WorldWideScience

Sample records for molecular phylogenetic position

  1. A molecular phylogenetic appraisal of the acanthostomines Acanthostomum and Timoniella and their position within Cryptogonimidae (Trematoda: Opisthorchioidea).

    Science.gov (United States)

    Martínez-Aquino, Andrés; Vidal-Martínez, Victor M; Aguirre-Macedo, M Leopoldina

    2017-01-01

    The phylogenetic position of three taxa from two trematode genera, belonging to the subfamily Acanthostominae (Opisthorchioidea: Cryptogonimidae), were analysed using partial 28S ribosomal DNA (Domains 1-2) and internal transcribed spacers (ITS1-5.8S-ITS2). Bayesian inference and Maximum likelihood analyses of combined 28S rDNA and ITS1 + 5.8S + ITS2 sequences indicated the monophyly of the genus Acanthostomum ( A. cf. americanum and A. burminis ) and paraphyly of the Acanthostominae . These phylogenetic relationships were consistent in analyses of 28S alone and concatenated 28S + ITS1 + 5.8S + ITS2 sequences analyses. Based on molecular phylogenetic analyses, the subfamily Acanthostominae is therefore a paraphyletic taxon, in contrast with previous classifications based on morphological data. Phylogenetic patterns of host specificity inferred from adult stages of other cryptogonimid taxa are also well supported. However, analyses using additional genera and species are necessary to support the phylogenetic inferences from this study. Our molecular phylogenetic reconstruction linked two larval stages of A. cf. americanum cercariae and metacercariae. Here, we present the evolutionary and ecological implications of parasitic infections in freshwater and brackish environments.

  2. A molecular phylogenetic appraisal of the acanthostomines Acanthostomum and Timoniella and their position within Cryptogonimidae (Trematoda: Opisthorchioidea

    Directory of Open Access Journals (Sweden)

    Andrés Martínez-Aquino

    2017-12-01

    Full Text Available The phylogenetic position of three taxa from two trematode genera, belonging to the subfamily Acanthostominae (Opisthorchioidea: Cryptogonimidae, were analysed using partial 28S ribosomal DNA (Domains 1–2 and internal transcribed spacers (ITS1–5.8S–ITS2. Bayesian inference and Maximum likelihood analyses of combined 28S rDNA and ITS1 + 5.8S + ITS2 sequences indicated the monophyly of the genus Acanthostomum (A. cf. americanum and A. burminis and paraphyly of the Acanthostominae. These phylogenetic relationships were consistent in analyses of 28S alone and concatenated 28S + ITS1 + 5.8S + ITS2 sequences analyses. Based on molecular phylogenetic analyses, the subfamily Acanthostominae is therefore a paraphyletic taxon, in contrast with previous classifications based on morphological data. Phylogenetic patterns of host specificity inferred from adult stages of other cryptogonimid taxa are also well supported. However, analyses using additional genera and species are necessary to support the phylogenetic inferences from this study. Our molecular phylogenetic reconstruction linked two larval stages of A. cf. americanum cercariae and metacercariae. Here, we present the evolutionary and ecological implications of parasitic infections in freshwater and brackish environments.

  3. Molecular Phylogenetics: Concepts for a Newcomer.

    Science.gov (United States)

    Ajawatanawong, Pravech

    Molecular phylogenetics is the study of evolutionary relationships among organisms using molecular sequence data. The aim of this review is to introduce the important terminology and general concepts of tree reconstruction to biologists who lack a strong background in the field of molecular evolution. Some modern phylogenetic programs are easy to use because of their user-friendly interfaces, but understanding the phylogenetic algorithms and substitution models, which are based on advanced statistics, is still important for the analysis and interpretation without a guide. Briefly, there are five general steps in carrying out a phylogenetic analysis: (1) sequence data preparation, (2) sequence alignment, (3) choosing a phylogenetic reconstruction method, (4) identification of the best tree, and (5) evaluating the tree. Concepts in this review enable biologists to grasp the basic ideas behind phylogenetic analysis and also help provide a sound basis for discussions with expert phylogeneticists.

  4. Ultrastructure and molecular phylogenetic position of a novel phagotrophic stramenopile from low oxygen environments: Rictus lutensis gen. et sp. nov. (Bicosoecida, incertae sedis).

    Science.gov (United States)

    Yubuki, Naoji; Leander, Brian S; Silberman, Jeffrey D

    2010-04-01

    A novel free free-living phagotrophic flagellate, Rictus lutensis gen. et sp. nov., with two heterodynamic flagella, a permanent cytostome and a cytopharynx was isolated from muddy, low oxygen coastal sediments in Cape Cod, MA, USA. We cultivated and characterized this flagellate with transmission electron microscopy, scanning electron microscopy and molecular phylogenetic analyses inferred from small subunit (SSU) rDNA sequences. These data demonstrated that this organism has the key ultrastructural characters of the Bicosoecida, including similar transitional zones and a similar overall flagellar apparatus consisting of an x fiber and an L-shape microtubular root 2 involved in food capture. Although the molecular phylogenetic analyses were concordant with the ultrastructural data in placing R. lutensis with the bicosoecid clade, the internal position of this relatively divergent sequence within the clade was not resolved. Therefore, we interpret R. lutensis gen. et sp. nov. as a novel bicosoecid incertae sedis. Copyright 2009 Elsevier GmbH. All rights reserved.

  5. Molecular Phylogenetics: Mathematical Framework and Unsolved Problems

    Science.gov (United States)

    Xia, Xuhua

    Phylogenetic relationship is essential in dating evolutionary events, reconstructing ancestral genes, predicting sites that are important to natural selection, and, ultimately, understanding genomic evolution. Three categories of phylogenetic methods are currently used: the distance-based, the maximum parsimony, and the maximum likelihood method. Here, I present the mathematical framework of these methods and their rationales, provide computational details for each of them, illustrate analytically and numerically the potential biases inherent in these methods, and outline computational challenges and unresolved problems. This is followed by a brief discussion of the Bayesian approach that has been recently used in molecular phylogenetics.

  6. TREEFINDER: a powerful graphical analysis environment for molecular phylogenetics

    Directory of Open Access Journals (Sweden)

    von Haeseler Arndt

    2004-06-01

    Full Text Available Abstract Background Most analysis programs for inferring molecular phylogenies are difficult to use, in particular for researchers with little programming experience. Results TREEFINDER is an easy-to-use integrative platform-independent analysis environment for molecular phylogenetics. In this paper the main features of TREEFINDER (version of April 2004 are described. TREEFINDER is written in ANSI C and Java and implements powerful statistical approaches for inferring gene tree and related analyzes. In addition, it provides a user-friendly graphical interface and a phylogenetic programming language. Conclusions TREEFINDER is a versatile framework for analyzing phylogenetic data across different platforms that is suited both for exploratory as well as advanced studies.

  7. Phylogenetic position of Loricifera inferred from nearly complete 18S and 28S rRNA gene sequences

    OpenAIRE

    Yamasaki, Hiroshi; Fujimoto, Shinta; Miyazaki, Katsumi

    2015-01-01

    Background Loricifera is an enigmatic metazoan phylum; its morphology appeared to place it with Priapulida and Kinorhyncha in the group Scalidophora which, along with Nematoida (Nematoda and Nematomorpha), comprised the group Cycloneuralia. Scarce molecular data have suggested an alternative phylogenetic hypothesis, that the phylum Loricifera is a sister taxon to Nematomorpha, although the actual phylogenetic position of the phylum remains unclear. Methods Ecdysozoan phylogeny was reconstruct...

  8. Molecular characterization and phylogenetic relationships among ...

    African Journals Online (AJOL)

    Molecular characterization and phylogenetic relationships among and within species of Phalaenopsis (Epidendroideae: Orchidaceae) based on RAPD analysis. ... Ph. parishii, Ph. labbi nepal, Ph. speciosa, Ph. lobbi yellow, Ph. venosa, Ph. hieroglyphica, and Ph. maculata; the third group consisted of Ph. minho princess, ...

  9. Molecular phylogenetics of mastodon and Tyrannosaurus rex.

    Science.gov (United States)

    Organ, Chris L; Schweitzer, Mary H; Zheng, Wenxia; Freimark, Lisa M; Cantley, Lewis C; Asara, John M

    2008-04-25

    We report a molecular phylogeny for a nonavian dinosaur, extending our knowledge of trait evolution within nonavian dinosaurs into the macromolecular level of biological organization. Fragments of collagen alpha1(I) and alpha2(I) proteins extracted from fossil bones of Tyrannosaurus rex and Mammut americanum (mastodon) were analyzed with a variety of phylogenetic methods. Despite missing sequence data, the mastodon groups with elephant and the T. rex groups with birds, consistent with predictions based on genetic and morphological data for mastodon and on morphological data for T. rex. Our findings suggest that molecular data from long-extinct organisms may have the potential for resolving relationships at critical areas in the vertebrate evolutionary tree that have, so far, been phylogenetically intractable.

  10. Molecular and phylogenetic analysis of HIV-1 variants circulating in Italy

    Directory of Open Access Journals (Sweden)

    Sbreglia Costanza

    2008-10-01

    Full Text Available Abstract Objective The continuous identification of HIV-1 non-B subtypes and recombinant forms in Italy indicates the need of constant molecular epidemiology survey of genetic forms circulating and transmitted in the resident population. Methods The distribution of HIV-1 subtypes has been evaluated in 25 seropositive individuals residing in Italy, most of whom were infected through a sexual route during the 1995–2005 period. Each sample has been characterized by detailed molecular and phylogenetic analyses. Results 18 of the 25 samples were positive at HIV-1 PCR amplification. Three samples showed a nucleotide divergence compatible with a non-B subtype classification. The phylogenetic analysis, performed on both HIV-1 env and gag regions, confirms the molecular sub-typing prediction, given that 1 sample falls into the C subtype and 2 into the G subtype. The B subtype isolates show high levels of intra-subtype nucleotide divergence, compatible with a long-lasting epidemic and a progressive HIV-1 molecular diversification. Conclusion The Italian HIV-1 epidemic is still mostly attributable to the B subtype, regardless the transmission route, which shows an increasing nucleotide heterogeneity. Heterosexual transmission and the interracial blending, however, are slowly introducing novel HIV-1 subtypes. Therefore, a molecular monitoring is needed to follow the constant evolution of the HIV-1 epidemic.

  11. Applying phylogenetic analysis to viral livestock diseases: moving beyond molecular typing.

    Science.gov (United States)

    Olvera, Alex; Busquets, Núria; Cortey, Marti; de Deus, Nilsa; Ganges, Llilianne; Núñez, José Ignacio; Peralta, Bibiana; Toskano, Jennifer; Dolz, Roser

    2010-05-01

    Changes in livestock production systems in recent years have altered the presentation of many diseases resulting in the need for more sophisticated control measures. At the same time, new molecular assays have been developed to support the diagnosis of animal viral disease. Nucleotide sequences generated by these diagnostic techniques can be used in phylogenetic analysis to infer phenotypes by sequence homology and to perform molecular epidemiology studies. In this review, some key elements of phylogenetic analysis are highlighted, such as the selection of the appropriate neutral phylogenetic marker, the proper phylogenetic method and different techniques to test the reliability of the resulting tree. Examples are given of current and future applications of phylogenetic reconstructions in viral livestock diseases. Copyright 2009 Elsevier Ltd. All rights reserved.

  12. Phylogenetic molecular function annotation

    International Nuclear Information System (INIS)

    Engelhardt, Barbara E; Jordan, Michael I; Repo, Susanna T; Brenner, Steven E

    2009-01-01

    It is now easier to discover thousands of protein sequences in a new microbial genome than it is to biochemically characterize the specific activity of a single protein of unknown function. The molecular functions of protein sequences have typically been predicted using homology-based computational methods, which rely on the principle that homologous proteins share a similar function. However, some protein families include groups of proteins with different molecular functions. A phylogenetic approach for predicting molecular function (sometimes called 'phylogenomics') is an effective means to predict protein molecular function. These methods incorporate functional evidence from all members of a family that have functional characterizations using the evolutionary history of the protein family to make robust predictions for the uncharacterized proteins. However, they are often difficult to apply on a genome-wide scale because of the time-consuming step of reconstructing the phylogenies of each protein to be annotated. Our automated approach for function annotation using phylogeny, the SIFTER (Statistical Inference of Function Through Evolutionary Relationships) methodology, uses a statistical graphical model to compute the probabilities of molecular functions for unannotated proteins. Our benchmark tests showed that SIFTER provides accurate functional predictions on various protein families, outperforming other available methods.

  13. A new miniature characid (Ostariophysi: Characiformes: Characidae, with phylogenetic position inferred from morphological and molecular data.

    Directory of Open Access Journals (Sweden)

    André Luiz Netto-Ferreira

    Full Text Available Erythrocharax altipinnis is described from the Serra do Cachimbo, Pará, Brazil. The new taxon is distinguished from all of the Characidae genera by having the pelvic bones firmly attached through the isquiatic processes; a nearly triangular hiatus in the musculature covering the anterior chamber of the swim bladder between the first and second pleural ribs (pseudotympanum; the pedunculate, notably expanded and distally compressed teeth in both jaws; circumorbital series represented by antorbital and four infraorbital bones with laterosensory canals not enclosed; a single tooth row in the premaxillary with the teeth perfectly aligned and similar in shape and cusp number; the first three branched dorsal-fin rays distinctly elongate in males; a bright red adipose and caudal fins in life; a conspicuous dark midlateral stripe extending from the opercle to the tip of the median caudal-fin rays; and by the absence of a humeral spot. The phylogenetic position of the new taxon is discussed using morphological and molecular datasets, with conflicting results of both approaches discussed. Additionally, a summarized discussion on the current problems in the Characidae taxonomy is presented and the principal biases in the morphological dataset are also discussed.

  14. PhyTB: Phylogenetic tree visualisation and sample positioning for M. tuberculosis

    KAUST Repository

    Benavente, Ernest D

    2015-05-13

    Background Phylogenetic-based classification of M. tuberculosis and other bacterial genomes is a core analysis for studying evolutionary hypotheses, disease outbreaks and transmission events. Whole genome sequencing is providing new insights into the genomic variation underlying intra- and inter-strain diversity, thereby assisting with the classification and molecular barcoding of the bacteria. One roadblock to strain investigation is the lack of user-interactive solutions to interrogate and visualise variation within a phylogenetic tree setting. Results We have developed a web-based tool called PhyTB (http://pathogenseq.lshtm.ac.uk/phytblive/index.php webcite) to assist phylogenetic tree visualisation and identification of M. tuberculosis clade-informative polymorphism. Variant Call Format files can be uploaded to determine a sample position within the tree. A map view summarises the geographical distribution of alleles and strain-types. The utility of the PhyTB is demonstrated on sequence data from 1,601 M. tuberculosis isolates. Conclusion PhyTB contextualises M. tuberculosis genomic variation within epidemiological, geographical and phylogenic settings. Further tool utility is possible by incorporating large variants and phenotypic data (e.g. drug-resistance profiles), and an assessment of genotype-phenotype associations. Source code is available to develop similar websites for other organisms (http://sourceforge.net/projects/phylotrack webcite).

  15. Molecular identification and phylogenetic study of Demodex caprae.

    Science.gov (United States)

    Zhao, Ya-E; Cheng, Juan; Hu, Li; Ma, Jun-Xian

    2014-10-01

    The DNA barcode has been widely used in species identification and phylogenetic analysis since 2003, but there have been no reports in Demodex. In this study, to obtain an appropriate DNA barcode for Demodex, molecular identification of Demodex caprae based on mitochondrial cox1 was conducted. Firstly, individual adults and eggs of D. caprae were obtained for genomic DNA (gDNA) extraction; Secondly, mitochondrial cox1 fragment was amplified, cloned, and sequenced; Thirdly, cox1 fragments of D. caprae were aligned with those of other Demodex retrieved from GenBank; Finally, the intra- and inter-specific divergences were computed and the phylogenetic trees were reconstructed to analyze phylogenetic relationship in Demodex. Results obtained from seven 429-bp fragments of D. caprae showed that sequence identities were above 99.1% among three adults and four eggs. The intraspecific divergences in D. caprae, Demodex folliculorum, Demodex brevis, and Demodex canis were 0.0-0.9, 0.5-0.9, 0.0-0.2, and 0.0-0.5%, respectively, while the interspecific divergences between D. caprae and D. folliculorum, D. canis, and D. brevis were 20.3-20.9, 21.8-23.0, and 25.0-25.3, respectively. The interspecific divergences were 10 times higher than intraspecific ones, indicating considerable barcoding gap. Furthermore, the phylogenetic trees showed that four Demodex species gathered separately, representing independent species; and Demodex folliculorum gathered with canine Demodex, D. caprae, and D. brevis in sequence. In conclusion, the selected 429-bp mitochondrial cox1 gene is an appropriate DNA barcode for molecular classification, identification, and phylogenetic analysis of Demodex. D. caprae is an independent species and D. folliculorum is closer to D. canis than to D. caprae or D. brevis.

  16. Molecular phylogenetic analysis of Enterobius vermicularis and development of an 18S ribosomal DNA-targeted diagnostic PCR.

    Science.gov (United States)

    Zelck, Ulrike E; Bialek, Ralf; Weiss, Michael

    2011-04-01

    We genetically characterized pinworms obtained from 37 children from different regions of Germany and established new species-specific molecular diagnostic tools. No ribosomal DNA diversity was found; the phylogenetic position of Enterobius vermicularis within the Oxyurida order and its close relationship to the Ascaridida and Spirurida orders was confirmed.

  17. Molecular Phylogenetic Analysis of Enterobius vermicularis and Development of an 18S Ribosomal DNA-Targeted Diagnostic PCR▿

    Science.gov (United States)

    Zelck, Ulrike E.; Bialek, Ralf; Weiß, Michael

    2011-01-01

    We genetically characterized pinworms obtained from 37 children from different regions of Germany and established new species-specific molecular diagnostic tools. No ribosomal DNA diversity was found; the phylogenetic position of Enterobius vermicularis within the Oxyurida order and its close relationship to the Ascaridida and Spirurida orders was confirmed. PMID:21248085

  18. Comparative analyses of the complete mitochondrial genomes of Dosinia clams and their phylogenetic position within Veneridae.

    Science.gov (United States)

    Lv, Changda; Li, Qi; Kong, Lingfeng

    2018-01-01

    Mitochondrial genomes have proved to be a powerful tool in resolving phylogenetic relationship. In order to understand the mitogenome characteristics and phylogenetic position of the genus Dosinia, we sequenced the complete mitochondrial genomes of Dosinia altior and Dosinia troscheli (Bivalvia: Veneridae), compared them with that of Dosinia japonica and established a phylogenetic tree for Veneridae. The mitogenomes of D. altior (17,536 bp) and D. troscheli (17,229 bp) are the two smallest in Veneridae, which include 13 protein-coding genes, 2 ribosomal RNA genes, 22 tRNA genes, and non-coding regions. The mitogenomes of the Dosinia species are similar in size, gene content, AT content, AT- and GC- skews, and gene arrangement. The phylogenetic relationships of family Veneridae were established based on 12 concatenated protein-coding genes using maximum likelihood and Bayesian analyses, which supported that Dosininae and Meretricinae have a closer relationship, with Tapetinae being the sister taxon. The information obtained in this study will contribute to further understanding of the molecular features of bivalve mitogenomes and the evolutionary history of the genus Dosinia.

  19. Integrative taxonomy of ciliates: Assessment of molecular phylogenetic content and morphological homology testing.

    Science.gov (United States)

    Vďačný, Peter

    2017-10-01

    The very diverse and comparatively complex morphology of ciliates has given rise to numerous taxonomic concepts. However, the information content of the utilized molecular markers has seldom been explored prior to phylogenetic analyses and taxonomic decisions. Likewise, robust testing of morphological homology statements and the apomorphic nature of diagnostic characters of ciliate taxa is rarely carried out. Four phylogenetic techniques that may help address these issues are reviewed. (1) Split spectrum analysis serves to determine the exact number and quality of nucleotide positions supporting individual nodes in phylogenetic trees and to discern long-branch artifacts that cause spurious phylogenies. (2) Network analysis can depict all possible evolutionary trajectories inferable from the dataset and locate and measure the conflict between them. (3) A priori likelihood mapping tests the suitability of data for reconstruction of a well resolved tree, visualizes the tree-likeness of quartets, and assesses the support of an internal branch of a given tree topology. (4) Reconstruction of ancestral morphologies can be applied for analyzing homology and apomorphy statements without circular reasoning. Since these phylogenetic tools are rarely used, their principles and interpretation are introduced and exemplified using various groups of ciliates. Finally, environmental sequencing data are discussed in this light. Copyright © 2017 The Author. Published by Elsevier GmbH.. All rights reserved.

  20. Phylogenetic relationships of Hemiuridae (Digenea: Hemiuroidea) with new morphometric and molecular data of Aphanurus mugilis Tang, 1981 (Aphanurinae) from mullet fish of Vietnam.

    Science.gov (United States)

    Atopkin, D M; Besprozvannykh, V V; Yu Beloded, A; Ngo, H D; Ha, N V; Tang, N V

    2017-12-01

    Adult Aphanurus mugilis Tang, 1981 worms were detected in the intestine of Moolgarda engeli in the shallow waters off Cat Ba Island, Vietnam. Tang (1981) first described this species in Mugil cephalus off China. The worms in Vietnamese mullet were identical to Chinese specimens in a number of morphometric characteristics, with the exception of body and ovary size. In the present study, morphological characteristics, and the first molecular data for A. mugilis are provided. Additionally, molecular phylogenetic analysis of the family Hemiuridae was performed. The results of our molecular phylogenetic study indicate that the presence or absence of an ecsoma was not associated with molecular data for hemiurid subfamilies differentiation. The basal position of Bunocotylinae on the molecular-based phylogenetic tree indicated a primordial nature of ecsoma of hemiurid trematodes. Considerable molecular differentiation of Bunocotylinae from other hemiurids indicated the possibility of the recognition of the family Bunocotylidae Dollfus, 1950. Assuming that Machidatrema chilostoma is considered within the Bunocotylinae, the paraphyly of the Lecithasterinae was supported. Copyright © 2017 Elsevier B.V. All rights reserved.

  1. Molecular evolution of ependymin and the phylogenetic resolution of early divergences among euteleost fishes.

    Science.gov (United States)

    Ortí, G; Meyer, A

    1996-04-01

    The rate and pattern of DNA evolution of ependymin, a single-copy gene coding for a highly expressed glycoprotein in the brain matrix of teleost fishes, is characterized and its phylogenetic utility for fish systematics is assessed. DNA sequences were determined from catfish, electric fish, and characiforms and compared with published ependymin sequences from cyprinids, salmon, pike, and herring. Among these groups, ependymin amino acid sequences were highly divergent (up to 60% sequence difference), but had surprisingly similar hydropathy profiles and invariant glycosylation sites, suggesting that functional properties of the proteins are conserved. Comparison of base composition at third codon positions and introns revealed AT-rich introns and GC-rich third codon positions, suggesting that the biased codon usage observed might not be due to mutational bias. Phylogenetic information content of third codon positions was surprisingly high and sufficient to recover the most basal nodes of the tree, in spite of the observation that pairwise distances (at third codon positions) were well above the presumed saturation level. This finding can be explained by the high proportion of phylogenetically informative nonsynonymous changes at third codon positions among these highly divergent proteins. Ependymin DNA sequences have established the first molecular evidence for the monophyly of a group containing salmonids and esociforms. In addition, ependymin suggests a sister group relationship of electric fish (Gymnotiformes) and Characiformes, constituting a significant departure from currently accepted classifications. However, relationships among characiform lineages were not completely resolved by ependymin sequences in spite of seemingly appropriate levels of variation among taxa and considerably low levels of homoplasy in the data (consistency index = 0.7). If the diversification of Characiformes took place in an "explosive" manner, over a relatively short period of time

  2. Molecular phylogenetics of porcini mushrooms (Boletus section Boletus).

    Science.gov (United States)

    Dentinger, Bryn T M; Ammirati, Joseph F; Both, Ernst E; Desjardin, Dennis E; Halling, Roy E; Henkel, Terry W; Moreau, Pierre-Arthur; Nagasawa, Eiji; Soytong, Kasem; Taylor, Andy F; Watling, Roy; Moncalvo, Jean-Marc; McLaughlin, David J

    2010-12-01

    Porcini (Boletus section Boletus: Boletaceae: Boletineae: Boletales) are a conspicuous group of wild, edible mushrooms characterized by fleshy fruiting bodies with a poroid hymenophore that is "stuffed" with white hyphae when young. Their reported distribution is with ectomycorrhizal plants throughout the Northern Hemisphere. Little progress has been made on the systematics of this group using modern molecular phylogenetic tools because sampling has been limited primarily to European species and the genes employed were insufficient to resolve the phylogeny. We examined the evolutionary history of porcini by using a global geographic sampling of most known species, new discoveries from little explored areas, and multiple genes. We used 78 sequences from the fast-evolving nuclear internal transcribed spacers and are able to recognize 18 reciprocally monophyletic species. To address whether or not porcini form a monophyletic group, we compiled a broadly sampled dataset of 41 taxa, including other members of the Boletineae, and used separate and combined phylogenetic analysis of sequences from the nuclear large subunit ribosomal DNA, the largest subunit of RNA polymerase II, and the mitochondrial ATPase subunit six gene. Contrary to previous studies, our separate and combined phylogenetic analyses support the monophyly of porcini. We also report the discovery of two taxa that expand the known distribution of porcini to Australia and Thailand and have ancient phylogenetic connections to the rest of the group. A relaxed molecular clock analysis with these new taxa dates the origin of porcini to between 42 and 54 million years ago, coinciding with the initial diversification of angiosperms, during the Eocene epoch when the climate was warm and humid. These results reveal an unexpected diversity, distribution, and ancient origin of a group of commercially valuable mushrooms that may provide an economic incentive for conservation and support the hypothesis of a tropical

  3. Conformation of phylogenetic relationship of Penaeidae shrimp based on morphometric and molecular investigations.

    Science.gov (United States)

    Rajakumaran, P; Vaseeharan, B; Jayakumar, R; Chidambara, R

    2014-01-01

    Understanding of accurate phylogenetic relationship among Penaeidae shrimp is important for academic and fisheries industry. The Morphometric and Randomly amplified polymorphic DNA (RAPD) analysis was used to make the phylogenetic relationsip among 13 Penaeidae shrimp. For morphometric analysis forty variables and total lengths of shrimp were measured for each species, and removed the effect of size variation. The size normalized values obtained was subjected to UPGMA (Unweighted Pair-Group Method with Arithmetic Mean) cluster analysis. For RAPD analysis, the four primers showed reliable differentiation between species, and used correlation coefficient between the DNA banding patterns of 13 Penaeidae species to construct UPGMA dendrogram. Phylogenetic relationship from morphometric and molecular analysis for Penaeidae species found to be congruent. We concluded that as the results from morphometry investigations concur with molecular one, phylogenetic relationship obtained for the studied Penaeidae are considered to be reliable.

  4. phylo-node: A molecular phylogenetic toolkit using Node.js.

    Science.gov (United States)

    O'Halloran, Damien M

    2017-01-01

    Node.js is an open-source and cross-platform environment that provides a JavaScript codebase for back-end server-side applications. JavaScript has been used to develop very fast and user-friendly front-end tools for bioinformatic and phylogenetic analyses. However, no such toolkits are available using Node.js to conduct comprehensive molecular phylogenetic analysis. To address this problem, I have developed, phylo-node, which was developed using Node.js and provides a stable and scalable toolkit that allows the user to perform diverse molecular and phylogenetic tasks. phylo-node can execute the analysis and process the resulting outputs from a suite of software options that provides tools for read processing and genome alignment, sequence retrieval, multiple sequence alignment, primer design, evolutionary modeling, and phylogeny reconstruction. Furthermore, phylo-node enables the user to deploy server dependent applications, and also provides simple integration and interoperation with other Node modules and languages using Node inheritance patterns, and a customized piping module to support the production of diverse pipelines. phylo-node is open-source and freely available to all users without sign-up or login requirements. All source code and user guidelines are openly available at the GitHub repository: https://github.com/dohalloran/phylo-node.

  5. Discovery of Paragonimus westermani in Vietnam and its molecular phylogenetic status in P. westermani complex.

    Science.gov (United States)

    Doanh, Pham Ngoc; Shinohara, Akio; Horii, Yoichiro; Habe, Shigehisa; Nawa, Yukifumi

    2009-04-01

    Paragonimus westermani is the most well-known species among the genus Paragonimus. It is widely distributed in Asia with considerable genetic diversity to form P. westermani species complex. While P. westermani distributed in Japan, Korea, China, and Taiwan are genetically homogeneous to form the East Asia group, those found in other geographic areas are heterogeneous and would be divided into several groups. Recent discoveries of P. westermani in India and Sri Lanka highlighted new insights on molecular phylogenetic relationship of geographic isolates of this species complex. Since Vietnam is located at the east end of Southeast Asia, the intermediate position between South and East Asia, it is of interest to see whether P. westermani is distributed in this country. Here, we report that P. westermani metacercariae were found in mountainous crabs, Potamiscus sp., collected in Quangtri province in the central Vietnam. Adult worms were successfully obtained by experimental infection in cats. Molecular phylogenetic analyses revealed that P. westermani of Vietnamese isolates have high similarities with those of East Asia group.

  6. Archaeal phylogeny: reexamination of the phylogenetic position of Archaeoglobus fulgidus in light of certain composition-induced artifacts

    Science.gov (United States)

    Woese, C. R.; Achenbach, L.; Rouviere, P.; Mandelco, L.

    1991-01-01

    A major and too little recognized source of artifact in phylogenetic analysis of molecular sequence data is compositional difference among sequences. The problem becomes particularly acute when alignments contain ribosomal RNAs from both mesophilic and thermophilic species. Among prokaryotes the latter are considerably higher in G + C content than the former, which often results in artificial clustering of thermophilic lineages and their being placed artificially deep in phylogenetic trees. In this communication we review archaeal phylogeny in the light of this consideration, focusing in particular on the phylogenetic position of the sulfate reducing species Archaeoglobus fulgidus, using both 16S rRNA and 23S rRNA sequences. The analysis shows clearly that the previously reported deep branching of the A. fulgidus lineage (very near the base of the euryarchaeal side of the archaeal tree) is incorrect, and that the lineage actually groups with a previously recognized unit that comprises the Methanomicrobiales and extreme halophiles.

  7. Exploring the Genomic Roadmap and Molecular Phylogenetics Associated with MODY Cascades Using Computational Biology.

    Science.gov (United States)

    Chakraborty, Chiranjib; Bandyopadhyay, Sanghamitra; Doss, C George Priya; Agoramoorthy, Govindasamy

    2015-04-01

    Maturity onset diabetes of the young (MODY) is a metabolic and genetic disorder. It is different from type 1 and type 2 diabetes with low occurrence level (1-2%) among all diabetes. This disorder is a consequence of β-cell dysfunction. Till date, 11 subtypes of MODY have been identified, and all of them can cause gene mutations. However, very little is known about the gene mapping, molecular phylogenetics, and co-expression among MODY genes and networking between cascades. This study has used latest servers and software such as VarioWatch, ClustalW, MUSCLE, G Blocks, Phylogeny.fr, iTOL, WebLogo, STRING, and KEGG PATHWAY to perform comprehensive analyses of gene mapping, multiple sequences alignment, molecular phylogenetics, protein-protein network design, co-expression analysis of MODY genes, and pathway development. The MODY genes are located in chromosomes-2, 7, 8, 9, 11, 12, 13, 17, and 20. Highly aligned block shows Pro, Gly, Leu, Arg, and Pro residues are highly aligned in the positions of 296, 386, 437, 455, 456 and 598, respectively. Alignment scores inform us that HNF1A and HNF1B proteins have shown high sequence similarity among MODY proteins. Protein-protein network design shows that HNF1A, HNF1B, HNF4A, NEUROD1, PDX1, PAX4, INS, and GCK are strongly connected, and the co-expression analyses between MODY genes also show distinct association between HNF1A and HNF4A genes. This study has used latest tools of bioinformatics to develop a rapid method to assess the evolutionary relationship, the network development, and the associations among eleven MODY genes and cascades. The prediction of sequence conservation, molecular phylogenetics, protein-protein network and the association between the MODY cascades enhances opportunities to get more insights into the less-known MODY disease.

  8. Extended molecular phylogenetics and revised systematics of Malagasy scincine lizards.

    Science.gov (United States)

    Erens, Jesse; Miralles, Aurélien; Glaw, Frank; Chatrou, Lars W; Vences, Miguel

    2017-02-01

    Among the endemic biota of Madagascar, skinks are a diverse radiation of lizards that exhibit a striking ecomorphological variation, and could provide an interesting system to study body-form evolution in squamate reptiles. We provide a new phylogenetic hypothesis for Malagasy skinks of the subfamily Scincinae based on an extended molecular dataset comprising 8060bp from three mitochondrial and nine nuclear loci. Our analysis also increases taxon sampling of the genus Amphiglossus by including 16 out of 25 nominal species. Additionally, we examined whether the molecular phylogenetic patterns coincide with morphological differentiation in the species currently assigned to this genus. Various methods of inference recover a mostly strongly supported phylogeny with three main clades of Amphiglossus. However, relationships among these three clades and the limb-reduced genera Grandidierina, Voeltzkowia and Pygomeles remain uncertain. Supported by a variety of morphological differences (predominantly related to the degree of body elongation), but considering the remaining phylogenetic uncertainty, we propose a redefinition of Amphiglossus into three different genera (Amphiglossus sensu stricto, Flexiseps new genus, and Brachyseps new genus) to remove the non-monophyly of Amphiglossus sensu lato and to facilitate future studies on this fascinating group of lizards. Copyright © 2016 Elsevier Inc. All rights reserved.

  9. Molecular and karyological data confirm that the enigmatic genus Platypholis from Bonin-Islands (SE Japan) is phylogenetically nested within Orobanche (Orobanchaceae).

    Science.gov (United States)

    Li, Xi; Jang, Tae-Soo; Temsch, Eva M; Kato, Hidetoshi; Takayama, Koji; Schneeweiss, Gerald M

    2017-03-01

    Molecular phylogenetic studies have greatly improved our understanding of phylogenetic relationships of non-photosynthetic parasitic broomrapes (Orobanche and related genera, Orobanchaceae), but a few genera have remained unstudied. One of those is Platypholis, whose sole species, Platypholis boninsimae, is restricted to the Bonin-Islands (Ogasawara Islands) about 1000 km southeast of Japan. Based on overall morphological similarity, Platypholis has been merged with Orobanche, but this hypothesis has never been tested with molecular data. Employing maximum likelihood and Bayesian analyses on a family-wide data set (two plastid markers, matK and rps2, and three nuclear markers, ITS, phyA and phyB) as well as on an ITS data set focusing on Orobanche s. str., it is shown that P. boninsimae Maxim. is phylogenetically closely linked to or even nested within Orobanche s. str. This position is supported both by morphological evidence and by the newly obtained chromosome number of 2n = 38, which is characteristic for the genus Orobanche s. str.

  10. Molecular and phylogenetic analysis of HIV-1 variants circulating among injecting drug users in Mashhad-Iran

    Directory of Open Access Journals (Sweden)

    Buonaguro FM

    2006-09-01

    Full Text Available Abstract Genetic and phylogenetic information on the HIV-1 epidemic in Middle-East Countries, and in particular in Iran, are extremely limited. By March 2004, the Iranian Ministry of Health officially reported a cumulative number of 6'532 HIV positive individuals and 214 AIDS cases in the Iranian HIV-1 epidemic. The intra-venous drug users (IDUs represent the group at highest risk for HIV-1 infection in Iran, accounting for almost 63% of all HIV-infected population. In this regards, a molecular phylogenetic study has been performed on a sentinel cohort of HIV-1 seropositive IDUs enrolled at the end of 2005 at the University of Mashhad, the largest city North East of Tehran. The study has been performed on both gag and env subgenomic regions amplified by Polymerase Chain Reaction (PCR from peripheral blood mononuclear cells (PBMCs and characterized by direct DNA sequence analysis. The results reported here show that the HIV-1 subtype A is circulating in this IDUs sentinel cohort. Moreover, the single phylogenetic cluster as well as the intra-group low nucleotide divergence is indicative of a recent outbreak. Unexpectedly, the Iranian samples appear to be phylogenetically derived from African Sub-Saharan subtype A viruses, raising stirring speculations on HIV-1 introduction into the IDUs epidemic in Mashhad. This sentinel study could represent the starting point for a wider molecular survey of the HIV-1 epidemics in Iran to evaluate in detail the distribution of genetic subtypes and possible natural drug-resistant variants, which are extremely helpful information to design diagnostic and therapeutic strategies.

  11. Phylogenetic Framework and Molecular Signatures for the Main Clades of the Phylum Actinobacteria

    Science.gov (United States)

    Gao, Beile

    2012-01-01

    Summary: The phylum Actinobacteria harbors many important human pathogens and also provides one of the richest sources of natural products, including numerous antibiotics and other compounds of biotechnological interest. Thus, a reliable phylogeny of this large phylum and the means to accurately identify its different constituent groups are of much interest. Detailed phylogenetic and comparative analyses of >150 actinobacterial genomes reported here form the basis for achieving these objectives. In phylogenetic trees based upon 35 conserved proteins, most of the main groups of Actinobacteria as well as a number of their superageneric clades are resolved. We also describe large numbers of molecular markers consisting of conserved signature indels in protein sequences and whole proteins that are specific for either all Actinobacteria or their different clades (viz., orders, families, genera, and subgenera) at various taxonomic levels. These signatures independently support the existence of different phylogenetic clades, and based upon them, it is now possible to delimit the phylum Actinobacteria (excluding Coriobacteriia) and most of its major groups in clear molecular terms. The species distribution patterns of these markers also provide important information regarding the interrelationships among different main orders of Actinobacteria. The identified molecular markers, in addition to enabling the development of a stable and reliable phylogenetic framework for this phylum, also provide novel and powerful means for the identification of different groups of Actinobacteria in diverse environments. Genetic and biochemical studies on these Actinobacteria-specific markers should lead to the discovery of novel biochemical and/or other properties that are unique to different groups of Actinobacteria. PMID:22390973

  12. First molecular data and the phylogenetic position of the millipede-like centipede Edentistoma octosulcatum Tömösváry, 1882 (Chilopoda: Scolopendromorpha: Scolopendridae.

    Directory of Open Access Journals (Sweden)

    Varpu Vahtera

    Full Text Available Edentistoma octosulcatum Tömösváry, 1882, is a rare, superficially millipede-like centipede known only from Borneo and the Philippines. It is unique within the order Scolopendromorpha for its slow gait, robust tergites, and highly modified gizzard and mandible morphology. Not much is known about the biology of the species but it has been speculated to be arboreal with a possibly vegetarian diet. Until now its phylogenetic position within the subfamily Otostigminae has been based only on morphological characters, being variably ranked as a monotypic tribe (Arrhabdotini or classified with the Southeast Asian genus Sterropristes Attems, 1934. The first molecular data for E. octosulcatum sourced from a newly collected specimen from Sarawak were analysed with and without morphology. Parsimony analysis of 122 morphological characters together with two nuclear and two mitochondrial loci resolves Edentistoma as sister group to three Indo-Australian species of Rhysida, this clade in turn grouping with Ethmostigmus, whereas maximum likelihood and parsimony analyses of the molecular data on their own ally Edentistoma with species of Otostigmus. A position of Edentistoma within Otostigmini (rather than being its sister group as predicted by the Arrhabdotini hypothesis is consistently retrieved under different analytical conditions, but support values within the subfamily remain low for most nodes. The species exhibits strong pushing behaviour, suggestive of burrowing habits. Evidence against a suggested vegetarian diet is provided by observation of E. octosulcatum feeding on millipedes in the genus Trachelomegalus.

  13. Revising the phylogenetic position of the extinct Mascarene Parrot Mascarinus mascarin (Linnaeus 1771) (Aves: Psittaciformes: Psittacidae).

    Science.gov (United States)

    Podsiadlowski, Lars; Gamauf, Anita; Töpfer, Till

    2017-02-01

    The phylogenetic position of the extinct Mascarene Parrot Mascarinus mascarin from La Réunion has been unresolved for centuries. A recent molecular study unexpectedly placed M. mascarin within the clade of phenotypically very different Vasa parrots Coracopsis. Based on DNA extracted from the only other preserved Mascarinus specimen, we show that the previously obtained cytb sequence is probably an artificial composite of partial sequences from two other parrot species and that M. mascarin is indeed a part of the Psittacula diversification, placed close to P. eupatria and P. wardi. Copyright © 2016 Elsevier Inc. All rights reserved.

  14. Molecular and phylogenetic characterization of two species of the genus Nostoc (Cyanobacteria based on the cpcB-IGS-cpcA locus of the phycocyanin operon

    Directory of Open Access Journals (Sweden)

    IVANKA TENEVA

    2012-01-01

    Full Text Available Traditionally, the taxonomy of the genus Nostoc is based on morphological and physiological characters. The extreme morphological variability of the Nostoc species, due to their life cycle and environmental conditions, hampers the correct identification of the individual species. This is also one of the reasons for the disputed taxonomic positions and relationships between the genera Anabaena–Aphanizomenon as well as between Anabaena–Nostoc. Therefore, it is necessary to use additional markers for development of a polyphasic classification system of order Nostocales. In light of this, we here present the first molecular and phy-logenetic characterization of two species of the genus Nostoc (Nostoc linckia and Nostoc punctiforme based on the cpcB-IGS-cpcA locus of the phycocyanin oper-on. The phylogenetic position of these two species within order Nostocales as well as within division Cyanobacteria has been determined. Our results indicate that genus Nostoc is heterogeneous. Analysis of the IGS region between cpcB and cpcA showed that Nostoc and Anabaena are distinct genera. Reported molecular and phylogenetic data will be useful to solve other problematic points in the tax-onomy of genera Aphanizomenon, Anabaena and Nostoc.

  15. PAL: an object-oriented programming library for molecular evolution and phylogenetics.

    Science.gov (United States)

    Drummond, A; Strimmer, K

    2001-07-01

    Phylogenetic Analysis Library (PAL) is a collection of Java classes for use in molecular evolution and phylogenetics. PAL provides a modular environment for the rapid construction of both special-purpose and general analysis programs. PAL version 1.1 consists of 145 public classes or interfaces in 13 packages, including classes for models of character evolution, maximum-likelihood estimation, and the coalescent, with a total of more than 27000 lines of code. The PAL project is set up as a collaborative project to facilitate contributions from other researchers. AVAILIABILTY: The program is free and is available at http://www.pal-project.org. It requires Java 1.1 or later. PAL is licensed under the GNU General Public License.

  16. Molecular phylogenetic study at the generic boundary between the lichen-forming fungi Caloplaca and Xanthoria (Ascomycota, Teloschistaceae)

    DEFF Research Database (Denmark)

    Søchting, Ulrik; Lutzoni, François

    2003-01-01

    A molecular phylogenetic analysis of rDNA was performed for seven Caloplaca, seven Xanthoria, one Fulgensia and five outgroup species. Phylogenetic hypotheses are constructed based on nuclear small and large subunit rDNA, separately and in combination. Three strongly supported major monophyletic ...

  17. The phylogenetic position of the solitary zoanthid genus Sphenopus (Cnidaria: Hexacorallia)

    NARCIS (Netherlands)

    Reimer, J.D.; Lin, M.; Fujii, T.

    2012-01-01

    The zoanthid genus Sphenopus (Cnidaria: Anthozoa: Zoantharia), like many other brachycnemic zoanthids, is found in shallow subtropical and tropical waters, but is uniquely unitary (solitary, monostomatous), azooxanthellate, and free-living. With sparse knowledge of its phylogenetic position, this

  18. Phylogenetic Position of Barbus lacerta Heckel, 1843

    Directory of Open Access Journals (Sweden)

    Mustafa Korkmaz

    2015-11-01

    As a result, five clades come out from phylogenetic reconstruction and in phylogenetic tree Barbus lacerta determined to be sister group of Barbus macedonicus, Barbus oligolepis and Barbus plebejus complex.

  19. Identification of a vertically transmitted strain from Anaplasma marginale (UFMG3): Molecular and phylogenetic characterization, and evaluation of virulence.

    Science.gov (United States)

    Silvestre, Bruna T; Silveira, Júlia A G; Meneses, Rodrigo M; Facury-Filho, Elias J; Carvalho, Antônio U; Ribeiro, Múcio F B

    2016-02-01

    Bovine anaplasmosis is a disease caused by the intraerythrocytic rickettsia species Anaplasma marginale and results in great economic losses in tropical and subtropical regions. Vertical transmission is an important phenomenon that contributes to the persistence of different strains of the agent within the same herd. The identification of new strains and genetic characterization studies are essential to understanding their epidemiology and virulence and for vaccine development. The aim of this study was to perform molecular and phylogenetic characterizations of a new vertically transmitted strain from A. marginale and to evaluate its virulence by experimental inoculation of rickettsia-free calves. Thirty newborn Holstein calves were subjected to molecular tests for the detection of A. marginale, Babesia bovis and Babesia bigemina. Calves positive for A. marginale (n=3) were splenectomized and monitored for the clinical manifestations of anaplasmosis. Blood samples from one of the calves that presented rickettsemia of 42.8% and spontaneous recovery of clinical parameters were used for molecular and phylogenetic characterization (msp1a gene), and inoculum production was used for the evaluation of virulence. This strain was identified as UFMG3. Three tandem repeat forms (13 and MGI19) were identified from the analysis of the msp1a gene, in which the form MGI19 appeared twice. Analysis of these repeats revealed the presence of the sequences QASTSS and SSASGQQQESS and of aspartic acid (D) at position 20 of both repeats. Phylogenetic analysis showed a close relationship among the UFMG3, MGI19 and UFMG2 strains. For virulence evaluation, six Holstein calves were inoculated intravenously with 2×10(7)A. marginale UFMG3-infected erythrocytes. The calves showed maximum rickettsemia of 5.1%, a moderate decrease in packed cell volume and spontaneous recovery of clinical parameters without the need for treatment. The results of experimental inoculation suggest that the strain A

  20. Analysis of HIV subtypes and the phylogenetic tree in HIV-positive samples from Saudi Arabia

    International Nuclear Information System (INIS)

    Al-Zahrani, Alhusain J.

    2008-01-01

    Objective was to assess the prevalence of HIV-1 genetic subtypes in Saudi Arabia in samples that are serologically positive for HIV-1 and compare the HIV-1 genetic subtypes prevalent in Saudi Arabia with the subtypes prevalent in other countries. Thirty-nine HIV-1 positive samples were analyzed for HIV-1 subtypes using molecular techniques. The study is retrospective study that was conducted in Dammam, Kingdom of Saudi Arabia and in Abbott laboratories (United States of America) from2004 to 2007. All samples were seropositive for HIV-1 group M. Of the 39 seropositive samples, only 12 were polymerase chain reaction positive. Subtype C is the most common virus strain as it occurred in 58% of these samples; subtype B occurred in 17%; subtypes A, D and G were found in 8% each. The phylogenetic tree was also identified for the isolates. Detection of HIV subtypes is important for epidemiological purposes and may help in tracing the source of HIV infections in the Kingdom of Saudi Arabia. (author)

  1. Improved phylogenetic analyses corroborate a plausible position of Martialis heureka in the ant tree of life.

    Directory of Open Access Journals (Sweden)

    Patrick Kück

    Full Text Available Martialinae are pale, eyeless and probably hypogaeic predatory ants. Morphological character sets suggest a close relationship to the ant subfamily Leptanillinae. Recent analyses based on molecular sequence data suggest that Martialinae are the sister group to all extant ants. However, by comparing molecular studies and different reconstruction methods, the position of Martialinae remains ambiguous. While this sister group relationship was well supported by Bayesian partitioned analyses, Maximum Likelihood approaches could not unequivocally resolve the position of Martialinae. By re-analysing a previous published molecular data set, we show that the Maximum Likelihood approach is highly appropriate to resolve deep ant relationships, especially between Leptanillinae, Martialinae and the remaining ant subfamilies. Based on improved alignments, alignment masking, and tree reconstructions with a sufficient number of bootstrap replicates, our results strongly reject a placement of Martialinae at the first split within the ant tree of life. Instead, we suggest that Leptanillinae are a sister group to all other extant ant subfamilies, whereas Martialinae branch off as a second lineage. This assumption is backed by approximately unbiased (AU tests, additional Bayesian analyses and split networks. Our results demonstrate clear effects of improved alignment approaches, alignment masking and data partitioning. We hope that our study illustrates the importance of thorough, comprehensible phylogenetic analyses using the example of ant relationships.

  2. Phylogenetic relationships among Neoechinorhynchus species (Acanthocephala: Neoechinorhynchidae) from North-East Asia based on molecular data.

    Science.gov (United States)

    Malyarchuk, Boris; Derenko, Miroslava; Mikhailova, Ekaterina; Denisova, Galina

    2014-02-01

    Phylogenetic and statistical analyses of DNA sequences of two genes, cytochrome oxidase subunit 1 (cox 1) of the mitochondrial DNA and 18S subunit of the nuclear ribosomal RNA (18S rRNA), was used to characterize Neoechinorhynchus species from fishes collected in different localities of North-East Asia. It has been found that four species can be clearly recognized using molecular markers-Neoechinorhynchus tumidus, Neoechinorhynchus beringianus, Neoechinorhynchus simansularis and Neoechinorhynchus salmonis. 18S sequences ascribed to Neoechinorhynchus crassus specimens from North-East Asia were identical to those of N. tumidus, but differed substantially from North American N. crassus. We renamed North-East Asian N. crassus specimens to N. sp., although the possibility that they represent a subspecies of N. tumidus cannot be excluded, taking into account a relatively small distance between cox 1 sequences of North-East Asian specimens of N. crassus and N. tumidus. Maximum likelihood, maximum parsimony and Bayesian inference analyses were performed for phylogeny reconstruction. All the phylogenetic trees showed that North-East Asian species of Neoechinorhynchus analyzed in this study represent independent clades, with the only exception of N. tumidus and N. sp. for 18S data. Phylogenetic analysis has shown that the majority of species sampled (N. tumidus+N. sp., N. simansularis and N. beringianus) are probably very closely related, while N. salmonis occupies separate position in the trees, possibly indicating a North American origin of this species. © 2013.

  3. Phylogenetic Analysis Using Protein Mass Spectrometry.

    Science.gov (United States)

    Ma, Shiyong; Downard, Kevin M; Wong, Jason W H

    2017-01-01

    Through advances in molecular biology, comparative analysis of DNA sequences is currently the cornerstone in the study of molecular evolution and phylogenetics. Nevertheless, protein mass spectrometry offers some unique opportunities to enable phylogenetic analyses in organisms where DNA may be difficult or costly to obtain. To date, the methods of phylogenetic analysis using protein mass spectrometry can be classified into three categories: (1) de novo protein sequencing followed by classical phylogenetic reconstruction, (2) direct phylogenetic reconstruction using proteolytic peptide mass maps, and (3) mapping of mass spectral data onto classical phylogenetic trees. In this chapter, we provide a brief description of the three methods and the protocol for each method along with relevant tools and algorithms.

