WorldWideScience

Sample records for molecular phylogenetic position

  1. A new miniature characid (Ostariophysi: Characiformes: Characidae, with phylogenetic position inferred from morphological and molecular data.

    Directory of Open Access Journals (Sweden)

    André Luiz Netto-Ferreira

    Full Text Available Erythrocharax altipinnis is described from the Serra do Cachimbo, Pará, Brazil. The new taxon is distinguished from all of the Characidae genera by having the pelvic bones firmly attached through the isquiatic processes; a nearly triangular hiatus in the musculature covering the anterior chamber of the swim bladder between the first and second pleural ribs (pseudotympanum; the pedunculate, notably expanded and distally compressed teeth in both jaws; circumorbital series represented by antorbital and four infraorbital bones with laterosensory canals not enclosed; a single tooth row in the premaxillary with the teeth perfectly aligned and similar in shape and cusp number; the first three branched dorsal-fin rays distinctly elongate in males; a bright red adipose and caudal fins in life; a conspicuous dark midlateral stripe extending from the opercle to the tip of the median caudal-fin rays; and by the absence of a humeral spot. The phylogenetic position of the new taxon is discussed using morphological and molecular datasets, with conflicting results of both approaches discussed. Additionally, a summarized discussion on the current problems in the Characidae taxonomy is presented and the principal biases in the morphological dataset are also discussed.

  2. A molecular phylogenetic appraisal of the acanthostomines Acanthostomum and Timoniella and their position within Cryptogonimidae (Trematoda: Opisthorchioidea).

    Science.gov (United States)

    Martínez-Aquino, Andrés; Vidal-Martínez, Victor M; Aguirre-Macedo, M Leopoldina

    2017-01-01

    The phylogenetic position of three taxa from two trematode genera, belonging to the subfamily Acanthostominae (Opisthorchioidea: Cryptogonimidae), were analysed using partial 28S ribosomal DNA (Domains 1-2) and internal transcribed spacers (ITS1-5.8S-ITS2). Bayesian inference and Maximum likelihood analyses of combined 28S rDNA and ITS1 + 5.8S + ITS2 sequences indicated the monophyly of the genus Acanthostomum ( A. cf. americanum and A. burminis ) and paraphyly of the Acanthostominae . These phylogenetic relationships were consistent in analyses of 28S alone and concatenated 28S + ITS1 + 5.8S + ITS2 sequences analyses. Based on molecular phylogenetic analyses, the subfamily Acanthostominae is therefore a paraphyletic taxon, in contrast with previous classifications based on morphological data. Phylogenetic patterns of host specificity inferred from adult stages of other cryptogonimid taxa are also well supported. However, analyses using additional genera and species are necessary to support the phylogenetic inferences from this study. Our molecular phylogenetic reconstruction linked two larval stages of A. cf. americanum cercariae and metacercariae. Here, we present the evolutionary and ecological implications of parasitic infections in freshwater and brackish environments.

  3. A molecular phylogenetic appraisal of the acanthostomines Acanthostomum and Timoniella and their position within Cryptogonimidae (Trematoda: Opisthorchioidea

    Directory of Open Access Journals (Sweden)

    Andrés Martínez-Aquino

    2017-12-01

    Full Text Available The phylogenetic position of three taxa from two trematode genera, belonging to the subfamily Acanthostominae (Opisthorchioidea: Cryptogonimidae, were analysed using partial 28S ribosomal DNA (Domains 1–2 and internal transcribed spacers (ITS1–5.8S–ITS2. Bayesian inference and Maximum likelihood analyses of combined 28S rDNA and ITS1 + 5.8S + ITS2 sequences indicated the monophyly of the genus Acanthostomum (A. cf. americanum and A. burminis and paraphyly of the Acanthostominae. These phylogenetic relationships were consistent in analyses of 28S alone and concatenated 28S + ITS1 + 5.8S + ITS2 sequences analyses. Based on molecular phylogenetic analyses, the subfamily Acanthostominae is therefore a paraphyletic taxon, in contrast with previous classifications based on morphological data. Phylogenetic patterns of host specificity inferred from adult stages of other cryptogonimid taxa are also well supported. However, analyses using additional genera and species are necessary to support the phylogenetic inferences from this study. Our molecular phylogenetic reconstruction linked two larval stages of A. cf. americanum cercariae and metacercariae. Here, we present the evolutionary and ecological implications of parasitic infections in freshwater and brackish environments.

  4. Phylogenetic molecular function annotation

    International Nuclear Information System (INIS)

    Engelhardt, Barbara E; Jordan, Michael I; Repo, Susanna T; Brenner, Steven E

    2009-01-01

    It is now easier to discover thousands of protein sequences in a new microbial genome than it is to biochemically characterize the specific activity of a single protein of unknown function. The molecular functions of protein sequences have typically been predicted using homology-based computational methods, which rely on the principle that homologous proteins share a similar function. However, some protein families include groups of proteins with different molecular functions. A phylogenetic approach for predicting molecular function (sometimes called 'phylogenomics') is an effective means to predict protein molecular function. These methods incorporate functional evidence from all members of a family that have functional characterizations using the evolutionary history of the protein family to make robust predictions for the uncharacterized proteins. However, they are often difficult to apply on a genome-wide scale because of the time-consuming step of reconstructing the phylogenies of each protein to be annotated. Our automated approach for function annotation using phylogeny, the SIFTER (Statistical Inference of Function Through Evolutionary Relationships) methodology, uses a statistical graphical model to compute the probabilities of molecular functions for unannotated proteins. Our benchmark tests showed that SIFTER provides accurate functional predictions on various protein families, outperforming other available methods.

  5. Ultrastructure and molecular phylogenetic position of a novel phagotrophic stramenopile from low oxygen environments: Rictus lutensis gen. et sp. nov. (Bicosoecida, incertae sedis).

    Science.gov (United States)

    Yubuki, Naoji; Leander, Brian S; Silberman, Jeffrey D

    2010-04-01

    A novel free free-living phagotrophic flagellate, Rictus lutensis gen. et sp. nov., with two heterodynamic flagella, a permanent cytostome and a cytopharynx was isolated from muddy, low oxygen coastal sediments in Cape Cod, MA, USA. We cultivated and characterized this flagellate with transmission electron microscopy, scanning electron microscopy and molecular phylogenetic analyses inferred from small subunit (SSU) rDNA sequences. These data demonstrated that this organism has the key ultrastructural characters of the Bicosoecida, including similar transitional zones and a similar overall flagellar apparatus consisting of an x fiber and an L-shape microtubular root 2 involved in food capture. Although the molecular phylogenetic analyses were concordant with the ultrastructural data in placing R. lutensis with the bicosoecid clade, the internal position of this relatively divergent sequence within the clade was not resolved. Therefore, we interpret R. lutensis gen. et sp. nov. as a novel bicosoecid incertae sedis. Copyright 2009 Elsevier GmbH. All rights reserved.

  6. Molecular Phylogenetics: Concepts for a Newcomer.

    Science.gov (United States)

    Ajawatanawong, Pravech

    Molecular phylogenetics is the study of evolutionary relationships among organisms using molecular sequence data. The aim of this review is to introduce the important terminology and general concepts of tree reconstruction to biologists who lack a strong background in the field of molecular evolution. Some modern phylogenetic programs are easy to use because of their user-friendly interfaces, but understanding the phylogenetic algorithms and substitution models, which are based on advanced statistics, is still important for the analysis and interpretation without a guide. Briefly, there are five general steps in carrying out a phylogenetic analysis: (1) sequence data preparation, (2) sequence alignment, (3) choosing a phylogenetic reconstruction method, (4) identification of the best tree, and (5) evaluating the tree. Concepts in this review enable biologists to grasp the basic ideas behind phylogenetic analysis and also help provide a sound basis for discussions with expert phylogeneticists.

  7. First molecular data and the phylogenetic position of the millipede-like centipede Edentistoma octosulcatum Tömösváry, 1882 (Chilopoda: Scolopendromorpha: Scolopendridae.

    Directory of Open Access Journals (Sweden)

    Varpu Vahtera

    Full Text Available Edentistoma octosulcatum Tömösváry, 1882, is a rare, superficially millipede-like centipede known only from Borneo and the Philippines. It is unique within the order Scolopendromorpha for its slow gait, robust tergites, and highly modified gizzard and mandible morphology. Not much is known about the biology of the species but it has been speculated to be arboreal with a possibly vegetarian diet. Until now its phylogenetic position within the subfamily Otostigminae has been based only on morphological characters, being variably ranked as a monotypic tribe (Arrhabdotini or classified with the Southeast Asian genus Sterropristes Attems, 1934. The first molecular data for E. octosulcatum sourced from a newly collected specimen from Sarawak were analysed with and without morphology. Parsimony analysis of 122 morphological characters together with two nuclear and two mitochondrial loci resolves Edentistoma as sister group to three Indo-Australian species of Rhysida, this clade in turn grouping with Ethmostigmus, whereas maximum likelihood and parsimony analyses of the molecular data on their own ally Edentistoma with species of Otostigmus. A position of Edentistoma within Otostigmini (rather than being its sister group as predicted by the Arrhabdotini hypothesis is consistently retrieved under different analytical conditions, but support values within the subfamily remain low for most nodes. The species exhibits strong pushing behaviour, suggestive of burrowing habits. Evidence against a suggested vegetarian diet is provided by observation of E. octosulcatum feeding on millipedes in the genus Trachelomegalus.

  8. Molecular Phylogenetics: Mathematical Framework and Unsolved Problems

    Science.gov (United States)

    Xia, Xuhua

    Phylogenetic relationship is essential in dating evolutionary events, reconstructing ancestral genes, predicting sites that are important to natural selection, and, ultimately, understanding genomic evolution. Three categories of phylogenetic methods are currently used: the distance-based, the maximum parsimony, and the maximum likelihood method. Here, I present the mathematical framework of these methods and their rationales, provide computational details for each of them, illustrate analytically and numerically the potential biases inherent in these methods, and outline computational challenges and unresolved problems. This is followed by a brief discussion of the Bayesian approach that has been recently used in molecular phylogenetics.

  9. Molecular characterization and phylogenetic relationships among ...

    African Journals Online (AJOL)

    Molecular characterization and phylogenetic relationships among and within species of Phalaenopsis (Epidendroideae: Orchidaceae) based on RAPD analysis. ... Ph. parishii, Ph. labbi nepal, Ph. speciosa, Ph. lobbi yellow, Ph. venosa, Ph. hieroglyphica, and Ph. maculata; the third group consisted of Ph. minho princess, ...

  10. Interordinal gene capture, the phylogenetic position of Steller's sea cow based on molecular and morphological data, and the macroevolutionary history of Sirenia.

    Science.gov (United States)

    Springer, Mark S; Signore, Anthony V; Paijmans, Johanna L A; Vélez-Juarbe, Jorge; Domning, Daryl P; Bauer, Cameron E; He, Kai; Crerar, Lorelei; Campos, Paula F; Murphy, William J; Meredith, Robert W; Gatesy, John; Willerslev, Eske; MacPhee, Ross D E; Hofreiter, Michael; Campbell, Kevin L

    2015-10-01

    The recently extinct (ca. 1768) Steller's sea cow (Hydrodamalis gigas) was a large, edentulous North Pacific sirenian. The phylogenetic affinities of this taxon to other members of this clade, living and extinct, are uncertain based on previous morphological and molecular studies. We employed hybridization capture methods and second generation sequencing technology to obtain >30kb of exon sequences from 26 nuclear genes for both H. gigas and Dugong dugon. We also obtained complete coding sequences for the tooth-related enamelin (ENAM) gene. Hybridization probes designed using dugong and manatee sequences were both highly effective in retrieving sequences from H. gigas (mean=98.8% coverage), as were more divergent probes for regions of ENAM (99.0% coverage) that were designed exclusively from a proboscidean (African elephant) and a hyracoid (Cape hyrax). New sequences were combined with available sequences for representatives of all other afrotherian orders. We also expanded a previously published morphological matrix for living and fossil Sirenia by adding both new taxa and nine new postcranial characters. Maximum likelihood and parsimony analyses of the molecular data provide robust support for an association of H. gigas and D. dugon to the exclusion of living trichechids (manatees). Parsimony analyses of the morphological data also support the inclusion of H. gigas in Dugongidae with D. dugon and fossil dugongids. Timetree analyses based on calibration density approaches with hard- and soft-bounded constraints suggest that H. gigas and D. dugon diverged in the Oligocene and that crown sirenians last shared a common ancestor in the Eocene. The coding sequence for the ENAM gene in H. gigas does not contain frameshift mutations or stop codons, but there is a transversion mutation (AG to CG) in the acceptor splice site of intron 2. This disruption in the edentulous Steller's sea cow is consistent with previous studies that have documented inactivating mutations in

  11. Molecular phylogenetics of mastodon and Tyrannosaurus rex.

    Science.gov (United States)

    Organ, Chris L; Schweitzer, Mary H; Zheng, Wenxia; Freimark, Lisa M; Cantley, Lewis C; Asara, John M

    2008-04-25

    We report a molecular phylogeny for a nonavian dinosaur, extending our knowledge of trait evolution within nonavian dinosaurs into the macromolecular level of biological organization. Fragments of collagen alpha1(I) and alpha2(I) proteins extracted from fossil bones of Tyrannosaurus rex and Mammut americanum (mastodon) were analyzed with a variety of phylogenetic methods. Despite missing sequence data, the mastodon groups with elephant and the T. rex groups with birds, consistent with predictions based on genetic and morphological data for mastodon and on morphological data for T. rex. Our findings suggest that molecular data from long-extinct organisms may have the potential for resolving relationships at critical areas in the vertebrate evolutionary tree that have, so far, been phylogenetically intractable.

  12. Phylogenetic Position of Barbus lacerta Heckel, 1843

    Directory of Open Access Journals (Sweden)

    Mustafa Korkmaz

    2015-11-01

    As a result, five clades come out from phylogenetic reconstruction and in phylogenetic tree Barbus lacerta determined to be sister group of Barbus macedonicus, Barbus oligolepis and Barbus plebejus complex.

  13. Phylogenetic position of Mexican jackrabbits within the genus Lepus (Mammalia: Lagomorpha: a molecular perspective Posición filogenética de las liebres mexicanas dentro del género Lepus (Mammalia: Lagomorpha: una perspectiva molecular

    Directory of Open Access Journals (Sweden)

    Juan Pablo Ramírez-Silva

    2010-12-01

    Full Text Available Although phylogenetic affinities of Mexican jackrabbits within the genus Lepus have been evaluated for a few species, no study has included all 5 species occurring in Mexico. In this study we assess the phylogenetic position of the Mexican species relative to other forms within the genus and evaluate evolutionary affinities among the Mexican forms. To do so, we analyzed 57 complete cytochrome b sequences belonging to the 5 Mexican jackrabbits and 18 species of Lepus distributed across Asia, Africa, Europe and America. We performed phylogenetic tree reconstruction with the neighbor-joining, maximum parsimony and maximum likelihood approaches. We also used a minimum spanning network to evaluate relationships among Mexican species. We found 5 main phylogenetic groups within Lepus, 4 of which corresponded to geographically well defined lineages. One group included L. americanus, 3 others corresponded to Mexican, African and European species, respectively. A fifth group included Asiatic, European and American forms. Our results suggest that Mexican species constitute a monophyletic entity that evolved independently of the other American species of Lepus. Within the Mexican forms, 2 main clades are apparent; 1 that includes L. alleni, L. callotis, and L. flavigularis, previously referred to as the white-sided jackrabbits, and a second one that groups together L. californicus and L. insularis, although L. californicus is a paraphyletic relative of L. insularis.Aunque la afinidad filogenética de las liebres mexicanas, dentro del género Lepus, ha sido evaluada para algunas especies, ningún estudio ha incluido las 5 especies que se presentan en México. En este trabajo estimamos la posición filogenética de las especies mexicanas de liebres en relación con otras formas dentro del género, y evaluamos las afinidades evolutivas entre ellas. Para ello analizamos 57 secuencias completas del citocromo b pertenecientes a las 5 especies mexicanas y 18

  14. TREEFINDER: a powerful graphical analysis environment for molecular phylogenetics

    Directory of Open Access Journals (Sweden)

    von Haeseler Arndt

    2004-06-01

    Full Text Available Abstract Background Most analysis programs for inferring molecular phylogenies are difficult to use, in particular for researchers with little programming experience. Results TREEFINDER is an easy-to-use integrative platform-independent analysis environment for molecular phylogenetics. In this paper the main features of TREEFINDER (version of April 2004 are described. TREEFINDER is written in ANSI C and Java and implements powerful statistical approaches for inferring gene tree and related analyzes. In addition, it provides a user-friendly graphical interface and a phylogenetic programming language. Conclusions TREEFINDER is a versatile framework for analyzing phylogenetic data across different platforms that is suited both for exploratory as well as advanced studies.

  15. Molecular identification and phylogenetic study of Demodex caprae.

    Science.gov (United States)

    Zhao, Ya-E; Cheng, Juan; Hu, Li; Ma, Jun-Xian

    2014-10-01

    The DNA barcode has been widely used in species identification and phylogenetic analysis since 2003, but there have been no reports in Demodex. In this study, to obtain an appropriate DNA barcode for Demodex, molecular identification of Demodex caprae based on mitochondrial cox1 was conducted. Firstly, individual adults and eggs of D. caprae were obtained for genomic DNA (gDNA) extraction; Secondly, mitochondrial cox1 fragment was amplified, cloned, and sequenced; Thirdly, cox1 fragments of D. caprae were aligned with those of other Demodex retrieved from GenBank; Finally, the intra- and inter-specific divergences were computed and the phylogenetic trees were reconstructed to analyze phylogenetic relationship in Demodex. Results obtained from seven 429-bp fragments of D. caprae showed that sequence identities were above 99.1% among three adults and four eggs. The intraspecific divergences in D. caprae, Demodex folliculorum, Demodex brevis, and Demodex canis were 0.0-0.9, 0.5-0.9, 0.0-0.2, and 0.0-0.5%, respectively, while the interspecific divergences between D. caprae and D. folliculorum, D. canis, and D. brevis were 20.3-20.9, 21.8-23.0, and 25.0-25.3, respectively. The interspecific divergences were 10 times higher than intraspecific ones, indicating considerable barcoding gap. Furthermore, the phylogenetic trees showed that four Demodex species gathered separately, representing independent species; and Demodex folliculorum gathered with canine Demodex, D. caprae, and D. brevis in sequence. In conclusion, the selected 429-bp mitochondrial cox1 gene is an appropriate DNA barcode for molecular classification, identification, and phylogenetic analysis of Demodex. D. caprae is an independent species and D. folliculorum is closer to D. canis than to D. caprae or D. brevis.

  16. Phylogenetic position of Loricifera inferred from nearly complete 18S and 28S rRNA gene sequences

    OpenAIRE

    Yamasaki, Hiroshi; Fujimoto, Shinta; Miyazaki, Katsumi

    2015-01-01

    Background Loricifera is an enigmatic metazoan phylum; its morphology appeared to place it with Priapulida and Kinorhyncha in the group Scalidophora which, along with Nematoida (Nematoda and Nematomorpha), comprised the group Cycloneuralia. Scarce molecular data have suggested an alternative phylogenetic hypothesis, that the phylum Loricifera is a sister taxon to Nematomorpha, although the actual phylogenetic position of the phylum remains unclear. Methods Ecdysozoan phylogeny was reconstruct...

  17. Extended molecular phylogenetics and revised systematics of Malagasy scincine lizards.

    Science.gov (United States)

    Erens, Jesse; Miralles, Aurélien; Glaw, Frank; Chatrou, Lars W; Vences, Miguel

    2017-02-01

    Among the endemic biota of Madagascar, skinks are a diverse radiation of lizards that exhibit a striking ecomorphological variation, and could provide an interesting system to study body-form evolution in squamate reptiles. We provide a new phylogenetic hypothesis for Malagasy skinks of the subfamily Scincinae based on an extended molecular dataset comprising 8060bp from three mitochondrial and nine nuclear loci. Our analysis also increases taxon sampling of the genus Amphiglossus by including 16 out of 25 nominal species. Additionally, we examined whether the molecular phylogenetic patterns coincide with morphological differentiation in the species currently assigned to this genus. Various methods of inference recover a mostly strongly supported phylogeny with three main clades of Amphiglossus. However, relationships among these three clades and the limb-reduced genera Grandidierina, Voeltzkowia and Pygomeles remain uncertain. Supported by a variety of morphological differences (predominantly related to the degree of body elongation), but considering the remaining phylogenetic uncertainty, we propose a redefinition of Amphiglossus into three different genera (Amphiglossus sensu stricto, Flexiseps new genus, and Brachyseps new genus) to remove the non-monophyly of Amphiglossus sensu lato and to facilitate future studies on this fascinating group of lizards. Copyright © 2016 Elsevier Inc. All rights reserved.

  18. Molecular phylogenetics of porcini mushrooms (Boletus section Boletus).

    Science.gov (United States)

    Dentinger, Bryn T M; Ammirati, Joseph F; Both, Ernst E; Desjardin, Dennis E; Halling, Roy E; Henkel, Terry W; Moreau, Pierre-Arthur; Nagasawa, Eiji; Soytong, Kasem; Taylor, Andy F; Watling, Roy; Moncalvo, Jean-Marc; McLaughlin, David J

    2010-12-01

    Porcini (Boletus section Boletus: Boletaceae: Boletineae: Boletales) are a conspicuous group of wild, edible mushrooms characterized by fleshy fruiting bodies with a poroid hymenophore that is "stuffed" with white hyphae when young. Their reported distribution is with ectomycorrhizal plants throughout the Northern Hemisphere. Little progress has been made on the systematics of this group using modern molecular phylogenetic tools because sampling has been limited primarily to European species and the genes employed were insufficient to resolve the phylogeny. We examined the evolutionary history of porcini by using a global geographic sampling of most known species, new discoveries from little explored areas, and multiple genes. We used 78 sequences from the fast-evolving nuclear internal transcribed spacers and are able to recognize 18 reciprocally monophyletic species. To address whether or not porcini form a monophyletic group, we compiled a broadly sampled dataset of 41 taxa, including other members of the Boletineae, and used separate and combined phylogenetic analysis of sequences from the nuclear large subunit ribosomal DNA, the largest subunit of RNA polymerase II, and the mitochondrial ATPase subunit six gene. Contrary to previous studies, our separate and combined phylogenetic analyses support the monophyly of porcini. We also report the discovery of two taxa that expand the known distribution of porcini to Australia and Thailand and have ancient phylogenetic connections to the rest of the group. A relaxed molecular clock analysis with these new taxa dates the origin of porcini to between 42 and 54 million years ago, coinciding with the initial diversification of angiosperms, during the Eocene epoch when the climate was warm and humid. These results reveal an unexpected diversity, distribution, and ancient origin of a group of commercially valuable mushrooms that may provide an economic incentive for conservation and support the hypothesis of a tropical

  19. Comparative analyses of the complete mitochondrial genomes of Dosinia clams and their phylogenetic position within Veneridae.

    Science.gov (United States)

    Lv, Changda; Li, Qi; Kong, Lingfeng

    2018-01-01

    Mitochondrial genomes have proved to be a powerful tool in resolving phylogenetic relationship. In order to understand the mitogenome characteristics and phylogenetic position of the genus Dosinia, we sequenced the complete mitochondrial genomes of Dosinia altior and Dosinia troscheli (Bivalvia: Veneridae), compared them with that of Dosinia japonica and established a phylogenetic tree for Veneridae. The mitogenomes of D. altior (17,536 bp) and D. troscheli (17,229 bp) are the two smallest in Veneridae, which include 13 protein-coding genes, 2 ribosomal RNA genes, 22 tRNA genes, and non-coding regions. The mitogenomes of the Dosinia species are similar in size, gene content, AT content, AT- and GC- skews, and gene arrangement. The phylogenetic relationships of family Veneridae were established based on 12 concatenated protein-coding genes using maximum likelihood and Bayesian analyses, which supported that Dosininae and Meretricinae have a closer relationship, with Tapetinae being the sister taxon. The information obtained in this study will contribute to further understanding of the molecular features of bivalve mitogenomes and the evolutionary history of the genus Dosinia.

  20. Revising the phylogenetic position of the extinct Mascarene Parrot Mascarinus mascarin (Linnaeus 1771) (Aves: Psittaciformes: Psittacidae).

    Science.gov (United States)

    Podsiadlowski, Lars; Gamauf, Anita; Töpfer, Till

    2017-02-01

    The phylogenetic position of the extinct Mascarene Parrot Mascarinus mascarin from La Réunion has been unresolved for centuries. A recent molecular study unexpectedly placed M. mascarin within the clade of phenotypically very different Vasa parrots Coracopsis. Based on DNA extracted from the only other preserved Mascarinus specimen, we show that the previously obtained cytb sequence is probably an artificial composite of partial sequences from two other parrot species and that M. mascarin is indeed a part of the Psittacula diversification, placed close to P. eupatria and P. wardi. Copyright © 2016 Elsevier Inc. All rights reserved.

  1. PhyTB: Phylogenetic tree visualisation and sample positioning for M. tuberculosis

    KAUST Repository

    Benavente, Ernest D

    2015-05-13

    Background Phylogenetic-based classification of M. tuberculosis and other bacterial genomes is a core analysis for studying evolutionary hypotheses, disease outbreaks and transmission events. Whole genome sequencing is providing new insights into the genomic variation underlying intra- and inter-strain diversity, thereby assisting with the classification and molecular barcoding of the bacteria. One roadblock to strain investigation is the lack of user-interactive solutions to interrogate and visualise variation within a phylogenetic tree setting. Results We have developed a web-based tool called PhyTB (http://pathogenseq.lshtm.ac.uk/phytblive/index.php webcite) to assist phylogenetic tree visualisation and identification of M. tuberculosis clade-informative polymorphism. Variant Call Format files can be uploaded to determine a sample position within the tree. A map view summarises the geographical distribution of alleles and strain-types. The utility of the PhyTB is demonstrated on sequence data from 1,601 M. tuberculosis isolates. Conclusion PhyTB contextualises M. tuberculosis genomic variation within epidemiological, geographical and phylogenic settings. Further tool utility is possible by incorporating large variants and phenotypic data (e.g. drug-resistance profiles), and an assessment of genotype-phenotype associations. Source code is available to develop similar websites for other organisms (http://sourceforge.net/projects/phylotrack webcite).

  2. The phylogenetic position of Amoebophrya sp. infecting Gymnodinium sanguineum.

    Science.gov (United States)

    Gunderson, J H; Goss, S H; Coats, D W

    1999-01-01

    The small-subunit rRNA sequence of a species of Amoebophrya infecting Gymnodinium sanguineum in Chesapeake Bay was obtained and compared to the small subunit rRNA sequences of other protists. Phylogenetic trees constructed with the new sequence place Amoebophrya between the remaining dinoflagellates and other protists.

  3. Molecular and phylogenetic analysis of HIV-1 variants circulating in Italy

    Directory of Open Access Journals (Sweden)

    Sbreglia Costanza

    2008-10-01

    Full Text Available Abstract Objective The continuous identification of HIV-1 non-B subtypes and recombinant forms in Italy indicates the need of constant molecular epidemiology survey of genetic forms circulating and transmitted in the resident population. Methods The distribution of HIV-1 subtypes has been evaluated in 25 seropositive individuals residing in Italy, most of whom were infected through a sexual route during the 1995–2005 period. Each sample has been characterized by detailed molecular and phylogenetic analyses. Results 18 of the 25 samples were positive at HIV-1 PCR amplification. Three samples showed a nucleotide divergence compatible with a non-B subtype classification. The phylogenetic analysis, performed on both HIV-1 env and gag regions, confirms the molecular sub-typing prediction, given that 1 sample falls into the C subtype and 2 into the G subtype. The B subtype isolates show high levels of intra-subtype nucleotide divergence, compatible with a long-lasting epidemic and a progressive HIV-1 molecular diversification. Conclusion The Italian HIV-1 epidemic is still mostly attributable to the B subtype, regardless the transmission route, which shows an increasing nucleotide heterogeneity. Heterosexual transmission and the interracial blending, however, are slowly introducing novel HIV-1 subtypes. Therefore, a molecular monitoring is needed to follow the constant evolution of the HIV-1 epidemic.

  4. Integrative taxonomy of ciliates: Assessment of molecular phylogenetic content and morphological homology testing.

    Science.gov (United States)

    Vďačný, Peter

    2017-10-01

    The very diverse and comparatively complex morphology of ciliates has given rise to numerous taxonomic concepts. However, the information content of the utilized molecular markers has seldom been explored prior to phylogenetic analyses and taxonomic decisions. Likewise, robust testing of morphological homology statements and the apomorphic nature of diagnostic characters of ciliate taxa is rarely carried out. Four phylogenetic techniques that may help address these issues are reviewed. (1) Split spectrum analysis serves to determine the exact number and quality of nucleotide positions supporting individual nodes in phylogenetic trees and to discern long-branch artifacts that cause spurious phylogenies. (2) Network analysis can depict all possible evolutionary trajectories inferable from the dataset and locate and measure the conflict between them. (3) A priori likelihood mapping tests the suitability of data for reconstruction of a well resolved tree, visualizes the tree-likeness of quartets, and assesses the support of an internal branch of a given tree topology. (4) Reconstruction of ancestral morphologies can be applied for analyzing homology and apomorphy statements without circular reasoning. Since these phylogenetic tools are rarely used, their principles and interpretation are introduced and exemplified using various groups of ciliates. Finally, environmental sequencing data are discussed in this light. Copyright © 2017 The Author. Published by Elsevier GmbH.. All rights reserved.

  5. Molecular phylogenetic analysis of Enterobius vermicularis and development of an 18S ribosomal DNA-targeted diagnostic PCR.

    Science.gov (United States)

    Zelck, Ulrike E; Bialek, Ralf; Weiss, Michael

    2011-04-01

    We genetically characterized pinworms obtained from 37 children from different regions of Germany and established new species-specific molecular diagnostic tools. No ribosomal DNA diversity was found; the phylogenetic position of Enterobius vermicularis within the Oxyurida order and its close relationship to the Ascaridida and Spirurida orders was confirmed.

  6. Molecular Phylogenetic Analysis of Enterobius vermicularis and Development of an 18S Ribosomal DNA-Targeted Diagnostic PCR▿

    Science.gov (United States)

    Zelck, Ulrike E.; Bialek, Ralf; Weiß, Michael

    2011-01-01

    We genetically characterized pinworms obtained from 37 children from different regions of Germany and established new species-specific molecular diagnostic tools. No ribosomal DNA diversity was found; the phylogenetic position of Enterobius vermicularis within the Oxyurida order and its close relationship to the Ascaridida and Spirurida orders was confirmed. PMID:21248085

  7. A molecular phylogenetic analysis of the Scarabaeinae (dung beetles).

    Science.gov (United States)

    Monaghan, Michael T; Inward, Daegan J G; Hunt, Toby; Vogler, Alfried P

    2007-11-01

    The dung beetles (Scarabaeinae) include ca. 5000 species and exhibit a diverse array of morphologies and behaviors. This variation presumably reflects the adaptation to a diversity of food types and the different strategies used to avoid competition for vertebrate dung, which is the primary breeding environment for most species. The current classification gives great weight to the major behavioral types, separating the ball rollers and the tunnelers, but existing phylogenetic studies have been based on limited taxonomic or biogeographic sampling and have been contradictory. Here, we present a molecular phylogenetic analysis of 214 species of Scarabaeinae, representing all 12 traditionally recognized tribes and six biogeographical regions, using partial gene sequences from one nuclear (28S) and two mitochondrial (cox1, rrnL) genes. Length variation in 28S (588-621 bp) and rrnL (514-523 bp) was subjected to a thorough evaluation of alternative alignments, gap-coding methods, and tree searches using model-based (Bayesian and likelihood), maximum parsimony, and direct optimization analyses. The small-bodied, non-dung-feeding Sarophorus+Coptorhina were basal in all reconstructions. These were closely related to rolling Odontoloma+Dicranocara, suggesting an early acquisition of rolling behavior. Smaller tribes and most genera were monophyletic, while Canthonini and Dichotomiini each consisted of multiple paraphyletic lineages at hierarchical levels equivalent to the smaller tribes. Plasticity of rolling and tunneling was evidenced by a lack of monophyly (S-H test, p > 0.05) and several reversals within clades. The majority of previously unrecognized clades were geographical, including the well-supported Neotropical Phanaeini+Eucraniini, and a large Australian clade of rollers as well as tunneling Coptodactyla and Demarziella. Only three lineages, Gymnopleurini, Copris+Microcopris and Onthophagus, were widespread and therefore appear to be dispersive at a global scale. A

  8. Improved phylogenetic analyses corroborate a plausible position of Martialis heureka in the ant tree of life.

    Directory of Open Access Journals (Sweden)

    Patrick Kück

    Full Text Available Martialinae are pale, eyeless and probably hypogaeic predatory ants. Morphological character sets suggest a close relationship to the ant subfamily Leptanillinae. Recent analyses based on molecular sequence data suggest that Martialinae are the sister group to all extant ants. However, by comparing molecular studies and different reconstruction methods, the position of Martialinae remains ambiguous. While this sister group relationship was well supported by Bayesian partitioned analyses, Maximum Likelihood approaches could not unequivocally resolve the position of Martialinae. By re-analysing a previous published molecular data set, we show that the Maximum Likelihood approach is highly appropriate to resolve deep ant relationships, especially between Leptanillinae, Martialinae and the remaining ant subfamilies. Based on improved alignments, alignment masking, and tree reconstructions with a sufficient number of bootstrap replicates, our results strongly reject a placement of Martialinae at the first split within the ant tree of life. Instead, we suggest that Leptanillinae are a sister group to all other extant ant subfamilies, whereas Martialinae branch off as a second lineage. This assumption is backed by approximately unbiased (AU tests, additional Bayesian analyses and split networks. Our results demonstrate clear effects of improved alignment approaches, alignment masking and data partitioning. We hope that our study illustrates the importance of thorough, comprehensible phylogenetic analyses using the example of ant relationships.

  9. Archaeal phylogeny: reexamination of the phylogenetic position of Archaeoglobus fulgidus in light of certain composition-induced artifacts

    Science.gov (United States)

    Woese, C. R.; Achenbach, L.; Rouviere, P.; Mandelco, L.

    1991-01-01

    A major and too little recognized source of artifact in phylogenetic analysis of molecular sequence data is compositional difference among sequences. The problem becomes particularly acute when alignments contain ribosomal RNAs from both mesophilic and thermophilic species. Among prokaryotes the latter are considerably higher in G + C content than the former, which often results in artificial clustering of thermophilic lineages and their being placed artificially deep in phylogenetic trees. In this communication we review archaeal phylogeny in the light of this consideration, focusing in particular on the phylogenetic position of the sulfate reducing species Archaeoglobus fulgidus, using both 16S rRNA and 23S rRNA sequences. The analysis shows clearly that the previously reported deep branching of the A. fulgidus lineage (very near the base of the euryarchaeal side of the archaeal tree) is incorrect, and that the lineage actually groups with a previously recognized unit that comprises the Methanomicrobiales and extreme halophiles.

  10. Molecular evolution of ependymin and the phylogenetic resolution of early divergences among euteleost fishes.

    Science.gov (United States)

    Ortí, G; Meyer, A

    1996-04-01

    The rate and pattern of DNA evolution of ependymin, a single-copy gene coding for a highly expressed glycoprotein in the brain matrix of teleost fishes, is characterized and its phylogenetic utility for fish systematics is assessed. DNA sequences were determined from catfish, electric fish, and characiforms and compared with published ependymin sequences from cyprinids, salmon, pike, and herring. Among these groups, ependymin amino acid sequences were highly divergent (up to 60% sequence difference), but had surprisingly similar hydropathy profiles and invariant glycosylation sites, suggesting that functional properties of the proteins are conserved. Comparison of base composition at third codon positions and introns revealed AT-rich introns and GC-rich third codon positions, suggesting that the biased codon usage observed might not be due to mutational bias. Phylogenetic information content of third codon positions was surprisingly high and sufficient to recover the most basal nodes of the tree, in spite of the observation that pairwise distances (at third codon positions) were well above the presumed saturation level. This finding can be explained by the high proportion of phylogenetically informative nonsynonymous changes at third codon positions among these highly divergent proteins. Ependymin DNA sequences have established the first molecular evidence for the monophyly of a group containing salmonids and esociforms. In addition, ependymin suggests a sister group relationship of electric fish (Gymnotiformes) and Characiformes, constituting a significant departure from currently accepted classifications. However, relationships among characiform lineages were not completely resolved by ependymin sequences in spite of seemingly appropriate levels of variation among taxa and considerably low levels of homoplasy in the data (consistency index = 0.7). If the diversification of Characiformes took place in an "explosive" manner, over a relatively short period of time

  11. The phylogenetic position of the solitary zoanthid genus Sphenopus (Cnidaria: Hexacorallia)

    NARCIS (Netherlands)

    Reimer, J.D.; Lin, M.; Fujii, T.

    2012-01-01

    The zoanthid genus Sphenopus (Cnidaria: Anthozoa: Zoantharia), like many other brachycnemic zoanthids, is found in shallow subtropical and tropical waters, but is uniquely unitary (solitary, monostomatous), azooxanthellate, and free-living. With sparse knowledge of its phylogenetic position, this

  12. Phylogenetic relationships among Neoechinorhynchus species (Acanthocephala: Neoechinorhynchidae) from North-East Asia based on molecular data.

    Science.gov (United States)

    Malyarchuk, Boris; Derenko, Miroslava; Mikhailova, Ekaterina; Denisova, Galina

    2014-02-01

    Phylogenetic and statistical analyses of DNA sequences of two genes, cytochrome oxidase subunit 1 (cox 1) of the mitochondrial DNA and 18S subunit of the nuclear ribosomal RNA (18S rRNA), was used to characterize Neoechinorhynchus species from fishes collected in different localities of North-East Asia. It has been found that four species can be clearly recognized using molecular markers-Neoechinorhynchus tumidus, Neoechinorhynchus beringianus, Neoechinorhynchus simansularis and Neoechinorhynchus salmonis. 18S sequences ascribed to Neoechinorhynchus crassus specimens from North-East Asia were identical to those of N. tumidus, but differed substantially from North American N. crassus. We renamed North-East Asian N. crassus specimens to N. sp., although the possibility that they represent a subspecies of N. tumidus cannot be excluded, taking into account a relatively small distance between cox 1 sequences of North-East Asian specimens of N. crassus and N. tumidus. Maximum likelihood, maximum parsimony and Bayesian inference analyses were performed for phylogeny reconstruction. All the phylogenetic trees showed that North-East Asian species of Neoechinorhynchus analyzed in this study represent independent clades, with the only exception of N. tumidus and N. sp. for 18S data. Phylogenetic analysis has shown that the majority of species sampled (N. tumidus+N. sp., N. simansularis and N. beringianus) are probably very closely related, while N. salmonis occupies separate position in the trees, possibly indicating a North American origin of this species. © 2013.

  13. Exploring the Genomic Roadmap and Molecular Phylogenetics Associated with MODY Cascades Using Computational Biology.

    Science.gov (United States)

    Chakraborty, Chiranjib; Bandyopadhyay, Sanghamitra; Doss, C George Priya; Agoramoorthy, Govindasamy

    2015-04-01

    Maturity onset diabetes of the young (MODY) is a metabolic and genetic disorder. It is different from type 1 and type 2 diabetes with low occurrence level (1-2%) among all diabetes. This disorder is a consequence of β-cell dysfunction. Till date, 11 subtypes of MODY have been identified, and all of them can cause gene mutations. However, very little is known about the gene mapping, molecular phylogenetics, and co-expression among MODY genes and networking between cascades. This study has used latest servers and software such as VarioWatch, ClustalW, MUSCLE, G Blocks, Phylogeny.fr, iTOL, WebLogo, STRING, and KEGG PATHWAY to perform comprehensive analyses of gene mapping, multiple sequences alignment, molecular phylogenetics, protein-protein network design, co-expression analysis of MODY genes, and pathway development. The MODY genes are located in chromosomes-2, 7, 8, 9, 11, 12, 13, 17, and 20. Highly aligned block shows Pro, Gly, Leu, Arg, and Pro residues are highly aligned in the positions of 296, 386, 437, 455, 456 and 598, respectively. Alignment scores inform us that HNF1A and HNF1B proteins have shown high sequence similarity among MODY proteins. Protein-protein network design shows that HNF1A, HNF1B, HNF4A, NEUROD1, PDX1, PAX4, INS, and GCK are strongly connected, and the co-expression analyses between MODY genes also show distinct association between HNF1A and HNF4A genes. This study has used latest tools of bioinformatics to develop a rapid method to assess the evolutionary relationship, the network development, and the associations among eleven MODY genes and cascades. The prediction of sequence conservation, molecular phylogenetics, protein-protein network and the association between the MODY cascades enhances opportunities to get more insights into the less-known MODY disease.

  14. Molecular Phylogenetic: Organism Taxonomy Method Based on Evolution History

    Directory of Open Access Journals (Sweden)

    N.L.P Indi Dharmayanti

    2011-03-01

    Full Text Available Phylogenetic is described as taxonomy classification of an organism based on its evolution history namely its phylogeny and as a part of systematic science that has objective to determine phylogeny of organism according to its characteristic. Phylogenetic analysis from amino acid and protein usually became important area in sequence analysis. Phylogenetic analysis can be used to follow the rapid change of a species such as virus. The phylogenetic evolution tree is a two dimensional of a species graphic that shows relationship among organisms or particularly among their gene sequences. The sequence separation are referred as taxa (singular taxon that is defined as phylogenetically distinct units on the tree. The tree consists of outer branches or leaves that represents taxa and nodes and branch represent correlation among taxa. When the nucleotide sequence from two different organism are similar, they were inferred to be descended from common ancestor. There were three methods which were used in phylogenetic, namely (1 Maximum parsimony, (2 Distance, and (3 Maximum likehoood. Those methods generally are applied to construct the evolutionary tree or the best tree for determine sequence variation in group. Every method is usually used for different analysis and data.

  15. Applying phylogenetic analysis to viral livestock diseases: moving beyond molecular typing.

    Science.gov (United States)

    Olvera, Alex; Busquets, Núria; Cortey, Marti; de Deus, Nilsa; Ganges, Llilianne; Núñez, José Ignacio; Peralta, Bibiana; Toskano, Jennifer; Dolz, Roser

    2010-05-01

    Changes in livestock production systems in recent years have altered the presentation of many diseases resulting in the need for more sophisticated control measures. At the same time, new molecular assays have been developed to support the diagnosis of animal viral disease. Nucleotide sequences generated by these diagnostic techniques can be used in phylogenetic analysis to infer phenotypes by sequence homology and to perform molecular epidemiology studies. In this review, some key elements of phylogenetic analysis are highlighted, such as the selection of the appropriate neutral phylogenetic marker, the proper phylogenetic method and different techniques to test the reliability of the resulting tree. Examples are given of current and future applications of phylogenetic reconstructions in viral livestock diseases. Copyright 2009 Elsevier Ltd. All rights reserved.

  16. Discovery of Paragonimus westermani in Vietnam and its molecular phylogenetic status in P. westermani complex.

    Science.gov (United States)

    Doanh, Pham Ngoc; Shinohara, Akio; Horii, Yoichiro; Habe, Shigehisa; Nawa, Yukifumi

    2009-04-01

    Paragonimus westermani is the most well-known species among the genus Paragonimus. It is widely distributed in Asia with considerable genetic diversity to form P. westermani species complex. While P. westermani distributed in Japan, Korea, China, and Taiwan are genetically homogeneous to form the East Asia group, those found in other geographic areas are heterogeneous and would be divided into several groups. Recent discoveries of P. westermani in India and Sri Lanka highlighted new insights on molecular phylogenetic relationship of geographic isolates of this species complex. Since Vietnam is located at the east end of Southeast Asia, the intermediate position between South and East Asia, it is of interest to see whether P. westermani is distributed in this country. Here, we report that P. westermani metacercariae were found in mountainous crabs, Potamiscus sp., collected in Quangtri province in the central Vietnam. Adult worms were successfully obtained by experimental infection in cats. Molecular phylogenetic analyses revealed that P. westermani of Vietnamese isolates have high similarities with those of East Asia group.

  17. Molecular phylogenetics and historical biogeography of Rhinolophus bats.

    Science.gov (United States)

    Stoffberg, Samantha; Jacobs, David S; Mackie, Iain J; Matthee, Conrad A

    2010-01-01

    The phylogenetic relationships within the horseshoe bats (genus Rhinolophus) are poorly resolved, particularly at deeper levels within the tree. We present a better-resolved phylogenetic hypothesis for 30 rhinolophid species based on parsimony and Bayesian analyses of the mitochondrial cytochrome b gene and three nuclear introns (TG, THY and PRKC1). Strong support was found for the existence of two geographic clades within the monophyletic Rhinolophidae: an African group and an Oriental assemblage. The relaxed Bayesian clock method indicated that the two rhinolophid clades diverged approximately 35 million years ago and results from Dispersal Vicariance (DIVA) analysis suggest that the horseshoe bats arose in Asia and subsequently dispersed into Europe and Africa.

  18. Analysis of HIV subtypes and the phylogenetic tree in HIV-positive samples from Saudi Arabia

    International Nuclear Information System (INIS)

    Al-Zahrani, Alhusain J.

    2008-01-01

    Objective was to assess the prevalence of HIV-1 genetic subtypes in Saudi Arabia in samples that are serologically positive for HIV-1 and compare the HIV-1 genetic subtypes prevalent in Saudi Arabia with the subtypes prevalent in other countries. Thirty-nine HIV-1 positive samples were analyzed for HIV-1 subtypes using molecular techniques. The study is retrospective study that was conducted in Dammam, Kingdom of Saudi Arabia and in Abbott laboratories (United States of America) from2004 to 2007. All samples were seropositive for HIV-1 group M. Of the 39 seropositive samples, only 12 were polymerase chain reaction positive. Subtype C is the most common virus strain as it occurred in 58% of these samples; subtype B occurred in 17%; subtypes A, D and G were found in 8% each. The phylogenetic tree was also identified for the isolates. Detection of HIV subtypes is important for epidemiological purposes and may help in tracing the source of HIV infections in the Kingdom of Saudi Arabia. (author)

  19. Extended molecular phylogenetics and revised systematics of Malagasy scincine lizards

    NARCIS (Netherlands)

    Erens, Jesse; Miralles, A.; Glaw, F.; Chatrou, L.W.; Vences, M.

    2017-01-01

    Among the endemic biota of Madagascar, skinks are a diverse radiation of lizards that exhibit a striking ecomorphological variation, and could provide an interesting system to study body-form evolution in squamate reptiles. We provide a new phylogenetic hypothesis for Malagasy skinks of the

  20. Conformation of phylogenetic relationship of Penaeidae shrimp based on morphometric and molecular investigations.

    Science.gov (United States)

    Rajakumaran, P; Vaseeharan, B; Jayakumar, R; Chidambara, R

    2014-01-01

    Understanding of accurate phylogenetic relationship among Penaeidae shrimp is important for academic and fisheries industry. The Morphometric and Randomly amplified polymorphic DNA (RAPD) analysis was used to make the phylogenetic relationsip among 13 Penaeidae shrimp. For morphometric analysis forty variables and total lengths of shrimp were measured for each species, and removed the effect of size variation. The size normalized values obtained was subjected to UPGMA (Unweighted Pair-Group Method with Arithmetic Mean) cluster analysis. For RAPD analysis, the four primers showed reliable differentiation between species, and used correlation coefficient between the DNA banding patterns of 13 Penaeidae species to construct UPGMA dendrogram. Phylogenetic relationship from morphometric and molecular analysis for Penaeidae species found to be congruent. We concluded that as the results from morphometry investigations concur with molecular one, phylogenetic relationship obtained for the studied Penaeidae are considered to be reliable.

  1. Molecular identification and phylogenetic analysis of Dipetalonema evansi (LEWIS, 1882) in camels (Camelus dromedarius) of Iran.

    Science.gov (United States)

    Sazmand, Alireza; Eigner, Barbara; Mirzaei, Mohammad; Hekmatimoghaddam, Seyedhossein; Harl, Josef; Duscher, Georg Gerhard; Fuehrer, Hans-Peter; Joachim, Anja

    2016-04-01

    Despite the economic importance of camels, the parasites that affect them have not received adequate attention so far and molecular studies are scarce compared to other livestock. In this study, we characterized peripheral blood microfilariae in 200 healthy one-humped camels (Camelus dromedarius) from south-east Iran by microscopy and molecular tools to receive a more detailed insight into prevalence and species that affect them. Moreover, adult specimens of the filarial nematode Dipetalonema evansi were collected from the carcass of an infected animal. Microscopic examination was performed on Giemsa-stained blood smears, and blood was also spotted on Whatman FTA(®) cards for DNA analysis. Genomic DNA was extracted, and PCR was carried out for the detection of filaroid helminths, followed by sequence analysis of positive samples. Four samples were positive for microfilariae by microscopy, while 16 animals (8 %) were positive by PCR. Sequence analysis revealed D. evansi in all cases. Phylogenetic analysis of a cytochrome C oxidase subunit I (COI) sequence of filaroid nematodes showed that most species in a single genus cluster in the same clade; however, D. evansi and D. gracile are not monophyletic and branch rather at the base of the tree. Further studies on the life cycle of D. evansi, specifically the identification of intermediate host(s), have become feasible with the provision of the first specific COI sequences in this study.

  2. Molecular Phylogenetics of the Serranid Subfamily Epinephelinae: Speciation and Biogeography in a Nearshore Marine Fish Clade

    OpenAIRE

    Craig, Matthew T,

    2005-01-01

    The processes that shape present day distributions of marine organisms have remained a central topic in evolutionary biology, conservation biology, and ecology. In this thesis, genetic data from mitochondrial and nuclear genes were used to create a phylogenetic hypothesis for the groupers of the subfamily Epinephelinae as a means of evaluating the current taxonomy of the group and the geography of speciation in marine organisms. The molecular phylogenetic hypothesis presented in Chap...

  3. Molecular evidence for deep phylogenetic divergence in Mandrillus sphinx.

    Science.gov (United States)

    Telfer, P T; Souquière, S; Clifford, S L; Abernethy, K A; Bruford, M W; Disotell, T R; Sterner, K N; Roques, P; Marx, P A; Wickings, E J

    2003-07-01

    Mandrills (Mandrillus sphinx) are forest primates indigenous to western central Africa. Phylogenetic analysis of 267 base pairs (bp) of the cytochrome b gene from 53 mandrills of known and 17 of unknown provenance revealed two phylogeographical groups, with haplotypes differentiated by 2.6% comprising seven synonymous transitions. The distribution of the haplotypes suggests that the Ogooué River, Gabon, which bisects their range, separates mandrill populations in Cameroon and northern Gabon from those in southern Gabon. The haplotype distribution is also concordant with that of two known mandrill simian immunodeficiency viruses, suggesting that these two mandrill phylogroups have followed different evolutionary trajectories since separation.

  4. Molecular characterization and phylogenetic analysis of Fasciola hepatica from Peru.

    Science.gov (United States)

    Ichikawa-Seki, Madoka; Ortiz, Pedro; Cabrera, Maria; Hobán, Cristian; Itagaki, Tadashi

    2016-06-01

    The causative agent of fasciolosis in South America is thought to be Fasciola hepatica. In this study, Fasciola flukes from Peru were analyzed to investigate their genetic structure and phylogenetic relationships with those from other countries. Fasciola flukes were collected from the three definitive host species: cattle, sheep, and pigs. They were identified as F. hepatica because mature sperms were observed in their seminal vesicles, and also they displayed Fh type, which has an identical fragment pattern to F. hepatica in the nuclear internal transcribed spacer 1. Eight haplotypes were obtained from the mitochondrial NADH dehydrogenase subunit 1 (nad1) sequences of Peruvian F. hepatica; however, no special difference in genetic structure was observed between the three host species. Its extremely low genetic diversity suggests that the Peruvian population was introduced from other regions. Nad1 haplotypes identical to those of Peruvian F. hepatica were detected in China, Uruguay, Italy, Iran, and Australia. Our results indicate that F. hepatica rapidly expanded its range due to human migration. Future studies are required to elucidate dispersal route of F. hepatica from Europe, its probable origin, to other areas, including Peru. Copyright © 2015. Published by Elsevier Ireland Ltd.

  5. Molecular phylogenetic analysis of Fasciola flukes from eastern India.

    Science.gov (United States)

    Hayashi, Kei; Ichikawa-Seki, Madoka; Mohanta, Uday Kumar; Singh, T Shantikumar; Shoriki, Takuya; Sugiyama, Hiromu; Itagaki, Tadashi

    2015-10-01

    Fasciola flukes from eastern India were characterized on the basis of spermatogenesis status and nuclear ITS1. Both Fasciola gigantica and aspermic Fasciola flukes were detected in Imphal, Kohima, and Gantoku districts. The sequences of mitochondrial nad1 were analyzed to infer their phylogenetical relationship with neighboring countries. The haplotypes of aspermic Fasciola flukes were identical or showed a single nucleotide substitution compared to those from populations in the neighboring countries, corroborating the previous reports that categorized them in the same lineage. However, the prevalence of aspermic Fasciola flukes in eastern India was lower than those in the neighboring countries, suggesting that they have not dispersed throughout eastern India. In contrast, F. gigantica was predominant and well diversified, and the species was thought to be distributed in the area for a longer time than the aspermic Fasciola flukes. Fasciola gigantica populations from eastern India were categorized into two distinct haplogroups A and B. The level of their genetic diversity suggests that populations belonging to haplogroup A have dispersed from the west side of the Indian subcontinent to eastern India with the artificial movement of domestic cattle, Bos indicus, whereas populations belonging to haplogroup B might have spread from Myanmar to eastern India with domestic buffaloes, Bubalus bubalis. Copyright © 2015 Elsevier Ireland Ltd. All rights reserved.

  6. Molecular phylogenetic implications in Brassica napus based on ...

    Indian Academy of Sciences (India)

    Brassica napus L. (canola, rapeseed) is one of the most important oil crops in many countries (Abdelmigid 2012;. Fayyaz et al. 2014), and thought to have originated from a cross where the maternal donor was closely related to two diploid species, B. oleracea (CC, 2n = 18) and B. rapa (AA, 2n = 20). Here, molecular ...

  7. Molecular phylogenetic identification of Fasciola flukes in Nepal.

    Science.gov (United States)

    Shoriki, Takuya; Ichikawa-Seki, Madoka; Devkota, Bhuminand; Rana, Hari B; Devkota, Shiva P; Humagain, Sudeep K; Itagaki, Tadashi

    2014-12-01

    Eighty-one Fasciola flukes collected from 8 districts in Nepal were analyzed for their species identification on the basis of their spermatogenic status and nuclear ribosomal internal transcribed spacer 1 (ITS1) and for their phylogenetic relation with Fasciola flukes from other Asian countries on the basis of the mitochondrial NADH dehydrogenase subunit 1 (nad1) gene. Sixty-one flukes (75.3%) were aspermic Fasciola sp., and 20 flukes (24.7%) were identified as Fasciola gigantica. All of the aspermic flukes displayed the Fh/Fg type in ITS1, which was predominant in aspermic Fasciola sp. from China, and most (60 flukes) displayed the Fsp-ND1-N1 haplotype in the nad1, which had an identical nucleotide sequence to the major haplotype (Fg-C2) of the aspermic flukes from China. These results suggest that aspermic Fasciola sp. was introduced into Nepal from China. Furthermore, the results of the diversity indices, neutrality indices, and median-joining network analysis with reference haplotypes from Asian countries suggest that aspermic Fasciola sp. rapidly expanded its distribution. In contrasts, F. gigantica displayed 10 nad1 haplotypes, which showed higher population diversity indices than the haplotypes of aspermic flukes, indicating that the F. gigantica population was clearly distributed in Nepal earlier than the aspermic Fasciola population. Although the F. gigantica haplotypes from Nepal formed a star-like phylogeny consisting of a main founder haplotype (Fg-ND1-N1), together with some F. gigantica haplotypes from Myanmar and Thailand, the Nepal population differed genetically from F. gigantica populations of neighboring countries as each country had distinct founder haplotype(s). Copyright © 2014 Elsevier Inc. All rights reserved.

  8. Molecular characterization and phylogenetic analysis of Fasciola gigantica from Nigeria.

    Science.gov (United States)

    Ichikawa-Seki, Madoka; Tokashiki, Minami; Opara, Maxwell Nwachukwu; Iroh, Gabriel; Hayashi, Kei; Kumar, Uday Mohanta; Itagaki, Tadashi

    2017-02-01

    Fasciola gigantica is considered the major pathogen causing fasciolosis in Africa; however, molecular characterization of this fluke has not been adequately elucidated. It is important to scientifically elucidate the dispersal history of F. gigantica by analyzing its genetic diversity. Fasciola flukes from Nigeria were analyzed using nuclear and mitochondrial DNA markers. A total of 172 Fasciola flukes collected from cattle were identified as F. gigantica because they displayed the F. gigantica fragment pattern in multiplex PCR for the nuclear marker, phosphoenolpyruvate carboxykinase (pepck). In total, 70 haplotypes were detected from Nigerian F. gigantica on the basis of the concatenated sequence of mitochondrial NADH dehydrogenase subunit 1 (nad1) and cytochrome c oxidase 1 (cox1). The index of neutrality (Fu's Fs) suggests rapid expansion of the Nigerian F. gigantica population. Although four haplogroups, Nigeria 1A, 1B, 2A, and 2B, were detected from Nigerian F. gigantica, a climate-specific genetic structure was not observed among F. gigantica populations from three agro-climatic regions (Sahel, Savannah, and Forest). This is probably because of the frequent transportation of livestock from one part of the country to the other. Nigeria 1A and 1B had close relationships with the Egyptian population of F. gigantica, whereas Nigeria 2A and 2B were comparatively related to the Zambian population. No haplotype was shared among the three countries, and it therefore is difficult to estimate the dispersal route of F. gigantica within the African continent. Copyright © 2016. Published by Elsevier Ireland Ltd.

  9. Complete Chloroplast Genomes of Papaver rhoeas and Papaver orientale: Molecular Structures, Comparative Analysis, and Phylogenetic Analysis

    Directory of Open Access Journals (Sweden)

    Jianguo Zhou

    2018-02-01

    Full Text Available Papaver rhoeas L. and P. orientale L., which belong to the family Papaveraceae, are used as ornamental and medicinal plants. The chloroplast genome has been used for molecular markers, evolutionary biology, and barcoding identification. In this study, the complete chloroplast genome sequences of P. rhoeas and P. orientale are reported. Results show that the complete chloroplast genomes of P. rhoeas and P. orientale have typical quadripartite structures, which are comprised of circular 152,905 and 152,799-bp-long molecules, respectively. A total of 130 genes were identified in each genome, including 85 protein-coding genes, 37 tRNA genes, and 8 rRNA genes. Sequence divergence analysis of four species from Papaveraceae indicated that the most divergent regions are found in the non-coding spacers with minimal differences among three Papaver species. These differences include the ycf1 gene and intergenic regions, such as rpoB-trnC, trnD-trnT, petA-psbJ, psbE-petL, and ccsA-ndhD. These regions are hypervariable regions, which can be used as specific DNA barcodes. This finding suggested that the chloroplast genome could be used as a powerful tool to resolve the phylogenetic positions and relationships of Papaveraceae. These results offer valuable information for future research in the identification of Papaver species and will benefit further investigations of these species.

  10. Molecular and phylogenetic analysis of HIV-1 variants circulating among injecting drug users in Mashhad-Iran

    Directory of Open Access Journals (Sweden)

    Buonaguro FM

    2006-09-01

    Full Text Available Abstract Genetic and phylogenetic information on the HIV-1 epidemic in Middle-East Countries, and in particular in Iran, are extremely limited. By March 2004, the Iranian Ministry of Health officially reported a cumulative number of 6'532 HIV positive individuals and 214 AIDS cases in the Iranian HIV-1 epidemic. The intra-venous drug users (IDUs represent the group at highest risk for HIV-1 infection in Iran, accounting for almost 63% of all HIV-infected population. In this regards, a molecular phylogenetic study has been performed on a sentinel cohort of HIV-1 seropositive IDUs enrolled at the end of 2005 at the University of Mashhad, the largest city North East of Tehran. The study has been performed on both gag and env subgenomic regions amplified by Polymerase Chain Reaction (PCR from peripheral blood mononuclear cells (PBMCs and characterized by direct DNA sequence analysis. The results reported here show that the HIV-1 subtype A is circulating in this IDUs sentinel cohort. Moreover, the single phylogenetic cluster as well as the intra-group low nucleotide divergence is indicative of a recent outbreak. Unexpectedly, the Iranian samples appear to be phylogenetically derived from African Sub-Saharan subtype A viruses, raising stirring speculations on HIV-1 introduction into the IDUs epidemic in Mashhad. This sentinel study could represent the starting point for a wider molecular survey of the HIV-1 epidemics in Iran to evaluate in detail the distribution of genetic subtypes and possible natural drug-resistant variants, which are extremely helpful information to design diagnostic and therapeutic strategies.

  11. Molecular and phylogenetic characterization of bovine coronavirus virus isolated from dairy cattle in Central Region, Thailand.

    Science.gov (United States)

    Singasa, Kanokwan; Songserm, Taweesak; Lertwatcharasarakul, Preeda; Arunvipas, Pipat

    2017-10-01

    Bovine coronavirus (BCoV) is involved mainly in enteric infections in cattle. This study reports the first molecular detection of BCoV in a diarrhea outbreak in dairy cows in the Central Region, Thailand. BCoV was molecularly detected from bloody diarrheic cattle feces by using nested PCR. Agarose gel electrophoresis of three diarrheic fecal samples yielded from the 25 samples desired amplicons that were 488 base pairs and sequencing substantiated that have BCoV. The sequence alignment indicated that nucleotide and amino acid sequences, the three TWD isolated in Thailand, were more quite homologous to each other (amino acid at position 39 of TWD1, TWD3 was proline, but TWD2 was serine) and closely related to OK-0514-3strain (virulent respiratory strain; RBCoV).The amino acid sequencing identities among TWD1, TWD2,TWD3, and OK-0514-3 strain were 96.0 to 96.6%, those at which T3I, H65N, D87G, H127Y, andQ136R were changed. In addition, the phylogenetic tree of the hypervariable region S1subunit spike glycoprotein BCoV gene was composed of three major clades by using the 54 sequences generated and showed that the evolutionally distance, TWD1, TWD2, and TWD3 were the isolated group together and most similar to OK-0514-3 strain (98.2 to 98.5% similarity). Further study will develop ELISA assay for serologic detection of winter dysentery disease.

  12. Evolution of species diversity in the genus Chamaecostus (Costaceae): molecular phylogenetics and morphometric approaches

    OpenAIRE

    Andre, Thiago; Specht, Chelsea; Salzman, Shayla; Palma-Silva, Clarisse [UNESP; Wendt, Tania

    2015-01-01

    While most species within the genus Chamaecostus (Costaceae) are well defined, the broad geographic range and long list of synonyms associated with Chamaecostus subsessilis led us to believe there may be some cryptic species within the complex. We thus investigate the phylogenetic relationships of species in the Chamaecostus lineage and specifically test the monophyly and diversity of the Chamaecostus subsessilis species complex from a population perspective by analyzing molecular sequence da...

  13. An evaluation of phylogenetic informativeness profiles and the molecular phylogeny of diplazontinae (Hymenoptera, Ichneumonidae).

    Science.gov (United States)

    Klopfstein, Seraina; Kropf, Christian; Quicke, Donald L J

    2010-03-01

    How to quantify the phylogenetic information content of a data set is a longstanding question in phylogenetics, influencing both the assessment of data quality in completed studies and the planning of future phylogenetic projects. Recently, a method has been developed that profiles the phylogenetic informativeness (PI) of a data set through time by linking its site-specific rates of change to its power to resolve relationships at different timescales. Here, we evaluate the performance of this method in the case of 2 standard genetic markers for phylogenetic reconstruction, 28S ribosomal RNA and cytochrome oxidase subunit 1 (CO1) mitochondrial DNA, with maximum parsimony, maximum likelihood, and Bayesian analyses of relationships within a group of parasitoid wasps (Hymenoptera: Ichneumonidae, Diplazontinae). Retrieving PI profiles of the 2 genes from our own and from 3 additional data sets, we find that the method repeatedly overestimates the performance of the more quickly evolving CO1 compared with 28S. We explore possible reasons for this bias, including phylogenetic uncertainty, violation of the molecular clock assumption, model misspecification, and nonstationary nucleotide composition. As none of these provides a sufficient explanation of the observed discrepancy, we use simulated data sets, based on an idealized setting, to show that the optimum evolutionary rate decreases with increasing number of taxa. We suggest that this relationship could explain why the formula derived from the 4-taxon case overrates the performance of higher versus lower rates of evolution in our case and that caution should be taken when the method is applied to data sets including more than 4 taxa.

  14. Molecular phylogenetics of finches and sparrows: consequences of character state removal in cytochrome b sequences.

    Science.gov (United States)

    Groth, J G

    1998-12-01

    The complete mitochondrial cytochrome b genes of 53 genera of oscine passerine birds representing the major groups of finches and some allies were compared. Phylogenetic trees resulting from three levels of character partition removal (no data removed, transitions at third positions of codons removed, and all transitions removed [transversion parsimony]) were generally concordant, and all supported several basic statements regarding relationships of finches and finch-like birds, including: (1) larks (Alaudidae) show no close relationship to any finch group; (2) Peucedramus (olive warbler) is phylogenetically far removed from true wood warblers; (3) a clade consisting of fringillids, passerids, motacillids, and emberizids is supported, and this clade is characterized by evolution of a vestigial 10th wing primary; and (4) Hawaiian honeycreepers are derived from within the cardueline finches. Excluding transition substitutions at third positions of codons resulted in phylogenetic trees similar to, but with greater bootstrap nodal support than, trees derived using either all data (equally weighted) or transversion parsimony. Relative to the shortest trees obtained using all data, the topologies obtained after elimination of third-position transitions showed only slight increases in realized treelength and homoplasy. These increases were negligable compared to increases in overall nodal support; therefore, this partition removal scheme may enhance recovery of deep phylogenetic signal in protein-coding DNA datasets. Copyright 1998 Academic Press.

  15. Detection, molecular typing and phylogenetic analysis of Leishmania isolated from cases of leishmaniasis among Syrian refugees in Lebanon

    Directory of Open Access Journals (Sweden)

    Tamara Salloum

    2016-06-01

    Two molecular typing methods of 39 FFPE Leishmania isolates were used: the ITS1-PCR RFLP and the nested ITS1-5.8S rDNA gene amplification followed by sequencing and phylogenetic analysis. The efficiency of these two techniques in Leishmania identification was compared and the phylogenetic relationships among these isolates were illustrated based on the neighbor-joining (NJ method. The results were statistically correlated with the parasitic index (PI. The DNA storage in formalin-fixed paraffin embedded (FFPE tissues was assessed as well. The parasites identified were all L. tropica as determined by both techniques. ITS1-5.8S rDNA gene based typing proved to be more sensitive in the detection of parasites (positive in 69.2% of the isolates as opposed to the ITS1-PCR RFLP method that was successful in identifying L. tropica in only 43.6% of the isolates. Sequencing and phylogenetic analysis revealed high levels of heterogeneity. A statistically significant correlation was observed between PI and the results of the nested ITS1-5.8S rDNA gene PCR. Genotyping at the species level is essential for monitoring the relative frequency of CL in the Mediterranean area that is correlated to three different Leishmania species (Leishmania infantum, Leishmania major and L. tropica, each characterized by distinct epidemiological features. The obtained results highlight the need to find a universally accepted diagnostic tool for Leishmania typing.

  16. Molecular phylogenetic study at the generic boundary between the lichen-forming fungi Caloplaca and Xanthoria (Ascomycota, Teloschistaceae)

    DEFF Research Database (Denmark)

    Søchting, Ulrik; Lutzoni, François

    2003-01-01

    A molecular phylogenetic analysis of rDNA was performed for seven Caloplaca, seven Xanthoria, one Fulgensia and five outgroup species. Phylogenetic hypotheses are constructed based on nuclear small and large subunit rDNA, separately and in combination. Three strongly supported major monophyletic ...

  17. Phylogenetic position of Loricifera inferred from nearly complete 18S and 28S rRNA gene sequences.

    Science.gov (United States)

    Yamasaki, Hiroshi; Fujimoto, Shinta; Miyazaki, Katsumi

    2015-01-01

    Loricifera is an enigmatic metazoan phylum; its morphology appeared to place it with Priapulida and Kinorhyncha in the group Scalidophora which, along with Nematoida (Nematoda and Nematomorpha), comprised the group Cycloneuralia. Scarce molecular data have suggested an alternative phylogenetic hypothesis, that the phylum Loricifera is a sister taxon to Nematomorpha, although the actual phylogenetic position of the phylum remains unclear. Ecdysozoan phylogeny was reconstructed through maximum-likelihood (ML) and Bayesian inference (BI) analyses of nuclear 18S and 28S rRNA gene sequences from 60 species representing all eight ecdysozoan phyla, and including a newly collected loriciferan species. Ecdysozoa comprised two clades with high support values in both the ML and BI trees. One consisted of Priapulida and Kinorhyncha, and the other of Loricifera, Nematoida, and Panarthropoda (Tardigrada, Onychophora, and Arthropoda). The relationships between Loricifera, Nematoida, and Panarthropoda were not well resolved. Loricifera appears to be closely related to Nematoida and Panarthropoda, rather than grouping with Priapulida and Kinorhyncha, as had been suggested by previous studies. Thus, both Scalidophora and Cycloneuralia are a polyphyletic or paraphyletic groups. In addition, Loricifera and Nematomorpha did not emerge as sister groups.

  18. Molecular phylogenetic reconstruction of the endemic Asian salamander family Hynobiidae (Amphibia, Caudata).

    Science.gov (United States)

    Weisrock, David W; Macey, J Robert; Matsui, Masafumi; Mulcahy, Daniel G; Papenfuss, Theodore J

    2013-01-01

    The salamander family Hynobiidae contains over 50 species and has been the subject of a number of molecular phylogenetic investigations aimed at reconstructing branches across the entire family. In general, studies using the greatest amount of sequence data have used reduced taxon sampling, while the study with the greatest taxon sampling has used a limited sequence data set. Here, we provide insights into the phylogenetic history of the Hynobiidae using both dense taxon sampling and a large mitochondrial DNA sequence data set. We report exclusive new mitochondrial DNA data of 2566 aligned bases (with 151 excluded sites, of included sites 1157 are variable with 957 parsimony informative). This is sampled from two genic regions encoding a 12S-16S region (the 3' end of 12S rRNA, tRNA(VAI), and the 5' end of 16S rRNA), and a ND2-COI region (ND2, tRNA(Trp), tRNA(Ala), tRNA(Asn), the origin for light strand replication--O(L), tRNA(Cys), tRNAT(Tyr), and the 5' end of COI). Analyses using parsimony, Bayesian, and maximum likelihood optimality criteria produce similar phylogenetic trees, with discordant branches generally receiving low levels of branch support. Monophyly of the Hynobiidae is strongly supported across all analyses, as is the sister relationship and deep divergence between the genus Onychodactylus with all remaining hynobiids. Within this latter grouping our phylogenetic results identify six clades that are relatively divergent from one another, but for which there is minimal support for their phylogenetic placement. This includes the genus Batrachuperus, the genus Hynobius, the genus Pachyhynobius, the genus Salamandrella, a clade containing the genera Ranodon and Paradactylodon, and a clade containing the genera Liua and Pseudohynobius. This latter clade receives low bootstrap support in the parsimony analysis, but is consistent across all three analytical methods. Our results also clarify a number of well-supported relationships within the larger

  19. Phylogenetic Framework and Molecular Signatures for the Main Clades of the Phylum Actinobacteria

    Science.gov (United States)

    Gao, Beile

    2012-01-01

    Summary: The phylum Actinobacteria harbors many important human pathogens and also provides one of the richest sources of natural products, including numerous antibiotics and other compounds of biotechnological interest. Thus, a reliable phylogeny of this large phylum and the means to accurately identify its different constituent groups are of much interest. Detailed phylogenetic and comparative analyses of >150 actinobacterial genomes reported here form the basis for achieving these objectives. In phylogenetic trees based upon 35 conserved proteins, most of the main groups of Actinobacteria as well as a number of their superageneric clades are resolved. We also describe large numbers of molecular markers consisting of conserved signature indels in protein sequences and whole proteins that are specific for either all Actinobacteria or their different clades (viz., orders, families, genera, and subgenera) at various taxonomic levels. These signatures independently support the existence of different phylogenetic clades, and based upon them, it is now possible to delimit the phylum Actinobacteria (excluding Coriobacteriia) and most of its major groups in clear molecular terms. The species distribution patterns of these markers also provide important information regarding the interrelationships among different main orders of Actinobacteria. The identified molecular markers, in addition to enabling the development of a stable and reliable phylogenetic framework for this phylum, also provide novel and powerful means for the identification of different groups of Actinobacteria in diverse environments. Genetic and biochemical studies on these Actinobacteria-specific markers should lead to the discovery of novel biochemical and/or other properties that are unique to different groups of Actinobacteria. PMID:22390973

  20. Molecular phylogenetic analysis of Commiphora (Burseraceae) yields insight on the evolution and historical biogeography of an "impossible" genus.

    Science.gov (United States)

    Weeks, Andrea; Simpson, Beryl B

    2007-01-01

    Expansion of the arid zone of sub-Saharan tropical Africa during the Miocene is posited as a significant contributing factor in the evolution of contemporary African flora. Nevertheless, few molecular phylogenetic studies have tested this hypothesis using reconstructed historical biogeographies of plants within this zone. Here, we present a molecular phylogeny of Commiphora, a predominantly tropical African, arid-adapted tree genus, in order to test the monophyly of its taxonomic sections and identify clades that will help direct future study of this species-rich and geographically widespread taxon. We then use multiple fossil calibrations of Commiphora phylogeny to determine the timing of well-supported diversification events within the genus and interpret these age estimates to determine the relative contribution of vicariance and dispersal in the expansion of Commiphora's geographic range. We find that Commiphora is sister to Vietnamese Bursera tonkinensis and that its crown group radiation corresponds with the onset of the Miocene.

  1. phylo-node: A molecular phylogenetic toolkit using Node.js.

    Science.gov (United States)

    O'Halloran, Damien M

    2017-01-01

    Node.js is an open-source and cross-platform environment that provides a JavaScript codebase for back-end server-side applications. JavaScript has been used to develop very fast and user-friendly front-end tools for bioinformatic and phylogenetic analyses. However, no such toolkits are available using Node.js to conduct comprehensive molecular phylogenetic analysis. To address this problem, I have developed, phylo-node, which was developed using Node.js and provides a stable and scalable toolkit that allows the user to perform diverse molecular and phylogenetic tasks. phylo-node can execute the analysis and process the resulting outputs from a suite of software options that provides tools for read processing and genome alignment, sequence retrieval, multiple sequence alignment, primer design, evolutionary modeling, and phylogeny reconstruction. Furthermore, phylo-node enables the user to deploy server dependent applications, and also provides simple integration and interoperation with other Node modules and languages using Node inheritance patterns, and a customized piping module to support the production of diverse pipelines. phylo-node is open-source and freely available to all users without sign-up or login requirements. All source code and user guidelines are openly available at the GitHub repository: https://github.com/dohalloran/phylo-node.

  2. Molecular and morphological analyses reveal phylogenetic relationships of stingrays focusing on the family Dasyatidae (Myliobatiformes.

    Directory of Open Access Journals (Sweden)

    Kean Chong Lim

    Full Text Available Elucidating the phylogenetic relationships of the current but problematic Dasyatidae (Order Myliobatiformes was the first priority of the current study. Here, we studied three molecular gene markers of 43 species (COI gene, 33 species (ND2 gene and 34 species (RAG1 gene of stingrays to draft out the phylogenetic tree of the order. Nine character states were identified and used to confirm the molecularly constructed phylogenetic trees. Eight or more clades (at different hierarchical level were identified for COI, ND2 and RAG1 genes in the Myliobatiformes including four clades containing members of the present Dasyatidae, thus rendering the latter non-monophyletic. The uncorrected p-distance between these four 'Dasytidae' clades when compared to the distance between formally known families confirmed that these four clades should be elevated to four separate families. We suggest a revision of the present classification, retaining the Dasyatidae (Dasyatis and Taeniurops species but adding three new families namely, Neotrygonidae (Neotrygon and Taeniura species, Himanturidae (Himantura species and Pastinachidae (Pastinachus species. Our result indicated the need to further review the classification of Dasyatis microps. By resolving the non-monophyletic problem, the suite of nine character states enables the natural classification of the Myliobatiformes into at least thirteen families based on morphology.

  3. Complete mitochondrial genome and the phylogenetic position of the Blotchy swell shark Cephaloscyllium umbratile.

    Science.gov (United States)

    Chen, Hao; Lin, Lingling; Chen, Xiao; Ai, Weiming; Chen, Shaobo

    2016-07-01

    In this study, the complete mitochondrial genome of the Blotchy swell shark Cephaloscyllium umbratile was determined. It was a circle molecular (16 698 bp), contained 37 genes with typical order to that of most other vertebrates. The nucleotide composition was 31.0% A, 24.0% C, 14.0% G, and 31.3% T. There were 26 bp short intergenic spaces located in 11 gene junctions and 28 bp overlaps located in 7 gene junctions in the whole mitogenome. Two start codons (GTG and ATG) and two stop codons (TAG and TAA/T) were used in the protein-coding genes. The phylogenetic result showed that C. umbratile was clustered with Scyliorhinus canicula and formed the Scyliorhinidae clade, which was the most basal clade within Carcharhiniformes, and Carcharhinidae is not monophyletic.

  4. Delimiting invasive Myriophyllum aquaticum in Kashmir Himalaya using a molecular phylogenetic approach.

    Science.gov (United States)

    Shah, M A; Ali, M A; Al-Hemaid, F M; Reshi, Z A

    2014-09-12

    Myriophyllum aquaticum (Vell.) Verdc. (family Haloragaceae) is one of the most invasive and destructive South American aquatic plant species and is present in a wide range of geographic regions, including the Kashmir Himalaya. Confusion regarding the taxonomic delimitation of M. aquaticum in the Himalayan region impedes effective and targeted management. Hence, our goal was improve the identification of M. aquaticum for exclusive delimitation from other related species in the study region using a molecular phylogenetic approach. A maximum parsimony tree recovered from phylogenetic analyses of the internal transcribed spacer sequences of nuclear ribosomal DNA was used to authenticate the identification of M. aquaticum. The results of this study can be used for targeted management of this tropical invader into the temperate Kashmir Himalaya.

  5. PAL: an object-oriented programming library for molecular evolution and phylogenetics.

    Science.gov (United States)

    Drummond, A; Strimmer, K

    2001-07-01

    Phylogenetic Analysis Library (PAL) is a collection of Java classes for use in molecular evolution and phylogenetics. PAL provides a modular environment for the rapid construction of both special-purpose and general analysis programs. PAL version 1.1 consists of 145 public classes or interfaces in 13 packages, including classes for models of character evolution, maximum-likelihood estimation, and the coalescent, with a total of more than 27000 lines of code. The PAL project is set up as a collaborative project to facilitate contributions from other researchers. AVAILIABILTY: The program is free and is available at http://www.pal-project.org. It requires Java 1.1 or later. PAL is licensed under the GNU General Public License.

