Miao-Miao; Li, Jin-Feng; Bai, Hongcun; Sun, Yin-Yin; Li, Jian-Li; Yin, Bing
2015-08-21
The regulation of the electronic properties of organic molecules induced by polynuclear superhalogens is theoretically explored here for sixteen composite structures. It is clearly indicated by the higher vertical electron detachment energy (VDE) that polynuclear superhalogens are more effective in regulating the electronic properties than mononuclear structures. However, this enhanced regulation is not only determined by superhalogens themselves but also related to the distribution of the extra electron of the final composites. The composites, in which the extra electron is mainly aggregated into the superhalogen moiety, will possess higher VDE values, as reported in the case of C1', 7.12 eV at the CCSD(T) level. This is probably due to the fact that, compared with organic molecules, superhalogens possess stronger attraction towards the extra electron and thus should lead to lower energies of the extra electrons and to higher VDE values eventually. Compared with CCSD(T), the Outer Valence Green's Function (OVGF) method fails completely for composite structures containing Cl atoms, while MP2 results are generally consistent in terms of the relative order of VDEs. Actually if the extra electron distribution of the systems could be approximated by the HOMO, the results at the OVGF level will be consistent with the CCSD(T) results. Conversely, the difference in VDEs between OVGF and CCSD(T) is significantly large. Besides superhalogen properties, the structures, relative stabilities and thermodynamic stabilities with respect to various fragmentation channels were also investigated for all the composite structures.
Single-molecule force-conductance spectroscopy of hydrogen-bonded complexes
Pirrotta, Alessandro; De Vico, Luca; Solomon, Gemma C.; Franco, Ignacio
2017-03-01
The emerging ability to study physical properties at the single-molecule limit highlights the disparity between what is observable in an ensemble of molecules and the heterogeneous contributions of its constituent parts. A particularly convenient platform for single-molecule studies are molecular junctions where forces and voltages can be applied to individual molecules, giving access to a series of electromechanical observables that can form the basis of highly discriminating multidimensional single-molecule spectroscopies. Here, we computationally examine the ability of force and conductance to inform about molecular recognition events at the single-molecule limit. For this, we consider the force-conductance characteristics of a prototypical class of hydrogen bonded bimolecular complexes sandwiched between gold electrodes. The complexes consist of derivatives of a barbituric acid and a Hamilton receptor that can form up to six simultaneous hydrogen bonds. The simulations combine classical molecular dynamics of the mechanical deformation of the junction with non-equilibrium Green's function computations of the electronic transport. As shown, in these complexes hydrogen bonds mediate transport either by directly participating as a possible transport pathway or by stabilizing molecular conformations with enhanced conductance properties. Further, we observe that force-conductance correlations can be very sensitive to small changes in the chemical structure of the complexes and provide detailed information about the behavior of single molecules that cannot be gleaned from either measurement alone. In fact, there are regions during the elongation that are only mechanically active, others that are only conductance active, and regions where both force and conductance changes as the complex is mechanically manipulated. The implication is that force and conductance provide complementary information about the evolution of molecules in junctions that can be used to
Schmid, Marc R.
2011-09-01
Structural and dynamical properties of the THF solvent in single-walled carbon nanotubes intercalated with lithium are investigated by NMR. 1H NMR experiments reveal the existence of two types of inequivalent THF solvent molecules with different chemical environments and dynamical behavior. At low temperatures THF molecules perpendicularly arranged in between adjacent SWNT presumably exhibit a restricted rotation around their dipolar axis. At higher temperatures THF molecules are isotropically rotating and diffusing along the interstitial channels of the SWNT bundles. © 2011 Elsevier B.V. All rights reserved.
Schmid, Marc R.; Goze-Bac, Christophe; Bouhrara, Mohamed; Saih, Youssef; Mehring, Michael; Abou-Hamad, Edy
2011-01-01
Structural and dynamical properties of the THF solvent in single-walled carbon nanotubes intercalated with lithium are investigated by NMR. 1H NMR experiments reveal the existence of two types of inequivalent THF solvent molecules with different chemical environments and dynamical behavior. At low temperatures THF molecules perpendicularly arranged in between adjacent SWNT presumably exhibit a restricted rotation around their dipolar axis. At higher temperatures THF molecules are isotropically rotating and diffusing along the interstitial channels of the SWNT bundles. © 2011 Elsevier B.V. All rights reserved.
Dhote, Valentin; Skaalure, Stacey; Akalp, Umut; Roberts, Justine; Bryant, Stephanie J; Vernerey, Franck J
2013-03-01
Damage to cartilage caused by injury or disease can lead to pain and loss of mobility, diminishing one's quality of life. Because cartilage has a limited capacity for self-repair, tissue engineering strategies, such as cells encapsulated in synthetic hydrogels, are being investigated as a means to restore the damaged cartilage. However, strategies to date are suboptimal in part because designing degradable hydrogels is complicated by structural and temporal complexities of the gel and evolving tissue along multiple length scales. To address this problem, this study proposes a multi-scale mechanical model using a triphasic formulation (solid, fluid, unbound matrix molecules) based on a single chondrocyte releasing extracellular matrix molecules within a degrading hydrogel. This model describes the key players (cells, proteoglycans, collagen) of the biological system within the hydrogel encompassing different length scales. Two mechanisms are included: temporal changes of bulk properties due to hydrogel degradation, and matrix transport. Numerical results demonstrate that the temporal change of bulk properties is a decisive factor in the diffusion of unbound matrix molecules through the hydrogel. Transport of matrix molecules in the hydrogel contributes both to the development of the pericellular matrix and the extracellular matrix and is dependent on the relative size of matrix molecules and the hydrogel mesh. The numerical results also demonstrate that osmotic pressure, which leads to changes in mesh size, is a key parameter for achieving a larger diffusivity for matrix molecules in the hydrogel. The numerical model is confirmed with experimental results of matrix synthesis by chondrocytes in biodegradable poly(ethylene glycol)-based hydrogels. This model may ultimately be used to predict key hydrogel design parameters towards achieving optimal cartilage growth. Copyright © 2012 Elsevier Ltd. All rights reserved.
DFT calculations on spectroscopic and structural properties of a NLO chromophore
Altürk, Sümeyye; Avci, Davut; Tamer, Ömer; Atalay, Yusuf
2016-03-01
The molecular geometry optimization, vibrational frequencies and gauge including atomic orbital (GIAO) 1H and 13C NMR chemical shift values of 2-(1'-(4'''-Methoxyphenyl)-5'-(thien-2″-yl)pyrrol-2'-yl)-1,3-benzothiazole as potential nonlinear optical (NLO) material were calculated using density functional theory (DFT) HSEh1PBE method with 6-311G(d,p) basis set. The best of our knowledge, this study have not been reported to date. Additionally, a detailed vibrational study was performed on the basis of potential energy distribution (PED) using VEDA program. It is noteworthy that NMR chemical shifts are quite useful for understanding the relationship between the molecular structure and electronic properties of molecules. The computed IR and NMR spectra were used to determine the types of the experimental bands observed. Predicted values of structural and spectroscopic parameters of the chromophore were compared with each other so as to display the effects of the different substituents on the spectroscopic and structural properties. Obtained data showed that there is an agreement between the predicted and experimental data.
Ha, T.-K.; Günthard, H. H.
1989-07-01
Structural parameters like bond length, bond angles, etc. and harmonic and anharmonic potential coefficients of molecules with internal rotation, inversion or puckering modes are generally assumed to vary with the large amplitude internal coordinates in a concerted manner (relaxation). Taking the coordinate vectors of the nuclear configuration of semirigid molecules with relaxation (SRMRs) as functions of relaxing structural parameters and finite amplitude internal coordinate, the isometric group of SRMRs is discussed and the irreducible representations of the latter are shown to classify into engendered and nonengendered ones. On this basis a concept of equivalent sets of nuclei SRMRs is introduced and an analytical expression is derived which defines the most general functional form of relaxation increments of all common types of structural parameters compatible with isometric symmetry. This formula is shown to be a close analog of an analytical expression defining the transformations induced by the isometric group of infinitesimal internal coordinates associated with typical structural parameters. Furthermore analogous formulae are given for the most general form of the relaxation of harmonic potential coefficients as a function of finite internal coordinates. The general relations are illustrated by ab initio calculations for 1,2-difluoroethane at the MP4/DZP//HF/4-31G* level for twelve values of the dihedral angle including complete structure optimization. The potential to internal rotation is found to be in essential agreement with experimentally derived data. For a complete set of ab initio structural parameters the associated relaxation increments are represented as Fourier series, which are shown to confirm the form predicted by the general formula and the isometric group of 1,2-difluoroethane. Depending on type of the structural parameters (bond length, bond angles, etc.), the associated relaxation increments appear to follow some simple rules. Similarly
International Nuclear Information System (INIS)
Damyanova, M; Balabanova, E; Hohm, U
2014-01-01
A temperature-dependent effective intermolecular interaction potential is applied to describe the interaction between two nitrogen fluoride (NF 3 ) molecules in gas phase. To this end, a spherically-symmetric (n-6) Lennard-Jones temperature-dependent potential (LJTDP) is used. The (n-6) LJTDP takes into account the influence of vibrational excitation of the molecules on the potential parameters, namely, the equilibrium distance r m and the potential well depth ε. The potential parameters at T = 0 K were obtained from the very small amount of existing thermophysical equilibrium and transport properties of low-density NF 3 gas. Fitting formulae are tabulated for a fast and reliable prediction of the thermophysical properties and potential parameters in the temperature range between 200 K and 1200 K. A comparison is also presented between our estimates for some thermophysical properties of the NF 3 gas with the available experimental and calculated data.
Electronic structure and physicochemical properties of selected penicillins
Soriano-Correa, Catalina; Ruiz, Juan F. Sánchez; Raya, A.; Esquivel, Rodolfo O.
Traditionally, penicillins have been used as antibacterial agents due to their characteristics and widespread applications with few collateral effects, which have motivated several theoretical and experimental studies. Despite the latter, their mechanism of biological action has not been completely elucidated. We present a theoretical study at the Hartree-Fock and density functional theory (DFT) levels of theory of a selected group of penicillins such as the penicillin-G, amoxicillin, ampicillin, dicloxacillin, and carbenicillin molecules, to systematically determine the electron structure of full ?-lactam antibiotics. Our results allow us to analyze the electronic properties of the pharmacophore group, the aminoacyl side-chain, and the influence of the substituents (R and X) attached to the aminoacyl side-chain at 6? (in contrast with previous studies focused at the 3? substituents), and to corroborate the results of previous studies performed at the semiempirical level, solely on the ?-lactam ring of penicillins. Besides, several density descriptors are determined with the purpose of analyzing their link to the antibacterial activity of these penicillin compounds. Our results for the atomic charges (fitted to the electrostatic potential), the bond orders, and several global reactivity descriptors, such as the dipole moments, ionization potential, hardness, and the electrophilicity index, led us to characterize: the active sites, the effect of the electron-attracting substituent properties and their physicochemical features, which altogether, might be important to understand the biological activity of these type of molecules.
Expert systems for structure elucidation of organic molecules by spectral methods
International Nuclear Information System (INIS)
Elyashberg, Mikhail E
1999-01-01
The state-of-the-art of the investigations aimed at creating expert systems for establishing the structure of organic molecules from IR, 1 H and 13 C NMR spectra is analysed. Computer methods used for identification of molecular fragments, generation of their structure and spectra prediction are considered. Principles of the creation of modern expert systems and general strategy of solving structural problems are discussed. The bibliography includes 174 references.
Dong, Fulong; Tian, Yiqun; Yu, Shujuan; Wang, Shang; Yang, Shiping; Chen, Yanjun
2015-07-13
We investigate the polarization properties of below-threshold harmonics from aligned molecules in linearly polarized laser fields numerically and analytically. We focus on lower-order harmonics (LOHs). Our simulations show that the ellipticity of below-threshold LOHs depends strongly on the orientation angle and differs significantly for different harmonic orders. Our analysis reveals that this LOH ellipticity is closely associated with resonance effects and the axis symmetry of the molecule. These results shed light on the complex generation mechanism of below-threshold harmonics from aligned molecules.
Adsorption of methanol molecule on graphene: Experimental results and first-principles calculations
Zhao, X. W.; Tian, Y. L.; Yue, W. W.; Chen, M. N.; Hu, G. C.; Ren, J. F.; Yuan, X. B.
2018-04-01
Adsorption properties of methanol molecule on graphene surface are studied both theoretically and experimentally. The adsorption geometrical structures, adsorption energies, band structures, density of states and the effective masses are obtained by means of first-principles calculations. It is found that the electronic characteristics and conductivity of graphene are sensitive to the methanol molecule adsorption. After adsorption of methanol molecule, bandgap appears. With the increasing of the adsorption distance, the bandgap, adsorption energy and effective mass of the adsorption system decreased, hence the resistivity of the system decreases gradually, these results are consistent with the experimental results. All these calculations and experiments indicate that the graphene-based sensors have a wide range of applications in detecting particular molecules.
Regulation of metabolic networks by small molecule metabolites
Directory of Open Access Journals (Sweden)
Kanehisa Minoru
2007-03-01
Full Text Available Abstract Background The ability to regulate metabolism is a fundamental process in living systems. We present an analysis of one of the mechanisms by which metabolic regulation occurs: enzyme inhibition and activation by small molecules. We look at the network properties of this regulatory system and the relationship between the chemical properties of regulatory molecules. Results We find that many features of the regulatory network, such as the degree and clustering coefficient, closely match those of the underlying metabolic network. While these global features are conserved across several organisms, we do find local differences between regulation in E. coli and H. sapiens which reflect their different lifestyles. Chemical structure appears to play an important role in determining a compounds suitability for use in regulation. Chemical structure also often determines how groups of similar compounds can regulate sets of enzymes. These groups of compounds and the enzymes they regulate form modules that mirror the modules and pathways of the underlying metabolic network. We also show how knowledge of chemical structure and regulation could be used to predict regulatory interactions for drugs. Conclusion The metabolic regulatory network shares many of the global properties of the metabolic network, but often varies at the level of individual compounds. Chemical structure is a key determinant in deciding how a compound is used in regulation and for defining modules within the regulatory system.
International Nuclear Information System (INIS)
Lee, G. H.; Kim, H. T.; Park, J. Y.; Nam, C. H.; Kim, T. K.; Lee, J. H.; Ihee, H.
2006-01-01
Revival structures (rotational coherence) of three linear molecules (N 2 , O 2 , and CO 2 ) in a field free alignment condition have been investigated using high-order harmonic generation. The harmonic yields of these molecules were measured in a pump-probe manner by using a weak femtosecond (fs) laser pulse for field-free alignment of molecules and another intense fs laser pulse for harmonic generation. The harmonic intensities from 23rd to 29th order with respect to the time delay between the pump and the probe pulses showed revival structures in the condition of a field-free alignment of molecules. While the revival structure of a N 2 molecule had one-fourth the period of the full revival time and different degrees of modulation among different fractional revival times, the revival structures of O 2 and CO 2 molecules showed one-eighth the periods of the full revival time and similar degrees of modulation among all fractional revival times. The revival structures could be interpreted in terms of the nature of the highest occupied molecular orbital and the total nuclear spin.
Waved graphene: Unique structure for the adsorption of small molecules
International Nuclear Information System (INIS)
Pan, Hui
2017-01-01
We propose waved graphenes for the strong adsorption of molecules and investigate their potential applications. We find that the physical adsorption of molecules on waved graphene is greatly enhanced by compression. At optimal compression, the physical adsorption energies of H_2, N_2, NO, and CO are increased by 6–9 times, and that for O_2 is more than 2 times. We show that the energy for their chemical adsorption on waved graphene decreases dramatically with the increment of compression. The energy of dissociation of H_2 on flat graphene is 1.63 eV and reduced to 0.06 eV (96% reduction) on waved graphene at a compression of 50%, respectively. The energy for chemical adsorption of O_2 on waved graphenes is extremely reduced from 0.98 eV to −0.57 eV as with compression increasing from 0 to 50%, indicating the transition of endothermic chemical adsorption to exothermic. We further show that the electronic properties of waved graphenes are modified, leading to the change of electrical characters. We see that the waved graphenes may find applications in gas storage, sensor and catalyst because of enhanced physical and chemical adsorption and the induced change of electronic properties. - Highlights: • Adsorption of small molecules on waved graphene is greatly enhanced. • Strong physical adsorption in the trough of waved graphene can be achieved by tuning the curvature. • Chemical adsorption is on the crest of waved graphene. • Exothermic dissociation of H2 and O2 can be realized on waved graphene under high compression. • Wave graphene can be candidates as catalysts and gas storage/sensor.
Waved graphene: Unique structure for the adsorption of small molecules
Energy Technology Data Exchange (ETDEWEB)
Pan, Hui, E-mail: huipan@umac.mo
2017-03-01
We propose waved graphenes for the strong adsorption of molecules and investigate their potential applications. We find that the physical adsorption of molecules on waved graphene is greatly enhanced by compression. At optimal compression, the physical adsorption energies of H{sub 2}, N{sub 2}, NO, and CO are increased by 6–9 times, and that for O{sub 2} is more than 2 times. We show that the energy for their chemical adsorption on waved graphene decreases dramatically with the increment of compression. The energy of dissociation of H{sub 2} on flat graphene is 1.63 eV and reduced to 0.06 eV (96% reduction) on waved graphene at a compression of 50%, respectively. The energy for chemical adsorption of O{sub 2} on waved graphenes is extremely reduced from 0.98 eV to −0.57 eV as with compression increasing from 0 to 50%, indicating the transition of endothermic chemical adsorption to exothermic. We further show that the electronic properties of waved graphenes are modified, leading to the change of electrical characters. We see that the waved graphenes may find applications in gas storage, sensor and catalyst because of enhanced physical and chemical adsorption and the induced change of electronic properties. - Highlights: • Adsorption of small molecules on waved graphene is greatly enhanced. • Strong physical adsorption in the trough of waved graphene can be achieved by tuning the curvature. • Chemical adsorption is on the crest of waved graphene. • Exothermic dissociation of H2 and O2 can be realized on waved graphene under high compression. • Wave graphene can be candidates as catalysts and gas storage/sensor.
Relation between structure and organisation properties of new amphiphilic cyclodextrins
International Nuclear Information System (INIS)
Moutard, Stephane
2003-01-01
Since a number of years, special attention and efforts have been made to prepare amphiphilic cyclodextrins (CDs) with the objective to use them to obtain supramolecular assemblies as such or in the presence of preformed lipidic structures. The aim of these investigation is in both cases to combine the size specificity of cyclodextrins for guests and the transport properties of phospho-lipidic structures. The final objects could be of importance to transport or target biologically relevant molecules such as drugs using new galenic formulations. In a first step, a new family of amphiphilic CDs was prepared from a pure phospholipids (DMPE) onto cyclodextrins or methylated derivatives through a spacing arm. The afforded compounds (phospholipidyl-cyclodextrins) were fully characterized by high field NMR and high resolution mass spectrometry. The methylated derivatives were shown to self-organize in water with low CMC to form fluctuating micellar fibers retaining the inclusion capacity of the cyclodextrin cavities. The interactions of these compounds with membrane systems were investigated as black films using X-ray reflectivity and by evaluation of their detergent power towards model DMPC liposomes. Their ability to cross over the Blood Brain Barrier was evidenced by a new approach making use of novel immuno-enzymatic assays. In a second step, a new class of amphiphilic cyclodextrins was considered (peptidolipidyl-cyclodextrins). Although they are structurally similar to phospholipidyl-CDs, their preparation overcomes the tedious steps of the later and lead to a considerable versatility in terms of the number of possible molecules to be prepared. Moreover, the stability problems encountered with phospholipids are avoided. Several examples have been prepared, fully characterized and their organization properties investigated by the determination of CMC and by deuterium NMR on a pure and homogeneous mixed peptidolipidyl-CD / DMPC lamellar phase. This novel class of
Cho, Kyungjune; Pak, Jinsu; Kim, Jae-Keun; Kang, Keehoon; Kim, Tae-Young; Shin, Jiwon; Choi, Barbara Yuri; Chung, Seungjun; Lee, Takhee
2018-05-01
Although 2D molybdenum disulfide (MoS 2 ) has gained much attention due to its unique electrical and optical properties, the limited electrical contact to 2D semiconductors still impedes the realization of high-performance 2D MoS 2 -based devices. In this regard, many studies have been conducted to improve the carrier-injection properties by inserting functional paths, such as graphene or hexagonal boron nitride, between the electrodes and 2D semiconductors. The reported strategies, however, require relatively time-consuming and low-yield transfer processes on sub-micrometer MoS 2 flakes. Here, a simple contact-engineering method is suggested, introducing chemically adsorbed thiol-molecules as thin tunneling barriers between the metal electrodes and MoS 2 channels. The selectively deposited thiol-molecules via the vapor-deposition process provide additional tunneling paths at the contact regions, improving the carrier-injection properties with lower activation energies in MoS 2 field-effect transistors. Additionally, by inserting thiol-molecules at the only one contact region, asymmetric carrier-injection is feasible depending on the temperature and gate bias. © 2018 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.
Properties of cellulase as template molecule on chitosan—methyl methacrylate membrane
Lian, Qi; Zheng, Xuefang; Wu, Haixia; Song, Shitao; Wang, Dongjun
2015-12-01
In this study, a novel molecular imprinting membrane made of chitosan and methyl methacrylate (MMA) was fabricated with cellulase as template molecule and the thermal response to cellulase was characterized. The film was characterized by infrared spectroscopy (IR), X-ray diffraction (XRD), scanning electron microscopy (SEM) and the permeation experiment. The results showed that the space structure of the film was as similar as the cellulase. Moreover, the membrane had advanced molecular imprinting capability to cellulase comparing to pepsin and pectinase at any temperature and the film had excellent ability to identify specific template molecule (cellulase) at the synthesis temperature compared to other temperatures.
International Nuclear Information System (INIS)
Machado, F.B.C.
1985-01-01
The use of the configuration (CI) method for the calculation of very accurate potential energy curves and dipole moment functions, and then their use in the comprehension of spectroscopic properties of diatomic molecules is presented. The spectroscopic properties of CH + and CD + such as: vibrational levels, spectroscopic constants, averaged dipole moments for all vibrational levels, radiative transition probabilities for emission and absorption, and radiative lifetimes are verificated. (M.J.C.) [pt
Anti-trypanosomal activities and structural chemical properties of selected compound classes.
Ponte-Sucre, Alicia; Bruhn, Heike; Schirmeister, Tanja; Cecil, Alexander; Albert, Christian R; Buechold, Christian; Tischer, Maximilian; Schlesinger, Susanne; Goebel, Tim; Fuß, Antje; Mathein, Daniela; Merget, Benjamin; Sotriffer, Christoph A; Stich, August; Krohne, Georg; Engstler, Markus; Bringmann, Gerhard; Holzgrabe, Ulrike
2015-02-01
Potent compounds do not necessarily make the best drugs in the market. Consequently, with the aim to describe tools that may be fundamental for refining the screening of candidates for animal and preclinical studies and further development, molecules of different structural classes synthesized within the frame of a broad screening platform were evaluated for their trypanocidal activities, cytotoxicities against murine macrophages J774.1 and selectivity indices, as well as for their ligand efficiencies and structural chemical properties. To advance into their modes of action, we also describe the morphological and ultrastructural changes exerted by selected members of each compound class on the parasite Trypanosoma brucei. Our data suggest that the potential organelles targeted are either the flagellar pocket (compound 77, N-Arylpyridinium salt; 15, amino acid derivative with piperazine moieties), the endoplasmic reticulum membrane systems (37, bisquaternary bisnaphthalimide; 77, N-Arylpyridinium salt; 68, piperidine derivative), or mitochondria and kinetoplasts (88, N-Arylpyridinium salt; 68, piperidine derivative). Amino acid derivatives with fumaric acid and piperazine moieties (4, 15) weakly inhibiting cysteine proteases seem to preferentially target acidic compartments. Our results suggest that ligand efficiency indices may be helpful to learn about the relationship between potency and chemical characteristics of the compounds. Interestingly, the correlations found between the physico-chemical parameters of the selected compounds and those of commercial molecules that target specific organelles indicate that our rationale might be helpful to drive compound design toward high activities and acceptable pharmacokinetic properties for all compound families.
Pal, Amrita; Arabnejad, Saeid; Yamashita, Koichi; Manzhos, Sergei
2018-05-01
C60 and C60 based molecules are efficient acceptors and electron transport layers for planar perovskite solar cells. While properties of these molecules are well studied by ab initio methods, those of solid C60, specifically its optical absorption properties, are not. We present a combined density functional theory-Density Functional Tight Binding (DFTB) study of the effect of solid state packing on the band structure and optical absorption of C60. The valence and conduction band edge energies of solid C60 differ on the order of 0.1 eV from single molecule frontier orbital energies. We show that calculations of optical properties using linear response time dependent-DFT(B) or the imaginary part of the dielectric constant (dipole approximation) can result in unrealistically large redshifts in the presence of intermolecular interactions compared to available experimental data. We show that optical spectra computed from the frequency-dependent real polarizability can better reproduce the effect of C60 aggregation on optical absorption, specifically with a generalized gradient approximation functional, and may be more suited to study effects of molecular aggregation.
Ab Initio Calculations of the Electronic Structures and Biological Functions of Protein Molecules
Zheng, Haoping
2003-04-01
The self-consistent cluster-embedding (SCCE) calculation method reduces the computational effort from M3 to about M1 (M is the number of atoms in the system) with unchanged calculation precision. So the ab initio, all-electron calculation of the electronic structure and biological function of protein molecule becomes a reality, which will promote new proteomics considerably. The calculated results of two real protein molecules, the trypsin inhibitor from the seeds of squash Cucurbita maxima (CMTI-I, 436 atoms) and the Ascaris trypsin inhibitor (912 atoms, two three-dimensional structures), are presented. The reactive sites of the inhibitors are determined and explained. The precision of structure determination of inhibitors are tested theoretically.
Zhang, Guiqiu; Song, Junjie; Fu, Lei; Tang, Kongshuang; Su, Yue; Chen, Dezhan
2018-04-18
The noble-gas hydrides, HNgX (X is an electronegative atom or fragment), represent potential high-energy materials because their two-body decomposition process, HNgX → Ng + HX, is strongly exoergic. Our previous studies have shown that each member of the HNgX (X = halogen atom or CN/NC fragment) molecules is composed of three leading resonance structures: two ω-bonding structures (H-Ng+ :X- and H:- Ng+-X) and one long-bonding structure (H∧X). The last one paints a novel [small sigma, Greek, circumflex]-type long-bonding picture. The present study focuses on the relationship between this novel bonding motif and the unusual energetic properties. We chose HNgCO+/CS+/OSi+/CN/NC, with the formula HNgAB (Ng = He, Ar, Kr, Xe, Rn; AB = CO+/CS+/OSi+/CN/NC) as the research system. We first investigated the bonding of HNgCO+ and its analogous HNgCS+/OSi+ species using NBO/NRT methods, and quantitatively compared the bonding with that in HNgCN/NC molecules. NBO/NRT results showed that each of the HNgCO+/CS+/OSi+ molecules could be better represented as a resonance hybrid of ω-bonding and long-bonding structures, but the long-bonding is much weaker than that in HNgCN/NC molecules. Furthermore, we introduced the long-bonding concept into the rationalization of the high-energy properties, and found a good correlation between the highly exothermic two-body dissociation channel and the long-bond order, bH-A. We also found that the long-bond order is highly tunable for these noble-gas hydrides due to its dependence on the nature of the electronegative AB fragments or the central noble-gas atoms, Ng. On the basis of these results, we could optimize the energetic properties by changing the long-bonding motif of our studied molecules. Overall, this study shows that the long-bonding model provides an easy way to rationalize and modulate the unusual energy properties of noble-gas hydrides, and that it is helpful to predict some noble-gas hydrides as potential energetic materials.
International Nuclear Information System (INIS)
Kim, Eunae; Yeom, Min Sun
2014-01-01
Molecular dynamics simulations were performed to understand the structural arrangement of water molecules around highly charged nanoparticles under aqueous conditions. The effect of two highly charged nanoparticles on the solvation charge asymmetry has been examined. We calculated the radial distribution functions of the components of water molecules around nanoparticles which have four charge types at two different salt concentrations. Even though the distributions of water molecules surrounding a sodium ion and a chloride ion are hardly affected by the charges of nanoparticles and the salt concentrations, those around highly charged nanoparticles are strongly influenced by the charges of nanoparticles, but hardly by the charges of nanoparticles and salt concentrations. We find that the distributions of hydrogen atoms in water molecules around one highly charged nanoparticle are dependent on the magnitude of the nanoparticle charge
PHYSICOCHEMICAL PROPERTY CALCULATIONS
Computer models have been developed to estimate a wide range of physical-chemical properties from molecular structure. The SPARC modeling system approaches calculations as site specific reactions (pKa, hydrolysis, hydration) and `whole molecule' properties (vapor pressure, boilin...
[Relationships between microscope structure and thermodynamic properties
International Nuclear Information System (INIS)
Wu, R.S.; Lee, L.L.; Cochran, D.
1990-01-01
This paper exhibits on the molecular level, the relationships between the microscopic structure and thermodynamic properties of dilute supercritical solutions by application of the integral equation theories for molecular distribution functions. To solve the integral equations, the authors use Baxter's Wiener-Hopf factorization of the Ornstein-Zernike equations and then apply this method to binary Lennard-Jones mixtures. A number of closure relations have been used: such as the Percus-Yevick (PY), the reference hypernetted chain (RHNC), the hybrid mean spherical approximation (HMSA), and the reference interaction-site (RISM) methods. The authors examine the microstructures of several important classes of supercritical mixtures, including the usual attractive-type and the less known repulsive-type solutions. The clustering of solvent molecules for solvent-solute structures in the attractive mixtures and, correspondingly, the solvent cavitation in the repulsive mixtures are clearly demonstrated. These are shown to be responsible for the large negative growth of the solute partial molar volumes in the attractive case and the positive growth in the repulsive case
Environmental effects on molecules immersed in liquids
International Nuclear Information System (INIS)
Sese, L.M.
1990-01-01
A methodology to study environmental effects is thoroughly discussed. It combines molecular quantum mechanics and classical statistical mechanics of molecular fluids. Pair distribution functions collecting statistical information appear quite naturally in the quantum equations describing a single molecule. As well as allowing the computation of any individual molecular property in a liquid phase, this approach satisfies a number of theoretical requirements (dependence on density and temperature, validity in the thermodynamic limit). In a sense, it can be regarded as a useful alternative to the well-known Monte Carlo averaging processes for calculating molecular properties. Numerical applications studying liquid carbon disulphide and liquid carbon tetrachloride at several state points are given. Results cover typical RHF information (CNDO/2) on molecules, and show the sensitivity of the presented methodology to structural changes in liquids. (orig.)
di Lauro, C.
2018-03-01
Transformations of vector or tensor properties from a space-fixed to a molecule-fixed axis system are often required in the study of rotating molecules. Spherical components λμ,ν of a first rank irreducible tensor can be obtained from the direction cosines between the two axis systems, and a second rank tensor with spherical components λμ,ν(2) can be built from the direct product λ × λ. It is shown that the treatment of the interaction between molecular rotation and the electric quadrupole of a nucleus is greatly simplified, if the coefficients in the axis-system transformation of the gradient of the electric field of the outer charges at the coupled nucleus are arranged as spherical components λμ,ν(2). Then the reduced matrix elements of the field gradient operators in a symmetric top eigenfunction basis, including their dependence on the molecule-fixed z-angular momentum component k, can be determined from the knowledge of those of λ(2) . The hyperfine structure Hamiltonian Hq is expressed as the sum of terms characterized each by a value of the molecule-fixed index ν, whose matrix elements obey the rule Δk = ν. Some of these terms may vanish because of molecular symmetry, and the specific cases of linear and symmetric top molecules, orthorhombic molecules, and molecules with symmetry lower than orthorhombic are considered. Each ν-term consists of a contraction of the rotational tensor λ(2) and the nuclear quadrupole tensor in the space-fixed frame, and its matrix elements in the rotation-nuclear spin coupled representation can be determined by the standard spherical tensor methods.
International Nuclear Information System (INIS)
Zhang Yonghui; Zhou Kaige; Xie Kefeng; Zeng Jing; Zhang Haoli; Peng Yong
2010-01-01
Using density functional theory and nonequilibrium Green's function (NEGF) formalism, we have theoretically investigated the binding of organic donor, acceptor and metal atoms on graphene sheets, and revealed the effects of the different noncovalent functionalizations on the electronic structure and transport properties of graphene. The adsorptions of 2,3-dichloro-5,6-dicyano-1,4-benzoquinone (DDQ) and tetrathiafulvalene (TTF) induce hybridization between the molecular levels and the graphene valence bands, and transform the zero-gap semiconducting graphene into a metallic graphene. However, the current versus voltage (I-V) simulation indicates that the noncovalent modifications by organic molecules are not sufficient to significantly alter the transport property of the graphene for sensing applications. We found that the molecule/graphene interaction could be dramatically enhanced by introducing metal atoms to construct molecule/metal/graphene sandwich structures. A chemical sensor based on iron modified graphene shows a sensitivity two orders of magnitude higher than that of pristine graphene. The results of this work could help to design novel graphene-based sensing or switching devices.
Pro-aromatic and anti-aromatic π-conjugated molecules: an irresistible wish to be diradicals
Zeng, Zebing
2015-01-01
© 2015 The Royal Society of Chemistry. Aromaticity is an important concept to understand the stability and physical properties of π-conjugated molecules. Recent studies on pro-aromatic and anti-aromatic molecules revealed their irresistible tendency to become diradicals in the ground state. Diradical character thus becomes another very important concept and it is fundamentally correlated to the physical (optical, electronic and magnetic) properties and chemical reactivity of most of the organic optoelectronic materials. Molecules with distinctive diradical character show unique properties which are very different from those of traditional closed-shell π-conjugated systems, and thus they have many potential applications in organic electronics, spintronics, non-linear optics and energy storage. This critical review first introduces the fundamental electronic structure of Kekulé diradicals within the concepts of anti-aromaticity and pro-aromaticity in the context of Hückel aromaticity and diradical character. Then recent research studies on various stable/persistent diradicaloids based on pro-aromatic and anti-aromatic compounds are summarized and discussed with regard to their synthetic chemistry, physical properties, structure-property relationships and potential material applications. A summary and personal perspective is given at the end.
Reinsch, Helge; Pillai, Renjith S; Siegel, Renée; Senker, Jürgen; Lieb, Alexandra; Maurin, Guillaume; Stock, Norbert
2016-03-14
The new aluminium based metal-organic framework [Al(OH)(O2C-C4H8-CO2)]·H2O denoted as Al-MIL-53-ADP-lp (lp stands for large pore) was synthesised under solvothermal conditions. This solid is an analogue of the archetypical aluminium terephthalate Al-MIL-53 based on the aliphatic single-chain linker molecule adipic acid (H2ADP, hexanedioic acid). In contrast to its aromatic counterparts, Al-MIL-53-ADP exhibits a structural breathing behaviour solely upon dehydration/rehydration. The crystal structure of the anhydrous compound denoted as Al-MIL-53-ADP-np (np stands for narrow pore) was determined by a combination of forcefield-based computations and Rietveld refinement of the powder X-ray diffraction data while the structure of the hydrated form Al-MIL-53-ADP-lp was derived computationally by a combination of force field based methods and Density Functional Theory calculations. Both structures were further supported by (1)H, (13)C and (27)Al high-resolution NMR MAS 1D data coupled again with simulations. Al-MIL-53-ADP was further characterised by means of vibrational spectroscopy, elemental analysis, thermogravimetry and water vapour sorption.
Granger, Devin Benjamin
Polycyclic aromatic hydrocarbons composed of benzenoid rings fused in a linear fashion comprise the class of compounds known as acenes. The structures containing three to six ring fusions are brightly colored and possess band gaps and charge transport efficiencies sufficient for semiconductor applications. These molecules have been investigated throughout the past several decades to assess their optoelectronic properties. The absorption, emission and charge transport properties of this series of molecules has been studied extensively to elucidate structure-property relationships. A wide variety of analogous molecules, incorporating heterocycles in place of benzenoid rings, demonstrate similar properties to the parent compounds and have likewise been investigated. Functionalization of acene compounds by placement of groups around the molecule affects the way in which molecules interact in the solid state, in addition to the energetics of the molecule. The use of electron donating or electron withdrawing groups affects the frontier molecular orbitals and thus affects the optical and electronic gaps of the molecules. The use of bulky side groups such as alkylsilylethynyl groups allows for crystal engineering of molecular aggregates, and changing the volume and dimensions of the alkylsilyl groups affects the intermolecular interactions and thus changes the packing motif. In chapter 2, a series of tetracene and pentacene molecules with strongly electron withdrawing groups is described. The investigation focuses on the change in energetics of the frontier molecular orbitals between the base acene and the nitrile and dicyanovinyl derivatives as well as the differences between the pentacene and tetracene molecules. The differences in close packing motifs through use of bulky alkylsilylethynyl groups is also discussed in relation to electron acceptor material design and bulk heterojunction organic photovoltaic characteristics. Chapter 3 focuses on molecular acceptor and
The Relation between Structure and Quantum Interference in Single Molecule Junctions
DEFF Research Database (Denmark)
Markussen, Troels; Stadler, Robert; Thygesen, Kristian Sommer
2010-01-01
Quantum interference (QI) of electron pathways has recently attracted increased interest as an enabling tool for single-molecule electronic devices. Although various molecular systems have been shown to exhibit QI effects and a number of methods have been proposed for its analysis, simple...... guidelines linking the molecular structure to QI effects in the phase-coherent transport regime have until now been lacking. In the present work we demonstrate that QI in aromatic molecules is intimately related to the topology of the molecule’s π system and establish a simple graphical scheme to predict...
International Nuclear Information System (INIS)
Sarma, Rahul; Paul, Sandip
2012-01-01
Highlights: ► NMA molecules are associated mostly through their hydrophobic methyl groups. ► High pressure reduces association propensity causing dispersion of these moieties. ► Orientational polarization of vicinal water molecules near O and H atoms of NMA. ► NMA prefers to be a H-bond acceptor rather than a donor in interaction with water. ► Energy of these hydrogen bonds reduces slightly at high pressure. -- Abstract: Effects of high pressure on hydrophobic and hydrogen bonding interactions are investigated by employing molecular dynamics (MD) simulations of aqueous N-methylacetamide (NMA) solutions. Such systems are of interest mainly because high pressure causes protein denaturation and NMA is a computationally effective model to understand the atomic-level picture of pressure-induced structural transitions of protein. Simulations are performed for five different pressure values ranging from 1 atm to 8000 atm. We find that NMA molecules are associated mostly through their hydrophobic methyl groups and high pressure reduces this association propensity, causing dispersion of these moieties. At high pressure, structural void decreases and the packing efficiency of water molecules around NMA molecules increases. Hydrogen bond properties calculations show favorable NMA–NMA hydrogen bonds as compared to those of NMA–water hydrogen bonds and preference of NMA to be a hydrogen bond acceptor rather than a donor in interaction with water.
Modification of the properties of porous silicon on adsorption of iodine molecules
International Nuclear Information System (INIS)
Vorontsov, A. S.; Osminkina, L. A.; Tkachenko, A. E.; Konstantinova, E. A.; Elenskii, V. G.; Timoshenko, V. Yu.; Kashkarov, P. K.
2007-01-01
Infrared spectroscopy and electron spin resonance measurements are used to study the properties of porous silicon layers on adsorption of the I 2 iodine molecules. The layers are formed on the p-an n-Si single-crystal wafers. It is established that, in the atmosphere of I 2 molecules, the charge-carrier concentration in the layers produced on the p-type wafers can be noticeably increased: the concentration of holes can attain values on the order of ∼10 18 -10 19 cm -3 . In porous silicon layers formed on the n-type wafers, the adsorption-induced inversion of the type of charge carriers and the partial substitution of silicon-hydrogen bonds by silicon-iodine bonds are observed. A decrease in the concentration of surface paramagnetic defects, P b centers, is observed in the samples with adsorbed iodine. The experimental data are interpreted in the context of the model in which it is assumed that both deep and shallow acceptor states are formed at the surface of silicon nanocrystals upon the adsorption of I 2 molecules
Energy Technology Data Exchange (ETDEWEB)
Ceyhan, Goekhan [Chemistry Department, K.Maras Suetcue Imam University, 46100 K.Maras (Turkey); Tuemer, Mehmet, E-mail: mtumer@ksu.edu.tr [Chemistry Department, K.Maras Suetcue Imam University, 46100 K.Maras (Turkey); Koese, Muhammet; McKee, Vickie [Chemistry Department, Loughborough University, LE11 3TU Leicestershire (United Kingdom)
2012-03-15
In this paper, we obtained a novel poly(vanillinato potassium) complex (PVP) as a single crystal and characterized by analytical and spectroscopic methods. A single crystal of the PVP was obtained from the acetone solution. X-ray structural data show that crystals contain polymeric K{sup +} complex of vanillin. Each potassium ion in the polymeric structure is identical and seven-coordinate, bonded to two methoxy, two phenoxy and three aldehyde oxygen atoms from four vaniline molecules. Two aldehyde oxygen atoms are bridging between potassium ions. It crystallizes in the monoclinic system, space group P2{sub 1}/c, with lattice parameters a=9.6215(10) A, b=17.4139(19) A, c=9.6119(10) A, {beta}=100.457(2) Degree-Sign and Z=4. Thermal properties of the PVP were investigated by TGA, DTA and DSC methods. The electrochemical properties of the complex were studied in different solvents and at various scan rates. The luminescence properties of the complex in different solvents and at different pH values have been investigated. The results show that the complex exhibits more efficient luminescence property in CH{sub 3}CN and n-butanol. - Highlights: Black-Right-Pointing-Pointer Novel polymeric potassium complex was prepared and fully characterized. Black-Right-Pointing-Pointer X-ray crystal structure of complex was reported. Black-Right-Pointing-Pointer Electrochemical properties of compound were investigated. Black-Right-Pointing-Pointer Thermal and DSC measurements of complex were examined.
International Nuclear Information System (INIS)
Wang, Qi; Li, Rong; Xu, Yuanlan; Zhang, Jianbing; Miao, Xiangshui; Zhang, Daoli
2014-01-01
In this present work, the geometric structures and electronic transport properties of (InAs) n (n = 2, 3, 4) molecule cluster junctions are comparatively investigated using NEGF combined with DFT. Results indicate that all (InAs) n molecule cluster junctions present metallic behavior at the low applied biases ([−2V, 2V]), while NDR appears at a certain high bias range. Our calculation shows that the current of (InAs) 4 molecule cluster–based junction is almost the largest at any bias. The mechanisms of the current–voltage characteristics of all the three molecule cluster junctions are proposed.
Relation between the development of structure and the properties of network polymers
International Nuclear Information System (INIS)
Williams, D.R.G.; Allen, P.E.M.; Simon, G.P.
1989-01-01
It was shown by various techniques that the development of structure in the early stages of cure determines the final structure and properties of glassy three-dimensional networks. Solid state [ 13 C]-nuclear magnetic resonance (NMR) techniques identified the structure groupings and the extent of heterogeneity soon after the commencement of polymerization through to the glassy state. Observations of the changes in mobility of groups during cure were correlated with the development of bulk properties such as the glass transition and compressive strength. Computer simulation of the kinetics of the polymerization based on a three-dimensional lattice closely followed the trends observed by experiment and provided insight into the formation of clusters of reacted polymer surrounded by pools of unreacted monomer. The difficulty in obtaining full cure was clearly associated with the presence of trapped reactive centres within the cluster. Observation of the behaviour of small probe or tracer molecules by NMR was shown to be a potent technique for investigating the organization of networks. 28 refs., 12 figs
Adsorption behavior of Co anchored on graphene sheets toward NO, SO2, NH3, CO and HCN molecules
International Nuclear Information System (INIS)
Tang, Yanan; Chen, Weiguang; Li, Chenggang; Pan, Lijun; Dai, Xianqi; Ma, Dongwei
2015-01-01
Graphical abstract: - Highlights: • In contrast to the pristine graphene, a vacancy defect in graphene strongly stabilizes the Co atom. • The positively charged of Co atom on graphene can regulate the stability of gas molecules. • Different gas molecules can modulate the electronic structure of Co–graphene systems. • The adsorbed NO on Co–graphene can effectively regulate the magnetic properties of systems. - Abstract: Based on the first-principles of density-functional theory (DFT), the effects of gas adsorption on the change in geometric stability, electronic structure and magnetic properties of graphene with anchored Co (Co–graphene) systems were investigated. A single Co adatom interacts much weaker with pristine graphene (Co/pri–graphene) than with the graphene containing a single vacancy (Co/SV–graphene). The Co dopant provides more electrons to the dangling bonds of carbon atom at defective site and exhibits more positive charges, which makes Co/SV–graphene less prone to be adsorbed by gas molecules in comparison to Co/pri–graphene. It is found that the electronic structure and magnetic properties of Co–graphene systems can be modulated by adsorbing gas molecules. Except the NH 3 molecule, the adsorbed NO, SO 2 , CO or HCN as electron acceptors on the Co/pri–graphene can exhibit semiconducting properties. Among the gas molecules, the strong adsorption of NO molecule can effectively regulate the magnetic properties of Co–graphene systems. Moreover, the stable configuration of Co/SV–graphene is more likely to be the gas sensor for detecting NO and SO 2 . The results validate that the reactivity of atomic-scale catalyst is supported on graphene sheets, which is expected to be potentially efficient in the gas sensors and electronic device
Structural and energetic properties of La3+ in water/DMSO mixtures
Montagna, Maria; Spezia, Riccardo; Bodo, Enrico
2017-11-01
By using molecular dynamics based on a custom polarizable force field, we have studied the solvation of La3+ in an equimolar mixture of dimethylsulfoxide (DMSO) with water. An extended structural analysis has been performed to provide a complete picture of the physical properties at the basis of the interaction of La3+ with both solvents. Through our simulations we found that, very likely, the first solvation shell in the mixture is not unlike the one found in pure water or pure DMSO and contains 9 solvent molecules. We have also found that the solvation is preferentially due to DMSO molecules with the water initially present in first shell quickly leaving to the bulk. The dehydration process of the first shell has been analyzed by both plain MD simulations and a constrained dynamics approach; the free energy profiles for the extraction of water from first shell have also been computed.