  4. Delimiting invasive Myriophyllum aquaticum in Kashmir Himalaya using a molecular phylogenetic approach.

    Science.gov (United States)

    Shah, M A; Ali, M A; Al-Hemaid, F M; Reshi, Z A

    2014-09-12

    Myriophyllum aquaticum (Vell.) Verdc. (family Haloragaceae) is one of the most invasive and destructive South American aquatic plant species and is present in a wide range of geographic regions, including the Kashmir Himalaya. Confusion regarding the taxonomic delimitation of M. aquaticum in the Himalayan region impedes effective and targeted management. Hence, our goal was improve the identification of M. aquaticum for exclusive delimitation from other related species in the study region using a molecular phylogenetic approach. A maximum parsimony tree recovered from phylogenetic analyses of the internal transcribed spacer sequences of nuclear ribosomal DNA was used to authenticate the identification of M. aquaticum. The results of this study can be used for targeted management of this tropical invader into the temperate Kashmir Himalaya.

  5. Molecular Phylogenetics of the Serranid Subfamily Epinephelinae: Speciation and Biogeography in a Nearshore Marine Fish Clade

    OpenAIRE

    Craig, Matthew T,

    2005-01-01

    The processes that shape present day distributions of marine organisms have remained a central topic in evolutionary biology, conservation biology, and ecology. In this thesis, genetic data from mitochondrial and nuclear genes were used to create a phylogenetic hypothesis for the groupers of the subfamily Epinephelinae as a means of evaluating the current taxonomy of the group and the geography of speciation in marine organisms. The molecular phylogenetic hypothesis presented in Chap...

  6. Phylogenetic position of Loricifera inferred from nearly complete 18S and 28S rRNA gene sequences.

    Science.gov (United States)

    Yamasaki, Hiroshi; Fujimoto, Shinta; Miyazaki, Katsumi

    2015-01-01

    Loricifera is an enigmatic metazoan phylum; its morphology appeared to place it with Priapulida and Kinorhyncha in the group Scalidophora which, along with Nematoida (Nematoda and Nematomorpha), comprised the group Cycloneuralia. Scarce molecular data have suggested an alternative phylogenetic hypothesis, that the phylum Loricifera is a sister taxon to Nematomorpha, although the actual phylogenetic position of the phylum remains unclear. Ecdysozoan phylogeny was reconstructed through maximum-likelihood (ML) and Bayesian inference (BI) analyses of nuclear 18S and 28S rRNA gene sequences from 60 species representing all eight ecdysozoan phyla, and including a newly collected loriciferan species. Ecdysozoa comprised two clades with high support values in both the ML and BI trees. One consisted of Priapulida and Kinorhyncha, and the other of Loricifera, Nematoida, and Panarthropoda (Tardigrada, Onychophora, and Arthropoda). The relationships between Loricifera, Nematoida, and Panarthropoda were not well resolved. Loricifera appears to be closely related to Nematoida and Panarthropoda, rather than grouping with Priapulida and Kinorhyncha, as had been suggested by previous studies. Thus, both Scalidophora and Cycloneuralia are a polyphyletic or paraphyletic groups. In addition, Loricifera and Nematomorpha did not emerge as sister groups.

  7. Molecular and phylogenetic analysis of the filarial nematode Micipsella numidica from the hare Lepus europaeus in Italy.

    Science.gov (United States)

    Gabrielli, S; Galuppi, R; Fraulo, M; Savini, F; Morandi, B; Cancrini, G; Poglayen, G

    2016-07-01

    The genus Micipsella comprises three species of filariae to date identified in lagomorphs only, whereas the other genera belonging to the subfamily Splendidofilariinae are described as parasites of birds, reptiles and mammals. In the present study seven specimens of Micipsella numidica (Seurat, 1917), collected from the hare Lepus europaeus in Italy, were characterized genetically by molecular amplification of the mitochondrial genes (12S rDNA; cox1) and the 5S rDNA gene spacer region. Phylogenetic trees inferred using available sequences from filariae and those identified in this study evidenced a close relationship between M. numidica and Splendidofilariinae of other mammals and reptiles (Rumenfilaria andersoni and Madathamugadia hiepei). The present findings, apart from adding new data about the hosts in Italy, support the taxonomic position of M. numidica and highlight the substantial biological and molecular differences existing between Splendidofilariinae and other Onchocercidae. The study also contributes to our knowledge of the molecular/genetic diagnosis of filarial parasites of veterinary and medical concern in any vertebrate or invertebrate host.

  8. A phylogenetic comparison of urease-positive thermophilic Campylobacter (UPTC) and urease-negative (UN) C. lari.

    Science.gov (United States)

    Hirayama, Junichi; Tazumi, Akihiro; Hayashi, Kyohei; Tasaki, Erina; Kuribayashi, Takashi; Moore, John E; Millar, Beverley C; Matsuda, Motoo

    2011-06-01

    In the present study, the reliability of full-length gene sequence information for several genes including 16S rRNA was examined, for the discrimination of the two representative Campylobacter lari taxa, namely urease-negative (UN) C. lari and urease-positive thermophilic Campylobacter (UPTC). As previously described, 16S rRNA gene sequence are not reliable for the molecular discrimination of UN C. lari from UPTC organisms employing both the unweighted pair group method using arithmetic means analysis (UPGMA) and neighbor joining (NJ) methods. In addition, three composite full-length gene sequences (ciaB, flaC and vacJ) out of seven gene loci examined were reliable for discrimination employing dendrograms constructed by the UPGMA method. In addition, all the dendrograms of the NJ phylogenetic trees constructed based on the nine gene information were not reliable for the discrimination. Three composite full-length gene sequences (ciaB, flaC and vacJ) were reliable for the molecular discrimination between UN C. lari and UPTC organisms employing the UPGMA method, as well as among four thermophilic Campylobacter species. Copyright © 2011 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  9. Molecular identification and phylogenetic analysis of Dipetalonema evansi (LEWIS, 1882) in camels (Camelus dromedarius) of Iran.

    Science.gov (United States)

    Sazmand, Alireza; Eigner, Barbara; Mirzaei, Mohammad; Hekmatimoghaddam, Seyedhossein; Harl, Josef; Duscher, Georg Gerhard; Fuehrer, Hans-Peter; Joachim, Anja

    2016-04-01

    Despite the economic importance of camels, the parasites that affect them have not received adequate attention so far and molecular studies are scarce compared to other livestock. In this study, we characterized peripheral blood microfilariae in 200 healthy one-humped camels (Camelus dromedarius) from south-east Iran by microscopy and molecular tools to receive a more detailed insight into prevalence and species that affect them. Moreover, adult specimens of the filarial nematode Dipetalonema evansi were collected from the carcass of an infected animal. Microscopic examination was performed on Giemsa-stained blood smears, and blood was also spotted on Whatman FTA(®) cards for DNA analysis. Genomic DNA was extracted, and PCR was carried out for the detection of filaroid helminths, followed by sequence analysis of positive samples. Four samples were positive for microfilariae by microscopy, while 16 animals (8 %) were positive by PCR. Sequence analysis revealed D. evansi in all cases. Phylogenetic analysis of a cytochrome C oxidase subunit I (COI) sequence of filaroid nematodes showed that most species in a single genus cluster in the same clade; however, D. evansi and D. gracile are not monophyletic and branch rather at the base of the tree. Further studies on the life cycle of D. evansi, specifically the identification of intermediate host(s), have become feasible with the provision of the first specific COI sequences in this study.

  10. Inferring phylogenetic trees from the knowledge of rare evolutionary events.

    Science.gov (United States)

    Hellmuth, Marc; Hernandez-Rosales, Maribel; Long, Yangjing; Stadler, Peter F

    2018-06-01

    Rare events have played an increasing role in molecular phylogenetics as potentially homoplasy-poor characters. In this contribution we analyze the phylogenetic information content from a combinatorial point of view by considering the binary relation on the set of taxa defined by the existence of a single event separating two taxa. We show that the graph-representation of this relation must be a tree. Moreover, we characterize completely the relationship between the tree of such relations and the underlying phylogenetic tree. With directed operations such as tandem-duplication-random-loss events in mind we demonstrate how non-symmetric information constrains the position of the root in the partially reconstructed phylogeny.

  11. Phylemon 2.0: a suite of web-tools for molecular evolution, phylogenetics, phylogenomics and hypotheses testing.

    Science.gov (United States)

    Sánchez, Rubén; Serra, François; Tárraga, Joaquín; Medina, Ignacio; Carbonell, José; Pulido, Luis; de María, Alejandro; Capella-Gutíerrez, Salvador; Huerta-Cepas, Jaime; Gabaldón, Toni; Dopazo, Joaquín; Dopazo, Hernán

    2011-07-01

    Phylemon 2.0 is a new release of the suite of web tools for molecular evolution, phylogenetics, phylogenomics and hypotheses testing. It has been designed as a response to the increasing demand of molecular sequence analyses for experts and non-expert users. Phylemon 2.0 has several unique features that differentiates it from other similar web resources: (i) it offers an integrated environment that enables evolutionary analyses, format conversion, file storage and edition of results; (ii) it suggests further analyses, thereby guiding the users through the web server; and (iii) it allows users to design and save phylogenetic pipelines to be used over multiple genes (phylogenomics). Altogether, Phylemon 2.0 integrates a suite of 30 tools covering sequence alignment reconstruction and trimming; tree reconstruction, visualization and manipulation; and evolutionary hypotheses testing.

  12. Phylemon 2.0: a suite of web-tools for molecular evolution, phylogenetics, phylogenomics and hypotheses testing

    Science.gov (United States)

    Sánchez, Rubén; Serra, François; Tárraga, Joaquín; Medina, Ignacio; Carbonell, José; Pulido, Luis; de María, Alejandro; Capella-Gutíerrez, Salvador; Huerta-Cepas, Jaime; Gabaldón, Toni; Dopazo, Joaquín; Dopazo, Hernán

    2011-01-01

    Phylemon 2.0 is a new release of the suite of web tools for molecular evolution, phylogenetics, phylogenomics and hypotheses testing. It has been designed as a response to the increasing demand of molecular sequence analyses for experts and non-expert users. Phylemon 2.0 has several unique features that differentiates it from other similar web resources: (i) it offers an integrated environment that enables evolutionary analyses, format conversion, file storage and edition of results; (ii) it suggests further analyses, thereby guiding the users through the web server; and (iii) it allows users to design and save phylogenetic pipelines to be used over multiple genes (phylogenomics). Altogether, Phylemon 2.0 integrates a suite of 30 tools covering sequence alignment reconstruction and trimming; tree reconstruction, visualization and manipulation; and evolutionary hypotheses testing. PMID:21646336

  13. Molecular Detection, Phylogenetic Analysis, and Identification of Transcription Motifs in Feline Leukemia Virus from Naturally Infected Cats in Malaysia

    Directory of Open Access Journals (Sweden)

    Faruku Bande

    2014-01-01

    Full Text Available A nested PCR assay was used to determine the viral RNA and proviral DNA status of naturally infected cats. Selected samples that were FeLV-positive by PCR were subjected to sequencing, phylogenetic analysis, and motifs search. Of the 39 samples that were positive for FeLV p27 antigen, 87.2% (34/39 were confirmed positive with nested PCR. FeLV proviral DNA was detected in 38 (97.3% of p27-antigen negative samples. Malaysian FeLV isolates are found to be highly similar with a homology of 91% to 100%. Phylogenetic analysis revealed that Malaysian FeLV isolates divided into two clusters, with a majority (86.2% sharing similarity with FeLV-K01803 and fewer isolates (13.8% with FeLV-GM1 strain. Different enhancer motifs including NF-GMa, Krox-20/WT1I-del2, BAF1, AP-2, TBP, TFIIF-beta, TRF, and TFIID are found to occur either in single, duplicate, triplicate, or sets of 5 in different positions within the U3-LTR-gag region. The present result confirms the occurrence of FeLV viral RNA and provirus DNA in naturally infected cats. Malaysian FeLV isolates are highly similar, and a majority of them are closely related to a UK isolate. This study provides the first molecular based information on FeLV in Malaysia. Additionally, different enhancer motifs likely associated with FeLV related pathogenesis have been identified.

  14. Molecular and morphological analyses reveal phylogenetic relationships of stingrays focusing on the family Dasyatidae (Myliobatiformes.

    Directory of Open Access Journals (Sweden)

    Kean Chong Lim

    Full Text Available Elucidating the phylogenetic relationships of the current but problematic Dasyatidae (Order Myliobatiformes was the first priority of the current study. Here, we studied three molecular gene markers of 43 species (COI gene, 33 species (ND2 gene and 34 species (RAG1 gene of stingrays to draft out the phylogenetic tree of the order. Nine character states were identified and used to confirm the molecularly constructed phylogenetic trees. Eight or more clades (at different hierarchical level were identified for COI, ND2 and RAG1 genes in the Myliobatiformes including four clades containing members of the present Dasyatidae, thus rendering the latter non-monophyletic. The uncorrected p-distance between these four 'Dasytidae' clades when compared to the distance between formally known families confirmed that these four clades should be elevated to four separate families. We suggest a revision of the present classification, retaining the Dasyatidae (Dasyatis and Taeniurops species but adding three new families namely, Neotrygonidae (Neotrygon and Taeniura species, Himanturidae (Himantura species and Pastinachidae (Pastinachus species. Our result indicated the need to further review the classification of Dasyatis microps. By resolving the non-monophyletic problem, the suite of nine character states enables the natural classification of the Myliobatiformes into at least thirteen families based on morphology.

  15. Molecular phylogenetic reconstruction of the endemic Asian salamander family Hynobiidae (Amphibia, Caudata).

    Science.gov (United States)

    Weisrock, David W; Macey, J Robert; Matsui, Masafumi; Mulcahy, Daniel G; Papenfuss, Theodore J

    2013-01-01

    The salamander family Hynobiidae contains over 50 species and has been the subject of a number of molecular phylogenetic investigations aimed at reconstructing branches across the entire family. In general, studies using the greatest amount of sequence data have used reduced taxon sampling, while the study with the greatest taxon sampling has used a limited sequence data set. Here, we provide insights into the phylogenetic history of the Hynobiidae using both dense taxon sampling and a large mitochondrial DNA sequence data set. We report exclusive new mitochondrial DNA data of 2566 aligned bases (with 151 excluded sites, of included sites 1157 are variable with 957 parsimony informative). This is sampled from two genic regions encoding a 12S-16S region (the 3' end of 12S rRNA, tRNA(VAI), and the 5' end of 16S rRNA), and a ND2-COI region (ND2, tRNA(Trp), tRNA(Ala), tRNA(Asn), the origin for light strand replication--O(L), tRNA(Cys), tRNAT(Tyr), and the 5' end of COI). Analyses using parsimony, Bayesian, and maximum likelihood optimality criteria produce similar phylogenetic trees, with discordant branches generally receiving low levels of branch support. Monophyly of the Hynobiidae is strongly supported across all analyses, as is the sister relationship and deep divergence between the genus Onychodactylus with all remaining hynobiids. Within this latter grouping our phylogenetic results identify six clades that are relatively divergent from one another, but for which there is minimal support for their phylogenetic placement. This includes the genus Batrachuperus, the genus Hynobius, the genus Pachyhynobius, the genus Salamandrella, a clade containing the genera Ranodon and Paradactylodon, and a clade containing the genera Liua and Pseudohynobius. This latter clade receives low bootstrap support in the parsimony analysis, but is consistent across all three analytical methods. Our results also clarify a number of well-supported relationships within the larger

  16. An evaluation of phylogenetic informativeness profiles and the molecular phylogeny of diplazontinae (Hymenoptera, Ichneumonidae).

    Science.gov (United States)

    Klopfstein, Seraina; Kropf, Christian; Quicke, Donald L J

    2010-03-01

    How to quantify the phylogenetic information content of a data set is a longstanding question in phylogenetics, influencing both the assessment of data quality in completed studies and the planning of future phylogenetic projects. Recently, a method has been developed that profiles the phylogenetic informativeness (PI) of a data set through time by linking its site-specific rates of change to its power to resolve relationships at different timescales. Here, we evaluate the performance of this method in the case of 2 standard genetic markers for phylogenetic reconstruction, 28S ribosomal RNA and cytochrome oxidase subunit 1 (CO1) mitochondrial DNA, with maximum parsimony, maximum likelihood, and Bayesian analyses of relationships within a group of parasitoid wasps (Hymenoptera: Ichneumonidae, Diplazontinae). Retrieving PI profiles of the 2 genes from our own and from 3 additional data sets, we find that the method repeatedly overestimates the performance of the more quickly evolving CO1 compared with 28S. We explore possible reasons for this bias, including phylogenetic uncertainty, violation of the molecular clock assumption, model misspecification, and nonstationary nucleotide composition. As none of these provides a sufficient explanation of the observed discrepancy, we use simulated data sets, based on an idealized setting, to show that the optimum evolutionary rate decreases with increasing number of taxa. We suggest that this relationship could explain why the formula derived from the 4-taxon case overrates the performance of higher versus lower rates of evolution in our case and that caution should be taken when the method is applied to data sets including more than 4 taxa.

  17. Molecular phylogenetics of finches and sparrows: consequences of character state removal in cytochrome b sequences.

    Science.gov (United States)

    Groth, J G

    1998-12-01

    The complete mitochondrial cytochrome b genes of 53 genera of oscine passerine birds representing the major groups of finches and some allies were compared. Phylogenetic trees resulting from three levels of character partition removal (no data removed, transitions at third positions of codons removed, and all transitions removed [transversion parsimony]) were generally concordant, and all supported several basic statements regarding relationships of finches and finch-like birds, including: (1) larks (Alaudidae) show no close relationship to any finch group; (2) Peucedramus (olive warbler) is phylogenetically far removed from true wood warblers; (3) a clade consisting of fringillids, passerids, motacillids, and emberizids is supported, and this clade is characterized by evolution of a vestigial 10th wing primary; and (4) Hawaiian honeycreepers are derived from within the cardueline finches. Excluding transition substitutions at third positions of codons resulted in phylogenetic trees similar to, but with greater bootstrap nodal support than, trees derived using either all data (equally weighted) or transversion parsimony. Relative to the shortest trees obtained using all data, the topologies obtained after elimination of third-position transitions showed only slight increases in realized treelength and homoplasy. These increases were negligable compared to increases in overall nodal support; therefore, this partition removal scheme may enhance recovery of deep phylogenetic signal in protein-coding DNA datasets. Copyright 1998 Academic Press.

  18. A phylogenetic Kalman filter for ancestral trait reconstruction using molecular data.

    Science.gov (United States)

    Lartillot, Nicolas

    2014-02-15

    Correlation between life history or ecological traits and genomic features such as nucleotide or amino acid composition can be used for reconstructing the evolutionary history of the traits of interest along phylogenies. Thus far, however, such ancestral reconstructions have been done using simple linear regression approaches that do not account for phylogenetic inertia. These reconstructions could instead be seen as a genuine comparative regression problem, such as formalized by classical generalized least-square comparative methods, in which the trait of interest and the molecular predictor are represented as correlated Brownian characters coevolving along the phylogeny. Here, a Bayesian sampler is introduced, representing an alternative and more efficient algorithmic solution to this comparative regression problem, compared with currently existing generalized least-square approaches. Technically, ancestral trait reconstruction based on a molecular predictor is shown to be formally equivalent to a phylogenetic Kalman filter problem, for which backward and forward recursions are developed and implemented in the context of a Markov chain Monte Carlo sampler. The comparative regression method results in more accurate reconstructions and a more faithful representation of uncertainty, compared with simple linear regression. Application to the reconstruction of the evolution of optimal growth temperature in Archaea, using GC composition in ribosomal RNA stems and amino acid composition of a sample of protein-coding genes, confirms previous findings, in particular, pointing to a hyperthermophilic ancestor for the kingdom. The program is freely available at www.phylobayes.org.

  19. Molecular phylogenetic analysis of Commiphora (Burseraceae) yields insight on the evolution and historical biogeography of an "impossible" genus.

    Science.gov (United States)

    Weeks, Andrea; Simpson, Beryl B

    2007-01-01

    Expansion of the arid zone of sub-Saharan tropical Africa during the Miocene is posited as a significant contributing factor in the evolution of contemporary African flora. Nevertheless, few molecular phylogenetic studies have tested this hypothesis using reconstructed historical biogeographies of plants within this zone. Here, we present a molecular phylogeny of Commiphora, a predominantly tropical African, arid-adapted tree genus, in order to test the monophyly of its taxonomic sections and identify clades that will help direct future study of this species-rich and geographically widespread taxon. We then use multiple fossil calibrations of Commiphora phylogeny to determine the timing of well-supported diversification events within the genus and interpret these age estimates to determine the relative contribution of vicariance and dispersal in the expansion of Commiphora's geographic range. We find that Commiphora is sister to Vietnamese Bursera tonkinensis and that its crown group radiation corresponds with the onset of the Miocene.

  20. Phylogenetic analysis and systematic position of two new species of the ant genus Crematogaster (Hymenoptera, Formicidae from Southeast Asia

    Directory of Open Access Journals (Sweden)

    Shingo Hosoishi

    2017-11-01

    Full Text Available Two distinct new species of the ant genus Crematogaster, C. khmerensis sp. nov. and C. pfeifferi sp. nov., are described from Cambodia and Malaysia, respectively. The two species are unique among Asian Crematogaster in that they have vertically directed propodeal spines, but their systematic positions have not been determined based on morphological characters alone. Molecular phylogenetic analysis of 89 Crematogaster taxon matrices previously published plus C. khmerensis sp. nov., using nuclear genes, reveals that C. khmerensis sp. nov. is nested within the Australo-Asian Crematogaster clade. Morphological assignment of the developed pronotal shoulders implies a close relationship between C. khmerensis sp. nov. and the C. tetracantha-group. Based on molecular and morphological evidence, we erect a new species group, C. khmerensis-group, to contain C. khmerensis sp. nov. and C. pfeifferi sp. nov. Divergence time estimates using MCMCTree shows that the root node of the C. khmerensis sp. nov. terminal is estimated to be of middle Miocene age at 15 million years old. The position of the C. khmerensis-group well supports the Oriental- to Australian-region dispersal history that has been proposed for the Australo-Asian Crematogaster clade.

  1. Detection, molecular typing and phylogenetic analysis of Leishmania isolated from cases of leishmaniasis among Syrian refugees in Lebanon

    Directory of Open Access Journals (Sweden)

    Tamara Salloum

    2016-06-01

    Two molecular typing methods of 39 FFPE Leishmania isolates were used: the ITS1-PCR RFLP and the nested ITS1-5.8S rDNA gene amplification followed by sequencing and phylogenetic analysis. The efficiency of these two techniques in Leishmania identification was compared and the phylogenetic relationships among these isolates were illustrated based on the neighbor-joining (NJ method. The results were statistically correlated with the parasitic index (PI. The DNA storage in formalin-fixed paraffin embedded (FFPE tissues was assessed as well. The parasites identified were all L. tropica as determined by both techniques. ITS1-5.8S rDNA gene based typing proved to be more sensitive in the detection of parasites (positive in 69.2% of the isolates as opposed to the ITS1-PCR RFLP method that was successful in identifying L. tropica in only 43.6% of the isolates. Sequencing and phylogenetic analysis revealed high levels of heterogeneity. A statistically significant correlation was observed between PI and the results of the nested ITS1-5.8S rDNA gene PCR. Genotyping at the species level is essential for monitoring the relative frequency of CL in the Mediterranean area that is correlated to three different Leishmania species (Leishmania infantum, Leishmania major and L. tropica, each characterized by distinct epidemiological features. The obtained results highlight the need to find a universally accepted diagnostic tool for Leishmania typing.

  2. Impact of gene molecular evolution on phylogenetic reconstruction: a case study in the rosids (Superorder Rosanae, Angiosperms).

    Science.gov (United States)

    Hilu, Khidir W; Black, Chelsea M; Oza, Dipan

    2014-01-01

    Rate of substitution of genomic regions is among the most debated intrinsic features that impact phylogenetic informativeness. However, this variable is also coupled with rates of nonsynonymous substitutions that underscore the nature and degree of selection on the selected genes. To empirically address these variables, we constructed four completely overlapping data sets of plastid matK, atpB, rbcL, and mitochondrial matR genes and used the rosid lineage (angiosperms) as a working platform. The genes differ in combinations of overall rates of nucleotide and amino acid substitutions. Tree robustness, homoplasy, accuracy in contrast to a reference tree, and phylogenetic informativeness are evaluated. The rapidly evolving/unconstrained matK faired best, whereas remaining genes varied in degrees of contribution to rosid phylogenetics across the lineage's 108 million years evolutionary history. Phylogenetic accuracy was low with the slowly evolving/unconstrained matR despite least amount of homoplasy. Third codon positions contributed the highest amount of parsimony informative sites, resolution and informativeness, but magnitude varied with gene mode of evolution. These findings are in clear contrast with the views that rapidly evolving regions and the 3rd codon position have inevitable negative impact on phylogenetic reconstruction at deep historic level due to accumulation of multiple hits and subsequent elevation in homoplasy and saturation. Relaxed evolutionary constraint in rapidly evolving genes distributes substitutions across codon positions, an evolutionary mode expected to reduce the frequency of multiple hits. These findings should be tested at deeper evolutionary histories.

  3. Hepatozoon canis in German red foxes (Vulpes vulpes) and their ticks: molecular characterization and the phylogenetic relationship to other Hepatozoon spp.

    Science.gov (United States)

    Najm, Nour-Addeen; Meyer-Kayser, Elisabeth; Hoffmann, Lothar; Pfister, Kurt; Silaghi, Cornelia

    2014-07-01

    In this study, the prevalence of Hepatozoon spp. in red foxes (Vulpes vulpes) and their ticks from Germany, as well as molecular characterizations and phylogenetic relationship to other Hepatozoon spp. were investigated. DNA extracts of 261 spleen samples and 1,953 ticks were examined for the presence of Hepatozoon spp. by a conventional polymerase chain reaction (PCR) targeting the 18S rRNA gene. The ticks included four tick species: Ixodes ricinus, Ixodes canisuga, Ixodes hexagonus and Dermacentor reticulatus. A total of 118/261 foxes (45.2%) and 148/1,953 ticks (7.5%) were Hepatozoon PCR-positive. Amplicons from 36 positive foxes and 41 positive ticks were sequenced. All sequences obtained from foxes and 39/41 from ticks had a 99% similarity to Hepatozoon canis, whereas two ticks' sequences had a 99% identity to Hepatozoon sp. The obtained Hepatozoon sequences in this study were phylogenetically related to other Hepatozoon sequences detected in other countries, which may represent strain variants. The high prevalence of H. canis DNA in red foxes in this study supports the suggested role of those animals in distribution of this parasite. Furthermore, detection of DNA of H. canis in foxes and all examined tick species collected from those foxes allows speculating about previously undescribed potential vectors for H. canis and suggests a potential role of the red fox in its natural endemic cycles.

  4. Molecular Phylogenetic: Organism Taxonomy Method Based on Evolution History

    Directory of Open Access Journals (Sweden)

    N.L.P Indi Dharmayanti

    2011-03-01

    Full Text Available Phylogenetic is described as taxonomy classification of an organism based on its evolution history namely its phylogeny and as a part of systematic science that has objective to determine phylogeny of organism according to its characteristic. Phylogenetic analysis from amino acid and protein usually became important area in sequence analysis. Phylogenetic analysis can be used to follow the rapid change of a species such as virus. The phylogenetic evolution tree is a two dimensional of a species graphic that shows relationship among organisms or particularly among their gene sequences. The sequence separation are referred as taxa (singular taxon that is defined as phylogenetically distinct units on the tree. The tree consists of outer branches or leaves that represents taxa and nodes and branch represent correlation among taxa. When the nucleotide sequence from two different organism are similar, they were inferred to be descended from common ancestor. There were three methods which were used in phylogenetic, namely (1 Maximum parsimony, (2 Distance, and (3 Maximum likehoood. Those methods generally are applied to construct the evolutionary tree or the best tree for determine sequence variation in group. Every method is usually used for different analysis and data.

  5. BIMLR: a method for constructing rooted phylogenetic networks from rooted phylogenetic trees.

    Science.gov (United States)

    Wang, Juan; Guo, Maozu; Xing, Linlin; Che, Kai; Liu, Xiaoyan; Wang, Chunyu

    2013-09-15

    Rooted phylogenetic trees constructed from different datasets (e.g. from different genes) are often conflicting with one another, i.e. they cannot be integrated into a single phylogenetic tree. Phylogenetic networks have become an important tool in molecular evolution, and rooted phylogenetic networks are able to represent conflicting rooted phylogenetic trees. Hence, the development of appropriate methods to compute rooted phylogenetic networks from rooted phylogenetic trees has attracted considerable research interest of late. The CASS algorithm proposed by van Iersel et al. is able to construct much simpler networks than other available methods, but it is extremely slow, and the networks it constructs are dependent on the order of the input data. Here, we introduce an improved CASS algorithm, BIMLR. We show that BIMLR is faster than CASS and less dependent on the input data order. Moreover, BIMLR is able to construct much simpler networks than almost all other methods. BIMLR is available at http://nclab.hit.edu.cn/wangjuan/BIMLR/. © 2013 Elsevier B.V. All rights reserved.

  6. Taxonomic revision and molecular phylogenetics of the Idarnes incertus species-group (Hymenoptera, Agaonidae, Sycophaginae

    Directory of Open Access Journals (Sweden)

    Fernando H.A. Farache

    2017-01-01

    Full Text Available Sycophaginae is a group of non-pollinating fig wasps considered closely related to the fig pollinators (Agaoninae, Tetrapusiinae, and Kradibiinae in the most recent phylogenetic analyses. They occur in all tropical regions and are associated with Ficus subgenera Urostigma and Sycomorus. There are six described genera of Sycophaginae, and two are native and confined to the Neotropics, namely Idarnes Walker, 1843 and Anidarnes Bouček, 1993. Genus Idarnes is divided into three morphologically distinct groups that were proven to be monophyletic by recent molecular phylogenetic analyses. In this paper we reviewed the Idarnes incertus species-group and provide detailed morphological descriptions and illustrations for the species belonging to this group. Three previously described species were redescribed: I. brasiliensis (Mayr, 1906 comb. nov., I. hansoni Bouček, 1993, and I. incertus (Ashmead, 1900. Seventeen new species are described by Farache and Rasplus: I. amacayacuensis sp. n., I. amazonicus sp. n., I. americanae sp. n., I. badiovertex sp. n., I. brevis sp. n., I. brunneus sp. n., I. comptoni sp. n., I. cremersiae sp. n., I. dimorphicus sp. n., I. flavicrus sp. n., I. flaviventris sp. n., I. gibberosus sp. n., I. gordhi sp. n., I. maximus sp. n., I. nigriventris sp. n., I. pseudoflavus sp. n. and I. ramirezi sp. n. We provided keys for the identification of the species as well as for recognising the different species-groups of Idarnes and a closely related genus (Sycophaga Westwood, 1840. Additionally, phylogenetic relationships among 13 species of the I. incertus species-group were inferred using four molecular markers and discussed in the light of Ficus taxonomy and host specificity.

  7. Evolution of species diversity in the genus Chamaecostus (Costaceae): molecular phylogenetics and morphometric approaches

    OpenAIRE

    Andre, Thiago; Specht, Chelsea; Salzman, Shayla; Palma-Silva, Clarisse [UNESP; Wendt, Tania

    2015-01-01

    While most species within the genus Chamaecostus (Costaceae) are well defined, the broad geographic range and long list of synonyms associated with Chamaecostus subsessilis led us to believe there may be some cryptic species within the complex. We thus investigate the phylogenetic relationships of species in the Chamaecostus lineage and specifically test the monophyly and diversity of the Chamaecostus subsessilis species complex from a population perspective by analyzing molecular sequence da...

  8. Phylogenetic Signal in AFLP Data Sets

    NARCIS (Netherlands)

    Koopman, W.J.M.

    2005-01-01

    AFLP markers provide a potential source of phylogenetic information for molecular systematic studies. However, there are properties of restriction fragment data that limit phylogenetic interpretation of AFLPs. These are (a) possible nonindependence of fragments, (b) problems of homology assignment

  9. Paleogenetic analyses reveal unsuspected phylogenetic affinities between mice and the extinct Malpaisomys insularis, an endemic rodent of the Canaries.

    Directory of Open Access Journals (Sweden)

    Marie Pagès

    Full Text Available BACKGROUND: The lava mouse, Malpaisomys insularis, was endemic to the Eastern Canary islands and became extinct at the beginning of the 14(th century when the Europeans reached the archipelago. Studies to determine Malpaisomys' phylogenetic affinities, based on morphological characters, remained inconclusive because morphological changes experienced by this insular rodent make phylogenetic investigations a real challenge. Over 20 years since its first description, Malpaisomys' phylogenetic position remains enigmatic. METHODOLOGY/PRINCIPAL FINDINGS: In this study, we resolved this issue using molecular characters. Mitochondrial and nuclear markers were successfully amplified from subfossils of three lava mouse samples. Molecular phylogenetic reconstructions revealed, without any ambiguity, unsuspected relationships between Malpaisomys and extant mice (genus Mus, Murinae. Moreover, through molecular dating we estimated the origin of the Malpaisomys/mouse clade at 6.9 Ma, corresponding to the maximal age at which the archipelago was colonised by the Malpaisomys ancestor via natural rafting. CONCLUSION/SIGNIFICANCE: This study reconsiders the derived morphological characters of Malpaisomys in light of this unexpected molecular finding. To reconcile molecular and morphological data, we propose to consider Malpaisomys insularis as an insular lineage of mouse.

  10. Molecular and phylogenetic evidence of chikungunya virus circulating in Assam, India

    Directory of Open Access Journals (Sweden)

    Prafulla Dutta

    2017-01-01

    Full Text Available Purpose: Northeast Region of India possesses an abundant number of Aedes mosquitoes, the common vector for Dengue and Chikungunya (CHIK. Dengue is reported every year from Assam, but active surveillance for CHIK virus (CHIKV infection is lacking in this part of India. Therefore, this present study has been undertaken to detect any CHIKV infection during a dengue outbreak in Assam. Materials and Methods: A total of 42 dengue negative samples collected from Guwahati were screened for the presence of CHIK IgM antibodies. Further, all the samples were processed for CHIKV RNA detection by reverse transcriptase-polymerase chain reaction (RT-PCR. Phylogenetic analysis was done by Maximum Likelihood method using Kimura-2 parameter model. Results: No IgM positivity was found in the processed samples; however, 7 samples were positive for CHIKV by RT-PCR. Phylogenetic analysis revealed that the circulating CHIKV belonged to Eastern, Central and Southern African genotype. Sequence analysis showed two uniform nucleotide substitutions and very less amino acid substitution. Conclusion: Silent existence of CHIKV beside dengue is reported from this study. Therefore, CHIKV diagnosis should be included as a regular practice for active surveillance of the disease and its accomplishment before commencing an outbreak.

  11. Molecular phylogenetic analysis of fleshy pored mushrooms: Neoboletus luridiformis and Hortiboletus rubellus from western Himalayan range of Pakistan

    International Nuclear Information System (INIS)

    Sarwar, S.; Khalid, N.; Dentinger, B.M.

    2016-01-01

    Fleshy pored mushrooms is the name given to boletes due to their porous hymenium and fleshy nature. These are ectomycorrhizal basidiomycetes found in all continents except Antarctica. These mushrooms are important economically due to their edibility and medicinal value. This research work highlights the diversity of boletes in Pakistan and their correct identification by using molecular phylogenetic techniques. Western Himalayan range (WHR) of Pakistan is considered as diversity rich area. During present investigation regarding diversity of boletes in these areas, two bolete taxa viz. Hortiboletus rubellus and Neoboletus luridiformis were found under conifers. These mushrooms were collected and analyzed morphologically as well as phylogenetically by using Internal Transcribed Spacer (ITS) region of nrDNA sequences, and compared with their allies. All description and comparison with related taxa is provided in detail. These boletes are first time analyzed using molecular method from Pakistan. (author)

  12. Molecular characterization and phylogenetic analysis of small ruminant lentiviruses isolated from Canadian sheep and goats

    Directory of Open Access Journals (Sweden)

    Bertoni Giuseppe

    2011-06-01

    Full Text Available Abstract Background Small Ruminant Lentiviruses (SRLV are widespread in Canadian sheep and goats and represent an important health issue in these animals. There is however no data about the genetic diversity of Caprine Arthritis Encephalitis Virus (CAEV or Maedi Visna Virus (MVV in this country. Findings We performed a molecular and phylogenetic analysis of sheep and goat lentiviruses from a small geographic area in Canada using long sequences from the gag region of 30 infected sheep and 36 infected goats originating from 14 different flocks. Pairwise DNA distance and phylogenetic analyses revealed that all SRLV sequences obtained from sheep clustered tightly with prototypical Maedi visna sequences from America. Similarly, all SRLV strains obtained from goats clustered tightly with prototypical US CAEV-Cork strain. Conclusions The data reported in this study suggests that Canadian and US SRLV strains share common origins. In addition, the molecular data failed to bring to light any evidence of past cross species transmission between sheep and goats, which is consistent with the type of farming practiced in this part of the country where single species flocks predominate and where opportunities of cross species transmissions are proportionately low.

  13. Phylogenetic classification of bony fishes.

    Science.gov (United States)

    Betancur-R, Ricardo; Wiley, Edward O; Arratia, Gloria; Acero, Arturo; Bailly, Nicolas; Miya, Masaki; Lecointre, Guillaume; Ortí, Guillermo

    2017-07-06

    Fish classifications, as those of most other taxonomic groups, are being transformed drastically as new molecular phylogenies provide support for natural groups that were unanticipated by previous studies. A brief review of the main criteria used by ichthyologists to define their classifications during the last 50 years, however, reveals slow progress towards using an explicit phylogenetic framework. Instead, the trend has been to rely, in varying degrees, on deep-rooted anatomical concepts and authority, often mixing taxa with explicit phylogenetic support with arbitrary groupings. Two leading sources in ichthyology frequently used for fish classifications (JS Nelson's volumes of Fishes of the World and W. Eschmeyer's Catalog of Fishes) fail to adopt a global phylogenetic framework despite much recent progress made towards the resolution of the fish Tree of Life. The first explicit phylogenetic classification of bony fishes was published in 2013, based on a comprehensive molecular phylogeny ( www.deepfin.org ). We here update the first version of that classification by incorporating the most recent phylogenetic results. The updated classification presented here is based on phylogenies inferred using molecular and genomic data for nearly 2000 fishes. A total of 72 orders (and 79 suborders) are recognized in this version, compared with 66 orders in version 1. The phylogeny resolves placement of 410 families, or ~80% of the total of 514 families of bony fishes currently recognized. The ordinal status of 30 percomorph families included in this study, however, remains uncertain (incertae sedis in the series Carangaria, Ovalentaria, or Eupercaria). Comments to support taxonomic decisions and comparisons with conflicting taxonomic groups proposed by others are presented. We also highlight cases were morphological support exist for the groups being classified. This version of the phylogenetic classification of bony fishes is substantially improved, providing resolution

  14. The long and winding road of molecular data in phylogenetic analysis.

    Science.gov (United States)

    Suárez-Díaz, Edna

    2014-01-01

    The use of molecules and reactions as evidence, markers and/or traits for evolutionary processes has a history more than a century long. Molecules have been used in studies of intra-specific variation and studies of similarity among species that do not necessarily result in the analysis of phylogenetic relations. Promoters of the use of molecular data have sustained the need for quantification as the main argument to make use of them. Moreover, quantification has allowed intensive statistical analysis, as a condition and a product of increasing automation. All of these analyses are subject to the methodological anxiety characteristic of a community in search of objectivity (Suárez-Díaz and Anaya-Munoz, Stud Hist Philos Biol Biomed Sci 39:451–458, 2008). It is in this context that scientists compared and evaluated protein and nucleic acid sequence data with other types of molecular data – including immunological, electrophoretic and hybridization data. This paper argues that by looking at longterm historical processes, such as the use of molecular evidence in evolutionary biology, we gain valuable insights into the history of science. In that sense, it accompanies a growing concern among historians for big-pictures of science that incorporate the fruitful historical research on local cases of the last decades.

  15. Molecular and morphological data supporting phylogenetic reconstruction of the genus Goniothalamus (Annonaceae), including a reassessment of previous infrageneric classifications.

    Science.gov (United States)

    Tang, Chin Cheung; Thomas, Daniel C; Saunders, Richard M K

    2015-09-01

    Data is presented in support of a phylogenetic reconstruction of the species-rich early-divergent angiosperm genus Goniothalamus (Annonaceae) (Tang et al., Mol. Phylogenetic Evol., 2015) [1], inferred using chloroplast DNA (cpDNA) sequences. The data includes a list of primers for amplification and sequencing for nine cpDNA regions: atpB-rbcL, matK, ndhF, psbA-trnH, psbM-trnD, rbcL, trnL-F, trnS-G, and ycf1, the voucher information and molecular data (GenBank accession numbers) of 67 ingroup Goniothalamus accessions and 14 outgroup accessions selected from across the tribe Annoneae, and aligned data matrices for each gene region. We also present our Bayesian phylogenetic reconstructions for Goniothalamus, with information on previous infrageneric classifications superimposed to enable an evaluation of monophyly, together with a taxon-character data matrix (with 15 morphological characters scored for 66 Goniothalamus species and seven other species from the tribe Annoneae that are shown to be phylogenetically correlated).

  16. Molecular and morphological data supporting phylogenetic reconstruction of the genus Goniothalamus (Annonaceae, including a reassessment of previous infrageneric classifications

    Directory of Open Access Journals (Sweden)

    Chin Cheung Tang

    2015-09-01

    Full Text Available Data is presented in support of a phylogenetic reconstruction of the species-rich early-divergent angiosperm genus Goniothalamus (Annonaceae (Tang et al., Mol. Phylogenetic Evol., 2015 [1], inferred using chloroplast DNA (cpDNA sequences. The data includes a list of primers for amplification and sequencing for nine cpDNA regions: atpB-rbcL, matK, ndhF, psbA-trnH, psbM-trnD, rbcL, trnL-F, trnS-G, and ycf1, the voucher information and molecular data (GenBank accession numbers of 67 ingroup Goniothalamus accessions and 14 outgroup accessions selected from across the tribe Annoneae, and aligned data matrices for each gene region. We also present our Bayesian phylogenetic reconstructions for Goniothalamus, with information on previous infrageneric classifications superimposed to enable an evaluation of monophyly, together with a taxon-character data matrix (with 15 morphological characters scored for 66 Goniothalamus species and seven other species from the tribe Annoneae that are shown to be phylogenetically correlated.

  17. Molecular cytogenetic characterisation and phylogenetic analysis of the seven cultivated Vigna species (Fabaceae).

    Science.gov (United States)

    She, C-W; Jiang, X-H; Ou, L-J; Liu, J; Long, K-L; Zhang, L-H; Duan, W-T; Zhao, W; Hu, J-C

    2015-01-01

    The genomic organisation of the seven cultivated Vigna species, V. unguiculata, V. subterranea, V. angularis, V. umbellata, V. radiata, V. mungo and V. aconitifolia, was determined using sequential combined PI and DAPI (CPD) staining and dual-colour fluorescence in situ hybridisation (FISH) with 5S and 45S rDNA probes. For phylogenetic analyses, comparative genomic in situ hybridisation (cGISH) onto somatic chromosomes and sequence analysis of the internal transcribed spacer (ITS) of 45S rDNA were used. Quantitative karyotypes were established using chromosome measurements, fluorochrome bands and rDNA FISH signals. All species had symmetrical karyotypes composed of only metacentric or metacentric and submetacentric chromosomes. Distinct heterochromatin differentiation was revealed by CPD staining and DAPI counterstaining after FISH. The rDNA sites among all species differed in their number, location and size. cGISH of V. umbellata genomic DNA to the chromosomes of all species produced strong signals in all centromeric regions of V. umbellata and V. angularis, weak signals in all pericentromeric regions of V. aconitifolia, and CPD-banded proximal regions of V. mungo var. mungo. Molecular phylogenetic trees showed that V. angularis and V. umbellata were the closest relatives, and V. mungo and V. aconitifolia were relatively closely related; these species formed a group that was separated from another group comprising V. radiata, V. unguiculata ssp. sesquipedalis and V. subterranea. This result was consistent with the phylogenetic relationships inferred from the heterochromatin and cGISH patterns; thus, fluorochrome banding and cGISH are efficient tools for the phylogenetic analysis of Vigna species. © 2014 German Botanical Society and The Royal Botanical Society of the Netherlands.

  18. Phylogenetic analysis of molecular and morphological data highlights uncertainty in the relationships of fossil and living species of Elopomorpha (Actinopterygii: Teleostei).

    Science.gov (United States)

    Dornburg, Alex; Friedman, Matt; Near, Thomas J

    2015-08-01

    Elopomorpha is one of the three main clades of living teleost fishes and includes a range of disparate lineages including eels, tarpons, bonefishes, and halosaurs. Elopomorphs were among the first groups of fishes investigated using Hennigian phylogenetic methods and continue to be the object of intense phylogenetic scrutiny due to their economic significance, diversity, and crucial evolutionary status as the sister group of all other teleosts. While portions of the phylogenetic backbone for Elopomorpha are consistent between studies, the relationships among Albula, Pterothrissus, Notacanthiformes, and Anguilliformes remain contentious and difficult to evaluate. This lack of phylogenetic resolution is problematic as fossil lineages are often described and placed taxonomically based on an assumed sister group relationship between Albula and Pterothrissus. In addition, phylogenetic studies using morphological data that sample elopomorph fossil lineages often do not include notacanthiform or anguilliform lineages, potentially introducing a bias toward interpreting fossils as members of the common stem of Pterothrissus and Albula. Here we provide a phylogenetic analysis of DNA sequences sampled from multiple nuclear genes that include representative taxa from Albula, Pterothrissus, Notacanthiformes and Anguilliformes. We integrate our molecular dataset with a morphological character matrix that spans both living and fossil elopomorph lineages. Our results reveal substantial uncertainty in the placement of Pterothrissus as well as all sampled fossil lineages, questioning the stability of the taxonomy of fossil Elopomorpha. However, despite topological uncertainty, our integration of fossil lineages into a Bayesian time calibrated framework provides divergence time estimates for the clade that are consistent with previously published age estimates based on the elopomorph fossil record and molecular estimates resulting from traditional node-dating methods. Copyright

  19. Bias in phylogenetic reconstruction of vertebrate rhodopsin sequences.

    Science.gov (United States)

    Chang, B S; Campbell, D L

    2000-08-01

    Two spurious nodes were found in phylogenetic analyses of vertebrate rhodopsin sequences in comparison with well-established vertebrate relationships. These spurious reconstructions were well supported in bootstrap analyses and occurred independently of the method of phylogenetic analysis used (parsimony, distance, or likelihood). Use of this data set of vertebrate rhodopsin sequences allowed us to exploit established vertebrate relationships, as well as the considerable amount known about the molecular evolution of this gene, in order to identify important factors contributing to the spurious reconstructions. Simulation studies using parametric bootstrapping indicate that it is unlikely that the spurious nodes in the parsimony analyses are due to long branches or other topological effects. Rather, they appear to be due to base compositional bias at third positions, codon bias, and convergent evolution at nucleotide positions encoding the hydrophobic residues isoleucine, leucine, and valine. LogDet distance methods, as well as maximum-likelihood methods which allow for nonstationary changes in base composition, reduce but do not entirely eliminate support for the spurious resolutions. Inclusion of five additional rhodopsin sequences in the phylogenetic analyses largely corrected one of the spurious reconstructions while leaving the other unaffected. The additional sequences not only were more proximal to the corrected node, but were also found to have intermediate levels of base composition and codon bias as compared with neighboring sequences on the tree. This study shows that the spurious reconstructions can be corrected either by excluding third positions, as well as those encoding the amino acids Ile, Val, and Leu (which may not be ideal, as these sites can contain useful phylogenetic signal for other parts of the tree), or by the addition of sequences that reduce problems associated with convergent evolution.

  20. Global patterns of amphibian phylogenetic diversity

    DEFF Research Database (Denmark)

    Fritz, Susanne; Rahbek, Carsten

    2012-01-01

    Aim  Phylogenetic diversity can provide insight into how evolutionary processes may have shaped contemporary patterns of species richness. Here, we aim to test for the influence of phylogenetic history on global patterns of amphibian species richness, and to identify areas where macroevolutionary...... processes such as diversification and dispersal have left strong signatures on contemporary species richness. Location  Global; equal-area grid cells of approximately 10,000 km2. Methods  We generated an amphibian global supertree (6111 species) and repeated analyses with the largest available molecular...... phylogeny (2792 species). We combined each tree with global species distributions to map four indices of phylogenetic diversity. To investigate congruence between global spatial patterns of amphibian species richness and phylogenetic diversity, we selected Faith’s phylogenetic diversity (PD) index...

  1. Molecular phylogenetics, seed morphometrics, chromosome number evolution and systematics of European Elatine L. (Elatinaceae species

    Directory of Open Access Journals (Sweden)

    Gábor Sramkó

    2016-12-01

    Full Text Available The genus Elatine contains ca 25 species, all of which are small, herbaceous annuals distributed in ephemeral waters on both hemispheres. However, due to a high degree of morphological variability (as a consequence of their amphibious life-style, the taxonomy of this genus remains controversial. Thus, to fill this gap in knowledge, we present a detailed molecular phylogenetic study of this genus based on nuclear (rITS and plastid (accD-psaI, psbJ-petA, ycf6-psbM-trnD sequences using 27 samples from 13 species. On the basis of this phylogenetic analysis, we provide a solid phylogenetic background for the modern taxonomy of the European members of the genus. Traditionally accepted sections of this tree (i.e., Crypta and Elatinella were found to be monophyletic; only E. borchoni—found to be a basal member of the genus—has to be excluded from the latter lineage to achieve monophyly. A number of taxonomic conclusions can also be drawn: E. hexandra, a high-ploid species, is most likely a stabilised hybrid between the main sections; E. campylosperma merits full species status based on both molecular and morphological evidence; E. gussonei is a more widespread and genetically diverse species with two main lineages; and the presence of the Asian E. ambigua in the European flora is questionable. The main lineages recovered in this analysis are also supported by a number of synapomorphic morphological characters as well as uniform chromosome counts. Based on all the evidence presented here, two new subsections within Elatinella are described: subsection Hydropipera consisting of the temperate species of the section, and subsection Macropodae including the Mediterranean species of the section.

  2. Phylogenetic relationships among extinct and extant turtles: the position of Pleurodira and the effects of the fossils on rooting crown-group turtles

    NARCIS (Netherlands)

    Sterli, J.

    2010-01-01

    The origin and evolution of the crown-group of turtles (Cryptodira + Pleurodira) is one of the most interesting topics in turtle evolution, second perhaps only to the phylogenetic position of turtles among amniotes. The present contribution focuses on the former problem, exploring the phylogenetic

  3. Interordinal gene capture, the phylogenetic position of Steller's sea cow based on molecular and morphological data, and the macroevolutionary history of Sirenia.