  6. Molecular evolution of Adh and LEAFY and the phylogenetic utility of their introns in Pyrus (Rosaceae).

    Science.gov (United States)

    Zheng, Xiaoyan; Hu, Chunyun; Spooner, David; Liu, Jing; Cao, Jiashu; Teng, Yuanwen

    2011-09-14

    The genus Pyrus belongs to the tribe Pyreae (the former subfamily Maloideae) of the family Rosaceae, and includes one of the most important commercial fruit crops, pear. The phylogeny of Pyrus has not been definitively reconstructed. In our previous efforts, the internal transcribed spacer region (ITS) revealed a poorly resolved phylogeny due to non-concerted evolution of nrDNA arrays. Therefore, introns of low copy nuclear genes (LCNG) are explored here for improved resolution. However, paralogs and lineage sorting are still two challenges for applying LCNGs in phylogenetic studies, and at least two independent nuclear loci should be compared. In this work the second intron of LEAFY and the alcohol dehydrogenase gene (Adh) were selected to investigate their molecular evolution and phylogenetic utility. DNA sequence analyses revealed a complex ortholog and paralog structure of Adh genes in Pyrus and Malus, the pears and apples. Comparisons between sequences from RT-PCR and genomic PCR indicate that some Adh homologs are putatively nonfunctional. A partial region of Adh1 was sequenced for 18 Pyrus species and three subparalogs representing Adh1-1 were identified. These led to poorly resolved phylogenies due to low sequence divergence and the inclusion of putative recombinants. For the second intron of LEAFY, multiple inparalogs were discovered for both LFY1int2 and LFY2int2. LFY1int2 is inadequate for phylogenetic analysis due to lineage sorting of two inparalogs. LFY2int2-N, however, showed a relatively high sequence divergence and led to the best-resolved phylogeny. This study documents the coexistence of outparalogs and inparalogs, and lineage sorting of these paralogs and orthologous copies. It reveals putative recombinants that can lead to incorrect phylogenetic inferences, and presents an improved phylogenetic resolution of Pyrus using LFY2int2-N. Our study represents the first phylogenetic analyses based on LCNGs in Pyrus. Ancient and recent duplications lead

  7. Molecular evolution of Adh and LEAFY and the phylogenetic utility of their introns in Pyrus (Rosaceae

    Directory of Open Access Journals (Sweden)

    Cao Jiashu

    2011-09-01

    Full Text Available Abstract Background The genus Pyrus belongs to the tribe Pyreae (the former subfamily Maloideae of the family Rosaceae, and includes one of the most important commercial fruit crops, pear. The phylogeny of Pyrus has not been definitively reconstructed. In our previous efforts, the internal transcribed spacer region (ITS revealed a poorly resolved phylogeny due to non-concerted evolution of nrDNA arrays. Therefore, introns of low copy nuclear genes (LCNG are explored here for improved resolution. However, paralogs and lineage sorting are still two challenges for applying LCNGs in phylogenetic studies, and at least two independent nuclear loci should be compared. In this work the second intron of LEAFY and the alcohol dehydrogenase gene (Adh were selected to investigate their molecular evolution and phylogenetic utility. Results DNA sequence analyses revealed a complex ortholog and paralog structure of Adh genes in Pyrus and Malus, the pears and apples. Comparisons between sequences from RT-PCR and genomic PCR indicate that some Adh homologs are putatively nonfunctional. A partial region of Adh1 was sequenced for 18 Pyrus species and three subparalogs representing Adh1-1 were identified. These led to poorly resolved phylogenies due to low sequence divergence and the inclusion of putative recombinants. For the second intron of LEAFY, multiple inparalogs were discovered for both LFY1int2 and LFY2int2. LFY1int2 is inadequate for phylogenetic analysis due to lineage sorting of two inparalogs. LFY2int2-N, however, showed a relatively high sequence divergence and led to the best-resolved phylogeny. This study documents the coexistence of outparalogs and inparalogs, and lineage sorting of these paralogs and orthologous copies. It reveals putative recombinants that can lead to incorrect phylogenetic inferences, and presents an improved phylogenetic resolution of Pyrus using LFY2int2-N. Conclusions Our study represents the first phylogenetic analyses based

  8. Phylogenetic relationships of Hemiuridae (Digenea: Hemiuroidea) with new morphometric and molecular data of Aphanurus mugilis Tang, 1981 (Aphanurinae) from mullet fish of Vietnam.

    Science.gov (United States)

    Atopkin, D M; Besprozvannykh, V V; Yu Beloded, A; Ngo, H D; Ha, N V; Tang, N V

    2017-12-01

    Adult Aphanurus mugilis Tang, 1981 worms were detected in the intestine of Moolgarda engeli in the shallow waters off Cat Ba Island, Vietnam. Tang (1981) first described this species in Mugil cephalus off China. The worms in Vietnamese mullet were identical to Chinese specimens in a number of morphometric characteristics, with the exception of body and ovary size. In the present study, morphological characteristics, and the first molecular data for A. mugilis are provided. Additionally, molecular phylogenetic analysis of the family Hemiuridae was performed. The results of our molecular phylogenetic study indicate that the presence or absence of an ecsoma was not associated with molecular data for hemiurid subfamilies differentiation. The basal position of Bunocotylinae on the molecular-based phylogenetic tree indicated a primordial nature of ecsoma of hemiurid trematodes. Considerable molecular differentiation of Bunocotylinae from other hemiurids indicated the possibility of the recognition of the family Bunocotylidae Dollfus, 1950. Assuming that Machidatrema chilostoma is considered within the Bunocotylinae, the paraphyly of the Lecithasterinae was supported. Copyright © 2017 Elsevier B.V. All rights reserved.

  9. Description, culture and phylogenetic position of a new xerotolerant species of Physarum.

    Science.gov (United States)

    Novozhilov, Yuri K; Okun, Mikhail V; Erastova, Daria A; Shchepin, Oleg N; Zemlyanskaya, Inna V; García-Carvajal, Eva; Schnittler, Martin

    2013-01-01

    A new widespread myxomycete species, Physarum pseudonotabile, inhabiting the arid regions of the Eurasia, South and North America is described and illustrated. Tentatively assigned to Ph. notabile T. Macbr., a phylogeny based on the small ribosomal subunit (SSU) and elongation factor 1 alpha (EF1a) genes placed the new species in a clade far from Ph. notabile. Ph. pseudonotabile was found to be frequent in surveys based on the moist chamber culture technique with samples of litter, bark and herbivore dung collected in dry steppe and deserts of the Caspian lowland (Russia), Kazakhstan, Mongolia, China, Spain, Argentina and USA. The main morphological difference between Ph. pseudonotabile and Ph. notabile lies in spore ornamentation. Spores of the former species display irregularly distributed verrucae, whereas the latter species possesses spores with dense and regularly arranged spinulae. In addition, the ecological preferences of the two species differ. Ph. pseudonotabile inhabits the bark of living plants and ground litter in arid regions, whereas Ph. notabile is found on coarse woody debris in boreal and temperate forests. Although the new species appears to be closest to Ph. notabile morphologically, the phylogenetic analysis reveals Ph. pusillum and Ph. nivale as the closest relatives. In addition, the molecular investigations revealed a considerable amount of hidden diversity within species of Physarum with gray lime flakes. Currently we have only sufficient material to assess the morphological variation of Ph. pseudonotabile but expect that more taxa within this clade may emerge within studies combining morphological and molecular analyses.

  10. A phylogenetic comparison of urease-positive thermophilic Campylobacter (UPTC) and urease-negative (UN) C. lari.

    Science.gov (United States)

    Hirayama, Junichi; Tazumi, Akihiro; Hayashi, Kyohei; Tasaki, Erina; Kuribayashi, Takashi; Moore, John E; Millar, Beverley C; Matsuda, Motoo

    2011-06-01

    In the present study, the reliability of full-length gene sequence information for several genes including 16S rRNA was examined, for the discrimination of the two representative Campylobacter lari taxa, namely urease-negative (UN) C. lari and urease-positive thermophilic Campylobacter (UPTC). As previously described, 16S rRNA gene sequence are not reliable for the molecular discrimination of UN C. lari from UPTC organisms employing both the unweighted pair group method using arithmetic means analysis (UPGMA) and neighbor joining (NJ) methods. In addition, three composite full-length gene sequences (ciaB, flaC and vacJ) out of seven gene loci examined were reliable for discrimination employing dendrograms constructed by the UPGMA method. In addition, all the dendrograms of the NJ phylogenetic trees constructed based on the nine gene information were not reliable for the discrimination. Three composite full-length gene sequences (ciaB, flaC and vacJ) were reliable for the molecular discrimination between UN C. lari and UPTC organisms employing the UPGMA method, as well as among four thermophilic Campylobacter species. Copyright © 2011 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  11. Mitochondrial genome and phylogenetic position of the sliteye shark Loxodon macrorhinus.

    Science.gov (United States)

    Wang, Junjie; Chen, Hao; Lin, Lingling; Ai, Weiming; Chen, Xiao

    2016-11-01

    The sliteye shark Loxodon macrorhinus is the only member of the genus Loxodon in the family Carcharhinidae. In this study, we first present the complete mitochondrial genome of L. macrorhinus and determine its phylogenetic position within Carcharhinidae based on relative mitogenomes. The mitochondrial genome was 16 702 bp in length with the typical gene order in vertebrates. The overall base composition of the H-strand was 31.7% A, 25.8% C, 13.1% G, and 29.4% T. Two start codons (ATG and GTG) and three stop codons (TAG, AGG, and TAA/T) were found in the protein-coding genes. The tRNA genes ranged from 67 bp to 75 bp. Loxodon macrorhinus was placed as sister to the genus Scoliodon in the Bayesian tree.

  12. Molecular cytogenetic characterisation and phylogenetic analysis of the seven cultivated Vigna species (Fabaceae).

    Science.gov (United States)

    She, C-W; Jiang, X-H; Ou, L-J; Liu, J; Long, K-L; Zhang, L-H; Duan, W-T; Zhao, W; Hu, J-C

    2015-01-01

    The genomic organisation of the seven cultivated Vigna species, V. unguiculata, V. subterranea, V. angularis, V. umbellata, V. radiata, V. mungo and V. aconitifolia, was determined using sequential combined PI and DAPI (CPD) staining and dual-colour fluorescence in situ hybridisation (FISH) with 5S and 45S rDNA probes. For phylogenetic analyses, comparative genomic in situ hybridisation (cGISH) onto somatic chromosomes and sequence analysis of the internal transcribed spacer (ITS) of 45S rDNA were used. Quantitative karyotypes were established using chromosome measurements, fluorochrome bands and rDNA FISH signals. All species had symmetrical karyotypes composed of only metacentric or metacentric and submetacentric chromosomes. Distinct heterochromatin differentiation was revealed by CPD staining and DAPI counterstaining after FISH. The rDNA sites among all species differed in their number, location and size. cGISH of V. umbellata genomic DNA to the chromosomes of all species produced strong signals in all centromeric regions of V. umbellata and V. angularis, weak signals in all pericentromeric regions of V. aconitifolia, and CPD-banded proximal regions of V. mungo var. mungo. Molecular phylogenetic trees showed that V. angularis and V. umbellata were the closest relatives, and V. mungo and V. aconitifolia were relatively closely related; these species formed a group that was separated from another group comprising V. radiata, V. unguiculata ssp. sesquipedalis and V. subterranea. This result was consistent with the phylogenetic relationships inferred from the heterochromatin and cGISH patterns; thus, fluorochrome banding and cGISH are efficient tools for the phylogenetic analysis of Vigna species. © 2014 German Botanical Society and The Royal Botanical Society of the Netherlands.

  13. Using genes as characters and a parsimony analysis to explore the phylogenetic position of turtles.

    Directory of Open Access Journals (Sweden)

    Bin Lu

    Full Text Available The phylogenetic position of turtles within the vertebrate tree of life remains controversial. Conflicting conclusions from different studies are likely a consequence of systematic error in the tree construction process, rather than random error from small amounts of data. Using genomic data, we evaluate the phylogenetic position of turtles with both conventional concatenated data analysis and a "genes as characters" approach. Two datasets were constructed, one with seven species (human, opossum, zebra finch, chicken, green anole, Chinese pond turtle, and western clawed frog and 4584 orthologous genes, and the second with four additional species (soft-shelled turtle, Nile crocodile, royal python, and tuatara but only 1638 genes. Our concatenated data analysis strongly supported turtle as the sister-group to archosaurs (the archosaur hypothesis, similar to several recent genomic data based studies using similar methods. When using genes as characters and gene trees as character-state trees with equal weighting for each gene, however, our parsimony analysis suggested that turtles are possibly sister-group to diapsids, archosaurs, or lepidosaurs. None of these resolutions were strongly supported by bootstraps. Furthermore, our incongruence analysis clearly demonstrated that there is a large amount of inconsistency among genes and most of the conflict relates to the placement of turtles. We conclude that the uncertain placement of turtles is a reflection of the true state of nature. Concatenated data analysis of large and heterogeneous datasets likely suffers from systematic error and over-estimates of confidence as a consequence of a large number of characters. Using genes as characters offers an alternative for phylogenomic analysis. It has potential to reduce systematic error, such as data heterogeneity and long-branch attraction, and it can also avoid problems associated with computation time and model selection. Finally, treating genes as

  14. Using Genes as Characters and a Parsimony Analysis to Explore the Phylogenetic Position of Turtles

    Science.gov (United States)

    Lu, Bin; Yang, Weizhao; Dai, Qiang; Fu, Jinzhong

    2013-01-01

    The phylogenetic position of turtles within the vertebrate tree of life remains controversial. Conflicting conclusions from different studies are likely a consequence of systematic error in the tree construction process, rather than random error from small amounts of data. Using genomic data, we evaluate the phylogenetic position of turtles with both conventional concatenated data analysis and a “genes as characters” approach. Two datasets were constructed, one with seven species (human, opossum, zebra finch, chicken, green anole, Chinese pond turtle, and western clawed frog) and 4584 orthologous genes, and the second with four additional species (soft-shelled turtle, Nile crocodile, royal python, and tuatara) but only 1638 genes. Our concatenated data analysis strongly supported turtle as the sister-group to archosaurs (the archosaur hypothesis), similar to several recent genomic data based studies using similar methods. When using genes as characters and gene trees as character-state trees with equal weighting for each gene, however, our parsimony analysis suggested that turtles are possibly sister-group to diapsids, archosaurs, or lepidosaurs. None of these resolutions were strongly supported by bootstraps. Furthermore, our incongruence analysis clearly demonstrated that there is a large amount of inconsistency among genes and most of the conflict relates to the placement of turtles. We conclude that the uncertain placement of turtles is a reflection of the true state of nature. Concatenated data analysis of large and heterogeneous datasets likely suffers from systematic error and over-estimates of confidence as a consequence of a large number of characters. Using genes as characters offers an alternative for phylogenomic analysis. It has potential to reduce systematic error, such as data heterogeneity and long-branch attraction, and it can also avoid problems associated with computation time and model selection. Finally, treating genes as characters

  15. Identification of a vertically transmitted strain from Anaplasma marginale (UFMG3): Molecular and phylogenetic characterization, and evaluation of virulence.

    Science.gov (United States)

    Silvestre, Bruna T; Silveira, Júlia A G; Meneses, Rodrigo M; Facury-Filho, Elias J; Carvalho, Antônio U; Ribeiro, Múcio F B

    2016-02-01

    Bovine anaplasmosis is a disease caused by the intraerythrocytic rickettsia species Anaplasma marginale and results in great economic losses in tropical and subtropical regions. Vertical transmission is an important phenomenon that contributes to the persistence of different strains of the agent within the same herd. The identification of new strains and genetic characterization studies are essential to understanding their epidemiology and virulence and for vaccine development. The aim of this study was to perform molecular and phylogenetic characterizations of a new vertically transmitted strain from A. marginale and to evaluate its virulence by experimental inoculation of rickettsia-free calves. Thirty newborn Holstein calves were subjected to molecular tests for the detection of A. marginale, Babesia bovis and Babesia bigemina. Calves positive for A. marginale (n=3) were splenectomized and monitored for the clinical manifestations of anaplasmosis. Blood samples from one of the calves that presented rickettsemia of 42.8% and spontaneous recovery of clinical parameters were used for molecular and phylogenetic characterization (msp1a gene), and inoculum production was used for the evaluation of virulence. This strain was identified as UFMG3. Three tandem repeat forms (13 and MGI19) were identified from the analysis of the msp1a gene, in which the form MGI19 appeared twice. Analysis of these repeats revealed the presence of the sequences QASTSS and SSASGQQQESS and of aspartic acid (D) at position 20 of both repeats. Phylogenetic analysis showed a close relationship among the UFMG3, MGI19 and UFMG2 strains. For virulence evaluation, six Holstein calves were inoculated intravenously with 2×10(7)A. marginale UFMG3-infected erythrocytes. The calves showed maximum rickettsemia of 5.1%, a moderate decrease in packed cell volume and spontaneous recovery of clinical parameters without the need for treatment. The results of experimental inoculation suggest that the strain A

  16. Molecular phylogenetics, seed morphometrics, chromosome number evolution and systematics of European Elatine L. (Elatinaceae species

    Directory of Open Access Journals (Sweden)

    Gábor Sramkó

    2016-12-01

    Full Text Available The genus Elatine contains ca 25 species, all of which are small, herbaceous annuals distributed in ephemeral waters on both hemispheres. However, due to a high degree of morphological variability (as a consequence of their amphibious life-style, the taxonomy of this genus remains controversial. Thus, to fill this gap in knowledge, we present a detailed molecular phylogenetic study of this genus based on nuclear (rITS and plastid (accD-psaI, psbJ-petA, ycf6-psbM-trnD sequences using 27 samples from 13 species. On the basis of this phylogenetic analysis, we provide a solid phylogenetic background for the modern taxonomy of the European members of the genus. Traditionally accepted sections of this tree (i.e., Crypta and Elatinella were found to be monophyletic; only E. borchoni—found to be a basal member of the genus—has to be excluded from the latter lineage to achieve monophyly. A number of taxonomic conclusions can also be drawn: E. hexandra, a high-ploid species, is most likely a stabilised hybrid between the main sections; E. campylosperma merits full species status based on both molecular and morphological evidence; E. gussonei is a more widespread and genetically diverse species with two main lineages; and the presence of the Asian E. ambigua in the European flora is questionable. The main lineages recovered in this analysis are also supported by a number of synapomorphic morphological characters as well as uniform chromosome counts. Based on all the evidence presented here, two new subsections within Elatinella are described: subsection Hydropipera consisting of the temperate species of the section, and subsection Macropodae including the Mediterranean species of the section.

  17. Taxonomic revision and molecular phylogenetics of the Idarnes incertus species-group (Hymenoptera, Agaonidae, Sycophaginae

    Directory of Open Access Journals (Sweden)

    Fernando H.A. Farache

    2017-01-01

    Full Text Available Sycophaginae is a group of non-pollinating fig wasps considered closely related to the fig pollinators (Agaoninae, Tetrapusiinae, and Kradibiinae in the most recent phylogenetic analyses. They occur in all tropical regions and are associated with Ficus subgenera Urostigma and Sycomorus. There are six described genera of Sycophaginae, and two are native and confined to the Neotropics, namely Idarnes Walker, 1843 and Anidarnes Bouček, 1993. Genus Idarnes is divided into three morphologically distinct groups that were proven to be monophyletic by recent molecular phylogenetic analyses. In this paper we reviewed the Idarnes incertus species-group and provide detailed morphological descriptions and illustrations for the species belonging to this group. Three previously described species were redescribed: I. brasiliensis (Mayr, 1906 comb. nov., I. hansoni Bouček, 1993, and I. incertus (Ashmead, 1900. Seventeen new species are described by Farache and Rasplus: I. amacayacuensis sp. n., I. amazonicus sp. n., I. americanae sp. n., I. badiovertex sp. n., I. brevis sp. n., I. brunneus sp. n., I. comptoni sp. n., I. cremersiae sp. n., I. dimorphicus sp. n., I. flavicrus sp. n., I. flaviventris sp. n., I. gibberosus sp. n., I. gordhi sp. n., I. maximus sp. n., I. nigriventris sp. n., I. pseudoflavus sp. n. and I. ramirezi sp. n. We provided keys for the identification of the species as well as for recognising the different species-groups of Idarnes and a closely related genus (Sycophaga Westwood, 1840. Additionally, phylogenetic relationships among 13 species of the I. incertus species-group were inferred using four molecular markers and discussed in the light of Ficus taxonomy and host specificity.

  18. Molecular characterization and phylogenetic analysis of small ruminant lentiviruses isolated from Canadian sheep and goats

    Directory of Open Access Journals (Sweden)

    Bertoni Giuseppe

    2011-06-01

    Full Text Available Abstract Background Small Ruminant Lentiviruses (SRLV are widespread in Canadian sheep and goats and represent an important health issue in these animals. There is however no data about the genetic diversity of Caprine Arthritis Encephalitis Virus (CAEV or Maedi Visna Virus (MVV in this country. Findings We performed a molecular and phylogenetic analysis of sheep and goat lentiviruses from a small geographic area in Canada using long sequences from the gag region of 30 infected sheep and 36 infected goats originating from 14 different flocks. Pairwise DNA distance and phylogenetic analyses revealed that all SRLV sequences obtained from sheep clustered tightly with prototypical Maedi visna sequences from America. Similarly, all SRLV strains obtained from goats clustered tightly with prototypical US CAEV-Cork strain. Conclusions The data reported in this study suggests that Canadian and US SRLV strains share common origins. In addition, the molecular data failed to bring to light any evidence of past cross species transmission between sheep and goats, which is consistent with the type of farming practiced in this part of the country where single species flocks predominate and where opportunities of cross species transmissions are proportionately low.

  19. A phylogenetic Kalman filter for ancestral trait reconstruction using molecular data.

    Science.gov (United States)

    Lartillot, Nicolas

    2014-02-15

    Correlation between life history or ecological traits and genomic features such as nucleotide or amino acid composition can be used for reconstructing the evolutionary history of the traits of interest along phylogenies. Thus far, however, such ancestral reconstructions have been done using simple linear regression approaches that do not account for phylogenetic inertia. These reconstructions could instead be seen as a genuine comparative regression problem, such as formalized by classical generalized least-square comparative methods, in which the trait of interest and the molecular predictor are represented as correlated Brownian characters coevolving along the phylogeny. Here, a Bayesian sampler is introduced, representing an alternative and more efficient algorithmic solution to this comparative regression problem, compared with currently existing generalized least-square approaches. Technically, ancestral trait reconstruction based on a molecular predictor is shown to be formally equivalent to a phylogenetic Kalman filter problem, for which backward and forward recursions are developed and implemented in the context of a Markov chain Monte Carlo sampler. The comparative regression method results in more accurate reconstructions and a more faithful representation of uncertainty, compared with simple linear regression. Application to the reconstruction of the evolution of optimal growth temperature in Archaea, using GC composition in ribosomal RNA stems and amino acid composition of a sample of protein-coding genes, confirms previous findings, in particular, pointing to a hyperthermophilic ancestor for the kingdom. The program is freely available at www.phylobayes.org.

  20. Molecular phylogenetic lineage of Plagiopogon and Askenasia (Protozoa, Ciliophora) revealed by their gene sequences

    Science.gov (United States)

    Liu, An; Yi, Zhenzhen; Lin, Xiaofeng; Hu, Xiaozhong; Al-Farraj, Saleh A.; Al-Rasheid, Khaled A. S.

    2015-08-01

    Prostomates and haptorians are two basal groups of ciliates with limited morphological characteristics available for taxonomy. Morphologically, the structures used to identify prostomates and haptorians are similar or even identical, which generate heavy taxonomic and phylogenetic confusion. In present work, phylogenetic positions lineage of two rare genera, Plagiopogon and Askenasia, were investigated. Three genes including small subunit ribosomal RNA gene (hereafter SSU rDNA), internal transcribed spacer region (ITS region), and large subunit ribosomal RNA gene (LSU rDNA) were analyzed, 10 new sequences five species each. Our findings included 1) class Prostomatea and order Haptorida are multiphyletic; 2) it may not be appropriate to place order Cyclotrichiida in subclass Haptoria, and the systematic lineage of order Cyclotrichiida needs to be verified further; 3) genus Plagiopogon branches consistently within a clade covering most prostomes and is basal of clade Colepidae, implying its close lineage to Prostomatea; and 4) Askenasia is phylogenetically distant from the subclass Haptoria but close to classes Prostomatea, Plagiopylea and Oligohymenophorea. We supposed that the toxicyst of Askenasia may be close to taxa of prostomes instead of haptorians, and the dorsal brush is a more typical morphological characteristics of haptorians than toxicysts.

  1. A new look at the ventral nerve centre of Sagitta: implications for the phylogenetic position of Chaetognatha (arrow worms and the evolution of the bilaterian nervous system

    Directory of Open Access Journals (Sweden)

    Müller Carsten HG

    2007-05-01

    Full Text Available Abstract Background The Chaetognatha (arrow worms are a group of marine carnivores whose phylogenetic relationships are still vigorously debated. Molecular studies have as yet failed to come up with a stable hypothesis on their phylogenetic position. In a wide range of metazoans, the nervous system has proven to provide a wealth of characters for analysing phylogenetic relationships (neurophylogeny. Therefore, in the present study we explored the structure of the ventral nerve centre ("ventral ganglion" in Sagitta setosa with a set of histochemical and immunohistochemical markers. Results In specimens that were immunolabeled for acetylated-alpha tubulin the ventral nerve centre appeared to be a condensed continuation of the peripheral intraepidermal nerve plexus. Yet, synapsin immunolocalization showed that the ventral nerve centre is organized into a highly ordered array of ca. 80 serially arranged microcompartments. Immunohistochemistry against RFamide revealed a set of serially arranged individually identifiable neurons in the ventral nerve centre that we charted in detail. Conclusion The new information on the structure of the chaetognath nervous system is compared to previous descriptions of the ventral nerve centre which are critically evaluated. Our findings are discussed with regard to the debate on nervous system organisation in the last common bilaterian ancestor and with regard to the phylogenetic affinities of this Chaetognatha. We suggest to place the Chaetognatha within the Protostomia and argue against hypotheses which propose a deuterostome affinity of Chaetognatha or a sister-group relationship to all other Bilateria.

  2. Molecular Detection, Phylogenetic Analysis, and Identification of Transcription Motifs in Feline Leukemia Virus from Naturally Infected Cats in Malaysia

    Directory of Open Access Journals (Sweden)

    Faruku Bande

    2014-01-01

    Full Text Available A nested PCR assay was used to determine the viral RNA and proviral DNA status of naturally infected cats. Selected samples that were FeLV-positive by PCR were subjected to sequencing, phylogenetic analysis, and motifs search. Of the 39 samples that were positive for FeLV p27 antigen, 87.2% (34/39 were confirmed positive with nested PCR. FeLV proviral DNA was detected in 38 (97.3% of p27-antigen negative samples. Malaysian FeLV isolates are found to be highly similar with a homology of 91% to 100%. Phylogenetic analysis revealed that Malaysian FeLV isolates divided into two clusters, with a majority (86.2% sharing similarity with FeLV-K01803 and fewer isolates (13.8% with FeLV-GM1 strain. Different enhancer motifs including NF-GMa, Krox-20/WT1I-del2, BAF1, AP-2, TBP, TFIIF-beta, TRF, and TFIID are found to occur either in single, duplicate, triplicate, or sets of 5 in different positions within the U3-LTR-gag region. The present result confirms the occurrence of FeLV viral RNA and provirus DNA in naturally infected cats. Malaysian FeLV isolates are highly similar, and a majority of them are closely related to a UK isolate. This study provides the first molecular based information on FeLV in Malaysia. Additionally, different enhancer motifs likely associated with FeLV related pathogenesis have been identified.

  3. The adder (Vipera berus in Southern Altay Mountains: population characteristics, distribution, morphology and phylogenetic position

    Directory of Open Access Journals (Sweden)

    Shaopeng Cui

    2016-08-01

    Full Text Available As the most widely distributed snake in Eurasia, the adder (Vipera berus has been extensively investigated in Europe but poorly understood in Asia. The Southern Altay Mountains represent the adder’s southern distribution limit in Central Asia, whereas its population status has never been assessed. We conducted, for the first time, field surveys for the adder at two areas of Southern Altay Mountains using a combination of line transects and random searches. We also described the morphological characteristics of the collected specimens and conducted analyses of external morphology and molecular phylogeny. The results showed that the adder distributed in both survey sites and we recorded a total of 34 sightings. In Kanas river valley, the estimated encounter rate over a total of 137 km transects was 0.15 ± 0.05 sightings/km. The occurrence of melanism was only 17%. The small size was typical for the adders in Southern Altay Mountains in contrast to other geographic populations of the nominate subspecies. A phylogenetic tree obtained by Bayesian Inference based on DNA sequences of the mitochondrial cytochrome b (1,023 bp grouped them within the Northern clade of the species but failed to separate them from the subspecies V. b. sachalinensis. Our discovery extends the distribution range of V. berus and provides a basis for further researches. We discuss the hypothesis that the adder expands its distribution border to the southwest along the mountains’ elevation gradient, but the population abundance declines gradually due to a drying climate.

  4. Molecular and phylogenetic analysis of the filarial nematode Micipsella numidica from the hare Lepus europaeus in Italy.

    Science.gov (United States)

    Gabrielli, S; Galuppi, R; Fraulo, M; Savini, F; Morandi, B; Cancrini, G; Poglayen, G

    2016-07-01

    The genus Micipsella comprises three species of filariae to date identified in lagomorphs only, whereas the other genera belonging to the subfamily Splendidofilariinae are described as parasites of birds, reptiles and mammals. In the present study seven specimens of Micipsella numidica (Seurat, 1917), collected from the hare Lepus europaeus in Italy, were characterized genetically by molecular amplification of the mitochondrial genes (12S rDNA; cox1) and the 5S rDNA gene spacer region. Phylogenetic trees inferred using available sequences from filariae and those identified in this study evidenced a close relationship between M. numidica and Splendidofilariinae of other mammals and reptiles (Rumenfilaria andersoni and Madathamugadia hiepei). The present findings, apart from adding new data about the hosts in Italy, support the taxonomic position of M. numidica and highlight the substantial biological and molecular differences existing between Splendidofilariinae and other Onchocercidae. The study also contributes to our knowledge of the molecular/genetic diagnosis of filarial parasites of veterinary and medical concern in any vertebrate or invertebrate host.

  5. Molecular identification and phylogenetic analysis of Wuchereria bancrofti from human blood samples in Egypt.

    Science.gov (United States)

    Abdel-Shafi, Iman R; Shoieb, Eman Y; Attia, Samar S; Rubio, José M; Ta-Tang, Thuy-Huong; El-Badry, Ayman A

    2017-03-01

    Lymphatic filariasis (LF) is a serious vector-borne health problem, and Wuchereria bancrofti (W.b) is the major cause of LF worldwide and is focally endemic in Egypt. Identification of filarial infection using traditional morphologic and immunological criteria can be difficult and lead to misdiagnosis. The aim of the present study was molecular detection of W.b in residents in endemic areas in Egypt, sequence variance analysis, and phylogenetic analysis of W.b DNA. Collected blood samples from residents in filariasis endemic areas in five governorates were subjected to semi-nested PCR targeting repeated DNA sequence, for detection of W.b DNA. PCR products were sequenced; subsequently, a phylogenetic analysis of the obtained sequences was performed. Out of 300 blood samples, W.b DNA was identified in 48 (16%). Sequencing analysis confirmed PCR results identifying only W.b species. Sequence alignment and phylogenetic analysis indicated genetically distinct clusters of W.b among the study population. Study results demonstrated that the semi-nested PCR proved to be an effective diagnostic tool for accurate and rapid detection of W.b infections in nano-epidemics and is applicable for samples collected in the daytime as well as the night time. PCR products sequencing and phylogenitic analysis revealed three different nucleotide sequences variants. Further genetic studies of W.b in Egypt and other endemic areas are needed to distinguish related strains and the various ecological as well as drug effects exerted on them to support W.b elimination.

  6. Molecular Signature in HCV-Positive Lymphomas

    Directory of Open Access Journals (Sweden)

    Valli De Re

    2012-01-01

    Full Text Available Hepatitis C virus (HCV is a positive, single-stranded RNA virus, which has been associated to different subtypes of B-cell non-Hodgkin lymphoma (B-NHL. Cumulative evidence suggests an HCV-related antigen driven process in the B-NHL development. The underlying molecular signature associated to HCV-related B-NHL has to date remained obscure. In this review, we discuss the recent developments in this field with a special mention to different sets of genes whose expression is associated with BCR coupled to Blys signaling which in turn was found to be linked to B-cell maturation stages and NF-κb transcription factor. Even if recent progress on HCV-B-NHL signature has been made, the precise relationship between HCV and lymphoma development and phenotype signature remain to be clarified.

  7. Molecular phylogenetic and expression analysis of the complete WRKY transcription factor family in maize.

    Science.gov (United States)

    Wei, Kai-Fa; Chen, Juan; Chen, Yan-Feng; Wu, Ling-Juan; Xie, Dao-Xin

    2012-04-01

    The WRKY transcription factors function in plant growth and development, and response to the biotic and abiotic stresses. Although many studies have focused on the functional identification of the WRKY transcription factors, much less is known about molecular phylogenetic and global expression analysis of the complete WRKY family in maize. In this study, we identified 136 WRKY proteins coded by 119 genes in the B73 inbred line from the complete genome and named them in an orderly manner. Then, a comprehensive phylogenetic analysis of five species was performed to explore the origin and evolutionary patterns of these WRKY genes, and the result showed that gene duplication is the major driving force for the origin of new groups and subgroups and functional divergence during evolution. Chromosomal location analysis of maize WRKY genes indicated that 20 gene clusters are distributed unevenly in the genome. Microarray-based expression analysis has revealed that 131 WRKY transcripts encoded by 116 genes may participate in the regulation of maize growth and development. Among them, 102 transcripts are stably expressed with a coefficient of variation (CV) value of WRKY genes with the CV value of >15% are further analysed to discover new organ- or tissue-specific genes. In addition, microarray analyses of transcriptional responses to drought stress and fungal infection showed that maize WRKY proteins are involved in stress responses. All these results contribute to a deep probing into the roles of WRKY transcription factors in maize growth and development and stress tolerance.

  8. Molecular typing of canine parvovirus from Sulaimani, Iraq and phylogenetic analysis using partial VP2 gene

    Directory of Open Access Journals (Sweden)

    M.O.Baba Sheikh

    2017-09-01

    Full Text Available Canine parvovirus (CPV remains the most significant viral cause of haemorrhagic enteritis and bloody diarrhoea in puppies over the age of 12 weeks. The objective of the present study was to detect and genotype CPV-2 by polymerase chain reaction (PCR and to perform phylogenetic analysis using partial VP2 gene sequences. We analysed eight faecal samples of unvaccinated dogs with signs of vomiting and bloody diarrhoea during the period from December 2013 to May 2014 in different locations in Sulaimani, Kurdistan, Iraq. After PCR detection, we found that all viral sequences in our study were CPV-2b variants, which differed genetically by 0.8% to 3.6% from five commercially available vaccines. Alignment between eight nucleotides of field virus sequences showed 95% to 99.5% similarity. The phylogenetic analysis for the 8 field sequences formed two distinct clusters with two sequences belonging to strains from China and Thailand and the other six – with a strain from Egypt. Molecular characterisation and CPV typing are crucial in epidemiological studies for future prevention and control of the disease.

  9. Molecular phylogenetic analysis of non-sexually transmitted strains of Haemophilus ducreyi.

    Science.gov (United States)

    Gaston, Jordan R; Roberts, Sally A; Humphreys, Tricia L

    2015-01-01

    Haemophilus ducreyi, the etiologic agent of chancroid, has been previously reported to show genetic variance in several key virulence factors, placing strains of the bacterium into two genetically distinct classes. Recent studies done in yaws-endemic areas of the South Pacific have shown that H. ducreyi is also a major cause of cutaneous limb ulcers (CLU) that are not sexually transmitted. To genetically assess CLU strains relative to the previously described class I, class II phylogenetic hierarchy, we examined nucleotide sequence diversity at 11 H. ducreyi loci, including virulence and housekeeping genes, which encompass approximately 1% of the H. ducreyi genome. Sequences for all 11 loci indicated that strains collected from leg ulcers exhibit DNA sequences homologous to class I strains of H. ducreyi. However, sequences for 3 loci, including a hemoglobin receptor (hgbA), serum resistance protein (dsrA), and a collagen adhesin (ncaA) contained informative amounts of variation. Phylogenetic analyses suggest that these non-sexually transmitted strains of H. ducreyi comprise a sub-clonal population within class I strains of H. ducreyi. Molecular dating suggests that CLU strains are the most recently developed, having diverged approximately 0.355 million years ago, fourteen times more recently than the class I/class II divergence. The CLU strains' divergence falls after the divergence of humans from chimpanzees, making it the first known H. ducreyi divergence event directly influenced by the selective pressures accompanying human hosts.

  10. Molecular phylogenetic analysis of non-sexually transmitted strains of Haemophilus ducreyi.

    Directory of Open Access Journals (Sweden)

    Jordan R Gaston

    Full Text Available Haemophilus ducreyi, the etiologic agent of chancroid, has been previously reported to show genetic variance in several key virulence factors, placing strains of the bacterium into two genetically distinct classes. Recent studies done in yaws-endemic areas of the South Pacific have shown that H. ducreyi is also a major cause of cutaneous limb ulcers (CLU that are not sexually transmitted. To genetically assess CLU strains relative to the previously described class I, class II phylogenetic hierarchy, we examined nucleotide sequence diversity at 11 H. ducreyi loci, including virulence and housekeeping genes, which encompass approximately 1% of the H. ducreyi genome. Sequences for all 11 loci indicated that strains collected from leg ulcers exhibit DNA sequences homologous to class I strains of H. ducreyi. However, sequences for 3 loci, including a hemoglobin receptor (hgbA, serum resistance protein (dsrA, and a collagen adhesin (ncaA contained informative amounts of variation. Phylogenetic analyses suggest that these non-sexually transmitted strains of H. ducreyi comprise a sub-clonal population within class I strains of H. ducreyi. Molecular dating suggests that CLU strains are the most recently developed, having diverged approximately 0.355 million years ago, fourteen times more recently than the class I/class II divergence. The CLU strains' divergence falls after the divergence of humans from chimpanzees, making it the first known H. ducreyi divergence event directly influenced by the selective pressures accompanying human hosts.

  11. Molecular and phylogenetic evidence of chikungunya virus circulating in Assam, India

    Directory of Open Access Journals (Sweden)

    Prafulla Dutta

    2017-01-01

    Full Text Available Purpose: Northeast Region of India possesses an abundant number of Aedes mosquitoes, the common vector for Dengue and Chikungunya (CHIK. Dengue is reported every year from Assam, but active surveillance for CHIK virus (CHIKV infection is lacking in this part of India. Therefore, this present study has been undertaken to detect any CHIKV infection during a dengue outbreak in Assam. Materials and Methods: A total of 42 dengue negative samples collected from Guwahati were screened for the presence of CHIK IgM antibodies. Further, all the samples were processed for CHIKV RNA detection by reverse transcriptase-polymerase chain reaction (RT-PCR. Phylogenetic analysis was done by Maximum Likelihood method using Kimura-2 parameter model. Results: No IgM positivity was found in the processed samples; however, 7 samples were positive for CHIKV by RT-PCR. Phylogenetic analysis revealed that the circulating CHIKV belonged to Eastern, Central and Southern African genotype. Sequence analysis showed two uniform nucleotide substitutions and very less amino acid substitution. Conclusion: Silent existence of CHIKV beside dengue is reported from this study. Therefore, CHIKV diagnosis should be included as a regular practice for active surveillance of the disease and its accomplishment before commencing an outbreak.

  12. A Molecular Assessment of Phylogenetic Relationships and LineageDiversification Within the Family Salamandridae (Amphibia, Caudata)

    Energy Technology Data Exchange (ETDEWEB)

    Weisrock, David W.; Papenfuss, Theodore J.; Macey, J. Robert; Litvinchuk, Spartak N.; Polymeni, Rosa; Ugurtas, Ismail H.; Zhao, Ermi; Larson, Allan

    2005-08-08

    Phylogenetic relationships among species of the salamanderfamily Salamandridae are investigated using nearly 3000 nucleotide basesof newly reported mitochondrial DNA sequence data from the mtDNA genicregion spanning the genes tRNALeu-COI. This study uses nearlycomprehensive species-level sampling to provide the first completephylogeny for the Salamandridae. Deep phylogenetic relationships amongthe three most divergent lineages in the family Salamandrina terdigitata,a clade comprising the "True" salamanders, and a clade comprising allnewts except S. terdigitata are difficult to resolve. However, mostrelationships within the latter two lineages are resolved with robustlevels of branch support. The genera Euproctus and Triturus arestatistically shown to be nonmonophyletic, instead each contains adiverse set of lineages positioned within the large newt clade. The genusParamesotriton is also resolve as a nonmonophyletic group, with the newlydescribed species P. laoensis constituting a divergent lineage placed ina sister position to clade containing all Pachytriton species and allremaining Paramesotriton species. Sequence divergences between P.laoensis and other Paramesotriton species are as great as those comparingP. laoensis and species of the genera Cynops and Pachytriton. Analyses oflineage diversification across the Salamandridae indicate that, despiteits exceptional diversity, lineage accumulation appears to have beenconstant across time, indicating that it does not represent a truespecies radiation.

  13. Morphological and Molecular Phylogenetic Data Reveal a New Species of Primula (Primulaceae from Hunan, China.

    Directory of Open Access Journals (Sweden)

    Yuan Xu

    Full Text Available A new species of Primulaceae, Primula undulifolia, is described from the hilly area of Hunan province in south-central China. Its morphology and distributional range suggest that it is allied to P. kwangtungensis, both adapted to subtropical climate, having contiguous distribution and similar habitat, growing on shady and moist cliffs. Petioles, scapes and pedicels of them are densely covered with rusty multicellular hairs, but the new species can be easily distinguished by its smaller flowers and narrowly oblong leaves with undulate margins. Molecular phylogenetic analysis based on four DNA markers (ITS, matK, trnL-F and rps16 confirmed the new species as an independent lineage and constitutes a main clade together with P. kwangtungensis, P. kweichouensis, P. wangii and P. hunanensis of Primula sect. Carolinella.

  14. Molecular and phylogenetic characterization of Cryptosporidium and Giardia from pigs and cattle in Denmark

    DEFF Research Database (Denmark)

    Langkjær, Rikke Breinhold; Vigre, Håkan; Enemark, Heidi L.

    2007-01-01

    The genetic diversity of Cryptosporidium spp. and Giardia duodenalis from dairy cattle and pigs in Denmark was determined in the present study. Faecal samples from 1237 pigs and 1150 cattle originating from 50 sow herds and 50 dairy herds, respectively, were analysed for the presence of the two...... parasites by immunofluorescence microscopy. A large proportion of the (oo)cyst containing samples were selected for molecular characterization. Sequencing and phylogenetic analysis of the 18S rDNA locus and/or the HSP70 gene of 183 pig and 154 cattle isolates of Cryptosporidium revealed the presence of C....... suis, pig genotype II, C. parvum (cattle genotype), C. bovis, Cryptosporidium deer-like genotype and a novel C. suis-like genotype. For both cattle and pigs, a host age-related change in distribution of species/genotypes was observed. The zoonotic C. parvum (cattle genotype) was most prevalent in young...

  15. Genetic characterization and phylogenetic position of Echinococcus felidis (Cestoda: Taeniidae) from the African lion.

    Science.gov (United States)

    Hüttner, Marion; Nakao, Minoru; Wassermann, Torsten; Siefert, Ludwig; Boomker, Joop D F; Dinkel, Anke; Sako, Yasuhito; Mackenstedt, Ute; Romig, Thomas; Ito, Akira

    2008-06-01

    Echinococcus felidis had been described in 1937 from African lions, but was later included in Echinococcus granulosus as a subspecies or a strain. In the absence of any genetic characterization, most previous records of this taxon from a variety of large African mammals remained unconfirmed due to the lack of diagnostic criteria and the possible confusion with the sympatric E. granulosus sensu stricto, Echinococcus ortleppi and Echinococcus canadensis. In this study, we obtained taeniid eggs from lion feces in Uganda and amplified DNA from individual eggs. Mitochondrial and nuclear DNA sequences showed similarities with those of other Echinococcus spp., but high values of percentage divergence of mitochondrial genes indicated the presence of a distinct species. In a second step, we compared this material with the preserved specimens of adult E. granulosus felidis, which had been identified morphologically approximately 40 years ago in South Africa. All DNA fragments (<200 bp) that could be amplified from the adults showed 100% similarity with the Ugandan material. In the phylogenetic tree of Echinococcus which was constructed from the mitochondrial genes, E. felidis is positioned as a sister taxon of E. granulosus sensu stricto. The data obtained will facilitate the development of diagnostic tools necessary to study the epidemiology of this enigmatic parasite.

  16. Two new hyaline-ascospored species of Trichoderma and their phylogenetic positions.

    Science.gov (United States)

    Qin, W T; Zhuang, W Y

    2016-01-01

    Collections of hypocrealean fungi found on decaying wood in subtropical regions of China were examined. Two new species, Trichoderma confluens and T. hubeiense, were discovered and are described. Trichoderma confluens is characterized by its widely effuse to rarely pulvinate, yellow stromata with densely disposed yellowish brown ostioles, simple acremonium- to verticillium-like conidiophores, hyaline conidia and multiform chlamydospores. Trichoderma hubeiense has pulvinate, grayish yellow stromata with brownish ostioles, trichoderma- to verticillium-like conidiophores and hyaline conidia. The phylogenetic positions of the two fungi were investigated based on sequence analyses of RNA polymerase II subunit b and translation elongation factor 1-α genes. The results indicate that T. confluens belongs to the Hypocreanum clade and is associated with but clearly separated from T. applanatum and T. decipiens. Trichoderma hubeiense belongs to the Polysporum clade and related to T. bavaricum but obviously differs from other members of the clade in sequence data. Morphological distinctions between the new species and their close relatives are noted and discussed. © 2016 by The Mycological Society of America.

  17. Genetic characterization, molecular epidemiology, and phylogenetic relationships of insect-specific viruses in the taxon Negevirus.

    Science.gov (United States)

    Nunes, Marcio R T; Contreras-Gutierrez, María Angélica; Guzman, Hilda; Martins, Livia C; Barbirato, Mayla Feitoza; Savit, Chelsea; Balta, Victoria; Uribe, Sandra; Vivero, Rafael; Suaza, Juan David; Oliveira, Hamilton; Nunes Neto, Joaquin P; Carvalho, Valeria L; da Silva, Sandro Patroca; Cardoso, Jedson F; de Oliveira, Rodrigo Santo; da Silva Lemos, Poliana; Wood, Thomas G; Widen, Steven G; Vasconcelos, Pedro F C; Fish, Durland; Vasilakis, Nikos; Tesh, Robert B

    2017-04-01

    The recently described taxon Negevirus is comprised of a diverse group of insect-specific viruses isolated from mosquitoes and phlebotomine sandflies. In this study, a comprehensive genetic characterization, molecular, epidemiological and evolutionary analyses were conducted on nearly full-length sequences of 91 new negevirus isolates obtained in Brazil, Colombia, Peru, Panama, USA and Nepal. We demonstrated that these arthropod restricted viruses are clustered in two major phylogenetic groups with origins related to three plant virus genera (Cilevirus, Higrevirus and Blunevirus). Molecular analyses demonstrated that specific host correlations are not present with most negeviruses; instead, high genetic variability, wide host-range, and cross-species transmission were noted. The data presented here also revealed the existence of five novel insect-specific viruses falling into two arthropod-restrictive virus taxa, previously proposed as distinct genera, designated Nelorpivirus and Sandewavirus. Our results provide a better understanding of the molecular epidemiology, evolution, taxonomy and stability of this group of insect-restricted viruses. Copyright © 2017 Elsevier Inc. All rights reserved.

  18. The long and winding road of molecular data in phylogenetic analysis.

    Science.gov (United States)

    Suárez-Díaz, Edna

    2014-01-01

    The use of molecules and reactions as evidence, markers and/or traits for evolutionary processes has a history more than a century long. Molecules have been used in studies of intra-specific variation and studies of similarity among species that do not necessarily result in the analysis of phylogenetic relations. Promoters of the use of molecular data have sustained the need for quantification as the main argument to make use of them. Moreover, quantification has allowed intensive statistical analysis, as a condition and a product of increasing automation. All of these analyses are subject to the methodological anxiety characteristic of a community in search of objectivity (Suárez-Díaz and Anaya-Munoz, Stud Hist Philos Biol Biomed Sci 39:451–458, 2008). It is in this context that scientists compared and evaluated protein and nucleic acid sequence data with other types of molecular data – including immunological, electrophoretic and hybridization data. This paper argues that by looking at longterm historical processes, such as the use of molecular evidence in evolutionary biology, we gain valuable insights into the history of science. In that sense, it accompanies a growing concern among historians for big-pictures of science that incorporate the fruitful historical research on local cases of the last decades.

  19. Immature stages and phylogenetic importance of Astrapaeus, a rove beetle genus of puzzling systematic position (Coleoptera, Staphylinidae, Staphylinini)

    NARCIS (Netherlands)

    Pietrykowska-Tudruj, E.; Staniec, B.; Wojas, T.; Alexey, A.

    2014-01-01

    For the first time eggs, larvae and pupae obtained by rearing are described for Astrapaeus, a monotypic West Palearctic rove beetle genus of a puzzling phylogenetic position within the megadiverse tribe Staphylinini. Morphology of the immature stages of Astrapaeus ulmi is compared to that of other

  20. PhyTB: Phylogenetic tree visualisation and sample positioning for M. tuberculosis

    KAUST Repository

    Benavente, Ernest D; Coll, Francesc; Furnham, Nick; McNerney, Ruth; Glynn, Judith R; Campino, Susana; Pain, Arnab; Mohareb, Fady R; Clark, Taane G

    2015-01-01

    Phylogenetic-based classification of M. tuberculosis and other bacterial genomes is a core analysis for studying evolutionary hypotheses, disease outbreaks and transmission events. Whole genome sequencing is providing new insights

  1. Molecular and phylogenetic characterization of two species of the genus Nostoc (Cyanobacteria based on the cpcB-IGS-cpcA locus of the phycocyanin operon

    Directory of Open Access Journals (Sweden)

    IVANKA TENEVA

    2012-01-01

    Full Text Available Traditionally, the taxonomy of the genus Nostoc is based on morphological and physiological characters. The extreme morphological variability of the Nostoc species, due to their life cycle and environmental conditions, hampers the correct identification of the individual species. This is also one of the reasons for the disputed taxonomic positions and relationships between the genera Anabaena–Aphanizomenon as well as between Anabaena–Nostoc. Therefore, it is necessary to use additional markers for development of a polyphasic classification system of order Nostocales. In light of this, we here present the first molecular and phy-logenetic characterization of two species of the genus Nostoc (Nostoc linckia and Nostoc punctiforme based on the cpcB-IGS-cpcA locus of the phycocyanin oper-on. The phylogenetic position of these two species within order Nostocales as well as within division Cyanobacteria has been determined. Our results indicate that genus Nostoc is heterogeneous. Analysis of the IGS region between cpcB and cpcA showed that Nostoc and Anabaena are distinct genera. Reported molecular and phylogenetic data will be useful to solve other problematic points in the tax-onomy of genera Aphanizomenon, Anabaena and Nostoc.

  2. Molecular characterization of Hepatozoon sp. from Brazilian dogs and its phylogenetic relationship with other Hepatozoon spp.

    Science.gov (United States)

    Forlano, M D; Teixeira, K R S; Scofield, A; Elisei, C; Yotoko, K S C; Fernandes, K R; Linhares, G F C; Ewing, S A; Massard, C L

    2007-04-10

    To characterize phylogenetically the species which causes canine hepatozoonosis at two rural areas of Rio de Janeiro State, Brazil, we used universal or Hepatozoon spp. primer sets for the 18S SSU rRNA coding region. DNA extracts were obtained from blood samples of thirteen dogs naturally infected, from four experimentally infected, and from five puppies infected by vertical transmission from a dam, that was experimentally infected. DNA of sporozoites of Hepatozoon americanum was used as positive control. The amplification of DNA extracts from blood of dogs infected with sporozoites of Hepatozoon spp. was observed in the presence of primers to 18S SSU rRNA gene of Hepatozoon spp., whereas DNA of H. americanum sporozoites was amplified in the presence of either universal or Hepatozoon spp.-specific primer sets; the amplified products were approximately 600bp in size. Cloned PCR products obtained from DNA extracts of blood from two dogs experimentally infected with Hepatozoon sp. were sequenced. The consensus sequence, derived from six sequence data sets, were blasted against sequences of 18S SSU rRNA of Hepatozoon spp. available at GenBank and aligned to homologous sequences to perform the phylogenetic analysis. This analysis clearly showed that our sequence clustered, independently of H. americanum sequences, within a group comprising other Hepatozoon canis sequences. Our results confirmed the hypothesis that the agent causing hepatozoonosis in the areas studied in Brazil is H. canis, supporting previous reports that were based on morphological and morphometric analyses.

  3. Molecular Phylogenetic Classification of Streptomycetes Isolated from the Rhizosphere of Tropical Legume (Paraserianthes falcataria (L. Nielsen

    Directory of Open Access Journals (Sweden)

    LANGKAH SEMBIRING

    2009-09-01

    Full Text Available Intrageneric diversity of 556 streptomycetes isolated from the rhizosphere of tropical legume was determined by using molecular taxonomic method based on 16S rDNA. A total of 46 isolates were taken to represent 37 colour groups of the isolates. 16S rDNA were amplified and subsequently sequenced and the sequences data were aligned with streptomycete sequences retrieved from the ribosomal data base project (RDP data. Phylogenetic trees were generated by using the PHYLIP software package and the matrix of nucleotide similarity and nucleotide difference were generated by using PHYDIT software. The results confirmed and extended the value of 16S rDNA sequencing in streptomycete systematic. The 16S rDNA sequence data showed that most of the tested colour group representatives formed new centers of taxonomic variation within the genus Streptomyces. The generic assignment of these organisms was underpinned by 16S rDNA sequence data which also suggested that most of the strains represented new centers of taxonomic variation. The taxonomic data indicate that diverse populations of streptomycetes are associated with the roots of tropical legume (P. falcataria. Therefore, the combination of selective isolation and molecular taxonomic procedures used in this study provide a powerful way of uncovering new centers of taxonomic variation within the genus Streptomyces.

  4. Beyond barcoding: a mitochondrial genomics approach to molecular phylogenetics and diagnostics of blowflies (Diptera: Calliphoridae).

    Science.gov (United States)

    Nelson, Leigh A; Lambkin, Christine L; Batterham, Philip; Wallman, James F; Dowton, Mark; Whiting, Michael F; Yeates, David K; Cameron, Stephen L

    2012-12-15

    Members of the Calliphoridae (blowflies) are significant for medical and veterinary management, due to the ability of some species to consume living flesh as larvae, and for forensic investigations due to the ability of others to develop in corpses. Due to the difficulty of accurately identifying larval blowflies to species there is a need for DNA-based diagnostics for this family, however the widely used DNA-barcoding marker, cox1, has been shown to fail for several groups within this family. Additionally, many phylogenetic relationships within the Calliphoridae are still unresolved, particularly deeper level relationships. Sequencing whole mt genomes has been demonstrated both as an effective method for identifying the most informative diagnostic markers and for resolving phylogenetic relationships. Twenty-seven complete, or nearly so, mt genomes were sequenced representing 13 species, seven genera and four calliphorid subfamilies and a member of the related family Tachinidae. PCR and sequencing primers developed for sequencing one calliphorid species could be reused to sequence related species within the same superfamily with success rates ranging from 61% to 100%, demonstrating the speed and efficiency with which an mt genome dataset can be assembled. Comparison of molecular divergences for each of the 13 protein-coding genes and 2 ribosomal RNA genes, at a range of taxonomic scales identified novel targets for developing as diagnostic markers which were 117-200% more variable than the markers which have been used previously in calliphorids. Phylogenetic analysis of whole mt genome sequences resulted in much stronger support for family and subfamily-level relationships. The Calliphoridae are polyphyletic, with the Polleninae more closely related to the Tachinidae, and the Sarcophagidae are the sister group of the remaining calliphorids. Within the Calliphoridae, there was strong support for the monophyly of the Chrysomyinae and Luciliinae and for the sister

  5. Molecular phylogenetic evaluation of classification and scenarios of character evolution in calcareous sponges (Porifera, Class Calcarea.

    Directory of Open Access Journals (Sweden)

    Oliver Voigt

    Full Text Available Calcareous sponges (Phylum Porifera, Class Calcarea are known to be taxonomically difficult. Previous molecular studies have revealed many discrepancies between classically recognized taxa and the observed relationships at the order, family and genus levels; these inconsistencies question underlying hypotheses regarding the evolution of certain morphological characters. Therefore, we extended the available taxa and character set by sequencing the complete small subunit (SSU rDNA and the almost complete large subunit (LSU rDNA of additional key species and complemented this dataset by substantially increasing the length of available LSU sequences. Phylogenetic analyses provided new hypotheses about the relationships of Calcarea and about the evolution of certain morphological characters. We tested our phylogeny against competing phylogenetic hypotheses presented by previous classification systems. Our data reject the current order-level classification by again finding non-monophyletic Leucosolenida, Clathrinida and Murrayonida. In the subclass Calcinea, we recovered a clade that includes all species with a cortex, which is largely consistent with the previously proposed order Leucettida. Other orders that had been rejected in the current system were not found, but could not be rejected in our tests either. We found several additional families and genera polyphyletic: the families Leucascidae and Leucaltidae and the genus Leucetta in Calcinea, and in Calcaronea the family Amphoriscidae and the genus Ute. Our phylogeny also provided support for the vaguely suspected close relationship of several members of Grantiidae with giantortical diactines to members of Heteropiidae. Similarly, our analyses revealed several unexpected affinities, such as a sister group relationship between Leucettusa (Leucaltidae and Leucettidae and between Leucascandra (Jenkinidae and Sycon carteri (Sycettidae. According to our results, the taxonomy of Calcarea is in

  6. Deceptive Desmas: Molecular Phylogenetics Suggests a New Classification and Uncovers Convergent Evolution of Lithistid Demosponges

    Science.gov (United States)

    Schuster, Astrid; Erpenbeck, Dirk; Pisera, Andrzej; Hooper, John; Bryce, Monika; Fromont, Jane; Wörheide, Gert

    2015-01-01

    Reconciling the fossil record with molecular phylogenies to enhance the understanding of animal evolution is a challenging task, especially for taxa with a mostly poor fossil record, such as sponges (Porifera). ‘Lithistida’, a polyphyletic group of recent and fossil sponges, are an exception as they provide the richest fossil record among demosponges. Lithistids, currently encompassing 13 families, 41 genera and >300 recent species, are defined by the common possession of peculiar siliceous spicules (desmas) that characteristically form rigid articulated skeletons. Their phylogenetic relationships are to a large extent unresolved and there has been no (taxonomically) comprehensive analysis to formally reallocate lithistid taxa to their closest relatives. This study, based on the most comprehensive molecular and morphological investigation of ‘lithistid’ demosponges to date, corroborates some previous weakly-supported hypotheses, and provides novel insights into the evolutionary relationships of the previous ‘order Lithistida’. Based on molecular data (partial mtDNA CO1 and 28S rDNA sequences), we show that 8 out of 13 ‘Lithistida’ families belong to the order Astrophorida, whereas Scleritodermidae and Siphonidiidae form a separate monophyletic clade within Tetractinellida. Most lithistid astrophorids are dispersed between different clades of the Astrophorida and we propose to formally reallocate them, respectively. Corallistidae, Theonellidae and Phymatellidae are monophyletic, whereas the families Pleromidae and Scleritodermidae are polyphyletic. Family Desmanthidae is polyphyletic and groups within Halichondriidae – we formally propose a reallocation. The sister group relationship of the family Vetulinidae to Spongillida is confirmed and we propose here for the first time to include Vetulina into a new Order Sphaerocladina. Megascleres and microscleres possibly evolved and/or were lost several times independently in different

  7. Deceptive desmas: molecular phylogenetics suggests a new classification and uncovers convergent evolution of lithistid demosponges.

    Directory of Open Access Journals (Sweden)

    Astrid Schuster

    Full Text Available Reconciling the fossil record with molecular phylogenies to enhance the understanding of animal evolution is a challenging task, especially for taxa with a mostly poor fossil record, such as sponges (Porifera. 'Lithistida', a polyphyletic group of recent and fossil sponges, are an exception as they provide the richest fossil record among demosponges. Lithistids, currently encompassing 13 families, 41 genera and >300 recent species, are defined by the common possession of peculiar siliceous spicules (desmas that characteristically form rigid articulated skeletons. Their phylogenetic relationships are to a large extent unresolved and there has been no (taxonomically comprehensive analysis to formally reallocate lithistid taxa to their closest relatives. This study, based on the most comprehensive molecular and morphological investigation of 'lithistid' demosponges to date, corroborates some previous weakly-supported hypotheses, and provides novel insights into the evolutionary relationships of the previous 'order Lithistida'. Based on molecular data (partial mtDNA CO1 and 28S rDNA sequences, we show that 8 out of 13 'Lithistida' families belong to the order Astrophorida, whereas Scleritodermidae and Siphonidiidae form a separate monophyletic clade within Tetractinellida. Most lithistid astrophorids are dispersed between different clades of the Astrophorida and we propose to formally reallocate them, respectively. Corallistidae, Theonellidae and Phymatellidae are monophyletic, whereas the families Pleromidae and Scleritodermidae are polyphyletic. Family Desmanthidae is polyphyletic and groups within Halichondriidae--we formally propose a reallocation. The sister group relationship of the family Vetulinidae to Spongillida is confirmed and we propose here for the first time to include Vetulina into a new Order Sphaerocladina. Megascleres and microscleres possibly evolved and/or were lost several times independently in different 'lithistid' taxa, and

  8. Phylogenetic position of the bee genera Ancyla and Tarsalia (Hymenoptera: Apidae): a remarkable base compositional bias and an early Paleogene geodispersal from North America to the Old World.

    Science.gov (United States)

    Praz, Christophe J; Packer, Laurence

    2014-12-01

    We address the phylogenetic position of the bee genera Tarsalia and Ancyla (currently forming the tribe Ancylaini) on the basis of morphological, molecular and combined data. We assembled a matrix of 309 morphological characters and 5246 aligned nucleotide positions from six nuclear genes (28S, EF-1a, wingless, POL2, LW-Rhodopsin, NAK). In addition to both constituent genera of Ancylaini, we include all three subtribes of the Eucerini as well as a large number of other tribes from the "eucerine line". The morphological data suggest Ancyla to be sister to Tarsalia+Eucerini and analyses of the entire molecular dataset suggest Tarsalia to be sister to Ancyla+Eucerini. However, analyses of the combined dataset suggests the Ancylaini to be monophyletic. We address possible bias within the molecular data and show that the base composition of two markers (EF-1a and NAK) is significantly heterogeneous among taxa and that this heterogeneity is strong enough to overcome the phylogenetic signal from the other markers. Analyses of a molecular matrix where the heterogeneous partitions have been RY-recoded yield trees that are better resolved and have higher nodal support values than those recovered in analyses of the non-recoded matrix, and strongly suggest the Ancylaini to be a monophyletic sister group to the Eucerini. A dated phylogeny and ancestral range reconstructions suggest that the common ancestor of the Ancylaini reached the Old World from the New World most probably via the Thulean Land Bridge in a time window between 69 and 47 mya, a period that includes the Early Eocene Climatic Optimum. No further exchanges between the New World and the Old World are implied by our data until the period between 22 mya and 13.9 mya. These more recent faunal exchanges probably involved geodispersal over the Bering Land Bridge by less thermophilic lineages. Copyright © 2014 Elsevier Inc. All rights reserved.

  9. Molecular and karyological data confirm that the enigmatic genus Platypholis from Bonin-Islands (SE Japan) is phylogenetically nested within Orobanche (Orobanchaceae).

    Science.gov (United States)

    Li, Xi; Jang, Tae-Soo; Temsch, Eva M; Kato, Hidetoshi; Takayama, Koji; Schneeweiss, Gerald M

    2017-03-01

    Molecular phylogenetic studies have greatly improved our understanding of phylogenetic relationships of non-photosynthetic parasitic broomrapes (Orobanche and related genera, Orobanchaceae), but a few genera have remained unstudied. One of those is Platypholis, whose sole species, Platypholis boninsimae, is restricted to the Bonin-Islands (Ogasawara Islands) about 1000 km southeast of Japan. Based on overall morphological similarity, Platypholis has been merged with Orobanche, but this hypothesis has never been tested with molecular data. Employing maximum likelihood and Bayesian analyses on a family-wide data set (two plastid markers, matK and rps2, and three nuclear markers, ITS, phyA and phyB) as well as on an ITS data set focusing on Orobanche s. str., it is shown that P. boninsimae Maxim. is phylogenetically closely linked to or even nested within Orobanche s. str. This position is supported both by morphological evidence and by the newly obtained chromosome number of 2n = 38, which is characteristic for the genus Orobanche s. str.

  10. Phylogenetic estimates of diversification rate are affected by molecular rate variation.

    Science.gov (United States)

    Duchêne, D A; Hua, X; Bromham, L

    2017-10-01

    Molecular phylogenies are increasingly being used to investigate the patterns and mechanisms of macroevolution. In particular, node heights in a phylogeny can be used to detect changes in rates of diversification over time. Such analyses rest on the assumption that node heights in a phylogeny represent the timing of diversification events, which in turn rests on the assumption that evolutionary time can be accurately predicted from DNA sequence divergence. But there are many influences on the rate of molecular evolution, which might also influence node heights in molecular phylogenies, and thus affect estimates of diversification rate. In particular, a growing number of studies have revealed an association between the net diversification rate estimated from phylogenies and the rate of molecular evolution. Such an association might, by influencing the relative position of node heights, systematically bias estimates of diversification time. We simulated the evolution of DNA sequences under several scenarios where rates of diversification and molecular evolution vary through time, including models where diversification and molecular evolutionary rates are linked. We show that commonly used methods, including metric-based, likelihood and Bayesian approaches, can have a low power to identify changes in diversification rate when molecular substitution rates vary. Furthermore, the association between the rates of speciation and molecular evolution rate can cause the signature of a slowdown or speedup in speciation rates to be lost or misidentified. These results suggest that the multiple sources of variation in molecular evolutionary rates need to be considered when inferring macroevolutionary processes from phylogenies. © 2017 European Society For Evolutionary Biology. Journal of Evolutionary Biology © 2017 European Society For Evolutionary Biology.

  11. The complete mitochondrial genome and phylogenetic position of the Philippines spurdog, Squalus montalbani.

    Science.gov (United States)

    Kemper, Jenny M; Naylor, Gavin J P

    2016-11-01

    We present the complete mitochondrial genome sequence (16 555 bp) of the Philippines spurdog, Squalus montalbani, currently listed as Vulnerable due to population declines and fishing pressures. A phylogenetic analysis was carried out on S. montalbani and representative shark mitogenomes. Squalus montalbani was placed within the Squaliformes as a sister taxon to Squalus acanthias and Cirrhigaleus australis.

  12. Zoosporogenesis, morphology, ultrastructure, pigment composition, and phylogenetic position of Trachydiscus minutus (Eustigmatophyceae, Heterokontophyta)

    Czech Academy of Sciences Publication Activity Database

    Přibyl, Pavel; Eliáš, M.; Cepák, Vladislav; Lukavský, Jaromír; Kaštánek, P.

    2012-01-01

    Roč. 48, č. 1 (2012), s. 231-242 ISSN 0022-3646 R&D Projects: GA MŠk 1M0571; GA ČR GPP501/10/P157 Institutional research plan: CEZ:AV0Z60050516 Keywords : phylogenetics * Trachydiscus * zoospores Subject RIV: EF - Botanics Impact factor: 2.239, year: 2012

  13. Molecular Epidemiology and Phylogenetic Analyses of Influenza B Virus in Thailand during 2010 to 2014

    Science.gov (United States)

    Tewawong, Nipaporn; Suwannakarn, Kamol; Prachayangprecha, Slinporn; Korkong, Sumeth; Vichiwattana, Preeyaporn; Vongpunsawad, Sompong; Poovorawan, Yong

    2015-01-01

    Influenza B virus remains a major contributor to the seasonal influenza outbreak and its prevalence has increased worldwide. We investigated the epidemiology and analyzed the full genome sequences of influenza B virus strains in Thailand between 2010 and 2014. Samples from the upper respiratory tract were collected from patients diagnosed with influenza like-illness. All samples were screened for influenza A/B viruses by one-step multiplex real-time RT-PCR. The whole genome of 53 influenza B isolates were amplified, sequenced, and analyzed. From 14,418 respiratory samples collected during 2010 to 2014, a total of 3,050 tested positive for influenza virus. Approximately 3.27% (471/14,418) were influenza B virus samples. Fifty three isolates of influenza B virus were randomly chosen for detailed whole genome analysis. Phylogenetic analysis of the HA gene showed clusters in Victoria clades 1A, 1B, 3, 5 and Yamagata clades 2 and 3. Both B/Victoria and B/Yamagata lineages were found to co-circulate during this time. The NA sequences of all isolates belonged to lineage II and consisted of viruses from both HA Victoria and Yamagata lineages, reflecting possible reassortment of the HA and NA genes. No significant changes were seen in the NA protein. The phylogenetic trees generated through the analysis of the PB1 and PB2 genes closely resembled that of the HA gene, while trees generated from the analysis of the PA, NP, and M genes showed similar topology. The NS gene exhibited the pattern of genetic reassortment distinct from those of the PA, NP or M genes. Thus, antigenic drift and genetic reassortment among the influenza B virus strains were observed in the isolates examined. Our findings indicate that the co-circulation of two distinct lineages of influenza B viruses and the limitation of cross-protection of the current vaccine formulation provide support for quadrivalent influenza vaccine in this region. PMID:25602617

  14. Phylogenetic and Functional Diversity of Fleshy-Fruited Plants Are Positively Associated with Seedling Diversity in a Tropical Montane Forest

    Directory of Open Access Journals (Sweden)

    Marcia C. Muñoz

    2017-08-01

    Full Text Available Mutualistic interactions between plants and animals can affect both plant and animal communities, and potentially leave imprints on plant demography. Yet, no study has simultaneously tested how trait variation in plant resources shapes the diversity of animal consumers, and how these interactions influence seedling recruitment. Here, we analyzed whether (i phylogenetic diversity and functional diversity of fruiting plants were correlated with the corresponding diversity of frugivorous birds, and (ii whether phylogenetic diversity and functional identity of plant and bird communities influenced the corresponding diversity and identity of seedling communities. We recorded mutualistic interactions between fleshy-fruited plants and frugivorous birds and seedling communities in 10 plots along an elevational gradient in the Colombian Andes. We built a phylogeny for plants/seedlings and birds and measured relevant morphological plant and bird traits that influence plant-bird interactions and seedling recruitment. We found that phylogenetic diversity and functional diversity of frugivorous birds were positively associated with the corresponding diversities of fruiting plants, consistent with a bottom-up effect of plants on birds. Moreover, the phylogenetic diversity of seedlings was related to the phylogenetic diversity of plants, but was unrelated to the phylogenetic diversity of frugivorous birds, suggesting that top-down effects of animals on seedlings were weak. Mean seed mass of seedling communities was positively associated with the mean fruit mass of plants, but was not associated with the mean avian body mass in the frugivore communities. Our study shows that variation in the traits of fleshy-fruited plants was associated with the diversity of frugivorous birds and affected the future trajectory of seedling recruitment, whereas the morphological traits of animal seed dispersers were unrelated to the phylogenetic and functional structure of

  15. Impact of gene molecular evolution on phylogenetic reconstruction: a case study in the rosids (Superorder Rosanae, Angiosperms).

    Science.gov (United States)

    Hilu, Khidir W; Black, Chelsea M; Oza, Dipan

    2014-01-01

    Rate of substitution of genomic regions is among the most debated intrinsic features that impact phylogenetic informativeness. However, this variable is also coupled with rates of nonsynonymous substitutions that underscore the nature and degree of selection on the selected genes. To empirically address these variables, we constructed four completely overlapping data sets of plastid matK, atpB, rbcL, and mitochondrial matR genes and used the rosid lineage (angiosperms) as a working platform. The genes differ in combinations of overall rates of nucleotide and amino acid substitutions. Tree robustness, homoplasy, accuracy in contrast to a reference tree, and phylogenetic informativeness are evaluated. The rapidly evolving/unconstrained matK faired best, whereas remaining genes varied in degrees of contribution to rosid phylogenetics across the lineage's 108 million years evolutionary history. Phylogenetic accuracy was low with the slowly evolving/unconstrained matR despite least amount of homoplasy. Third codon positions contributed the highest amount of parsimony informative sites, resolution and informativeness, but magnitude varied with gene mode of evolution. These findings are in clear contrast with the views that rapidly evolving regions and the 3rd codon position have inevitable negative impact on phylogenetic reconstruction at deep historic level due to accumulation of multiple hits and subsequent elevation in homoplasy and saturation. Relaxed evolutionary constraint in rapidly evolving genes distributes substitutions across codon positions, an evolutionary mode expected to reduce the frequency of multiple hits. These findings should be tested at deeper evolutionary histories.

  16. Molecular phylogenetics of the genus Costularia (Schoeneae, Cyperaceae) reveals multiple distinct evolutionary lineages.

    Science.gov (United States)

    Larridon, Isabel; Bauters, Kenneth; Semmouri, Ilias; Viljoen, Jan-Adriaan; Prychid, Christina J; Muasya, A Muthama; Bruhl, Jeremy J; Wilson, Karen L; Senterre, Bruno; Goetghebeur, Paul

    2018-04-19

    We investigated the monophyly of Costularia (25 species), a genus of tribe Schoeneae (Cyperaceae) that illustrates a remarkable distribution pattern from southeastern Africa, over Madagascar, the Mascarenes and Seychelles, to Malesia and New Caledonia. A further species, Tetraria borneensis, has been suggested to belong to Costularia. Relationships and divergence times were inferred using an existing four marker phylogeny of Cyperaceae tribe Schoeneae expanded with newly generated sequence data mainly for Costularia s.l. species. Phylogenetic reconstruction was executed using Bayesian inference and maximum likelihood approaches. Divergence times were estimated using a relaxed molecular clock model, calibrated with fossil data. Based on our results, Tetraria borneensis is not related to the species of Costularia. Costularia s.l. is composed of four distinct evolutionary lineages. Two lineages, one including the type species, are part of the Oreobolus clade, i.e. a much reduced genus Costularia restricted to southeastern Africa, Madagascar, the Mascarenes and Seychelles, and a small endemic genus from New Caledonia for which a new genus Chamaedendron is erected based on Costularia subgenus Chamaedendron. The other two lineages are part of the Tricostularia clade, i.e. a separate single-species lineage from the Seychelles for which a new genus (Xyroschoenus) is described, and Costularia subgenus Lophoschoenus. For the latter, more research is needed to test whether they are congeneric with the species placed in the reticulate-sheathed Tetraria clade. Copyright © 2018 Elsevier Inc. All rights reserved.

  17. Molecular Characterization and Comparative Phylogenetic Analysis of Phytases from Fungi with Their Prospective Applications

    Directory of Open Access Journals (Sweden)

    Sharad Tiwari

    2013-01-01

    Full Text Available Plant seeds that have high phytate content are used as animal feed. Phytases, enzymes that catalyze the breakdown of phytate into inorganic phosphorus and myoinositol phosphate derivatives, have been intensively studied in recent years and gained immense attention because of their application in reducing phytate content in animal feed and food for human consumption, thus indirectly lowering environmental pollution caused by undigested phytate. This review is focused on summarising the current knowledge on recent developments of fungal and yeast phytases. Comparative account on diverse sources and physiological roles, molecular characteristics and regulation mechanisms of phytases are discussed. Phylogenetic relationship of phytases from different classes of fungi is studied in details. It is inferred on the basis of phylogeny that phytases from Ascomycetes and Basidiomycetes differ in the amino acid sequences, therefore they fall in separate clade in the tree. The prospective biotechnological applications of microbial phytases such as animal feed additives, probiotics, pharmaceuticals, as well as in aquaculture, food industry, paper manufacturing, development of transgenic plants and animals with special reference to its use as biofertilizers are also emphasised in this review.

  18. Molecular phylogenetics of emydine turtles: taxonomic revision and the evolution of shell kinesis.

    Science.gov (United States)

    Feldman, Chris R; Parham, James Ford

    2002-03-01

    The 10 extant species of emydine turtles represent an array of morphological and ecological forms recognizable and popular among scientists and hobbyists. Nevertheless, the phylogenetic affinities of most emydines remain contentious. Here, we examine the evolutionary relationships of emydine turtles using 2092 bp of DNA encoding the mitochondrial genes cyt b, ND4, and adjacent tRNAs. These data contain 339 parsimony informative characters that we use to erect hypotheses of relationships for the Emydinae. Both maximum parsimony and maximum likelihood methods yield a monophyletic Emydinae in which all but three nodes are well resolved. Emys orbicularis, Emydoidea blandingii, and Clemmys marmorata form a monophyletic clade, as do the species of Terrapene. Clemmys muhlenbergii and Clemmys insculpta form a third monophyletic group that may be sister to all other emydines. Clemmys guttata is problematic and probably related to Terrapene. Based on this phylogeny, and previous molecular work on the group, we suggest the following taxonomic revisions: (1) Clemmys should be restricted to a single species, C. guttata. (2) Calemys should be resurrected for C. muhlenbergii and C. insculpta. (3) Emys should be expanded to include three species: E. orbicularis, E. blandingii, and E. marmorata. Furthermore, our analyses show that neither kinetic-shelled nor akinetic-shelled emydines form monophyletic groups. Therefore, shell kinesis was either independently gained in Emys and Terrapene or secondarily lost in E. marmorata and C. guttata. Parsimony, paleontological evidence, and the multiple origins of shell kinesis in related turtle lineages (especially geoemydines) support the independent origin of plastral kinesis.

  19. Molecular characterization and phylogenetic analysis of Babesia sp. NV-1 detected from wild American Mink ( Neovison vison ) in Hokkaido, Japan.

    Science.gov (United States)

    Hirata, Haruyuki; Ishinabe, Satoki; Jinnai, Michio; Asakawa, Mitsuhiko; Ishihara, Chiaki

    2013-04-01

    Babesiosis is a tick-borne protozoan disease affecting many mammalian species worldwide, caused by the intraerythrocytic multiplication of Babesia spp. The present study aimed to detect the presence of Babesia sp. in 13 American mink from Hokkaido, Japan. One of 13 animals was positive, as indicated by nested PCR targeting the 18S ribosomal RNA (SSU rDNA) and subunit 7 (eta) of the chaperonin-containing t-complex polypeptide 1 (CCT7) genes from species of Babesia and Theileria. Sequencing of the PCR product of SSU rDNA revealed 99% homology to the isolates of Babesia sp. SAP#131 found in raccoons in Hokkaido, whereas that of the CCT7 gene showed 80% homology to the isolates of Babesia gibsoni in dogs as determined by BLAST analysis. We refer to the cognate sequence as Babesia sp. NV-1. Phylogenetic analyses of SSU rDNA and CCT7 genes from Babesia sp. NV-1 revealed them to be most closely related to the Babesia sp. SAP#131 from a raccoon in Hokkaido and to canine B. gibsoni, respectively. Here, we provide the first molecular evidence of the Babesia sp. NV-1 parasite in feral American mink ( Neovison vison ) in Hokkaido, Japan.

  20. Phylemon 2.0: a suite of web-tools for molecular evolution, phylogenetics, phylogenomics and hypotheses testing.

    Science.gov (United States)

    Sánchez, Rubén; Serra, François; Tárraga, Joaquín; Medina, Ignacio; Carbonell, José; Pulido, Luis; de María, Alejandro; Capella-Gutíerrez, Salvador; Huerta-Cepas, Jaime; Gabaldón, Toni; Dopazo, Joaquín; Dopazo, Hernán

    2011-07-01

    Phylemon 2.0 is a new release of the suite of web tools for molecular evolution, phylogenetics, phylogenomics and hypotheses testing. It has been designed as a response to the increasing demand of molecular sequence analyses for experts and non-expert users. Phylemon 2.0 has several unique features that differentiates it from other similar web resources: (i) it offers an integrated environment that enables evolutionary analyses, format conversion, file storage and edition of results; (ii) it suggests further analyses, thereby guiding the users through the web server; and (iii) it allows users to design and save phylogenetic pipelines to be used over multiple genes (phylogenomics). Altogether, Phylemon 2.0 integrates a suite of 30 tools covering sequence alignment reconstruction and trimming; tree reconstruction, visualization and manipulation; and evolutionary hypotheses testing.