Shedding light on protein folding, structural and functional dynamics by single molecule studies
DEFF Research Database (Denmark)
Bavishi, Krutika; Hatzakis, Nikos
2014-01-01
property of a population, single molecule measurements offer observation and quantification of the abundance, lifetime and function of multiple protein states. They also permit the direct observation of the transient and rarely populated intermediates in the energy landscape that are typically averaged out...
Surface structure and properties of functionalized nanodiamonds: a first-principles study
International Nuclear Information System (INIS)
Datta, Aditi; Kirca, Mesut; Fu Yao; To, Albert C
2011-01-01
The goal of this work is to gain fundamental understanding of the surface and internal structure of functionalized detonation nanodiamonds (NDs) using quantum mechanics based density functional theory (DFT) calculations. The unique structure of ND assists in the binding of different functional groups to its surface which in turn facilitates binding with drug molecules. The ability to comprehensively model the surface properties, as well as drug-ND interactions during functionalization, is a challenge and is the problem of our interest. First, the structure of NDs of technologically relevant size (∼5 nm) was optimized using classical mechanics based molecular mechanics simulations. Quantum mechanics based density functional theory (DFT) was then employed to analyse the properties of smaller relevant parts of the optimized cluster further to address the effect of functionalization on the stability of the cluster and reactivity at its surface. It is found that functionalization is preferred over reconstruction at the (100) surface and promotes graphitization in the (111) surface for NDs functionalized with the carbonyl oxygen (C = O) group. It is also seen that the edges of ND are the preferred sites for functionalization with the carboxyl group (-COOH) vis-a-vis the corners of ND.
Surface structure and properties of functionalized nanodiamonds: a first-principles study
Energy Technology Data Exchange (ETDEWEB)
Datta, Aditi; Kirca, Mesut; Fu Yao; To, Albert C, E-mail: albertto@pitt.edu [Department of Mechanical Engineering and Materials Science and Department of Civil and Environmental Engineering, University of Pittsburgh, Pittsburgh, PA 15261 (United States)
2011-02-11
The goal of this work is to gain fundamental understanding of the surface and internal structure of functionalized detonation nanodiamonds (NDs) using quantum mechanics based density functional theory (DFT) calculations. The unique structure of ND assists in the binding of different functional groups to its surface which in turn facilitates binding with drug molecules. The ability to comprehensively model the surface properties, as well as drug-ND interactions during functionalization, is a challenge and is the problem of our interest. First, the structure of NDs of technologically relevant size ({approx}5 nm) was optimized using classical mechanics based molecular mechanics simulations. Quantum mechanics based density functional theory (DFT) was then employed to analyse the properties of smaller relevant parts of the optimized cluster further to address the effect of functionalization on the stability of the cluster and reactivity at its surface. It is found that functionalization is preferred over reconstruction at the (100) surface and promotes graphitization in the (111) surface for NDs functionalized with the carbonyl oxygen (C = O) group. It is also seen that the edges of ND are the preferred sites for functionalization with the carboxyl group (-COOH) vis-a-vis the corners of ND.
Vibronic coupling in ionized organic molecules: structural distortions and chemical reactions
International Nuclear Information System (INIS)
Williams, Ffrancon
2003-01-01
Ionized organic molecules (radical cations) in radiation chemistry are liable to undergo vibronic coupling whenever there is a relatively small energy gap (∼0.5-1.5 eV) between their ground and excited states. As a result of this mixing, the force constant for the symmetry-allowed vibrational mode that couples these states is lowered in the ground state of the radical cation so that deformation can take place more easily along this specific mode. This pseudo-Jahn-Teller effect can then result in a permanent structural distortion of the radical cation relative to the symmetry of the parent neutral molecule. It can also bring about an energetically favored pathway for a facile chemical rearrangement along a reaction coordinate defined by the coupling mode. Examples taken from matrix-isolation studies are used to illustrate these dramatic consequences of vibronic coupling in radical cations. Thus, the bicyclo[2.2.2]oct-2-ene and tetramethylurea radical cations are found to have twisted structures departing from the C 2v symmetry of their parent molecules, while the oxirane and bicyclo[1.1.1]pentane radical cations undergo ring-opening rearrangements along reaction coordinates that correspond to the deformational modes predicted by the pseudo-Jahn-Teller effect
Correlating substituent parameter values to electron transport properties of molecules
International Nuclear Information System (INIS)
Vedova-Brook, Natalie; Matsunaga, Nikita; Sohlberg, Karl
2004-01-01
There are a vast number of organic compounds that could be considered for use in molecular electronics. Because of this, the need for efficient and economical screening tools has emerged. We demonstrate that the substituent parameter values (σ), commonly found in advanced organic chemistry textbooks, correlate strongly with features of the charge migration process, establishing them as useful indicators of electronic properties. Specifically, we report that ab initio derived electronic charge transfer values for 16 different substituted aromatic molecules for molecular junctions correlate to the σ values with a correlation coefficient squared (R 2 ) of 0.863
FlavorDB: a database of flavor molecules.
Garg, Neelansh; Sethupathy, Apuroop; Tuwani, Rudraksh; Nk, Rakhi; Dokania, Shubham; Iyer, Arvind; Gupta, Ayushi; Agrawal, Shubhra; Singh, Navjot; Shukla, Shubham; Kathuria, Kriti; Badhwar, Rahul; Kanji, Rakesh; Jain, Anupam; Kaur, Avneet; Nagpal, Rashmi; Bagler, Ganesh
2018-01-04
Flavor is an expression of olfactory and gustatory sensations experienced through a multitude of chemical processes triggered by molecules. Beyond their key role in defining taste and smell, flavor molecules also regulate metabolic processes with consequences to health. Such molecules present in natural sources have been an integral part of human history with limited success in attempts to create synthetic alternatives. Given their utility in various spheres of life such as food and fragrances, it is valuable to have a repository of flavor molecules, their natural sources, physicochemical properties, and sensory responses. FlavorDB (http://cosylab.iiitd.edu.in/flavordb) comprises of 25,595 flavor molecules representing an array of tastes and odors. Among these 2254 molecules are associated with 936 natural ingredients belonging to 34 categories. The dynamic, user-friendly interface of the resource facilitates exploration of flavor molecules for divergent applications: finding molecules matching a desired flavor or structure; exploring molecules of an ingredient; discovering novel food pairings; finding the molecular essence of food ingredients; associating chemical features with a flavor and more. Data-driven studies based on FlavorDB can pave the way for an improved understanding of flavor mechanisms. © The Author(s) 2017. Published by Oxford University Press on behalf of Nucleic Acids Research.
The structure of small molecules with the Coulomb Explosion method
International Nuclear Information System (INIS)
Vager, Z.; Kanter, E.P.
1987-01-01
The content of this paper is divided into two parts: (1) achievements of the last two years in studying molecular ion structure with the aid of the newly developed Coulomb-Explosion (CE) method, and (2) the understanding of the modern CE data in terms of an invariant density of nuclear coordinates of the studied molecule
Energy Technology Data Exchange (ETDEWEB)
Park, Jaeok [McGill University, 3655 Promenade Sir William Osler, Montreal, QC H3G 1Y6 (Canada); Lin, Yih-Shyan [McGill University, 801 Rue Sherbrooke Ouest, Montreal, QC H3A 0B8 (Canada); Tsantrizos, Youla S. [McGill University, 3655 Promenade Sir William Osler, Montreal, QC H3G 1Y6 (Canada); McGill University, 801 Rue Sherbrooke Ouest, Montreal, QC H3A 0B8 (Canada); McGill University, 3649 Promenade Sir William Osler, Montreal, QC H3G 0B1 (Canada); Berghuis, Albert M., E-mail: albert.berghuis@mcgill.ca [McGill University, 3655 Promenade Sir William Osler, Montreal, QC H3G 1Y6 (Canada); McGill University, 3649 Promenade Sir William Osler, Montreal, QC H3G 0B1 (Canada); McGill University, 3775 Rue University, Montreal, QC H3A 2B4 (Canada)
2014-02-19
A co-crystal structure of human farnesyl pyrophosphate synthase in complex with an aminopyridine bisphosphonate, YS0470, and two molecules of inorganic phosphate has been determined. The identity of the phosphate ligands was confirmed by anomalous diffraction data. Human farnesyl pyrophosphate synthase (hFPPS) produces farnesyl pyrophos@@phate, an isoprenoid essential for a variety of cellular processes. The enzyme has been well established as the molecular target of the nitrogen-containing bisphosphonates (N-BPs), which are best known for their antiresorptive effects in bone but are also known for their anticancer properties. Crystal structures of hFPPS in ternary complexes with a novel bisphosphonate, YS0470, and the secondary ligands inorganic phosphate (P{sub i}), inorganic pyrophosphate (PP{sub i}) and isopentenyl pyrophosphate (IPP) have recently been reported. Only the co-binding of the bisphosphonate with either PP{sub i} or IPP resulted in the full closure of the C-@@terminal tail of the enzyme, a conformational change that is required for catalysis and that is also responsible for the potent in vivo efficacy of N-BPs. In the present communication, a co-crystal structure of hFPPS in complex with YS0470 and two molecules of P{sub i} is reported. The unusually close proximity between these ligands, which was confirmed by anomalous diffraction data, suggests that they interact with one another, with their anionic charges neutralized in their bound state. The structure also showed the tail of the enzyme to be fully disordered, indicating that simultaneous binding of two P{sub i} molecules with a bisphosphonate cannot induce the tail-closing conformational change in hFPPS. Examination of homologous FPPSs suggested that this ligand-dependent tail closure is only conserved in the mammalian proteins. The prevalence of P{sub i}-bound hFPPS structures in the PDB raises a question regarding the in vivo relevance of P{sub i} binding to the function of the enzyme.
International Nuclear Information System (INIS)
Naik, K. Praveen Kumar; Sreeramulu, V.; Ramya, E.; Muralidharan, K.; Rao, D. Narayana
2016-01-01
Cyclophosphazene based hyperstructured molecules were synthesized through simple nucleophilic substitution reactions. All these molecules were characterized by multinuclear NMR, MALDI and HRMS spectral data. Third order nonlinear optical properties of the hyperstructured molecules were measured using Z-scan technique with 532 nm, picosecond (ps) laser and 800 nm, femtosecond (fs) laser pulses. The molecules showed reverse saturable absorption on excitation at both 532 nm and 800 nm, which could be attributed to the two-photon absorption (2 PA) and three-photon absorption (3 PA), respectively. The 2 PA and 3 PA cross section values exhibited by the molecules based on cyclophosphazene are as high as 527 GM and 1.86 × 10"−"7"6 cm"−"6 s"2 photon"−"1, respectively. The 2PA, 3PA coefficients and optical limiting properties make them suitable candidates for nonlinear optical devices in the visible and near IR range. - Graphical abstract: The hyperstructured molecules based on cyclophosphazene core were synthesized and used for multiphoton absorption. Open aperture Z-scan curves of hyper structured molecules at the excitation of (a) picosecond laser and (b) femtosecond laser representing multiphoton absorption properties are reported. - Highlights: • Two hyperstructured molecules based on cyclophosphazene core are designed for multiphoton absorption. • NLO properties are measured using Z-scan technique at 532 nm and 800 nm wavelengths. • The molecules were tested for the optical limiting applications at 532 nm and 800 nm laser pulses.
Energy Technology Data Exchange (ETDEWEB)
Naik, K. Praveen Kumar [School of Chemistry, University of Hyderabad, Hyderabad 500046 India (India); Sreeramulu, V. [School of Physics, University of Hyderabad, Hyderabad 500046 India (India); CNR-IFN CSMFO Laboratory, Via alla Cascata, 56/C Povo, Trento (Italy); Ramya, E. [School of Physics, University of Hyderabad, Hyderabad 500046 India (India); Muralidharan, K., E-mail: murali@uohyd.ac.in [School of Chemistry, University of Hyderabad, Hyderabad 500046 India (India); Rao, D. Narayana [School of Physics, University of Hyderabad, Hyderabad 500046 India (India)
2016-09-01
Cyclophosphazene based hyperstructured molecules were synthesized through simple nucleophilic substitution reactions. All these molecules were characterized by multinuclear NMR, MALDI and HRMS spectral data. Third order nonlinear optical properties of the hyperstructured molecules were measured using Z-scan technique with 532 nm, picosecond (ps) laser and 800 nm, femtosecond (fs) laser pulses. The molecules showed reverse saturable absorption on excitation at both 532 nm and 800 nm, which could be attributed to the two-photon absorption (2 PA) and three-photon absorption (3 PA), respectively. The 2 PA and 3 PA cross section values exhibited by the molecules based on cyclophosphazene are as high as 527 GM and 1.86 × 10{sup −76} cm{sup −6} s{sup 2} photon{sup −1}, respectively. The 2PA, 3PA coefficients and optical limiting properties make them suitable candidates for nonlinear optical devices in the visible and near IR range. - Graphical abstract: The hyperstructured molecules based on cyclophosphazene core were synthesized and used for multiphoton absorption. Open aperture Z-scan curves of hyper structured molecules at the excitation of (a) picosecond laser and (b) femtosecond laser representing multiphoton absorption properties are reported. - Highlights: • Two hyperstructured molecules based on cyclophosphazene core are designed for multiphoton absorption. • NLO properties are measured using Z-scan technique at 532 nm and 800 nm wavelengths. • The molecules were tested for the optical limiting applications at 532 nm and 800 nm laser pulses.
Adsorption studies of alcohol molecules on monolayer MoS_2 nanosheet—A first-principles insights
International Nuclear Information System (INIS)
Nagarajan, V.; Chandiramouli, R.
2017-01-01
Highlights: • The adsorption of methanol, ethanol & 1-propanol on MoS_2 nanosheet are studied. • The PDOS & band structure confirms adsorption of alcohol vapors on MoS_2 nanosheet. • The adsorption of 1-propanol vapor on MoS_2 nanosheet is more favorable. • The alcohol molecules adsorption on MoS_2 nanosheet is explored in atomistic level. - Abstract: The electronic and adsorption properties of three different alcohol molecules namely methanol, ethanol and 1-propanol vapors on MoS_2 nanosheet is investigated using DFT method. The structural stability of MoS_2 nanosheet is ascertained with formation energy. The adsorption properties of alcohol molecules on MoS_2 base material is discussed in terms of average energy gap variation, Mulliken charge transfer, energy band gap and adsorption energy. The prominent adsorption sites of methanol, ethanol and 1-propanol vapors on MoS_2 nanosheet are studied in atomistic level. The projected density of states (PDOS) spectrum gives the clear insights on the electronic properties of MoS_2 nanosheet. The PDOS and energy band structure confirmed the adsorption of alcohol vapors on MoS_2 nanosheet. The variation in the band structure and PDOS is noticed upon adsorption of methanol, ethanol and 1-propanol molecules on MoS_2 nanosheet. The PDOS spectrum also reveals the variation in peak maxima owing to transfer of electron between alcohol molecules and MoS_2 base material. The adsorption of 1-propanol vapor on MoS_2 nanosheet is observed to be more favorable than other alcohol molecules. The findings confirm that monolayer MoS_2 nanosheet can be used to detect the presence of alcohol vapors in the environment.
The growth and electronic structure of azobenzene-based functional molecules on layered crystals
International Nuclear Information System (INIS)
Iwicki, J; Ludwig, E; Buck, J; Kalläne, M; Kipp, L; Rossnagel, K; Köhler, F; Herges, R
2012-01-01
In situ ultraviolet photoelectron spectroscopy is used to study the growth of ultrathin films of azobenzene-based functional molecules (azobenzene, Disperse Orange 3 and a triazatriangulenium platform with an attached functional azo-group) on the layered metal TiTe 2 and on the layered semiconductor HfS 2 at liquid nitrogen temperatures. Effects of intermolecular interactions, of the substrate electronic structure, and of the thermal energy of the sublimated molecules on the growth process and on the adsorbate electronic structure are identified and discussed. A weak adsorbate-substrate interaction is particularly observed for the layered semiconducting substrate, holding the promise of efficient molecular photoswitching.
Theoretical conformational analysis of the bovine adrenal medulla 12 residue peptide molecule
Akhmedov, N. A.; Tagiyev, Z. H.; Hasanov, E. M.; Akverdieva, G. A.
2003-02-01
The spatial structure and conformational properties of the bovine adrenal medulla 12 residue peptide Tyr1-Gly2-Gly3-Phe4-Met5-Arg6-Arg7-Val8-Gly9-Arg10-Pro11-Glu12 (BAM-12P) molecule were studied by theoretical conformational analysis. It is revealed that this molecule can exist in several stable states. The energy and geometrical parameters for the low-energy conformations are obtained. The conformationally rigid and labile segments of this molecule were revealed.
International Nuclear Information System (INIS)
Ye Chaohong; Sun Haoling; Wang Xinyi; Li Junran; Nie Daobo; Fu Wenfu; Gao Song
2004-01-01
Three new rare earth p-aminobenzoic acid complexes, [Tb 2 L 6 (H 2 O) 2 ] n (1), [Tb 2 L 6 (H 2 O) 4 ].2H 2 O (2) and [Tb(phen) 2 L 2 (H 2 O) 2 ](phen)L·4H 2 O (3) (HL: p-aminobenzoic acid; phen: 1, 10-phenanthroline), with different structural forms are reported in this paper. Complex 1 is a polymolecule with a two-dimensional plane structure. Compound 2 is a binuclear molecule, and 3 appears to be a mononuclear complex. The fluorescence intensity, the fluorescence life-time and emission quantum yield of 2, which has two coordination water molecules, is better than those of 1, which has only one coordination water molecule. This is an unusual phenomenon for general fluorescent rare earth complexes. The fluorescence performance of 3 is the most unsatisfactory among the three complexes. Their crystal structures show that the coordination mode of the ligand is an important factor influencing the luminescence properties of a fluorescent rare earth complex
Interfacial assembly structures and nanotribological properties of saccharic acids.
Shi, Hongyu; Liu, Yuhong; Zeng, Qingdao; Yang, Yanlian; Wang, Chen; Lu, Xinchun
2017-01-04
Saccharides have been recognized as potential bio-lubricants because of their good hydration ability. However, the interfacial structures of saccharides and their derivatives are rarely studied and the molecular details of interaction mechanisms have not been well understood. In this paper, the supramolecular assembly structures of saccharic acids (including galactaric acid and lactobionic acid), mediated by hydrogen bonds O-HN and O-HO, were successfully constructed on a highly oriented pyrolytic graphite (HOPG) surface by introducing pyridine modulators and were explicitly revealed by using scanning tunneling microscopy (STM). Furthermore, friction forces were measured in the saccharic acid/pyridine co-assembled system by atomic force microscopy (AFM), revealing a larger value than a pristine saccharic acid system, which could be attributed to the stronger tip-assembled molecule interactions that lead to the higher potential energy barrier needed to overcome. The effort on saccharide-related supramolecular self-assembly and nanotribological behavior could provide a novel and promising pathway to explore the interaction mechanisms underlying friction and reveal the structure-property relationship at the molecular level.
Selective small-molecule inhibition of an RNA structural element
Energy Technology Data Exchange (ETDEWEB)
Howe, John A.; Wang, Hao; Fischmann, Thierry O.; Balibar, Carl J.; Xiao, Li; Galgoci, Andrew M.; Malinverni, Juliana C.; Mayhood, Todd; Villafania, Artjohn; Nahvi, Ali; Murgolo, Nicholas; Barbieri, Christopher M.; Mann, Paul A.; Carr, Donna; Xia, Ellen; Zuck, Paul; Riley, Dan; Painter, Ronald E.; Walker, Scott S.; Sherborne, Brad; de Jesus, Reynalda; Pan, Weidong; Plotkin, Michael A.; Wu, Jin; Rindgen, Diane; Cummings, John; Garlisi, Charles G.; Zhang, Rumin; Sheth, Payal R.; Gill, Charles J.; Tang, Haifeng; Roemer , Terry (Merck)
2015-09-30
Riboswitches are non-coding RNA structures located in messenger RNAs that bind endogenous ligands, such as a specific metabolite or ion, to regulate gene expression. As such, riboswitches serve as a novel, yet largely unexploited, class of emerging drug targets. Demonstrating this potential, however, has proven difficult and is restricted to structurally similar antimetabolites and semi-synthetic analogues of their cognate ligand, thus greatly restricting the chemical space and selectivity sought for such inhibitors. Here we report the discovery and characterization of ribocil, a highly selective chemical modulator of bacterial riboflavin riboswitches, which was identified in a phenotypic screen and acts as a structurally distinct synthetic mimic of the natural ligand, flavin mononucleotide, to repress riboswitch-mediated ribB gene expression and inhibit bacterial cell growth. Our findings indicate that non-coding RNA structural elements may be more broadly targeted by synthetic small molecules than previously expected.
Structures and potential energy functions of Pu3 molecule
International Nuclear Information System (INIS)
Meng Daqiao; Jiang Gang; Liu Xiaoya; Luo Deli; Zhu Zhenghe
2001-01-01
Density functional (B3LYP) method with relativistic effective core potential (RECP) has been used to optimize the structures of Pu 2 and Pu 3 molecules. The results show that the ground states of Pu 2 and Pu 3 molecules are of D ∞h and D 3h symmetry, and of 13 and 19 fold, respectively. The spectral constants of Pu 2 , ω e = 52.3845 cm -1 and ω e x e = 0.0201 cm -1 , and the harmonic frequencies of Pu 3 , ν 1 = 56.9007 cm -1 , ν 2 = 57.1816 cm - '1 and ν 3 = 64.0785 cm -1 , have also been obtained on the B3LYP/RECP level. The potential energy functions of Pu 2 and Pu 3 have been derived, for the first time so far as known, from normal equation fitting and the many-body expansion theory
International Nuclear Information System (INIS)
Oliveira, I. S. S. de; Miwa, R. H.
2015-01-01
We use ab initio simulations to investigate the adsorption and the self-assembly processes of tetracyanoquinodimethane (TCNQ), tetrafluoro-tetracyanoquinodimethane (F4-TCNQ), and tetrasodium 1,3,6,8-pyrenetetrasulfonic acid (TPA) on the graphene surface. We find that there are no chemical bonds at the molecule–graphene interface, even at the presence of grain boundaries on the graphene surface. The molecules bond to graphene through van der Waals interactions. In addition to the molecule–graphene interaction, we performed a detailed study of the role played by the (lateral) molecule–molecule interaction in the formation of the, experimentally verified, self-assembled layers of TCNQ and TPA on graphene. Regarding the electronic properties, we calculate the electronic charge transfer from the graphene sheet to the TCNQ and F4-TCNQ molecules, leading to a p-doping of graphene. Meanwhile, such charge transfer is reduced by an order of magnitude for TPA molecules on graphene. In this case, it is not expected a significant doping process upon the formation of self-assembled layer of TPA molecules on the graphene sheet
Raithel, Georg; Zhao, Jianming
2017-04-01
Cold atomic systems have opened new frontiers at the interface of atomic and molecular physics. These include research on novel types of Rydberg molecules. Three types of molecules will be reviewed. Long-range, homonuclear Rydberg molecules, first predicted in [1] and observed in [2], are formed via low-energy electron scattering of the Rydberg electron from a ground-state atom within the Rydberg atom's volume. The binding mostly arises from S- and P-wave triplet scattering. We use a Fermi model that includes S-wave and P-wave singlet and triplet scattering, the fine structure coupling of the Rydberg atom and the hyperfine structure coupling of the 5S1/2 atom (in rubidium [3]). The hyperfine structure gives rise to mixed singlet-triplet potentials for both low-L and high-L Rydberg molecules [3]. A classification into Hund's cases [3, 4, 5] will be discussed. The talk further includes results on adiabatic potentials and adiabatic states of Rydberg-Rydberg molecules in Rb and Cs. These molecules, which have even larger bonding length than Rydberg-ground molecules, are formed via electrostatic multipole interactions. The leading interaction term of neutral Rydberg-Rydberg molecules is between two dipoles, while for ionic Rydberg molecules it is between a dipole and a monopole. NSF (PHY-1506093), NNSF of China (61475123).
SerpentinaDB: a database of plant-derived molecules of Rauvolfia serpentina.
Pathania, Shivalika; Ramakrishnan, Sai Mukund; Randhawa, Vinay; Bagler, Ganesh
2015-08-04
Plant-derived molecules (PDMs) are known to be a rich source of diverse scaffolds that could serve as a basis for rational drug design. Structured compilation of phytochemicals from traditional medicinal plants can facilitate prospection for novel PDMs and their analogs as therapeutic agents. Rauvolfia serpentina is an important medicinal plant, endemic to Himalayan mountain ranges of Indian subcontinent, reported to be of immense therapeutic value against various diseases. We present SerpentinaDB, a structured compilation of 147 R. serpentina PDMs, inclusive of their plant part source, chemical classification, IUPAC, SMILES, physicochemical properties, and 3D chemical structures with associated references. It also provides refined search option for identification of analogs of natural molecules against ZINC database at user-defined cut-off. SerpentinaDB is an exhaustive resource of R. serpentina molecules facilitating prospection for therapeutic molecules from a medicinally important source of natural products. It also provides refined search option to explore the neighborhood of chemical space against ZINC database to identify analogs of natural molecules obtained as leads. In a previous study, we have demonstrated the utility of this resource by identifying novel aldose reductase inhibitors towards intervention of complications of diabetes.
Luminescence of Rubrene and DCJTB molecules in organic light-emitting devices
Energy Technology Data Exchange (ETDEWEB)
Moon, Chang-Bum, E-mail: cbmoon@hoseo.edu [Department of Display Engineering, Hoseo University, Sechul-Ri 160, Baebang, Asan, Chung-Nam 336-795 (Korea, Republic of); Department of Engineering Physics, McMaster University, Hamilton, Ontario, Canada L8S4L7 (Canada); Song, Wook; Meng, Mei; Kim, Nam Ho; Yoon, Ju-An [Department of Display Engineering, Hoseo University, Sechul-Ri 160, Baebang, Asan, Chung-Nam 336-795 (Korea, Republic of); Kim, Woo Young, E-mail: wykim@hoseo.edu [Department of Display Engineering, Hoseo University, Sechul-Ri 160, Baebang, Asan, Chung-Nam 336-795 (Korea, Republic of); Wood, Richard; Mascher, Peter [Department of Engineering Physics, McMaster University, Hamilton, Ontario, Canada L8S4L7 (Canada)
2014-02-15
We investigated the optical properties of light emission based on the resonance energy transfer mechanism between two molecules in the host–dopant systems. For this purpose, we fabricated the organic light-emitting devices with the different doped emissive layers. The host matrices were made of 4,4′,4″-tris(carbasol-l-nyl)triphenylamine (TCTA) and 2-methyl-9,10-di(2-naphthyl)anthracene (MADN) molecules and the doped molecules were 5,6,11,12-tetraphenylnaphtacene (Rubrene) and 4-(Dicyanomethylene)-2-tert-butyl-6- (1,1,7,7-tetramethyljulolidin-4-yl-vinyl)-4H-pyran (DCJTB). The concentrations of the doped molecules were 0.1%, 0.3%, 0.5%, and 0.8%. Through spectroscopic analysis using multi-peak fits with a Gaussian function to the emission spectra, we obtained the relative light intensity of the two dopants according to the doping concentrations and examined the relations between the molecular excited energy states and the nature of energy transfer in the host and dopant systems. We show that the luminous efficiency of the devices has a strong correlation between the energy transfer owing to the individual molecular intrinsic properties and the electrical characteristics associated with the bulky properties in the devices. -- Highlights: • Fabrication and characterization of the OLEDs with a host–dopant system in the emissive layer. • Investigation of the optical properties of light emission based on the resonance energy transfer mechanism between the dopant molecules. • EL and PL spectroscopic study for the structure of the molecular energy levels in the dopant molecules.
ChemNet: A Transferable and Generalizable Deep Neural Network for Small-Molecule Property Prediction
Energy Technology Data Exchange (ETDEWEB)
Goh, Garrett B.; Siegel, Charles M.; Vishnu, Abhinav; Hodas, Nathan O.
2017-12-08
With access to large datasets, deep neural networks through representation learning have been able to identify patterns from raw data, achieving human-level accuracy in image and speech recognition tasks. However, in chemistry, availability of large standardized and labelled datasets is scarce, and with a multitude of chemical properties of interest, chemical data is inherently small and fragmented. In this work, we explore transfer learning techniques in conjunction with the existing Chemception CNN model, to create a transferable and generalizable deep neural network for small-molecule property prediction. Our latest model, ChemNet learns in a semi-supervised manner from inexpensive labels computed from the ChEMBL database. When fine-tuned to the Tox21, HIV and FreeSolv dataset, which are 3 separate chemical tasks that ChemNet was not originally trained on, we demonstrate that ChemNet exceeds the performance of existing Chemception models, contemporary MLP models that trains on molecular fingerprints, and it matches the performance of the ConvGraph algorithm, the current state-of-the-art. Furthermore, as ChemNet has been pre-trained on a large diverse chemical database, it can be used as a universal “plug-and-play” deep neural network, which accelerates the deployment of deep neural networks for the prediction of novel small-molecule chemical properties.
Shi, Xueliang
2014-01-01
Recent studies demonstrated that aromaticity and biradical character play important roles in determining the ground-state structures and physical properties of quinoidal polycyclic hydrocarbons and oligothiophenes, a kind of molecular materials showing promising applications for organic electronics, photonics and spintronics. In this work, we designed and synthesized a new type of hybrid system, the so-called bisindeno-[n]thienoacenes (n = 1-4), by annulation of quinoidal fused α-oligothiophenes with two indene units. The obtained molecules can be regarded as antiaromatic systems containing 4n π electrons with small singlet biradical character (y0). Their ground-state geometry and electronic structures were studied by X-ray crystallographic analysis, NMR, ESR and Raman spectroscopy, assisted by density functional theory calculations. With extension of the chain length, the molecules showed a gradual increase of the singlet biradical character accompanied by decreased antiaromaticity, finally leading to a highly reactive bisindeno[4]thienoacene (S4-TIPS) which has a singlet biradical ground state (y0= 0.202). Their optical and electronic properties in the neutral and charged states were systematically investigated by one-photon absorption, two-photon absorption, transient absorption spectroscopy, cyclic voltammetry and spectroelectrochemistry, which could be correlated to the chain length dependent antiaromaticity and biradical character. Our detailed studies revealed a clear structure-aromaticity-biradical character-physical properties-reactivity relationship, which is of importance for tailored material design in the future. This journal is
Sinurat, E. N.; Yudiarsah, E.
2017-07-01
The charge transport properties of DNA aperiodic molecule has been studied by considering various interbase hopping parameter on Watson-Crick base pair. 32 base pairs long double-stranded DNA aperiodic model with sequence GCTAGTACGTGACGTAGCTAGGATATGCCTGA on one chain and its complement on the other chain is used. Transfer matrix method has been used to calculate transmission probabilities, for determining I-V characteristic using Landauer Büttiker formula. DNA molecule is modeled using tight binding hamiltonian combined with the theory of Slater-Koster. The result show, the increment of Watson-Crick hopping value leads to the transmission probabilities and current of DNA aperiodic molecule increases.
Pang, Xiao-feng
2012-05-01
The mechanism and properties of bio-photon emission and absorption in bio-tissues were studied using Pang's theory of bio-energy transport, in which the energy spectra of protein molecules are obtained from the discrete dynamic equation. From the energy spectra, it was determined that the protein molecules could both radiate and absorb bio-photons with wavelengths of energy level transitions of the excitons. These results were consistent with the experimental data; this consisted of infrared absorption data from collagen, bovine serum albumin, the protein-like molecule acetanilide, plasma, and a person's finger, and the laser-Raman spectra of acidity I-type collagen in the lungs of a mouse, and metabolically active Escherichia coli. We further elucidated the mechanism responsible for the non-thermal biological effects produced by the infrared light absorbed by the bio-tissues, using the above results. No temperature rise was observed; instead, the absorbed infrared light promoted the vibrations of amides as well the transport of the bio-energy from one place to other in the protein molecules, which changed their conformations. These experimental results, therefore, not only confirmed the validity of the mechanism of bio-photon emission, and the newly developed theory of bio-energy transport mentioned above, but also explained the mechanism and properties of the non-thermal biological effects produced by the absorption of infrared light by the living systems.
Charge transport properties of a twisted DNA molecule: A renormalization approach
Energy Technology Data Exchange (ETDEWEB)
Almeida, M.L. de; Ourique, G.S.; Fulco, U.L. [Departamento de Biofísica e Farmacologia, Universidade Federal do Rio Grande do Norte, 59072-970 Natal-RN (Brazil); Albuquerque, E.L., E-mail: eudenilson@gmail.com [Departamento de Biofísica e Farmacologia, Universidade Federal do Rio Grande do Norte, 59072-970 Natal-RN (Brazil); Moura, F.A.B.F. de; Lyra, M.L. [Instituto de Física, Universidade Federal de Alagoas, 57072-900 Maceió-AL (Brazil)
2016-10-20
In this work we study the charge transport properties of a nanodevice consisting of a finite segment of the DNA molecule sandwiched between two metallic electrodes. Our model takes into account a nearest-neighbor tight-binding Hamiltonian considering the nucleobases twist motion, whose solutions make use of a two-steps renormalization process to simplify the algebra, which can be otherwise quite involved. The resulting variations of the charge transport efficiency are analyzed by numerically computing the main features of the electron transmittance spectra as well as their I × V characteristic curves.
NMR-study of dynamic structural transtions in RNA-molecules
Fürtig, Boris
2007-01-01
The following thesis is concerned with the elucidation of structural changes of RNA molecules during the time course of dynamic processes that are commonly denoted as folding reactions. In contrast to the field of protein folding, the concept of RNA folding comprises not only folding reactions itself but also refolding- or conformational switching- and assembly processes (see chapter III). The method in this thesis to monitor these diverse processes is high resolution liquid-state NMR spectro...
Energy Technology Data Exchange (ETDEWEB)
Nagarajan, V.; Chandiramouli, R., E-mail: rcmoulii@gmail.com
2017-08-15
Highlights: • The adsorption of methanol, ethanol & 1-propanol on MoS{sub 2} nanosheet are studied. • The PDOS & band structure confirms adsorption of alcohol vapors on MoS{sub 2} nanosheet. • The adsorption of 1-propanol vapor on MoS{sub 2} nanosheet is more favorable. • The alcohol molecules adsorption on MoS{sub 2} nanosheet is explored in atomistic level. - Abstract: The electronic and adsorption properties of three different alcohol molecules namely methanol, ethanol and 1-propanol vapors on MoS{sub 2} nanosheet is investigated using DFT method. The structural stability of MoS{sub 2} nanosheet is ascertained with formation energy. The adsorption properties of alcohol molecules on MoS{sub 2} base material is discussed in terms of average energy gap variation, Mulliken charge transfer, energy band gap and adsorption energy. The prominent adsorption sites of methanol, ethanol and 1-propanol vapors on MoS{sub 2} nanosheet are studied in atomistic level. The projected density of states (PDOS) spectrum gives the clear insights on the electronic properties of MoS{sub 2} nanosheet. The PDOS and energy band structure confirmed the adsorption of alcohol vapors on MoS{sub 2} nanosheet. The variation in the band structure and PDOS is noticed upon adsorption of methanol, ethanol and 1-propanol molecules on MoS{sub 2} nanosheet. The PDOS spectrum also reveals the variation in peak maxima owing to transfer of electron between alcohol molecules and MoS{sub 2} base material. The adsorption of 1-propanol vapor on MoS{sub 2} nanosheet is observed to be more favorable than other alcohol molecules. The findings confirm that monolayer MoS{sub 2} nanosheet can be used to detect the presence of alcohol vapors in the environment.
Dielectric relaxation of guest molecules in a clathrate structure of syndiotactic polystyrene.
Urakawa, Osamu; Kaneko, Fumitoshi; Kobayashi, Hideo
2012-12-13
Structure and dynamics of semicrystalline polymer films composed of syndiotactic polystyrene (sPS) and 2-butanone were examined through X-ray diffraction, polarized FTIR, and dielectric relaxation measurements. The X-ray and FTIR measurements revealed its crystal structure to be δ-clathrate containing 2-butanone molecules inside. The carbonyl group of 2-butanone in the crystal was found to orient preferentially parallel to the ac plane of the crystal through the polarized ATR FTIR measurements. Dielectric measurements were also conducted on these film samples to see only the relaxation dynamics of 2-butanone thanks to the high dielectric intensity of 2-butanone compared to sPS. Two relaxation modes denoted by slow and fast modes appeared. The former was assigned to the motion of 2-butanone molecules entrapped in the cavities of the crystalline (δ-form) and the latter to those in the amorphous region. We focused on the slow mode in order to elucidate the specific dynamics of the guest molecule confined in the crystalline region. The relaxation time of the slow mode was about 4 orders of magnitude longer than that of liquid 2-butanone. This suggests that the dynamics of guest molecules is highly restricted due to the high barrier to conformational and/or orientational change of the guest molecule in the cavity of δ-crystal. Furthermore, the dielectric intensity Δε of the slow mode was much smaller than the one calculated from that of bulk liquid 2-butanone and the guest concentration in the crystalline region (the intensity was only 10% of the estimated value from the bulk liquid data). This result also indicates that the free rotational motion of 2-butanone molecules is restricted inside the crystal. This will be consistently related to the weak uniplanar orientation of the carbonyl group of 2-butanone parallel to the ac plane revealed by the X-ray and polarized ATR FTIR measurements.
Molecular electronics: the single molecule switch and transistor
Sotthewes, Kai; Geskin, Victor; Heimbuch, Rene; Kumar, Avijit; Zandvliet, Henricus J.W.
2014-01-01
In order to design and realize single-molecule devices it is essential to have a good understanding of the properties of an individual molecule. For electronic applications, the most important property of a molecule is its conductance. Here we show how a single octanethiol molecule can be connected
Coban, Mustafa Burak
2018-06-01
A new GdIII coordination complex, {[Gd(2-stp)2(H2O)6].2(4,4'-bipy).4(H2O)}, complex 1, (2-stp = 2-sulfoterephthalate anion and 4,4'-bipy = 4,4'-bipyridine), has been synthesized by hydrothermal method and characterized by elemental analysis, solid state UV-Vis and FT-IR spectroscopy, single-crystal X-ray diffraction, solid state photoluminescence and variable-temperature magnetic measurements. The crystal structure determination shows that GdIII ions are eight coordinated and adopt a distorted square-antiprismatic geometry. Molecules interacting through intra- and intermolecular (O-H⋯O, O-H⋯N) hydrogen bonds in complex 1, give rise to 3D hydrogen bonded structure and the discrete lattice 4,4'-bipy molecules occupy the channel of the 3D structure. π-π stacking interactions also exist 4,4'-bipy-4,4'-bipy and 4,4'-bipy-2-stp molecule rings in 3D structures. Additionally, solid state photoluminescence properties of complex 1 at room temperature have been investigated. Under the excitation of UV light (at 349 nm), the complex 1 exhibited green emissions (at 505 nm) of GdIII ion in the visible region. Furthermore, Variable-temperature magnetic susceptibility and isothermal magnetization as function of external magnetic field studies reveal that complex 1 displays possible antiferromagnetic interaction.
Energy Technology Data Exchange (ETDEWEB)
Tang, Yanan, E-mail: yntang2010@hotmail.com [College of Physics and Electronic Engineering, Zhengzhou Normal University, Zhengzhou, Henan 450044 (China); Quantum Materials Research Center, Zhengzhou Normal University, Henan 450044 (China); Chen, Weiguang; Li, Chenggang; Pan, Lijun [College of Physics and Electronic Engineering, Zhengzhou Normal University, Zhengzhou, Henan 450044 (China); Quantum Materials Research Center, Zhengzhou Normal University, Henan 450044 (China); Dai, Xianqi, E-mail: xqdai@henannu.edu.cn [College of Physics and Electronic Engineering, Zhengzhou Normal University, Zhengzhou, Henan 450044 (China); Quantum Materials Research Center, Zhengzhou Normal University, Henan 450044 (China); Ma, Dongwei [College of Physics and Electrical Engineering, Anyang Normal University, Anyang, Henan 455000 (China)
2015-07-01
Graphical abstract: - Highlights: • In contrast to the pristine graphene, a vacancy defect in graphene strongly stabilizes the Co atom. • The positively charged of Co atom on graphene can regulate the stability of gas molecules. • Different gas molecules can modulate the electronic structure of Co–graphene systems. • The adsorbed NO on Co–graphene can effectively regulate the magnetic properties of systems. - Abstract: Based on the first-principles of density-functional theory (DFT), the effects of gas adsorption on the change in geometric stability, electronic structure and magnetic properties of graphene with anchored Co (Co–graphene) systems were investigated. A single Co adatom interacts much weaker with pristine graphene (Co/pri–graphene) than with the graphene containing a single vacancy (Co/SV–graphene). The Co dopant provides more electrons to the dangling bonds of carbon atom at defective site and exhibits more positive charges, which makes Co/SV–graphene less prone to be adsorbed by gas molecules in comparison to Co/pri–graphene. It is found that the electronic structure and magnetic properties of Co–graphene systems can be modulated by adsorbing gas molecules. Except the NH{sub 3} molecule, the adsorbed NO, SO{sub 2}, CO or HCN as electron acceptors on the Co/pri–graphene can exhibit semiconducting properties. Among the gas molecules, the strong adsorption of NO molecule can effectively regulate the magnetic properties of Co–graphene systems. Moreover, the stable configuration of Co/SV–graphene is more likely to be the gas sensor for detecting NO and SO{sub 2}. The results validate that the reactivity of atomic-scale catalyst is supported on graphene sheets, which is expected to be potentially efficient in the gas sensors and electronic device.
Solid state proton spin-lattice relaxation in four structurally related organic molecules
International Nuclear Information System (INIS)
Beckmann, Peter A.; Burbank, Kendra S.; Lau, Matty M.W.; Ree, Jessica N.; Weber, Tracy L.
2003-01-01
We report and interpret the temperature dependence of the proton spin-lattice relaxation rate at 8.50 and 22.5 MHz in four polycrystalline solids composed of structurally related molecules: 2-ethylanthracene, 2-t-butylanthracene, 2-ethylanthraquinone, and 2-t-butylanthraquinone. We have been unable to grow single crystals and therefore do not know the crystal structures. Hence, we use the NMR relaxometry data to make predictions about the solid state structures. As expected, we are able to conclude that the ethyl groups do not reorient in the solid state but that the t-butyl groups do. The anthraquinones have a ''simpler'' structure than the anthracenes. The best dynamical models suggest that there is a unique crystallographic site for the t-butyl groups in 2-t-butylanthraquinone and two sites, each with half the molecules, for the ethyl groups in 2-ethylanthraquinone. There are also two sites in 2-ethylanthracene, but with unequal weights, suggesting four sites in the unit cell with lower symmetry than the two anthraquinones. Finally, the observed relaxation rate data in 2-t-butylanthracene is very complex and its interpretation demonstrates the uniqueness problem that arises in interpreting relaxometry data without the knowledge of the crystal structure
Possible B{sup (*)} anti K hadronic molecule state
Energy Technology Data Exchange (ETDEWEB)
Xiao, Cheng-Jian [Chinese Academy of Sciences, Institute of Modern Physics, Lanzhou (China); University of Chinese Academy of Sciences, Beijing (China); Chen, Dian-Yong [Southeast University, School of Physics, Nanjing (China)
2017-06-15
In the present work, the possibility of the observed structure X(5568) or X(5616) as a hadronic molecule is investigated via its decay properties. Our estimations of the strong decay mode indicate that the hadronic molecule interpretation cannot be excluded since the determined parameter value is located in the empirical region. However, the unnatural large coupling constants indicate the molecular interpretation may be questionable. In addition, the radiative decays of the neutral partners of the X(5568) and X(5616) are estimated, which can be a test of the molecular interpretation in the future experiments. (orig.)
The mechanism of 2-dimensional manipulation of DNA molecules by water and ethanol flows
International Nuclear Information System (INIS)
Shen Zigang; Huang Yibo; Li Bin; Zhang Yi
2007-01-01
Due to its unique physical and chemical properties, DNA has recently become a promising material for building blocks in nanofabrication. Many researches focus on how to use DNA molecules as a template for nanowires. Molecular Combing technique is one of important methods to manipulate DNA molecules by using a water meniscus and form specific DNA nano-structures on surfaces. In this paper, by employing a modified molecular combing technique, special patterns of DNA molecules was formed, and the interaction between liquid flows or meniscus and DNA molecules was analyzed, and the mechanism of manipulating DNA molecules by liquid was studied. (authors)
Jha, Omkant; Yadav, T K; Yadav, R A
2018-01-15
Structural and vibrational studies for the most stable conformer of dopamine {4-(2-Aminoethyl) benzene-1, 2-diol} have been carried out at the DFT/B3LYP/6-311++G** level using the Gaussian 09 software. The IR and Raman spectra have been recorded and analyzed in light of the computed vibrational parameters using the DFT and the PEDs computed with the help of the GAR2PED software. Some of the fundamentals have considerably changed frequencies in going from benzene to dopamine. Except the rocking and wagging modes of the NH 2 group the other four modes are pure group modes. The rocking and wagging modes of the NH 2 group show mixing with the other modes. The two OH stretching vibrations are highly localized modes. The Kekule phenyl ring stretching mode is found to remain almost unchanged. The HOMO-LUMO study suggests the existence of charge transfer within the molecule and the energy gap supports the pharmacological active property of the dopamine molecule. The NBO analysis has been carried out to understand the proper and improper hydrogen bonding. Copyright © 2017. Published by Elsevier B.V.