    Science.gov (United States)

    Springer, Mark S; Signore, Anthony V; Paijmans, Johanna L A; Vélez-Juarbe, Jorge; Domning, Daryl P; Bauer, Cameron E; He, Kai; Crerar, Lorelei; Campos, Paula F; Murphy, William J; Meredith, Robert W; Gatesy, John; Willerslev, Eske; MacPhee, Ross D E; Hofreiter, Michael; Campbell, Kevin L

    2015-10-01

    The recently extinct (ca. 1768) Steller's sea cow (Hydrodamalis gigas) was a large, edentulous North Pacific sirenian. The phylogenetic affinities of this taxon to other members of this clade, living and extinct, are uncertain based on previous morphological and molecular studies. We employed hybridization capture methods and second generation sequencing technology to obtain >30kb of exon sequences from 26 nuclear genes for both H. gigas and Dugong dugon. We also obtained complete coding sequences for the tooth-related enamelin (ENAM) gene. Hybridization probes designed using dugong and manatee sequences were both highly effective in retrieving sequences from H. gigas (mean=98.8% coverage), as were more divergent probes for regions of ENAM (99.0% coverage) that were designed exclusively from a proboscidean (African elephant) and a hyracoid (Cape hyrax). New sequences were combined with available sequences for representatives of all other afrotherian orders. We also expanded a previously published morphological matrix for living and fossil Sirenia by adding both new taxa and nine new postcranial characters. Maximum likelihood and parsimony analyses of the molecular data provide robust support for an association of H. gigas and D. dugon to the exclusion of living trichechids (manatees). Parsimony analyses of the morphological data also support the inclusion of H. gigas in Dugongidae with D. dugon and fossil dugongids. Timetree analyses based on calibration density approaches with hard- and soft-bounded constraints suggest that H. gigas and D. dugon diverged in the Oligocene and that crown sirenians last shared a common ancestor in the Eocene. The coding sequence for the ENAM gene in H. gigas does not contain frameshift mutations or stop codons, but there is a transversion mutation (AG to CG) in the acceptor splice site of intron 2. This disruption in the edentulous Steller's sea cow is consistent with previous studies that have documented inactivating mutations in

  4. Virulence, serotype and phylogenetic groups of diarrhoeagenic ...

    African Journals Online (AJOL)

    Dr DADIE Thomas

    2014-02-17

    Feb 17, 2014 ... The virulence, serotype and phylogenetic traits of diarrhoeagenic Escherichia coli were detected in 502 strains isolated during digestive infections. Molecular detection of the target virulence genes, rfb gene of operon O and phylogenetic grouping genes Chua, yjaA and TSPE4.C2 was performed.

  5. Phylogenetic and Functional Diversity of Fleshy-Fruited Plants Are Positively Associated with Seedling Diversity in a Tropical Montane Forest

    Directory of Open Access Journals (Sweden)

    Marcia C. Muñoz

    2017-08-01

    Full Text Available Mutualistic interactions between plants and animals can affect both plant and animal communities, and potentially leave imprints on plant demography. Yet, no study has simultaneously tested how trait variation in plant resources shapes the diversity of animal consumers, and how these interactions influence seedling recruitment. Here, we analyzed whether (i phylogenetic diversity and functional diversity of fruiting plants were correlated with the corresponding diversity of frugivorous birds, and (ii whether phylogenetic diversity and functional identity of plant and bird communities influenced the corresponding diversity and identity of seedling communities. We recorded mutualistic interactions between fleshy-fruited plants and frugivorous birds and seedling communities in 10 plots along an elevational gradient in the Colombian Andes. We built a phylogeny for plants/seedlings and birds and measured relevant morphological plant and bird traits that influence plant-bird interactions and seedling recruitment. We found that phylogenetic diversity and functional diversity of frugivorous birds were positively associated with the corresponding diversities of fruiting plants, consistent with a bottom-up effect of plants on birds. Moreover, the phylogenetic diversity of seedlings was related to the phylogenetic diversity of plants, but was unrelated to the phylogenetic diversity of frugivorous birds, suggesting that top-down effects of animals on seedlings were weak. Mean seed mass of seedling communities was positively associated with the mean fruit mass of plants, but was not associated with the mean avian body mass in the frugivore communities. Our study shows that variation in the traits of fleshy-fruited plants was associated with the diversity of frugivorous birds and affected the future trajectory of seedling recruitment, whereas the morphological traits of animal seed dispersers were unrelated to the phylogenetic and functional structure of

  6. Morphological and molecular characterization and phylogenetic relationships of a new species of trypanosome in Tapirus terrestris (lowland tapir), Trypanosoma terrestris sp. nov., from Atlantic Rainforest of southeastern Brazi.

    Science.gov (United States)

    Acosta, Igor da Cunha Lima; da Costa, Andrea Pereira; Nunes, Pablo Henrique; Gondim, Maria Fernanda Naegeli; Gatti, Andressa; Rossi, João Luiz; Gennari, Solange Maria; Marcili, Arlei

    2013-12-11

    The Lowland tapir (Tapirus terrestris) is the largest Brazilian mammal and despite being distributed in various Brazilian biomes, it is seriously endangered in the Atlantic Rainforest. These hosts were never evaluated for the presence of Trypanosoma parasites. The Lowland tapirs were captured in the Brazilian southeastern Atlantic Rainforest, Espírito Santo state. Trypanosomes were isolated by hemoculture, and the molecular phylogeny based on small subunit rDNA (SSU rDNA) and glycosomal-3-phosphate dehydrogenase (gGAPDH) gene sequences and the ultrastructural features seen via light microscopy and scanning and transmission electron microscopy are described. Phylogenetic trees using combined SSU rDNA and gGAPDH data sets clustered the trypanosomes of Lowland tapirs, which were highly divergent from other trypanosome species. The phylogenetic position and morphological discontinuities, mainly in epimastigote culture forms, made it possible to classify the trypanosomes from Lowland tapirs as a separate species. The isolated trypanosomes from Tapirus terrestris are a new species, Trypanosoma terrestris sp. n., and were positioned in a new Trypanosoma clade, named T. terrestris clade.

  7. Detection of Anaplasma sp. phylogenetically related to A. phagocytophilum in a free-living bird in Brazil

    Directory of Open Access Journals (Sweden)

    Anna Claudia Baumel Mongruel

    2017-08-01

    Full Text Available Abstract Wild animals play an important role in carrying vectors that may potentially transmit pathogens. Several reports highlighted the participation of wild animals on the Anaplasma phagocytophilum cycle, including as hosts of the agent. The aim of this study was to report the molecular detection of an agent phylogenetically related to A. phagocytophilum isolated from a wild bird in the Midwest of the state of Paraná, Brazil. Fifteen blood samples were collected from eleven different bird species in the Guarapuava region. One sample collected from a Penelope obscura bird was positive in nested PCR targeting the 16S rRNA gene of Anaplasma spp. The phylogenetic tree based on the Maximum Likelihood analysis showed that the sequence obtained was placed in the same clade with A. phagocytophilum isolated from domestic cats in Brazil. The present study reports the first molecular detection of a phylogenetically related A. phagocytophilum bacterium in a bird from Paraná State.

  8. Molecular phylogenetic analysis of non-sexually transmitted strains of Haemophilus ducreyi.

    Science.gov (United States)

    Gaston, Jordan R; Roberts, Sally A; Humphreys, Tricia L

    2015-01-01

    Haemophilus ducreyi, the etiologic agent of chancroid, has been previously reported to show genetic variance in several key virulence factors, placing strains of the bacterium into two genetically distinct classes. Recent studies done in yaws-endemic areas of the South Pacific have shown that H. ducreyi is also a major cause of cutaneous limb ulcers (CLU) that are not sexually transmitted. To genetically assess CLU strains relative to the previously described class I, class II phylogenetic hierarchy, we examined nucleotide sequence diversity at 11 H. ducreyi loci, including virulence and housekeeping genes, which encompass approximately 1% of the H. ducreyi genome. Sequences for all 11 loci indicated that strains collected from leg ulcers exhibit DNA sequences homologous to class I strains of H. ducreyi. However, sequences for 3 loci, including a hemoglobin receptor (hgbA), serum resistance protein (dsrA), and a collagen adhesin (ncaA) contained informative amounts of variation. Phylogenetic analyses suggest that these non-sexually transmitted strains of H. ducreyi comprise a sub-clonal population within class I strains of H. ducreyi. Molecular dating suggests that CLU strains are the most recently developed, having diverged approximately 0.355 million years ago, fourteen times more recently than the class I/class II divergence. The CLU strains' divergence falls after the divergence of humans from chimpanzees, making it the first known H. ducreyi divergence event directly influenced by the selective pressures accompanying human hosts.

  9. Molecular phylogenetic analysis of non-sexually transmitted strains of Haemophilus ducreyi.

    Directory of Open Access Journals (Sweden)

    Jordan R Gaston

    Full Text Available Haemophilus ducreyi, the etiologic agent of chancroid, has been previously reported to show genetic variance in several key virulence factors, placing strains of the bacterium into two genetically distinct classes. Recent studies done in yaws-endemic areas of the South Pacific have shown that H. ducreyi is also a major cause of cutaneous limb ulcers (CLU that are not sexually transmitted. To genetically assess CLU strains relative to the previously described class I, class II phylogenetic hierarchy, we examined nucleotide sequence diversity at 11 H. ducreyi loci, including virulence and housekeeping genes, which encompass approximately 1% of the H. ducreyi genome. Sequences for all 11 loci indicated that strains collected from leg ulcers exhibit DNA sequences homologous to class I strains of H. ducreyi. However, sequences for 3 loci, including a hemoglobin receptor (hgbA, serum resistance protein (dsrA, and a collagen adhesin (ncaA contained informative amounts of variation. Phylogenetic analyses suggest that these non-sexually transmitted strains of H. ducreyi comprise a sub-clonal population within class I strains of H. ducreyi. Molecular dating suggests that CLU strains are the most recently developed, having diverged approximately 0.355 million years ago, fourteen times more recently than the class I/class II divergence. The CLU strains' divergence falls after the divergence of humans from chimpanzees, making it the first known H. ducreyi divergence event directly influenced by the selective pressures accompanying human hosts.

  10. Phylogenetic relationships of African sunbird-like warblers: Moho ...

    African Journals Online (AJOL)

    Phylogenetic relationships of African sunbird-like warblers: Moho ( Hypergerus atriceps ), Green Hylia ( Hylia prasina ) and Tit-hylia ( Pholidornis rushiae ) ... different points in avian evolution reduces the phylogenetic signal in molecular sequence data, making difficult the reconstruction of relationships among taxa resulting ...

  11. Molecular identification and phylogenetic analysis of Wuchereria bancrofti from human blood samples in Egypt.

    Science.gov (United States)

    Abdel-Shafi, Iman R; Shoieb, Eman Y; Attia, Samar S; Rubio, José M; Ta-Tang, Thuy-Huong; El-Badry, Ayman A

    2017-03-01

    Lymphatic filariasis (LF) is a serious vector-borne health problem, and Wuchereria bancrofti (W.b) is the major cause of LF worldwide and is focally endemic in Egypt. Identification of filarial infection using traditional morphologic and immunological criteria can be difficult and lead to misdiagnosis. The aim of the present study was molecular detection of W.b in residents in endemic areas in Egypt, sequence variance analysis, and phylogenetic analysis of W.b DNA. Collected blood samples from residents in filariasis endemic areas in five governorates were subjected to semi-nested PCR targeting repeated DNA sequence, for detection of W.b DNA. PCR products were sequenced; subsequently, a phylogenetic analysis of the obtained sequences was performed. Out of 300 blood samples, W.b DNA was identified in 48 (16%). Sequencing analysis confirmed PCR results identifying only W.b species. Sequence alignment and phylogenetic analysis indicated genetically distinct clusters of W.b among the study population. Study results demonstrated that the semi-nested PCR proved to be an effective diagnostic tool for accurate and rapid detection of W.b infections in nano-epidemics and is applicable for samples collected in the daytime as well as the night time. PCR products sequencing and phylogenitic analysis revealed three different nucleotide sequences variants. Further genetic studies of W.b in Egypt and other endemic areas are needed to distinguish related strains and the various ecological as well as drug effects exerted on them to support W.b elimination.

  12. Molecular evolution of Adh and LEAFY and the phylogenetic utility of their introns in Pyrus (Rosaceae).

    Science.gov (United States)

    Zheng, Xiaoyan; Hu, Chunyun; Spooner, David; Liu, Jing; Cao, Jiashu; Teng, Yuanwen

    2011-09-14

    The genus Pyrus belongs to the tribe Pyreae (the former subfamily Maloideae) of the family Rosaceae, and includes one of the most important commercial fruit crops, pear. The phylogeny of Pyrus has not been definitively reconstructed. In our previous efforts, the internal transcribed spacer region (ITS) revealed a poorly resolved phylogeny due to non-concerted evolution of nrDNA arrays. Therefore, introns of low copy nuclear genes (LCNG) are explored here for improved resolution. However, paralogs and lineage sorting are still two challenges for applying LCNGs in phylogenetic studies, and at least two independent nuclear loci should be compared. In this work the second intron of LEAFY and the alcohol dehydrogenase gene (Adh) were selected to investigate their molecular evolution and phylogenetic utility. DNA sequence analyses revealed a complex ortholog and paralog structure of Adh genes in Pyrus and Malus, the pears and apples. Comparisons between sequences from RT-PCR and genomic PCR indicate that some Adh homologs are putatively nonfunctional. A partial region of Adh1 was sequenced for 18 Pyrus species and three subparalogs representing Adh1-1 were identified. These led to poorly resolved phylogenies due to low sequence divergence and the inclusion of putative recombinants. For the second intron of LEAFY, multiple inparalogs were discovered for both LFY1int2 and LFY2int2. LFY1int2 is inadequate for phylogenetic analysis due to lineage sorting of two inparalogs. LFY2int2-N, however, showed a relatively high sequence divergence and led to the best-resolved phylogeny. This study documents the coexistence of outparalogs and inparalogs, and lineage sorting of these paralogs and orthologous copies. It reveals putative recombinants that can lead to incorrect phylogenetic inferences, and presents an improved phylogenetic resolution of Pyrus using LFY2int2-N. Our study represents the first phylogenetic analyses based on LCNGs in Pyrus. Ancient and recent duplications lead

  13. Molecular evolution of Adh and LEAFY and the phylogenetic utility of their introns in Pyrus (Rosaceae

    Directory of Open Access Journals (Sweden)

    Cao Jiashu

    2011-09-01

    Full Text Available Abstract Background The genus Pyrus belongs to the tribe Pyreae (the former subfamily Maloideae of the family Rosaceae, and includes one of the most important commercial fruit crops, pear. The phylogeny of Pyrus has not been definitively reconstructed. In our previous efforts, the internal transcribed spacer region (ITS revealed a poorly resolved phylogeny due to non-concerted evolution of nrDNA arrays. Therefore, introns of low copy nuclear genes (LCNG are explored here for improved resolution. However, paralogs and lineage sorting are still two challenges for applying LCNGs in phylogenetic studies, and at least two independent nuclear loci should be compared. In this work the second intron of LEAFY and the alcohol dehydrogenase gene (Adh were selected to investigate their molecular evolution and phylogenetic utility. Results DNA sequence analyses revealed a complex ortholog and paralog structure of Adh genes in Pyrus and Malus, the pears and apples. Comparisons between sequences from RT-PCR and genomic PCR indicate that some Adh homologs are putatively nonfunctional. A partial region of Adh1 was sequenced for 18 Pyrus species and three subparalogs representing Adh1-1 were identified. These led to poorly resolved phylogenies due to low sequence divergence and the inclusion of putative recombinants. For the second intron of LEAFY, multiple inparalogs were discovered for both LFY1int2 and LFY2int2. LFY1int2 is inadequate for phylogenetic analysis due to lineage sorting of two inparalogs. LFY2int2-N, however, showed a relatively high sequence divergence and led to the best-resolved phylogeny. This study documents the coexistence of outparalogs and inparalogs, and lineage sorting of these paralogs and orthologous copies. It reveals putative recombinants that can lead to incorrect phylogenetic inferences, and presents an improved phylogenetic resolution of Pyrus using LFY2int2-N. Conclusions Our study represents the first phylogenetic analyses based

  14. A new look at the ventral nerve centre of Sagitta: implications for the phylogenetic position of Chaetognatha (arrow worms and the evolution of the bilaterian nervous system

    Directory of Open Access Journals (Sweden)

    Müller Carsten HG

    2007-05-01

    Full Text Available Abstract Background The Chaetognatha (arrow worms are a group of marine carnivores whose phylogenetic relationships are still vigorously debated. Molecular studies have as yet failed to come up with a stable hypothesis on their phylogenetic position. In a wide range of metazoans, the nervous system has proven to provide a wealth of characters for analysing phylogenetic relationships (neurophylogeny. Therefore, in the present study we explored the structure of the ventral nerve centre ("ventral ganglion" in Sagitta setosa with a set of histochemical and immunohistochemical markers. Results In specimens that were immunolabeled for acetylated-alpha tubulin the ventral nerve centre appeared to be a condensed continuation of the peripheral intraepidermal nerve plexus. Yet, synapsin immunolocalization showed that the ventral nerve centre is organized into a highly ordered array of ca. 80 serially arranged microcompartments. Immunohistochemistry against RFamide revealed a set of serially arranged individually identifiable neurons in the ventral nerve centre that we charted in detail. Conclusion The new information on the structure of the chaetognath nervous system is compared to previous descriptions of the ventral nerve centre which are critically evaluated. Our findings are discussed with regard to the debate on nervous system organisation in the last common bilaterian ancestor and with regard to the phylogenetic affinities of this Chaetognatha. We suggest to place the Chaetognatha within the Protostomia and argue against hypotheses which propose a deuterostome affinity of Chaetognatha or a sister-group relationship to all other Bilateria.

  15. Molecular phylogenetic lineage of Plagiopogon and Askenasia (Protozoa, Ciliophora) revealed by their gene sequences

    Science.gov (United States)

    Liu, An; Yi, Zhenzhen; Lin, Xiaofeng; Hu, Xiaozhong; Al-Farraj, Saleh A.; Al-Rasheid, Khaled A. S.

    2015-08-01

    Prostomates and haptorians are two basal groups of ciliates with limited morphological characteristics available for taxonomy. Morphologically, the structures used to identify prostomates and haptorians are similar or even identical, which generate heavy taxonomic and phylogenetic confusion. In present work, phylogenetic positions lineage of two rare genera, Plagiopogon and Askenasia, were investigated. Three genes including small subunit ribosomal RNA gene (hereafter SSU rDNA), internal transcribed spacer region (ITS region), and large subunit ribosomal RNA gene (LSU rDNA) were analyzed, 10 new sequences five species each. Our findings included 1) class Prostomatea and order Haptorida are multiphyletic; 2) it may not be appropriate to place order Cyclotrichiida in subclass Haptoria, and the systematic lineage of order Cyclotrichiida needs to be verified further; 3) genus Plagiopogon branches consistently within a clade covering most prostomes and is basal of clade Colepidae, implying its close lineage to Prostomatea; and 4) Askenasia is phylogenetically distant from the subclass Haptoria but close to classes Prostomatea, Plagiopylea and Oligohymenophorea. We supposed that the toxicyst of Askenasia may be close to taxa of prostomes instead of haptorians, and the dorsal brush is a more typical morphological characteristics of haptorians than toxicysts.

  16. Simultaneous analysis of five molecular markers provides a well-supported phylogenetic hypothesis for the living bony-tongue fishes (Osteoglossomorpha: Teleostei).

    Science.gov (United States)

    Lavoué, Sébastien; Sullivan, John P

    2004-10-01

    Fishes of the Superorder Osteoglossomorpha (the "bonytongues") constitute a morphologically heterogeneous group of basal teleosts, including highly derived subgroups such as African electric fishes, the African butterfly fish, and Old World knifefishes. Lack of consensus among hypotheses of osteoglossomorph relationships advanced during the past 30 years may be due in part to the difficulty of identifying shared derived characters among the morphologically differentiated extant families of this group. In this study, we present a novel phylogenetic hypothesis for this group, based on the analysis of more than 4000 characters from five molecular markers (the mitochondrial cytochrome b, 12S and 16S rRNA genes, and the nuclear genes RAG2 and MLL). Our taxonomic sampling includes one representative of each extant non-mormyrid osteoglossomorph genus, one representative for the monophyletic family Mormyridae, and four outgroup taxa within the basal Teleostei. Maximum parsimony analysis of combined and equally weighted characters from the five molecular markers and Bayesian analysis provide a single, well-supported, hypothesis of osteoglossomorph interrelationships and show the group to be monophyletic. The tree topology is the following: (Hiodon alosoides, (Pantodon buchholzi, (((Osteoglossum bicirrhosum, Scleropages sp.), (Arapaima gigas, Heterotis niloticus)), ((Gymnarchus niloticus, Ivindomyrus opdenboschi), ((Notopterus notopterus, Chitala ornata), (Xenomystus nigri, Papyrocranus afer)))))). We compare our results with previously published phylogenetic hypotheses based on morpho-anatomical data. Additionally, we explore the consequences of the long terminal branch length for the taxon Pantodon buchholzi in our phylogenetic reconstruction and we use the obtained phylogenetic tree to reconstruct the evolutionary history of electroreception in the Notopteroidei.

  17. Phylogenetic position of the bee genera Ancyla and Tarsalia (Hymenoptera: Apidae): a remarkable base compositional bias and an early Paleogene geodispersal from North America to the Old World.

    Science.gov (United States)

    Praz, Christophe J; Packer, Laurence

    2014-12-01

    We address the phylogenetic position of the bee genera Tarsalia and Ancyla (currently forming the tribe Ancylaini) on the basis of morphological, molecular and combined data. We assembled a matrix of 309 morphological characters and 5246 aligned nucleotide positions from six nuclear genes (28S, EF-1a, wingless, POL2, LW-Rhodopsin, NAK). In addition to both constituent genera of Ancylaini, we include all three subtribes of the Eucerini as well as a large number of other tribes from the "eucerine line". The morphological data suggest Ancyla to be sister to Tarsalia+Eucerini and analyses of the entire molecular dataset suggest Tarsalia to be sister to Ancyla+Eucerini. However, analyses of the combined dataset suggests the Ancylaini to be monophyletic. We address possible bias within the molecular data and show that the base composition of two markers (EF-1a and NAK) is significantly heterogeneous among taxa and that this heterogeneity is strong enough to overcome the phylogenetic signal from the other markers. Analyses of a molecular matrix where the heterogeneous partitions have been RY-recoded yield trees that are better resolved and have higher nodal support values than those recovered in analyses of the non-recoded matrix, and strongly suggest the Ancylaini to be a monophyletic sister group to the Eucerini. A dated phylogeny and ancestral range reconstructions suggest that the common ancestor of the Ancylaini reached the Old World from the New World most probably via the Thulean Land Bridge in a time window between 69 and 47 mya, a period that includes the Early Eocene Climatic Optimum. No further exchanges between the New World and the Old World are implied by our data until the period between 22 mya and 13.9 mya. These more recent faunal exchanges probably involved geodispersal over the Bering Land Bridge by less thermophilic lineages. Copyright © 2014 Elsevier Inc. All rights reserved.

  18. Genetic characterization, molecular epidemiology, and phylogenetic relationships of insect-specific viruses in the taxon Negevirus.

    Science.gov (United States)

    Nunes, Marcio R T; Contreras-Gutierrez, María Angélica; Guzman, Hilda; Martins, Livia C; Barbirato, Mayla Feitoza; Savit, Chelsea; Balta, Victoria; Uribe, Sandra; Vivero, Rafael; Suaza, Juan David; Oliveira, Hamilton; Nunes Neto, Joaquin P; Carvalho, Valeria L; da Silva, Sandro Patroca; Cardoso, Jedson F; de Oliveira, Rodrigo Santo; da Silva Lemos, Poliana; Wood, Thomas G; Widen, Steven G; Vasconcelos, Pedro F C; Fish, Durland; Vasilakis, Nikos; Tesh, Robert B

    2017-04-01

    The recently described taxon Negevirus is comprised of a diverse group of insect-specific viruses isolated from mosquitoes and phlebotomine sandflies. In this study, a comprehensive genetic characterization, molecular, epidemiological and evolutionary analyses were conducted on nearly full-length sequences of 91 new negevirus isolates obtained in Brazil, Colombia, Peru, Panama, USA and Nepal. We demonstrated that these arthropod restricted viruses are clustered in two major phylogenetic groups with origins related to three plant virus genera (Cilevirus, Higrevirus and Blunevirus). Molecular analyses demonstrated that specific host correlations are not present with most negeviruses; instead, high genetic variability, wide host-range, and cross-species transmission were noted. The data presented here also revealed the existence of five novel insect-specific viruses falling into two arthropod-restrictive virus taxa, previously proposed as distinct genera, designated Nelorpivirus and Sandewavirus. Our results provide a better understanding of the molecular epidemiology, evolution, taxonomy and stability of this group of insect-restricted viruses. Copyright © 2017 Elsevier Inc. All rights reserved.

  19. Morphological reassessment and molecular phylogenetic analyses of Amauroderma s.lat. raised new perspectives in the generic classification of the Ganodermataceae family

    NARCIS (Netherlands)

    Costa-Rezende, D.H.; Robledo, G.L.; Góes-Neto, A.; Reck, M.A.; Crespo, E.; Drechsler-Santos, E.R.

    2017-01-01

    Ganodermataceae is a remarkable group of polypore fungi, mainly characterized by particular doublewalled basidiospores with a coloured endosporium ornamented with columns or crests, and a hyaline smooth exosporium. In order to establish an integrative morphological and molecular phylogenetic

  20. Molecular, phylogenetic and comparative genomic analysis of the cytokinin oxidase/dehydrogenase gene family in the Poaceae.

    Science.gov (United States)

    Mameaux, Sabine; Cockram, James; Thiel, Thomas; Steuernagel, Burkhard; Stein, Nils; Taudien, Stefan; Jack, Peter; Werner, Peter; Gray, John C; Greenland, Andy J; Powell, Wayne

    2012-01-01

    The genomes of cereals such as wheat (Triticum aestivum) and barley (Hordeum vulgare) are large and therefore problematic for the map-based cloning of agronomicaly important traits. However, comparative approaches within the Poaceae permit transfer of molecular knowledge between species, despite their divergence from a common ancestor sixty million years ago. The finding that null variants of the rice gene cytokinin oxidase/dehydrogenase 2 (OsCKX2) result in large yield increases provides an opportunity to explore whether similar gains could be achieved in other Poaceae members. Here, phylogenetic, molecular and comparative analyses of CKX families in the sequenced grass species rice, brachypodium, sorghum, maize and foxtail millet, as well as members identified from the transcriptomes/genomes of wheat and barley, are presented. Phylogenetic analyses define four Poaceae CKX clades. Comparative analyses showed that CKX phylogenetic groupings can largely be explained by a combination of local gene duplication, and the whole-genome duplication event that predates their speciation. Full-length OsCKX2 homologues in barley (HvCKX2.1, HvCKX2.2) and wheat (TaCKX2.3, TaCKX2.4, TaCKX2.5) are characterized, with comparative analysis at the DNA, protein and genetic/physical map levels suggesting that true CKX2 orthologs have been identified. Furthermore, our analysis shows CKX2 genes in barley and wheat have undergone a Triticeae-specific gene-duplication event. Finally, by identifying ten of the eleven CKX genes predicted to be present in barley by comparative analyses, we show that next-generation sequencing approaches can efficiently determine the gene space of large-genome crops. Together, this work provides the foundation for future functional investigation of CKX family members within the Poaceae. © 2011 National Institute of Agricultural Botany (NIAB). Plant Biotechnology Journal © 2011 Society for Experimental Biology, Association of Applied Biologists and Blackwell

  1. Calculation of evolutionary correlation between individual genes and full-length genome: a method useful for choosing phylogenetic markers for molecular epidemiology.

    Directory of Open Access Journals (Sweden)

    Shuai Wang

    Full Text Available Individual genes or regions are still commonly used to estimate the phylogenetic relationships among viral isolates. The genomic regions that can faithfully provide assessments consistent with those predicted with full-length genome sequences would be preferable to serve as good candidates of the phylogenetic markers for molecular epidemiological studies of many viruses. Here we employed a statistical method to evaluate the evolutionary relationships between individual viral genes and full-length genomes without tree construction as a way to determine which gene can match the genome well in phylogenetic analyses. This method was performed by calculation of linear correlations between the genetic distance matrices of aligned individual gene sequences and aligned genome sequences. We applied this method to the phylogenetic analyses of porcine circovirus 2 (PCV2, measles virus (MV, hepatitis E virus (HEV and Japanese encephalitis virus (JEV. Phylogenetic trees were constructed for comparisons and the possible factors affecting the method accuracy were also discussed in the calculations. The results revealed that this method could produce results consistent with those of previous studies about the proper consensus sequences that could be successfully used as phylogenetic markers. And our results also suggested that these evolutionary correlations could provide useful information for identifying genes that could be used effectively to infer the genetic relationships.

  2. Phylogenetic diversity of insecticolous fusaria inferred from multilocus DNA sequence data and their molecular identification via FUSARIUM-ID and Fusarium MLST

    NARCIS (Netherlands)

    O'Donnell, K.; Humber, R.A.; Geiser, D.M.; Kang, S.; Robert, V.; Park, B.; Crous, P.W.; Johnston, P.; Aoki, T.; Rooney, A.P.; Rehner, S.A.

    2012-01-01

    We constructed several multilocus DNA sequence datasets to assess the phylogenetic diversity of insecticolous fusaria, especially focusing on those housed at the Agricultural Research Service Collection of Entomopathogenic Fungi (ARSEF), and to aid molecular identifications of unknowns via the

  3. Molecular phylogenetics and historical biogeography of Rhinolophus bats.

    Science.gov (United States)

    Stoffberg, Samantha; Jacobs, David S; Mackie, Iain J; Matthee, Conrad A

    2010-01-01

    The phylogenetic relationships within the horseshoe bats (genus Rhinolophus) are poorly resolved, particularly at deeper levels within the tree. We present a better-resolved phylogenetic hypothesis for 30 rhinolophid species based on parsimony and Bayesian analyses of the mitochondrial cytochrome b gene and three nuclear introns (TG, THY and PRKC1). Strong support was found for the existence of two geographic clades within the monophyletic Rhinolophidae: an African group and an Oriental assemblage. The relaxed Bayesian clock method indicated that the two rhinolophid clades diverged approximately 35 million years ago and results from Dispersal Vicariance (DIVA) analysis suggest that the horseshoe bats arose in Asia and subsequently dispersed into Europe and Africa.

  4. Identification of three new isolates of Tomato spotted wilt virus from different hosts in China: molecular diversity, phylogenetic and recombination analyses.

    Science.gov (United States)

    Zhang, Zhenjia; Wang, Deya; Yu, Chengming; Wang, Zenghui; Dong, Jiahong; Shi, Kerong; Yuan, Xuefeng

    2016-01-14

    Destructive diseases caused by Tomato spotted wilt virus (TSWV) have been reported associated with many important plants worldwide. Recently, TSWV was reported to infect different hosts in China. It is of value to clone TSWV isolates from different hosts and examine diversity and evolution among different TSWV isolates in China as well as worldwide. RT-PCR was used to clone the full-length genome (L, M and S segments) of three new isolates of TSWV that infected different hosts (tobacco, red pepper and green pepper) in China. Identity of nucleotide and amino acid sequences among TSWV isolates were analyzed by DNAMAN. MEGA 5.0 was used to construct phylogenetic trees. RDP4 was used to detect recombination events during evolution of these isolates. Whole-genome sequences of three new TSWV isolates in China were determined. Together with other available isolates, 29 RNA L, 62 RNA M and 66 RNA S of TSWV isolates were analyzed for molecular diversity, phylogenetic and recombination events. This analysis revealed that the entire TSWV genome, especially the M and S RNAs, had major variations in genomic size that mainly involve the A-U rich intergenic region (IGR). Phylogenetic analyses on TSWV isolates worldwide revealed evidence for frequent reassortments in the evolution of tripartite negative-sense RNA genome. Significant numbers of recombination events with apparent 5' regional preference were detected among TSWV isolates worldwide. Moreover, TSWV isolates with similar recombination events usually had closer relationships in phylogenetic trees. All five Chinese TSWV isolates including three TSWV isolates of this study and previously reported two isolates can be divided into two groups with different origins based on molecular diversity and phylogenetic analysis. During their evolution, both reassortment and recombination played roles. These results suggest that recombination could be an important mechanism in the evolution of multipartite RNA viruses, even negative

  5. Phylogenetic and chemical studies in the potential psychotropic species complex of Psilocybe atrobrunnea with taxonomic and nomenclatural notes

    NARCIS (Netherlands)

    Borovička, J.; Oborník, M.; Stříbrný, J.; Noordeloos, M.E.; Parra Sánchez, L.A.; Gryndler, M.

    2015-01-01

    Five Psilocybe species with unresolved systematic position (P. atrobrunnea, P. laetissima, P. medullosa, P. pelliculosa, and P. silvatica) were investigated using four molecular markers (EF1-α, ITS, LSU, and IGS). Phylogenetic analysis revealed that with the exception of P. laetissima, which is now

  6. Molecular and phylogenetic characterization of bovine coronavirus virus isolated from dairy cattle in Central Region, Thailand.

    Science.gov (United States)

    Singasa, Kanokwan; Songserm, Taweesak; Lertwatcharasarakul, Preeda; Arunvipas, Pipat

    2017-10-01

    Bovine coronavirus (BCoV) is involved mainly in enteric infections in cattle. This study reports the first molecular detection of BCoV in a diarrhea outbreak in dairy cows in the Central Region, Thailand. BCoV was molecularly detected from bloody diarrheic cattle feces by using nested PCR. Agarose gel electrophoresis of three diarrheic fecal samples yielded from the 25 samples desired amplicons that were 488 base pairs and sequencing substantiated that have BCoV. The sequence alignment indicated that nucleotide and amino acid sequences, the three TWD isolated in Thailand, were more quite homologous to each other (amino acid at position 39 of TWD1, TWD3 was proline, but TWD2 was serine) and closely related to OK-0514-3strain (virulent respiratory strain; RBCoV).The amino acid sequencing identities among TWD1, TWD2,TWD3, and OK-0514-3 strain were 96.0 to 96.6%, those at which T3I, H65N, D87G, H127Y, andQ136R were changed. In addition, the phylogenetic tree of the hypervariable region S1subunit spike glycoprotein BCoV gene was composed of three major clades by using the 54 sequences generated and showed that the evolutionally distance, TWD1, TWD2, and TWD3 were the isolated group together and most similar to OK-0514-3 strain (98.2 to 98.5% similarity). Further study will develop ELISA assay for serologic detection of winter dysentery disease.

  7. Phylogenetic reconstruction methods: an overview.

    Science.gov (United States)

    De Bruyn, Alexandre; Martin, Darren P; Lefeuvre, Pierre

    2014-01-01

    Initially designed to infer evolutionary relationships based on morphological and physiological characters, phylogenetic reconstruction methods have greatly benefited from recent developments in molecular biology and sequencing technologies with a number of powerful methods having been developed specifically to infer phylogenies from macromolecular data. This chapter, while presenting an overview of basic concepts and methods used in phylogenetic reconstruction, is primarily intended as a simplified step-by-step guide to the construction of phylogenetic trees from nucleotide sequences using fairly up-to-date maximum likelihood methods implemented in freely available computer programs. While the analysis of chloroplast sequences from various Vanilla species is used as an illustrative example, the techniques covered here are relevant to the comparative analysis of homologous sequences datasets sampled from any group of organisms.

  8. Mitochondrial genome and phylogenetic position of the sliteye shark Loxodon macrorhinus.

    Science.gov (United States)

    Wang, Junjie; Chen, Hao; Lin, Lingling; Ai, Weiming; Chen, Xiao

    2016-11-01

    The sliteye shark Loxodon macrorhinus is the only member of the genus Loxodon in the family Carcharhinidae. In this study, we first present the complete mitochondrial genome of L. macrorhinus and determine its phylogenetic position within Carcharhinidae based on relative mitogenomes. The mitochondrial genome was 16 702 bp in length with the typical gene order in vertebrates. The overall base composition of the H-strand was 31.7% A, 25.8% C, 13.1% G, and 29.4% T. Two start codons (ATG and GTG) and three stop codons (TAG, AGG, and TAA/T) were found in the protein-coding genes. The tRNA genes ranged from 67 bp to 75 bp. Loxodon macrorhinus was placed as sister to the genus Scoliodon in the Bayesian tree.

  9. Phylogenetic reconstruction using secondary structures of Internal Transcribed Spacer 2 (ITS2, rDNA: finding the molecular and morphological gap in Caribbean gorgonian corals

    Directory of Open Access Journals (Sweden)

    Sánchez Juan A

    2007-06-01

    Full Text Available Abstract Background Most phylogenetic studies using current methods have focused on primary DNA sequence information. However, RNA secondary structures are particularly useful in systematics because they include characteristics, not found in the primary sequence, that give "morphological" information. Despite the number of recent molecular studies on octocorals, there is no consensus opinion about a region that carries enough phylogenetic resolution to solve intrageneric or close species relationships. Moreover, intrageneric morphological information by itself does not always produce accurate phylogenies; intra-species comparisons can reveal greater differences than intra-generic ones. The search for new phylogenetic approaches, such as by RNA secondary structure analysis, is therefore a priority in octocoral research. Results Initially, twelve predicted RNA secondary structures were reconstructed to provide the basic information for phylogenetic analyses; they accorded with the 6 helicoidal ring model, also present in other groups of corals and eukaryotes. We obtained three similar topologies for nine species of the Caribbean gorgonian genus Eunicea (candelabrum corals with two sister taxa as outgroups (genera Plexaura and Pseudoplexaura on the basis of molecular morphometrics of ITS2 RNA secondary structures only, traditional primary sequence analyses and maximum likelihood, and a Bayesian analysis of the combined data. The latter approach allowed us to include both primary sequence and RNA molecular morphometrics; each data partition was allowed to have a different evolution rate. In addition, each helix was partitioned as if it had evolved at a distinct rate. Plexaura flexuosa was found to group within Eunicea; this was best supported by both the molecular morphometrics and combined analyses. We suggest Eunicea flexuosa (Lamouroux, 1821 comb. nov., and we present a new species description including Scanning Electron Microscopy (SEM images of

  10. treespace: Statistical exploration of landscapes of phylogenetic trees.

    Science.gov (United States)

    Jombart, Thibaut; Kendall, Michelle; Almagro-Garcia, Jacob; Colijn, Caroline

    2017-11-01

    The increasing availability of large genomic data sets as well as the advent of Bayesian phylogenetics facilitates the investigation of phylogenetic incongruence, which can result in the impossibility of representing phylogenetic relationships using a single tree. While sometimes considered as a nuisance, phylogenetic incongruence can also reflect meaningful biological processes as well as relevant statistical uncertainty, both of which can yield valuable insights in evolutionary studies. We introduce a new tool for investigating phylogenetic incongruence through the exploration of phylogenetic tree landscapes. Our approach, implemented in the R package treespace, combines tree metrics and multivariate analysis to provide low-dimensional representations of the topological variability in a set of trees, which can be used for identifying clusters of similar trees and group-specific consensus phylogenies. treespace also provides a user-friendly web interface for interactive data analysis and is integrated alongside existing standards for phylogenetics. It fills a gap in the current phylogenetics toolbox in R and will facilitate the investigation of phylogenetic results. © 2017 The Authors. Molecular Ecology Resources Published by John Wiley & Sons Ltd.

  11. Immature stages and phylogenetic importance of Astrapaeus, a rove beetle genus of puzzling systematic position (Coleoptera, Staphylinidae, Staphylinini)

    NARCIS (Netherlands)

    Pietrykowska-Tudruj, E.; Staniec, B.; Wojas, T.; Alexey, A.

    2014-01-01

    For the first time eggs, larvae and pupae obtained by rearing are described for Astrapaeus, a monotypic West Palearctic rove beetle genus of a puzzling phylogenetic position within the megadiverse tribe Staphylinini. Morphology of the immature stages of Astrapaeus ulmi is compared to that of other

  12. Taxonomic study on Japanese Salvia (Lamiaceae): Phylogenetic position of S. akiensis, and polyphyletic nature of S. lutescens var. intermedia.

    Science.gov (United States)

    Takano, Atsuko

    2017-01-01

    Both Salvia akiensis and S. lutescens (Lamiaceae) are endemic to Japan. Salvia akiensis was recently described in 2014 in the Chugoku (= SW Honshu) region, and each four varieties of S. lutescens distributed allopatrically. Among varieties in S. lutescens , var. intermedia show a disjunctive distribution in the Kanto (=E Honshu) and Kinki (= W Honshu) regions. Recent field studies of S. lutescens var. intermedia revealed several morphological differences between the Kanto and Kinki populations. Here, I evaluated these differences among Salvia lutescens var. intermedia and its allies with morphological analysis and molecular phylogenetic analyses of nuclear ribosomal DNA (internal and external transcribed spacer regions) and plastid DNA ( ycf1-rps15 spacer, rbcL , and trnL-F ) sequences. Both morphological analysis and molecular phylogenetic analyses showed that S. lutescens var. intermedia from the Kinki region and var. lutescens were closely related to each other. However, var. intermedia from the Kanto region exhibited an association with S. lutescens var. crenata and var. stolonifera, which also grew in eastern Japan, rather than var. intermedia in the Kinki region. These results indicated that S. lutescens var. intermedia is not a taxon with a disjunctive distribution, but a combination of two or more allopatric taxa. Present study also suggested that S. akiensis was most closely related to S. omerocalyx .

  13. Evolutionary history of tall fescue morphotypes inferred from molecular phylogenetics of the Lolium-Festuca species complex

    Directory of Open Access Journals (Sweden)

    Stewart Alan V

    2010-10-01

    phylogenetic analysis of the Festuca genus to include representatives of each tall fescue morphotype, and to use low copy nuclear gene-derived sequences to identify putative progenitors of the polyploid species. The demonstration of distinct tall fescue lineages has implications for both taxonomy and molecular breeding strategies, and may facilitate the generation of morphotype and/or sub-genome-specific molecular markers.

  14. Phylogenetics of neotropical Platymiscium (Leguminosae

    DEFF Research Database (Denmark)

    Saslis-Lagoudakis, C. Haris; Chase, Mark W; Robinson, Daniel N

    2008-01-01

    Platymiscium is a neotropical legume genus of forest trees in the Pterocarpus clade of the pantropical "dalbergioid" clade. It comprises 19 species (29 taxa), distributed from Mexico to southern Brazil. This study presents a molecular phylogenetic analysis of Platymiscium and allies inferred from...

  15. A molecular phylogenetic analysis of the Scarabaeinae (dung beetles).

    Science.gov (United States)

    Monaghan, Michael T; Inward, Daegan J G; Hunt, Toby; Vogler, Alfried P

    2007-11-01

    The dung beetles (Scarabaeinae) include ca. 5000 species and exhibit a diverse array of morphologies and behaviors. This variation presumably reflects the adaptation to a diversity of food types and the different strategies used to avoid competition for vertebrate dung, which is the primary breeding environment for most species. The current classification gives great weight to the major behavioral types, separating the ball rollers and the tunnelers, but existing phylogenetic studies have been based on limited taxonomic or biogeographic sampling and have been contradictory. Here, we present a molecular phylogenetic analysis of 214 species of Scarabaeinae, representing all 12 traditionally recognized tribes and six biogeographical regions, using partial gene sequences from one nuclear (28S) and two mitochondrial (cox1, rrnL) genes. Length variation in 28S (588-621 bp) and rrnL (514-523 bp) was subjected to a thorough evaluation of alternative alignments, gap-coding methods, and tree searches using model-based (Bayesian and likelihood), maximum parsimony, and direct optimization analyses. The small-bodied, non-dung-feeding Sarophorus+Coptorhina were basal in all reconstructions. These were closely related to rolling Odontoloma+Dicranocara, suggesting an early acquisition of rolling behavior. Smaller tribes and most genera were monophyletic, while Canthonini and Dichotomiini each consisted of multiple paraphyletic lineages at hierarchical levels equivalent to the smaller tribes. Plasticity of rolling and tunneling was evidenced by a lack of monophyly (S-H test, p > 0.05) and several reversals within clades. The majority of previously unrecognized clades were geographical, including the well-supported Neotropical Phanaeini+Eucraniini, and a large Australian clade of rollers as well as tunneling Coptodactyla and Demarziella. Only three lineages, Gymnopleurini, Copris+Microcopris and Onthophagus, were widespread and therefore appear to be dispersive at a global scale. A

  16. Complete mitochondrial genome and the phylogenetic position of the Blotchy swell shark Cephaloscyllium umbratile.

    Science.gov (United States)

    Chen, Hao; Lin, Lingling; Chen, Xiao; Ai, Weiming; Chen, Shaobo

    2016-07-01

    In this study, the complete mitochondrial genome of the Blotchy swell shark Cephaloscyllium umbratile was determined. It was a circle molecular (16 698 bp), contained 37 genes with typical order to that of most other vertebrates. The nucleotide composition was 31.0% A, 24.0% C, 14.0% G, and 31.3% T. There were 26 bp short intergenic spaces located in 11 gene junctions and 28 bp overlaps located in 7 gene junctions in the whole mitogenome. Two start codons (GTG and ATG) and two stop codons (TAG and TAA/T) were used in the protein-coding genes. The phylogenetic result showed that C. umbratile was clustered with Scyliorhinus canicula and formed the Scyliorhinidae clade, which was the most basal clade within Carcharhiniformes, and Carcharhinidae is not monophyletic.

  17. Molecular Phylogenetics and Temporal Diversification in the Genus Aeromonas Based on the Sequences of Five Housekeeping Genes

    Science.gov (United States)

    Lorén, J. Gaspar; Farfán, Maribel; Fusté, M. Carmen

    2014-01-01

    Several approaches have been developed to estimate both the relative and absolute rates of speciation and extinction within clades based on molecular phylogenetic reconstructions of evolutionary relationships, according to an underlying model of diversification. However, the macroevolutionary models established for eukaryotes have scarcely been used with prokaryotes. We have investigated the rate and pattern of cladogenesis in the genus Aeromonas (γ-Proteobacteria, Proteobacteria, Bacteria) using the sequences of five housekeeping genes and an uncorrelated relaxed-clock approach. To our knowledge, until now this analysis has never been applied to all the species described in a bacterial genus and thus opens up the possibility of establishing models of speciation from sequence data commonly used in phylogenetic studies of prokaryotes. Our results suggest that the genus Aeromonas began to diverge between 248 and 266 million years ago, exhibiting a constant divergence rate through the Phanerozoic, which could be described as a pure birth process. PMID:24586399

  18. A taxonomic and phylogenetic re-appraisal of the genus Curvularia

    Science.gov (United States)

    Species of Curvularia are important plant and human pathogens worldwide. In this study, the genus Curvularia is re-assessed based on molecular phylogenetic analysis and morphological observations of available isolates and specimens. A multi-gene phylogenetic tree inferred from ITS, TEF and GPDH gene...

  19. Molecular typing of canine parvovirus from Sulaimani, Iraq and phylogenetic analysis using partial VP2 gene

    Directory of Open Access Journals (Sweden)

    M.O.Baba Sheikh

    2017-09-01

    Full Text Available Canine parvovirus (CPV remains the most significant viral cause of haemorrhagic enteritis and bloody diarrhoea in puppies over the age of 12 weeks. The objective of the present study was to detect and genotype CPV-2 by polymerase chain reaction (PCR and to perform phylogenetic analysis using partial VP2 gene sequences. We analysed eight faecal samples of unvaccinated dogs with signs of vomiting and bloody diarrhoea during the period from December 2013 to May 2014 in different locations in Sulaimani, Kurdistan, Iraq. After PCR detection, we found that all viral sequences in our study were CPV-2b variants, which differed genetically by 0.8% to 3.6% from five commercially available vaccines. Alignment between eight nucleotides of field virus sequences showed 95% to 99.5% similarity. The phylogenetic analysis for the 8 field sequences formed two distinct clusters with two sequences belonging to strains from China and Thailand and the other six – with a strain from Egypt. Molecular characterisation and CPV typing are crucial in epidemiological studies for future prevention and control of the disease.

  20. The phylogenetic position of Amoebophrya sp. infecting Gymnodinium sanguineum.

    Science.gov (United States)

    Gunderson, J H; Goss, S H; Coats, D W

    1999-01-01

    The small-subunit rRNA sequence of a species of Amoebophrya infecting Gymnodinium sanguineum in Chesapeake Bay was obtained and compared to the small subunit rRNA sequences of other protists. Phylogenetic trees constructed with the new sequence place Amoebophrya between the remaining dinoflagellates and other protists.

  1. Towards an integrated phylogenetic classification of the Tremellomycetes.

    Science.gov (United States)

    Liu, X-Z; Wang, Q-M; Göker, M; Groenewald, M; Kachalkin, A V; Lumbsch, H T; Millanes, A M; Wedin, M; Yurkov, A M; Boekhout, T; Bai, F-Y

    2015-06-01

    Families and genera assigned to Tremellomycetes have been mainly circumscribed by morphology and for the yeasts also by biochemical and physiological characteristics. This phenotype-based classification is largely in conflict with molecular phylogenetic analyses. Here a phylogenetic classification framework for the Tremellomycetes is proposed based on the results of phylogenetic analyses from a seven-genes dataset covering the majority of tremellomycetous yeasts and closely related filamentous taxa. Circumscriptions of the taxonomic units at the order, family and genus levels recognised were quantitatively assessed using the phylogenetic rank boundary optimisation (PRBO) and modified general mixed Yule coalescent (GMYC) tests. In addition, a comprehensive phylogenetic analysis on an expanded LSU rRNA (D1/D2 domains) gene sequence dataset covering as many as available teleomorphic and filamentous taxa within Tremellomycetes was performed to investigate the relationships between yeasts and filamentous taxa and to examine the stability of undersampled clades. Based on the results inferred from molecular data and morphological and physiochemical features, we propose an updated classification for the Tremellomycetes. We accept five orders, 17 families and 54 genera, including seven new families and 18 new genera. In addition, seven families and 17 genera are emended and one new species name and 185 new combinations are proposed. We propose to use the term pro tempore or pro tem. in abbreviation to indicate the species names that are temporarily maintained.

  2. Mapping Phylogenetic Trees to Reveal Distinct Patterns of Evolution.

    Science.gov (United States)

    Kendall, Michelle; Colijn, Caroline

    2016-10-01

    Evolutionary relationships are frequently described by phylogenetic trees, but a central barrier in many fields is the difficulty of interpreting data containing conflicting phylogenetic signals. We present a metric-based method for comparing trees which extracts distinct alternative evolutionary relationships embedded in data. We demonstrate detection and resolution of phylogenetic uncertainty in a recent study of anole lizards, leading to alternate hypotheses about their evolutionary relationships. We use our approach to compare trees derived from different genes of Ebolavirus and find that the VP30 gene has a distinct phylogenetic signature composed of three alternatives that differ in the deep branching structure. phylogenetics, evolution, tree metrics, genetics, sequencing. © The Author 2016. Published by Oxford University Press on behalf of the Society for Molecular Biology and Evolution.