  1. Phylemon 2.0: a suite of web-tools for molecular evolution, phylogenetics, phylogenomics and hypotheses testing

    Science.gov (United States)

    Sánchez, Rubén; Serra, François; Tárraga, Joaquín; Medina, Ignacio; Carbonell, José; Pulido, Luis; de María, Alejandro; Capella-Gutíerrez, Salvador; Huerta-Cepas, Jaime; Gabaldón, Toni; Dopazo, Joaquín; Dopazo, Hernán

    2011-01-01

    Phylemon 2.0 is a new release of the suite of web tools for molecular evolution, phylogenetics, phylogenomics and hypotheses testing. It has been designed as a response to the increasing demand of molecular sequence analyses for experts and non-expert users. Phylemon 2.0 has several unique features that differentiates it from other similar web resources: (i) it offers an integrated environment that enables evolutionary analyses, format conversion, file storage and edition of results; (ii) it suggests further analyses, thereby guiding the users through the web server; and (iii) it allows users to design and save phylogenetic pipelines to be used over multiple genes (phylogenomics). Altogether, Phylemon 2.0 integrates a suite of 30 tools covering sequence alignment reconstruction and trimming; tree reconstruction, visualization and manipulation; and evolutionary hypotheses testing. PMID:21646336

  2. Molecular phylogenetic analysis of fleshy pored mushrooms: Neoboletus luridiformis and Hortiboletus rubellus from western Himalayan range of Pakistan

    International Nuclear Information System (INIS)

    Sarwar, S.; Khalid, N.; Dentinger, B.M.

    2016-01-01

    Fleshy pored mushrooms is the name given to boletes due to their porous hymenium and fleshy nature. These are ectomycorrhizal basidiomycetes found in all continents except Antarctica. These mushrooms are important economically due to their edibility and medicinal value. This research work highlights the diversity of boletes in Pakistan and their correct identification by using molecular phylogenetic techniques. Western Himalayan range (WHR) of Pakistan is considered as diversity rich area. During present investigation regarding diversity of boletes in these areas, two bolete taxa viz. Hortiboletus rubellus and Neoboletus luridiformis were found under conifers. These mushrooms were collected and analyzed morphologically as well as phylogenetically by using Internal Transcribed Spacer (ITS) region of nrDNA sequences, and compared with their allies. All description and comparison with related taxa is provided in detail. These boletes are first time analyzed using molecular method from Pakistan. (author)

  3. Phylogenetic relationships among extinct and extant turtles: the position of Pleurodira and the effects of the fossils on rooting crown-group turtles

    NARCIS (Netherlands)

    Sterli, J.

    2010-01-01

    The origin and evolution of the crown-group of turtles (Cryptodira + Pleurodira) is one of the most interesting topics in turtle evolution, second perhaps only to the phylogenetic position of turtles among amniotes. The present contribution focuses on the former problem, exploring the phylogenetic

  4. Taxonomic study on Japanese Salvia (Lamiaceae): Phylogenetic position of S. akiensis, and polyphyletic nature of S. lutescens var. intermedia.

    Science.gov (United States)

    Takano, Atsuko

    2017-01-01

    Both Salvia akiensis and S. lutescens (Lamiaceae) are endemic to Japan. Salvia akiensis was recently described in 2014 in the Chugoku (= SW Honshu) region, and each four varieties of S. lutescens distributed allopatrically. Among varieties in S. lutescens , var. intermedia show a disjunctive distribution in the Kanto (=E Honshu) and Kinki (= W Honshu) regions. Recent field studies of S. lutescens var. intermedia revealed several morphological differences between the Kanto and Kinki populations. Here, I evaluated these differences among Salvia lutescens var. intermedia and its allies with morphological analysis and molecular phylogenetic analyses of nuclear ribosomal DNA (internal and external transcribed spacer regions) and plastid DNA ( ycf1-rps15 spacer, rbcL , and trnL-F ) sequences. Both morphological analysis and molecular phylogenetic analyses showed that S. lutescens var. intermedia from the Kinki region and var. lutescens were closely related to each other. However, var. intermedia from the Kanto region exhibited an association with S. lutescens var. crenata and var. stolonifera, which also grew in eastern Japan, rather than var. intermedia in the Kinki region. These results indicated that S. lutescens var. intermedia is not a taxon with a disjunctive distribution, but a combination of two or more allopatric taxa. Present study also suggested that S. akiensis was most closely related to S. omerocalyx .

  5. Morphological support for the phylogenetic positioning of Pentastomida and related fossils

    Directory of Open Access Journals (Sweden)

    Elaine Christine Costa Eloy

    2008-09-01

    Full Text Available Pentastomida is a group of parasites that infects the respiratory tracts of vertebrates. They have a mixture of annelid and arthropod characteristics. For that reason, the phylogenetic relationships of the pentastomids have been controversial in proposals of metazoan phylogeny. Forty-seven characters were selected for the analyses of the taxa Annelida, Arthropoda, Kinorhyncha, Loricifera, Nematoda, Nematomorpha, Onychophora, Pentastomida, Priapulida and Tardigrada. The analyses with PAUP resulted in a single shortest cladogram (length 89, ci 0.78, ri 0.86. Our results indicate that Pentastomida is a transitional group between the Arthropoda and some of the Nemathelminth groups such as Nematoda and Nematomorpha.

  6. Phylogenetic position of Leishmania isolates from Khyber Pakhtunkhwa province of Pakistan.

    Science.gov (United States)

    Khan, Nazma Habib; Messenger, Louisa A; Wahid, Sobia; Sutherland, Colin J

    2016-08-01

    Several species of the genus Leishmania are causative agents of cutaneous leishmaniasis in Pakistan. This study aimed to determine phylogenetic placement of Leishmania species causing cutaneous leishmaniasis in Khyber Pakhtunkhwa province, Pakistan (34 Leishmania tropica, 3 Leishmania infantum), in-relation to species from other geographical areas using gene sequences encoding cytochrome b (cytb) and internal transcribed spacer 2 (its2). Based on cytochrome b sequence analysis, L. tropica strains from Pakistan and other geographical regions were differentiated into two genotype groups, A and B. Within the province, five distinct L. tropica genotypes were recognized; two in group A, three in group B. Two L. infantum isolates from the province were closely associated with both Afro-Eurasian and American species of the Leishmania donovani complex, including Leishmania chagasi, L. infantum and L. donovani from Sudan and Ethiopia; while a third L. infantum isolate could not be differentiated from visceralizing Kenyan and Indian L. donovani. We observed apposite phylogenetic placement of CL-causing L. tropica and L. infantum from Khyber Pakhtunkhwa. Affinities ascribed to Leishmania spp. From the region are valuable in tracing potential importation of leishmaniasis. Copyright © 2016 The Author(s). Published by Elsevier Inc. All rights reserved.

  7. Molecular and morphological data supporting phylogenetic reconstruction of the genus Goniothalamus (Annonaceae), including a reassessment of previous infrageneric classifications.

    Science.gov (United States)

    Tang, Chin Cheung; Thomas, Daniel C; Saunders, Richard M K

    2015-09-01

    Data is presented in support of a phylogenetic reconstruction of the species-rich early-divergent angiosperm genus Goniothalamus (Annonaceae) (Tang et al., Mol. Phylogenetic Evol., 2015) [1], inferred using chloroplast DNA (cpDNA) sequences. The data includes a list of primers for amplification and sequencing for nine cpDNA regions: atpB-rbcL, matK, ndhF, psbA-trnH, psbM-trnD, rbcL, trnL-F, trnS-G, and ycf1, the voucher information and molecular data (GenBank accession numbers) of 67 ingroup Goniothalamus accessions and 14 outgroup accessions selected from across the tribe Annoneae, and aligned data matrices for each gene region. We also present our Bayesian phylogenetic reconstructions for Goniothalamus, with information on previous infrageneric classifications superimposed to enable an evaluation of monophyly, together with a taxon-character data matrix (with 15 morphological characters scored for 66 Goniothalamus species and seven other species from the tribe Annoneae that are shown to be phylogenetically correlated).

  8. Molecular and morphological data supporting phylogenetic reconstruction of the genus Goniothalamus (Annonaceae, including a reassessment of previous infrageneric classifications

    Directory of Open Access Journals (Sweden)

    Chin Cheung Tang

    2015-09-01

    Full Text Available Data is presented in support of a phylogenetic reconstruction of the species-rich early-divergent angiosperm genus Goniothalamus (Annonaceae (Tang et al., Mol. Phylogenetic Evol., 2015 [1], inferred using chloroplast DNA (cpDNA sequences. The data includes a list of primers for amplification and sequencing for nine cpDNA regions: atpB-rbcL, matK, ndhF, psbA-trnH, psbM-trnD, rbcL, trnL-F, trnS-G, and ycf1, the voucher information and molecular data (GenBank accession numbers of 67 ingroup Goniothalamus accessions and 14 outgroup accessions selected from across the tribe Annoneae, and aligned data matrices for each gene region. We also present our Bayesian phylogenetic reconstructions for Goniothalamus, with information on previous infrageneric classifications superimposed to enable an evaluation of monophyly, together with a taxon-character data matrix (with 15 morphological characters scored for 66 Goniothalamus species and seven other species from the tribe Annoneae that are shown to be phylogenetically correlated.

  9. In situ, measurements on plutonium concentration, in vegetal and animal marine species as a function of their phylogenetic position

    International Nuclear Information System (INIS)

    Fraizier, Albert; Guary, J.-C.

    1975-10-01

    The accumulation of plutonium by 31 vegetal and animal marine species belonging to a large number of phyla was demonstrated in a reference coastal site. Fixation levels ranging from 171.6pCi/kg fresh weight for a lichen to 0.04pCi/k fresh weight for a fish showed that the retention of the radionuclide by the organisms studied was related to their phylogenetic position. Biological indicators especially suitable for monitoring coastal plutonium radioactivity has been identified [fr

  10. Complete mitochondrial genome and phylogenetic position of the Sicklefin weasel shark Hemigaleus microstoma.

    Science.gov (United States)

    Mai, Quanfa; Li, Weidong; Chen, Hao; Ai, Weiming; Chen, Xiao

    2016-09-01

    The complete mitochondrial genome of the Sicklefin weasel shark Hemigaleus microstoma was first presented in this study. It was 16 701 bp in length with the typical gene arrangement in vertebrates. A total of 25 bp short intergenic spaces and 33 bp overlaps located in 12 and 9 gene junctions, respectively. The overall nucleotide composition was 31.0% A, 26.4% C, 13.5% G and 29.1% T. Two start (ATG and GTG) and three stop (TAG, AGG and TAA/T) codons were found in the protein-coding genes. The size of 22 tRNA genes ranged from 67 to 75 bp. In the phylogenetic tree, H. microstoma (Hemigaleidae) was placed as sister to Galeocerdo cuvier (Carcharhinidae).

  11. Identification of Phylogenetic Position in the Chlamydiaceae Family for Chlamydia Strains Released from Monkeys and Humans with Chlamydial Pathology

    Directory of Open Access Journals (Sweden)

    Alexander Karaulov

    2010-01-01

    Full Text Available Based on the results of the comparative analysis concerning relatedness and evolutional difference of the 16S–23S nucleotide sequences of the middle ribosomal cluster and 23S rRNA I domain, and based on identification of phylogenetic position for Chlamydophila pneumoniae and Chlamydia trichomatis strains released from monkeys, relatedness of the above stated isolates with similar strains released from humans and with strains having nucleotide sequences presented in the GenBank electronic database has been detected for the first time ever. Position of these isolates in the Chlamydiaceae family phylogenetic tree has been identified. The evolutional position of the investigated original Chlamydia and Chlamydophila strains close to analogous strains from the Gen-Bank electronic database has been demonstrated. Differences in the 16S–23S nucleotide sequence of the middle ribosomal cluster and 23S rRNA I domain of plasmid and nonplasmid Chlamydia trachomatis strains released from humans and monkeys relative to different genotype groups (group B-B, Ba, D, Da, E, L1, L2, L2a; intermediate group-F, G, Ga have been revealed for the first time ever. Abnormality in incA chromosomal gene expression resulting in Chlamydia life development cycle disorder, and decrease of Chlamydia virulence can be related to probable changes in the nucleotide sequence of the gene under consideration

  12. Big and slow: phylogenetic estimates of molecular evolution in baleen whales (suborder mysticeti).

    Science.gov (United States)

    Jackson, J A; Baker, C S; Vant, M; Steel, D J; Medrano-González, L; Palumbi, S R

    2009-11-01

    Baleen whales are the largest animals that have ever lived. To develop an improved estimation of substitution rate for nuclear and mitochondrial DNA for this taxon, we implemented a relaxed-clock phylogenetic approach using three fossil calibration dates: the divergence between odontocetes and mysticetes approximately 34 million years ago (Ma), between the balaenids and balaenopterids approximately 28 Ma, and the time to most recent common ancestor within the Balaenopteridae approximately 12 Ma. We examined seven mitochondrial genomes, a large number of mitochondrial control region sequences (219 haplotypes for 465 bp) and nine nuclear introns representing five species of whales, within which multiple species-specific alleles were sequenced to account for within-species diversity (1-15 for each locus). The total data set represents >1.65 Mbp of mitogenome and nuclear genomic sequence. The estimated substitution rate for the humpback whale control region (3.9%/million years, My) was higher than previous estimates for baleen whales but slow relative to other mammal species with similar generation times (e.g., human-chimp mean rate > 20%/My). The mitogenomic third codon position rate was also slow relative to other mammals (mean estimate 1%/My compared with a mammalian average of 9.8%/My for the cytochrome b gene). The mean nuclear genomic substitution rate (0.05%/My) was substantially slower than average synonymous estimates for other mammals (0.21-0.37%/My across a range of studies). The nuclear and mitogenome rate estimates for baleen whales were thus roughly consistent with an 8- to 10-fold slowing due to a combination of large body size and long generation times. Surprisingly, despite the large data set of nuclear intron sequences, there was only weak and conflicting support for alternate hypotheses about the phylogeny of balaenopterid whales, suggesting that interspecies introgressions or a rapid radiation has obscured species relationships in the nuclear genome.

  13. Phylogenetic diversity of insecticolous fusaria inferred from multilocus DNA sequence data and their molecular identification via FUSARIUM-ID and Fusarium MLST

    NARCIS (Netherlands)

    O'Donnell, K.; Humber, R.A.; Geiser, D.M.; Kang, S.; Robert, V.; Park, B.; Crous, P.W.; Johnston, P.; Aoki, T.; Rooney, A.P.; Rehner, S.A.

    2012-01-01

    We constructed several multilocus DNA sequence datasets to assess the phylogenetic diversity of insecticolous fusaria, especially focusing on those housed at the Agricultural Research Service Collection of Entomopathogenic Fungi (ARSEF), and to aid molecular identifications of unknowns via the

  14. Morphological reassessment and molecular phylogenetic analyses of Amauroderma s.lat. raised new perspectives in the generic classification of the Ganodermataceae family

    NARCIS (Netherlands)

    Costa-Rezende, D.H.; Robledo, G.L.; Góes-Neto, A.; Reck, M.A.; Crespo, E.; Drechsler-Santos, E.R.

    2017-01-01

    Ganodermataceae is a remarkable group of polypore fungi, mainly characterized by particular doublewalled basidiospores with a coloured endosporium ornamented with columns or crests, and a hyaline smooth exosporium. In order to establish an integrative morphological and molecular phylogenetic

  15. The Phylogenetic Position of Osteina obducta (Polyporales, Basidiomycota) Based on Samples from Northern Hemisphere

    Czech Academy of Sciences Publication Activity Database

    Cui, B.-K.; Vlasák, Josef; Dai, Y.C.

    2014-01-01

    Roč. 41, č. 4 (2014), s. 838-845 ISSN 0125-2526 Institutional support: RVO:60077344 Keywords : Perenniporia polyporales * taxonomy * genus * China Subject RIV: EB - Genetics ; Molecular Biology Impact factor: 0.371, year: 2014

  16. Hepatozoon canis in German red foxes (Vulpes vulpes) and their ticks: molecular characterization and the phylogenetic relationship to other Hepatozoon spp.

    Science.gov (United States)

    Najm, Nour-Addeen; Meyer-Kayser, Elisabeth; Hoffmann, Lothar; Pfister, Kurt; Silaghi, Cornelia

    2014-07-01

    In this study, the prevalence of Hepatozoon spp. in red foxes (Vulpes vulpes) and their ticks from Germany, as well as molecular characterizations and phylogenetic relationship to other Hepatozoon spp. were investigated. DNA extracts of 261 spleen samples and 1,953 ticks were examined for the presence of Hepatozoon spp. by a conventional polymerase chain reaction (PCR) targeting the 18S rRNA gene. The ticks included four tick species: Ixodes ricinus, Ixodes canisuga, Ixodes hexagonus and Dermacentor reticulatus. A total of 118/261 foxes (45.2%) and 148/1,953 ticks (7.5%) were Hepatozoon PCR-positive. Amplicons from 36 positive foxes and 41 positive ticks were sequenced. All sequences obtained from foxes and 39/41 from ticks had a 99% similarity to Hepatozoon canis, whereas two ticks' sequences had a 99% identity to Hepatozoon sp. The obtained Hepatozoon sequences in this study were phylogenetically related to other Hepatozoon sequences detected in other countries, which may represent strain variants. The high prevalence of H. canis DNA in red foxes in this study supports the suggested role of those animals in distribution of this parasite. Furthermore, detection of DNA of H. canis in foxes and all examined tick species collected from those foxes allows speculating about previously undescribed potential vectors for H. canis and suggests a potential role of the red fox in its natural endemic cycles.

  17. Orders out of chaos--molecular phylogenetics reveals the complexity of shark and stingray tapeworm relationships.

    Science.gov (United States)

    Caira, Janine N; Jensen, Kirsten; Waeschenbach, Andrea; Olson, Peter D; Littlewood, D Timothy J

    2014-01-01

    Novel molecular data are presented to resolve the long-standing issue of the non-monophyly of the elasmobranch-hosted tapeworm order Tetraphyllidea relative to the other acetabulate eucestode orders. Bayesian inference analyses of various combinations of full ssrDNA, and full or partial lsrDNA (D1-D3), sequence data, which included 134 species representing 97 genera across the 15 eucestode orders, were conducted. New ssrDNA data were generated for 82 species, partial lsrDNA data for 53 species, and full lsrDNA data for 29 species. The monophyly of each of the elasmobranch-hosted orders Cathetocephalidea, Litobothriidea, Lecanicephalidea and Rhinebothriidea was confirmed, as was the non-monophyly of the Tetraphyllidea. Two relatively stable groups of tetraphyllidean taxa emerged and are hereby designated as new orders. The Onchoproteocephalidea n. ord. is established to recognise the integrated nature of one undescribed and 10 described genera of hook-bearing tetraphyllideans, previously placed in the family Onchobothriidae, with the members of the order Proteocephalidea. The Phyllobothriidea n. ord. is established for a subset of 12 non-hooked genera characterised by scoleces bearing four bothridia each with an anterior accessory sucker; most parasitise sharks and have been assigned to the Phyllobothriidae at one time or another. Tentative ordinal placements are suggested for eight additional genera; placements for the remaining tetraphyllidean genera have not yet emerged. We propose that these 17 genera remain in the "Tetraphyllidea". Among these, particularly labile across analyses were Anthobothrium, Megalonchos, Carpobothrium, Calliobothrium and Caulobothrium. The unique association of Chimaerocestus with holocephalans, rather than with elasmobranchs, appears to represent a host-switching event. Both of the non-elasmobranch hosted clades of acetabulate cestodes (i.e. Proteocephalidea and Cyclophyllidea and their kin) appear to have had their origins with

  18. Molecular phylogenetics and historical biogeography of the west-palearctic common toads (Bufo bufo species complex).

    Science.gov (United States)

    Garcia-Porta, J; Litvinchuk, S N; Crochet, P A; Romano, A; Geniez, P H; Lo-Valvo, M; Lymberakis, P; Carranza, S

    2012-04-01

    In most pan-Eurasiatic species complexes, two phenomena have been traditionally considered key processes of their cladogenesis and biogeography. First, it is hypothesized that the origin and development of the Central Asian Deserts generated a biogeographic barrier that fragmented past continuous distributions in Eastern and Western domains. Second, Pleistocene glaciations have been proposed as the main process driving the regional diversification within each of these domains. The European common toad and its closest relatives provide an interesting opportunity to examine the relative contributions of these paleogeographic and paleoclimatic events to the phylogeny and biogeography of a widespread Eurasiatic group. We investigate this issue by applying a multiproxy approach combining information from molecular phylogenies, a multiple correspondence analysis of allozyme data and species distribution models. Our study includes 304 specimens from 164 populations, covering most of the distributional range of the Bufo bufo species complex in the Western Palearctic. The phylogenies (ML and Bayesian analyses) were based on a total of 1988 bp of mitochondrial DNA encompassing three genes (tRNAval, 16S and ND1). A dataset with 173 species of the family Bufonidae was assembled to estimate the separation of the two pan-Eurasiatic species complexes of Bufo and to date the main biogeographic events within the Bufo bufo species complex. The allozyme study included sixteen protein systems, corresponding to 21 presumptive loci. Finally, the distribution models were based on maximum entropy. Our distribution models show that Eastern and Western species complexes are greatly isolated by the Central Asian Deserts, and our dating estimates place this divergence during the Middle Miocene, a moment in which different sources of evidence document a major upturn of the aridification rate of Central Asia. This climate-driven process likely separated the Eastern and Western species. At the

  19. Molecular phylogenetics, historical biogeography, and chromosome number evolution of Portulaca (Portulacaceae).

    Science.gov (United States)

    Ocampo, Gilberto; Columbus, J Travis

    2012-04-01

    Portulaca is the only genus in Portulacaceae and has ca. 100 species distributed worldwide, mainly in the tropics and subtropics. Molecular data place the genus as one of the closest relatives of Cactaceae, but phylogenetic relationships within Portulaca are barely known. This study samples 59 species of Portulaca, 10 infraspecific taxa, and three cultivars, including multiple samples of widespread species. The sampled taxa represent all subgenera in the classifications of von Poellnitz (1934), Legrand (1958), and Geesink (1969) and come from around the world. Nuclear ITS and chloroplast ndhF, trnT-psbD intergenic spacer, and ndhA intron DNA sequences were analyzed using maximum likelihood and Bayesian methods to produce a hypothesis of relationships within Portulaca. Divergence times were estimated using Hawaiian endemics for calibration, and biogeographical patterns were examined using a Bayes-DIVA approach. In addition, the evolution of chromosome numbers in the genus was investigated using probabilistic models. The analyses strongly support the monophyly of Portulaca, with an age of the most recent common ancestor (MRCA) of 23 Myr. Within Portulaca are two major lineages: the OL clade (comprising opposite-leaved species) distributed in Africa, Asia, and Australia, and the AL clade (comprising alternate to subopposite-leaved species), which is more widespread and originated in the New World. Sedopsis, a genus sometimes recognized as distinct from Portulaca based on a long corolla tube, is nested within the OL clade and does not merit taxonomic recognition. Samples of Portulaca grandiflora, Portulaca halimoides, and Portulaca oleracea were found to be non-monophyletic. It is hypothesized that the ancestral distribution area of Portulaca included southern hemisphere continents and Asia. The OL clade remained restricted to the Old World (except Portulaca quadrifida, a pantropical weed), while the AL clade, with a South American origin, was able to disperse multiple

  20. Molecular Phylogenetics and Temporal Diversification in the Genus Aeromonas Based on the Sequences of Five Housekeeping Genes

    Science.gov (United States)

    Lorén, J. Gaspar; Farfán, Maribel; Fusté, M. Carmen

    2014-01-01

    Several approaches have been developed to estimate both the relative and absolute rates of speciation and extinction within clades based on molecular phylogenetic reconstructions of evolutionary relationships, according to an underlying model of diversification. However, the macroevolutionary models established for eukaryotes have scarcely been used with prokaryotes. We have investigated the rate and pattern of cladogenesis in the genus Aeromonas (γ-Proteobacteria, Proteobacteria, Bacteria) using the sequences of five housekeeping genes and an uncorrelated relaxed-clock approach. To our knowledge, until now this analysis has never been applied to all the species described in a bacterial genus and thus opens up the possibility of establishing models of speciation from sequence data commonly used in phylogenetic studies of prokaryotes. Our results suggest that the genus Aeromonas began to diverge between 248 and 266 million years ago, exhibiting a constant divergence rate through the Phanerozoic, which could be described as a pure birth process. PMID:24586399

  1. Phylogenetic analysis of canine distemper virus in South America clade 1 reveals unique molecular signatures of the local epidemic.

    Science.gov (United States)

    Fischer, Cristine D B; Gräf, Tiago; Ikuta, Nilo; Lehmann, Fernanda K M; Passos, Daniel T; Makiejczuk, Aline; Silveira, Marcos A T; Fonseca, André S K; Canal, Cláudio W; Lunge, Vagner R

    2016-07-01

    Canine distemper virus (CDV) is a highly contagious pathogen for domestic dogs and several wild carnivore species. In Brazil, natural infection of CDV in dogs is very high due to the large non-vaccinated dog population, a scenario that calls for new studies on the molecular epidemiology. This study investigates the phylodynamics and amino-acid signatures of CDV epidemic in South America by analyzing a large dataset compiled from publicly available sequences and also by collecting new samples from Brazil. A population of 175 dogs with canine distemper (CD) signs was sampled, from which 89 were positive for CDV, generating 42 new CDV sequences. Phylogenetic analysis of the new and publicly available sequences revealed that Brazilian sequences mainly clustered in South America 1 (SA1) clade, which has its origin estimated to the late 1980's. The reconstruction of the demographic history in SA1 clade showed an epidemic expanding until the recent years, doubling in size every nine years. SA1 clade epidemic distinguished from the world CDV epidemic by the emergence of the R580Q strain, a very rare and potentially detrimental substitution in the viral genome. The R580Q substitution was estimated to have happened in one single evolutionary step in the epidemic history in SA1 clade, emerging shortly after introduction to the continent. Moreover, a high prevalence (11.9%) of the Y549H mutation was observed among the domestic dogs sampled here. This finding was associated (p<0.05) with outcome-death and higher frequency in mixed-breed dogs, the later being an indicator of a continuous exchange of CDV strains circulating among wild carnivores and domestic dogs. The results reported here highlight the diversity of the worldwide CDV epidemic and reveal local features that can be valuable for combating the disease. Copyright © 2016 Elsevier B.V. All rights reserved.

  2. Phylogenetic analysis and systematic position of two new species of the ant genus Crematogaster (Hymenoptera, Formicidae from Southeast Asia

    Directory of Open Access Journals (Sweden)

    Shingo Hosoishi

    2017-11-01

    Full Text Available Two distinct new species of the ant genus Crematogaster, C. khmerensis sp. nov. and C. pfeifferi sp. nov., are described from Cambodia and Malaysia, respectively. The two species are unique among Asian Crematogaster in that they have vertically directed propodeal spines, but their systematic positions have not been determined based on morphological characters alone. Molecular phylogenetic analysis of 89 Crematogaster taxon matrices previously published plus C. khmerensis sp. nov., using nuclear genes, reveals that C. khmerensis sp. nov. is nested within the Australo-Asian Crematogaster clade. Morphological assignment of the developed pronotal shoulders implies a close relationship between C. khmerensis sp. nov. and the C. tetracantha-group. Based on molecular and morphological evidence, we erect a new species group, C. khmerensis-group, to contain C. khmerensis sp. nov. and C. pfeifferi sp. nov. Divergence time estimates using MCMCTree shows that the root node of the C. khmerensis sp. nov. terminal is estimated to be of middle Miocene age at 15 million years old. The position of the C. khmerensis-group well supports the Oriental- to Australian-region dispersal history that has been proposed for the Australo-Asian Crematogaster clade.

  3. Molecular Phylogenetic Exploration of Bacterial Diversity in a Bakreshwar (India) Hot Spring and Culture of Shewanella-Related Thermophiles

    Science.gov (United States)

    Ghosh, Dhritiman; Bal, Bijay; Kashyap, V. K.; Pal, Subrata

    2003-01-01

    The bacterial diversity of a hot spring in Bakreshwar, India, was investigated by a culture-independent approach. 16S ribosomal DNA clones derived from the sediment samples were found to be associated with gamma-Proteobacteria, cyanobacteria, and green nonsulfur and low-GC gram-positive bacteria. The first of the above phylotypes cobranches with Shewanella, a well-known iron reducer. This phylogenetic correlation has been exploited to develop culture conditions for thermophilic iron-reducing microorganisms. PMID:12839826

  4. Complete mitochondrial genome of Bugula neritina (Bryozoa, Gymnolaemata, Cheilostomata: phylogenetic position of Bryozoa and phylogeny of lophophorates within the Lophotrochozoa

    Directory of Open Access Journals (Sweden)

    Jang Kuem

    2009-04-01

    Full Text Available Abstract Background The phylogenetic position of Bryozoa is one of the most controversial issues in metazoan phylogeny. In an attempt to address this issue, the first bryozoan mitochondrial genome from Flustrellidra hispida (Gymnolaemata, Ctenostomata was recently sequenced and characterized. Unfortunately, it has extensive gene translocation and extremely reduced size. In addition, the phylogenies obtained from the result were conflicting, so they failed to assign a reliable phylogenetic position to Bryozoa or to clarify lophophorate phylogeny. Thus, it is necessary to characterize further mitochondrial genomes from slowly-evolving bryozoans to obtain a more credible lophophorate phylogeny. Results The complete mitochondrial genome (15,433 bp of Bugula neritina (Bryozoa, Gymnolaemata, Cheilostomata, one of the most widely distributed cheliostome bryozoans, is sequenced. This second bryozoan mitochondrial genome contains the set of 37 components generally observed in other metazoans, differing from that of F. hispida (Bryozoa, Gymnolaemata, Ctenostomata, which has only 36 components with loss of tRNAser(ucn genes. The B. neritina mitochondrial genome possesses 27 multiple noncoding regions. The gene order is more similar to those of the two remaining lophophorate phyla (Brachiopoda and Phoronida and a chiton Katharina tunicate than to that of F. hispida. Phylogenetic analyses based on the nucleotide sequences or amino acid residues of 12 protein-coding genes showed consistently that, within the Lophotrochozoa, the monophyly of the bryozoan class Gymnolaemata (B. neritina and F. hispida was strongly supported and the bryozoan clade was grouped with brachiopods. Echiura appeared as a subtaxon of Annelida, and Entoprocta as a sister taxon of Phoronida. The clade of Bryozoa + Brachiopoda was clustered with either the clade of Annelida-Echiura or that of Phoronida + Entoprocta. Conclusion This study presents the complete mitochondrial genome of a

  5. Phylogenetic relationships in the "grossulariae" species group of the genus Aphis (Hemiptera: Sternorrhyncha: Aphididae): Molecular evidence

    DEFF Research Database (Denmark)

    Turcinaviciene, Jorga; Rakauskas, Rimantas; Pedersen, Bo Vest

    2006-01-01

    Phylogenetic relationships among Palaearctic Ribes and/or Onagraceae inhabiting Aphis species from five countries were examined using mitochondrial gene cytochrome oxidase I (CO-I) and nuclear gene elongation factor 1 a (EF-1a) sequences. There was no major conflict between the trees obtained fro...

  6. Multigene molecular phylogenetics reveals true morels (Morchella) are especially species-rich in China

    Science.gov (United States)

    The phylogenetic diversity of true morels (Morchella) in China was estimated by initially analyzing nuclear ribosomal internal transcribed spacer (ITS) rDNA sequences from 361 specimens collected in 21 provinces during the 2003-2011 growing seasons, together with six collections obtained on loan fro...

  7. Evolution of feeding specialization in Tanganyikan scale-eating cichlids: a molecular phylogenetic approach

    Directory of Open Access Journals (Sweden)

    Nishida Mutsumi

    2007-10-01

    Full Text Available Abstract Background Cichlid fishes in Lake Tanganyika exhibit remarkable diversity in their feeding habits. Among them, seven species in the genus Perissodus are known for their unique feeding habit of scale eating with specialized feeding morphology and behaviour. Although the origin of the scale-eating habit has long been questioned, its evolutionary process is still unknown. In the present study, we conducted interspecific phylogenetic analyses for all nine known species in the tribe Perissodini (seven Perissodus and two Haplotaxodon species using amplified fragment length polymorphism (AFLP analyses of the nuclear DNA. On the basis of the resultant phylogenetic frameworks, the evolution of their feeding habits was traced using data from analyses of stomach contents, habitat depths, and observations of oral jaw tooth morphology. Results AFLP analyses resolved the phylogenetic relationships of the Perissodini, strongly supporting monophyly for each species. The character reconstruction of feeding ecology based on the AFLP tree suggested that scale eating evolved from general carnivorous feeding to highly specialized scale eating. Furthermore, scale eating is suggested to have evolved in deepwater habitats in the lake. Oral jaw tooth shape was also estimated to have diverged in step with specialization for scale eating. Conclusion The present evolutionary analyses of feeding ecology and morphology based on the obtained phylogenetic tree demonstrate for the first time the evolutionary process leading from generalised to highly specialized scale eating, with diversification in feeding morphology and behaviour among species.

  8. Sequence exploration reveals information bias among molecular markers used in phylogenetic reconstruction for Colletotrichum species.

    Science.gov (United States)

    Rampersad, Sephra N; Hosein, Fazeeda N; Carrington, Christine Vf

    2014-01-01

    The Colletotrichum gloeosporioides species complex is among the most destructive fungal plant pathogens in the world, however, identification of isolates of quarantine importance to the intra-specific level is confounded by a number of factors that affect phylogenetic reconstruction. Information bias and quality parameters were investigated to determine whether nucleotide sequence alignments and phylogenetic trees accurately reflect the genetic diversity and phylogenetic relatedness of individuals. Sequence exploration of GAPDH, ACT, TUB2 and ITS markers indicated that the query sequences had different patterns of nucleotide substitution but were without evidence of base substitution saturation. Regions of high entropy were much more dispersed in the ACT and GAPDH marker alignments than for the ITS and TUB2 markers. A discernible bimodal gap in the genetic distance frequency histograms was produced for the ACT and GAPDH markers which indicated successful separation of intra- and inter-specific sequences in the data set. Overall, analyses indicated clear differences in the ability of these markers to phylogenetically separate individuals to the intra-specific level which coincided with information bias.

  9. Morphological and molecular characterization and phylogenetic relationships of a new species of trypanosome in Tapirus terrestris (lowland tapir), Trypanosoma terrestris sp. nov., from Atlantic Rainforest of southeastern Brazi.

    Science.gov (United States)

    Acosta, Igor da Cunha Lima; da Costa, Andrea Pereira; Nunes, Pablo Henrique; Gondim, Maria Fernanda Naegeli; Gatti, Andressa; Rossi, João Luiz; Gennari, Solange Maria; Marcili, Arlei

    2013-12-11

    The Lowland tapir (Tapirus terrestris) is the largest Brazilian mammal and despite being distributed in various Brazilian biomes, it is seriously endangered in the Atlantic Rainforest. These hosts were never evaluated for the presence of Trypanosoma parasites. The Lowland tapirs were captured in the Brazilian southeastern Atlantic Rainforest, Espírito Santo state. Trypanosomes were isolated by hemoculture, and the molecular phylogeny based on small subunit rDNA (SSU rDNA) and glycosomal-3-phosphate dehydrogenase (gGAPDH) gene sequences and the ultrastructural features seen via light microscopy and scanning and transmission electron microscopy are described. Phylogenetic trees using combined SSU rDNA and gGAPDH data sets clustered the trypanosomes of Lowland tapirs, which were highly divergent from other trypanosome species. The phylogenetic position and morphological discontinuities, mainly in epimastigote culture forms, made it possible to classify the trypanosomes from Lowland tapirs as a separate species. The isolated trypanosomes from Tapirus terrestris are a new species, Trypanosoma terrestris sp. n., and were positioned in a new Trypanosoma clade, named T. terrestris clade.

  10. Candelariella placodizans (Candelariaceae reported new to mainland China and Taiwan based on morphological, chemical and molecular phylogenetic analyses

    Directory of Open Access Journals (Sweden)

    Lidia Yakovchenko

    2016-06-01

    Full Text Available Candelariella placodizans is newly reported from China. It was collected on exposed rocks with mosses on the alpine areas of Taiwan and Yunnan Province, China at elevation between 3200-4400 m. Molecular phylogenetic analyses based on ITS rDNA sequences were also performed to confirm the monophyly of the Chinese populations with respect to already existing sequences of the species, and then further to examine their relationships to other members of the genus. An identification key to all 14 known taxa of Candelariella in China is provided.

  11. Molecular Identification of Dendrobium Species (Orchidaceae) Based on the DNA Barcode ITS2 Region and Its Application for Phylogenetic Study.

    Science.gov (United States)

    Feng, Shangguo; Jiang, Yan; Wang, Shang; Jiang, Mengying; Chen, Zhe; Ying, Qicai; Wang, Huizhong

    2015-09-11

    The over-collection and habitat destruction of natural Dendrobium populations for their commercial medicinal value has led to these plants being under severe threat of extinction. In addition, many Dendrobium plants are similarly shaped and easily confused during the absence of flowering stages. In the present study, we examined the application of the ITS2 region in barcoding and phylogenetic analyses of Dendrobium species (Orchidaceae). For barcoding, ITS2 regions of 43 samples in Dendrobium were amplified. In combination with sequences from GenBank, the sequences were aligned using Clustal W and genetic distances were computed using MEGA V5.1. The success rate of PCR amplification and sequencing was 100%. There was a significant divergence between the inter- and intra-specific genetic distances of ITS2 regions, while the presence of a barcoding gap was obvious. Based on the BLAST1, nearest distance and TaxonGAP methods, our results showed that the ITS2 regions could successfully identify the species of most Dendrobium samples examined; Second, we used ITS2 as a DNA marker to infer phylogenetic relationships of 64 Dendrobium species. The results showed that cluster analysis using the ITS2 region mainly supported the relationship between the species of Dendrobium established by traditional morphological methods and many previous molecular analyses. To sum up, the ITS2 region can not only be used as an efficient barcode to identify Dendrobium species, but also has the potential to contribute to the phylogenetic analysis of the genus Dendrobium.

  12. Systematics of the grey mullets (Teleostei: Mugiliformes: Mugilidae): molecular phylogenetic evidence challenges two centuries of morphology-based taxonomy.

    Science.gov (United States)

    Durand, J-D; Shen, K-N; Chen, W-J; Jamandre, B W; Blel, H; Diop, K; Nirchio, M; Garcia de León, F J; Whitfield, A K; Chang, C-W; Borsa, P

    2012-07-01

    The family Mugilidae comprises mainly coastal marine species that are widely distributed in all tropical, subtropical and temperate seas. Mugilid species are generally considered to be ecologically important and they are a major food resource for human populations in certain parts of the world. The taxonomy and systematics of the Mugilidae are still much debated and based primarily on morphological characters. In this study, we provide the first comprehensive molecular systematic account of the Mugilidae using phylogenetic analyses of nucleotide sequence variation at three mitochondrial loci (16S rRNA, cytochrome oxidase I, and cytochrome b) for 257 individuals from 55 currently recognized species. The study covers all 20 mugilid genera currently recognized as being valid. The family comprises seven major lineages that radiated early on from the ancestor to all current forms. All genera that were represented by two species or more, except Cestraeus, turned out to be paraphyletic or polyphyletic. Thus, the present phylogenetic results generally disagree with the current taxonomy at the genus level and imply that the anatomical characters used for the systematics of the Mugilidae may be poorly informative phylogenetically. The present results should provide a sound basis for a taxonomic revision of the mugilid genera. A proportion of the species with large distribution ranges (including Moolgarda seheli, Mugil cephalus and M. curema) appear to consist of cryptic species, thus warranting further taxonomic and genetic work at the infra-generic level. Copyright © 2012 Elsevier Inc. All rights reserved.

  13. Molecular Identification of Dendrobium Species (Orchidaceae Based on the DNA Barcode ITS2 Region and Its Application for Phylogenetic Study

    Directory of Open Access Journals (Sweden)

    Shangguo Feng

    2015-09-01

    Full Text Available The over-collection and habitat destruction of natural Dendrobium populations for their commercial medicinal value has led to these plants being under severe threat of extinction. In addition, many Dendrobium plants are similarly shaped and easily confused during the absence of flowering stages. In the present study, we examined the application of the ITS2 region in barcoding and phylogenetic analyses of Dendrobium species (Orchidaceae. For barcoding, ITS2 regions of 43 samples in Dendrobium were amplified. In combination with sequences from GenBank, the sequences were aligned using Clustal W and genetic distances were computed using MEGA V5.1. The success rate of PCR amplification and sequencing was 100%. There was a significant divergence between the inter- and intra-specific genetic distances of ITS2 regions, while the presence of a barcoding gap was obvious. Based on the BLAST1, nearest distance and TaxonGAP methods, our results showed that the ITS2 regions could successfully identify the species of most Dendrobium samples examined; Second, we used ITS2 as a DNA marker to infer phylogenetic relationships of 64 Dendrobium species. The results showed that cluster analysis using the ITS2 region mainly supported the relationship between the species of Dendrobium established by traditional morphological methods and many previous molecular analyses. To sum up, the ITS2 region can not only be used as an efficient barcode to identify Dendrobium species, but also has the potential to contribute to the phylogenetic analysis of the genus Dendrobium.

  14. Mitochondrial genome of the stonefly Kamimuria wangi (Plecoptera: Perlidae) and phylogenetic position of plecoptera based on mitogenomes.

    Science.gov (United States)

    Yu-Han, Qian; Hai-Yan, Wu; Xiao-Yu, Ji; Wei-Wei, Yu; Yu-Zhou, Du

    2014-01-01

    This study determined the mitochondrial genome sequence of the stonefly, Kamimuria wangi. In order to investigate the relatedness of stonefly to other members of Neoptera, a phylogenetic analysis was undertaken based on 13 protein-coding genes of mitochondrial genomes in 13 representative insects. The mitochondrial genome of the stonefly is a circular molecule consisting of 16,179 nucleotides and contains the 37 genes typically found in other insects. A 10-bp poly-T stretch was observed in the A+T-rich region of the K. wangi mitochondrial genome. Downstream of the poly-T stretch, two regions were located with potential ability to form stem-loop structures; these were designated stem-loop 1 (positions 15848-15651) and stem-loop 2 (15965-15998). The arrangement of genes and nucleotide composition of the K. wangi mitogenome are similar to those in Pteronarcys princeps, suggesting a conserved genome evolution within the Plecoptera. Phylogenetic analysis using maximum likelihood and Bayesian inference of 13 protein-coding genes supported a novel relationship between the Plecoptera and Ephemeroptera. The results contradict the existence of a monophyletic Plectoptera and Plecoptera as sister taxa to Embiidina, and thus requires further analyses with additional mitogenome sampling at the base of the Neoptera.

  15. Mitochondrial genome of the stonefly Kamimuria wangi (Plecoptera: Perlidae and phylogenetic position of plecoptera based on mitogenomes.

    Directory of Open Access Journals (Sweden)

    Qian Yu-Han

    Full Text Available This study determined the mitochondrial genome sequence of the stonefly, Kamimuria wangi. In order to investigate the relatedness of stonefly to other members of Neoptera, a phylogenetic analysis was undertaken based on 13 protein-coding genes of mitochondrial genomes in 13 representative insects. The mitochondrial genome of the stonefly is a circular molecule consisting of 16,179 nucleotides and contains the 37 genes typically found in other insects. A 10-bp poly-T stretch was observed in the A+T-rich region of the K. wangi mitochondrial genome. Downstream of the poly-T stretch, two regions were located with potential ability to form stem-loop structures; these were designated stem-loop 1 (positions 15848-15651 and stem-loop 2 (15965-15998. The arrangement of genes and nucleotide composition of the K. wangi mitogenome are similar to those in Pteronarcys princeps, suggesting a conserved genome evolution within the Plecoptera. Phylogenetic analysis using maximum likelihood and Bayesian inference of 13 protein-coding genes supported a novel relationship between the Plecoptera and Ephemeroptera. The results contradict the existence of a monophyletic Plectoptera and Plecoptera as sister taxa to Embiidina, and thus requires further analyses with additional mitogenome sampling at the base of the Neoptera.

  16. Molecular phylogenetic trees - On the validity of the Goodman-Moore augmentation algorithm

    Science.gov (United States)

    Holmquist, R.

    1979-01-01

    A response is made to the reply of Nei and Tateno (1979) to the letter of Holmquist (1978) supporting the validity of the augmentation algorithm of Moore (1977) in reconstructions of nucleotide substitutions by means of the maximum parsimony principle. It is argued that the overestimation of the augmented numbers of nucleotide substitutions (augmented distances) found by Tateno and Nei (1978) is due to an unrepresentative data sample and that it is only necessary that evolution be stochastically uniform in different regions of the phylogenetic network for the augmentation method to be useful. The importance of the average value of the true distance over all links is explained, and the relative variances of the true and augmented distances are calculated to be almost identical. The effects of topological changes in the phylogenetic tree on the augmented distance and the question of the correctness of ancestral sequences inferred by the method of parsimony are also clarified.

  17. Molecular cloning, phylogenetic analysis and heat shock response of Babesia gibsoni heat shock protein 90.

    Science.gov (United States)

    Yamasaki, Masahiro; Tsuboi, Yoshihiro; Taniyama, Yusuke; Uchida, Naohiro; Sato, Reeko; Nakamura, Kensuke; Ohta, Hiroshi; Takiguchi, Mitsuyoshi

    2016-09-01

    The Babesia gibsoni heat shock protein 90 (BgHSP90) gene was cloned and sequenced. The length of the gene was 2,610 bp with two introns. This gene was amplified from cDNA corresponding to full length coding sequence (CDS) with an open reading frame of 2,148 bp. A phylogenetic analysis of the CDS of HSP90 gene showed that B. gibsoni was most closely related to B. bovis and Babesia sp. BQ1/Lintan and lies within a phylogenetic cluster of protozoa. Moreover, mRNA transcription profile for BgHSP90 exposed to high temperature were examined by quantitative real-time reverse transcription-polymerase chain reaction. BgHSP90 levels were elevated when the parasites were incubated at 43°C for 1 hr.

  18. Molecular phylogenetics and character evolution of morphologically diverse groups, Dendrobium section Dendrobium and allies

    Science.gov (United States)

    Takamiya, Tomoko; Wongsawad, Pheravut; Sathapattayanon, Apirada; Tajima, Natsuko; Suzuki, Shunichiro; Kitamura, Saki; Shioda, Nao; Handa, Takashi; Kitanaka, Susumu; Iijima, Hiroshi; Yukawa, Tomohisa

    2014-01-01

    It is always difficult to construct coherent classification systems for plant lineages having diverse morphological characters. The genus Dendrobium, one of the largest genera in the Orchidaceae, includes ∼1100 species, and enormous morphological diversification has hindered the establishment of consistent classification systems covering all major groups of this genus. Given the particular importance of species in Dendrobium section Dendrobium and allied groups as floriculture and crude drug genetic resources, there is an urgent need to establish a stable classification system. To clarify phylogenetic relationships in Dendrobium section Dendrobium and allied groups, we analysed the macromolecular characters of the group. Phylogenetic analyses of 210 taxa of Dendrobium were conducted on DNA sequences of internal transcribed spacer (ITS) regions of 18S–26S nuclear ribosomal DNA and the maturase-coding gene (matK) located in an intron of the plastid gene trnK using maximum parsimony and Bayesian methods. The parsimony and Bayesian analyses revealed 13 distinct clades in the group comprising section Dendrobium and its allied groups. Results also showed paraphyly or polyphyly of sections Amblyanthus, Aporum, Breviflores, Calcarifera, Crumenata, Dendrobium, Densiflora, Distichophyllae, Dolichocentrum, Holochrysa, Oxyglossum and Pedilonum. On the other hand, the monophyly of section Stachyobium was well supported. It was found that many of the morphological characters that have been believed to reflect phylogenetic relationships are, in fact, the result of convergence. As such, many of the sections that have been recognized up to this point were found to not be monophyletic, so recircumscription of sections is required. PMID:25107672

  19. Molecular Phylogenetic Screening of Withania somnifera Relative From Indonesia Based on Internal Transcribed Spacer Region

    Directory of Open Access Journals (Sweden)

    Topik Hidayat

    2016-04-01

    Full Text Available Withania somnifera (family Solanaceae, known commonly as Ashwaganda, is one of the important medicinal plants, and recent studies reported that Withanone, one of the chemical components in this plant, has ability to kill cancer cell. Because of endemic state of this plant to South Asia, exploring plant species under the same family which grow well in Indonesia has been of interest. The purpose of this study was to screen the Indonesian plant which has strong phylogenetic relationship with Ashwaganda. Thus, phylogenetic analysis using DNA sequences of internal transcribed spacer (ITS region was conducted. Thus, 19 species of Solanaceae and two species of Convolvulaceae as outgroup were examined. Five ITS regions of Ashwaganda retrieved from GenBank were included in the phylogenetic analysis. Parsimony analysis showed that Indonesia Solanaceae comprises seven groups which is consistent with the global Solanaceae relationship as previously reported. Furthermore, our study revealed that two species, Physalis angulata and Physalis peruviana, are relative to W. somnifera. Morphologically, they share characters of flower and fruit. This result indicated that these two species are potential to have similar chemical properties as Ashwaganda, thus we can have new variants of Withanone originated from Indonesia with similar effect.

  20. Molecular, phylogenetic and comparative genomic analysis of the cytokinin oxidase/dehydrogenase gene family in the Poaceae.

    Science.gov (United States)

    Mameaux, Sabine; Cockram, James; Thiel, Thomas; Steuernagel, Burkhard; Stein, Nils; Taudien, Stefan; Jack, Peter; Werner, Peter; Gray, John C; Greenland, Andy J; Powell, Wayne

    2012-01-01

    The genomes of cereals such as wheat (Triticum aestivum) and barley (Hordeum vulgare) are large and therefore problematic for the map-based cloning of agronomicaly important traits. However, comparative approaches within the Poaceae permit transfer of molecular knowledge between species, despite their divergence from a common ancestor sixty million years ago. The finding that null variants of the rice gene cytokinin oxidase/dehydrogenase 2 (OsCKX2) result in large yield increases provides an opportunity to explore whether similar gains could be achieved in other Poaceae members. Here, phylogenetic, molecular and comparative analyses of CKX families in the sequenced grass species rice, brachypodium, sorghum, maize and foxtail millet, as well as members identified from the transcriptomes/genomes of wheat and barley, are presented. Phylogenetic analyses define four Poaceae CKX clades. Comparative analyses showed that CKX phylogenetic groupings can largely be explained by a combination of local gene duplication, and the whole-genome duplication event that predates their speciation. Full-length OsCKX2 homologues in barley (HvCKX2.1, HvCKX2.2) and wheat (TaCKX2.3, TaCKX2.4, TaCKX2.5) are characterized, with comparative analysis at the DNA, protein and genetic/physical map levels suggesting that true CKX2 orthologs have been identified. Furthermore, our analysis shows CKX2 genes in barley and wheat have undergone a Triticeae-specific gene-duplication event. Finally, by identifying ten of the eleven CKX genes predicted to be present in barley by comparative analyses, we show that next-generation sequencing approaches can efficiently determine the gene space of large-genome crops. Together, this work provides the foundation for future functional investigation of CKX family members within the Poaceae. © 2011 National Institute of Agricultural Botany (NIAB). Plant Biotechnology Journal © 2011 Society for Experimental Biology, Association of Applied Biologists and Blackwell

  1. A remarkable new family of Jurassic insects (Neuroptera with primitive wing venation and its phylogenetic position in Neuropterida.

    Directory of Open Access Journals (Sweden)

    Qiang Yang

    Full Text Available BACKGROUND: Lacewings (insect order Neuroptera, known in the fossil record since the Early Permian, were most diverse in the Mesozoic. A dramatic variety of forms ranged in that time from large butterfly-like Kalligrammatidae to minute two-winged Dipteromantispidae. PRINCIPAL FINDINGS: We describe the intriguing new neuropteran family Parakseneuridae fam. nov. with three new genera and 15 new species from the Middle Jurassic of Daohugou (Inner Mongolia, China and the Early/Middle Jurassic of Sai-Sagul (Kyrgyzstan: Parakseneura undula gen. et sp. nov., P. albomacula gen. et sp. nov., P. curvivenis gen. et sp. nov., P. nigromacula gen. et sp. nov., P. nigrolinea gen. et sp. nov., P. albadelta gen. et sp. nov., P. cavomaculata gen. et sp. nov., P. inflata gen. et sp. nov., P. metallica gen. et sp. nov., P. emarginata gen. et sp. nov., P. directa gen. et sp. nov., Pseudorapisma jurassicum gen. et sp. nov., P. angustipenne gen. et sp. nov., P. maculatum gen. et sp. nov. (Daohugou; Shuraboneura ovata gen. et sp. nov. (Sai-Sagul. The family comprises large neuropterans with most primitive wing venation in the order indicated by the presence of ScA and AA1+2, and the dichotomous branching of MP, CuA, CuP, AA3+4, AP1+2. The phylogenetic position of Parakseneuridae was investigated using a phylogenetic analysis of morphological scoring for 33 families of extinct and extant Neuropterida combined with DNA sequence data for representatives of all extant families. Parakseneuridae were recovered in a clade with Osmylopsychopidae, Prohemerobiidae, and Ithonidae. CONCLUSIONS/SIGNIFICANCE: The presence of the presumed AA1+2 in wings of Parakseneuridae is a unique plesiomorphic condition hitherto unknown in Neuropterida, the clade comprising Neuroptera, Megaloptera, Raphidioptera. The relative uncertainty of phylogenetic position of Parakseneuridae and the majority of other families of Neuroptera reflects deficient paleontological data, especially from critical

  2. MOLECULAR-PHYLOGENETIC CHARACTERIZATION AND ANTIMICROBIAL RESISTANCE OF Escherichia coli ISOLATED FROM GOATS WITH DIARRHEA

    Directory of Open Access Journals (Sweden)

    Rodrigo Almeida Guimarães

    2015-10-01

    Full Text Available Neonatal diarrhea determines significant changes in feed conversion, causing productivity loss in caprine herds. The antimicrobial resistance in bacteria is characterized as an important public health issue; therefore, Escherichia coli may be characterized as an important pathogen due to expressing virulence mechanisms responsible for significant clinical conditions in humans and animals. The present study evaluated the presence of E. coli among 117 caprine fecal samples and analyzed the isolates for antimicrobial resistance. Suggestive colonies were submitted to biochemical screening followed by genotypic group determination and phylogenetic analysis; further, the samples were submitted to antimicrobials susceptibility test. E. coli, Salmonella spp, Shigella sonnei and Enterobacter aerogenes were identified. E. coli isolates were phylogenetically classified as B2 (9/39, D (19/39, B1 (7/39 e A (4/29 groups. The analysis of the isolates also revealed the presence of K99 (04/39 and Stx (02/39 virulence factors. Antimicrobial susceptibility test revealed sensitive isolates to Chloramphenicol, Streptomycin, Amoxicillin and Ciprofloxacin, being all resistant to Lincomycin, Vancomycin and Penicillin. The results support the need of establishing restricted protocols for antimicrobial use, a fundamental procedure for health improvement in Brazilian caprine herds.

  3. Molecular Identification and Phylogenetic Relationships of Pleurotus spp. Diversity in Malaysia by ITS Marker

    International Nuclear Information System (INIS)

    Zaiton Abdul Kadir; Azhar Mohamad; Nie, H.J.

    2016-01-01

    Pleurotus species is an edible mushroom in Malaysia which is commonly known as Oyster mushroom and grow by small holder farmers. This species is important for nutraceutical, pharmaceutical and cosmoceutical industries. However, there is some mis identification due to phenotypic variation in which the species shared some similarities due to environmental factors, and thus create troublesome. Thus, eleven isolates of Pleurotus sample which comprise of 4 different species were collected from different locations in Malaysia were used for strain and species identification including mutant line Pleurotus. Pleurotus pulmonarius coded as ATCC 62887 was used as a reference. Total genomic DNA was extracted, quantified and amplified by using rDNA-ITS (Ribosomal DNA Internal Transcribed Spacers) ITS8-F: 5"'AGTCGTAACAAGGTTTCCGTAGGTG3"' and ITS6-R: 5"'TTCCCGCTTCACTCGC-AGT3"'primers. The PCR products were directly sequenced for BLAST evaluation. Phylogenetic (UPGMA) was constructed by using CLC Sequence Viewer 6.8.1. It clearly shown distinct clades of the Pleurotus species and strains. Pleurotus pulmonarius were found to be grouped in one group while Pleurotus florida and Pleurotus columbinus were in the other different clade. For Pleurotus geesteranus, which has the most nucleotide similarity and morphology with Pleurotus pulmonarius, was grouped in its own clade and was single isolated. Thus, ITS marker found to be reliable, rapid, robust and reproducible approach in screening of Pleurotus species and its variants for taxonomical purposes and phylogenetic analysis. (author)

  4. Molecular Phylogenetics of Centrocestus formosanus (Digenea: Heterophyidae) Originated from Freshwater Fish from Chiang Mai Province, Thailand.

    Science.gov (United States)

    Wongsawad, Chalobol; Wongsawad, Pheravut; Sukontason, Kom; Maneepitaksanti, Worawit; Nantarat, Nattawadee

    2017-02-01

    This study aimed to investigate the morphology and reconstruct the phylogenetic relationships of Centrocestus formosanus originating from 5 species of freshwater fish, i.e., Esomus metallicus, Puntius brevis, Anabas testudineus, Parambassis siamensis , and Carassius auratus , in Chiang Mai province, Thailand. Sequence-related amplified polymorphism (SRAP) and phylogeny based on internal transcribed spacer 2 (ITS2) and mitochondrial cytochrome c oxidase subunit 1 (CO1) were performed. The results showed similar morphologies of adult C. formosanus from day 5 after infection in chicks. C. formosanus originated from 4 species of freshwater fish had the same number of circumoral spines on the oral sucker, except for those from C. auratus which revealed 34 circumoral spines. The phylogenetic tree obtained from SRAP profile and the combination of ITS2 and CO1 sequence showed similar results that were correlated with the number of circumoral spines in adult worms. Genetic variability of C. formosanus also occurred in different species of freshwater fish hosts. However, more details of adult worm morphologies and more sensitive genetic markers are needed to confirm the species validity of C. formosanus with 34 circumoral spines originating from C. auratus in the future.

  5. Complex phylogenetic placement of ilex species (aquifoliaceae): a case study of molecular phylogeny

    International Nuclear Information System (INIS)

    Yi, F.; Sun, L.; Xiao, P.G.; Hao, D.C.

    2017-01-01

    To investigate the phylogenetic relationships among Ilex species distributed in China, we analyzed two alignments including 4,698 characters corresponding to six plastid sequences (matK, rbcL, atpB-rbcL, trnL-F, psbA-trnH, and rpl32-trnL) and 1,748 characters corresponding to two nuclear sequences (ITS and nepGS). Using different partitioning strategies and approaches (i.e., Bayesian inference, maximum likelihood, and maximum parsimony) for phylogeny reconstruction, different topologies and clade supports were determined. A total of 18 Ilex species was divided into two major groups (group I and II) in both plastid and nuclear phylogenies with some incongruences. Potential hybridization events may account, in part, for those phylogenetic uncertainties. The analyses, together with previously identified sequences, indicated that all 18 species were recovered within Eurasia or Asia/North America groups based on plastid data. Meanwhile, the species in group II in the nuclear phylogeny were placed in the Aquifolium clade, as inferred from traditional classification, whereas the species in group I belonged to several other clades. The divergence time of most of the 18 Ilex species was estimated to be not more than 10 million years ago. Based on the results of this study, we concluded that paleogeographical events and past climate changes during the same period might have played important roles in these diversifications. (author)

  6. Phylogenetic Molecular Species Delimitations Unravel Potential New Species in the Pest Genus Spodoptera Guenée, 1852 (Lepidoptera, Noctuidae)

    Science.gov (United States)

    Dumas, Pascaline; Barbut, Jérôme; Le Ru, Bruno; Silvain, Jean-François; Clamens, Anne-Laure; d’Alençon, Emmanuelle; Kergoat, Gael J.

    2015-01-01

    Nowadays molecular species delimitation methods promote the identification of species boundaries within complex taxonomic groups by adopting innovative species concepts and theories (e.g. branching patterns, coalescence). As some of them can efficiently deal with large single-locus datasets, they could speed up the process of species discovery compared to more time consuming molecular methods, and benefit from the existence of large public datasets; these methods can also particularly favour scientific research and actions dealing with threatened or economically important taxa. In this study we aim to investigate and clarify the status of economically important moths species belonging to the genus Spodoptera (Lepidoptera, Noctuidae), a complex group in which previous phylogenetic analyses and integrative approaches already suggested the possible occurrence of cryptic species and taxonomic ambiguities. In this work, the effectiveness of innovative (and faster) species delimitation approaches to infer putative species boundaries has been successfully tested in Spodoptera, by processing the most comprehensive dataset (in terms of number of species and specimens) ever achieved; results are congruent and reliable, irrespective of the set of parameters and phylogenetic models applied. Our analyses confirm the existence of three potential new species clusters (for S. exigua (Hübner, 1808), S. frugiperda (J.E. Smith, 1797) and S. mauritia (Boisduval, 1833)) and support the synonymy of S. marima (Schaus, 1904) with S. ornithogalli (Guenée, 1852). They also highlight the ambiguity of the status of S. cosmiodes (Walker, 1858) and S. descoinsi Lalanne-Cassou & Silvain, 1994. This case study highlights the interest of molecular species delimitation methods as valuable tools for species discovery and to emphasize taxonomic ambiguities. PMID:25853412

  7. Phylogenetic molecular species delimitations unravel potential new species in the pest genus Spodoptera Guenée, 1852 (Lepidoptera, Noctuidae.

    Directory of Open Access Journals (Sweden)

    Pascaline Dumas

    Full Text Available Nowadays molecular species delimitation methods promote the identification of species boundaries within complex taxonomic groups by adopting innovative species concepts and theories (e.g. branching patterns, coalescence. As some of them can efficiently deal with large single-locus datasets, they could speed up the process of species discovery compared to more time consuming molecular methods, and benefit from the existence of large public datasets; these methods can also particularly favour scientific research and actions dealing with threatened or economically important taxa. In this study we aim to investigate and clarify the status of economically important moths species belonging to the genus Spodoptera (Lepidoptera, Noctuidae, a complex group in which previous phylogenetic analyses and integrative approaches already suggested the possible occurrence of cryptic species and taxonomic ambiguities. In this work, the effectiveness of innovative (and faster species delimitation approaches to infer putative species boundaries has been successfully tested in Spodoptera, by processing the most comprehensive dataset (in terms of number of species and specimens ever achieved; results are congruent and reliable, irrespective of the set of parameters and phylogenetic models applied. Our analyses confirm the existence of three potential new species clusters (for S. exigua (Hübner, 1808, S. frugiperda (J.E. Smith, 1797 and S. mauritia (Boisduval, 1833 and support the synonymy of S. marima (Schaus, 1904 with S. ornithogalli (Guenée, 1852. They also highlight the ambiguity of the status of S. cosmiodes (Walker, 1858 and S. descoinsi Lalanne-Cassou & Silvain, 1994. This case study highlights the interest of molecular species delimitation methods as valuable tools for species discovery and to emphasize taxonomic ambiguities.

  8. Piscine reovirus: Genomic and molecular phylogenetic analysis from farmed and wild salmonids collected on the Canada/US Pacific Coast

    Science.gov (United States)

    Siah, Ahmed; Morrison, Diane B.; Fringuelli, Elena; Savage, Paul S.; Richmond, Zina; Purcell, Maureen K.; Johns, Robert; Johnson, Stewart C.; Sakasida, Sonja M.

    2015-01-01

    Piscine reovirus (PRV) is a double stranded non-enveloped RNA virus detected in farmed and wild salmonids. This study examined the phylogenetic relationships among different PRV sequence types present in samples from salmonids in Western Canada and the US, including Alaska (US), British Columbia (Canada) and Washington State (US). Tissues testing positive for PRV were partially sequenced for segment S1, producing 71 sequences that grouped into 10 unique sequence types. Sequence analysis revealed no identifiable geographical or temporal variation among the sequence types. Identical sequence types were found in fish sampled in 2001, 2005 and 2014. In addition, PRV positive samples from fish derived from Alaska, British Columbia and Washington State share identical sequence types. Comparative analysis of the phylogenetic tree indicated that Canada/US Pacific Northwest sequences formed a subgroup with some Norwegian sequence types (group II), distinct from other Norwegian and Chilean sequences (groups I, III and IV). Representative PRV positive samples from farmed and wild fish in British Columbia and Washington State were subjected to genome sequencing using next generation sequencing methods. Individual analysis of each of the 10 partial segments indicated that the Canadian and US PRV sequence types clustered separately from available whole genome sequences of some Norwegian and Chilean sequences for all segments except the segment S4. In summary, PRV was genetically homogenous over a large geographic distance (Alaska to Washington State), and the sequence types were relatively stable over a 13 year period.

  9. A DNA-Based Assessment of the Phylogenetic Position of a Morphologically Distinct, Anchialine-Lake-Restricted Seahorse.

    Science.gov (United States)

    Rose, Emily; Masonjones, Heather D; Jones, Adam G

    2016-11-01

    Isolated populations provide special opportunities to study local adaptation and incipient speciation. In some cases, however, morphological evolution can obscure the taxonomic status of recently founded populations. Here, we use molecular markers to show that an anchialine-lake-restricted population of seahorses, originally identified as Hippocampus reidi, appears on the basis of DNA data to be Hippocampus erectus We collected seahorses from Sweetings Pond, on Eleuthera Island, Bahamas, during the summer of 2014. We measured morphological traits and sequenced 2 genes, cytochrome b and ribosomal protein S7, from 19 seahorses in our sample. On the basis of morphology, Sweetings Pond seahorses could not be assigned definitively to either of the 2 species of seahorse, H. reidi and H. erectus, that occur in marine waters surrounding the Bahamas. However, our DNA-based phylogenetic analysis showed that the Sweetings Pond fish were firmly nested within the H. erectus clade with a Bayesian posterior probability greater than 0.99. Thus, Sweetings Pond seahorses most recently shared a common ancestor with H. erectus populations from the Western Atlantic. Interestingly, the seahorses from Sweetings Pond differ morphologically from other marine populations of H. erectus in having a more even torso to tail length ratio. The substantial habitat differences between Sweetings Pond and the surrounding coastal habitat make Sweetings Pond seahorses particularly interesting from the perspectives of conservation, local adaptation, and incipient speciation. © The American Genetic Association 2016. All rights reserved. For permissions, please e-mail: journals.permissions@oup.com.

  10. Larval morphology and phylogenetic position of Drusus balcanicus, Drusus botosaneanui, Drusus serbicus and Drusus tenellus (Trichoptera: Limnephilidae: Drusinae)

    Science.gov (United States)

    WARINGER, JOHANN; GRAF, WOLFRAM; BÁLINT, MIKLÓS; KUČINIĆ, MLADEN; PAULS, STEFFEN U.; PREVIŠIĆ, ANA; KERESZTES, LUJZA; IBRAHIMI, HALIL; ŽIVIĆ, IVANA; BJELANOVIĆ, KATARINA; KRPAČ, VLADIMIR; VITECEK, SIMON

    2016-01-01

    In a recent 3–gene phylogeny of the Trichoptera subfamily Drusinae Banks, 1916 molecular data clearly correlated with the morphology and feeding ecology of larvae. The largest of three main groups, the Drusinae grazer clade, exhibits an unusual larval feeding ecology for Limnephilidae, and is the most diverse group. In this paper we describe four previously unknown Drusinae larvae from this clade: Drusus balcanicus Kumanski, 1973 (micro–endemic to Eastern Balkans); Drusus botosaneanui Kumanski, 1968 (Dinaric Western Balkans, Hellenic and Eastern Balkan, Asia Minor), Drusus serbicus Marinković-Gospodnetić, 1971a (micro–endemic to Dinaric Western Balkans); and Drusus tenellus (Klapálek, 1898) (Carpathians, Dinaric Eastern Balkans). Characteristically, the larvae of these species develop toothless mandibles typical for the Drusinae grazer clade. Larvae and adults were unambiguously associated by a phylogenetic approach based on two mitochondrial (mtCOI, mtLSU= 16S rDNA) and two nuclear genes (nuWG, nuCAD). In addition, information on the morphology of the larvae is given and the diagnostic features necessary for identification are illustrated. PMID:26997882

  11. Molecular cytogenetic (FISH and genome analysis of diploid wheatgrasses and their phylogenetic relationship.

    Directory of Open Access Journals (Sweden)

    Gabriella Linc

    Full Text Available This paper reports detailed FISH-based karyotypes for three diploid wheatgrass species Agropyron cristatum (L. Beauv., Thinopyrum bessarabicum (Savul.&Rayss A. Löve, Pseudoroegneria spicata (Pursh A. Löve, the supposed ancestors of hexaploid Thinopyrum intermedium (Host Barkworth & D.R.Dewey, compiled using DNA repeats and comparative genome analysis based on COS markers. Fluorescence in situ hybridization (FISH with repetitive DNA probes proved suitable for the identification of individual chromosomes in the diploid JJ, StSt and PP genomes. Of the seven microsatellite markers tested only the (GAAn trinucleotide sequence was appropriate for use as a single chromosome marker for the P. spicata AS chromosome. Based on COS marker analysis, the phylogenetic relationship between diploid wheatgrasses and the hexaploid bread wheat genomes was established. These findings confirmed that the J and E genomes are in neighbouring clusters.

  12. In Silico Phylogenetic Analysis and Molecular Modelling Study of 2-Haloalkanoic Acid Dehalogenase Enzymes from Bacterial and Fungal Origin

    Directory of Open Access Journals (Sweden)

    Raghunath Satpathy

    2016-01-01

    Full Text Available 2-Haloalkanoic acid dehalogenase enzymes have broad range of applications, starting from bioremediation to chemical synthesis of useful compounds that are widely distributed in fungi and bacteria. In the present study, a total of 81 full-length protein sequences of 2-haloalkanoic acid dehalogenase from bacteria and fungi were retrieved from NCBI database. Sequence analysis such as multiple sequence alignment (MSA, conserved motif identification, computation of amino acid composition, and phylogenetic tree construction were performed on these primary sequences. From MSA analysis, it was observed that the sequences share conserved lysine (K and aspartate (D residues in them. Also, phylogenetic tree indicated a subcluster comprised of both fungal and bacterial species. Due to nonavailability of experimental 3D structure for fungal 2-haloalkanoic acid dehalogenase in the PDB, molecular modelling study was performed for both fungal and bacterial sources of enzymes present in the subcluster. Further structural analysis revealed a common evolutionary topology shared between both fungal and bacterial enzymes. Studies on the buried amino acids showed highly conserved Leu and Ser in the core, despite variation in their amino acid percentage. Additionally, a surface exposed tryptophan was conserved in all of these selected models.

  13. Molecular phylogenetics and species delimitation of leaf-toed geckos (Phyllodactylidae: Phyllodactylus) throughout the Mexican tropical dry forest.

    Science.gov (United States)

    Blair, Christopher; Méndez de la Cruz, Fausto R; Law, Christopher; Murphy, Robert W

    2015-03-01

    Methods and approaches for accurate species delimitation continue to be a highly controversial subject in the systematics community. Inaccurate assessment of species' limits precludes accurate inference of historical evolutionary processes. Recent evidence suggests that multilocus coalescent methods show promise in delimiting species in cryptic clades. We combine multilocus sequence data with coalescence-based phylogenetics in a hypothesis-testing framework to assess species limits and elucidate the timing of diversification in leaf-toed geckos (Phyllodactylus) of Mexico's dry forests. Tropical deciduous forests (TDF) of the Neotropics are among the planet's most diverse ecosystems. However, in comparison to moist tropical forests, little is known about the mode and tempo of biotic evolution throughout this threatened biome. We find increased speciation and substantial, cryptic molecular diversity originating following the formation of Mexican TDF 30-20million years ago due to orogenesis of the Sierra Madre Occidental and Mexican Volcanic Belt. Phylogenetic results suggest that the Mexican Volcanic Belt, the Rio Fuerte, and Isthmus of Tehuantepec may be important biogeographic barriers. Single- and multilocus coalescent analyses suggest that nearly every sampling locality may be a distinct species. These results suggest unprecedented levels of diversity, a complex evolutionary history, and that the formation and expansion of TDF vegetation in the Miocene may have influenced subsequent cladogenesis of leaf-toed geckos throughout western Mexico. Copyright © 2015 Elsevier Inc. All rights reserved.

  14. A member of the HSP90 family from ovine Babesia in China: molecular characterization, phylogenetic analysis and antigenicity.

    Science.gov (United States)

    Guan, Guiquan; Liu, Junlong; Liu, Aihong; Li, Youquan; Niu, Qingli; Gao, Jinliang; Luo, Jianxun; Chauvin, Alain; Yin, Hong; Moreau, Emmanuelle

    2015-09-01

    Heat shock protein 90 (HSP90) is a key component of the molecular chaperone complex essential for activating many signalling proteins involved in the development and progression of pathogenic cellular transformation. A Hsp90 gene (BQHsp90) was cloned and characterized from Babesia sp. BQ1 (Lintan), an ovine Babesia isolate belonging to Babesia motasi-like group, by screening a cDNA expression library and performing rapid amplification of cDNA ends. The full-length cDNA of BQHsp90 is 2399 bp with an open reading frame of 2154 bp encoding a predicted 83 kDa polypeptide with 717 amino acid residues. It shows significant homology and similar structural characteristics to Hsp90 of other apicomplex organisms. Phylogenetic analysis, based on the HSP90 amino acid sequences, showed that the Babesia genus is clearly separated from other apicomplexa genera. Five Chinese ovine Babesia isolates were divided into 2 phylogenetic clusters, namely Babesia sp. Xinjiang (previously designated a new species) cluster and B. motasi-like cluster which could be further divided into 2 subclusters (Babesia sp. BQ1 (Lintan)/Babesia sp. Tianzhu and Babesia sp. BQ1 (Ningxian)/Babesia sp. Hebei). Finally, the antigenicity of rBQHSP90 protein from prokaryotic expression was also evaluated using western blot and enzyme-linked immunosorbent assay (ELISA).

  15. Molecular phylogenetics of the genus Neoconocephalus (orthoptera, tettigoniidae and the evolution of temperate life histories.

    Directory of Open Access Journals (Sweden)

    Robert L Snyder

    Full Text Available BACKGROUND: The katydid genus Neoconocephalus (25+ species has a prominent acoustic communication system and occurs in large parts of the Neotropics and Nearctic. This group has been subject of numerous behavioral, physiological, and evolutionary studies of its acoustic communication system. Two distinct life histories occur in this group: The tropical life history incorporates multiple generations/year and direct egg development without environmental triggers. Temperate life history is characterized by overwintering in the egg stage, cold trigger of egg development, and one generation/year. This study reconstructs the phylogenetic relationships within the genus to (1 determine the evolutionary history of the temperate life history, and (2 to support comparative studies of evolutionary and physiological problems in this genus. METHODOLOGY/PRINCIPAL FINDINGS: We used Amplified Fragment Length Polymorphisms (AFLP, and sequences of two nuclear loci and one mitochondrial locus to reconstruct phylogenetic relationships. The analysis included 17 ingroup and two outgroup species. AFLP and mitochondrial data provided resolution at the species level while the two nuclear loci revealed only deeper nodes. The data sets were combined in a super-matrix to estimate a total evidence tree. Seven of the temperate species form a monophyletic group; however, three more temperate species were placed as siblings of tropical species. CONCLUSIONS/SIGNIFICANCE: Our analyses support the reliability of the current taxonomic treatment of the Neoconocephalus fauna of Caribbean, Central, and North America. Ancestral state reconstruction of life history traits was not conclusive, however at least four transitions between life histories occurred among our sample of species. The proposed phylogeny will strengthen conclusions from comparative work in this group.

  16. Molecular phylogenetics, vocalizations, and species limits in Celeus woodpeckers (Aves: Picidae).

    Science.gov (United States)

    Benz, Brett W; Robbins, Mark B

    2011-10-01

    Species limits and the evolutionary mechanisms that have shaped diversification of woodpeckers and allies (Picidae) remain obscure, as inter and intraspecific phylogenetic relationships have yet to be comprehensively resolved for most genera. Herein, we analyzed 5020 base pairs of nucleotide sequence data from the mitochondrial and nuclear genomes to reconstruct the evolutionary history of Celeus woodpeckers. Broad geographic sampling was employed to assess species limits in phenotypically variable lineages and provide a first look at the evolution of song and plumage traits in this poorly known Neotropical genus. Our results strongly support the monophyly of Celeus and reveal several novel relationships across a shallow phylogenetic topology. We confirm the close sister relationship between Celeus spectabilis and the enigmatic Celeus obrieni, both of which form a clade with Celeus flavus. The Mesoamerican Celeus castaneus was placed as sister to a Celeus undatus-grammicus lineage, with the species status of the latter drawn into question given the lack of substantial genetic, morphological, and vocal variation in these taxa. We recovered paraphyly in Celeus elegans; however, this result appears to be the consequence of mitochondrial introgression from Celeus lugubris considering the monophyly of elegans at the ß-FIBI7 locus. A second instance of paraphyly was observed in Celeus flavescens with deep genetic splits and substantial phenotypic variation indicating the presence of two distinct species in this broadly distributed lineage. As such, we advocate elevation of Celeus flavescens ochraceus to species status. Our analysis of Celeus vocalizations and plumage characters demonstrates a pattern of lability consistent with a relatively recent origin of the genus and potentially rapid speciation history. Copyright © 2011 Elsevier Inc. All rights reserved.

  17. Molecular characterization and phylogenetic relatedness of dog-derived Rabies Viruses circulating in Cameroon between 2010 and 2016.

    Directory of Open Access Journals (Sweden)

    Serge Alain Sadeuh-Mba

    2017-10-01

    Full Text Available Rabies is enzootic among dog populations in some parts of Cameroon and the risk of human rabies is thought to be steadily high in these regions. However, the molecular epidemiology of circulating Rabies Virus (RABV has been hardly considered in Cameroon as well as in most neighboring central African countries. To address this fundamental gap, 76 nucleoprotein (N gene sequences of dog-derived RABV were obtained from 100 brain specimens sampled in Cameroon from 2010 to 2016. Studied sequences were subjected to molecular and phylogenetic analyses with reference strains retrieved from databases. The 71 studied Africa-1 isolates displayed 93.5-100% nucleotide (nt and 98.3-100% amino-acid (aa identities to each other while, the 5 studied Africa-2 isolates shared 99.4-99.7% sequence similarities at nt and aa levels. Maximum Likelihood based phylogenies inferred from nucleotide sequences confirmed all studied RABV isolates as members of the dog-related species 1 of the Lyssavirus genus. Individual isolates could be unambiguously assigned as either the Africa-1 subclade of the Cosmopolitan clade or the Africa 2 clade. The Africa-1 subclade appeared to be more prevalent and diversified. Indeed, 70 studied isolates segregated into 3 distinct circulating variants within Africa-1a lineage while a unique isolate was strikingly related to the Africa-1b lineage known to be prevalent in the neighboring Central African Republic and eastern Africa. Interestingly, all five Africa-2 isolates fell into the group-E lineage even though they appeared to be loosely related to databases available reference RABV; including those previously documented in Cameroon. This study uncovered the co-circulation of several Africa-1 and Africa-2 lineages in the southern regions of Cameroon. Striking phylogenetic outcasts to the geographic differentiation of RABV variants indicated that importation from close regions or neighboring countries apparently contributes to the sustainment

  18. Molecular characterization and phylogenetic relatedness of dog-derived Rabies Viruses circulating in Cameroon between 2010 and 2016.