Computational design of molecules for an all-quinone redox flow battery.
Er, Süleyman; Suh, Changwon; Marshak, Michael P; Aspuru-Guzik, Alán
2015-02-01
Inspired by the electron transfer properties of quinones in biological systems, we recently showed that quinones are also very promising electroactive materials for stationary energy storage applications. Due to the practically infinite chemical space of organic molecules, the discovery of additional quinones or other redox-active organic molecules for energy storage applications is an open field of inquiry. Here, we introduce a high-throughput computational screening approach that we applied to an accelerated study of a total of 1710 quinone (Q) and hydroquinone (QH 2 ) ( i.e. , two-electron two-proton) redox couples. We identified the promising candidates for both the negative and positive sides of organic-based aqueous flow batteries, thus enabling an all-quinone battery. To further aid the development of additional interesting electroactive small molecules we also provide emerging quantitative structure-property relationships.
Single molecule DNA detection with an atomic vapor notch filter
Energy Technology Data Exchange (ETDEWEB)
Uhland, Denis; Rendler, Torsten; Widmann, Matthias; Lee, Sang-Yun [University of Stuttgart and Stuttgart Research Center of Photonic Engineering (SCoPE) and IQST, 3rd Physics Institute, Stuttgart (Germany); Wrachtrup, Joerg; Gerhardt, Ilja [University of Stuttgart and Stuttgart Research Center of Photonic Engineering (SCoPE) and IQST, 3rd Physics Institute, Stuttgart (Germany); Max Planck Institute for Solid State Research, Stuttgart (Germany)
2015-12-01
The detection of single molecules has facilitated many advances in life- and material-science. Commonly the fluorescence of dye molecules is detected, which are attached to a non-fluorescent structure under study. For fluorescence microscopy one desires to maximize the detection efficiency together with an efficient suppression of undesired laser leakage. Here we present the use of the narrow-band filtering properties of hot atomic sodium vapor to selectively filter the excitation light from the red-shifted fluorescence of dye labeled single-stranded DNA molecules. A statistical analysis proves an enhancement in detection efficiency of more than 15% in a confocal and in a wide-field configuration. (orig.)
International Nuclear Information System (INIS)
Moradian, R.; Mohammadi, Y.
2007-01-01
Based on tight binding model we investigated effects of bi-atomic molecules gas(in the general form denoted by X 2 )on single-walled carbon nano tubes electronic properties. We found for some specified values of hopping integrals and random on-site energies, adsorbed molecules bound states located inside of the (10,0) single-walled carbon nano tubes energy gap, where it is similar to the reported experimental results for O 2 adsorption while for other values there is no bound states inside of energy gap. This is similar to the N 2 adsorption on semiconductor single-walled carbon nano tubes.
Structure and properties of molecular and ionic clusters in vapour over caesium fluoride
Mwanga, Stanley F.; Pogrebnaya, Tatiana P.; Pogrebnoi, Alexander M.
2015-06-01
The properties of neutral molecules Cs2F2, Cs3F3, and Cs4F4, and positive and negative cluster ions Cs2F+, CsF2-, Cs3F2+, Cs2F3-, Cs4F3+, and Cs5F4+ were studied by several of quantum chemical methods implementing density function theory and Möller-Plesset perturbation theory of second and fourth orders. For all species, the equilibrium geometrical structure and vibrational spectra were determined. Different isomers have been revealed for the trimer neutral molecule Cs3F3; pentaatomic, both positive and negative, Cs3F2+, Cs2F3-; and heptaatomic Cs4F3+ ions. The most abundant isomers in the saturated vapour were determined. Enthalpies of dissociation reactions and enthalpies of formation of the species were obtained.
Tabanelli, Giulia; Vernocchi, Pamela; Patrignani, Francesca; Del Chierico, Federica; Putignani, Lorenza; Vinderola, Gabriel; Reinheimer, Jorge A; Gardini, Fausto; Lanciotti, Rosalba
2015-01-01
Applying sub-lethal levels of high-pressure homogenization (HPH) to lactic acid bacteria has been proposed as a method of enhancing some of their functional properties. Because the principal targets of HPH are the cell-surface structures, the aim of this study was to examine the effect of sub-lethal HPH treatment on the outermost cellular structures and the proteomic profiles of two known probiotic bacterial strains. Moreover, the effect of HPH treatment on the metabolism of probiotic cells within a dairy product during its refrigerated storage was investigated using SPME-GC-MS. Transmission electron microscopy was used to examine the microstructural changes in the outermost cellular structures due to HPH treatment. These alterations may be involved in the changes in some of the technological and functional properties of the strains that were observed after pressure treatment. Moreover, the proteomic profiles of the probiotic strains treated with HPH and incubated at 37°C for various periods showed different peptide patterns compared with those of the untreated cells. In addition, there were differences in the peaks that were observed in the low-mass spectral region (2000-3000 Da) of the spectral profiles of the control and treated samples. Due to pressure treatment, the volatile-molecule profiles of buttermilk inoculated with treated or control cells and stored at 4°C for 30 days exhibited overall changes in the aroma profile and in the production of molecules that improved its sensory profile, although the two different species imparted specific fingerprints to the product. The results of this study will contribute to understanding the changes that occur in the outermost cellular structures and the metabolism of LAB in response to HPH treatment. The findings of this investigation may contribute to elucidating the relationships between these changes and the alterations of the technological and functional properties of LAB induced by pressure treatment.
Magnetic field modification of ultracold molecule-molecule collisions
International Nuclear Information System (INIS)
Tscherbul, T V; Suleimanov, Yu V; Aquilanti, V; Krems, R V
2009-01-01
We present an accurate quantum mechanical study of molecule-molecule collisions in the presence of a magnetic field. The work focuses on the analysis of elastic scattering and spin relaxation in collisions of O 2 ( 3 Σ g - ) molecules at cold (∼0.1 K) and ultracold (∼10 -6 K) temperatures. Our calculations show that magnetic spin relaxation in molecule-molecule collisions is extremely efficient except at magnetic fields below 1 mT. The rate constant for spin relaxation at T=0.1 K and a magnetic field of 0.1 T is found to be as large as 6.1x10 -11 cm -3 s -1 . The magnetic field dependence of elastic and inelastic scattering cross sections at ultracold temperatures is dominated by a manifold of Feshbach resonances with the density of ∼100 resonances per Tesla for collisions of molecules in the absolute ground state. This suggests that the scattering length of ultracold molecules in the absolute ground state can be effectively tuned in a very wide range of magnetic fields. Our calculations demonstrate that the number and properties of the magnetic Feshbach resonances are dramatically different for molecules in the absolute ground and excited spin states. The density of Feshbach resonances for molecule-molecule scattering in the low-field-seeking Zeeman state is reduced by a factor of 10.
Measurement and control of detailed electronic properties in a single molecule break junction.
Wang, Kun; Hamill, Joseph; Zhou, Jianfeng; Guo, Cunlan; Xu, Bingqian
2014-01-01
The lack of detailed experimental controls has been one of the major obstacles hindering progress in molecular electronics. While large fluctuations have been occurring in the experimental data, specific details, related mechanisms, and data analysis techniques are in high demand to promote our physical understanding at the single-molecule level. A series of modulations we recently developed, based on traditional scanning probe microscopy break junctions (SPMBJs), have helped to discover significant properties in detail which are hidden in the contact interfaces of a single-molecule break junction (SMBJ). For example, in the past we have shown that the correlated force and conductance changes under the saw tooth modulation and stretch-hold mode of PZT movement revealed inherent differences in the contact geometries of a molecular junction. In this paper, using a bias-modulated SPMBJ and utilizing emerging data analysis techniques, we report on the measurement of the altered alignment of the HOMO of benzene molecules with changing the anchoring group which coupled the molecule to metal electrodes. Further calculations based on Landauer fitting and transition voltage spectroscopy (TVS) demonstrated the effects of modulated bias on the location of the frontier molecular orbitals. Understanding the alignment of the molecular orbitals with the Fermi level of the electrodes is essential for understanding the behaviour of SMBJs and for the future design of more complex devices. With these modulations and analysis techniques, fruitful information has been found about the nature of the metal-molecule junction, providing us insightful clues towards the next step for in-depth study.
Porous Materials - Structure and Properties
DEFF Research Database (Denmark)
Nielsen, Anders
1997-01-01
The paper presents some viewpoints on the description of the pore structure and the modelling of the properties of the porous building materials. Two examples are given , where it has been possible to connect the pore structure to the properties: Shrinkage of autoclaved aerated concrete...
Keshavarzi, Ezat; Kamalvand, Mohammad
2009-04-23
The structure and properties of fluids confined in nanopores may show a dramatic departure from macroscopic bulk fluids. The main reason for this difference lies in the influence of system walls. In addition to the entropic wall effect, system walls can significantly change the energy of the confined fluid compared to macroscopic bulk fluids. The energy effect of the walls on a nanoconfined fluid appears in two forms. The first effect is the cutting off of the intermolecular interactions by the walls, which appears for example in the integrals for calculation of the thermodynamic properties. The second wall effect involves the wall-molecule interactions. In such confined fluids, the introduction of wall forces and the competition between fluid-wall and fluid-fluid forces could lead to interesting thermodynamic properties, including new kinds of phase transitions not observed in the macroscopic fluid systems. In this article, we use the perturbative fundamental measure density functional theory to study energy effects on the structure and properties of a hard core two-Yukawa fluid confined in a nanoslit. Our results show the changes undergone by the structure and phase transition of the nanoconfined fluids as a result of energy effects.
Zhao, Hongxia; Yang, Yong; Shu, Xin; Wang, Yanwei; Ran, Qianping
2018-04-09
First-principle calculations, especially by the density functional theory (DFT) methods, are becoming a power technique to study molecular structure and properties of organic/inorganic interfaces. This review introduces some recent examples on the study of adsorption models of organic molecules or oligomers on mineral surfaces and interfacial properties obtained from first-principles calculations. The aim of this contribution is to inspire scientists to benefit from first-principle calculations and to apply the similar strategies when studying and tailoring interfacial properties at the atomistic scale, especially for those interested in the design and development of new molecules and new products. Copyright © 2017. Published by Elsevier B.V.
Impact of Dendrimers on Solubility of Hydrophobic Drug Molecules
Directory of Open Access Journals (Sweden)
Sonam Choudhary
2017-05-01
Full Text Available Adequate aqueous solubility has been one of the desired properties while selecting drug molecules and other bio-actives for product development. Often solubility of a drug determines its pharmaceutical and therapeutic performance. Majority of newly synthesized drug molecules fail or are rejected during the early phases of drug discovery and development due to their limited solubility. Sufficient permeability, aqueous solubility and physicochemical stability of the drug are important for achieving adequate bioavailability and therapeutic outcome. A number of different approaches including co-solvency, micellar solubilization, micronization, pH adjustment, chemical modification, and solid dispersion have been explored toward improving the solubility of various poorly aqueous-soluble drugs. Dendrimers, a new class of polymers, possess great potential for drug solubility improvement, by virtue of their unique properties. These hyper-branched, mono-dispersed molecules have the distinct ability to bind the drug molecules on periphery as well as to encapsulate these molecules within the dendritic structure. There are numerous reported studies which have successfully used dendrimers to enhance the solubilization of poorly soluble drugs. These promising outcomes have encouraged the researchers to design, synthesize, and evaluate various dendritic polymers for their use in drug delivery and product development. This review will discuss the aspects and role of dendrimers in the solubility enhancement of poorly soluble drugs. The review will also highlight the important and relevant properties of dendrimers which contribute toward drug solubilization. Finally, hydrophobic drugs which have been explored for dendrimer assisted solubilization, and the current marketing status of dendrimers will be discussed.
Individual Magnetic Molecules on Ultrathin Insulating Surfaces
El Hallak, Fadi; Warner, Ben; Hirjibehedin, Cyrus
2012-02-01
Single molecule magnets have attracted ample interest because of their exciting magnetic and quantum properties. Recent studies have demonstrated that some of these molecules can be evaporated on surfaces without losing their magnetic properties [M. Mannini et al., Nature 468, 417, (2010)]. This remarkable progress enhances the chances of real world applications for these molecules. We present STM imaging and spectroscopy data on iron phthalocyanine molecules deposited on Cu(100) and on a Cu2N ultrathin insulating surface. These molecules have been shown to display a large magnetic anisotropy on another thin insulating surface, oxidized Cu(110) [N. Tsukahara et al., Phys. Rev. Lett. 102, 167203 (2009)]. By using a combination of elastic and inelastic electron tunnelling spectroscopy, we investigate the binding of the molecules to the surface and the impact that the surface has on their electronic and magnetic properties.
Energy Technology Data Exchange (ETDEWEB)
Nascimento, Daniel R.; DePrince, A. Eugene, E-mail: deprince@chem.fsu.edu [Department of Chemistry and Biochemistry, Florida State University, Tallahassee, Florida 32306-4390 (United States)
2015-12-07
We present a combined cavity quantum electrodynamics/ab initio electronic structure approach for simulating plasmon-molecule interactions in the time domain. The simple Jaynes-Cummings-type model Hamiltonian typically utilized in such simulations is replaced with one in which the molecular component of the coupled system is treated in a fully ab initio way, resulting in a computationally efficient description of general plasmon-molecule interactions. Mutual polarization effects are easily incorporated within a standard ground-state Hartree-Fock computation, and time-dependent simulations carry the same formal computational scaling as real-time time-dependent Hartree-Fock theory. As a proof of principle, we apply this generalized method to the emergence of a Fano-like resonance in coupled molecule-plasmon systems; this feature is quite sensitive to the nanoparticle-molecule separation and the orientation of the molecule relative to the polarization of the external electric field.
International Nuclear Information System (INIS)
Belogorokhov, I. A.; Tikhonov, E. V.; Breusova, M. O.; Pushkarev, V. E.; Zoteev, A. V.; Tomilova, L. G.; Khokhlov, D. R.
2007-01-01
Semiconductor structures of the type of butyl-substituted erbium monophthalocyanine and triphthalocyanine are studied by Raman spectroscopy. It is shown that, when the sandwich-like structure of the molecule incorporating two complexing atoms between the ligands is considered instead of the planar molecular structure with one ligand and one metal atom, a series of lines appears in the Raman spectrum. In this series, the wave numbers of the lines represent an arithmetic progression with the arithmetical ratio ∼80 cm -1 . It is suggested that this feature is due to the larger number of organic molecules per metal atom in the triphthalocyanine complex, and the four Raman peaks at the frequencies 122, 208, 280, and 362 cm -1 are the manifestation of slight out-of-plane vibrations of the phthalocyanine ligands
Liu, Weiwen
The continual downsizing of the basic functional units used in the electronics industry has motivated the study of the quantum computation and related topics. To overcome the limitations of classical physics and engineering, some unique quantum mechanical features, especially entanglement and superpositions have begun to be considered as important properties for future bits. Including these quantum mechanical features is attractive because the ability to utilize quantum mechanics can dramatically enhance computational power. Among the various ways of constructing the basic building blocks for quantum computation, we are particularly interested in using spins inside epitaxially grown InAs/GaAs quantum dot molecules as quantum bits (qubits). The ability to design and engineer nanostructures with tailored quantum properties is critical to engineering quantum computers and other novel electro-optical devices and is one of the key challenges for scaling up new ideas for device application. In this thesis, we will focus on how the structure and composition of quantum dot molecules can be used to control spin properties and charge interactions. Tunable spin and charge properties can enable new, more scalable, methods of initializing and manipulating quantum information. In this thesis, we demonstrate one method to enable electric-field tunability of Zeeman splitting for a single electron spin inside a quantum dot molecules by using heterostructure engineering techniques to modify the barrier that separates quantum dots. We describe how these structural changes to the quantum dot molecules also change charge interactions and propose ways to use this effect to enable accurate measurement of coulomb interactions and possibly charge occupancy inside these complicated quantum dot molecules.
Structural characterization of chiral molecules using vibrational circular dichroism spectroscopy
DEFF Research Database (Denmark)
Lassen, Peter Rygaard
2006-01-01
comparison of experimental and calculated spectra. Theoretical structures of the sample molecules were constructed and optimized using molecular mechanical force fields followed by the quantum mechanical method density functional theory (DFT). Calculations of IR absorption and VCD spectra were then carried...... out using the same DFT methods. Here, VCD has the advantage over CD that time-independent DFT calculations are sufficient. During the course of this project, the above methodology has been applied to a range of molecules. Some of them (nyasol, curcuphenol dimers and ginkgolide) are purely organic...... or as flexible as the curcuphenol dimer with 11 variable dihedral angles. This illustrates the capabilities of the method, which are primarily limited by the duration of DFT calculations. In the case of metal complexes, they have only recently become within reach of DFT, which opens new possibilities...
Data mining for materials design: A computational study of single molecule magnet
Energy Technology Data Exchange (ETDEWEB)
Dam, Hieu Chi [Japan Advanced Institute of Science and Technology, 1-1 Asahidai, Nomi, Ishikawa 923-1292 (Japan); Faculty of Physics, Vietnam National University, 334 Nguyen Trai, Hanoi (Viet Nam); Pham, Tien Lam; Ho, Tu Bao [Japan Advanced Institute of Science and Technology, 1-1 Asahidai, Nomi, Ishikawa 923-1292 (Japan); Nguyen, Anh Tuan [Faculty of Physics, Vietnam National University, 334 Nguyen Trai, Hanoi (Viet Nam); Nguyen, Viet Cuong [HPC Systems, Inc., 3-9-15 Kaigan, Minato-ku, Tokyo 108-0022 (Japan)
2014-01-28
We develop a method that combines data mining and first principles calculation to guide the designing of distorted cubane Mn{sup 4+} Mn {sub 3}{sup 3+} single molecule magnets. The essential idea of the method is a process consisting of sparse regressions and cross-validation for analyzing calculated data of the materials. The method allows us to demonstrate that the exchange coupling between Mn{sup 4+} and Mn{sup 3+} ions can be predicted from the electronegativities of constituent ligands and the structural features of the molecule by a linear regression model with high accuracy. The relations between the structural features and magnetic properties of the materials are quantitatively and consistently evaluated and presented by a graph. We also discuss the properties of the materials and guide the material design basing on the obtained results.
Amino Acid-Assisted Incorporation of Dye Molecules within Calcite Crystals.
Marzec, Bartosz; Green, David C; Holden, Mark A; Coté, Alexander S; Ihli, Johannes; Khalid, Saba; Kulak, Alexander; Walker, Daniel; Tang, Chiu; Duffy, Dorothy M; Kim, Yi-Yeoun; Meldrum, Fiona C
2018-05-23
Biomineralisation processes invariably occur in the presence of multiple organic additives, which act in combination to give exceptional control over structures and properties. However, few synthetic studies have investigated the cooperative effects of soluble additives. This work addresses this challenge and focuses on the combined effects of amino acids and coloured dye molecules. The experiments demonstrate that strongly coloured calcite crystals only form in the presence of Brilliant Blue R (BBR) and four of the seventeen soluble amino acids, as compared with almost colourless crystals using the dye alone. The active amino acids are identified as those which themselves effectively occlude in calcite, suggesting a mechanism where they can act as chaperones for individual molecules or even aggregates of dyes molecules. These results provide new insight into crystal-additive interactions and suggest a novel strategy for generating materials with target properties. © 2018 Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim.
Curvature contributions to the static electrical properties of push-pull molecules
International Nuclear Information System (INIS)
Squitieri, Emilio
2005-01-01
Calculations of the curvature contribution to the diagonals components of the static dipole moment (μ), polarizability (α), first (β) and second (γ) hyperpolarizability of push-pull molecules are presented. This contribution was obtained from the analytical evaluation of electrical properties method using the harmonic zero-point energy. The valence-bond charge-transfer model was employed to obtain the field-dependent force constant and their derivates with respect to electric field. Our results show a relationship between the curvature and electronic contributions. We have also found that the curvature contribution is important in a numerical estimation of β and γ
Hydrogen-Bonded Polymer-Small Molecule Complexes with Tunable Mechanical Properties.
Liu, Tianqi; Peng, Xin; Chen, Ya-Nan; Bai, Qing-Wen; Shang, Cong; Zhang, Lin; Wang, Huiliang
2018-03-13
A novel type of polymeric material with tunable mechanical properties is fabricated from polymers and small molecules that can form hydrogen-bonded intermolecular complexes (IMCs). In this work, poly(vinyl alcohol) (PVA)-glycerol hydrogels are first prepared, and then they are dried to form IMCs. The tensile strengths and moduli of IMCs decrease dramatically with increasing glycerol content, while the elongations increase gradually. The mechanical properties are comparable with or even superior to those of common engineering plastics and rubbers. The IMCs with high glycerol content also show excellent flexibility and cold-resistance at subzero temperatures. Cyclic tensile and stress relaxation tests prove that there is an effective energy dissipation mechanism in IMCs and dynamic mechanical analysis confirms their physical crosslinking nature. FTIR and NMR characterizations prove the existence of hydrogen bonding between glycerol and PVA chains, which suppresses the crystallization of PVA from X-ray diffraction measurement. These PVA-glycerol IMCs may find potential applications in barrier films, biomedical packaging, etc., in the future. © 2018 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.
DEFF Research Database (Denmark)
Rasmussen, Kim Krighaar; Kulahin, Nikolaj; Kristensen, Ole
2008-01-01
The crystal structure of the first immunoglobulin (Ig1) domain of neural cell adhesion molecule 2 (NCAM2/OCAM/RNCAM) is presented at a resolution of 2.7 A. NCAM2 is a member of the immunoglobulin superfamily of cell adhesion molecules (IgCAMs). In the structure, two Ig domains interact by domain...
Valence electronic structure of the indene molecule: Experiment vs. GW calculations
Energy Technology Data Exchange (ETDEWEB)
Umari, P.; Stenuit, G. [CNR-IOM DEMOCRITOS Theory Elettra Group, Basovizza, Trieste (Italy); Castellarin-Cudia, C.; Feyer, V.; Di Santo, G.; Goldoni, A. [Sincrotrone Trieste S.C.p.A., Basovizza, Trieste (Italy); Borghetti, P.; Sangaletti, L. [Dipartimento di Matematica e Fisica, Universita Cattolica del Sacro Cuore, Brescia (Italy)
2011-04-15
We investigate the valence electronic properties in the gas phase of the indene molecule, which is one of the simplest polycyclic aromatic hydrocarbons, with photoemission spectroscopy using synchrotron light and through first-principles calculations using a many-body perturbation theory GW approach. We found an excellent agreement between theory and experiment. This allows us to assign to the peaks appearing in the photoemission spectrum the calculated molecular orbitals. (Copyright copyright 2011 WILEY-VCH Verlag GmbH and Co. KGaA, Weinheim)
Energy Technology Data Exchange (ETDEWEB)
Descours, A.
1997-02-14
The separation of para-xylene from C8 aromatics is performed industrially bu adsorption process on zeolitic molecular sieves. The sorption properties of these zeolites are strongly linked to their structure, and their comprehension require an accurate knowledge of the interactions between sorbate molecules and zeolitic structure. The aim of this work is to characterise from a structural point of view the adsorption of para- and meta-xylenes in BaX and NaX zeolites. The former is selective for para-xylene, and the latter has not selective properties for para- and meta-isomers of xylene. For each zeolite, the adsorption of pure para-xylene and meta-xylene or a mixture of the two isomers, is investigated as a function of coverage. Powder neutron diffraction is used to determine the crystalline structure of these zeolites and the different crystallographic adsorption sites of the molecules. The influence of coverage on sorbate-sorbent and sorbate-sorbate interactions is investigated. Infrared spectroscopy allows to determine the chemical environment of the sorbate molecules at low coverage or when the coverage increases, and is particularly effective for the study of the binary mixture of xylenes. This study is performed by sorbing a mixture of xylene isomers, or by sorbing these isomers successively. Infrared studies and crystallographic analysis are compared in order to get a consistent description of adsorption mechanism of xylene isomers for both zeolites as a function of coverage. The role of coverage, of cation type, an the presence of the two xylene isomers is the super-cages is essential. For both zeolites, the increase of coverage actually leads to steric hindrances between sorbed molecules and molecular rearrangements. These reorganizations are connected to the cationic distribution of NaX and BaX zeolites. The sorbed molecules are connected to the cationic distribution of NaX and BaX zeolites. The sorbed molecules are particularly confined in BaX zeolite
Handbook of Single-Molecule Biophysics
Hinterdorfer, Peter
2009-01-01
The last decade has seen the development of a number of novel biophysical methods that allow the manipulation and study of individual biomolecules. The ability to monitor biological processes at this fundamental level of sensitivity has given rise to an improved understanding of the underlying molecular mechanisms. Through the removal of ensemble averaging, distributions and fluctuations of molecular properties can be characterized, transient intermediates identified, and catalytic mechanisms elucidated. By applying forces on biomolecules while monitoring their activity, important information can be obtained on how proteins couple function to structure. The Handbook of Single-Molecule Biophysics provides an introduction to these techniques and presents an extensive discussion of the new biological insights obtained from them. Coverage includes: Experimental techniques to monitor and manipulate individual biomolecules The use of single-molecule techniques in super-resolution and functional imaging Single-molec...
Electronic structure of molecules of substituted benzenes by x-ray spectroscopy. I. Nitrobenzene
International Nuclear Information System (INIS)
Yumatov, V.D.; Murakhtanov, V.V.; Salakhutdinov, N.F.; Okotrub, A.V.; Mazalov, L.N.; Logunova, L.G.; Koptyug, V.A.; Furin, G.G.
1988-01-01
The electronic structure of the nitrobenzene molecule has been studied by x-ray spectroscopy with the aid of quantum-chemical calculations. The structure of the molecular orbitals of nitrobenzene has been compared with the structure of benzene and nitrogen dioxide. It has been shown in the framework of a fragment-by-fragment analysis that the interaction of the highest occupied π orbitals of the benzene ring and the nitro group is weak
Wang, Lei; Huang, Wei; Li, Run; Gehrig, Dominik; Blom, Paul W M; Landfester, Katharina; Zhang, Kai A I
2016-08-08
Herein, we report on the structural design principle of small-molecule organic semiconductors as metal-free, pure organic and visible light-active photocatalysts. Two series of electron-donor and acceptor-type organic semiconductor molecules were synthesized to meet crucial requirements, such as 1) absorption range in the visible region, 2) sufficient photoredox potential, and 3) long lifetime of photogenerated excitons. The photocatalytic activity was demonstrated in the intermolecular C-H functionalization of electron-rich heteroaromates with malonate derivatives. A mechanistic study of the light-induced electron transport between the organic photocatalyst, substrate, and the sacrificial agent are described. With their tunable absorption range and defined energy-band structure, the small-molecule organic semiconductors could offer a new class of metal-free and visible light-active photocatalysts for chemical reactions. © 2016 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.
Single Molecule Conductance of Oligothiophene Derivatives
Dell, Emma J.
This thesis studies the electronic properties of small organic molecules based on the thiophene motif. If we are to build next-generation devices, advanced materials must be designed which possess requisite electronic functionality. Molecules present attractive candidates for these ad- vanced materials since nanoscale devices are particularly sought after. However, selecting a molecule that is suited to a certain electronic function remains a challenge, and characterization of electronic behavior is therefore critical. Single molecule conductance measurements are a powerful tool to determine properties on the nanoscale and, as such, can be used to investigate novel building blocks that may fulfill the design requirements of next-generation devices. Combining these conductance results with strategic chemical synthesis allows for the development of new families of molecules that show attractive properties for future electronic devices. Since thiophene rings are the fruitflies of organic semiconductors on the bulk scale, they present an intriguing starting point for building functional materials on the nanoscale, and therefore form the structural basis of all molecules studied herein. First, the single-molecule conductance of a family of bithiophene derivatives was measured. A broad distribution in the single-molecule conductance of bithiophene was found compared with that of a biphenyl. This increased breadth in the conductance distribution was shown to be explained by the difference in 5-fold symmetry of thiophene rings as compared to the 6-fold symmetry of benzene rings. The reduced symmetry of thiophene rings results in a restriction on the torsion angle space available to these molecules when bound between two metal electrodes in a junction, causing each molecular junction to sample a different set of conformers in the conductance measurements. By contrast, the rotations of biphenyl are essentially unimpeded by junction binding, allowing each molecular junction
Energy Technology Data Exchange (ETDEWEB)
Yilmaz, Emel Maden; Güntert, Peter, E-mail: guentert@em.uni-frankfurt.de [Goethe University Frankfurt am Main, Center for Biomolecular Magnetic Resonance, Institute of Biophysical Chemistry (Germany)
2015-09-15
An algorithm, CYLIB, is presented for converting molecular topology descriptions from the PDB Chemical Component Dictionary into CYANA residue library entries. The CYANA structure calculation algorithm uses torsion angle molecular dynamics for the efficient computation of three-dimensional structures from NMR-derived restraints. For this, the molecules have to be represented in torsion angle space with rotations around covalent single bonds as the only degrees of freedom. The molecule must be given a tree structure of torsion angles connecting rigid units composed of one or several atoms with fixed relative positions. Setting up CYANA residue library entries therefore involves, besides straightforward format conversion, the non-trivial step of defining a suitable tree structure of torsion angles, and to re-order the atoms in a way that is compatible with this tree structure. This can be done manually for small numbers of ligands but the process is time-consuming and error-prone. An automated method is necessary in order to handle the large number of different potential ligand molecules to be studied in drug design projects. Here, we present an algorithm for this purpose, and show that CYANA structure calculations can be performed with almost all small molecule ligands and non-standard amino acid residues in the PDB Chemical Component Dictionary.
Widom, Julia R.; Dhakal, Soma; Heinicke, Laurie A.; Walter, Nils G.
2015-01-01
Toxicology is the highly interdisciplinary field studying the adverse effects of chemicals on living organisms. It requires sensitive tools to detect such effects. After their initial implementation during the 1990s, single-molecule fluorescence detection tools were quickly recognized for their potential to contribute greatly to many different areas of scientific inquiry. In the intervening time, technical advances in the field have generated ever-improving spatial and temporal resolution, and have enabled the application of single-molecule fluorescence to increasingly complex systems, such as live cells. In this review, we give an overview of the optical components necessary to implement the most common versions of single-molecule fluorescence detection. We then discuss current applications to enzymology and structural studies, systems biology, and nanotechnology, presenting the technical considerations that are unique to each area of study, along with noteworthy recent results. We also highlight future directions that have the potential to revolutionize these areas of study by further exploiting the capabilities of single-molecule fluorescence microscopy. PMID:25212907
The Molecule Cloud - compact visualization of large collections of molecules
Directory of Open Access Journals (Sweden)
Ertl Peter
2012-07-01
Full Text Available Abstract Background Analysis and visualization of large collections of molecules is one of the most frequent challenges cheminformatics experts in pharmaceutical industry are facing. Various sophisticated methods are available to perform this task, including clustering, dimensionality reduction or scaffold frequency analysis. In any case, however, viewing and analyzing large tables with molecular structures is necessary. We present a new visualization technique, providing basic information about the composition of molecular data sets at a single glance. Summary A method is presented here allowing visual representation of the most common structural features of chemical databases in a form of a cloud diagram. The frequency of molecules containing particular substructure is indicated by the size of respective structural image. The method is useful to quickly perceive the most prominent structural features present in the data set. This approach was inspired by popular word cloud diagrams that are used to visualize textual information in a compact form. Therefore we call this approach “Molecule Cloud”. The method also supports visualization of additional information, for example biological activity of molecules containing this scaffold or the protein target class typical for particular scaffolds, by color coding. Detailed description of the algorithm is provided, allowing easy implementation of the method by any cheminformatics toolkit. The layout algorithm is available as open source Java code. Conclusions Visualization of large molecular data sets using the Molecule Cloud approach allows scientists to get information about the composition of molecular databases and their most frequent structural features easily. The method may be used in the areas where analysis of large molecular collections is needed, for example processing of high throughput screening results, virtual screening or compound purchasing. Several example visualizations of large
Rudberg, Elias
2012-02-01
Self-consistency-based Kohn-Sham density functional theory (KS-DFT) electronic structure calculations with Gaussian basis sets are reported for a set of 17 protein-like molecules with geometries obtained from the Protein Data Bank. It is found that in many cases such calculations do not converge due to vanishing HOMO-LUMO gaps. A sequence of polyproline I helix molecules is also studied and it is found that self-consistency calculations using pure functionals fail to converge for helices longer than six proline units. Since the computed gap is strongly correlated to the fraction of Hartree-Fock exchange, test calculations using both pure and hybrid density functionals are reported. The tested methods include the pure functionals BLYP, PBE and LDA, as well as Hartree-Fock and the hybrid functionals BHandHLYP, B3LYP and PBE0. The effect of including solvent molecules in the calculations is studied, and it is found that the inclusion of explicit solvent molecules around the protein fragment in many cases gives a larger gap, but that convergence problems due to vanishing gaps still occur in calculations with pure functionals. In order to achieve converged results, some modeling of the charge distribution of solvent water molecules outside the electronic structure calculation is needed. Representing solvent water molecules by a simple point charge distribution is found to give non-vanishing HOMO-LUMO gaps for the tested protein-like systems also for pure functionals.
International Nuclear Information System (INIS)
Rudberg, Elias
2012-01-01
Self-consistency-based Kohn-Sham density functional theory (KS-DFT) electronic structure calculations with Gaussian basis sets are reported for a set of 17 protein-like molecules with geometries obtained from the Protein Data Bank. It is found that in many cases such calculations do not converge due to vanishing HOMO-LUMO gaps. A sequence of polyproline I helix molecules is also studied and it is found that self-consistency calculations using pure functionals fail to converge for helices longer than six proline units. Since the computed gap is strongly correlated to the fraction of Hartree-Fock exchange, test calculations using both pure and hybrid density functionals are reported. The tested methods include the pure functionals BLYP, PBE and LDA, as well as Hartree-Fock and the hybrid functionals BHandHLYP, B3LYP and PBE0. The effect of including solvent molecules in the calculations is studied, and it is found that the inclusion of explicit solvent molecules around the protein fragment in many cases gives a larger gap, but that convergence problems due to vanishing gaps still occur in calculations with pure functionals. In order to achieve converged results, some modeling of the charge distribution of solvent water molecules outside the electronic structure calculation is needed. Representing solvent water molecules by a simple point charge distribution is found to give non-vanishing HOMO-LUMO gaps for the tested protein-like systems also for pure functionals. (fast track communication)
Detecting and characterizing N-acyl-homoserine lactone signal molecules by thin-layer chromatography
Shaw, Paul D.; Ping, Gao; Daly, Sean L.; Cha, Chung; Cronan, John E.; Rinehart, Kenneth L.; Farrand, Stephen K.
1997-01-01
Many Gram-negative bacteria regulate gene expression in response to their population size by sensing the level of acyl-homoserine lactone signal molecules which they produce and liberate to the environment. We have developed an assay for these signals that couples separation by thin-layer chromatography with detection using Agrobacterium tumefaciens harboring lacZ fused to a gene that is regulated by autoinduction. With the exception of N-butanoyl-l-homoserine lactone, the reporter detected acyl-homoserine lactones with 3-oxo-, 3-hydroxy-, and 3-unsubstituted side chains of all lengths tested. The intensity of the response was proportional to the amount of the signal molecule chromatographed. Each of the 3-oxo- and the 3-unsubstituted derivatives migrated with a unique mobility. Using the assay, we showed that some bacteria produce as many as five detectable signal molecules. Structures could be assigned tentatively on the basis of mobility and spot shape. The dominant species produced by Pseudomonas syringae pv. tabaci chromatographed with the properties of N-(3-oxohexanoyl)-l-homoserine lactone, a structure that was confirmed by mass spectrometry. An isolate of Pseudomonas fluorescens produced five detectable species, three of which had novel chromatographic properties. These were identified as the 3-hydroxy- forms of N-hexanoyl-, N-octanoyl-, and N-decanoyl-l-homoserine lactone. The assay can be used to screen cultures of bacteria for acyl-homoserine lactones, for quantifying the amounts of these molecules produced, and as an analytical and preparative aid in determining the structures of these signal molecules. PMID:9177164
Fine structure and optical properties of biological polarizers in crustaceans and cephalopods
Chiou, Tsyr-Huei; Caldwell, Roy L.; Hanlon, Roger T.; Cronin, Thomas W.
2008-04-01
The lighting of the underwater environment is constantly changing due to attenuation by water, scattering by suspended particles, as well as the refraction and reflection caused by the surface waves. These factors pose a great challenge for marine animals which communicate through visual signals, especially those based on color. To escape this problem, certain cephalopod mollusks and stomatopod crustaceans utilize the polarization properties of light. While the mechanisms behind the polarization vision of these two animal groups are similar, several distinctive types of polarizers (i.e. the structure producing the signal) have been found in these animals. To gain a better knowledge of how these polarizers function, we studied the relationships between fine structures and optical properties of four types of polarizers found in cephalopods and stomatopods. Although all the polarizers share a somewhat similar spectral range, around 450- 550 nm, the reflectance properties of the signals and the mechanisms used to produce them have dramatic differences. In cephalopods, stack-plates polarizers produce the polarization patterns found on the arms and around their eyes. In stomatopods, we have found one type of beam-splitting polarizer based on photonic structures and two absorptive polarizer types based on dichroic molecules. These stomatopod polarizers may be found on various appendages, and on the cuticle covering dorsal or lateral sides of the animal. Since the efficiencies of all these polarizer types are somewhat sensitive to the change of illumination and viewing angle, how these animals compensate with different behaviors or fine structural features of the polarizer also varies.
Lach, Joanna; Goclon, Jakub; Rodziewicz, Pawel
2016-04-05
Sulfur mustard (SM) is one of the most dangerous chemical compounds used against humans, mostly at war conditions but also in terrorist attacks. Even though the sulfur mustard has been synthesized over a hundred years ago, some of its molecular properties are not yet resolved. We investigate the structural flexibility of the SM molecule in the gas phase by Car-Parrinello molecular dynamics simulations. Thorough conformation analysis of 81 different SM configurations using density functional theory is performed to analyze the behavior of the system at finite temperature. The conformational diversity is analyzed with respect to the formation of intramolecular blue-shifting CH⋯S and CH⋯Cl hydrogen bonds. Molecular dynamics simulations indicate that all structural rearrangements between SM local minima are realized either in direct or non-direct way, including the intermediate structure in the last case. We study the lifetime of the SM conformers and perform the population analysis. Additionally, we provide the anharmonic dynamical finite temperature IR spectrum from the Fourier Transform of the dipole moment autocorrelation function to mimic the missing experimental IR spectrum. Copyright © 2015 Elsevier B.V. All rights reserved.
Chemical wiring and soldering toward all-molecule electronic circuitry.
Okawa, Yuji; Mandal, Swapan K; Hu, Chunping; Tateyama, Yoshitaka; Goedecker, Stefan; Tsukamoto, Shigeru; Hasegawa, Tsuyoshi; Gimzewski, James K; Aono, Masakazu
2011-06-01
Key to single-molecule electronics is connecting functional molecules to each other using conductive nanowires. This involves two issues: how to create conductive nanowires at designated positions, and how to ensure chemical bonding between the nanowires and functional molecules. Here, we present a novel method that solves both issues. Relevant functional molecules are placed on a self-assembled monolayer of diacetylene compound. A probe tip of a scanning tunneling microscope is then positioned on the molecular row of the diacetylene compound to which the functional molecule is adsorbed, and a conductive polydiacetylene nanowire is fabricated by initiating chain polymerization by stimulation with the tip. Since the front edge of chain polymerization necessarily has a reactive chemical species, the created polymer nanowire forms chemical bonding with an encountered molecular element. We name this spontaneous reaction "chemical soldering". First-principles theoretical calculations are used to investigate the structures and electronic properties of the connection. We demonstrate that two conductive polymer nanowires are connected to a single phthalocyanine molecule. A resonant tunneling diode formed by this method is discussed. © 2011 American Chemical Society
Shi, Ruili; Wang, Pengju; Tang, Lingli; Huang, Xiaoming; Chen, Yonggang; Su, Yan; Zhao, Jijun
2018-04-05
Using a genetic algorithm incorporated in density functional theory, we explore the ground state structures of fluoride anion-water clusters F - (H 2 O) n with n = 1-10. The F - (H 2 O) n clusters prefer structures in which the F - anion remains at the surface of the structure and coordinates with four water molecules, as the F - (H 2 O) n clusters have strong F - -H 2 O interactions as well as strong hydrogen bonds between H 2 O molecules. The strong interaction between the F - anion and adjacent H 2 O molecule leads to a longer O-H distance in the adjacent molecule than in an individual water molecule. The simulated infrared (IR) spectra of the F - (H 2 O) 1-5 clusters obtained via second-order vibrational perturbation theory (VPT2) and including anharmonic effects reproduce the experimental results quite well. The strong interaction between the F - anion and water molecules results in a large redshift (600-2300 cm -1 ) of the adjacent O-H stretching mode. Natural bond orbital (NBO) analysis of the lowest-energy structures of the F - (H 2 O) 1-10 clusters illustrates that charge transfer from the lone pair electron orbital of F - to the antibonding orbital of the adjacent O-H is mainly responsible for the strong interaction between the F - anion and water molecules, which leads to distinctly different geometric and vibrational properties compared with neutral water clusters.
In situ STM imaging of the structures of pentacene molecules adsorbed on Au(111).
Pong, Ifan; Yau, Shuehlin; Huang, Peng-Yi; Chen, Ming-Chou; Hu, Tarng-Shiang; Yang, Yawchia; Lee, Yuh-Lang
2009-09-01
In situ scanning tunneling microscope (STM) was used to examine the spatial structures of pentacene molecules adsorbed onto a Au(111) single-crystal electrode from a benzene dosing solution containing 16-400 microM pentacene. Molecular-resolution STM imaging conducted in 0.1 M HClO(4) revealed highly ordered pentacene structures of ( radical31 x radical31)R8.9 degrees , (3 x 10), ( radical31 x 10), and ( radical7 x 2 radical7)R19.1 degrees adsorbed on the reconstructed Au(111) electrode dosed with different pentacene solutions. These pentacene structures and the reconstructed Au(111) substrate were stable between 0.2 and 0.8 V [vs reversible hydrogen electrode, RHE]. Increasing the potential to E > 0.8 V lifted the reconstructed Au(111) surface and disrupted the ordered pentacene adlattices simultaneously. Ordered pentacene structures could be restored by applying potentials negative enough to reinforce the reconstructed Au(111). At potentials negative of 0.2 V, the adsorption of protons became increasingly important to displace adsorbed pentacene admolecules. Although the reconstructed Au(111) structure was not essential to produce ordered pentacene adlayers, it seemed to help the adsorption of pentacene molecules in a long-range ordered pattern. At room temperature (25 degrees C), approximately 100 pentacene molecules seen in STM images could rotate and align themselves to a neighboring domain in 10 s, suggesting that pentacene admolecules could be mobile on Au(111) under the STM imaging conditions of -150 mV in bias voltage and 1 nA in feedback current.
Energy Technology Data Exchange (ETDEWEB)
Kuo, Cheng-Yu [C-PCS, Chemistry Division, Los Alamos National Laboratory, Los Alamos, NM 87545 (United States); Liu, Yinghao; Yarotski, Dmitry [Center of Integrated Nanotechnologies, Materials Physics and Application Division, Los Alamos National Laboratory, Los Alamos, NM 87545 (United States); Li, Hao [Theory Division, Los Alamos National Laboratory, Los Alamos, NM 87545 (United States); Xu, Ping; Yen, Hung-Ju [C-PCS, Chemistry Division, Los Alamos National Laboratory, Los Alamos, NM 87545 (United States); Tretiak, Sergei, E-mail: serg@lanl.gov [Theory Division, Los Alamos National Laboratory, Los Alamos, NM 87545 (United States); Wang, Hsing-Lin, E-mail: hwang@lanl.gov [C-PCS, Chemistry Division, Los Alamos National Laboratory, Los Alamos, NM 87545 (United States)
2016-12-20
Graphical abstract: STM imaging reveals differently oriented domains of self-assembled tetrathiophene molecules. - Highlights: • Optical and redox properties of oligothiophene derivatives are studied. • Packing pattern of self-assembly monolayer depends on the conjugation length. • Strong electronic coupling and three redox couples in cyclic voltamogram are observed in the hierarchical self-assembly. - Abstract: Three oligothiophene (terthiophene, tetrathiophene and pentathiophene) derivatives are synthesized and their monolayer self-assemblies on gold (Au) are prepared via Au–S covalent bond. Our UV–Vis experimental characterization of solution reveals the dependence of the optical properties on the conjugation length of the oligothiophenes, which compares well with Time-Dependent Density Functional Theory (TDDFT) simulations of spectra of individual chromophores. Photoluminescent spectra of thin films show pronounced red shifts compared to that of solutions, suggesting strong inter-oligomer interactions. The comparative studies of cyclic voltammograms of tetrathiophene from solution, cast film and self-assembled monolayer (SAM) indicate presence of one, two, and three oxidized species in these samples, respectively, suggesting a very strong electronic coupling between tetrathiophene molecules in the SAM. Scanning tunneling microscopy (STM) imaging of SAMs of the tetrathiophene on an atomically flat Au surface exhibits formation of monolayer assemblies with molecular order, and the molecular packing appears to show an overlay of oligothiophene molecules on top of another one. In contrast, the trimer and pentamer images show only aggregated species lacking long-range order on the molecular level. Such trends in going from disordered–ordered–disordered monolayer assemblies are mainly due to a delicate balance between inter-chromophore π–π couplings, hydrophobic interaction and the propensity to form Au–S covalent bond. Such hypothesis has been
Formation of clusters composed of C60 molecules via self-assembly in critical fluids
International Nuclear Information System (INIS)
Fukuda, Takahiro; Ishii, Koji; Kurosu, Shunji; Whitby, Raymond; Maekawa, Toru
2007-01-01
Fullerenes are promising candidates for intelligent, functional nanomaterials because of their unique mechanical, electronic and chemical properties. However, it is necessary to invent some efficient but relatively simple methods of producing structures composed of fullerenes for the development of nanomechatronic, nanoelectronic and biochemical devices and sensors. In this paper, we show that various structures such as straight fibres, networks formed by fibres, wide sheets and helical structures, which are composed of C 60 molecules, are created by placing C 60 -crystals in critical ethane, carbon dioxide and xenon even though C 60 molecules do not dissolve or disperse in the above fluids. It is supposed, judging by the intermolecular potentials between C 60 and C 60 , between C 60 and ethane, and between ethane and ethane, that C 60 -clusters grow with the assistance of solvent molecules, which are trapped between C 60 molecules under critical conditions. This room-temperature self-assembly cluster growth process in critical fluids may open up a new methodology of forming structures built up with fullerenes without the need for any ultra-fine processing technologies
Structure, processing, and properties of potatoes
Lloyd, Isabel K.; Kolos, Kimberly R.; Menegaux, Edmond C.; Luo, Huy; McCuen, Richard H.; Regan, Thomas M.