  3. A Molecular Assessment of Phylogenetic Relationships and LineageDiversification Within the Family Salamandridae (Amphibia, Caudata)

    Energy Technology Data Exchange (ETDEWEB)

    Weisrock, David W.; Papenfuss, Theodore J.; Macey, J. Robert; Litvinchuk, Spartak N.; Polymeni, Rosa; Ugurtas, Ismail H.; Zhao, Ermi; Larson, Allan

    2005-08-08

    Phylogenetic relationships among species of the salamanderfamily Salamandridae are investigated using nearly 3000 nucleotide basesof newly reported mitochondrial DNA sequence data from the mtDNA genicregion spanning the genes tRNALeu-COI. This study uses nearlycomprehensive species-level sampling to provide the first completephylogeny for the Salamandridae. Deep phylogenetic relationships amongthe three most divergent lineages in the family Salamandrina terdigitata,a clade comprising the "True" salamanders, and a clade comprising allnewts except S. terdigitata are difficult to resolve. However, mostrelationships within the latter two lineages are resolved with robustlevels of branch support. The genera Euproctus and Triturus arestatistically shown to be nonmonophyletic, instead each contains adiverse set of lineages positioned within the large newt clade. The genusParamesotriton is also resolve as a nonmonophyletic group, with the newlydescribed species P. laoensis constituting a divergent lineage placed ina sister position to clade containing all Pachytriton species and allremaining Paramesotriton species. Sequence divergences between P.laoensis and other Paramesotriton species are as great as those comparingP. laoensis and species of the genera Cynops and Pachytriton. Analyses oflineage diversification across the Salamandridae indicate that, despiteits exceptional diversity, lineage accumulation appears to have beenconstant across time, indicating that it does not represent a truespecies radiation.

  4. Phylogenetic relationships of the intercellular fish pathogen Ichthyophonus hoferi and fungi, choanoflagellates and the rosette agent

    DEFF Research Database (Denmark)

    Spanggaard, Bettina; Skouboe, P.; Rossen, L.

    1996-01-01

    Ichthyophonus hoferi Plehn and Mulsow, 1911 is thought to be one of the few pathogenic fungal infections of marine fish. The result of an attack is severe epizootics in herring stocks with drastic reduction in the population as a consequence. The exact phylogenetic position of the genus Ichthyoph......Ichthyophonus hoferi Plehn and Mulsow, 1911 is thought to be one of the few pathogenic fungal infections of marine fish. The result of an attack is severe epizootics in herring stocks with drastic reduction in the population as a consequence. The exact phylogenetic position of the genus...... Ichthyophonus is not known. In the present study, a combination of molecular data, ultrastructure and biochemical characters were utilized to investigate the phylogeny of I. hoferi. The genomic DNA encoding the small subunit ribosomal RNA (18S rRNA) was amplified and sequenced. Comparisons with other eukaryotic...

  5. Molecular and phylogenetic characterizations of an Eimeria krijgsmanni Yakimoff & Gouseff, 1938 (Apicomplexa: Eimeriidae) mouse intestinal protozoan parasite by partial 18S ribosomal RNA gene sequence analysis.

    Science.gov (United States)

    Takeo, Toshinori; Tanaka, Tetsuya; Matsubayashi, Makoto; Maeda, Hiroki; Kusakisako, Kodai; Matsui, Toshihiro; Mochizuki, Masami; Matsuo, Tomohide

    2014-08-01

    Previously, we characterized an undocumented strain of Eimeria krijgsmanni by morphological and biological features. Here, we present a detailed molecular phylogenetic analysis of this organism. Namely, 18S ribosomal RNA gene (rDNA) sequences of E. krijgsmanni were analyzed to incorporate this species into a comprehensive Eimeria phylogeny. As a result, partial 18S rDNA sequence from E. krijgsmanni was successfully determined, and two different types, Type A and Type B, that differed by 1 base pair were identified. E. krijgsmanni was originally isolated from a single oocyst, and thus the result show that the two types might have allelic sequence heterogeneity in the 18S rDNA. Based on phylogenetic analyses, the two types of E. krijgsmanni 18S rDNA formed one of two clades among murine Eimeria spp.; these Eimeria clades reflected morphological similarity among the Eimeria spp. This is the third molecular phylogenetic characterization of a murine Eimeria spp. in addition to E. falciformis and E. papillata. Copyright © 2014 Elsevier Ireland Ltd. All rights reserved.

  6. Description, culture and phylogenetic position of a new xerotolerant species of Physarum.

    Science.gov (United States)

    Novozhilov, Yuri K; Okun, Mikhail V; Erastova, Daria A; Shchepin, Oleg N; Zemlyanskaya, Inna V; García-Carvajal, Eva; Schnittler, Martin

    2013-01-01

    A new widespread myxomycete species, Physarum pseudonotabile, inhabiting the arid regions of the Eurasia, South and North America is described and illustrated. Tentatively assigned to Ph. notabile T. Macbr., a phylogeny based on the small ribosomal subunit (SSU) and elongation factor 1 alpha (EF1a) genes placed the new species in a clade far from Ph. notabile. Ph. pseudonotabile was found to be frequent in surveys based on the moist chamber culture technique with samples of litter, bark and herbivore dung collected in dry steppe and deserts of the Caspian lowland (Russia), Kazakhstan, Mongolia, China, Spain, Argentina and USA. The main morphological difference between Ph. pseudonotabile and Ph. notabile lies in spore ornamentation. Spores of the former species display irregularly distributed verrucae, whereas the latter species possesses spores with dense and regularly arranged spinulae. In addition, the ecological preferences of the two species differ. Ph. pseudonotabile inhabits the bark of living plants and ground litter in arid regions, whereas Ph. notabile is found on coarse woody debris in boreal and temperate forests. Although the new species appears to be closest to Ph. notabile morphologically, the phylogenetic analysis reveals Ph. pusillum and Ph. nivale as the closest relatives. In addition, the molecular investigations revealed a considerable amount of hidden diversity within species of Physarum with gray lime flakes. Currently we have only sufficient material to assess the morphological variation of Ph. pseudonotabile but expect that more taxa within this clade may emerge within studies combining morphological and molecular analyses.

  7. Molecular Characterization and Phylogenetic Analysis of Anaplasma spp. and Ehrlichia spp. Isolated from Various Ticks in Southeastern and Northwestern Regions of Iran.

    Science.gov (United States)

    Jafar Bekloo, Ahmad; Ramzgouyan, Maryam Roya; Shirian, Sadegh; Faghihi, Faezeh; Bakhshi, Hassan; Naseri, Fatemeh; Sedaghat, Mehdi; Telmadarraiy, Zakkyeh

    2018-05-01

    Anaplasma/Ehrlichia species are tick-transmitted pathogens that cause infections in humans and numerous domestic and wild animal species. There is no information available on the molecular characteristics and phylogenetic position of Anaplasma/Ehrlichia spp. isolated from tick species from different geographic locations in Iran. The aim of this study was to determine the prevalence, molecular characteristics, and phylogenetic relationship of both Anaplasma spp. and Ehrlichia spp. in tick species isolated from different domestic animals from two different geographical locations of Iran. A total of 930 ticks were collected from 93 cattle, 250 sheep, and 587 goats inhabiting the study areas. The collected ticks were then investigated for the presence of Anaplasma/Ehrlichia spp. using nested PCR based on the 16S rRNA gene, followed by sequencing. Sequence analysis was done based on the data published in the GenBank on Anaplasma/Ehrlichia spp. isolates using bioinformatic tools such as the standard nucleotide BLAST. Genome of Anaplasma or Ehrlichia spp. was detected in 14 ticks collected in Heris, including 5 Dermacentor marginatus, 1 Haemaphysalis erinacei, 3 Hyalomma anatolicum, and 4 Rhipicephalus sanguineus, also in 29 ticks collected in Chabahar, including 14 R. sanguineus, 8 D. marginatus, 3 Hyalomma Anatolicum, and 4 Hyalomma dromedarii. Partial analysis of the 16S rRNA gene sequence of positive samples collected from goats and sheep showed that they were infected with Anaplasma/Ehrlichia spp. that were 94-98% identical to ovine Anaplasma and 91-96% identical to Neoehrlichia and Ehrlichia spp. The various ticks identified in this study suggest the possible emergence of tick-borne diseases in animals and humans in these regions. R. sanguineus and D. marginatus seem to be predominant vectors responsible for anaplasmosis in these regions. Partial sequence analysis of the 16S rRNA gene showed that A. ovis is genetically polymorphic in these regions. Furthermore, an

  8. Phylogenetic Analysis of Phytophthora Species Based on Mitochondrial and Nuclear DNA Sequences

    NARCIS (Netherlands)

    Kroon, L.P.N.M.; Bakker, F.T.; Bosch, van den G.B.M.; Bonants, P.J.M.; Flier, W.G.

    2004-01-01

    A molecular phylogenetic analysis of the genus Phytophthora was performed, 113 isolates from 48 Phytophthora species were included in this analysis. Phylogenetic analyses were performed on regions of mitochondrial (cytochrome c oxidase subunit 1; NADH dehydrogenase subunit 1) and nuclear gene

  9. Functional & phylogenetic diversity of copepod communities

    Science.gov (United States)

    Benedetti, F.; Ayata, S. D.; Blanco-Bercial, L.; Cornils, A.; Guilhaumon, F.

    2016-02-01

    The diversity of natural communities is classically estimated through species identification (taxonomic diversity) but can also be estimated from the ecological functions performed by the species (functional diversity), or from the phylogenetic relationships among them (phylogenetic diversity). Estimating functional diversity requires the definition of specific functional traits, i.e., phenotypic characteristics that impact fitness and are relevant to ecosystem functioning. Estimating phylogenetic diversity requires the description of phylogenetic relationships, for instance by using molecular tools. In the present study, we focused on the functional and phylogenetic diversity of copepod surface communities in the Mediterranean Sea. First, we implemented a specific trait database for the most commonly-sampled and abundant copepod species of the Mediterranean Sea. Our database includes 191 species, described by seven traits encompassing diverse ecological functions: minimal and maximal body length, trophic group, feeding type, spawning strategy, diel vertical migration and vertical habitat. Clustering analysis in the functional trait space revealed that Mediterranean copepods can be gathered into groups that have different ecological roles. Second, we reconstructed a phylogenetic tree using the available sequences of 18S rRNA. Our tree included 154 of the analyzed Mediterranean copepod species. We used these two datasets to describe the functional and phylogenetic diversity of copepod surface communities in the Mediterranean Sea. The replacement component (turn-over) and the species richness difference component (nestedness) of the beta diversity indices were identified. Finally, by comparing various and complementary aspects of plankton diversity (taxonomic, functional, and phylogenetic diversity) we were able to gain a better understanding of the relationships among the zooplankton community, biodiversity, ecosystem function, and environmental forcing.

  10. Evaluation of a Phylogenetic Marker Based on Genomic Segment B of Infectious Bursal Disease Virus: Facilitating a Feasible Incorporation of this Segment to the Molecular Epidemiology Studies for this Viral Agent.

    Science.gov (United States)

    Alfonso-Morales, Abdulahi; Rios, Liliam; Martínez-Pérez, Orlando; Dolz, Roser; Valle, Rosa; Perera, Carmen L; Bertran, Kateri; Frías, Maria T; Ganges, Llilianne; Díaz de Arce, Heidy; Majó, Natàlia; Núñez, José I; Pérez, Lester J

    2015-01-01

    Infectious bursal disease (IBD) is a highly contagious and acute viral disease, which has caused high mortality rates in birds and considerable economic losses in different parts of the world for more than two decades and it still represents a considerable threat to poultry. The current study was designed to rigorously measure the reliability of a phylogenetic marker included into segment B. This marker can facilitate molecular epidemiology studies, incorporating this segment of the viral genome, to better explain the links between emergence, spreading and maintenance of the very virulent IBD virus (vvIBDV) strains worldwide. Sequences of the segment B gene from IBDV strains isolated from diverse geographic locations were obtained from the GenBank Database; Cuban sequences were obtained in the current work. A phylogenetic marker named B-marker was assessed by different phylogenetic principles such as saturation of substitution, phylogenetic noise and high consistency. This last parameter is based on the ability of B-marker to reconstruct the same topology as the complete segment B of the viral genome. From the results obtained from B-marker, demographic history for both main lineages of IBDV regarding segment B was performed by Bayesian skyline plot analysis. Phylogenetic analysis for both segments of IBDV genome was also performed, revealing the presence of a natural reassortant strain with segment A from vvIBDV strains and segment B from non-vvIBDV strains within Cuban IBDV population. This study contributes to a better understanding of the emergence of vvIBDV strains, describing molecular epidemiology of IBDV using the state-of-the-art methodology concerning phylogenetic reconstruction. This study also revealed the presence of a novel natural reassorted strain as possible manifest of change in the genetic structure and stability of the vvIBDV strains. Therefore, it highlights the need to obtain information about both genome segments of IBDV for molecular

  11. Molecular phylogenetic and expression analysis of the complete WRKY transcription factor family in maize.

    Science.gov (United States)

    Wei, Kai-Fa; Chen, Juan; Chen, Yan-Feng; Wu, Ling-Juan; Xie, Dao-Xin

    2012-04-01

    The WRKY transcription factors function in plant growth and development, and response to the biotic and abiotic stresses. Although many studies have focused on the functional identification of the WRKY transcription factors, much less is known about molecular phylogenetic and global expression analysis of the complete WRKY family in maize. In this study, we identified 136 WRKY proteins coded by 119 genes in the B73 inbred line from the complete genome and named them in an orderly manner. Then, a comprehensive phylogenetic analysis of five species was performed to explore the origin and evolutionary patterns of these WRKY genes, and the result showed that gene duplication is the major driving force for the origin of new groups and subgroups and functional divergence during evolution. Chromosomal location analysis of maize WRKY genes indicated that 20 gene clusters are distributed unevenly in the genome. Microarray-based expression analysis has revealed that 131 WRKY transcripts encoded by 116 genes may participate in the regulation of maize growth and development. Among them, 102 transcripts are stably expressed with a coefficient of variation (CV) value of WRKY genes with the CV value of >15% are further analysed to discover new organ- or tissue-specific genes. In addition, microarray analyses of transcriptional responses to drought stress and fungal infection showed that maize WRKY proteins are involved in stress responses. All these results contribute to a deep probing into the roles of WRKY transcription factors in maize growth and development and stress tolerance.

  12. Nodal distances for rooted phylogenetic trees.

    Science.gov (United States)

    Cardona, Gabriel; Llabrés, Mercè; Rosselló, Francesc; Valiente, Gabriel

    2010-08-01

    Dissimilarity measures for (possibly weighted) phylogenetic trees based on the comparison of their vectors of path lengths between pairs of taxa, have been present in the systematics literature since the early seventies. For rooted phylogenetic trees, however, these vectors can only separate non-weighted binary trees, and therefore these dissimilarity measures are metrics only on this class of rooted phylogenetic trees. In this paper we overcome this problem, by splitting in a suitable way each path length between two taxa into two lengths. We prove that the resulting splitted path lengths matrices single out arbitrary rooted phylogenetic trees with nested taxa and arcs weighted in the set of positive real numbers. This allows the definition of metrics on this general class of rooted phylogenetic trees by comparing these matrices through metrics in spaces M(n)(R) of real-valued n x n matrices. We conclude this paper by establishing some basic facts about the metrics for non-weighted phylogenetic trees defined in this way using L(p) metrics on M(n)(R), with p [epsilon] R(>0).

  13. Molecular characterization of Hepatozoon canis in dogs from Colombia.

    Science.gov (United States)

    Vargas-Hernandez, Giovanni; André, Marcos R; Munhoz, Thiago D; Faria, Joice M L; Machado, Rosangela Z; Tinucci-Costa, Mirela

    2012-01-01

    Hepatozoonosis is a tick-borne disease whose transmission to dogs occurs by ingestion of oocysts infected ticks or feeding on preys infested by infected ticks. Until now, there is no previous report of molecular characterization of Hepatozoon sp. in dogs from Colombia. EDTA blood samples were collected from 91 dogs from central-western region of Colombia (Bogotá, Bucaramanga, and Villavicencio cities) and submitted to 18S rRNA Hepatozoon sp. PCR and blood smears confection. Phylogenetic analysis was used to access the identity of Hepatozoon species found in sampled dogs. From 91 sampled dogs, 29 (31.8%) were positive to Hepatozoon sp. (25 dogs were only positive in PCR, 1 was positive only in blood smears, and 3 were positive in both blood smears and PCR). After sequencing, the found Hepatozoon sp. DNA showed 100% of identity with Hepatozoon canis DNA isolates. The phylogenetic tree supported the identity of the found Hepatozoon sp. DNA, showing that the isolates from Colombia were placed in the same clade than other H. canis isolates from Venezuela, Spain, and Taiwan. This is the first molecular detection of H. canis in dogs from Colombia.

  14. Phylogenetic Molecular Species Delimitations Unravel Potential New Species in the Pest Genus Spodoptera Guenée, 1852 (Lepidoptera, Noctuidae)

    Science.gov (United States)

    Dumas, Pascaline; Barbut, Jérôme; Le Ru, Bruno; Silvain, Jean-François; Clamens, Anne-Laure; d’Alençon, Emmanuelle; Kergoat, Gael J.

    2015-01-01

    Nowadays molecular species delimitation methods promote the identification of species boundaries within complex taxonomic groups by adopting innovative species concepts and theories (e.g. branching patterns, coalescence). As some of them can efficiently deal with large single-locus datasets, they could speed up the process of species discovery compared to more time consuming molecular methods, and benefit from the existence of large public datasets; these methods can also particularly favour scientific research and actions dealing with threatened or economically important taxa. In this study we aim to investigate and clarify the status of economically important moths species belonging to the genus Spodoptera (Lepidoptera, Noctuidae), a complex group in which previous phylogenetic analyses and integrative approaches already suggested the possible occurrence of cryptic species and taxonomic ambiguities. In this work, the effectiveness of innovative (and faster) species delimitation approaches to infer putative species boundaries has been successfully tested in Spodoptera, by processing the most comprehensive dataset (in terms of number of species and specimens) ever achieved; results are congruent and reliable, irrespective of the set of parameters and phylogenetic models applied. Our analyses confirm the existence of three potential new species clusters (for S. exigua (Hübner, 1808), S. frugiperda (J.E. Smith, 1797) and S. mauritia (Boisduval, 1833)) and support the synonymy of S. marima (Schaus, 1904) with S. ornithogalli (Guenée, 1852). They also highlight the ambiguity of the status of S. cosmiodes (Walker, 1858) and S. descoinsi Lalanne-Cassou & Silvain, 1994. This case study highlights the interest of molecular species delimitation methods as valuable tools for species discovery and to emphasize taxonomic ambiguities. PMID:25853412

  15. Phylogenetic molecular species delimitations unravel potential new species in the pest genus Spodoptera Guenée, 1852 (Lepidoptera, Noctuidae.

    Directory of Open Access Journals (Sweden)

    Pascaline Dumas

    Full Text Available Nowadays molecular species delimitation methods promote the identification of species boundaries within complex taxonomic groups by adopting innovative species concepts and theories (e.g. branching patterns, coalescence. As some of them can efficiently deal with large single-locus datasets, they could speed up the process of species discovery compared to more time consuming molecular methods, and benefit from the existence of large public datasets; these methods can also particularly favour scientific research and actions dealing with threatened or economically important taxa. In this study we aim to investigate and clarify the status of economically important moths species belonging to the genus Spodoptera (Lepidoptera, Noctuidae, a complex group in which previous phylogenetic analyses and integrative approaches already suggested the possible occurrence of cryptic species and taxonomic ambiguities. In this work, the effectiveness of innovative (and faster species delimitation approaches to infer putative species boundaries has been successfully tested in Spodoptera, by processing the most comprehensive dataset (in terms of number of species and specimens ever achieved; results are congruent and reliable, irrespective of the set of parameters and phylogenetic models applied. Our analyses confirm the existence of three potential new species clusters (for S. exigua (Hübner, 1808, S. frugiperda (J.E. Smith, 1797 and S. mauritia (Boisduval, 1833 and support the synonymy of S. marima (Schaus, 1904 with S. ornithogalli (Guenée, 1852. They also highlight the ambiguity of the status of S. cosmiodes (Walker, 1858 and S. descoinsi Lalanne-Cassou & Silvain, 1994. This case study highlights the interest of molecular species delimitation methods as valuable tools for species discovery and to emphasize taxonomic ambiguities.

  16. Comprehensive untargeted metabolomics of Lychnnophorinae subtribe (Asteraceae: Vernonieae) in a phylogenetic context.

    Science.gov (United States)

    Martucci, Maria Elvira Poleti; Loeuille, Benoit; Pirani, José Rubens; Gobbo-Neto, Leonardo

    2018-01-01

    Members of the subtribe Lychnophorinae occur mostly within the Cerrado domain of the Brazilian Central Plateau. The relationships between its 11 genera, as well as between Lychnophorinae and other subtribes belonging to the tribe Vernonieae, have recently been investigated upon a phylogeny based on molecular and morphological data. We report the use of a comprehensive untargeted metabolomics approach, combining HPLC-MS and GC-MS data, followed by multivariate analyses aiming to assess the congruence between metabolomics data and the phylogenetic hypothesis, as well as its potential as a chemotaxonomic tool. We analyzed 78 species by UHPLC-MS and GC-MS in both positive and negative ionization modes. The metabolic profiles obtained for these species were treated in MetAlign and in MSClust and the matrices generated were used in SIMCA for hierarchical cluster analyses, principal component analyses and orthogonal partial least square discriminant analysis. The results showed that metabolomic analyses are mostly congruent with the phylogenetic hypothesis especially at lower taxonomic levels (Lychnophora or Eremanthus). Our results confirm that data generated using metabolomics provide evidence for chemotaxonomical studies, especially for phylogenetic inference of the Lychnophorinae subtribe and insight into the evolution of the secondary metabolites of this group.

  17. Candelariella placodizans (Candelariaceae reported new to mainland China and Taiwan based on morphological, chemical and molecular phylogenetic analyses

    Directory of Open Access Journals (Sweden)

    Lidia Yakovchenko

    2016-06-01

    Full Text Available Candelariella placodizans is newly reported from China. It was collected on exposed rocks with mosses on the alpine areas of Taiwan and Yunnan Province, China at elevation between 3200-4400 m. Molecular phylogenetic analyses based on ITS rDNA sequences were also performed to confirm the monophyly of the Chinese populations with respect to already existing sequences of the species, and then further to examine their relationships to other members of the genus. An identification key to all 14 known taxa of Candelariella in China is provided.

  18. Phylogenetic relationship among Kenyan sorghum germplasms ...

    African Journals Online (AJOL)

    Mr Kiboi

    phylogenetic relationships based on 10 DNA fragments at AltSB loci with SbMATE, ORF9 and MITE primers. .... estimate the overall genetic diversity in Kenyan sorghum lines: Cheprot et al. 3529 ..... EARN project and Generation Challenge (GCP), ... genetics and molecular biology of plant aluminum resistance and toxicity.

  19. Genomic repeat abundances contain phylogenetic signal

    Czech Academy of Sciences Publication Activity Database

    Dodsworth, S.; Chase, M.W.; Kelly, L.J.; Leitch, I.J.; Macas, Jiří; Novák, Petr; Piednoël, M.; Weiß-Schneeweiss, H.; Leitch, A.R.

    2015-01-01

    Roč. 64, č. 1 (2015), s. 112-126 ISSN 1063-5157 R&D Projects: GA ČR GBP501/12/G090 Institutional support: RVO:60077344 Keywords : Repetitive DNA * continuous characters * genomics * next-generation sequencing * phylogenetics Subject RIV: EB - Genetics ; Molecular Biology Impact factor: 8.225, year: 2015

  20. PhyTB: Phylogenetic tree visualisation and sample positioning for M. tuberculosis

    KAUST Repository

    Benavente, Ernest D; Coll, Francesc; Furnham, Nick; McNerney, Ruth; Glynn, Judith R; Campino, Susana; Pain, Arnab; Mohareb, Fady R; Clark, Taane G

    2015-01-01

    Phylogenetic-based classification of M. tuberculosis and other bacterial genomes is a core analysis for studying evolutionary hypotheses, disease outbreaks and transmission events. Whole genome sequencing is providing new insights

  1. A remarkable new species of Liparis (Orchidaceae from China and its phylogenetic implications.

    Directory of Open Access Journals (Sweden)

    Lin Li

    Full Text Available In the present study, we formally describe Liparis pingxiangensis as a new species from Guangxi, China on the basis of morphological and molecular phylogenetic analyses. It is easily distinguished from closely related species by strongly curved column without column wings, and broadly rhombic-elliptic lip with 2 uncinate calli at the base. In particular, it differs most markedly from its congeners in possessing two pollinia attached by long and prominent caudicles (not stipes, to a distinct sticky disc. This type of pollinarium, as far as we know, is not found in any other species of Liparis, and is also unique among the orchids with waxy pollinia. We then proceeded to a phylogenetic analysis to ascertain the systematic position of this enigmatic species. Molecular study based on nuclear ribosomal ITS and plastid matK DNA sequence data supports L. pingxiangensis as a distinct species, which forms an independent lineage sister to L. nervosa and its allies (93% BS, 1.00 BPP. In the light of previous work, the findings have important implications for a better understanding of the well-supported pattern mainly based on vegetative features in Malaxideae.

  2. Two new hyaline-ascospored species of Trichoderma and their phylogenetic positions.

    Science.gov (United States)

    Qin, W T; Zhuang, W Y

    2016-01-01

    Collections of hypocrealean fungi found on decaying wood in subtropical regions of China were examined. Two new species, Trichoderma confluens and T. hubeiense, were discovered and are described. Trichoderma confluens is characterized by its widely effuse to rarely pulvinate, yellow stromata with densely disposed yellowish brown ostioles, simple acremonium- to verticillium-like conidiophores, hyaline conidia and multiform chlamydospores. Trichoderma hubeiense has pulvinate, grayish yellow stromata with brownish ostioles, trichoderma- to verticillium-like conidiophores and hyaline conidia. The phylogenetic positions of the two fungi were investigated based on sequence analyses of RNA polymerase II subunit b and translation elongation factor 1-α genes. The results indicate that T. confluens belongs to the Hypocreanum clade and is associated with but clearly separated from T. applanatum and T. decipiens. Trichoderma hubeiense belongs to the Polysporum clade and related to T. bavaricum but obviously differs from other members of the clade in sequence data. Morphological distinctions between the new species and their close relatives are noted and discussed. © 2016 by The Mycological Society of America.

  3. Phylogenetic diversity and biodiversity indices on phylogenetic networks.

    Science.gov (United States)

    Wicke, Kristina; Fischer, Mareike

    2018-04-01

    In biodiversity conservation it is often necessary to prioritize the species to conserve. Existing approaches to prioritization, e.g. the Fair Proportion Index and the Shapley Value, are based on phylogenetic trees and rank species according to their contribution to overall phylogenetic diversity. However, in many cases evolution is not treelike and thus, phylogenetic networks have been developed as a generalization of phylogenetic trees, allowing for the representation of non-treelike evolutionary events, such as hybridization. Here, we extend the concepts of phylogenetic diversity and phylogenetic diversity indices from phylogenetic trees to phylogenetic networks. On the one hand, we consider the treelike content of a phylogenetic network, e.g. the (multi)set of phylogenetic trees displayed by a network and the so-called lowest stable ancestor tree associated with it. On the other hand, we derive the phylogenetic diversity of subsets of taxa and biodiversity indices directly from the internal structure of the network. We consider both approaches that are independent of so-called inheritance probabilities as well as approaches that explicitly incorporate these probabilities. Furthermore, we introduce our software package NetDiversity, which is implemented in Perl and allows for the calculation of all generalized measures of phylogenetic diversity and generalized phylogenetic diversity indices established in this note that are independent of inheritance probabilities. We apply our methods to a phylogenetic network representing the evolutionary relationships among swordtails and platyfishes (Xiphophorus: Poeciliidae), a group of species characterized by widespread hybridization. Copyright © 2018 Elsevier Inc. All rights reserved.

  4. Complete Chloroplast Genomes of Papaver rhoeas and Papaver orientale: Molecular Structures, Comparative Analysis, and Phylogenetic Analysis

    Directory of Open Access Journals (Sweden)

    Jianguo Zhou

    2018-02-01

    Full Text Available Papaver rhoeas L. and P. orientale L., which belong to the family Papaveraceae, are used as ornamental and medicinal plants. The chloroplast genome has been used for molecular markers, evolutionary biology, and barcoding identification. In this study, the complete chloroplast genome sequences of P. rhoeas and P. orientale are reported. Results show that the complete chloroplast genomes of P. rhoeas and P. orientale have typical quadripartite structures, which are comprised of circular 152,905 and 152,799-bp-long molecules, respectively. A total of 130 genes were identified in each genome, including 85 protein-coding genes, 37 tRNA genes, and 8 rRNA genes. Sequence divergence analysis of four species from Papaveraceae indicated that the most divergent regions are found in the non-coding spacers with minimal differences among three Papaver species. These differences include the ycf1 gene and intergenic regions, such as rpoB-trnC, trnD-trnT, petA-psbJ, psbE-petL, and ccsA-ndhD. These regions are hypervariable regions, which can be used as specific DNA barcodes. This finding suggested that the chloroplast genome could be used as a powerful tool to resolve the phylogenetic positions and relationships of Papaveraceae. These results offer valuable information for future research in the identification of Papaver species and will benefit further investigations of these species.

  5. Evidence of two distinct phylogenetic lineages of dog rabies virus circulating in Cambodia.

    Science.gov (United States)

    Mey, Channa; Metlin, Artem; Duong, Veasna; Ong, Sivuth; In, Sotheary; Horwood, Paul F; Reynes, Jean-Marc; Bourhy, Hervé; Tarantola, Arnaud; Buchy, Philippe

    2016-03-01

    This first extensive retrospective study of the molecular epidemiology of dog rabies in Cambodia included 149 rabies virus (RABV) entire nucleoprotein sequences obtained from 1998-2011. The sequences were analyzed in conjunction with RABVs from other Asian countries. Phylogenetic reconstruction confirmed the South-East Asian phylogenetic clade comprising viruses from Cambodia, Vietnam, Thailand, Laos and Myanmar. The present study represents the first attempt to classify the phylogenetic lineages inside this clade, resulting in the confirmation that all the Cambodian viruses belonged to the South-East Asian (SEA) clade. Three distinct phylogenetic lineages in the region were established with the majority of viruses from Cambodia closely related to viruses from Thailand, Laos and Vietnam, forming the geographically widespread phylogenetic lineage SEA1. A South-East Asian lineage SEA2 comprised two viruses from Cambodia was identified, which shared a common ancestor with RABVs originating from Laos. Viruses from Myanmar formed separate phylogenetic lineages within the major SEA clade. Bayesian molecular clock analysis suggested that the time to most recent common ancestor (TMRCA) of all Cambodian RABVs dated to around 1950. The TMRCA of the Cambodian SEA1 lineage was around 1964 and that of the SEA2 lineage was around 1953. The results identified three phylogenetically distinct and geographically separated lineages inside the earlier identified major SEA clade, covering at least five countries in the region. A greater understanding of the molecular epidemiology of rabies in South-East Asia is an important step to monitor progress on the efforts to control canine rabies in the region. Copyright © 2015 Elsevier B.V. All rights reserved.

  6. A RAD-based phylogenetics for Orestias fishes from Lake Titicaca.

    Science.gov (United States)

    Takahashi, Tetsumi; Moreno, Edmundo

    2015-12-01

    The fish genus Orestias is endemic to the Andes highlands, and Lake Titicaca is the centre of the species diversity of the genus. Previous phylogenetic studies based on a single locus of mitochondrial and nuclear DNA strongly support the monophyly of a group composed of many of species endemic to the Lake Titicaca basin (the Lake Titicaca radiation), but the relationships among the species in the radiation remain unclear. Recently, restriction site-associated DNA (RAD) sequencing, which can produce a vast number of short sequences from various loci of nuclear DNA, has emerged as a useful way to resolve complex phylogenetic problems. To propose a new phylogenetic hypothesis of Orestias fishes of the Lake Titicaca radiation, we conducted a cluster analysis based on morphological similarities among fish samples and a molecular phylogenetic analysis based on RAD sequencing. From a morphological cluster analysis, we recognised four species groups in the radiation, and three of the four groups were resolved as monophyletic groups in maximum-likelihood trees based on RAD sequencing data. The other morphology-based group was not resolved as a monophyletic group in molecular phylogenies, and some members of the group were diverged from its sister group close to the root of the Lake Titicaca radiation. The evolution of these fishes is discussed from the phylogenetic relationships. Copyright © 2015 Elsevier Inc. All rights reserved.

  7. Systematics of the grey mullets (Teleostei: Mugiliformes: Mugilidae): molecular phylogenetic evidence challenges two centuries of morphology-based taxonomy.

    Science.gov (United States)

    Durand, J-D; Shen, K-N; Chen, W-J; Jamandre, B W; Blel, H; Diop, K; Nirchio, M; Garcia de León, F J; Whitfield, A K; Chang, C-W; Borsa, P

    2012-07-01

    The family Mugilidae comprises mainly coastal marine species that are widely distributed in all tropical, subtropical and temperate seas. Mugilid species are generally considered to be ecologically important and they are a major food resource for human populations in certain parts of the world. The taxonomy and systematics of the Mugilidae are still much debated and based primarily on morphological characters. In this study, we provide the first comprehensive molecular systematic account of the Mugilidae using phylogenetic analyses of nucleotide sequence variation at three mitochondrial loci (16S rRNA, cytochrome oxidase I, and cytochrome b) for 257 individuals from 55 currently recognized species. The study covers all 20 mugilid genera currently recognized as being valid. The family comprises seven major lineages that radiated early on from the ancestor to all current forms. All genera that were represented by two species or more, except Cestraeus, turned out to be paraphyletic or polyphyletic. Thus, the present phylogenetic results generally disagree with the current taxonomy at the genus level and imply that the anatomical characters used for the systematics of the Mugilidae may be poorly informative phylogenetically. The present results should provide a sound basis for a taxonomic revision of the mugilid genera. A proportion of the species with large distribution ranges (including Moolgarda seheli, Mugil cephalus and M. curema) appear to consist of cryptic species, thus warranting further taxonomic and genetic work at the infra-generic level. Copyright © 2012 Elsevier Inc. All rights reserved.

  8. Identification of Phylogenetic Position in the Chlamydiaceae Family for Chlamydia Strains Released from Monkeys and Humans with Chlamydial Pathology

    Directory of Open Access Journals (Sweden)

    Alexander Karaulov

    2010-01-01

    Full Text Available Based on the results of the comparative analysis concerning relatedness and evolutional difference of the 16S–23S nucleotide sequences of the middle ribosomal cluster and 23S rRNA I domain, and based on identification of phylogenetic position for Chlamydophila pneumoniae and Chlamydia trichomatis strains released from monkeys, relatedness of the above stated isolates with similar strains released from humans and with strains having nucleotide sequences presented in the GenBank electronic database has been detected for the first time ever. Position of these isolates in the Chlamydiaceae family phylogenetic tree has been identified. The evolutional position of the investigated original Chlamydia and Chlamydophila strains close to analogous strains from the Gen-Bank electronic database has been demonstrated. Differences in the 16S–23S nucleotide sequence of the middle ribosomal cluster and 23S rRNA I domain of plasmid and nonplasmid Chlamydia trachomatis strains released from humans and monkeys relative to different genotype groups (group B-B, Ba, D, Da, E, L1, L2, L2a; intermediate group-F, G, Ga have been revealed for the first time ever. Abnormality in incA chromosomal gene expression resulting in Chlamydia life development cycle disorder, and decrease of Chlamydia virulence can be related to probable changes in the nucleotide sequence of the gene under consideration

  9. Phylogenetic estimates of diversification rate are affected by molecular rate variation.

    Science.gov (United States)

    Duchêne, D A; Hua, X; Bromham, L

    2017-10-01

    Molecular phylogenies are increasingly being used to investigate the patterns and mechanisms of macroevolution. In particular, node heights in a phylogeny can be used to detect changes in rates of diversification over time. Such analyses rest on the assumption that node heights in a phylogeny represent the timing of diversification events, which in turn rests on the assumption that evolutionary time can be accurately predicted from DNA sequence divergence. But there are many influences on the rate of molecular evolution, which might also influence node heights in molecular phylogenies, and thus affect estimates of diversification rate. In particular, a growing number of studies have revealed an association between the net diversification rate estimated from phylogenies and the rate of molecular evolution. Such an association might, by influencing the relative position of node heights, systematically bias estimates of diversification time. We simulated the evolution of DNA sequences under several scenarios where rates of diversification and molecular evolution vary through time, including models where diversification and molecular evolutionary rates are linked. We show that commonly used methods, including metric-based, likelihood and Bayesian approaches, can have a low power to identify changes in diversification rate when molecular substitution rates vary. Furthermore, the association between the rates of speciation and molecular evolution rate can cause the signature of a slowdown or speedup in speciation rates to be lost or misidentified. These results suggest that the multiple sources of variation in molecular evolutionary rates need to be considered when inferring macroevolutionary processes from phylogenies. © 2017 European Society For Evolutionary Biology. Journal of Evolutionary Biology © 2017 European Society For Evolutionary Biology.

  10. Morphological and Molecular Phylogenetic Data Reveal a New Species of Primula (Primulaceae from Hunan, China.

    Directory of Open Access Journals (Sweden)

    Yuan Xu

    Full Text Available A new species of Primulaceae, Primula undulifolia, is described from the hilly area of Hunan province in south-central China. Its morphology and distributional range suggest that it is allied to P. kwangtungensis, both adapted to subtropical climate, having contiguous distribution and similar habitat, growing on shady and moist cliffs. Petioles, scapes and pedicels of them are densely covered with rusty multicellular hairs, but the new species can be easily distinguished by its smaller flowers and narrowly oblong leaves with undulate margins. Molecular phylogenetic analysis based on four DNA markers (ITS, matK, trnL-F and rps16 confirmed the new species as an independent lineage and constitutes a main clade together with P. kwangtungensis, P. kweichouensis, P. wangii and P. hunanensis of Primula sect. Carolinella.

  11. Evaluation of a Phylogenetic Marker Based on Genomic Segment B of Infectious Bursal Disease Virus: Facilitating a Feasible Incorporation of this Segment to the Molecular Epidemiology Studies for this Viral Agent.

    Directory of Open Access Journals (Sweden)

    Abdulahi Alfonso-Morales

    Full Text Available Infectious bursal disease (IBD is a highly contagious and acute viral disease, which has caused high mortality rates in birds and considerable economic losses in different parts of the world for more than two decades and it still represents a considerable threat to poultry. The current study was designed to rigorously measure the reliability of a phylogenetic marker included into segment B. This marker can facilitate molecular epidemiology studies, incorporating this segment of the viral genome, to better explain the links between emergence, spreading and maintenance of the very virulent IBD virus (vvIBDV strains worldwide.Sequences of the segment B gene from IBDV strains isolated from diverse geographic locations were obtained from the GenBank Database; Cuban sequences were obtained in the current work. A phylogenetic marker named B-marker was assessed by different phylogenetic principles such as saturation of substitution, phylogenetic noise and high consistency. This last parameter is based on the ability of B-marker to reconstruct the same topology as the complete segment B of the viral genome. From the results obtained from B-marker, demographic history for both main lineages of IBDV regarding segment B was performed by Bayesian skyline plot analysis. Phylogenetic analysis for both segments of IBDV genome was also performed, revealing the presence of a natural reassortant strain with segment A from vvIBDV strains and segment B from non-vvIBDV strains within Cuban IBDV population.This study contributes to a better understanding of the emergence of vvIBDV strains, describing molecular epidemiology of IBDV using the state-of-the-art methodology concerning phylogenetic reconstruction. This study also revealed the presence of a novel natural reassorted strain as possible manifest of change in the genetic structure and stability of the vvIBDV strains. Therefore, it highlights the need to obtain information about both genome segments of IBDV for

  12. Phylogenetic systematics of the genus Echinococcus (Cestoda: Taeniidae).

    Science.gov (United States)

    Nakao, Minoru; Lavikainen, Antti; Yanagida, Tetsuya; Ito, Akira

    2013-11-01

    Echinococcosis is a serious helminthic zoonosis in humans, livestock and wildlife. The pathogenic organisms are members of the genus Echinococcus (Cestoda: Taeniidae). Life cycles of Echinococcus spp. are consistently dependent on predator-prey association between two obligate mammalian hosts. Carnivores (canids and felids) serve as definitive hosts for adult tapeworms and their herbivore prey (ungulates, rodents and lagomorphs) as intermediate hosts for metacestode larvae. Humans are involved as an accidental host for metacestode infections. The metacestodes develop in various internal organs, particularly in liver and lungs. Each metacestode of Echinococcus spp. has an organotropism and a characteristic form known as an unilocular (cystic), alveolar or polycystic hydatid. Recent molecular phylogenetic studies have demonstrated that the type species, Echinococcus granulosus, causing cystic echinococcosis is a cryptic species complex. Therefore, the orthodox taxonomy of Echinococcus established from morphological criteria has been revised from the standpoint of phylogenetic systematics. Nine valid species including newly resurrected taxa are recognised as a result of the revision. This review summarises the recent advances in the phylogenetic systematics of Echinococcus, together with the historical backgrounds and molecular epidemiological aspects of each species. A new phylogenetic tree inferred from the mitochondrial genomes of all valid Echinococcus spp. is also presented. The taxonomic nomenclature for Echinococcus oligarthrus is shown to be incorrect and this name should be replaced with Echinococcus oligarthra. Copyright © 2013 Australian Society for Parasitology Inc. Published by Elsevier Ltd. All rights reserved.

  13. [Molecular diagnostics of ALK-positive lung cancer].

    Science.gov (United States)

    Tímár, József; Lotz, Gábor; Rásó, Erzsébet; Moldvay, Judit

    2017-09-20

    ALK translocation is the 3rd most frequent genetic aberration in lung adenocarcinoma, and several inhibitors are now clinically available in first and second line settings. Accordingly, molecular diagnostics of ALK-positive lung cancer is very important and can be done with the rational combination of several methods. All international recommendations suggest that, except for cytological samples, screening technology for ALK-positive tumors is immunohistochemistry using a validated test. It is highly recommended that in case of ALK protein positive samples gene translocation must be confirmed by fluorescent in situ hybridization (FISH). In case of cytological samples FISH technique must be used as ALK diagnostics. In equivocal cases the genetic alteration of ALK can be confirmed by alternative molecular techniques such as next generation sequencing or RNAbased PCR methods. Upon administration of ALK inhibitors, acquired resistance is frequent which is mostly due to ALK amplification and/or mutation. It is evident that the diagnostics of these secondary ALK gene alterations must be done from recurrent tumors or circulating nucleic acids.

  14. Molecular and phylogenetic characterization of Cryptosporidium and Giardia from pigs and cattle in Denmark

    DEFF Research Database (Denmark)

    Langkjær, Rikke Breinhold; Vigre, Håkan; Enemark, Heidi L.

    2007-01-01

    The genetic diversity of Cryptosporidium spp. and Giardia duodenalis from dairy cattle and pigs in Denmark was determined in the present study. Faecal samples from 1237 pigs and 1150 cattle originating from 50 sow herds and 50 dairy herds, respectively, were analysed for the presence of the two...... parasites by immunofluorescence microscopy. A large proportion of the (oo)cyst containing samples were selected for molecular characterization. Sequencing and phylogenetic analysis of the 18S rDNA locus and/or the HSP70 gene of 183 pig and 154 cattle isolates of Cryptosporidium revealed the presence of C....... suis, pig genotype II, C. parvum (cattle genotype), C. bovis, Cryptosporidium deer-like genotype and a novel C. suis-like genotype. For both cattle and pigs, a host age-related change in distribution of species/genotypes was observed. The zoonotic C. parvum (cattle genotype) was most prevalent in young...

  15. Phylogenetic placement of two species known only from resting spores

    DEFF Research Database (Denmark)

    Hajek, Ann E; Gryganskyi, Andrii; Bittner, Tonya

    2016-01-01

    resting spores, Zoophthora independentia, infecting Tipula (Lunatipula) submaculata in New York State, is now described as a new species and Tarichium porteri, described in 1942, which infects Tipula (Triplicitipula) colei in Tennessee, is transferred to the genus Zoophthora. We have shown that use......Molecular methods were used to determine the generic placement of two species of Entomophthorales known only from resting spores. Historically, these species would belong in the form-genus Tarichium, but this classification provides no information about phylogenetic relationships. Using DNA from...... of molecular methods can assist with determination of the phylogenetic relations of specimens within the form-genus Tarichium for an already described species and a new species for which only resting spores are available....

  16. PhyDesign: an online application for profiling phylogenetic informativeness

    Directory of Open Access Journals (Sweden)

    Townsend Jeffrey P

    2011-05-01

    Full Text Available Abstract Background The rapid increase in number of sequenced genomes for species across of the tree of life is revealing a diverse suite of orthologous genes that could potentially be employed to inform molecular phylogenetic studies that encompass broader taxonomic sampling. Optimal usage of this diversity of loci requires user-friendly tools to facilitate widespread cost-effective locus prioritization for phylogenetic sampling. The Townsend (2007 phylogenetic informativeness provides a unique empirical metric for guiding marker selection. However, no software or automated methodology to evaluate sequence alignments and estimate the phylogenetic informativeness metric has been available. Results Here, we present PhyDesign, a platform-independent online application that implements the Townsend (2007 phylogenetic informativeness analysis, providing a quantitative prediction of the utility of loci to solve specific phylogenetic questions. An easy-to-use interface facilitates uploading of alignments and ultrametric trees to calculate and depict profiles of informativeness over specified time ranges, and provides rankings of locus prioritization for epochs of interest. Conclusions By providing these profiles, PhyDesign facilitates locus prioritization increasing the efficiency of sequencing for phylogenetic purposes compared to traditional studies with more laborious and low capacity screening methods, as well as increasing the accuracy of phylogenetic studies. Together with a manual and sample files, the application is freely accessible at http://phydesign.townsend.yale.edu.

  17. Using genes as characters and a parsimony analysis to explore the phylogenetic position of turtles.

    Directory of Open Access Journals (Sweden)

    Bin Lu

    Full Text Available The phylogenetic position of turtles within the vertebrate tree of life remains controversial. Conflicting conclusions from different studies are likely a consequence of systematic error in the tree construction process, rather than random error from small amounts of data. Using genomic data, we evaluate the phylogenetic position of turtles with both conventional concatenated data analysis and a "genes as characters" approach. Two datasets were constructed, one with seven species (human, opossum, zebra finch, chicken, green anole, Chinese pond turtle, and western clawed frog and 4584 orthologous genes, and the second with four additional species (soft-shelled turtle, Nile crocodile, royal python, and tuatara but only 1638 genes. Our concatenated data analysis strongly supported turtle as the sister-group to archosaurs (the archosaur hypothesis, similar to several recent genomic data based studies using similar methods. When using genes as characters and gene trees as character-state trees with equal weighting for each gene, however, our parsimony analysis suggested that turtles are possibly sister-group to diapsids, archosaurs, or lepidosaurs. None of these resolutions were strongly supported by bootstraps. Furthermore, our incongruence analysis clearly demonstrated that there is a large amount of inconsistency among genes and most of the conflict relates to the placement of turtles. We conclude that the uncertain placement of turtles is a reflection of the true state of nature. Concatenated data analysis of large and heterogeneous datasets likely suffers from systematic error and over-estimates of confidence as a consequence of a large number of characters. Using genes as characters offers an alternative for phylogenomic analysis. It has potential to reduce systematic error, such as data heterogeneity and long-branch attraction, and it can also avoid problems associated with computation time and model selection. Finally, treating genes as

  18. Using Genes as Characters and a Parsimony Analysis to Explore the Phylogenetic Position of Turtles

    Science.gov (United States)

    Lu, Bin; Yang, Weizhao; Dai, Qiang; Fu, Jinzhong

    2013-01-01

    The phylogenetic position of turtles within the vertebrate tree of life remains controversial. Conflicting conclusions from different studies are likely a consequence of systematic error in the tree construction process, rather than random error from small amounts of data. Using genomic data, we evaluate the phylogenetic position of turtles with both conventional concatenated data analysis and a “genes as characters” approach. Two datasets were constructed, one with seven species (human, opossum, zebra finch, chicken, green anole, Chinese pond turtle, and western clawed frog) and 4584 orthologous genes, and the second with four additional species (soft-shelled turtle, Nile crocodile, royal python, and tuatara) but only 1638 genes. Our concatenated data analysis strongly supported turtle as the sister-group to archosaurs (the archosaur hypothesis), similar to several recent genomic data based studies using similar methods. When using genes as characters and gene trees as character-state trees with equal weighting for each gene, however, our parsimony analysis suggested that turtles are possibly sister-group to diapsids, archosaurs, or lepidosaurs. None of these resolutions were strongly supported by bootstraps. Furthermore, our incongruence analysis clearly demonstrated that there is a large amount of inconsistency among genes and most of the conflict relates to the placement of turtles. We conclude that the uncertain placement of turtles is a reflection of the true state of nature. Concatenated data analysis of large and heterogeneous datasets likely suffers from systematic error and over-estimates of confidence as a consequence of a large number of characters. Using genes as characters offers an alternative for phylogenomic analysis. It has potential to reduce systematic error, such as data heterogeneity and long-branch attraction, and it can also avoid problems associated with computation time and model selection. Finally, treating genes as characters

  19. Compositional and mutational rate heterogeneity in mitochondrial genomes and its effect on the phylogenetic inferences of Cimicomorpha (Hemiptera: Heteroptera).

    Science.gov (United States)

    Yang, Huanhuan; Li, Teng; Dang, Kai; Bu, Wenjun

    2018-04-18

    Mitochondrial genome (mt-genome) data can potentially return artefactual relationships in the higher-level phylogenetic inference of insects due to the biases of accelerated substitution rates and compositional heterogeneity. Previous studies based on mt-genome data alone showed a paraphyly of Cimicomorpha (Insecta, Hemiptera) due to the positions of the families Tingidae and Reduviidae rather than the monophyly that was supported based on morphological characters, morphological and molecular combined data and large scale molecular datasets. Various strategies have been proposed to ameliorate the effects of potential mt-genome biases, including dense taxon sampling, removal of third codon positions or purine-pyrimidine coding and the use of site-heterogeneous models. In this study, we sequenced the mt-genomes of five additional Tingidae species and discussed the compositional and mutational rate heterogeneity in mt-genomes and its effect on the phylogenetic inferences of Cimicomorpha by implementing the bias-reduction strategies mentioned above. Heterogeneity in nucleotide composition and mutational biases were found in mt protein-coding genes, and the third codon exhibited high levels of saturation. Dense taxon sampling of Tingidae and Reduviidae and the other common strategies mentioned above were insufficient to recover the monophyly of the well-established group Cimicomorpha. When the sites with weak phylogenetic signals in the dataset were removed, the remaining dataset of mt-genomes can support the monophyly of Cimicomorpha; this support demonstrates that mt-genomes possess strong phylogenetic signals for the inference of higher-level phylogeny of this group. Comparison of the ratio of the removal of amino acids for each PCG showed that ATP8 has the highest ratio while CO1 has the lowest. This pattern is largely congruent with the evolutionary rate of 13 PCGs that ATP8 represents the highest evolutionary rate, whereas CO1 appears to be the lowest. Notably

  20. A nuclear phylogenetic analysis: SNPs, indels and SSRs deliver new insights into the relationships in the 'true citrus fruit trees' group (Citrinae, Rutaceae) and the origin of cultivated species.