    Science.gov (United States)

    Sadeuh-Mba, Serge Alain; Momo, Jean Blaise; Besong, Laura; Loul, Sévérin; Njouom, Richard

    2017-10-01

    Rabies is enzootic among dog populations in some parts of Cameroon and the risk of human rabies is thought to be steadily high in these regions. However, the molecular epidemiology of circulating Rabies Virus (RABV) has been hardly considered in Cameroon as well as in most neighboring central African countries. To address this fundamental gap, 76 nucleoprotein (N) gene sequences of dog-derived RABV were obtained from 100 brain specimens sampled in Cameroon from 2010 to 2016. Studied sequences were subjected to molecular and phylogenetic analyses with reference strains retrieved from databases. The 71 studied Africa-1 isolates displayed 93.5-100% nucleotide (nt) and 98.3-100% amino-acid (aa) identities to each other while, the 5 studied Africa-2 isolates shared 99.4-99.7% sequence similarities at nt and aa levels. Maximum Likelihood based phylogenies inferred from nucleotide sequences confirmed all studied RABV isolates as members of the dog-related species 1 of the Lyssavirus genus. Individual isolates could be unambiguously assigned as either the Africa-1 subclade of the Cosmopolitan clade or the Africa 2 clade. The Africa-1 subclade appeared to be more prevalent and diversified. Indeed, 70 studied isolates segregated into 3 distinct circulating variants within Africa-1a lineage while a unique isolate was strikingly related to the Africa-1b lineage known to be prevalent in the neighboring Central African Republic and eastern Africa. Interestingly, all five Africa-2 isolates fell into the group-E lineage even though they appeared to be loosely related to databases available reference RABV; including those previously documented in Cameroon. This study uncovered the co-circulation of several Africa-1 and Africa-2 lineages in the southern regions of Cameroon. Striking phylogenetic outcasts to the geographic differentiation of RABV variants indicated that importation from close regions or neighboring countries apparently contributes to the sustainment of the enzootic

  19. Evolutionary history of tall fescue morphotypes inferred from molecular phylogenetics of the Lolium-Festuca species complex

    Directory of Open Access Journals (Sweden)

    Stewart Alan V

    2010-10-01

    phylogenetic analysis of the Festuca genus to include representatives of each tall fescue morphotype, and to use low copy nuclear gene-derived sequences to identify putative progenitors of the polyploid species. The demonstration of distinct tall fescue lineages has implications for both taxonomy and molecular breeding strategies, and may facilitate the generation of morphotype and/or sub-genome-specific molecular markers.

  20. Molecular diagnostics of aleutian mink disease virus: applied use of next generation sequencing and phylogenetics

    DEFF Research Database (Denmark)

    Hagberg, Emma Elisabeth

    based either on partial or entire genes, or on pure epidemiological data. Thus, when initiating this project, little was known about AMDV’s total genomic diversity and how the virus was spread between farms. Recent advances in the field of molecular diagnostics have made high throughput tools...... could contribute to the elucidation of AMDV transmission between farms and improve molecular diagnostics. During the first phase of this project a method for performing whole genome sequencing of AMDV was developed. This protocol enabled the sequencing of a large number of in vivo infectious AMDV......-estimates. Altogether, the work presented in this thesis provides a contribution to the molecular diagnostics of AMDV, enables us better to understand the virus’ evolutionary behaviour in the context of mink farming, and is anticipated to be of value for more accurately tracing back in time the emergence of future...

  1. Molecular and phylogenetic analysis of Anaplasma spp. in sheep and goats from six provinces of China.

    Science.gov (United States)

    Zhang, Yan; Lv, Yali; Zhang, Feifei; Zhang, Wenjing; Wang, Jinhong; Cui, Yanyan; Wang, Rongjun; Jian, Fuchun; Zhang, Longxian; Ning, Changshen

    2016-12-30

    Members of the genus Anaplasma are important emerging tick-borne pathogens in both humans and animals in tropical and subtropical areas. Here, we investigated the presence of Anaplasma spp. in 621 sheep and 710 goats from six provinces of China. Polymerase chain reaction (PCR) and DNA sequencing were conducted to determine the prevalence of Anaplasma (A.) phagocytophilum, A. ovis and A. bovis targeting the 16S ribosomal RNA or the major surface protein 4 gene. PCR revealed Anaplasma in 39.0% (240/621) of sheep and 45.5% (323/710) of goats. The most frequently detected species was A. ovis (88/621, 14.2% for sheep; 129/710, 18.2% for goats), followed by A. bovis (60/621, 9.7% for sheep; 74/710, 10.4% for goats) and A. phagocytophilum (33/621, 5.3% for sheep; 15/710, 2.1% for goats). Additionally, eight sheep and 20 goats were found to be infected with three pathogens simultaneously. DNA sequencing confirmed the presence of these three Anaplasma species in the investigated areas, and phylogenetic analysis indicated that there was geographic segregation to a certain extent, as well as a relationship between the host and cluster of A. ovis. The results of the present study provide valuable data that helps understand the epidemiology of anaplasmosis in ruminants from China.

  2. Molecular characterization and phylogenetic analysis of Fasciola gigantica from western Java, Indonesia.

    Science.gov (United States)

    Hayashi, Kei; Ichikawa-Seki, Madoka; Allamanda, Puttik; Wibowo, Putut Eko; Mohanta, Uday Kumar; Sodirun; Guswanto, Azirwan; Nishikawa, Yoshifumi

    2016-10-01

    Fasciola gigantica and aspermic (hybrid) Fasciola flukes are thought to be distributed in Southeast Asian countries. The objectives of this study were to investigate the distribution of these flukes from unidentified ruminants in western Java, Indonesia, and to determine their distribution history into the area. Sixty Fasciola flukes from western Java were identified as F. gigantica based on the nucleotide sequences of the nuclear phosphoenolpyruvate carboxykinase (pepck) and DNA polymerase delta (pold) genes. The flukes were then analyzed phylogenetically based on the nucleotide sequence of the mitochondrial NADH dehydrogenase subunit 1 (nad1) gene, together with Fasciola flukes from other Asian countries. All but one F. gigantica fluke were classified in F. gigantica haplogroup C, which mainly contains nad1 haplotypes detected in flukes from Thailand, Vietnam, and China. A population genetic analysis suggested that haplogroup C spread from Thailand to the neighboring countries including Indonesia together with domestic ruminants, such as the swamp buffalo, Bubalus bubalis. The swamp buffalo is one of the important definitive hosts of Fasciola flukes in Indonesia, and is considered to have been domesticated in the north of Thailand. The remaining one fluke displayed a novel nad1 haplotype that has never been detected in the reference countries. Therefore, the origin of the fluke could not be established. No hybrid Fasciola flukes were detected in this study, in contrast to neighboring Asian countries. Copyright © 2016. Published by Elsevier Ireland Ltd.

  3. The age and evolution of sociality in Stegodyphus spiders: a molecular phylogenetic perspective

    DEFF Research Database (Denmark)

    Johannesen, Jes; Lubin, Yael; Smith, Deborah R.

    2007-01-01

    suggested to be unstable in evolutionary time, and hence sociality a rare phenomenon in spiders. Based on a partial molecular phylogeny of the genus Stegodyphus, we address the hypothesis that social spiders in this genus are evolutionary transient. We estimate the age of the three social species, test...

  4. Parasite histories and novel phylogenetic tools: alternative approaches to inferring parasite evolution from molecular markers

    Czech Academy of Sciences Publication Activity Database

    Hypša, Václav

    2006-01-01

    Roč. 36, č. 2 (2006), s. 141-155 ISSN 0020-7519 R&D Projects: GA ČR GA206/04/0520 Institutional research plan: CEZ:AV0Z60220518 Keywords : molecular phylogeny * parasite evolution Subject RIV: EE - Microbiology, Virology Impact factor: 3.337, year: 2006

  5. The phylogenetic position of Lygodactylus angularis and the utility of using the 16S rDNA gene for delimiting species in Lygodactylus (Squamata, Gekkonidae

    Directory of Open Access Journals (Sweden)

    Riccardo Castiglia

    2011-06-01

    Full Text Available The African genus Lygodactylus Gray, is composed of roughly 60 species of diurnal geckos that inhabit tropical and temperate Africa, Madagascar, and South America. In this study, we assessed the phylogenetic position of L. angularis, for which molecular data were so far lacking, by means of sequence analysis of the mitochondrial 16S rDNA gene. We also compared intraspecific vs. interspecific genetic divergences using an extended data set (34 species, 153 sequences, to determine whether a fragment of this gene can be useful for species identification and to reveal the possible existence of new cryptic species in the genus. The analysis placed L. angularis in a monophyletic group together with members of “fischeri” and “picturatus” groups. Nevertheless, the independence of the “angularis” lineage is supported by the high genetic divergence. Comparison of intraspecific vs. interspecific genetic distances highlights that, assuming an equal molecular rate of evolution among the studied species for the used gene, the threshold value useful for recognising a candidate new species can be tentatively placed at 7%. We identified four species that showed an intraspecific divergence higher than, or close to, the 7% threshold: L. capensis (8.7%, L. gutturalis (9.3%, L. madagascariensis (6.5% and L. picturatus (8.1%. Moreover, two species, L. mombasicus and L. verticillatus, are paraphyletic in terms of gene genealogy. Thus, the study shows that a short fragment of the 16S rDNA gene can be an informative tool for species-level taxonomy in the genus Lygodactylus.

  6. Molecular Characterization and Phylogenetic Analysis of Listeria monocytogenes Isolated from Milk and Milk Products in Kaduna, Nigeria

    Directory of Open Access Journals (Sweden)

    U. B. Usman

    2016-01-01

    Full Text Available In this study, Listeria (L. monocytogenes isolated from milk and milk products in Kaduna, Nigeria, were subjected to a multiplex PCR assay to identify virulence-associated genes (such as prf A, inl A, hly A, act A, and iap. Of the 36 isolates, 9 (25% were positive for one or two virulence-associated genes. Based on the sample type, 6 (16.9% of the isolates that possessed virulence-associated genes were obtained from raw milk, 2 (3.2% from “Manshanu,” and 1 (2.8% from “Kindrimo.” Sequence and phylogenetic analysis based on the 16S rRNA revealed that Nigerian L. monocytogenes isolates (NGA 34A, NGA 35A, NGA 41A, and NGA 38A, when compared with reference L. monocytogenes, were grouped into two distinct clusters, A and B, with sequence (NGA 34A, NGA 35A, and NGA 41A phylogenetically closer to J1776; N1-011A; R2-502; J1816; and J2-031, whereas L. monocytogenes isolate (NGA 38A clustered with EDG; J1-220; J1926; J1817; and J2-1091. The separation of the Nigerian L. monocytogenes isolates into linage A (responsible for epidemic listeriosis and lineage B (responsible for sporadic cases of listeriosis is of public health concern and that local isolates might have potentials for human food borne listeriosis based on the virulence factors so far identified.

  7. On the production of positive molecular ions in cometary comas

    International Nuclear Information System (INIS)

    Tarafdar, S.P.; Wickramasinghe, N.C.

    1977-01-01

    Positively charged molecular ions, such as H 2 O + , which have been observed in cometary comas, may be efficiently produced by the evaporation of positively charged clathrate grains of radii in the range approximately 10 -6 -10 -3 cm. Such grains may be expelled from nuclei of comets, along with gaseous molecules. Grain charging occurs via interaction with solar ultraviolet photons and/or solar wind protons. Observational data on the total quantities as well as the distributions of H 2 O and H 2 O + in cometary comas are shown to be in accord with detailed model calculations. (Auth.)

  8. Molecular characterization and phylogenetic analysis of human influenza A viruses isolated in Iran during the 2014-2015 season.

    Science.gov (United States)

    Moasser, Elham; Behzadian, Farida; Moattari, Afagh; Fotouhi, Fatemeh; Rahimi, Amir; Zaraket, Hassan; Hosseini, Seyed Younes

    2017-07-01

    Influenza A viruses are an important cause of severe infectious diseases in humans and are characterized by their fast evolution rate. Global monitoring of these viruses is critical to detect newly emerging variants during annual epidemics. Here, we sought to genetically characterize influenza A/H1N1pdm09 and A/H3N2 viruses collected in Iran during the 2014-2015 influenza season. A total of 200 nasopharyngeal swabs were collected from patients with influenza-like illnesses. Swabs were screened for influenza A and B using real-time PCR. Furthermore, positive specimens with high virus load underwent virus isolation and genetic characterization of their hemagglutinin (HA) and M genes. Of the 200 specimens, 80 were influenza A-positive, including 44 A/H1N1pdm09 and 36 A/H3N2, while 18 were influenza B-positive. Phylogenetic analysis of the HA genes of the A/H1N1pdm09 viruses revealed the circulation of clade 6C, characterized by amino acid substitutions D97N, V234I and K283E. Analysis of the A/H3N2 viruses showed a genetic drift from the vaccine strain A/Texas/50/2012 with 5 mutations (T128A, R142G, N145S, P198S and S219F) belonging to the antigenic sites A, B, and D of the HA protein. The A/H3N2 viruses belonged to phylogenetic clades 3C.2 and 3C.3. The M gene trees of the Iranian A/H1N1pdm09 and A/H3N2 mirrored the clustering patterns of their corresponding HA trees. Our results reveal co-circulation of several influenza A virus strains in Iran during the 2014-2015 influenza season.

  9. Molecular differentiation and phylogenetic analysis of the Egyptian foot-and-mouth disease virus SAT2.

    Science.gov (United States)

    El-Shehawy, Laila I; Abu-Elnaga, Hany I; Rizk, Sonia A; Abd El-Kreem, Ahmed S; Mohamed, A A; Fawzy, Hossam G

    2014-03-01

    In February 2012, a massive new foot-and-mouth disease (FMD) outbreak struck Egypt. In this work, one-step RT-PCR assays were used for in-house detection and differentiation of foot-and-mouth disease virus (FMDV) in Egypt in this year using pan-serotypic and serotype-targeting sequence primers. FMDV SAT2 was the dominant virus in the examined isolates from the epidemic. The complete VP1 coding regions of two isolates were sequenced. The two isolates had 99.2 % sequence identity to most contemporary Egyptian SAT2 reference viruses, whereas they had 89.7-90.1 % identity to the SAT2/EGY/2/2012 isolate, which was collected from Alexandria, Egypt, and previously sequenced by WRLFMD. Phylogenetic analysis showed that Egypt had one topotype and two lineage of FMDV SAT2 in 2012. The Egyptian and the Palestinian 2012 strains were associated mainly with topotype VII, lineage SAT2/VII/Ghb-12, while the virus isolated from Alexandria Governorate belonged to the SAT2/VII/Alx-12 lineage. Topotype VII also comprised lineages that included strains isolated from Libya in 2012 and 2003. Furthermore, within the same topotype, the Egyptian SAT2/2012 isolates were related to strains from Saudi Arabia, Sudan, Eritrea, Cameroon and Nigeria. Nevertheless, more epidemiological work with neighboring countries is needed to prevent cross-border spread of disease and to reach a precise conclusion about the origin of the 2012 FMDV SAT2 emergency in the Middle East.

  10. Molecular characterization and phylogenetic analysis of Sugarcane yellow leaf virus isolates from China.

    Science.gov (United States)

    Gao, San-Ji; Lin, Yi-Hua; Pan, Yong-Bao; Damaj, Mona B; Wang, Qin-Nan; Mirkov, T Erik; Chen, Ru-Kai

    2012-10-01

    Sugarcane yellow leaf virus (SCYLV) (genus Polerovirus, family Luteoviridae), the causal agent of sugarcane yellow leaf disease (YLD), was first detected in China in 2006. To assess the distribution of SCYLV in the major sugarcane-growing Chinese provinces, leaf samples from 22 sugarcane clones (Saccharum spp. hybrid) showing YLD symptoms were collected and analyzed for infection by the virus using reverse transcription PCR (RT-PCR), quantitative RT-PCR, and immunological assays. A complete genomic sequence (5,879 nt) of the Chinese SCYLV isolate CHN-FJ1 and partial genomic sequences (2,915 nt) of 13 other Chinese SCYLV isolates from this study were amplified, cloned, and sequenced. The genomic sequence of the CHN-FJ1 isolate was found to share a high identity (98.4-99.1 %) with those of the Brazilian (BRA) genotype isolates and a low identity (86.5-86.9 %) with those of the CHN1 and Cuban (CUB) genotype isolates. The genetic diversity of these 14 Chinese SCYLV isolates was assessed along with that of 29 SCYLV isolates of worldwide origin reported in the GenBank database, based on the full or partial genomic sequence. Phylogenetic analysis demonstrated that all the 14 Chinese SCYLV isolates clustered into one large group with the BRA genotype and 12 other reported SCYLV isolates. In addition, five reported Chinese SCYLV isolates were grouped with the Peruvian (PER), CHN1 and CUB genotypes. We therefore speculated that at least four SCYLV genotypes, BRA, PER, CHN1, and CUB, are associated with YLD in China. Interestingly, a 39-nt deletion was detected in the sequence of the CHN-GD3 isolate, in the middle of the ORF1 region adjacent to the overlap between ORF1 and ORF2. This location is known to be one of the recombination breakpoints in the Luteoviridae family.

  11. Hidden diversity and evolutionary trends in malacosporean parasites (Cnidaria: Myxozoa) identified using molecular phylogenetics

    Czech Academy of Sciences Publication Activity Database

    Bartošová, Pavla; Hrabcová, M.; Pecková, Hana; Patra, Sneha; Kodádková, Alena; Jurajda, Pavel; Tyml, Tomáš; Holzer, Astrid S.

    2014-01-01

    Roč. 44, č. 8 (2014), s. 565-577 ISSN 0020-7519 R&D Projects: GA ČR(CZ) GPP506/11/P724; GA ČR GBP505/12/G112; GA AV ČR(CZ) M200961205 Institutional support: RVO:60077344 ; RVO:68081766 Keywords : Buddenbrockia * Tetracapsuloides * diversity * phylogeny * Bryozoa * fish * cryptic * worm Subject RIV: EB - Genetics ; Molecular Biology; EG - Zoology (UBO-W) Impact factor: 3.872, year: 2014

  12. DOMINO: development of informative molecular markers for phylogenetic and genome-wide population genetic studies in non-model organisms.

    Science.gov (United States)

    Frías-López, Cristina; Sánchez-Herrero, José F; Guirao-Rico, Sara; Mora, Elisa; Arnedo, Miquel A; Sánchez-Gracia, Alejandro; Rozas, Julio

    2016-12-15

    The development of molecular markers is one of the most important challenges in phylogenetic and genome wide population genetics studies, especially in studies with non-model organisms. A highly promising approach for obtaining suitable markers is the utilization of genomic partitioning strategies for the simultaneous discovery and genotyping of a large number of markers. Unfortunately, not all markers obtained from these strategies provide enough information for solving multiple evolutionary questions at a reasonable taxonomic resolution. We have developed Development Of Molecular markers In Non-model Organisms (DOMINO), a bioinformatics tool for informative marker development from both next generation sequencing (NGS) data and pre-computed sequence alignments. The application implements popular NGS tools with new utilities in a highly versatile pipeline specifically designed to discover or select personalized markers at different levels of taxonomic resolution. These markers can be directly used to study the taxa surveyed for their design, utilized for further downstream PCR amplification in a broader set taxonomic scope, or exploited as suitable templates to bait design for target DNA enrichment techniques. We conducted an exhaustive evaluation of the performance of DOMINO via computer simulations and illustrate its utility to find informative markers in an empirical dataset. DOMINO is freely available from www.ub.edu/softevol/domino CONTACT: elsanchez@ub.edu or jrozas@ub.eduSupplementary information: Supplementary data are available at Bioinformatics online. © The Author 2016. Published by Oxford University Press. All rights reserved. For Permissions, please e-mail: journals.permissions@oup.com.

  13. Molecular phylogenetic analysis supports a Gondwanan origin of the Hyriidae (Mollusca: Bivalvia: Unionida) and the paraphyly of Australasian taxa.

    Science.gov (United States)

    Graf, Daniel L; Jones, Hugh; Geneva, Anthony J; Pfeiffer, John M; Klunzinger, Michael W

    2015-04-01

    The freshwater mussel family Hyriidae (Mollusca: Bivalvia: Unionida) has a disjunct trans-Pacific distribution in Australasia and South America. Previous phylogenetic analyses have estimated the evolutionary relationships of the family and the major infra-familial taxa (Velesunioninae and Hyriinae: Hyridellini in Australia; Hyriinae: Hyriini, Castaliini, and Rhipidodontini in South America), but taxon and character sampling have been too incomplete to support a predictive classification or allow testing of biogeographical hypotheses. We sampled 30 freshwater mussel individuals representing the aforementioned hyriid taxa, as well as outgroup species representing the five other freshwater mussel families and their marine sister group (order Trigoniida). Our ingroup included representatives of all Australian genera. Phylogenetic relationships were estimated from three gene fragments (nuclear 28S, COI and 16S mtDNA) using maximum parsimony, maximum likelihood, and Bayesian inference, and we applied a Bayesian relaxed clock model calibrated with fossil dates to estimate node ages. Our analyses found good support for monophyly of the Hyriidae and the subfamilies and tribes, as well as the paraphyly of the Australasian taxa (Velesunioninae, (Hyridellini, (Rhipidodontini, (Castaliini, Hyriini)))). The Hyriidae was recovered as sister to a clade comprised of all other Recent freshwater mussel families. Our molecular date estimation supported Cretaceous origins of the major hyriid clades, pre-dating the Tertiary isolation of South America from Antarctica/Australia. We hypothesize that early diversification of the Hyriidae was driven by terrestrial barriers on Gondwana rather than marine barriers following disintegration of the super-continent. Copyright © 2015 Elsevier Inc. All rights reserved.

  14. Calculation of evolutionary correlation between individual genes and full-length genome: a method useful for choosing phylogenetic markers for molecular epidemiology.

    Directory of Open Access Journals (Sweden)

    Shuai Wang

    Full Text Available Individual genes or regions are still commonly used to estimate the phylogenetic relationships among viral isolates. The genomic regions that can faithfully provide assessments consistent with those predicted with full-length genome sequences would be preferable to serve as good candidates of the phylogenetic markers for molecular epidemiological studies of many viruses. Here we employed a statistical method to evaluate the evolutionary relationships between individual viral genes and full-length genomes without tree construction as a way to determine which gene can match the genome well in phylogenetic analyses. This method was performed by calculation of linear correlations between the genetic distance matrices of aligned individual gene sequences and aligned genome sequences. We applied this method to the phylogenetic analyses of porcine circovirus 2 (PCV2, measles virus (MV, hepatitis E virus (HEV and Japanese encephalitis virus (JEV. Phylogenetic trees were constructed for comparisons and the possible factors affecting the method accuracy were also discussed in the calculations. The results revealed that this method could produce results consistent with those of previous studies about the proper consensus sequences that could be successfully used as phylogenetic markers. And our results also suggested that these evolutionary correlations could provide useful information for identifying genes that could be used effectively to infer the genetic relationships.

  15. Across Siberia and over Europe: Phylogenetic relationship of the freshwater fish genus Rhodeus in Europe and the phylogenetic position of R. sericeus from the River Amur.

    Czech Academy of Sciences Publication Activity Database

    Bohlen, Jörg; Šlechtová, Vendula; Bogutskaya, N. G.; Freyhof, J.

    2006-01-01

    Roč. 40, 3 (2006), s. 856-865 ISSN 1055-7903 R&D Projects: GA AV ČR IAA600450508; GA MŠk LC06073; GA MŽP SM/6/3/05 Institutional research plan: CEZ:AV0Z50450515 Keywords : Acheilognatinae * biogeography * freshwater fishes Subject RIV: EB - Genetics ; Molecular Biology Impact factor: 3.528, year: 2006

  16. Phylogenetic reconstruction of Syntermitinae (Isoptera, Termitidae based on morphological and molecular data.

    Directory of Open Access Journals (Sweden)

    Mauricio M Rocha

    Full Text Available The subfamily Syntermitinae comprises a group of Neotropical termites with 18 genera and 101 species described. It has been considered a natural group, but relationships among the genera within the subfamily remain uncertain, and some genera appear to be non-monophyletic. Here, we provide a comprehensive phylogeny including six Neotropical species of Termitinae as outgroup, 42 Syntermitinae species as ingroup, 92 morphological characters (from external and internal anatomy of soldier and worker castes and 117 molecular sequences (109 obtained for this study and 8 from GenBank of 4 gene regions (41 and 22 from Cytochrome Oxidase I and II respectively, 19 from Cytochrome b, and 35 from 16S rDNA. Morphological and molecular data were analyzed in combination, with the Bayesian inference method, and the important aspects of termite biology, defense and feeding habits are discussed based on the resulting tree. Although useful for providing diagnostic characters, the morphology of the soldier caste reveals several cases of convergence; whereas the feeding habit shows indications of evolutionary significance.

  17. Phylogenetic Study of Haemonchus Species from Iran Based On Morpho-Molecular Characterization.

    Directory of Open Access Journals (Sweden)

    Behnam Meshgi

    2015-06-01

    Full Text Available Haemonchosis has a negative effect on the farming industry throughout the world, especially in the tropic and sub-tropic countries. The present study was carried out to differentiate Haemonchus species from its main hosts in Iran, including sheep, goat and camel.The identification took place based on the morphometrics of the spicules and molecular characters. Two hundred seventy adult male nematodes were collected from the abomasums of different ruminants (90 samples from each animal at the slaughterhouses from different localities in Iran. Samples were morphologically identified according to the spicules' morphometric measurements. In the section on molecular study, 10 samples of each Haemonchus isolates were genetically examined. A simple PCR-restriction fragment length polymorphism (PCR-RFLP assay of the second internal transcribed spacer of ribosomal DNA (ITS2-rDNA were described to confirm the PCR results.PCR-RFLP profile obtained from the restriction enzyme HPa1 in H. contortus and H. longistipes indicated 1 (278 bp and 2 (113 and 135 bp different fragments, respectively. The morphological parameters clearly distinguish H. contortus from H. longistipes. Moreover, regarding the ITS2-rDNA, sequences of 295 bp and 314 bp were obtained from H. contortus and H. longistipes, respectively.The genotypic results are in agreement with the phenotypic findings of both species.

  18. Phylogenetic reconstruction of Syntermitinae (Isoptera, Termitidae) based on morphological and molecular data.

    Science.gov (United States)

    Rocha, Mauricio M; Morales-Corrêa E Castro, Adriana C; Cuezzo, Carolina; Cancello, Eliana M

    2017-01-01

    The subfamily Syntermitinae comprises a group of Neotropical termites with 18 genera and 101 species described. It has been considered a natural group, but relationships among the genera within the subfamily remain uncertain, and some genera appear to be non-monophyletic. Here, we provide a comprehensive phylogeny including six Neotropical species of Termitinae as outgroup, 42 Syntermitinae species as ingroup, 92 morphological characters (from external and internal anatomy of soldier and worker castes) and 117 molecular sequences (109 obtained for this study and 8 from GenBank) of 4 gene regions (41 and 22 from Cytochrome Oxidase I and II respectively, 19 from Cytochrome b, and 35 from 16S rDNA). Morphological and molecular data were analyzed in combination, with the Bayesian inference method, and the important aspects of termite biology, defense and feeding habits are discussed based on the resulting tree. Although useful for providing diagnostic characters, the morphology of the soldier caste reveals several cases of convergence; whereas the feeding habit shows indications of evolutionary significance.

  19. Molecular Characterization and Phylogenetic Analysis of Anaplasma spp. and Ehrlichia spp. Isolated from Various Ticks in Southeastern and Northwestern Regions of Iran.

    Science.gov (United States)

    Jafar Bekloo, Ahmad; Ramzgouyan, Maryam Roya; Shirian, Sadegh; Faghihi, Faezeh; Bakhshi, Hassan; Naseri, Fatemeh; Sedaghat, Mehdi; Telmadarraiy, Zakkyeh

    2018-05-01

    Anaplasma/Ehrlichia species are tick-transmitted pathogens that cause infections in humans and numerous domestic and wild animal species. There is no information available on the molecular characteristics and phylogenetic position of Anaplasma/Ehrlichia spp. isolated from tick species from different geographic locations in Iran. The aim of this study was to determine the prevalence, molecular characteristics, and phylogenetic relationship of both Anaplasma spp. and Ehrlichia spp. in tick species isolated from different domestic animals from two different geographical locations of Iran. A total of 930 ticks were collected from 93 cattle, 250 sheep, and 587 goats inhabiting the study areas. The collected ticks were then investigated for the presence of Anaplasma/Ehrlichia spp. using nested PCR based on the 16S rRNA gene, followed by sequencing. Sequence analysis was done based on the data published in the GenBank on Anaplasma/Ehrlichia spp. isolates using bioinformatic tools such as the standard nucleotide BLAST. Genome of Anaplasma or Ehrlichia spp. was detected in 14 ticks collected in Heris, including 5 Dermacentor marginatus, 1 Haemaphysalis erinacei, 3 Hyalomma anatolicum, and 4 Rhipicephalus sanguineus, also in 29 ticks collected in Chabahar, including 14 R. sanguineus, 8 D. marginatus, 3 Hyalomma Anatolicum, and 4 Hyalomma dromedarii. Partial analysis of the 16S rRNA gene sequence of positive samples collected from goats and sheep showed that they were infected with Anaplasma/Ehrlichia spp. that were 94-98% identical to ovine Anaplasma and 91-96% identical to Neoehrlichia and Ehrlichia spp. The various ticks identified in this study suggest the possible emergence of tick-borne diseases in animals and humans in these regions. R. sanguineus and D. marginatus seem to be predominant vectors responsible for anaplasmosis in these regions. Partial sequence analysis of the 16S rRNA gene showed that A. ovis is genetically polymorphic in these regions. Furthermore, an

  20. Molecular phylogenetic study of a myrmecophyte symbiosis: did Leonardoxa/ ant associations diversify via cospeciation?

    Science.gov (United States)

    Chenuil, A; McKey, D B

    1996-10-01

    The Leonardoxa africana (Leguminosae: Caesalpinioideae) complex is a group of four closely related taxa (L1 to L4) exhibiting various grades of specificity and specialization in mutualistic associations with ants. Each of the two most specialized species, Leonardoxa taxon 3 (L3) and L. africana sensu stricto (L4), interacts with a specific species of formicine ant, respectively Aphomomyrmex after and Petalomyrmex phylax, which nests in specialized swollen twigs. These two monotypic genera are the sole African members of the tribe Myrmelachistini, and their occurrence in closely related plants suggested thehypothesis that the two associations L4/Petalomyrmex and L3/Aphomomyrmex are derived by cospeciation from an ancestral association. Phylogenies based on DNA sequences were reconstructed for the ants and compared with phylogenies available for the plants in order to test for this hypothesis of cospeciation. The resulting topologies suggest either that the association with myrmelachistine ants arose several times or that a plant species (L2) and an ant population split off from an ancestral association. Furthermore, dates of speciation events appear to differ between ants and corresponding plants. An estimate of at least 4 million years was obtained for the separation of Aphomomyrmex and Petalomyrmex, whereas biological, biogeographic, and molecular-genetic data suggest a much more recent divergence for the plants. Thus, we reject the hypothesis of cospeciation and conclude that Aphomomyrmex and Petalomyrmex independently colonized different taxa of Leonardoxa. This striking instance of parallel evolution supports the notion that specific ant-plant associations originated by ecological fitting of preadapted partners. We discuss alternative evolutionary scenarios that are consistent with molecular data.

  1. Molecular and phylogenetic characterization of the sieve element occlusion gene family in Fabaceae and non-Fabaceae plants.

    Science.gov (United States)

    Rüping, Boris; Ernst, Antonia M; Jekat, Stephan B; Nordzieke, Steffen; Reineke, Anna R; Müller, Boje; Bornberg-Bauer, Erich; Prüfer, Dirk; Noll, Gundula A

    2010-10-08

    The phloem of dicotyledonous plants contains specialized P-proteins (phloem proteins) that accumulate during sieve element differentiation and remain parietally associated with the cisternae of the endoplasmic reticulum in mature sieve elements. Wounding causes P-protein filaments to accumulate at the sieve plates and block the translocation of photosynthate. Specialized, spindle-shaped P-proteins known as forisomes that undergo reversible calcium-dependent conformational changes have evolved exclusively in the Fabaceae. Recently, the molecular characterization of three genes encoding forisome components in the model legume Medicago truncatula (MtSEO1, MtSEO2 and MtSEO3; SEO = sieve element occlusion) was reported, but little is known about the molecular characteristics of P-proteins in non-Fabaceae. We performed a comprehensive genome-wide comparative analysis by screening the M. truncatula, Glycine max, Arabidopsis thaliana, Vitis vinifera and Solanum phureja genomes, and a Malus domestica EST library for homologs of MtSEO1, MtSEO2 and MtSEO3 and identified numerous novel SEO genes in Fabaceae and even non-Fabaceae plants, which do not possess forisomes. Even in Fabaceae some SEO genes appear to not encode forisome components. All SEO genes have a similar exon-intron structure and are expressed predominantly in the phloem. Phylogenetic analysis revealed the presence of several subgroups with Fabaceae-specific subgroups containing all of the known as well as newly identified forisome component proteins. We constructed Hidden Markov Models that identified three conserved protein domains, which characterize SEO proteins when present in combination. In addition, one common and three subgroup specific protein motifs were found in the amino acid sequences of SEO proteins. SEO genes are organized in genomic clusters and the conserved synteny allowed us to identify several M. truncatula vs G. max orthologs as well as paralogs within the G. max genome. The unexpected

  2. [Molecular diagnostics of ALK-positive lung cancer].

    Science.gov (United States)

    Tímár, József; Lotz, Gábor; Rásó, Erzsébet; Moldvay, Judit

    2017-09-20

    ALK translocation is the 3rd most frequent genetic aberration in lung adenocarcinoma, and several inhibitors are now clinically available in first and second line settings. Accordingly, molecular diagnostics of ALK-positive lung cancer is very important and can be done with the rational combination of several methods. All international recommendations suggest that, except for cytological samples, screening technology for ALK-positive tumors is immunohistochemistry using a validated test. It is highly recommended that in case of ALK protein positive samples gene translocation must be confirmed by fluorescent in situ hybridization (FISH). In case of cytological samples FISH technique must be used as ALK diagnostics. In equivocal cases the genetic alteration of ALK can be confirmed by alternative molecular techniques such as next generation sequencing or RNAbased PCR methods. Upon administration of ALK inhibitors, acquired resistance is frequent which is mostly due to ALK amplification and/or mutation. It is evident that the diagnostics of these secondary ALK gene alterations must be done from recurrent tumors or circulating nucleic acids.

  3. Phylogenetic analysis of molecular and morphological data highlights uncertainty in the relationships of fossil and living species of Elopomorpha (Actinopterygii: Teleostei).

    Science.gov (United States)

    Dornburg, Alex; Friedman, Matt; Near, Thomas J

    2015-08-01

    Elopomorpha is one of the three main clades of living teleost fishes and includes a range of disparate lineages including eels, tarpons, bonefishes, and halosaurs. Elopomorphs were among the first groups of fishes investigated using Hennigian phylogenetic methods and continue to be the object of intense phylogenetic scrutiny due to their economic significance, diversity, and crucial evolutionary status as the sister group of all other teleosts. While portions of the phylogenetic backbone for Elopomorpha are consistent between studies, the relationships among Albula, Pterothrissus, Notacanthiformes, and Anguilliformes remain contentious and difficult to evaluate. This lack of phylogenetic resolution is problematic as fossil lineages are often described and placed taxonomically based on an assumed sister group relationship between Albula and Pterothrissus. In addition, phylogenetic studies using morphological data that sample elopomorph fossil lineages often do not include notacanthiform or anguilliform lineages, potentially introducing a bias toward interpreting fossils as members of the common stem of Pterothrissus and Albula. Here we provide a phylogenetic analysis of DNA sequences sampled from multiple nuclear genes that include representative taxa from Albula, Pterothrissus, Notacanthiformes and Anguilliformes. We integrate our molecular dataset with a morphological character matrix that spans both living and fossil elopomorph lineages. Our results reveal substantial uncertainty in the placement of Pterothrissus as well as all sampled fossil lineages, questioning the stability of the taxonomy of fossil Elopomorpha. However, despite topological uncertainty, our integration of fossil lineages into a Bayesian time calibrated framework provides divergence time estimates for the clade that are consistent with previously published age estimates based on the elopomorph fossil record and molecular estimates resulting from traditional node-dating methods. Copyright

  4. Phylogenetic and Molecular Evolutionary Analysis of Mitophagy Receptors under Hypoxic Conditions

    Directory of Open Access Journals (Sweden)

    Xiaomei Wu

    2017-07-01

    Full Text Available As animals evolved to use oxygen as the main strategy to produce ATP through the process of mitochondrial oxidative phosphorylation, the ability to adapt to fluctuating oxygen concentrations is a crucial component of evolutionary pressure. Three mitophagy receptors, FUNDC1, BNIP3 and NIX, induce the removal of dysfunctional mitochondria (mitophagy under prolonged hypoxic conditions in mammalian cells, to maintain oxygen homeostasis and prevent cell death. However, the evolutionary origins and structure-function relationships of these receptors remain poorly understood. Here, we found that FUN14 domain-containing proteins are present in archaeal, bacterial and eukaryotic genomes, while the family of BNIP3 domain-containing proteins evolved from early animals. We investigated conservation patterns of the critical amino acid residues of the human mitophagy receptors. These residues are involved in receptor regulation, mainly through phosphorylation, and in interaction with LC3 on the phagophore. Whereas FUNDC1 may be able to bind to LC3 under the control of post-translational regulations during the early evolution of vertebrates, BINP3 and NIX had already gained the ability for LC3 binding in early invertebrates. Moreover, FUNDC1 and BNIP3 each lack a layer of phosphorylation regulation in fishes that is conserved in land vertebrates. Molecular evolutionary analysis revealed that BNIP3 and NIX, as the targets of oxygen sensing HIF-1α, showed higher rates of substitution in fishes than in mammals. Conversely, FUNDC1 and its regulator MARCH5 showed higher rates of substitution in mammals. Thus, we postulate that the structural traces of mitophagy receptors in land vertebrates and fishes may reflect the process of vertebrate transition from water onto land, during which the changes in atmospheric oxygen concentrations acted as a selection force in vertebrate evolution. In conclusion, our study, combined with previous experimental results, shows that

  5. Molecular evolution of glutamine synthetase II: Phylogenetic evidence of a non-endosymbiotic gene transfer event early in plant evolution

    Directory of Open Access Journals (Sweden)

    Tartar Aurélien

    2010-06-01

    Full Text Available Abstract Background Glutamine synthetase (GS is essential for ammonium assimilation and the biosynthesis of glutamine. The three GS gene families (GSI, GSII, and GSIII are represented in both prokaryotic and eukaryotic organisms. In this study, we examined the evolutionary relationship of GSII from eubacterial and eukaryotic lineages and present robust phylogenetic evidence that GSII was transferred from γ-Proteobacteria (Eubacteria to the Chloroplastida. Results GSII sequences were isolated from four species of green algae (Trebouxiophyceae, and additional green algal (Chlorophyceae and Prasinophytae and streptophyte (Charales, Desmidiales, Bryophyta, Marchantiophyta, Lycopodiophyta and Tracheophyta sequences were obtained from public databases. In Bayesian and maximum likelihood analyses, eubacterial (GSIIB and eukaryotic (GSIIE GSII sequences formed distinct clades. Both GSIIB and GSIIE were found in chlorophytes and early-diverging streptophytes. The GSIIB enzymes from these groups formed a well-supported sister clade with the γ-Proteobacteria, providing evidence that GSIIB in the Chloroplastida arose by horizontal gene transfer (HGT. Bayesian relaxed molecular clock analyses suggest that GSIIB and GSIIE coexisted for an extended period of time but it is unclear whether the proposed HGT happened prior to or after the divergence of the primary endosymbiotic lineages (the Archaeplastida. However, GSIIB genes have not been identified in glaucophytes or red algae, favoring the hypothesis that GSIIB was gained after the divergence of the primary endosymbiotic lineages. Duplicate copies of the GSIIB gene were present in Chlamydomonas reinhardtii, Volvox carteri f. nagariensis, and Physcomitrella patens. Both GSIIB proteins in C. reinhardtii and V. carteri f. nagariensis had N-terminal transit sequences, indicating they are targeted to the chloroplast or mitochondrion. In contrast, GSIIB proteins of P. patens lacked transit sequences, suggesting

  6. Phylogenetic reconstruction using secondary structures of Internal Transcribed Spacer 2 (ITS2, rDNA: finding the molecular and morphological gap in Caribbean gorgonian corals

    Directory of Open Access Journals (Sweden)

    Sánchez Juan A

    2007-06-01

    Full Text Available Abstract Background Most phylogenetic studies using current methods have focused on primary DNA sequence information. However, RNA secondary structures are particularly useful in systematics because they include characteristics, not found in the primary sequence, that give "morphological" information. Despite the number of recent molecular studies on octocorals, there is no consensus opinion about a region that carries enough phylogenetic resolution to solve intrageneric or close species relationships. Moreover, intrageneric morphological information by itself does not always produce accurate phylogenies; intra-species comparisons can reveal greater differences than intra-generic ones. The search for new phylogenetic approaches, such as by RNA secondary structure analysis, is therefore a priority in octocoral research. Results Initially, twelve predicted RNA secondary structures were reconstructed to provide the basic information for phylogenetic analyses; they accorded with the 6 helicoidal ring model, also present in other groups of corals and eukaryotes. We obtained three similar topologies for nine species of the Caribbean gorgonian genus Eunicea (candelabrum corals with two sister taxa as outgroups (genera Plexaura and Pseudoplexaura on the basis of molecular morphometrics of ITS2 RNA secondary structures only, traditional primary sequence analyses and maximum likelihood, and a Bayesian analysis of the combined data. The latter approach allowed us to include both primary sequence and RNA molecular morphometrics; each data partition was allowed to have a different evolution rate. In addition, each helix was partitioned as if it had evolved at a distinct rate. Plexaura flexuosa was found to group within Eunicea; this was best supported by both the molecular morphometrics and combined analyses. We suggest Eunicea flexuosa (Lamouroux, 1821 comb. nov., and we present a new species description including Scanning Electron Microscopy (SEM images of

  7. Molecular phylogenetics and anti-Pythium activity of endophytes from rhizomes of wild ginger congener, Zingiber zerumbet Smith.

    Science.gov (United States)

    Keerthi, D; Aswati Nair, R; Prasath, D

    2016-03-01

    Zingiber zerumbet, a perennial rhizomatous herb exhibits remarkable disease resistance as well as a wide range of pharmacological activities. Towards characterizing the endophytic population of Z. zerumbet rhizomes, experiments were carried out during two different growing seasons viz., early-June of 2013 and late-July of 2014. A total of 34 endophytes were isolated and categorized into 11 morphologically distinct groups. Fungi were observed to predominate bacterial species with colonization frequency values ranging from 12.5 to 50%. Among the 11 endophyte groups isolated, molecular analyses based on ITS/16S rRNA gene sequences identified seven isolate groups as Fusarium solani, two as F. oxysporum and one as the bacterium Rhizobium spp. Phylogenetic tree clustered the ITS sequences from Z. zerumbet endophytes into distinct clades consistent with morphological and sequence analysis. Dual culture assays were carried out to determine antagonistic activity of the isolated endophytes against Pythium myriotylum, an economically significant soil-borne phytopathogen of cultivated ginger. Experiments revealed significant P. myriotylum growth inhibition by F. solani and F. oxysporum isolates with percentage of inhibition (PoI) ranging from 45.17 ± 0.29 to 62.2 ± 2.58 with F. oxysporum exhibiting higher PoI values against P. myriotylum. Using ZzEF8 metabolite extract, concentration-dependent P. myriotylum hyphal growth inhibition was observed following radial diffusion assays. These observations were confirmed by scanning electron microscopy analysis wherein exposure to ZzEF8 metabolite extract induced hyphal deformities. Results indicate Z. zerumbet endophytes as promising resources for biologically active compounds and as biocontrol agents for soft rot disease management caused by Pythium spp.

  8. Leishmania tropica isolates from non-healed and healed patients in Iran: A molecular typing and phylogenetic analysis.

    Science.gov (United States)

    Bamorovat, Mehdi; Sharifi, Iraj; Mohammadi, Mohammad Ali; Eybpoosh, Sana; Nasibi, Saeid; Aflatoonian, Mohammad Reza; Khosravi, Ahmad

    2018-03-01

    The precise identification of the parasite species causing leishmaniasis is essential for selecting proper treatment modality. The present study aims to compare the nucleotide variations of the ITS1, 7SL RNA, and Hsp70 sequences between non-healed and healed anthroponotic cutaneous leishmaniasis (ACL) patients in major foci in Iran. A case-control study was carried out from September 2015 to October 2016 in the cities of Kerman and Bam, in the southeast of Iran. Randomly selected skin-scraping lesions of 40 patients (20 non-healed and 20 healed) were examined and the organisms were grown in a culture medium. Promastigotes were collected by centrifugation and kept for further molecular examinations. The extracted DNA was amplified and sequenced. After global sequence alignment with BioEdit software, maximum likelihood phylogenetic analysis was performed in PhyML for typing of Leishmania isolates. Nucleotide composition of each genetic region was also compared between non-healed and healed patients. Our results showed that all isolates belonged to the Leishmania tropica complex, with their genetic composition in the ITS1 region being different among non-healed and healed patients. 7SL RNA and Hsp70 regions were genetically identical between both groups. Variability in nucleotide patterns observed between both groups in the ITS1 region may serve to encourage future research on the function of these polymorphisms and may improve our understanding of the role of parasite genome properties on patients' response to Leishmania treatment. Our results also do not support future use of 7SL RNA and Hsp70 regions of the parasite for comparative genomic analyses. Copyright © 2018 Elsevier Ltd. All rights reserved.

  9. Molecular characterization and phylogenetic analysis of two novel regio-specific flavonoid prenyltransferases from Morus alba and Cudrania tricuspidata.

    Science.gov (United States)

    Wang, Ruishan; Chen, Ridao; Li, Jianhua; Liu, Xiao; Xie, Kebo; Chen, Dawei; Yin, Yunze; Tao, Xiaoyu; Xie, Dan; Zou, Jianhua; Yang, Lin; Dai, Jungui

    2014-12-26

    Prenylated flavonoids are attractive specialized metabolites with a wide range of biological activities and are distributed in several plant families. The prenylation catalyzed by prenyltransferases represents a Friedel-Crafts alkylation of the flavonoid skeleton in the biosynthesis of natural prenylated flavonoids and contributes to the structural diversity and biological activities of these compounds. To date, all identified plant flavonoid prenyltransferases (FPTs) have been identified in Leguminosae. In the present study two new FPTs, Morus alba isoliquiritigenin 3'-dimethylallyltransferase (MaIDT) and Cudrania tricuspidata isoliquiritigenin 3'-dimethylallyltransferase (CtIDT), were identified from moraceous plants M. alba and C. tricuspidata, respectively. MaIDT and CtIDT shared low levels of homology with the leguminous FPTs. MaIDT and CtIDT are predicted to be membrane-bound proteins with predicted transit peptides, seven transmembrane regions, and conserved functional domains that are similar to other homogentisate prenyltransferases. Recombinant MaIDT and CtIDT were able to regioselectively introduce dimethylallyl diphosphate into the A ring of three flavonoids with different skeleton types (chalcones, isoflavones, and flavones). Phylogenetic analysis revealed that MaIDT and CtIDT are distantly related to their homologs in Leguminosae, which suggests that FPTs in Moraceae and Leguminosae might have evolved independently. MaIDT and CtIDT represent the first two non-Leguminosae FPTs to be identified in plants and could thus lead to the identification of additional evolutionarily varied FPTs in other non-Leguminosae plants and could elucidate the biosyntheses of prenylated flavonoids in various plants. Furthermore, MaIDT and CtIDT might be used for regiospecific prenylation of flavonoids to produce bioactive compounds for potential therapeutic applications due to their high efficiency and catalytic promiscuity. © 2014 by The American Society for Biochemistry

  10. Molecular phylogenetic reconstruction and taxonomic investigation of eelpouts (Cottoidei: Zoarcales) based on Co-1 and Cyt-b mitochondrial genes.

    Science.gov (United States)

    Turanov, S V; Kartavtsev, Yu Ph; Lee, Y H; Jeong, D

    2017-07-01

    The infraorder Zoarcales (Cottoidei), or eelpouts, includes about 400 species of coldwater fishes concentrated mainly in the North Pacific. To date, the molecular phylogenetic methods in combination with morphological data have significantly contributed to understanding the taxonomic composition of this group and made it possible to confirm/refute validity of some families of obscure origin. In spite of the growing amount of new data on taxonomy and evolution of eelpouts, a consideration of the original and independent data is obviously needed to verify the existing knowledge of this taxon. In this study, which is based on concatenated matrix of Co-1 and Cyt-b mitochondrial genes, as well as relying on the samples from seven families and 45 species of eelpouts, we have reconstructed the phylogeny, which is generally consistent with previous inferences. Despite the resolution of the original data matrix is low, we have demonstrated the monophyletic origin of the families Zoarcidae and Anarhichadidae, as well as Neozoarcidae, previously related to Stichaeidae and recently revised Eulophiidae. The polyphyletic patterns amongst some subfamilies in Stichaeidae have been confirmed, whereas Opisthocentrinae and Pholidae seem to constitute a valid family-level taxon. Our results provide new opportunities with respect to taxonomic relationships in the complex and diverse group of eelpouts , whose part in the tree of life is not covered by recently flourishing multilocus phylogeny of teleost fishes. In light of the data obtained, the necessity of more unified and reproducible approaches to resolve the issues of evolution and taxonomy of such a complex group as Zoarcales becomes more evident.

  11. Identification of three new isolates of Tomato spotted wilt virus from different hosts in China: molecular diversity, phylogenetic and recombination analyses.

    Science.gov (United States)

    Zhang, Zhenjia; Wang, Deya; Yu, Chengming; Wang, Zenghui; Dong, Jiahong; Shi, Kerong; Yuan, Xuefeng

    2016-01-14

    Destructive diseases caused by Tomato spotted wilt virus (TSWV) have been reported associated with many important plants worldwide. Recently, TSWV was reported to infect different hosts in China. It is of value to clone TSWV isolates from different hosts and examine diversity and evolution among different TSWV isolates in China as well as worldwide. RT-PCR was used to clone the full-length genome (L, M and S segments) of three new isolates of TSWV that infected different hosts (tobacco, red pepper and green pepper) in China. Identity of nucleotide and amino acid sequences among TSWV isolates were analyzed by DNAMAN. MEGA 5.0 was used to construct phylogenetic trees. RDP4 was used to detect recombination events during evolution of these isolates. Whole-genome sequences of three new TSWV isolates in China were determined. Together with other available isolates, 29 RNA L, 62 RNA M and 66 RNA S of TSWV isolates were analyzed for molecular diversity, phylogenetic and recombination events. This analysis revealed that the entire TSWV genome, especially the M and S RNAs, had major variations in genomic size that mainly involve the A-U rich intergenic region (IGR). Phylogenetic analyses on TSWV isolates worldwide revealed evidence for frequent reassortments in the evolution of tripartite negative-sense RNA genome. Significant numbers of recombination events with apparent 5' regional preference were detected among TSWV isolates worldwide. Moreover, TSWV isolates with similar recombination events usually had closer relationships in phylogenetic trees. All five Chinese TSWV isolates including three TSWV isolates of this study and previously reported two isolates can be divided into two groups with different origins based on molecular diversity and phylogenetic analysis. During their evolution, both reassortment and recombination played roles. These results suggest that recombination could be an important mechanism in the evolution of multipartite RNA viruses, even negative

  12. The phylogenetic position of the roughskin skate Dipturus trachyderma (Krefft & Stehmann, 1975) (Rajiformes, Rajidae) inferred from the mitochondrial genome.

    Science.gov (United States)

    Vargas-Caro, Carolina; Bustamante, Carlos; Lamilla, Julio; Bennett, Michael B; Ovenden, Jennifer R

    2016-07-01

    The complete mitochondrial genome of the roughskin skate Dipturus trachyderma is described from 1 455 724 sequences obtained using Illumina NGS technology. Total length of the mitogenome was 16 909 base pairs, comprising 2 rRNAs, 13 protein-coding genes, 22 tRNAs and 2 non-coding regions. Phylogenetic analysis based on mtDNA revealed low genetic divergence among longnose skates, in particular, those dwelling the continental shelf and slope off the coasts of Chile and Argentina.

  13. Phylogenetic trees

    OpenAIRE

    Baños, Hector; Bushek, Nathaniel; Davidson, Ruth; Gross, Elizabeth; Harris, Pamela E.; Krone, Robert; Long, Colby; Stewart, Allen; Walker, Robert

    2016-01-01

    We introduce the package PhylogeneticTrees for Macaulay2 which allows users to compute phylogenetic invariants for group-based tree models. We provide some background information on phylogenetic algebraic geometry and show how the package PhylogeneticTrees can be used to calculate a generating set for a phylogenetic ideal as well as a lower bound for its dimension. Finally, we show how methods within the package can be used to compute a generating set for the join of any two ideals.

  14. First evidence of Leishmania infection in European brown hare (Lepus europaeus) in Greece: GIS analysis and phylogenetic position within the Leishmania spp.

    Science.gov (United States)

    Tsokana, C N; Sokos, C; Giannakopoulos, A; Mamuris, Z; Birtsas, P; Papaspyropoulos, K; Valiakos, G; Spyrou, V; Lefkaditis, M; Chatzopoulos, D C; Kantere, M; Manolakou, K; Touloudi, A; Burriel, A Rodi; Ferroglio, E; Hadjichristodoulou, C; Billinis, C

    2016-01-01

    Although the existence of a sylvatic transmission cycle of Leishmania spp., independent from the domestic cycle, has been proposed, data are scarce on Leishmania infection in wild mammals in Greece. In this study, we aimed to investigate the presence of Leishmania infection in the European brown hare in Greece, to infer the phylogenetic position of the Leishmania parasites detected in hares in Greece, and to identify any possible correlation between Leishmania infection in hares with environmental parameters, using the geographical information system (GIS). Spleen samples from 166 hares were tested by internal transcribed spacer-1 (ITS-1)-nested PCR for the detection of Leishmania DNA. Phylogenetic analysis was performed on Leishmania sequences from hares in Greece in conjunction with Leishmania sequences from dogs in Greece and 46 Leishmania sequences retrieved from GenBank. The Leishmania DNA prevalence in hares was found to be 23.49 % (95 % confidence interval (CI) 17.27-30.69). The phylogenetic analysis confirmed that the Leishmania sequences from hares in Greece belong in the Leishmania donovani complex. The widespread Leishmania infection in hares should be taken into consideration because under specific circumstances, this species can act as a reservoir host. This study suggests that the role of wild animals, including hares, in the epidemiology of Leishmania spp. in Greece deserves further elucidation.

  15. Molecular and phylogenetic characterizations of an Eimeria krijgsmanni Yakimoff & Gouseff, 1938 (Apicomplexa: Eimeriidae) mouse intestinal protozoan parasite by partial 18S ribosomal RNA gene sequence analysis.

    Science.gov (United States)

    Takeo, Toshinori; Tanaka, Tetsuya; Matsubayashi, Makoto; Maeda, Hiroki; Kusakisako, Kodai; Matsui, Toshihiro; Mochizuki, Masami; Matsuo, Tomohide

    2014-08-01

    Previously, we characterized an undocumented strain of Eimeria krijgsmanni by morphological and biological features. Here, we present a detailed molecular phylogenetic analysis of this organism. Namely, 18S ribosomal RNA gene (rDNA) sequences of E. krijgsmanni were analyzed to incorporate this species into a comprehensive Eimeria phylogeny. As a result, partial 18S rDNA sequence from E. krijgsmanni was successfully determined, and two different types, Type A and Type B, that differed by 1 base pair were identified. E. krijgsmanni was originally isolated from a single oocyst, and thus the result show that the two types might have allelic sequence heterogeneity in the 18S rDNA. Based on phylogenetic analyses, the two types of E. krijgsmanni 18S rDNA formed one of two clades among murine Eimeria spp.; these Eimeria clades reflected morphological similarity among the Eimeria spp. This is the third molecular phylogenetic characterization of a murine Eimeria spp. in addition to E. falciformis and E. papillata. Copyright © 2014 Elsevier Ireland Ltd. All rights reserved.

  16. Phylogenetic position of the North American isolate of Pasteuria that parasitizes the soybean cyst nematode, Heterodera glycines, as inferred from 16S rDNA sequence analysis.

    Science.gov (United States)

    Atibalentja, N; Noel, G R; Domier, L L

    2000-03-01

    A 1341 bp sequence of the 16S rDNA of an undescribed species of Pasteuria that parasitizes the soybean cyst nematode, Heterodera glycines, was determined and then compared with a homologous sequence of Pasteuria ramosa, a parasite of cladoceran water fleas of the family Daphnidae. The two Pasteuria sequences, which diverged from each other by a dissimilarity index of 7%, also were compared with the 16S rDNA sequences of 30 other bacterial species to determine the phylogenetic position of the genus Pasteuria among the Gram-positive eubacteria. Phylogenetic analyses using maximum-likelihood, maximum-parsimony and neighbour-joining methods showed that the Heterodera glycines-infecting Pasteuria and its sister species, P. ramosa, form a distinct line of descent within the Alicyclobacillus group of the Bacillaceae. These results are consistent with the view that the genus Pasteuria is a deeply rooted member of the Clostridium-Bacillus-Streptococcus branch of the Gram-positive eubacteria, neither related to the actinomycetes nor closely related to true endospore-forming bacteria.

  17. Selective constraints, molecular recombination structure and phylogenetic reconstruction of isometric plant RNA viruses of the families Luteoviridae and Tymoviridae.

    Science.gov (United States)

    Boulila, Moncef

    2011-02-01

    In an effort to enhance the knowledge on molecular evolution of currently the known members of the families Luteoviridae and Tymoviridae, in-depth molecular investigations in the entire genome of 147 accessions retrieved from the international databases, were carried out. Two algorithms (RECCO and RDP version 3.31β) adapted to the mosaic structure of viruses were utilized. The recombination frequency along the sequences was dissected and demonstrated that the three virus genera of the family Luteoviridae comprise numerous members subjected to recombination. It has pointed out that the major viruses swapped a few but long genomic segments. In addition, in Barley yellow dwarf virus, heredity material might be exchanged between two different serotypes. Even more, putative recombination events occurred between two different genera. Based on Fisher's Exact Test of Neutrality, positive selection acting on protein expression was detected only in the poleroviruses Cereal yellow dwarf virus, Potato leafroll virus and Wheat yellow dwarf virus. In contrast, several components of the family Tymoviridae were highly recombinant. Genomic portion exchange arose in many positions consisting of short fragments. Furthermore, no positive selection was detected. The evolutionary history showed, in the Luteoviridae, that all screened isolates split into three clusters corresponding to the three virus genera forming this family. Moreover, in the serotype PAV of Barley yellow dwarf virus, two major clades corresponding to PAV-USA and PAV-China, were delineated. Similarly, in the Tymoviridae, all analyzed isolates fell into four groups corresponding to the three virus genera composing this family along with the unclassified Tymoviridae. Inferred phylogenies reshuffled the existing classification and showed that Wheat yellow dwarf virus-RPV was genetically closely related to Cereal yellow dwarf virus and the unclassified Tymoviridae Grapevine syrah virus-1 constituted an integral part of

  18. Distinctive mitochondrial genome of Calanoid copepod Calanus sinicus with multiple large non-coding regions and reshuffled gene order: Useful molecular markers for phylogenetic and population studies

    Science.gov (United States)

    2011-01-01

    Background Copepods are highly diverse and abundant, resulting in extensive ecological radiation in marine ecosystems. Calanus sinicus dominates continental shelf waters in the northwest Pacific Ocean and plays an important role in the local ecosystem by linking primary production to higher trophic levels. A lack of effective molecular markers has hindered phylogenetic and population genetic studies concerning copepods. As they are genome-level informative, mitochondrial DNA sequences can be used as markers for population genetic studies and phylogenetic studies. Results The mitochondrial genome of C. sinicus is distinct from other arthropods owing to the concurrence of multiple non-coding regions and a reshuffled gene arrangement. Further particularities in the mitogenome of C. sinicus include low A + T-content, symmetrical nucleotide composition between strands, abbreviated stop codons for several PCGs and extended lengths of the genes atp6 and atp8 relative to other copepods. The monophyletic Copepoda should be placed within the Vericrustacea. The close affinity between Cyclopoida and Poecilostomatoida suggests reassigning the latter as subordinate to the former. Monophyly of Maxillopoda is rejected. Within the alignment of 11 C. sinicus mitogenomes, there are 397 variable sites harbouring three 'hotspot' variable sites and three microsatellite loci. Conclusion The occurrence of the circular subgenomic fragment during laboratory assays suggests that special caution should be taken when sequencing mitogenomes using long PCR. Such a phenomenon may provide additional evidence of mitochondrial DNA recombination, which appears to have been a prerequisite for shaping the present mitochondrial profile of C. sinicus during its evolution. The lack of synapomorphic gene arrangements among copepods has cast doubt on the utility of gene order as a useful molecular marker for deep phylogenetic analysis. However, mitochondrial genomic sequences have been valuable markers for

  19. Simultaneous analysis of five molecular markers provides a well-supported phylogenetic hypothesis for the living bony-tongue fishes (Osteoglossomorpha: Teleostei).

    Science.gov (United States)

    Lavoué, Sébastien; Sullivan, John P

    2004-10-01

    Fishes of the Superorder Osteoglossomorpha (the "bonytongues") constitute a morphologically heterogeneous group of basal teleosts, including highly derived subgroups such as African electric fishes, the African butterfly fish, and Old World knifefishes. Lack of consensus among hypotheses of osteoglossomorph relationships advanced during the past 30 years may be due in part to the difficulty of identifying shared derived characters among the morphologically differentiated extant families of this group. In this study, we present a novel phylogenetic hypothesis for this group, based on the analysis of more than 4000 characters from five molecular markers (the mitochondrial cytochrome b, 12S and 16S rRNA genes, and the nuclear genes RAG2 and MLL). Our taxonomic sampling includes one representative of each extant non-mormyrid osteoglossomorph genus, one representative for the monophyletic family Mormyridae, and four outgroup taxa within the basal Teleostei. Maximum parsimony analysis of combined and equally weighted characters from the five molecular markers and Bayesian analysis provide a single, well-supported, hypothesis of osteoglossomorph interrelationships and show the group to be monophyletic. The tree topology is the following: (Hiodon alosoides, (Pantodon buchholzi, (((Osteoglossum bicirrhosum, Scleropages sp.), (Arapaima gigas, Heterotis niloticus)), ((Gymnarchus niloticus, Ivindomyrus opdenboschi), ((Notopterus notopterus, Chitala ornata), (Xenomystus nigri, Papyrocranus afer)))))). We compare our results with previously published phylogenetic hypotheses based on morpho-anatomical data. Additionally, we explore the consequences of the long terminal branch length for the taxon Pantodon buchholzi in our phylogenetic reconstruction and we use the obtained phylogenetic tree to reconstruct the evolutionary history of electroreception in the Notopteroidei.

  20. A molecular phylogenetic reappraisal of the Hysteriaceae, Mytilinidiaceae and Gloniaceae (Pleosporomycetidae, Dothideomycetes) with keys to world species

    Science.gov (United States)

    Boehm, E.W.A.; Mugambi, G.K.; Miller, A.N.; Huhndorf, S.M.; Marincowitz, S.; Spatafora, J.W.; Schoch, C.L.

    2009-01-01

    A reappraisal of the phylogenetic integrity of bitunicate ascomycete fungi belonging to or previously affiliated with the Hysteriaceae, Mytilinidiaceae, Gloniaceae and Patellariaceae is presented, based on an analysis of 121 isolates and four nuclear genes, the ribosomal large and small subunits, transcription elongation factor 1 and the second largest RNA polymerase II subunit. A geographically diverse and high density taxon sampling strategy was employed, including multiple isolates/species from the following genera: Anteaglonium (6/4), Encephalographa (1/1), Farlowiella (3/1), Gloniopsis (8/4), Glonium (4/2), Hysterium (12/5), Hysterobrevium (14/3), Hysterographium (2/1), Hysteropatella (2/2), Lophium (4/2), Mytilinidion (13/10), Oedohysterium (5/3), Ostreichnion (2/2), Patellaria (1/1), Psiloglonium (11/3), Quasiconcha (1/1), Rhytidhysteron (8/3), and 24 outgroup taxa. Sequence data indicate that although the Hysteriales are closely related to the Pleosporales, sufficient branch support exists for their separation into separate orders within the Pleosporomycetidae. The Mytilinidiales are more distantly related within the subclass and show a close association with the Gloniaceae. Although there are examples of concordance between morphological and molecular data, these are few. Molecular data instead support the premise of a large number of convergent evolutionary lineages, which do not correspond to previously held assumptions of synapomorphy relating to spore morphology. Thus, within the Hysteriaceae, the genera Gloniopsis, Glonium, Hysterium and Hysterographium are highly polyphyletic. This necessitated the transfer of two species of Hysterium to Oedohysterium gen. nov. (Od. insidens comb. nov. and Od. sinense comb. nov.), the description of a new species, Hysterium barrianum sp. nov., and the transfer of two species of Gloniopsis to Hysterobrevium gen. nov. (Hb. smilacis comb. nov. and Hb. constrictum comb. nov.). While Hysterographium, with the type Hg

  1. Relationships among North American and Japanese Laetiporus isolates inferred from molecular phylogenetics and single-spore incompatibility reactions

    Science.gov (United States)

    Mark T. Banik; Daniel L. Lindner; Yuko Ota; Tsutomu Hattori

    2010-01-01

    Relationships were investigated among North American and Japanese isolates of Laetiporus using phylogenetic analysis of ITS sequences and single-spore isolate incompatibility. Single-spore isolate pairings revealed no significant compatibility between North American and Japanese isolates. ITS analysis revealed 12 clades within the core ...

  2. The cave beetle genus Anthroherpon is polyphyletic : molecular phylogenetics and description of Graciliella n. gen.(Leiodidae, Leptodirini)

    NARCIS (Netherlands)

    Njunji, Iva; Perreau, Michel; Hendriks, Kasper; Schilthuizen, Menno; Deharveng, Louis

    2016-01-01

    The subtribe Anthroherponina form an iconic group of obligate cave beetles, typical representatives of the Dinaric subterranean fauna, which is considered to be the richest in the world. Phylogenetic studies within this subtribe are scarce and based only on morphological characters, which, due to

  3. The cave beetle genus Anthroherpon is polyphyletic; molecular phylogenetics and description of Graciliella n. gen. (Leiodidae, Leptodirini)

    NARCIS (Netherlands)

    Njunjić, I.; Perreau, M.; Hendriks, K.; Schilthuizen, M.; Deharveng, L.

    2016-01-01

    The subtribe Anthroherponina form an iconic group of obligate cave beetles, typical representatives of the Dinaric subterranean fauna, which is considered to be the richest in the world. Phylogenetic studies within this subtribe are scarce and based only on morphological characters, which, due to

  4. On the phylogenetic position of Pseudophilomedinae within Sarsielloidea (Ostracoda, Myodocopida), with a description of one new Harbansus from Ningaloo Reef and redescription of H. paucichelatus from Yucatan

    Science.gov (United States)

    Karanovic, Ivana; Orduña-Martínez, Lorena; Ardisson, Pedro-Luis

    2015-03-01

    Previous studies have suggested incongruence between current systematics and molecular phylogenies of Sarsielloidea, with a possible polyphyly of the family Philomedidae. Here, we provide molecular phylogenetic analyses based on 18S rDNA and 28S rDNA. The former includes five new sequences and 12 from the GenBank, and the latter two new and six sequences from the GenBank. We use three methods, maximum likelihood, maximum parsimony, and neighbor joining, and all reconstructed phylogenies support previously suggested polyphyly, indicating a closer relationship of the subfamily Pseudophilomedinae with one subfamily of Sarsiellidae than with the nominotypical subfamily of Philomedidae. Morphological characters that may be key indicators of the phylogenetic relationships between three Sarsielloidea families are discussed. We also describe the 21st representative of the Pseudophilomedinae genus, Harbansus Kornicker, (Smith Contrib Zool 260:75, 1978), Harbansus ningalooi n. sp., from the Ningaloo Reef, Western Australia. This is the first Harbansus reported from the Australian west coast and the second from the Australian coral reef systems. It differs from all other congeners by peculiar claw-like processes on the posterior infold. Most Harbansus species have relatively restricted distributions, except Harbansus paucichelatus (Kornicker, in Inst Mar Sci 5:195-300, 1958), which has also been postulated to represent a species complex. We present a detailed morphological redescription of this species, based on the freshly collected material from the Yucatan Peninsula, as well as four mitochondrial COI sequences. These become the first COI sequences of the entire superfamily Sarsielloidea available on the GenBank. To facilitate future identification, we include a key to species of Harbansus.

  5. Testing morphologically based phylogenetic theories within the cartilaginous fishes with molecular data, with special reference to the catshark family (Chondrichthyes; Scyliorhinidae) and the interrelationships within them.

    Science.gov (United States)

    Human, Brett A; Owen, E Patricia; Compagno, Leonard J V; Harley, Eric H

    2006-05-01

    A molecular phylogenetic investigation was conducted to examine phylogenetic relationships between various members of the catsharks (Chondrichthyes; Carcharhiniformes; Scyliorhinidae), and is the largest chondrichthyan data set yet analysed, consisting of nearly 130,000 nucleotides. Three mitochondrial DNA genes were used to construct the phylogenies, cytochrome b, NADH-2, and NADH-4, with 41 sequences from 18 taxa being novel. These sequences were either used separately or combined into a single data set, and phylogenies were constructed using various methods, however, only the Bayesian inference tree derived from the cytochrome b data set was resolved sufficiently for phylogenetic inferences to be made. Interestingly, the family Scyliorhinidae was not supported by the results and was found to be paraphyletic. The Scyliorhininae and Pentanchinae were supported, whereas the Pentanchini clade was present, but not well supported. The Halaelurini hypothesis was supported with Holohalaelurus identified as the basal genus of that clade, and Haploblepharus edwardsii identified as the basal taxon for that genus. Elsewhere within the Chondrichthyes, the Carcharhiniformes and the Lamniformes were found to be monophyletic, and the Heterodontiformes was placed within the Squalimorphs. The placement of the skates and rays in these analyses support the Batoidea as being sister to the Elasmobranchii.

  6. Genomic characterization and phylogenetic position of two new species in Rhabdoviridae infecting the parasitic copepod, salmon louse (Lepeophtheirus salmonis).

    Science.gov (United States)

    Økland, Arnfinn Lodden; Nylund, Are; Øvergård, Aina-Cathrine; Blindheim, Steffen; Watanabe, Kuninori; Grotmol, Sindre; Arnesen, Carl-Erik; Plarre, Heidrun

    2014-01-01

    Several new viruses have emerged during farming of salmonids in the North Atlantic causing large losses to the industry. Still the blood feeding copepod parasite, Lepeophtheirus salmonis, remains the major challenge for the industry. Histological examinations of this parasite have revealed the presence of several virus-like particles including some with morphologies similar to rhabdoviruses. This study is the first description of the genome and target tissues of two new species of rhabdoviruses associated with pathology in the salmon louse. Salmon lice were collected at different Atlantic salmon (Salmo salar) farming sites on the west coast of Norway and prepared for histology, transmission electron microscopy and Illumina sequencing of the complete RNA extracted from these lice. The nearly complete genomes, around 11,600 nucleotides encoding the five typical rhabdovirus genes N, P, M, G and L, of two new species were obtained. The genome sequences, the putative protein sequences, and predicted transcription strategies for the two viruses are presented. Phylogenetic analyses of the putative N and L proteins indicated closest similarity to the Sigmavirus/Dimarhabdoviruses cluster, however, the genomes of both new viruses are significantly diverged with no close affinity to any of the existing rhabdovirus genera. In situ hybridization, targeting the N protein genes, showed that the viruses were present in the same glandular tissues as the observed rhabdovirus-like particles. Both viruses were present in all developmental stages of the salmon louse, and associated with necrosis of glandular tissues in adult lice. As the two viruses were present in eggs and free-living planktonic stages of the salmon louse vertical, transmission of the viruses are suggested. The tissues of the lice host, Atlantic salmon, with the exception of skin at the attachment site for the salmon louse chalimi stages, were negative for these two viruses.

  7. Genomic Characterization and Phylogenetic Position of Two New Species in Rhabdoviridae Infecting the Parasitic Copepod, Salmon Louse (Lepeophtheirus salmonis)

    Science.gov (United States)

    Økland, Arnfinn Lodden; Nylund, Are; Øvergård, Aina-Cathrine; Blindheim, Steffen; Watanabe, Kuninori; Grotmol, Sindre; Arnesen, Carl-Erik; Plarre, Heidrun

    2014-01-01

    Several new viruses have emerged during farming of salmonids in the North Atlantic causing large losses to the industry. Still the blood feeding copepod parasite, Lepeophtheirus salmonis, remains the major challenge for the industry. Histological examinations of this parasite have revealed the presence of several virus-like particles including some with morphologies similar to rhabdoviruses. This study is the first description of the genome and target tissues of two new species of rhabdoviruses associated with pathology in the salmon louse. Salmon lice were collected at different Atlantic salmon (Salmo salar) farming sites on the west coast of Norway and prepared for histology, transmission electron microscopy and Illumina sequencing of the complete RNA extracted from these lice. The nearly complete genomes, around 11 600 nucleotides encoding the five typical rhabdovirus genes N, P, M, G and L, of two new species were obtained. The genome sequences, the putative protein sequences, and predicted transcription strategies for the two viruses are presented. Phylogenetic analyses of the putative N and L proteins indicated closest similarity to the Sigmavirus/Dimarhabdoviruses cluster, however, the genomes of both new viruses are significantly diverged with no close affinity to any of the existing rhabdovirus genera. In situ hybridization, targeting the N protein genes, showed that the viruses were present in the same glandular tissues as the observed rhabdovirus-like particles. Both viruses were present in all developmental stages of the salmon louse, and associated with necrosis of glandular tissues in adult lice. As the two viruses were present in eggs and free-living planktonic stages of the salmon louse vertical, transmission of the viruses are suggested. The tissues of the lice host, Atlantic salmon, with the exception of skin at the attachment site for the salmon louse chalimi stages, were negative for these two viruses. PMID:25402203

  8. Genomic characterization and phylogenetic position of two new species in Rhabdoviridae infecting the parasitic copepod, salmon louse (Lepeophtheirus salmonis.

    Directory of Open Access Journals (Sweden)

    Arnfinn Lodden Økland

    Full Text Available Several new viruses have emerged during farming of salmonids in the North Atlantic causing large losses to the industry. Still the blood feeding copepod parasite, Lepeophtheirus salmonis, remains the major challenge for the industry. Histological examinations of this parasite have revealed the presence of several virus-like particles including some with morphologies similar to rhabdoviruses. This study is the first description of the genome and target tissues of two new species of rhabdoviruses associated with pathology in the salmon louse. Salmon lice were collected at different Atlantic salmon (Salmo salar farming sites on the west coast of Norway and prepared for histology, transmission electron microscopy and Illumina sequencing of the complete RNA extracted from these lice. The nearly complete genomes, around 11,600 nucleotides encoding the five typical rhabdovirus genes N, P, M, G and L, of two new species were obtained. The genome sequences, the putative protein sequences, and predicted transcription strategies for the two viruses are presented. Phylogenetic analyses of the putative N and L proteins indicated closest similarity to the Sigmavirus/Dimarhabdoviruses cluster, however, the genomes of both new viruses are significantly diverged with no close affinity to any of the existing rhabdovirus genera. In situ hybridization, targeting the N protein genes, showed that the viruses were present in the same glandular tissues as the observed rhabdovirus-like particles. Both viruses were present in all developmental stages of the salmon louse, and associated with necrosis of glandular tissues in adult lice. As the two viruses were present in eggs and free-living planktonic stages of the salmon louse vertical, transmission of the viruses are suggested. The tissues of the lice host, Atlantic salmon, with the exception of skin at the attachment site for the salmon louse chalimi stages, were negative for these two viruses.

  9. Targeted Enrichment of Large Gene Families for Phylogenetic Inference: Phylogeny and Molecular Evolution of Photosynthesis Genes in the Portullugo Clade (Caryophyllales).

    Science.gov (United States)

    Moore, Abigail J; Vos, Jurriaan M De; Hancock, Lillian P; Goolsby, Eric; Edwards, Erika J

    2018-05-01

    Hybrid enrichment is an increasingly popular approach for obtaining hundreds of loci for phylogenetic analysis across many taxa quickly and cheaply. The genes targeted for sequencing are typically single-copy loci, which facilitate a more straightforward sequence assembly and homology assignment process. However, this approach limits the inclusion of most genes of functional interest, which often belong to multi-gene families. Here, we demonstrate the feasibility of including large gene families in hybrid enrichment protocols for phylogeny reconstruction and subsequent analyses of molecular evolution, using a new set of bait sequences designed for the "portullugo" (Caryophyllales), a moderately sized lineage of flowering plants (~ 2200 species) that includes the cacti and harbors many evolutionary transitions to C$_{\\mathrm{4}}$ and CAM photosynthesis. Including multi-gene families allowed us to simultaneously infer a robust phylogeny and construct a dense sampling of sequences for a major enzyme of C$_{\\mathrm{4}}$ and CAM photosynthesis, which revealed the accumulation of adaptive amino acid substitutions associated with C$_{\\mathrm{4}}$ and CAM origins in particular paralogs. Our final set of matrices for phylogenetic analyses included 75-218 loci across 74 taxa, with ~ 50% matrix completeness across data sets. Phylogenetic resolution was greatly improved across the tree, at both shallow and deep levels. Concatenation and coalescent-based approaches both resolve the sister lineage of the cacti with strong support: Anacampserotaceae $+$ Portulacaceae, two lineages of mostly diminutive succulent herbs of warm, arid regions. In spite of this congruence, BUCKy concordance analyses demonstrated strong and conflicting signals across gene trees. Our results add to the growing number of examples illustrating the complexity of phylogenetic signals in genomic-scale data.

  10. Phylogenetic and taxonomic position of the genus Wollea with the description of Wollea salina sp. nov. (Cyanobacteria, Nostocales).

    Czech Academy of Sciences Publication Activity Database

    Kozlíková-Zapomělová, Eliška; Chatchawan, T.; Kaštovský, J.; Komárek, Jiří

    2016-01-01

    Roč. 16, č. 1 (2016), s. 43-55 ISSN 1802-5439 R&D Projects: GA ČR GAP506/12/1818; GA ČR(CZ) GA14-18067S; GA ČR(CZ) GA15-11912S Institutional support: RVO:60077344 ; RVO:67985939 Keywords : Anabaena * Cyanobacteria * ecology * molecular analyses * morphology * polyphasic approach * taxonomy * Wollea Subject RIV: EF - Botanics Impact factor: 1.350, year: 2016

  11. Phylogenetic Signal in AFLP Data Sets

    NARCIS (Netherlands)

    Koopman, W.J.M.

    2005-01-01

    AFLP markers provide a potential source of phylogenetic information for molecular systematic studies. However, there are properties of restriction fragment data that limit phylogenetic interpretation of AFLPs. These are (a) possible nonindependence of fragments, (b) problems of homology assignment

  12. Evaluation of positive Rift Valley fever virus formalin-fixed paraffin embedded samples as a source of sequence data for retrospective phylogenetic analysis.

    Science.gov (United States)

    Mubemba, B; Thompson, P N; Odendaal, L; Coetzee, P; Venter, E H

    2017-05-01

    Rift Valley fever (RVF), caused by an arthropod borne Phlebovirus in the family Bunyaviridae, is a haemorrhagic disease that affects ruminants and humans. Due to the zoonotic nature of the virus, a biosafety level 3 laboratory is required for isolation of the virus. Fresh and frozen samples are the preferred sample type for isolation and acquisition of sequence data. However, these samples are scarce in addition to posing a health risk to laboratory personnel. Archived formalin-fixed, paraffin-embedded (FFPE) tissue samples are safe and readily available, however FFPE derived RNA is in most cases degraded and cross-linked in peptide bonds and it is unknown whether the sample type would be suitable as reference material for retrospective phylogenetic studies. A RT-PCR assay targeting a 490 nt portion of the structural G N glycoprotein encoding gene of the RVFV M-segment was applied to total RNA extracted from archived RVFV positive FFPE samples. Several attempts to obtain target amplicons were unsuccessful. FFPE samples were then analysed using next generation sequencing (NGS), i.e. Truseq ® (Illumina) and sequenced on the Miseq ® genome analyser (Illumina). Using reference mapping, gapped virus sequence data of varying degrees of shallow depth was aligned to a reference sequence. However, the NGS did not yield long enough contigs that consistently covered the same genome regions in all samples to allow phylogenetic analysis. Copyright © 2017 Elsevier B.V. All rights reserved.