1992-06-01
The objective of this experiment and lesson intended for high school students in an engineering or materials science course or college freshmen is to demonstrate the relation between processing, structure, and thermodynamic and physical properties. The specific objectives are to show the effect of structure and structural changes on thermodynamic properties (specific heat) and physical properties (compressive strength); to illustrate the first law of thermodynamics; to compare boiling a potato in water with cooking it in a microwave in terms of the rate of structural change and the energy consumed to 'process' the potato; and to demonstrate compression testing.
Structure, processing, and properties of potatoes
Lloyd, Isabel K.; Kolos, Kimberly R.; Menegaux, Edmond C.; Luo, Huy; Mccuen, Richard H.; Regan, Thomas M.
1992-01-01
The objective of this experiment and lesson intended for high school students in an engineering or materials science course or college freshmen is to demonstrate the relation between processing, structure, and thermodynamic and physical properties. The specific objectives are to show the effect of structure and structural changes on thermodynamic properties (specific heat) and physical properties (compressive strength); to illustrate the first law of thermodynamics; to compare boiling a potato in water with cooking it in a microwave in terms of the rate of structural change and the energy consumed to 'process' the potato; and to demonstrate compression testing.
International Nuclear Information System (INIS)
Delcroix, J.L.
1977-08-01
GAPHYOR (GAz PHYsique ORsay) is a retrieval system of the simple properties of atoms and molecules (energy levels, lifetimes, dipole moments, polarizability etc.), of the interaction properties between these particles (cross-sections, reaction rates etc.) and of the macroscopic properties of the corresponding gases (viscosity, electronic and ion mobility, thermodynamic functions etc.). The chemical systems described must be based on a small number of elements (1 to 4 in the most recent version) and composed of molecules having 8 atoms at the most. In the present article the fundamental principles of GAPHYOR are described and by means of a few simple statistics the present state of the bank after five years of operation is analysed. On 1.11.76 the file contained more than 33,000 lines, and these increase by about 10,000 per year. The information comes from about 300 periodicals, although 45% of the results are taken from 4 principal journals. Geographical analysis of the file provides useful information about the scientific work of the various research centres and the scientific publishing policies of the different countries. Finally, the qualities, difficulties and possible improvements of GAPHYOR are analysed
Cleavage and Cell Adhesion Properties of Human Epithelial Cell Adhesion Molecule (HEPCAM)*
Tsaktanis, Thanos; Kremling, Heidi; Pavšič, Miha; von Stackelberg, Ricarda; Mack, Brigitte; Fukumori, Akio; Steiner, Harald; Vielmuth, Franziska; Spindler, Volker; Huang, Zhe; Jakubowski, Jasmine; Stoecklein, Nikolas H.; Luxenburger, Elke; Lauber, Kirsten; Lenarčič, Brigita; Gires, Olivier
2015-01-01
Human epithelial cell adhesion molecule (HEPCAM) is a tumor-associated antigen frequently expressed in carcinomas, which promotes proliferation after regulated intramembrane proteolysis. Here, we describe extracellular shedding of HEPCAM at two α-sites through a disintegrin and metalloprotease (ADAM) and at one β-site through BACE1. Transmembrane cleavage by γ-secretase occurs at three γ-sites to generate extracellular Aβ-like fragments and at two ϵ-sites to release human EPCAM intracellular domain HEPICD, which is efficiently degraded by the proteasome. Mapping of cleavage sites onto three-dimensional structures of HEPEX cis-dimer predicted conditional availability of α- and β-sites. Endocytosis of HEPCAM warrants acidification in cytoplasmic vesicles to dissociate protein cis-dimers required for cleavage by BACE1 at low pH values. Intramembrane cleavage sites are accessible and not part of the structurally important transmembrane helix dimer crossing region. Surprisingly, neither chemical inhibition of cleavage nor cellular knock-out of HEPCAM using CRISPR-Cas9 technology impacted the adhesion of carcinoma cell lines. Hence, a direct function of HEPCAM as an adhesion molecule in carcinoma cells is not supported and appears to be questionable. PMID:26292218
Layers of Cold Dipolar Molecules in the Harmonic Approximation
DEFF Research Database (Denmark)
R. Armstrong, J.; Zinner, Nikolaj Thomas; V. Fedorov, D.
2012-01-01
We consider the N-body problem in a layered geometry containing cold polar molecules with dipole moments that are polarized perpendicular to the layers. A harmonic approximation is used to simplify the hamiltonian and bound state properties of the two-body inter-layer dipolar potential are used...... to adjust this effective interaction. To model the intra-layer repulsion of the polar molecules, we introduce a repulsive inter-molecule potential that can be parametrically varied. Single chains containing one molecule in each layer, as well as multi-chain structures in many layers are discussed...... and their energies and radii determined. We extract the normal modes of the various systems as measures of their volatility and eventually of instability, and compare our findings to the excitations in crystals. We find modes that can be classified as either chains vibrating in phase or as layers vibrating against...
Haldar, Soumyajyoti
2017-09-13
In this paper, we have done a comparative study of electronic and magnetic properties of iron phthalocyanine (FePc) and cobalt phthalocyanine (CoPc) molecules physisorbed on monolayer of MoS$_2$ and graphene by using density functional theory. Various different types of physisorption sites have been considered for both surfaces. Our calculations reveal that the $M$Pc molecules prefer the S-top position on MoS$_2$. However, on graphene, FePc molecule prefers the bridge position while CoPc molecule prefers the top position. The $M$Pc molecules are physisorbed strongly on the MoS$_2$ surface than the graphene ($\\\\sim$ 2.5 eV higher physisorption energy). Analysis of magnetic properties indicates the presence of strong spin dipole moment opposite to the spin moment and hence a huge reduction of effective spin moment can be observed. Our calculations of magnetic anisotropy energies using both variational approach and $2^{nd}$ order perturbation approach indicate no significant changes after physisorption. In case of FePc, an out-of-plane easy axis and in case of CoPc, an in-plane easy axis can be seen. Calculations of work function indicate a reduction of MoS$_2$ work function $\\\\sim$ 1 eV due to physisorption of $M$Pc molecules while it does not change significantly in case of graphene.
Energy Technology Data Exchange (ETDEWEB)
Ebata, Takayuki; Kusaka, Ryoji [Department of Chemistry, Graduate School of Science, Hiroshima University, Kagamiyama 1-3-1, Higashi-Hiroshima, 739-8526 (Japan); Xantheas, Sotiris S. [Chemical and Materials Sciences Division, Pacific Northwest National Laboratory, 902 Battelle Boulevard, P.O. Box 999, MS K1-83, Richland, WA 99352 (United States)
2015-01-22
Extensive laser spectroscopic and theoretical studies have been recently carried out with the aim to reveal the structure and dynamics of encapsulation complexes in the gas phase. The characteristics of the encapsulation complexes are governed by the fact that (i) most of the host molecules are flexible and (ii) the complexes form high dimensional structures by using weak non-covalent interactions. These characteristics result in the possibility of the coexistence of many conformers in close energetic proximity. The combination of supersonic jet/laser spectroscopy and high level quantum chemical calculations is essential in tackling these challenging problems. In this report we describe our recent studies on the structures and dynamics of the encapsulation complexes formed by calix[4]arene (C4A), dibenzo-18-crown-6-ether (DB18C6), and benzo-18-crown-6-ether (B18C6) 'hosts' interacting with N{sub 2}, acetylene, water, and ammonia 'guest' molecules. The gaseous host-guest complexes are generated under jet-cooled conditions. We apply various laser spectroscopic methods to obtain the conformer- and isomer-specified electronic and IR spectra. The experimental results are complemented with quantum chemical calculations ranging from density functional theory to high level first principles calculations at the MP2 and CCSD(T) levels of theory. We discuss the possible conformations of the bare host molecules, the structural changes they undergo upon complexation, and the key interactions that are responsible in stabilizing the specific complexes.
Structure, reactivity and electronic properties of Mn doped Ni13 clusters
International Nuclear Information System (INIS)
Banerjee, Radhashyam; Datta, Soumendu; Mookerjee, Abhijit
2013-01-01
In this work we have studied the structural and magnetic properties of Ni 13 cluster mono- and bi-doped with Mn atoms. We have noted their tendency of being reactive toward the H 2 molecule. We have found unusually enhanced stability in the mono-doped cluster (i.e. of the Ni 12 Mn) and the diminished stability of the corresponding chemisorbed cluster, Ni 12 MnH 2 . Our analysis of the stability and HOMO–LUMO gap explains this unusual behavior. Interestingly, we have also seen the quenching in the net magnetic moment upon H 2 absorption in the doped Ni 13−m Mn m alloy clusters. This has been reported earlier for smaller Ni n clusters [1
Structure, reactivity and electronic properties of Mn doped Ni13 clusters
Banerjee, Radhashyam; Datta, Soumendu; Mookerjee, Abhijit
2013-06-01
In this work we have studied the structural and magnetic properties of Ni13 cluster mono- and bi-doped with Mn atoms. We have noted their tendency of being reactive toward the H2 molecule. We have found unusually enhanced stability in the mono-doped cluster (i.e. of the Ni12Mn) and the diminished stability of the corresponding chemisorbed cluster, Ni12MnH2. Our analysis of the stability and HOMO-LUMO gap explains this unusual behavior. Interestingly, we have also seen the quenching in the net magnetic moment upon H2 absorption in the doped NiMnm alloy clusters. This has been reported earlier for smaller Nin clusters [1].
Institute of Scientific and Technical Information of China (English)
Jian-Yong Zhang; Li-Hua Zeng; Juan Feng
2017-01-01
Dynamic covalent chemistry has emerged recently to be a powerful tool to construct functional materials.This article reviews the progress in the research and development of dynamic covalent chemistry in gels assembled from small molecules.First dynamic covalent reactions used in gels are reviewed to understand the dynamic covalent bonding.Afterwards the catalogues of dynamic covalent gels are reviewed according to the nature of gelators and the interactions between gelators.Dynamic covalent bonding can be involved to form low molecular weight gelators.Low molecular weight molecules with multiple functional groups react to form dynamic covalent cross-linked polymers and act as gelators.Two catalogues of gels show different properties arising from their different structures.This review aims to illustrate the structure-property relationships of these dynamic covalent gels.
International Nuclear Information System (INIS)
Zong-Liang, Li; Huai-Zhi, Li; Yong, Ma; Guang-Ping, Zhang; Chuan-Kui, Wang
2010-01-01
A first-principles computational method based on the hybrid density functional theory is developed to simulate the electronic transport properties of oligomeric phenylene ethynylene molecular junctions with H 2 O molecules accumulated in the vicinity as recently reported by Na et al. [Nanotechnology 18 424001 (2007)]. The numerical results show that the hydrogen bonds between the oxygen atoms of the oligomeric phenylene ethynylene molecule and H 2 O molecules result in the localisation of the molecular orbitals and lead to the lower transition peaks. The H 2 O molecular chains accumulated in the vicinity of the molecular junction can not only change the electronic structure of the molecular junctions, but also open additional electronic transport pathways. The obvious influence of H 2 O molecules on the electronic structure of the molecular junction and its electronic transport properties is thus demonstrated. (condensed matter: electronic structure, electrical, magnetic, and optical properties)
Why Do Simple Molecules with "Isolated" Phenyl Rings Emit Visible Light?
Zhang, Haoke; Zheng, Xiaoyan; Xie, Ni; He, Zikai; Liu, Junkai; Leung, Nelson L C; Niu, Yingli; Huang, Xuhui; Wong, Kam Sing; Kwok, Ryan T K; Sung, Herman H Y; Williams, Ian D; Qin, Anjun; Lam, Jacky W Y; Tang, Ben Zhong
2017-11-15
π-Bonds connected with aromatic rings were generally believed as the standard structures for constructing highly efficient fluorophores. Materials without these typical structures, however, exhibited only low fluorescence quantum yields and emitted in the ultraviolet spectral region. In this work, three molecules, namely bis(2,4,5-trimethylphenyl)methane, 1,1,2,2-tetrakis(2,4,5-trimethylphenyl)ethane, and 1,1,2,2-tetraphenylethane, with nonconjugated structures and isolated phenyl rings were synthesized and their photophysical properties were systematically investigated. Interestingly, the emission spectra of these three molecules could be well extended to 600 nm with high solid-state quantum yields of up to 70%. Experimental and theoretical analyses proved that intramolecular through-space conjugation between the "isolated" phenyl rings played an important role for this abnormal phenomenon.
Ghosh, Pritam; Hazra, Abhijit; Ghosh, Meenakshi; Chandra Murmu, Naresh; Banerjee, Priyabrata
2018-04-01
Biologically relevant halide salts and its solution state structural properties are always been significant. In general, exposure of halide salts into polar solution medium results in solvation which in turn separates the cationic and anionic part of the salt. However, the conventional behaviour of salts might alter in presence of any secondary amine based compound, i.e.; moderately strong Lewis acid. In its consequence, to investigate the effect of secondary amine based compound in the salt solution, novel (E)-2-(4-bromobenzylidene)-1-(perfluorophenyl) hydrazine has been synthesized and used as secondary amine source. The secondary amine compound interestingly shows a drastic color change upon exposure to fluoride salts owing to hydrogen bonding interaction. Several experimental methods, e.g.; SCXRD, UV-Vis, FT-IR, ESI-MS and DLS together with modern DFT (i.e.; DFT-D3) have been performed to explore the structural properties of the halide salts upon exposure to secondary amine based compound. The effect of counter cation of the fluoride salt in binding with secondary amine source has also been investigated.
International Nuclear Information System (INIS)
Ueda, Kazushige; Hiramatsu, Hidenori; Hirano, Masahiro; Kamiya, Toshio; Hosono, Hideo
2006-01-01
Applying the concept of materials design for transparent conductive oxides to layered oxychalcogenides, several p-type and n-type layered oxychalcogenides were proposed as wide-gap semiconductors and their basic optical and electrical properties were examined. The layered oxychalcogenides are composed of ionic oxide layers and covalent chalcogenide layers, which bring wide-gap and conductive properties to these materials, respectively. The electronic structures of the materials were examined by normal/inverse photoemission spectroscopy and energy band calculations. The results of the examinations suggested that these materials possess unique features more than simple wide-gap semiconductors. Namely, the layered oxychalcogenides are considered to be extremely thin quantum wells composed of the oxide and chalcogenide layers or 2D chalcogenide crystals/molecules embedded in an oxide matrix. Observation of step-like absorption edges, large band gap energy and large exciton binding energy demonstrated these features originating from 2D density of states and quantum size effects in these layered materials
Energy Technology Data Exchange (ETDEWEB)
Inal, Sahika; Castellani, Mauro; Neher, Dieter [Universitaet Potsdam, Institut fuer Physik und Astronomie, Potsdam-Golm (Germany); Sellinger, Alan [Institute of Materials Research and Engineering, Singapore (Singapore)
2009-07-01
Recent experimental investigations revealed that the photovoltaic properties of our devices are related to the balance between recombination and field-induced dissociation of interfacial excited states such as exciplexes or geminate polaron pairs. This balance was shown to be affected by the nanomorphology at the heterojunction. We have analyzed the photophysical properties of a new materials couple comprising an electron-donating PPV copolymer and a vinazene-based small molecule acceptor. Steady state and time-resolved photoluminescence (PL) spectroscopy in solution and in the solid state showed the formation of excimers within the acceptor. The associated long-range diffusion promise efficient energy harvesting at the heterojunction. On the other hand, blends of the PPV-derivative and the small molecule revealed strong exciplex formation. Therefore, bilayered hybrid small-molecular/polymeric solar cells have been fabricated by consequently spin-coating the macromolecular donor and the small molecule acceptor from two different solvents. The bilayer architecture limits recombination processes enabling high FFs of around 44% and a technologically important open circuit voltage of 1Volt.
International Nuclear Information System (INIS)
Feldman, V.I.
1997-01-01
Use of IR spectroscopy (as a supplement to EPR) may provide new insight into the problem of analysis of structure and properties of organic radical cations. In this work, the results of combined EPR/IR studies of the formation, structure and properties of hydrocarbon radical cations in halocarbon and solid rare gas matrices are discussed. Both IR and EPR studies were carried out with matrix deposited samples irradiated with fast electrons at 15 or 77 K. IR spectroscopic data were found to be helpful in three aspects: (i) characterization of the conformation and association and molecule-matrix interactions of the parent molecules; (ii) identification of diamagnetic products of the reactions of radical cations in ground and excited states; (iii) determining the characteristics of vibrational spectra of the radical cations, which are of primary interest for analysis of chemical bonding and reactivity of the radical cations. The applications of the combined approach are illustrated with examples of studies of several alkenes in Freon matrices and alkanes in solid rare gas matrices. The matrix effects on trapping and degradation of radical cations were interpreted as the result of variations in matrix electronic characteristics (IP, polarizability) and molecule-matrix interactions. (au) 48 refs
Peironcely, Julio E; Rojas-Chertó, Miguel; Fichera, Davide; Reijmers, Theo; Coulier, Leon; Faulon, Jean-Loup; Hankemeier, Thomas
2012-09-17
Computer Assisted Structure Elucidation has been used for decades to discover the chemical structure of unknown compounds. In this work we introduce the first open source structure generator, Open Molecule Generator (OMG), which for a given elemental composition produces all non-isomorphic chemical structures that match that elemental composition. Furthermore, this structure generator can accept as additional input one or multiple non-overlapping prescribed substructures to drastically reduce the number of possible chemical structures. Being open source allows for customization and future extension of its functionality. OMG relies on a modified version of the Canonical Augmentation Path, which grows intermediate chemical structures by adding bonds and checks that at each step only unique molecules are produced. In order to benchmark the tool, we generated chemical structures for the elemental formulas and substructures of different metabolites and compared the results with a commercially available structure generator. The results obtained, i.e. the number of molecules generated, were identical for elemental compositions having only C, O and H. For elemental compositions containing C, O, H, N, P and S, OMG produces all the chemically valid molecules while the other generator produces more, yet chemically impossible, molecules. The chemical completeness of the OMG results comes at the expense of being slower than the commercial generator. In addition to being open source, OMG clearly showed the added value of constraining the solution space by using multiple prescribed substructures as input. We expect this structure generator to be useful in many fields, but to be especially of great importance for metabolomics, where identifying unknown metabolites is still a major bottleneck.
Directory of Open Access Journals (Sweden)
Peironcely Julio E
2012-09-01
Full Text Available Abstract Computer Assisted Structure Elucidation has been used for decades to discover the chemical structure of unknown compounds. In this work we introduce the first open source structure generator, Open Molecule Generator (OMG, which for a given elemental composition produces all non-isomorphic chemical structures that match that elemental composition. Furthermore, this structure generator can accept as additional input one or multiple non-overlapping prescribed substructures to drastically reduce the number of possible chemical structures. Being open source allows for customization and future extension of its functionality. OMG relies on a modified version of the Canonical Augmentation Path, which grows intermediate chemical structures by adding bonds and checks that at each step only unique molecules are produced. In order to benchmark the tool, we generated chemical structures for the elemental formulas and substructures of different metabolites and compared the results with a commercially available structure generator. The results obtained, i.e. the number of molecules generated, were identical for elemental compositions having only C, O and H. For elemental compositions containing C, O, H, N, P and S, OMG produces all the chemically valid molecules while the other generator produces more, yet chemically impossible, molecules. The chemical completeness of the OMG results comes at the expense of being slower than the commercial generator. In addition to being open source, OMG clearly showed the added value of constraining the solution space by using multiple prescribed substructures as input. We expect this structure generator to be useful in many fields, but to be especially of great importance for metabolomics, where identifying unknown metabolites is still a major bottleneck.
Goszczycki, Piotr; Stadnicka, Katarzyna; Brela, Mateusz Z.; Grolik, Jarosław; Ostrowska, Katarzyna
2017-10-01
Three (E/Z)-diastereoisomers, based on pyrrolo[2,3-b]quinoxaline system as fluorophore and containing: 2-thienylmethyl (1), bis(2-thienylmethyl)-2-aminoethyl (3a), bis(2-thienylmethyl)-3-aminopropyl (3b) groups as substituents, were synthesized and characterized by X-ray structural analysis, PXRD, NMR, UV-Vis as well as fluorescence. These compounds are non-fluorescent in acetonitrile solution, however, they exhibit aggregation induced emission enhancement (AIEE) upon water addition and in solid state. X-ray structural analysis revealed that molecules with 2-thienylmethyl and bis(2-thienylmethyl)-2-aminoethyl groups form dimers and π-stacks through π-π interactions between anitiparallel oriented pyrroloquinoxaline cores with interplanar distances 3.45 Å and 3.20 Å, respectively. Conformation of bis(2-thienylmethyl)-3-aminopropyl group is imposed by incorporated DMSO-d6 solvent molecule and weak intermolecular S-π and CH-π interactions, that prevents π-π interaction between fluorophore cores. The correlation between crystal structure and fluorescent properties of synthesized molecules was discussed. The DFT calculations were performed to rationalize the differences between considered systems.
GARN2: coarse-grained prediction of 3D structure of large RNA molecules by regret minimization.
Boudard, Mélanie; Barth, Dominique; Bernauer, Julie; Denise, Alain; Cohen, Johanne
2017-08-15
Predicting the 3D structure of RNA molecules is a key feature towards predicting their functions. Methods which work at atomic or nucleotide level are not suitable for large molecules. In these cases, coarse-grained prediction methods aim to predict a shape which could be refined later by using more precise methods on smaller parts of the molecule. We developed a complete method for sampling 3D RNA structure at a coarse-grained model, taking a secondary structure as input. One of the novelties of our method is that a second step extracts two best possible structures close to the native, from a set of possible structures. Although our method benefits from the first version of GARN, some of the main features on GARN2 are very different. GARN2 is much faster than the previous version and than the well-known methods of the state-of-art. Our experiments show that GARN2 can also provide better structures than the other state-of-the-art methods. GARN2 is written in Java. It is freely distributed and available at http://garn.lri.fr/. melanie.boudard@lri.fr or johanne.cohen@lri.fr. Supplementary data are available at Bioinformatics online. © The Author (2017). Published by Oxford University Press. All rights reserved. For Permissions, please email: journals.permissions@oup.com
Li, Linnan; Xie, Shaodong; Cai, Hao; Bai, Xuetao; Xue, Zhao
2008-08-01
Theoretical molecular descriptors were tested against logK(OW) values for polybrominated diphenyl ethers (PBDEs) using the Partial Least-Squares Regression method which can be used to analyze data with many variables and few observations. A quantitative structure-property relationship (QSPR) model was successfully developed with a high cross-validated value (Q(cum)(2)) of 0.961, indicating a good predictive ability and stability of the model. The predictive power of the QSPR model was further cross-validated. The values of logK(OW) for PBDEs are mainly governed by molecular surface area, energy of the lowest unoccupied molecular orbital and the net atomic charges on the oxygen atom. All these descriptors have been discussed to interpret the partitioning mechanism of PBDE chemicals. The bulk property of the molecules represented by molecular surface area is the leading factor, and K(OW) values increase with the increase of molecular surface area. Higher energy of the lowest unoccupied molecular orbital and higher net atomic charge on the oxygen atom of PBDEs result in smaller K(OW). The energy of the lowest unoccupied molecular orbital and the net atomic charge on PBDEs oxygen also play important roles in affecting the partition of PBDEs between octanol and water by influencing the interactions between PBDEs and solvent molecules.
Structural and electronic properties of OsB2 : A hard metallic material
Chen, Z. Y.; Xiang, H. J.; Yang, Jinlong; Hou, J. G.; Zhu, Qingshi
2006-07-01
We calculate the structural and electronic properties of OsB2 using density functional theory with or without taking into account the spin-orbit (SO) interaction. Our results show that the bulk modulus with and without SO interactions are 364 and 365GPa , respectively, both are in good agreement with experiment (365-395GPa) . The evidence of covalent bonding of Os-B, which plays an important role to form a hard material, is indicated both in charge density, atoms in molecules analysis, and density of states analysis. The good metallicity and hardness of OsB2 might suggest its potential application as hard conductors.
International Nuclear Information System (INIS)
Jing, Yu; Tang, Qing; He, Peng; Zhou, Zhen; Shen, Panwen
2015-01-01
Systematical computations on the density functional theory were performed to investigate the adsorption of three typical organic molecules, tetracyanoquinodimethane (TCNQ), tetracyanoethylene (TCNE) and tetrathiafulvalene (TTF), on the surface of phosphorene monolayers and thicker layers. There exist considerable charge transfer and strong non-covalent interaction between these molecules and phosphorene. In particular, the band gap of phosphorene decreases dramatically due to the molecular modification and can be further tuned by applying an external electric field. Meanwhile, surface molecular modification has proven to be an effective way to enhance the light harvesting of phosphorene in different directions. Our results predict a flexible method toward modulating the electronic and optical properties of phosphorene and shed light on its experimental applications. (paper)
Electron-excited molecule interactions
International Nuclear Information System (INIS)
Christophorou, L.G.; Tennessee Univ., Knoxville, TN
1991-01-01
In this paper the limited but significant knowledge to date on electron scattering from vibrationally/rotationally excited molecules and electron scattering from and electron impact ionization of electronically excited molecules is briefly summarized and discussed. The profound effects of the internal energy content of a molecule on its electron attachment properties are highlighted focusing in particular on electron attachment to vibrationally/rotationally and to electronically excited molecules. The limited knowledge to date on electron-excited molecule interactions clearly shows that the cross sections for certain electron-molecule collision processes can be very different from those involving ground state molecules. For example, optically enhanced electron attachment studies have shown that electron attachment to electronically excited molecules can occur with cross sections 10 6 to 10 7 times larger compared to ground state molecules. The study of electron-excited molecule interactions offers many experimental and theoretical challenges and opportunities and is both of fundamental and technological significance. 54 refs., 15 figs
Structural studies on proton/protonation of the protein molecule
International Nuclear Information System (INIS)
Morimoto, Yukio; Kida, Akiko; Chatake, Toshiyuki; Yamaguchi, Hiroshi; Hosokawa, Keiichi; Murakami, Takuto; Umino, Masaaki; Tanaka, Ichiro; Hisatome, Ichiro; Yanagisawa, Yasutake; Fujiwara, Satoshi; Hidaka, Yuji; Shimamoto, Shigeru; Fujiwara, Mitsutoshi; Nakanishi, Takeyoshi
2015-01-01
This paper reports three studies involved in the analysis of protons and protonation at physiologically active sites in protein molecules. (1) 'Elucidation of the higher-order structure formation and activity performing mechanism of yeast proteasome.' With an aim to apply to anti-cancer drugs, this study performed the shape analysis of the total structure of 26S proteasome using small-angle X-ray scattering to clarify the complex form where controlling elements bonded to the both ends of 20S catalyst body, and analyzed the complex structure between the active sites of 20S and inhibitor (drug). (2) 'Basic study on the neutron experiment of biomolecules such as physiologically active substances derived from Natto-bacteria.' This study conducted the purification, crystallization, and X-ray analysis experiment of nattokinase; high-grade purification and solution experiment of vitamin K2 (menaquinone-7); and Z-DNA crystal structure study related to the neutron crystal analysis of DNA as another biomolecule structure study. (3) 'Functional evaluation on digestive enzymes derived from Nephila clavata.' As an Alzheimer's disease-related amyloid fibril formation model, this study carried out elucidation on the fibrosis and fiber-forming mechanism of the traction fiber of Nephila clavata, and the functional analysis of its degrading enzyme. (A.O.)
Detecting and identifying small molecules in a nanopore flux capacitor
International Nuclear Information System (INIS)
Bearden, Samuel; Zhang, Guigen; McClure, Ethan
2016-01-01
A new method of molecular detection in a metallic-semiconductor nanopore was developed and evaluated with experimental and computational methods. Measurements were made of the charging potential of the electrical double layer (EDL) capacitance as charge-carrying small molecules translocated the nanopore. Signals in the charging potential were found to be correlated to the physical properties of analyte molecules. From the measured signals, we were able to distinguish molecules with different valence charge or similar valence charge but different size. The relative magnitude of the signals from different analytes was consistent over a wide range of experimental conditions, suggesting that the detected signals are likely due to single molecules. Computational modeling of the nanopore system indicated that the double layer potential signal may be described in terms of disruption of the EDL structure due to the size and charge of the analyte molecule, in agreement with Huckel and Debye’s analysis of the electrical atmosphere of electrolyte solutions. (paper)
Rabanal-León, Walter A; Páez-Hernández, Dayán; Arratia-Pérez, Ramiro
2014-12-21
The present work is focused on the elucidation of the electronic structure, bonding nature and optical properties of a series of low symmetry (C2) coordination compounds of type [Ln(III)HAM](3+), where "Ln(III)" are the trivalent lanthanide ions: La(3+), Ce(3+), Eu(3+) and Lu(3+), while "HAM" is the neutral six-nitrogen donor macrocyclic ligand [C22N6H26]. This systematic study has been performed in the framework of the Relativistic Density Functional Theory (R-DFT) and also using a multi-reference approach via the Complete Active Space (CAS) wavefunction treatment with the aim of analyzing their ground state and excited state electronic structures as well as electronic correlation. Furthermore, the use of the energy decomposition scheme proposed by Morokuma-Ziegler and the electron localization function (ELF) allows us to characterize the bonding between the lanthanide ions and the macrocyclic ligand, obtaining as a result a dative-covalent interaction. Due to a great deal of lanthanide optical properties and their technological applications, the absorption spectra of this set of coordination compounds were calculated using the time-dependent density functional theory (TD-DFT), where the presence of the intense Ligand to Metal Charge Transfer (LMCT) bands in the ultraviolet and visible region and the inherent f-f electronic transitions in the Near-Infra Red (NIR) region for some lanthanide ions allow us to propose these systems as "single antenna molecules" with potential applications in NIR technologies.
Structure and spectra of a confined HeH molecule
International Nuclear Information System (INIS)
Lo, J M H; Klobukowski, M; Bielinska-Wacz, D; Schreiner, E W S; Diercksen, G H F
2006-01-01
The influence of spatial confinement on the structure and spectra of the Rydberg HeH molecule is analysed at the level of the variational full configuration interaction approach. The confining potential is assumed to have cylindrical symmetry, with the symmetry axis of the potential overlapping with the molecular bond. In the direction perpendicular to the axis quadratic dependence of the potential on the electron coordinates is assumed. The influence of the confining potential on the form of the potential energy curves (in particular on the bond lengths), on the electronic spectra and on the ionization due to the confinement is studied in detail
Computational Study of the Structure and Mechanical Properties of the Molecular Crystal RDX
2012-11-01
basic equilibrium properties of and transitions to and from the α and γ polymorphs in crystalline RDX based on the SB potential (17). Atomic-level...elastic constants, polymorph transitions , cleavage properties, and energy barriers to slip. The energy barriers to slip are determined through the... RDX molecule containing three R2N-NO2 groups, where each R=CH2; and (c) HMX molecule containing four R2N-NO2 groups with R=CH2
Davie, Stuart J; Di Pasquale, Nicodemo; Popelier, Paul L A
2016-10-15
Machine learning algorithms have been demonstrated to predict atomistic properties approaching the accuracy of quantum chemical calculations at significantly less computational cost. Difficulties arise, however, when attempting to apply these techniques to large systems, or systems possessing excessive conformational freedom. In this article, the machine learning method kriging is applied to predict both the intra-atomic and interatomic energies, as well as the electrostatic multipole moments, of the atoms of a water molecule at the center of a 10 water molecule (decamer) cluster. Unlike previous work, where the properties of small water clusters were predicted using a molecular local frame, and where training set inputs (features) were based on atomic index, a variety of feature definitions and coordinate frames are considered here to increase prediction accuracy. It is shown that, for a water molecule at the center of a decamer, no single method of defining features or coordinate schemes is optimal for every property. However, explicitly accounting for the structure of the first solvation shell in the definition of the features of the kriging training set, and centring the coordinate frame on the atom-of-interest will, in general, return better predictions than models that apply the standard methods of feature definition, or a molecular coordinate frame. © 2016 The Authors. Journal of Computational Chemistry Published by Wiley Periodicals, Inc. © 2016 The Authors. Journal of Computational Chemistry Published by Wiley Periodicals, Inc.
Investigation on Single-Molecule Junctions Based on Current–Voltage Characteristics
Directory of Open Access Journals (Sweden)
Yuji Isshiki
2018-02-01
Full Text Available The relationship between the current through an electronic device and the voltage across its terminals is a current–voltage characteristic (I–V that determine basic device performance. Currently, I–V measurement on a single-molecule scale can be performed using break junction technique, where a single molecule junction can be prepared by trapping a single molecule into a nanogap between metal electrodes. The single-molecule I–Vs provide not only the device performance, but also reflect information on energy dispersion of the electronic state and the electron-molecular vibration coupling in the junction. This mini review focuses on recent representative studies on I–Vs of the single molecule junctions that cover investigation on the single-molecule diode property, the molecular vibration, and the electronic structure as a form of transmission probability, and electronic density of states, including the spin state of the single-molecule junctions. In addition, thermoelectronic measurements based on I–Vs and identification of the charged carriers (i.e., electrons or holes are presented. The analysis in the single-molecule I–Vs provides fundamental and essential information for a better understanding of the single-molecule science, and puts the single molecule junction to more practical use in molecular devices.
Roggatz, Christina C; Lorch, Mark; Hardege, Jörg D; Benoit, David M
2016-12-01
Ocean acidification is a global challenge that faces marine organisms in the near future with a predicted rapid drop in pH of up to 0.4 units by the end of this century. Effects of the change in ocean carbon chemistry and pH on the development, growth and fitness of marine animals are well documented. Recent evidence also suggests that a range of chemically mediated behaviours and interactions in marine fish and invertebrates will be affected. Marine animals use chemical cues, for example, to detect predators, for settlement, homing and reproduction. But, while effects of high CO 2 conditions on these behaviours are described across many species, little is known about the underlying mechanisms, particularly in invertebrates. Here, we investigate the direct influence of future oceanic pH conditions on the structure and function of three peptide signalling molecules with an interdisciplinary combination of methods. NMR spectroscopy and quantum chemical calculations were used to assess the direct molecular influence of pH on the peptide cues, and we tested the functionality of the cues in different pH conditions using behavioural bioassays with shore crabs (Carcinus maenas) as a model system. We found that peptide signalling cues are susceptible to protonation in future pH conditions, which will alter their overall charge. We also show that structure and electrostatic properties important for receptor binding differ significantly between the peptide forms present today and the protonated signalling peptides likely to be dominating in future oceans. The bioassays suggest an impaired functionality of the signalling peptides at low pH. Physiological changes due to high CO 2 conditions were found to play a less significant role in influencing the investigated behaviour. From our results, we conclude that the change of charge, structure and consequently function of signalling molecules presents one possible mechanism to explain altered behaviour under future oceanic p
Xiao, Hang
properties of P2S3 structure can be tuned by stacking into multilayer P2S3 structures, forming P2S3 nanoribbons or rolling into P2S3 nanotubes, expanding its potential applications for the emerging field of 2D electronics. Then we showed that the hydrolysis reaction is strongly affected by relative humidity. The hydrolysis of CO32- with n = 1-8 water molecules was investigated by ab initio method. For n = 1-5 water molecules, all the reactants follow a stepwise pathway to the transition state. For n = 6-8 water molecules, all the reactants undergo a direct proton transfer to the transition state with overall lower activation free energy. The activation free energy of the reaction is dramatically reduced from 10.4 to 2.4 kcal/mol as the number of water molecules increases from 1 to 6. Meanwhile, the degree of the hydrolysis of CO32- is significantly increased compared to the bulk water solution scenario. The incomplete hydration shells facilitate the hydrolysis of CO3 2- with few water molecules to be not only thermodynamically favorable but also kinetically favorable. We showed that the chemical kinetics is not likely to constrain the speed of CO2 air capture driven by the humidity-swing. (Abstract shortened by ProQuest.).
Coherent interaction of single molecules and plasmonic nanowires
Gerhardt, Ilja; Grotz, Bernhard; Siyushev, Petr; Wrachtrup, Jörg
2017-09-01
Quantum plasmonics opens the option to integrate complex quantum optical circuitry onto chip scale devices. In the past, often external light sources were used and nonclassical light was coupled in and out of plasmonic structures, such as hole arrays or waveguide structures. Another option to launch single plasmonic excitations is the coupling of single emitters in the direct proximity of, e.g., a silver or gold nanostructure. Here, we present our attempts to integrate the research of single emitters with wet-chemically grown silver nanowires. The emitters of choice are single organic dye molecules under cryogenic conditions, which are known to act as high-brightness and extremely narrow-band single photon sources. Another advantage is their high optical nonlinearity, such that they might mediate photon-photon interactions on the nanoscale. We report on the coupling of a single molecule fluorescence emission through the wire over the length of several wavelengths. The transmission of coherently emitted photons is proven by an extinction type experiment. As for influencing the spectral properties of a single emitter, we are able to show a remote change of the line-width of a single terrylene molecule, which is in close proximity to the nanowire.
Electronic, structural, and substrate effect properties of single-layer covalent organic frameworks
International Nuclear Information System (INIS)
Liang, Liangbo; Zhu, Pan; Meunier, Vincent
2015-01-01
Recently synthesized two-dimensional covalent organic frameworks (COFs) exhibit high surface area, large pore size, and unique structural architectures, making them promising materials for various energy applications. Here, a total of nine COFs structures, including two deposited on a hexagonal boron nitride substrate, are investigated using density functional theory, quasi-particle many-body theory within the GW approximation, and an image charge model. The structures considered belong to two major families (thiophene-based COF-n (T-COF-n) and tetrakis (4-aminophenyl) porphyrin-x (TAPP-x)) differing from the presence of B—O or C=N linkers. While T-COF-n structures are shown to constitute planar networks, TAPP-x systems can display non-negligible corrugation due to the out-of-plane rotation of phenyl rings. We find that the electronic properties do not differ significantly when altering the chain molecules within each family. Many-body effects are shown to lead to large band-gap increase while the presence of the substrate yields appreciable reductions of the gaps, due to substrate polarization effects
Identification of a cytotoxic molecule in heat-modified citrus pectin.
Leclere, Lionel; Fransolet, Maude; Cambier, Pierre; El Bkassiny, Sandy; Tikad, Abdellatif; Dieu, Marc; Vincent, Stéphane P; Van Cutsem, Pierre; Michiels, Carine
2016-02-10
Modified forms of citrus pectin possess anticancer properties. However, their mechanism of action and the structural features involved remain unclear. Here, we showed that citrus pectin modified by heat treatment displayed cytotoxic effects in cancer cells. A fractionation approach was used aiming to identify active molecules. Dialysis and ethanol precipitation followed by HPLC analysis evidenced that most of the activity was related to molecules with molecular weight corresponding to low degree of polymerization oligogalacturonic acid. Heat-treatment of galacturonic acid also generated cytotoxic molecules. Furthermore, heat-modified galacturonic acid and heat-fragmented pectin contained the same molecule that induced cell death when isolated by HPLC separation. Mass spectrometry analyses revealed that 4,5-dihydroxy-2-cyclopenten-1-one was one cytotoxic molecule present in heat-treated pectin. Finally, we synthesized the enantiopure (4R,5R)-4,5-dihydroxy-2-cyclopenten-1-one and demonstrated that this molecule was cytotoxic and induced a similar pattern of apoptotic-like features than heat-modified pectin. Copyright © 2015 Elsevier Ltd. All rights reserved.
Directory of Open Access Journals (Sweden)
Nilisha Rastogi
Full Text Available Lactoferrin is an 80 kDa bilobal, iron binding glycoprotein which is primarily antimicrobial in nature. The hydrolysis of lactoferrin by various proteases in the gut produces several functional fragments of lactoferrin which have varying molecular sizes and properties. Here, bovine lactoferrin has been hydrolyzed by trypsin, the major enzyme present in the gut, to produce three functional molecules of sizes approximately 21 kDa, 38 kDa and 45 kDa. The molecules have been purified using ion exchange and gel filtration chromatography and identified using N-terminal sequencing, which reveals that while the 21 kDa molecule corresponds to the N2 domain (21LF, the 38 kDa represents the whole C-lobe (38LF and the 45 kDa is a portion of N1 domain of N-lobe attached to the C-lobe (45LF. The iron binding and release properties of 21LF, 38LF and 45LF have been studied and compared. The sequence and structure analysis of the portions of the excision sites of LF from various species have been done. The antibacterial properties of these three molecules against bacterial strains, Streptococcus pyogenes, Escherichia coli, Yersinia enterocolitica and Listeria monocytogenes were investigated. The antifungal action of the molecules was also evaluated against Candida albicans. This is the first report on the antimicrobial actions of the trypsin cleaved functional molecules of lactoferrin from any species.
Mixing of alcohol and water molecules studied by neutron probe. Structure and dynamics
International Nuclear Information System (INIS)
Yoshida, Koji
2001-01-01
Structure of water/alcohol mixing solution was studied by three methods such as an isotope-exchanged neutron scattering method, RISM (Reference Interaction Site Model) integral equation and a neutron spin echo method. The principle of methods, experiments and results were reported. The results of experiments of water/tert-butyl alcohol (TBA) solution by the isotope-exchange neutron scattering method showed TBA molecule associated with each other through end methyl group. Especially this effect was the largest at x TBA = 0.06 and decreased with increasing the concentration of TBA. However, hydrogen bonding of TBA was very rare at x TBA = 0.06. By the partial radial distribution function obtained from RISM integral equation, it indicated that the structure of pure TBA became chain structure by hydrogen bond but changed to the structure contacted directly each hydrophobic group with increasing the concentration of water. Water/2-butoxyethanol (BE) mixing solution was measured by a neutron spin echo method. The activation energy of the diffusion coefficients obtained agreed to the energy of hydrogen bonding. The temperature response of diffusion coefficients showed the inverse of the experimental results obtained by the dynamic light scattering method. The difference between two measurement methods was different time scale and space scale. Namely, the object of the neutron scattering method is nano meter and nano second, but one of light scattering method many times over. It was proved from the above results that there was the cluster consisted of the same kind of molecule in the homogeneous two components solution, but the cluster was not stable and constantly exchanged with molecule, where the production and decay of the cluster is repeated at about nano sec. (S.Y.)
International Nuclear Information System (INIS)
Myneni, Satish C.
2008-01-01
Organic molecules are common in all Earth surface environments, and their composition and chemistry play an important role in a variety of biogeochemical reactions, such as mineral weathering, nutrient cycling and the solubility and transport of contaminants. However, most of what we know about the chemistry of these molecules comes from spectroscopy and microscopy studies of organic molecules extracted from different natural systems using either inorganic or organic solvents. Although all these methods gave us clues about the composition of these molecules, their composition and structure change with the extraction and the type of ex-situ analysis, their true behavior is less well understood. The goal of this project is to develop synchrotron instrumentation for studying natural organics, and to apply these recently developed synchrotron X-ray spectroscopy and microscopy techniques for understanding the: (1) functional group composition of naturally occurring organic molecules; (2) macromolecular structures of organic molecules; and (3) the nature of interactions of organic molecules with mineral surfaces in different environmental conditions.
Functional materials discovery using energy-structure-function maps.
Pulido, Angeles; Chen, Linjiang; Kaczorowski, Tomasz; Holden, Daniel; Little, Marc A; Chong, Samantha Y; Slater, Benjamin J; McMahon, David P; Bonillo, Baltasar; Stackhouse, Chloe J; Stephenson, Andrew; Kane, Christopher M; Clowes, Rob; Hasell, Tom; Cooper, Andrew I; Day, Graeme M
2017-03-30
Molecular crystals cannot be designed in the same manner as macroscopic objects, because they do not assemble according to simple, intuitive rules. Their structures result from the balance of many weak interactions, rather than from the strong and predictable bonding patterns found in metal-organic frameworks and covalent organic frameworks. Hence, design strategies that assume a topology or other structural blueprint will often fail. Here we combine computational crystal structure prediction and property prediction to build energy-structure-function maps that describe the possible structures and properties that are available to a candidate molecule. Using these maps, we identify a highly porous solid, which has the lowest density reported for a molecular crystal so far. Both the structure of the crystal and its physical properties, such as methane storage capacity and guest-molecule selectivity, are predicted using the molecular structure as the only input. More generally, energy-structure-function maps could be used to guide the experimental discovery of materials with any target function that can be calculated from predicted crystal structures, such as electronic structure or mechanical properties.