    Science.gov (United States)

    Garcia-Lor, Andres; Curk, Franck; Snoussi-Trifa, Hager; Morillon, Raphael; Ancillo, Gema; Luro, François; Navarro, Luis; Ollitrault, Patrick

    2013-01-01

    Despite differences in morphology, the genera representing 'true citrus fruit trees' are sexually compatible, and their phylogenetic relationships remain unclear. Most of the important commercial 'species' of Citrus are believed to be of interspecific origin. By studying polymorphisms of 27 nuclear genes, the average molecular differentiation between species was estimated and some phylogenetic relationships between 'true citrus fruit trees' were clarified. Sanger sequencing of PCR-amplified fragments from 18 genes involved in metabolite biosynthesis pathways and nine putative genes for salt tolerance was performed for 45 genotypes of Citrus and relatives of Citrus to mine single nucleotide polymorphisms (SNPs) and indel polymorphisms. Fifty nuclear simple sequence repeats (SSRs) were also analysed. A total of 16 238 kb of DNA was sequenced for each genotype, and 1097 single nucleotide polymorphisms (SNPs) and 50 indels were identified. These polymorphisms were more valuable than SSRs for inter-taxon differentiation. Nuclear phylogenetic analysis revealed that Citrus reticulata and Fortunella form a cluster that is differentiated from the clade that includes three other basic taxa of cultivated citrus (C. maxima, C. medica and C. micrantha). These results confirm the taxonomic subdivision between the subgenera Metacitrus and Archicitrus. A few genes displayed positive selection patterns within or between species, but most of them displayed neutral patterns. The phylogenetic inheritance patterns of the analysed genes were inferred for commercial Citrus spp. Numerous molecular polymorphisms (SNPs and indels), which are potentially useful for the analysis of interspecific genetic structures, have been identified. The nuclear phylogenetic network for Citrus and its sexually compatible relatives was consistent with the geographical origins of these genera. The positive selection observed for a few genes will help further works to analyse the molecular basis of the

  1. The limitations of ontogenetic data in phylogenetic analyses

    NARCIS (Netherlands)

    Koenemann, Stefan; Schram, Frederick R.

    2002-01-01

    The analysis of consecutive ontogenetic stages, or events, introduces a new class of data to phylogenetic systematics that are distinctly different from traditional morphological characters and molecular sequence data. Ontogenetic event sequences are distinguished by varying degrees of both a

  2. Comprehensive untargeted metabolomics of Lychnnophorinae subtribe (Asteraceae: Vernonieae in a phylogenetic context.

    Directory of Open Access Journals (Sweden)

    Maria Elvira Poleti Martucci

    Full Text Available Members of the subtribe Lychnophorinae occur mostly within the Cerrado domain of the Brazilian Central Plateau. The relationships between its 11 genera, as well as between Lychnophorinae and other subtribes belonging to the tribe Vernonieae, have recently been investigated upon a phylogeny based on molecular and morphological data. We report the use of a comprehensive untargeted metabolomics approach, combining HPLC-MS and GC-MS data, followed by multivariate analyses aiming to assess the congruence between metabolomics data and the phylogenetic hypothesis, as well as its potential as a chemotaxonomic tool. We analyzed 78 species by UHPLC-MS and GC-MS in both positive and negative ionization modes. The metabolic profiles obtained for these species were treated in MetAlign and in MSClust and the matrices generated were used in SIMCA for hierarchical cluster analyses, principal component analyses and orthogonal partial least square discriminant analysis. The results showed that metabolomic analyses are mostly congruent with the phylogenetic hypothesis especially at lower taxonomic levels (Lychnophora or Eremanthus. Our results confirm that data generated using metabolomics provide evidence for chemotaxonomical studies, especially for phylogenetic inference of the Lychnophorinae subtribe and insight into the evolution of the secondary metabolites of this group.

  3. Unrealistic phylogenetic trees may improve phylogenetic footprinting.

    Science.gov (United States)

    Nettling, Martin; Treutler, Hendrik; Cerquides, Jesus; Grosse, Ivo

    2017-06-01

    The computational investigation of DNA binding motifs from binding sites is one of the classic tasks in bioinformatics and a prerequisite for understanding gene regulation as a whole. Due to the development of sequencing technologies and the increasing number of available genomes, approaches based on phylogenetic footprinting become increasingly attractive. Phylogenetic footprinting requires phylogenetic trees with attached substitution probabilities for quantifying the evolution of binding sites, but these trees and substitution probabilities are typically not known and cannot be estimated easily. Here, we investigate the influence of phylogenetic trees with different substitution probabilities on the classification performance of phylogenetic footprinting using synthetic and real data. For synthetic data we find that the classification performance is highest when the substitution probability used for phylogenetic footprinting is similar to that used for data generation. For real data, however, we typically find that the classification performance of phylogenetic footprinting surprisingly increases with increasing substitution probabilities and is often highest for unrealistically high substitution probabilities close to one. This finding suggests that choosing realistic model assumptions might not always yield optimal predictions in general and that choosing unrealistically high substitution probabilities close to one might actually improve the classification performance of phylogenetic footprinting. The proposed PF is implemented in JAVA and can be downloaded from https://github.com/mgledi/PhyFoo. : martin.nettling@informatik.uni-halle.de. Supplementary data are available at Bioinformatics online. © The Author 2017. Published by Oxford University Press.

  4. A nuclear phylogenetic analysis: SNPs, indels and SSRs deliver new insights into the relationships in the ‘true citrus fruit trees’ group (Citrinae, Rutaceae) and the origin of cultivated species

    Science.gov (United States)

    Garcia-Lor, Andres; Curk, Franck; Snoussi-Trifa, Hager; Morillon, Raphael; Ancillo, Gema; Luro, François; Navarro, Luis; Ollitrault, Patrick

    2013-01-01

    Background and Aims Despite differences in morphology, the genera representing ‘true citrus fruit trees’ are sexually compatible, and their phylogenetic relationships remain unclear. Most of the important commercial ‘species’ of Citrus are believed to be of interspecific origin. By studying polymorphisms of 27 nuclear genes, the average molecular differentiation between species was estimated and some phylogenetic relationships between ‘true citrus fruit trees’ were clarified. Methods Sanger sequencing of PCR-amplified fragments from 18 genes involved in metabolite biosynthesis pathways and nine putative genes for salt tolerance was performed for 45 genotypes of Citrus and relatives of Citrus to mine single nucleotide polymorphisms (SNPs) and indel polymorphisms. Fifty nuclear simple sequence repeats (SSRs) were also analysed. Key Results A total of 16 238 kb of DNA was sequenced for each genotype, and 1097 single nucleotide polymorphisms (SNPs) and 50 indels were identified. These polymorphisms were more valuable than SSRs for inter-taxon differentiation. Nuclear phylogenetic analysis revealed that Citrus reticulata and Fortunella form a cluster that is differentiated from the clade that includes three other basic taxa of cultivated citrus (C. maxima, C. medica and C. micrantha). These results confirm the taxonomic subdivision between the subgenera Metacitrus and Archicitrus. A few genes displayed positive selection patterns within or between species, but most of them displayed neutral patterns. The phylogenetic inheritance patterns of the analysed genes were inferred for commercial Citrus spp. Conclusions Numerous molecular polymorphisms (SNPs and indels), which are potentially useful for the analysis of interspecific genetic structures, have been identified. The nuclear phylogenetic network for Citrus and its sexually compatible relatives was consistent with the geographical origins of these genera. The positive selection observed for a few genes will

  5. Extended molecular phylogenetics and revised systematics of Malagasy scincine lizards

    NARCIS (Netherlands)

    Erens, Jesse; Miralles, A.; Glaw, F.; Chatrou, L.W.; Vences, M.

    2017-01-01

    Among the endemic biota of Madagascar, skinks are a diverse radiation of lizards that exhibit a striking ecomorphological variation, and could provide an interesting system to study body-form evolution in squamate reptiles. We provide a new phylogenetic hypothesis for Malagasy skinks of the

  6. Phylogenetic trees

    OpenAIRE

    Baños, Hector; Bushek, Nathaniel; Davidson, Ruth; Gross, Elizabeth; Harris, Pamela E.; Krone, Robert; Long, Colby; Stewart, Allen; Walker, Robert

    2016-01-01

    We introduce the package PhylogeneticTrees for Macaulay2 which allows users to compute phylogenetic invariants for group-based tree models. We provide some background information on phylogenetic algebraic geometry and show how the package PhylogeneticTrees can be used to calculate a generating set for a phylogenetic ideal as well as a lower bound for its dimension. Finally, we show how methods within the package can be used to compute a generating set for the join of any two ideals.

  7. A remarkable new family of Jurassic insects (Neuroptera with primitive wing venation and its phylogenetic position in Neuropterida.

    Directory of Open Access Journals (Sweden)

    Qiang Yang

    Full Text Available BACKGROUND: Lacewings (insect order Neuroptera, known in the fossil record since the Early Permian, were most diverse in the Mesozoic. A dramatic variety of forms ranged in that time from large butterfly-like Kalligrammatidae to minute two-winged Dipteromantispidae. PRINCIPAL FINDINGS: We describe the intriguing new neuropteran family Parakseneuridae fam. nov. with three new genera and 15 new species from the Middle Jurassic of Daohugou (Inner Mongolia, China and the Early/Middle Jurassic of Sai-Sagul (Kyrgyzstan: Parakseneura undula gen. et sp. nov., P. albomacula gen. et sp. nov., P. curvivenis gen. et sp. nov., P. nigromacula gen. et sp. nov., P. nigrolinea gen. et sp. nov., P. albadelta gen. et sp. nov., P. cavomaculata gen. et sp. nov., P. inflata gen. et sp. nov., P. metallica gen. et sp. nov., P. emarginata gen. et sp. nov., P. directa gen. et sp. nov., Pseudorapisma jurassicum gen. et sp. nov., P. angustipenne gen. et sp. nov., P. maculatum gen. et sp. nov. (Daohugou; Shuraboneura ovata gen. et sp. nov. (Sai-Sagul. The family comprises large neuropterans with most primitive wing venation in the order indicated by the presence of ScA and AA1+2, and the dichotomous branching of MP, CuA, CuP, AA3+4, AP1+2. The phylogenetic position of Parakseneuridae was investigated using a phylogenetic analysis of morphological scoring for 33 families of extinct and extant Neuropterida combined with DNA sequence data for representatives of all extant families. Parakseneuridae were recovered in a clade with Osmylopsychopidae, Prohemerobiidae, and Ithonidae. CONCLUSIONS/SIGNIFICANCE: The presence of the presumed AA1+2 in wings of Parakseneuridae is a unique plesiomorphic condition hitherto unknown in Neuropterida, the clade comprising Neuroptera, Megaloptera, Raphidioptera. The relative uncertainty of phylogenetic position of Parakseneuridae and the majority of other families of Neuroptera reflects deficient paleontological data, especially from critical

  8. Timing of organogenesis support basal position of turtles in the amniote tree of life

    Directory of Open Access Journals (Sweden)

    Sánchez-Villagra Marcelo R

    2009-04-01

    Full Text Available Abstract Background The phylogenetic position of turtles is the most disputed aspect in the reconstruction of the land vertebrate tree of life. This controversy has arisen after many different kinds and revisions of investigations of molecular and morphological data. Three main hypotheses of living sister-groups of turtles have resulted from them: all reptiles, crocodiles + birds or squamates + tuatara. Although embryology has played a major role in morphological studies of vertebrate phylogeny, data on developmental timing have never been examined to explore and test the alternative phylogenetic hypotheses. We conducted a comprehensive study of published and new embryological data comprising 15 turtle and eight tetrapod species belonging to other taxa, integrating for the first time data on the side-necked turtle clade. Results The timing of events in organogenesis of diverse character complexes in all body regions is not uniform across amniotes and can be analysed using a parsimony-based method. Changes in the relative timing of particular events diagnose many clades of amniotes and include a phylogenetic signal. A basal position of turtles to the living saurian clades is clearly supported by timing of organogenesis data. Conclusion The clear signal of a basal position of turtles provided by heterochronic data implies significant convergence in either molecular, adult morphological or developmental timing characters, as only one of the alternative solutions to the phylogenetic conundrum can be right. The development of a standard reference series of embryological events in amniotes as presented here should enable future improvements and expansion of sampling and thus the examination of other hypotheses about phylogeny and patterns of the evolution of land vertebrate development.

  9. Fourier transform inequalities for phylogenetic trees.

    Science.gov (United States)

    Matsen, Frederick A

    2009-01-01

    Phylogenetic invariants are not the only constraints on site-pattern frequency vectors for phylogenetic trees. A mutation matrix, by its definition, is the exponential of a matrix with non-negative off-diagonal entries; this positivity requirement implies non-trivial constraints on the site-pattern frequency vectors. We call these additional constraints "edge-parameter inequalities". In this paper, we first motivate the edge-parameter inequalities by considering a pathological site-pattern frequency vector corresponding to a quartet tree with a negative internal edge. This site-pattern frequency vector nevertheless satisfies all of the constraints described up to now in the literature. We next describe two complete sets of edge-parameter inequalities for the group-based models; these constraints are square-free monomial inequalities in the Fourier transformed coordinates. These inequalities, along with the phylogenetic invariants, form a complete description of the set of site-pattern frequency vectors corresponding to bona fide trees. Said in mathematical language, this paper explicitly presents two finite lists of inequalities in Fourier coordinates of the form "monomial < or = 1", each list characterizing the phylogenetically relevant semialgebraic subsets of the phylogenetic varieties.

  10. Complete mitochondrial genome of Bugula neritina (Bryozoa, Gymnolaemata, Cheilostomata: phylogenetic position of Bryozoa and phylogeny of lophophorates within the Lophotrochozoa

    Directory of Open Access Journals (Sweden)

    Jang Kuem

    2009-04-01

    Full Text Available Abstract Background The phylogenetic position of Bryozoa is one of the most controversial issues in metazoan phylogeny. In an attempt to address this issue, the first bryozoan mitochondrial genome from Flustrellidra hispida (Gymnolaemata, Ctenostomata was recently sequenced and characterized. Unfortunately, it has extensive gene translocation and extremely reduced size. In addition, the phylogenies obtained from the result were conflicting, so they failed to assign a reliable phylogenetic position to Bryozoa or to clarify lophophorate phylogeny. Thus, it is necessary to characterize further mitochondrial genomes from slowly-evolving bryozoans to obtain a more credible lophophorate phylogeny. Results The complete mitochondrial genome (15,433 bp of Bugula neritina (Bryozoa, Gymnolaemata, Cheilostomata, one of the most widely distributed cheliostome bryozoans, is sequenced. This second bryozoan mitochondrial genome contains the set of 37 components generally observed in other metazoans, differing from that of F. hispida (Bryozoa, Gymnolaemata, Ctenostomata, which has only 36 components with loss of tRNAser(ucn genes. The B. neritina mitochondrial genome possesses 27 multiple noncoding regions. The gene order is more similar to those of the two remaining lophophorate phyla (Brachiopoda and Phoronida and a chiton Katharina tunicate than to that of F. hispida. Phylogenetic analyses based on the nucleotide sequences or amino acid residues of 12 protein-coding genes showed consistently that, within the Lophotrochozoa, the monophyly of the bryozoan class Gymnolaemata (B. neritina and F. hispida was strongly supported and the bryozoan clade was grouped with brachiopods. Echiura appeared as a subtaxon of Annelida, and Entoprocta as a sister taxon of Phoronida. The clade of Bryozoa + Brachiopoda was clustered with either the clade of Annelida-Echiura or that of Phoronida + Entoprocta. Conclusion This study presents the complete mitochondrial genome of a

  11. A case study for effects of operational taxonomic units from intracellular endoparasites and ciliates on the eukaryotic phylogeny: phylogenetic position of the haptophyta in analyses of multiple slowly evolving genes.

    Directory of Open Access Journals (Sweden)

    Hisayoshi Nozaki

    Full Text Available Recent multigene phylogenetic analyses have contributed much to our understanding of eukaryotic phylogeny. However, the phylogenetic positions of various lineages within the eukaryotes have remained unresolved or in conflict between different phylogenetic studies. These phylogenetic ambiguities might have resulted from mixtures or integration from various factors including limited taxon sampling, missing data in the alignment, saturations of rapidly evolving genes, mixed analyses of short- and long-branched operational taxonomic units (OTUs, intracellular endoparasite and ciliate OTUs with unusual substitution etc. In order to evaluate the effects from intracellular endoparasite and ciliate OTUs co-analyzed on the eukaryotic phylogeny and simplify the results, we here used two different sets of data matrices of multiple slowly evolving genes with small amounts of missing data and examined the phylogenetic position of the secondary photosynthetic chromalveolates Haptophyta, one of the most abundant groups of oceanic phytoplankton and significant primary producers. In both sets, a robust sister relationship between Haptophyta and SAR (stramenopiles, alveolates, rhizarians, or SA [stramenopiles and alveolates] was resolved when intracellular endoparasite/ciliate OTUs were excluded, but not in their presence. Based on comparisons of character optimizations on a fixed tree (with a clade composed of haptophytes and SAR or SA, disruption of the monophyly between haptophytes and SAR (or SA in the presence of intracellular endoparasite/ciliate OTUs can be considered to be a result of multiple evolutionary reversals of character positions that supported the synapomorphy of the haptophyte and SAR (or SA clade in the absence of intracellular endoparasite/ciliate OTUs.

  12. Targeted Enrichment of Large Gene Families for Phylogenetic Inference: Phylogeny and Molecular Evolution of Photosynthesis Genes in the Portullugo Clade (Caryophyllales).

    Science.gov (United States)

    Moore, Abigail J; Vos, Jurriaan M De; Hancock, Lillian P; Goolsby, Eric; Edwards, Erika J

    2018-05-01

    Hybrid enrichment is an increasingly popular approach for obtaining hundreds of loci for phylogenetic analysis across many taxa quickly and cheaply. The genes targeted for sequencing are typically single-copy loci, which facilitate a more straightforward sequence assembly and homology assignment process. However, this approach limits the inclusion of most genes of functional interest, which often belong to multi-gene families. Here, we demonstrate the feasibility of including large gene families in hybrid enrichment protocols for phylogeny reconstruction and subsequent analyses of molecular evolution, using a new set of bait sequences designed for the "portullugo" (Caryophyllales), a moderately sized lineage of flowering plants (~ 2200 species) that includes the cacti and harbors many evolutionary transitions to C$_{\\mathrm{4}}$ and CAM photosynthesis. Including multi-gene families allowed us to simultaneously infer a robust phylogeny and construct a dense sampling of sequences for a major enzyme of C$_{\\mathrm{4}}$ and CAM photosynthesis, which revealed the accumulation of adaptive amino acid substitutions associated with C$_{\\mathrm{4}}$ and CAM origins in particular paralogs. Our final set of matrices for phylogenetic analyses included 75-218 loci across 74 taxa, with ~ 50% matrix completeness across data sets. Phylogenetic resolution was greatly improved across the tree, at both shallow and deep levels. Concatenation and coalescent-based approaches both resolve the sister lineage of the cacti with strong support: Anacampserotaceae $+$ Portulacaceae, two lineages of mostly diminutive succulent herbs of warm, arid regions. In spite of this congruence, BUCKy concordance analyses demonstrated strong and conflicting signals across gene trees. Our results add to the growing number of examples illustrating the complexity of phylogenetic signals in genomic-scale data.

  13. Phylogenetic Analysis of Petunia sensu Jussieu (Solanaceae) using Chloroplast DNA RFLP

    OpenAIRE

    ANDO, TOSHIO; KOKUBUN, HISASHI; WATANABE, HITOSHI; TANAKA, NORIO; YUKAWA, TOMOHISA; HASHIMOTO, GORO; MARCHESI, EDUARDO; SUÁREZ, ENRIQUE; BASUALDO, ISABEL L.

    2005-01-01

    • Background and Aims The phylogenetic relationships of Petunia sensu Jussieu (Petunia sensu Wijsman plus Calibrachoa) are unclear. This study aimed to resolve this uncertainty using molecular evidence.

  14. Different relationships between temporal phylogenetic turnover and phylogenetic similarity and in two forests were detected by a new null model.

    Science.gov (United States)

    Huang, Jian-Xiong; Zhang, Jian; Shen, Yong; Lian, Ju-yu; Cao, Hong-lin; Ye, Wan-hui; Wu, Lin-fang; Bin, Yue

    2014-01-01

    Ecologists have been monitoring community dynamics with the purpose of understanding the rates and causes of community change. However, there is a lack of monitoring of community dynamics from the perspective of phylogeny. We attempted to understand temporal phylogenetic turnover in a 50 ha tropical forest (Barro Colorado Island, BCI) and a 20 ha subtropical forest (Dinghushan in southern China, DHS). To obtain temporal phylogenetic turnover under random conditions, two null models were used. The first shuffled names of species that are widely used in community phylogenetic analyses. The second simulated demographic processes with careful consideration on the variation in dispersal ability among species and the variations in mortality both among species and among size classes. With the two models, we tested the relationships between temporal phylogenetic turnover and phylogenetic similarity at different spatial scales in the two forests. Results were more consistent with previous findings using the second null model suggesting that the second null model is more appropriate for our purposes. With the second null model, a significantly positive relationship was detected between phylogenetic turnover and phylogenetic similarity in BCI at a 10 m×10 m scale, potentially indicating phylogenetic density dependence. This relationship in DHS was significantly negative at three of five spatial scales. This could indicate abiotic filtering processes for community assembly. Using variation partitioning, we found phylogenetic similarity contributed to variation in temporal phylogenetic turnover in the DHS plot but not in BCI plot. The mechanisms for community assembly in BCI and DHS vary from phylogenetic perspective. Only the second null model detected this difference indicating the importance of choosing a proper null model.

  15. Beyond barcoding: a mitochondrial genomics approach to molecular phylogenetics and diagnostics of blowflies (Diptera: Calliphoridae).

    Science.gov (United States)

    Nelson, Leigh A; Lambkin, Christine L; Batterham, Philip; Wallman, James F; Dowton, Mark; Whiting, Michael F; Yeates, David K; Cameron, Stephen L

    2012-12-15

    Members of the Calliphoridae (blowflies) are significant for medical and veterinary management, due to the ability of some species to consume living flesh as larvae, and for forensic investigations due to the ability of others to develop in corpses. Due to the difficulty of accurately identifying larval blowflies to species there is a need for DNA-based diagnostics for this family, however the widely used DNA-barcoding marker, cox1, has been shown to fail for several groups within this family. Additionally, many phylogenetic relationships within the Calliphoridae are still unresolved, particularly deeper level relationships. Sequencing whole mt genomes has been demonstrated both as an effective method for identifying the most informative diagnostic markers and for resolving phylogenetic relationships. Twenty-seven complete, or nearly so, mt genomes were sequenced representing 13 species, seven genera and four calliphorid subfamilies and a member of the related family Tachinidae. PCR and sequencing primers developed for sequencing one calliphorid species could be reused to sequence related species within the same superfamily with success rates ranging from 61% to 100%, demonstrating the speed and efficiency with which an mt genome dataset can be assembled. Comparison of molecular divergences for each of the 13 protein-coding genes and 2 ribosomal RNA genes, at a range of taxonomic scales identified novel targets for developing as diagnostic markers which were 117-200% more variable than the markers which have been used previously in calliphorids. Phylogenetic analysis of whole mt genome sequences resulted in much stronger support for family and subfamily-level relationships. The Calliphoridae are polyphyletic, with the Polleninae more closely related to the Tachinidae, and the Sarcophagidae are the sister group of the remaining calliphorids. Within the Calliphoridae, there was strong support for the monophyly of the Chrysomyinae and Luciliinae and for the sister

  16. Phylogenetic reconstruction prompts taxonomic changes in Sauropus, Synostemon and Breynia (Phyllanthaceae tribe Phyllantheae)

    NARCIS (Netherlands)

    Welzen, van P.C.; Pruesapan, K.; Telford, I.R.H.; Esser, H.-J.; Bruhl, J.J.

    2014-01-01

    Previous molecular phylogenetic studies indicated expansion of Breynia with inclusion of Sauropus s.str. (excluding Synostemon). The present study adds qualitative and quantitative morphological characters to molecular data to find more resolution and/or higher support for the subgroups within

  17. Detecting taxonomic and phylogenetic signals in equid cheek teeth: towards new palaeontological and archaeological proxies

    Science.gov (United States)

    Mohaseb, A.; Peigné, S.; Debue, K.; Orlando, L.; Mashkour, M.

    2017-01-01

    The Plio–Pleistocene evolution of Equus and the subsequent domestication of horses and donkeys remains poorly understood, due to the lack of phenotypic markers capable of tracing this evolutionary process in the palaeontological/archaeological record. Using images from 345 specimens, encompassing 15 extant taxa of equids, we quantified the occlusal enamel folding pattern in four mandibular cheek teeth with a single geometric morphometric protocol. We initially investigated the protocol accuracy by assigning each tooth to its correct anatomical position and taxonomic group. We then contrasted the phylogenetic signal present in each tooth shape with an exome-wide phylogeny from 10 extant equine species. We estimated the strength of the phylogenetic signal using a Brownian motion model of evolution with multivariate K statistic, and mapped the dental shape along the molecular phylogeny using an approach based on squared-change parsimony. We found clear evidence for the relevance of dental phenotypes to accurately discriminate all modern members of the genus Equus and capture their phylogenetic relationships. These results are valuable for both palaeontologists and zooarchaeologists exploring the spatial and temporal dynamics of the evolutionary history of the horse family, up to the latest domestication trajectories of horses and donkeys. PMID:28484618

  18. Distinctive mitochondrial genome of Calanoid copepod Calanus sinicus with multiple large non-coding regions and reshuffled gene order: Useful molecular markers for phylogenetic and population studies

    Science.gov (United States)

    2011-01-01

    Background Copepods are highly diverse and abundant, resulting in extensive ecological radiation in marine ecosystems. Calanus sinicus dominates continental shelf waters in the northwest Pacific Ocean and plays an important role in the local ecosystem by linking primary production to higher trophic levels. A lack of effective molecular markers has hindered phylogenetic and population genetic studies concerning copepods. As they are genome-level informative, mitochondrial DNA sequences can be used as markers for population genetic studies and phylogenetic studies. Results The mitochondrial genome of C. sinicus is distinct from other arthropods owing to the concurrence of multiple non-coding regions and a reshuffled gene arrangement. Further particularities in the mitogenome of C. sinicus include low A + T-content, symmetrical nucleotide composition between strands, abbreviated stop codons for several PCGs and extended lengths of the genes atp6 and atp8 relative to other copepods. The monophyletic Copepoda should be placed within the Vericrustacea. The close affinity between Cyclopoida and Poecilostomatoida suggests reassigning the latter as subordinate to the former. Monophyly of Maxillopoda is rejected. Within the alignment of 11 C. sinicus mitogenomes, there are 397 variable sites harbouring three 'hotspot' variable sites and three microsatellite loci. Conclusion The occurrence of the circular subgenomic fragment during laboratory assays suggests that special caution should be taken when sequencing mitogenomes using long PCR. Such a phenomenon may provide additional evidence of mitochondrial DNA recombination, which appears to have been a prerequisite for shaping the present mitochondrial profile of C. sinicus during its evolution. The lack of synapomorphic gene arrangements among copepods has cast doubt on the utility of gene order as a useful molecular marker for deep phylogenetic analysis. However, mitochondrial genomic sequences have been valuable markers for

  19. Marine turtle mitogenome phylogenetics and evolution

    DEFF Research Database (Denmark)

    Duchene, Sebastián; Frey, Amy; Alfaro-Núñez, Luis Alonso

    2012-01-01

    The sea turtles are a group of cretaceous origin containing seven recognized living species: leatherback, hawksbill, Kemp's ridley, olive ridley, loggerhead, green, and flatback. The leatherback is the single member of the Dermochelidae family, whereas all other sea turtles belong in Cheloniidae...... distributions, shedding light on complex migration patterns and possible geographic or climatic events as driving forces of sea-turtle distribution. We have sequenced complete mitogenomes for all sea-turtle species, including samples from their geographic range extremes, and performed phylogenetic analyses...... to assess sea-turtle evolution with a large molecular dataset. We found variation in the length of the ATP8 gene and a highly variable site in ND4 near a proton translocation channel in the resulting protein. Complete mitogenomes show strong support and resolution for phylogenetic relationships among all...

  20. Phylogenetic relationships of Chilean leptodactylids: a molecular approach based on mitochondrial genes 12S and 16S Relaciones filogenéticas de los leptodactílidos chilenos: una aproximación molecular basada en los genes mitocondriales 12S y 16S

    Directory of Open Access Journals (Sweden)

    CLAUDIO CORREA

    2006-12-01

    Full Text Available Most Chilean amphibians belong to the subfamily Telmatobiinae (Anura, Leptodactylidae. Several phylogenetic studies of Leptodactylidae and Telmatobiinae, based principally on morphological characters, have implicitly suggested closer relationships of some species of the Telmatobiinae with members of other subfamilies of leptodactylids, including the leptodactyline genus Pleurodema which is present in Chile. Furthermore, a growing number of molecular studies suggest a non monophyletic status for Telmatobiinae, although none of these studies have investigated the phylogenetic relationships of this subfamily. We compared partial sequences of the ribosomal mitochondrial genes 12S and 16S to determine the phylogenetic relationships of Chilean leptodactylids and its position within the modern anurans (Neobatrachia. We included 22 species from nine of the 10 genera of telmatobiines present in Chile (Alsodes, Atelognathus, Batrachyla, Caudiverbera, Eupsophus, Hylorina, Insuetophrynus, Telmatobufo and Telmatobius, two species of the genus Pleurodema, and one species of Rhinodermatidae, which is considered a leptodactylid derivative family by some authors. We also included 51 species representing most of the families that compose Neobatrachia. Phylogenetic reconstructions were performed using the methods of maximum parsimony, maximum likelihood and Bayesian inference. The topologies obtained in all the analyses indicate that Telmatobiinae is a polyphyletic assemblage, composed by species belonging to Hyloidea (most of the genera and species more related to Australasian taxa (the clade Caudiverbera + Telmatobufo, defined as the tribe Calyptocephalellini. These molecular data support groups based on other kinds of evidence (Caudiverbera + Telmatobufo, Alsodes + Eupsophus and Batrachyla + Hylorina and raise new phylogenetic hypotheses for several genera of telmatobiines (Atelognathus with Batrachyla and Hylorina, Insuetophrynus + Rhinoderma. The phylogenetic

  1. In Silico Phylogenetic Analysis and Molecular Modelling Study of 2-Haloalkanoic Acid Dehalogenase Enzymes from Bacterial and Fungal Origin

    Directory of Open Access Journals (Sweden)

    Raghunath Satpathy

    2016-01-01

    Full Text Available 2-Haloalkanoic acid dehalogenase enzymes have broad range of applications, starting from bioremediation to chemical synthesis of useful compounds that are widely distributed in fungi and bacteria. In the present study, a total of 81 full-length protein sequences of 2-haloalkanoic acid dehalogenase from bacteria and fungi were retrieved from NCBI database. Sequence analysis such as multiple sequence alignment (MSA, conserved motif identification, computation of amino acid composition, and phylogenetic tree construction were performed on these primary sequences. From MSA analysis, it was observed that the sequences share conserved lysine (K and aspartate (D residues in them. Also, phylogenetic tree indicated a subcluster comprised of both fungal and bacterial species. Due to nonavailability of experimental 3D structure for fungal 2-haloalkanoic acid dehalogenase in the PDB, molecular modelling study was performed for both fungal and bacterial sources of enzymes present in the subcluster. Further structural analysis revealed a common evolutionary topology shared between both fungal and bacterial enzymes. Studies on the buried amino acids showed highly conserved Leu and Ser in the core, despite variation in their amino acid percentage. Additionally, a surface exposed tryptophan was conserved in all of these selected models.

  2. The power and pitfalls of HIV phylogenetics in public health.

    Science.gov (United States)

    Brooks, James I; Sandstrom, Paul A

    2013-07-25

    Phylogenetics is the application of comparative studies of genetic sequences in order to infer evolutionary relationships among organisms. This tool can be used as a form of molecular epidemiology to enhance traditional population-level communicable disease surveillance. Phylogenetic study has resulted in new paradigms being created in the field of communicable diseases and this commentary aims to provide the reader with an explanation of how phylogenetics can be used in tracking infectious diseases. Special emphasis will be placed upon the application of phylogenetics as a tool to help elucidate HIV transmission patterns and the limitations to these methods when applied to forensic analysis. Understanding infectious disease epidemiology in order to prevent new transmissions is the sine qua non of public health. However, with increasing epidemiological resolution, there may be an associated potential loss of privacy to the individual. It is within this context that we aim to promote the discussion on how to use phylogenetics to achieve important public health goals, while at the same time protecting the rights of the individual.

  3. Molecular phylogenetics and species delimitation of leaf-toed geckos (Phyllodactylidae: Phyllodactylus) throughout the Mexican tropical dry forest.

    Science.gov (United States)

    Blair, Christopher; Méndez de la Cruz, Fausto R; Law, Christopher; Murphy, Robert W

    2015-03-01

    Methods and approaches for accurate species delimitation continue to be a highly controversial subject in the systematics community. Inaccurate assessment of species' limits precludes accurate inference of historical evolutionary processes. Recent evidence suggests that multilocus coalescent methods show promise in delimiting species in cryptic clades. We combine multilocus sequence data with coalescence-based phylogenetics in a hypothesis-testing framework to assess species limits and elucidate the timing of diversification in leaf-toed geckos (Phyllodactylus) of Mexico's dry forests. Tropical deciduous forests (TDF) of the Neotropics are among the planet's most diverse ecosystems. However, in comparison to moist tropical forests, little is known about the mode and tempo of biotic evolution throughout this threatened biome. We find increased speciation and substantial, cryptic molecular diversity originating following the formation of Mexican TDF 30-20million years ago due to orogenesis of the Sierra Madre Occidental and Mexican Volcanic Belt. Phylogenetic results suggest that the Mexican Volcanic Belt, the Rio Fuerte, and Isthmus of Tehuantepec may be important biogeographic barriers. Single- and multilocus coalescent analyses suggest that nearly every sampling locality may be a distinct species. These results suggest unprecedented levels of diversity, a complex evolutionary history, and that the formation and expansion of TDF vegetation in the Miocene may have influenced subsequent cladogenesis of leaf-toed geckos throughout western Mexico. Copyright © 2015 Elsevier Inc. All rights reserved.

  4. Molecular Phylogenetic Exploration of Bacterial Diversity in a Bakreshwar (India) Hot Spring and Culture of Shewanella-Related Thermophiles

    Science.gov (United States)

    Ghosh, Dhritiman; Bal, Bijay; Kashyap, V. K.; Pal, Subrata

    2003-01-01

    The bacterial diversity of a hot spring in Bakreshwar, India, was investigated by a culture-independent approach. 16S ribosomal DNA clones derived from the sediment samples were found to be associated with gamma-Proteobacteria, cyanobacteria, and green nonsulfur and low-GC gram-positive bacteria. The first of the above phylotypes cobranches with Shewanella, a well-known iron reducer. This phylogenetic correlation has been exploited to develop culture conditions for thermophilic iron-reducing microorganisms. PMID:12839826

  5. A member of the HSP90 family from ovine Babesia in China: molecular characterization, phylogenetic analysis and antigenicity.

    Science.gov (United States)

    Guan, Guiquan; Liu, Junlong; Liu, Aihong; Li, Youquan; Niu, Qingli; Gao, Jinliang; Luo, Jianxun; Chauvin, Alain; Yin, Hong; Moreau, Emmanuelle

    2015-09-01

    Heat shock protein 90 (HSP90) is a key component of the molecular chaperone complex essential for activating many signalling proteins involved in the development and progression of pathogenic cellular transformation. A Hsp90 gene (BQHsp90) was cloned and characterized from Babesia sp. BQ1 (Lintan), an ovine Babesia isolate belonging to Babesia motasi-like group, by screening a cDNA expression library and performing rapid amplification of cDNA ends. The full-length cDNA of BQHsp90 is 2399 bp with an open reading frame of 2154 bp encoding a predicted 83 kDa polypeptide with 717 amino acid residues. It shows significant homology and similar structural characteristics to Hsp90 of other apicomplex organisms. Phylogenetic analysis, based on the HSP90 amino acid sequences, showed that the Babesia genus is clearly separated from other apicomplexa genera. Five Chinese ovine Babesia isolates were divided into 2 phylogenetic clusters, namely Babesia sp. Xinjiang (previously designated a new species) cluster and B. motasi-like cluster which could be further divided into 2 subclusters (Babesia sp. BQ1 (Lintan)/Babesia sp. Tianzhu and Babesia sp. BQ1 (Ningxian)/Babesia sp. Hebei). Finally, the antigenicity of rBQHSP90 protein from prokaryotic expression was also evaluated using western blot and enzyme-linked immunosorbent assay (ELISA).

  6. In situ, measurements on plutonium concentration, in vegetal and animal marine species as a function of their phylogenetic position

    International Nuclear Information System (INIS)

    Fraizier, Albert; Guary, J.-C.

    1975-10-01

    The accumulation of plutonium by 31 vegetal and animal marine species belonging to a large number of phyla was demonstrated in a reference coastal site. Fixation levels ranging from 171.6pCi/kg fresh weight for a lichen to 0.04pCi/k fresh weight for a fish showed that the retention of the radionuclide by the organisms studied was related to their phylogenetic position. Biological indicators especially suitable for monitoring coastal plutonium radioactivity has been identified [fr

  7. Soft-tissue anatomy of the extant hominoids: a review and phylogenetic analysis

    Science.gov (United States)

    Gibbs, S; Collard, M; Wood, B

    2002-01-01

    This paper reports the results of a literature search for information about the soft-tissue anatomy of the extant non-human hominoid genera, Pan, Gorilla, Pongo and Hylobates, together with the results of a phylogenetic analysis of these data plus comparable data for Homo. Information on the four extant non-human hominoid genera was located for 240 out of the 1783 soft-tissue structures listed in the Nomina Anatomica. Numerically these data are biased so that information about some systems (e.g. muscles) and some regions (e.g. the forelimb) are over-represented, whereas other systems and regions (e.g. the veins and the lymphatics of the vascular system, the head region) are either under-represented or not represented at all. Screening to ensure that the data were suitable for use in a phylogenetic analysis reduced the number of eligible soft-tissue structures to 171. These data, together with comparable data for modern humans, were converted into discontinuous character states suitable for phylogenetic analysis and then used to construct a taxon-by-character matrix. This matrix was used in two tests of the hypothesis that soft-tissue characters can be relied upon to reconstruct hominoid phylogenetic relationships. In the first, parsimony analysis was used to identify cladograms requiring the smallest number of character state changes. In the second, the phylogenetic bootstrap was used to determine the confidence intervals of the most parsimonious clades. The parsimony analysis yielded a single most parsimonious cladogram that matched the molecular cladogram. Similarly the bootstrap analysis yielded clades that were compatible with the molecular cladogram; a (Homo, Pan) clade was supported by 95% of the replicates, and a (Gorilla, Pan, Homo) clade by 96%. These are the first hominoid morphological data to provide statistically significant support for the clades favoured by the molecular evidence. PMID:11833653

  8. Piscine reovirus: Genomic and molecular phylogenetic analysis from farmed and wild salmonids collected on the Canada/US Pacific Coast

    Science.gov (United States)

    Siah, Ahmed; Morrison, Diane B.; Fringuelli, Elena; Savage, Paul S.; Richmond, Zina; Purcell, Maureen K.; Johns, Robert; Johnson, Stewart C.; Sakasida, Sonja M.

    2015-01-01

    Piscine reovirus (PRV) is a double stranded non-enveloped RNA virus detected in farmed and wild salmonids. This study examined the phylogenetic relationships among different PRV sequence types present in samples from salmonids in Western Canada and the US, including Alaska (US), British Columbia (Canada) and Washington State (US). Tissues testing positive for PRV were partially sequenced for segment S1, producing 71 sequences that grouped into 10 unique sequence types. Sequence analysis revealed no identifiable geographical or temporal variation among the sequence types. Identical sequence types were found in fish sampled in 2001, 2005 and 2014. In addition, PRV positive samples from fish derived from Alaska, British Columbia and Washington State share identical sequence types. Comparative analysis of the phylogenetic tree indicated that Canada/US Pacific Northwest sequences formed a subgroup with some Norwegian sequence types (group II), distinct from other Norwegian and Chilean sequences (groups I, III and IV). Representative PRV positive samples from farmed and wild fish in British Columbia and Washington State were subjected to genome sequencing using next generation sequencing methods. Individual analysis of each of the 10 partial segments indicated that the Canadian and US PRV sequence types clustered separately from available whole genome sequences of some Norwegian and Chilean sequences for all segments except the segment S4. In summary, PRV was genetically homogenous over a large geographic distance (Alaska to Washington State), and the sequence types were relatively stable over a 13 year period.

  9. Phylogenetic position of the North American isolate of Pasteuria that parasitizes the soybean cyst nematode, Heterodera glycines, as inferred from 16S rDNA sequence analysis.

    Science.gov (United States)

    Atibalentja, N; Noel, G R; Domier, L L

    2000-03-01

    A 1341 bp sequence of the 16S rDNA of an undescribed species of Pasteuria that parasitizes the soybean cyst nematode, Heterodera glycines, was determined and then compared with a homologous sequence of Pasteuria ramosa, a parasite of cladoceran water fleas of the family Daphnidae. The two Pasteuria sequences, which diverged from each other by a dissimilarity index of 7%, also were compared with the 16S rDNA sequences of 30 other bacterial species to determine the phylogenetic position of the genus Pasteuria among the Gram-positive eubacteria. Phylogenetic analyses using maximum-likelihood, maximum-parsimony and neighbour-joining methods showed that the Heterodera glycines-infecting Pasteuria and its sister species, P. ramosa, form a distinct line of descent within the Alicyclobacillus group of the Bacillaceae. These results are consistent with the view that the genus Pasteuria is a deeply rooted member of the Clostridium-Bacillus-Streptococcus branch of the Gram-positive eubacteria, neither related to the actinomycetes nor closely related to true endospore-forming bacteria.

  10. Incompletely resolved phylogenetic trees inflate estimates of phylogenetic conservatism.

    Science.gov (United States)

    Davies, T Jonathan; Kraft, Nathan J B; Salamin, Nicolas; Wolkovich, Elizabeth M

    2012-02-01

    The tendency for more closely related species to share similar traits and ecological strategies can be explained by their longer shared evolutionary histories and represents phylogenetic conservatism. How strongly species traits co-vary with phylogeny can significantly impact how we analyze cross-species data and can influence our interpretation of assembly rules in the rapidly expanding field of community phylogenetics. Phylogenetic conservatism is typically quantified by analyzing the distribution of species values on the phylogenetic tree that connects them. Many phylogenetic approaches, however, assume a completely sampled phylogeny: while we have good estimates of deeper phylogenetic relationships for many species-rich groups, such as birds and flowering plants, we often lack information on more recent interspecific relationships (i.e., within a genus). A common solution has been to represent these relationships as polytomies on trees using taxonomy as a guide. Here we show that such trees can dramatically inflate estimates of phylogenetic conservatism quantified using S. P. Blomberg et al.'s K statistic. Using simulations, we show that even randomly generated traits can appear to be phylogenetically conserved on poorly resolved trees. We provide a simple rarefaction-based solution that can reliably retrieve unbiased estimates of K, and we illustrate our method using data on first flowering times from Thoreau's woods (Concord, Massachusetts, USA).

  11. Mitochondrial genome of the stonefly Kamimuria wangi (Plecoptera: Perlidae) and phylogenetic position of plecoptera based on mitogenomes.

    Science.gov (United States)

    Yu-Han, Qian; Hai-Yan, Wu; Xiao-Yu, Ji; Wei-Wei, Yu; Yu-Zhou, Du

    2014-01-01

    This study determined the mitochondrial genome sequence of the stonefly, Kamimuria wangi. In order to investigate the relatedness of stonefly to other members of Neoptera, a phylogenetic analysis was undertaken based on 13 protein-coding genes of mitochondrial genomes in 13 representative insects. The mitochondrial genome of the stonefly is a circular molecule consisting of 16,179 nucleotides and contains the 37 genes typically found in other insects. A 10-bp poly-T stretch was observed in the A+T-rich region of the K. wangi mitochondrial genome. Downstream of the poly-T stretch, two regions were located with potential ability to form stem-loop structures; these were designated stem-loop 1 (positions 15848-15651) and stem-loop 2 (15965-15998). The arrangement of genes and nucleotide composition of the K. wangi mitogenome are similar to those in Pteronarcys princeps, suggesting a conserved genome evolution within the Plecoptera. Phylogenetic analysis using maximum likelihood and Bayesian inference of 13 protein-coding genes supported a novel relationship between the Plecoptera and Ephemeroptera. The results contradict the existence of a monophyletic Plectoptera and Plecoptera as sister taxa to Embiidina, and thus requires further analyses with additional mitogenome sampling at the base of the Neoptera.

  12. Mitochondrial genome of the stonefly Kamimuria wangi (Plecoptera: Perlidae and phylogenetic position of plecoptera based on mitogenomes.

    Directory of Open Access Journals (Sweden)

    Qian Yu-Han

    Full Text Available This study determined the mitochondrial genome sequence of the stonefly, Kamimuria wangi. In order to investigate the relatedness of stonefly to other members of Neoptera, a phylogenetic analysis was undertaken based on 13 protein-coding genes of mitochondrial genomes in 13 representative insects. The mitochondrial genome of the stonefly is a circular molecule consisting of 16,179 nucleotides and contains the 37 genes typically found in other insects. A 10-bp poly-T stretch was observed in the A+T-rich region of the K. wangi mitochondrial genome. Downstream of the poly-T stretch, two regions were located with potential ability to form stem-loop structures; these were designated stem-loop 1 (positions 15848-15651 and stem-loop 2 (15965-15998. The arrangement of genes and nucleotide composition of the K. wangi mitogenome are similar to those in Pteronarcys princeps, suggesting a conserved genome evolution within the Plecoptera. Phylogenetic analysis using maximum likelihood and Bayesian inference of 13 protein-coding genes supported a novel relationship between the Plecoptera and Ephemeroptera. The results contradict the existence of a monophyletic Plectoptera and Plecoptera as sister taxa to Embiidina, and thus requires further analyses with additional mitogenome sampling at the base of the Neoptera.

  13. Evolution of feeding specialization in Tanganyikan scale-eating cichlids: a molecular phylogenetic approach

    Directory of Open Access Journals (Sweden)

    Nishida Mutsumi

    2007-10-01

    Full Text Available Abstract Background Cichlid fishes in Lake Tanganyika exhibit remarkable diversity in their feeding habits. Among them, seven species in the genus Perissodus are known for their unique feeding habit of scale eating with specialized feeding morphology and behaviour. Although the origin of the scale-eating habit has long been questioned, its evolutionary process is still unknown. In the present study, we conducted interspecific phylogenetic analyses for all nine known species in the tribe Perissodini (seven Perissodus and two Haplotaxodon species using amplified fragment length polymorphism (AFLP analyses of the nuclear DNA. On the basis of the resultant phylogenetic frameworks, the evolution of their feeding habits was traced using data from analyses of stomach contents, habitat depths, and observations of oral jaw tooth morphology. Results AFLP analyses resolved the phylogenetic relationships of the Perissodini, strongly supporting monophyly for each species. The character reconstruction of feeding ecology based on the AFLP tree suggested that scale eating evolved from general carnivorous feeding to highly specialized scale eating. Furthermore, scale eating is suggested to have evolved in deepwater habitats in the lake. Oral jaw tooth shape was also estimated to have diverged in step with specialization for scale eating. Conclusion The present evolutionary analyses of feeding ecology and morphology based on the obtained phylogenetic tree demonstrate for the first time the evolutionary process leading from generalised to highly specialized scale eating, with diversification in feeding morphology and behaviour among species.

  14. Molecular characterization and phylogenetic analysis of Babesia sp. NV-1 detected from wild American Mink ( Neovison vison ) in Hokkaido, Japan.

    Science.gov (United States)

    Hirata, Haruyuki; Ishinabe, Satoki; Jinnai, Michio; Asakawa, Mitsuhiko; Ishihara, Chiaki

    2013-04-01

    Babesiosis is a tick-borne protozoan disease affecting many mammalian species worldwide, caused by the intraerythrocytic multiplication of Babesia spp. The present study aimed to detect the presence of Babesia sp. in 13 American mink from Hokkaido, Japan. One of 13 animals was positive, as indicated by nested PCR targeting the 18S ribosomal RNA (SSU rDNA) and subunit 7 (eta) of the chaperonin-containing t-complex polypeptide 1 (CCT7) genes from species of Babesia and Theileria. Sequencing of the PCR product of SSU rDNA revealed 99% homology to the isolates of Babesia sp. SAP#131 found in raccoons in Hokkaido, whereas that of the CCT7 gene showed 80% homology to the isolates of Babesia gibsoni in dogs as determined by BLAST analysis. We refer to the cognate sequence as Babesia sp. NV-1. Phylogenetic analyses of SSU rDNA and CCT7 genes from Babesia sp. NV-1 revealed them to be most closely related to the Babesia sp. SAP#131 from a raccoon in Hokkaido and to canine B. gibsoni, respectively. Here, we provide the first molecular evidence of the Babesia sp. NV-1 parasite in feral American mink ( Neovison vison ) in Hokkaido, Japan.

  15. Molecular characterization and phylogenetic relatedness of dog-derived Rabies Viruses circulating in Cameroon between 2010 and 2016.

    Directory of Open Access Journals (Sweden)

    Serge Alain Sadeuh-Mba

    2017-10-01

    Full Text Available Rabies is enzootic among dog populations in some parts of Cameroon and the risk of human rabies is thought to be steadily high in these regions. However, the molecular epidemiology of circulating Rabies Virus (RABV has been hardly considered in Cameroon as well as in most neighboring central African countries. To address this fundamental gap, 76 nucleoprotein (N gene sequences of dog-derived RABV were obtained from 100 brain specimens sampled in Cameroon from 2010 to 2016. Studied sequences were subjected to molecular and phylogenetic analyses with reference strains retrieved from databases. The 71 studied Africa-1 isolates displayed 93.5-100% nucleotide (nt and 98.3-100% amino-acid (aa identities to each other while, the 5 studied Africa-2 isolates shared 99.4-99.7% sequence similarities at nt and aa levels. Maximum Likelihood based phylogenies inferred from nucleotide sequences confirmed all studied RABV isolates as members of the dog-related species 1 of the Lyssavirus genus. Individual isolates could be unambiguously assigned as either the Africa-1 subclade of the Cosmopolitan clade or the Africa 2 clade. The Africa-1 subclade appeared to be more prevalent and diversified. Indeed, 70 studied isolates segregated into 3 distinct circulating variants within Africa-1a lineage while a unique isolate was strikingly related to the Africa-1b lineage known to be prevalent in the neighboring Central African Republic and eastern Africa. Interestingly, all five Africa-2 isolates fell into the group-E lineage even though they appeared to be loosely related to databases available reference RABV; including those previously documented in Cameroon. This study uncovered the co-circulation of several Africa-1 and Africa-2 lineages in the southern regions of Cameroon. Striking phylogenetic outcasts to the geographic differentiation of RABV variants indicated that importation from close regions or neighboring countries apparently contributes to the sustainment

  16. Molecular characterization and phylogenetic relatedness of dog-derived Rabies Viruses circulating in Cameroon between 2010 and 2016.