  13. Phylogenetic distribution of intron positions in alpha-amylase genes of bilateria suggests numerous gains and losses.

    Directory of Open Access Journals (Sweden)

    Jean-Luc Da Lage

    Full Text Available Most eukaryotes have at least some genes interrupted by introns. While it is well accepted that introns were already present at moderate density in the last eukaryote common ancestor, the conspicuous diversity of intron density among genomes suggests a complex evolutionary history, with marked differences between phyla. The question of the rates of intron gains and loss in the course of evolution and factors influencing them remains controversial. We have investigated a single gene family, alpha-amylase, in 55 species covering a variety of animal phyla. Comparison of intron positions across phyla suggests a complex history, with a likely ancestral intronless gene undergoing frequent intron loss and gain, leading to extant intron/exon structures that are highly variable, even among species from the same phylum. Because introns are known to play no regulatory role in this gene and there is no alternative splicing, the structural differences may be interpreted more easily: intron positions, sizes, losses or gains may be more likely related to factors linked to splicing mechanisms and requirements, and to recognition of introns and exons, or to more extrinsic factors, such as life cycle and population size. We have shown that intron losses outnumbered gains in recent periods, but that "resets" of intron positions occurred at the origin of several phyla, including vertebrates. Rates of gain and loss appear to be positively correlated. No phase preference was found. We also found evidence for parallel gains and for intron sliding. Presence of introns at given positions was correlated to a strong protosplice consensus sequence AG/G, which was much weaker in the absence of intron. In contrast, recent intron insertions were not associated with a specific sequence. In animal Amy genes, population size and generation time seem to have played only minor roles in shaping gene structures.

  14. Molecular Evolution and Phylogenetic Analysis of Eight COL Superfamily Genes in Group I Related to Photoperiodic Regulation of Flowering Time in Wild and Domesticated Cotton (Gossypium) Species

    Science.gov (United States)

    Zhang, Rui; Ding, Jian; Liu, Chunxiao; Cai, Caiping; Zhou, Baoliang; Zhang, Tianzhen; Guo, Wangzhen

    2015-01-01

    Flowering time is an important ecological trait that determines the transition from vegetative to reproductive growth. Flowering time in cotton is controlled by short-day photoperiods, with strict photoperiod sensitivity. As the CO-FT (CONSTANS-FLOWER LOCUS T) module regulates photoperiodic flowering in several plants, we selected eight CONSTANS genes (COL) in group I to detect their expression patterns in long-day and short-day conditions. Further, we individually cloned and sequenced their homologs from 25 different cotton accessions and one outgroup. Finally, we studied their structures, phylogenetic relationship, and molecular evolution in both coding region and three characteristic domains. All the eight COLs in group I show diurnal expression. In the orthologous and homeologous loci, each gene structure in different cotton species is highly conserved, while length variation has occurred due to insertions/deletions in intron and/or exon regions. Six genes, COL2 to COL5, COL7 and COL8, exhibit higher nucleotide diversity in the D-subgenome than in the A-subgenome. The Ks values of 98.37% in all allotetraploid cotton species examined were higher in the A-D and At-Dt comparison than in the A-At and D-Dt comparisons, and the Pearson’s correlation coefficient (r) of Ks between A vs. D and At vs. Dt also showed positive, high correlations, with a correlation coefficient of at least 0.797. The nucleotide polymorphism in wild species is significantly higher compared to G. hirsutum and G. barbadense, indicating a genetic bottleneck associated with the domesticated cotton species. Three characteristic domains in eight COLs exhibit different evolutionary rates, with the CCT domain highly conserved, while the B-box and Var domain much more variable in allotetraploid species. Taken together, COL1, COL2 and COL8 endured greater selective pressures during the domestication process. The study improves our understanding of the domestication-related genes/traits during cotton

  15. Molecular sleds comprising a positively -charged amino acid sequence and a molecular cargo and uses thereof

    NARCIS (Netherlands)

    Mangel, F Walter; Blainey, Paul C; Graziano, Vito; Herrmann, Andreas; McGrath, William J; van Oijen, Antonius Martinus; Xie, Xiaoliang Sunney

    2014-01-01

    The present invention relates to compositions which may comprise a molecular sled linked to cargo and uses thereof. In particular, the present invention relates to a non-naturally occurring or engineered composition which may comprise a molecular sled, linkers and a molecular cargo connected to the

  16. Phylogenetic Analysis and Molecular Characterization of Xanthium sibiricum Using DNA Barcoding, PCR-RFLP, and Specific Primers.

    Science.gov (United States)

    Tomasello, Salvatore; Heubl, Günther

    2017-07-01

    The fruits of Xanthium sibiricum have been widely used in traditional Chinese medicine for the treatment of nasal sinusitis and headaches. The genus Xanthium (cocklebur) is a taxonomically complex genus. Different taxonomic concepts have been proposed, some including several species, others lumping the different taxa in a few extremely polymorphic species. Due to the morphological similarities between species, the correct authentication of X. sibiricum is very difficult. Therefore, we established a polymerase chain reaction-restriction fragment length polymorphism method and diagnostic PCR based on nuclear internal transcribed spacer and chloroplast trnQ-rps16 barcodes to differentiate X. sibirium from related species.Results from the phylogenetic analyses based on sequence information from four marker regions (plastidal psbA-trnH and trnQ-rps16 and nuclear ITS and D35 ) support those taxonomic concepts accepting a reduced number of species, as four to five major clades are revealed in the phylogenetic reconstructions. X. sibiricum , together with some accessions from closely related taxa, is always supported as monophyletic, constituting a well-defined genetic entity. Allele-specific primer pairs for ITS and trnQ-rps16 were designed to amplify diagnostic products from the genomic DNA of X. sibiricum . Specific PCR in combination with digestion using the restriction enzyme Mse I allowed for the identification of X. sibiricum by producing specific restriction patterns. The results demonstrate that the applied techniques provide effective and accurate authentication of X. sibiricum . Georg Thieme Verlag KG Stuttgart · New York.

  17. Unique phylogenetic position of the African truffle-like fungus, Octaviania ivoryana (Boletaceae, Boletales), and the proposal of a new genus, Afrocastellanoa.

    Science.gov (United States)

    Orihara, Takamichi; Smith, Matthew E

    2017-01-01

    The sequestrate (truffle-like) basidiomycete Octaviania ivoryana was originally described based on collections from Zimbabwe, Kenya, Guinea, and Senegal. This species has basidiomes that stain blue-green and basidiospores with crowded spines that are characteristic of the genus Octaviania. However, O. ivoryana is the only Octaviania species described from sub-Saharan Africa, and the phylogenetic relationship of the species to other species of Octaviania sensu stricto has not been previously investigated. We examined the phylogenetic position of the isotype and paratype specimens of O. ivoryana based on two nuc rDNA loci-ITS1-5.8S-ITS2 (internal transcribed spacer [ITS]) and partial 28S-and the translation elongation factor 1-α gene. The resultant phylogenies indicate that O. ivoryana does not belong to Octaviania s. s. but instead forms a clade with the epigeous bolete genus, Porphyrellus sensu stricto (i.e., P. porphyrosporus and allies). The internal transcribed spacer phylogeny also recovers a monophyletic clade that includes sequences from O. ivoryana basidiomes as well as sequences from ectomycorrhizal root tips of Uapaca, Anthonotha, and assorted ectomycorrhizal Fabaceae species, suggesting that there is likely additional undescribed diversity within the lineage. We accordingly propose a new genus, Afrocastellanoa M.E. Sm. & Orihara, to accommodate the species O. ivoryana. Afrocastellanoa is morphologically distinct from Octaviania in the combination of a solid gleba, multilayered peridium, and the lack of distinct hymenium within the gleba. Our data suggest that the genus Afrocastellanoa is a unique sequestrate lineage with one described species and several undescribed species, all of which likely form ectomycorrhizas with African trees.

  18. Molecular characterization of Fasciola gigantica in Delhi, India and its phylogenetic relation to the species from South Asian countries.

    Science.gov (United States)

    Hayashi, Kei; Mohanta, Uday K; Neeraja, Tambireddy; Itagaki, Tadashi

    2016-10-01

    The aim of this study was to phylogenetically analyze Fasciola gigantica (F. gigantica) from mainland India and to reveal the expansion history of F. gigantica in the Indian subcontinent. We analyzed 40 Fasciola flukes that were collected from Delhi, in the Indian mainland, and identified them as F. gigantica by using nucleotide analyses of the nuclear phosphoenolpyruvate carboxykinase (pepck) and DNA polymerase delta (pold) genes. Based on the nucleotide sequence of mitochondrial NADH dehydrogenase subunit 1 (nad1) gene, the flukes had 18 haplotypes. The haplotypes were classified under haplogroup A, which is predominant in the F. gigantica of South Asia. The population genetics of haplogroup A revealed that Delhi population showed higher π value than eastern India population. These results suggest that F. gigantica of haplogroup A might have spread from the west to the east in India along with the artificial migration of the domestic Zebu cattle, Bos indicus.

  19. Molecular phylogenetics and comparative modeling of HEN1, a methyltransferase involved in plant microRNA biogenesis

    Directory of Open Access Journals (Sweden)

    Obarska Agnieszka

    2006-01-01

    Full Text Available Abstract Background Recently, HEN1 protein from Arabidopsis thaliana was discovered as an essential enzyme in plant microRNA (miRNA biogenesis. HEN1 transfers a methyl group from S-adenosylmethionine to the 2'-OH or 3'-OH group of the last nucleotide of miRNA/miRNA* duplexes produced by the nuclease Dicer. Previously it was found that HEN1 possesses a Rossmann-fold methyltransferase (RFM domain and a long N-terminal extension including a putative double-stranded RNA-binding motif (DSRM. However, little is known about the details of the structure and the mechanism of action of this enzyme, and about its phylogenetic origin. Results Extensive database searches were carried out to identify orthologs and close paralogs of HEN1. Based on the multiple sequence alignment a phylogenetic tree of the HEN1 family was constructed. The fold-recognition approach was used to identify related methyltransferases with experimentally solved structures and to guide the homology modeling of the HEN1 catalytic domain. Additionally, we identified a La-like predicted RNA binding domain located C-terminally to the DSRM domain and a domain with a peptide prolyl cis/trans isomerase (PPIase fold, but without the conserved PPIase active site, located N-terminally to the catalytic domain. Conclusion The bioinformatics analysis revealed that the catalytic domain of HEN1 is not closely related to any known RNA:2'-OH methyltransferases (e.g. to the RrmJ/fibrillarin superfamily, but rather to small-molecule methyltransferases. The structural model was used as a platform to identify the putative active site and substrate-binding residues of HEN and to propose its mechanism of action.

  20. Molecular detection and phylogenetic analysis of Hepatozoon spp. in questing Ixodes ricinus ticks and rodents from Slovakia and Czech Republic.

    Science.gov (United States)

    Hamšíková, Zuzana; Silaghi, Cornelia; Rudolf, Ivo; Venclíková, Kristýna; Mahríková, Lenka; Slovák, Mirko; Mendel, Jan; Blažejová, Hana; Berthová, Lenka; Kocianová, Elena; Hubálek, Zdeněk; Schnittger, Leonhard; Kazimírová, Mária

    2016-10-01

    By amplification and sequencing of 18S rRNA gene fragments, Hepatozoon spp. DNA was detected in 0.08 % (4/5057) and 0.04 % (1/2473) of questing Ixodes ricinus ticks from Slovakia and Czech Republic, respectively. Hepatozoon spp. DNA was also detected in spleen and/or lungs of 4.45 % (27/606) of rodents from Slovakia. Prevalence of infection was significantly higher in Myodes glareolus (11.45 %) than in Apodemus spp. (0.28 %) (P Hepatozoon spp. gene amplicons from I. ricinus showed 100 % identity with Hepatozoon canis isolates from red foxes or dogs in Europe. Phylogenetic analysis showed that at least two H. canis 18S rRNA genotypes exist in Slovakia of which one was identified also in the Czech Republic. The finding of H. canis in questing I. ricinus suggests the geographical spread of the parasite and a potential role of other ticks as its vectors in areas where Rhipicephalus sanguineus is not endemic. Sequencing of 18S rRNA gene amplicons from M. glareolus revealed the presence of two closely related genetic variants, Hepatozoon sp. SK1 and Hepatozoon sp. SK2, showing 99-100 % identity with isolates from M. glareolus from other European countries. Phylogenetic analysis demonstrates that 18S rRNA variants SK1 and SK2 correspond to previously described genotypes UR1 and UR2 of H. erhardovae, respectively. The isolate from Apodemus flavicollis (Hepatozoon sp. SK3b) was 99 % identical with isolates from reptiles in Africa and Asia. Further studies are necessary to identify the taxonomic status of Hepatozoon spp. parasitizing rodents in Europe and the host-parasite interactions in natural foci.

  1. On The Molecular Mechanism Of Positive Novolac Resists

    Science.gov (United States)

    Huang, Jian-Ping; Kwei, T. K.; Reiser, Arnost

    1989-08-01

    A molecular mechanism for the dissolution of novolac is proposed, based on the idea of a critical degree of deprotonation as being the condition for the transfer of polymer into solution. The rate at which the critical deprotonation condition is achieved is controlled by the supply of developer into a thin penetration zone, and depends in particular on the rate of diffusion of the base cations which are the developer component with the lowest mobility. The penetration zone contains phenolate ions and ion-bound water, but it retains the structure of a rigid polymer membrane, as evidenced by the diffusion coefficient of cations in the pene;tration zone which is several orders of magnitude slower than in an open gel of the same material. When the critical degree of deprotonation is reached, the membrane structure unravels and all subsequent events, chain rearrangement and transfer into solution, occur rapidly. The supralinear dependence of dissolution rate on base concentration and the effect of the size of the base cation are plausibly interpreted by the model. The diffusion of developer components is assumed to occur preferentially via hydrophilic sites in the polymer matrix. These sites define a diffusion path which acts like a hydrophilic diffusion channel. Suitably designed hydrophobic molecules can block some of the channels and in this way alter the dissolution rate. They reduce in effect the diffusion crossect ion of the material. Hydrophilic additives, on the other hand, introduce additional channels into the system and promote dissolution. The concept of diffusion channels appears to provide a unified interpretation for a number of common observations.

  2. Molecular diagnosis and phylogenetic analysis of Babesia bigemina and Babesia bovis hemoparasites from cattle in South Africa

    Science.gov (United States)

    2013-01-01

    Background Babesia parasites, mainly Babesia bovis and B. bigemina, are tick-borne hemoparasites inducing bovine babesiosis in cattle globally. The clinical signs of the disease include, among others, anemia, fever and hemoglobinuria. Babesiosis is known to occur in tropical and subtropical regions of the world. In this study, we aim to provide information about the occurrence and phylogenetic relationship of B. bigemina and B. bovis species in cattle from different locations in nine provinces of South Africa. A total of 430 blood samples were randomly collected from apparently healthy cattle. These samples were genetically tested for Babesia parasitic infections using nested PCR assays with species-specific primers. Results Nested PCR assays with Group I primer sets revealed that the overall prevalence of B. bigemina and B. bovis in all bovine samples tested was 64.7% (95% CI = 60.0-69.0) and 35.1% (95% CI = 30.6-39.8), respectively. Only 117/430 (27.2%) animals had a mixed infection. The highest prevalence of 87.5% (95% CI = 77.2-93.5) for B. bigemina was recorded in the Free State province collection sites (Ficksburg, Philippolis and Botshabelo), while North West collection sites had the highest number of animals infected with B. bovis (65.5%; 95% CI = 52.7-76.4). Phylograms were inferred based on B. bigemina-specific gp45 and B. bovis-specific rap-1 nucleotide sequences obtained with Group II nested PCR primers. Phylogenetic analysis of gp45 sequences revealed significant differences in the genotypes of B. bigemina isolates investigated, including those of strains published in GenBank. On the other hand, a phylogeny based on B. bovis rap-1 sequences indicated a similar trend of clustering among the sequences of B. bovis isolates investigated in this study. Conclusion This study demonstrates the occurrence of Babesia parasites in cattle from different provinces of South Africa. It was also noted that the situation of Babesia parasitic infection

  3. Molecular diagnosis and phylogenetic analysis of Babesia bigemina and Babesia bovis hemoparasites from cattle in South Africa.

    Science.gov (United States)

    Mtshali, Moses Sibusiso; Mtshali, Phillip Senzo

    2013-08-08

    Babesia parasites, mainly Babesia bovis and B. bigemina, are tick-borne hemoparasites inducing bovine babesiosis in cattle globally. The clinical signs of the disease include, among others, anemia, fever and hemoglobinuria. Babesiosis is known to occur in tropical and subtropical regions of the world. In this study, we aim to provide information about the occurrence and phylogenetic relationship of B. bigemina and B. bovis species in cattle from different locations in nine provinces of South Africa. A total of 430 blood samples were randomly collected from apparently healthy cattle. These samples were genetically tested for Babesia parasitic infections using nested PCR assays with species-specific primers. Nested PCR assays with Group I primer sets revealed that the overall prevalence of B. bigemina and B. bovis in all bovine samples tested was 64.7% (95% CI = 60.0-69.0) and 35.1% (95% CI = 30.6-39.8), respectively. Only 117/430 (27.2%) animals had a mixed infection. The highest prevalence of 87.5% (95% CI = 77.2-93.5) for B. bigemina was recorded in the Free State province collection sites (Ficksburg, Philippolis and Botshabelo), while North West collection sites had the highest number of animals infected with B. bovis (65.5%; 95% CI = 52.7-76.4). Phylograms were inferred based on B. bigemina-specific gp45 and B. bovis-specific rap-1 nucleotide sequences obtained with Group II nested PCR primers. Phylogenetic analysis of gp45 sequences revealed significant differences in the genotypes of B. bigemina isolates investigated, including those of strains published in GenBank. On the other hand, a phylogeny based on B. bovis rap-1 sequences indicated a similar trend of clustering among the sequences of B. bovis isolates investigated in this study. This study demonstrates the occurrence of Babesia parasites in cattle from different provinces of South Africa. It was also noted that the situation of Babesia parasitic infection in cattle from certain areas

  4. Molecular characterization and phylogenetic analysis of infectious bursal disease viruses isolated from chicken in South China in 2011.

    Science.gov (United States)

    Liu, Di; Zhang, Xiang-Bin; Yan, Zhuan-Qiang; Chen, Feng; Ji, Jun; Qin, Jian-Ping; Li, Hai-Yan; Lu, Jun-Peng; Xue, Yu; Liu, Jia-Jia; Xie, Qing-Mei; Ma, Jing-Yun; Xue, Chun-Yi; Bee, Ying-Zuo

    2013-06-01

    Infectious bursal disease virus (IBDV) is a double-stranded RNA virus that causes immunosuppressive disease in young chickens. Thousands of cases of IBDV infection are reported each year in South China, and these infections can result in considerable economic losses to the poultry industry. To monitor variations of the virus during the outbreaks, 30 IBDVs were identified from vaccinated chicken flocks from nine provinces in South China in 2011. VP2 fragments from different virus strains were sequenced and analyzed by comparison with the published sequences of IBDV strains from China and around the world. Phylogenetic analysis of hypervariable regions of the VP2 (vVP2) gene showed that 29 of the isolates were very virulent (vv) IBDVs, and were closely related to vvIBDV strains from Europe and Asia. Alignment analysis of the deduced amino acid (aa) sequences of vVP2 showed the 29 vv isolates had high uniformity, indicated low variability and slow evolution of the virus. The non-vvIBDV isolate JX2-11 was associated with higher than expected mortality, and had high deduced aa sequence similarity (99.2 %) with the attenuated vaccine strain B87 (BJ). The present study has demonstrated the continued circulation of IBDV strains in South China, and emphasizes the importance of reinforcing IBDV surveillance.

  5. Molecular phylogenetic studies on an unnamed bovine Babesia sp. based on small subunit ribosomal RNA gene sequences.

    Science.gov (United States)

    Luo, Jianxun; Yin, Hong; Liu, Zhijie; Yang, Dongying; Guan, Guiquan; Liu, Aihong; Ma, Miling; Dang, Shengzhi; Lu, Bingyi; Sun, Caiqin; Bai, Qi; Lu, Wenshun; Chen, Puyan

    2005-10-10

    The 18S small subunit ribosomal RNA (18S rRNA) gene of an unnamed Babesia species (designated B. U sp.) was sequenced and analyzed in an attempt to distinguish it from other Babesia species in China. The target DNA segment was amplified by polymerase chain reaction (PCR). The PCR product was ligated to the pGEM-T Easy vector for sequencing. It was found that the length of the 18S rRNA gene of all B. U sp. Kashi 1 and B. U sp. Kashi 2 was 1699 bp and 1689 bp. Two phylogenetic trees were, respectively, inferred based on 18S rRNA sequence of the Chinese bovine Babesia isolates and all of Babesia species available in GenBank. The first tree showed that B. U sp. was situated in the branch between B. major Yili and B. bovis Shannxian, and the second tree revealed that B. U sp. was confined to the same group as B. caballi. The percent identity of B. U sp. with other Chinese Babesia species was between 74.2 and 91.8, while the percent identity between two B. U sp. isolates was 99.7. These results demonstrated that this B. U sp. is different from other Babesia species, but that two B. U sp. isolates obtained with nymphal and adultal Hyalomma anatolicum anatolicum tick belong to the same species.

  6. Pyruvate:Quinone Oxidoreductase in Corynebacterium glutamicum: Molecular Analysis of the pqo Gene, Significance of the Enzyme, and Phylogenetic Aspects

    Czech Academy of Sciences Publication Activity Database

    Schreiner, M. E.; Riedel, Ch.; Holátko, Jiří; Pátek, Miroslav; Eikmanns, B. J.

    2006-01-01

    Roč. 188, č. 4 (2006), s. 1341-1350 ISSN 0021-9193 R&D Projects: GA ČR GA525/04/0548 Institutional research plan: CEZ:AV0Z50200510 Keywords : corynebacterium glutamicum * pqo * molecular analysis Subject RIV: EE - Microbiology, Virology Impact factor: 3.993, year: 2006

  7. Peculiarities of inflorescences morphogenesis in model representatives of the Celastraceae R.Br. in context of molecular phylogenetic data

    Directory of Open Access Journals (Sweden)

    Ivan A. Savinov

    2014-04-01

    Full Text Available Peculiarities of laying and forming of inflorescences for model representatives of the Celastraceae are studied. Specific characters in rhythm development of generative elements for different taxa are determined. Morphological markers, which are coincided completely with molecular characters, are determined. They are evidenced on closely relation between next taxa: Celastrus and Tripterygium, Salacia and Sarawakodendron, Salacia and Brexia.

  8. The phylogenetic intrarelationships of spiny-rayed fishes (Acanthomorpha, Teleostei, Actinopterygii: fossil taxa increase the congruence of morphology with molecular data

    Directory of Open Access Journals (Sweden)

    Donald Davesne

    2016-11-01

    Full Text Available Acanthomorpha (spiny-rayed fishes is a clade of teleosts that includes more than 15 000 extant species. Their deep phylogenetic intrarelationships, first reconstructed using morphological characters, have been extensively revised with molecular data. Moreover, the deep branches of the acanthomorph tree are still largely unresolved, with strong disagreement between studies. Here, we review the historical propositions for acanthomorph deep intrarelationships and attempt to resolve their earliest branching patterns using a new morphological data matrix compiling and revising characters from previous studies. The taxon sampling we use constitutes a first attempt to test all previous hypotheses (molecular and morphological alike with morphological data only. Our sampling also includes Late Cretaceous fossil taxa, which yield new character state combinations that are absent in extant taxa. Analysis of the complete morphological data matrix yields a new topology that shows remarkable congruence with the well-supported molecular results. Lampridiformes (oarfishes and allies are the sister to all other acanthomorphs. Gadiformes (cods and allies and Zeiformes (dories form a clade with Percopsiformes (trout-perches and the enigmatic Polymixia (beardfish and Stylephorus (tube-eye. Ophidiiformes (cusk-eels and allies and Batrachoidiformes (toadfishes are nested within Percomorpha, the clade that includes most of modern acanthomorph diversity. These results provide morphological synapomorphies and independent corroboration of clades previously only recovered from molecular data, thereby suggesting the emergence of a congruent picture of acanthomorph deep intrarelationships. Fossil taxa play a critical role in achieving this congruence, since a very different topology is found when they are excluded from the analysis.

  9. Archigregarines of the English Channel revisited: New molecular data on Selenidium species including early described and new species and the uncertainties of phylogenetic relationships.

    Directory of Open Access Journals (Sweden)

    Sonja Rueckert

    Full Text Available Gregarines represent an important transition step from free-living predatory (colpodellids s.l. and/or photosynthetic (Chromera and Vitrella apicomplexan lineages to the most important pathogens, obligate intracellular parasites of humans and domestic animals such as coccidians and haemosporidians (Plasmodium, Toxoplasma, Eimeria, Babesia, etc.. While dozens of genomes of other apicomplexan groups are available, gregarines are barely entering the molecular age. Among the gregarines, archigregarines possess a unique mixture of ancestral (myzocytosis and derived (lack of apicoplast, presence of subpellicular microtubules features.In this study we revisited five of the early-described species of the genus Selenidium including the type species Selenidium pendula, with special focus on surface ultrastructure and molecular data. We were also able to describe three new species within this genus. All species were characterized at morphological (light and scanning electron microscopy data and molecular (SSU rDNA sequence data levels. Gregarine specimens were isolated from polychaete hosts collected from the English Channel near the Station Biologique de Roscoff, France: Selenidium pendula from Scolelepis squamata, S. hollandei and S. sabellariae from Sabellaria alveolata, S. sabellae from Sabella pavonina, Selenidium fallax from Cirriformia tentaculata, S. spiralis sp. n. and S. antevariabilis sp. n. from Amphitritides gracilis, and S. opheliae sp. n. from Ophelia roscoffensis. Molecular phylogenetic analyses of these data showed archigregarines clustering into five separate clades and support previous doubts about their monophyly.Our phylogenies using the extended gregarine sampling show that the archigregarines are indeed not monophyletic with one strongly supported clade of Selenidium sequences around the type species S. pendula. We suggest the revision of the whole archigregarine taxonomy with only the species within this clade remaining in the genus

  10. Highly pathogenic avian influenza virus subtype H5N1 in Africa: a comprehensive phylogenetic analysis and molecular characterization of isolates.

    Directory of Open Access Journals (Sweden)

    Giovanni Cattoli

    Full Text Available Highly pathogenic avian influenza virus A/H5N1 was first officially reported in Africa in early 2006. Since the first outbreak in Nigeria, this virus spread rapidly to other African countries. From its emergence to early 2008, 11 African countries experienced A/H5N1 outbreaks in poultry and human cases were also reported in three of these countries. At present, little is known of the epidemiology and molecular evolution of A/H5N1 viruses in Africa. We have generated 494 full gene sequences from 67 African isolates and applied molecular analysis tools to a total of 1,152 A/H5N1 sequences obtained from viruses isolated in Africa, Europe and the Middle East between 2006 and early 2008. Detailed phylogenetic analyses of the 8 gene viral segments confirmed that 3 distinct sublineages were introduced, which have persisted and spread across the continent over this 2-year period. Additionally, our molecular epidemiological studies highlighted the association between genetic clustering and area of origin in a majority of cases. Molecular signatures unique to strains isolated in selected areas also gave us a clearer picture of the spread of A/H5N1 viruses across the continent. Mutations described as typical of human influenza viruses in the genes coding for internal proteins or associated with host adaptation and increased resistance to antiviral drugs have also been detected in the genes coding for transmembrane proteins. These findings raise concern for the possible human health risk presented by viruses with these genetic properties and highlight the need for increased efforts to monitor the evolution of A/H5N1 viruses across the African continent. They further stress how imperative it is to implement sustainable control strategies to improve animal and public health at a global level.

  11. Circulation of different lineages of Dengue virus 2, genotype American/Asian in Brazil: dynamics and molecular and phylogenetic characterization.

    Directory of Open Access Journals (Sweden)

    Betânia Paiva Drumond

    Full Text Available The American/Asian genotype of Dengue virus type 2 (DENV-2 was introduced into the Americas in the 80's. Although there is no data showing when this genotype was first introduced into Brazil, it was first detected in Brazil in 1990. After which the virus spread throughout the country and major epidemics occurred in 1998, 2007/08 and 2010. In this study we sequenced 12 DENV-2 genomes obtained from serum samples of patients with dengue fever residing in São José do Rio Preto, São Paulo (SJRP/SP, Brazil, in 2008. The whole open reading frame or envelope sequences were used to perform phylogenetic, phylogeographic and evolutionary analyses. Isolates from SJRP/SP were grouped within one lineage (BR3 close to isolates from Rio de Janeiro, Brazil. Isolates from SJRP were probably introduced there at least in 2007, prior to its detection in the 2008 outbreak. DENV-2 circulation in Brazil is characterized by the introduction, displacement and circulation of three well-defined lineages in different times, most probably from the Caribbean. Thirty-seven unique amino acid substitutions were observed among the lineages, including seven amino acid differences in domains I to III of the envelope protein. Moreover, we dated here, for the first time, the introduction of American/Asian genotype into Brazil (lineage BR1 to 1988/89, followed by the introduction of lineages BR2 (1998-2000 and BR3 (2003-05. Our results show a delay between the introduction and detection of DENV-2 lineages in Brazil, reinforcing the importance and need for surveillance programs to detect and trace the evolution of these viruses. Additionally, Brazilian DENV-2 differed in genetic diversity, date of introduction and geographic origin and distribution in Brazil, and these are important factors for the evolution, dynamics and control of dengue.

  12. Molecular Characterization and Phylogenetic Analysis of Two Novel Regio-specific Flavonoid Prenyltransferases from Morus alba and Cudrania tricuspidata*

    Science.gov (United States)

    Wang, Ruishan; Chen, Ridao; Li, Jianhua; Liu, Xiao; Xie, Kebo; Chen, Dawei; Yin, Yunze; Tao, Xiaoyu; Xie, Dan; Zou, Jianhua; Yang, Lin; Dai, Jungui

    2014-01-01

    Prenylated flavonoids are attractive specialized metabolites with a wide range of biological activities and are distributed in several plant families. The prenylation catalyzed by prenyltransferases represents a Friedel-Crafts alkylation of the flavonoid skeleton in the biosynthesis of natural prenylated flavonoids and contributes to the structural diversity and biological activities of these compounds. To date, all identified plant flavonoid prenyltransferases (FPTs) have been identified in Leguminosae. In the present study two new FPTs, Morus alba isoliquiritigenin 3′-dimethylallyltransferase (MaIDT) and Cudrania tricuspidata isoliquiritigenin 3′-dimethylallyltransferase (CtIDT), were identified from moraceous plants M. alba and C. tricuspidata, respectively. MaIDT and CtIDT shared low levels of homology with the leguminous FPTs. MaIDT and CtIDT are predicted to be membrane-bound proteins with predicted transit peptides, seven transmembrane regions, and conserved functional domains that are similar to other homogentisate prenyltransferases. Recombinant MaIDT and CtIDT were able to regioselectively introduce dimethylallyl diphosphate into the A ring of three flavonoids with different skeleton types (chalcones, isoflavones, and flavones). Phylogenetic analysis revealed that MaIDT and CtIDT are distantly related to their homologs in Leguminosae, which suggests that FPTs in Moraceae and Leguminosae might have evolved independently. MaIDT and CtIDT represent the first two non-Leguminosae FPTs to be identified in plants and could thus lead to the identification of additional evolutionarily varied FPTs in other non-Leguminosae plants and could elucidate the biosyntheses of prenylated flavonoids in various plants. Furthermore, MaIDT and CtIDT might be used for regiospecific prenylation of flavonoids to produce bioactive compounds for potential therapeutic applications due to their high efficiency and catalytic promiscuity. PMID:25361766

  13. Spatiotemporal Phylogenetic Analysis and Molecular Characterisation of Infectious Bursal Disease Viruses Based on the VP2 Hyper-Variable Region.

    Directory of Open Access Journals (Sweden)

    Abdulahi Alfonso-Morales

    Full Text Available Infectious bursal disease is a highly contagious and acute viral disease caused by the infectious bursal disease virus (IBDV; it affects all major poultry producing areas of the world. The current study was designed to rigorously measure the global phylogeographic dynamics of IBDV strains to gain insight into viral population expansion as well as the emergence, spread and pattern of the geographical structure of very virulent IBDV (vvIBDV strains.Sequences of the hyper-variable region of the VP2 (HVR-VP2 gene from IBDV strains isolated from diverse geographic locations were obtained from the GenBank database; Cuban sequences were obtained in the current work. All sequences were analysed by Bayesian phylogeographic analysis, implemented in the Bayesian Evolutionary Analysis Sampling Trees (BEAST, Bayesian Tip-association Significance testing (BaTS and Spatial Phylogenetic Reconstruction of Evolutionary Dynamics (SPREAD software packages. Selection pressure on the HVR-VP2 was also assessed. The phylogeographic association-trait analysis showed that viruses sampled from individual countries tend to cluster together, suggesting a geographic pattern for IBDV strains. Spatial analysis from this study revealed that strains carrying sequences that were linked to increased virulence of IBDV appeared in Iran in 1981 and spread to Western Europe (Belgium in 1987, Africa (Egypt around 1990, East Asia (China and Japan in 1993, the Caribbean Region (Cuba by 1995 and South America (Brazil around 2000. Selection pressure analysis showed that several codons in the HVR-VP2 region were under purifying selection.To our knowledge, this work is the first study applying the Bayesian phylogeographic reconstruction approach to analyse the emergence and spread of vvIBDV strains worldwide.

  14. Spatiotemporal Phylogenetic Analysis and Molecular Characterisation of Infectious Bursal Disease Viruses Based on the VP2 Hyper-Variable Region.

    Science.gov (United States)

    Alfonso-Morales, Abdulahi; Martínez-Pérez, Orlando; Dolz, Roser; Valle, Rosa; Perera, Carmen L; Bertran, Kateri; Frías, Maria T; Majó, Natàlia; Ganges, Llilianne; Pérez, Lester J

    2013-01-01

    Infectious bursal disease is a highly contagious and acute viral disease caused by the infectious bursal disease virus (IBDV); it affects all major poultry producing areas of the world. The current study was designed to rigorously measure the global phylogeographic dynamics of IBDV strains to gain insight into viral population expansion as well as the emergence, spread and pattern of the geographical structure of very virulent IBDV (vvIBDV) strains. Sequences of the hyper-variable region of the VP2 (HVR-VP2) gene from IBDV strains isolated from diverse geographic locations were obtained from the GenBank database; Cuban sequences were obtained in the current work. All sequences were analysed by Bayesian phylogeographic analysis, implemented in the Bayesian Evolutionary Analysis Sampling Trees (BEAST), Bayesian Tip-association Significance testing (BaTS) and Spatial Phylogenetic Reconstruction of Evolutionary Dynamics (SPREAD) software packages. Selection pressure on the HVR-VP2 was also assessed. The phylogeographic association-trait analysis showed that viruses sampled from individual countries tend to cluster together, suggesting a geographic pattern for IBDV strains. Spatial analysis from this study revealed that strains carrying sequences that were linked to increased virulence of IBDV appeared in Iran in 1981 and spread to Western Europe (Belgium) in 1987, Africa (Egypt) around 1990, East Asia (China and Japan) in 1993, the Caribbean Region (Cuba) by 1995 and South America (Brazil) around 2000. Selection pressure analysis showed that several codons in the HVR-VP2 region were under purifying selection. To our knowledge, this work is the first study applying the Bayesian phylogeographic reconstruction approach to analyse the emergence and spread of vvIBDV strains worldwide.

  15. Molecular and phylogenetic analyses of Salmonella Gallinarum trace the origin and diversification of recent outbreaks of fowl typhoid in poultry farms.

    Science.gov (United States)

    De Carli, Silvia; Gräf, Tiago; Kipper, Diéssy; Lehmann, Fernanda Kieling Moreira; Zanetti, Nathalie; Siqueira, Franciele Maboni; Cibulski, Samuel; Fonseca, André Salvador Kazantzi; Ikuta, Nilo; Lunge, Vagner Ricardo

    2017-12-01

    Fowl typhoid (FT) and pullorum disease (PD) are two important poultry infections caused by Salmonella enterica subsp. enterica serotype Gallinarum (S. Gallinarum). S. Gallinarum strains are adapted to birds and classified into biovars Gallinarum (bvGA) and Pullorum (bvPU) as they are the causative agent of FT and PD, respectively. In Brazil, FT/PD outbreaks have been reported along the last 50 years, but there was a recent increase of FT field reports with the suspicion it could be due to virulence reversion of the attenuated live vaccine SG9R. In this study, we applied molecular biology assays and phylogenetic methods to detect and investigate S. Gallinarum isolates from commercial poultry flocks in order to understand the evolutionary history and origin of the recent FT outbreaks in Brazil. S. Gallinarum isolates were obtained from thirteen different poultry flocks with clinical signs of FT/PD from 2013 to 2015. These isolates were serotyped, tested with three specific PCR (for the detection of bvGA, bvPU and live vaccine strain SG9R) and submitted to sequencing of a variable genome region (ISR analysis). The complete genome of one bvGA strain (BR_RS12) was also compared to other S. Gallinarum complete genomes (including other two Brazilian ones: bvGA 287/91 and bvPU FCVA198). PCR detected all thirteen isolates as S. Gallinarum (eight bvGA and five bvPU), none positive for SG9R strain. ISR analysis revealed that all eight bvGA isolates showed exactly the same nucleotide sequences with 100% similarity to reference strains, while two patterns were observed for bvPU. Genome phylogeny demonstrated distinct clades for bvGA and bvPU, with the bvGA clade showing a clear subdivision including three genomes: SG9R vaccine, the respective SG9 parent strain and one SG9R revertant field isolate (MB4523). The evolutionary rate of the total S. Gallinarum genome was calculated at 6.15×10 -7 substitutions/site/year, with 2.8 observed substitutions per year per genome (1 SNP per

  16. Molecular characterization and phylogenetic relationship of wild type 1 poliovirus strains circulating across Pakistan and Afghanistan bordering areas during 2010-2012.

    Directory of Open Access Journals (Sweden)

    Shahzad Shaukat

    Full Text Available Pakistan and Afghanistan share a long uncontrolled border with extensive population movement on both sides. Wild poliovirus transmission has never been interrupted in this block due to war against terrorism, poor public health infrastructure, misconceptions about polio vaccines and inadequate immunization activities. All these issues complicate the eradication operations and reinforce the complexity of wiping out poliomyelitis from this region. This study illustrates the origins and routes of cross-border wild poliovirus type 1 (WPV1 transmission during 2010-2012 between Pakistan and Afghanistan. Sequence analyses were conducted based on complete VP1 capsid protein sequences for WPV1 study strains to determine the origin of poliovirus genetic lineages and their evolutionary relationships. Phylogenetic tree was constructed from VP1 gene sequences applying Maximum Likelihood method using Kimura 2- parameter model in MEGA program v 5.0. A total of 72 (14.3% out of 502 wild-type 1 polioviruses were found circulating in border areas of both countries during 2010-2012. Molecular phylogenetic analysis classified these strains in to two sub-genotypes with four clusters and 18 lineages. Genetic data confirmed that the most of WPV1 lineages (12; 66.6% were transmitted from Pakistan to Afghanistan. However, the genetic diversity was significantly reduced during 2012 as most of the lineages were completely eliminated. In conclusion, Pakistan-Afghanistan block has emerged as a single poliovirus reservoir sharing the multiple poliovirus lineages due to uncontrolled movement of people across the borders between two countries. If it is neglected, it can jeopardize the extensive global efforts done so-far to eradicate the poliovirus infection. Our data will be helpful to devise the preventive strategies for effective control of wild poliovirus transmission in this region.

  17. Molecular phylogenetic reconstruction and localization of the (TTAGGn telomeric repeats in the chromosomes of Acromyrmex striatus (Roger, 1863 suggests a lower ancestral karyotype for leafcutter ants (Hymenoptera

    Directory of Open Access Journals (Sweden)

    Tássia Tatiane Pontes Pereira

    2018-01-01

    Full Text Available Chromosome counts and karyotype characterization have proved to be important features of a genome. Chromosome changes during the diversification of ants might play an important role, given the diversity and success of Formicidae. Comparative karyotype analyses on ants have enriched and helped ant systematics. Among leafcutter ants, two major chromosome counts have been described, one frequent in Atta Fabricius, 1804 (2n = 22 in all Atta spp. whose karyotype is known and the other frequent in Acromyrmex Mayr, 1865 (2n = 38 in the majority of species whose karyotype is known. The main exception is Acromyrmex striatus (Roger, 1863, which harbors a diploid chromosome set of 22. Here we describe the use of fluorescence in situ hybridization (FISH with telomeric probes with (TTAGG6 repeats to describe the telomere composition of A. striatus and to recover potential interstitial non-telomeric signals that may reflect fusion events during the evolution of leafcutter lineage from 38 to 22 chromosomes. Further, we reconstruct the ancestral chromosome numbers of the leafcutter clade based on a recently proposed molecular phylogenetic hypothesis and phylogenomic tree. Distinct signals have been observed in both extremities on the telomere chromosomes of A. striatus. Non-telomeric signals have not been retrieved in our analysis. It could be supposed that the low-numbered karyotype indeed represents the ancestral chromosome number of leafcutters. The phylogenetic reconstruction also recovered a low chromosome number from the diverse approaches implemented, suggesting that n = 11 is the most likely ancestral karyotype of the leafcutter ants and is a plesiomorphic feature shared between A. striatus and Atta spp.

  18. Avian influenza A (H9N2: computational molecular analysis and phylogenetic characterization of viral surface proteins isolated between 1997 and 2009 from the human population

    Directory of Open Access Journals (Sweden)

    Idrees Muhammad

    2010-11-01

    Full Text Available Abstract Background H9N2 avian influenza A viruses have become panzootic in Eurasia over the last decade and have caused several human infections in Asia since 1998. To study their evolution and zoonotic potential, we conducted an in silico analysis of H9N2 viruses that have infected humans between 1997 and 2009 and identified potential novel reassortments. Results A total of 22 hemagglutinin (HA and neuraminidase (NA nucleotide and deduced amino acid sequences were retrieved from the NCBI flu database. It was identified that mature peptide sequences of HA genes isolated from humans in 2009 had glutamine at position 226 (H3 of the receptor binding site, indicating a preference to bind to the human α (2-6 sialic acid receptors, which is different from previously isolated viruses and studies where the presence of leucine at the same position contributes to preference for human receptors and presence of glutamine towards avian receptors. Similarly, strains isolated in 2009 possessed new motif R-S-N-R in spite of typical R-S-S-R at the cleavage site of HA, which isn't reported before for H9N2 cases in humans. Other changes involved loss, addition, and variations in potential glycosylation sites as well as in predicted epitopes. The results of phylogenetic analysis indicated that HA and NA gene segments of H9N2 including those from current and proposed vaccine strains belong to two different Eurasian phylogenetic lineages confirming possible genetic reassortments. Conclusions These findings support the continuous evolution of avian H9N2 viruses towards human as host and are in favor of effective surveillance and better characterization studies to address this issue.

  19. Evaluation of a Phylogenetic Marker Based on Genomic Segment B of Infectious Bursal Disease Virus: Facilitating a Feasible Incorporation of this Segment to the Molecular Epidemiology Studies for this Viral Agent.

    Directory of Open Access Journals (Sweden)

    Abdulahi Alfonso-Morales

    Full Text Available Infectious bursal disease (IBD is a highly contagious and acute viral disease, which has caused high mortality rates in birds and considerable economic losses in different parts of the world for more than two decades and it still represents a considerable threat to poultry. The current study was designed to rigorously measure the reliability of a phylogenetic marker included into segment B. This marker can facilitate molecular epidemiology studies, incorporating this segment of the viral genome, to better explain the links between emergence, spreading and maintenance of the very virulent IBD virus (vvIBDV strains worldwide.Sequences of the segment B gene from IBDV strains isolated from diverse geographic locations were obtained from the GenBank Database; Cuban sequences were obtained in the current work. A phylogenetic marker named B-marker was assessed by different phylogenetic principles such as saturation of substitution, phylogenetic noise and high consistency. This last parameter is based on the ability of B-marker to reconstruct the same topology as the complete segment B of the viral genome. From the results obtained from B-marker, demographic history for both main lineages of IBDV regarding segment B was performed by Bayesian skyline plot analysis. Phylogenetic analysis for both segments of IBDV genome was also performed, revealing the presence of a natural reassortant strain with segment A from vvIBDV strains and segment B from non-vvIBDV strains within Cuban IBDV population.This study contributes to a better understanding of the emergence of vvIBDV strains, describing molecular epidemiology of IBDV using the state-of-the-art methodology concerning phylogenetic reconstruction. This study also revealed the presence of a novel natural reassorted strain as possible manifest of change in the genetic structure and stability of the vvIBDV strains. Therefore, it highlights the need to obtain information about both genome segments of IBDV for

  20. Evaluation of a Phylogenetic Marker Based on Genomic Segment B of Infectious Bursal Disease Virus: Facilitating a Feasible Incorporation of this Segment to the Molecular Epidemiology Studies for this Viral Agent.

    Science.gov (United States)

    Alfonso-Morales, Abdulahi; Rios, Liliam; Martínez-Pérez, Orlando; Dolz, Roser; Valle, Rosa; Perera, Carmen L; Bertran, Kateri; Frías, Maria T; Ganges, Llilianne; Díaz de Arce, Heidy; Majó, Natàlia; Núñez, José I; Pérez, Lester J

    2015-01-01

    Infectious bursal disease (IBD) is a highly contagious and acute viral disease, which has caused high mortality rates in birds and considerable economic losses in different parts of the world for more than two decades and it still represents a considerable threat to poultry. The current study was designed to rigorously measure the reliability of a phylogenetic marker included into segment B. This marker can facilitate molecular epidemiology studies, incorporating this segment of the viral genome, to better explain the links between emergence, spreading and maintenance of the very virulent IBD virus (vvIBDV) strains worldwide. Sequences of the segment B gene from IBDV strains isolated from diverse geographic locations were obtained from the GenBank Database; Cuban sequences were obtained in the current work. A phylogenetic marker named B-marker was assessed by different phylogenetic principles such as saturation of substitution, phylogenetic noise and high consistency. This last parameter is based on the ability of B-marker to reconstruct the same topology as the complete segment B of the viral genome. From the results obtained from B-marker, demographic history for both main lineages of IBDV regarding segment B was performed by Bayesian skyline plot analysis. Phylogenetic analysis for both segments of IBDV genome was also performed, revealing the presence of a natural reassortant strain with segment A from vvIBDV strains and segment B from non-vvIBDV strains within Cuban IBDV population. This study contributes to a better understanding of the emergence of vvIBDV strains, describing molecular epidemiology of IBDV using the state-of-the-art methodology concerning phylogenetic reconstruction. This study also revealed the presence of a novel natural reassorted strain as possible manifest of change in the genetic structure and stability of the vvIBDV strains. Therefore, it highlights the need to obtain information about both genome segments of IBDV for molecular

  1. First time molecular detection and phylogenetic relationships of torque teno sus virus 1 and 2 in domestic pigs in Uganda: further evidence for a global distribution

    Directory of Open Access Journals (Sweden)

    Brink Matilda

    2012-02-01

    Full Text Available Abstract Background Torque teno sus virus 1 (TTSuV1 and 2 (TTSuV2 are small, single-stranded circular DNA viruses belonging to the Anelloviridae family. Available studies clearly show that both viruses are widely distributed in the pig populations in America, Europe and Asia, although the impact of the infection is still unclear. Currently, the situation in domestic pig populations on the African continent is not known. Therefore, the aim of this study was to investigate the possible presence of the two viruses in domestic pigs in Uganda, and describe the phylogenetic relationships to those in the rest of the world. Results Ninety-five serum samples from six districts in Uganda were used, and PCR using TTSuV1 and 2 specific primers for the UTR region was run for viral nucleic acid detection. The positive samples were sequenced, and phylogenetic analyses performed in order to compare the Ugandan sequences with sequences from other parts of the world. The prevalence of TTSuV1 and 2 in the selected domestic pigs were estimated at 16.8% and 48.4% respectively, with co-infection found in 13.7%. The sequence identity was 90-100% between the Ugandan TTSuV1; and 63-100% between the Ugandan TTSuV2 sequences. Conclusion This is the first report on the presence of TTSuV1 and 2 in domestic pigs in Uganda. These results highlight the importance of screening for emerging viruses given the globalisation of human activities.

  2. A case study for effects of operational taxonomic units from intracellular endoparasites and ciliates on the eukaryotic phylogeny: phylogenetic position of the haptophyta in analyses of multiple slowly evolving genes.

    Directory of Open Access Journals (Sweden)

    Hisayoshi Nozaki

    Full Text Available Recent multigene phylogenetic analyses have contributed much to our understanding of eukaryotic phylogeny. However, the phylogenetic positions of various lineages within the eukaryotes have remained unresolved or in conflict between different phylogenetic studies. These phylogenetic ambiguities might have resulted from mixtures or integration from various factors including limited taxon sampling, missing data in the alignment, saturations of rapidly evolving genes, mixed analyses of short- and long-branched operational taxonomic units (OTUs, intracellular endoparasite and ciliate OTUs with unusual substitution etc. In order to evaluate the effects from intracellular endoparasite and ciliate OTUs co-analyzed on the eukaryotic phylogeny and simplify the results, we here used two different sets of data matrices of multiple slowly evolving genes with small amounts of missing data and examined the phylogenetic position of the secondary photosynthetic chromalveolates Haptophyta, one of the most abundant groups of oceanic phytoplankton and significant primary producers. In both sets, a robust sister relationship between Haptophyta and SAR (stramenopiles, alveolates, rhizarians, or SA [stramenopiles and alveolates] was resolved when intracellular endoparasite/ciliate OTUs were excluded, but not in their presence. Based on comparisons of character optimizations on a fixed tree (with a clade composed of haptophytes and SAR or SA, disruption of the monophyly between haptophytes and SAR (or SA in the presence of intracellular endoparasite/ciliate OTUs can be considered to be a result of multiple evolutionary reversals of character positions that supported the synapomorphy of the haptophyte and SAR (or SA clade in the absence of intracellular endoparasite/ciliate OTUs.

  3. Molecular characterization and phylogenetic analysis of highly pathogenic Vibrio alginolyticus strains isolated during mortality outbreaks in cultured Ruditapes decussatus juvenile.

    Science.gov (United States)

    Mechri, Badreddine; Monastiri, Abir; Medhioub, Amel; Medhioub, Mohamed Nejib; Aouni, Mahjoub

    2017-10-01

    In the summer of 2008 and 2009, a series of mortalities in growing out seeds of R. decussatus juveniles were occurred in the eastern Tunisian littoral. Nine predominant bacterial strains were isolated from dead and moribund juveniles and characterized as Vibrio alginolyticus. These isolates were subjected to biochemical and molecular characterization. All the Vibrio strains were tested for their susceptibility against the most widely used antibiotic in aquaculture as well as, the assessment of the presence of erythromycin (emrB) and tetracycline (tetS) resistance genes among the tested bacteria. The degree of genetic relatedness between V. alginolyticus strains was evaluated on the basis of the Entero-Bacterial Repetitive Intergenic Consensus (ERIC) and the Random Amplification of Polymorphic DNA-PCR (RAPD-PCR) approaches. We also looked for siderophore activity and the ability to grow under iron limitation. Furthermore, the pathogenic potential of the tested isolates was evaluated using R. decussatus larva and juveniles as infection models. On antimicrobial susceptibility test, Vibrio strains exhibited total resistance to at least four antibiotics. The MICs data revealed that flumequine and oxolinic acid were the most effective antibiotics to control the studied bacteria. Results also showed that studied antibiotics resistance genes were widely disseminated in the genome of V. alginolyticus strains. Both ERIC and RAPD-PCR fingerprinting showed the presence of genetic variation among Vibrio isolates. However, RAPD typing exhibited a higher discriminative potential than ERIC-PCR. Besides, we reported here for the first time the co-production of catechol and hydroxamte by V. alginolyticus species. The challenge experiment showed that most of Vibrio isolates caused high mortality rates for both larva and juveniles at 48-h post-exposure to a bacterial concentration of 10 6  CFU/ml. Copyright © 2017 Elsevier Ltd. All rights reserved.

  4. A large-scale, higher-level, molecular phylogenetic study of the insect order Lepidoptera (moths and butterflies.

    Directory of Open Access Journals (Sweden)

    Jerome C Regier

    Full Text Available Higher-level relationships within the Lepidoptera, and particularly within the species-rich subclade Ditrysia, are generally not well understood, although recent studies have yielded progress. We present the most comprehensive molecular analysis of lepidopteran phylogeny to date, focusing on relationships among superfamilies.483 taxa spanning 115 of 124 families were sampled for 19 protein-coding nuclear genes, from which maximum likelihood tree estimates and bootstrap percentages were obtained using GARLI. Assessment of heuristic search effectiveness showed that better trees and higher bootstrap percentages probably remain to be discovered even after 1000 or more search replicates, but further search proved impractical even with grid computing. Other analyses explored the effects of sampling nonsynonymous change only versus partitioned and unpartitioned total nucleotide change; deletion of rogue taxa; and compositional heterogeneity. Relationships among the non-ditrysian lineages previously inferred from morphology were largely confirmed, plus some new ones, with strong support. Robust support was also found for divergences among non-apoditrysian lineages of Ditrysia, but only rarely so within Apoditrysia. Paraphyly for Tineoidea is strongly supported by analysis of nonsynonymous-only signal; conflicting, strong support for tineoid monophyly when synonymous signal was added back is shown to result from compositional heterogeneity.Support for among-superfamily relationships outside the Apoditrysia is now generally strong. Comparable support is mostly lacking within Apoditrysia, but dramatically increased bootstrap percentages for some nodes after rogue taxon removal, and concordance with other evidence, strongly suggest that our picture of apoditrysian phylogeny is approximately correct. This study highlights the challenge of finding optimal topologies when analyzing hundreds of taxa. It also shows that some nodes get strong support only when

  5. Molecular and phylogenetic characterization of honey bee viruses, Nosema microsporidia, protozoan parasites, and parasitic mites in China.

    Science.gov (United States)

    Yang, Bu; Peng, Guangda; Li, Tianbang; Kadowaki, Tatsuhiko

    2013-02-01

    China has the largest number of managed honey bee colonies, which produce the highest quantity of honey and royal jelly in the world; however, the presence of honey bee pathogens and parasites has never been rigorously identified in Chinese apiaries. We thus conducted a molecular survey of honey bee RNA viruses, Nosema microsporidia, protozoan parasites, and tracheal mites associated with nonnative Apis mellifera ligustica and native Apis cerana cerana colonies in China. We found the presence of black queen cell virus (BQCV), chronic bee paralysis virus (CBPV), deformed wing virus (DWV), Israeli acute paralysis virus (IAPV), and sacbrood virus (SBV), but not that of acute bee paralysis virus (ABPV) or Kashmir bee virus (KBV). DWV was the most prevalent in the tested samples. Phylogenies of Chinese viral isolates demonstrated that genetically heterogeneous populations of BQCV, CBPV, DWV, and A. cerana-infecting SBV, and relatively homogenous populations of IAPV and A. meliifera-infecting new strain of SBV with single origins, are spread in Chinese apiaries. Similar to previous observations in many countries, Nosema ceranae, but not Nosema apis, was prevalent in the tested samples. Crithidia mellificae, but not Apicystis bombi was found in five samples, including one A. c. cerana colony, demonstrating that C. mellificae is capable of infecting multiple honey bee species. Based on kinetoplast-encoded cytochrome b sequences, the C. mellificae isolate from A. c. cerana represents a novel haplotype with 19 nucleotide differences from the Chinese and Japanese isolates from A. m. ligustica. This suggests that A. c. cerana is the native host for this specific haplotype. The tracheal mite, Acarapis woodi, was detected in one A. m. ligustica colony. Our results demonstrate that honey bee RNA viruses, N. ceranae, C. mellificae, and tracheal mites are present in Chinese apiaries, and some might be originated from native Asian honey bees.

  6. The role of fusion in ant chromosome evolution: insights from cytogenetic analysis using a molecular phylogenetic approach in the genus mycetophylax.

    Science.gov (United States)

    Cardoso, Danon Clemes; das Graças Pompolo, Silvia; Cristiano, Maykon Passos; Tavares, Mara Garcia

    2014-01-01

    Among insect taxa, ants exhibit one of the most variable chromosome numbers ranging from n = 1 to n = 60. This high karyotype diversity is suggested to be correlated to ants diversification. The karyotype evolution of ants is usually understood in terms of Robertsonian rearrangements towards an increase in chromosome numbers. The ant genus Mycetophylax is a small monogynous basal Attini ant (Formicidae: Myrmicinae), endemic to sand dunes along the Brazilian coastlines. A recent taxonomic revision validates three species, Mycetophylax morschi, M. conformis and M. simplex. In this paper, we cytogenetically characterized all species that belongs to the genus and analyzed the karyotypic evolution of Mycetophylax in the context of a molecular phylogeny and ancestral character state reconstruction. M. morschi showed a polymorphic number of chromosomes, with colonies showing 2n = 26 and 2n = 30 chromosomes. M. conformis presented a diploid chromosome number of 30 chromosomes, while M. simplex showed 36 chromosomes. The probabilistic models suggest that the ancestral haploid chromosome number of Mycetophylax was 17 (Likelihood framework) or 18 (Bayesian framework). The analysis also suggested that fusions were responsible for the evolutionary reduction in chromosome numbers of M. conformis and M. morschi karyotypes whereas fission may determines the M. simplex karyotype. These results obtained show the importance of fusions in chromosome changes towards a chromosome number reduction in Formicidae and how a phylogenetic background can be used to reconstruct hypotheses about chromosomes evolution.

  7. Molecular differentiation and phylogenetic relationships of three Angiostrongylus species and Angiostrongylus cantonensis geographical isolates based on a 66-kDa protein gene of A. cantonensis (Nematoda: Angiostrongylidae).

    Science.gov (United States)

    Eamsobhana, Praphathip; Lim, Phaik Eem; Zhang, Hongman; Gan, Xiaoxian; Yong, Hoi Sen

    2010-12-01

    The phylogenetic relationships and molecular differentiation of three species of angiostrongylid nematodes (Angiostrongylus cantonensis, Angiostrongylus costaricensis and Angiostrongylus malaysiensis) were studied using the AC primers for a 66-kDa protein gene of A. cantonensis. The AC primers successfully amplified the genomic DNA of these angiostrongylid nematodes. No amplification was detected for the DNA of Ascaris lumbricoides, Ascaris suum, Anisakis simplex, Gnathostoma spinigerum, Toxocara canis, and Trichinella spiralis. The maximum-parsimony (MP) consensus tree and the maximum-likelihood (ML) tree both showed that the Angiostrongylus taxa could be divided into two major clades - Clade 1 (A. costaricensis) and Clade 2 (A. cantonensis and A. malaysiensis) with a full support bootstrap value. A. costaricensis is the most distant taxon. A. cantonensis is a sister group to A. malaysiensis; these two taxa (species) are clearly separated. There is no clear distinction between the A. cantonensis samples from four different geographical localities (Thailand, China, Japan and Hawaii); only some of the samples are grouped ranging from no support or low support to moderate support of bootstrap values. The published nucleotide sequences of A. cantonensis adult-specific native 66kDa protein mRNA, clone L5-400 from Taiwan (U17585) appear to be very distant from the A. cantonensis samples from Thailand, China, Japan and Hawaii, with the uncorrected p-distance values ranging from 26.87% to 29.92%.

  8. Phylogenetic analysis, genetic diversity and relationships between the recently segregated species of Corynandra and Cleoserrata from the genus Cleome using DNA barcoding and molecular markers.

    Science.gov (United States)

    Tamboli, Asif Shabodin; Patil, Swapnil Mahadeo; Gholave, Avinash Ramchandra; Kadam, Suhas Kishor; Kotibhaskar, Shreya Vijaykumar; Yadav, Shrirang Ramchandra; Govindwar, Sanjay Prabhu

    2016-01-01

    Cleome is the largest genus in the family Cleomaceae and it is known for its various medicinal properties. Recently, some species from the Cleome genus (Cleome viscosa, Cleome chelidonii, Cleome felina and Cleome speciosa) are split into genera Corynandra (Corynandra viscosa, Corynandra chelidonii, Corynandra felina), and Cleoserrata (Cleoserrata speciosa). The objective of this study was to obtain DNA barcodes for these species for their accurate identification and determining phylogenetic relationships. Out of 10 screened barcoding regions, rbcL, matK and ITS1 regions showed higher PCR efficiency and sequencing success. This study added matK, rbcL and ITS1 barcodes for the identification of Corynandra chelidonii, Corynandra felina, Cleome simplicifolia and Cleome aspera species in existing barcode data. Corynandra chelidonii and Corynandra felina species belong to the Corynandra genus, but they are not grouped with the Corynandra viscosa species, however clustered with the Cleome species. Molecular marker analysis showed 100% polymorphism among the studied plant samples. Diversity indices for molecular markers were ranged from He=0.1115-0.1714 and I=0.2268-0.2700, which indicates a significant amount of genetic diversity among studied species. Discrimination of the Cleome and Corynandra species from Cleoserrata speciosa was obtained by two RAPD primers (OPA-4 and RAPD-17) and two ISSR primers (ISSR-1 and ISSR-2). RAPD and ISSR markers are useful for the genetic characterization of these studied species. The present investigation will be helpful to understand the relationships of Cleome lineages with Corynandra and Cleoserrata species. Copyright © 2016 Académie des sciences. Published by Elsevier SAS. All rights reserved.

  9. Targeting N-Glycan Cryptic Sugar Moieties for Broad-Spectrum Virus Neutralization: Progress in Identifying Conserved Molecular Targets in Viruses of Distinct Phylogenetic Origins

    Directory of Open Access Journals (Sweden)

    Denong Wang

    2015-03-01

    Full Text Available Identifying molecular targets for eliciting broadly virus-neutralizing antibodies is one of the key steps toward development of vaccines against emerging viral pathogens. Owing to genomic and somatic diversities among viral species, identifying protein targets for broad-spectrum virus neutralization is highly challenging even for the same virus, such as HIV-1. However, viruses rely on host glycosylation machineries to synthesize and express glycans and, thereby, may display common carbohydrate moieties. Thus, exploring glycan-binding profiles of broad-spectrum virus-neutralizing agents may provide key information to uncover the carbohydrate-based virus-neutralizing epitopes. In this study, we characterized two broadly HIV-neutralizing agents, human monoclonal antibody 2G12 and Galanthus nivalis lectin (GNA, for their viral targeting activities. Although these agents were known to be specific for oligomannosyl antigens, they differ strikingly in virus-binding activities. The former is HIV-1 specific; the latter is broadly reactive and is able to neutralize viruses of distinct phylogenetic origins, such as HIV-1, severe acute respiratory syndrome coronavirus (SARS-CoV, and human cytomegalovirus (HCMV. In carbohydrate microarray analyses, we explored the molecular basis underlying the striking differences in the spectrum of anti-virus activities of the two probes. Unlike 2G12, which is strictly specific for the high-density Man9GlcNAc2Asn (Man9-clusters, GNA recognizes a number of N-glycan cryptic sugar moieties. These include not only the known oligomannosyl antigens but also previously unrecognized tri-antennary or multi-valent GlcNAc-terminating N-glycan epitopes (Tri/m-Gn. These findings highlight the potential of N-glycan cryptic sugar moieties as conserved targets for broad-spectrum virus neutralization and suggest the GNA-model of glycan-binding warrants focused investigation.

  10. Phylogenetic position of the yeast-like symbiotes of Tagosodes orizicolus (Homoptera: Delphacidae based on 18S ribosomal DNA partial sequences

    Directory of Open Access Journals (Sweden)

    Ana M Xet-Mull

    2004-09-01

    Full Text Available Tagosodes orizicolus Muir (Homoptera: Delphacidae, the endemic delphacid species of tropical America carries yeast-like symbiotes (YLS in the abdominal fat bodies and the ovarial tissues, like other rice planthoppers of Asia. These YLS are obligate symbiotes, which are transmitted transovarially, and maintain a mutualistic relationship with the insect host. This characteristic has made in vitro culture and classification of YLS rather difficult using conventional methods. Nevertheless, microorganisms of similar characteristics have been successfully classified by using molecular taxonomy. In the present work, the YLS of Tagosodes orizicolus(YLSTo were purified on Percoll® gradients, and specific segments of 18S rDNA were amplified by PCR, cloned and sequenced. Sequences were aligned by means of the CLUSTAL V (DNASTAR program; phylogenetic trees were constructed with the Phylogeny Inference Package (PHYLIP, showing that YLSTo belong to the fungi class Pyrenomycetes, phylum Ascomycota. Similarities between 98% and 100% were observed among YLS of the rice delphacids Tagosodes orizicolus, Nilaparvata lugens, Laodelphax striatellus and Sogatella furcifera, and between 89.8% and 90.8% when comparing the above to YLS of the aphid Hamiltonaphis styraci. These comparisons revealed that delphacid YLS are a highly conserved monophyletic group within the Pyrenomycetes and are closely related to Hypomyces chrysospermus. Rev. Biol. Trop. 52(3: 777-785. Epub 2004 Dic 15.Tagosodes orizicolus Muir (Homoptera: Delphacidae es una especie endémica de América tropical que al igual que otros saltahojas de Asia, tiene simbiontes levaduriformes (YLS, por sus siglas en Inglés en los cuerpos grasos del abdomen y en los tejidos de los ovarios. Los YLS son simbiontes obligados que se transmiten transovarialmente y que mantienen relaciones mutualística con el insecto hospedero. Esta característica ha hecho muy difícil su cultivo in vitro y por ende su clasificaci

  11. Time spans and spacers : Molecular phylogenetic explorations in the Cladophora complex (Chlorophyta) from the perspective of rDNA gene and spacer sequences

    NARCIS (Netherlands)

    Bakker, Frederik Theodoor

    1995-01-01

    In this study, phylogenetic relationships among genera, species and biogeographic representatives of single Cladophora species within the Cladophorales were analyzed using rDNA gene and spacer sequences. Based on phylogenetic analysis of 18S rRNA gene sequences, the Cladophora complex is shown to be

  12. Phylogenetic Analysis Using Protein Mass Spectrometry.

    Science.gov (United States)

    Ma, Shiyong; Downard, Kevin M; Wong, Jason W H

    2017-01-01

    Through advances in molecular biology, comparative analysis of DNA sequences is currently the cornerstone in the study of molecular evolution and phylogenetics. Nevertheless, protein mass spectrometry offers some unique opportunities to enable phylogenetic analyses in organisms where DNA may be difficult or costly to obtain. To date, the methods of phylogenetic analysis using protein mass spectrometry can be classified into three categories: (1) de novo protein sequencing followed by classical phylogenetic reconstruction, (2) direct phylogenetic reconstruction using proteolytic peptide mass maps, and (3) mapping of mass spectral data onto classical phylogenetic trees. In this chapter, we provide a brief description of the three methods and the protocol for each method along with relevant tools and algorithms.

  13. First molecular data on the phylum Loricifera: an investigation into the phylogeny of ecdysozoa with emphasis on the positions of Loricifera and Priapulida.

    Science.gov (United States)

    Park, Joong-Ki; Rho, Hyun Soo; Kristensen, Reinhardt Møbjerg; Kim, Won; Giribet, Gonzalo

    2006-11-01

    Recent progress in molecular techniques has generated a wealth of information for phylogenetic analysis. Among metazoans all but a single phylum have been incorporated into some sort of molecular analysis. However, the minute and rare species of the phylum Loricifera have remained elusive to molecular systematists. Here we report the first molecular sequence data (nearly complete 18S rRNA) for a member of the phylum Loricifera, Pliciloricus sp. from Korea. The new sequence data were analyzed together with 52 other ecdysozoan sequences, with all other phyla represented by three or more sequences. The data set was analyzed using parsimony as an optimality criterion under direct optimization as well as using a Bayesian approach. The parsimony analysis was also accompanied by a sensitivity analysis. The results of both analyses are largely congruent, finding monophyly of each ecdysozoan phylum, except for Priapulida, in which the coelomate Meiopriapulus is separate from a clade of pseudocoelomate priapulids. The data also suggest a relationship of the pseudocoelomate priapulids to kinorhynchs, and a relationship of nematodes to tardigrades. The Bayesian analysis placed the arthropods as the sister group to a clade that includes tardigrades and nematodes. However, these results were shown to be parameter dependent in the sensitivity analysis. The position of Loricifera was extremely unstable to parameter variation, and support for a relationship of loriciferans to any particular ecdysozoan phylum was not found in the data.

  14. Inferring phylogenetic trees from the knowledge of rare evolutionary events.

    Science.gov (United States)

    Hellmuth, Marc; Hernandez-Rosales, Maribel; Long, Yangjing; Stadler, Peter F

    2018-06-01

    Rare events have played an increasing role in molecular phylogenetics as potentially homoplasy-poor characters. In this contribution we analyze the phylogenetic information content from a combinatorial point of view by considering the binary relation on the set of taxa defined by the existence of a single event separating two taxa. We show that the graph-representation of this relation must be a tree. Moreover, we characterize completely the relationship between the tree of such relations and the underlying phylogenetic tree. With directed operations such as tandem-duplication-random-loss events in mind we demonstrate how non-symmetric information constrains the position of the root in the partially reconstructed phylogeny.

  15. Phylogenetic classification of bony fishes.

    Science.gov (United States)

    Betancur-R, Ricardo; Wiley, Edward O; Arratia, Gloria; Acero, Arturo; Bailly, Nicolas; Miya, Masaki; Lecointre, Guillaume; Ortí, Guillermo

    2017-07-06

    Fish classifications, as those of most other taxonomic groups, are being transformed drastically as new molecular phylogenies provide support for natural groups that were unanticipated by previous studies. A brief review of the main criteria used by ichthyologists to define their classifications during the last 50 years, however, reveals slow progress towards using an explicit phylogenetic framework. Instead, the trend has been to rely, in varying degrees, on deep-rooted anatomical concepts and authority, often mixing taxa with explicit phylogenetic support with arbitrary groupings. Two leading sources in ichthyology frequently used for fish classifications (JS Nelson's volumes of Fishes of the World and W. Eschmeyer's Catalog of Fishes) fail to adopt a global phylogenetic framework despite much recent progress made towards the resolution of the fish Tree of Life. The first explicit phylogenetic classification of bony fishes was published in 2013, based on a comprehensive molecular phylogeny ( www.deepfin.org ). We here update the first version of that classification by incorporating the most recent phylogenetic results. The updated classification presented here is based on phylogenies inferred using molecular and genomic data for nearly 2000 fishes. A total of 72 orders (and 79 suborders) are recognized in this version, compared with 66 orders in version 1. The phylogeny resolves placement of 410 families, or ~80% of the total of 514 families of bony fishes currently recognized. The ordinal status of 30 percomorph families included in this study, however, remains uncertain (incertae sedis in the series Carangaria, Ovalentaria, or Eupercaria). Comments to support taxonomic decisions and comparisons with conflicting taxonomic groups proposed by others are presented. We also highlight cases were morphological support exist for the groups being classified. This version of the phylogenetic classification of bony fishes is substantially improved, providing resolution

  16. Molecular phylogenetic analysis of Chinese indigenous blue-shelled chickens inferred from whole genomic region of the SLCO1B3 gene.

    Science.gov (United States)

    Dalirsefat, Seyed Benyamin; Dong, Xianggui; Deng, Xuemei

    2015-08-01

    In total, 246 individuals from 8 Chinese indigenous blue- and brown-shelled chicken populations (Yimeng Blue, Wulong Blue, Lindian Blue, Dongxiang Blue, Lushi Blue, Jingmen Blue, Dongxiang Brown, and Lushi Brown) were genotyped for 21 SNP markers from the SLCO1B3 gene to evaluate phylogenetic relationships. As a representative of nonblue-shelled breeds, White Leghorn was included in the study for reference. A high proportion of SNP polymorphism was observed in Chinese chicken populations, ranging from 89% in Jingmen Blue to 100% in most populations, with a mean of 95% across all populations. The White Leghorn breed showed the lowest polymorphism, accounting for 43% of total SNPs. The mean expected heterozygosity varied from 0.11 in Dongxiang Blue to 0.46 in Yimeng Blue. Analysis of molecular variation (AMOVA) for 2 groups of Chinese chickens based on eggshell color type revealed 52% within-group and 43% between-group variations of the total genetic variation. As expected, FST and Reynolds' genetic distance were greatest between White Leghorn and Chinese chicken populations, with average values of 0.40 and 0.55, respectively. The first and second principal coordinates explained approximately 92% of the total variation and supported the clustering of the populations according to their eggshell color type and historical origins. STRUCTURE analysis showed a considerable source of variation among populations for the clustering into blue-shelled and nonblue-shelled chicken populations. The low estimation of genetic differentiation (FST) between Chinese chicken populations is possibly due to a common historical origin and high gene flow. Remarkably similar population classifications were obtained with all methods used in the study. Aligning endogenous avian retroviral (EAV)-HP insertion sequences showed no difference among the blue-shelled chickens. © 2015 Poultry Science Association Inc.

  17. Molecular organization and phylogenetic analysis of 5S rDNA in crustaceans of the genus Pollicipes reveal birth-and-death evolution and strong purifying selection.

    Science.gov (United States)

    Perina, Alejandra; Seoane, David; González-Tizón, Ana M; Rodríguez-Fariña, Fernanda; Martínez-Lage, Andrés

    2011-10-17

    The 5S ribosomal DNA (5S rDNA) is organized in tandem arrays with repeat units that consist of a transcribing region (5S) and a variable nontranscribed spacer (NTS), in higher eukaryotes. Until recently the 5S rDNA was thought to be subject to concerted evolution, however, in several taxa, sequence divergence levels between the 5S and the NTS were found higher than expected under this model. So, many studies have shown that birth-and-death processes and selection can drive the evolution of 5S rDNA. In analyses of 5S rDNA evolution is found several 5S rDNA types in the genome, with low levels of nucleotide variation in the 5S and a spacer region highly divergent. Molecular organization and nucleotide sequence of the 5S ribosomal DNA multigene family (5S rDNA) were investigated in three Pollicipes species in an evolutionary context. The nucleotide sequence variation revealed that several 5S rDNA variants occur in Pollicipes genomes. They are clustered in up to seven different types based on differences in their nontranscribed spacers (NTS). Five different units of 5S rDNA were characterized in P. pollicipes and two different units in P. elegans and P. polymerus. Analysis of these sequences showed that identical types were shared among species and that two pseudogenes were present. We predicted the secondary structure and characterized the upstream and downstream conserved elements. Phylogenetic analysis showed an among-species clustering pattern of 5S rDNA types. These results suggest that the evolution of Pollicipes 5S rDNA is driven by birth-and-death processes with strong purifying selection.

  18. Glycoprotein-G-gene-based molecular and phylogenetic analysis of rabies viruses associated with a large outbreak of bovine rabies in southern Brazil.

    Science.gov (United States)

    Cargnelutti, Juliana F; de Quadros, João M; Martins, Mathias; Batista, Helena B C R; Weiblen, Rudi; Flores, Eduardo F

    2017-12-01

    A large outbreak of hematophagous-bat-associated bovine rabies has been occurring in Rio Grande do Sul (RS), the southernmost Brazilian state, since 2011, with official estimates exceeding 50,000 cattle deaths. The present article describes a genetic characterization of rabies virus (RABV) recovered from 59 affected cattle and two sheep, from 56 herds in 16 municipalities (2012-2016). Molecular analysis was performed using the nucleotide (nt) and predicted amino acid (aa) sequences of RABV glycoprotein G (G). A high level of nt and aa sequence identity was observed among the examined G sequences, ranging from 98.4 to 100%, and from 97.3 to 100%, respectively. Likewise, high levels of nt and aa sequence identity were observed with bovine (nt, 99.8%; aa, 99.8%) and hematophagous bat (nt, 99.5%; aa, 99.4%) RABV sequences from GenBank, and lower levels were observed with carnivore RABV sequences (nt, 92.8%; aa, 88.1%). Some random mutations were observed in the analyzed sequences, and a few consistent mutations were observed in some sequences belonging to cluster 2, subcluster 2b. The clustering of the sequences was observed in a phylogenetic tree, where two distinct clusters were evident. Cluster 1 comprised RABV sequences covering the entire study period (2012 to 2016), but subclusters corresponding to different years could be identified, indicating virus evolution and/or introduction of new viruses into the population. In some cases, viruses from the same location obtained within a short period grouped into different subclusters, suggesting co-circulation of viruses of different origins. Subcluster segregation was also observed in sequences obtained in the same region during different periods, indicating the involvement of different viruses in the cases at different times. In summary, our results indicate that the outbreaks occurring in RS (2012 to 2016) probably involved RABV of different origins, in addition to a possible evolution of RABV isolates within this

  19. Molecular diversity of bacterial endosymbionts associated with dagger nematodes of the genus Xiphinema (Nematoda: Longidoridae) reveals a high degree of phylogenetic congruence with their host.

    Science.gov (United States)

    Palomares-Rius, Juan E; Archidona-Yuste, Antonio; Cantalapiedra-Navarrete, Carolina; Prieto, Pilar; Castillo, Pablo

    2016-12-01

    Bacterial endosymbionts have been detected in some groups of plant-parasitic nematodes, but few cases have been reported compared to other groups in the phylum Nematoda, such as animal-parasitic or free-living nematodes. This study was performed on a wide variety of plant-parasitic nematode families and species from different host plants and nematode populations. A total of 124 nematode populations (previously identified morphologically and molecularly) were screened for the presence of potential bacterial endosymbionts using the partial 16S rRNA gene and fluorescence in situ hybridization (FISH) and confocal microscopy. Potential bacterial endosymbionts were only detected in nematode species belonging to the genus Xiphinema and specifically in the X. americanum group. Fifty-seven partial 16S rRNA sequences were obtained from bacterial endosymbionts in this study. One group of sequences was closely related to the genus 'Candidatus Xiphinematobacter' (19 bacterial endosymbiont sequences were associated with seven nematode host species, including two that have already been described and three unknown bacterial endosymbionts). The second bacterial endosymbiont group (38 bacterial endosymbiont sequences associated with six nematode species) was related to the family Burkholderiaceae, which includes fungal and soil-plant bacterial endosymbionts. These endosymbionts were reported for the first time in the phylum Nematoda. Our findings suggest that there is a highly specific symbiotic relationship between nematode host and bacterial endosymbionts. Overall, these results were corroborated by a phylogeny of nematode host and bacterial endosymbionts that suggested that there was a high degree of phylogenetic congruence and long-term evolutionary persistence between hosts and endosymbionts. © 2016 John Wiley & Sons Ltd.

  20. [Reconstruction of the phylogenetic position of larch (Larix sukaczewii Dylis) by sequencing data for the trnK intron of chloroplast DNA].

    Science.gov (United States)

    Bashalkhanov, S I; Konstantinov, Iu M; Verbitskiĭ, D S; Kobzev, V F

    2003-10-01

    To reconstruct the systematic relationships of larch Larix sukaczewii, we used the chloroplast trnK intron sequences of L. decidua, L. sukaczewii, L. sibirica, L. czekanovskii, and L. gmelinii. Analysis of phylogenetic trees constructed using the maximum parsimony and maximum likelihood methods showed a clear divergence of the trnK intron sequences between L. sukaczewii and L. sibirica. This divergence reaches intraspecific level, which supports a previously published hypothesis on the taxonomic isolation of L. sukaczewii.