Structural Basis for Selective Small Molecule Kinase Inhibition of Activated c-Met
Energy Technology Data Exchange (ETDEWEB)
Rickert, Keith W.; Patel, Sangita B.; Allison, Timothy J.; Byrne, Noel J.; Darke, Paul L.; Ford, Rachael E.; Guerin, David J.; Hall, Dawn L.; Kornienko, Maria; Lu, Jun; Munshi, Sanjeev K.; Reid, John C.; Shipman, Jennifer M.; Stanton, Elizabeth F.; Wilson, Kevin J.; Young, Jonathon R.; Soisson, Stephen M.; Lumb, Kevin J. (Merck)
2012-03-15
The receptor tyrosine kinase c-Met is implicated in oncogenesis and is the target for several small molecule and biologic agents in clinical trials for the treatment of cancer. Binding of the hepatocyte growth factor to the cell surface receptor of c-Met induces activation via autophosphorylation of the kinase domain. Here we describe the structural basis of c-Met activation upon autophosphorylation and the selective small molecule inhibiton of autophosphorylated c-Met. MK-2461 is a potent c-Met inhibitor that is selective for the phosphorylated state of the enzyme. Compound 1 is an MK-2461 analog with a 20-fold enthalpy-driven preference for the autophosphorylated over unphosphorylated c-Met kinase domain. The crystal structure of the unbound kinase domain phosphorylated at Tyr-1234 and Tyr-1235 shows that activation loop phosphorylation leads to the ejection and disorder of the activation loop and rearrangement of helix {alpha}C and the G loop to generate a viable active site. Helix {alpha}C adopts a orientation different from that seen in activation loop mutants. The crystal structure of the complex formed by the autophosphorylated c-Met kinase domain and compound 1 reveals a significant induced fit conformational change of the G loop and ordering of the activation loop, explaining the selectivity of compound 1 for the autophosphorylated state. The results highlight the role of structural plasticity within the kinase domain in imparting the specificity of ligand binding and provide the framework for structure-guided design of activated c-Met inhibitors.
Structural and mechanical properties of glassy water in nanoscale confinement.
Lombardo, Thomas G; Giovambattista, Nicolás; Debenedetti, Pablo G
2009-01-01
We investigate the structure and mechanical properties of glassy water confined between silica-based surfaces with continuously tunable hydrophobicity and hydrophilicity by computing and analyzing minimum energy, mechanically stable configurations (inherent structures). The structured silica substrate imposes long-range order on the first layer of water molecules under hydrophobic confinement at high density (p > or = 1.0 g cm(-3)). This proximal layer is also structured in hydrophilic confinement at very low density (p approximately 0.4 g cm(-3)). The ordering of water next to the hydrophobic surface greatly enhances the mechanical strength of thin films (0.8 nm). This leads to a substantial stress anisotropy; the transverse strength of the film exceeds the normal strength by 500 MPa. The large transverse strength results in a minimum in the equation of state of the energy landscape that does not correspond to a mechanical instability, but represents disruption of the ordered layer of water next to the wall. In addition, we find that the mode of mechanical failure is dependent on the type of confinement. Under large lateral strain, water confined by hydrophilic surfaces preferentially forms voids in the middle of the film and fails cohesively. In contrast, water under hydrophobic confinement tends to form voids near the walls and fails by loss of adhesion.
Transport mirages in single-molecule devices
Gaudenzi, R.; Misiorny, M.; Burzurí, E.; Wegewijs, M. R.; van der Zant, H. S. J.
2017-03-01
Molecular systems can exhibit a complex, chemically tailorable inner structure which allows for targeting of specific mechanical, electronic, and optical properties. At the single-molecule level, two major complementary ways to explore these properties are molecular quantum-dot structures and scanning probes. This article outlines comprehensive principles of electron-transport spectroscopy relevant to both these approaches and presents a new, high-resolution experiment on a high-spin single-molecule junction exemplifying these principles. Such spectroscopy plays a key role in further advancing our understanding of molecular and atomic systems, in particular, the relaxation of their spin. In this joint experimental and theoretical analysis, particular focus is put on the crossover between the resonant regime [single-electron tunneling] and the off-resonant regime [inelastic electron (co)tunneling spectroscopy (IETS)]. We show that the interplay of these two processes leads to unexpected mirages of resonances not captured by either of the two pictures alone. Although this turns out to be important in a large fraction of the possible regimes of level positions and bias voltages, it has been given little attention in molecular transport studies. Combined with nonequilibrium IETS—four-electron pump-probe excitations—these mirages provide crucial information on the relaxation of spin excitations. Our encompassing physical picture is supported by a master-equation approach that goes beyond weak coupling. The present work encourages the development of a broader connection between the fields of molecular quantum-dot and scanning probe spectroscopy.
Structure of the Buried Metal-Molecule Interface in Organic Thin Film Devices
DEFF Research Database (Denmark)
Hansen, Christian Rein; Sørensen, Thomas Just; Glyvradal, Magni
2009-01-01
By use of specular X-ray reflectivity (XR) the structure of a metal-covered organic thin film device is measured with angstrom resolution. The model system is a Langmuir-Blodgett (LB) film, sandwiched between a silicon substrate and a top electrode consisting of 25 Å titanium and 100 Å aluminum....... By comparison of XR data for the five-layer Pb2+ arachidate LB film before and after vapor deposition of the Ti/Al top electrode, a detailed account of the structural damage to the organic film at the buried metal-molecule interface is obtained. We find that the organized structure of the two topmost LB layers...
Duerinck, Tim; Couck, Sarah; Vermoortele, Frederik; De Vos, Dirk E; Baron, Gino V; Denayer, Joeri F M
2012-10-02
The low coverage adsorptive properties of the MIL-47 metal organic framework toward aromatic and heterocyclic molecules are reported in this paper. The effect of molecular functionality and size on Henry adsorption constants and adsorption enthalpies of alkyl and heteroatom functionalized benzene derivates and heterocyclic molecules was studied using pulse gas chromatography. By means of statistical analysis, experimental data was analyzed and modeled using principal component analysis and partial least-squares regression. Structure-property relationships were established, revealing and confirming several trends. Among the molecular properties governing the adsorption process, vapor pressure, mean polarizability, and dipole moment play a determining role.
Energy Technology Data Exchange (ETDEWEB)
Kimori, Yoshitaka [Division of Biomolecular Imaging, Institute of Medical Science, The University of Tokyo, Minato-ku, Tokyo 108-8639 (Japan); Department of Bioscience and Bioinformatics, Kyushu Institute of Technology, Iizuka, Fukuoka 820-8502 (Japan); Oguchi, Yosuke [Department of Electric Engineering, Kogakuin University, Hachioji, Tokyo 192-0015 (Japan); Ichise, Norihiko [Department of Visual Communication, Komazawa Women' s University, Inagi, Tokyo 206-8511 (Japan); Baba, Norio [Department of Electric Engineering, Kogakuin University, Hachioji, Tokyo 192-0015 (Japan); Katayama, Eisaku [Division of Biomolecular Imaging, Institute of Medical Science, The University of Tokyo, Minato-ku, Tokyo 108-8639 (Japan)]. E-mail: ekatayam@ims.u-tokyo.ac.jp
2007-01-15
Quick-freeze deep-etch replica electron microscopy gives high contrast snapshots of individual protein molecules under physiological conditions in vitro or in situ. The images show delicate internal pattern, possibly reflecting the rotary-shadowed surface profile of the molecule. As a step to build the new system for the 'Structural analysis of single molecules', we propose a procedure to quantitatively characterize the structural property of individual molecules; e.g. conformational type and precise view-angle of the molecules, if the crystallographic structure of the target molecule is available. This paper presents a framework to determine the observed face of the protein molecule by analyzing the surface profile of individual molecules visualized in freeze-replica specimens. A comprehensive set of rotary-shadowed views of the protein molecule was artificially generated from the available atomic coordinates using light-rendering software. Exploiting new mathematical morphology-based image filter, characteristic features were extracted from each image and stored as template. Similar features were extracted from the true replica image and the most likely projection angle and the conformation of the observed particle were determined by quantitative comparison with a set of archived images. The performance and the robustness of the procedure were examined with myosin head structure in defined configuration for actual application.
International Nuclear Information System (INIS)
Kimori, Yoshitaka; Oguchi, Yosuke; Ichise, Norihiko; Baba, Norio; Katayama, Eisaku
2007-01-01
Quick-freeze deep-etch replica electron microscopy gives high contrast snapshots of individual protein molecules under physiological conditions in vitro or in situ. The images show delicate internal pattern, possibly reflecting the rotary-shadowed surface profile of the molecule. As a step to build the new system for the 'Structural analysis of single molecules', we propose a procedure to quantitatively characterize the structural property of individual molecules; e.g. conformational type and precise view-angle of the molecules, if the crystallographic structure of the target molecule is available. This paper presents a framework to determine the observed face of the protein molecule by analyzing the surface profile of individual molecules visualized in freeze-replica specimens. A comprehensive set of rotary-shadowed views of the protein molecule was artificially generated from the available atomic coordinates using light-rendering software. Exploiting new mathematical morphology-based image filter, characteristic features were extracted from each image and stored as template. Similar features were extracted from the true replica image and the most likely projection angle and the conformation of the observed particle were determined by quantitative comparison with a set of archived images. The performance and the robustness of the procedure were examined with myosin head structure in defined configuration for actual application
Directory of Open Access Journals (Sweden)
Nuri ÖZTÜRK
2018-02-01
Full Text Available The experimental spectroscopic investigation of N-benzyloxycarbonyloxy-5-norbornene-2,3-dicarboximide (C17H15NO5 molecule has been done using 1H and 13C NMR chemical shifts, FT-IR and Raman spectroscopies. Conformational forms have been determined depending on orientation of N-benzyloxycarbonyloxy and 5-norbornene-2,3-dicarboximide (NDI groups of the title compound. The structural geometric optimizations, vibrational wavenumbers, NMR chemical shifts (in vacuum and chloroform and HOMO-LUMO analyses for all conformers of the title molecule have been done with DFT/CAM-B3LYP method at the 6-311++G(d,p basis set. Additionally, based on the calculated HOMO and LUMO energy values, some molecular properties such as ionization potential (I, electron affinity (A, electronegativity (χ, chemical hardness (h, chemical softness (z, chemical potential (μ and electrophilicity index (w parameters are determined for all conformers. The non-linear optical (NLO properties have been studied for the title molecule. We can say that the experimental spectral data are in accordance with calculated values.
Structure and dynamics of water and lipid molecules in charged anionic DMPG lipid bilayer membranes
International Nuclear Information System (INIS)
Rønnest, A. K.; Peters, G. H.; Hansen, F. Y.; Taub, H.; Miskowiec, A.
2016-01-01
Molecular dynamics simulations have been used to investigate the influence of the valency of counter-ions on the structure of freestanding bilayer membranes of the anionic 1,2-dimyristoyl-sn-glycero-3-phosphoglycerol (DMPG) lipid at 310 K and 1 atm. At this temperature, the membrane is in the fluid phase with a monovalent counter-ion and in the gel phase with a divalent counter-ion. The diffusion constant of water as a function of its depth in the membrane has been determined from mean-square-displacement calculations. Also, calculated incoherent quasielastic neutron scattering functions have been compared to experimental results and used to determine an average diffusion constant for all water molecules in the system. On extrapolating the diffusion constants inferred experimentally to a temperature of 310 K, reasonable agreement with the simulations is obtained. However, the experiments do not have the sensitivity to confirm the diffusion of a small component of water bound to the lipids as found in the simulations. In addition, the orientation of the dipole moment of the water molecules has been determined as a function of their depth in the membrane. Previous indirect estimates of the electrostatic potential within phospholipid membranes imply an enormous electric field of 10 8 –10 9 V m −1 , which is likely to have great significance in controlling the conformation of translocating membrane proteins and in the transfer of ions and molecules across the membrane. We have calculated the membrane potential for DMPG bilayers and found ∼1 V (∼2 ⋅ 10 8 V m −1 ) when in the fluid phase with a monovalent counter-ion and ∼1.4 V (∼2.8 ⋅ 10 8 V m −1 ) when in the gel phase with a divalent counter-ion. The number of water molecules for a fully hydrated DMPG membrane has been estimated to be 9.7 molecules per lipid in the gel phase and 17.5 molecules in the fluid phase, considerably smaller than inferred experimentally for 1,2-dimyristoyl-sn-glycero-3
Structure and dynamics of water and lipid molecules in charged anionic DMPG lipid bilayer membranes
Energy Technology Data Exchange (ETDEWEB)
Rønnest, A. K.; Peters, G. H.; Hansen, F. Y., E-mail: flemming@kemi.dtu.dk [Department of Chemistry, Technical University of Denmark, IK 207 DTU, DK-2800 Lyngby (Denmark); Taub, H.; Miskowiec, A. [Department of Physics and Astronomy and the University of Missouri Research Reactor,University of Missouri, Columbia, Missouri 65211 (United States)
2016-04-14
Molecular dynamics simulations have been used to investigate the influence of the valency of counter-ions on the structure of freestanding bilayer membranes of the anionic 1,2-dimyristoyl-sn-glycero-3-phosphoglycerol (DMPG) lipid at 310 K and 1 atm. At this temperature, the membrane is in the fluid phase with a monovalent counter-ion and in the gel phase with a divalent counter-ion. The diffusion constant of water as a function of its depth in the membrane has been determined from mean-square-displacement calculations. Also, calculated incoherent quasielastic neutron scattering functions have been compared to experimental results and used to determine an average diffusion constant for all water molecules in the system. On extrapolating the diffusion constants inferred experimentally to a temperature of 310 K, reasonable agreement with the simulations is obtained. However, the experiments do not have the sensitivity to confirm the diffusion of a small component of water bound to the lipids as found in the simulations. In addition, the orientation of the dipole moment of the water molecules has been determined as a function of their depth in the membrane. Previous indirect estimates of the electrostatic potential within phospholipid membranes imply an enormous electric field of 10{sup 8}–10{sup 9} V m{sup −1}, which is likely to have great significance in controlling the conformation of translocating membrane proteins and in the transfer of ions and molecules across the membrane. We have calculated the membrane potential for DMPG bilayers and found ∼1 V (∼2 ⋅ 10{sup 8} V m{sup −1}) when in the fluid phase with a monovalent counter-ion and ∼1.4 V (∼2.8 ⋅ 10{sup 8} V m{sup −1}) when in the gel phase with a divalent counter-ion. The number of water molecules for a fully hydrated DMPG membrane has been estimated to be 9.7 molecules per lipid in the gel phase and 17.5 molecules in the fluid phase, considerably smaller than inferred experimentally for 1
Effects of a donor on the bond property of quantum-dot molecules
Institute of Scientific and Technical Information of China (English)
Wang Li-Min; Luo Ying; Ma Ben-Kun; Duan Su-Qing; Zhao Xian-Geng
2004-01-01
Within the framework of effective mass approximation, we have calculated the electronic structure of the two laterally coupled quantum dots with a donor by the finite element method. The calculated results show that the bond states of quantum-dot molecules are quite sensitive to the donor positions. By varying the donor position, the transition from covalent to ionic bond state is realized for some electronic states. Some extreme cases are also discussed for comparison.
Physics of Complex Polymeric Molecules
Kelly, Joshua Walter
The statistical physics of complex polymers with branches and circuits is the topic of this dissertation. An important motivation are large, single-stranded (ss) RNA molecules. Such molecules form complex ``secondary" and ``tertiary" structures that can be represented as branched polymers with circuits. Such structures are in part directly determined by the nucleotide sequence and in part subject to thermal fluctuations. The polymer physics literature on molecules in this class has mostly focused on randomly branched polymers without circuits while there has been minimal research on polymers with specific structures and on polymers that contain circuits. The dissertation is composed of three parts: Part I studies branched polymers with thermally fluctuating structure confined to a potential well as a simple model for the encapsidation of viral RNA. Excluded volume interactions were ignored. In Part II, I apply Flory theory to the study of the encapsidation of viral ss RNA molecules with specific branched structures, but without circuits, in the presence of excluded volume interaction. In Part III, I expand on Part II and consider complex polymers with specific structure including both branching and circuits. I introduce a method based on the mathematics of Laplacian matrices that allows me to calculate density profiles for such molecules, which was not possible within Flory theory.
Cellulose nanomaterials review: structure, properties and nanocomposites
Robert J. Moon; Ashlie Martini; John Nairn; John Simonsen; Jeff Youngblood
2011-01-01
This critical review provides a processing-structure-property perspective on recent advances in cellulose nanoparticles and composites produced from them. It summarizes cellulose nanoparticles in terms of particle morphology, crystal structure, and properties. Also described are the self-assembly and rheological properties of cellulose nanoparticle suspensions. The...
Conserved water molecules in bacterial serine hydroxymethyltransferases.
Milano, Teresa; Di Salvo, Martino Luigi; Angelaccio, Sebastiana; Pascarella, Stefano
2015-10-01
Water molecules occurring in the interior of protein structures often are endowed with key structural and functional roles. We report the results of a systematic analysis of conserved water molecules in bacterial serine hydroxymethyltransferases (SHMTs). SHMTs are an important group of pyridoxal-5'-phosphate-dependent enzymes that catalyze the reversible conversion of l-serine and tetrahydropteroylglutamate to glycine and 5,10-methylenetetrahydropteroylglutamate. The approach utilized in this study relies on two programs, ProACT2 and WatCH. The first software is able to categorize water molecules in a protein crystallographic structure as buried, positioned in clefts or at the surface. The other program finds, in a set of superposed homologous proteins, water molecules that occur approximately in equivalent position in each of the considered structures. These groups of molecules are referred to as 'clusters' and represent structurally conserved water molecules. Several conserved clusters of buried or cleft water molecules were found in the set of 11 bacterial SHMTs we took into account for this work. The majority of these clusters were not described previously. Possible structural and functional roles for the conserved water molecules are envisaged. This work provides a map of the conserved water molecules helpful for deciphering SHMT mechanism and for rational design of molecular engineering experiments. © The Author 2015. Published by Oxford University Press. All rights reserved. For Permissions, please e-mail: journals.permissions@oup.com.
Directory of Open Access Journals (Sweden)
Ruijin Hong
2017-01-01
Full Text Available Au/graphene oxide/Ag sandwich structure thin film was fabricated. The effects of graphene oxide (GO and bimetal on the structure and optical properties of metal silver films were investigated by X-ray diffraction (XRD, optical absorption, and Raman intensity measurements, respectively. Compared to silver thin film, Au/graphene oxide/Ag sandwich structure composite thin films were observed with wider optical absorption peak and enhanced absorption intensity. The Raman signal for Rhodamine B molecules based on the Au/graphene oxide/Ag sandwich nanostructure substrate were obviously enhanced due to the bimetal layer and GO layer with tunable absorption intensity and fluorescence quenching effects.
Collier, Thomas A; Nash, Anthony; Birch, Helen L; de Leeuw, Nora H
2018-02-15
Type I collagen is an essential extracellular protein that plays an important structural role in tissues that require high tensile strength. However, owing to the molecule's size, to date no experimental structural data are available for the Homo sapiens species. Therefore, there is a real need to develop a reliable homology model and a method to study the packing of the collagen molecules within the fibril. Through the use of the homology model and implementation of a novel simulation technique, we have ascertained the orientations of the collagen molecules within a fibril, which is currently below the resolution limit of experimental techniques. The longitudinal orientation of collagen molecules within a fibril has a significant effect on the mechanical and biological properties of the fibril, owing to the different amino acid side chains available at the interface between the molecules.
Structures and anti-inflammatory properties of 4-halogenated -mofebutazones
Reichelt, Hendrik; Paradies, Henrich H.
2018-02-01
The crystal structures of the 4-halogenated (hal: F, Cl, Br)-4-butyl-1-phenyl-1,3-pyrolidine-dione (mofebutazone) are determined, and compared with their solution structures. The racemic 4-halogenated mofebutazone approximants crystallize in a monoclinic space group with four molecules in the unit cell. The 4-hal-mofebutazone molecules reveal strong hydrogen bonding between the hydrogen atom located at the N-2 nitrogen atom and a carbonyl oxygen atom of an adjacent 4-hal-mofebutazone molecule. The hydrogen bond angle for 4-Br-mifebutazone N (2)sbnd H (1)⋯O (1) is 173(3) °, so that the hydrogen bond is essentially linear indicating an infinite chain hydrogen bond network. The 3d and 2d structures are stabilized by π-π and σ-π interactions, short intermolecular distances, and apolar forces between adjacently stacked phenyl rings. Small-angle-X-ray scattering (SAXS) experiments and osmometric measurements reveal the presence of dimers for the 4-hal-mofebutazone molecules. Molecular simulations indicate similar solution structure factors for the 4-hal-mofebutazones solutions, S(Q), and in the solid state. There is a strong indication that the [1,1,0], [1,0,0], and [1,0,0] periodicities of the 4-Brsbnd , 4-Clsbnd and 4-F-mofebutazone in the crystalline solid state were also present in the solution phase. The biochemical and cellular activities of the different 4-hal-mofebutazones were monitored by the magnitude of their inhibition of the PGE2 biosynthesis through the cyclo-oxygenase (COX-1) in macrophages, and on the inhibition of LTD4 (5-lipoxygenase) in polymorphonuclear leukocytes.
Elbing, Mark; Ochs, Rolf; Koentopp, Max; Fischer, Matthias; von Hänisch, Carsten; Weigend, Florian; Evers, Ferdinand; Weber, Heiko B.; Mayor, Marcel
2005-06-01
We have designed and synthesized a molecular rod that consists of two weakly coupled electronic π -systems with mutually shifted energy levels. The asymmetry thus implied manifests itself in a current-voltage characteristic with pronounced dependence on the sign of the bias voltage, which makes the molecule a prototype for a molecular diode. The individual molecules were immobilized by sulfur-gold bonds between both electrodes of a mechanically controlled break junction, and their electronic transport properties have been investigated. The results indeed show diode-like current-voltage characteristics. In contrast to that, control experiments with symmetric molecular rods consisting of two identical π -systems did not show significant asymmetries in the transport properties. To investigate the underlying transport mechanism, phenomenological arguments are combined with calculations based on density functional theory. The theoretical analysis suggests that the bias dependence of the polarizability of the molecule feeds back into the current leading to an asymmetric shape of the current-voltage characteristics, similar to the phenomena in a semiconductor diode. Author contributions: F.E., H.B.W., and M.M. designed research; M.E., R.O., M.K., M.F., F.E., H.B.W., and M.M. performed research; M.E., R.O., M.K., M.F., C.v.H., F.W., F.E., H.B.W., and M.M. contributed new reagents/analytic tools; M.E., R.O., M.K., C.v.H., F.E., H.B.W., and M.M. analyzed data; and F.E., H.B.W., and M.M. wrote the paper.This paper was submitted directly (Track II) to the PNAS office.Abbreviations: A, acceptor; D, donor; MCB, mechanically controlled break junction.Data deposition: The atomic coordinates have been deposited in the Cambridge Structural Database, Cambridge Crystallographic Data Centre, Cambridge CB2 1EZ, United Kingdom (CSD reference no. 241632).
Mechanical response of collagen molecule under hydrostatic compression
International Nuclear Information System (INIS)
Saini, Karanvir; Kumar, Navin
2015-01-01
Proteins like collagen are the basic building blocks of various body tissues (soft and hard). Collagen molecules find their presence in the skeletal system of the body where they bear mechanical loads from different directions, either individually or along with hydroxy-apatite crystals. Therefore, it is very important to understand the mechanical behavior of the collagen molecule which is subjected to multi-axial state of loading. The estimation of strains of collagen molecule along different directions resulting from the changes in hydrostatic pressure magnitude, can provide us new insights into its mechanical behavior. In the present work, full atomistic simulations have been used to study global (volumetric) as well as local (along different directions) mechanical properties of the hydrated collagen molecule which is subjected to different hydrostatic pressure magnitudes. To estimate the local mechanical properties, the strains of collagen molecule along its longitudinal and transverse directions have been acquired at different hydrostatic pressure magnitudes. In spite of non-homogeneous distribution of atoms within the collagen molecule, the calculated values of local mechanical properties have been found to carry the same order of magnitude along the longitudinal and transverse directions. It has been demonstrated that the values of global mechanical properties like compressibility, bulk modulus, etc. as well as local mechanical properties like linear compressibility, linear elastic modulus, etc. are functions of magnitudes of applied hydrostatic pressures. The mechanical characteristics of collagen molecule based on the atomistic model have also been compared with that of the continuum model in the present work. The comparison showed up orthotropic material behavior for the collagen molecule. The information on collagen molecule provided in the present study can be very helpful in designing the future bio-materials.
Mechanical response of collagen molecule under hydrostatic compression.
Saini, Karanvir; Kumar, Navin
2015-04-01
Proteins like collagen are the basic building blocks of various body tissues (soft and hard). Collagen molecules find their presence in the skeletal system of the body where they bear mechanical loads from different directions, either individually or along with hydroxy-apatite crystals. Therefore, it is very important to understand the mechanical behavior of the collagen molecule which is subjected to multi-axial state of loading. The estimation of strains of collagen molecule along different directions resulting from the changes in hydrostatic pressure magnitude, can provide us new insights into its mechanical behavior. In the present work, full atomistic simulations have been used to study global (volumetric) as well as local (along different directions) mechanical properties of the hydrated collagen molecule which is subjected to different hydrostatic pressure magnitudes. To estimate the local mechanical properties, the strains of collagen molecule along its longitudinal and transverse directions have been acquired at different hydrostatic pressure magnitudes. In spite of non-homogeneous distribution of atoms within the collagen molecule, the calculated values of local mechanical properties have been found to carry the same order of magnitude along the longitudinal and transverse directions. It has been demonstrated that the values of global mechanical properties like compressibility, bulk modulus, etc. as well as local mechanical properties like linear compressibility, linear elastic modulus, etc. are functions of magnitudes of applied hydrostatic pressures. The mechanical characteristics of collagen molecule based on the atomistic model have also been compared with that of the continuum model in the present work. The comparison showed up orthotropic material behavior for the collagen molecule. The information on collagen molecule provided in the present study can be very helpful in designing the future bio-materials. Copyright © 2015 Elsevier B.V. All rights
Mechanical response of collagen molecule under hydrostatic compression
Energy Technology Data Exchange (ETDEWEB)
Saini, Karanvir, E-mail: karans@iitrpr.ac.in; Kumar, Navin
2015-04-01
Proteins like collagen are the basic building blocks of various body tissues (soft and hard). Collagen molecules find their presence in the skeletal system of the body where they bear mechanical loads from different directions, either individually or along with hydroxy-apatite crystals. Therefore, it is very important to understand the mechanical behavior of the collagen molecule which is subjected to multi-axial state of loading. The estimation of strains of collagen molecule along different directions resulting from the changes in hydrostatic pressure magnitude, can provide us new insights into its mechanical behavior. In the present work, full atomistic simulations have been used to study global (volumetric) as well as local (along different directions) mechanical properties of the hydrated collagen molecule which is subjected to different hydrostatic pressure magnitudes. To estimate the local mechanical properties, the strains of collagen molecule along its longitudinal and transverse directions have been acquired at different hydrostatic pressure magnitudes. In spite of non-homogeneous distribution of atoms within the collagen molecule, the calculated values of local mechanical properties have been found to carry the same order of magnitude along the longitudinal and transverse directions. It has been demonstrated that the values of global mechanical properties like compressibility, bulk modulus, etc. as well as local mechanical properties like linear compressibility, linear elastic modulus, etc. are functions of magnitudes of applied hydrostatic pressures. The mechanical characteristics of collagen molecule based on the atomistic model have also been compared with that of the continuum model in the present work. The comparison showed up orthotropic material behavior for the collagen molecule. The information on collagen molecule provided in the present study can be very helpful in designing the future bio-materials.
International Nuclear Information System (INIS)
Godunov, I.A.; Bataev, V.A.; Maslov, D.V.; Yakovlev, N.N.
2017-01-01
The structure of conformational non-rigid molecules in the excited electronic states are investigated by joint theoretical and experimental methods. The theoretical part of work consist of two stages. In first stage the ab initio quantum-chemical calculations are carried out using high level methods. In second stage the vibrational problems of the various dimensions are solved by variational method for vibrations of large amplitude. In experimental part of work the vibronic spectra are investigated: gas-phase absorption and also, fluorescence excitation spectra of jet-cooled molecules. Some examples are considered.
Strain-induced formation of fourfold symmetric SiGe quantum dot molecules.
Zinovyev, V A; Dvurechenskii, A V; Kuchinskaya, P A; Armbrister, V A
2013-12-27
The strain field distribution at the surface of a multilayer structure with disklike SiGe nanomounds formed by heteroepitaxy is exploited to arrange the symmetric quantum dot molecules typically consisting of four elongated quantum dots ordered along the [010] and [100] directions. The morphological transition from fourfold quantum dot molecules to continuous fortresslike quantum rings with an increasing amount of deposited Ge is revealed. We examine key mechanisms underlying the formation of lateral quantum dot molecules by using scanning tunneling microscopy and numerical calculations of the strain energy distribution on the top of disklike SiGe nanomounds. Experimental data are well described by a simple thermodynamic model based on the accurate evaluation of the strain dependent part of the surface chemical potential. The spatial arrangement of quantum dots inside molecules is attributed to the effect of elastic property anisotropy.
Electronic structure of molecular Rydberg states of some small molecules and molecular ion
International Nuclear Information System (INIS)
Sun Biao; Li Jiaming
1993-01-01
Based on an independent-particle-approximation (i.e. the multiple scattering self-consistent-field theory), the electronic structures of Rydberg states of the small diatomic molecules H 2 , He 2 and the He 2 + molecular ion were studied. The principal quantum number of the first state of the Rydberg series is determined from a convention of the limit of the molecular electronic configuration. The dynamics of the excited molecules and molecular ion has been elucidated. The theoretical results are in fair agreement with the existing experimental measurements, thus they can serve as a reliable basis for future refined treatment such as the configuration interaction calculation
International Nuclear Information System (INIS)
Fan Zhi-Qiang; Zhang Zhen-Hua; Qiu Ming; Deng Xiao-Qing; Tang Gui-Ping
2012-01-01
We report the ab initio calculations of transport behaviors of an azobenzene molecular device which is similar to the experimental configurations. The calculated results show that the transport behaviors of the device are sensitive to the molecule-electrode distance and the currents will drop rapidly when the molecule-electrode distance changes from 1.7 Å to 2.0 Å. More interestingly, the negative differential resistance behavior can be found in our device. Nevertheless, it is not the inherent property of an azobenzene molecular device but an effect of the molecule-electrode distance. Detailed analyses of the molecular projected self-consistent Hamiltonian states and the transmission spectra of the system reveal the physical mechanism of these behaviors. (condensed matter: electronic structure, electrical, magnetic, and optical properties)
Secondary structure of 5S RNA: NMR experiments on RNA molecules partially labeled with Nitrogen-15
International Nuclear Information System (INIS)
Gewirth, D.T.; Abo, S.R.; Leontis, N.B.; Moore, P.B.
1987-01-01
A method has been found for reassembling fragment 1 of Escherichia coli 5S RNA from mixtures containing strand III (bases 69-87) and the complex consisting of strand II (bases 89-120) and strand IV (bases 1-11). The reassembled molecule is identical with unreconstituted fragment 1. With this technique, fragment 1 molecules have been constructed 15 N-labeled either in strand III or in the strand II-strand IV complex. Spectroscopic data obtained with these partially labeled molecules show that the terminal helix of 5S RNA includes the GU and GC base pairs at positions 9 and 10 which the standard model for 5S secondary structure predicts but that these base pairs are unstable both in the fragment and in native 5S RNA. The data also assign three resonances to the helix V region of the molecule (bases 70-77 and 99-106). None of these resonances has a normal chemical shift even though two of them correspond to AU or GU base pairs in the standard model. The implications of these findings for the authors understanding of the structure of 5S RNA and its complex with ribosomal protein L25 are discussed
Structural Approaches to Sequence Evolution Molecules, Networks, Populations
Bastolla, Ugo; Roman, H. Eduardo; Vendruscolo, Michele
2007-01-01
Structural requirements constrain the evolution of biological entities at all levels, from macromolecules to their networks, right up to populations of biological organisms. Classical models of molecular evolution, however, are focused at the level of the symbols - the biological sequence - rather than that of their resulting structure. Now recent advances in understanding the thermodynamics of macromolecules, the topological properties of gene networks, the organization and mutation capabilities of genomes, and the structure of populations make it possible to incorporate these key elements into a broader and deeply interdisciplinary view of molecular evolution. This book gives an account of such a new approach, through clear tutorial contributions by leading scientists specializing in the different fields involved.
Structure, Electronic and Nonlinear Optical Properties of Furyloxazoles and Thienyloxazoles
International Nuclear Information System (INIS)
Dagli, Ozlem; Gok, Rabia; Bahat, Mehmet; Ozbay, Akif
2016-01-01
Geometry optimization, electronic and nonlinear optical properties of isomers of furyloxazole and thienyloxazole molecules are carried out at the B3LYP/6-311++G(2d,p) level. The conformational analysis of 12 compounds have been studied as a function of torsional angle between rings. Electronic and NLO properties such as dipole moment, energy gap, polarizability and first hyperpolarizability were also calculated. (paper)
Structure of a Pheromone Receptor-Associated Mhc Molecule With An Open And Empty Groove
Energy Technology Data Exchange (ETDEWEB)
Olson, R.; Huey-Tubman, K.E.; Dulac, C.; Bjorkman, P.J.; /Caltech /Harvard U.
2006-10-06
Neurons in the murine vomeronasal organ (VNO) express a family of class Ib major histocompatibility complex (MHC) proteins (M10s) that interact with the V2R class of VNO receptors. This interaction may play a direct role in the detection of pheromonal cues that initiate reproductive and territorial behaviors. The crystal structure of M10.5, an M10 family member, is similar to that of classical MHC molecules. However, the M10.5 counterpart of the MHC peptide-binding groove is open and unoccupied, revealing the first structure of an empty class I MHC molecule. Similar to empty MHC molecules, but unlike peptide-filled MHC proteins and non-peptide-binding MHC homologs, M10.5 is thermally unstable, suggesting that its groove is normally occupied. However, M10.5 does not bind endogenous peptides when expressed in mammalian cells or when offered a mixture of class I-binding peptides. The F pocket side of the M10.5 groove is open, suggesting that ligands larger than 8-10-mer class I-binding peptides could fit by extending out of the groove. Moreover, variable residues point up from the groove helices, rather than toward the groove as in classical MHC structures. These data suggest that M10s are unlikely to provide specific recognition of class I MHC-binding peptides, but are consistent with binding to other ligands, including proteins such as the V2Rs.
Structure of a pheromone receptor-associated MHC molecule with an open and empty groove.
Directory of Open Access Journals (Sweden)
2005-08-01
Full Text Available Neurons in the murine vomeronasal organ (VNO express a family of class Ib major histocompatibility complex (MHC proteins (M10s that interact with the V2R class of VNO receptors. This interaction may play a direct role in the detection of pheromonal cues that initiate reproductive and territorial behaviors. The crystal structure of M10.5, an M10 family member, is similar to that of classical MHC molecules. However, the M10.5 counterpart of the MHC peptide-binding groove is open and unoccupied, revealing the first structure of an empty class I MHC molecule. Similar to empty MHC molecules, but unlike peptide-filled MHC proteins and non-peptide-binding MHC homologs, M10.5 is thermally unstable, suggesting that its groove is normally occupied. However, M10.5 does not bind endogenous peptides when expressed in mammalian cells or when offered a mixture of class I-binding peptides. The F pocket side of the M10.5 groove is open, suggesting that ligands larger than 8-10-mer class I-binding peptides could fit by extending out of the groove. Moreover, variable residues point up from the groove helices, rather than toward the groove as in classical MHC structures. These data suggest that M10s are unlikely to provide specific recognition of class I MHC-binding peptides, but are consistent with binding to other ligands, including proteins such as the V2Rs.
Hyperfine-Structure-Induced Depolarization of Impulsively Aligned I2 Molecules
Thomas, Esben F.; Søndergaard, Anders A.; Shepperson, Benjamin; Henriksen, Niels E.; Stapelfeldt, Henrik
2018-04-01
A moderately intense 450 fs laser pulse is used to create rotational wave packets in gas phase I2 molecules. The ensuing time-dependent alignment, measured by Coulomb explosion imaging with a delayed probe pulse, exhibits the characteristic revival structures expected for rotational wave packets but also a complex nonperiodic substructure and decreasing mean alignment not observed before. A quantum mechanical model attributes the phenomena to coupling between the rotational angular momenta and the nuclear spins through the electric quadrupole interaction. The calculated alignment trace agrees very well with the experimental results.
Spin-orbit-coupled Bose-Einstein condensates of rotating polar molecules
Deng, Y.; You, L.; Yi, S.
2018-05-01
An experimental proposal for realizing spin-orbit (SO) coupling of pseudospin 1 in the ground manifold 1Σ (υ =0 ) of (bosonic) bialkali polar molecules is presented. The three spin components are composed of the ground rotational state and two substates from the first excited rotational level. Using hyperfine resolved Raman processes through two select excited states resonantly coupled by a microwave, an effective coupling between the spin tensor and linear momentum is realized. The properties of Bose-Einstein condensates for such SO-coupled molecules exhibiting dipolar interactions are further explored. In addition to the SO-coupling-induced stripe structures, the singly and doubly quantized vortex phases are found to appear, implicating exciting opportunities for exploring novel quantum physics using SO-coupled rotating polar molecules with dipolar interactions.
Energy Technology Data Exchange (ETDEWEB)
Ganji, M. Darvish, E-mail: ganji_md@yahoo.com [Nanotechnology Research Institute, Faculty of Chemical Engineering, Babol Noshirvani University of Technology, Babol (Iran, Islamic Republic of); Gholian, M.; Mohammadzadeh, S. [Department of Chemistry, Qaemshahr Branch, Islamic Azad University, Qaemshahr (Iran, Islamic Republic of)
2014-09-30
Highlights: • ab initio DFT calculations were used for interaction of DMMP with BNNTs. • Full structural optimization was performed for several possible active sites. • Electronic structure of the energetically favorable complexes was analyzed. • The stability of the most stable complex was evaluated at ambient condition. • First-principles calculations showed that DMMP is strongly bound to the small diameter BNNTs. - Abstract: The adsorption of DMMP as an intoxicating chemical warfare agent onto the boron nitride nanotube has been investigated by using density functional theory calculations. Several active sites were considered for both interacting systems and full structural optimization was performed to accurately find the energetically favorable state. It is found that DMMP molecule prefers to be adsorbed strongly on the top site above the B atom of a (5, 0) BNNT with a binding energy of about −103.24 kJ mol{sup −1} and an O–B binding distance of 1.641 Å. We have performed a comparative investigation of BNNTs with different diameters and the results indicate that the DMMP adsorption ability for the side wall of the tubes significantly decreases for higher diameters BNNTs. Furthermore, the adsorption properties of DMMP molecule onto the BNNT have been investigated using the ab initio MD simulation at room temperature. Our result showed that BNNTs facilitates the DMMP detection at ambient conditions for practical applications.
Atomic-level structure and structure-property relationship in metallic glass
Cheng, Yongqiang
One of the key tasks in material science is to understand the structure and structure-property relationship. The recently emerging bulk metallic glasses (BMGs) have demonstrated unique properties, especially intriguing mechanical properties such as their high strength and high propensity to localize deformation in shear bands. However, a comprehensive understanding of the structure of BMGs has been hindered by the complexity of these amorphous materials. Even more challenging is the structure-property correlation, which has been well established in crystals but has been seriously lacking for BMGs. This thesis presents a systematic study of the atomic-level structures of two representative BMGs, Cu-Zr and Cu-Zr-Al. The interpenetrating Cu-centered icosahedral clusters have been identified to be the primary structural feature. The fraction of icosahedra increases with increasing Cu or Al contents, and with decreasing cooling rate. The effect of Al in improving the icosahedral order is two-fold: the geometric effect due to the atomic-size mismatch and the chemical effect originated from the Cu-Al bond shortening. The resolved structure is used to study the structure-property relationship. The full icosahedra are found to be responsible for the dynamical slowdown of the supercooled liquid, which underlies the non-Arrhenius behavior, and explains the composition dependence of glass transition temperature, glass forming ability, and the room temperature strength. By simulated deformation, the initiation of plasticity and tendency for strain localization are also investigated. The full icosahedra are found to be the most rigid and resistant cluster with solid-like character, while the unstable clusters with liquid-like character serve as the fertile sites for initiating shear transformations. In addition, the elastic moduli are calculated and analyzed, and the origins of the different configurational dependence of shear modulus (G) and bulk modulus ( B) are explained. The
Energy Technology Data Exchange (ETDEWEB)
Kergueris, Ch
1998-12-17
We investigate the electrical transport through a very few molecules connected to metallic electrodes at room temperature. First, the state of the art in molecular electronics is outlined. We present the most convincing molecular devices reported so far in the literature and the theoretical tools available to analyze the electron transport mechanism through a molecular junction. Second, we describe the use of mechanically controllable break junctions to investigate the electron transport properties through a metal-molecule-metal junction. Two kindsof molecules were adsorbed on the two facing gold electrodes, dodecane-thiol (DT) and bis-thiol-ter-thiophene ({alpha},{omega} T3), that are basically expected to behave as an insulator and as a molecular wire, respectively. In the latter case, we study the chemical reactivity of the molecule and show that {alpha},{omega} T3 is chemically adsorbed on gold electrodes. Current-voltage characteristics of the junction were observed at room temperature. The Gold-DT-Gold junction behaves as a simple metal-insulator-metal junction. On the other hand, the electron transport through a Gold-{alpha},{omega} T3-Gold junction explicitly involves the electronic structure of the molecule which gives rise to step-like features in the current-voltage characteristics. The measured zero bias conductance is interpreted using the scattering theory. At high bias, we discuss two different models: a coherent model where the electron has no time to be completely re-localized in the molecule and a sequential model where the electron is localized in the molecule during the transfer. Finally, we show that the mechanical action of decreasing the inter-electrodes spacing can be used to induce a strong modification of the current-voltage characteristics. (author)
The study of the valence bond property in a two-different-quantum-dot molecule
Institute of Scientific and Technical Information of China (English)
王立民; 罗莹; 马本堃
2002-01-01
The electronic energy spectrum and wavefunction of a quantum-dot molecule are studied by means of the finite-element solution of the single electron Schrodinger equation. We find that the nature of the coupling can be covalent,two dots, the height of potential barrier, matching of the energies and parities of the orbital localized on each dot. Thebond property can be used to explain the experimental result obtained by Oosterkamp et al. (1998 Nature 395 873).
International Nuclear Information System (INIS)
Winters, D.L.; Ling, A.C.
1976-01-01
The effects of γ-radiolysis at room temperature on adamantane and adamantane-d 16 matrices doped with 5-membered heterocyclic molecules has been examined by X-band electron spin resonance (esr) spectrometry. Radical structures formed from heterocyclic solute molecules are discussed and tentative assignments made. Discussion of possible radical structures derived from selected heterocyclic compounds is included, but unambiguous assignmens of structure cannot be made for these compounds from the esr data obtained. It was noted that perdeuterated adamantane matrices provided superior resolution for esr spectra derived from radicals with a delocalized spin center such as allyl or allenyl species. (author)
Hiong Teh, Thomas Kok; Hong Goh, James Cho; Toh, Siew Lok
2015-01-01
The interest in polymeric nanofibers has escalated over the past decade given its promise as tissue engineering scaffolds that can mimic the nanoscale structure of the native extracellular matrix. With functionalization of the polymeric nanofibers using bioactive molecules, localized signaling moieties can be established for the attached cells, to stimulate desired biological effects and direct cellular or tissue response. The inherently high surface area per unit mass of polymeric nanofibers can enhance cell adhesion, bioactive molecules loading and release efficiencies, and mass transfer properties. In this review article, the application of polymeric nanofibers for controlled bioactive molecules delivery will be discussed, with a focus on tendon and ligament tissue engineering. Various polymeric materials of different mechanical and degradation properties will be presented along with the nanofiber fabrication techniques explored. The bioactive molecules of interest for tendon and ligament tissue engineering, including growth factors and small molecules, will also be reviewed and compared in terms of their nanofiber incorporation strategies and release profiles. This article will also highlight and compare various innovative strategies to control the release of bioactive molecules spatiotemporally and explore an emerging tissue engineering strategy involving controlled multiple bioactive molecules sequential release. Finally, the review article concludes with challenges and future trends in the innovation and development of bioactive molecules delivery using polymeric nanofibers for tendon and ligament tissue engineering.
Structure determination by photoelectron diffraction of small molecules on surfaces
International Nuclear Information System (INIS)
Booth, N.A.