    Science.gov (United States)

    Sadeuh-Mba, Serge Alain; Momo, Jean Blaise; Besong, Laura; Loul, Sévérin; Njouom, Richard

    2017-10-01

    Rabies is enzootic among dog populations in some parts of Cameroon and the risk of human rabies is thought to be steadily high in these regions. However, the molecular epidemiology of circulating Rabies Virus (RABV) has been hardly considered in Cameroon as well as in most neighboring central African countries. To address this fundamental gap, 76 nucleoprotein (N) gene sequences of dog-derived RABV were obtained from 100 brain specimens sampled in Cameroon from 2010 to 2016. Studied sequences were subjected to molecular and phylogenetic analyses with reference strains retrieved from databases. The 71 studied Africa-1 isolates displayed 93.5-100% nucleotide (nt) and 98.3-100% amino-acid (aa) identities to each other while, the 5 studied Africa-2 isolates shared 99.4-99.7% sequence similarities at nt and aa levels. Maximum Likelihood based phylogenies inferred from nucleotide sequences confirmed all studied RABV isolates as members of the dog-related species 1 of the Lyssavirus genus. Individual isolates could be unambiguously assigned as either the Africa-1 subclade of the Cosmopolitan clade or the Africa 2 clade. The Africa-1 subclade appeared to be more prevalent and diversified. Indeed, 70 studied isolates segregated into 3 distinct circulating variants within Africa-1a lineage while a unique isolate was strikingly related to the Africa-1b lineage known to be prevalent in the neighboring Central African Republic and eastern Africa. Interestingly, all five Africa-2 isolates fell into the group-E lineage even though they appeared to be loosely related to databases available reference RABV; including those previously documented in Cameroon. This study uncovered the co-circulation of several Africa-1 and Africa-2 lineages in the southern regions of Cameroon. Striking phylogenetic outcasts to the geographic differentiation of RABV variants indicated that importation from close regions or neighboring countries apparently contributes to the sustainment of the enzootic

  17. Phylogenetic relationships within the cyst-forming nematodes (Nematoda, Heteroderidae) based on analysis of sequences from the ITS regions of ribosomal DNA.

    Science.gov (United States)

    Subbotin, S A; Vierstraete, A; De Ley, P; Rowe, J; Waeyenberge, L; Moens, M; Vanfleteren, J R

    2001-10-01

    The ITS1, ITS2, and 5.8S gene sequences of nuclear ribosomal DNA from 40 taxa of the family Heteroderidae (including the genera Afenestrata, Cactodera, Heterodera, Globodera, Punctodera, Meloidodera, Cryphodera, and Thecavermiculatus) were sequenced and analyzed. The ITS regions displayed high levels of sequence divergence within Heteroderinae and compared to outgroup taxa. Unlike recent findings in root knot nematodes, ITS sequence polymorphism does not appear to complicate phylogenetic analysis of cyst nematodes. Phylogenetic analyses with maximum-parsimony, minimum-evolution, and maximum-likelihood methods were performed with a range of computer alignments, including elision and culled alignments. All multiple alignments and phylogenetic methods yielded similar basic structure for phylogenetic relationships of Heteroderidae. The cyst-forming nematodes are represented by six main clades corresponding to morphological characters and host specialization, with certain clades assuming different positions depending on alignment procedure and/or method of phylogenetic inference. Hypotheses of monophyly of Punctoderinae and Heteroderinae are, respectively, strongly and moderately supported by the ITS data across most alignments. Close relationships were revealed between the Avenae and the Sacchari groups and between the Humuli group and the species H. salixophila within Heteroderinae. The Goettingiana group occupies a basal position within this subfamily. The validity of the genera Afenestrata and Bidera was tested and is discussed based on molecular data. We conclude that ITS sequence data are appropriate for studies of relationships within the different species groups and less so for recovery of more ancient speciations within Heteroderidae. Copyright 2001 Academic Press.

  18. Molecular Phylogenetic Classification of Streptomycetes Isolated from the Rhizosphere of Tropical Legume (Paraserianthes falcataria (L. Nielsen

    Directory of Open Access Journals (Sweden)

    LANGKAH SEMBIRING

    2009-09-01

    Full Text Available Intrageneric diversity of 556 streptomycetes isolated from the rhizosphere of tropical legume was determined by using molecular taxonomic method based on 16S rDNA. A total of 46 isolates were taken to represent 37 colour groups of the isolates. 16S rDNA were amplified and subsequently sequenced and the sequences data were aligned with streptomycete sequences retrieved from the ribosomal data base project (RDP data. Phylogenetic trees were generated by using the PHYLIP software package and the matrix of nucleotide similarity and nucleotide difference were generated by using PHYDIT software. The results confirmed and extended the value of 16S rDNA sequencing in streptomycete systematic. The 16S rDNA sequence data showed that most of the tested colour group representatives formed new centers of taxonomic variation within the genus Streptomyces. The generic assignment of these organisms was underpinned by 16S rDNA sequence data which also suggested that most of the strains represented new centers of taxonomic variation. The taxonomic data indicate that diverse populations of streptomycetes are associated with the roots of tropical legume (P. falcataria. Therefore, the combination of selective isolation and molecular taxonomic procedures used in this study provide a powerful way of uncovering new centers of taxonomic variation within the genus Streptomyces.

  19. Phylogenetic relationships of Chaetomium isolates based on the ...

    African Journals Online (AJOL)

    Molecular characterization of 18 Chaetomium isolates collected from India based on the internal transcribed spacer (ITS) region of the rRNA gene sequences was done. Phylogenetic analysis of full length ITS region showed that Chaetomium globosum isolates, Cg1, Cg2, Cg6, Cg11 and Cg15, Chaetomium spp. isolates, ...

  20. Phylogenetic position of Leishmania isolates from Khyber Pakhtunkhwa province of Pakistan.

    Science.gov (United States)

    Khan, Nazma Habib; Messenger, Louisa A; Wahid, Sobia; Sutherland, Colin J

    2016-08-01

    Several species of the genus Leishmania are causative agents of cutaneous leishmaniasis in Pakistan. This study aimed to determine phylogenetic placement of Leishmania species causing cutaneous leishmaniasis in Khyber Pakhtunkhwa province, Pakistan (34 Leishmania tropica, 3 Leishmania infantum), in-relation to species from other geographical areas using gene sequences encoding cytochrome b (cytb) and internal transcribed spacer 2 (its2). Based on cytochrome b sequence analysis, L. tropica strains from Pakistan and other geographical regions were differentiated into two genotype groups, A and B. Within the province, five distinct L. tropica genotypes were recognized; two in group A, three in group B. Two L. infantum isolates from the province were closely associated with both Afro-Eurasian and American species of the Leishmania donovani complex, including Leishmania chagasi, L. infantum and L. donovani from Sudan and Ethiopia; while a third L. infantum isolate could not be differentiated from visceralizing Kenyan and Indian L. donovani. We observed apposite phylogenetic placement of CL-causing L. tropica and L. infantum from Khyber Pakhtunkhwa. Affinities ascribed to Leishmania spp. From the region are valuable in tracing potential importation of leishmaniasis. Copyright © 2016 The Author(s). Published by Elsevier Inc. All rights reserved.

  1. Molecular Identification of Dendrobium Species (Orchidaceae) Based on the DNA Barcode ITS2 Region and Its Application for Phylogenetic Study.

    Science.gov (United States)

    Feng, Shangguo; Jiang, Yan; Wang, Shang; Jiang, Mengying; Chen, Zhe; Ying, Qicai; Wang, Huizhong

    2015-09-11

    The over-collection and habitat destruction of natural Dendrobium populations for their commercial medicinal value has led to these plants being under severe threat of extinction. In addition, many Dendrobium plants are similarly shaped and easily confused during the absence of flowering stages. In the present study, we examined the application of the ITS2 region in barcoding and phylogenetic analyses of Dendrobium species (Orchidaceae). For barcoding, ITS2 regions of 43 samples in Dendrobium were amplified. In combination with sequences from GenBank, the sequences were aligned using Clustal W and genetic distances were computed using MEGA V5.1. The success rate of PCR amplification and sequencing was 100%. There was a significant divergence between the inter- and intra-specific genetic distances of ITS2 regions, while the presence of a barcoding gap was obvious. Based on the BLAST1, nearest distance and TaxonGAP methods, our results showed that the ITS2 regions could successfully identify the species of most Dendrobium samples examined; Second, we used ITS2 as a DNA marker to infer phylogenetic relationships of 64 Dendrobium species. The results showed that cluster analysis using the ITS2 region mainly supported the relationship between the species of Dendrobium established by traditional morphological methods and many previous molecular analyses. To sum up, the ITS2 region can not only be used as an efficient barcode to identify Dendrobium species, but also has the potential to contribute to the phylogenetic analysis of the genus Dendrobium.

  2. Molecular Identification of Dendrobium Species (Orchidaceae Based on the DNA Barcode ITS2 Region and Its Application for Phylogenetic Study

    Directory of Open Access Journals (Sweden)

    Shangguo Feng

    2015-09-01

    Full Text Available The over-collection and habitat destruction of natural Dendrobium populations for their commercial medicinal value has led to these plants being under severe threat of extinction. In addition, many Dendrobium plants are similarly shaped and easily confused during the absence of flowering stages. In the present study, we examined the application of the ITS2 region in barcoding and phylogenetic analyses of Dendrobium species (Orchidaceae. For barcoding, ITS2 regions of 43 samples in Dendrobium were amplified. In combination with sequences from GenBank, the sequences were aligned using Clustal W and genetic distances were computed using MEGA V5.1. The success rate of PCR amplification and sequencing was 100%. There was a significant divergence between the inter- and intra-specific genetic distances of ITS2 regions, while the presence of a barcoding gap was obvious. Based on the BLAST1, nearest distance and TaxonGAP methods, our results showed that the ITS2 regions could successfully identify the species of most Dendrobium samples examined; Second, we used ITS2 as a DNA marker to infer phylogenetic relationships of 64 Dendrobium species. The results showed that cluster analysis using the ITS2 region mainly supported the relationship between the species of Dendrobium established by traditional morphological methods and many previous molecular analyses. To sum up, the ITS2 region can not only be used as an efficient barcode to identify Dendrobium species, but also has the potential to contribute to the phylogenetic analysis of the genus Dendrobium.

  3. Phylogenetic placement of the Dominican Republic endemic genus Sarcopilea (Urticaceae)

    Czech Academy of Sciences Publication Activity Database

    Jestrow, B.; Valdés, James J.; Rodríguez, F. J.; Francisco-Ortega, J.

    2012-01-01

    Roč. 61, č. 3 (2012), s. 592-600 ISSN 0040-0262 Institutional support: RVO:60077344 Keywords : CAM * Caribbean Islands * cystoliths * epistomatic * hyperstomatic * hydathodes * phylogenetics * Pilea * Sarcopilea * succulent * Urticaceae Subject RIV: EB - Genetics ; Molecular Biology Impact factor: 2.782, year: 2012

  4. The phylogenetic relationships among infraorders and superfamilies of Diptera based on morphological evidence

    DEFF Research Database (Denmark)

    Lambkin, Christine L.; Sinclair, Bradley J.; Pape, Thomas

    2013-01-01

    Members of the megadiverse insect order Diptera (flies) have successfully colonized all continents and nearly all habitats. There are more than 154 000 described fly species, representing 1012% of animal species. Elucidating the phylogenetic relationships of such a large component of global...... biodiversity is challenging, but significant advances have been made in the last few decades. Since Hennig first discussed the monophyly of major groupings, Diptera has attracted much study, but most researchers have used non-numerical qualitative methods to assess morphological data. More recently......, quantitative phylogenetic methods have been used on both morphological and molecular data. All previous quantitative morphological studies addressed narrower phylogenetic problems, often below the suborder or infraorder level. Here we present the first numerical analysis of phylogenetic relationships...

  5. Sequence exploration reveals information bias among molecular markers used in phylogenetic reconstruction for Colletotrichum species.

    Science.gov (United States)

    Rampersad, Sephra N; Hosein, Fazeeda N; Carrington, Christine Vf

    2014-01-01

    The Colletotrichum gloeosporioides species complex is among the most destructive fungal plant pathogens in the world, however, identification of isolates of quarantine importance to the intra-specific level is confounded by a number of factors that affect phylogenetic reconstruction. Information bias and quality parameters were investigated to determine whether nucleotide sequence alignments and phylogenetic trees accurately reflect the genetic diversity and phylogenetic relatedness of individuals. Sequence exploration of GAPDH, ACT, TUB2 and ITS markers indicated that the query sequences had different patterns of nucleotide substitution but were without evidence of base substitution saturation. Regions of high entropy were much more dispersed in the ACT and GAPDH marker alignments than for the ITS and TUB2 markers. A discernible bimodal gap in the genetic distance frequency histograms was produced for the ACT and GAPDH markers which indicated successful separation of intra- and inter-specific sequences in the data set. Overall, analyses indicated clear differences in the ability of these markers to phylogenetically separate individuals to the intra-specific level which coincided with information bias.

  6. Phylogenetic analysis of the genus Hordeum using repetitive DNA sequences

    DEFF Research Database (Denmark)

    Svitashev, S.; Bryngelsson, T.; Vershinin, A.

    1994-01-01

    A set of six cloned barley (Hordeum vulgare) repetitive DNA sequences was used for the analysis of phylogenetic relationships among 31 species (46 taxa) of the genus Hordeum, using molecular hybridization techniques. In situ hybridization experiments showed dispersed organization of the sequences...

  7. Phylogenetic position of Mexican jackrabbits within the genus Lepus (Mammalia: Lagomorpha: a molecular perspective Posición filogenética de las liebres mexicanas dentro del género Lepus (Mammalia: Lagomorpha: una perspectiva molecular

    Directory of Open Access Journals (Sweden)

    Juan Pablo Ramírez-Silva

    2010-12-01

    Full Text Available Although phylogenetic affinities of Mexican jackrabbits within the genus Lepus have been evaluated for a few species, no study has included all 5 species occurring in Mexico. In this study we assess the phylogenetic position of the Mexican species relative to other forms within the genus and evaluate evolutionary affinities among the Mexican forms. To do so, we analyzed 57 complete cytochrome b sequences belonging to the 5 Mexican jackrabbits and 18 species of Lepus distributed across Asia, Africa, Europe and America. We performed phylogenetic tree reconstruction with the neighbor-joining, maximum parsimony and maximum likelihood approaches. We also used a minimum spanning network to evaluate relationships among Mexican species. We found 5 main phylogenetic groups within Lepus, 4 of which corresponded to geographically well defined lineages. One group included L. americanus, 3 others corresponded to Mexican, African and European species, respectively. A fifth group included Asiatic, European and American forms. Our results suggest that Mexican species constitute a monophyletic entity that evolved independently of the other American species of Lepus. Within the Mexican forms, 2 main clades are apparent; 1 that includes L. alleni, L. callotis, and L. flavigularis, previously referred to as the white-sided jackrabbits, and a second one that groups together L. californicus and L. insularis, although L. californicus is a paraphyletic relative of L. insularis.Aunque la afinidad filogenética de las liebres mexicanas, dentro del género Lepus, ha sido evaluada para algunas especies, ningún estudio ha incluido las 5 especies que se presentan en México. En este trabajo estimamos la posición filogenética de las especies mexicanas de liebres en relación con otras formas dentro del género, y evaluamos las afinidades evolutivas entre ellas. Para ello analizamos 57 secuencias completas del citocromo b pertenecientes a las 5 especies mexicanas y 18

  8. Deceptive desmas: molecular phylogenetics suggests a new classification and uncovers convergent evolution of lithistid demosponges.

    Directory of Open Access Journals (Sweden)

    Astrid Schuster

    Full Text Available Reconciling the fossil record with molecular phylogenies to enhance the understanding of animal evolution is a challenging task, especially for taxa with a mostly poor fossil record, such as sponges (Porifera. 'Lithistida', a polyphyletic group of recent and fossil sponges, are an exception as they provide the richest fossil record among demosponges. Lithistids, currently encompassing 13 families, 41 genera and >300 recent species, are defined by the common possession of peculiar siliceous spicules (desmas that characteristically form rigid articulated skeletons. Their phylogenetic relationships are to a large extent unresolved and there has been no (taxonomically comprehensive analysis to formally reallocate lithistid taxa to their closest relatives. This study, based on the most comprehensive molecular and morphological investigation of 'lithistid' demosponges to date, corroborates some previous weakly-supported hypotheses, and provides novel insights into the evolutionary relationships of the previous 'order Lithistida'. Based on molecular data (partial mtDNA CO1 and 28S rDNA sequences, we show that 8 out of 13 'Lithistida' families belong to the order Astrophorida, whereas Scleritodermidae and Siphonidiidae form a separate monophyletic clade within Tetractinellida. Most lithistid astrophorids are dispersed between different clades of the Astrophorida and we propose to formally reallocate them, respectively. Corallistidae, Theonellidae and Phymatellidae are monophyletic, whereas the families Pleromidae and Scleritodermidae are polyphyletic. Family Desmanthidae is polyphyletic and groups within Halichondriidae--we formally propose a reallocation. The sister group relationship of the family Vetulinidae to Spongillida is confirmed and we propose here for the first time to include Vetulina into a new Order Sphaerocladina. Megascleres and microscleres possibly evolved and/or were lost several times independently in different 'lithistid' taxa, and

  9. Application of multigene phylogenetics and site-stripping to resolve intraordinal relationships in the Rhodymeniales (Rhodophyta).

    Science.gov (United States)

    Filloramo, Gina V; Saunders, Gary W

    2016-06-01

    Previous molecular assessments of the red algal order Rhodymeniales have confirmed its monophyly and distinguished the six currently recognized families (viz. Champiaceae, Faucheaceae, Fryeellaceae, Hymenocladiaceae, Lomentariaceae, and Rhodymeniaceae); however, relationships among most of these families have remained unresolved possibly as a result of substitution saturation at deeper phylogenetic nodes. The objective of the current study was to improve rhodymenialean systematics by increasing taxonomic representation and using a more robust multigene dataset of mitochondrial (COB, COI/COI-5P), nuclear (LSU, EF2) and plastid markers (psbA, rbcL). Additionally, we aimed to prevent phylogenetic inference problems associated with substitution saturation (particularly at the interfamilial nodes) by removing fast-evolving sites and analyzing a series of progressively more conservative alignments. The Rhodymeniales was resolved as two major lineages: (i) the Fryeellaceae as sister to the Faucheaceae and Lomentariaceae; and (ii) the Rhodymeniaceae allied to the Champiaceae and Hymenocladiaceae. Support at the interfamilial nodes was highest when 20% of variable sites were removed. Inclusion of Binghamiopsis, Chamaebotrys, and Minium, which were absent in previous phylogenetic investigations, established their phylogenetic affinities while assessment of two genera consistently polyphyletic in phylogenetic analyses, Erythrymenia and Lomentaria, resulted in the proposition of the novel genera Perbella and Fushitsunagia. The taxonomic position of Drouetia was reinvestigated with re-examination of holotype material of D. coalescens to clarify tetrasporangial development in this genus. In addition, we added three novel Australian species to Drouetia as a result of ongoing DNA barcoding assessments-D. aggregata sp. nov., D. scutellata sp. nov., and D. viridescens sp. nov. © 2016 Phycological Society of America.

  10. PhyloSift: phylogenetic analysis of genomes and metagenomes.

    Science.gov (United States)

    Darling, Aaron E; Jospin, Guillaume; Lowe, Eric; Matsen, Frederick A; Bik, Holly M; Eisen, Jonathan A

    2014-01-01

    Like all organisms on the planet, environmental microbes are subject to the forces of molecular evolution. Metagenomic sequencing provides a means to access the DNA sequence of uncultured microbes. By combining DNA sequencing of microbial communities with evolutionary modeling and phylogenetic analysis we might obtain new insights into microbiology and also provide a basis for practical tools such as forensic pathogen detection. In this work we present an approach to leverage phylogenetic analysis of metagenomic sequence data to conduct several types of analysis. First, we present a method to conduct phylogeny-driven Bayesian hypothesis tests for the presence of an organism in a sample. Second, we present a means to compare community structure across a collection of many samples and develop direct associations between the abundance of certain organisms and sample metadata. Third, we apply new tools to analyze the phylogenetic diversity of microbial communities and again demonstrate how this can be associated to sample metadata. These analyses are implemented in an open source software pipeline called PhyloSift. As a pipeline, PhyloSift incorporates several other programs including LAST, HMMER, and pplacer to automate phylogenetic analysis of protein coding and RNA sequences in metagenomic datasets generated by modern sequencing platforms (e.g., Illumina, 454).

  11. PhyloSift: phylogenetic analysis of genomes and metagenomes

    Directory of Open Access Journals (Sweden)

    Aaron E. Darling

    2014-01-01

    Full Text Available Like all organisms on the planet, environmental microbes are subject to the forces of molecular evolution. Metagenomic sequencing provides a means to access the DNA sequence of uncultured microbes. By combining DNA sequencing of microbial communities with evolutionary modeling and phylogenetic analysis we might obtain new insights into microbiology and also provide a basis for practical tools such as forensic pathogen detection.In this work we present an approach to leverage phylogenetic analysis of metagenomic sequence data to conduct several types of analysis. First, we present a method to conduct phylogeny-driven Bayesian hypothesis tests for the presence of an organism in a sample. Second, we present a means to compare community structure across a collection of many samples and develop direct associations between the abundance of certain organisms and sample metadata. Third, we apply new tools to analyze the phylogenetic diversity of microbial communities and again demonstrate how this can be associated to sample metadata.These analyses are implemented in an open source software pipeline called PhyloSift. As a pipeline, PhyloSift incorporates several other programs including LAST, HMMER, and pplacer to automate phylogenetic analysis of protein coding and RNA sequences in metagenomic datasets generated by modern sequencing platforms (e.g., Illumina, 454.

  12. A phylogenetic analysis of Diurideae (Orchidaceae) based on plastid DNA sequence data.

    Science.gov (United States)

    Kores, P J; Molvray, M; Weston, P H; Hopper, S D; Brown, A P; Cameron, K M; Chase, M W

    2001-10-01

    DNA sequence data from plastid matK and trnL-F regions were used in phylogenetic analyses of Diurideae, which indicate that Diurideae are not monophyletic as currently delimited. However, if Chloraeinae and Pterostylidinae are excluded from Diurideae, the remaining subtribes form a well-supported, monophyletic group that is sister to a "spiranthid" clade. Chloraea, Gavilea, and Megastylis pro parte (Chloraeinae) are all placed among the spiranthid orchids and form a grade with Pterostylis leading to a monophyletic Cranichideae. Codonorchis, previously included among Chloraeinae, is sister to Orchideae. Within the more narrowly delimited Diurideae two major lineages are apparent. One includes Diuridinae, Cryptostylidinae, Thelymitrinae, and an expanded Drakaeinae; the other includes Caladeniinae s.s., Prasophyllinae, and Acianthinae. The achlorophyllous subtribe Rhizanthellinae is a member of Diurideae, but its placement is otherwise uncertain. The sequence-based trees indicate that some morphological characters used in previous classifications, such as subterranean storage organs, anther position, growth habit, fungal symbionts, and pollination syndromes have more complex evolutionary histories than previously hypothesized. Treatments based upon these characters have produced conflicting classifications, and molecular data offer a tool for reevaluating these phylogenetic hypotheses.

  13. Phylogenetic comparative methods on phylogenetic networks with reticulations.

    Science.gov (United States)

    Bastide, Paul; Solís-Lemus, Claudia; Kriebel, Ricardo; Sparks, K William; Ané, Cécile

    2018-04-25

    The goal of Phylogenetic Comparative Methods (PCMs) is to study the distribution of quantitative traits among related species. The observed traits are often seen as the result of a Brownian Motion (BM) along the branches of a phylogenetic tree. Reticulation events such as hybridization, gene flow or horizontal gene transfer, can substantially affect a species' traits, but are not modeled by a tree. Phylogenetic networks have been designed to represent reticulate evolution. As they become available for downstream analyses, new models of trait evolution are needed, applicable to networks. One natural extension of the BM is to use a weighted average model for the trait of a hybrid, at a reticulation point. We develop here an efficient recursive algorithm to compute the phylogenetic variance matrix of a trait on a network, in only one preorder traversal of the network. We then extend the standard PCM tools to this new framework, including phylogenetic regression with covariates (or phylogenetic ANOVA), ancestral trait reconstruction, and Pagel's λ test of phylogenetic signal. The trait of a hybrid is sometimes outside of the range of its two parents, for instance because of hybrid vigor or hybrid depression. These two phenomena are rather commonly observed in present-day hybrids. Transgressive evolution can be modeled as a shift in the trait value following a reticulation point. We develop a general framework to handle such shifts, and take advantage of the phylogenetic regression view of the problem to design statistical tests for ancestral transgressive evolution in the evolutionary history of a group of species. We study the power of these tests in several scenarios, and show that recent events have indeed the strongest impact on the trait distribution of present-day taxa. We apply those methods to a dataset of Xiphophorus fishes, to confirm and complete previous analysis in this group. All the methods developed here are available in the Julia package PhyloNetworks.

  14. Cytotaxonomy of Eurypyga helias (Gruiformes, Eurypygidae): First Karyotypic Description and Phylogenetic Proximity with Rynochetidae

    Science.gov (United States)

    dos Santos, Michelly da Silva; Tagliarini, Marcella Mergulhão; O´Brien, Patricia C. M.; Ferguson-Smith, Malcolm A.; de Oliveira, Edivaldo H. C.

    2015-01-01

    The sunbittern (Eurypyga helias) is a South American Gruiformes, the only member of Family Eurypigidae. In most phylogenetic proposals, it is placed in a more distant position than other families of the so-called “core Gruiformes”. Different studies based on molecular, morphological and biogeographical data suggest that the Eurypigidae is closely related to the kagu (Rhynochetos jubatus), the only species in Rynochetidae, another family not included in the core Gruiformes. Here, the karyotype of the sunbittern is described for the first time, by classical and molecular cytogenetics, using whole chromosome probes derived from Gallus gallus and Leucopternis albicollis. We found a diploid number of 80, with only one pair of biarmed autosomal macrochromosomes, similar to that observed in the kagu. Chromosome painting revealed that most syntenies found in the avian putative ancestral karyotype (PAK) were conserved in the sunbittern. However, PAK1, PAK2, and PAK5 corresponded to two chromosome pairs each. Probes derived from L. albicollis confirm that fissions in PAK1 and PAK2 were centric, whereas in PAK5 the fission is interstitial. In addition, there is fusion of segments homologous to PAK2q and PAK5. From a phylogenetic point of view, comparisons of our results with two other Gruiformes belonging to family Rallidae suggest that the PAK5q fission might be a synapomorphy for Gruiformes. Fissions in PAK1 and PAK2 are found only in Eurypigidae, and might also occur in Rynochetidae, in view of the similar chromosomal morphology between the sunbittern and the kagu. This suggests a close phylogenetic relationship between Eurypigidae and Rynochetidae, whose common ancestor was separated by the Gondwana vicariancy in South America and New Caledonia, respectively. PMID:26624624

  15. High school students' learning and perceptions of phylogenetics of flowering plants.

    Science.gov (United States)

    Bokor, Julie R; Landis, Jacob B; Crippen, Kent J

    2014-01-01

    Basic phylogenetics and associated "tree thinking" are often minimized or excluded in formal school curricula. Informal settings provide an opportunity to extend the K-12 school curriculum, introducing learners to new ideas, piquing interest in science, and fostering scientific literacy. Similarly, university researchers participating in science, technology, engineering, and mathematics (STEM) outreach activities increase awareness of college and career options and highlight interdisciplinary fields of science research and augment the science curriculum. To aid in this effort, we designed a 6-h module in which students utilized 12 flowering plant species to generate morphological and molecular phylogenies using biological techniques and bioinformatics tools. The phylogenetics module was implemented with 83 high school students during a weeklong university STEM immersion program and aimed to increase student understanding of phylogenetics and coevolution of plants and pollinators. Student response reflected positive engagement and learning gains as evidenced through content assessments, program evaluation surveys, and program artifacts. We present the results of the first year of implementation and discuss modifications for future use in our immersion programs as well as in multiple course settings at the high school and undergraduate levels. © 2014 J. R. Bokor et al. CBE—Life Sciences Education © 2014 The American Society for Cell Biology. This article is distributed by The American Society for Cell Biology under license from the author(s). It is available to the public under an Attribution–Noncommercial–Share Alike 3.0 Unported Creative Commons License (http://creativecommons.org/licenses/by-nc-sa/3.0).

  16. Phylogenetic reconstruction of the family Acrypteridae (Orthoptera: Acridoidea) based on mitochondrial cytochrome B gene.

    Science.gov (United States)

    Huo, Guangming; Jiang, Guofang; Sun, Zhengli; Liu, Dianfeng; Zhang, Yalin; Lu, Lin

    2007-04-01

    Sequences from the mitochondrial cytochrome b gene (Cyt b) were determined for 25 species from the superfamily Acridoidae and the homologous sequences of 19 species of grasshoppers were downloaded from the GenBank data library. The purpose was to develop a molecular phylogeny of the Acrypteridae, and to interpret the phylogenetic position of the family within the superfamily Acridoidea. Phylogeny was reconstructed by Maximum-parsimony (MP) and Bayesian criteria using Yunnanites coriacea and Tagasta marginella as outgroups. The alignment length of the fragments was 384 bp after excluding ambiguous sites, including 167 parsimony informative sites. In the fragments, the percentages of A + T and G + C were 70.7% and 29.3%, respectively. The monophyly of Arcypteridae is not supported by phylogenetic trees. Within the Arcypteridae, neither Arcypterinae nor Ceracrinae is supported as a monophyletic group. The current genus Chorthippus is not a monophyletic group, and should be a polyphyletic group. The present results are significantly different from the classification scheme of Arcypteridae, which is based on morphology.

  17. Molecular characterization and phylogenetic analysis of human influenza A viruses isolated in Iran during the 2014-2015 season.

    Science.gov (United States)

    Moasser, Elham; Behzadian, Farida; Moattari, Afagh; Fotouhi, Fatemeh; Rahimi, Amir; Zaraket, Hassan; Hosseini, Seyed Younes

    2017-07-01

    Influenza A viruses are an important cause of severe infectious diseases in humans and are characterized by their fast evolution rate. Global monitoring of these viruses is critical to detect newly emerging variants during annual epidemics. Here, we sought to genetically characterize influenza A/H1N1pdm09 and A/H3N2 viruses collected in Iran during the 2014-2015 influenza season. A total of 200 nasopharyngeal swabs were collected from patients with influenza-like illnesses. Swabs were screened for influenza A and B using real-time PCR. Furthermore, positive specimens with high virus load underwent virus isolation and genetic characterization of their hemagglutinin (HA) and M genes. Of the 200 specimens, 80 were influenza A-positive, including 44 A/H1N1pdm09 and 36 A/H3N2, while 18 were influenza B-positive. Phylogenetic analysis of the HA genes of the A/H1N1pdm09 viruses revealed the circulation of clade 6C, characterized by amino acid substitutions D97N, V234I and K283E. Analysis of the A/H3N2 viruses showed a genetic drift from the vaccine strain A/Texas/50/2012 with 5 mutations (T128A, R142G, N145S, P198S and S219F) belonging to the antigenic sites A, B, and D of the HA protein. The A/H3N2 viruses belonged to phylogenetic clades 3C.2 and 3C.3. The M gene trees of the Iranian A/H1N1pdm09 and A/H3N2 mirrored the clustering patterns of their corresponding HA trees. Our results reveal co-circulation of several influenza A virus strains in Iran during the 2014-2015 influenza season.

  18. Phylogenetic analyses provide insights into the historical biogeography and evolution of Brachyrhaphis fishes.

    Science.gov (United States)

    Ingley, Spencer J; Reina, Ruth G; Bermingham, Eldredge; Johnson, Jerald B

    2015-08-01

    The livebearing fish genus Brachyrhaphis (Poeciliidae) has become an increasingly important model in evolution and ecology research, yet the phylogeny of this group is not well understood, nor has it been examined thoroughly using modern phylogenetic methods. Here, we present the first comprehensive phylogenetic analysis of Brachyrhaphis by using four molecular markers (3mtDNA, 1nucDNA) to infer relationships among species in this genus. We tested the validity of this genus as a monophyletic group using extensive outgroup sampling based on recent phylogenetic hypotheses of Poeciliidae. We also tested the validity of recently described species of Brachyrhaphis that are part of the B. episcopi complex in Panama. Finally, we examined the impact of historical events on diversification of Brachyrhaphis, and made predictions regarding the role of different ecological environments on evolutionary diversification where known historical events apparently fail to explain speciation. Based on our results, we reject the monophyly of Brachyrhaphis, and question the validity of two recently described species (B. hessfeldi and B. roswithae). Historical biogeography of Brachyrhaphis generally agrees with patterns found in other freshwater taxa in Lower Central America, which show that geological barriers frequently predict speciation. Specifically, we find evidence in support of an 'island' model of Lower Central American formation, which posits that the nascent isthmus was partitioned by several marine connections before linking North and South America. In some cases where historic events (e.g., vicariance) fail to explain allopatric species breaks in Brachyrhaphis, ecological processes (e.g., divergent predation environments) offer additional insight into our understanding of phylogenetic diversification in this group. Copyright © 2015 Elsevier Inc. All rights reserved.

  19. Whole genome sequence phylogenetic analysis of four Mexican rabies viruses isolated from cattle.

    Science.gov (United States)

    Bárcenas-Reyes, I; Loza-Rubio, E; Cantó-Alarcón, G J; Luna-Cozar, J; Enríquez-Vázquez, A; Barrón-Rodríguez, R J; Milián-Suazo, F

    2017-08-01

    Phylogenetic analysis of the rabies virus in molecular epidemiology has been traditionally performed on partial sequences of the genome, such as the N, G, and P genes; however, that approach raises concerns about the discriminatory power compared to whole genome sequencing. In this study we characterized four strains of the rabies virus isolated from cattle in Querétaro, Mexico by comparing the whole genome sequence to that of strains from the American, European and Asian continents. Four cattle brain samples positive to rabies and characterized as AgV11, genotype 1, were used in the study. A cDNA sequence was generated by reverse transcription PCR (RT-PCR) using oligo dT. cDNA samples were sequenced in an Illumina NextSeq 500 platform. The phylogenetic analysis was performed with MEGA 6.0. Minimum evolution phylogenetic trees were constructed with the Neighbor-Joining method and bootstrapped with 1000 replicates. Three large and seven small clusters were formed with the 26 sequences used. The largest cluster grouped strains from different species in South America: Brazil, and the French Guyana. The second cluster grouped five strains from Mexico. A Mexican strain reported in a different study was highly related to our four strains, suggesting common source of infection. The phylogenetic analysis shows that the type of host is different for the different regions in the American Continent; rabies is more related to bats. It was concluded that the rabies virus in central Mexico is genetically stable and that it is transmitted by the vampire bat Desmodus rotundus. Copyright © 2017 Elsevier Ltd. All rights reserved.

  20. Phylogenetic turnover during subtropical forest succession across environmental and phylogenetic scales.

    Science.gov (United States)

    Purschke, Oliver; Michalski, Stefan G; Bruelheide, Helge; Durka, Walter

    2017-12-01

    Although spatial and temporal patterns of phylogenetic community structure during succession are inherently interlinked and assembly processes vary with environmental and phylogenetic scales, successional studies of community assembly have yet to integrate spatial and temporal components of community structure, while accounting for scaling issues. To gain insight into the processes that generate biodiversity after disturbance, we combine analyses of spatial and temporal phylogenetic turnover across phylogenetic scales, accounting for covariation with environmental differences. We compared phylogenetic turnover, at the species- and individual-level, within and between five successional stages, representing woody plant communities in a subtropical forest chronosequence. We decomposed turnover at different phylogenetic depths and assessed its covariation with between-plot abiotic differences. Phylogenetic turnover between stages was low relative to species turnover and was not explained by abiotic differences. However, within the late-successional stages, there was high presence-/absence-based turnover (clustering) that occurred deep in the phylogeny and covaried with environmental differentiation. Our results support a deterministic model of community assembly where (i) phylogenetic composition is constrained through successional time, but (ii) toward late succession, species sorting into preferred habitats according to niche traits that are conserved deep in phylogeny, becomes increasingly important.

  1. A phylogenetic study of Boletus section Boletus in Europe

    NARCIS (Netherlands)

    Beugelsdijk, D.C.M.; Linde, van der S.; Zuccarello, G.C.; Bakker, den H.C.

    2008-01-01

    A phylogenetic study of the species in Boletus sect. Boletus was undertaken using the molecular markers ITS1-5.8S-ITS2 and Gap dh. Four well-supported lineages, one comprising Boletus edulis s.l., the others referring to B. aereus, B. reticulatus and B. pinophilus have been distinguished. The ML and

  2. New approaches to phylogenetic tree search and their application to large numbers of protein alignments.

    Science.gov (United States)

    Whelan, Simon

    2007-10-01

    Phylogenetic tree estimation plays a critical role in a wide variety of molecular studies, including molecular systematics, phylogenetics, and comparative genomics. Finding the optimal tree relating a set of sequences using score-based (optimality criterion) methods, such as maximum likelihood and maximum parsimony, may require all possible trees to be considered, which is not feasible even for modest numbers of sequences. In practice, trees are estimated using heuristics that represent a trade-off between topological accuracy and speed. I present a series of novel algorithms suitable for score-based phylogenetic tree reconstruction that demonstrably improve the accuracy of tree estimates while maintaining high computational speeds. The heuristics function by allowing the efficient exploration of large numbers of trees through novel hill-climbing and resampling strategies. These heuristics, and other computational approximations, are implemented for maximum likelihood estimation of trees in the program Leaphy, and its performance is compared to other popular phylogenetic programs. Trees are estimated from 4059 different protein alignments using a selection of phylogenetic programs and the likelihoods of the tree estimates are compared. Trees estimated using Leaphy are found to have equal to or better likelihoods than trees estimated using other phylogenetic programs in 4004 (98.6%) families and provide a unique best tree that no other program found in 1102 (27.1%) families. The improvement is particularly marked for larger families (80 to 100 sequences), where Leaphy finds a unique best tree in 81.7% of families.

  3. The phylogenetic position of Lygodactylus angularis and the utility of using the 16S rDNA gene for delimiting species in Lygodactylus (Squamata, Gekkonidae

    Directory of Open Access Journals (Sweden)

    Riccardo Castiglia

    2011-06-01

    Full Text Available The African genus Lygodactylus Gray, is composed of roughly 60 species of diurnal geckos that inhabit tropical and temperate Africa, Madagascar, and South America. In this study, we assessed the phylogenetic position of L. angularis, for which molecular data were so far lacking, by means of sequence analysis of the mitochondrial 16S rDNA gene. We also compared intraspecific vs. interspecific genetic divergences using an extended data set (34 species, 153 sequences, to determine whether a fragment of this gene can be useful for species identification and to reveal the possible existence of new cryptic species in the genus. The analysis placed L. angularis in a monophyletic group together with members of “fischeri” and “picturatus” groups. Nevertheless, the independence of the “angularis” lineage is supported by the high genetic divergence. Comparison of intraspecific vs. interspecific genetic distances highlights that, assuming an equal molecular rate of evolution among the studied species for the used gene, the threshold value useful for recognising a candidate new species can be tentatively placed at 7%. We identified four species that showed an intraspecific divergence higher than, or close to, the 7% threshold: L. capensis (8.7%, L. gutturalis (9.3%, L. madagascariensis (6.5% and L. picturatus (8.1%. Moreover, two species, L. mombasicus and L. verticillatus, are paraphyletic in terms of gene genealogy. Thus, the study shows that a short fragment of the 16S rDNA gene can be an informative tool for species-level taxonomy in the genus Lygodactylus.

  4. Molecular Characterization and Comparative Phylogenetic Analysis of Phytases from Fungi with Their Prospective Applications

    Directory of Open Access Journals (Sweden)

    Sharad Tiwari

    2013-01-01

    Full Text Available Plant seeds that have high phytate content are used as animal feed. Phytases, enzymes that catalyze the breakdown of phytate into inorganic phosphorus and myoinositol phosphate derivatives, have been intensively studied in recent years and gained immense attention because of their application in reducing phytate content in animal feed and food for human consumption, thus indirectly lowering environmental pollution caused by undigested phytate. This review is focused on summarising the current knowledge on recent developments of fungal and yeast phytases. Comparative account on diverse sources and physiological roles, molecular characteristics and regulation mechanisms of phytases are discussed. Phylogenetic relationship of phytases from different classes of fungi is studied in details. It is inferred on the basis of phylogeny that phytases from Ascomycetes and Basidiomycetes differ in the amino acid sequences, therefore they fall in separate clade in the tree. The prospective biotechnological applications of microbial phytases such as animal feed additives, probiotics, pharmaceuticals, as well as in aquaculture, food industry, paper manufacturing, development of transgenic plants and animals with special reference to its use as biofertilizers are also emphasised in this review.

  5. The rhabdoviruses: biodiversity, phylogenetics, and evolution.

    Science.gov (United States)

    Kuzmin, I V; Novella, I S; Dietzgen, R G; Padhi, A; Rupprecht, C E

    2009-07-01

    Rhabdoviruses (family Rhabdoviridae) include a diversity of important pathogens of animals and plants. They share morphology and genome organization. The understanding of rhabdovirus phylogeny, ecology and evolution has progressed greatly during the last 30 years, due to enhanced surveillance and improved methodologies of molecular characterization. Along with six established genera, several phylogenetic groups at different levels were described within the Rhabdoviridae. However, comparative relationships between viral phylogeny and taxonomy remains incomplete, with multiple representatives awaiting further genetic characterization. The same is true for rhabdovirus evolution. To date, rather simplistic molecular clock models only partially describe the evolutionary dynamics of postulated viral lineages. Ongoing progress in viral evolutionary and ecological investigations will provide the platform for future studies of this diverse family.

  6. A Genome-Scale Investigation of How Sequence, Function, and Tree-Based Gene Properties Influence Phylogenetic Inference.

    Science.gov (United States)

    Shen, Xing-Xing; Salichos, Leonidas; Rokas, Antonis

    2016-09-02

    Molecular phylogenetic inference is inherently dependent on choices in both methodology and data. Many insightful studies have shown how choices in methodology, such as the model of sequence evolution or optimality criterion used, can strongly influence inference. In contrast, much less is known about the impact of choices in the properties of the data, typically genes, on phylogenetic inference. We investigated the relationships between 52 gene properties (24 sequence-based, 19 function-based, and 9 tree-based) with each other and with three measures of phylogenetic signal in two assembled data sets of 2,832 yeast and 2,002 mammalian genes. We found that most gene properties, such as evolutionary rate (measured through the percent average of pairwise identity across taxa) and total tree length, were highly correlated with each other. Similarly, several gene properties, such as gene alignment length, Guanine-Cytosine content, and the proportion of tree distance on internal branches divided by relative composition variability (treeness/RCV), were strongly correlated with phylogenetic signal. Analysis of partial correlations between gene properties and phylogenetic signal in which gene evolutionary rate and alignment length were simultaneously controlled, showed similar patterns of correlations, albeit weaker in strength. Examination of the relative importance of each gene property on phylogenetic signal identified gene alignment length, alongside with number of parsimony-informative sites and variable sites, as the most important predictors. Interestingly, the subsets of gene properties that optimally predicted phylogenetic signal differed considerably across our three phylogenetic measures and two data sets; however, gene alignment length and RCV were consistently included as predictors of all three phylogenetic measures in both yeasts and mammals. These results suggest that a handful of sequence-based gene properties are reliable predictors of phylogenetic signal

  7. An attempt to reconstruct phylogenetic relationships within Caribbean nummulitids: simulating relationships and tracing character evolution

    Science.gov (United States)

    Eder, Wolfgang; Ives Torres-Silva, Ana; Hohenegger, Johann

    2017-04-01

    Phylogenetic analysis and trees based on molecular data are broadly applied and used to infer genetical and biogeographic relationship in recent larger foraminifera. Molecular phylogenetic is intensively used within recent nummulitids, however for fossil representatives these trees are only of minor informational value. Hence, within paleontological studies a phylogenetic approach through morphometric analysis is of much higher value. To tackle phylogenetic relationships within the nummulitid family, a much higher number of morphological character must be measured than are commonly used in biometric studies, where mostly parameters describing embryonic size (e.g., proloculus diameter, deuteroloculus diameter) and/or the marginal spiral (e.g., spiral diagrams, spiral indices) are studied. For this purpose 11 growth-independent and/or growth-invariant characters have been used to describe the morphological variability of equatorial thin sections of seven Carribbean nummulitid taxa (Nummulites striatoreticulatus, N. macgillavry, Palaeonummulites willcoxi, P.floridensis, P. soldadensis, P.trinitatensis and P.ocalanus) and one outgroup taxon (Ranikothalia bermudezi). Using these characters, phylogenetic trees were calculated using a restricted maximum likelihood algorithm (REML), and results are cross-checked by ordination and cluster analysis. Square-change parsimony method has been run to reconstruct ancestral states, as well as to simulate the evolution of the chosen characters along the calculated phylogenetic tree and, independent - contrast analysis was used to estimate confidence intervals. Based on these simulations, phylogenetic tendencies of certain characters proposed for nummulitids (e.g., Cope's rule or nepionic acceleration) can be tested, whether these tendencies are valid for the whole family or only for certain clades. At least, within the Carribean nummulitids, phylogenetic trends along some growth-independent characters of the embryo (e.g., first

  8. The complete chloroplast genome sequence of Ampelopsis: gene organization, comparative analysis and phylogenetic relationships to other angiosperms

    Directory of Open Access Journals (Sweden)

    Gurusamy eRaman

    2016-03-01

    Full Text Available Ampelopsis brevipedunculata is an economically important plant that belongs to the Vitaceae family of angiosperms. The phylogenetic placement of Vitaceae is still unresolved. Recent phylogenetic studies suggested that it should be placed in various alternative families including Caryophyllaceae, asteraceae, Saxifragaceae, Dilleniaceae, or with the rest of the rosid families. However, these analyses provided weak supportive results because they were based on only one of several genes. Accordingly, complete chloroplast genome sequences are required to resolve the phylogenetic relationships among angiosperms. Recent phylogenetic analyses based on the complete chloroplast genome sequence suggested strong support for the position of Vitaceae as the earliest diverging lineage of rosids and placed it as a sister to the remaining rosids. These studies also revealed relationships among several major lineages of angiosperms; however, they highlighted the significance of taxon sampling for obtaining accurate phylogenies. In the present study, we sequenced the complete chloroplast genome of A. brevipedunculata and used these data to assess the relationships among 32 angiosperms, including 18 taxa of rosids. The Ampelopsis chloroplast genome is 161,090 bp in length, and includes a pair of inverted repeats of 26,394 bp that are separated by small and large single copy regions of 19,036 bp and 89,266 bp, respectively. The gene content and order of Ampelopsis is identical to many other unrearranged angiosperm chloroplast genomes, including Vitis and tobacco. A phylogenetic tree constructed based on 70 protein-coding genes of 33 angiosperms showed that both Saxifragales and Vitaceae diverged from the rosid clade and formed two clades with 100% bootstrap value. The position of the Vitaceae is sister to Saxifragales, and both are the basal and earliest diverging lineages. Moreover, Saxifragales forms a sister clade to Vitaceae of rosids. Overall, the results of

  9. TreeScaper: Visualizing and Extracting Phylogenetic Signal from Sets of Trees.

    Science.gov (United States)

    Huang, Wen; Zhou, Guifang; Marchand, Melissa; Ash, Jeremy R; Morris, David; Van Dooren, Paul; Brown, Jeremy M; Gallivan, Kyle A; Wilgenbusch, Jim C

    2016-12-01

    Modern phylogenomic analyses often result in large collections of phylogenetic trees representing uncertainty in individual gene trees, variation across genes, or both. Extracting phylogenetic signal from these tree sets can be challenging, as they are difficult to visualize, explore, and quantify. To overcome some of these challenges, we have developed TreeScaper, an application for tree set visualization as well as the identification of distinct phylogenetic signals. GUI and command-line versions of TreeScaper and a manual with tutorials can be downloaded from https://github.com/whuang08/TreeScaper/releases TreeScaper is distributed under the GNU General Public License. © The Author 2016. Published by Oxford University Press on behalf of the Society for Molecular Biology and Evolution. All rights reserved. For permissions, please e-mail: journals.permissions@oup.com.

  10. Co-circulating serotypes in a dengue fever outbreak: Differential hematological profiles and phylogenetic relationships among viruses.

    Science.gov (United States)

    Carmo, Andreia Moreira Dos Santos; Suzuki, Rodrigo Buzinaro; Cabral, Aline Diniz; Costa, Renata Torres da; Massari, Gabriela Pena; Riquena, Michele Marcondes; Fracasso, Helio Augusto Alves; Eterovic, Andre; Marcili, Arlei; Sperança, Márcia Aparecida

    2017-05-01

    Dengue virus, represented by four distinct, genetically diverse serotypes, is the etiologic agent of asymptomatic to severe hemorrhagic diseases. The spatiotemporal dynamics of dengue serotypes and its association to specific diseases vary among the different regions worldwide. By 2007, and in São Paulo State, Brazil, dengue-case concentration in urban centers had changed to increased incidence in small- and medium-sized towns, the case of Marília. The aim of this article was to distinguish dengue serotypes circulating during the 2007 Marília outbreak and define their association to demographic and hematological patient profiles, as well as the phylogenetic relationships among the different viruses. PCR amplicons corresponding to the junction of capsid and dengue pre-membrane encoding genes, obtained from dengue serologically positive patients, were sequenced. Hematological and demographic data of patients with different Dengue serotypes were evaluated by univariate and bivariate statistics. Dengue PCR sequences were used in phylogenetic relationships analyzed for maximum parsimony. Molecular typing confirmed co-circulation of the dengue serotypes 1 (DENV1) and 3 (DENV3), which presented divergent correlation patterns with regard to hematological descriptors. The increase in atypical lymphocytes, a likely indication of virus load, could be significantly associated to a decrease in leukocyte counts in the DENV3 group and platelet in the DENV1. Phylogenetic reconstitution revealed the introduction of DENV1 from northern Brazil and local divergence of DENV3 by either microevolution or viral introduction from other geographical regions or both. Dengue dynamics showed regional molecular-epidemiologic specificity, which has important implications for introduction of vaccines, disease management, and transmission control. Copyright © 2017 Elsevier B.V. All rights reserved.