  1. Epstein-Barr virus-positive gastric cancer: a distinct molecular subtype of the disease?

    Science.gov (United States)

    Jácome, Alexandre Andrade Dos Anjos; Lima, Enaldo Melo de; Kazzi, Ana Izabela; Chaves, Gabriela Freitas; Mendonça, Diego Cavalheiro de; Maciel, Marina Mara; Santos, José Sebastião Dos

    2016-04-01

    Approximately 90% of the world population is infected by Epstein-Barr virus (EBV). Usually, it infects B lymphocytes, predisposing them to malignant transformation. Infection of epithelial cells occurs rarely, and it is estimated that about to 10% of gastric cancer patients harbor EBV in their malignant cells. Given that gastric cancer is the third leading cause of cancer-related mortality worldwide, with a global annual incidence of over 950,000 cases, EBV-positive gastric cancer is the largest group of EBV-associated malignancies. Based on gene expression profile studies, gastric cancer was recently categorized into four subtypes; EBV-positive, microsatellite unstable, genomically stable and chromosomal instability. Together with previous studies, this report provided a more detailed molecular characterization of gastric cancer, demonstrating that EBV-positive gastric cancer is a distinct molecular subtype of the disease, with unique genetic and epigenetic abnormalities, reflected in a specific phenotype. The recognition of characteristic molecular alterations in gastric cancer allows the identification of molecular pathways involved in cell proliferation and survival, with the potential to identify therapeutic targets. These findings highlight the enormous heterogeneity of gastric cancer, and the complex interplay between genetic and epigenetic alterations in the disease, and provide a roadmap to implementation of genome-guided personalized therapy in gastric cancer. The present review discusses the initial studies describing EBV-positive gastric cancer as a distinct clinical entity, presents recently described genetic and epigenetic alterations, and considers potential therapeutic insights derived from the recognition of this new molecular subtype of gastric adenocarcinoma.

  2. Time spans and spacers: Molecular phylogenetic explorations in the Cladophora complex (Chlorophyta) from the perspective of rDNA gene and spacer sequences

    OpenAIRE

    Bakker, Frederik Theodoor

    1995-01-01

    In this study, phylogenetic relationships among genera, species and biogeographic representatives of single Cladophora species within the Cladophorales were analyzed using rDNA gene and spacer sequences. Based on phylogenetic analysis of 18S rRNA gene sequences, the Cladophora complex is shown to be paraphyletic with respect to Cladophora species and includes several genera shich werde traditionally ascribed to the Siphonocladales (Chapter 3). ... Zie: Summary/Samenvatting

  3. Phylogenetics of neotropical Platymiscium (Leguminosae

    DEFF Research Database (Denmark)

    Saslis-Lagoudakis, C. Haris; Chase, Mark W; Robinson, Daniel N

    2008-01-01

    Platymiscium is a neotropical legume genus of forest trees in the Pterocarpus clade of the pantropical "dalbergioid" clade. It comprises 19 species (29 taxa), distributed from Mexico to southern Brazil. This study presents a molecular phylogenetic analysis of Platymiscium and allies inferred from...

  4. Virulence, serotype and phylogenetic groups of diarrhoeagenic ...

    African Journals Online (AJOL)

    Dr DADIE Thomas

    2014-02-17

    Feb 17, 2014 ... The virulence, serotype and phylogenetic traits of diarrhoeagenic Escherichia coli were detected in 502 strains isolated during digestive infections. Molecular detection of the target virulence genes, rfb gene of operon O and phylogenetic grouping genes Chua, yjaA and TSPE4.C2 was performed.

  5. HPV Positive Head and Neck Cancers: Molecular Pathogenesis and Evolving Treatment Strategies

    Directory of Open Access Journals (Sweden)

    Rüveyda Dok

    2016-03-01

    Full Text Available Head and neck squamous cell carcinoma (HNSCC is a highly heterogeneous disease that is the result of tobacco and/or alcohol abuse or infection with high-risk Human papillomaviruses. Despite the fact that HPV positive HNSCC cancers form a distinct clinical entity with better treatment outcome, all HNSCC are currently treated uniformly with the same treatment modality. At present, biologic basis of these different outcomes and their therapeutic influence are areas of intense investigation. In this review, we will summarize the molecular basis for this different outcome, novel treatment opportunities and possible biomarkers for HPV positive HNSCC. In particular, the focus will be on several molecular targeted strategies that can improve the chemoradiation response by influencing DNA repair mechanisms.

  6.  Molecular evolution and positive selection of the symbiotic gene NORK in Medicago truncatula

    DEFF Research Database (Denmark)

    De Mita, Stephane; Santoni, Sylvain; Hochu, Isabelle

    2006-01-01

     Understanding the selective constraints of partner specificity in mutually beneficial symbiosis is a significant, yet largely unexplored, prospect of evolutionary biology. These selective constraints can be explored through the study of nucleotide polymorphism at loci controlling specificity...... domain of the protein, evolved under the regime of positive selection. Further research should focus on the rate and direction of molecular coevolution between microorganisms' signaling molecules and legumes' receptors....

  7. The role of positive selection in determining the molecular cause of species differences in disease

    Directory of Open Access Journals (Sweden)

    Foord Steven M

    2008-10-01

    Full Text Available Abstract Background Related species, such as humans and chimpanzees, often experience the same disease with varying degrees of pathology, as seen in the cases of Alzheimer's disease, or differing symptomatology as in AIDS. Furthermore, certain diseases such as schizophrenia, epithelial cancers and autoimmune disorders are far more frequent in humans than in other species for reasons not associated with lifestyle. Genes that have undergone positive selection during species evolution are indicative of functional adaptations that drive species differences. Thus we investigate whether biomedical disease differences between species can be attributed to positively selected genes. Results We identified genes that putatively underwent positive selection during the evolution of humans and four mammals which are often used to model human diseases (mouse, rat, chimpanzee and dog. We show that genes predicted to have been subject to positive selection pressure during human evolution are implicated in diseases such as epithelial cancers, schizophrenia, autoimmune diseases and Alzheimer's disease, all of which differ in prevalence and symptomatology between humans and their mammalian relatives. In agreement with previous studies, the chimpanzee lineage was found to have more genes under positive selection than any of the other lineages. In addition, we found new evidence to support the hypothesis that genes that have undergone positive selection tend to interact with each other. This is the first such evidence to be detected widely among mammalian genes and may be important in identifying molecular pathways causative of species differences. Conclusion Our dataset of genes predicted to have been subject to positive selection in five species serves as an informative resource that can be consulted prior to selecting appropriate animal models during drug target validation. We conclude that studying the evolution of functional and biomedical disease differences

  8. Phylogenetic reconstruction methods: an overview.

    Science.gov (United States)

    De Bruyn, Alexandre; Martin, Darren P; Lefeuvre, Pierre

    2014-01-01

    Initially designed to infer evolutionary relationships based on morphological and physiological characters, phylogenetic reconstruction methods have greatly benefited from recent developments in molecular biology and sequencing technologies with a number of powerful methods having been developed specifically to infer phylogenies from macromolecular data. This chapter, while presenting an overview of basic concepts and methods used in phylogenetic reconstruction, is primarily intended as a simplified step-by-step guide to the construction of phylogenetic trees from nucleotide sequences using fairly up-to-date maximum likelihood methods implemented in freely available computer programs. While the analysis of chloroplast sequences from various Vanilla species is used as an illustrative example, the techniques covered here are relevant to the comparative analysis of homologous sequences datasets sampled from any group of organisms.

  9. Positive Selection or Free to Vary? Assessing the Functional Significance of Sequence Change Using Molecular Dynamics.

    Directory of Open Access Journals (Sweden)

    Jane R Allison

    Full Text Available Evolutionary arms races between pathogens and their hosts may be manifested as selection for rapid evolutionary change of key genes, and are sometimes detectable through sequence-level analyses. In the case of protein-coding genes, such analyses frequently predict that specific codons are under positive selection. However, detecting positive selection can be non-trivial, and false positive predictions are a common concern in such analyses. It is therefore helpful to place such predictions within a structural and functional context. Here, we focus on the p19 protein from tombusviruses. P19 is a homodimer that sequesters siRNAs, thereby preventing the host RNAi machinery from shutting down viral infection. Sequence analysis of the p19 gene is complicated by the fact that it is constrained at the sequence level by overprinting of a viral movement protein gene. Using homology modeling, in silico mutation and molecular dynamics simulations, we assess how non-synonymous changes to two residues involved in forming the dimer interface-one invariant, and one predicted to be under positive selection-impact molecular function. Interestingly, we find that both observed variation and potential variation (where a non-synonymous change to p19 would be synonymous for the overprinted movement protein does not significantly impact protein structure or RNA binding. Consequently, while several methods identify residues at the dimer interface as being under positive selection, MD results suggest they are functionally indistinguishable from a site that is free to vary. Our analyses serve as a caveat to using sequence-level analyses in isolation to detect and assess positive selection, and emphasize the importance of also accounting for how non-synonymous changes impact structure and function.

  10. Visualizing phylogenetic tree landscapes.

    Science.gov (United States)

    Wilgenbusch, James C; Huang, Wen; Gallivan, Kyle A

    2017-02-02

    Genomic-scale sequence alignments are increasingly used to infer phylogenies in order to better understand the processes and patterns of evolution. Different partitions within these new alignments (e.g., genes, codon positions, and structural features) often favor hundreds if not thousands of competing phylogenies. Summarizing and comparing phylogenies obtained from multi-source data sets using current consensus tree methods discards valuable information and can disguise potential methodological problems. Discovery of efficient and accurate dimensionality reduction methods used to display at once in 2- or 3- dimensions the relationship among these competing phylogenies will help practitioners diagnose the limits of current evolutionary models and potential problems with phylogenetic reconstruction methods when analyzing large multi-source data sets. We introduce several dimensionality reduction methods to visualize in 2- and 3-dimensions the relationship among competing phylogenies obtained from gene partitions found in three mid- to large-size mitochondrial genome alignments. We test the performance of these dimensionality reduction methods by applying several goodness-of-fit measures. The intrinsic dimensionality of each data set is also estimated to determine whether projections in 2- and 3-dimensions can be expected to reveal meaningful relationships among trees from different data partitions. Several new approaches to aid in the comparison of different phylogenetic landscapes are presented. Curvilinear Components Analysis (CCA) and a stochastic gradient decent (SGD) optimization method give the best representation of the original tree-to-tree distance matrix for each of the three- mitochondrial genome alignments and greatly outperformed the method currently used to visualize tree landscapes. The CCA + SGD method converged at least as fast as previously applied methods for visualizing tree landscapes. We demonstrate for all three mtDNA alignments that 3D

  11. The phylogenetic position of Lygodactylus angularis and the utility of the 16S rDNA gene for delimiting species in Lygodactylus (Squamata, Gekkonidae

    Directory of Open Access Journals (Sweden)

    Riccardo Castiglia

    2011-06-01

    ="EN-US">, the phylogenetic position of one species for which molecular data are lacking, L. angularis. Moreover, we compared the intraspecific vs interspecific genetic divergence using an extended dataset (37 species, 160 haplotypes, to determine whether a fragment of the same gene can be useful for species identification and to reveal the possible presence of new cryptic species in the genus. Lygodactylus angularis resulted in a monophyletic group together with members of the “fisheri” group and of the “picturatus” group. Nevertheless, the independence of the “angularis” lineage is supported by the high genetic divergence. Comparison of intraspecific vs interpecific genetic distances highlights that the threshold values useful for recognising a candidate new species can be tentatively placed at 7%. We identified four species that showed an intraspecific divergence higher than or near the 7% threshold: L. capensis (8.7%, L. gutturalis (9.3%, L. madagascariensis (6.5% and L. picturatus (8.1%. Moreover two species, L. mombasicus and L. verticillatus are paraphyletic in terms of gene genealogy. This study shows that a short fragment of the 16S rDNA gene

  12. Molecular marker differences relate to developmental position and subsets of mesodiencephalic dopaminergic neurons.

    Directory of Open Access Journals (Sweden)

    Simone M Smits

    Full Text Available The development of mesodiencephalic dopaminergic (mdDA neurons located in the substantia nigra compacta (SNc and ventral tegmental area (VTA follow a number of stages marked by distinct events. After preparation of the region by signals that provide induction and patterning, several transcription factors have been identified, which are involved in specifying the neuronal fate of these cells. The specific vulnerability of SNc neurons is thought to root in these specific developmental programs. The present study examines the positions of young postmitotic mdDA neurons to relate developmental position to mdDA subset specific markers. MdDA neurons were mapped relative to the neuromeric domains (prosomeres 1-3 (P1-3, midbrain, and hindbrain as well as the longitudinal subdivisions (floor plate, basal plate, alar plate, as proposed by the prosomeric model. We found that postmitotic mdDA neurons are located mainly in the floorplate domain and very few in slightly more lateral domains. Moreover, mdDA neurons are present along a large proportion of the anterior/posterior axis extending from the midbrain to P3 in the diencephalon. The specific positions relate to some extent to the presence of specific subset markers as Ahd2. In the adult stage more of such subsets specific expressed genes are present and may represent a molecular map defining molecularly distinct groups of mdDA neurons.

  13. Molecular phylogenetics, diversification, and systematics of Tibicen Latreille 1825 and allied cicadas of the tribe Cryptotympanini, with three new genera and emphasis on species from the USA and Canada(Hemiptera: Auchenorrhyncha: Cicadidae).

    Science.gov (United States)

    Hill, Kathy B R; Marshall, David C; Moulds, Maxwell S; Simon, Chris

    2015-07-10

    North America has a diverse cicada fauna with multiple genera from all three Cicadidae subfamilies, yet molecular phylogenetic analyses have been completed only for the well-studied periodical cicadas (Magicicada Davis). The genus Tibicen Latreille, a large group of charismatic species, is in need of such work because morphological patterns suggest multiple groups with complicated relationships to other genera in the tribe Cryptotympanini. In this paper we present a molecular phylogenetic analysis, based on mitochondrial and nuclear DNA, of 35 of the 38 extant USA species and subspecies of the genus Tibicen together with their North American tribal allies (Cornuplura Davis, Cacama Davis), selected Tibicen species from Eurasia, and representatives of other Eurasian and Pacific cryptotympanine genera. This tree shows that Tibicen contains several well-supported clades, one predominating in eastern and central North America and related to Cryptotympana Stål and Raiateana Boulard, another in western North America related to Cacama and Cornuplura, and at least two clades in Eurasia. We also present a morphological cladistic analysis of Tibicen and its close allies based on 27 characters. Character states identified in the cladistic analysis define three new genera, two for North American taxa (Hadoa gen. n. and Neotibicen gen. n.) including several Mexican species, and one for Asian species (Subsolanus gen. n.). Using relaxed molecular clocks and literature-derived mtDNA rate estimates, we estimate the timeframe of diversification of Tibicen clades and find that intergeneric divergence has occurred since the late Eocene, with most extant species within the former Tibicen originating after the mid-Miocene. We review patterns of ecology, behavior, and geography among Tibicen clades in light of the phylogenetic results and note that the study of these insects is still in its early stages. Some Mexican species formerly placed in Tibicen are here transferred to Diceroprocta

  14. Molecular characteristics of bap-positive Staphylococcus aureus strains from dairy cow mastitis.

    Science.gov (United States)

    Snel, Gustavo G M; Monecke, Stefan; Ehricht, Ralf; Piccinini, Renata

    2015-08-01

    The biofilm-associated protein (Bap) of Staphylococcus aureus is a high molecular weight cell-wall-anchored protein involved in biofilm formation, first described in bovine mastitis strains from Spain. So far, studies regarding Bap were mainly based on the Spanish strain V329 and its mutants, but no information on the genetic variability of bap-positive Staph. aureus strains is yet available in the literature. The present study investigated the molecular characteristics of 8 bap-positive Staph. aureus strains from subclinical bovine mastitis, isolated in 5 herds; somatic cell counts (SCC) of milk samples were also registered. Strains were characterised using MLST, SPA typing and microarray and the results were compared with V329. All isolates from this study and V329 were assigned to ST126, t605, but some molecular differences were observed. Only herd A and B strains harboured the genes for β-lactams resistance; the leukocidin D/E gene, a type I site-specific deoxyribonuclease subunit, 3rd locus gene and serin-protease A and B were carried by all strains, but not by V329, while serin-protease E was absent in V329 and in another isolate. Four isolates and V329 harboured the fibronectin-binding protein B gene. SCC showed the highest value in the milk sample affected by the only strain carrying all the virulence factors considered. Potential large variability of virulence was evidenced among V329 and all bap-positive Staph. aureus strains considered: the carriage of fnb could enhance the accumulation of biofilm, but the lack of lukD/E and splA, B or E might decrease the invasiveness of strain.

  15. Phylogenetic relationships of Chilean leptodactylids: a molecular approach based on mitochondrial genes 12S and 16S Relaciones filogenéticas de los leptodactílidos chilenos: una aproximación molecular basada en los genes mitocondriales 12S y 16S

    Directory of Open Access Journals (Sweden)

    CLAUDIO CORREA

    2006-12-01

    Full Text Available Most Chilean amphibians belong to the subfamily Telmatobiinae (Anura, Leptodactylidae. Several phylogenetic studies of Leptodactylidae and Telmatobiinae, based principally on morphological characters, have implicitly suggested closer relationships of some species of the Telmatobiinae with members of other subfamilies of leptodactylids, including the leptodactyline genus Pleurodema which is present in Chile. Furthermore, a growing number of molecular studies suggest a non monophyletic status for Telmatobiinae, although none of these studies have investigated the phylogenetic relationships of this subfamily. We compared partial sequences of the ribosomal mitochondrial genes 12S and 16S to determine the phylogenetic relationships of Chilean leptodactylids and its position within the modern anurans (Neobatrachia. We included 22 species from nine of the 10 genera of telmatobiines present in Chile (Alsodes, Atelognathus, Batrachyla, Caudiverbera, Eupsophus, Hylorina, Insuetophrynus, Telmatobufo and Telmatobius, two species of the genus Pleurodema, and one species of Rhinodermatidae, which is considered a leptodactylid derivative family by some authors. We also included 51 species representing most of the families that compose Neobatrachia. Phylogenetic reconstructions were performed using the methods of maximum parsimony, maximum likelihood and Bayesian inference. The topologies obtained in all the analyses indicate that Telmatobiinae is a polyphyletic assemblage, composed by species belonging to Hyloidea (most of the genera and species more related to Australasian taxa (the clade Caudiverbera + Telmatobufo, defined as the tribe Calyptocephalellini. These molecular data support groups based on other kinds of evidence (Caudiverbera + Telmatobufo, Alsodes + Eupsophus and Batrachyla + Hylorina and raise new phylogenetic hypotheses for several genera of telmatobiines (Atelognathus with Batrachyla and Hylorina, Insuetophrynus + Rhinoderma. The phylogenetic

  16. How to Make a Dolphin: Molecular Signature of Positive Selection in Cetacean Genome.

    Directory of Open Access Journals (Sweden)

    Mariana F Nery

    Full Text Available Cetaceans are unique in being the only mammals completely adapted to an aquatic environment. This adaptation has required complex changes and sometimes a complete restructuring of physiology, behavior and morphology. Identifying genes that have been subjected to selection pressure during cetacean evolution would greatly enhance our knowledge of the ways in which genetic variation in this mammalian order has been shaped by natural selection. Here, we performed a genome-wide scan for positive selection in the dolphin lineage. We employed models of codon substitution that account for variation of selective pressure over branches on the tree and across sites in a sequence. We analyzed 7,859 nuclear-coding ortholog genes and using a series of likelihood ratio tests (LRTs, we identified 376 genes (4.8% with molecular signatures of positive selection in the dolphin lineage. We used the cow as the sister group and compared estimates of selection in the cetacean genome to this using the same methods. This allowed us to define which genes have been exclusively under positive selection in the dolphin lineage. The enrichment analysis found that the identified positively selected genes are significantly over-represented for three exclusive functional categories only in the dolphin lineage: segment specification, mesoderm development and system development. Of particular interest for cetacean adaptation to an aquatic life are the following GeneOntology targets under positive selection: genes related to kidney, heart, lung, eye, ear and nervous system development.

  17. Unrealistic phylogenetic trees may improve phylogenetic footprinting.

    Science.gov (United States)

    Nettling, Martin; Treutler, Hendrik; Cerquides, Jesus; Grosse, Ivo

    2017-06-01

    The computational investigation of DNA binding motifs from binding sites is one of the classic tasks in bioinformatics and a prerequisite for understanding gene regulation as a whole. Due to the development of sequencing technologies and the increasing number of available genomes, approaches based on phylogenetic footprinting become increasingly attractive. Phylogenetic footprinting requires phylogenetic trees with attached substitution probabilities for quantifying the evolution of binding sites, but these trees and substitution probabilities are typically not known and cannot be estimated easily. Here, we investigate the influence of phylogenetic trees with different substitution probabilities on the classification performance of phylogenetic footprinting using synthetic and real data. For synthetic data we find that the classification performance is highest when the substitution probability used for phylogenetic footprinting is similar to that used for data generation. For real data, however, we typically find that the classification performance of phylogenetic footprinting surprisingly increases with increasing substitution probabilities and is often highest for unrealistically high substitution probabilities close to one. This finding suggests that choosing realistic model assumptions might not always yield optimal predictions in general and that choosing unrealistically high substitution probabilities close to one might actually improve the classification performance of phylogenetic footprinting. The proposed PF is implemented in JAVA and can be downloaded from https://github.com/mgledi/PhyFoo. : martin.nettling@informatik.uni-halle.de. Supplementary data are available at Bioinformatics online. © The Author 2017. Published by Oxford University Press.

  18. The influence of molecular markers and methods on inferring the phylogenetic relationships between the representatives of the Arini (parrots, Psittaciformes), determined on the basis of their complete mitochondrial genomes.

    Science.gov (United States)

    Urantowka, Adam Dawid; Kroczak, Aleksandra; Mackiewicz, Paweł

    2017-07-14

    Conures are a morphologically diverse group of Neotropical parrots classified as members of the tribe Arini, which has recently been subjected to a taxonomic revision. The previously broadly defined Aratinga genus of this tribe has been split into the 'true' Aratinga and three additional genera, Eupsittula, Psittacara and Thectocercus. Popular markers used in the reconstruction of the parrots' phylogenies derive from mitochondrial DNA. However, current phylogenetic analyses seem to indicate conflicting relationships between Aratinga and other conures, and also among other Arini members. Therefore, it is not clear if the mtDNA phylogenies can reliably define the species tree. The inconsistencies may result from the variable evolution rate of the markers used or their weak phylogenetic signal. To resolve these controversies and to assess to what extent the phylogenetic relationships in the tribe Arini can be inferred from mitochondrial genomes, we compared representative Arini mitogenomes as well as examined the usefulness of the individual mitochondrial markers and the efficiency of various phylogenetic methods. Single molecular markers produced inconsistent tree topologies, while different methods offered various topologies even for the same marker. A significant disagreement in these tree topologies occurred for cytb, nd2 and nd6 genes, which are commonly used in parrot phylogenies. The strongest phylogenetic signal was found in the control region and RNA genes. However, these markers cannot be used alone in inferring Arini phylogenies because they do not provide fully resolved trees. The most reliable phylogeny of the parrots under study is obtained only on the concatenated set of all mitochondrial markers. The analyses established significantly resolved relationships within the former Aratinga representatives and the main genera of the tribe Arini. Such mtDNA phylogeny can be in agreement with the species tree, owing to its match with synapomorphic features in

  19. Molecular epidemiology and genotyping of hepatitis B virus of HBsAg-positive patients in Oman.

    Science.gov (United States)

    Al Baqlani, Said Ali; Sy, Bui Tien; Ratsch, Boris A; Al Naamani, Khalid; Al Awaidy, Salah; Busaidy, Suleiman Al; Pauli, Georg; Bock, C-Thomas

    2014-01-01

    Hepatitis B virus (HBV) infection is a major global health burden with distinct geographic public health significance. Oman is a country with intermediate HBV carrier prevalence; however, little is known about the incidence of HBV variants in circulation. We investigated the HBV genotype distribution, the occurrence of antiviral resistance, and HBV surface antigen (HBsAg) escape mutations in HBsAg-positive patients in Oman. Serum samples were collected from 179 chronically HBV-infected patients enrolled in various gastroenterology clinics in Oman. HBV genotypes were determined by sequencing and phylogenetic analysis. Mutations in the HBV polymerase and the HBsAg gene were characterized by mutational analysis. HBV genotypes D (130/170; 76.47%) and A (32/170; 18.28%) are predominant in Oman. The HBV genotypes C and E were less frequent (each 1.18%), while the HBV genotypes B, G, F, and H were not detected. Four patients revealed HBV genotype mixtures (HBV-A/D and D/C). The analyses of vaccine escape mutations yield that 148/170 (87.06%) HBV sequences were wild type. 22/170 (12.94%) HBV sequences showed mutations in the "a" determinant of the HBsAg domain. Two patients showed the described HBV vaccine escape mutation sP120T. 8/146 (5.48%) HBV isolates harbored mutations in the HBV polymerase known to confer resistance against antiviral therapy. Especially the lamivudine resistance mutations rtL180M/rtM204V and rtM204I were detected. This study shows the distribution of HBV genotypes, therapy resistance, and vaccine escape mutations in HBV-infected patients in Oman. Our findings will have a major impact on therapy management and diagnostics of chronic HBV infections in Oman to control HBV infection in this intermediate HBV-endemic country.

  20. Phylogenetic position of the giant anuran trypanosomes Trypanosoma chattoni, Trypanosoma fallisi, Trypanosoma mega, Trypanosoma neveulemairei, and Trypanosoma ranarum inferred from 18S rRNA gene sequences.

    Science.gov (United States)

    Martin, Donald S; Wright, André-Denis G; Barta, John R; Desser, Sherwin S

    2002-06-01

    Phylogenetic relationships within the kinetoplastid flagellates were inferred from comparisons of small-subunit ribosomal RNA gene sequences. These included 5 new gene sequences, Trypanosoma fallisi (2,239 bp), Trypanosoma chattoni (2,180 bp), Trypanosoma mega (2,211 bp), Trypanosoma neveulemairei (2,197 bp), and Trypanosoma ranarum (2,203 bp). Trees produced using maximum-parsimony and distance-matrix methods (least-squares, neighbor-joining, and maximum-likelihood), supported by strong bootstrap and quartet-puzzle analyses, indicated that the trypanosomes are a monophyletic group that divides into 2 major lineages, the salivarian trypanosomes and the nonsalivarian trypanosomes. The nonsalivarian trypanosomes further divide into 2 lineages, 1 containing trypanosomes of birds, mammals, and reptiles and the other containing trypanosomes of fish, reptiles, and anurans. Among the giant trypanosomes, T. chattoni is clearly shown to be distantly related to all the other anuran trypanosome species. Trypanosoma mega is closely associated with T. fallisi and T. ranarum, whereas T. neveulemairei and Trypanosoma rotatorium are sister taxa. The branching order of the anuran trypanosomes suggests that some toad trypanosomes may have evolved by host switching from frogs to toads.

  1. Unique phylogenetic position of Diplomonadida based on the complete small subunit ribosomal RNA sequence of Giardia ardeae, G. muris, G. duodenalis and Hexamita sp.

    Science.gov (United States)

    van Keulen, H; Gutell, R R; Gates, M A; Campbell, S R; Erlandsen, S L; Jarroll, E L; Kulda, J; Meyer, E A

    1993-01-01

    Complete small-subunit rRNA (SSU-rRNA) coding region sequences were determined for two species of the intestinal parasite Giardia: G. ardeae and G. muris, both belonging to the order Diplomonadida, and a free-living member of this order, Hexamita sp. These sequences were compared to published SSU-rDNA sequences from a third member of the genus Giardia, G. duodenalis (often called G. intestinalis or G. lamblia) and various representative organisms from other taxa. Of the three Giardia sequences analyzed, the SSU-rRNA from G. muris is the smallest (1432 bases as compared to 1435 and 1453 for G. ardeae and G. duodenalis, respectively) and has the lowest G+C content (58.9%). The Hexamita SSU-rRNA is the largest in this group, containing 1550 bases. Because the sizes of the SSU-rRNA are prokaryotic rather than typically eukaryotic, the secondary structures of the SSU-rRNAs were constructed. These structures show a number of typically eukaryotic signature sequences. Sequence alignments based on constraints imposed by secondary structure were used for construction of a phylogenetic tree for these four taxa. The results show that of the four diplomonads represented, the Giardia species form a distinct group. The other diplomonad Hexamita and the microsporidium Vairimorpha necatrix appear to be distinct from Giardia.

  2. Sinuolinea infections in the urinary system of Cynoscion species (Sciaenidae) and the search for the phylogenetic position of the type species of Sinuolinea Davis, 1917 (Myxozoa: Myxosporea)

    Czech Academy of Sciences Publication Activity Database

    Dyková, I.; Kodádková, Alena; de Buron, I.; Fiala, Ivan; Roumillat, W. A.

    2013-01-01

    Roč. 2, - (2013), s. 10-17 ISSN 2213-2244 R&D Projects: GA ČR GBP505/12/G112 Institutional support: RVO:60077344 Keywords : Sinuolinea dimorpha * Cynoscion nebulosus * Cynoscion regalis * Cryptic species * Myxosporean phylogeny Subject RIV: EB - Genetics ; Molecular Biology

  3. Molecular sites for the positive allosteric modulation of glycine receptors by endocannabinoids.

    Directory of Open Access Journals (Sweden)

    Gonzalo E Yévenes

    Full Text Available Glycine receptors (GlyRs are transmitter-gated anion channels of the Cys-loop superfamily which mediate synaptic inhibition at spinal and selected supraspinal sites. Although they serve pivotal functions in motor control and sensory processing, they have yet to be exploited as drug targets partly because of hitherto limited possibilities for allosteric control. Endocannabinoids (ECs have recently been characterized as direct allosteric GlyR modulators, but the underlying molecular sites have remained unknown. Here, we show that chemically neutral ECs (e.g. anandamide, AEA are positive modulators of α(1, α(2 and α(3 GlyRs, whereas acidic ECs (e.g. N-arachidonoyl-glycine; NA-Gly potentiate α(1 GlyRs but inhibit α(2 and α(3. This subunit-specificity allowed us to identify the underlying molecular sites through analysis of chimeric and mutant receptors. We found that alanine 52 in extracellular loop 2, glycine 254 in transmembrane (TM region 2 and intracellular lysine 385 determine the positive modulation of α(1 GlyRs by NA-Gly. Successive substitution of non-conserved extracellular and TM residues in α(2 converted NA-Gly-mediated inhibition into potentiation. Conversely, mutation of the conserved lysine within the intracellular loop between TM3 and TM4 attenuated NA-Gly-mediated potentiation of α(1 GlyRs, without affecting inhibition of α(2 and α(3. Notably, this mutation reduced modulation by AEA of all three GlyRs. These results define molecular sites for allosteric control of GlyRs by ECs and reveal an unrecognized function for the TM3-4 intracellular loop in the allosteric modulation of Cys-loop ion channels. The identification of these sites may help to understand the physiological role of this modulation and facilitate the development of novel therapeutic approaches to diseases such as spasticity, startle disease and possibly chronic pain.

  4. Molecular characterization and phylogenetic analysis of Explanatum explanatum in India based on nucleotide sequences of ribosomal ITS2 and the mitochondrial gene nad1.

    Science.gov (United States)

    Hayashi, Kei; Mohanta, Uday K; Ohari, Yuma; Neeraja, Tambireddy; Singh, T Shantikumar; Sugiyama, Hiromu; Itagaki, Tadashi

    2016-12-01

    The aim of this study was to analyze the phylogenetic relationship between Explanatum explanatum populations in India and other countries of the Indian subcontinent. Seventy liver amphistomes collected from four localities in India were identified as E. explanatum based on the nucleotide sequences of ribosomal ITS2. The flukes were then analyzed phylogenetically based on the nucleotide sequence of the mitochondrial gene nad1 in comparison with flukes from Bangladesh and Nepal. In the resulting phylogenetic tree, the nad1 haplotypes from India were divided into four clades, and the flukes showing the haplotypes of clades A and C were predominant in India. The haplotypes of the clades A and C have also been detected in Bangladesh and Nepal, and therefore, it seems they occur commonly throughout the Indian subcontinent. The results of AMOVA suggested that gene flow was likely to occur between E. explanatum populations in these countries. These countries are geographically close and have been historically and culturally connected to each other, and therefore, the movements of host ruminants among these countries might have been involved in the migration of the flukes and their gene flow.

  5. Molecular phylogenetics of Floridosentis ward, 1953 (Acanthocephala: Neoechinorhynchidae) parasites of mullets (Osteichthyes) from Mexico, using 28S rDNA sequences.

    Science.gov (United States)

    Rosas-Valdez, Rogelio; Morrone, Juan J; García-Varela, Martín

    2012-08-01

    Species of Floridosentis (Acanthocephala) are common parasites of mullets (Mugil spp., Mugilidae) found in tropical marine and brackish water in the Americas. Floridosentis includes 2 species distributed in Mexico, i.e., Floridosentis pacifica, restricted to the Pacific Ocean near Salina Cruz, Oaxaca, and Floridosentis mugilis, distributed along the coast of the Pacific Ocean and the Gulf of Mexico. We sampled 18 populations of F. mugilis and F. pacifica (12 from the Pacific and 6 from the Gulf of Mexico) and sequenced a fragment of the rDNA large subunit to evaluate phylogenetic relationships of populations of Floridosentis spp. from Mexico. Species identification of museum specimens of F. mugilis from the Pacific Ocean was confirmed by examination of morphology traits. Phylogenetic trees inferred with maximum parsimony, maximum likelihood, and Bayesian inference indicate that Floridosentis is monophyletic comprising of 2 major well-supported clades, the first clade corresponding to F. mugilis from the Gulf of Mexico, and the second to F. pacifica from the Pacific Ocean. Genetic divergence between species ranged from 7.68 to 8.60%. Intraspecific divergence ranged from 0.14 to 0.86% for F. mugilis and from 1.72 to 4.49% for F. pacifica. Data obtained from diagnostic characters indicate that specimens from the Pacific Ocean in Mexico have differences in some traits among locations. These results are consistent with the phylogenetic hypothesis, indicating that F. pacifica is distributed in the Pacific Ocean in Mexico with 3 major lineages.

  6. Facile Fabrication of Animal-Specific Positioning Molds For Multi-modality Molecular Imaging

    International Nuclear Information System (INIS)

    Park, Jeong Chan; Oh, Ji Eun; Woo, Seung Tae

    2008-01-01

    Recently multi-modal imaging system has become widely adopted in molecular imaging. We tried to fabricate animal-specific positioning molds for PET/MR fusion imaging using easily available molding clay and rapid foam. The animal-specific positioning molds provide immobilization and reproducible positioning of small animal. Herein, we have compared fiber-based molding clay with rapid foam in fabricating the molds of experimental animal. The round bottomed-acrylic frame, which fitted into microPET gantry, was prepared at first. The experimental mice was anesthetized and placed on the mold for positioning. Rapid foam and fiber-based clay were used to fabricate the mold. In case of both rapid foam and the clay, the experimental animal needs to be pushed down smoothly into the mold for positioning. However, after the mouse was removed, the fabricated clay needed to be dried completely at 60 .deg. C in oven overnight for hardening. Four sealed pipe tips containing [ 18 F]FDG solution were used as fiduciary markers. After injection of [ 18 F]FDG via tail vein, microPET scanning was performed. Successively, MRI scanning was followed in the same animal. Animal-specific positioning molds were fabricated using rapid foam and fiber-based molding clay for multimodality imaging. Functional and anatomical images were obtained with microPET and MRI, respectively. The fused PET/MR images were obtained using freely available AMIDE program. Animal-specific molds were successfully prepared using easily available rapid foam, molding clay and disposable pipet tips. Thanks to animal-specific molds, fusion images of PET and MR were co-registered with negligible misalignment

  7. The first complete organellar genomes of an Antarctic red alga, Pyropia endiviifolia: insights into its genome architecture and phylogenetic position within genus Pyropia (Bangiales, Rhodophyta)

    Science.gov (United States)

    Xu, Kuipeng; Tang, Xianghai; Bi, Guiqi; Cao, Min; Wang, Lu; Mao, Yunxiang

    2017-08-01

    Pyropia species grow in the intertidal zone and are cold-water adapted. To date, most of the information about the whole plastid and mitochondrial genomes (ptDNA and mtDNA) of this genus is limited to Northern Hemisphere species. Here, we report the sequencing of the ptDNA and mtDNA of the Antarctic red alga Pyropia endiviifolia using the Illumina platform. The plastid genome (195 784 bp, 33.28% GC content) contains 210 protein-coding genes, 37 tRNA genes and 6 rRNA genes. The mitochondrial genome (34 603 bp, 30.5% GC content) contains 26 protein-coding genes, 25 tRNA genes and 2 rRNA genes. Our results suggest that the organellar genomes of Py. endiviifolia have a compact organization. Although the collinearity of these genomes is conserved compared with other Pyropia species, the genome sizes show significant differences, mainly because of the different copy numbers of rDNA operons in the ptDNA and group II introns in the mtDNA. The other Pyropia species have 2u20133 distinct intronic ORFs in their cox 1 genes, but Py. endiviifolia has no introns in its cox 1 gene. This has led to a smaller mtDNA than in other Pyropia species. The phylogenetic relationships within Pyropia were examined using concatenated gene sets from most of the available organellar genomes with both the maximum likelihood and Bayesian methods. The analysis revealed a sister taxa affiliation between the Antarctic species Py. endiviifolia and the North American species Py. kanakaensis.

  8. Global patterns of amphibian phylogenetic diversity

    DEFF Research Database (Denmark)

    Fritz, Susanne; Rahbek, Carsten

    2012-01-01

    Aim  Phylogenetic diversity can provide insight into how evolutionary processes may have shaped contemporary patterns of species richness. Here, we aim to test for the influence of phylogenetic history on global patterns of amphibian species richness, and to identify areas where macroevolutionary...... processes such as diversification and dispersal have left strong signatures on contemporary species richness. Location  Global; equal-area grid cells of approximately 10,000 km2. Methods  We generated an amphibian global supertree (6111 species) and repeated analyses with the largest available molecular...... phylogeny (2792 species). We combined each tree with global species distributions to map four indices of phylogenetic diversity. To investigate congruence between global spatial patterns of amphibian species richness and phylogenetic diversity, we selected Faith’s phylogenetic diversity (PD) index...

  9. Antimicrobial resistance and molecular characterization of virulence genes, phylogenetic groups of Escherichia coli isolated from diarrheic and healthy camel-calves in Tunisia.

    Science.gov (United States)

    Bessalah, Salma; Fairbrother, John Morris; Salhi, Imed; Vanier, Ghyslaine; Khorchani, Touhami; Seddik, Mouldi Mabrouk; Hammadi, Mohamed

    2016-12-01

    This study was conducted to determine the prevalence of virulence genes, serogroups, antimicrobial resistance and phylogenetic groups of Escherichia coli strains isolated from diarrheic and healthy camel calves in Tunisia. From 120 fecal samples (62 healthy and 58 diarrheic camel calves aged less than 3 months), 70 E. coli isolates (53 from diarrheic herds and 17 from healthy herds) were examined by PCR for detection of the virulence genes associated with pathogenic E. coli in animals. A significantly greater frequency of the f17 gene was observed in individual camels and in herds with diarrhea, this gene being found in 44.7% and 41.5% of isolates from camels and herds with diarrhea versus 22.5% and 11.7% in camels (p=0.05) and herds without diarrhea (p=0.02). The aida, cnf1/2, f18, stx2 and paa genes were found only in isolates from camels with diarrhea, although at a low prevalence, 1.8%, 3.7%, 1.8%, 3.7% and 11.3%, respectively. Prevalence of afa8, cdtB, eae, east1, iroN, iss, kpsMTII, paa, sfa, tsh and papC genes did not differ significantly between herds with or without diarrhea. Genes coding for faeG, fanC, f41, estI, estII, CS31a and eltA were not detected in any isolates. All isolates were sensitive to amikacin, chloramphenicol, ciprofloxacin, gentamicin and ceftiofur and the highest frequency of resistance was observed to tetracycline, and ampicillin (52.8% and 37.1% respectively). The phylogenetic groups were identified by conventional triplex PCR. Results showed that E. coli strains segregated mainly in phylogenetic group B1, 52.8% in diarrheic herds and 52.9% in healthy herds. Copyright © 2016 Elsevier Ltd. All rights reserved.

  10. Defined-size DNA triple crossover construct for molecular electronics: modification, positioning and conductance properties.

    Science.gov (United States)

    Linko, Veikko; Leppiniemi, Jenni; Paasonen, Seppo-Tapio; Hytönen, Vesa P; Toppari, J Jussi

    2011-07-08

    We present a novel, defined-size, small and rigid DNA template, a so-called B-A-B complex, based on DNA triple crossover motifs (TX tiles), which can be utilized in molecular scale patterning for nanoelectronics, plasmonics and sensing applications. The feasibility of the designed construct is demonstrated by functionalizing the TX tiles with one biotin-triethylene glycol (TEG) and efficiently decorating them with streptavidin, and furthermore by positioning and anchoring single thiol-modified B-A-B complexes to certain locations on a chip via dielectrophoretic trapping. Finally, we characterize the conductance properties of the non-functionalized construct, first by measuring DC conductivity and second by utilizing AC impedance spectroscopy in order to describe the conductivity mechanism of a single B-A-B complex using a detailed equivalent circuit model. This analysis also reveals further information about the conductivity of DNA structures in general.

  11. Phylogenetic and chemical studies in the potential psychotropic species complex of Psilocybe atrobrunnea with taxonomic and nomenclatural notes

    NARCIS (Netherlands)

    Borovička, J.; Oborník, M.; Stříbrný, J.; Noordeloos, M.E.; Parra Sánchez, L.A.; Gryndler, M.

    2015-01-01

    Five Psilocybe species with unresolved systematic position (P. atrobrunnea, P. laetissima, P. medullosa, P. pelliculosa, and P. silvatica) were investigated using four molecular markers (EF1-α, ITS, LSU, and IGS). Phylogenetic analysis revealed that with the exception of P. laetissima, which is now

  12. Optically directed molecular transport and 3D isoelectric positioning of amphoteric biomolecules

    International Nuclear Information System (INIS)

    Hafeman, Dean G.; Harkins, James B.; Witkowski, Charles E. II; Lewis, Nathan S.; Brown, Gilbert M.; Warmack, Robert J. Bruce; Thundat, Thomas George

    2006-01-01

    We demonstrate the formation of charged molecular packets and their transport within optically created electrical force-field traps in a pH-buffered electrolyte. We call this process photoelectrophoretic localization and transport (PELT). The electrolyte is in contact with a photoconductive semiconductor electrode and a counterelectrode that are connected through an external circuit. A light beam directed to coordinates on the photoconductive electrode surface produces a photocurrent within the circuit and electrolyte. Within the electrolyte, the photocurrent creates localized force-field traps centered at the illuminated coordinates. Charged molecules, including polypeptides and proteins, electrophoretically accumulate into the traps and subsequently can be transported in the electrolyte by moving the traps over the photoconductive electrode in response to movement of the light beam. The molecules in a single trap can be divided into aliquots, and the aliquots can be directed along multiple routes simultaneously by using multiple light beams. This photoelectrophoretic transport of charged molecules by PELT resembles the electrostatic transport of electrons within force-field wells of solid-state charge-coupled devices. The molecules, however, travel in a liquid electrolyte rather than a solid. Furthermore, we have used PELT to position amphoteric biomolecules in three dimensions. A 3D pH gradient was created in an electrolyte medium by controlling the illumination position on a photoconductive anode where protons were generated electrolytically. Photoelectrophoretic transport of amphoteric molecules through the pH gradient resulted in accumulation of the molecules at their apparent 3D isoelectric coordinates in the medium.

  13. Position sensitive detection coupled to high-resolution time-of-flight mass spectrometry: Imaging for molecular beam deflection experiments

    International Nuclear Information System (INIS)

    Abd El Rahim, M.; Antoine, R.; Arnaud, L.; Barbaire, M.; Broyer, M.; Clavier, Ch.; Compagnon, I.; Dugourd, Ph.; Maurelli, J.; Rayane, D.

    2004-01-01

    We have developed and tested a high-resolution time-of-flight mass spectrometer coupled to a position sensitive detector for molecular beam deflection experiments. The major achievement of this new spectrometer is to provide a three-dimensional imaging (X and Y positions and time-of-flight) of the ion packet on the detector, with a high acquisition rate and a high resolution on both the mass and the position. The calibration of the experimental setup and its application to molecular beam deflection experiments are discussed

  14. An outbreak of Leishmania major from an endemic to a non-endemic region posed a public health threat in Iraq from 2014-2017: Epidemiological, molecular and phylogenetic studies.

    Directory of Open Access Journals (Sweden)

    Mariwan M M Al-Bajalan

    2018-03-01

    Full Text Available Cutaneous leishmaniasis (CL is a neglected worldwide, zoonotic, vector-borne, tropical disease that is a threat to public health. This threat may spread from endemic to non-endemic areas. Current research has exploited epidemiological, molecular and phylogenetical studies to determine the danger of an outbreak of CL in the borderline area between northern and central Iraq from 2014-2017.For the first time, using sequence analysis of the cytochrome b gene, the occurrence of CL in the borderline area between northern and central Iraq was confirmed to be due to Leishmania major. The phylogenetic analysis indicated that it was closely related to the L. major MRHO/IR/75/ER strain in Iran.In conclusion, the genotype confirmation of the L. major strain will improve our understanding of the epidemiology of the disease. This is important for facilitating control programs to prevent the further spread of CL. Furthermore, this area could be considered as a model for further research on the risk of global CL epidemics in other non-endemic countries where both reservoir hosts and sandfly vectors are present.

  15. An outbreak of Leishmania major from an endemic to a non-endemic region posed a public health threat in Iraq from 2014-2017: Epidemiological, molecular and phylogenetic studies.

    Science.gov (United States)

    Al-Bajalan, Mariwan M M; Al-Jaf, Sirwan M A; Niranji, Sherko S; Abdulkareem, Dler R; Al-Kayali, Khudhair K; Kato, Hirotomo

    2018-03-01

    Cutaneous leishmaniasis (CL) is a neglected worldwide, zoonotic, vector-borne, tropical disease that is a threat to public health. This threat may spread from endemic to non-endemic areas. Current research has exploited epidemiological, molecular and phylogenetical studies to determine the danger of an outbreak of CL in the borderline area between northern and central Iraq from 2014-2017. For the first time, using sequence analysis of the cytochrome b gene, the occurrence of CL in the borderline area between northern and central Iraq was confirmed to be due to Leishmania major. The phylogenetic analysis indicated that it was closely related to the L. major MRHO/IR/75/ER strain in Iran. In conclusion, the genotype confirmation of the L. major strain will improve our understanding of the epidemiology of the disease. This is important for facilitating control programs to prevent the further spread of CL. Furthermore, this area could be considered as a model for further research on the risk of global CL epidemics in other non-endemic countries where both reservoir hosts and sandfly vectors are present.

  16. The Complete Plastid Genome Sequence of Madagascar Periwinkle Catharanthus roseus (L.) G. Don: Plastid Genome Evolution, Molecular Marker Identification, and Phylogenetic Implications in Asterids

    Science.gov (United States)

    Ku, Chuan; Chung, Wan-Chia; Chen, Ling-Ling; Kuo, Chih-Horng

    2013-01-01

    The Madagascar periwinkle ( Catharanthus roseus in the family Apocynaceae) is an important medicinal plant and is the source of several widely marketed chemotherapeutic drugs. It is also commonly grown for its ornamental values and, due to ease of infection and distinctiveness of symptoms, is often used as the host for studies on phytoplasmas, an important group of uncultivated plant pathogens. To gain insights into the characteristics of apocynaceous plastid genomes (plastomes), we used a reference-assisted approach to assemble the complete plastome of C . roseus , which could be applied to other C . roseus -related studies. The C . roseus plastome is the second completely sequenced plastome in the asterid order Gentianales. We performed comparative analyses with two other representative sequences in the same order, including the complete plastome of Coffea arabica (from the basal Gentianales family Rubiaceae) and the nearly complete plastome of Asclepias syriaca (Apocynaceae). The results demonstrated considerable variations in gene content and plastome organization within Apocynaceae, including the presence/absence of three essential genes (i.e., accD, clpP, and ycf1) and large size changes in non-coding regions (e.g., rps2-rpoC2 and IRb-ndhF). To find plastome markers of potential utility for Catharanthus breeding and phylogenetic analyses, we identified 41 C . roseus -specific simple sequence repeats. Furthermore, five intergenic regions with high divergence between C . roseus and three other euasterids I taxa were identified as candidate markers. To resolve the euasterids I interordinal relationships, 82 plastome genes were used for phylogenetic inference. With the addition of representatives from Apocynaceae and sampling of most other asterid orders, a sister relationship between Gentianales and Solanales is supported. PMID:23825699

  17. Molecular characterization and phylogenetic relationships among microsporidian isolates infecting silkworm, Bombyx mori using small subunit rRNA (SSU-rRNA) gene sequence analysis.

    Science.gov (United States)

    Nath, B Surendra; Gupta, S K; Bajpai, A K

    2012-12-01

    The life cycle, spore morphology, pathogenicity, tissue specificity, mode of transmission and small subunit rRNA (SSU-rRNA) gene sequence analysis of the five new microsporidian isolates viz., NIWB-11bp, NIWB-12n, NIWB-13md, NIWB-14b and NIWB-15mb identified from the silkworm, Bombyx mori have been studied along with type species, NIK-1s_mys. The life cycle of the microsporidians identified exhibited the sequential developmental cycles that are similar to the general developmental cycle of the genus, Nosema. The spores showed considerable variations in their shape, length and width. The pathogenicity observed was dose-dependent and differed from each of the microsporidian isolates; the NIWB-15mb was found to be more virulent than other isolates. All of the microsporidians were found to infect most of the tissues examined and showed gonadal infection and transovarial transmission in the infected silkworms. SSU-rRNA sequence based phylogenetic tree placed NIWB-14b, NIWB-12n and NIWB-11bp in a separate branch along with other Nosema species and Nosema bombycis; while NIWB-15mb and NIWB-13md together formed another cluster along with other Nosema species. NIK-1s_mys revealed a signature sequence similar to standard type species, N. bombycis, indicating that NIK-1s_mys is similar to N. bombycis. Based on phylogenetic relationships, branch length information based on genetic distance and nucleotide differences, we conclude that the microsporidian isolates identified are distinctly different from the other known species and belonging to the genus, Nosema. This SSU-rRNA gene sequence analysis method is found to be more useful approach in detecting different and closely related microsporidians of this economically important domestic insect.

  18. Archigregarines of the English Channel revisited: New molecular data on Selenidium species including early described and new species and the uncertainties of phylogenetic relationships

    Czech Academy of Sciences Publication Activity Database

    Rueckert, S.; Horák, Aleš

    2017-01-01

    Roč. 12, č. 11 (2017), č. článku e0187430. E-ISSN 1932-6203 R&D Projects: GA ČR GA15-17643S EU Projects: European Commission(XE) 316304 - MODBIOLIN Institutional support: RVO:60077344 Keywords : gregarine parasites apicomplexa * sabellaria alveolata l * revised classification * sequence alignment * genome-sequence * ultrastructure * checklist * lecudina * sporozoa Subject RIV: EB - Genetics ; Molecular Biology OBOR OECD: Biochemistry and molecular biology Impact factor: 2.806, year: 2016

  19. Total protein, albumin and low-molecular-weight protein excretion in HIV-positive patients

    Directory of Open Access Journals (Sweden)

    Campbell Lucy J

    2012-08-01

    Full Text Available Abstract Background Chronic kidney disease is common in HIV positive patients and renal tubular dysfunction has been reported in those receiving combination antiretroviral therapy (cART. Tenofovir (TFV in particular has been linked to severe renal tubular disease as well as proximal tubular dysfunction. Markedly elevated urinary concentrations of retinal-binding protein (RBP have been reported in patients with severe renal tubular disease, and low-molecular-weight proteins (LMWP such as RBP may be useful in clinical practice to assess renal tubular function in patients receiving TFV. We analysed 3 LMWP as well as protein and albumin in the urine of a sample of HIV positive patients. Methods In a cross-sectional fashion, total protein, albumin, RBP, cystatin C, and neutrophil gelatinase-associated lipocalin (NGAL were quantified in random urine samples of 317 HIV positive outpatients and expressed as the ratio-to-creatinine (RBPCR, CCR and NGALCR. Exposure to cART was categorised as none, cART without TFV, and cART containing TFV and a non-nucleoside reverse-transcriptase-inhibitor (TFV/NNRTI or TFV and a protease-inhibitor (TFV/PI. Results Proteinuria was present in 10.4 % and microalbuminuria in 16.7 % of patients. Albumin accounted for approximately 10 % of total urinary protein. RBPCR was within the reference range in 95 % of patients while NGALCR was elevated in 67 % of patients. No overall differences in urine protein, albumin, and LMWP levels were observed among patients stratified by cART exposure, although a greater proportion of patients exposed to TFV/PI had RBPCR >38.8 μg/mmol (343 μg/g (p = 0.003. In multivariate analyses, black ethnicity (OR 0.43, 95 % CI 0.24, 0.77 and eGFR 2 (OR 3.54, 95 % CI 1.61, 7.80 were independently associated with upper quartile (UQ RBPCR. RBPCR correlated well to CCR (r2 = 0.71, but not to NGALCR, PCR or ACR. Conclusions In HIV positive patients, proteinuria was predominantly of

  20. Bias in phylogenetic reconstruction of vertebrate rhodopsin sequences.

    Science.gov (United States)

    Chang, B S; Campbell, D L

    2000-08-01

    Two spurious nodes were found in phylogenetic analyses of vertebrate rhodopsin sequences in comparison with well-established vertebrate relationships. These spurious reconstructions were well supported in bootstrap analyses and occurred independently of the method of phylogenetic analysis used (parsimony, distance, or likelihood). Use of this data set of vertebrate rhodopsin sequences allowed us to exploit established vertebrate relationships, as well as the considerable amount known about the molecular evolution of this gene, in order to identify important factors contributing to the spurious reconstructions. Simulation studies using parametric bootstrapping indicate that it is unlikely that the spurious nodes in the parsimony analyses are due to long branches or other topological effects. Rather, they appear to be due to base compositional bias at third positions, codon bias, and convergent evolution at nucleotide positions encoding the hydrophobic residues isoleucine, leucine, and valine. LogDet distance methods, as well as maximum-likelihood methods which allow for nonstationary changes in base composition, reduce but do not entirely eliminate support for the spurious resolutions. Inclusion of five additional rhodopsin sequences in the phylogenetic analyses largely corrected one of the spurious reconstructions while leaving the other unaffected. The additional sequences not only were more proximal to the corrected node, but were also found to have intermediate levels of base composition and codon bias as compared with neighboring sequences on the tree. This study shows that the spurious reconstructions can be corrected either by excluding third positions, as well as those encoding the amino acids Ile, Val, and Leu (which may not be ideal, as these sites can contain useful phylogenetic signal for other parts of the tree), or by the addition of sequences that reduce problems associated with convergent evolution.

  1. Islandinium minutum subsp. barbatum subsp. nov. (Dinoflagellata), a New Organic-Walled Dinoflagellate Cyst from the Western Arctic: Morphology, Phylogenetic Position Based on SSU rDNA and LSU rDNA, and Distribution.

    Science.gov (United States)

    Potvin, Éric; Kim, So-Young; Yang, Eun Jin; Head, Martin J; Kim, Hyun-Cheol; Nam, Seung-Il; Yim, Joung Han; Kang, Sung-Ho

    2018-03-25

    A study of modern sediment from the Western Arctic has revealed the presence of a distinctive brown-colored cyst with a spherical central body bearing unbranched processes that are usually solid with a small basal pericoel. Distinctive barbs project from some processes, and process tips are usually minutely expanded into conjoined barbs. The archeopyle is apical and saphopylic. This cyst corresponds to Islandinium? cezare morphotype 2 of Head et al. (2001, J. Quat. Sci., 16:621). Phylogenetic analyses based on the small and large subunit rRNA genes infer close relationship with Islandinium minutum, the type of which is that of the genus. Re-examination of specimens of I. minutum reveals the presence of minute barbs on its processes, but differences with Islandinium? cezare morphotype 2 remain based on size, process distribution, and barb development. Furthermore, the internal transcribed spacer shows I. minutum to be distinct from this morphotype. On the basis of these small but discrete differences, we propose the new subspecies Islandinium minutum subsp. barbatum subsp. nov. Molecular sequencing of other cysts encountered, namely Echinidinium karaense, an unidentified flattened cyst, and "Polykrikos quadratus", places them in the Monovela clade, the latter showing greater morphological variability than previously thought. © 2018 The Author(s) Journal of Eukaryotic Microbiology © 2018 International Society of Protistologists.

  2. Molecular identification and phylogenetic analysis of important medicinal plant species in genus Paeonia based on rDNA-ITS, matK, and rbcL DNA barcode sequences.

    Science.gov (United States)

    Kim, W J; Ji, Y; Choi, G; Kang, Y M; Yang, S; Moon, B C

    2016-08-05

    This study was performed to identify and analyze the phylogenetic relationship among four herbaceous species of the genus Paeonia, P. lactiflora, P. japonica, P. veitchii, and P. suffruticosa, using DNA barcodes. These four species, which are commonly used in traditional medicine as Paeoniae Radix and Moutan Radicis Cortex, are pharmaceutically defined in different ways in the national pharmacopoeias in Korea, Japan, and China. To authenticate the different species used in these medicines, we evaluated rDNA-internal transcribed spacers (ITS), matK and rbcL regions, which provide information capable of effectively distinguishing each species from one another. Seventeen samples were collected from different geographic regions in Korea and China, and DNA barcode regions were amplified using universal primers. Comparative analyses of these DNA barcode sequences revealed species-specific nucleotide sequences capable of discriminating the four Paeonia species. Among the entire sequences of three barcodes, marker nucleotides were identified at three positions in P. lactiflora, eleven in P. japonica, five in P. veitchii, and 25 in P. suffruticosa. Phylogenetic analyses also revealed four distinct clusters showing homogeneous clades with high resolution at the species level. The results demonstrate that the analysis of these three DNA barcode sequences is a reliable method for identifying the four Paeonia species and can be used to authenticate Paeoniae Radix and Moutan Radicis Cortex at the species level. Furthermore, based on the assessment of amplicon sizes, inter/intra-specific distances, marker nucleotides, and phylogenetic analysis, rDNA-ITS was the most suitable DNA barcode for identification of these species.

  3. Do freshwater fishes diversify faster than marine fishes? A test using state-dependent diversification analyses and molecular phylogenetics of new world silversides (atherinopsidae).

    Science.gov (United States)

    Bloom, Devin D; Weir, Jason T; Piller, Kyle R; Lovejoy, Nathan R

    2013-07-01

    Freshwater habitats make up only ∼0.01% of available aquatic habitat and yet harbor 40% of all fish species, whereas marine habitats comprise >99% of available aquatic habitat and have only 60% of fish species. One possible explanation for this pattern is that diversification rates are higher in freshwater habitats than in marine habitats. We investigated diversification in marine and freshwater lineages in the New World silverside fish clade Menidiinae (Teleostei, Atherinopsidae). Using a time-calibrated phylogeny and a state-dependent speciation-extinction framework, we determined the frequency and timing of habitat transitions in Menidiinae and tested for differences in diversification parameters between marine and freshwater lineages. We found that Menidiinae is an ancestrally marine lineage that independently colonized freshwater habitats four times followed by three reversals to the marine environment. Our state-dependent diversification analyses showed that freshwater lineages have higher speciation and extinction rates than marine lineages. Net diversification rates were higher (but not significant) in freshwater than marine environments. The marine lineage-through time (LTT) plot shows constant accumulation, suggesting that ecological limits to clade growth have not slowed diversification in marine lineages. Freshwater lineages exhibited an upturn near the recent in their LTT plot, which is consistent with our estimates of high background extinction rates. All sequence data are currently being archived on Genbank and phylogenetic trees archived on Treebase. © 2013 The Author(s). Evolution © 2013 The Society for the Study of Evolution.

  4. Biochemical and Molecular Phylogenetic Study of Agriculturally Useful Association of a Nitrogen-Fixing Cyanobacterium and Nodule Sinorhizobium with Medicago sativa L.

    Directory of Open Access Journals (Sweden)

    E. V. Karaushu

    2015-01-01

    Full Text Available Seed inoculation with bacterial consortium was found to increase legume yield, providing a higher growth than the standard nitrogen treatment methods. Alfalfa plants were inoculated by mono- and binary compositions of nitrogen-fixing microorganisms. Their physiological and biochemical properties were estimated. Inoculation by microbial consortium of Sinorhizobium meliloti T17 together with a new cyanobacterial isolate Nostoc PTV was more efficient than the single-rhizobium strain inoculation. This treatment provides an intensification of the processes of biological nitrogen fixation by rhizobia bacteria in the root nodules and an intensification of plant photosynthesis. Inoculation by bacterial consortium stimulates growth of plant mass and rhizogenesis and leads to increased productivity of alfalfa and to improving the amino acid composition of plant leaves. The full nucleotide sequence of the rRNA gene cluster and partial sequence of the dinitrogenase reductase (nifH gene of Nostoc PTV were deposited to GenBank (JQ259185.1, JQ259186.1. Comparison of these gene sequences of Nostoc PTV with all sequences present at the GenBank shows that this cyanobacterial strain does not have 100% identity with any organisms investigated previously. Phylogenetic analysis showed that this cyanobacterium clustered with high credibility values with Nostoc muscorum.

  5. Detection, molecular characterization and phylogenetic analysis of full-length equine infectious anemia (EIAV) gag genes isolated from Shackleford Banks wild horses.

    Science.gov (United States)

    Capomaccio, S; Willand, Z A; Cook, S J; Issel, C J; Santos, E M; Reis, J K P; Cook, R F

    2012-06-15

    The genetically distinct wild horse herds inhabiting Shackleford Banks, North Carolina are probably the direct descendents of Spanish stock abandoned after failed attempts to settle mid-Atlantic coastal regions of North America in the Sixteenth Century. In a 1996 island survey, 41% of the gathered horses were discovered seropositive for Equine Infectious Anemia Virus (EIAV) with additional cases identified in 1997 and 1998. As a result of their unique genetic heritage, EIAV seropositive individuals identified in the two latter surveys were transferred to a quarantine facility on the mainland. In September 2008 two of the horses SB1 and SB2 after 10 and 11 years in quarantine respectively, developed clinical signs of EIA. In the case of SB2 these were so severe that the only humane option was euthanasia. Although SB1, survived it experienced a second clinical episode one month later. In May 2009, a third horse in quarantine, SB3, developed extremely severe clinical EIA and was euthanized. This demonstrates naturally infected long-term inapparent carriers can experience recrudescence of very severe disease many years after initial exposure to EIAV. Phylogenetic analysis of complete EIAV gag gene sequences obtained from each of three Shackleford horses demonstrated they were infected with very closely related viruses. Although these were distinguishable from all other strains examined, they belong to a monophyletic group comprising almost exclusively of New World isolates that is distinct from a number of recently characterized Central European EIAV strains. Copyright © 2012 Elsevier B.V. All rights reserved.

  6. Molecular phylogenetic biodiversity assessment of arctic and boreal ectomycorrhizal Lactarius Pers. (Russulales; Basidiomycota) in Alaska, based on soil and sporocarp DNA

    Science.gov (United States)

    Jozsef Geml; Gary A. Laursen; Ina Timling; Jack M. McFarland; Michael G. Booth; Niall Lennon; Chad Nusbaum; D. Lee. Taylor

    2009-01-01

    Despite the critical roles fungi play in the functioning of ecosystems, especially as symbionts of plants and recyclers of organic matter, their biodiversity is poorly known in high-latitude regions. In this paper, we discuss the molecular diversity of one of the most diverse and abundant groups of ectomycorrhizal fungi: the genus Lactarius Pers....

  7. Phylogenetic relationships between pinworms (Nematoda: Enterobiinae) parasitising the critically endangered orang-utan, according to the characterisation of molecular genomic and mitochondrial markers

    Czech Academy of Sciences Publication Activity Database

    Foitová, I.; Civáňová, K.; Baruš, Vlastimil; Nurcahyo, W.

    2014-01-01

    Roč. 113, č. 7 (2014), s. 2455-2466 ISSN 0932-0113 Institutional support: RVO:68081766 Keywords : Molecular phylogeny * Cytochromoxidase 1 * 18S rDNA * ITS1 * Orang-utan pinworms * Pongo abelii Subject RIV: EG - Zoology Impact factor: 2.098, year: 2014

  8. A molecular phylogenetic study on South Korean Tettigonia species (Orthoptera: Tettigoniidae) using five genetic loci: The possibility of multiple allopatric speciation.

    Science.gov (United States)

    Kim, Tae-Kyu; Han, Taeman; Kim, Tae-Woo; Park, In Gyun; Kim, Seonghyun; Park, Haechul

    2016-03-15

    In Korea, members of the genus Tettigonia have been known as two species, T. ussuriana and T. dolichoptera dolichoptera. However, the taxonomic status of the Jeju Island population of T. ussuriana (JJ-TU) is in question, relative to the mainland population (ML-TU), because of their different body sizes and ratios of wing length. To clarify the relatedness of JJ-TU and ML-TU, we examined the genetic variation and phylogenetic relationships within and between T. ussuriana and related species collected in South Korea, using five genetic loci: three mitochondrial genes (cytochrome c oxidase subunit 1 [CO1], cytochrome c oxidase subunit 2 [CO2], NADH dehydrogenase 1 [ND1]) and two nuclear loci (second internal transcribed spacer [ITS2], and tubulin alpha-1 [TA1]). Unexpectedly, the JJ-TU population is explicitly sister to T. d. dolichoptera, with low genetic distance (0.76-1.22% in CO1), indicating no direct connection with the ML-TU population; this finding suggests a recent divergence involving rapid morphological change without gene flow between JJ-TU and mainland T. d. dolichoptera. The separation of these populations from their common ancestor was caused by geographical isolation during last glacial age. This finding indicates that the JJ-TU population should be elevated to the rank of subspecies, at the very least. Furthermore, the ML-TU population was also revealed to have four genetically divided groups (group A-D) from four localized populations, but no significant morphological differences exist among them. The genetic difference (range 3.19-4.10% in CO1) between group A + B and C + D was especially large, suggesting that cryptic speciation has widely occurred within the mainland areas, caused by allopatric isolations resulting from mountain barriers.

  9. Revision of torrent mites (Parasitengona, Torrenticolidae, Torrenticola of the United States and Canada: 90 descriptions, molecular phylogenetics, and a key to species

    Directory of Open Access Journals (Sweden)

    J. Ray Fisher

    2017-09-01

    Full Text Available The descriptive biology of torrent mites (Parasitengona: Torrenticolidae: Torrenticola of North America (north of Mexico is investigated using integrative methods. Material examined includes approximately 2,300 specimens from nearly 500 localities across the United States and Canada, and a few collections in Mexico and Central America. Species hypotheses are derived from a phylogenetic analysis of the barcoding region of cytochrome c oxidase subunit 1 (COI for 476 specimens and supported with morphology and biogeography. Relationships between species are examined with a combined analysis of COI and two expansion regions (D2–3 of the large ribosomal subunit (28S rDNA for 57 specimens. All previously described species from the US and Canada are examined. Our results indicate the need to synonymize four species: T. mercedensis (Marshall, 1943 is a junior synonym of T. sierrensis (Marshall, 1943; T. rectiforma Habeeb, 1974 is a junior synonym of T. ellipsoidalis (Marshall, 1943; T. neoconnexa Habeeb, 1957 is a junior synonym of T. magnexa Habeeb, 1955; and T. esbelta Cramer, 1992 is a junior synonym of T. boettgeri KO Viets, 1977. We describe 66 new species and re-describe all previously described regional species. Our findings indicate that total diversity of Torrenticola in the United States and Canada comprises 90 species, 57 known from the east and 33 from the west. We organize these species into four species complexes that include 13 identification groups. An additional 13 species do not fit within an identification group. The southern Appalachians are suspected to contain the highest concentration of remaining undescribed diversity. A key is provided to all known species in the US and Canada.

  10. Molecular phylogenetic and scanning electron microscopical analyses places the Choanephoraceae and the Gilbertellaceae in a monophyletic group within the Mucorales (Zygomycetes, Fungi).

    Science.gov (United States)

    Voigt, Kerstin; Olsson, L

    2008-09-01

    A multi-gene genealogy based on maximum parsimony and distance analyses of the exonic genes for actin (act) and translation elongation factor 1 alpha (tef), the nuclear genes for the small (18S) and large (28S) subunit ribosomal RNA (comprising 807, 1092, 1863, 389 characters, respectively) of all 50 genera of the Mucorales (Zygomycetes) suggests that the Choanephoraceae is a monophyletic group. The monotypic Gilbertellaceae appears in close phylogenetic relatedness to the Choanephoraceae. The monophyly of the Choanephoraceae has moderate to strong support (bootstrap proportions 67% and 96% in distance and maximum parsimony analyses, respectively), whereas the monophyly of the Choanephoraceae-Gilbertellaceae clade is supported by high bootstrap values (100% and 98%). This suggests that the two families can be joined into one family, which leads to the elimination of the Gilbertellaceae as a separate family. In order to test this hypothesis single-locus neighbor-joining analyses were performed on nuclear genes of the 18S, 5.8S, 28S and internal transcribed spacer (ITS) 1 ribosomal RNA and the translation elongation factor 1 alpha (tef) and beta tubulin (betatub) nucleotide sequences. The common monophyletic origin of the Choanephoraceae-Gilbertellaceae clade could be confirmed in all gene trees and by investigation of their ultrastructure. Sporangia with persistent, sutured walls splitting in half at maturity and ellipsoidal sporangiospores with striated ornamentations and polar ciliate appendages arising from spores in persistent sporangia and dehiscent sporangiola represent synapomorphic characters of this group. We discuss our data in the context of the historical development of their taxonomy and physiology and propose a reduction of the two families to one family, the Choanephoraceae sensu lato comprising species which are facultative plant pathogens and parasites, especially in subtropical to tropical regions.

  11. Detection of Anaplasma sp. phylogenetically related to A. phagocytophilum in a free-living bird in Brazil

    Directory of Open Access Journals (Sweden)

    Anna Claudia Baumel Mongruel

    2017-08-01

    Full Text Available Abstract Wild animals play an important role in carrying vectors that may potentially transmit pathogens. Several reports highlighted the participation of wild animals on the Anaplasma phagocytophilum cycle, including as hosts of the agent. The aim of this study was to report the molecular detection of an agent phylogenetically related to A. phagocytophilum isolated from a wild bird in the Midwest of the state of Paraná, Brazil. Fifteen blood samples were collected from eleven different bird species in the Guarapuava region. One sample collected from a Penelope obscura bird was positive in nested PCR targeting the 16S rRNA gene of Anaplasma spp. The phylogenetic tree based on the Maximum Likelihood analysis showed that the sequence obtained was placed in the same clade with A. phagocytophilum isolated from domestic cats in Brazil. The present study reports the first molecular detection of a phylogenetically related A. phagocytophilum bacterium in a bird from Paraná State.

  12. A survey on relation of morphological, molecular and phylogenetic structure of zoanthids of the islands located in the Hormoz Strait (Hormoz, Qeshm, Larak, Hengam)

    OpenAIRE

    Noori Koupaei, Atoosa

    2014-01-01

    The order Zoantharia (Zoanthids) is one of the most neglected orders of cnidarians in the Persian Gulf. The present study aims to investigate the biodiversity of this order with morphological and molecular examination in the Persian Gulf. For this purpose, 123 colonies of zoanthids with variety of shape and colors have been collected from intertidal and shallow water zone of four islands, i. e. Hengam, Qeshm, Larak and Hormoz. After sampling, morphological characteristics of each specimen wer...

  13. Molecular evolution inferred from small subunit rRNA sequences: what does it tell us about phylogenetic relationships and taxonomy of the parabasalids?

    Science.gov (United States)

    Viscogliosi, E.; Edgcomb, V. P.; Gerbod, D.; Noel, C.; Delgado-Viscogliosi, P.; Sogin, M. L. (Principal Investigator)

    1999-01-01

    The Parabasala are a primitive group of protists divided into two classes: the trichomonads and the hypermastigids. Until recently, phylogeny and taxonomy of parabasalids were mainly based on the comparative analysis of morphological characters primarily linked to the development of their cytoskeleton. Recent use of molecular markers, such as small subunit (SSU) rRNA has led to now insights into the systematics of the Parabasala and other groups of prolists. An updated phylogeny based on SSU rRNA is provided and compared to that inferred from ultrastructural data. The SSU rRNA phylogeny contradicts the dogma equating simple characters with pumitive characters. Hypermastigids, possessing a hyperdeveloped cytoskeleton, exhibit the most basal emergence in the parabasalid lineage. Other observations emerge from the SSU rRNA analysis, such as the secondary loss of some cytoskeleton structures in all representatives of the Monocercomonadidae, the existence of secondarily free living taxa (reversibility of parasitism) and the evidence against the co-evolution of the endobiotic parabasalids and their animal hosts. According to phylogenies based on SSU rRNA, all the trichomonad families are not monophyletic groups, putting into question the validity of current taxonomic assignments. The precise branching order of some taxa remains unclear, but this issue can possibly be addressed by the molecular analysis of additional parabasalids. The goal of such additional analyses would be to propose, in a near future, a revision of the taxonomy of this group of protists that takes into account both molecular and morphological data.

  14. Phylogenetic Trees From Sequences

    Science.gov (United States)

    Ryvkin, Paul; Wang, Li-San

    In this chapter, we review important concepts and approaches for phylogeny reconstruction from sequence data.We first cover some basic definitions and properties of phylogenetics, and briefly explain how scientists model sequence evolution and measure sequence divergence. We then discuss three major approaches for phylogenetic reconstruction: distance-based phylogenetic reconstruction, maximum parsimony, and maximum likelihood. In the third part of the chapter, we review how multiple phylogenies are compared by consensus methods and how to assess confidence using bootstrapping. At the end of the chapter are two sections that list popular software packages and additional reading.

  15. Evaluation of an Improved Branch-Site Likelihood Method for Detecting Positive Selection at the Molecular Level

    DEFF Research Database (Denmark)

    Zhang, Jianzhi; Nielsen, Rasmus; Yang, Ziheng

    2005-01-01

    of interest, while test 2 had acceptable false-positive rates and appeared robust against violations of model assumptions. As test 2 is a direct test of positive selection on the lineages of interest, it is referred to as the branch-site test of positive selection and is recommended for use in real data......Detecting positive Darwinian selection at the DNA sequence level has been a subject of considerable interest. However, positive selection is difficult to detect because it often operates episodically on a few amino acid sites, and the signal may be masked by negative selection. Several methods have...... been developed to test positive selection that acts on given branches (branch methods) or on a subset of sites (site methods). Recently, Yang, Z., and R. Nielsen (2002. Codon-substitution models for detecting molecular adaptation at individual sites along specific lineages. Mol. Biol. Evol. 19...

  16. Phylogenetic position and physiology of Cerinosterus cyanescens

    NARCIS (Netherlands)

    Middelhoven, W.J.; Gueho, E.; Hoog, de G.S.

    2000-01-01

    Partial 25S rRNA sequencing of Cerinosterus cyanescens showed it to be a close relative of Microstroma juglandis, a member of the basidiomycetous order Microstromatales. It is unrelated to the generic type species, C. luteoalba, which is a member of the order Dacrymycetales. The clinical occurrence

  17. Phylogenetic position of the spirochetal genus Cristispira

    DEFF Research Database (Denmark)

    Paster, B.J.; Pelletier, D.A.; Dewhirst, F.E.

    1996-01-01

    a cell-laden crystalline styles of the oyster Crassostrea virginica. The amplified products were then cloned into Escherichia coli plasmids. Sequence comparisons of the gene coding for 16S rRNA (rDNA) insert of one clone, designated CP1, indicated that it was spirochetal. The sequence of the 16S r...

  18. Paleogenetic analyses reveal unsuspected phylogenetic affinities between mice and the extinct Malpaisomys insularis, an endemic rodent of the Canaries.

    Directory of Open Access Journals (Sweden)

    Marie Pagès

    Full Text Available BACKGROUND: The lava mouse, Malpaisomys insularis, was endemic to the Eastern Canary islands and became extinct at the beginning of the 14(th century when the Europeans reached the archipelago. Studies to determine Malpaisomys' phylogenetic affinities, based on morphological characters, remained inconclusive because morphological changes experienced by this insular rodent make phylogenetic investigations a real challenge. Over 20 years since its first description, Malpaisomys' phylogenetic position remains enigmatic. METHODOLOGY/PRINCIPAL FINDINGS: In this study, we resolved this issue using molecular characters. Mitochondrial and nuclear markers were successfully amplified from subfossils of three lava mouse samples. Molecular phylogenetic reconstructions revealed, without any ambiguity, unsuspected relationships between Malpaisomys and extant mice (genus Mus, Murinae. Moreover, through molecular dating we estimated the origin of the Malpaisomys/mouse clade at 6.9 Ma, corresponding to the maximal age at which the archipelago was colonised by the Malpaisomys ancestor via natural rafting. CONCLUSION/SIGNIFICANCE: This study reconsiders the derived morphological characters of Malpaisomys in light of this unexpected molecular finding. To reconcile molecular and morphological data, we propose to consider Malpaisomys insularis as an insular lineage of mouse.

  19. Molecular phylogenetic reconstruction and localization of the (TTAGG)n telomeric repeats in the chromosomes of Acromyrmex striatus (Roger, 1863) suggests a lower ancestral karyotype for leafcutter ants (Hymenoptera).

    Science.gov (United States)

    Pereira, Tássia Tatiane Pontes; Dos Reis, Ana Caroline Coelho Corrêa; Cardoso, Danon Clemes; Cristiano, Maykon Passos

    2018-01-01

    Chromosome counts and karyotype characterization have proved to be important features of a genome. Chromosome changes during the diversification of ants might play an important role, given the diversity and success of Formicidae. Comparative karyotype analyses on ants have enriched and helped ant systematics. Among leafcutter ants, two major chromosome counts have been described, one frequent in Atta Fabricius, 1804 (2n = 22 in all Atta spp. whose karyotype is known) and the other frequent in Acromyrmex Mayr, 1865 (2n = 38 in the majority of species whose karyotype is known). The main exception is Acromyrmex striatus (Roger, 1863), which harbors a diploid chromosome set of 22. Here we describe the use of fluorescence in situ hybridization (FISH) with telomeric probes with (TTAGG) 6 repeats to describe the telomere composition of A. striatus and to recover potential interstitial non-telomeric signals that may reflect fusion events during the evolution of leafcutter lineage from 38 to 22 chromosomes. Further, we reconstruct the ancestral chromosome numbers of the leafcutter clade based on a recently proposed molecular phylogenetic hypothesis and phylogenomic tree. Distinct signals have been observed in both extremities on the telomere chromosomes of A. striatus . Non-telomeric signals have not been retrieved in our analysis. It could be supposed that the low-numbered karyotype indeed represents the ancestral chromosome number of leafcutters. The phylogenetic reconstruction also recovered a low chromosome number from the diverse approaches implemented, suggesting that n = 11 is the most likely ancestral karyotype of the leafcutter ants and is a plesiomorphic feature shared between A. striatus and Atta spp.

  20. Phylogenetic relationship among Kenyan sorghum germplasms ...

    African Journals Online (AJOL)

    Mr Kiboi

    phylogenetic relationships based on 10 DNA fragments at AltSB loci with SbMATE, ORF9 and MITE primers. .... estimate the overall genetic diversity in Kenyan sorghum lines: Cheprot et al. 3529 ..... EARN project and Generation Challenge (GCP), ... genetics and molecular biology of plant aluminum resistance and toxicity.

  1. Genomic repeat abundances contain phylogenetic signal

    Czech Academy of Sciences Publication Activity Database

    Dodsworth, S.; Chase, M.W.; Kelly, L.J.; Leitch, I.J.; Macas, Jiří; Novák, Petr; Piednoël, M.; Weiß-Schneeweiss, H.; Leitch, A.R.