1998-05-01
The synchrotron radiation based technique of Photoelectron Diffraction (PhD) has been applied to three adsorption systems. Structure determinations, are presented for each system which involve the adsorption of small molecules on the low index {110} plane of single crystal Cu and Ni substrates. For the NH 3 -Cu(110) system PhD was successful in determining a N-Cu bondlength of 2.05 ± 0.03 A as well as values for the anisotropic vibrational amplitudes of the N and an expansion of the 1st to 2nd Cu substrate layer spacing from the bulk value of 0.08 ± 0.08 A. The most significant and surprising structural parameter determined for this system was that the N atom occupies an asymmetric adsorption site. Rather than being situated in the expected high symmetry atop site the N atom was found to be offset parallel to the surface by 0.37 ± 0.12 A in the [001] azimuth. In studying the glycine-Cu(110) system the adsorption structure of an amino-acid has been quantified. The local adsorption geometries of all the atoms involved in the molecule to surface bond have been determined. The glycine molecule is found to be bonded to the surface via both its amino and carboxylate functional groups. The molecule straddles two [11-bar0] rows of the Cu substrate. The two O atoms are found to be in identical sites both approximately atop Cu atoms on the [11-bar0] rows offset parallel to the surface by 0.80 ± 0.05 A in the [001] azimuth, the O-Cu bondlength was found to be 2.03 ± 0.05 A. The N atom was also found to adsorb in an approximately atop geometry but offset parallel to the surface by 0.24 ± 0.10A in the [11-bar0] direction, the N-Cu bondlength was found to be 2.05± 0.05 A. PhD was unsuccessful in determining the positions of the two C atoms that form a bridge between the two functional groups bonded to the surface due to difficulties in separating the two inequivalent contributions to the final intensity modulation function. For the CN-Ni(110) system both PhD and Near Edge
Tertiary Structures of the Escherichia coli and Human Chromosome 21 Molecules of DNA
Czech Academy of Sciences Publication Activity Database
Hanzálek, Petr; Kypr, Jaroslav
2001-01-01
Roč. 283, č. 1 (2001), s. 219-223 ISSN 0006-291X R&D Projects: GA AV ČR IAA5004802 Institutional research plan: CEZ:AV0Z5004920 Keywords : DNA crystal structures * phosphorus atom representation * genomic DNA molecules Subject RIV: BO - Biophysics Impact factor: 2.946, year: 2001
Effects of Magnetic Field on the Valence Bond Property of the Double-Quantum-Dot Molecule
Institute of Scientific and Technical Information of China (English)
王立民; 罗莹; 马本堃
2002-01-01
The effects of the magnetic field on the valence bond property of the double-quantum-dot molecule are numerically studied by the finite element method and perturbation approach because of the absence of cylindrical symmetry in the horizontally coupled dots. The calculation results show that the energy value of the ground state changes differently from that of the first excited state with increasing magnetic field strength, and they cross under a certain magnetic field. The increasing magnetic field makes the covalent bond state change into an ionic bond state, which agrees qualitatively with experimental results and makes ionic bond states remain. The oscillator strength of transition between covalent bond states decreases distinctly with the increasing magnetic field strength, when the molecule is irradiated by polarized light. Such a phenomenon is possibly useful for actual applications.
Needham, David
1993-01-01
The objectives are to demonstrate how we can make direct measurements of the mechanical properties of a special structure in biology, namely the lipid bilayer membrane, using a micromanipulation technique, and how these properties compare and contrast with 'more traditional' technological/engineering materials. Given that the investment in equipment and expertise to carry out these experiments is probably beyond the scope of most teaching labs, the described experiment is not intended as one that can actually be demonstrated in a student laboratory class. The intention behind presenting this work is to begin to raise awareness in the Material Science community about the material properties of biological material that form a new (to us) category of soft engineering materials that have dimensions on the nanoscale.
DEFF Research Database (Denmark)
Thomsen, Jon Juel; Blekhman, Iliya I.
2007-01-01
What are the effective properties of a generally nonlinear material or structure, whose local properties are modulated in both space and time? It has been suggested to use spatiotemporal modulation of structural properties to create materials and structures with adjustable effective properties......, and to call these dynamic materials or spatiotemporal composites. Also, according to theoretical predictions, structural nonlinearity enhances the possibilities of achieving specific effective properties. For example, with an elastic rod having cubical elastic nonlinearities, it seems possible to control......, and exemplified. Then simple approximate analytical expressions are derived for the effective wave speed and natural frequencies for one-dimensional wave propagation in a nonlinear elastic rod, where the spatiotemporal modulation is imposed as a high-frequency standing wave, supposed to be given. Finally the more...
Wang, Jian; Dong, Xiao; Xue, Min; Dong, Xuemin; Xu, Zhibin; Meng, Zihui; Luo, Jun
2016-06-01
The molecularly imprinted polymers (MIPs) for two structural analogs, 1,3,5-triacetyl-1,3,5-triazacyclohexane (TRAT) and 1,3,5,7-tetraacetyl-1,3,5,7-tetraazacyclooctane (TAT), have been synthesized respectively under the same conditions. The TAT-MIP showed excellent imprinting effect, whereas the TRAT-MIP did not. To understand the different imprinting effects of the MIPs prepared from these two templates, the geometric structures and energetic properties of complexes formed around TAT and TRAT were studied computationally. The results indicate that in liquid phase, for the complexes formed with TAT and its nearest neighbor molecules, the magnitude of the binding energy increases with the number of surrounding TAT, methacrylic acid, and acetonitrile (ACT), whereas for the cases of TRAT, the magnitude of the binding energy increases with the number of surrounding TRAT and trimethylolpropane trimethacrylate. The studied systems form stronger and thus more stable networks encapsulating TAT than with TRAT. ACT may also play an important role in the polymerization phase in stabilizing the shapes of the cavities that TATs reside in. We propose these as the major factors that affect the different imprinting effects of the two MIPs. Copyright © 2016 John Wiley & Sons, Ltd. Copyright © 2016 John Wiley & Sons, Ltd.
Structure Property Relationships in Organic Conjugated Systems
O'Neill, Luke; Lynch, Patrick; McNamara, Mary
2005-01-01
A series of π conjugated oligomers were studied by absorption and photoluminescence spectroscopy. A linear relationship between the positioning of the absorption and photoluminescence maxima plotted against inverse conjugation length is observed. The relationships are in good agreement with the simple particle in a box method, one of the earliest descriptions of the properties of one-dimensional organic molecules. In addition to the electronic transition energies, it was observed that the Sto...
Statistical Exploration of Electronic Structure of Molecules from Quantum Monte-Carlo Simulations
Energy Technology Data Exchange (ETDEWEB)
Prabhat, Mr; Zubarev, Dmitry; Lester, Jr., William A.
2010-12-22
In this report, we present results from analysis of Quantum Monte Carlo (QMC) simulation data with the goal of determining internal structure of a 3N-dimensional phase space of an N-electron molecule. We are interested in mining the simulation data for patterns that might be indicative of the bond rearrangement as molecules change electronic states. We examined simulation output that tracks the positions of two coupled electrons in the singlet and triplet states of an H2 molecule. The electrons trace out a trajectory, which was analyzed with a number of statistical techniques. This project was intended to address the following scientific questions: (1) Do high-dimensional phase spaces characterizing electronic structure of molecules tend to cluster in any natural way? Do we see a change in clustering patterns as we explore different electronic states of the same molecule? (2) Since it is hard to understand the high-dimensional space of trajectories, can we project these trajectories to a lower dimensional subspace to gain a better understanding of patterns? (3) Do trajectories inherently lie in a lower-dimensional manifold? Can we recover that manifold? After extensive statistical analysis, we are now in a better position to respond to these questions. (1) We definitely see clustering patterns, and differences between the H2 and H2tri datasets. These are revealed by the pamk method in a fairly reliable manner and can potentially be used to distinguish bonded and non-bonded systems and get insight into the nature of bonding. (2) Projecting to a lower dimensional subspace ({approx}4-5) using PCA or Kernel PCA reveals interesting patterns in the distribution of scalar values, which can be related to the existing descriptors of electronic structure of molecules. Also, these results can be immediately used to develop robust tools for analysis of noisy data obtained during QMC simulations (3) All dimensionality reduction and estimation techniques that we tried seem to
Brázda, Petr; Mutombo, Pingo; Ondráček, Martin; Corrêa, Cinthia Antunes; Kopeček, Jaromír; Palatinus, Lukáš
2018-05-01
The bulk and surface structures of calcium and strontium disilicides are investigated by computational methods using density functional theory. The investigated structures are R6, R3 and P1-CaSi2 and P1-SrSi2. The investigated properties are the cleavage energy at the silicene sheet, buckling of the bulk and surface silicene layers, charge transfer from calcium to silicon, band structure of bulk and surface-terminated structures and adsorption energies on H atoms and H2 molecules on the silicene-terminated surface of the R3 phase. The cleavage energy at the silicene surface is low in all cases. Structures P1-CaSi2 and R3-CaSi2 contain silicene sheets with different coordination to Ca, while R6-CaSi2 contains both types of the sheets. It is shown that the properties of the two types of silicene-like sheets in R6-CaSi2 are similar to those of the corresponding sheets in P1-CaSi2 and R3-CaSi2, and the thermodynamically stable R6 phase is a good candidate for experimental investigation of silicene-terminated surface in calcium disilicide.
Photonic Molecule Lasers Revisited
Gagnon, Denis; Dumont, Joey; Déziel, Jean-Luc; Dubé, Louis J.
2014-05-01
Photonic molecules (PMs) formed by coupling two or more optical resonators are ideal candidates for the fabrication of integrated microlasers, photonic molecule lasers. Whereas most calculations on PM lasers have been based on cold-cavity (passive) modes, i.e. quasi-bound states, a recently formulated steady-state ab initio laser theory (SALT) offers the possibility to take into account the spectral properties of the underlying gain transition, its position and linewidth, as well as incorporating an arbitrary pump profile. We will combine two theoretical approaches to characterize the lasing properties of PM lasers: for two-dimensional systems, the generalized Lorenz-Mie theory will obtain the resonant modes of the coupled molecules in an active medium described by SALT. Not only is then the theoretical description more complete, the use of an active medium provides additional parameters to control, engineer and harness the lasing properties of PM lasers for ultra-low threshold and directional single-mode emission. We will extend our recent study and present new results for a number of promising geometries. The authors acknowledge financial support from NSERC (Canada) and the CERC in Photonic Innovations of Y. Messaddeq.
Köse, Muhammet; Ceyhan, Gökhan; Tümer, Mehmet; Demirtaş, Ibrahim; Gönül, İlyas; McKee, Vickie
2015-02-25
Two Schiff base compounds, N,N'-bis(2-methoxy phenylidene)-1,5-diamino naphthalene (L(1)) and N,N'-bis(3,4,5-trimethoxy phenylidene)-1,5-diamino naphthalene (L(2)) were synthesized and characterized by the analytical and spectroscopic methods. The electrochemical and photoluminescence properties of the Schiff bases were investigated in the different conditions. The compounds L(1) and L(2) show the reversible redox processes at some potentials. The sensor properties of the Schiff bases were examined and color changes were observed upon addition of the metal cations, such as Hg(II), Cu(II), Co(II) and Al(III). The Schiff base compounds show the bathochromic shift from 545 to 585 nm. The single crystals of the compounds (L(1)) and (L(2)) were obtained from the methanol solution and characterized structurally by the X-ray crystallography technique. The molecule L(2) is centrosymmetric whereas the L(1) has no crystallographically imposed molecular symmetry. However, the molecular structures for these compounds are quite similar, differing principally in the conformation about methoxy groups and the dihedral angle between the two aromatic rings and diamine naphthalene. Copyright © 2014 Elsevier B.V. All rights reserved.
Polarization effects on the electric properties of urea and thiourea molecules in solid phase
International Nuclear Information System (INIS)
Santos, O. L.; Fonseca, T. L.; Sabino, J. R.; Georg, H. C.; Castro, M. A.
2015-01-01
We present theoretical results for the dipole moment, linear polarizability, and first hyperpolarizability of the urea and thiourea molecules in solid phase. The in-crystal electric properties were determined by applying a supermolecule approach in combination with an iterative electrostatic scheme, in which the surrounding molecules are represented by point charges. It is found for both urea and thiourea molecules that the influence of the polarization effects is mild for the linear polarizability, but it is marked for the dipole moment and first hyperpolarizability. The replacement of oxygen atoms by sulfur atoms increases, in general, the electric responses. Our second-order Møller–Plesset perturbation theory based iterative scheme predicts for the in-crystal dipole moment of urea and thiourea the values of 7.54 and 9.19 D which are, respectively, increased by 61% and 58%, in comparison with the corresponding isolated values. The result for urea is in agreement with the available experimental result of 6.56 D. In addition, we present an estimate of macroscopic quantities considering explicit unit cells of urea and thiourea crystals including environment polarization effects. These supermolecule calculations take into account partially the exchange and dispersion effects. The results illustrate the role played by the electrostatic interactions on the static second-order nonlinear susceptibility of the urea crystal
Yamamoto, Takaki; Hatano, Junichi; Nakagawa, Takafumi; Yamaguchi, Shigeru; Matsuo, Yutaka
2013-01-01
Utilizing tetraethynyl porphyrin derivative (TE-Por) as a small molecule donor material, we fabricated a small molecule solution-processed bulk heterojunction (BHJ) solar cell with inverted structure, which exhibited 1.6% power conversion efficiency (JSC (short-circuit current) = 4.6 mA/cm2, VOC (open-circuit voltage) = 0.90 V, and FF (fill factor) = 0.39) in the device configuration indium tin oxide/TiOx (titanium sub-oxide)/[6,6]-phenyl-C61-butyric acid methyl ester:TE-Por (5:1)/MoOx (molybdenum sub-oxide)/Au under AM1.5 G illumination at 100 mW/cm2. Without encapsulation, the small molecule solution-processed inverted BHJ solar cell also showed remarkable durability to air, where it kept over 73% of its initial power conversion efficiency after storage for 28 days under ambient atmosphere in the dark.
Zbik, Marek S; Martens, Wayde N; Frost, Ray L; Song, Yen-Fang; Chen, Yi-Ming; Chen, Jian-Hua
2010-05-01
The aggregate structure which occurs in aqueous smectitic suspensions is responsible for poor water clarification, difficulties in sludge dewatering and the unusual rheological behaviour of smectite rich soils. These macroscopic properties are dictated by the 3D structural arrangement of smectite finest fraction within flocculated aggregates. Here, we report results from a relatively new technique, transmission X-ray microscopy (TXM), which makes it possible to investigate the internal structure and 3D tomographic reconstruction of the smectite clay aggregates modified by Al(13) Keggin macro-molecule [Al(13)(O)(4)(OH)(24)(H(2)O)(12)](7+). Three different treatment methods were shown resulted in three different micro-structural environments of the resulting flocculation. In case of smectite sample prepared in Methods 1 and 3 particles fall into the primary minimum where Van der Waals forces act between FF oriented smectite flakes and aggregates become approach irreversible flocculation. In case of sample prepared using Method 2, particles contacting by edges (EE) and edge to face (EF) orientation fell into secondary minimum and weak flocculation resulted in severe gelation and formation of the micelle-like texture in fringe superstructure, which was first time observed in smectite based gel. Copyright 2010 Elsevier Inc. All rights reserved.
Structure and Properties of Compressed Borate Glasses
DEFF Research Database (Denmark)
Smedskjær, Morten Mattrup; Bauer, U.; Behrens, H.
While the influence of thermal history on the structure and properties of glasses has been thoroughly studied in the past century, the influence of pressure history has received considerably less attention. In this study, we investigate the pressure-induced changes in structure and properties in ......, hardness and crack formation from nanoindentation experiments, and overshoot in isobaric heat capacity from DSC experiments at ambient pressure. The influence of the initial boron speciation on the degree of changes in structure and properties will also be discussed....
Directory of Open Access Journals (Sweden)
Aminoddin Haji
2012-08-01
Full Text Available In this work, mechanical and structural parameters related to the optical properties of polyethylene terephthalate (PET fibers drawn at hot multistage have been investigated. The changes in optical parameters upon changing draw ratio are used to obtain the mechanical orientation factors and , various orientation functions f2(θ, f4(θ and f6(θ, and amorphous and crystalline orientation functions (f a and f c. Also, the numbers of random links between the network junction points (N1, the average optical orientation (Fav, and the distribution function of segment ω(cos θ were calculated. In addition, an empirical formula was suggested to correlate changes in the birefringence with the draw ratio and its constants were determined. The study demonstrated change on the molecular orientation functions and structural parameters upon hot multistage drawing. Significant variations in the characteristic properties of the drawn PET fibers were due to reorientation of the molecules caused by applied heat and external tension.
Single-molecule detection of dihydroazulene photo-thermal reaction using break junction technique
Huang, Cancan; Jevric, Martyn; Borges, Anders; Olsen, Stine T.; Hamill, Joseph M.; Zheng, Jue-Ting; Yang, Yang; Rudnev, Alexander; Baghernejad, Masoud; Broekmann, Peter; Petersen, Anne Ugleholdt; Wandlowski, Thomas; Mikkelsen, Kurt V.; Solomon, Gemma C.; Brøndsted Nielsen, Mogens; Hong, Wenjing
2017-05-01
Charge transport by tunnelling is one of the most ubiquitous elementary processes in nature. Small structural changes in a molecular junction can lead to significant difference in the single-molecule electronic properties, offering a tremendous opportunity to examine a reaction on the single-molecule scale by monitoring the conductance changes. Here, we explore the potential of the single-molecule break junction technique in the detection of photo-thermal reaction processes of a photochromic dihydroazulene/vinylheptafulvene system. Statistical analysis of the break junction experiments provides a quantitative approach for probing the reaction kinetics and reversibility, including the occurrence of isomerization during the reaction. The product ratios observed when switching the system in the junction does not follow those observed in solution studies (both experiment and theory), suggesting that the junction environment was perturbing the process significantly. This study opens the possibility of using nano-structured environments like molecular junctions to tailor product ratios in chemical reactions.
A first-principles study of gas molecule adsorption on borophene
Directory of Open Access Journals (Sweden)
Tingting Liu
2017-12-01
Full Text Available Borophene, a new two-dimensional material, was recently synthesized. The unique anisotropic structure and excellent properties of borophene have attracted considerable research interest. This paper presents a first-principles study of the adsorption of gas molecules (CO, CO2, NH3, NO, NO2 and CH4 on borophene. The adsorption configurations, adsorption energies and electronic properties of the gas molecules absorpted on borophene are determined, and the mechanisms of the interactions between the gas molecules and borophene are evaluated. We find that CO, CO2, NH3, NO and NO2 are chemisorbed on borophene, while CH4 is physisorbed on borophene. Furthermore, our calculation also indicate that CO and CO2 are chemisorbed on borophene with moderate adsorption energy and NO, NO2 and NH3 are chemisorbed on borophene via strong covalent bonds. Moreover, CO is found as an electron donor, while CO2 an electron acceptor. The chemisorption of CO and CO2 on borophene increases the electrical conductivity, so It seems that borophene has the potential to be used in high-sensitivity CO and CO2 gas sensors.
A semantic web ontology for small molecules and their biological targets.
Choi, Jooyoung; Davis, Melissa J; Newman, Andrew F; Ragan, Mark A
2010-05-24
A wide range of data on sequences, structures, pathways, and networks of genes and gene products is available for hypothesis testing and discovery in biological and biomedical research. However, data describing the physical, chemical, and biological properties of small molecules have not been well-integrated with these resources. Semantically rich representations of chemical data, combined with Semantic Web technologies, have the potential to enable the integration of small molecule and biomolecular data resources, expanding the scope and power of biomedical and pharmacological research. We employed the Semantic Web technologies Resource Description Framework (RDF) and Web Ontology Language (OWL) to generate a Small Molecule Ontology (SMO) that represents concepts and provides unique identifiers for biologically relevant properties of small molecules and their interactions with biomolecules, such as proteins. We instanced SMO using data from three public data sources, i.e., DrugBank, PubChem and UniProt, and converted to RDF triples. Evaluation of SMO by use of predetermined competency questions implemented as SPARQL queries demonstrated that data from chemical and biomolecular data sources were effectively represented and that useful knowledge can be extracted. These results illustrate the potential of Semantic Web technologies in chemical, biological, and pharmacological research and in drug discovery.
Quantum interference experiments with complex organic molecules
International Nuclear Information System (INIS)
Eibenberger, S. I.
2015-01-01
Matter-wave interference with complex particles is a thriving field in experimental quantum physics. The quest for testing the quantum superposition principle with highly complex molecules has motivated the development of the Kapitza-Dirac-Talbot-Lau interferometer (KDTLI). This interferometer has enabled quantum interference with large organic molecules in an unprecedented mass regime. In this doctoral thesis I describe quantum superposition experiments which we were able to successfully realize with molecules of masses beyond 10 000 amu and consisting of more than 800 atoms. The typical de Broglie wavelengths of all particles in this thesis are in the order of 0.3-5 pm. This is significantly smaller than any molecular extension (nanometers) or the delocalization length in our interferometer (hundreds of nanometers). Many vibrational and rotational states are populated since the molecules are thermally highly excited (300-1000 K). And yet, high-contrast quantum interference patterns could be observed. The visibility and position of these matter-wave interference patterns is highly sensitive to external perturbations. This sensitivity has opened the path to extensive studies of the influence of internal molecular properties on the coherence of their associated matter waves. In addition, it enables a new approach to quantum-assisted metrology. Quantum interference imprints a high-contrast nano-structured density pattern onto the molecular beam which allows us to resolve tiny shifts and dephasing of the molecular beam. I describe how KDTL interferometry can be used to investigate a number of different molecular properties. We have studied vibrationally-induced conformational changes of floppy molecules and permanent electric dipole moments using matter-wave deflectometry in an external electric field. We have developed a new method for optical absorption spectroscopy which uses the recoil of the molecules upon absorption of individual photons. This allows us to
Gorski, Christopher A; Klüpfel, Laura E; Voegelin, Andreas; Sander, Michael; Hofstetter, Thomas B
2013-01-01
Structural Fe in clay minerals is an important redox-active species in many pristine and contaminated environments as well as in engineered systems. Understanding the extent and kinetics of redox reactions involving Fe-bearing clay minerals has been challenging due to the inability to relate structural Fe(2+)/Fe(total) fractions to fundamental redox properties, such as reduction potentials (EH). Here, we overcame this challenge by using mediated electrochemical reduction (MER) and oxidation (MEO) to characterize the fraction of redox-active structural Fe (Fe(2+)/Fe(total)) in smectites over a wide range of applied EH-values (-0.6 V to +0.6 V). We examined Fe(2+)/Fe(total )- EH relationships of four natural Fe-bearing smectites (SWy-2, SWa-1, NAu-1, NAu-2) in their native, reduced, and reoxidized states and compared our measurements with spectroscopic observations and a suite of mineralogical properties. All smectites exhibited unique Fe(2+)/Fe(total) - EH relationships, were redox active over wide EH ranges, and underwent irreversible electron transfer induced structural changes that were observable with X-ray absorption spectroscopy. Variations among the smectite Fe(2+)/Fe(total) - EH relationships correlated well with both bulk and molecular-scale properties, including Fe(total) content, layer charge, and quadrupole splitting values, suggesting that multiple structural parameters determined the redox properties of smectites. The Fe(2+)/Fe(total) - EH relationships developed for these four commonly studied clay minerals may be applied to future studies interested in relating the extent of structural Fe reduction or oxidation to EH-values.
International Nuclear Information System (INIS)
Ghasemi, Jahanbakhsh; Saaidpour, Saadi
2007-01-01
A quantitative structure-property relationship (QSPR) study was performed to develop models those relate the structures of 150 drug organic compounds to their n-octanol-water partition coefficients (log P o/w ). Molecular descriptors derived solely from 3D structures of the molecular drugs. A genetic algorithm was also applied as a variable selection tool in QSPR analysis. The models were constructed using 110 molecules as training set, and predictive ability tested using 40 compounds. Modeling of log P o/w of these compounds as a function of the theoretically derived descriptors was established by multiple linear regression (MLR). Four descriptors for these compounds molecular volume (MV) (geometrical), hydrophilic-lipophilic balance (HLB) (constitutional), hydrogen bond forming ability (HB) (electronic) and polar surface area (PSA) (electrostatic) are taken as inputs for the model. The use of descriptors calculated only from molecular structure eliminates the need for experimental determination of properties for use in the correlation and allows for the estimation of log P o/w for molecules not yet synthesized. Application of the developed model to a testing set of 40 drug organic compounds demonstrates that the model is reliable with good predictive accuracy and simple formulation. The prediction results are in good agreement with the experimental value. The root mean square error of prediction (RMSEP) and square correlation coefficient (R 2 ) for MLR model were 0.22 and 0.99 for the prediction set log P o/w
Do, Khanh
2015-10-22
In the quest to improve the performance of organic bulk-heterojunction solar cells, many recent efforts have focused on developing molecular and polymer alternatives to commonly used fullerene acceptors. Here, molecular dynamics simulations are used to investigate polymer-molecule blends comprised of the polymer donor poly(3-hexylthiophene) (P3HT) with a series of acceptors based on trialkylsilylethynyl-substituted pentacene. A matrix of nine pentacene derivatives, consisting of systematic chemical variation both in the nature of the alkyl groups and electron-withdrawing moieties appended to the acene, is used to draw connections between the chemical structure of the acene acceptor and the nanoscale properties of the polymer-molecule blend. These connections include polymer and molecular diffusivity, donor-acceptor packing and interfacial (contact) area, and miscibility. The results point to the very significant role that seemingly modest changes in chemical structure play during the formation of polymer-molecule blend morphologies.
Do, Khanh; Risko, Chad; Anthony, John E; Amassian, Aram; Bredas, Jean-Luc
2015-01-01
In the quest to improve the performance of organic bulk-heterojunction solar cells, many recent efforts have focused on developing molecular and polymer alternatives to commonly used fullerene acceptors. Here, molecular dynamics simulations are used to investigate polymer-molecule blends comprised of the polymer donor poly(3-hexylthiophene) (P3HT) with a series of acceptors based on trialkylsilylethynyl-substituted pentacene. A matrix of nine pentacene derivatives, consisting of systematic chemical variation both in the nature of the alkyl groups and electron-withdrawing moieties appended to the acene, is used to draw connections between the chemical structure of the acene acceptor and the nanoscale properties of the polymer-molecule blend. These connections include polymer and molecular diffusivity, donor-acceptor packing and interfacial (contact) area, and miscibility. The results point to the very significant role that seemingly modest changes in chemical structure play during the formation of polymer-molecule blend morphologies.
Pedersen, J T; Olsen, O H; Betzel, C; Eschenburg, S; Branner, S; Hastrup, S
1994-09-23
The subtilisin molecule possesses several internal water molecules, which may be characterised as an integral part of the protein structure. We have introduced specific mutations (T71I, T71S, T71V, T71A and T71G) at position 71 in the subtilisin variant Savinase from Bacillus lentus. This position is involved in a hydrogen bonded network with several internal water molecules, forming a water channel. The water channel and most of the other internal water molecules are positioned in the interface between two half-domains of the subtilisin molecule. The data presented here indicate that the internal water molecules are structural, and may be the result of trapping during the folding process.
Composition-structure-property relation of oxide glasses
DEFF Research Database (Denmark)
Hermansen, Christian
also increases such properties. Yet, these rules are not strictly followed even for the simplest binary oxide glasses, such as alkali silicates, borates and phosphates. In this thesis it is argued that the missing link between composition and properties is the glass structure. Structural models...... are proposed based on topological selection rules and experimentally verified. The relation between structure and properties is evaluated using topological constraint theory, which in its essence is a theory that quantifies the two intuitions of the glass scientist. The end result is a quantitative model...
RaptorX-Property: a web server for protein structure property prediction.
Wang, Sheng; Li, Wei; Liu, Shiwang; Xu, Jinbo
2016-07-08
RaptorX Property (http://raptorx2.uchicago.edu/StructurePropertyPred/predict/) is a web server predicting structure property of a protein sequence without using any templates. It outperforms other servers, especially for proteins without close homologs in PDB or with very sparse sequence profile (i.e. carries little evolutionary information). This server employs a powerful in-house deep learning model DeepCNF (Deep Convolutional Neural Fields) to predict secondary structure (SS), solvent accessibility (ACC) and disorder regions (DISO). DeepCNF not only models complex sequence-structure relationship by a deep hierarchical architecture, but also interdependency between adjacent property labels. Our experimental results show that, tested on CASP10, CASP11 and the other benchmarks, this server can obtain ∼84% Q3 accuracy for 3-state SS, ∼72% Q8 accuracy for 8-state SS, ∼66% Q3 accuracy for 3-state solvent accessibility, and ∼0.89 area under the ROC curve (AUC) for disorder prediction. © The Author(s) 2016. Published by Oxford University Press on behalf of Nucleic Acids Research.
Nonadiabatic dynamics of electron injection into organic molecules
International Nuclear Information System (INIS)
Zhu Li-Ping; Qiu Yu; Tong Guo-Ping
2012-01-01
We numerically investigate the injection process of electrons from metal electrodes to one-dimensional organic molecules by combining the extended Su—Schrieffer—Heeger (SSH) model with a nonadiabatic dynamics method. It is found that a match between the Fermi level of electrodes and the highest occupied molecular orbital (HOMO) or the lowest unoccupied molecular orbital (LUMO) of organic molecules can be greatly affected by the length of the organic chains, which has a great impact on electron injection. The correlation between oligomers and electrodes is found to open more efficient channels for electron injection as compared with that in polymer/electrode structures. For oligomer/electrode structures, we show that the Schottky barrier essentially does not affect the electron injection as the electrode work function is smaller than a critical value. This means that the Schottky barrier is pinned for a small work-function electrode. For polymer/electrode structures, we find that it is possible for the Fermi level of electrodes to be pinned to the polaronic level. The condition under which the Fermi level of electrodes exceeds the polaronic level of polymers is shown to not always lead to spontaneous electron transfer from electrodes to polymers. (condensed matter: electronic structure, electrical, magnetic, and optical properties)
Claudio-Rizo, Jesús A; Rangel-Argote, Magdalena; Castellano, Laura E; Delgado, Jorge; Mata-Mata, José L; Mendoza-Novelo, Birzabith
2017-10-01
In this work, hydrolysates of extracellular matrix (hECM) were obtained from rat tail tendon (TR), bovine Achilles tendon (TAB), porcine small intestinal submucosa (SIS) and bovine pericardium (PB), and they were polymerized to generate ECM hydrogels. The composition of hECM was evaluated by quantifying the content of sulphated glycosaminoglycans (sGAG), fibronectin and laminin. The polymerization process, structure, physicochemical properties, in vitro degradation and biocompatibility were studied and related to their composition. The results indicated that the hECM derived from SIS and PB were significantly richer in sGAG, fibronectin and laminin, than those derived from TAB and TR. These differences in hECM composition influenced the polymerization and the structural characteristics of the fibrillar gel network. Consequently, the swelling, mechanics and degradation of the hydrogels showed a direct relationship with the remaining composition. Moreover, the cytocompatibility and the secretion of transforming growth factor beta-1 (TGF-β1) by macrophages were enhanced in hydrogels with the highest residual content of ECM biomolecules. The results of this work evidenced the role of the ECM molecules remaining after both decellularization and hydrolysis steps to produce tissue derived hydrogels with structure and properties tailored to enhance their performance in tissue engineering and regenerative medicine applications. Copyright © 2017 Elsevier B.V. All rights reserved.
The nano-science of C60 molecule
International Nuclear Information System (INIS)
Rafii-Tabar, H.
2002-01-01
Over the past few years, nano-science and its associated nano-technology have emerged into prominence in research institutions across the world. They have brought about new scientific and engineering paradigms, allowing for the manipulation of single atoms and molecules, designing and fabricating new materials, atom-by-atom, and devices that operate on significantly reduced time and length scales. One important area of research in nano-science and nano technology is carbon-based physics in the form of fullerene physics. The C 6 0 molecule, and other cage-like fullerenes, together with carbon nano tubes provide objects that can be combined to generate three-dimensional functional structures for use in the anticipated nano-technology of future. The unique properties of C 6 0 can also be exploited in designing nano-phase thin films with applications in nano-scope device technology and processes such as nano-lithography. This requires a deep understanding of the highly complex process of adsorption of this molecule on a variety of substrates. We review the field of nano-scale nucleation and growth of C 6 0 molecules on some of the technologically important substrates. In addition to experimental results, the results of a set of highly accurate computational simulations are also reported
Wu, Jiang
2014-01-01
This book reviews recent advances in the exciting and rapidly growing field of quantum dot molecules (QDMs). It offers state-of-the-art coverage of novel techniques and connects fundamental physical properties with device design.
Electronic structure of the Fe2 molecule in the local-spin-density approximation
International Nuclear Information System (INIS)
Dhar, S.; Kestner, N.R.
1988-01-01
Ab initio self-consistent all-electron spin-polarized calculations have been performed for the ground-state properties of the Fe 2 molecule using the local-spin-density approximation. A Gaussian orbital basis is employed and all the two-electron integrals are evaluated analytically. The matrix elements of the exchange-correlation potential are computed numerically. The total energy, the binding energy, the equilibrium distance, vibrational frequency, and the ground-state configurations are reported and compared with other calculations and experimental results
International Nuclear Information System (INIS)
Kong, Lingqian; Zhao, Zengdian; Chen, Kexun; Wang, Ping; Zhang, Daopeng
2013-01-01
We obtained a heterobimetallic one-dimensional cyanide-bridged Mn(II)-Ni(II) complex and an Co(III)-Ni(II) ion-pair complex with [Ni(CN) 4 ] 2- as building block and M(II)-phenanthroline (M = Mn, Co) compounds as assembling segment. The different structural types of complexes 1 and 2 indicate that the property of the metal ions the assembling segment contained have obvious influence on the structure of the cyanide-bridged complex. Investigation over the magnetic properties of complex 1 reveals an overall weak antiferromagnetic coupling between the adjacent Mn(II) ions bridged by the antiferromagnetic [-NC-Ni-CN-] unit. Among of all the molecular magnetism systems, for the well known reasons, cyanide-containing complexes have been widely employed as bridges to assemble homo/hetero-metallic molecular magnetic materials by using the cyanide bridge transferring magnetic coupling between the neighboring paramagnetic ions, in whichsome showed interesting magnetic properties, such as high-Tc magnets, spin crossover materials, single-molecule magnets (SMMs) and single-chain magnets (SCMs)
The [Fe(III)[Fe(III)(L1)2]3] star-type single-molecule magnet.
Saalfrank, Rolf W; Scheurer, Andreas; Bernt, Ingo; Heinemann, Frank W; Postnikov, Andrei V; Schünemann, Volker; Trautwein, Alfred X; Alam, Mohammad S; Rupp, Holger; Müller, Paul
2006-06-21
Star-shaped complex [Fe(III)[Fe(III)(L1)2]3] (3) was synthesized starting from N-methyldiethanolamine H2L1 (1) and ferric chloride in the presence of sodium hydride. For 3, two different high-spin iron(III) ion sites were confirmed by Mössbauer spectroscopy at 77 K. Single-crystal X-ray structure determination revealed that 3 crystallizes with four molecules of chloroform, but, with only three molecules of dichloromethane. The unit cell of 3.4CHCl3 contains the enantiomers (delta)-[(S,S)(R,R)(R,R)] and (lambda)-[(R,R)(S,S)(S,S)], whereas in case of 3.3CH2Cl2 four independent molecules, forming pairs of the enantiomers [lambda-(R,R)(R,R)(R,R)]-3 and [lambda-(S,S)(S,S)(S,S)]-3, were observed in the unit cell. According to SQUID measurements, the antiferromagnetic intramolecular coupling of the iron(III) ions in 3 results in a S = 10/2 ground state multiplet. The anisotropy is of the easy-axis type. EPR measurements enabled an accurate determination of the ligand-field splitting parameters. The ferric star 3 is a single-molecule magnet (SMM) and shows hysteretic magnetization characteristics below a blocking temperature of about 1.2 K. However, weak intermolecular couplings, mediated in a chainlike fashion via solvent molecules, have a strong influence on the magnetic properties. Scanning tunneling microscopy (STM) and scanning tunneling spectroscopy (STS) were used to determine the structural and electronic properties of star-type tetranuclear iron(III) complex 3. The molecules were deposited onto highly ordered pyrolytic graphite (HOPG). Small, regular molecule clusters, two-dimensional monolayers as well as separated single molecules were observed. In our STS measurements we found a rather large contrast at the expected locations of the metal centers of the molecules. This direct addressing of the metal centers was confirmed by DFT calculations.
Structure, reactivity and electronic properties of Mn doped Ni{sub 13} clusters
Energy Technology Data Exchange (ETDEWEB)
Banerjee, Radhashyam; Datta, Soumendu; Mookerjee, Abhijit, E-mail: abhijit.mookerjee61@gmail.com
2013-06-15
In this work we have studied the structural and magnetic properties of Ni{sub 13} cluster mono- and bi-doped with Mn atoms. We have noted their tendency of being reactive toward the H{sub 2} molecule. We have found unusually enhanced stability in the mono-doped cluster (i.e. of the Ni{sub 12}Mn) and the diminished stability of the corresponding chemisorbed cluster, Ni{sub 12}MnH{sub 2}. Our analysis of the stability and HOMO–LUMO gap explains this unusual behavior. Interestingly, we have also seen the quenching in the net magnetic moment upon H{sub 2} absorption in the doped Ni{sub 13−m}Mn{sub m} alloy clusters. This has been reported earlier for smaller Ni{sub n} clusters [1].
Structure and potential energy function investigation on UH and UH2 molecules
International Nuclear Information System (INIS)
Luo Deli; Liu Xiaoya; Jiang Gang; Meng Daqiao; Zhu Zhenghe
2001-01-01
Density functional (B3LYP) method with Relativistic Effective Core Potential (RECP) have been used to optimize the structures and to calculate the potential energy function both for the ground and excited states of UH and UH 2 molecules. Results show that the ground state of UH and UH 2 molecules are X 4 II and X 3 A 2 , which belongs to C2v symmetry, and the disassociation energies are 2.886 eV and 5.249 ev respectively, and the spectral data of UH and UH 2 have also been derived both for the ground and excited state. The potential energy function of UH and UH 2 have been derived based on normal equation fitting method and the many-body expansion theory. The information is useful to mechanism analysis of the aging effect of the hydrogen storage material
Parker, Christian R; Leary, Edmund; Frisenda, Riccardo; Wei, Zhongming; Jennum, Karsten S; Glibstrup, Emil; Abrahamsen, Peter Bæch; Santella, Marco; Christensen, Mikkel A; Della Pia, Eduardo Antonio; Li, Tao; Gonzalez, Maria Teresa; Jiang, Xingbin; Morsing, Thorbjørn J; Rubio-Bollinger, Gabino; Laursen, Bo W; Nørgaard, Kasper; van der Zant, Herre; Agrait, Nicolas; Nielsen, Mogens Brøndsted
2014-11-26
Cruciform-like molecules with two orthogonally placed π-conjugated systems have in recent years attracted significant interest for their potential use as molecular wires in molecular electronics. Here we present synthetic protocols for a large selection of cruciform molecules based on oligo(phenyleneethynylene) (OPE) and tetrathiafulvalene (TTF) scaffolds, end-capped with acetyl-protected thiolates as electrode anchoring groups. The molecules were subjected to a comprehensive study of their conducting properties as well as their photophysical and electrochemical properties in solution. The complex nature of the molecules and their possible binding in different configurations in junctions called for different techniques of conductance measurements: (1) conducting-probe atomic force microscopy (CP-AFM) measurements on self-assembled monolayers (SAMs), (2) mechanically controlled break-junction (MCBJ) measurements, and (3) scanning tunneling microscopy break-junction (STM-BJ) measurements. The CP-AFM measurements showed structure-property relationships from SAMs of series of OPE3 and OPE5 cruciform molecules; the conductance of the SAM increased with the number of dithiafulvene (DTF) units (0, 1, 2) along the wire, and it increased when substituting two arylethynyl end groups of the OPE3 backbone with two DTF units. The MCBJ and STM-BJ studies on single molecules both showed that DTFs decreased the junction formation probability, but, in contrast, no significant influence on the single-molecule conductance was observed. We suggest that the origins of the difference between SAM and single-molecule measurements lie in the nature of the molecule-electrode interface as well as in effects arising from molecular packing in the SAMs. This comprehensive study shows that for complex molecules care should be taken when directly comparing single-molecule measurements and measurements of SAMs and solid-state devices thereof.
Yun, Jae Hoon; Park, Sungmin; Heo, Jin Hyuck; Lee, Hyo-Sang; Yoon, Seongwon; Kang, Jinback; Im, Sang Hyuk; Kim, Hyunjung; Lee, Wonmok; Kim, BongSoo; Ko, Min Jae; Chung, Dae Sung; Son, Hae Jung
2016-11-01
We prepared a series of small molecules based on 7,7'-(4,4-bis(2-ethylhexyl)-4 H -silolo[3,2- b :4,5- b ']dithiophene-2,6-diyl)bis(4-(5'-hexyl-[2,2'-bithiophene]-5-yl)benzo[ c ][1,2,5]thiadiazole) with different fluorine substitution patterns ( 0F-4F ). Depending on symmetricity and numbers of fluorine atoms incorporated in the benzo[ c ][1,2,5]thiadiazole unit, they show very different optical and morphological properties in a film. 2F and 4F , which featured symmetric and even-numbered fluorine substitution patterns, display improved molecular packing structures and higher crystalline properties in a film compared with 1F and 3F and thus, 2F achieved the highest OTFT mobility, which is followed by 4F . In the bulk heterojunction solar cell fabricated with PC 71 BM, 2F achieves the highest photovoltaic performance with an 8.14% efficiency and 0F shows the lowest efficiency of 1.28%. Moreover, the planar-type perovskite solar cell (PSC) prepared with 2F as a dopant-free hole transport material shows a high power conversion efficiency of 14.5% due to its high charge transporting properties, which were significantly improved compared with the corresponding PSC device obtained from 0F (8.5%). From the studies, it is demonstrated that low variation in the local dipole moment and the narrow distribution of 2F conformers make intermolecular interactions favorable, which may effectively drive crystal formations in the solid state and thus, higher charge transport properties compared with 1F and 3F .
Anisimova, N Y; Kiselevsky, M V; Sukhorukova, I V; Shvindina, N V; Shtansky, D V
2015-09-01
The present paper was focused on the development of a new method of decellularized extracellular matrix (DECM) fabrication via a chemical treatment of a native bone tissue. Particular attention was paid to the influence of chemical treatment on the mechanical properties of native bones, sterility, and biological performance in vivo using the syngeneic heterotopic and orthotopic implantation models. The obtained data indicated that after a chemical decellularization treatment in 4% aqueous sodium chlorite, no noticeable signs of the erosion of compact cortical bone surface or destruction of trabeculae of spongy bone in spinal channel were observed. The histological studies showed that the chemical treatment resulted in the decellularization of both bone and cartilage tissues. The DECM samples demonstrated no signs of chemical and biological degradation in vivo. Thorough structural characterization revealed that after decellularization, the mineral frame retained its integrity with the organic phase; however clotting and destruction of organic molecules and fibers were observed. FTIR studies revealed several structural changes associated with the destruction of organic molecules, although all organic components typical of intact bone were preserved. The decellularization-induced structural changes in the collagen constituent resulted changed the deformation under compression mechanism: from the major fracture by crack propagation throughout the sample to the predominantly brittle fracture. Although the mechanical properties of radius bones subjected to decellularization were observed to degrade, the mechanical properties of ulna bones in compression and humerus bones in bending remained unchanged. The compressive strength of both the intact and decellularized ulna bones was 125-130 MPa and the flexural strength of humerus bones was 156 and 145 MPa for the intact and decellularized samples, respectively. These results open new avenues for the use of DECM samples as
Institute of Scientific and Technical Information of China (English)
Shaoqing Zhang; Liyan Yang; Delong Liu; Chang He; Jianqi Zhang; Yun Zhang; Jianhui Hou
2017-01-01
Two benzo[1,2-b:4,5-b']dithiophene (BDT)-based small molecule (SM) donor materials with identical conjugated backbones but different substitution groups,named as DRTB-O and DRTB-T,were well explored to demonstrate the influence of the replacement of alkoxy with alkylthienyl on their photovoltaic properties in fullerene-based and fullerene-free organic solar cells (OSCs).The study shows that the two SM donors possess similar absorption spectra and energy levels but different crystalline structures in solid films.The carrier transport property and phase separation morphologies of the blend films have also been fully investigated.By employing PC71BM as the acceptor,the power conversion efficiency (PCE) of DRTB-O:PC71BM and DRTB-T:PC71BM based devices were 4.91% and 7.08%,respectively.However,by blending with IDIC,the two SM donors exhibited distinctly different photovoltaic properties in fullerene-free OSCs,and the PCE of DRTB-O:IDIC and DRTB-T:IDIC based devices were 0.15% and 9.06%,respectively.These results indicate that the replacement of alkoxyl with alkylthienyl in designing SM donor materials plays an important role in the application of fullerene-free OSCs.
Radiation - induced changes in the optical properties of hemoglobin molecule
International Nuclear Information System (INIS)
Selim, N.S; El-Marakby, S.M.
2009-01-01
Adult male albino rats were exposed to different doses of gamma radiation from Cs-137 source. Hemoglobin samples were analyzed 24 hrs after irradiation. The UV-visible spectrum of hemoglobin molecule was measured in the range 200 to 700 nm. The overall spectrum of the hemoglobin molecule showed hypochromicity that increased with dose increase. To investigate the effect of radiation on the hemoglobin molecule, different parameters of the spectrum were calculated: molar absorption coefficient, absorption cross section, transition dipole moment , dipole length, the optical energy gap and activation energy for each characteristic peak. The obtained results revealed that the radiation effect can induce rearrangement of the transition dipole moments and change molecular energy levels of the hemoglobin molecule
Formation of Ultracold Molecules
Energy Technology Data Exchange (ETDEWEB)
Cote, Robin [Univ. of Connecticut, Storrs, CT (United States)
2016-01-28
Advances in our ability to slow down and cool atoms and molecules to ultracold temperatures have paved the way to a revolution in basic research on molecules. Ultracold molecules are sensitive of very weak interactions, even when separated by large distances, which allow studies of the effect of those interactions on the behavior of molecules. In this program, we have explored ways to form ultracold molecules starting from pairs of atoms that have already reached the ultracold regime. We devised methods that enhance the efficiency of ultracold molecule production, for example by tuning external magnetic fields and using appropriate laser excitations. We also investigates the properties of those ultracold molecules, especially their de-excitation into stable molecules. We studied the possibility of creating new classes of ultra-long range molecules, named macrodimers, thousand times more extended than regular molecules. Again, such objects are possible because ultra low temperatures prevent their breakup by collision. Finally, we carried out calculations on how chemical reactions are affected and modified at ultracold temperatures. Normally, reactions become less effective as the temperature decreases, but at ultracold temperatures, they can become very effective. We studied this counter-intuitive behavior for benchmark chemical reactions involving molecular hydrogen.