  11. PyElph - a software tool for gel images analysis and phylogenetics

    Directory of Open Access Journals (Sweden)

    Pavel Ana Brânduşa

    2012-01-01

    Full Text Available Abstract Background This paper presents PyElph, a software tool which automatically extracts data from gel images, computes the molecular weights of the analyzed molecules or fragments, compares DNA patterns which result from experiments with molecular genetic markers and, also, generates phylogenetic trees computed by five clustering methods, using the information extracted from the analyzed gel image. The software can be successfully used for population genetics, phylogenetics, taxonomic studies and other applications which require gel image analysis. Researchers and students working in molecular biology and genetics would benefit greatly from the proposed software because it is free, open source, easy to use, has a friendly Graphical User Interface and does not depend on specific image acquisition devices like other commercial programs with similar functionalities do. Results PyElph software tool is entirely implemented in Python which is a very popular programming language among the bioinformatics community. It provides a very friendly Graphical User Interface which was designed in six steps that gradually lead to the results. The user is guided through the following steps: image loading and preparation, lane detection, band detection, molecular weights computation based on a molecular weight marker, band matching and finally, the computation and visualization of phylogenetic trees. A strong point of the software is the visualization component for the processed data. The Graphical User Interface provides operations for image manipulation and highlights lanes, bands and band matching in the analyzed gel image. All the data and images generated in each step can be saved. The software has been tested on several DNA patterns obtained from experiments with different genetic markers. Examples of genetic markers which can be analyzed using PyElph are RFLP (Restriction Fragment Length Polymorphism, AFLP (Amplified Fragment Length Polymorphism, RAPD

  12. Molecular and phylogenetic characterization of the sieve element occlusion gene family in Fabaceae and non-Fabaceae plants.

    Science.gov (United States)

    Rüping, Boris; Ernst, Antonia M; Jekat, Stephan B; Nordzieke, Steffen; Reineke, Anna R; Müller, Boje; Bornberg-Bauer, Erich; Prüfer, Dirk; Noll, Gundula A

    2010-10-08

    The phloem of dicotyledonous plants contains specialized P-proteins (phloem proteins) that accumulate during sieve element differentiation and remain parietally associated with the cisternae of the endoplasmic reticulum in mature sieve elements. Wounding causes P-protein filaments to accumulate at the sieve plates and block the translocation of photosynthate. Specialized, spindle-shaped P-proteins known as forisomes that undergo reversible calcium-dependent conformational changes have evolved exclusively in the Fabaceae. Recently, the molecular characterization of three genes encoding forisome components in the model legume Medicago truncatula (MtSEO1, MtSEO2 and MtSEO3; SEO = sieve element occlusion) was reported, but little is known about the molecular characteristics of P-proteins in non-Fabaceae. We performed a comprehensive genome-wide comparative analysis by screening the M. truncatula, Glycine max, Arabidopsis thaliana, Vitis vinifera and Solanum phureja genomes, and a Malus domestica EST library for homologs of MtSEO1, MtSEO2 and MtSEO3 and identified numerous novel SEO genes in Fabaceae and even non-Fabaceae plants, which do not possess forisomes. Even in Fabaceae some SEO genes appear to not encode forisome components. All SEO genes have a similar exon-intron structure and are expressed predominantly in the phloem. Phylogenetic analysis revealed the presence of several subgroups with Fabaceae-specific subgroups containing all of the known as well as newly identified forisome component proteins. We constructed Hidden Markov Models that identified three conserved protein domains, which characterize SEO proteins when present in combination. In addition, one common and three subgroup specific protein motifs were found in the amino acid sequences of SEO proteins. SEO genes are organized in genomic clusters and the conserved synteny allowed us to identify several M. truncatula vs G. max orthologs as well as paralogs within the G. max genome. The unexpected

  13. Molecular evidence for deep phylogenetic divergence in Mandrillus sphinx.

    Science.gov (United States)

    Telfer, P T; Souquière, S; Clifford, S L; Abernethy, K A; Bruford, M W; Disotell, T R; Sterner, K N; Roques, P; Marx, P A; Wickings, E J

    2003-07-01

    Mandrills (Mandrillus sphinx) are forest primates indigenous to western central Africa. Phylogenetic analysis of 267 base pairs (bp) of the cytochrome b gene from 53 mandrills of known and 17 of unknown provenance revealed two phylogeographical groups, with haplotypes differentiated by 2.6% comprising seven synonymous transitions. The distribution of the haplotypes suggests that the Ogooué River, Gabon, which bisects their range, separates mandrill populations in Cameroon and northern Gabon from those in southern Gabon. The haplotype distribution is also concordant with that of two known mandrill simian immunodeficiency viruses, suggesting that these two mandrill phylogroups have followed different evolutionary trajectories since separation.

  14. First evidence of Leishmania infection in European brown hare (Lepus europaeus) in Greece: GIS analysis and phylogenetic position within the Leishmania spp.

    Science.gov (United States)

    Tsokana, C N; Sokos, C; Giannakopoulos, A; Mamuris, Z; Birtsas, P; Papaspyropoulos, K; Valiakos, G; Spyrou, V; Lefkaditis, M; Chatzopoulos, D C; Kantere, M; Manolakou, K; Touloudi, A; Burriel, A Rodi; Ferroglio, E; Hadjichristodoulou, C; Billinis, C

    2016-01-01

    Although the existence of a sylvatic transmission cycle of Leishmania spp., independent from the domestic cycle, has been proposed, data are scarce on Leishmania infection in wild mammals in Greece. In this study, we aimed to investigate the presence of Leishmania infection in the European brown hare in Greece, to infer the phylogenetic position of the Leishmania parasites detected in hares in Greece, and to identify any possible correlation between Leishmania infection in hares with environmental parameters, using the geographical information system (GIS). Spleen samples from 166 hares were tested by internal transcribed spacer-1 (ITS-1)-nested PCR for the detection of Leishmania DNA. Phylogenetic analysis was performed on Leishmania sequences from hares in Greece in conjunction with Leishmania sequences from dogs in Greece and 46 Leishmania sequences retrieved from GenBank. The Leishmania DNA prevalence in hares was found to be 23.49 % (95 % confidence interval (CI) 17.27-30.69). The phylogenetic analysis confirmed that the Leishmania sequences from hares in Greece belong in the Leishmania donovani complex. The widespread Leishmania infection in hares should be taken into consideration because under specific circumstances, this species can act as a reservoir host. This study suggests that the role of wild animals, including hares, in the epidemiology of Leishmania spp. in Greece deserves further elucidation.

  15. First molecular data on the phylum Loricifera: an investigation into the phylogeny of ecdysozoa with emphasis on the positions of Loricifera and Priapulida.

    Science.gov (United States)

    Park, Joong-Ki; Rho, Hyun Soo; Kristensen, Reinhardt Møbjerg; Kim, Won; Giribet, Gonzalo

    2006-11-01

    Recent progress in molecular techniques has generated a wealth of information for phylogenetic analysis. Among metazoans all but a single phylum have been incorporated into some sort of molecular analysis. However, the minute and rare species of the phylum Loricifera have remained elusive to molecular systematists. Here we report the first molecular sequence data (nearly complete 18S rRNA) for a member of the phylum Loricifera, Pliciloricus sp. from Korea. The new sequence data were analyzed together with 52 other ecdysozoan sequences, with all other phyla represented by three or more sequences. The data set was analyzed using parsimony as an optimality criterion under direct optimization as well as using a Bayesian approach. The parsimony analysis was also accompanied by a sensitivity analysis. The results of both analyses are largely congruent, finding monophyly of each ecdysozoan phylum, except for Priapulida, in which the coelomate Meiopriapulus is separate from a clade of pseudocoelomate priapulids. The data also suggest a relationship of the pseudocoelomate priapulids to kinorhynchs, and a relationship of nematodes to tardigrades. The Bayesian analysis placed the arthropods as the sister group to a clade that includes tardigrades and nematodes. However, these results were shown to be parameter dependent in the sensitivity analysis. The position of Loricifera was extremely unstable to parameter variation, and support for a relationship of loriciferans to any particular ecdysozoan phylum was not found in the data.

  16. Coalescent methods for estimating phylogenetic trees.

    Science.gov (United States)

    Liu, Liang; Yu, Lili; Kubatko, Laura; Pearl, Dennis K; Edwards, Scott V

    2009-10-01

    We review recent models to estimate phylogenetic trees under the multispecies coalescent. Although the distinction between gene trees and species trees has come to the fore of phylogenetics, only recently have methods been developed that explicitly estimate species trees. Of the several factors that can cause gene tree heterogeneity and discordance with the species tree, deep coalescence due to random genetic drift in branches of the species tree has been modeled most thoroughly. Bayesian approaches to estimating species trees utilizes two likelihood functions, one of which has been widely used in traditional phylogenetics and involves the model of nucleotide substitution, and the second of which is less familiar to phylogeneticists and involves the probability distribution of gene trees given a species tree. Other recent parametric and nonparametric methods for estimating species trees involve parsimony criteria, summary statistics, supertree and consensus methods. Species tree approaches are an appropriate goal for systematics, appear to work well in some cases where concatenation can be misleading, and suggest that sampling many independent loci will be paramount. Such methods can also be challenging to implement because of the complexity of the models and computational time. In addition, further elaboration of the simplest of coalescent models will be required to incorporate commonly known issues such as deviation from the molecular clock, gene flow and other genetic forces.

  17. Short interspersed elements (SINEs) in plants: origin, classification, and use as phylogenetic markers.

    Science.gov (United States)

    Deragon, Jean-Marc; Zhang, Xiaoyu

    2006-12-01

    Short interspersed elements (SINEs) are a class of dispersed mobile sequences that use RNA as an intermediate in an amplification process called retroposition. The presence-absence of a SINE at a given locus has been used as a meaningful classification criterion to evaluate phylogenetic relations among species. We review here recent developments in the characterisation of plant SINEs and their use as molecular makers to retrace phylogenetic relations among wild and cultivated Oryza and Brassica species. In Brassicaceae, further use of SINE markers is limited by our partial knowledge of endogenous SINE families (their origin and evolution histories) and by the absence of a clear classification. To solve this problem, phylogenetic relations among all known Brassicaceae SINEs were analyzed and a new classification, grouping SINEs in 15 different families, is proposed. The relative age and size of each Brassicaceae SINE family was evaluated and new phylogenetically supported subfamilies were described. We also present evidence suggesting that new potentially active SINEs recently emerged in Brassica oleracea from the shuffling of preexisting SINE portions. Finally, the comparative evolution history of SINE families present in Arabidopsis thaliana and Brassica oleracea revealed that SINEs were in general more active in the Brassica lineage. The importance of these new data for the use of Brassicaceae SINEs as molecular markers in future applications is discussed.

  18. BLAST-EXPLORER helps you building datasets for phylogenetic analysis

    Directory of Open Access Journals (Sweden)

    Claverie Jean-Michel

    2010-01-01

    Full Text Available Abstract Background The right sampling of homologous sequences for phylogenetic or molecular evolution analyses is a crucial step, the quality of which can have a significant impact on the final interpretation of the study. There is no single way for constructing datasets suitable for phylogenetic analysis, because this task intimately depends on the scientific question we want to address, Moreover, database mining softwares such as BLAST which are routinely used for searching homologous sequences are not specifically optimized for this task. Results To fill this gap, we designed BLAST-Explorer, an original and friendly web-based application that combines a BLAST search with a suite of tools that allows interactive, phylogenetic-oriented exploration of the BLAST results and flexible selection of homologous sequences among the BLAST hits. Once the selection of the BLAST hits is done using BLAST-Explorer, the corresponding sequence can be imported locally for external analysis or passed to the phylogenetic tree reconstruction pipelines available on the Phylogeny.fr platform. Conclusions BLAST-Explorer provides a simple, intuitive and interactive graphical representation of the BLAST results and allows selection and retrieving of the BLAST hit sequences based a wide range of criterions. Although BLAST-Explorer primarily aims at helping the construction of sequence datasets for further phylogenetic study, it can also be used as a standard BLAST server with enriched output. BLAST-Explorer is available at http://www.phylogeny.fr

  19. Molecular phylogenetic trees - On the validity of the Goodman-Moore augmentation algorithm

    Science.gov (United States)

    Holmquist, R.

    1979-01-01

    A response is made to the reply of Nei and Tateno (1979) to the letter of Holmquist (1978) supporting the validity of the augmentation algorithm of Moore (1977) in reconstructions of nucleotide substitutions by means of the maximum parsimony principle. It is argued that the overestimation of the augmented numbers of nucleotide substitutions (augmented distances) found by Tateno and Nei (1978) is due to an unrepresentative data sample and that it is only necessary that evolution be stochastically uniform in different regions of the phylogenetic network for the augmentation method to be useful. The importance of the average value of the true distance over all links is explained, and the relative variances of the true and augmented distances are calculated to be almost identical. The effects of topological changes in the phylogenetic tree on the augmented distance and the question of the correctness of ancestral sequences inferred by the method of parsimony are also clarified.

  20. Molecular phylogenetic evaluation of classification and scenarios of character evolution in calcareous sponges (Porifera, Class Calcarea.

    Directory of Open Access Journals (Sweden)

    Oliver Voigt

    Full Text Available Calcareous sponges (Phylum Porifera, Class Calcarea are known to be taxonomically difficult. Previous molecular studies have revealed many discrepancies between classically recognized taxa and the observed relationships at the order, family and genus levels; these inconsistencies question underlying hypotheses regarding the evolution of certain morphological characters. Therefore, we extended the available taxa and character set by sequencing the complete small subunit (SSU rDNA and the almost complete large subunit (LSU rDNA of additional key species and complemented this dataset by substantially increasing the length of available LSU sequences. Phylogenetic analyses provided new hypotheses about the relationships of Calcarea and about the evolution of certain morphological characters. We tested our phylogeny against competing phylogenetic hypotheses presented by previous classification systems. Our data reject the current order-level classification by again finding non-monophyletic Leucosolenida, Clathrinida and Murrayonida. In the subclass Calcinea, we recovered a clade that includes all species with a cortex, which is largely consistent with the previously proposed order Leucettida. Other orders that had been rejected in the current system were not found, but could not be rejected in our tests either. We found several additional families and genera polyphyletic: the families Leucascidae and Leucaltidae and the genus Leucetta in Calcinea, and in Calcaronea the family Amphoriscidae and the genus Ute. Our phylogeny also provided support for the vaguely suspected close relationship of several members of Grantiidae with giantortical diactines to members of Heteropiidae. Similarly, our analyses revealed several unexpected affinities, such as a sister group relationship between Leucettusa (Leucaltidae and Leucettidae and between Leucascandra (Jenkinidae and Sycon carteri (Sycettidae. According to our results, the taxonomy of Calcarea is in

  1. Two mitochondrial genomes in Alcedinidae (Ceryle rudis/Halcyon pileata) and the phylogenetic placement of Coraciiformes.

    Science.gov (United States)

    Sun, Xiaomin; Zhao, Ruoping; Zhang, Ting; Gong, Jie; Jing, Meidong; Huang, Ling

    2017-10-01

    Coraciiformes comprises 209 species belonging to ten families with significant divergence on external morphologies and life styles. The phylogenetic placement of Coraciiformes was still in debate. Here, we determined the complete mitochondrial genomes (mitogenomes) of Crested Kingfisher (Ceryle rudis) and Black-capped Kingfisher (Halcyon pileata). The mitogenomes were 17,355 bp (C. rudis) and 17,612 bp (H. pileata) in length, and both of them contained 37 genes (two rRNA genes, 22 tRNA genes and 13 protein-coding genes) and one control region. The gene organizations and characters of two mitogenomes were similar with those of other mitogenomes in Coraciiformes, however the sizes and nucleotide composition of control regions in different mitogenomes were significantly different. Phylogenetic trees were constructed with both Bayesian and Maximum Likelihood methods based on mitogenome sequences from 11 families of six orders. The trees based on two different data sets supported the basal position of Psittacidae (Psittaciformes), the closest relationship between Cuculiformes (Cuculidae) and Trogoniformes (Trogonidae), and the close relationship between Coraciiformes and Piciformes. The phylogenetic placement of the clade including Cuculiformes and Trogoniformes has not been resolved in present study, which need further investigations with more molecular markers and species. The mitogenome sequences presented here provided valuable data for further taxonomic studies on Coraciiformes and other related groups.

  2. Zoosporogenesis, morphology, ultrastructure, pigment composition, and phylogenetic position of Trachydiscus minutus (Eustigmatophyceae, Heterokontophyta)

    Czech Academy of Sciences Publication Activity Database

    Přibyl, Pavel; Eliáš, M.; Cepák, Vladislav; Lukavský, Jaromír; Kaštánek, P.

    2012-01-01

    Roč. 48, č. 1 (2012), s. 231-242 ISSN 0022-3646 R&D Projects: GA MŠk 1M0571; GA ČR GPP501/10/P157 Institutional research plan: CEZ:AV0Z60050516 Keywords : phylogenetics * Trachydiscus * zoospores Subject RIV: EF - Botanics Impact factor: 2.239, year: 2012

  3. Molecular characterization of Hepatozoon sp. from Brazilian dogs and its phylogenetic relationship with other Hepatozoon spp.

    Science.gov (United States)

    Forlano, M D; Teixeira, K R S; Scofield, A; Elisei, C; Yotoko, K S C; Fernandes, K R; Linhares, G F C; Ewing, S A; Massard, C L

    2007-04-10

    To characterize phylogenetically the species which causes canine hepatozoonosis at two rural areas of Rio de Janeiro State, Brazil, we used universal or Hepatozoon spp. primer sets for the 18S SSU rRNA coding region. DNA extracts were obtained from blood samples of thirteen dogs naturally infected, from four experimentally infected, and from five puppies infected by vertical transmission from a dam, that was experimentally infected. DNA of sporozoites of Hepatozoon americanum was used as positive control. The amplification of DNA extracts from blood of dogs infected with sporozoites of Hepatozoon spp. was observed in the presence of primers to 18S SSU rRNA gene of Hepatozoon spp., whereas DNA of H. americanum sporozoites was amplified in the presence of either universal or Hepatozoon spp.-specific primer sets; the amplified products were approximately 600bp in size. Cloned PCR products obtained from DNA extracts of blood from two dogs experimentally infected with Hepatozoon sp. were sequenced. The consensus sequence, derived from six sequence data sets, were blasted against sequences of 18S SSU rRNA of Hepatozoon spp. available at GenBank and aligned to homologous sequences to perform the phylogenetic analysis. This analysis clearly showed that our sequence clustered, independently of H. americanum sequences, within a group comprising other Hepatozoon canis sequences. Our results confirmed the hypothesis that the agent causing hepatozoonosis in the areas studied in Brazil is H. canis, supporting previous reports that were based on morphological and morphometric analyses.

  4. Deceptive Desmas: Molecular Phylogenetics Suggests a New Classification and Uncovers Convergent Evolution of Lithistid Demosponges

    Science.gov (United States)

    Schuster, Astrid; Erpenbeck, Dirk; Pisera, Andrzej; Hooper, John; Bryce, Monika; Fromont, Jane; Wörheide, Gert

    2015-01-01

    Reconciling the fossil record with molecular phylogenies to enhance the understanding of animal evolution is a challenging task, especially for taxa with a mostly poor fossil record, such as sponges (Porifera). ‘Lithistida’, a polyphyletic group of recent and fossil sponges, are an exception as they provide the richest fossil record among demosponges. Lithistids, currently encompassing 13 families, 41 genera and >300 recent species, are defined by the common possession of peculiar siliceous spicules (desmas) that characteristically form rigid articulated skeletons. Their phylogenetic relationships are to a large extent unresolved and there has been no (taxonomically) comprehensive analysis to formally reallocate lithistid taxa to their closest relatives. This study, based on the most comprehensive molecular and morphological investigation of ‘lithistid’ demosponges to date, corroborates some previous weakly-supported hypotheses, and provides novel insights into the evolutionary relationships of the previous ‘order Lithistida’. Based on molecular data (partial mtDNA CO1 and 28S rDNA sequences), we show that 8 out of 13 ‘Lithistida’ families belong to the order Astrophorida, whereas Scleritodermidae and Siphonidiidae form a separate monophyletic clade within Tetractinellida. Most lithistid astrophorids are dispersed between different clades of the Astrophorida and we propose to formally reallocate them, respectively. Corallistidae, Theonellidae and Phymatellidae are monophyletic, whereas the families Pleromidae and Scleritodermidae are polyphyletic. Family Desmanthidae is polyphyletic and groups within Halichondriidae – we formally propose a reallocation. The sister group relationship of the family Vetulinidae to Spongillida is confirmed and we propose here for the first time to include Vetulina into a new Order Sphaerocladina. Megascleres and microscleres possibly evolved and/or were lost several times independently in different

  5. Detection of Horizontal Gene Transfers from Phylogenetic Comparisons

    Science.gov (United States)

    Pylro, Victor Satler; Vespoli, Luciano de Souza; Duarte, Gabriela Frois; Yotoko, Karla Suemy Clemente

    2012-01-01

    Bacterial phylogenies have become one of the most important challenges for microbial ecology. This field started in the mid-1970s with the aim of using the sequence of the small subunit ribosomal RNA (16S) tool to infer bacterial phylogenies. Phylogenetic hypotheses based on other sequences usually give conflicting topologies that reveal different evolutionary histories, which in some cases may be the result of horizontal gene transfer events. Currently, one of the major goals of molecular biology is to understand the role that horizontal gene transfer plays in species adaptation and evolution. In this work, we compared the phylogenetic tree based on 16S with the tree based on dszC, a gene involved in the cleavage of carbon-sulfur bonds. Bacteria of several genera perform this survival task when living in environments lacking free mineral sulfur. The biochemical pathway of the desulphurization process was extensively studied due to its economic importance, since this step is expensive and indispensable in fuel production. Our results clearly show that horizontal gene transfer events could be detected using common phylogenetic methods with gene sequences obtained from public sequence databases. PMID:22675653

  6. Phylogenetic signal dissection identifies the root of starfishes.

    Directory of Open Access Journals (Sweden)

    Roberto Feuda

    Full Text Available Relationships within the class Asteroidea have remained controversial for almost 100 years and, despite many attempts to resolve this problem using molecular data, no consensus has yet emerged. Using two nuclear genes and a taxon sampling covering the major asteroid clades we show that non-phylogenetic signal created by three factors--Long Branch Attraction, compositional heterogeneity and the use of poorly fitting models of evolution--have confounded accurate estimation of phylogenetic relationships. To overcome the effect of this non-phylogenetic signal we analyse the data using non-homogeneous models, site stripping and the creation of subpartitions aimed to reduce or amplify the systematic error, and calculate Bayes Factor support for a selection of previously suggested topological arrangements of asteroid orders. We show that most of the previous alternative hypotheses are not supported in the most reliable data partitions, including the previously suggested placement of either Forcipulatida or Paxillosida as sister group to the other major branches. The best-supported solution places Velatida as the sister group to other asteroids, and the implications of this finding for the morphological evolution of asteroids are presented.

  7. Phylogenetic affinity of tree shrews to Glires is attributed to fast evolution rate.

    Science.gov (United States)

    Lin, Jiannan; Chen, Guangfeng; Gu, Liang; Shen, Yuefeng; Zheng, Meizhu; Zheng, Weisheng; Hu, Xinjie; Zhang, Xiaobai; Qiu, Yu; Liu, Xiaoqing; Jiang, Cizhong

    2014-02-01

    Previous phylogenetic analyses have led to incongruent evolutionary relationships between tree shrews and other suborders of Euarchontoglires. What caused the incongruence remains elusive. In this study, we identified 6845 orthologous genes between seventeen placental mammals. Tree shrews and Primates were monophyletic in the phylogenetic trees derived from the first or/and second codon positions whereas tree shrews and Glires formed a monophyly in the trees derived from the third or all codon positions. The same topology was obtained in the phylogeny inference using the slowly and fast evolving genes, respectively. This incongruence was likely attributed to the fast substitution rate in tree shrews and Glires. Notably, sequence GC content only was not informative to resolve the controversial phylogenetic relationships between tree shrews, Glires, and Primates. Finally, estimation in the confidence of the tree selection strongly supported the phylogenetic affiliation of tree shrews to Primates as a monophyly. Copyright © 2013 Elsevier Inc. All rights reserved.

  8. Visualizing phylogenetic tree landscapes.

    Science.gov (United States)

    Wilgenbusch, James C; Huang, Wen; Gallivan, Kyle A

    2017-02-02

    Genomic-scale sequence alignments are increasingly used to infer phylogenies in order to better understand the processes and patterns of evolution. Different partitions within these new alignments (e.g., genes, codon positions, and structural features) often favor hundreds if not thousands of competing phylogenies. Summarizing and comparing phylogenies obtained from multi-source data sets using current consensus tree methods discards valuable information and can disguise potential methodological problems. Discovery of efficient and accurate dimensionality reduction methods used to display at once in 2- or 3- dimensions the relationship among these competing phylogenies will help practitioners diagnose the limits of current evolutionary models and potential problems with phylogenetic reconstruction methods when analyzing large multi-source data sets. We introduce several dimensionality reduction methods to visualize in 2- and 3-dimensions the relationship among competing phylogenies obtained from gene partitions found in three mid- to large-size mitochondrial genome alignments. We test the performance of these dimensionality reduction methods by applying several goodness-of-fit measures. The intrinsic dimensionality of each data set is also estimated to determine whether projections in 2- and 3-dimensions can be expected to reveal meaningful relationships among trees from different data partitions. Several new approaches to aid in the comparison of different phylogenetic landscapes are presented. Curvilinear Components Analysis (CCA) and a stochastic gradient decent (SGD) optimization method give the best representation of the original tree-to-tree distance matrix for each of the three- mitochondrial genome alignments and greatly outperformed the method currently used to visualize tree landscapes. The CCA + SGD method converged at least as fast as previously applied methods for visualizing tree landscapes. We demonstrate for all three mtDNA alignments that 3D

  9. Testing morphologically based phylogenetic theories within the cartilaginous fishes with molecular data, with special reference to the catshark family (Chondrichthyes; Scyliorhinidae) and the interrelationships within them.

    Science.gov (United States)

    Human, Brett A; Owen, E Patricia; Compagno, Leonard J V; Harley, Eric H

    2006-05-01

    A molecular phylogenetic investigation was conducted to examine phylogenetic relationships between various members of the catsharks (Chondrichthyes; Carcharhiniformes; Scyliorhinidae), and is the largest chondrichthyan data set yet analysed, consisting of nearly 130,000 nucleotides. Three mitochondrial DNA genes were used to construct the phylogenies, cytochrome b, NADH-2, and NADH-4, with 41 sequences from 18 taxa being novel. These sequences were either used separately or combined into a single data set, and phylogenies were constructed using various methods, however, only the Bayesian inference tree derived from the cytochrome b data set was resolved sufficiently for phylogenetic inferences to be made. Interestingly, the family Scyliorhinidae was not supported by the results and was found to be paraphyletic. The Scyliorhininae and Pentanchinae were supported, whereas the Pentanchini clade was present, but not well supported. The Halaelurini hypothesis was supported with Holohalaelurus identified as the basal genus of that clade, and Haploblepharus edwardsii identified as the basal taxon for that genus. Elsewhere within the Chondrichthyes, the Carcharhiniformes and the Lamniformes were found to be monophyletic, and the Heterodontiformes was placed within the Squalimorphs. The placement of the skates and rays in these analyses support the Batoidea as being sister to the Elasmobranchii.

  10. Bayesian phylogenetic estimation of fossil ages.

    Science.gov (United States)

    Drummond, Alexei J; Stadler, Tanja

    2016-07-19

    Recent advances have allowed for both morphological fossil evidence and molecular sequences to be integrated into a single combined inference of divergence dates under the rule of Bayesian probability. In particular, the fossilized birth-death tree prior and the Lewis-Mk model of discrete morphological evolution allow for the estimation of both divergence times and phylogenetic relationships between fossil and extant taxa. We exploit this statistical framework to investigate the internal consistency of these models by producing phylogenetic estimates of the age of each fossil in turn, within two rich and well-characterized datasets of fossil and extant species (penguins and canids). We find that the estimation accuracy of fossil ages is generally high with credible intervals seldom excluding the true age and median relative error in the two datasets of 5.7% and 13.2%, respectively. The median relative standard error (RSD) was 9.2% and 7.2%, respectively, suggesting good precision, although with some outliers. In fact, in the two datasets we analyse, the phylogenetic estimate of fossil age is on average less than 2 Myr from the mid-point age of the geological strata from which it was excavated. The high level of internal consistency found in our analyses suggests that the Bayesian statistical model employed is an adequate fit for both the geological and morphological data, and provides evidence from real data that the framework used can accurately model the evolution of discrete morphological traits coded from fossil and extant taxa. We anticipate that this approach will have diverse applications beyond divergence time dating, including dating fossils that are temporally unconstrained, testing of the 'morphological clock', and for uncovering potential model misspecification and/or data errors when controversial phylogenetic hypotheses are obtained based on combined divergence dating analyses.This article is part of the themed issue 'Dating species divergences using

  11. The complete mitochondrial genome and phylogenetic position of the Philippines spurdog, Squalus montalbani.

    Science.gov (United States)

    Kemper, Jenny M; Naylor, Gavin J P

    2016-11-01

    We present the complete mitochondrial genome sequence (16 555 bp) of the Philippines spurdog, Squalus montalbani, currently listed as Vulnerable due to population declines and fishing pressures. A phylogenetic analysis was carried out on S. montalbani and representative shark mitogenomes. Squalus montalbani was placed within the Squaliformes as a sister taxon to Squalus acanthias and Cirrhigaleus australis.

  12. Molecular basis for convergent evolution of glutamate recognition by pentameric ligand-gated ion channels

    DEFF Research Database (Denmark)

    Lynagh, Timothy; Beech, Robin N.; Lalande, Maryline J.

    2015-01-01

    that glutamate recognition requires an arginine residue in the base of the binding site, which originated at least three distinct times according to phylogenetic analysis. Most remarkably, the arginine emerged on the principal face of the binding site in the Lophotrochozoan lineage, but 65 amino acids upstream......Glutamate is an indispensable neurotransmitter, triggering postsynaptic signals upon recognition by postsynaptic receptors. We questioned the phylogenetic position and the molecular details of when and where glutamate recognition arose in the glutamate-gated chloride channels. Experiments revealed......, on the complementary face, in the Ecdysozoan lineage. This combined experimental and computational approach throws new light on the evolution of synaptic signalling....

  13. Phylogenetic stratigraphy in the Guerrero Negro hypersaline microbial mat.

    Science.gov (United States)

    Harris, J Kirk; Caporaso, J Gregory; Walker, Jeffrey J; Spear, John R; Gold, Nicholas J; Robertson, Charles E; Hugenholtz, Philip; Goodrich, Julia; McDonald, Daniel; Knights, Dan; Marshall, Paul; Tufo, Henry; Knight, Rob; Pace, Norman R

    2013-01-01

    The microbial mats of Guerrero Negro (GN), Baja California Sur, Mexico historically were considered a simple environment, dominated by cyanobacteria and sulfate-reducing bacteria. Culture-independent rRNA community profiling instead revealed these microbial mats as among the most phylogenetically diverse environments known. A preliminary molecular survey of the GN mat based on only ∼1500 small subunit rRNA gene sequences discovered several new phylum-level groups in the bacterial phylogenetic domain and many previously undetected lower-level taxa. We determined an additional ∼119,000 nearly full-length sequences and 28,000 >200 nucleotide 454 reads from a 10-layer depth profile of the GN mat. With this unprecedented coverage of long sequences from one environment, we confirm the mat is phylogenetically stratified, presumably corresponding to light and geochemical gradients throughout the depth of the mat. Previous shotgun metagenomic data from the same depth profile show the same stratified pattern and suggest that metagenome properties may be predictable from rRNA gene sequences. We verify previously identified novel lineages and identify new phylogenetic diversity at lower taxonomic levels, for example, thousands of operational taxonomic units at the family-genus levels differ considerably from known sequences. The new sequences populate parts of the bacterial phylogenetic tree that previously were poorly described, but indicate that any comprehensive survey of GN diversity has only begun. Finally, we show that taxonomic conclusions are generally congruent between Sanger and 454 sequencing technologies, with the taxonomic resolution achieved dependent on the abundance of reference sequences in the relevant region of the rRNA tree of life.

  14. The phylogenetic intrarelationships of spiny-rayed fishes (Acanthomorpha, Teleostei, Actinopterygii: fossil taxa increase the congruence of morphology with molecular data

    Directory of Open Access Journals (Sweden)

    Donald Davesne

    2016-11-01

    Full Text Available Acanthomorpha (spiny-rayed fishes is a clade of teleosts that includes more than 15 000 extant species. Their deep phylogenetic intrarelationships, first reconstructed using morphological characters, have been extensively revised with molecular data. Moreover, the deep branches of the acanthomorph tree are still largely unresolved, with strong disagreement between studies. Here, we review the historical propositions for acanthomorph deep intrarelationships and attempt to resolve their earliest branching patterns using a new morphological data matrix compiling and revising characters from previous studies. The taxon sampling we use constitutes a first attempt to test all previous hypotheses (molecular and morphological alike with morphological data only. Our sampling also includes Late Cretaceous fossil taxa, which yield new character state combinations that are absent in extant taxa. Analysis of the complete morphological data matrix yields a new topology that shows remarkable congruence with the well-supported molecular results. Lampridiformes (oarfishes and allies are the sister to all other acanthomorphs. Gadiformes (cods and allies and Zeiformes (dories form a clade with Percopsiformes (trout-perches and the enigmatic Polymixia (beardfish and Stylephorus (tube-eye. Ophidiiformes (cusk-eels and allies and Batrachoidiformes (toadfishes are nested within Percomorpha, the clade that includes most of modern acanthomorph diversity. These results provide morphological synapomorphies and independent corroboration of clades previously only recovered from molecular data, thereby suggesting the emergence of a congruent picture of acanthomorph deep intrarelationships. Fossil taxa play a critical role in achieving this congruence, since a very different topology is found when they are excluded from the analysis.

  15. Phylogenetic turnover during subtropical forest succession across environmental and phylogenetic scales

    OpenAIRE

    Purschke, Oliver; Michalski, Stefan G.; Bruelheide, Helge; Durka, Walter

    2017-01-01

    Abstract Although spatial and temporal patterns of phylogenetic community structure during succession are inherently interlinked and assembly processes vary with environmental and phylogenetic scales, successional studies of community assembly have yet to integrate spatial and temporal components of community structure, while accounting for scaling issues. To gain insight into the processes that generate biodiversity after disturbance, we combine analyses of spatial and temporal phylogenetic ...

  16. Phylogenetic mixtures and linear invariants for equal input models.

    Science.gov (United States)

    Casanellas, Marta; Steel, Mike

    2017-04-01

    The reconstruction of phylogenetic trees from molecular sequence data relies on modelling site substitutions by a Markov process, or a mixture of such processes. In general, allowing mixed processes can result in different tree topologies becoming indistinguishable from the data, even for infinitely long sequences. However, when the underlying Markov process supports linear phylogenetic invariants, then provided these are sufficiently informative, the identifiability of the tree topology can be restored. In this paper, we investigate a class of processes that support linear invariants once the stationary distribution is fixed, the 'equal input model'. This model generalizes the 'Felsenstein 1981' model (and thereby the Jukes-Cantor model) from four states to an arbitrary number of states (finite or infinite), and it can also be described by a 'random cluster' process. We describe the structure and dimension of the vector spaces of phylogenetic mixtures and of linear invariants for any fixed phylogenetic tree (and for all trees-the so called 'model invariants'), on any number n of leaves. We also provide a precise description of the space of mixtures and linear invariants for the special case of [Formula: see text] leaves. By combining techniques from discrete random processes and (multi-) linear algebra, our results build on a classic result that was first established by James Lake (Mol Biol Evol 4:167-191, 1987).

  17. Epstein-Barr virus-positive gastric cancer: a distinct molecular subtype of the disease?

    Science.gov (United States)

    Jácome, Alexandre Andrade Dos Anjos; Lima, Enaldo Melo de; Kazzi, Ana Izabela; Chaves, Gabriela Freitas; Mendonça, Diego Cavalheiro de; Maciel, Marina Mara; Santos, José Sebastião Dos

    2016-04-01

    Approximately 90% of the world population is infected by Epstein-Barr virus (EBV). Usually, it infects B lymphocytes, predisposing them to malignant transformation. Infection of epithelial cells occurs rarely, and it is estimated that about to 10% of gastric cancer patients harbor EBV in their malignant cells. Given that gastric cancer is the third leading cause of cancer-related mortality worldwide, with a global annual incidence of over 950,000 cases, EBV-positive gastric cancer is the largest group of EBV-associated malignancies. Based on gene expression profile studies, gastric cancer was recently categorized into four subtypes; EBV-positive, microsatellite unstable, genomically stable and chromosomal instability. Together with previous studies, this report provided a more detailed molecular characterization of gastric cancer, demonstrating that EBV-positive gastric cancer is a distinct molecular subtype of the disease, with unique genetic and epigenetic abnormalities, reflected in a specific phenotype. The recognition of characteristic molecular alterations in gastric cancer allows the identification of molecular pathways involved in cell proliferation and survival, with the potential to identify therapeutic targets. These findings highlight the enormous heterogeneity of gastric cancer, and the complex interplay between genetic and epigenetic alterations in the disease, and provide a roadmap to implementation of genome-guided personalized therapy in gastric cancer. The present review discusses the initial studies describing EBV-positive gastric cancer as a distinct clinical entity, presents recently described genetic and epigenetic alterations, and considers potential therapeutic insights derived from the recognition of this new molecular subtype of gastric adenocarcinoma.

  18. Molecular phylogenetics of the genus Costularia (Schoeneae, Cyperaceae) reveals multiple distinct evolutionary lineages.

    Science.gov (United States)

    Larridon, Isabel; Bauters, Kenneth; Semmouri, Ilias; Viljoen, Jan-Adriaan; Prychid, Christina J; Muasya, A Muthama; Bruhl, Jeremy J; Wilson, Karen L; Senterre, Bruno; Goetghebeur, Paul

    2018-04-19

    We investigated the monophyly of Costularia (25 species), a genus of tribe Schoeneae (Cyperaceae) that illustrates a remarkable distribution pattern from southeastern Africa, over Madagascar, the Mascarenes and Seychelles, to Malesia and New Caledonia. A further species, Tetraria borneensis, has been suggested to belong to Costularia. Relationships and divergence times were inferred using an existing four marker phylogeny of Cyperaceae tribe Schoeneae expanded with newly generated sequence data mainly for Costularia s.l. species. Phylogenetic reconstruction was executed using Bayesian inference and maximum likelihood approaches. Divergence times were estimated using a relaxed molecular clock model, calibrated with fossil data. Based on our results, Tetraria borneensis is not related to the species of Costularia. Costularia s.l. is composed of four distinct evolutionary lineages. Two lineages, one including the type species, are part of the Oreobolus clade, i.e. a much reduced genus Costularia restricted to southeastern Africa, Madagascar, the Mascarenes and Seychelles, and a small endemic genus from New Caledonia for which a new genus Chamaedendron is erected based on Costularia subgenus Chamaedendron. The other two lineages are part of the Tricostularia clade, i.e. a separate single-species lineage from the Seychelles for which a new genus (Xyroschoenus) is described, and Costularia subgenus Lophoschoenus. For the latter, more research is needed to test whether they are congeneric with the species placed in the reticulate-sheathed Tetraria clade. Copyright © 2018 Elsevier Inc. All rights reserved.

  19. Taxonomic revision and phylogenetic analyses of rubber powdery mildew fungi.

    Science.gov (United States)

    Liyanage, K K; Khan, Sehroon; Brooks, Siraprapa; Mortimer, Peter E; Karunarathna, Samantha C; Xu, Jianchu; Hyde, Kevin D

    2017-04-01

    Powdery mildew is a fungal disease that infects a wide range of plants, including rubber trees, which results in a reduction of latex yields of up to 45%. The causal agent of powdery mildew of rubber was first described as Oidium heveae, but later morpho-molecular research suggested that in the past, O. heveae has been confused with Erysiphe quercicola. However, it is still under debate whether the causal agent should be classified as a species of the genus Erysiphe emend. or Golovinomyces and Podosphaera, respectively. Therefore, the aim of this study was to undertake the morpho-molecular characterization of powdery mildew species associated with rubber trees, thus resolving these taxonomic issues. Morphological observation under light and scanning electron microscopes (SEM) clearly identified two morphotypes of the rubber powdery mildew. With the support of morphological and phylogenetic data, one of the two morphotypes was identified as the asexual morph of E. quercicola, while the second morphotype is still insufficiently known and according to the morphological results obtained we assume that it might belong to the genus Golovinomyces. More collections and additional molecular data are required for final conclusions regarding the exact taxonomic position of the second morphotype of rubber powdery mildew and its relation to the name O. heveae. The haplotype analysis identified eight haplotype groups of E. quercicola indicating the high genetic diversity of the species. Copyright © 2017 Elsevier Ltd. All rights reserved.

  20. Multigene molecular phylogenetics reveals true morels (Morchella) are especially species-rich in China

    Science.gov (United States)

    The phylogenetic diversity of true morels (Morchella) in China was estimated by initially analyzing nuclear ribosomal internal transcribed spacer (ITS) rDNA sequences from 361 specimens collected in 21 provinces during the 2003-2011 growing seasons, together with six collections obtained on loan fro...

  1. Morphological support for the phylogenetic positioning of Pentastomida and related fossils

    Directory of Open Access Journals (Sweden)

    Elaine Christine Costa Eloy

    2008-09-01

    Full Text Available Pentastomida is a group of parasites that infects the respiratory tracts of vertebrates. They have a mixture of annelid and arthropod characteristics. For that reason, the phylogenetic relationships of the pentastomids have been controversial in proposals of metazoan phylogeny. Forty-seven characters were selected for the analyses of the taxa Annelida, Arthropoda, Kinorhyncha, Loricifera, Nematoda, Nematomorpha, Onychophora, Pentastomida, Priapulida and Tardigrada. The analyses with PAUP resulted in a single shortest cladogram (length 89, ci 0.78, ri 0.86. Our results indicate that Pentastomida is a transitional group between the Arthropoda and some of the Nemathelminth groups such as Nematoda and Nematomorpha.

  2. Molecular Characterization and Phylogenetic Analysis of Listeria monocytogenes Isolated from Milk and Milk Products in Kaduna, Nigeria

    Directory of Open Access Journals (Sweden)

    U. B. Usman

    2016-01-01

    Full Text Available In this study, Listeria (L. monocytogenes isolated from milk and milk products in Kaduna, Nigeria, were subjected to a multiplex PCR assay to identify virulence-associated genes (such as prf A, inl A, hly A, act A, and iap. Of the 36 isolates, 9 (25% were positive for one or two virulence-associated genes. Based on the sample type, 6 (16.9% of the isolates that possessed virulence-associated genes were obtained from raw milk, 2 (3.2% from “Manshanu,” and 1 (2.8% from “Kindrimo.” Sequence and phylogenetic analysis based on the 16S rRNA revealed that Nigerian L. monocytogenes isolates (NGA 34A, NGA 35A, NGA 41A, and NGA 38A, when compared with reference L. monocytogenes, were grouped into two distinct clusters, A and B, with sequence (NGA 34A, NGA 35A, and NGA 41A phylogenetically closer to J1776; N1-011A; R2-502; J1816; and J2-031, whereas L. monocytogenes isolate (NGA 38A clustered with EDG; J1-220; J1926; J1817; and J2-1091. The separation of the Nigerian L. monocytogenes isolates into linage A (responsible for epidemic listeriosis and lineage B (responsible for sporadic cases of listeriosis is of public health concern and that local isolates might have potentials for human food borne listeriosis based on the virulence factors so far identified.

  3. Phylogenetic inference in Rafflesiales: the influence of rate heterogeneity and horizontal gene transfer

    Directory of Open Access Journals (Sweden)

    Vidal-Russell Romina

    2004-10-01

    Full Text Available Abstract Background The phylogenetic relationships among the holoparasites of Rafflesiales have remained enigmatic for over a century. Recent molecular phylogenetic studies using the mitochondrial matR gene placed Rafflesia, Rhizanthes and Sapria (Rafflesiaceae s. str. in the angiosperm order Malpighiales and Mitrastema (Mitrastemonaceae in Ericales. These phylogenetic studies did not, however, sample two additional groups traditionally classified within Rafflesiales (Apodantheaceae and Cytinaceae. Here we provide molecular phylogenetic evidence using DNA sequence data from mitochondrial and nuclear genes for representatives of all genera in Rafflesiales. Results Our analyses indicate that the phylogenetic affinities of the large-flowered clade and Mitrastema, ascertained using mitochondrial matR, are congruent with results from nuclear SSU rDNA when these data are analyzed using maximum likelihood and Bayesian methods. The relationship of Cytinaceae to Malvales was recovered in all analyses. Relationships between Apodanthaceae and photosynthetic angiosperms varied depending upon the data partition: Malvales (3-gene, Cucurbitales (matR or Fabales (atp1. The latter incongruencies suggest that horizontal gene transfer (HGT may be affecting the mitochondrial gene topologies. The lack of association between Mitrastema and Ericales using atp1 is suggestive of HGT, but greater sampling within eudicots is needed to test this hypothesis further. Conclusions Rafflesiales are not monophyletic but composed of three or four independent lineages (families: Rafflesiaceae, Mitrastemonaceae, Apodanthaceae and Cytinaceae. Long-branch attraction appears to be misleading parsimony analyses of nuclear small-subunit rDNA data, but model-based methods (maximum likelihood and Bayesian analyses recover a topology that is congruent with the mitochondrial matR gene tree, thus providing compelling evidence for organismal relationships. Horizontal gene transfer appears to

  4. Phylogenetic inference with weighted codon evolutionary distances.

    Science.gov (United States)

    Criscuolo, Alexis; Michel, Christian J

    2009-04-01

    We develop a new approach to estimate a matrix of pairwise evolutionary distances from a codon-based alignment based on a codon evolutionary model. The method first computes a standard distance matrix for each of the three codon positions. Then these three distance matrices are weighted according to an estimate of the global evolutionary rate of each codon position and averaged into a unique distance matrix. Using a large set of both real and simulated codon-based alignments of nucleotide sequences, we show that this approach leads to distance matrices that have a significantly better treelikeness compared to those obtained by standard nucleotide evolutionary distances. We also propose an alternative weighting to eliminate the part of the noise often associated with some codon positions, particularly the third position, which is known to induce a fast evolutionary rate. Simulation results show that fast distance-based tree reconstruction algorithms on distance matrices based on this codon position weighting can lead to phylogenetic trees that are at least as accurate as, if not better, than those inferred by maximum likelihood. Finally, a well-known multigene dataset composed of eight yeast species and 106 codon-based alignments is reanalyzed and shows that our codon evolutionary distances allow building a phylogenetic tree which is similar to those obtained by non-distance-based methods (e.g., maximum parsimony and maximum likelihood) and also significantly improved compared to standard nucleotide evolutionary distance estimates.

  5. Larval morphology and phylogenetic position of Drusus balcanicus, Drusus botosaneanui, Drusus serbicus and Drusus tenellus (Trichoptera: Limnephilidae: Drusinae)

    Science.gov (United States)

    WARINGER, JOHANN; GRAF, WOLFRAM; BÁLINT, MIKLÓS; KUČINIĆ, MLADEN; PAULS, STEFFEN U.; PREVIŠIĆ, ANA; KERESZTES, LUJZA; IBRAHIMI, HALIL; ŽIVIĆ, IVANA; BJELANOVIĆ, KATARINA; KRPAČ, VLADIMIR; VITECEK, SIMON

    2016-01-01

    In a recent 3–gene phylogeny of the Trichoptera subfamily Drusinae Banks, 1916 molecular data clearly correlated with the morphology and feeding ecology of larvae. The largest of three main groups, the Drusinae grazer clade, exhibits an unusual larval feeding ecology for Limnephilidae, and is the most diverse group. In this paper we describe four previously unknown Drusinae larvae from this clade: Drusus balcanicus Kumanski, 1973 (micro–endemic to Eastern Balkans); Drusus botosaneanui Kumanski, 1968 (Dinaric Western Balkans, Hellenic and Eastern Balkan, Asia Minor), Drusus serbicus Marinković-Gospodnetić, 1971a (micro–endemic to Dinaric Western Balkans); and Drusus tenellus (Klapálek, 1898) (Carpathians, Dinaric Eastern Balkans). Characteristically, the larvae of these species develop toothless mandibles typical for the Drusinae grazer clade. Larvae and adults were unambiguously associated by a phylogenetic approach based on two mitochondrial (mtCOI, mtLSU= 16S rDNA) and two nuclear genes (nuWG, nuCAD). In addition, information on the morphology of the larvae is given and the diagnostic features necessary for identification are illustrated. PMID:26997882

  6. Dynamically heterogenous partitions and phylogenetic inference: an evaluation of analytical strategies with cytochrome b and ND6 gene sequences in cranes.

    Science.gov (United States)

    Krajewski, C; Fain, M G; Buckley, L; King, D G

    1999-11-01

    ki ctes over whether molecular sequence data should be partitioned for phylogenetic analysis often confound two types of heterogeneity among partitions. We distinguish historical heterogeneity (i.e., different partitions have different evolutionary relationships) from dynamic heterogeneity (i.e., different partitions show different patterns of sequence evolution) and explore the impact of the latter on phylogenetic accuracy and precision with a two-gene, mitochondrial data set for cranes. The well-established phylogeny of cranes allows us to contrast tree-based estimates of relevant parameter values with estimates based on pairwise comparisons and to ascertain the effects of incorporating different amounts of process information into phylogenetic estimates. We show that codon positions in the cytochrome b and NADH dehydrogenase subunit 6 genes are dynamically heterogenous under both Poisson and invariable-sites + gamma-rates versions of the F84 model and that heterogeneity includes variation in base composition and transition bias as well as substitution rate. Estimates of transition-bias and relative-rate parameters from pairwise sequence comparisons were comparable to those obtained as tree-based maximum likelihood estimates. Neither rate-category nor mixed-model partitioning strategies resulted in a loss of phylogenetic precision relative to unpartitioned analyses. We suggest that weighted-average distances provide a computationally feasible alternative to direct maximum likelihood estimates of phylogeny for mixed-model analyses of large, dynamically heterogenous data sets. Copyright 1999 Academic Press.