    2015-01-01

    Roč. 64, č. 1 (2015), s. 112-126 ISSN 1063-5157 R&D Projects: GA ČR GBP501/12/G090 Institutional support: RVO:60077344 Keywords : Repetitive DNA * continuous characters * genomics * next-generation sequencing * phylogenetics Subject RIV: EB - Genetics ; Molecular Biology Impact factor: 8.225, year: 2015

  2. Molecular cloning, phylogenetic analysis, and expression patterns of LATERAL SUPPRESSOR-LIKE and REGULATOR OF AXILLARY MERISTEM FORMATION-LIKE genes in sunflower (Helianthus annuus L.).

    Science.gov (United States)

    Fambrini, Marco; Salvini, Mariangela; Pugliesi, Claudio

    2017-03-01

    The wild sunflower (Helianthus annuus) plants develop a highly branched form with numerous small flowering heads. The origin of a no branched sunflower, producing a single large head, has been a key event in the domestication process of this species. The interaction between hormonal factors and several genes organizes the initiation and outgrowth of axillary meristems (AMs). From sunflower, we have isolated two genes putatively involved in this process, LATERAL SUPPRESSOR (LS)-LIKE (Ha-LSL) and REGULATOR OF AXILLARY MERISTEM FORMATION (ROX)-LIKE (Ha-ROXL), encoding for a GRAS and a bHLH transcription factor (TF), respectively. Typical amino acid residues and phylogenetic analyses suggest that Ha-LSL and Ha-ROXL are the orthologs of the branching regulator LS and ROX/LAX1, involved in the growth habit of both dicot and monocot species. qRT-PCR analyses revealed a high accumulation of Ha-LSL transcripts in roots, vegetative shoots, and inflorescence shoots. By contrast, in internodal stems and young leaves, a lower amount of Ha-LSL transcripts was observed. A comparison of transcription patterns between Ha-LSL and Ha-ROXL revealed some analogies but also remarkable differences; in fact, the gene Ha-ROXL displayed a low expression level in all organs analyzed. In situ hybridization (ISH) analysis showed that Ha-ROXL transcription was strongly restricted to a small domain within the boundary zone separating the shoot apical meristem (SAM) and the leaf primordia and in restricted regions of the inflorescence meristem, beforehand the separation of floral bracts from disc flower primordia. These results suggested that Ha-ROXL may be involved to establish a cell niche for the initiation of AMs as well as flower primordia. The accumulation of Ha-LSL transcripts was not restricted to the boundary zones in vegetative and inflorescence shoots, but the mRNA activity was expanded in other cellular domains of primary shoot apical meristem as well as AMs. In addition, Ha

  3. Phylogenetic relationships of African sunbird-like warblers: Moho ...

    African Journals Online (AJOL)

    Phylogenetic relationships of African sunbird-like warblers: Moho ( Hypergerus atriceps ), Green Hylia ( Hylia prasina ) and Tit-hylia ( Pholidornis rushiae ) ... different points in avian evolution reduces the phylogenetic signal in molecular sequence data, making difficult the reconstruction of relationships among taxa resulting ...

  4. Improved abundance sensitivity of molecular ions in positive-ion APCI MS analysis of petroleum in toluene.

    Science.gov (United States)

    Kim, Young Hwan; Kim, Sunghwan

    2010-03-01

    Positive-ion atmospheric pressure chemical ionization (APCI) Fourier transform ion cyclotron resonance mass spectrometry (FT-ICR MS) analyses of petroleum sample were performed with higher sensitivity by switching the solvent composition from toluene and methanol or acetonitrile to a one-component system consisting only of toluene. In solvent blends, molecular ions were more abundant than were protonated ions with increasing percentages of toluene. In 100% toluene, the double-bond equivalence (DBE) distributions of molecular ions obtained by APCI MS for each compound class were very similar to those obtained in dopant assisted atmospheric pressure photo ionization (APPI) MS analyses. Therefore, it was concluded that charge-transfer reaction, which is important in toluene-doped APPI processes, also plays a major role in positive-ion APCI. In the DBE distributions of S(1), S(2), and SO heteroatom classes, a larger enhancement in the relative abundance of molecular ions at fairly specific DBE values was observed as the solvent was progressively switched to toluene. This enhanced abundance of molecular ions was likely dependent on molecular structure. Copyright 2010 American Society for Mass Spectrometry. Published by Elsevier Inc. All rights reserved.

  5. Taxonomic position and phylogenetic relationships of the genera and species Euaphidius and Remaudierea (Hymenoptera: Braconidae: Aphidiinae) analyzed using molecular markers and geometric morphometrics

    Czech Academy of Sciences Publication Activity Database

    Milošević, M.I.; Petrović, A.; Stanković, S. S.; Črkić, J.; Starý, Petr; Žikić, V.; Tomanović, Ž.

    2015-01-01

    Roč. 108, č. 3 (2015), s. 435-445 ISSN 0013-8746 Grant - others:The Ministry of Education, Science, and Technological Development of the Republic of Serbia(RS) III43001 Institutional support: RVO:60077344 Keywords : Aphidius * Euaphidius * Remaudierea Subject RIV: EG - Zoology Impact factor: 1.140, year: 2015

  6. Functional & phylogenetic diversity of copepod communities

    Science.gov (United States)

    Benedetti, F.; Ayata, S. D.; Blanco-Bercial, L.; Cornils, A.; Guilhaumon, F.

    2016-02-01

    The diversity of natural communities is classically estimated through species identification (taxonomic diversity) but can also be estimated from the ecological functions performed by the species (functional diversity), or from the phylogenetic relationships among them (phylogenetic diversity). Estimating functional diversity requires the definition of specific functional traits, i.e., phenotypic characteristics that impact fitness and are relevant to ecosystem functioning. Estimating phylogenetic diversity requires the description of phylogenetic relationships, for instance by using molecular tools. In the present study, we focused on the functional and phylogenetic diversity of copepod surface communities in the Mediterranean Sea. First, we implemented a specific trait database for the most commonly-sampled and abundant copepod species of the Mediterranean Sea. Our database includes 191 species, described by seven traits encompassing diverse ecological functions: minimal and maximal body length, trophic group, feeding type, spawning strategy, diel vertical migration and vertical habitat. Clustering analysis in the functional trait space revealed that Mediterranean copepods can be gathered into groups that have different ecological roles. Second, we reconstructed a phylogenetic tree using the available sequences of 18S rRNA. Our tree included 154 of the analyzed Mediterranean copepod species. We used these two datasets to describe the functional and phylogenetic diversity of copepod surface communities in the Mediterranean Sea. The replacement component (turn-over) and the species richness difference component (nestedness) of the beta diversity indices were identified. Finally, by comparing various and complementary aspects of plankton diversity (taxonomic, functional, and phylogenetic diversity) we were able to gain a better understanding of the relationships among the zooplankton community, biodiversity, ecosystem function, and environmental forcing.

  7. The limitations of ontogenetic data in phylogenetic analyses

    NARCIS (Netherlands)

    Koenemann, Stefan; Schram, Frederick R.

    2002-01-01

    The analysis of consecutive ontogenetic stages, or events, introduces a new class of data to phylogenetic systematics that are distinctly different from traditional morphological characters and molecular sequence data. Ontogenetic event sequences are distinguished by varying degrees of both a

  8. BIMLR: a method for constructing rooted phylogenetic networks from rooted phylogenetic trees.

    Science.gov (United States)

    Wang, Juan; Guo, Maozu; Xing, Linlin; Che, Kai; Liu, Xiaoyan; Wang, Chunyu

    2013-09-15

    Rooted phylogenetic trees constructed from different datasets (e.g. from different genes) are often conflicting with one another, i.e. they cannot be integrated into a single phylogenetic tree. Phylogenetic networks have become an important tool in molecular evolution, and rooted phylogenetic networks are able to represent conflicting rooted phylogenetic trees. Hence, the development of appropriate methods to compute rooted phylogenetic networks from rooted phylogenetic trees has attracted considerable research interest of late. The CASS algorithm proposed by van Iersel et al. is able to construct much simpler networks than other available methods, but it is extremely slow, and the networks it constructs are dependent on the order of the input data. Here, we introduce an improved CASS algorithm, BIMLR. We show that BIMLR is faster than CASS and less dependent on the input data order. Moreover, BIMLR is able to construct much simpler networks than almost all other methods. BIMLR is available at http://nclab.hit.edu.cn/wangjuan/BIMLR/. © 2013 Elsevier B.V. All rights reserved.

  9. Molecular identification of Anaplasma marginale in two autochthonous South American wild species revealed an identical new genotype and its phylogenetic relationship with those of bovines.

    Science.gov (United States)

    Guillemi, Eliana C; de la Fourniere, Sofía; Orozco, Marcela; Peña Martinez, Jorge; Correa, Elena; Fernandez, Javier; Lopez Arias, Ludmila; Paoletta, Martina; Corona, Belkis; Pinarello, Valérie; Wilkowsky, Silvina E; Farber, Marisa D

    2016-05-26

    Anaplasma marginale is a well-known cattle pathogen of tropical and subtropical world regions. Even though, this obligate intracellular bacterium has been reported in other host species different than bovine, it has never been documented in Myrmecophaga tridactyla (giant anteater) or Hippocamelus antisense (taruca), which are two native endangered species. Samples from two sick wild animals: a Myrmecophaga tridactyla (blood) and a Hippocamelus antisense (blood and serum) were studied for the presence of A. marginale DNA through msp5 gene fragment amplification. Further characterization was done through MSP1a tandem repeats analysis and MLST scheme and the genetic relationship among previously characterized A. marginale sequences were studied by applying, eBURST algorithm and AMOVA analysis. Anaplasma marginale DNA was identified in the Myrmecophaga tridactyla and Hippocamelus antisense samples. Through molecular markers, we identified an identical genotype in both animals that was not previously reported in bovine host. The analysis through eBURST and AMOVA revealed no differentiation between the taruca/anteater isolate and the bovine group. In the present publication we report the identification of A. marginale DNA in a novel ruminant (Hippocamelus antisense) and non-ruminant (Myrmecophaga tridactyla) host species. Genotyping analysis of isolates demonstrated the close relatedness of the new isolate with the circulation population of A. marginale in livestock. Further analysis is needed to understand whether these two hosts contribute to the anaplasmosis epidemiology.

  10. A new species of Mud Snake (Serpentes, Homalopsidae, Gyiophis Murphy & Voris, 2014) from Myanmar with a first molecular phylogenetic assessment of the genus.

    Science.gov (United States)

    Quah, Evan S H; Grismer, L Lee; Wood, Perry L Jr; Thura, Myint Kyaw; Zin, Thaw; Kyaw, Htet; Lwin, Ngwe; Grismer, Marta S; Murdoch, Matthew L

    2017-03-06

    A newly discovered species of homalopsid snake from the genus Gyiophis Murphy & Voris is described from the lowlands of Mawlamyine District in Mon state, southeastern Myanmar. Gyiophis salweenensis sp. nov. is presumed to be closely related to G. maculosa Blanford and G. vorisi Murphy based on the similarities in pholidosis and patterning but can be separated from G. maculosa by the shape of its first three dorsal scale rows that are square, ventral scale pattern that lacks a central spot, and a faint stripe on dorsal scale rows 1-4. It can be further distinguished from G. vorisi by its lower number of ventral scales (129 vs. 142-152), lower number of subcaudals (30/29 vs. 41-58), narrow rostral scale, and having more rows of spots on the dorsum (four vs. three). A preliminary molecular analysis using 1050 base pairs of cytochrome b (cytb) recovered G. salweenensis sp. nov. as the sister species to the Chinese Mud Snake (Myrrophis chinensis). G. maculosa and G. vorisi were unavailable for the analysis. The discovery of G. salweenensis sp. nov. highlights the need for more surveys into the herpetological diversity of eastern Myanmar which remains very much underestimated.

  11. Molecular Characterization of ERα-positive and Triple Negative Breast Cancer

    NARCIS (Netherlands)

    Severson, T.M.

    2016-01-01

    Breast cancer, one of the most common of all cancers, is diagnosed in over 1.5 million people world-wide each year. Overall, treatments for breast cancer are considered relatively successful, however recurrence is a clinical problem of paramount importance. Molecular subtypes of breast cancer,

  12. Molecular networks in Position, Momentum, and Phase Space: A Case Study on Simple Hydrocarbons

    DEFF Research Database (Denmark)

    Schmider, Hartmut; Ho, Minhhuy

    1996-01-01

    are identified in a series of nine small hydrocarbonic molecules, and the resulting "molecular graphs" are interpreted in terms of symmetry and topology. For the example of a symmetric SN2 reaction, it is shown that the topology of the Husimi function based graphs can be useful for the classification of chemical...

  13. The phylogenetic likelihood library.

    Science.gov (United States)

    Flouri, T; Izquierdo-Carrasco, F; Darriba, D; Aberer, A J; Nguyen, L-T; Minh, B Q; Von Haeseler, A; Stamatakis, A

    2015-03-01

    We introduce the Phylogenetic Likelihood Library (PLL), a highly optimized application programming interface for developing likelihood-based phylogenetic inference and postanalysis software. The PLL implements appropriate data structures and functions that allow users to quickly implement common, error-prone, and labor-intensive tasks, such as likelihood calculations, model parameter as well as branch length optimization, and tree space exploration. The highly optimized and parallelized implementation of the phylogenetic likelihood function and a thorough documentation provide a framework for rapid development of scalable parallel phylogenetic software. By example of two likelihood-based phylogenetic codes we show that the PLL improves the sequential performance of current software by a factor of 2-10 while requiring only 1 month of programming time for integration. We show that, when numerical scaling for preventing floating point underflow is enabled, the double precision likelihood calculations in the PLL are up to 1.9 times faster than those in BEAGLE. On an empirical DNA dataset with 2000 taxa the AVX version of PLL is 4 times faster than BEAGLE (scaling enabled and required). The PLL is available at http://www.libpll.org under the GNU General Public License (GPL). © The Author(s) 2014. Published by Oxford University Press, on behalf of the Society of Systematic Biologists.

  14. Molecular Typing and Phylogenetic Analysis of Some Species Belonging to Phlebotomus (Larroussius and Phlebotomus (Adlerius Subgenera (Diptera: Psychodidae from Two Locations in Iran

    Directory of Open Access Journals (Sweden)

    P Parvizi

    2010-12-01

    Full Text Available Background: Haematophagous females of some phlebotomine sandflies are the only natural vectors of Leishmania species, the causative agents of leishmaniasis in many parts of the tropics and subtropics, including Iran.  We report the presence of Phlebotomus (Larroussius major and Phlebotomus (Adlerius halepensis in Tonekabon (Ma­zanderan Province and Phlebotomus (Larroussius tobbi in Pakdasht (Tehran Province. It is the first report of these species, known as potential vectors of zoonotic visceral leishmaniasis in Iran, are identified in these areas.Methods: In 2006-2007 individual wild-caught sandflies were characterized by both morphological features and sequence analysis of their mitochondrial genes (Cytochrome b.  The analyses were based on a fragment of  494 bp at the 3´ end of the Cyt b gene (Cyt b 3´ fragment and a fragment of  382 bp CB3 at the 5´ end of the Cyt b gene (Cyt b 5´ fragment. We also analysed the Cyt b Long fragment, which is located on the last 717 bp of the Cyt b gene, followed by 20 bp of intergenic spacer and the transfer RNA ser(TCN gene.Results: Twenty-seven P. halepensis and four P. major from Dohezar, Tonekabon, Mazanderan province and 8 P. tobbi from Packdasht, Tehran Province were identified by morphological and molecular characters. Cyt b 5´ and Cyt b 3´ fragment sequences were obtained from 15 and 9 flies, respectively. Cyt b long fragment sequences were ob­tained from 8 out of 27 P. halepensis.Conclusion: Parsimony analyses (using heuristic searches of the DNA sequences of Cyt b always showed mono­phyletic clades of subgenera and each species did form a monophyletic group.

  15. Molecular typing and phylogenetic analysis of some species belonging to phlebotomus (larroussius) and phlebotomus (adlerius) subgenera (Diptera: psychodidae) from two locations in iran.

    Science.gov (United States)

    Parvizi, P; Naddaf, S R; Alaeenovin, E

    2010-01-01

    Haematophagous females of some phlebotomine sandflies are the only natural vectors of Leishmania species, the causative agents of leishmaniasis in many parts of the tropics and subtropics, including Iran. We report the presence of Phlebotomus (Larroussius) major and Phlebotomus (Adlerius) halepensis in Tonekabon (Mazanderan Province) and Phlebotomus (Larroussius) tobbi in Pakdasht (Tehran Province). It is the first report of these species, known as potential vectors of zoonotic visceral leishmaniasis in Iran, are identified in these areas. In 2006-2007 individual wild-caught sandflies were characterized by both morphological features and sequence analysis of their mitochondrial genes (Cytochrome b). The analyses were based on a fragment of 494 bp at the 3' end of the Cyt b gene (Cyt b 3' fragment) and a fragment of 382 bp CB3 at the 5' end of the Cyt b gene (Cyt b 5' fragment). We also analysed the Cyt b Long fragment, which is located on the last 717 bp of the Cyt b gene, followed by 20 bp of intergenic spacer and the transfer RNA ser(TCN) gene. Twenty-seven P. halepensis and four P. major from Dohezar, Tonekabon, Mazanderan province and 8 P. tobbi from Packdasht, Tehran Province were identified by morphological and molecular characters. Cyt b 5' and Cyt b 3' fragment sequences were obtained from 15 and 9 flies, respectively. Cyt b long fragment sequences were obtained from 8 out of 27 P. halepensis. Parsimony analyses (using heuristic searches) of the DNA sequences of Cyt b always showed monophyletic clades of subgenera and each species did form a monophyletic group.

  16. Molecular Typing and Phylogenetic Analysis of Some Species Belonging to Phlebotomus (Larroussius and Phlebotomus (Adlerius Subgenera (Diptera: Psychodidae from Two Locations in Iran

    Directory of Open Access Journals (Sweden)

    E AlaeeNovin

    2010-12-01

    Full Text Available "nAbstract"nBackground: Haematophagous females of some phlebotomine sandflies are the only natural vectors of Leishmania species, the causative agents of leishmaniasis in many parts of the tropics and subtropics, including Iran.  We report the presence of Phlebotomus (Larroussius major and Phlebotomus (Adlerius halepensis in Tonekabon (Ma­zanderan Province and Phlebotomus (Larroussius tobbi in Pakdasht (Tehran Province. It is the first report of these species, known as potential vectors of zoonotic visceral leishmaniasis in Iran, are identified in these areas."nMethods: In 2006-2007 individual wild-caught sandflies were characterized by both morphological features and sequence analysis of their mitochondrial genes (Cytochrome b.  The analyses were based on a fragment of  494 bp at the 3´ end of the Cyt b gene (Cyt b 3´ fragment and a fragment of  382 bp CB3 at the 5´ end of the Cyt b gene (Cyt b 5´ fragment. We also analysed the Cyt b Long fragment, which is located on the last 717 bp of the Cyt b gene, followed by 20 bp of intergenic spacer and the transfer RNA ser(TCN gene."nResults: Twenty-seven P. halepensis and four P. major from Dohezar, Tonekabon, Mazanderan province and 8 P. tobbi from Packdasht, Tehran Province were identified by morphological and molecular characters. Cyt b 5´ and Cyt b 3´ fragment sequences were obtained from 15 and 9 flies, respectively. Cyt b long fragment sequences were ob­tained from 8 out of 27 P. halepensis."nConclusion: Parsimony analyses (using heuristic searches of the DNA sequences of Cyt b always showed mono­phyletic clades of subgenera and each species did form a monophyletic group. "nKeywords: Mitochondrial Cytochrome b, Phlebotomus (Larroussius major, Phlebotomus (Larroussius tobbi, Phlebotomus (Adlerius halepensis, Iran

  17. Molecular epidemiology and phylogenetic analysis of human papillomavirus infection in women with cervical lesions and cancer from the coastal region of Ecuador.

    Science.gov (United States)

    Bedoya-Pilozo, Cesar H; Medina Magües, Lex G; Espinosa-García, Maylen; Sánchez, Martha; Parrales Valdiviezo, Johanna V; Molina, Denisse; Ibarra, María A; Quimis-Ponce, María; España, Karool; Párraga Macias, Karla E; Cajas Flores, Nancy V; Orlando, Solon A; Robalino Penaherrera, Jorge A; Chedraui, Peter; Escobar, Saul; Loja Chango, Rita D; Ramirez-Morán, Cecibel; Espinoza-Caicedo, Jasson; Sánchez-Giler, Sunny; Limia, Celia M; Alemán, Yoan; Soto, Yudira; Kouri, Vivian; Culasso, Andrés C A; Badano, Inés

    The aim of the present study was to gather information regarding the molecular epidemiology of Human papillomavirus (HPV) and related risk factors in a group of women with low- and high-grade cervical lesions and cancer from the coastal region of Ecuador. In addition, we studied the evolution of HPV variants from the most prevalent types and provided a temporal framework for their emergence, which may help to trace the source of dissemination within the region. We analyzed 166 samples, including 57 CIN1, 95 CIN2/3 and 14 cancer cases. HPV detection and typing was done by PCR-sequencing (MY09/MY11). HPV variants and estimation of the time to most recent common ancestor (tMRCA) was assessed through phylogeny and coalescence analysis. HPV DNA was found in 54.4% of CIN1, 74.7% of CIN2/3 and 78.6% of cancer samples. HPV16 (38.9%) and HPV58 (19.5%) were the most prevalent types. Risk factors for the development of cervical lesions/cancer were the following: three or more pregnancies (OR=4.3), HPV infection (OR=3.7 for high-risk types; OR=3.5 for HPV16), among others. With regard to HPV evolution, HPV16 isolates belonged to lineages A (69%) and D (31%) whereas HPV58 isolates belonged only to lineage A. The period of emergence of HPV16 was in association with human populations (tMRCA=91052 years for HPV16A and 27000 years for HPV16D), whereas HPV58A preceded Homo sapiens evolution (322257 years). This study provides novel data on HPV epidemiology and evolution in Ecuador, which will be fundamental in the vaccine era. Copyright © 2017 Asociación Argentina de Microbiología. Publicado por Elsevier España, S.L.U. All rights reserved.

  18. A molecular phylogenetic and fruit evolutionary analysis of the major groups of the paleotropical woody bamboos (Gramineae: Bambusoideae) based on nuclear ITS, GBSSI gene and plastid trnL-F DNA sequences.

    Science.gov (United States)

    Yang, Han-Qi; Yang, Jun-Bo; Peng, Zhen-Hua; Gao, Jian; Yang, Yu-Ming; Peng, Sheng; Li, De-Zhu

    2008-09-01

    This study presented the first molecular phylogenetic analysis of the major clades of woody bamboos of the Old World tropics based on nuclear and chloroplast sequences (ITS, GBSSI and trnL-F). Sequence data from 53 species, representing 17 paleotropical woody bamboo genera, were analyzed using the maximum parsimony and Bayesian inference methods. All examined ingroup taxa were clustered into two clades, i.e., the Bambusinae+Dinochloa clade and the Melocanninae clade. The former clade included Bambusa, Bonia, Dendrocalamus, Dendrocalamopsis, Dinochloa, Gigantochloa, Molecalamus, Neomicrocalamus, Neosinocalamus, Oxytenanthera s. str. (sensu stricto), Racemobambos and Thyrsostachys. The Melocanninae clade consisted of Cephalostachyum, Leptocanna (better treated as part of Cephalostachyum), Melocanna, Pseudostachyum and Schizostachyum s. str. The subtribe Racemobambosinae and tribes Dendrocalameae and Oxytenanthereae were not supported and may be better placed in subtribe Bambusinae. The ovary characters seemed to be good criteria to distinguish these two clades. The reconstruction of ancestral fruit characters indicated that the bacoid caryopsis, namely, fleshy or berry-like fruits, was found to be scattered in three lineages of the examined paleotropical woody bamboos. Fruit characters are thus not reliable indicators of phylogeny and bacoid caryopsis likely represents a specialization for particular ecological conditions.

  19. Phylogenetic diversity and biodiversity indices on phylogenetic networks.

    Science.gov (United States)

    Wicke, Kristina; Fischer, Mareike

    2018-04-01

    In biodiversity conservation it is often necessary to prioritize the species to conserve. Existing approaches to prioritization, e.g. the Fair Proportion Index and the Shapley Value, are based on phylogenetic trees and rank species according to their contribution to overall phylogenetic diversity. However, in many cases evolution is not treelike and thus, phylogenetic networks have been developed as a generalization of phylogenetic trees, allowing for the representation of non-treelike evolutionary events, such as hybridization. Here, we extend the concepts of phylogenetic diversity and phylogenetic diversity indices from phylogenetic trees to phylogenetic networks. On the one hand, we consider the treelike content of a phylogenetic network, e.g. the (multi)set of phylogenetic trees displayed by a network and the so-called lowest stable ancestor tree associated with it. On the other hand, we derive the phylogenetic diversity of subsets of taxa and biodiversity indices directly from the internal structure of the network. We consider both approaches that are independent of so-called inheritance probabilities as well as approaches that explicitly incorporate these probabilities. Furthermore, we introduce our software package NetDiversity, which is implemented in Perl and allows for the calculation of all generalized measures of phylogenetic diversity and generalized phylogenetic diversity indices established in this note that are independent of inheritance probabilities. We apply our methods to a phylogenetic network representing the evolutionary relationships among swordtails and platyfishes (Xiphophorus: Poeciliidae), a group of species characterized by widespread hybridization. Copyright © 2018 Elsevier Inc. All rights reserved.

  20. Molecular and phylogenetic analyses of the liver amphistome Explanatum explanatum (Creplin, 1847) Fukui, 1929 in ruminants from Bangladesh and Nepal based on nuclear ribosomal ITS2 and mitochondrial nad1 sequences.

    Science.gov (United States)

    Mohanta, U K; Rana, H B; Devkota, B; Itagaki, T

    2017-07-01

    Explanatum explanatum flukes, liver amphistomes of ruminants, cause significant economic loss in the livestock industry by inducing severe liver damage. A total of 66 flukes from 26 buffaloes and 7 cattle in four different geographic areas of Bangladesh and 20 flukes from 10 buffaloes in the Chitwan district of Nepal were subjected for analysis. The sequences (442 bp) of the second internal transcribed spacer (ITS2) of ribosomal DNA and the variable fragments (657 bp) of mitochondrial nicotinamide dehydrogenase subunit 1 (nad1) of E. explanatum flukes from Bangladesh and Nepal were analysed. The aim of this study was molecular characterization of the flukes and to elucidate their origin and biogeography. In the ITS2 region, two genotypes were detected among the flukes from Bangladesh, while flukes from Nepal were of only one genotype. Phylogenetic analyses inferred from the nad1 gene revealed that at least four divergent populations (groups I-IV) are distributed in Bangladesh, whereas two divergent populations were found to be distributed in Nepal. Fst values (pairwise fixation index) suggest that Bangladeshi and Nepalese populations of group I to IV are significantly different from each other; but within groups III and IV, the populations from Bangladesh and Nepal were genetically close. This divergence in the nad1 gene indicates that each lineage of E. explanatum from diverse geography was co-adapted during the multiple domestication events of ruminants. This study, for the first time, provides molecular characterization of E. explanatum in Bangladesh and Nepal, and may provide useful information for elucidating its origin and dispersal route in Asia.

  1. Nodal distances for rooted phylogenetic trees.

    Science.gov (United States)

    Cardona, Gabriel; Llabrés, Mercè; Rosselló, Francesc; Valiente, Gabriel

    2010-08-01

    Dissimilarity measures for (possibly weighted) phylogenetic trees based on the comparison of their vectors of path lengths between pairs of taxa, have been present in the systematics literature since the early seventies. For rooted phylogenetic trees, however, these vectors can only separate non-weighted binary trees, and therefore these dissimilarity measures are metrics only on this class of rooted phylogenetic trees. In this paper we overcome this problem, by splitting in a suitable way each path length between two taxa into two lengths. We prove that the resulting splitted path lengths matrices single out arbitrary rooted phylogenetic trees with nested taxa and arcs weighted in the set of positive real numbers. This allows the definition of metrics on this general class of rooted phylogenetic trees by comparing these matrices through metrics in spaces M(n)(R) of real-valued n x n matrices. We conclude this paper by establishing some basic facts about the metrics for non-weighted phylogenetic trees defined in this way using L(p) metrics on M(n)(R), with p [epsilon] R(>0).

  2. Phylogenetic Analysis of Petunia sensu Jussieu (Solanaceae) using Chloroplast DNA RFLP

    OpenAIRE

    ANDO, TOSHIO; KOKUBUN, HISASHI; WATANABE, HITOSHI; TANAKA, NORIO; YUKAWA, TOMOHISA; HASHIMOTO, GORO; MARCHESI, EDUARDO; SUÁREZ, ENRIQUE; BASUALDO, ISABEL L.

    2005-01-01

    • Background and Aims The phylogenetic relationships of Petunia sensu Jussieu (Petunia sensu Wijsman plus Calibrachoa) are unclear. This study aimed to resolve this uncertainty using molecular evidence.

  3. Phylogenetic Origins of Brain Organisers

    Directory of Open Access Journals (Sweden)

    Ellen Robertshaw

    2012-01-01

    Full Text Available The regionalisation of the nervous system begins early in embryogenesis, concomitant with the establishment of the anteroposterior (AP and dorsoventral (DV body axes. The molecular mechanisms that drive axis induction appear to be conserved throughout the animal kingdom and may be phylogenetically older than the emergence of bilateral symmetry. As a result of this process, groups of patterning genes that are equally well conserved are expressed at specific AP and DV coordinates of the embryo. In the emerging nervous system of vertebrate embryos, this initial pattern is refined by local signalling centres, secondary organisers, that regulate patterning, proliferation, and axonal pathfinding in adjacent neuroepithelium. The main secondary organisers for the AP neuraxis are the midbrain-hindbrain boundary, zona limitans intrathalamica, and anterior neural ridge and for the DV neuraxis the notochord, floor plate, and roof plate. A search for homologous secondary organisers in nonvertebrate lineages has led to controversy over their phylogenetic origins. Based on a recent study in hemichordates, it has been suggested that the AP secondary organisers evolved at the base of the deuterostome superphylum, earlier than previously thought. According to this view, the lack of signalling centres in some deuterostome lineages is likely to reflect a secondary loss due to adaptive processes. We propose that the relative evolutionary flexibility of secondary organisers has contributed to a broader morphological complexity of nervous systems in different clades.

  4. Phylogenetic relationships of the intercellular fish pathogen Ichthyophonus hoferi and fungi, choanoflagellates and the rosette agent

    DEFF Research Database (Denmark)

    Spanggaard, Bettina; Skouboe, P.; Rossen, L.

    1996-01-01

    Ichthyophonus hoferi Plehn and Mulsow, 1911 is thought to be one of the few pathogenic fungal infections of marine fish. The result of an attack is severe epizootics in herring stocks with drastic reduction in the population as a consequence. The exact phylogenetic position of the genus Ichthyoph......Ichthyophonus hoferi Plehn and Mulsow, 1911 is thought to be one of the few pathogenic fungal infections of marine fish. The result of an attack is severe epizootics in herring stocks with drastic reduction in the population as a consequence. The exact phylogenetic position of the genus...... Ichthyophonus is not known. In the present study, a combination of molecular data, ultrastructure and biochemical characters were utilized to investigate the phylogeny of I. hoferi. The genomic DNA encoding the small subunit ribosomal RNA (18S rRNA) was amplified and sequenced. Comparisons with other eukaryotic...

  5. Hepatitis C virus positive diffuse large B-cell lymphomas have distinct molecular features and lack BCL2 translocations

    DEFF Research Database (Denmark)

    Visco, Carlo; Wang, Jinfen; Tisi, Maria Chiara

    2017-01-01

    apoptotic pathways, have higher proliferative index, and lack BCL2 translocations. CONCLUSIONS: HCV-positive DLBCL have distinct molecular and pathological features compared to the HCV-negative counterparts.British Journal of Cancer advance online publication, 26 September 2017; doi:10.1038/bjc.2017.345 www.bjcancer.com....... in lymphomagenesis, as witnessed by the curative potential of antiviral therapy in HCV-related low-grade B-cell lymphomas. METHODS: We performed a case-control study including 44 HCV-positive cases of de novo DLBCL, comparing them with 132 HCV-negative patients as controls (ratio 3 to 1). Cases and controls were...... for MYC, BCL2 and BCL6, TP53 mutations, and diagnostic specimens reviewed to exclude transformation from low-grade lymphoma. RESULTS: Compared to the HCV-negative controls, patients with HCV-positive de novo DLBCL had differential expression of genes that regulate innate immune response and modulate...

  6. A Universal Phylogenetic Tree.

    Science.gov (United States)

    Offner, Susan

    2001-01-01

    Presents a universal phylogenetic tree suitable for use in high school and college-level biology classrooms. Illustrates the antiquity of life and that all life is related, even if it dates back 3.5 billion years. Reflects important evolutionary relationships and provides an exciting way to learn about the history of life. (SAH)

  7. Molecular pathways of early CD105-positive erythroid cells as compared with CD34-positive common precursor cells by flow cytometric cell-sorting and gene expression profiling

    International Nuclear Information System (INIS)

    Machherndl-Spandl, S; Suessner, S; Danzer, M; Proell, J; Gabriel, C; Lauf, J; Sylie, R; Klein, H-U; Béné, M C; Weltermann, A; Bettelheim, P

    2013-01-01

    Special attention has recently been drawn to the molecular network of different genes that are responsible for the development of erythroid cells. The aim of the present study was to establish in detail the immunophenotype of early erythroid cells and to compare the gene expression profile of freshly isolated early erythroid precursors with that of the CD34-positive (CD34 + ) compartment. Multiparameter flow cytometric analyses of human bone marrow mononuclear cell fractions (n=20) defined three distinct early erythroid stages. The gene expression profile of sorted early erythroid cells was analyzed by Affymetrix array technology. For 4524 genes, a differential regulation was found in CD105-positive erythroid cells as compared with the CD34 + progenitor compartment (2362 upregulated genes). A highly significant difference was observed in the expression level of genes involved in transcription, heme synthesis, iron and mitochondrial metabolism and transforming growth factor-β signaling. A comparison with recently published data showed over 1000 genes that as yet have not been reported to be upregulated in the early erythroid lineage. The gene expression level within distinct pathways could be illustrated directly by applying the Ingenuity software program. The results of gene expression analyses can be seen at the Gene Expression Omnibus repository

  8. treespace: Statistical exploration of landscapes of phylogenetic trees.

    Science.gov (United States)

    Jombart, Thibaut; Kendall, Michelle; Almagro-Garcia, Jacob; Colijn, Caroline

    2017-11-01

    The increasing availability of large genomic data sets as well as the advent of Bayesian phylogenetics facilitates the investigation of phylogenetic incongruence, which can result in the impossibility of representing phylogenetic relationships using a single tree. While sometimes considered as a nuisance, phylogenetic incongruence can also reflect meaningful biological processes as well as relevant statistical uncertainty, both of which can yield valuable insights in evolutionary studies. We introduce a new tool for investigating phylogenetic incongruence through the exploration of phylogenetic tree landscapes. Our approach, implemented in the R package treespace, combines tree metrics and multivariate analysis to provide low-dimensional representations of the topological variability in a set of trees, which can be used for identifying clusters of similar trees and group-specific consensus phylogenies. treespace also provides a user-friendly web interface for interactive data analysis and is integrated alongside existing standards for phylogenetics. It fills a gap in the current phylogenetics toolbox in R and will facilitate the investigation of phylogenetic results. © 2017 The Authors. Molecular Ecology Resources Published by John Wiley & Sons Ltd.

  9. The augmentation algorithm and molecular phylogenetic trees

    Science.gov (United States)

    Holmquist, R.

    1978-01-01

    Moore's (1977) augmentation procedure is discussed, and it is concluded that the procedure is valid for obtaining estimates of the total number of fixed nucleotide substitutions both theoretically and in practice, for both simulated and real data, and in agreement, for experimentally dense data sets, with stochastic estimates of the divergence, provided the restrictions on codon mutability resulting from natural selection are explicitly allowed for. Tateno and Nei's (1978) critique that the augmentation procedure has a systematic bias toward overestimation of the total number of nucleotide replacements is disputed, and a data analysis suggests that ancestral sequences inferred by the method of parsimony contain a large number of incorrectly assigned nucleotides.

  10. Molecular phylogenetics and the diversification of hummingbirds.

    Science.gov (United States)

    McGuire, Jimmy A; Witt, Christopher C; Remsen, J V; Corl, Ammon; Rabosky, Daniel L; Altshuler, Douglas L; Dudley, Robert

    2014-04-14

    The tempo of species diversification in large clades can reveal fundamental evolutionary mechanisms that operate on large temporal and spatial scales. Hummingbirds have radiated into a diverse assemblage of specialized nectarivores comprising 338 species, but their evolutionary history has not, until now, been comprehensively explored. We studied hummingbird diversification by estimating a time-calibrated phylogeny for 284 hummingbird species, demonstrating that hummingbirds invaded South America by ∼22 million years ago, and subsequently diversified into nine principal clades (see [5-7]). Using ancestral state reconstruction and diversification analyses, we (1) estimate the age of the crown-group hummingbird assemblage, (2) investigate the timing and patterns of lineage accumulation for hummingbirds overall and regionally, and (3) evaluate the role of Andean uplift in hummingbird speciation. Detailed analyses reveal disparate clade-specific processes that allowed for ongoing species diversification. One factor was significant variation among clades in diversification rates. For example, the nine principal clades of hummingbirds exhibit ∼15-fold variation in net diversification rates, with evidence for accelerated speciation of a clade that includes the Bee, Emerald, and Mountain Gem groups of hummingbirds. A second factor was colonization of key geographic regions, which opened up new ecological niches. For example, some clades diversified in the context of the uplift of the Andes Mountains, whereas others were affected by the formation of the Panamanian land bridge. Finally, although species accumulation is slowing in all groups of hummingbirds, several major clades maintain rapid rates of diversification on par with classical examples of rapid adaptive radiation. Copyright © 2014 Elsevier Ltd. All rights reserved.

  11. Modulation of Quorum Sensing in a Gram-Positive Pathogen by Linear Molecularly Imprinted Polymers with Anti-infective Properties.

    Science.gov (United States)

    Motib, Anfal; Guerreiro, Antonio; Al-Bayati, Firas; Piletska, Elena; Manzoor, Irfan; Shafeeq, Sulman; Kadam, Anagha; Kuipers, Oscar; Hiller, Luisa; Cowen, Todd; Piletsky, Sergey; Andrew, Peter W; Yesilkaya, Hasan

    2017-12-22

    We describe the development, characterization, and biological testing of a new type of linear molecularly imprinted polymer (LMIP) designed to act as an anti-infective by blocking the quorum sensing (QS) mechanism and so abrogating the virulence of the pathogen Streptococcus pneumoniae. The LMIP is prepared (polymerized) in presence of a template molecule, but unlike in traditional molecular imprinting approaches, no cross-linker is used. This results in soluble low-molecular-weight oligomers that can act as a therapeutic agent in vitro and in vivo. The LMIP was characterized by mass spectrometry to determine its monomer composition. Fragments identified were then aligned along the peptide template by computer modeling to predict the possible monomer sequence of the LMIP. These findings provide a proof of principle that LMIPs can be used to block QS, thus setting the stage for the development of LMIPs a novel drug-discovery platform and class of materials to target Gram-positive pathogens. © 2017 Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim.

  12. Detection of Staphylococcus aureus among coagulase positive staphylococci from animal origin based on conventional and molecular methods

    Directory of Open Access Journals (Sweden)

    Nikolina Velizarova Rusenova

    2017-03-01

    Full Text Available The present study aimed to detect Staphylococcus aureus (S. aureus among other coagulase positive staphylococci from animal origin by using conventional methods (biochemical tests and latex agglutination and a molecular method, based on the nuc gene, as the gold standard and to assess the usefulness of these methods. For this purpose, total of 344 staphylococcal isolates were collected and analysed. A total of 156 isolates suspicious for S. aureus were detected by a conventional biochemical method – 88 from cows, 18 from goats, 7 from pigs, 17 from poultry, 7 from rabbits and 19 from dogs. The majority of S. aureus strains gave typical biochemical reactions with the exception of 30 (19.2% and 25 (16% that were VP negative and weak positive in fermenting mannitol, respectively. Twelve strains were found to be non-haemolytic (7.7% and four strains did not ferment trehalose (2.6%. Other staphylococci were identified as S. pseudintermedius (n = 103, S. hyicus (n = 23 and the rest were coagulase-negative staphylococci. Latex agglutination test resulted in rapid positive reactions with S. aureus with exception of 5 strains (3.2% from cow mastitis milk. Positive agglutination reactions were also established with S. pseudintermedius, and S. hyicus. PCR confirmed all strains that were preliminary identified as S. aureus by amplification of 270 bp fragment of nuc gene specific for this species. The atypical reactions in certain strains established in this study have shown that the precise detection of S. aureus from animal origin should be done by combination of conventional and molecular methods.

  13. Fourier transform inequalities for phylogenetic trees.

    Science.gov (United States)

    Matsen, Frederick A

    2009-01-01

    Phylogenetic invariants are not the only constraints on site-pattern frequency vectors for phylogenetic trees. A mutation matrix, by its definition, is the exponential of a matrix with non-negative off-diagonal entries; this positivity requirement implies non-trivial constraints on the site-pattern frequency vectors. We call these additional constraints "edge-parameter inequalities". In this paper, we first motivate the edge-parameter inequalities by considering a pathological site-pattern frequency vector corresponding to a quartet tree with a negative internal edge. This site-pattern frequency vector nevertheless satisfies all of the constraints described up to now in the literature. We next describe two complete sets of edge-parameter inequalities for the group-based models; these constraints are square-free monomial inequalities in the Fourier transformed coordinates. These inequalities, along with the phylogenetic invariants, form a complete description of the set of site-pattern frequency vectors corresponding to bona fide trees. Said in mathematical language, this paper explicitly presents two finite lists of inequalities in Fourier coordinates of the form "monomial < or = 1", each list characterizing the phylogenetically relevant semialgebraic subsets of the phylogenetic varieties.

  14. Mapping Phylogenetic Trees to Reveal Distinct Patterns of Evolution.

    Science.gov (United States)

    Kendall, Michelle; Colijn, Caroline

    2016-10-01

    Evolutionary relationships are frequently described by phylogenetic trees, but a central barrier in many fields is the difficulty of interpreting data containing conflicting phylogenetic signals. We present a metric-based method for comparing trees which extracts distinct alternative evolutionary relationships embedded in data. We demonstrate detection and resolution of phylogenetic uncertainty in a recent study of anole lizards, leading to alternate hypotheses about their evolutionary relationships. We use our approach to compare trees derived from different genes of Ebolavirus and find that the VP30 gene has a distinct phylogenetic signature composed of three alternatives that differ in the deep branching structure. phylogenetics, evolution, tree metrics, genetics, sequencing. © The Author 2016. Published by Oxford University Press on behalf of the Society for Molecular Biology and Evolution.

  15. A Molecular Mechanism to Regulate Lysosome Motility for Lysosome Positioning and Tubulation

    Science.gov (United States)

    Li, Xinran; Rydzewski, Nicholas; Hider, Ahmad; Zhang, Xiaoli; Yang, Junsheng; Wang, Wuyang; Gao, Qiong; Cheng, Xiping; Xu, Haoxing

    2016-01-01

    To mediate the degradation of bio-macromolecules, lysosomes must traffic towards cargo-carrying vesicles for subsequent membrane fusion or fission. Mutations of the lysosomal Ca2+ channel TRPML1 cause lysosome storage disease (LSD) characterized by disordered lysosomal membrane trafficking in cells. Here we show that TRPML1 activity is required to promote Ca2+-dependent centripetal movement of lysosomes towards the perinuclear region, where autophagosomes accumulate, upon autophagy induction. ALG-2, an EF-hand-containing protein, serves as a lysosomal Ca2+ sensor that associates physically with the minus-end directed dynactin-dynein motor, while PI(3,5)P2, a lysosome-localized phosphoinositide, acts upstream of TRPML1. Furthermore, the PI(3,5)P2-TRPML1-ALG-2-dynein signaling is necessary for lysosome tubulation and reformation. In contrast, the TRPML1 pathway is not required for the perinuclear accumulation of lysosomes observed in many LSDs, which is instead likely caused by secondary cholesterol accumulation that constitutively activates Rab7-RILP-dependent retrograde transport. Collectively, Ca2+ release from lysosomes provides an on-demand mechanism regulating lysosome motility, positioning, and tubulation. PMID:26950892

  16. PhyDesign: an online application for profiling phylogenetic informativeness

    Directory of Open Access Journals (Sweden)

    Townsend Jeffrey P

    2011-05-01

    Full Text Available Abstract Background The rapid increase in number of sequenced genomes for species across of the tree of life is revealing a diverse suite of orthologous genes that could potentially be employed to inform molecular phylogenetic studies that encompass broader taxonomic sampling. Optimal usage of this diversity of loci requires user-friendly tools to facilitate widespread cost-effective locus prioritization for phylogenetic sampling. The Townsend (2007 phylogenetic informativeness provides a unique empirical metric for guiding marker selection. However, no software or automated methodology to evaluate sequence alignments and estimate the phylogenetic informativeness metric has been available. Results Here, we present PhyDesign, a platform-independent online application that implements the Townsend (2007 phylogenetic informativeness analysis, providing a quantitative prediction of the utility of loci to solve specific phylogenetic questions. An easy-to-use interface facilitates uploading of alignments and ultrametric trees to calculate and depict profiles of informativeness over specified time ranges, and provides rankings of locus prioritization for epochs of interest. Conclusions By providing these profiles, PhyDesign facilitates locus prioritization increasing the efficiency of sequencing for phylogenetic purposes compared to traditional studies with more laborious and low capacity screening methods, as well as increasing the accuracy of phylogenetic studies. Together with a manual and sample files, the application is freely accessible at http://phydesign.townsend.yale.edu.

  17. Fast phylogenetic DNA barcoding

    DEFF Research Database (Denmark)

    Terkelsen, Kasper Munch; Boomsma, Wouter Krogh; Willerslev, Eske

    2008-01-01

    We present a heuristic approach to the DNA assignment problem based on phylogenetic inferences using constrained neighbour joining and non-parametric bootstrapping. We show that this method performs as well as the more computationally intensive full Bayesian approach in an analysis of 500 insect...... DNA sequences obtained from GenBank. We also analyse a previously published dataset of environmental DNA sequences from soil from New Zealand and Siberia, and use these data to illustrate the fact that statistical approaches to the DNA assignment problem allow for more appropriate criteria...... for determining the taxonomic level at which a particular DNA sequence can be assigned....

  18. Experimental investigation of the formation of negative hydrogen ions in collisions between positive ions and atomic or molecular targets

    International Nuclear Information System (INIS)

    Lattouf, Elie

    2013-01-01

    The formation of the negative hydrogen ion (H - ) in collisions between a positive ion and a neutral atomic or molecular target is studied experimentally at impact energies of a few keV. The doubly-differential cross sections for H - formation are measured as a function of the kinetic energy and emission angle for the collision systems OH + + Ar and O + + H 2 O at 412 eV/a.m.u. These H - ions can be emitted at high energies (keV) in hard quasi-elastic two-body collisions involving a large momentum transfer to the H center. However, H - anions are preferentially emitted at low energy (eV) due to soft many-body (≥ 2) collisions resulting in a low momentum transfer. The formation of H - ions by electron capture follows excitation or ionization of the molecule. The molecular fragmentation dynamics is modeled to simulate the emission of H - ions. The overall good agreement between the simulation and the experiment leads to the understanding of most of the experimental observations. (author) [fr

  19. Phylogenetic trees in bioinformatics

    Energy Technology Data Exchange (ETDEWEB)

    Burr, Tom L [Los Alamos National Laboratory

    2008-01-01

    Genetic data is often used to infer evolutionary relationships among a collection of viruses, bacteria, animal or plant species, or other operational taxonomic units (OTU). A phylogenetic tree depicts such relationships and provides a visual representation of the estimated branching order of the OTUs. Tree estimation is unique for several reasons, including: the types of data used to represent each OTU; the use ofprobabilistic nucleotide substitution models; the inference goals involving both tree topology and branch length, and the huge number of possible trees for a given sample of a very modest number of OTUs, which implies that fmding the best tree(s) to describe the genetic data for each OTU is computationally demanding. Bioinformatics is too large a field to review here. We focus on that aspect of bioinformatics that includes study of similarities in genetic data from multiple OTUs. Although research questions are diverse, a common underlying challenge is to estimate the evolutionary history of the OTUs. Therefore, this paper reviews the role of phylogenetic tree estimation in bioinformatics, available methods and software, and identifies areas for additional research and development.

  20. Taxonomic revision and phylogenetic analyses of rubber powdery mildew fungi.

    Science.gov (United States)

    Liyanage, K K; Khan, Sehroon; Brooks, Siraprapa; Mortimer, Peter E; Karunarathna, Samantha C; Xu, Jianchu; Hyde, Kevin D

    2017-04-01

    Powdery mildew is a fungal disease that infects a wide range of plants, including rubber trees, which results in a reduction of latex yields of up to 45%. The causal agent of powdery mildew of rubber was first described as Oidium heveae, but later morpho-molecular research suggested that in the past, O. heveae has been confused with Erysiphe quercicola. However, it is still under debate whether the causal agent should be classified as a species of the genus Erysiphe emend. or Golovinomyces and Podosphaera, respectively. Therefore, the aim of this study was to undertake the morpho-molecular characterization of powdery mildew species associated with rubber trees, thus resolving these taxonomic issues. Morphological observation under light and scanning electron microscopes (SEM) clearly identified two morphotypes of the rubber powdery mildew. With the support of morphological and phylogenetic data, one of the two morphotypes was identified as the asexual morph of E. quercicola, while the second morphotype is still insufficiently known and according to the morphological results obtained we assume that it might belong to the genus Golovinomyces. More collections and additional molecular data are required for final conclusions regarding the exact taxonomic position of the second morphotype of rubber powdery mildew and its relation to the name O. heveae. The haplotype analysis identified eight haplotype groups of E. quercicola indicating the high genetic diversity of the species. Copyright © 2017 Elsevier Ltd. All rights reserved.

  1. Marine turtle mitogenome phylogenetics and evolution

    DEFF Research Database (Denmark)

    Duchene, Sebastián; Frey, Amy; Alfaro-Núñez, Luis Alonso

    2012-01-01

    The sea turtles are a group of cretaceous origin containing seven recognized living species: leatherback, hawksbill, Kemp's ridley, olive ridley, loggerhead, green, and flatback. The leatherback is the single member of the Dermochelidae family, whereas all other sea turtles belong in Cheloniidae...... distributions, shedding light on complex migration patterns and possible geographic or climatic events as driving forces of sea-turtle distribution. We have sequenced complete mitogenomes for all sea-turtle species, including samples from their geographic range extremes, and performed phylogenetic analyses...... to assess sea-turtle evolution with a large molecular dataset. We found variation in the length of the ATP8 gene and a highly variable site in ND4 near a proton translocation channel in the resulting protein. Complete mitogenomes show strong support and resolution for phylogenetic relationships among all...

  2. Incompletely resolved phylogenetic trees inflate estimates of phylogenetic conservatism.

    Science.gov (United States)

    Davies, T Jonathan; Kraft, Nathan J B; Salamin, Nicolas; Wolkovich, Elizabeth M

    2012-02-01

    The tendency for more closely related species to share similar traits and ecological strategies can be explained by their longer shared evolutionary histories and represents phylogenetic conservatism. How strongly species traits co-vary with phylogeny can significantly impact how we analyze cross-species data and can influence our interpretation of assembly rules in the rapidly expanding field of community phylogenetics. Phylogenetic conservatism is typically quantified by analyzing the distribution of species values on the phylogenetic tree that connects them. Many phylogenetic approaches, however, assume a completely sampled phylogeny: while we have good estimates of deeper phylogenetic relationships for many species-rich groups, such as birds and flowering plants, we often lack information on more recent interspecific relationships (i.e., within a genus). A common solution has been to represent these relationships as polytomies on trees using taxonomy as a guide. Here we show that such trees can dramatically inflate estimates of phylogenetic conservatism quantified using S. P. Blomberg et al.'s K statistic. Using simulations, we show that even randomly generated traits can appear to be phylogenetically conserved on poorly resolved trees. We provide a simple rarefaction-based solution that can reliably retrieve unbiased estimates of K, and we illustrate our method using data on first flowering times from Thoreau's woods (Concord, Massachusetts, USA).

  3. Transforming phylogenetic networks: Moving beyond tree space

    OpenAIRE

    Huber, Katharina T.; Moulton, Vincent; Wu, Taoyang

    2016-01-01

    Phylogenetic networks are a generalization of phylogenetic trees that are used to represent reticulate evolution. Unrooted phylogenetic networks form a special class of such networks, which naturally generalize unrooted phylogenetic trees. In this paper we define two operations on unrooted phylogenetic networks, one of which is a generalization of the well-known nearest-neighbor interchange (NNI) operation on phylogenetic trees. We show that any unrooted phylogenetic network can be transforme...

  4. Different relationships between temporal phylogenetic turnover and phylogenetic similarity and in two forests were detected by a new null model.

    Science.gov (United States)

    Huang, Jian-Xiong; Zhang, Jian; Shen, Yong; Lian, Ju-yu; Cao, Hong-lin; Ye, Wan-hui; Wu, Lin-fang; Bin, Yue

    2014-01-01

    Ecologists have been monitoring community dynamics with the purpose of understanding the rates and causes of community change. However, there is a lack of monitoring of community dynamics from the perspective of phylogeny. We attempted to understand temporal phylogenetic turnover in a 50 ha tropical forest (Barro Colorado Island, BCI) and a 20 ha subtropical forest (Dinghushan in southern China, DHS). To obtain temporal phylogenetic turnover under random conditions, two null models were used. The first shuffled names of species that are widely used in community phylogenetic analyses. The second simulated demographic processes with careful consideration on the variation in dispersal ability among species and the variations in mortality both among species and among size classes. With the two models, we tested the relationships between temporal phylogenetic turnover and phylogenetic similarity at different spatial scales in the two forests. Results were more consistent with previous findings using the second null model suggesting that the second null model is more appropriate for our purposes. With the second null model, a significantly positive relationship was detected between phylogenetic turnover and phylogenetic similarity in BCI at a 10 m×10 m scale, potentially indicating phylogenetic density dependence. This relationship in DHS was significantly negative at three of five spatial scales. This could indicate abiotic filtering processes for community assembly. Using variation partitioning, we found phylogenetic similarity contributed to variation in temporal phylogenetic turnover in the DHS plot but not in BCI plot. The mechanisms for community assembly in BCI and DHS vary from phylogenetic perspective. Only the second null model detected this difference indicating the importance of choosing a proper null model.

  5. Application of multigene phylogenetics and site-stripping to resolve intraordinal relationships in the Rhodymeniales (Rhodophyta).

    Science.gov (United States)

    Filloramo, Gina V; Saunders, Gary W

    2016-06-01

    Previous molecular assessments of the red algal order Rhodymeniales have confirmed its monophyly and distinguished the six currently recognized families (viz. Champiaceae, Faucheaceae, Fryeellaceae, Hymenocladiaceae, Lomentariaceae, and Rhodymeniaceae); however, relationships among most of these families have remained unresolved possibly as a result of substitution saturation at deeper phylogenetic nodes. The objective of the current study was to improve rhodymenialean systematics by increasing taxonomic representation and using a more robust multigene dataset of mitochondrial (COB, COI/COI-5P), nuclear (LSU, EF2) and plastid markers (psbA, rbcL). Additionally, we aimed to prevent phylogenetic inference problems associated with substitution saturation (particularly at the interfamilial nodes) by removing fast-evolving sites and analyzing a series of progressively more conservative alignments. The Rhodymeniales was resolved as two major lineages: (i) the Fryeellaceae as sister to the Faucheaceae and Lomentariaceae; and (ii) the Rhodymeniaceae allied to the Champiaceae and Hymenocladiaceae. Support at the interfamilial nodes was highest when 20% of variable sites were removed. Inclusion of Binghamiopsis, Chamaebotrys, and Minium, which were absent in previous phylogenetic investigations, established their phylogenetic affinities while assessment of two genera consistently polyphyletic in phylogenetic analyses, Erythrymenia and Lomentaria, resulted in the proposition of the novel genera Perbella and Fushitsunagia. The taxonomic position of Drouetia was reinvestigated with re-examination of holotype material of D. coalescens to clarify tetrasporangial development in this genus. In addition, we added three novel Australian species to Drouetia as a result of ongoing DNA barcoding assessments-D. aggregata sp. nov., D. scutellata sp. nov., and D. viridescens sp. nov. © 2016 Phycological Society of America.

  6. Molecular identification and characterisation of catalase and catalase-like protein genes in urease-positive thermophilic Campylobacter (UPTC).

    Science.gov (United States)

    Nakajima, T; Kuribayashi, T; Moore, J E; Millar, B C; Yamamoto, S; Matsuda, Motoo

    2016-01-01

    Thermophilic Campylobacter are important bacterial pathogens of foodborne diseases worldwide. These organisms' physiology requires a microaerophilic atmosphere. To date, little is known about the protective catalase mechanism in urease-positive thermophilic campylobacters (UPTC); hence, it was the aim of this study to identify and characterise catalase and catalase-like protein genes in these organisms. Catalase (katA) and catalase (Kat)-like protein genes from the Japanese UPTC CF89-12 strain were molecularly analysed and compared with C. lari RM2100 and other C. lari and thermophilic Campylobacter reference isolates. A possible open reading frame of 1,422 base pairs, predicted to encode a peptide of 474 amino acid residues, with calculated molecular weight of 52.7 kilo Daltons for katA, was identified within UPTC CF89-12. A probable ribosome binding site, two putative promoters and a putative ρ-independent transcription terminator were also identified within katA. A similar katA cluster also existed in the C. lari RM2100 strain, except that this strain carries no DcuB genes. However, the Kat-like protein gene or any other homologue(s) were never identified in the C. lari RM2100 strain, or in C. jejuni and C. upsaliensis. This study demonstrates the presence of catalase/catalase-like protein genes in UPTC organisms. These findings are significant in that they suggest that UPTC organisms have the protective genetic capability of helping protect the organisms from toxic oxygen stress, which may help them to survive in physiologically harsh environments, both within human and animal hosts, as well as in the natural environment.

  7. Ultrafast Approximation for Phylogenetic Bootstrap

    NARCIS (Netherlands)

    Bui Quang Minh, [No Value; Nguyen, Thi; von Haeseler, Arndt

    Nonparametric bootstrap has been a widely used tool in phylogenetic analysis to assess the clade support of phylogenetic trees. However, with the rapidly growing amount of data, this task remains a computational bottleneck. Recently, approximation methods such as the RAxML rapid bootstrap (RBS) and

  8. A format for phylogenetic placements.

    Directory of Open Access Journals (Sweden)

    Frederick A Matsen

    Full Text Available We have developed a unified format for phylogenetic placements, that is, mappings of environmental sequence data (e.g., short reads into a phylogenetic tree. We are motivated to do so by the growing number of tools for computing and post-processing phylogenetic placements, and the lack of an established standard for storing them. The format is lightweight, versatile, extensible, and is based on the JSON format, which can be parsed by most modern programming languages. Our format is already implemented in several tools for computing and post-processing parsimony- and likelihood-based phylogenetic placements and has worked well in practice. We believe that establishing a standard format for analyzing read placements at this early stage will lead to a more efficient development of powerful and portable post-analysis tools for the growing applications of phylogenetic placement.

  9. Dynamic Contraction of the Positive Column of a Self-Sustained Glow Discharge in Molecular Gas Flow

    Science.gov (United States)

    Shneider, Mikhail

    2014-10-01

    Contraction of the gas discharge, when current contracts from a significant volume of weakly ionized plasma into a thin arc channel, was attracted attention of scientists for more than a century. Studies of the contraction (also called constriction) mechanisms, besides carrying interesting science, are of practical importance, especially when contraction should be prevented. A set of time-dependent two-dimensional equations for the non-equilibrium weakly-ionized nitrogen/ air plasma is formulated. The process is described by a set of time-dependent continuity equations for the electrons, positive and negative ions; gas and vibrational temperature; by taking into account the convective heat and plasma losses by the transverse flux. Transition from the uniform to contracted state was analyzed. It was shown that such transition experiences a hysteresis, and that the critical current of the transition increases when the pressure (gas density) drops. Possible coexistence of the contracted and uniform state of the plasma in the discharge where the current flows along the density gradient of the background gas was discussed. In this talk the problems related to the dynamic contraction of the current channel inside a quasineutral positive column of a self-sustained glow discharge in molecular gas in a rectangular duct with convection cooling will be discussed. Study presented in this talk was stimulated by the fact that there are large number of experiments on the dynamic contraction of a glow discharge in nitrogen and air flows and a many of possible applications. Similar processes play a role in the powerful gas-discharge lasers. In addition, the problem of dynamic contraction in the large volume of non-equilibrium weakly ionized plasma is closely related to the problem of streamer to leader transitions in lightning and blue jets.

  10. Charles Darwin, beetles and phylogenetics

    Science.gov (United States)

    Beutel, Rolf G.; Friedrich, Frank; Leschen, Richard A. B.

    2009-11-01

    . This has changed dramatically. With very large data sets and high throughput sampling, phylogenetic questions can be addressed without prior knowledge of morphological characters. Nevertheless, molecular studies have not lead to the great breakthrough in beetle systematics—yet. Especially the phylogeny of the extremely species rich suborder Polyphaga remains incompletely resolved. Coordinated efforts of molecular workers and of morphologists using innovative techniques may lead to more profound insights in the near future. The final aim is to develop a well-founded phylogeny, which truly reflects the evolution of this immensely species rich group of organisms.

  11. Charles Darwin, beetles and phylogenetics.

    Science.gov (United States)

    Beutel, Rolf G; Friedrich, Frank; Leschen, Richard A B

    2009-11-01

    changed dramatically. With very large data sets and high throughput sampling, phylogenetic questions can be addressed without prior knowledge of morphological characters. Nevertheless, molecular studies have not lead to the great breakthrough in beetle systematics--yet. Especially the phylogeny of the extremely species rich suborder Polyphaga remains incompletely resolved. Coordinated efforts of molecular workers and of morphologists using innovative techniques may lead to more profound insights in the near future. The final aim is to develop a well-founded phylogeny, which truly reflects the evolution of this immensely species rich group of organisms.

  12. Coalescent methods for estimating phylogenetic trees.

    Science.gov (United States)

    Liu, Liang; Yu, Lili; Kubatko, Laura; Pearl, Dennis K; Edwards, Scott V

    2009-10-01

    We review recent models to estimate phylogenetic trees under the multispecies coalescent. Although the distinction between gene trees and species trees has come to the fore of phylogenetics, only recently have methods been developed that explicitly estimate species trees. Of the several factors that can cause gene tree heterogeneity and discordance with the species tree, deep coalescence due to random genetic drift in branches of the species tree has been modeled most thoroughly. Bayesian approaches to estimating species trees utilizes two likelihood functions, one of which has been widely used in traditional phylogenetics and involves the model of nucleotide substitution, and the second of which is less familiar to phylogeneticists and involves the probability distribution of gene trees given a species tree. Other recent parametric and nonparametric methods for estimating species trees involve parsimony criteria, summary statistics, supertree and consensus methods. Species tree approaches are an appropriate goal for systematics, appear to work well in some cases where concatenation can be misleading, and suggest that sampling many independent loci will be paramount. Such methods can also be challenging to implement because of the complexity of the models and computational time. In addition, further elaboration of the simplest of coalescent models will be required to incorporate commonly known issues such as deviation from the molecular clock, gene flow and other genetic forces.

  13. Phylogenetic relationships within the cyst-forming nematodes (Nematoda, Heteroderidae) based on analysis of sequences from the ITS regions of ribosomal DNA.

    Science.gov (United States)

    Subbotin, S A; Vierstraete, A; De Ley, P; Rowe, J; Waeyenberge, L; Moens, M; Vanfleteren, J R

    2001-10-01

    The ITS1, ITS2, and 5.8S gene sequences of nuclear ribosomal DNA from 40 taxa of the family Heteroderidae (including the genera Afenestrata, Cactodera, Heterodera, Globodera, Punctodera, Meloidodera, Cryphodera, and Thecavermiculatus) were sequenced and analyzed. The ITS regions displayed high levels of sequence divergence within Heteroderinae and compared to outgroup taxa. Unlike recent findings in root knot nematodes, ITS sequence polymorphism does not appear to complicate phylogenetic analysis of cyst nematodes. Phylogenetic analyses with maximum-parsimony, minimum-evolution, and maximum-likelihood methods were performed with a range of computer alignments, including elision and culled alignments. All multiple alignments and phylogenetic methods yielded similar basic structure for phylogenetic relationships of Heteroderidae. The cyst-forming nematodes are represented by six main clades corresponding to morphological characters and host specialization, with certain clades assuming different positions depending on alignment procedure and/or method of phylogenetic inference. Hypotheses of monophyly of Punctoderinae and Heteroderinae are, respectively, strongly and moderately supported by the ITS data across most alignments. Close relationships were revealed between the Avenae and the Sacchari groups and between the Humuli group and the species H. salixophila within Heteroderinae. The Goettingiana group occupies a basal position within this subfamily. The validity of the genera Afenestrata and Bidera was tested and is discussed based on molecular data. We conclude that ITS sequence data are appropriate for studies of relationships within the different species groups and less so for recovery of more ancient speciations within Heteroderidae. Copyright 2001 Academic Press.

  14. Peptide insertion, positioning, and stabilization in a membrane: insight from an all-atom molecular dynamics simulation.

    Science.gov (United States)

    Babakhani, Arneh; Gorfe, Alemayehu A; Gullingsrud, Justin; Kim, Judy E; Andrew McCammon, J

    Peptide insertion, positioning, and stabilization in a model membrane are probed via an all-atom molecular dynamics (MD) simulation. One peptide (WL5) is simulated in each leaflet of a solvated dimyristoylglycero-3-phosphate (DMPC) membrane. Within the first 5 ns, the peptides spontaneously insert into the membrane and then stabilize during the remaining 70 ns of simulation time. In both leaflets, the peptides localize to the membrane interface, and this localization is attributed to the formation of peptide-lipid hydrogen bonds. We show that the single tryptophan residue in each peptide contributes significantly to these hydrogen bonds; specifically, the nitrogen heteroatom of the indole ring plays a critical role. The tilt angles of the indole rings relative to the membrane normal in the upper and lower leaflets are approximately 26 degrees and 54 degrees , respectively. The tilt angles of the entire peptide chain are 62 degrees and 74 degrees . The membrane induces conformations of the peptide that are characteristic of beta-sheets, and the peptide enhances the lipid ordering in the membrane. Finally, the diffusion rate of the peptides in the membrane plane is calculated (based on experimental peptide concentrations) to be approximately 6 A(2)/ns, thus suggesting a 500 ns time scale for intermolecular interactions.

  15. Molecular evolution of the nif gene cluster carrying nifI1 and nifI2 genes in the Gram-positive phototrophic bacterium Heliobacterium chlorum.

    Science.gov (United States)

    Enkh-Amgalan, Jigjiddorj; Kawasaki, Hiroko; Seki, Tatsuji

    2006-01-01

    A major nif cluster was detected in the strictly anaerobic, Gram-positive phototrophic bacterium Heliobacterium chlorum. The cluster consisted of 11 genes arranged within a 10 kb region in the order nifI1, nifI2, nifH, nifD, nifK, nifE, nifN, nifX, fdx, nifB and nifV. The phylogenetic position of Hbt. chlorum was the same in the NifH, NifD, NifK, NifE and NifN trees; Hbt. chlorum formed a cluster with Desulfitobacterium hafniense, the closest neighbour of heliobacteria based on the 16S rRNA phylogeny, and two species of the genus Geobacter belonging to the Deltaproteobacteria. Two nifI genes, known to occur in the nif clusters of methanogenic archaea between nifH and nifD, were found upstream of the nifH gene of Hbt. chlorum. The organization of the nif operon and the phylogeny of individual and concatenated gene products showed that the Hbt. chlorum nif operon carrying nifI genes upstream of the nifH gene was an intermediate between the nif operon with nifI downstream of nifH (group II and III of the nitrogenase classification) and the nif operon lacking nifI (group I). Thus, the phylogenetic position of Hbt. chlorum nitrogenase may reflect an evolutionary stage of a divergence of the two nitrogenase groups, with group I consisting of the aerobic diazotrophs and group II consisting of strictly anaerobic prokaryotes.

  16. Bayesian phylogenetic estimation of fossil ages.

    Science.gov (United States)

    Drummond, Alexei J; Stadler, Tanja

    2016-07-19

    Recent advances have allowed for both morphological fossil evidence and molecular sequences to be integrated into a single combined inference of divergence dates under the rule of Bayesian probability. In particular, the fossilized birth-death tree prior and the Lewis-Mk model of discrete morphological evolution allow for the estimation of both divergence times and phylogenetic relationships between fossil and extant taxa. We exploit this statistical framework to investigate the internal consistency of these models by producing phylogenetic estimates of the age of each fossil in turn, within two rich and well-characterized datasets of fossil and extant species (penguins and canids). We find that the estimation accuracy of fossil ages is generally high with credible intervals seldom excluding the true age and median relative error in the two datasets of 5.7% and 13.2%, respectively. The median relative standard error (RSD) was 9.2% and 7.2%, respectively, suggesting good precision, although with some outliers. In fact, in the two datasets we analyse, the phylogenetic estimate of fossil age is on average less than 2 Myr from the mid-point age of the geological strata from which it was excavated. The high level of internal consistency found in our analyses suggests that the Bayesian statistical model employed is an adequate fit for both the geological and morphological data, and provides evidence from real data that the framework used can accurately model the evolution of discrete morphological traits coded from fossil and extant taxa. We anticipate that this approach will have diverse applications beyond divergence time dating, including dating fossils that are temporally unconstrained, testing of the 'morphological clock', and for uncovering potential model misspecification and/or data errors when controversial phylogenetic hypotheses are obtained based on combined divergence dating analyses.This article is part of the themed issue 'Dating species divergences using

  17. The aberrant millipede genus Pteridoiulus and its position in a revised molecular phylogeny of the family Julidae (Diplopoda : Julida)

    DEFF Research Database (Denmark)

    Enghoff, Henrik; Petersen, Gitte; Seberg, Ole

    2013-01-01

    A phylogenetic analysis of 62 species (32 genera) of the Palaearctic millipede family Julidae, including the aberrant alpine genus Pteridoiulus Verhoeff, 1913, was made based on partial sequences of the mitochondrial 16S rRNA (16S) gene and the nuclear 28SrRNA(28S) gene, respectively. The two......MAFTTand run inTNT both with gaps treated as a fifth state, and as missing, and finally the alignments were used as input in a maximum likelihood (ML) analysis. The order Julida and the family Julidae were recovered as monophyletic under all weight sets in POY, as well as in the TNT andMLanalyses. Likewise...

  18. 68Ga-DOTA-NGR as a novel molecular probe for APN-positive tumor imaging using MicroPET.

    Science.gov (United States)

    Zhang, Jun; Lu, Xiaoli; Wan, Nan; Hua, Zichun; Wang, Zizheng; Huang, Hongbo; Yang, Min; Wang, Feng

    2014-03-01

    -DOTA-NGR was easily synthesized and showed favorable biodistribution and kinetics. (68)Ga-DOTA-NGR could also specifically bind to the APN receptor in vitro and in vivo, and might be a potential molecular probe for the noninvasive detection of APN-positive tumors and neovasculature. Copyright © 2014 Elsevier Inc. All rights reserved.

  19. phangorn: phylogenetic analysis in R.

    Science.gov (United States)

    Schliep, Klaus Peter

    2011-02-15

    phangorn is a package for phylogenetic reconstruction and analysis in the R language. Previously it was only possible to estimate phylogenetic trees with distance methods in R. phangorn, now offers the possibility of reconstructing phylogenies with distance based methods, maximum parsimony or maximum likelihood (ML) and performing Hadamard conjugation. Extending the general ML framework, this package provides the possibility of estimating mixture and partition models. Furthermore, phangorn offers several functions for comparing trees, phylogenetic models or splits, simulating character data and performing congruence analyses. phangorn can be obtained through the CRAN homepage http://cran.r-project.org/web/packages/phangorn/index.html. phangorn is licensed under GPL 2.

  20. On Nakhleh's metric for reduced phylogenetic networks

    OpenAIRE

    Cardona, Gabriel; Llabrés, Mercè; Rosselló, Francesc; Valiente Feruglio, Gabriel Alejandro

    2009-01-01

    We prove that Nakhleh’s metric for reduced phylogenetic networks is also a metric on the classes of tree-child phylogenetic networks, semibinary tree-sibling time consistent phylogenetic networks, and multilabeled phylogenetic trees. We also prove that it separates distinguishable phylogenetic networks. In this way, it becomes the strongest dissimilarity measure for phylogenetic networks available so far. Furthermore, we propose a generalization of that metric that separates arbitrary phyl...

  1. Phylogenetic comparative methods on phylogenetic networks with reticulations.

    Science.gov (United States)

    Bastide, Paul; Solís-Lemus, Claudia; Kriebel, Ricardo; Sparks, K William; Ané, Cécile

    2018-04-25

    The goal of Phylogenetic Comparative Methods (PCMs) is to study the distribution of quantitative traits among related species. The observed traits are often seen as the result of a Brownian Motion (BM) along the branches of a phylogenetic tree. Reticulation events such as hybridization, gene flow or horizontal gene transfer, can substantially affect a species' traits, but are not modeled by a tree. Phylogenetic networks have been designed to represent reticulate evolution. As they become available for downstream analyses, new models of trait evolution are needed, applicable to networks. One natural extension of the BM is to use a weighted average model for the trait of a hybrid, at a reticulation point. We develop here an efficient recursive algorithm to compute the phylogenetic variance matrix of a trait on a network, in only one preorder traversal of the network. We then extend the standard PCM tools to this new framework, including phylogenetic regression with covariates (or phylogenetic ANOVA), ancestral trait reconstruction, and Pagel's λ test of phylogenetic signal. The trait of a hybrid is sometimes outside of the range of its two parents, for instance because of hybrid vigor or hybrid depression. These two phenomena are rather commonly observed in present-day hybrids. Transgressive evolution can be modeled as a shift in the trait value following a reticulation point. We develop a general framework to handle such shifts, and take advantage of the phylogenetic regression view of the problem to design statistical tests for ancestral transgressive evolution in the evolutionary history of a group of species. We study the power of these tests in several scenarios, and show that recent events have indeed the strongest impact on the trait distribution of present-day taxa. We apply those methods to a dataset of Xiphophorus fishes, to confirm and complete previous analysis in this group. All the methods developed here are available in the Julia package PhyloNetworks.

  2. Molecular phylogenetics of the family Cyprinidae (Actinopterygii: Cypriniformes) as evidenced by sequence variation in the first intron of S7 ribosomal protein-coding gene: further evidence from a nuclear gene of the systematic chaos in the family.

    Science.gov (United States)

    He, Shunping; Mayden, Richard L; Wang, Xuzheng; Wang, Wei; Tang, Kevin L; Chen, Wei-Jen; Chen, Yiyu

    2008-03-01

    The family Cyprinidae is the largest freshwater fish group in the world, including over 200 genera and 2100 species. The phylogenetic relationships of major clades within this family are simply poorly understood, largely because of the overwhelming diversity of the group; however, several investigators have advanced different hypotheses of relationships that pre- and post-date the use of shared-derived characters as advocated through phylogenetic systematics. As expected, most previous investigations used morphological characters. Recently, mitochondrial DNA (mtDNA) sequences and combined morphological and mtDNA investigations have been used to explore and advance our understanding of species relationships and test monophyletic groupings. Limitations of these studies include limited taxon sampling and a strict reliance upon maternally inherited mtDNA variation. The present study is the first endeavor to recover the phylogenetic relationships of the 12 previously recognized monophyletic subfamilies within the Cyprinidae using newly sequenced nuclear DNA (nDNA) for over 50 species representing members of the different previously hypothesized subfamily and family groupings within the Cyprinidae and from other cypriniform families as outgroup taxa. Hypothesized phylogenetic relationships are constructed using maximum parsimony and Basyesian analyses of 1042 sites, of which 971 sites were variable and 790 were phylogenetically informative. Using other appropriate cypriniform taxa of the families Catostomidae (Myxocyprinus asiaticus), Gyrinocheilidae (Gyrinocheilus aymonieri), and Balitoridae (Nemacheilus sp. and Beaufortia kweichowensis) as outgroups, the Cyprinidae is resolved as a monophyletic group. Within the family the genera Raiamas, Barilius, Danio, and Rasbora, representing many of the tropical cyprinids, represent basal members of the family. All other species can be classified into variably supported and resolved monophyletic lineages, depending upon analysis

  3. Phylogenetic inference with weighted codon evolutionary distances.

    Science.gov (United States)

    Criscuolo, Alexis; Michel, Christian J

    2009-04-01

    We develop a new approach to estimate a matrix of pairwise evolutionary distances from a codon-based alignment based on a codon evolutionary model. The method first computes a standard distance matrix for each of the three codon positions. Then these three distance matrices are weighted according to an estimate of the global evolutionary rate of each codon position and averaged into a unique distance matrix. Using a large set of both real and simulated codon-based alignments of nucleotide sequences, we show that this approach leads to distance matrices that have a significantly better treelikeness compared to those obtained by standard nucleotide evolutionary distances. We also propose an alternative weighting to eliminate the part of the noise often associated with some codon positions, particularly the third position, which is known to induce a fast evolutionary rate. Simulation results show that fast distance-based tree reconstruction algorithms on distance matrices based on this codon position weighting can lead to phylogenetic trees that are at least as accurate as, if not better, than those inferred by maximum likelihood. Finally, a well-known multigene dataset composed of eight yeast species and 106 codon-based alignments is reanalyzed and shows that our codon evolutionary distances allow building a phylogenetic tree which is similar to those obtained by non-distance-based methods (e.g., maximum parsimony and maximum likelihood) and also significantly improved compared to standard nucleotide evolutionary distance estimates.

  4. Phylogenetic relationships of Chaetomium isolates based on the ...

    African Journals Online (AJOL)

    Molecular characterization of 18 Chaetomium isolates collected from India based on the internal transcribed spacer (ITS) region of the rRNA gene sequences was done. Phylogenetic analysis of full length ITS region showed that Chaetomium globosum isolates, Cg1, Cg2, Cg6, Cg11 and Cg15, Chaetomium spp. isolates, ...

  5. Phylogenetic placement of the Dominican Republic endemic genus Sarcopilea (Urticaceae)

    Czech Academy of Sciences Publication Activity Database

    Jestrow, B.; Valdés, James J.; Rodríguez, F. J.; Francisco-Ortega, J.

    2012-01-01

    Roč. 61, č. 3 (2012), s. 592-600 ISSN 0040-0262 Institutional support: RVO:60077344 Keywords : CAM * Caribbean Islands * cystoliths * epistomatic * hyperstomatic * hydathodes * phylogenetics * Pilea * Sarcopilea * succulent * Urticaceae Subject RIV: EB - Genetics ; Molecular Biology Impact factor: 2.782, year: 2012

  6. A phylogenetic study of Boletus section Boletus in Europe

    NARCIS (Netherlands)

    Beugelsdijk, D.C.M.; Linde, van der S.; Zuccarello, G.C.; Bakker, den H.C.

    2008-01-01

    A phylogenetic study of the species in Boletus sect. Boletus was undertaken using the molecular markers ITS1-5.8S-ITS2 and Gap dh. Four well-supported lineages, one comprising Boletus edulis s.l., the others referring to B. aereus, B. reticulatus and B. pinophilus have been distinguished. The ML and

  7. Phylogenetic analysis of the genus Hordeum using repetitive DNA sequences

    DEFF Research Database (Denmark)

    Svitashev, S.; Bryngelsson, T.; Vershinin, A.

    1994-01-01

    A set of six cloned barley (Hordeum vulgare) repetitive DNA sequences was used for the analysis of phylogenetic relationships among 31 species (46 taxa) of the genus Hordeum, using molecular hybridization techniques. In situ hybridization experiments showed dispersed organization of the sequences...