Minenkov, Yury; Cavallo, Luigi
2017-01-01
-GGA approximations with B3PW91, APF, TPSSh, mPW1PW91, PBE0, mPW1PBE, B972, and B98 functionals, resulting in lowest errors. We recommend using these methods to predict accurate three-dimensional structures of inorganic molecules when intramolecular dispersion
Institute of Scientific and Technical Information of China (English)
无
2009-01-01
The valence electronic structures of Fe, Co and Ni have been investigated with Empirical Electron Theory of Solids and Molecules. The magnetic moments, Curie temperature, cohesive energy and melting point have been calculated according to the valence electronic structure. These calculations fit the experimental data very well. Based on the calculations, the magnetic moments are proportional to the number of 3d magnetic electrons. Curie temperatures are related to the magnetic electrons and the bond lengths between magnetic atoms. Cohesive energies increase with the increase of the number of covalent electrons, and the decrease of the number of magnetic and dumb pair electrons. The melting point is mainly related to the number of covalent electron pairs distributed in the strongest bond. The contribution from the lattice electrons is very small, the dumb pair electrons weaken the melting point; however, the contribution to melting point of the magnetic electrons can be neglected. It reveals that the magnetic and thermal properties are closely related to the valence electronic structures, and the changes or transitions between the electrons obviously affect the physical properties.
International Nuclear Information System (INIS)
Porzio, William; Pasini, Mariacecilia; Destri, Silvia; Giovanella, Umberto; Fontaine, Philippe
2006-01-01
The crystal structure of a conjugated molecule containing thiophene and fluorenone residues has been determined from powder X-ray diffraction (XRD). Thin films ( -5 Pa) onto oxidized silicon substrates, are oriented along with different crystallographic directions. A comparison of XRD in both Grazing Incidence and Bragg-Brentano geometries allowed to perform a quantitative analysis of the various orientations. This approach is generally applicable in the case of multi-oriented films. The results fully account for the poor performance of this molecule in p-type field effect transistor devices
Minenkov, Yury
2017-11-29
We tested a battery of density functional theory (DFT) methods ranging from generalized gradient approximation (GGA) via meta-GGA to hybrid meta-GGA schemes as well as Møller–Plesset perturbation theory of the second order and a single and double excitation coupled-cluster (CCSD) theory for their ability to reproduce accurate gas-phase structures of di- and triatomic molecules derived from microwave spectroscopy. We obtained the most accurate molecular structures using the hybrid and hybrid meta-GGA approximations with B3PW91, APF, TPSSh, mPW1PW91, PBE0, mPW1PBE, B972, and B98 functionals, resulting in lowest errors. We recommend using these methods to predict accurate three-dimensional structures of inorganic molecules when intramolecular dispersion interactions play an insignificant role. The structures that the CCSD method predicts are of similar quality although at considerably larger computational cost. The structures that GGA and meta-GGA schemes predict are less accurate with the largest absolute errors detected with BLYP and M11-L, suggesting that these methods should not be used if accurate three-dimensional molecular structures are required. Because of numerical problems related to the integration of the exchange–correlation part of the functional and large scattering of errors, most of the Minnesota models tested, particularly MN12-L, M11, M06-L, SOGGA11, and VSXC, are also not recommended for geometry optimization. When maintaining a low computational budget is essential, the nonseparable gradient functional N12 might work within an acceptable range of error. As expected, the DFT-D3 dispersion correction had a negligible effect on the internuclear distances when combined with the functionals tested on nonweakly bonded di- and triatomic inorganic molecules. By contrast, the dispersion correction for the APF-D functional has been found to shorten the bonds significantly, up to 0.064 Å (AgI), in Ag halides, BaO, BaS, BaF, BaCl, Cu halides, and Li and
Structures and properties of spatially distorted porphyrins
International Nuclear Information System (INIS)
Golubchikov, Oleg A; Kuvshinova, Elizaveta M; Pukhovskaya, Svetlana G
2005-01-01
The published data on the structures and properties of porphyrins with distorted aromatic macrocycles are generalised and analysed. Data on the crystal structures, spectra and kinetics of formation and dissociation of their coordination derivatives are summarised. It is demonstrated that the distortion of the planar structure of the tetrapyrrole core is one of the most efficient means of controlling spectral, physicochemical and coordination properties of these compounds.
Research Update: Molecular electronics: The single-molecule switch and transistor
Directory of Open Access Journals (Sweden)
Kai Sotthewes
2014-01-01
Full Text Available In order to design and realize single-molecule devices it is essential to have a good understanding of the properties of an individual molecule. For electronic applications, the most important property of a molecule is its conductance. Here we show how a single octanethiol molecule can be connected to macroscopic leads and how the transport properties of the molecule can be measured. Based on this knowledge we have realized two single-molecule devices: a molecular switch and a molecular transistor. The switch can be opened and closed at will by carefully adjusting the separation between the electrical contacts and the voltage drop across the contacts. This single-molecular switch operates in a broad temperature range from cryogenic temperatures all the way up to room temperature. Via mechanical gating, i.e., compressing or stretching of the octanethiol molecule, by varying the contact's interspace, we are able to systematically adjust the conductance of the electrode-octanethiol-electrode junction. This two-terminal single-molecule transistor is very robust, but the amplification factor is rather limited.
2013-01-01
Background Human triosephosphate isomerase (HsTIM) deficiency is a genetic disease caused often by the pathogenic mutation E104D. This mutation, located at the side of an abnormally large cluster of water in the inter-subunit interface, reduces the thermostability of the enzyme. Why and how these water molecules are directly related to the excessive thermolability of the mutant have not been investigated in structural biology. Results This work compares the structure of the E104D mutant with its wild type counterparts. It is found that the water topology in the dimer interface of HsTIM is atypical, having a "wet-core-dry-rim" distribution with 16 water molecules tightly packed in a small deep region surrounded by 22 residues including GLU104. These water molecules are co-conserved with their surrounding residues in non-archaeal TIMs (dimers) but not conserved across archaeal TIMs (tetramers), indicating their importance in preserving the overall quaternary structure. As the structural permutation induced by the mutation is not significant, we hypothesize that the excessive thermolability of the E104D mutant is attributed to the easy propagation of atoms' flexibility from the surface into the core via the large cluster of water. It is indeed found that the B factor increment in the wet region is higher than other regions, and, more importantly, the B factor increment in the wet region is maintained in the deeply buried core. Molecular dynamics simulations revealed that for the mutant structure at normal temperature, a clear increase of the root-mean-square deviation is observed for the wet region contacting with the large cluster of interfacial water. Such increase is not observed for other interfacial regions or the whole protein. This clearly suggests that, in the E104D mutant, the large water cluster is responsible for the subunit interface flexibility and overall thermolability, and it ultimately leads to the deficiency of this enzyme. Conclusions Our study
International Nuclear Information System (INIS)
Kochorovski, Z.; Zagorska, I.; Pruzhkovska-Drakhal, R.; Trasatti, S.
1995-01-01
The results of systematic investigation of influence of crystal structure of Bi-, Sb- and Cd-electrode surfaces on regularities of double electric layer structure in aqueous and nonaqueous solutions of surface-nonactive electrolyte are given. Influence of electrode surface characteristics on adsorptive behaviour of different organic molecules has been studied. General regularities of of chemical nature influence and surface crystallographic structure on the double layer structure and on organic compounds adsorption have been established. 57 refs., 7 figs., 4 tabs
Single molecules and nanotechnology
Vogel, Horst
2007-01-01
This book focuses on recent advances in the rapidly evolving field of single molecule research. These advances are of importance for the investigation of biopolymers and cellular biochemical reactions, and are essential to the development of quantitative biology. Written by leading experts in the field, the articles cover a broad range of topics, including: quantum photonics of organic dyes and inorganic nanoparticles their use in detecting properties of single molecules the monitoring of single molecule (enzymatic) reactions single protein (un)folding in nanometer-sized confined volumes the dynamics of molecular interactions in biological cells The book is written for advanced students and scientists who wish to survey the concepts, techniques and results of single molecule research and assess them for their own scientific activities.
Turner, Walter E; Agarwal, Jay; Schaefer, Henry F
2015-12-03
The recent discovery of PN in the oxygen-rich shell of the supergiant star VY Canis Majoris points to the formation of several triatomic molecules involving oxygen, nitrogen, and phosphorus; these are also intriguing targets for main-group synthetic inorganic chemistry. In this research, high-level ab initio electronic structure computations were conducted on the potential circumstellar molecule OPN and several of its heavier group 15 and 16 congeners (SPN, SePN, TePN, OPP, OPAs, and OPSb). For each congener, four isomers were examined. Optimized geometries were obtained with coupled cluster theory [CCSD(T)] using large Dunning basis sets [aug-cc-pVQZ, aug-cc-pV(Q+d)Z, and aug-cc-pVQZ-PP], and relative energies were determined at the complete basis set limit of CCSDT(Q) from focal point analyses. The linear phosphorus-centered molecules were consistently the lowest in energy of the group 15 congeners by at least 6 kcal mol(-1), resulting from double-triple and single-double bond resonances within the molecule. The linear nitrogen-centered molecules were consistently the lowest in energy of the group 16 congeners by at least 5 kcal mol(-1), due to the electronegative central nitrogen atom encouraging electron delocalization throughout the molecule. For OPN, OPP, and SPN, anharmonic vibrational frequencies and vibrationally corrected rotational constants are predicted; good agreement with available experimental data is observed.
Energy Technology Data Exchange (ETDEWEB)
Subbotin, O.; Belosludov, V.; Adamova, T. [Russian Academy of Science, Novosibirsk (Russian Federation). Nikolaev Inst. of Inorganic Chemistry; Belosludov, R.; Kawazoe, Y. [Tohoku Univ., Aoba-ku, Sendai (Japan). Inst. for Materials Research; Kudoh, J.I. [Tohoku Univ., Aoba-ku, Sendai (Japan). Center for Northeast Asia Studies
2008-07-01
This paper presented a newly developed method to accurately predict the thermodynamic properties of clathrate hydrates, particularly their structural phase transitions under pressure. The method is based on the theory of Van-der-Waals and Platteeuw with some modifications that include the influence of guest molecules on the host lattice. The model was used to explain the exception from the established rule that small guest molecules form structure s1 and large molecules form structure s2 hydrates. In this study, the thermodynamic properties of argon (Ar) hydrate and methane hydrate, each in both cubic structure s1 and s2 were modelled. The model showed that two competing factors play a role in the formation of inclusions, notably the intermolecular interaction of guest molecules with water molecules, and the configuration entropy. Competition of these 2 factors determines the structure of hydrate formed at different pressures. The model provides an accurate description of the thermodynamic properties of gas hydrates and how they behave under pressure. For the argon hydrates, the structural phase transition from structure s2 to s1 at high pressure was predicted, while methane hydrates were predicted to be metastable in the s2 structure. The model can be used for other inclusion compounds with the same type of composition such as clathrate silicon, zeolites, and inclusion compounds of semiconductor elements. 17 refs., 5 figs.
Electron Accumulative Molecules.
Buades, Ana B; Sanchez Arderiu, Víctor; Olid-Britos, David; Viñas, Clara; Sillanpää, Reijo; Haukka, Matti; Fontrodona, Xavier; Paradinas, Markos; Ocal, Carmen; Teixidor, Francesc
2018-02-28
With the goal to produce molecules with high electron accepting capacity and low reorganization energy upon gaining one or more electrons, a synthesis procedure leading to the formation of a B-N(aromatic) bond in a cluster has been developed. The research was focused on the development of a molecular structure able to accept and release a specific number of electrons without decomposing or change in its structural arrangement. The synthetic procedure consists of a parallel decomposition reaction to generate a reactive electrophile and a synthesis reaction to generate the B-N(aromatic) bond. This procedure has paved the way to produce the metallacarboranylviologen [M(C 2 B 9 H 11 )(C 2 B 9 H 10 )-NC 5 H 4 -C 5 H 4 N-M'(C 2 B 9 H 11 )(C 2 B 9 H 10 )] (M = M' = Co, Fe and M = Co and M' = Fe) and semi(metallacarboranyl)viologen [3,3'-M(8-(NC 5 H 4 -C 5 H 4 N-1,2-C 2 B 9 H 10 )(1',2'-C 2 B 9 H 11 )] (M = Co, Fe) electron cumulative molecules. These molecules are able to accept up to five electrons and to donate one in single electron steps at accessible potentials and in a reversible way. By targeted synthesis and corresponding electrochemical tests each electron transfer (ET) step has been assigned to specific fragments of the molecules. The molecules have been carefully characterized, and the electronic communication between both metal centers (when this situation applies) has been definitely observed through the coplanarity of both pyridine fragments. The structural characteristics of these molecules imply a low reorganization energy that is a necessary requirement for low energy ET processes. This makes them electronically comparable to fullerenes, but on their side, they have a wide range of possible solvents. The ET from one molecule to another has been clearly demonstrated as well as their self-organizing capacity. We consider that these molecules, thanks to their easy synthesis, ET, self-organizing capacity, wide range of solubility, and easy processability, can
Model Hamiltonian Calculations of the Nonlinear Polarizabilities of Conjugated Molecules.
Risser, Steven Michael
This dissertation advances the theoretical knowledge of the nonlinear polarizabilities of conjugated molecules. The unifying feature of these molecules is an extended delocalized pi electron structure. The pi electrons dominate the electronic properties of the molecules, allowing prediction of molecular properties based on the treatment of just the pi electrons. Two separate pi electron Hamiltonians are used in the research. The principal Hamiltonian used is the non-interacting single-particle Huckel Hamiltonian, which replaces the Coulomb interaction among the pi electrons with a mean field interaction. The simplification allows for exact solution of the Hamiltonian for large molecules. The second Hamiltonian used for this research is the interacting multi-particle Pariser-Parr-Pople (PPP) Hamiltonian, which retains explicit Coulomb interactions. This limits exact solutions to molecules containing at most eight electrons. The molecular properties being investigated are the linear polarizability, and the second and third order hyperpolarizabilities. The hyperpolarizabilities determine the nonlinear optical response of materials. These molecular parameters are determined by two independent approaches. The results from the Huckel Hamiltonian are obtained through first, second and third order perturbation theory. The results from the PPP Hamiltonian are obtained by including the applied field directly in the Hamiltonian and determining the ground state energy at a series of field strengths. By fitting the energy to a polynomial in field strength, the polarizability and hyperpolarizabilities are determined. The Huckel Hamiltonian is used to calculate the third order hyperpolarizability of polyenes. These calculations were the first to show the average hyperpolarizability of the polyenes to be positive, and also to show the saturation of the hyperpolarizability. Comparison of these Huckel results to those from the PPP Hamiltonian shows the lack of explicit Coulomb
International Nuclear Information System (INIS)
Nie Shanshan; Zhang Yaobin; Liu Bin; Li Zuoxi; Hu Huaiming; Xue Ganglin; Fu Feng; Wang Jiwu
2010-01-01
Two novel inorganic-organic hybrid materials based on an organic dye cation methylene blue (MB) and Lindqvist-type POM polyanions, [C 22 H 18 N 3 S] 2 Mo 6 O 19 2DMF (1) and [C 22 H 18 N 3 S] 2 W 6 O 19 2DMF (2) were synthesized under ambient conditions and characterized by CV, IR spectroscopy, solid diffuse reflectance spectrum, UV-vis spectra in DMF solution, luminescent spectrum and single crystal X-ray diffraction. Crystallographic data reveal that compounds 1 and 2 are isostructural and both crystallize in the triclinic space group P1-bar . Their crystal structures present that the layers of organic molecules and inorganic anions array alternatively, and there exist strong π...π stacking interactions between dimeric MB cations and near distance interactions among organic dye cations, Lindqvist-type POM polyanions and DMF molecules. The solid diffuse reflectance spectra and UV-vis spectra in DMF solution appear new absorption bands ascribed to the charge-transfer transition between the cationic MB donor and the POM acceptors. Studies of the photoluminescent properties show that the formation of 1 and 2 lead to the fluorescence quenching of starting materials. -- Graphical abstract: Their crystal structures present that the layers of organic molecules and inorganic anions array alternatively, and there exist strong π...π stacking interactions between dimeric MB cations. Display Omitted
Zhang, Min; Liang, Zuozhong; Wu, Fei; Chen, Jian-Feng; Xue, Chunyu; Zhao, Hong
2017-06-01
We selected the crystal structures of ibuprofen with seven common space groups (Cc, P21/c, P212121, P21, Pbca, Pna21, and Pbcn), which was generated from ibuprofen molecule by molecular simulation. The predicted crystal structures of ibuprofen with space group P21/c has the lowest total energy and the largest density, which is nearly indistinguishable with experimental result. In addition, the XRD patterns for predicted crystal structure are highly consistent with recrystallization from solvent of ibuprofen. That indicates that the simulation can accurately predict the crystal structure of ibuprofen from the molecule. Furthermore, based on this crystal structure, we predicted the crystal habit in vacuum using the attachment energy (AE) method and considered solvent effects in a systematic way using the modified attachment energy (MAE) model. The simulation can accurately construct a complete process from molecule to crystal structure to morphology prediction. Experimentally, we observed crystal morphologies in four different polarity solvents compounds (ethanol, acetonitrile, ethyl acetate, and toluene). We found that the aspect ratio decreases of crystal habits in this ibuprofen system were found to vary with increasing solvent relative polarity. Besides, the modified crystal morphologies are in good agreement with the observed experimental morphologies. Finally, this work may guide computer-aided design of the desirable crystal morphology.
Biological Nanopores: Confined Spaces for Electrochemical Single-Molecule Analysis.
Cao, Chan; Long, Yi-Tao
2018-02-20
Nanopore sensing is developing into a powerful single-molecule approach to investigate the features of biomolecules that are not accessible by studying ensemble systems. When a target molecule is transported through a nanopore, the ions occupying the pore are excluded, resulting in an electrical signal from the intermittent ionic blockade event. By statistical analysis of the amplitudes, duration, frequencies, and shapes of the blockade events, many properties of the target molecule can be obtained in real time at the single-molecule level, including its size, conformation, structure, charge, geometry, and interactions with other molecules. With the development of the use of α-hemolysin to characterize individual polynucleotides, nanopore technology has attracted a wide range of research interest in the fields of biology, physics, chemistry, and nanoscience. As a powerful single-molecule analytical method, nanopore technology has been applied for the detection of various biomolecules, including oligonucleotides, peptides, oligosaccharides, organic molecules, and disease-related proteins. In this Account, we highlight recent developments of biological nanopores in DNA-based sensing and in studying the conformational structures of DNA and RNA. Furthermore, we introduce the application of biological nanopores to investigate the conformations of peptides affected by charge, length, and dipole moment and to study disease-related proteins' structures and aggregation transitions influenced by an inhibitor, a promoter, or an applied voltage. To improve the sensing ability of biological nanopores and further extend their application to a wider range of molecular sensing, we focus on exploring novel biological nanopores, such as aerolysin and Stable Protein 1. Aerolysin exhibits an especially high sensitivity for the detection of single oligonucleotides both in current separation and duration. Finally, to facilitate the use of nanopore measurements and statistical analysis
International Nuclear Information System (INIS)
Nakasako, Masayoshi; Yamamoto, Masaki
2015-01-01
In Japan, X-ray structure analyses of molecules and particles from biology started in the 1970s. The structure analysis methods have been developed through the innovation of various techniques in advance, and have contributed for understanding the elementary and microscopic processes in life. Here we summarize briefly the history of X-ray structure analyses for structural biology in Japan and think about the prospect. (author)
International Nuclear Information System (INIS)
Miyake, K; Nakano, M; Korenaga, A; Mano, H; Ando, Y
2010-01-01
The tribological properties of nanostripe surface structures were investigated using a pin-on-plate tribometer in order to propose a design concept for improving the tribological properties. The authors used four kinds of nanostripe structures consisting of different combinations of materials (Fe-Au, C-SiC, Al-Al 2 O 3 and Al-Pt) fabricated by a process they had previously proposed. The frictional properties of the nanostripe structures depended on the materials that constituted the nanostripes. When the sliding direction in friction tests was parallel to the microgrooves, nanostripe structures remained on all surfaces even after friction tests. Based on the friction test results, the authors considered a design concept for nanostripe structures in tribological applications.
Observation of pendular butterfly Rydberg molecules
Niederprüm, Thomas; Thomas, Oliver; Eichert, Tanita; Lippe, Carsten; Pérez-Ríos, Jesús; Greene, Chris H.; Ott, Herwig
2016-01-01
Engineering molecules with a tunable bond length and defined quantum states lies at the heart of quantum chemistry. The unconventional binding mechanism of Rydberg molecules makes them a promising candidate to implement such tunable molecules. A very peculiar type of Rydberg molecules are the so-called butterfly molecules, which are bound by a shape resonance in the electron–perturber scattering. Here we report the observation of these exotic molecules and employ their exceptional properties to engineer their bond length, vibrational state, angular momentum and orientation in a small electric field. Combining the variable bond length with their giant dipole moment of several hundred Debye, we observe counter-intuitive molecules which locate the average electron position beyond the internuclear distance. PMID:27703143
Investigation of polyelectrolyte desorption by single molecule force spectroscopy
International Nuclear Information System (INIS)
Friedsam, C; Seitz, M; Gaub, H E
2004-01-01
Single molecule force spectroscopy has evolved into a powerful method for the investigation of intra- and intermolecular interactions at the level of individual molecules. Many examples, including the investigation of the dynamic properties of complex biological systems as well as the properties of covalent bonds or intermolecular transitions within individual polymers, are reported in the literature. The technique has recently been extended to the systematic investigation of desorption processes of individual polyelectrolyte molecules adsorbed on generic surfaces. The stable covalent attachment of polyelectrolyte molecules to the AFM-tip provides the possibility of performing long-term measurements with the same set of molecules and therefore allows the in situ observation of the impact of environmental changes on the adsorption behaviour of individual molecules. Different types of interactions, e.g. electrostatic or hydrophobic interactions, that determine the adsorption process could be identified and characterized. The experiments provided valuable details that help to understand the nature and the properties of non-covalent interactions, which is helpful with regard to biological systems as well as for technical applications. Apart from this, desorption experiments can be utilized to characterize the properties of surfaces or polymer coatings. Therefore they represent a versatile tool that can be further developed in terms of various aspects
Bonding and vibrational dynamics of a large π-conjugated molecule on a metal surface
International Nuclear Information System (INIS)
Temirov, R; Soubatch, S; Lassise, A; Tautz, F S
2008-01-01
The interplay between the substrate bonding of a large π-conjugated semiconductor molecule and the dynamical properties of the metal-organic interface is studied, employing the prototypical PTCDA/Ag(111) monolayer as an example. Both the coupling of molecular vibrations to the electron-hole-pair continuum of the metal surface and the inelastic scattering of tunnelling electrons by the molecular vibrations on their passage through the molecule are considered. The results of both types of experiment are consistent with the findings of measurements which probe the geometric and electronic structure of the adsorbate-substrate complex directly; generally speaking, they can be understood in the framework of standard theories for the electron-vibron coupling. While the experiments reported here in fact provide additional qualitative insights into the substrate bonding of our π-conjugated model molecule, their detailed quantitative understanding would require a full calculation of the dynamical interface properties, which is currently not available
Dworkin, Jason P.; Sandford, Scott A.; Deamer, David W.; Gillette, J. Seb; Zare, Richard N.; Allamandola, Louis J. (Technical Monitor)
1999-01-01
The combination of realistic laboratory simulations and infrared observations have revolutionized our understanding of interstellar dust and ice-the main component of comets. Since comets and carbonaceous micrometeorites may have been important sources of volatiles and carbon compounds on the early Earth, their organic composition may be related to the origin of life. Ices on grains in molecular clouds contain a variety of simple molecules. The D/H ratios of the comets Hale-Bopp and Hyakutake are consistent with a primarily interstellar ice mixture. Within the cloud and especially in the presolar nebula through the early solar system, these icy grains would have been photoprocessed by the ultraviolet producing more complex species such as hexamethylenetetramine, polyoxymethylenes, and simple keones. We reported at the 1999 Bioastronomy meeting laboratory simulations studied to identify the types of molecules which could have been generated in pre-cometary ices. Experiments were conducted by forming a realistic interstellar mixed-molecular ice (H2O, CH3OH, NH3 and CO) at approximately 10 K under high vacuum irradiated with UV light from a hydrogen plasma lamp. The gas mixture was typically 100:50:1:1, however when different ratios were used material with similar characteristics was still produced. The residue that remained after warming to room temperature was analyzed by HPLC, and by several mass spectrometric methods. This material contains a rich mixture of complex compounds with mass spectral profiles resembling those found in IDPs and meteorites. Surface tension measurements show that an amphiphilic component is also present. These species do not appear in various controls or in unphotolyzed samples. Residues from the simulations were also dispersed in aqueous media for microscopy. The organic material forms 10-40 gm diameter droplets that fluoresce at 300-450 nm under UV excitation. These droplets have a morphology and internal structure which appear
Library design practices for success in lead generation with small molecule libraries.
Goodnow, R A; Guba, W; Haap, W
2003-11-01
The generation of novel structures amenable to rapid and efficient lead optimization comprises an emerging strategy for success in modern drug discovery. Small molecule libraries of sufficient size and diversity to increase the chances of discovery of novel structures make the high throughput synthesis approach the method of choice for lead generation. Despite an industry trend for smaller, more focused libraries, the need to generate novel lead structures makes larger libraries a necessary strategy. For libraries of a several thousand or more members, solid phase synthesis approaches are the most suitable. While the technology and chemistry necessary for small molecule library synthesis continue to advance, success in lead generation requires rigorous consideration in the library design process to ensure the synthesis of molecules possessing the proper characteristics for subsequent lead optimization. Without proper selection of library templates and building blocks, solid phase synthesis methods often generate molecules which are too heavy, too lipophilic and too complex to be useful for lead optimization. The appropriate filtering of virtual library designs with multiple computational tools allows the generation of information-rich libraries within a drug-like molecular property space. An understanding of the hit-to-lead process provides a practical guide to molecular design characteristics. Examples of leads generated from library approaches also provide a benchmarking of successes as well as aspects for continued development of library design practices.
Electronic and conformational properties of 2,3-benzodiazepine derivates
International Nuclear Information System (INIS)
Pelaggi, M.; Girlanda, R.; Chimirri, A.; Gitto, R.
1996-01-01
The molecular geometric and electronic structures of 2,3-benzodiazepine derivates have been studied by means of the MNDO-PM3 method. A number of electronic properties have been computed and examined in order to find indication of the role of the electronic characteristics of the different molecules and their pharmacological properties. Theoretical data indicate that both electronic and structural properties appear responsible for the varying degree of anticonvulsant activity exhibited by compounds 1-4
Electronic and conformational properties of 2,3-benzodiazepine derivates
Energy Technology Data Exchange (ETDEWEB)
Pelaggi, M.; Girlanda, R. [Messina Univ. (Italy). Dip. di Fisica della Materia e Fisica dell`Ambiente; Chimirri, A.; Gitto, R. [Messina Univ. (Italy). Dip. Farmaco-Chimico
1996-04-01
The molecular geometric and electronic structures of 2,3-benzodiazepine derivates have been studied by means of the MNDO-PM3 method. A number of electronic properties have been computed and examined in order to find indication of the role of the electronic characteristics of the different molecules and their pharmacological properties. Theoretical data indicate that both electronic and structural properties appear responsible for the varying degree of anticonvulsant activity exhibited by compounds 1-4.
Penocchio, Emanuele; Piccardo, Matteo; Barone, Vincenzo
2015-10-13
The B2PLYP double hybrid functional, coupled with the correlation-consistent triple-ζ cc-pVTZ (VTZ) basis set, has been validated in the framework of the semiexperimental (SE) approach for deriving accurate equilibrium structures of molecules containing up to 15 atoms. A systematic comparison between new B2PLYP/VTZ results and several equilibrium SE structures previously determined at other levels, in particular B3LYP/SNSD and CCSD(T) with various basis sets, has put in evidence the accuracy and the remarkable stability of such model chemistry for both equilibrium structures and vibrational corrections. New SE equilibrium structures for phenylacetylene, pyruvic acid, peroxyformic acid, and phenyl radical are discussed and compared with literature data. Particular attention has been devoted to the discussion of systems for which lack of sufficient experimental data prevents a complete SE determination. In order to obtain an accurate equilibrium SE structure for these situations, the so-called templating molecule approach is discussed and generalized with respect to our previous work. Important applications are those involving biological building blocks, like uracil and thiouracil. In addition, for more general situations the linear regression approach has been proposed and validated.
Pál, Edit; Hornok, Viktória; Sebok, Dániel; Majzik, Andrea; Dékány, Imre
2010-08-01
Lysozyme/gold thin layers were prepared by layer-by-layer (LbL) self-assembly method. The build-up of the films was followed by UV-vis-absorbance spectra, quartz crystal microbalance (QCM) and surface plasmon resonance (SPR) techniques. The structural property of films was examined by X-ray diffraction (XRD) measurements, while their morphology was studied by scanning electron microscopy (SEM) and atomic force microscopy (AFM). It was found that gold nanoparticles (NPs) had cubic crystalline structure, the primary particles form aggregates in the thin layer due to the presence of lysozyme molecules. The UV-vis measurements prove change in particle size while the colour of the film changes from wine-red to blue. The layer thickness of films was determined using the above methods and the loose, porous structure of the films explains the difference in the results. The vapour adsorption property of hybrid layers was also studied by QCM using different saturated vapours and ammonia gas. The lysozyme/Au films were most sensitive for ammonia gas among the tested gases/vapours due to the strongest interaction between the functional groups of the protein. Copyright 2010 Elsevier B.V. All rights reserved.
International Nuclear Information System (INIS)
Chew, H.; McNulty, P.J.
1982-01-01
In earlier work a model of fluorescent and Raman scattering by active molecules represented as classical electric dipoles embedded in small particles was developed. The intensity and angular distribution of the inelastically scattered radiation was shown to depend on the geometric and optical properties of the particle. The model was originally developed for particles having spherical shape and later extended to concentric spheres, cylinders, and prolate spheroids. The active molecules were originally assumed to be isotropically polarizable. The model has been recently extended to certain types of anisotropically polarizable molecules. The model had also been applied to particles having internal structure
Surface functionalization of aluminosilicate nanotubes with organic molecules
Directory of Open Access Journals (Sweden)
Wei Ma
2012-02-01
Full Text Available The surface functionalization of inorganic nanostructures is an effective approach for enriching the potential applications of existing nanomaterials. Inorganic nanotubes attract great research interest due to their one-dimensional structure and reactive surfaces. In this review paper, recent developments in surface functionalization of an aluminosilicate nanotube, “imogolite”, are introduced. The functionalization processes are based on the robust affinity between phosphate groups of organic molecules and the aluminol (AlOH surface of imogolite nanotubes. An aqueous modification process employing a water soluble ammonium salt of alkyl phosphate led to chemisorption of molecules on imogolite at the nanotube level. Polymer-chain-grafted imogolite nanotubes were prepared through surface-initiated polymerization. In addition, the assembly of conjugated molecules, 2-(5’’-hexyl-2,2’:5’,2’’-terthiophen-5-ylethylphosphonic acid (HT3P and 2-(5’’-hexyl-2,2’:5’,2’’-terthiophen-5-ylethylphosphonic acid 1,1-dioxide (HT3OP, on the imogolite nanotube surface was achieved by introducing a phosphonic acid group to the corresponding molecules. The optical and photophysical properties of these conjugated-molecule-decorated imogolite nanotubes were characterized. Moreover, poly(3-hexylthiophene (P3HT chains were further hybridized with HT3P modified imogolite to form a nanofiber hybrid.
International Nuclear Information System (INIS)
Nakvasina, M.A.; Artyukhov, V.G.; Agisheva, N.V.
1999-01-01
Photoinduced changes in structural and functional properties of lactatedehydrogenase isoenzymes from human erythrocytes in free state and in the presence of serotonin have been studied by means of gel chromatography, electrophoresis, IR-spectrophotometry and by the method of definition of catalytic activity. UV radiation exposure induces photoinactivation of erythrocytes lactatedehydrogenase, while its inhibitory effect intensifies with the increase of radiation dose. Pronounced photoprotective effect of serotonin towards the molecules of erythrocytic lactatedehydrogenase isoenzymes has been discovered. It seems to be caused by formation of enzyme - biogenic amine complex affecting the secondary protein structure [ru
Kaneko, Satoshi; Takahashi, Ryoji; Fujii, Shintaro; Nishino, Tomoaki; Kiguchi, Manabu
2017-04-12
The formation process and atomic structures were investigated for single pyrazine molecular junctions sandwiched by three different Au, Ag, and Cu electrodes using a mechanically controllable break junction technique in ultrahigh vacuum conditions at 300 K. We demonstrated that the formation process of the single-molecule junction crucially depended on the choice of the metal electrodes. While single-molecule junction showing two distinct conductance states were found for the Au electrodes, only the single conductance state was evident for the Ag electrodes, and there was no junction formation for the Cu electrodes. These results suggested that metal-molecule interaction dominates the formation process and probability of the single-molecule junction. In addition to the metal-molecule interaction, temperature affected the formation process of the single-molecule junction. The single pyrazine molecular junction formed between Au electrodes exhibited significant temperature dependence where the junction-formation probability was about 8% at 300 K, while there was no junction-formation at 100 K. Instead of the junction formation, an Au atomic wire was formed at the low temperature. This study provides insight into the tuning of the junction-forming process for single-molecule junctions, which is needed to construct device structures on a single molecule scale.
Click strategies for single-molecule protein fluorescence.
Milles, Sigrid; Tyagi, Swati; Banterle, Niccolò; Koehler, Christine; VanDelinder, Virginia; Plass, Tilman; Neal, Adrian P; Lemke, Edward A
2012-03-21
Single-molecule methods have matured into central tools for studies in biology. Foerster resonance energy transfer (FRET) techniques, in particular, have been widely applied to study biomolecular structure and dynamics. The major bottleneck for a facile and general application of these studies arises from the need to label biological samples site-specifically with suitable fluorescent dyes. In this work, we present an optimized strategy combining click chemistry and the genetic encoding of unnatural amino acids (UAAs) to overcome this limitation for proteins. We performed a systematic study with a variety of clickable UAAs and explored their potential for high-resolution single-molecule FRET (smFRET). We determined all parameters that are essential for successful single-molecule studies, such as accessibility of the probes, expression yield of proteins, and quantitative labeling. Our multiparameter fluorescence analysis allowed us to gain new insights into the effects and photophysical properties of fluorescent dyes linked to various UAAs for smFRET measurements. This led us to determine that, from the extended tool set that we now present, genetically encoding propargyllysine has major advantages for state-of-the-art measurements compared to other UAAs. Using this optimized system, we present a biocompatible one-step dual-labeling strategy of the regulatory protein RanBP3 with full labeling position freedom. Our technique allowed us then to determine that the region encompassing two FxFG repeat sequences adopts a disordered but collapsed state. RanBP3 serves here as a prototypical protein that, due to its multiple cysteines, size, and partially disordered structure, is not readily accessible to any of the typical structure determination techniques such as smFRET, NMR, and X-ray crystallography.
The Tunable Bandgap of AB-Stacked Bilayer Graphene on SiO2 with H2O Molecule Adsorption
International Nuclear Information System (INIS)
Wang Tao; Guo Qing; Liu Yan; Wang Wen-Bo; Sheng Kuang; Ao Zhi-Min; Yu Bin
2011-01-01
The atomic and electronic structures of AB-stacking bilayer graphene (BLG) in the presence of H 2 O molecules are investigated by density functional theory calculations. For free-standing BLG, the bandgap is opened to 0.101 eV with a single H 2 O molecule adsorbed on its surface. The perfectly suspended BLG is sensitive to H 2 O adsorbates, which break the BLG lattice symmetry and open an energy gap. While a single H 2 O molecule is adsorbed on the BLG surface with a SiO 2 substrate, the bandgap widens to 0.363 eV. Both the H 2 O molecule adsorption and the oxide substrate contribute to the BLG bandgap opening. The phenomenon is interpreted with the charge transfer process in 2D carbon nanostructures. (condensed matter: electronic structure, electrical, magnetic, and optical properties)
Taking snapshots of photoexcited molecules in disordered media using pulsed synchrotron x-rays
International Nuclear Information System (INIS)
Chen, L.X.
2004-01-01
Photoexcited molecules are quintessential reactants in photochemistry. Structures of these photoexcited molecules in disordered media in which a majority of photochemical reactions take place remained elusive for decades owing to a lack of suitable X-ray sources, despite their importance in understanding fundamental aspects in photochemistry. As new pulsed X-ray sources become available, short-lived excited-state molecular structures in disordered media can now be captured by using laser-pulse pump, X-ray pulse-probe techniques of third-generation synchrotron sources with time resolutions of 30-100 ps, as demonstrated by examples in this review. These studies provide unprecedented information on structural origins of molecular properties in the excited states. By using other ultrafast X-ray facilities that will be completed in the near future, time-resolution for the excited-state structure measurements should reach the femtosecond timescales, which will make 'molecular movies' of bond breaking or formation, and vibrational relaxation, a reality.
Jansens, Koen J A; Lagrain, Bert; Brijs, Kristof; Goderis, Bart; Smet, Mario; Delcour, Jan A
2013-11-06
High-temperature compression molding of wheat gluten at low water levels yields a rigid plastic-like material. We performed a systematic study to determine the effect of additives with multiple thiol (SH) groups on gluten network formation during processing and investigate the impact of the resulting gluten network on the mechanical properties of the glassy end product. To this end, a fraction of the hydroxyl groups of different polyols was converted into SH functionalities by esterifying with 3-mercaptopropionic acid (MPA). The monofunctional additive MPA was evaluated as well. During low-temperature mixing SH-containing additives decreased the gluten molecular weight, whereas protein cross-linking occurred during high-temperature compression molding. The extent of both processes depended on the molecular architecture of the additives and their concentration. After molding, the material strength and failure strain increased without affecting the modulus, provided the additive concentration was low. The strength decreased again at too high concentrations for polyols with low SH functionalization. Attributing these effects solely to the interplay of plasticization and the SH-facilitated introduction of cross-links is inadequate, since an improvement in both strength and failure strain was also observed in the presence of high levels of MPA. It is hypothesized that, regardless of the molecular structure of the additive, the presence of SH-containing groups induces conformational changes which contribute to the mechanical properties of glassy gluten materials.
International Nuclear Information System (INIS)
Hada, Subin; Solvason, Charles C.; Eden, Mario R.
2014-01-01
In this work, multivariate characterization data such as infrared spectroscopy was used as a source of descriptor data involving information on molecular architecture for designing structured molecules with tailored properties. Application of multivariate statistical techniques such as principal component analysis allowed capturing important features of the molecular architecture from enormous amount of complex data to build appropriate latent variable models. Combining the property clustering techniques and group contribution methods based on characterization (cGCM) data in a reverse problem formulation enabled identifying candidate components by combining or mixing molecular fragments until the resulting properties match the targets. The developed methodology is demonstrated using molecular design of biodiesel additive, which when mixed with off-spec biodiesel produces biodiesel that meets the desired fuel specifications. The contribution of this work is that the complex structures and orientations of the molecule can be included in the design, thereby allowing enumeration of all feasible candidate molecules that matched the identified target but were not part of original training set of molecules.
Energy Technology Data Exchange (ETDEWEB)
Hada, Subin; Solvason, Charles C.; Eden, Mario R., E-mail: edenmar@auburn.edu [Department of Chemical Engineering, Auburn University, Auburn, AL (United States)
2014-06-10
In this work, multivariate characterization data such as infrared spectroscopy was used as a source of descriptor data involving information on molecular architecture for designing structured molecules with tailored properties. Application of multivariate statistical techniques such as principal component analysis allowed capturing important features of the molecular architecture from enormous amount of complex data to build appropriate latent variable models. Combining the property clustering techniques and group contribution methods based on characterization (cGCM) data in a reverse problem formulation enabled identifying candidate components by combining or mixing molecular fragments until the resulting properties match the targets. The developed methodology is demonstrated using molecular design of biodiesel additive, which when mixed with off-spec biodiesel produces biodiesel that meets the desired fuel specifications. The contribution of this work is that the complex structures and orientations of the molecule can be included in the design, thereby allowing enumeration of all feasible candidate molecules that matched the identified target but were not part of original training set of molecules.
Transport through overlapping states in quantum dots and double dot molecules
International Nuclear Information System (INIS)
Berkovits, R.
2006-01-01
Full Text: We shall review the transport properties of interacting quantum dots with overlapping orbitals for which the orthodox Coulomb blockade picture no longer holds. We shall concentrate on he conductance through a serial double dot structure for which the inter-dot tunneling is stronger than the tunneling to the leads. When the dots are occupied by 1 or 3 electrons the usual Kondo peak is observed. For the case in which 2 electrons occupy the molecule a singlet is formed. Nevertheless, the conductance in that case has a constant non-zero value, and might even be equal to the maximum conductance of 2e 2 /h for certain values of the molecule parameters. We show that this is the result of the subtle interplay between the symmetric and anti-symmetric orbitals of the molecule caused by interactions and interference
International Nuclear Information System (INIS)
Manna, Arun K.; Pati, Swapan K.
2013-01-01
Highlights: • Stability and electronic structure of various carbon capsules are studied. • Effects of capsule’s sizes on electronic and optical properties are explored. • Changes in cohesive and formation energy and electronic gap are discussed. • Capsule’s gas storage propensity is addressed using DFT and ab initio MD. • Capsule’s optical absorptions are discussed with and without stored gas molecules. - Abstract: Structures, electronic and optical properties of carbon nanocapsules of varying sizes (length and diameter) are studied using first-principles density functional theory. Based on calculated cohesive energy, formation energy, electronic gap and extent of orbital delocalization, we examine structural stability and changes in low-energy physics of these carbon capsules. We find that both cohesive and formation energy decrease with increase in capsule’s sizes, indicating their greater structural rigidity and favorable formation feasibility. The electronic gap also decreases with increase in capsule’s sizes due to the larger electronic delocalization. The simulated optical absorption spectra show lowering of low-energy peak positions with increase in the capsule’s dimensions, consistent with the reduction in electronic gap. Additionally, we also provide an estimate of gas storage capacity for the larger carbon capsule (C 460 ) considered. We find 7.69 wt.% and 28.08 wt.% storage propensity for hydrogen and carbon dioxide gases, respectively, which clearly suggests their potential use as light storage materials
Thermal ion-molecule reactions in oxygen-containing molecules
International Nuclear Information System (INIS)
Kumakura, Minoru
1981-02-01
The energetics of ions and the thermal ion-molecule reactions in oxygen-containing molecules have been studied with a modified time-of-flight mass spectrometer. It was found that the translational energy of ion can be easily obtained from analysis of the decay curve using the time-of-flight mass spectrometer. The condensation-elimination reactions proceeded via cross- and homo-elimination mechanism in which the nature of intermediate-complex could be correlated with the nature of reactant ion. It was elucidated that behavior of poly-atomic oxygen-containing ions on the condensation-elimination reactions is considerably influenced by their oxonium ion structures having functional groups. In addition, the rate constants of the condensation-elimination reactions have affected with the energy state of reactant ion and the dipole moment and/or the polarizability of neutral molecule. It was clarified that the rate constants of the ion-molecule clustering reactions in poly-atomic oxygen-containing molecules such as cyclic ether of six member rings are very large and the cluster ions are stable owing to the large number of vibrational degree of freedom in the cluster ions. (author)
Elbing, Mark; Ochs, Rolf; Koentopp, Max; Fischer, Matthias; von Hänisch, Carsten; Weigend, Florian; Evers, Ferdinand; Weber, Heiko B.; Mayor, Marcel
2005-01-01
We have designed and synthesized a molecular rod that consists of two weakly coupled electronic π -systems with mutually shifted energy levels. The asymmetry thus implied manifests itself in a current–voltage characteristic with pronounced dependence on the sign of the bias voltage, which makes the molecule a prototype for a molecular diode. The individual molecules were immobilized by sulfur–gold bonds between both electrodes of a mechanically controlled break junction, and their electronic transport properties have been investigated. The results indeed show diode-like current–voltage characteristics. In contrast to that, control experiments with symmetric molecular rods consisting of two identical π -systems did not show significant asymmetries in the transport properties. To investigate the underlying transport mechanism, phenomenological arguments are combined with calculations based on density functional theory. The theoretical analysis suggests that the bias dependence of the polarizability of the molecule feeds back into the current leading to an asymmetric shape of the current–voltage characteristics, similar to the phenomena in a semiconductor diode. PMID:15956208
International Nuclear Information System (INIS)
Ho, P. J.; Starodub, D.; Saldin, D. K.; Shneerson, V. L.; Ourmazd, A.; Santra, R.
2009-01-01
We investigate the molecular structure information contained in the x-ray diffraction patterns of an ensemble of rigid CF 3 Br molecules aligned by an intense laser pulse at finite rotational temperature. The diffraction patterns are calculated at an x-ray photon energy of 20 keV to probe molecular structure at angstrom-scale resolution. We find that a structural reconstruction algorithm based on iterative phase retrieval fails to extract a reliable structure. However, the high atomic number of Br compared with C or F allows each diffraction pattern to be treated as a hologram. Using this approach, the azimuthal projection of the molecular electron density about the alignment axis may be retrieved.
Structural, electronic, and magnetic properties of pristine and oxygen-adsorbed graphene nanoribbons
Energy Technology Data Exchange (ETDEWEB)
Miwa, R.H.; Veiga, R.G.A. [Instituto de Fisica, Universidade Federal de Uberlandia, Caixa Postal 593, CEP 38400-902, Uberlandia, MG (Brazil); Srivastava, G.P., E-mail: gps@excc.ex.ac.uk [School of Physics, University of Exeter, Stocker Road, Exeter EX4 4QL (United Kingdom)
2010-07-15
The structural, electronic and magnetic properties of pristine and oxygen-adsorbed (3,0) zigzag and (6,1) armchair graphene nanoribbons have been investigated theoretically, by employing the ab initio pseudopotential method within the density functional scheme. The zigzag nanoribbon is more stable with antiferromagnetically coupled edges, and is semiconducting. The armchair nanoribbon does not show any preference for magnetic ordering and is semiconducting. The oxygen molecule in its triplet state is adsorbed most stably at the edge of the zigzag nanoribbon. The Stoner metallic behaviour of the ferromagnetic nanoribbons and the Slater insulating (ground state) behaviour of the antiferromagnetic nanoribbons remain intact upon oxygen adsorption. However, the local magnetic moment of the edge carbon atom of the ferromagnetic zigzag ribbon is drastically reduced, due to the formation of a spin-paired C-O bond.
Barone, Vincenzo; Improta, Roberto; Rega, Nadia
2008-05-01
Interpretation of structural properties and dynamic behavior of molecules in solution is of fundamental importance to understand their stability, chemical reactivity, and catalytic action. While information can be gained, in principle, by a variety of spectroscopic techniques, the interpretation of the rich indirect information that can be inferred from the analysis of experimental spectra is seldom straightforward because of the subtle interplay of several different effects, whose specific role is not easy to separate and evaluate. In such a complex scenario, theoretical studies can be very helpful at two different levels: (i) supporting and complementing experimental results to determine the structure of the target molecule starting from its spectral properties; (ii) dissecting and evaluating the role of different effects in determining the observed spectroscopic properties. This is the reason why computational spectroscopy is rapidly evolving from a highly specialized research field into a versatile and widespread tool for the assignment of experimental spectra and their interpretation in terms of chemical physical effects. In such a situation, it becomes important that both computationally and experimentally oriented chemists are aware that new methodological advances and integrated computational strategies are available, providing reliable estimates of fundamental spectral parameters not only for relatively small molecules in the gas phase but also for large and flexible molecules in condensed phases. In this Account, we review the most significant methodological contributions from our research group in this field, and by exploiting some recent results of their application to the computation of IR, UV-vis, NMR, and EPR spectral parameters, we discuss the microscopic mechanisms underlying solvent and vibrational effects on the spectral parameters. After reporting some recent achievements for the study of excited states by first principle quantum mechanical
Zhang, Shanshan; Niu, Qingfen; Sun, Tao; Li, Yang; Li, Tianduo; Liu, Haixia
2017-08-01
A novel linear A-π-D-π-A-type organic small molecule Ph2(PDPP)2 consisting diketopyrrolopyrrole (DPP) as acceptor unit, biphenylene as donor unit and acetylene unit as π-linkage has been successfully designed and synthesized. Its corresponding thermal, photophysical and electrochemical properties as well as the photoinduced charge-separation process were investigated. Ph2(PDPP)2 exhibits high thermal stability and it can be soluble in common organic solvents such as chloroform and tetrahydrofuran. The photophysical properties show that DPP2Ph2 harvests sunlight over the entire visible spectrum range in the thin-film state (300-800 nm). DPP2Ph2 has lower band gaps and appropriate energy levels to satisfy the requirement of solution-processable organic solar cells. The efficient photoinduced charge separation process was clearly observed between DPP2Ph2 with PC61BM and the Ksv value was found to be as high as 2.13 × 104 M- 1. Therefore, these excellent properties demonstrate that the designed A-π-D-π-A-type small molecule Ph2(PDPP)2 is the prospective candidate as donor material for organic photovoltaic material.
A Mott-like State of Molecules
International Nuclear Information System (INIS)
Duerr, S.; Volz, T.; Syassen, N.; Bauer, D. M.; Hansis, E.; Rempe, G.
2006-01-01
We prepare a quantum state where each site of an optical lattice is occupied by exactly one molecule. This is the same quantum state as in a Mott insulator of molecules in the limit of negligible tunneling. Unlike previous Mott insulators, our system consists of molecules which can collide inelastically. In the absence of the optical lattice these collisions would lead to fast loss of the molecules from the sample. To prepare the state, we start from a Mott insulator of atomic 87Rb with a central region, where each lattice site is occupied by exactly two atoms. We then associate molecules using a Feshbach resonance. Remaining atoms can be removed using blast light. Our method does not rely on the molecule-molecule interaction properties and is therefore applicable to many systems
Light incoupling in small molecule organic solar cells
Energy Technology Data Exchange (ETDEWEB)
Allinger, Nikola; Meiss, Jan; Riede, Moritz; Leo, Karl [Institut fuer Angewandte Photophysik, Technische Universitaet Dresden, 01069 Dresden (Germany); Gnehr, Wolf-Michael [Heliatek GmbH, Liebigstrasse 26, 01187 Dresden (Germany)
2008-07-01
Light incoupling is an essential topic for optimization of organic solar cells. In our group, we examine light incoupling of different kinds of transparent contacting materials as well as external dielectric coatings, using optical simulation of thin film systems and experimental methods. Thin films of small molecules are prepared by thermal evaporation in a multi-chamber UHV system. Complex refraction indices of various materials are calculated from reflection and transmission measurements of monolayers. For modelling of optical properties of thin film systems, we developed a numerical simulation program based on the transfer matrix method. The cell structures investigated consist of nanolayers of small molecules, using ZnPc/C60 as an acceptor-donor heterojunction. As contact materials, we compare the expensive standard material indium tin oxide (ITO) with more cost-efficient alternatives like thin Ag layers or spin-coated layers of the polymer PEDOT:PSS, and discuss the resulting cell properties. Additional dielectric layers of varying materials, like tris(8-hydroxy-quinolinate)-aluminum (Alq3) or N,N'-tetrakis(4-methoxyphenyl)-benzidine (MeO-TPD), are deposited on top of the stack and their influence on cell efficiencies is investigated.
DEFF Research Database (Denmark)
Zhang, Jingdong; Chi, Qijin; Ulstrup, Jens
The structure, two-dimensional organization, and function of molecules immobilized on solid surfaces can be addressed in a degree of detail that has reached the level of the single-molecule. In this context redox molecules are “smart” molecules adding sophisticated electronic function. Redox meta...
Controlling the interparticle distance in a 2D molecule-nanoparticle network
Energy Technology Data Exchange (ETDEWEB)
Guedon, C M; Zonneveld, J; Van der Molen, S J [Kamerlingh Onnes Laboratorium, Leiden University, PO Box 9504, 2300 RA Leiden (Netherlands); Valkenier, H; Hummelen, J C [Stratingh Institute for Chemistry, University of Groningen, Nijenborgh 4, 9747 AG Groningen (Netherlands)
2011-03-25
Mechanically controllable break junctions allow for an impressive level of control over the distance between two electrodes, but lack stability at room temperature. On the other hand, two-dimensional (2D) networks of nanoparticles bridged by molecules form a stable device structure for investigating molecular conductance properties. Here, we combine both techniques to create a robust platform for molecular charge transport with control over the inter-electrode distance on the picometer scale. The resistance change due to bending of our structures is dependent on the molecular species present between the nanoparticles.
Controlling the interparticle distance in a 2D molecule-nanoparticle network
International Nuclear Information System (INIS)
Guedon, C M; Zonneveld, J; Van der Molen, S J; Valkenier, H; Hummelen, J C
2011-01-01
Mechanically controllable break junctions allow for an impressive level of control over the distance between two electrodes, but lack stability at room temperature. On the other hand, two-dimensional (2D) networks of nanoparticles bridged by molecules form a stable device structure for investigating molecular conductance properties. Here, we combine both techniques to create a robust platform for molecular charge transport with control over the inter-electrode distance on the picometer scale. The resistance change due to bending of our structures is dependent on the molecular species present between the nanoparticles.
Directory of Open Access Journals (Sweden)
Vladimir I. Volchikhin
2017-06-01
Full Text Available Introduction: The study promotes to decrease a number of errors of calculating the correlation coefficient in small test samples. Materials and Methods: We used simulation tool for the distribution functions of the density values of the correlation coefficient in small samples. A method for quantization of the data, allows obtaining a discrete spectrum states of one of the varieties of correlation functional. This allows us to consider the proposed structure as a mathematical correlation molecule, described by some analogue continuous-quantum Schrödinger equation. Results: The chi-squared Pearson’s molecule on small samples allows enhancing power of classical chi-squared test to 20 times. A mathematical correlation molecule described in the article has similar properties. It allows in the future reducing calculation errors of the classical correlation coefficients in small samples. Discussion and Conclusions: The authors suggest that there are infinitely many mathematical molecules are similar in their properties to the actual physical molecules. Schrödinger equations are not unique, their analogues can be constructed for each mathematical molecule. You can expect a mathematical synthesis of molecules for a large number of known statistical tests and statistical moments. All this should make it possible to reduce calculation errors due to quantum effects that occur in small test samples.
Designing small molecule polyaromatic p- and n-type semiconductor materials for organic electronics
Collis, Gavin E.
2015-12-22
By combining computational aided design with synthetic chemistry, we are able to identify core 2D polyaromatic small molecule templates with the necessary optoelectronic properties for p- and n-type materials. By judicious selection of the functional groups, we can tune the physical properties of the material making them amenable to solution and vacuum deposition. In addition to solubility, we observe that the functional group can influence the thin film molecular packing. By developing structure-property relationships (SPRs) for these families of compounds we observe that some compounds are better suited for use in organic solar cells, while others, varying only slightly in structure, are favoured in organic field effect transistor devices. We also find that the processing conditions can have a dramatic impact on molecular packing (i.e. 1D vs 2D polymorphism) and charge mobility; this has implications for material and device long term stability. We have developed small molecule p- and n-type materials for organic solar cells with efficiencies exceeding 2%. Subtle variations in the functional groups of these materials produces p- and ntype materials with mobilities higher than 0.3 cm2/Vs. We are also interested in using our SPR approach to develop materials for sensor and bioelectronic applications.
Effect of lattice-gas atoms on the adsorption behaviour of thioether molecules.
Pan, Yi; Yang, Bing; Hulot, Catherine; Blechert, Siegfried; Nilius, Niklas; Freund, Hans-Joachim
2012-08-21
Using STM topographic imaging and spectroscopy, we have investigated the adsorption of two thioether molecules, 1,2-bis(phenylthio)benzene and (bis(3-phenylthio)-phenyl)sulfane, on noble and transition metal surfaces. The two substrates show nearly antipodal behaviour. Whereas complexes with one or two protruding centres are observed on Au(111), only flat and uniform ad-structures are found on NiAl(110). The difference is ascribed to the possibility of the thioethers to form metal-organic complexes by coordinating lattice-gas atoms on the Au(111), while only the pristine molecules adsorb on the alloy surface. The metal coordination in the first case is driven by the formation of strong Au-S bonds and enables the formation of characteristic monomer, dimer and chain-like structures of the thioethers, using the Au atoms as linkers. A similar mechanism is not available on the NiAl, because no lattice gas develops at this surface at room temperature. Our work demonstrates how surface properties, i.e. the availability of mobile ad-species, determine the interaction of organic molecules with metallic substrates.
Odell, Anders
2011-10-03
The influence of the electrode\\'s Fermi surface on the transport properties of a photoswitching molecule is investigated with state-of-the-art ab initio transport methods. We report results for the conducting properties of the two forms of dithienylethene attached either to Ag or to nonmagnetic Ni leads. The I-V curves of the Ag/dithienylethene/Ag device are found to be very similar to those reported previously for Au. In contrast, when Ni is used as the electrode material the zero-bias transmission coefficient is profoundly different as a result of the role played by the Ni d bands in the bonding between the molecule and the electrodes. Intriguingly, despite these differences the overall conducting properties depend little on the electrode material. We thus conclude that electron transport in dithienylethene is, for the cases studied, mainly governed by the intrinsic electronic structure of the molecule. © 2011 American Physical Society.
Exploring charge transport properties and functionality of molecule-nanoparticle ensembles
Devid, Edwin Johan
2015-01-01
For more than 65 years, scientists have been fascinated by the idea to miniaturize electrical circuits toward the smallest length scales. One particular way is inspired by nature itself, specifically to assemble electrical components and switches from atoms and molecules. The molecules typically
Energy Technology Data Exchange (ETDEWEB)
Kazempoor, Michel
2009-02-02
The present work covers two topics namely the coadsorption of formic acid and water on Au(111) and the structure of biphenylalkanthiole SAMs on Au(111) surfaces. The coadsorption of formic acid and water on Au(111) surfaces has been investigated by means of vibrational and photoelectron spectroscopy (HREELS, XPS). Formic acid adsorbs at 90 K molecularly with vibrational modes characteristic for flat lying zig-zag chains in the mono- and multilayer regime, like in solid formic acid. The structure of the flat lying formic acid chains was determined by low energy electron diffraction (LEED) as a (2r3 x r19) unit cell. Annealing results in a complete desorption at 190 K. Sequential adsorption of formic acid and water at 90 K shows no significant chemical interaction. Upon annealing the coadsorbed layer to 140 K a hydrogenbonded cyclic complex of formic acid with one water molecule could be identified using isotopically labelled adsorbates. Upon further annealing this complex decomposes leaving molecularly adsorbed formic acid on the surface at 160 K, accompanied by a proton exchange between formic acid and water. The influence of the alkane spacer chain length on the structure of biphenylalkanethiols on Au(111) surfaces was investigated as well. A systematic study was done on BPn-SAMs deposited from the gas phase. For every chain length a structure was found by LEED. Furthermore the influence of temperature on the structure was investigated in the range from room temperature up to about 400 K. To obviate influences from different preparation methods BP3 and BP4 was deposited from gas phase and from solution. No LEED spots were observed on BP4 SAMs deposited from solution. For BP3 an influence of the preparation could be excluded. For all BPn-SAMs a good agreement between LEED and STM data's was found. Nevertheless different unit cells were determined by LEED and STM consistent structures could be suggested considering the unit cell size given by LEED and the
James, David T; Frost, Jarvist M; Wade, Jessica; Nelson, Jenny; Kim, Ji-Seon
2013-09-24
The consideration of anisotropic structural properties and their impact on optoelectronic properties in small-molecule thin films is vital to understand the performance of devices incorporating crystalline organic semiconductors. Here we report on the important relationship between structural and optoelectronic anisotropy in aligned, functionalized-pentacene thin films fabricated using the solution-based zone-casting technique. The microstructure of thin films composed of 6,13-bis(triisopropylsilylethynyl)pentacene (TIPS-pentacene) and 6,13-bis(triethylsilylethynyl)pentacene (TES-pentacene) is systematically controlled by varying the casting speed. By controlling the structural alignment, we were able to experimentally decouple, for the first time in these films, an intramolecular absorption transition dipole (at ∼440 nm) oriented close to the pentacene short axis and an intermolecular absorption transition dipole (at ∼695 nm) oriented predominantly along the conjugated pentacene-pentacene core stacking axis (crystallographic a-axis) in both films. Using the intermolecular absorption as a signature for intermolecular delocalization, much higher optical dichroism was obtained in TES-pentacene (16 ± 6) than TIPS-pentacene (3.2 ± 0.1), which was attributed to the 1D packing structure of TES-pentacene compared to the 2D packing structure of TIPS-pentacene. This result was also supported by field-effect mobility anisotropy measurements of the films, with TES-pentacene exhibiting a higher anisotropy (∼21-47, depending on the casting speed) than TIPS-pentacene (∼3-10).
Haldar, Soumyajyoti; Bhandary, Sumanta; Vovusha, Hakkim; Sanyal, Biplab
2017-01-01
In this paper, we have done a comparative study of electronic and magnetic properties of iron phthalocyanine (FePc) and cobalt phthalocyanine (CoPc) molecules physisorbed on monolayer of MoS$_2$ and graphene by using density functional theory
TiO2/Gold nanocomposite as an extremely sensitive molecule sensor for NO2 detection: A DFT study
Directory of Open Access Journals (Sweden)
Amirali Abbasi
2016-07-01
Full Text Available First-principles calculations within density functional theory (DFT have been performed to investigate the interactions of NO2 molecules with TiO2/Gold nanocomposites in order to completely exploit the adsorption properties of these nanostructures. Given the need to further comprehend the behavior of the NO2 molecules positioned between the TiO2 nanoparticle and Au monolayer, we have geometrically optimized the complex systems consisting of the NO2 molecule oriented at appropriate positions between the nanoparticle and Au monolayer. The structural properties such as bond lengths, bond angles, adsorption energies and Mulliken population analysis and the electronic properties including the density of states and molecular orbitals have been also analyzed in detail. The results indicate that the interaction between NO2 and undoped TiO2-N/Gold nanocomposites is stronger than that between gas molecules and N-doped TiO2/Gold nanocomposites, which reveals that the pristine nanocomposite can react with NO2 molecule more efficiently. Therefore, the obtained results also suggest a theoretical basis for the potential applications of TiO2/Gold nanocomposites in gas sensing, which could help in the developing of novel TiO2 based advanced sensor devices.
Multiphase composite coatings: structure and properties
International Nuclear Information System (INIS)
Yurov, V M; Guchenko, S A; Platonova, E S; Syzdykova, A Sh; Lysenko, E N
2015-01-01
The paper discusses the results of the research into the formation of ion-plasma multiphase coatings. The types of the formed structures are found to be not so diverse, as those formed, for example, in alloy crystallization. The structures observed are basically of globular type and, more rarely, of unclosed dissipative and cellular structures. It is shown that the properties of the coating formed in deposition are largely determined by its surface energy or surface tension. Since the magnitude of the surface tension (surface energy) in most cases is an additive quantity, each of the elements of the coating composition contributes to the total surface energy. In case of simultaneous sputtering of multiphase cathodes, high entropy coatings with an ordered cellular structure and improved mechanical properties are formed. (paper)
International Nuclear Information System (INIS)
Ullrich, Aladin; Horn, Siegfried
2013-01-01
We have investigated the structure of iron oxide nanoparticles produced by remineralization and thermal treatment of horse spleen apoferritin molecules. The described procedure allows to synthesize particles with diameters ranging from 4 to 7 nm in size. Atomic force microscopy and transmission electron microscopy (TEM) investigations were performed for shape and size determination, whereas energy-dispersive X-ray (TEM-EDX), high-resolution TEM, and electron diffraction measurements revealed the chemical composition and crystal structure of the particles. We found predominantly single crystalline nanoparticles with a hematite-like (α-Fe 2 O 3 ) structure
Yoo, Hyejin
2012-10-25
Perylenediimide (PDI) molecules are promising building blocks for photophysical studies of electronic interactions within multichromophore arrays. Such PDI arrays are important materials for fabrication of molecular nanodevices such as organic light-emitting diodes, organic semiconductors, and biosensors because of their high photostability, chemical and physical inertness, electron affinity, and high tinctorial strength over the entire visible spectrum. In this work, PDIs have been organized into linear (L3) and trefoil (T3) trimer molecules and investigated by single-molecule fluorescence microscopy to probe the relationship between molecular structures and interchromophoric electronic interactions. We found a broad distribution of coupling strengths in both L3 and T3 and hence strong/weak coupling between PDI units by monitoring spectral peak shifts in single-molecule fluorescence spectra upon sequential photobleaching of each constituent chromophore. In addition, we used a wide-field defocused imaging technique to resolve heterogeneities in molecular structures of L3 and T3 embedded in a PMMA polymer matrix. A systematic comparison between the two sets of experimental results allowed us to infer the correlation between intermolecular interactions and molecular structures. Our results show control of the PDI intermolecular interactions using suitable multichromophoric structures. © 2012 American Chemical Society.
Yoo, Hyejin; Furumaki, Shu; Yang, Jaesung; Lee, Ji-Eun; Chung, Heejae; Oba, Tatsuya; Kobayashi, Hiroyuki; Rybtchinski, Boris; Wilson, Thea M.; Wasielewski, Michael R.; Vacha, Martin; Kim, Dongho
2012-01-01
Perylenediimide (PDI) molecules are promising building blocks for photophysical studies of electronic interactions within multichromophore arrays. Such PDI arrays are important materials for fabrication of molecular nanodevices such as organic light-emitting diodes, organic semiconductors, and biosensors because of their high photostability, chemical and physical inertness, electron affinity, and high tinctorial strength over the entire visible spectrum. In this work, PDIs have been organized into linear (L3) and trefoil (T3) trimer molecules and investigated by single-molecule fluorescence microscopy to probe the relationship between molecular structures and interchromophoric electronic interactions. We found a broad distribution of coupling strengths in both L3 and T3 and hence strong/weak coupling between PDI units by monitoring spectral peak shifts in single-molecule fluorescence spectra upon sequential photobleaching of each constituent chromophore. In addition, we used a wide-field defocused imaging technique to resolve heterogeneities in molecular structures of L3 and T3 embedded in a PMMA polymer matrix. A systematic comparison between the two sets of experimental results allowed us to infer the correlation between intermolecular interactions and molecular structures. Our results show control of the PDI intermolecular interactions using suitable multichromophoric structures. © 2012 American Chemical Society.
DFT study of adsorption and dissociation of thiophene molecules on Ni(1 1 0)
Morin, C.; Eichler, A.; Hirschl, R.; Sautet, P.; Hafner, J.
2003-08-01
The different adsorption possibilities of thiophene (C 4H 4S) on the Ni(1 1 0) surface have been studied using first principle local-density-functional calculations, with the Vienna ab initio simulation package, which is based on a plane wave basis set and projector augmented wave potentials. For each configuration, a geometric optimisation has been performed. A detailed analysis of the structural and electronic properties of the molecule and the surface in the most stable conformations is presented, showing the combined roles of the molecular distortion and the interactions between the molecule and the surface. Three structures with comparatively large adsorption energies are identified, all with the molecule plane parallel to the surface. Starting from these stabilised structures, various scenarios for the desulfurisation process have been envisaged. While, for the most stable structure, the formation of an adsorbed thiol is an activated process, with an energetic barrier of 0.70 eV, the two structures which are just a bit less stable can dissociate to a C 4H 4 species and a sulfur atom with barriers as low as 0.07 eV. A description of the different transition states and a kinetic analysis of the desulfurisation reaction is also presented.
Monte Carlo study of the honeycomb structure of anthraquinone molecules on Cu(111)
Kim, Kwangmoo; Einstein, T. L.
2011-06-01
Using Monte Carlo calculations of the two-dimensional (2D) triangular lattice gas model, we demonstrate a mechanism for the spontaneous formation of honeycomb structure of anthraquinone (AQ) molecules on a Cu(111) plane. In our model long-range attractions play an important role, in addition to the long-range repulsions and short-range attractions proposed by Pawin, Wong, Kwon, and Bartels [ScienceSCIEAS0036-807510.1126/science.1129309 313, 961 (2006)]. We provide a global account of the possible combinations of long-range attractive coupling constants which lead to a honeycomb superstructure. We also provide the critical temperature of disruption of the honeycomb structure and compare the critical local coverage rate of AQ’s where the honeycomb structure starts to form with the experimental observations.
Structural and Interfacial Properties of Hyperbranched-Linear Polymer Surfactant.
Qiang, Taotao; Bu, Qiaoqiao; Huang, Zhaofeng; Wang, Xuechuan
2014-01-01
With oleic acid grafting modification, a series of hyperbranched-linear polymer surfactants (HLPS) were prepared by hydroxyl-terminated hyperbranched polymer (HBP), which was gained through a step synthesis method using trimethylolpropane and AB 2 monomer. The AB 2 monomers were obtained through the Michael addition reaction of methyl acrylate and diethanol amine. The structures of HLPS were characterised by Fourier transform infrared spectrophotometer and nuclear magnetic resonance (NMR), which indicated that HBP was successfully modified by oleic acid. Furthermore, the properties of surface tension and critical micelle concentration of HLPS solution showed that HLPS can significantly reduce the surface tension of water. The morphology of the HLPS solution was characterised by dynamic light scattering, which revealed that HLPS exhibited a nonmonotonic appearance in particle size at different scattering angles owing to the different replaced linear portions. The relationships of the surface pressure to monolayer area and time were measured using the Langmuir-Blodgett instrument, which showed that the surface tension of monolayer molecules increased with the increasing of hydrophobic groups. In addition, the interface conditions of different replaced HLPS solutions were simulated.
International Nuclear Information System (INIS)
Shi, Li Bin; Wang, Yong Ping; Dong, Hai Kuan
2015-01-01
Graphical abstract: - Highlights: • Cr, Mn and Fe doped graphene is more active to adsorb HCN molecule than pristine graphene. • The conductivity of Fe and Mn doped graphene hardly changes after adsorption HCN molecule. • The conductivity of Cr doped graphene can be affected significantly due to HCN adsorption. • The Cr, Mn and Fe may destroy the long range order in graphene. • Phonon density of states suggests that Cr doped graphene is stable. - Abstract: The adsorption energy, electronic structure, lattice vibration and magnetic properties of Cr, Mn and Fe doped graphene with and without HCN adsorption are investigated by the first principles based on density functional theory. The physisorption and chemisorption have been identified. In the paper, Cr-NG, Mn-NG and Fe-NG denote HCN adsorption on Cr, Mn and Fe doped graphene with N atom toward the adsorption site. It is found that the adsorption energy is −1.36 eV for Fe-NG, −0.60 eV for Mn-NG and −0.86 eV for Cr-NG. The Cr-NG will convert from half-metallic behavior to semiconductor after adsorbing HCN molecule, which indicates that the conductivity changes significantly. Phonon density of states (PDOS) shows that the long range order in graphene can be destroyed by doping Fe, Mn and Cr. The imaginary frequency mode in PDOS suggests that Fe and Mn doped graphene is unstable, while Cr doped graphene is stable. The electronic properties are sensitive toward adsorbing HCN, indicating that Cr doped graphene is a promising sensor for detecting HCN molecule. This study provides a useful basis for understanding of a wide variety of physical properties on graphene
International Nuclear Information System (INIS)
Oszwaldowski, R; Vazquez, H; Pou, P; Ortega, J; Perez, R; Flores, F
2003-01-01
A new DF-LCAO (density functional with local combination of atomic orbitals) method is used to calculate the electronic properties of 3,4,9,10 perylenetetracarboxylic dianhydride (PTCDA), C 6 H 6 , CH 4 , and CO. The method, called the OO (orbital occupancy) method, is a DF-based theory, which uses the OOs instead of ρ(r) to calculate the exchange and correlation energies. In our calculations, we compare the OO method with the conventional local density approximation approach. Our results show that, using a minimal basis set, we obtain equilibrium bond lengths and binding energies for PTCDA, C 6 H 6 , and CH 4 which are respectively within 6, and 10-15% of the experimental values. We have also calculated the affinity and ionization levels, as well as the optical gap, for benzene and PTCDA and have found that a variant of Koopmans' theorem works well for these molecules. Using this theorem we calculate the Koopmans relaxation energies of the σ- and π-orbitals for PTCDA and have obtained this molecule's density of states which compares well with experimental evidence
Structural Properties of Ferroelectric Perovskites
National Research Council Canada - National Science Library
Vanderbilt, David
1998-01-01
Under this research grant, we carried out realistic first-principles computer calculations of the ground-state and finite-temperature structural and dielectric properties of cubic perovskite materials...
Spin-Dependent Transport through Chiral Molecules Studied by Spin-Dependent Electrochemistry
2016-01-01
Conspectus Molecular spintronics (spin + electronics), which aims to exploit both the spin degree of freedom and the electron charge in molecular devices, has recently received massive attention. Our recent experiments on molecular spintronics employ chiral molecules which have the unexpected property of acting as spin filters, by way of an effect we call “chiral-induced spin selectivity” (CISS). In this Account, we discuss new types of spin-dependent electrochemistry measurements and their use to probe the spin-dependent charge transport properties of nonmagnetic chiral conductive polymers and biomolecules, such as oligopeptides, L/D cysteine, cytochrome c, bacteriorhodopsin (bR), and oligopeptide-CdSe nanoparticles (NPs) hybrid structures. Spin-dependent electrochemical measurements were carried out by employing ferromagnetic electrodes modified with chiral molecules used as the working electrode. Redox probes were used either in solution or when directly attached to the ferromagnetic electrodes. During the electrochemical measurements, the ferromagnetic electrode was magnetized either with its magnetic moment pointing “UP” or “DOWN” using a permanent magnet (H = 0.5 T), placed underneath the chemically modified ferromagnetic electrodes. The spin polarization of the current was found to be in the range of 5–30%, even in the case of small chiral molecules. Chiral films of the l- and d-cysteine tethered with a redox-active dye, toludin blue O, show spin polarizarion that depends on the chirality. Because the nickel electrodes are susceptible to corrosion, we explored the effect of coating them with a thin gold overlayer. The effect of the gold layer on the spin polarization of the electrons ejected from the electrode was investigated. In addition, the role of the structure of the protein on the spin selective transport was also studied as a function of bias voltage and the effect of protein denaturation was revealed. In addition to
Preedy, Victor R
2016-01-01
This book covers the structure and classification of adhesion molecules in relation to signaling pathways and gene expression. It discusses immunohistochemical localization, neutrophil migration, and junctional, functional, and inflammatory adhesion molecules in pathologies such as leukocyte decompression sickness and ischemia reperfusion injury. Highlighting the medical applications of current research, chapters cover diabetes, obesity, and metabolic syndrome; hypoxia; kidney disease; smoking, atrial fibrillation, and heart disease, the brain and dementia; and tumor proliferation. Finally, it looks at molecular imaging and bioinformatics, high-throughput technologies, and chemotherapy.
Single NdPc2 molecules on surfaces. Adsorption, interaction, and molecular magnetism
International Nuclear Information System (INIS)
Fahrendorf, Sarah
2013-01-01
They have huge potential for application in molecular-spin-transistors, molecular-spinvalves, and molecular quantum computing. SMMs are characterized by high spin ground states with zero-field splitting leading to high relaxation barriers and long relaxation times. A relevant class of molecules are the lanthanide double-decker phthalocyanines (LaPc 2 ) with only one metal atom sandwiched between two organic phthalocyanine (Pc) ligands. For envisaged spintronic applications it is important to understand the interaction between the molecules and the substrate and its influence on the electronic and magnetic properties. The subject of this thesis is the investigation of the adsorbed neodymium double-decker phthalocyanine (NdPc 2 ) by means of low temperature scanning tunneling microscopy and spectroscopy (STM and STS). The molecules are deposited by sublimation onto different substrates. It is observed that a large fraction of the double-decker molecules decomposes during deposition. The decomposition probability strongly depends on the chosen substrate. Therefore it is concluded that the substrate modifies the electronic structure of the molecule leading to a stabilization or destabilization of the molecular entity. Charge transfer from the surface to the molecule is identified as a potential stabilizing mechanism. The electronic and magnetic properties are investigated in detail for adsorbed NdPc 2 molecules on Cu(100). The results of the experimental study are compared to state-of-the-art density functional theory calculations performed by our colleagues from the Peter Gruenberg Institute (PGI-1) at the Forschungszentrum Juelich. Interestingly, the lower Pc ring of the molecule hybridizes intensely with the substrate leading to strong chemisorption of the molecule, while the upper Pc ring keeps its molecular type electronic states, which can be energetically shifted by an external electric field. Importantly, it is possible to get direct access to the spin
Single Molecules as Optical Probes for Structure and Dynamics
Orrit, Michel
Single molecules and single nanoparticles are convenient links between the nanoscale world and the laboratory. We discuss the limits for their optical detection by three different methods: fluorescence, direct absorption, and photothermal detection. We briefly review some recent illustrations of qualitatively new information gathered from single-molecule signals: intermittency of the fluorescence intensity, acoustic vibrations of nanoparticles (1-100 GHz) or of extended defects in molecular crystals (0.1-1 MHz), and dynamical heterogeneity in glass-forming molecular liquids. We conclude with an outlook of future uses of single-molecule methods in physical chemistry, soft matter, and material science.
Energy Technology Data Exchange (ETDEWEB)
Kong, Lingqian [Liaocheng Univ., Liaocheng (China); Zhao, Zengdian; Chen, Kexun; Wang, Ping; Zhang, Daopeng [Shandong Univ. of Technology, Zibo (China)
2013-07-15
We obtained a heterobimetallic one-dimensional cyanide-bridged Mn(II)-Ni(II) complex and an Co(III)-Ni(II) ion-pair complex with [Ni(CN){sub 4}]{sup 2-} as building block and M(II)-phenanthroline (M = Mn, Co) compounds as assembling segment. The different structural types of complexes 1 and 2 indicate that the property of the metal ions the assembling segment contained have obvious influence on the structure of the cyanide-bridged complex. Investigation over the magnetic properties of complex 1 reveals an overall weak antiferromagnetic coupling between the adjacent Mn(II) ions bridged by the antiferromagnetic [-NC-Ni-CN-] unit. Among of all the molecular magnetism systems, for the well known reasons, cyanide-containing complexes have been widely employed as bridges to assemble homo/hetero-metallic molecular magnetic materials by using the cyanide bridge transferring magnetic coupling between the neighboring paramagnetic ions, in whichsome showed interesting magnetic properties, such as high-Tc magnets, spin crossover materials, single-molecule magnets (SMMs) and single-chain magnets (SCMs)
Composition-Structure-Property Relationships in Boroaluminosilicate Glasses
DEFF Research Database (Denmark)
Zheng, Qiuju; Potuzak, M.; Mauro, J.C.
2012-01-01
boroaluminosilicate glasses from peralkaline to peraluminous compositions by substituting Al2O3 for SiO2. Our results reveal a pronounced change in all the measured physical properties (density, elastic moduli, hardness, glass transition temperature, and liquid fragility) around [Al2O3]–[Na2O]=0. The structural......The complicated structural speciation in boroaluminosilicate glasses leads to a mixed network former effect yielding nonlinear variation in many macroscopic properties as a function of chemical composition. Here we study the composition–structure–property relationships in a series of sodium...
Structural and dynamical properties of Yukawa balls
International Nuclear Information System (INIS)
Block, D; Kroll, M; Arp, O; Piel, A; Kaeding, S; Ivanov, Y; Melzer, A; Henning, C; Baumgartner, H; Ludwig, P; Bonitz, M
2007-01-01
To study the structural and dynamical properties of finite 3D dust clouds (Yukawa balls) new diagnostic tools have been developed. This contribution describes the progress towards 3D diagnostics for measuring the particle positions. It is shown that these diagnostics are capable of investigating the structural and dynamical properties of Yukawa balls and gaining insight into their basic construction principles
Structure-Property Relationships in Polycyanurate / Graphene Networks
2015-12-12
Briefing Charts 3. DATES COVERED (From - To) 17 Nov 2015 – 12 Dec 2015 4. TITLE AND SUBTITLE Structure-Property Relationships in Polycyanurate...ANSI Std. 239.18 1 DISTRIBUTION STATEMENT A. Approved for public release; distribution is unlimited. Structure-Property Relationships in...the attractive processing characteristics of LECy are retained in graphene oxide / LECy mixtures. Impurities, such as aryl phenols and transition metals
Predicting structural properties of fluids by thermodynamic extrapolation
Mahynski, Nathan A.; Jiao, Sally; Hatch, Harold W.; Blanco, Marco A.; Shen, Vincent K.
2018-05-01
We describe a methodology for extrapolating the structural properties of multicomponent fluids from one thermodynamic state to another. These properties generally include features of a system that may be computed from an individual configuration such as radial distribution functions, cluster size distributions, or a polymer's radius of gyration. This approach is based on the principle of using fluctuations in a system's extensive thermodynamic variables, such as energy, to construct an appropriate Taylor series expansion for these structural properties in terms of intensive conjugate variables, such as temperature. Thus, one may extrapolate these properties from one state to another when the series is truncated to some finite order. We demonstrate this extrapolation for simple and coarse-grained fluids in both the canonical and grand canonical ensembles, in terms of both temperatures and the chemical potentials of different components. The results show that this method is able to reasonably approximate structural properties of such fluids over a broad range of conditions. Consequently, this methodology may be employed to increase the computational efficiency of molecular simulations used to measure the structural properties of certain fluid systems, especially those used in high-throughput or data-driven investigations.
Structures and physicochemical properties of molecular aggregates of lipids
International Nuclear Information System (INIS)
Iwahashi, Makio
2005-01-01
Structures and physicochemical properties of lipids such as fatty acids, alcohols, acylglycerols and steroids in their two- or three-dimensional states were studied through the measurements of surface pressure (π), surface-molecular area (A), vapor-pressure osmosis, radioactivity (R), self-diffusion coefficient (D), density, viscosity, near-infrared spectroscopy (NIR), 13 C-NMR spin-lattice relaxation time (T 1 ), ESR, SEM, DSC, X-ray diffraction and small-angle neutron scattering (SANS). Following results are obtained: (1) π-A and R-A relationships indicate that the explanation, being widely believed, of the reaction occurred in the oleic acid or the trioleylglycerol monolayer on the aqueous KMnO 4 solution is incorrect. (2) By using the LB film of 3 H-labelled fatty acid, the upper limit of the neutrino mass was determined. In addition, by using the LB film of 14 C-labelled fatty acid, a new type of crystal-transformation process was found, in which fatty-acid crystal transforms from its unstable state to its stable one by the transfer of the fatty acid molecules through the vapor phase. (3) Fatty acids always exist as their dimers in their liquid state and mostly in non-polar solvents; the dimers are the units of the molecular movements in the molten liquid and in solvents. T 1 results clearly showed the internal molecular movements of the dimers. In addition, D and SANS results indicated that two different kinds of fatty acids in their binary mixture make only each homodimers. (4) Furthermore, the study on the liquid structure of fatty acids such as cis-6-, cis-9-, cis-11-, trans-9-octadecenoic acids and stearic acid indicated that these fatty-acid dimers construct the clusters resemble to the smectic-liquid crystal in the liquid state. The clusters determine the physicochemical properties of the liquid of the fatty acid. (author)
Data base on structural materials aging properties
International Nuclear Information System (INIS)
Oland, C.B.
1992-01-01
The US Nuclear Regulatory Commission has initiated a Structural Aging Program at the Oak Ridge National Laboratory to identify potential structural safety issues related to continued service of nuclear power plants and to establish criteria for evaluating and resolving these issues. One of the tasks in this program focuses on the establishment of a Structural Materials Information Center where long-term and environment-dependent properties of concretes and other structural materials are being collected and assembled into a data base. These properties will be used to evaluate the current condition of critical structural components in nuclear power plants and to estimate the future performance of these materials during the continued service period
Photoelectrical Properties and Energetical Structure of Thin Films of Indandione Derivatives
Directory of Open Access Journals (Sweden)
Maira INDRIKOVA
2011-07-01
Full Text Available A sandwich type structure of two dimetilaminobenziliden-1,3-indandione (DMABI derivatives placed between metal electrodes was made to investigate the photoelectrical properties of these derivatives. DMABI is an organic isolator with a wide energy gap and high quantum efficiency of the photogeneration, DMABI derivatives have received also considerable attention because of its large dipole moment and optical nonlinearities. Besides, since it is a photosensitive material, its use in solar systems is very promising. The energy gap of each material and combined system was observed from the spectral dependence of the quantum efficiency of the photoconductivity and results are compared with results of oxidation and reduction potential of the materials. The values showed a good correlation between experimental data of the photoconductivity and voltamperometry and calculated data of the HOMO and LUMO levels of the molecules.http://dx.doi.org/10.5755/j01.ms.17.2.480
Directory of Open Access Journals (Sweden)
Subin eHada
2014-06-01
Full Text Available In this work, multivariate characterization data such as infrared (IR spectroscopy was used as a source of descriptor data involving information on molecular architecture for designing structured molecules with tailored properties. Application of multivariate statistical techniques such as principal component analysis (PCA allowed capturing important features of the molecular architecture from complex data to build appropriate latent variable models. Combining the property clustering techniques and group contribution methods (GCM based on characterization data in a reverse problem formulation enabled identifying candidate components by combining or mixing molecular fragments until the resulting properties match the targets. The developed methodology is demonstrated using molecular design of biodiesel additive which when mixed with off-spec biodiesel produces biodiesel that meets the desired fuel specifications. The contribution of this work is that the complex structures and orientations of the molecule can be included in the design, thereby allowing enumeration of all feasible candidate molecules that matched the identified target but were not part of original training set of molecules.
From properties to materials: An efficient and simple approach.
Huwig, Kai; Fan, Chencheng; Springborg, Michael
2017-12-21
We present an inverse-design method, the poor man's materials optimization, that is designed to identify materials within a very large class with optimized values for a pre-chosen property. The method combines an efficient genetic-algorithm-based optimization, an automatic approach for generating modified molecules, a simple approach for calculating the property of interest, and a mathematical formulation of the quantity whose value shall be optimized. In order to illustrate the performance of our approach, we study the properties of organic molecules related to those used in dye-sensitized solar cells, whereby we, for the sake of proof of principle, consider benzene as a simple test system. Using a genetic algorithm, the substituents attached to the organic backbone are varied and the best performing molecules are identified. We consider several properties to describe the performance of organic molecules, including the HOMO-LUMO gap, the sunlight absorption, the spatial distance of the orbitals, and the reorganisation energy. The results show that our method is able to identify a large number of good candidate structures within a short time. In some cases, chemical/physical intuition can be used to rationalize the substitution pattern of the best structures, although this is not always possible. The present investigations provide a solid foundation for dealing with more complex and technically relevant systems such as porphyrins. Furthermore, our "properties first, materials second" approach is not limited to solar-energy harvesting but can be applied to many other fields, as briefly is discussed in the paper.
From properties to materials: An efficient and simple approach
Huwig, Kai; Fan, Chencheng; Springborg, Michael
2017-12-01
We present an inverse-design method, the poor man's materials optimization, that is designed to identify materials within a very large class with optimized values for a pre-chosen property. The method combines an efficient genetic-algorithm-based optimization, an automatic approach for generating modified molecules, a simple approach for calculating the property of interest, and a mathematical formulation of the quantity whose value shall be optimized. In order to illustrate the performance of our approach, we study the properties of organic molecules related to those used in dye-sensitized solar cells, whereby we, for the sake of proof of principle, consider benzene as a simple test system. Using a genetic algorithm, the substituents attached to the organic backbone are varied and the best performing molecules are identified. We consider several properties to describe the performance of organic molecules, including the HOMO-LUMO gap, the sunlight absorption, the spatial distance of the orbitals, and the reorganisation energy. The results show that our method is able to identify a large number of good candidate structures within a short time. In some cases, chemical/physical intuition can be used to rationalize the substitution pattern of the best structures, although this is not always possible. The present investigations provide a solid foundation for dealing with more complex and technically relevant systems such as porphyrins. Furthermore, our "properties first, materials second" approach is not limited to solar-energy harvesting but can be applied to many other fields, as briefly is discussed in the paper.
Peironcely, J.E.; Rojas-Chertó, M.; Fichera, D.; Reijmers, T.; Coulier, L.; Faulon, J.-L.; Hankemeier, T.
2012-01-01
Computer Assisted Structure Elucidation has been used for decades to discover the chemical structure of unknown compounds. In this work we introduce the first open source structure generator, Open Molecule Generator (OMG), which for a given elemental composition produces all non-isomorphic chemical
Mapping the Small Molecule Interactome by Mass Spectrometry.
Flaxman, Hope A; Woo, Christina M
2018-01-16
Mapping small molecule interactions throughout the proteome provides the critical structural basis for functional analysis of their impact on biochemistry. However, translation of mass spectrometry-based proteomics methods to directly profile the interaction between a small molecule and the whole proteome is challenging because of the substoichiometric nature of many interactions, the diversity of covalent and noncovalent interactions involved, and the subsequent computational complexity associated with their spectral assignment. Recent advances in chemical proteomics have begun fill this gap to provide a structural basis for the breadth of small molecule-protein interactions in the whole proteome. Innovations enabling direct characterization of the small molecule interactome include faster, more sensitive instrumentation coupled to chemical conjugation, enrichment, and labeling methods that facilitate detection and assignment. These methods have started to measure molecular interaction hotspots due to inherent differences in local amino acid reactivity and binding affinity throughout the proteome. Measurement of the small molecule interactome is producing structural insights and methods for probing and engineering protein biochemistry. Direct structural characterization of the small molecule interactome is a rapidly emerging area pushing new frontiers in biochemistry at the interface of small molecules and the proteome.
Process, structure, property and applications of metallic glasses
Directory of Open Access Journals (Sweden)
B. Geetha Priyadarshini
2016-07-01
Full Text Available Metallic glasses (MGs are gaining immense technological significance due to their unique structure-property relationship with renewed interest in diverse field of applications including biomedical implants, commercial products, machinery parts, and micro-electro-mechanical systems (MEMS. Various processing routes have been adopted to fabricate MGs with short-range ordering which is believed to be the genesis of unique structure. Understanding the structure of these unique materials is a long-standing unsolved mystery. Unlike crystalline counterpart, the outstanding properties of metallic glasses owing to the absence of grain boundaries is reported to exhibit high hardness, excellent strength, high elastic strain, and anti-corrosion properties. The combination of these remarkable properties would significantly contribute to improvement of performance and reliability of these materials when incorporated as bio-implants. The nucleation and growth of metallic glasses is driven by thermodynamics and kinetics in non-equilibrium conditions. This comprehensive review article discusses the various attributes of metallic glasses with an aim to understand the fundamentals of relationship process-structure-property existing in such unique class of material.
Sheikhi, Masoome; Shahab, Siyamak; Khaleghian, Mehrnoosh; Hajikolaee, Fatemeh Haji; Balakhanava, Iryna; Alnajjar, Radwan
2018-05-01
In the present work the adsorption properties of the molecule Resveratrol (RSV) (trans-3,5,4‧-Trihydroxystilbene) on CNT(8,0-10) nanotube was investigated by Density Functional Theory (DFT) in the gaseous phase for the first time. The non-bonded interaction effects of compounds RSV and CNT(8,0-10) nanotube on the electronic properties, chemical shift tensors and natural charge were determined and discussed. The electronic spectra of the RSV and the complex CNT(8,0-10)/RSV in the gaseous phase were calculated by Time Dependent Density Functional Theory (TD-DFT) for investigation of the maximum wavelength value of the RSV before and after the non-bonded interaction with the CNT(8,0-10) nanotube and molecular orbitals involved in the formation of absorption spectrum of the complex RSV at maximum wavelength.