  8. Comprehensive untargeted metabolomics of Lychnnophorinae subtribe (Asteraceae: Vernonieae) in a phylogenetic context.

    Science.gov (United States)

    Martucci, Maria Elvira Poleti; Loeuille, Benoit; Pirani, José Rubens; Gobbo-Neto, Leonardo

    2018-01-01

    Members of the subtribe Lychnophorinae occur mostly within the Cerrado domain of the Brazilian Central Plateau. The relationships between its 11 genera, as well as between Lychnophorinae and other subtribes belonging to the tribe Vernonieae, have recently been investigated upon a phylogeny based on molecular and morphological data. We report the use of a comprehensive untargeted metabolomics approach, combining HPLC-MS and GC-MS data, followed by multivariate analyses aiming to assess the congruence between metabolomics data and the phylogenetic hypothesis, as well as its potential as a chemotaxonomic tool. We analyzed 78 species by UHPLC-MS and GC-MS in both positive and negative ionization modes. The metabolic profiles obtained for these species were treated in MetAlign and in MSClust and the matrices generated were used in SIMCA for hierarchical cluster analyses, principal component analyses and orthogonal partial least square discriminant analysis. The results showed that metabolomic analyses are mostly congruent with the phylogenetic hypothesis especially at lower taxonomic levels (Lychnophora or Eremanthus). Our results confirm that data generated using metabolomics provide evidence for chemotaxonomical studies, especially for phylogenetic inference of the Lychnophorinae subtribe and insight into the evolution of the secondary metabolites of this group.

  9. Comprehensive untargeted metabolomics of Lychnnophorinae subtribe (Asteraceae: Vernonieae in a phylogenetic context.

    Directory of Open Access Journals (Sweden)

    Maria Elvira Poleti Martucci

    Full Text Available Members of the subtribe Lychnophorinae occur mostly within the Cerrado domain of the Brazilian Central Plateau. The relationships between its 11 genera, as well as between Lychnophorinae and other subtribes belonging to the tribe Vernonieae, have recently been investigated upon a phylogeny based on molecular and morphological data. We report the use of a comprehensive untargeted metabolomics approach, combining HPLC-MS and GC-MS data, followed by multivariate analyses aiming to assess the congruence between metabolomics data and the phylogenetic hypothesis, as well as its potential as a chemotaxonomic tool. We analyzed 78 species by UHPLC-MS and GC-MS in both positive and negative ionization modes. The metabolic profiles obtained for these species were treated in MetAlign and in MSClust and the matrices generated were used in SIMCA for hierarchical cluster analyses, principal component analyses and orthogonal partial least square discriminant analysis. The results showed that metabolomic analyses are mostly congruent with the phylogenetic hypothesis especially at lower taxonomic levels (Lychnophora or Eremanthus. Our results confirm that data generated using metabolomics provide evidence for chemotaxonomical studies, especially for phylogenetic inference of the Lychnophorinae subtribe and insight into the evolution of the secondary metabolites of this group.

  10. Two mitochondrial genomes in Alcedinidae (Ceryle rudis/Halcyon pileata) and the phylogenetic placement of Coraciiformes.

    Science.gov (United States)

    Sun, Xiaomin; Zhao, Ruoping; Zhang, Ting; Gong, Jie; Jing, Meidong; Huang, Ling

    2017-10-01

    Coraciiformes comprises 209 species belonging to ten families with significant divergence on external morphologies and life styles. The phylogenetic placement of Coraciiformes was still in debate. Here, we determined the complete mitochondrial genomes (mitogenomes) of Crested Kingfisher (Ceryle rudis) and Black-capped Kingfisher (Halcyon pileata). The mitogenomes were 17,355 bp (C. rudis) and 17,612 bp (H. pileata) in length, and both of them contained 37 genes (two rRNA genes, 22 tRNA genes and 13 protein-coding genes) and one control region. The gene organizations and characters of two mitogenomes were similar with those of other mitogenomes in Coraciiformes, however the sizes and nucleotide composition of control regions in different mitogenomes were significantly different. Phylogenetic trees were constructed with both Bayesian and Maximum Likelihood methods based on mitogenome sequences from 11 families of six orders. The trees based on two different data sets supported the basal position of Psittacidae (Psittaciformes), the closest relationship between Cuculiformes (Cuculidae) and Trogoniformes (Trogonidae), and the close relationship between Coraciiformes and Piciformes. The phylogenetic placement of the clade including Cuculiformes and Trogoniformes has not been resolved in present study, which need further investigations with more molecular markers and species. The mitogenome sequences presented here provided valuable data for further taxonomic studies on Coraciiformes and other related groups.

  11. Detecting taxonomic and phylogenetic signals in equid cheek teeth: towards new palaeontological and archaeological proxies

    Science.gov (United States)

    Mohaseb, A.; Peigné, S.; Debue, K.; Orlando, L.; Mashkour, M.

    2017-01-01

    The Plio–Pleistocene evolution of Equus and the subsequent domestication of horses and donkeys remains poorly understood, due to the lack of phenotypic markers capable of tracing this evolutionary process in the palaeontological/archaeological record. Using images from 345 specimens, encompassing 15 extant taxa of equids, we quantified the occlusal enamel folding pattern in four mandibular cheek teeth with a single geometric morphometric protocol. We initially investigated the protocol accuracy by assigning each tooth to its correct anatomical position and taxonomic group. We then contrasted the phylogenetic signal present in each tooth shape with an exome-wide phylogeny from 10 extant equine species. We estimated the strength of the phylogenetic signal using a Brownian motion model of evolution with multivariate K statistic, and mapped the dental shape along the molecular phylogeny using an approach based on squared-change parsimony. We found clear evidence for the relevance of dental phenotypes to accurately discriminate all modern members of the genus Equus and capture their phylogenetic relationships. These results are valuable for both palaeontologists and zooarchaeologists exploring the spatial and temporal dynamics of the evolutionary history of the horse family, up to the latest domestication trajectories of horses and donkeys. PMID:28484618

  12. The rhabdoviruses: biodiversity, phylogenetics, and evolution.

    Science.gov (United States)

    Kuzmin, I V; Novella, I S; Dietzgen, R G; Padhi, A; Rupprecht, C E

    2009-07-01

    Rhabdoviruses (family Rhabdoviridae) include a diversity of important pathogens of animals and plants. They share morphology and genome organization. The understanding of rhabdovirus phylogeny, ecology and evolution has progressed greatly during the last 30 years, due to enhanced surveillance and improved methodologies of molecular characterization. Along with six established genera, several phylogenetic groups at different levels were described within the Rhabdoviridae. However, comparative relationships between viral phylogeny and taxonomy remains incomplete, with multiple representatives awaiting further genetic characterization. The same is true for rhabdovirus evolution. To date, rather simplistic molecular clock models only partially describe the evolutionary dynamics of postulated viral lineages. Ongoing progress in viral evolutionary and ecological investigations will provide the platform for future studies of this diverse family.

  13. A taxonomic and phylogenetic re-appraisal of the genus Curvularia

    Science.gov (United States)

    Species of Curvularia are important plant and human pathogens worldwide. In this study, the genus Curvularia is re-assessed based on molecular phylogenetic analysis and morphological observations of available isolates and specimens. A multi-gene phylogenetic tree inferred from ITS, TEF and GPDH gene...

  14. Phylogenetic Analysis of Phytophthora Species Based on Mitochondrial and Nuclear DNA Sequences

    NARCIS (Netherlands)

    Kroon, L.P.N.M.; Bakker, F.T.; Bosch, van den G.B.M.; Bonants, P.J.M.; Flier, W.G.

    2004-01-01

    A molecular phylogenetic analysis of the genus Phytophthora was performed, 113 isolates from 48 Phytophthora species were included in this analysis. Phylogenetic analyses were performed on regions of mitochondrial (cytochrome c oxidase subunit 1; NADH dehydrogenase subunit 1) and nuclear gene

  15. A phylogenetic blueprint for a modern whale.

    Science.gov (United States)

    Gatesy, John; Geisler, Jonathan H; Chang, Joseph; Buell, Carl; Berta, Annalisa; Meredith, Robert W; Springer, Mark S; McGowen, Michael R

    2013-02-01

    The emergence of Cetacea in the Paleogene represents one of the most profound macroevolutionary transitions within Mammalia. The move from a terrestrial habitat to a committed aquatic lifestyle engendered wholesale changes in anatomy, physiology, and behavior. The results of this remarkable transformation are extant whales that include the largest, biggest brained, fastest swimming, loudest, deepest diving mammals, some of which can detect prey with a sophisticated echolocation system (Odontoceti - toothed whales), and others that batch feed using racks of baleen (Mysticeti - baleen whales). A broad-scale reconstruction of the evolutionary remodeling that culminated in extant cetaceans has not yet been based on integration of genomic and paleontological information. Here, we first place Cetacea relative to extant mammalian diversity, and assess the distribution of support among molecular datasets for relationships within Artiodactyla (even-toed ungulates, including Cetacea). We then merge trees derived from three large concatenations of molecular and fossil data to yield a composite hypothesis that encompasses many critical events in the evolutionary history of Cetacea. By combining diverse evidence, we infer a phylogenetic blueprint that outlines the stepwise evolutionary development of modern whales. This hypothesis represents a starting point for more detailed, comprehensive phylogenetic reconstructions in the future, and also highlights the synergistic interaction between modern (genomic) and traditional (morphological+paleontological) approaches that ultimately must be exploited to provide a rich understanding of evolutionary history across the entire tree of Life. Copyright © 2012 Elsevier Inc. All rights reserved.

  16. Point estimates in phylogenetic reconstructions

    OpenAIRE

    Benner, Philipp; Bacak, Miroslav; Bourguignon, Pierre-Yves

    2013-01-01

    Motivation: The construction of statistics for summarizing posterior samples returned by a Bayesian phylogenetic study has so far been hindered by the poor geometric insights available into the space of phylogenetic trees, and ad hoc methods such as the derivation of a consensus tree makeup for the ill-definition of the usual concepts of posterior mean, while bootstrap methods mitigate the absence of a sound concept of variance. Yielding satisfactory results with sufficiently concentrated pos...

  17. Revisiting the Zingiberales: using multiplexed exon capture to resolve ancient and recent phylogenetic splits in a charismatic plant lineage

    Directory of Open Access Journals (Sweden)

    Chodon Sass

    2016-01-01

    Full Text Available The Zingiberales are an iconic order of monocotyledonous plants comprising eight families with distinctive and diverse floral morphologies and representing an important ecological element of tropical and subtropical forests. While the eight families are demonstrated to be monophyletic, phylogenetic relationships among these families remain unresolved. Neither combined morphological and molecular studies nor recent attempts to resolve family relationships using sequence data from whole plastomes has resulted in a well-supported, family-level phylogenetic hypothesis of relationships. Here we approach this challenge by leveraging the complete genome of one member of the order, Musa acuminata, together with transcriptome information from each of the other seven families to design a set of nuclear loci that can be enriched from highly divergent taxa with a single array-based capture of indexed genomic DNA. A total of 494 exons from 418 nuclear genes were captured for 53 ingroup taxa. The entire plastid genome was also captured for the same 53 taxa. Of the total genes captured, 308 nuclear and 68 plastid genes were used for phylogenetic estimation. The concatenated plastid and nuclear dataset supports the position of Musaceae as sister to the remaining seven families. Moreover, the combined dataset recovers known intra- and inter-family phylogenetic relationships with generally high bootstrap support. This is a flexible and cost effective method that gives the broader plant biology community a tool for generating phylogenomic scale sequence data in non-model systems at varying evolutionary depths.

  18. Towards an integrated phylogenetic classification of the Tremellomycetes.

    Science.gov (United States)

    Liu, X-Z; Wang, Q-M; Göker, M; Groenewald, M; Kachalkin, A V; Lumbsch, H T; Millanes, A M; Wedin, M; Yurkov, A M; Boekhout, T; Bai, F-Y

    2015-06-01

    Families and genera assigned to Tremellomycetes have been mainly circumscribed by morphology and for the yeasts also by biochemical and physiological characteristics. This phenotype-based classification is largely in conflict with molecular phylogenetic analyses. Here a phylogenetic classification framework for the Tremellomycetes is proposed based on the results of phylogenetic analyses from a seven-genes dataset covering the majority of tremellomycetous yeasts and closely related filamentous taxa. Circumscriptions of the taxonomic units at the order, family and genus levels recognised were quantitatively assessed using the phylogenetic rank boundary optimisation (PRBO) and modified general mixed Yule coalescent (GMYC) tests. In addition, a comprehensive phylogenetic analysis on an expanded LSU rRNA (D1/D2 domains) gene sequence dataset covering as many as available teleomorphic and filamentous taxa within Tremellomycetes was performed to investigate the relationships between yeasts and filamentous taxa and to examine the stability of undersampled clades. Based on the results inferred from molecular data and morphological and physiochemical features, we propose an updated classification for the Tremellomycetes. We accept five orders, 17 families and 54 genera, including seven new families and 18 new genera. In addition, seven families and 17 genera are emended and one new species name and 185 new combinations are proposed. We propose to use the term pro tempore or pro tem. in abbreviation to indicate the species names that are temporarily maintained.

  19. A Consistent Phylogenetic Backbone for the Fungi

    Science.gov (United States)

    Ebersberger, Ingo; de Matos Simoes, Ricardo; Kupczok, Anne; Gube, Matthias; Kothe, Erika; Voigt, Kerstin; von Haeseler, Arndt

    2012-01-01

    The kingdom of fungi provides model organisms for biotechnology, cell biology, genetics, and life sciences in general. Only when their phylogenetic relationships are stably resolved, can individual results from fungal research be integrated into a holistic picture of biology. However, and despite recent progress, many deep relationships within the fungi remain unclear. Here, we present the first phylogenomic study of an entire eukaryotic kingdom that uses a consistency criterion to strengthen phylogenetic conclusions. We reason that branches (splits) recovered with independent data and different tree reconstruction methods are likely to reflect true evolutionary relationships. Two complementary phylogenomic data sets based on 99 fungal genomes and 109 fungal expressed sequence tag (EST) sets analyzed with four different tree reconstruction methods shed light from different angles on the fungal tree of life. Eleven additional data sets address specifically the phylogenetic position of Blastocladiomycota, Ustilaginomycotina, and Dothideomycetes, respectively. The combined evidence from the resulting trees supports the deep-level stability of the fungal groups toward a comprehensive natural system of the fungi. In addition, our analysis reveals methodologically interesting aspects. Enrichment for EST encoded data—a common practice in phylogenomic analyses—introduces a strong bias toward slowly evolving and functionally correlated genes. Consequently, the generalization of phylogenomic data sets as collections of randomly selected genes cannot be taken for granted. A thorough characterization of the data to assess possible influences on the tree reconstruction should therefore become a standard in phylogenomic analyses. PMID:22114356

  20. New substitution models for rooting phylogenetic trees.

    Science.gov (United States)

    Williams, Tom A; Heaps, Sarah E; Cherlin, Svetlana; Nye, Tom M W; Boys, Richard J; Embley, T Martin

    2015-09-26

    The root of a phylogenetic tree is fundamental to its biological interpretation, but standard substitution models do not provide any information on its position. Here, we describe two recently developed models that relax the usual assumptions of stationarity and reversibility, thereby facilitating root inference without the need for an outgroup. We compare the performance of these models on a classic test case for phylogenetic methods, before considering two highly topical questions in evolutionary biology: the deep structure of the tree of life and the root of the archaeal radiation. We show that all three alignments contain meaningful rooting information that can be harnessed by these new models, thus complementing and extending previous work based on outgroup rooting. In particular, our analyses exclude the root of the tree of life from the eukaryotes or Archaea, placing it on the bacterial stem or within the Bacteria. They also exclude the root of the archaeal radiation from several major clades, consistent with analyses using other rooting methods. Overall, our results demonstrate the utility of non-reversible and non-stationary models for rooting phylogenetic trees, and identify areas where further progress can be made. © 2015 The Authors.

  1. Phylogenetic lineages in Pseudocercospora.

    Science.gov (United States)

    Crous, P W; Braun, U; Hunter, G C; Wingfield, M J; Verkley, G J M; Shin, H-D; Nakashima, C; Groenewald, J Z

    2013-06-30

    Pseudocercospora is a large cosmopolitan genus of plant pathogenic fungi that are commonly associated with leaf and fruit spots as well as blights on a wide range of plant hosts. They occur in arid as well as wet environments and in a wide range of climates including cool temperate, sub-tropical and tropical regions. Pseudocercospora is now treated as a genus in its own right, although formerly recognised as either an anamorphic state of Mycosphaerella or having mycosphaerella-like teleomorphs. The aim of this study was to sequence the partial 28S nuclear ribosomal RNA gene of a selected set of isolates to resolve phylogenetic generic limits within the Pseudocercospora complex. From these data, 14 clades are recognised, six of which cluster in Mycosphaerellaceae. Pseudocercospora s. str. represents a distinct clade, sister to Passalora eucalypti, and a clade representing the genera Scolecostigmina, Trochophora and Pallidocercospora gen. nov., taxa formerly accommodated in the Mycosphaerella heimii complex and characterised by smooth, pale brown conidia, as well as the formation of red crystals in agar media. Other clades in Mycosphaerellaceae include Sonderhenia, Microcyclosporella, and Paracercospora. Pseudocercosporella resides in a large clade along with Phloeospora, Miuraea, Cercospora and Septoria. Additional clades represent Dissoconiaceae, Teratosphaeriaceae, Cladosporiaceae, and the genera Xenostigmina, Strelitziana, Cyphellophora and Thedgonia. The genus Phaeomycocentrospora is introduced to accommodate Mycocentrospora cantuariensis, primarily distinguished from Pseudocercospora based on its hyaline hyphae, broad conidiogenous loci and hila. Host specificity was considered for 146 species of Pseudocercospora occurring on 115 host genera from 33 countries. Partial nucleotide sequence data for three gene loci, ITS, EF-1α, and ACT suggest that the majority of these species are host specific. Species identified on the basis of host, symptomatology and general

  2. The complete chloroplast genome sequence of Ampelopsis: gene organization, comparative analysis and phylogenetic relationships to other angiosperms

    Directory of Open Access Journals (Sweden)

    Gurusamy eRaman

    2016-03-01

    Full Text Available Ampelopsis brevipedunculata is an economically important plant that belongs to the Vitaceae family of angiosperms. The phylogenetic placement of Vitaceae is still unresolved. Recent phylogenetic studies suggested that it should be placed in various alternative families including Caryophyllaceae, asteraceae, Saxifragaceae, Dilleniaceae, or with the rest of the rosid families. However, these analyses provided weak supportive results because they were based on only one of several genes. Accordingly, complete chloroplast genome sequences are required to resolve the phylogenetic relationships among angiosperms. Recent phylogenetic analyses based on the complete chloroplast genome sequence suggested strong support for the position of Vitaceae as the earliest diverging lineage of rosids and placed it as a sister to the remaining rosids. These studies also revealed relationships among several major lineages of angiosperms; however, they highlighted the significance of taxon sampling for obtaining accurate phylogenies. In the present study, we sequenced the complete chloroplast genome of A. brevipedunculata and used these data to assess the relationships among 32 angiosperms, including 18 taxa of rosids. The Ampelopsis chloroplast genome is 161,090 bp in length, and includes a pair of inverted repeats of 26,394 bp that are separated by small and large single copy regions of 19,036 bp and 89,266 bp, respectively. The gene content and order of Ampelopsis is identical to many other unrearranged angiosperm chloroplast genomes, including Vitis and tobacco. A phylogenetic tree constructed based on 70 protein-coding genes of 33 angiosperms showed that both Saxifragales and Vitaceae diverged from the rosid clade and formed two clades with 100% bootstrap value. The position of the Vitaceae is sister to Saxifragales, and both are the basal and earliest diverging lineages. Moreover, Saxifragales forms a sister clade to Vitaceae of rosids. Overall, the results of

  3. Locating a tree in a phylogenetic network

    NARCIS (Netherlands)

    Iersel, van L.J.J.; Semple, C.; Steel, M.A.

    2010-01-01

    Phylogenetic trees and networks are leaf-labelled graphs that are used to describe evolutionary histories of species. The Tree Containment problem asks whether a given phylogenetic tree is embedded in a given phylogenetic network. Given a phylogenetic network and a cluster of species, the Cluster

  4. Phylogenetic analyses provide insights into the historical biogeography and evolution of Brachyrhaphis fishes.

    Science.gov (United States)

    Ingley, Spencer J; Reina, Ruth G; Bermingham, Eldredge; Johnson, Jerald B

    2015-08-01

    The livebearing fish genus Brachyrhaphis (Poeciliidae) has become an increasingly important model in evolution and ecology research, yet the phylogeny of this group is not well understood, nor has it been examined thoroughly using modern phylogenetic methods. Here, we present the first comprehensive phylogenetic analysis of Brachyrhaphis by using four molecular markers (3mtDNA, 1nucDNA) to infer relationships among species in this genus. We tested the validity of this genus as a monophyletic group using extensive outgroup sampling based on recent phylogenetic hypotheses of Poeciliidae. We also tested the validity of recently described species of Brachyrhaphis that are part of the B. episcopi complex in Panama. Finally, we examined the impact of historical events on diversification of Brachyrhaphis, and made predictions regarding the role of different ecological environments on evolutionary diversification where known historical events apparently fail to explain speciation. Based on our results, we reject the monophyly of Brachyrhaphis, and question the validity of two recently described species (B. hessfeldi and B. roswithae). Historical biogeography of Brachyrhaphis generally agrees with patterns found in other freshwater taxa in Lower Central America, which show that geological barriers frequently predict speciation. Specifically, we find evidence in support of an 'island' model of Lower Central American formation, which posits that the nascent isthmus was partitioned by several marine connections before linking North and South America. In some cases where historic events (e.g., vicariance) fail to explain allopatric species breaks in Brachyrhaphis, ecological processes (e.g., divergent predation environments) offer additional insight into our understanding of phylogenetic diversification in this group. Copyright © 2015 Elsevier Inc. All rights reserved.

  5. Whole genome sequence phylogenetic analysis of four Mexican rabies viruses isolated from cattle.

    Science.gov (United States)

    Bárcenas-Reyes, I; Loza-Rubio, E; Cantó-Alarcón, G J; Luna-Cozar, J; Enríquez-Vázquez, A; Barrón-Rodríguez, R J; Milián-Suazo, F

    2017-08-01

    Phylogenetic analysis of the rabies virus in molecular epidemiology has been traditionally performed on partial sequences of the genome, such as the N, G, and P genes; however, that approach raises concerns about the discriminatory power compared to whole genome sequencing. In this study we characterized four strains of the rabies virus isolated from cattle in Querétaro, Mexico by comparing the whole genome sequence to that of strains from the American, European and Asian continents. Four cattle brain samples positive to rabies and characterized as AgV11, genotype 1, were used in the study. A cDNA sequence was generated by reverse transcription PCR (RT-PCR) using oligo dT. cDNA samples were sequenced in an Illumina NextSeq 500 platform. The phylogenetic analysis was performed with MEGA 6.0. Minimum evolution phylogenetic trees were constructed with the Neighbor-Joining method and bootstrapped with 1000 replicates. Three large and seven small clusters were formed with the 26 sequences used. The largest cluster grouped strains from different species in South America: Brazil, and the French Guyana. The second cluster grouped five strains from Mexico. A Mexican strain reported in a different study was highly related to our four strains, suggesting common source of infection. The phylogenetic analysis shows that the type of host is different for the different regions in the American Continent; rabies is more related to bats. It was concluded that the rabies virus in central Mexico is genetically stable and that it is transmitted by the vampire bat Desmodus rotundus. Copyright © 2017 Elsevier Ltd. All rights reserved.

  6. Locating a tree in a phylogenetic network

    OpenAIRE

    van Iersel, Leo; Semple, Charles; Steel, Mike

    2010-01-01

    Phylogenetic trees and networks are leaf-labelled graphs that are used to describe evolutionary histories of species. The Tree Containment problem asks whether a given phylogenetic tree is embedded in a given phylogenetic network. Given a phylogenetic network and a cluster of species, the Cluster Containment problem asks whether the given cluster is a cluster of some phylogenetic tree embedded in the network. Both problems are known to be NP-complete in general. In this article, we consider t...

  7. Phylogenetic distribution of fungal sterols.

    Directory of Open Access Journals (Sweden)

    John D Weete

    Full Text Available BACKGROUND: Ergosterol has been considered the "fungal sterol" for almost 125 years; however, additional sterol data superimposed on a recent molecular phylogeny of kingdom Fungi reveals a different and more complex situation. METHODOLOGY/PRINCIPAL FINDINGS: The interpretation of sterol distribution data in a modern phylogenetic context indicates that there is a clear trend from cholesterol and other Delta(5 sterols in the earliest diverging fungal species to ergosterol in later diverging fungi. There are, however, deviations from this pattern in certain clades. Sterols of the diverse zoosporic and zygosporic forms exhibit structural diversity with cholesterol and 24-ethyl -Delta(5 sterols in zoosporic taxa, and 24-methyl sterols in zygosporic fungi. For example, each of the three monophyletic lineages of zygosporic fungi has distinctive major sterols, ergosterol in Mucorales, 22-dihydroergosterol in Dimargaritales, Harpellales, and Kickxellales (DHK clade, and 24-methyl cholesterol in Entomophthorales. Other departures from ergosterol as the dominant sterol include: 24-ethyl cholesterol in Glomeromycota, 24-ethyl cholest-7-enol and 24-ethyl-cholesta-7,24(28-dienol in rust fungi, brassicasterol in Taphrinales and hypogeous pezizalean species, and cholesterol in Pneumocystis. CONCLUSIONS/SIGNIFICANCE: Five dominant end products of sterol biosynthesis (cholesterol, ergosterol, 24-methyl cholesterol, 24-ethyl cholesterol, brassicasterol, and intermediates in the formation of 24-ethyl cholesterol, are major sterols in 175 species of Fungi. Although most fungi in the most speciose clades have ergosterol as a major sterol, sterols are more varied than currently understood, and their distribution supports certain clades of Fungi in current fungal phylogenies. In addition to the intellectual importance of understanding evolution of sterol synthesis in fungi, there is practical importance because certain antifungal drugs (e.g., azoles target reactions in

  8. A remarkable new species of Liparis (Orchidaceae from China and its phylogenetic implications.

    Directory of Open Access Journals (Sweden)

    Lin Li

    Full Text Available In the present study, we formally describe Liparis pingxiangensis as a new species from Guangxi, China on the basis of morphological and molecular phylogenetic analyses. It is easily distinguished from closely related species by strongly curved column without column wings, and broadly rhombic-elliptic lip with 2 uncinate calli at the base. In particular, it differs most markedly from its congeners in possessing two pollinia attached by long and prominent caudicles (not stipes, to a distinct sticky disc. This type of pollinarium, as far as we know, is not found in any other species of Liparis, and is also unique among the orchids with waxy pollinia. We then proceeded to a phylogenetic analysis to ascertain the systematic position of this enigmatic species. Molecular study based on nuclear ribosomal ITS and plastid matK DNA sequence data supports L. pingxiangensis as a distinct species, which forms an independent lineage sister to L. nervosa and its allies (93% BS, 1.00 BPP. In the light of previous work, the findings have important implications for a better understanding of the well-supported pattern mainly based on vegetative features in Malaxideae.

  9. Compositional and mutational rate heterogeneity in mitochondrial genomes and its effect on the phylogenetic inferences of Cimicomorpha (Hemiptera: Heteroptera).

    Science.gov (United States)

    Yang, Huanhuan; Li, Teng; Dang, Kai; Bu, Wenjun

    2018-04-18

    Mitochondrial genome (mt-genome) data can potentially return artefactual relationships in the higher-level phylogenetic inference of insects due to the biases of accelerated substitution rates and compositional heterogeneity. Previous studies based on mt-genome data alone showed a paraphyly of Cimicomorpha (Insecta, Hemiptera) due to the positions of the families Tingidae and Reduviidae rather than the monophyly that was supported based on morphological characters, morphological and molecular combined data and large scale molecular datasets. Various strategies have been proposed to ameliorate the effects of potential mt-genome biases, including dense taxon sampling, removal of third codon positions or purine-pyrimidine coding and the use of site-heterogeneous models. In this study, we sequenced the mt-genomes of five additional Tingidae species and discussed the compositional and mutational rate heterogeneity in mt-genomes and its effect on the phylogenetic inferences of Cimicomorpha by implementing the bias-reduction strategies mentioned above. Heterogeneity in nucleotide composition and mutational biases were found in mt protein-coding genes, and the third codon exhibited high levels of saturation. Dense taxon sampling of Tingidae and Reduviidae and the other common strategies mentioned above were insufficient to recover the monophyly of the well-established group Cimicomorpha. When the sites with weak phylogenetic signals in the dataset were removed, the remaining dataset of mt-genomes can support the monophyly of Cimicomorpha; this support demonstrates that mt-genomes possess strong phylogenetic signals for the inference of higher-level phylogeny of this group. Comparison of the ratio of the removal of amino acids for each PCG showed that ATP8 has the highest ratio while CO1 has the lowest. This pattern is largely congruent with the evolutionary rate of 13 PCGs that ATP8 represents the highest evolutionary rate, whereas CO1 appears to be the lowest. Notably

  10. Interpreting the universal phylogenetic tree

    Science.gov (United States)

    Woese, C. R.

    2000-01-01

    The universal phylogenetic tree not only spans all extant life, but its root and earliest branchings represent stages in the evolutionary process before modern cell types had come into being. The evolution of the cell is an interplay between vertically derived and horizontally acquired variation. Primitive cellular entities were necessarily simpler and more modular in design than are modern cells. Consequently, horizontal gene transfer early on was pervasive, dominating the evolutionary dynamic. The root of the universal phylogenetic tree represents the first stage in cellular evolution when the evolving cell became sufficiently integrated and stable to the erosive effects of horizontal gene transfer that true organismal lineages could exist.

  11. 16O + 16O + valence neutrons in molecular orbitals structures of positive- and negative-parity superdeformed bands in 34S

    International Nuclear Information System (INIS)

    Taniguchi, Yasutaka

    2015-01-01

    The structures of superdeformed (SD) states in 34 S have been investigated using the antisymmetrized molecular dynamics and generator coordinate method (GCM). The GCM basis wave functions are calculated via energy variation with a constraint on the quadrupole deformation parameter β. By applying the GCM after parity and angular momentum projections, the coexistence of two positive- and one negative-parity SD bands are predicted, and low-lying states and other deformed bands are obtained. The SD bands have structures of 16 O + 16 O + two valence neutrons in molecular orbitals around the two 16 O cores in a cluster picture. The configurations of the two valence neutrons are δ 2 and π 2 for the positive-parity SD bands and π 1 δ 1 for the negative-parity SD band. (author)

  12. 16O + 16O + valence neutrons in molecular orbitals structures of positive- and negative-parity superdeformed bands in 34S

    International Nuclear Information System (INIS)

    Taniguchi, Yasutaka

    2014-01-01

    The structures of superdeformed (SD) states in 34 S are investigated using the antisymmetrized molecular dynamics and generator coordinate method (GCM). The GCM basis wave functions are calculated via energy variation with a constraint on the quadrupole deformation parameter β. By applying the GCM after parity and angular momentum projections, the coexistence of two positive- and one negative-parity SD bands are predicted, and low-lying states and other deformed bands are obtained. The SD bands have structures of 16 O + 16 O + two valence neutrons in molecular orbitals around the two 16 O cores in a cluster picture. The configurations of the two valence neutrons are δ 2 and π 2 for the positive-parity SD bands and π 1 δ 1 for the negative-parity SD band

  13. Cytotaxonomy of Eurypyga helias (Gruiformes, Eurypygidae): First Karyotypic Description and Phylogenetic Proximity with Rynochetidae

    Science.gov (United States)

    dos Santos, Michelly da Silva; Tagliarini, Marcella Mergulhão; O´Brien, Patricia C. M.; Ferguson-Smith, Malcolm A.; de Oliveira, Edivaldo H. C.

    2015-01-01

    The sunbittern (Eurypyga helias) is a South American Gruiformes, the only member of Family Eurypigidae. In most phylogenetic proposals, it is placed in a more distant position than other families of the so-called “core Gruiformes”. Different studies based on molecular, morphological and biogeographical data suggest that the Eurypigidae is closely related to the kagu (Rhynochetos jubatus), the only species in Rynochetidae, another family not included in the core Gruiformes. Here, the karyotype of the sunbittern is described for the first time, by classical and molecular cytogenetics, using whole chromosome probes derived from Gallus gallus and Leucopternis albicollis. We found a diploid number of 80, with only one pair of biarmed autosomal macrochromosomes, similar to that observed in the kagu. Chromosome painting revealed that most syntenies found in the avian putative ancestral karyotype (PAK) were conserved in the sunbittern. However, PAK1, PAK2, and PAK5 corresponded to two chromosome pairs each. Probes derived from L. albicollis confirm that fissions in PAK1 and PAK2 were centric, whereas in PAK5 the fission is interstitial. In addition, there is fusion of segments homologous to PAK2q and PAK5. From a phylogenetic point of view, comparisons of our results with two other Gruiformes belonging to family Rallidae suggest that the PAK5q fission might be a synapomorphy for Gruiformes. Fissions in PAK1 and PAK2 are found only in Eurypigidae, and might also occur in Rynochetidae, in view of the similar chromosomal morphology between the sunbittern and the kagu. This suggests a close phylogenetic relationship between Eurypigidae and Rynochetidae, whose common ancestor was separated by the Gondwana vicariancy in South America and New Caledonia, respectively. PMID:26624624

  14. BLAST-EXPLORER helps you building datasets for phylogenetic analysis

    Directory of Open Access Journals (Sweden)

    Claverie Jean-Michel

    2010-01-01

    Full Text Available Abstract Background The right sampling of homologous sequences for phylogenetic or molecular evolution analyses is a crucial step, the quality of which can have a significant impact on the final interpretation of the study. There is no single way for constructing datasets suitable for phylogenetic analysis, because this task intimately depends on the scientific question we want to address, Moreover, database mining softwares such as BLAST which are routinely used for searching homologous sequences are not specifically optimized for this task. Results To fill this gap, we designed BLAST-Explorer, an original and friendly web-based application that combines a BLAST search with a suite of tools that allows interactive, phylogenetic-oriented exploration of the BLAST results and flexible selection of homologous sequences among the BLAST hits. Once the selection of the BLAST hits is done using BLAST-Explorer, the corresponding sequence can be imported locally for external analysis or passed to the phylogenetic tree reconstruction pipelines available on the Phylogeny.fr platform. Conclusions BLAST-Explorer provides a simple, intuitive and interactive graphical representation of the BLAST results and allows selection and retrieving of the BLAST hit sequences based a wide range of criterions. Although BLAST-Explorer primarily aims at helping the construction of sequence datasets for further phylogenetic study, it can also be used as a standard BLAST server with enriched output. BLAST-Explorer is available at http://www.phylogeny.fr

  15. The power and pitfalls of HIV phylogenetics in public health.

    Science.gov (United States)

    Brooks, James I; Sandstrom, Paul A

    2013-07-25

    Phylogenetics is the application of comparative studies of genetic sequences in order to infer evolutionary relationships among organisms. This tool can be used as a form of molecular epidemiology to enhance traditional population-level communicable disease surveillance. Phylogenetic study has resulted in new paradigms being created in the field of communicable diseases and this commentary aims to provide the reader with an explanation of how phylogenetics can be used in tracking infectious diseases. Special emphasis will be placed upon the application of phylogenetics as a tool to help elucidate HIV transmission patterns and the limitations to these methods when applied to forensic analysis. Understanding infectious disease epidemiology in order to prevent new transmissions is the sine qua non of public health. However, with increasing epidemiological resolution, there may be an associated potential loss of privacy to the individual. It is within this context that we aim to promote the discussion on how to use phylogenetics to achieve important public health goals, while at the same time protecting the rights of the individual.

  16. A preliminary mitochondrial genome phylogeny of Orthoptera (Insecta) and approaches to maximizing phylogenetic signal found within mitochondrial genome data.

    Science.gov (United States)

    Fenn, J Daniel; Song, Hojun; Cameron, Stephen L; Whiting, Michael F

    2008-10-01

    The phylogenetic utility of mitochondrial genomes (mtgenomes) is examined using the framework of a preliminary phylogeny of Orthoptera. This study presents five newly sequenced genomes from four orthopteran families. While all ensiferan and polyneopteran taxa retain the ancestral gene order, all caeliferan lineages including the newly sequenced caeliferan species contain a tRNA rearrangement from the insect ground plan tRNA(Lys)(K)-tRNA(Asp)(D) swapping to tRNA(Asp) (D)-tRNA(Lys) (K) confirming that this rearrangement is a possible molecular synapomorphy for this suborder. The phylogenetic signal in mtgenomes is rigorously examined under the analytical regimens of parsimony, maximum likelihood and Bayesian inference, along with how gene inclusion/exclusion, data recoding, gap coding, and different partitioning schemes influence the phylogenetic reconstruction. When all available data are analyzed simultaneously, the monophyly of Orthoptera and its two suborders, Caelifera and Ensifera, are consistently recovered in the context of our taxon sampling, regardless of the optimality criteria. When protein-coding genes are analyzed as a single partition, nearly identical topology to the combined analyses is recovered, suggesting that much of the signals of the mtgenome come from the protein-coding genes. Transfer and ribosomal RNAs perform poorly when analyzed individually, but contribute signal when analyzed in combination with the protein-coding genes. Inclusion of third codon position of the protein-coding genes does not negatively affect the phylogenetic reconstruction when all genes are analyzed together, whereas recoding of the protein-coding genes into amino acid sequences introduces artificial resolution. Over-partitioning in a Bayesian framework appears to have a negative effect in achieving convergence. Our findings suggest that the best phylogenetic inferences are made when all available nucleotide data from the mtgenome are analyzed simultaneously, and that

  17. Collyricloides massanae (Digenea, Collyriclidae: spermatozoon ultrastructure and phylogenetic importance

    Directory of Open Access Journals (Sweden)

    Bakhoum Abdoulaye Jacque

    2014-01-01

    Full Text Available The spermatological characteristics of Collyricloides massanae (Digenea: Collyriclidae, a parasite of Apodemus sylvaticus caught in France, were studied by means of transmission electron microscopy. The mature sperm of C. massanae presents two axonemes of different lengths with the 9 + “1” pattern of the Trepaxonemata, two bundles of parallel cortical microtubules, external ornamentation of the plasma membrane, spine-like bodies, one mitochondrion, a nucleus and granules of glycogen. An analysis of spermatological organisation emphasised some differences between the mature spermatozoon of C. massanae and those reported in the Gorgoderoidea species studied to date, specially belonging to the families Dicrocoeliidae, Paragonimidae and Troglotrematidae. The ultrastructural criteria described in C. massanae such as the morphology of both anterior and posterior spermatozoon extremities, the association “external ornamentation + cortical microtubules”, the type 2 of external ornamentation and the spine-like bodies would allow us to bring closer the Collyriclidae to Microphalloidea. However, further ultrastructural and molecular studies are needed particularly in the unexplored taxa in order to fully resolve the phylogenetic position of the Collyriclidae.

  18. Phylogenetic Analysis of Canine Parvovirus VP2 Gene in China.

    Science.gov (United States)

    Yi, L; Tong, M; Cheng, Y; Song, W; Cheng, S

    2016-04-01

    In this study, a total of 37 samples (58.0%) were found through PCR assay to be positive for canine parvovirus (CPV) of 66 suspected faecal samples of dogs collected from various cities throughout China. Eight CPV isolates could be obtained in the CRFK cell line. The sequencing of the VP2 gene of CPV identified the predominant CPV strain as CPV-2a (Ser297Ala), with two CPV-2b (Ser297Ala). Sequence comparison revealed homologies of 99.3-99.9%, 99.9% and 99.3-99.7% within the CPV 2a isolates, within the CPV 2b isolates and between the CPV 2a and 2b isolates, respectively. In addition, several non-synonymous and synonymous mutations were also recorded. The phylogenetic tree revealed that most of the CPV strains from different areas in China were located in the formation of a large branch, which were grouped together along with the KU143-09 strain from Thailand and followed the same evolution. In this study, we provide an updated molecular characterization of CPV 2 circulation in China. © 2014 Blackwell Verlag GmbH.

  19. On the origin of the treponematoses: a phylogenetic approach.

    Directory of Open Access Journals (Sweden)

    Kristin N Harper

    2008-01-01

    Full Text Available Since the first recorded epidemic of syphilis in 1495, controversy has surrounded the origins of the bacterium Treponema pallidum subsp. pallidum and its relationship to the pathogens responsible for the other treponemal diseases: yaws, endemic syphilis, and pinta. Some researchers have argued that the syphilis-causing bacterium, or its progenitor, was brought from the New World to Europe by Christopher Columbus and his men, while others maintain that the treponematoses, including syphilis, have a much longer history on the European continent.We applied phylogenetics to this problem, using data from 21 genetic regions examined in 26 geographically disparate strains of pathogenic Treponema. Of all the strains examined, the venereal syphilis-causing strains originated most recently and were more closely related to yaws-causing strains from South America than to other non-venereal strains. Old World yaws-causing strains occupied a basal position on the tree, indicating that they arose first in human history, and a simian strain of T. pallidum was found to be indistinguishable from them.Our results lend support to the Columbian theory of syphilis's origin while suggesting that the non-sexually transmitted subspecies arose earlier in the Old World. This study represents the first attempt to address the problem of the origin of syphilis using molecular genetics, as well as the first source of information regarding the genetic make-up of non-venereal strains from the Western hemisphere.

  20. Phylogenetic relationships among Maloideae species

    Science.gov (United States)

    The Maloideae is a highly diverse sub-family of the Rosaceae containing several agronomically important species (Malus sp. and Pyrus sp.) and their wild relatives. Previous phylogenetic work within the group has revealed extensive intergeneric hybridization and polyploidization. In order to develop...

  1. Phylogenetic systematics of the genus Echinococcus (Cestoda: Taeniidae).

    Science.gov (United States)

    Nakao, Minoru; Lavikainen, Antti; Yanagida, Tetsuya; Ito, Akira

    2013-11-01

    Echinococcosis is a serious helminthic zoonosis in humans, livestock and wildlife. The pathogenic organisms are members of the genus Echinococcus (Cestoda: Taeniidae). Life cycles of Echinococcus spp. are consistently dependent on predator-prey association between two obligate mammalian hosts. Carnivores (canids and felids) serve as definitive hosts for adult tapeworms and their herbivore prey (ungulates, rodents and lagomorphs) as intermediate hosts for metacestode larvae. Humans are involved as an accidental host for metacestode infections. The metacestodes develop in various internal organs, particularly in liver and lungs. Each metacestode of Echinococcus spp. has an organotropism and a characteristic form known as an unilocular (cystic), alveolar or polycystic hydatid. Recent molecular phylogenetic studies have demonstrated that the type species, Echinococcus granulosus, causing cystic echinococcosis is a cryptic species complex. Therefore, the orthodox taxonomy of Echinococcus established from morphological criteria has been revised from the standpoint of phylogenetic systematics. Nine valid species including newly resurrected taxa are recognised as a result of the revision. This review summarises the recent advances in the phylogenetic systematics of Echinococcus, together with the historical backgrounds and molecular epidemiological aspects of each species. A new phylogenetic tree inferred from the mitochondrial genomes of all valid Echinococcus spp. is also presented. The taxonomic nomenclature for Echinococcus oligarthrus is shown to be incorrect and this name should be replaced with Echinococcus oligarthra. Copyright © 2013 Australian Society for Parasitology Inc. Published by Elsevier Ltd. All rights reserved.

  2. Phylogenetic placement of two species known only from resting spores

    DEFF Research Database (Denmark)

    Hajek, Ann E; Gryganskyi, Andrii; Bittner, Tonya

    2016-01-01

    resting spores, Zoophthora independentia, infecting Tipula (Lunatipula) submaculata in New York State, is now described as a new species and Tarichium porteri, described in 1942, which infects Tipula (Triplicitipula) colei in Tennessee, is transferred to the genus Zoophthora. We have shown that use......Molecular methods were used to determine the generic placement of two species of Entomophthorales known only from resting spores. Historically, these species would belong in the form-genus Tarichium, but this classification provides no information about phylogenetic relationships. Using DNA from...... of molecular methods can assist with determination of the phylogenetic relations of specimens within the form-genus Tarichium for an already described species and a new species for which only resting spores are available....

  3. The transposition distance for phylogenetic trees

    OpenAIRE

    Rossello, Francesc; Valiente, Gabriel

    2006-01-01

    The search for similarity and dissimilarity measures on phylogenetic trees has been motivated by the computation of consensus trees, the search by similarity in phylogenetic databases, and the assessment of clustering results in bioinformatics. The transposition distance for fully resolved phylogenetic trees is a recent addition to the extensive collection of available metrics for comparing phylogenetic trees. In this paper, we generalize the transposition distance from fully resolved to arbi...

  4. TreeCluster: Massively scalable transmission clustering using phylogenetic trees

    OpenAIRE

    Moshiri, Alexander

    2018-01-01

    Background: The ability to infer transmission clusters from molecular data is critical to designing and evaluating viral control strategies. Viral sequencing datasets are growing rapidly, but standard methods of transmission cluster inference do not scale well beyond thousands of sequences. Results: I present TreeCluster, a cross-platform tool that performs transmission cluster inference on a given phylogenetic tree orders of magnitude faster than existing inference methods and supports multi...

  5. Epitope discovery with phylogenetic hidden Markov models.

    LENUS (Irish Health Repository)

    Lacerda, Miguel

    2010-05-01

    Existing methods for the prediction of immunologically active T-cell epitopes are based on the amino acid sequence or structure of pathogen proteins. Additional information regarding the locations of epitopes may be acquired by considering the evolution of viruses in hosts with different immune backgrounds. In particular, immune-dependent evolutionary patterns at sites within or near T-cell epitopes can be used to enhance epitope identification. We have developed a mutation-selection model of T-cell epitope evolution that allows the human leukocyte antigen (HLA) genotype of the host to influence the evolutionary process. This is one of the first examples of the incorporation of environmental parameters into a phylogenetic model and has many other potential applications where the selection pressures exerted on an organism can be related directly to environmental factors. We combine this novel evolutionary model with a hidden Markov model to identify contiguous amino acid positions that appear to evolve under immune pressure in the presence of specific host immune alleles and that therefore represent potential epitopes. This phylogenetic hidden Markov model provides a rigorous probabilistic framework that can be combined with sequence or structural information to improve epitope prediction. As a demonstration, we apply the model to a data set of HIV-1 protein-coding sequences and host HLA genotypes.

  6. Phylogenetically-informed priorities for amphibian conservation.

    Science.gov (United States)

    Isaac, Nick J B; Redding, David W; Meredith, Helen M; Safi, Kamran

    2012-01-01

    The amphibian decline and extinction crisis demands urgent action to prevent further large numbers of species extinctions. Lists of priority species for conservation, based on a combination of species' threat status and unique contribution to phylogenetic diversity, are one tool for the direction and catalyzation of conservation action. We describe the construction of a near-complete species-level phylogeny of 5713 amphibian species, which we use to create a list of evolutionarily distinct and globally endangered species (EDGE list) for the entire class Amphibia. We present sensitivity analyses to test the robustness of our priority list to uncertainty in species' phylogenetic position and threat status. We find that both sources of uncertainty have only minor impacts on our 'top 100' list of priority species, indicating the robustness of the approach. By contrast, our analyses suggest that a large number of Data Deficient species are likely to be high priorities for conservation action from the perspective of their contribution to the evolutionary history.

  7. Phylogenetically-informed priorities for amphibian conservation.

    Directory of Open Access Journals (Sweden)

    Nick J B Isaac

    Full Text Available The amphibian decline and extinction crisis demands urgent action to prevent further large numbers of species extinctions. Lists of priority species for conservation, based on a combination of species' threat status and unique contribution to phylogenetic diversity, are one tool for the direction and catalyzation of conservation action. We describe the construction of a near-complete species-level phylogeny of 5713 amphibian species, which we use to create a list of evolutionarily distinct and globally endangered species (EDGE list for the entire class Amphibia. We present sensitivity analyses to test the robustness of our priority list to uncertainty in species' phylogenetic position and threat status. We find that both sources of uncertainty have only minor impacts on our 'top 100' list of priority species, indicating the robustness of the approach. By contrast, our analyses suggest that a large number of Data Deficient species are likely to be high priorities for conservation action from the perspective of their contribution to the evolutionary history.

  8. Phylogenetic footprints in organizational behavior

    OpenAIRE

    Witt, Ulrich; Schwesinger, Georg

    2012-01-01

    An evolutionary tool kit is applied in this paper to explain how innate social behavior traits evolved in early human groups. These traits were adapted to the particular production requirements of the group in human phylogeny. They shaped the group members' attitudes towards contributing to the group's goals and towards other group members. We argue that these attitudes are still present in modern humans and leave their phylogenetic footprints also in present-day organizational life. We discu...

  9. The infra-red spectrum of the molecular dication (doubly positively charged molecule) D35Cl2+

    International Nuclear Information System (INIS)

    Abusen, R.A.

    1999-07-01

    The ion-beam/laser-beam spectrometer used in this work was designed, built and commissioned for the experimental investigation of doubly charged molecular species [Shiell 1995]. Using this spectrometer the photodissociation spectrum of the X 3 Σ - state of the molecular dication D 35 Cl 2+ was measured in the infrared. It has not yet been possible to assign and fit the observed transitions in the usual way, but comparisons of our spectra with ab-initio generated spectra show good agreement and form the basis for our preliminary assignments. Our preliminary analysis shows a good agreement between the measured spectra and an ab-initio theoretical spectra of the ν = 2-1 band, including the rotational constants and tunneling lifetimes, calculated from the potential energy of Bennett and McNab [1995]. The theoretical spectrum was brought into agreement with the measured spectra by moving its band origin by -21.1 cm -1 . The theoretical rotational constants that give good agreement with the spectrum are (in cm -1 ) B'' = 3.898, D'' = 3.561, H'' = 1.04 x 10 -9 , B' = 3.648, D' = 3.163 x 10 -4 , H' = -9.269 x 10 -8 . The shifted origin of the ν = 2-1 band is 994.3 cm -1 . A Fortran computer program was written to simulate 3Σ-3Σ vibration-rotation spectra. The theoretical spectrum obtained with this computer program has been compared with our measured spectrum. Our experimentally measured line widths and wavenumbers have been compared with the ab-initio theoretical spectrum and a good agreement obtained. This is good evidence that we are observing the ν=2-1 band of D 35 CI 2+ in the ground electronic state (X 3 Σ - state). Good agreement between measured and predicted hyperfine patterns was found using a Fermi contact constant (for the chlorine nucleus) of 190 MHz. (author)

  10. Phylogeny and systematic position of Opiliones: a combined analysis of chelicerate relationships using morphological and molecular data

    Science.gov (United States)

    Giribet, Gonzalo; Edgecombe, Gregory D.; Wheeler, Ward C.; Babbitt, Courtney

    2002-01-01

    The ordinal level phylogeny of the Arachnida and the suprafamilial level phylogeny of the Opiliones were studied on the basis of a combined analysis of 253 morphological characters, the complete sequence of the 18S rRNA gene, and the D3 region of the 28S rRNA gene. Molecular data were collected for 63 terminal taxa. Morphological data were collected for 35 exemplar taxa of Opiliones, but groundplans were applied to some of the remaining chelicerate groups. Six extinct terminals, including Paleozoic scorpions, are scored for morphological characters. The data were analyzed using strict parsimony for the morphological data matrix and via direct optimization for the molecular and combined data matrices. A sensitivity analysis of 15 parameter sets was undertaken, and character congruence was used as the optimality criterion to choose among competing hypotheses. The results obtained are unstable for the high-level chelicerate relationships (except for Tetrapulmonata, Pedipalpi, and Camarostomata), and the sister group of the Opiliones is not clearly established, although the monophyly of Dromopoda is supported under many parameter sets. However, the internal phylogeny of the Opiliones is robust to parameter choice and allows the discarding of previous hypotheses of opilionid phylogeny such as the "Cyphopalpatores" or "Palpatores." The topology obtained is congruent with the previous hypothesis of "Palpatores" paraphyly as follows: (Cyphophthalmi (Eupnoi (Dyspnoi + Laniatores))). Resolution within the Eupnoi, Dyspnoi, and Laniatores (the latter two united as Dyspnolaniatores nov.) is also stable to the superfamily level, permitting a new classification system for the Opiliones. c2002 The Willi Hennig Society.

  11. Maximum Parsimony on Phylogenetic networks

    Science.gov (United States)

    2012-01-01

    Background Phylogenetic networks are generalizations of phylogenetic trees, that are used to model evolutionary events in various contexts. Several different methods and criteria have been introduced for reconstructing phylogenetic trees. Maximum Parsimony is a character-based approach that infers a phylogenetic tree by minimizing the total number of evolutionary steps required to explain a given set of data assigned on the leaves. Exact solutions for optimizing parsimony scores on phylogenetic trees have been introduced in the past. Results In this paper, we define the parsimony score on networks as the sum of the substitution costs along all the edges of the network; and show that certain well-known algorithms that calculate the optimum parsimony score on trees, such as Sankoff and Fitch algorithms extend naturally for networks, barring conflicting assignments at the reticulate vertices. We provide heuristics for finding the optimum parsimony scores on networks. Our algorithms can be applied for any cost matrix that may contain unequal substitution costs of transforming between different characters along different edges of the network. We analyzed this for experimental data on 10 leaves or fewer with at most 2 reticulations and found that for almost all networks, the bounds returned by the heuristics matched with the exhaustively determined optimum parsimony scores. Conclusion The parsimony score we define here does not directly reflect the cost of the best tree in the network that displays the evolution of the character. However, when searching for the most parsimonious network that describes a collection of characters, it becomes necessary to add additional cost considerations to prefer simpler structures, such as trees over networks. The parsimony score on a network that we describe here takes into account the substitution costs along the additional edges incident on each reticulate vertex, in addition to the substitution costs along the other edges which are

  12. Country-wide surveillance of molecular markers of antimalarial drug resistance in Senegal by use of positive Malaria Rapid Diagnostic Tests

    DEFF Research Database (Denmark)

    Ndiaye, Magatte; Sow, Doudou; Nag, Sidsel

    2017-01-01

    of drug resistance. Therefore, surveillance of drug resistance in the malaria parasites is essential. The objective of this pilot study was to test the feasibility of routinely sampled malaria rapid diagnostic tests (RDTs) at a national scale to assess the temporal changes in the molecular profiles...... of antimalarial drug resistance markers of Plasmodium falciparum parasites. Overall, 9,549 positive malaria RDTs were collected from 14 health facilities across the country. A limited random set of RDTs were analyzed regarding Pfcrt gene polymorphisms at codon 72-76. Overall, a high but varied prevalence (> 50...

  13. The Phylogenetic Significance of Fruit Structural Variation in the Tribe Heteromorpheae (Apiaceae)

    International Nuclear Information System (INIS)

    Liu, M.; Lowry, P. P.; Magee, A. R.

    2016-01-01

    Fruit structure of Apiaceae was studied in 19 species representing the 10 genera of the tribe Heteromorpheae. Our results indicate this group has a woody habit, simple leaves, heteromorphic mericarps with lateral wings. fruits with bottle-shaped or bulging epidermal cells which have thickened and cutinized outer wall, regular vittae (one in furrow and two in commissure) and irregular vittae (short, dwarf, or branching and anatosmosing), and dispersed druse crystals. However, lateral winged mericarps, bottle-shaped epidermal cells, and branching and anatosmosing vittae are peculiar in the tribe Heteromorpheae of Apioideae sub family. Although many features share with other early-diverging groups of Apiaceae, including Annesorhiza clade, Saniculoideae sensu lato, Azorelloideae, Mackinlayoideae, as well as with Araliaceae. Our study shows that fruit anatomy can be used to define the tribe by molecular phylogenetic studies and support that Heteromorpheae are close to Annesorhiza clade and both are placed in the basal position of Apioideae. (author)

  14. Phylogenetic reconstruction prompts taxonomic changes in Sauropus, Synostemon and Breynia (Phyllanthaceae tribe Phyllantheae)

    NARCIS (Netherlands)

    Welzen, van P.C.; Pruesapan, K.; Telford, I.R.H.; Esser, H.-J.; Bruhl, J.J.

    2014-01-01

    Previous molecular phylogenetic studies indicated expansion of Breynia with inclusion of Sauropus s.str. (excluding Synostemon). The present study adds qualitative and quantitative morphological characters to molecular data to find more resolution and/or higher support for the subgroups within

  15. Molecular essence and endocrine responsiveness of estrogen receptor-negative, progesterone receptor-positive, and HER2-negative breast cancer.

    Science.gov (United States)

    Yu, Ke-Da; Jiang, Yi-Zhou; Hao, Shuang; Shao, Zhi-Ming

    2015-10-05

    The clinical significance of progesterone receptor (PgR) expression in estrogen receptor-negative (ER-) breast cancer is controversial. Herein, we systemically investigate the clinicopathologic features, molecular essence, and endocrine responsiveness of ER-/PgR+/HER2- phenotype. Four study cohorts were included. The first and second cohorts were from the Surveillance, Epidemiology, and End Results database (n = 67,932) and Fudan University Shanghai Cancer Center (n = 2,338), respectively, for clinicopathologic and survival analysis. The third and fourth cohorts were from two independent publicly available microarray datasets including 837 operable cases and 483 cases undergoing neoadjuvant chemotherapy, respectively, for clinicopathologic and gene-expression analysis. Characterized genes defining subgroups within the ER-/PgR+/HER2- phenotype were determined and further validated. Clinicopathologic features and survival outcomes of the ER-/PgR+ phenotype fell in between the ER+/PgR+ and ER-/PgR- phenotypes, but were more similar to ER-/PgR-. Among the ER-/PgR+ phenotype, 30% (95% confidence interval [CI] 17-42%, pooled by a fixed-effects method) were luminal-like and 59% (95% CI 45-72%, pooled by a fixed-effects method) were basal-like. We further refined the characterized genes for subtypes within the ER-/PgR+ phenotype and developed an immunohistochemistry-based method that could determine the molecular essence of ER-/PgR+ using three markers, TFF1, CK5, and EGFR. Either PAM50-defined or immunohistochemistry-defined basal-like ER-/PgR+ cases have a lower endocrine therapy sensitivity score compared with luminal-like ER-/PgR+ cases (P defined basal-like ER-/PgR+ cases might not benefit from adjuvant endocrine therapy (log-rank P = 0.61 for sufficient versus insufficient endocrine therapy). The majority of ER-/PgR+/HER2- phenotype breast cancers are basal-like and associated with a lower endocrine therapy sensitivity score. Additional studies are needed

  16. Dynamically heterogenous partitions and phylogenetic inference: an evaluation of analytical strategies with cytochrome b and ND6 gene sequences in cranes.

    Science.gov (United States)

    Krajewski, C; Fain, M G; Buckley, L; King, D G

    1999-11-01

    ki ctes over whether molecular sequence data should be partitioned for phylogenetic analysis often confound two types of heterogeneity among partitions. We distinguish historical heterogeneity (i.e., different partitions have different evolutionary relationships) from dynamic heterogeneity (i.e., different partitions show different patterns of sequence evolution) and explore the impact of the latter on phylogenetic accuracy and precision with a two-gene, mitochondrial data set for cranes. The well-established phylogeny of cranes allows us to contrast tree-based estimates of relevant parameter values with estimates based on pairwise comparisons and to ascertain the effects of incorporating different amounts of process information into phylogenetic estimates. We show that codon positions in the cytochrome b and NADH dehydrogenase subunit 6 genes are dynamically heterogenous under both Poisson and invariable-sites + gamma-rates versions of the F84 model and that heterogeneity includes variation in base composition and transition bias as well as substitution rate. Estimates of transition-bias and relative-rate parameters from pairwise sequence comparisons were comparable to those obtained as tree-based maximum likelihood estimates. Neither rate-category nor mixed-model partitioning strategies resulted in a loss of phylogenetic precision relative to unpartitioned analyses. We suggest that weighted-average distances provide a computationally feasible alternative to direct maximum likelihood estimates of phylogeny for mixed-model analyses of large, dynamically heterogenous data sets. Copyright 1999 Academic Press.

  17. Transforming phylogenetic networks: Moving beyond tree space.

    Science.gov (United States)

    Huber, Katharina T; Moulton, Vincent; Wu, Taoyang

    2016-09-07

    Phylogenetic networks are a generalization of phylogenetic trees that are used to represent reticulate evolution. Unrooted phylogenetic networks form a special class of such networks, which naturally generalize unrooted phylogenetic trees. In this paper we define two operations on unrooted phylogenetic networks, one of which is a generalization of the well-known nearest-neighbor interchange (NNI) operation on phylogenetic trees. We show that any unrooted phylogenetic network can be transformed into any other such network using only these operations. This generalizes the well-known fact that any phylogenetic tree can be transformed into any other such tree using only NNI operations. It also allows us to define a generalization of tree space and to define some new metrics on unrooted phylogenetic networks. To prove our main results, we employ some fascinating new connections between phylogenetic networks and cubic graphs that we have recently discovered. Our results should be useful in developing new strategies to search for optimal phylogenetic networks, a topic that has recently generated some interest in the literature, as well as for providing new ways to compare networks. Copyright © 2016 Elsevier Ltd. All rights reserved.

  18. A nuclear phylogenetic analysis: SNPs, indels and SSRs deliver new insights into the relationships in the 'true citrus fruit trees' group (Citrinae, Rutaceae) and the origin of cultivated species.

    Science.gov (United States)

    Garcia-Lor, Andres; Curk, Franck; Snoussi-Trifa, Hager; Morillon, Raphael; Ancillo, Gema; Luro, François; Navarro, Luis; Ollitrault, Patrick

    2013-01-01

    Despite differences in morphology, the genera representing 'true citrus fruit trees' are sexually compatible, and their phylogenetic relationships remain unclear. Most of the important commercial 'species' of Citrus are believed to be of interspecific origin. By studying polymorphisms of 27 nuclear genes, the average molecular differentiation between species was estimated and some phylogenetic relationships between 'true citrus fruit trees' were clarified. Sanger sequencing of PCR-amplified fragments from 18 genes involved in metabolite biosynthesis pathways and nine putative genes for salt tolerance was performed for 45 genotypes of Citrus and relatives of Citrus to mine single nucleotide polymorphisms (SNPs) and indel polymorphisms. Fifty nuclear simple sequence repeats (SSRs) were also analysed. A total of 16 238 kb of DNA was sequenced for each genotype, and 1097 single nucleotide polymorphisms (SNPs) and 50 indels were identified. These polymorphisms were more valuable than SSRs for inter-taxon differentiation. Nuclear phylogenetic analysis revealed that Citrus reticulata and Fortunella form a cluster that is differentiated from the clade that includes three other basic taxa of cultivated citrus (C. maxima, C. medica and C. micrantha). These results confirm the taxonomic subdivision between the subgenera Metacitrus and Archicitrus. A few genes displayed positive selection patterns within or between species, but most of them displayed neutral patterns. The phylogenetic inheritance patterns of the analysed genes were inferred for commercial Citrus spp. Numerous molecular polymorphisms (SNPs and indels), which are potentially useful for the analysis of interspecific genetic structures, have been identified. The nuclear phylogenetic network for Citrus and its sexually compatible relatives was consistent with the geographical origins of these genera. The positive selection observed for a few genes will help further works to analyse the molecular basis of the

  19. A nuclear phylogenetic analysis: SNPs, indels and SSRs deliver new insights into the relationships in the ‘true citrus fruit trees’ group (Citrinae, Rutaceae) and the origin of cultivated species

    Science.gov (United States)

    Garcia-Lor, Andres; Curk, Franck; Snoussi-Trifa, Hager; Morillon, Raphael; Ancillo, Gema; Luro, François; Navarro, Luis; Ollitrault, Patrick

    2013-01-01

    Background and Aims Despite differences in morphology, the genera representing ‘true citrus fruit trees’ are sexually compatible, and their phylogenetic relationships remain unclear. Most of the important commercial ‘species’ of Citrus are believed to be of interspecific origin. By studying polymorphisms of 27 nuclear genes, the average molecular differentiation between species was estimated and some phylogenetic relationships between ‘true citrus fruit trees’ were clarified. Methods Sanger sequencing of PCR-amplified fragments from 18 genes involved in metabolite biosynthesis pathways and nine putative genes for salt tolerance was performed for 45 genotypes of Citrus and relatives of Citrus to mine single nucleotide polymorphisms (SNPs) and indel polymorphisms. Fifty nuclear simple sequence repeats (SSRs) were also analysed. Key Results A total of 16 238 kb of DNA was sequenced for each genotype, and 1097 single nucleotide polymorphisms (SNPs) and 50 indels were identified. These polymorphisms were more valuable than SSRs for inter-taxon differentiation. Nuclear phylogenetic analysis revealed that Citrus reticulata and Fortunella form a cluster that is differentiated from the clade that includes three other basic taxa of cultivated citrus (C. maxima, C. medica and C. micrantha). These results confirm the taxonomic subdivision between the subgenera Metacitrus and Archicitrus. A few genes displayed positive selection patterns within or between species, but most of them displayed neutral patterns. The phylogenetic inheritance patterns of the analysed genes were inferred for commercial Citrus spp. Conclusions Numerous molecular polymorphisms (SNPs and indels), which are potentially useful for the analysis of interspecific genetic structures, have been identified. The nuclear phylogenetic network for Citrus and its sexually compatible relatives was consistent with the geographical origins of these genera. The positive selection observed for a few genes will

  20. Nonbinary Tree-Based Phylogenetic Networks.

    Science.gov (United States)

    Jetten, Laura; van Iersel, Leo

    2018-01-01

    Rooted phylogenetic networks are used to describe evolutionary histories that contain non-treelike evolutionary events such as hybridization and horizontal gene transfer. In some cases, such histories can be described by a phylogenetic base-tree with additional linking arcs, which can, for example, represent gene transfer events. Such phylogenetic networks are called tree-based. Here, we consider two possible generalizations of this concept to nonbinary networks, which we call tree-based and strictly-tree-based nonbinary phylogenetic networks. We give simple graph-theoretic characterizations of tree-based and strictly-tree-based nonbinary phylogenetic networks. Moreover, we show for each of these two classes that it can be decided in polynomial time whether a given network is contained in the class. Our approach also provides a new view on tree-based binary phylogenetic networks. Finally, we discuss two examples of nonbinary phylogenetic networks in biology and show how our results can be applied to them.

  1. Functional and phylogenetic ecology in R

    CERN Document Server

    Swenson, Nathan G

    2014-01-01

    Functional and Phylogenetic Ecology in R is designed to teach readers to use R for phylogenetic and functional trait analyses. Over the past decade, a dizzying array of tools and methods were generated to incorporate phylogenetic and functional information into traditional ecological analyses. Increasingly these tools are implemented in R, thus greatly expanding their impact. Researchers getting started in R can use this volume as a step-by-step entryway into phylogenetic and functional analyses for ecology in R. More advanced users will be able to use this volume as a quick reference to understand particular analyses. The volume begins with an introduction to the R environment and handling relevant data in R. Chapters then cover phylogenetic and functional metrics of biodiversity; null modeling and randomizations for phylogenetic and functional trait analyses; integrating phylogenetic and functional trait information; and interfacing the R environment with a popular C-based program. This book presents a uni...

  2. Genetic and molecular functional characterization of variants within TNFSF13B, a positional candidate preeclampsia susceptibility gene on 13q.

    Directory of Open Access Journals (Sweden)

    Mona H Fenstad

    Full Text Available BACKGROUND: Preeclampsia is a serious pregnancy complication, demonstrating a complex pattern of inheritance. The elucidation of genetic liability to preeclampsia remains a major challenge in obstetric medicine. We have adopted a positional cloning approach to identify maternal genetic components, with linkages previously demonstrated to chromosomes 2q, 5q and 13q in an Australian/New Zealand familial cohort. The current study aimed to identify potential functional and structural variants in the positional candidate gene TNFSF13B under the 13q linkage peak and assess their association status with maternal preeclampsia genetic susceptibility. METHODOLOGY/PRINCIPAL FINDINGS: The proximal promoter and coding regions of the positional candidate gene TNFSF13B residing within the 13q linkage region was sequenced using 48 proband or founder individuals from Australian/New Zealand families. Ten sequence variants (nine SNPs and one single base insertion were identified and seven SNPs were successfully genotyped in the total Australian/New Zealand family cohort (74 families/480 individuals. Borderline association to preeclampsia (p = 0.0153 was observed for three rare SNPs (rs16972194, rs16972197 and rs56124946 in strong linkage disequilibrium with each other. Functional evaluation by electrophoretic mobility shift assays showed differential nuclear factor binding to the minor allele of the rs16972194 SNP, residing upstream of the translation start site, making this a putative functional variant. The observed genetic associations were not replicated in a Norwegian case/control cohort (The Nord-Trøndelag Health Study (HUNT2, 851 preeclamptic and 1,440 non-preeclamptic women. CONCLUSION/SIGNIFICANCE: TNFSF13B has previously been suggested to contribute to the normal immunological adaption crucial for a successful pregnancy. Our observations support TNFSF13B as a potential novel preeclampsia susceptibility gene. We discuss a possible role for TNFSF13B in

  3. Cophenetic metrics for phylogenetic trees, after Sokal and Rohlf.

    Science.gov (United States)

    Cardona, Gabriel; Mir, Arnau; Rosselló, Francesc; Rotger, Lucía; Sánchez, David

    2013-01-16

    Phylogenetic tree comparison metrics are an important tool in the study of evolution, and hence the definition of such metrics is an interesting problem in phylogenetics. In a paper in Taxon fifty years ago, Sokal and Rohlf proposed to measure quantitatively the difference between a pair of phylogenetic trees by first encoding them by means of their half-matrices of cophenetic values, and then comparing these matrices. This idea has been used several times since then to define dissimilarity measures between phylogenetic trees but, to our knowledge, no proper metric on weighted phylogenetic trees with nested taxa based on this idea has been formally defined and studied yet. Actually, the cophenetic values of pairs of different taxa alone are not enough to single out phylogenetic trees with weighted arcs or nested taxa. For every (rooted) phylogenetic tree T, let its cophenetic vectorφ(T) consist of all pairs of cophenetic values between pairs of taxa in T and all depths of taxa in T. It turns out that these cophenetic vectors single out weighted phylogenetic trees with nested taxa. We then define a family of cophenetic metrics dφ,p by comparing these cophenetic vectors by means of Lp norms, and we study, either analytically or numerically, some of their basic properties: neighbors, diameter, distribution, and their rank correlation with each other and with other metrics. The cophenetic metrics can be safely used on weighted phylogenetic trees with nested taxa and no restriction on degrees, and they can be computed in O(n2) time, where n stands for the number of taxa. The metrics dφ,1 and dφ,2 have positive skewed distributions, and they show a low rank correlation with the Robinson-Foulds metric and the nodal metrics, and a very high correlation with each other and with the splitted nodal metrics. The diameter of dφ,p, for p⩾1 , is in O(n(p+2)/p), and thus for low p they are more discriminative, having a wider range of values.

  4. Phylogenetic position and emended description of the genus Methylovorus.

    Science.gov (United States)

    Doronina, Nina V; Ivanova, Ekaterina G; Trotsenko, Yuri A

    2005-03-01

    The genus Methylovorus, currently represented by the restricted facultative methylotroph Methylovorus glucosotrophus Govorukhina and Trotsenko 1991 and the obligate methylotroph Methylovorus mays Doronina et al. 2001, is here established by direct sequencing of amplified 16S rRNA genes and DNA-DNA hybridization to be clearly separated from the extant ribulose monophosphate (RuMP) pathway methylobacteria and to form a distinct branch within the beta-Proteobacteria.

  5. Phylogenetic position of avian nocturnal and diurnal raptors.

    Science.gov (United States)

    Mahmood, Muhammad Tariq; McLenachan, Patricia A; Gibb, Gillian C; Penny, David

    2014-02-01

    We report three new avian mitochondrial genomes, two from widely separated groups of owls and a falcon relative (the Secretarybird). We then report additional progress in resolving Neoavian relationships in that the two groups of owls do come together (it is not just long-branch attraction), and the Secretarybird is the deepest divergence on the Accipitridae lineage. This is now agreed between mitochondrial and nuclear sequences. There is no evidence for the monophyly of the combined three groups of raptors (owls, eagles, and falcons), and again this is agreed by nuclear and mitochondrial sequences. All three groups (owls, accipitrids [eagles], and falcons) do appear to be members of the "higher land birds," and though there may not yet be full "consilience" between mitochondrial and nuclear sequences for the precise order of divergences of the eagles, falcons, and the owls, there is good progress on their relationships.

  6. PhyloSift: phylogenetic analysis of genomes and metagenomes.

    Science.gov (United States)

    Darling, Aaron E; Jospin, Guillaume; Lowe, Eric; Matsen, Frederick A; Bik, Holly M; Eisen, Jonathan A

    2014-01-01

    Like all organisms on the planet, environmental microbes are subject to the forces of molecular evolution. Metagenomic sequencing provides a means to access the DNA sequence of uncultured microbes. By combining DNA sequencing of microbial communities with evolutionary modeling and phylogenetic analysis we might obtain new insights into microbiology and also provide a basis for practical tools such as forensic pathogen detection. In this work we present an approach to leverage phylogenetic analysis of metagenomic sequence data to conduct several types of analysis. First, we present a method to conduct phylogeny-driven Bayesian hypothesis tests for the presence of an organism in a sample. Second, we present a means to compare community structure across a collection of many samples and develop direct associations between the abundance of certain organisms and sample metadata. Third, we apply new tools to analyze the phylogenetic diversity of microbial communities and again demonstrate how this can be associated to sample metadata. These analyses are implemented in an open source software pipeline called PhyloSift. As a pipeline, PhyloSift incorporates several other programs including LAST, HMMER, and pplacer to automate phylogenetic analysis of protein coding and RNA sequences in metagenomic datasets generated by modern sequencing platforms (e.g., Illumina, 454).

  7. PhyloSift: phylogenetic analysis of genomes and metagenomes

    Directory of Open Access Journals (Sweden)

    Aaron E. Darling

    2014-01-01

    Full Text Available Like all organisms on the planet, environmental microbes are subject to the forces of molecular evolution. Metagenomic sequencing provides a means to access the DNA sequence of uncultured microbes. By combining DNA sequencing of microbial communities with evolutionary modeling and phylogenetic analysis we might obtain new insights into microbiology and also provide a basis for practical tools such as forensic pathogen detection.In this work we present an approach to leverage phylogenetic analysis of metagenomic sequence data to conduct several types of analysis. First, we present a method to conduct phylogeny-driven Bayesian hypothesis tests for the presence of an organism in a sample. Second, we present a means to compare community structure across a collection of many samples and develop direct associations between the abundance of certain organisms and sample metadata. Third, we apply new tools to analyze the phylogenetic diversity of microbial communities and again demonstrate how this can be associated to sample metadata.These analyses are implemented in an open source software pipeline called PhyloSift. As a pipeline, PhyloSift incorporates several other programs including LAST, HMMER, and pplacer to automate phylogenetic analysis of protein coding and RNA sequences in metagenomic datasets generated by modern sequencing platforms (e.g., Illumina, 454.

  8. Phylogenetic mixtures and linear invariants for equal input models.

    Science.gov (United States)

    Casanellas, Marta; Steel, Mike

    2017-04-01

    The reconstruction of phylogenetic trees from molecular sequence data relies on modelling site substitutions by a Markov process, or a mixture of such processes. In general, allowing mixed processes can result in different tree topologies becoming indistinguishable from the data, even for infinitely long sequences. However, when the underlying Markov process supports linear phylogenetic invariants, then provided these are sufficiently informative, the identifiability of the tree topology can be restored. In this paper, we investigate a class of processes that support linear invariants once the stationary distribution is fixed, the 'equal input model'. This model generalizes the 'Felsenstein 1981' model (and thereby the Jukes-Cantor model) from four states to an arbitrary number of states (finite or infinite), and it can also be described by a 'random cluster' process. We describe the structure and dimension of the vector spaces of phylogenetic mixtures and of linear invariants for any fixed phylogenetic tree (and for all trees-the so called 'model invariants'), on any number n of leaves. We also provide a precise description of the space of mixtures and linear invariants for the special case of [Formula: see text] leaves. By combining techniques from discrete random processes and (multi-) linear algebra, our results build on a classic result that was first established by James Lake (Mol Biol Evol 4:167-191, 1987).

  9. High school students' learning and perceptions of phylogenetics of flowering plants.

    Science.gov (United States)

    Bokor, Julie R; Landis, Jacob B; Crippen, Kent J

    2014-01-01

    Basic phylogenetics and associated "tree thinking" are often minimized or excluded in formal school curricula. Informal settings provide an opportunity to extend the K-12 school curriculum, introducing learners to new ideas, piquing interest in science, and fostering scientific literacy. Similarly, university researchers participating in science, technology, engineering, and mathematics (STEM) outreach activities increase awareness of college and career options and highlight interdisciplinary fields of science research and augment the science curriculum. To aid in this effort, we designed a 6-h module in which students utilized 12 flowering plant species to generate morphological and molecular phylogenies using biological techniques and bioinformatics tools. The phylogenetics module was implemented with 83 high school students during a weeklong university STEM immersion program and aimed to increase student understanding of phylogenetics and coevolution of plants and pollinators. Student response reflected positive engagement and learning gains as evidenced through content assessments, program evaluation surveys, and program artifacts. We present the results of the first year of implementation and discuss modifications for future use in our immersion programs as well as in multiple course settings at the high school and undergraduate levels. © 2014 J. R. Bokor et al. CBE—Life Sciences Education © 2014 The American Society for Cell Biology. This article is distributed by The American Society for Cell Biology under license from the author(s). It is available to the public under an Attribution–Noncommercial–Share Alike 3.0 Unported Creative Commons License (http://creativecommons.org/licenses/by-nc-sa/3.0).

  10. Phylogenetic characterization of Canine Parvovirus VP2 partial sequences from symptomatic dogs samples.

    Science.gov (United States)

    Zienius, D; Lelešius, R; Kavaliauskis, H; Stankevičius, A; Šalomskas, A

    2016-01-01

    The aim of the present study was to detect canine parvovirus (CPV) from faecal samples of clinically ill domestic dogs by polymerase chain reaction (PCR) followed by VP2 gene partial sequencing and molecular characterization of circulating strains in Lithuania. Eleven clinically and antigen-tested positive dog faecal samples, collected during the period of 2014-2015, were investigated by using PCR. The phylogenetic investigations indicated that the Lithuanian CPV VP2 partial sequences (3025-3706 cds) were closely related and showed 99.0-99.9% identity. All Lithuanian sequences were associated with one phylogroup, but grouped in different clusters. Ten of investigated Lithuanian CPV VP2 sequences were closely associated with CPV 2a antigenic variant (99.4% nt identity). Five CPV VP2 sequences from Lithuania were related to CPV-2a, but were rather divergent (6.8 nt differences). Only one CPV VP2 sequence from Lithuania was associated (99.3% nt identity) with CPV-2b VP2 sequences from France, Italy, USA and Korea. The four of eleven investigated Lithuanian dogs with CPV infection symptoms were vaccinated with CPV-2 vaccine, but their VP2 sequences were phylogenetically distantly associated with CPV vaccine strains VP2 sequences (11.5-15.8 nt differences). Ten Lithuanian CPV VP2 sequences had monophyletic relations among the close geographically associated samples, but five of them were rather divergent (1.0% less sequence similarity). The one Lithuanian CPV VP2 sequence was closely related with CPV-2b antigenic variant. All the Lithuanian CPV VP2 partial sequences were conservative and phylogenetically low associated with most commonly used CPV vaccine strains.

  11. Minimum variance rooting of phylogenetic trees and implications for species tree reconstruction.

    Science.gov (United States)

    Mai, Uyen; Sayyari, Erfan; Mirarab, Siavash

    2017-01-01

    Phylogenetic trees inferred using commonly-used models of sequence evolution are unrooted, but the root position matters both for interpretation and downstream applications. This issue has been long recognized; however, whether the potential for discordance between the species tree and gene trees impacts methods of rooting a phylogenetic tree has not been exte