  7. Revisiting the Zingiberales: using multiplexed exon capture to resolve ancient and recent phylogenetic splits in a charismatic plant lineage

    Directory of Open Access Journals (Sweden)

    Chodon Sass

    2016-01-01

    Full Text Available The Zingiberales are an iconic order of monocotyledonous plants comprising eight families with distinctive and diverse floral morphologies and representing an important ecological element of tropical and subtropical forests. While the eight families are demonstrated to be monophyletic, phylogenetic relationships among these families remain unresolved. Neither combined morphological and molecular studies nor recent attempts to resolve family relationships using sequence data from whole plastomes has resulted in a well-supported, family-level phylogenetic hypothesis of relationships. Here we approach this challenge by leveraging the complete genome of one member of the order, Musa acuminata, together with transcriptome information from each of the other seven families to design a set of nuclear loci that can be enriched from highly divergent taxa with a single array-based capture of indexed genomic DNA. A total of 494 exons from 418 nuclear genes were captured for 53 ingroup taxa. The entire plastid genome was also captured for the same 53 taxa. Of the total genes captured, 308 nuclear and 68 plastid genes were used for phylogenetic estimation. The concatenated plastid and nuclear dataset supports the position of Musaceae as sister to the remaining seven families. Moreover, the combined dataset recovers known intra- and inter-family phylogenetic relationships with generally high bootstrap support. This is a flexible and cost effective method that gives the broader plant biology community a tool for generating phylogenomic scale sequence data in non-model systems at varying evolutionary depths.

  8. Molecular characterization of dengue viruses isolated from patients in Central Java, Indonesia.

    Science.gov (United States)

    Kusmintarsih, Endang S; Hayati, Rahma F; Turnip, Oktaviani N; Yohan, Benediktus; Suryaningsih, Suhestri; Pratiknyo, Hery; Denis, Dionisius; Sasmono, R Tedjo

    2017-10-19

    Dengue is hyper-endemic in Indonesia. Purwokerto city in Central Java province is routinely ravaged by the disease. Despite the endemicity of dengue in this city, there is still no data on the virological aspects of dengue in the city. We conducted a molecular surveillance study of the circulating dengue viruses (DENV) in Purwokerto city to gain information on the virus origin, serotype and genotype distribution, and phylogenetic characteristics of DENV. A cross-sectional dengue molecular surveillance study was conducted in Purwokerto. Sera were collected from dengue-suspected patients attending three hospitals in the city. Diagnosis was performed using dengue NS1 antigen and IgG/IgM antibodies detection. DENV serotyping was performed using Simplexa Dengue real-time RT-PCR. Sequencing was conducted to obtain full-length DENV Envelope (E) gene sequences, which were then used in phylogenetic and genotypic analyses. Patients' clinical and demographic data were collected and analyzed. A total of 105 dengue-suspected patients' sera were collected, in which 80 (76.2%) were positive for IgM and/or IgG, and 57 (54.2%) were confirmed as dengue by NS1 antigen and/or DENV RNA detection using RT-PCR. Serotyping was successful for 47 isolates. All four serotypes circulated in the area with DENV-3 as the predominant serotype. Phylogenetic analyses grouped the isolates into Genotype I for DENV-1, Cosmopolitan genotype for DENV-2, and Genotype I and II for DENV-3 and -4, respectively. The analyses also revealed the close relatedness of Purwokerto isolates to other DENV strains from Indonesia and neighboring countries. We reveal the molecular and virological characteristics of DENV in Purwokerto, Banyumas regency, Central Java. The genotype and phylogenetic analyses indicate the endemicity of the circulating DENV in the city. Our serotype and genotype data provide references for future dengue molecular epidemiology studies and disease management in the region. Copyright © 2017 The

  9. Aquatic insect ecophysiological traits reveal phylogenetically based differences in dissolved cadmium susceptibility.

    Science.gov (United States)

    Buchwalter, David B; Cain, Daniel J; Martin, Caitrin A; Xie, Lingtian; Luoma, Samuel N; Garland, Theodore

    2008-06-17

    We used a phylogenetically based comparative approach to evaluate the potential for physiological studies to reveal patterns of diversity in traits related to susceptibility to an environmental stressor, the trace metal cadmium (Cd). Physiological traits related to Cd bioaccumulation, compartmentalization, and ultimately susceptibility were measured in 21 aquatic insect species representing the orders Ephemeroptera, Plecoptera, and Trichoptera. We mapped these experimentally derived physiological traits onto a phylogeny and quantified the tendency for related species to be similar (phylogenetic signal). All traits related to Cd bioaccumulation and susceptibility exhibited statistically significant phylogenetic signal, although the signal strength varied among traits. Conventional and phylogenetically based regression models were compared, revealing great variability within orders but consistent, strong differences among insect families. Uptake and elimination rate constants were positively correlated among species, but only when effects of body size and phylogeny were incorporated in the analysis. Together, uptake and elimination rates predicted dramatic Cd bioaccumulation differences among species that agreed with field-based measurements. We discovered a potential tradeoff between the ability to eliminate Cd and the ability to detoxify it across species, particularly mayflies. The best-fit regression models were driven by phylogenetic parameters (especially differences among families) rather than functional traits, suggesting that it may eventually be possible to predict a taxon's physiological performance based on its phylogenetic position, provided adequate physiological information is available for close relatives. There appears to be great potential for evolutionary physiological approaches to augment our understanding of insect responses to environmental stressors in nature.

  10. Molecular phylogenetics, diversification, and systematics of Tibicen Latreille 1825 and allied cicadas of the tribe Cryptotympanini, with three new genera and emphasis on species from the USA and Canada(Hemiptera: Auchenorrhyncha: Cicadidae).

    Science.gov (United States)

    Hill, Kathy B R; Marshall, David C; Moulds, Maxwell S; Simon, Chris

    2015-07-10

    North America has a diverse cicada fauna with multiple genera from all three Cicadidae subfamilies, yet molecular phylogenetic analyses have been completed only for the well-studied periodical cicadas (Magicicada Davis). The genus Tibicen Latreille, a large group of charismatic species, is in need of such work because morphological patterns suggest multiple groups with complicated relationships to other genera in the tribe Cryptotympanini. In this paper we present a molecular phylogenetic analysis, based on mitochondrial and nuclear DNA, of 35 of the 38 extant USA species and subspecies of the genus Tibicen together with their North American tribal allies (Cornuplura Davis, Cacama Davis), selected Tibicen species from Eurasia, and representatives of other Eurasian and Pacific cryptotympanine genera. This tree shows that Tibicen contains several well-supported clades, one predominating in eastern and central North America and related to Cryptotympana Stål and Raiateana Boulard, another in western North America related to Cacama and Cornuplura, and at least two clades in Eurasia. We also present a morphological cladistic analysis of Tibicen and its close allies based on 27 characters. Character states identified in the cladistic analysis define three new genera, two for North American taxa (Hadoa gen. n. and Neotibicen gen. n.) including several Mexican species, and one for Asian species (Subsolanus gen. n.). Using relaxed molecular clocks and literature-derived mtDNA rate estimates, we estimate the timeframe of diversification of Tibicen clades and find that intergeneric divergence has occurred since the late Eocene, with most extant species within the former Tibicen originating after the mid-Miocene. We review patterns of ecology, behavior, and geography among Tibicen clades in light of the phylogenetic results and note that the study of these insects is still in its early stages. Some Mexican species formerly placed in Tibicen are here transferred to Diceroprocta

  11. Phylogenetic studies of transmission dynamics in generalized HIV epidemics: An essential tool where the burden is greatest?

    Science.gov (United States)

    Dennis, Ann M.; Herbeck, Joshua T.; Brown, Andrew Leigh; Kellam, Paul; de Oliveira, Tulio; Pillay, Deenan; Fraser, Christophe; Cohen, Myron S.

    2014-01-01

    Efficient and effective HIV prevention measures for generalized epidemics in sub-Saharan Africa have not yet been validated at the population-level. Design and impact evaluation of such measures requires fine-scale understanding of local HIV transmission dynamics. The novel tools of HIV phylogenetics and molecular epidemiology may elucidate these transmission dynamics. Such methods have been incorporated into studies of concentrated HIV epidemics to identify proximate and determinant traits associated with ongoing transmission. However, applying similar phylogenetic analyses to generalized epidemics, including the design and evaluation of prevention trials, presents additional challenges. Here we review the scope of these methods and present examples of their use in concentrated epidemics in the context of prevention. Next, we describe the current uses for phylogenetics in generalized epidemics, and discuss their promise for elucidating transmission patterns and informing prevention trials. Finally, we review logistic and technical challenges inherent to large-scale molecular epidemiological studies of generalized epidemics, and suggest potential solutions. PMID:24977473

  12. Phylogenetically diverse macrophyte community promotes species diversity of mobile epi-benthic invertebrates

    Science.gov (United States)

    Nakamoto, Kenta; Hayakawa, Jun; Kawamura, Tomohiko; Kodama, Masafumi; Yamada, Hideaki; Kitagawa, Takashi; Watanabe, Yoshiro

    2018-07-01

    Various aspects of plant diversity such as species diversity and phylogenetic diversity enhance the species diversity of associated animals in terrestrial systems. In marine systems, however, the effects of macrophyte diversity on the species diversity of associated animals have received little attention. Here, we sampled in a subtropical seagrass-seaweed mixed bed to elucidate the effect of the macrophyte phylogenetic diversity based on the taxonomic relatedness as well as the macrophyte species diversity on species diversity of mobile epi-benthic invertebrates. Using regression analyses for each macrophyte parameter as well as multiple regression analyses, we found that the macrophyte phylogenetic diversity (taxonomic diversity index: Delta) positively influenced the invertebrate species richness and diversity index (H‧). Although the macrophyte species richness and H‧ also positively influenced the invertebrate species richness, the best fit model for invertebrate species richness did not include them, suggesting that the macrophyte species diversity indirectly influenced invertebrate species diversity. Possible explanations of the effects of macrophyte Delta on the invertebrate species diversity were the niche complementarity effect and the selection effect. This is the first study which demonstrates that macrophyte phylogenetic diversity has a strong effect on the species diversity of mobile epi-benthic invertebrates.

  13. TreeCluster: Massively scalable transmission clustering using phylogenetic trees

    OpenAIRE

    Moshiri, Alexander

    2018-01-01

    Background: The ability to infer transmission clusters from molecular data is critical to designing and evaluating viral control strategies. Viral sequencing datasets are growing rapidly, but standard methods of transmission cluster inference do not scale well beyond thousands of sequences. Results: I present TreeCluster, a cross-platform tool that performs transmission cluster inference on a given phylogenetic tree orders of magnitude faster than existing inference methods and supports multi...

  14. Cophenetic metrics for phylogenetic trees, after Sokal and Rohlf.

    Science.gov (United States)

    Cardona, Gabriel; Mir, Arnau; Rosselló, Francesc; Rotger, Lucía; Sánchez, David

    2013-01-16

    Phylogenetic tree comparison metrics are an important tool in the study of evolution, and hence the definition of such metrics is an interesting problem in phylogenetics. In a paper in Taxon fifty years ago, Sokal and Rohlf proposed to measure quantitatively the difference between a pair of phylogenetic trees by first encoding them by means of their half-matrices of cophenetic values, and then comparing these matrices. This idea has been used several times since then to define dissimilarity measures between phylogenetic trees but, to our knowledge, no proper metric on weighted phylogenetic trees with nested taxa based on this idea has been formally defined and studied yet. Actually, the cophenetic values of pairs of different taxa alone are not enough to single out phylogenetic trees with weighted arcs or nested taxa. For every (rooted) phylogenetic tree T, let its cophenetic vectorφ(T) consist of all pairs of cophenetic values between pairs of taxa in T and all depths of taxa in T. It turns out that these cophenetic vectors single out weighted phylogenetic trees with nested taxa. We then define a family of cophenetic metrics dφ,p by comparing these cophenetic vectors by means of Lp norms, and we study, either analytically or numerically, some of their basic properties: neighbors, diameter, distribution, and their rank correlation with each other and with other metrics. The cophenetic metrics can be safely used on weighted phylogenetic trees with nested taxa and no restriction on degrees, and they can be computed in O(n2) time, where n stands for the number of taxa. The metrics dφ,1 and dφ,2 have positive skewed distributions, and they show a low rank correlation with the Robinson-Foulds metric and the nodal metrics, and a very high correlation with each other and with the splitted nodal metrics. The diameter of dφ,p, for p⩾1 , is in O(n(p+2)/p), and thus for low p they are more discriminative, having a wider range of values.

  15. A phylogenetic blueprint for a modern whale.

    Science.gov (United States)

    Gatesy, John; Geisler, Jonathan H; Chang, Joseph; Buell, Carl; Berta, Annalisa; Meredith, Robert W; Springer, Mark S; McGowen, Michael R

    2013-02-01

    The emergence of Cetacea in the Paleogene represents one of the most profound macroevolutionary transitions within Mammalia. The move from a terrestrial habitat to a committed aquatic lifestyle engendered wholesale changes in anatomy, physiology, and behavior. The results of this remarkable transformation are extant whales that include the largest, biggest brained, fastest swimming, loudest, deepest diving mammals, some of which can detect prey with a sophisticated echolocation system (Odontoceti - toothed whales), and others that batch feed using racks of baleen (Mysticeti - baleen whales). A broad-scale reconstruction of the evolutionary remodeling that culminated in extant cetaceans has not yet been based on integration of genomic and paleontological information. Here, we first place Cetacea relative to extant mammalian diversity, and assess the distribution of support among molecular datasets for relationships within Artiodactyla (even-toed ungulates, including Cetacea). We then merge trees derived from three large concatenations of molecular and fossil data to yield a composite hypothesis that encompasses many critical events in the evolutionary history of Cetacea. By combining diverse evidence, we infer a phylogenetic blueprint that outlines the stepwise evolutionary development of modern whales. This hypothesis represents a starting point for more detailed, comprehensive phylogenetic reconstructions in the future, and also highlights the synergistic interaction between modern (genomic) and traditional (morphological+paleontological) approaches that ultimately must be exploited to provide a rich understanding of evolutionary history across the entire tree of Life. Copyright © 2012 Elsevier Inc. All rights reserved.

  16. Molecular analysis reveals the diversity of Hepatozoon species naturally infecting domestic dogs in a northern region of Brazil.

    Science.gov (United States)

    Gomes, Laise de Azevedo; Moraes, Pablo Henrique Gonçalves; do Nascimento, Luciana de Cássia Silva; O'Dwyer, Lucia Helena; Nunes, Márcio Roberto Teixeira; Rossi, Adriana Dos Reis Ponce; Aguiar, Délia Cristina Figueira; Gonçalves, Evonnildo Costa

    2016-10-01

    This study aimed to optimize molecular methods for detecting DNA of Hepatozoon spp. as well as identify the phylogenetic relationships of Hepatozoon strains naturally infecting domestic dogs in Belém, Pará, northern Brazil. Blood samples were collected from 138 dogs, and screened for Hepatozoon spp. using a new nested PCR assay. Positive samples were subjected to genetic characterization based on amplification and sequencing of approximately 670bp of the Hepatozoon spp. 18S rRNA. Of the positive dogs, four shared the haplotype Belém 01, one dog presented the haplotype Belém 02 and two dogs shared the haplotype Belém 03. A Bayesian inference indicates that haplotypes Belém 01 and Belém 02 are phylogenetically related to H. canis, while Belém 03 is related to H. americanum. Overall, based on the first molecular evidence of H. americanum in Brazilian domestic dogs, the proposed protocol may improve the epidemiological investigation of canine hepatozoonosis. Copyright © 2016 Elsevier GmbH. All rights reserved.

  17. Molecular phylogenetic analysis supports a Gondwanan origin of the Hyriidae (Mollusca: Bivalvia: Unionida) and the paraphyly of Australasian taxa.

    Science.gov (United States)

    Graf, Daniel L; Jones, Hugh; Geneva, Anthony J; Pfeiffer, John M; Klunzinger, Michael W

    2015-04-01

    The freshwater mussel family Hyriidae (Mollusca: Bivalvia: Unionida) has a disjunct trans-Pacific distribution in Australasia and South America. Previous phylogenetic analyses have estimated the evolutionary relationships of the family and the major infra-familial taxa (Velesunioninae and Hyriinae: Hyridellini in Australia; Hyriinae: Hyriini, Castaliini, and Rhipidodontini in South America), but taxon and character sampling have been too incomplete to support a predictive classification or allow testing of biogeographical hypotheses. We sampled 30 freshwater mussel individuals representing the aforementioned hyriid taxa, as well as outgroup species representing the five other freshwater mussel families and their marine sister group (order Trigoniida). Our ingroup included representatives of all Australian genera. Phylogenetic relationships were estimated from three gene fragments (nuclear 28S, COI and 16S mtDNA) using maximum parsimony, maximum likelihood, and Bayesian inference, and we applied a Bayesian relaxed clock model calibrated with fossil dates to estimate node ages. Our analyses found good support for monophyly of the Hyriidae and the subfamilies and tribes, as well as the paraphyly of the Australasian taxa (Velesunioninae, (Hyridellini, (Rhipidodontini, (Castaliini, Hyriini)))). The Hyriidae was recovered as sister to a clade comprised of all other Recent freshwater mussel families. Our molecular date estimation supported Cretaceous origins of the major hyriid clades, pre-dating the Tertiary isolation of South America from Antarctica/Australia. We hypothesize that early diversification of the Hyriidae was driven by terrestrial barriers on Gondwana rather than marine barriers following disintegration of the super-continent. Copyright © 2015 Elsevier Inc. All rights reserved.

  18. Some limitations of public sequence data for phylogenetic inference (in plants).

    Science.gov (United States)

    Hinchliff, Cody E; Smith, Stephen Andrew

    2014-01-01

    The GenBank database contains essentially all of the nucleotide sequence data generated for published molecular systematic studies, but for the majority of taxa these data remain sparse. GenBank has value for phylogenetic methods that leverage data-mining and rapidly improving computational methods, but the limits imposed by the sparse structure of the data are not well understood. Here we present a tree representing 13,093 land plant genera--an estimated 80% of extant plant diversity--to illustrate the potential of public sequence data for broad phylogenetic inference in plants, and we explore the limits to inference imposed by the structure of these data using theoretical foundations from phylogenetic data decisiveness. We find that despite very high levels of missing data (over 96%), the present data retain the potential to inform over 86.3% of all possible phylogenetic relationships. Most of these relationships, however, are informed by small amounts of data--approximately half are informed by fewer than four loci, and more than 99% are informed by fewer than fifteen. We also apply an information theoretic measure of branch support to assess the strength of phylogenetic signal in the data, revealing many poorly supported branches concentrated near the tips of the tree, where data are sparse and the limiting effects of this sparseness are stronger. We argue that limits to phylogenetic inference and signal imposed by low data coverage may pose significant challenges for comprehensive phylogenetic inference at the species level. Computational requirements provide additional limits for large reconstructions, but these may be overcome by methodological advances, whereas insufficient data coverage can only be remedied by additional sampling effort. We conclude that public databases have exceptional value for modern systematics and evolutionary biology, and that a continued emphasis on expanding taxonomic and genomic coverage will play a critical role in developing

  19. Genetic characterization and phylogenetic position of Echinococcus felidis (Cestoda: Taeniidae) from the African lion.

    Science.gov (United States)

    Hüttner, Marion; Nakao, Minoru; Wassermann, Torsten; Siefert, Ludwig; Boomker, Joop D F; Dinkel, Anke; Sako, Yasuhito; Mackenstedt, Ute; Romig, Thomas; Ito, Akira

    2008-06-01

    Echinococcus felidis had been described in 1937 from African lions, but was later included in Echinococcus granulosus as a subspecies or a strain. In the absence of any genetic characterization, most previous records of this taxon from a variety of large African mammals remained unconfirmed due to the lack of diagnostic criteria and the possible confusion with the sympatric E. granulosus sensu stricto, Echinococcus ortleppi and Echinococcus canadensis. In this study, we obtained taeniid eggs from lion feces in Uganda and amplified DNA from individual eggs. Mitochondrial and nuclear DNA sequences showed similarities with those of other Echinococcus spp., but high values of percentage divergence of mitochondrial genes indicated the presence of a distinct species. In a second step, we compared this material with the preserved specimens of adult E. granulosus felidis, which had been identified morphologically approximately 40 years ago in South Africa. All DNA fragments (<200 bp) that could be amplified from the adults showed 100% similarity with the Ugandan material. In the phylogenetic tree of Echinococcus which was constructed from the mitochondrial genes, E. felidis is positioned as a sister taxon of E. granulosus sensu stricto. The data obtained will facilitate the development of diagnostic tools necessary to study the epidemiology of this enigmatic parasite.

  20. Untangling hybrid phylogenetic signals: horizontal gene transfer and artifacts of phylogenetic reconstruction.

    Science.gov (United States)

    Beiko, Robert G; Ragan, Mark A

    2009-01-01

    Phylogenomic methods can be used to investigate the tangled evolutionary relationships among genomes. Building 'all the trees of all the genes' can potentially identify common pathways of horizontal gene transfer (HGT) among taxa at varying levels of phylogenetic depth. Phylogenetic affinities can be aggregated and merged with the information about genetic linkage and biochemical function to examine hypotheses of adaptive evolution via HGT. Additionally, the use of many genetic data sets increases the power of statistical tests for phylogenetic artifacts. However, large-scale phylogenetic analyses pose several challenges, including the necessary abandonment of manual validation techniques, the need to translate inferred phylogenetic discordance into inferred HGT events, and the challenges involved in aggregating results from search-based inference methods. In this chapter we describe a tree search procedure to recover the most parsimonious pathways of HGT, and examine some of the assumptions that are made by this method.

  1. Phylogenetic analyses of Vitis (Vitaceae) based on complete chloroplast genome sequences: effects of taxon sampling and phylogenetic methods on resolving relationships among rosids.

    Science.gov (United States)

    Jansen, Robert K; Kaittanis, Charalambos; Saski, Christopher; Lee, Seung-Bum; Tomkins, Jeffrey; Alverson, Andrew J; Daniell, Henry

    2006-04-09

    The Vitaceae (grape) is an economically important family of angiosperms whose phylogenetic placement is currently unresolved. Recent phylogenetic analyses based on one to several genes have suggested several alternative placements of this family, including sister to Caryophyllales, asterids, Saxifragales, Dilleniaceae or to rest of rosids, though support for these different results has been weak. There has been a recent interest in using complete chloroplast genome sequences for resolving phylogenetic relationships among angiosperms. These studies have clarified relationships among several major lineages but they have also emphasized the importance of taxon sampling and the effects of different phylogenetic methods for obtaining accurate phylogenies. We sequenced the complete chloroplast genome of Vitis vinifera and used these data to assess relationships among 27 angiosperms, including nine taxa of rosids. The Vitis vinifera chloroplast genome is 160,928 bp in length, including a pair of inverted repeats of 26,358 bp that are separated by small and large single copy regions of 19,065 bp and 89,147 bp, respectively. The gene content and order of Vitis is identical to many other unrearranged angiosperm chloroplast genomes, including tobacco. Phylogenetic analyses using maximum parsimony and maximum likelihood were performed on DNA sequences of 61 protein-coding genes for two datasets with 28 or 29 taxa, including eight or nine taxa from four of the seven currently recognized major clades of rosids. Parsimony and likelihood phylogenies of both data sets provide strong support for the placement of Vitaceae as sister to the remaining rosids. However, the position of the Myrtales and support for the monophyly of the eurosid I clade differs between the two data sets and the two methods of analysis. In parsimony analyses, the inclusion of Gossypium is necessary to obtain trees that support the monophyly of the eurosid I clade. However, maximum likelihood analyses place

  2. Phylogenetic analyses of Vitis (Vitaceae based on complete chloroplast genome sequences: effects of taxon sampling and phylogenetic methods on resolving relationships among rosids

    Directory of Open Access Journals (Sweden)

    Alverson Andrew J

    2006-04-01

    Full Text Available Abstract Background The Vitaceae (grape is an economically important family of angiosperms whose phylogenetic placement is currently unresolved. Recent phylogenetic analyses based on one to several genes have suggested several alternative placements of this family, including sister to Caryophyllales, asterids, Saxifragales, Dilleniaceae or to rest of rosids, though support for these different results has been weak. There has been a recent interest in using complete chloroplast genome sequences for resolving phylogenetic relationships among angiosperms. These studies have clarified relationships among several major lineages but they have also emphasized the importance of taxon sampling and the effects of different phylogenetic methods for obtaining accurate phylogenies. We sequenced the complete chloroplast genome of Vitis vinifera and used these data to assess relationships among 27 angiosperms, including nine taxa of rosids. Results The Vitis vinifera chloroplast genome is 160,928 bp in length, including a pair of inverted repeats of 26,358 bp that are separated by small and large single copy regions of 19,065 bp and 89,147 bp, respectively. The gene content and order of Vitis is identical to many other unrearranged angiosperm chloroplast genomes, including tobacco. Phylogenetic analyses using maximum parsimony and maximum likelihood were performed on DNA sequences of 61 protein-coding genes for two datasets with 28 or 29 taxa, including eight or nine taxa from four of the seven currently recognized major clades of rosids. Parsimony and likelihood phylogenies of both data sets provide strong support for the placement of Vitaceae as sister to the remaining rosids. However, the position of the Myrtales and support for the monophyly of the eurosid I clade differs between the two data sets and the two methods of analysis. In parsimony analyses, the inclusion of Gossypium is necessary to obtain trees that support the monophyly of the eurosid I clade

  3. Molecular Signature in HCV-Positive Lymphomas

    Directory of Open Access Journals (Sweden)

    Valli De Re

    2012-01-01

    Full Text Available Hepatitis C virus (HCV is a positive, single-stranded RNA virus, which has been associated to different subtypes of B-cell non-Hodgkin lymphoma (B-NHL. Cumulative evidence suggests an HCV-related antigen driven process in the B-NHL development. The underlying molecular signature associated to HCV-related B-NHL has to date remained obscure. In this review, we discuss the recent developments in this field with a special mention to different sets of genes whose expression is associated with BCR coupled to Blys signaling which in turn was found to be linked to B-cell maturation stages and NF-κb transcription factor. Even if recent progress on HCV-B-NHL signature has been made, the precise relationship between HCV and lymphoma development and phenotype signature remain to be clarified.

  4. Collyricloides massanae (Digenea, Collyriclidae: spermatozoon ultrastructure and phylogenetic importance

    Directory of Open Access Journals (Sweden)

    Bakhoum Abdoulaye Jacque

    2014-01-01

    Full Text Available The spermatological characteristics of Collyricloides massanae (Digenea: Collyriclidae, a parasite of Apodemus sylvaticus caught in France, were studied by means of transmission electron microscopy. The mature sperm of C. massanae presents two axonemes of different lengths with the 9 + “1” pattern of the Trepaxonemata, two bundles of parallel cortical microtubules, external ornamentation of the plasma membrane, spine-like bodies, one mitochondrion, a nucleus and granules of glycogen. An analysis of spermatological organisation emphasised some differences between the mature spermatozoon of C. massanae and those reported in the Gorgoderoidea species studied to date, specially belonging to the families Dicrocoeliidae, Paragonimidae and Troglotrematidae. The ultrastructural criteria described in C. massanae such as the morphology of both anterior and posterior spermatozoon extremities, the association “external ornamentation + cortical microtubules”, the type 2 of external ornamentation and the spine-like bodies would allow us to bring closer the Collyriclidae to Microphalloidea. However, further ultrastructural and molecular studies are needed particularly in the unexplored taxa in order to fully resolve the phylogenetic position of the Collyriclidae.

  5. Phylogenetic characterization of Canine Parvovirus VP2 partial sequences from symptomatic dogs samples.

    Science.gov (United States)

    Zienius, D; Lelešius, R; Kavaliauskis, H; Stankevičius, A; Šalomskas, A

    2016-01-01

    The aim of the present study was to detect canine parvovirus (CPV) from faecal samples of clinically ill domestic dogs by polymerase chain reaction (PCR) followed by VP2 gene partial sequencing and molecular characterization of circulating strains in Lithuania. Eleven clinically and antigen-tested positive dog faecal samples, collected during the period of 2014-2015, were investigated by using PCR. The phylogenetic investigations indicated that the Lithuanian CPV VP2 partial sequences (3025-3706 cds) were closely related and showed 99.0-99.9% identity. All Lithuanian sequences were associated with one phylogroup, but grouped in different clusters. Ten of investigated Lithuanian CPV VP2 sequences were closely associated with CPV 2a antigenic variant (99.4% nt identity). Five CPV VP2 sequences from Lithuania were related to CPV-2a, but were rather divergent (6.8 nt differences). Only one CPV VP2 sequence from Lithuania was associated (99.3% nt identity) with CPV-2b VP2 sequences from France, Italy, USA and Korea. The four of eleven investigated Lithuanian dogs with CPV infection symptoms were vaccinated with CPV-2 vaccine, but their VP2 sequences were phylogenetically distantly associated with CPV vaccine strains VP2 sequences (11.5-15.8 nt differences). Ten Lithuanian CPV VP2 sequences had monophyletic relations among the close geographically associated samples, but five of them were rather divergent (1.0% less sequence similarity). The one Lithuanian CPV VP2 sequence was closely related with CPV-2b antigenic variant. All the Lithuanian CPV VP2 partial sequences were conservative and phylogenetically low associated with most commonly used CPV vaccine strains.

  6. Molecular phylogenetics of emydine turtles: taxonomic revision and the evolution of shell kinesis.

    Science.gov (United States)

    Feldman, Chris R; Parham, James Ford

    2002-03-01

    The 10 extant species of emydine turtles represent an array of morphological and ecological forms recognizable and popular among scientists and hobbyists. Nevertheless, the phylogenetic affinities of most emydines remain contentious. Here, we examine the evolutionary relationships of emydine turtles using 2092 bp of DNA encoding the mitochondrial genes cyt b, ND4, and adjacent tRNAs. These data contain 339 parsimony informative characters that we use to erect hypotheses of relationships for the Emydinae. Both maximum parsimony and maximum likelihood methods yield a monophyletic Emydinae in which all but three nodes are well resolved. Emys orbicularis, Emydoidea blandingii, and Clemmys marmorata form a monophyletic clade, as do the species of Terrapene. Clemmys muhlenbergii and Clemmys insculpta form a third monophyletic group that may be sister to all other emydines. Clemmys guttata is problematic and probably related to Terrapene. Based on this phylogeny, and previous molecular work on the group, we suggest the following taxonomic revisions: (1) Clemmys should be restricted to a single species, C. guttata. (2) Calemys should be resurrected for C. muhlenbergii and C. insculpta. (3) Emys should be expanded to include three species: E. orbicularis, E. blandingii, and E. marmorata. Furthermore, our analyses show that neither kinetic-shelled nor akinetic-shelled emydines form monophyletic groups. Therefore, shell kinesis was either independently gained in Emys and Terrapene or secondarily lost in E. marmorata and C. guttata. Parsimony, paleontological evidence, and the multiple origins of shell kinesis in related turtle lineages (especially geoemydines) support the independent origin of plastral kinesis.

  7. Re-Evaluation of Phylogenetic Relationships among Species of the Mangrove Genus Avicennia from Indo-West Pacific Based on Multilocus Analyses.

    Science.gov (United States)

    Li, Xinnian; Duke, Norman C; Yang, Yuchen; Huang, Lishi; Zhu, Yuxiang; Zhang, Zhang; Zhou, Renchao; Zhong, Cairong; Huang, Yelin; Shi, Suhua

    2016-01-01

    Avicennia L. (Avicenniaceae), one of the most diverse mangrove genera, is distributed widely in tropical and subtropical intertidal zones worldwide. Five species of Avicennia in the Indo-West Pacific region have been previously described. However, their phylogenetic relationships were determined based on morphological and allozyme data. To enhance our understanding of evolutionary patterns in the clade, we carried out a molecular phylogenetic study using wide sampling and multiple loci. Our results support two monophyletic clades across all species worldwide in Avicennia: an Atlantic-East Pacific (AEP) lineage and an Indo-West Pacific (IWP) lineage. This split is in line with biogeographic distribution of the clade. Focusing on the IWP branch, we reconstructed a detailed phylogenetic tree based on sequences from 25 nuclear genes. The results identified three distinct subclades, (1) A. rumphiana and A. alba, (2) A. officinalis and A. integra, and (3) the A. marina complex, with high bootstrap support. The results strongly corresponded to two morphological traits in floral structure: stigma position in relation to the anthers and style length. Using Bayesian dating methods we estimated diversification of the IWP lineage was dated to late Miocene (c. 6.0 million years ago) and may have been driven largely by the fluctuating sea levels since that time.

  8. Re-Evaluation of Phylogenetic Relationships among Species of the Mangrove Genus Avicennia from Indo-West Pacific Based on Multilocus Analyses.

    Directory of Open Access Journals (Sweden)

    Xinnian Li

    Full Text Available Avicennia L. (Avicenniaceae, one of the most diverse mangrove genera, is distributed widely in tropical and subtropical intertidal zones worldwide. Five species of Avicennia in the Indo-West Pacific region have been previously described. However, their phylogenetic relationships were determined based on morphological and allozyme data. To enhance our understanding of evolutionary patterns in the clade, we carried out a molecular phylogenetic study using wide sampling and multiple loci. Our results support two monophyletic clades across all species worldwide in Avicennia: an Atlantic-East Pacific (AEP lineage and an Indo-West Pacific (IWP lineage. This split is in line with biogeographic distribution of the clade. Focusing on the IWP branch, we reconstructed a detailed phylogenetic tree based on sequences from 25 nuclear genes. The results identified three distinct subclades, (1 A. rumphiana and A. alba, (2 A. officinalis and A. integra, and (3 the A. marina complex, with high bootstrap support. The results strongly corresponded to two morphological traits in floral structure: stigma position in relation to the anthers and style length. Using Bayesian dating methods we estimated diversification of the IWP lineage was dated to late Miocene (c. 6.0 million years ago and may have been driven largely by the fluctuating sea levels since that time.

  9. Nonbinary Tree-Based Phylogenetic Networks.

    Science.gov (United States)

    Jetten, Laura; van Iersel, Leo

    2018-01-01

    Rooted phylogenetic networks are used to describe evolutionary histories that contain non-treelike evolutionary events such as hybridization and horizontal gene transfer. In some cases, such histories can be described by a phylogenetic base-tree with additional linking arcs, which can, for example, represent gene transfer events. Such phylogenetic networks are called tree-based. Here, we consider two possible generalizations of this concept to nonbinary networks, which we call tree-based and strictly-tree-based nonbinary phylogenetic networks. We give simple graph-theoretic characterizations of tree-based and strictly-tree-based nonbinary phylogenetic networks. Moreover, we show for each of these two classes that it can be decided in polynomial time whether a given network is contained in the class. Our approach also provides a new view on tree-based binary phylogenetic networks. Finally, we discuss two examples of nonbinary phylogenetic networks in biology and show how our results can be applied to them.

  10. Phylogenetic radiation of the greenbottle flies (Diptera, Calliphoridae, Luciliinae)

    Science.gov (United States)

    Williams, Kirstin A.; Lamb, Jennifer; Villet, Martin H.

    2016-01-01

    Abstract The subfamily Luciliinae is diverse and geographically widespread. Its four currently recognised genera (Dyscritomyia Grimshaw, 1901, Hemipyrellia Townsend, 1918, Hypopygiopsis Townsend 1916 and Lucilia Robineau-Desvoidy, 1830) contain species that range from saprophages to obligate parasites, but their pattern of phylogenetic diversification is unclear. The 28S rRNA, COI and Period genes of 14 species of Lucilia and Hemipyrellia were partially sequenced and analysed together with sequences of 11 further species from public databases. The molecular data confirmed molecular paraphyly in three species-pairs in Lucilia that hamper barcode identifications of those six species. Lucilia sericata and Lucilia cuprina were confirmed as mutual sister species. The placements of Dyscritomyia and Hypopygiopsis were ambiguous, since both made Lucilia paraphyletic in some analyses. Recognising Hemipyrellia as a genus consistently left Lucilia s.l. paraphyletic, and the occasionally-recognised (sub)genus Phaenicia was consistently paraphyletic, so these taxa should be synonymised with Lucilia to maintain monophyly. Analysis of a matrix of 14 morphological characters scored for adults of all genera and for most of the species included in the molecular analysis confirmed several of these findings. The different degrees of parasitism were phylogenetically clustered within this genus but did not form a graded series of evolutionary stages, and there was no particular relationship between feeding habits and biogeography. Because of the ubiquity of hybridization, introgression and incomplete lineage sorting in blow flies, we recommend that using a combination of mitochondrial and nuclear markers should be a procedural standard for medico-criminal forensic identifications of insects. PMID:27103874

  11. Molecular Phylogenetic Screening of Withania somnifera Relative From Indonesia Based on Internal Transcribed Spacer Region

    Directory of Open Access Journals (Sweden)

    Topik Hidayat

    2016-04-01

    Full Text Available Withania somnifera (family Solanaceae, known commonly as Ashwaganda, is one of the important medicinal plants, and recent studies reported that Withanone, one of the chemical components in this plant, has ability to kill cancer cell. Because of endemic state of this plant to South Asia, exploring plant species under the same family which grow well in Indonesia has been of interest. The purpose of this study was to screen the Indonesian plant which has strong phylogenetic relationship with Ashwaganda. Thus, phylogenetic analysis using DNA sequences of internal transcribed spacer (ITS region was conducted. Thus, 19 species of Solanaceae and two species of Convolvulaceae as outgroup were examined. Five ITS regions of Ashwaganda retrieved from GenBank were included in the phylogenetic analysis. Parsimony analysis showed that Indonesia Solanaceae comprises seven groups which is consistent with the global Solanaceae relationship as previously reported. Furthermore, our study revealed that two species, Physalis angulata and Physalis peruviana, are relative to W. somnifera. Morphologically, they share characters of flower and fruit. This result indicated that these two species are potential to have similar chemical properties as Ashwaganda, thus we can have new variants of Withanone originated from Indonesia with similar effect.

  12. New substitution models for rooting phylogenetic trees.

    Science.gov (United States)

    Williams, Tom A; Heaps, Sarah E; Cherlin, Svetlana; Nye, Tom M W; Boys, Richard J; Embley, T Martin

    2015-09-26

    The root of a phylogenetic tree is fundamental to its biological interpretation, but standard substitution models do not provide any information on its position. Here, we describe two recently developed models that relax the usual assumptions of stationarity and reversibility, thereby facilitating root inference without the need for an outgroup. We compare the performance of these models on a classic test case for phylogenetic methods, before considering two highly topical questions in evolutionary biology: the deep structure of the tree of life and the root of the archaeal radiation. We show that all three alignments contain meaningful rooting information that can be harnessed by these new models, thus complementing and extending previous work based on outgroup rooting. In particular, our analyses exclude the root of the tree of life from the eukaryotes or Archaea, placing it on the bacterial stem or within the Bacteria. They also exclude the root of the archaeal radiation from several major clades, consistent with analyses using other rooting methods. Overall, our results demonstrate the utility of non-reversible and non-stationary models for rooting phylogenetic trees, and identify areas where further progress can be made. © 2015 The Authors.

  13. Ecosystem Functions across Trophic Levels Are Linked to Functional and Phylogenetic Diversity

    Science.gov (United States)

    Thompson, Patrick L.; Davies, T. Jonathan; Gonzalez, Andrew

    2015-01-01

    In experimental systems, it has been shown that biodiversity indices based on traits or phylogeny can outperform species richness as predictors of plant ecosystem function. However, it is unclear whether this pattern extends to the function of food webs in natural ecosystems. Here we tested whether zooplankton functional and phylogenetic diversity explains the functioning of 23 natural pond communities. We used two measures of ecosystem function: (1) zooplankton community biomass and (2) phytoplankton abundance (Chl a). We tested for diversity-ecosystem function relationships within and across trophic levels. We found a strong correlation between zooplankton diversity and ecosystem function, whereas local environmental conditions were less important. Further, the positive diversity-ecosystem function relationships were more pronounced for measures of functional and phylogenetic diversity than for species richness. Zooplankton and phytoplankton biomass were best predicted by different indices, suggesting that the two functions are dependent upon different aspects of diversity. Zooplankton community biomass was best predicted by zooplankton trait-based functional richness, while phytoplankton abundance was best predicted by zooplankton phylogenetic diversity. Our results suggest that the positive relationship between diversity and ecosystem function can extend across trophic levels in natural environments, and that greater insight into variation in ecosystem function can be gained by combining functional and phylogenetic diversity measures. PMID:25693188

  14. DOMINO: development of informative molecular markers for phylogenetic and genome-wide population genetic studies in non-model organisms.

    Science.gov (United States)

    Frías-López, Cristina; Sánchez-Herrero, José F; Guirao-Rico, Sara; Mora, Elisa; Arnedo, Miquel A; Sánchez-Gracia, Alejandro; Rozas, Julio

    2016-12-15

    The development of molecular markers is one of the most important challenges in phylogenetic and genome wide population genetics studies, especially in studies with non-model organisms. A highly promising approach for obtaining suitable markers is the utilization of genomic partitioning strategies for the simultaneous discovery and genotyping of a large number of markers. Unfortunately, not all markers obtained from these strategies provide enough information for solving multiple evolutionary questions at a reasonable taxonomic resolution. We have developed Development Of Molecular markers In Non-model Organisms (DOMINO), a bioinformatics tool for informative marker development from both next generation sequencing (NGS) data and pre-computed sequence alignments. The application implements popular NGS tools with new utilities in a highly versatile pipeline specifically designed to discover or select personalized markers at different levels of taxonomic resolution. These markers can be directly used to study the taxa surveyed for their design, utilized for further downstream PCR amplification in a broader set taxonomic scope, or exploited as suitable templates to bait design for target DNA enrichment techniques. We conducted an exhaustive evaluation of the performance of DOMINO via computer simulations and illustrate its utility to find informative markers in an empirical dataset. DOMINO is freely available from www.ub.edu/softevol/domino CONTACT: elsanchez@ub.edu or jrozas@ub.eduSupplementary information: Supplementary data are available at Bioinformatics online. © The Author 2016. Published by Oxford University Press. All rights reserved. For Permissions, please e-mail: journals.permissions@oup.com.

  15. Evidence of positive selection associated with placental loss in tiger sharks.

    Science.gov (United States)

    Swift, Dominic G; Dunning, Luke T; Igea, Javier; Brooks, Edward J; Jones, Catherine S; Noble, Leslie R; Ciezarek, Adam; Humble, Emily; Savolainen, Vincent

    2016-06-14

    All vertebrates initially feed their offspring using yolk reserves. In some live-bearing species these yolk reserves may be supplemented with extra nutrition via a placenta. Sharks belonging to the Carcharhinidae family are all live-bearing, and with the exception of the tiger shark (Galeocerdo cuvier), develop placental connections after exhausting yolk reserves. Phylogenetic relationships suggest the lack of placenta in tiger sharks is due to secondary loss. This represents a dramatic shift in reproductive strategy, and is likely to have left a molecular footprint of positive selection within the genome. We sequenced the transcriptome of the tiger shark and eight other live-bearing shark species. From this data we constructed a time-calibrated phylogenetic tree estimating the tiger shark lineage diverged from the placental carcharhinids approximately 94 million years ago. Along the tiger shark lineage, we identified five genes exhibiting a signature of positive selection. Four of these genes have functions likely associated with brain development (YWHAE and ARL6IP5) and sexual reproduction (VAMP4 and TCTEX1D2). Our results indicate the loss of placenta in tiger sharks may be associated with subsequent adaptive changes in brain development and sperm production.

  16. A preliminary mitochondrial genome phylogeny of Orthoptera (Insecta) and approaches to maximizing phylogenetic signal found within mitochondrial genome data.

    Science.gov (United States)

    Fenn, J Daniel; Song, Hojun; Cameron, Stephen L; Whiting, Michael F

    2008-10-01

    The phylogenetic utility of mitochondrial genomes (mtgenomes) is examined using the framework of a preliminary phylogeny of Orthoptera. This study presents five newly sequenced genomes from four orthopteran families. While all ensiferan and polyneopteran taxa retain the ancestral gene order, all caeliferan lineages including the newly sequenced caeliferan species contain a tRNA rearrangement from the insect ground plan tRNA(Lys)(K)-tRNA(Asp)(D) swapping to tRNA(Asp) (D)-tRNA(Lys) (K) confirming that this rearrangement is a possible molecular synapomorphy for this suborder. The phylogenetic signal in mtgenomes is rigorously examined under the analytical regimens of parsimony, maximum likelihood and Bayesian inference, along with how gene inclusion/exclusion, data recoding, gap coding, and different partitioning schemes influence the phylogenetic reconstruction. When all available data are analyzed simultaneously, the monophyly of Orthoptera and its two suborders, Caelifera and Ensifera, are consistently recovered in the context of our taxon sampling, regardless of the optimality criteria. When protein-coding genes are analyzed as a single partition, nearly identical topology to the combined analyses is recovered, suggesting that much of the signals of the mtgenome come from the protein-coding genes. Transfer and ribosomal RNAs perform poorly when analyzed individually, but contribute signal when analyzed in combination with the protein-coding genes. Inclusion of third codon position of the protein-coding genes does not negatively affect the phylogenetic reconstruction when all genes are analyzed together, whereas recoding of the protein-coding genes into amino acid sequences introduces artificial resolution. Over-partitioning in a Bayesian framework appears to have a negative effect in achieving convergence. Our findings suggest that the best phylogenetic inferences are made when all available nucleotide data from the mtgenome are analyzed simultaneously, and that

  17. Molecular cloning, phylogenetic analysis and heat shock response of Babesia gibsoni heat shock protein 90.

    Science.gov (United States)

    Yamasaki, Masahiro; Tsuboi, Yoshihiro; Taniyama, Yusuke; Uchida, Naohiro; Sato, Reeko; Nakamura, Kensuke; Ohta, Hiroshi; Takiguchi, Mitsuyoshi

    2016-09-01

    The Babesia gibsoni heat shock protein 90 (BgHSP90) gene was cloned and sequenced. The length of the gene was 2,610 bp with two introns. This gene was amplified from cDNA corresponding to full length coding sequence (CDS) with an open reading frame of 2,148 bp. A phylogenetic analysis of the CDS of HSP90 gene showed that B. gibsoni was most closely related to B. bovis and Babesia sp. BQ1/Lintan and lies within a phylogenetic cluster of protozoa. Moreover, mRNA transcription profile for BgHSP90 exposed to high temperature were examined by quantitative real-time reverse transcription-polymerase chain reaction. BgHSP90 levels were elevated when the parasites were incubated at 43°C for 1 hr.

  18. Molecular phylogenetics and character evolution of morphologically diverse groups, Dendrobium section Dendrobium and allies

    Science.gov (United States)

    Takamiya, Tomoko; Wongsawad, Pheravut; Sathapattayanon, Apirada; Tajima, Natsuko; Suzuki, Shunichiro; Kitamura, Saki; Shioda, Nao; Handa, Takashi; Kitanaka, Susumu; Iijima, Hiroshi; Yukawa, Tomohisa

    2014-01-01

    It is always difficult to construct coherent classification systems for plant lineages having diverse morphological characters. The genus Dendrobium, one of the largest genera in the Orchidaceae, includes ∼1100 species, and enormous morphological diversification has hindered the establishment of consistent classification systems covering all major groups of this genus. Given the particular importance of species in Dendrobium section Dendrobium and allied groups as floriculture and crude drug genetic resources, there is an urgent need to establish a stable classification system. To clarify phylogenetic relationships in Dendrobium section Dendrobium and allied groups, we analysed the macromolecular characters of the group. Phylogenetic analyses of 210 taxa of Dendrobium were conducted on DNA sequences of internal transcribed spacer (ITS) regions of 18S–26S nuclear ribosomal DNA and the maturase-coding gene (matK) located in an intron of the plastid gene trnK using maximum parsimony and Bayesian methods. The parsimony and Bayesian analyses revealed 13 distinct clades in the group comprising section Dendrobium and its allied groups. Results also showed paraphyly or polyphyly of sections Amblyanthus, Aporum, Breviflores, Calcarifera, Crumenata, Dendrobium, Densiflora, Distichophyllae, Dolichocentrum, Holochrysa, Oxyglossum and Pedilonum. On the other hand, the monophyly of section Stachyobium was well supported. It was found that many of the morphological characters that have been believed to reflect phylogenetic relationships are, in fact, the result of convergence. As such, many of the sections that have been recognized up to this point were found to not be monophyletic, so recircumscription of sections is required. PMID:25107672

  19. Phylogenetic and recombination analysis of tomato spotted wilt virus.

    Directory of Open Access Journals (Sweden)

    Sen Lian

    Full Text Available Tomato spotted wilt virus (TSWV severely damages and reduces the yield of many economically important plants worldwide. In this study, we determined the whole-genome sequences of 10 TSWV isolates recently identified from various regions and hosts in Korea. Phylogenetic analysis of these 10 isolates as well as the three previously sequenced isolates indicated that the 13 Korean TSWV isolates could be divided into two groups reflecting either two different origins or divergences of Korean TSWV isolates. In addition, the complete nucleotide sequences for the 13 Korean TSWV isolates along with previously sequenced TSWV RNA segments from Korea and other countries were subjected to phylogenetic and recombination analysis. The phylogenetic analysis indicated that both the RNA L and RNA M segments of most Korean isolates might have originated in Western Europe and North America but that the RNA S segments for all Korean isolates might have originated in China and Japan. Recombination analysis identified a total of 12 recombination events among all isolates and segments and five recombination events among the 13 Korea isolates; among the five recombinants from Korea, three contained the whole RNA L segment, suggesting reassortment rather than recombination. Our analyses provide evidence that both recombination and reassortment have contributed to the molecular diversity of TSWV.

  20. HPV Positive Head and Neck Cancers: Molecular Pathogenesis and Evolving Treatment Strategies

    Directory of Open Access Journals (Sweden)

    Rüveyda Dok

    2016-03-01

    Full Text Available Head and neck squamous cell carcinoma (HNSCC is a highly heterogeneous disease that is the result of tobacco and/or alcohol abuse or infection with high-risk Human papillomaviruses. Despite the fact that HPV positive HNSCC cancers form a distinct clinical entity with better treatment outcome, all HNSCC are currently treated uniformly with the same treatment modality. At present, biologic basis of these different outcomes and their therapeutic influence are areas of intense investigation. In this review, we will summarize the molecular basis for this different outcome, novel treatment opportunities and possible biomarkers for HPV positive HNSCC. In particular, the focus will be on several molecular targeted strategies that can improve the chemoradiation response by influencing DNA repair mechanisms.

  1. Transforming phylogenetic networks: Moving beyond tree space

    OpenAIRE

    Huber, Katharina T.; Moulton, Vincent; Wu, Taoyang

    2016-01-01

    Phylogenetic networks are a generalization of phylogenetic trees that are used to represent reticulate evolution. Unrooted phylogenetic networks form a special class of such networks, which naturally generalize unrooted phylogenetic trees. In this paper we define two operations on unrooted phylogenetic networks, one of which is a generalization of the well-known nearest-neighbor interchange (NNI) operation on phylogenetic trees. We show that any unrooted phylogenetic network can be transforme...

  2. Phylogenetic Origins of Brain Organisers

    Directory of Open Access Journals (Sweden)

    Ellen Robertshaw

    2012-01-01

    Full Text Available The regionalisation of the nervous system begins early in embryogenesis, concomitant with the establishment of the anteroposterior (AP and dorsoventral (DV body axes. The molecular mechanisms that drive axis induction appear to be conserved throughout the animal kingdom and may be phylogenetically older than the emergence of bilateral symmetry. As a result of this process, groups of patterning genes that are equally well conserved are expressed at specific AP and DV coordinates of the embryo. In the emerging nervous system of vertebrate embryos, this initial pattern is refined by local signalling centres, secondary organisers, that regulate patterning, proliferation, and axonal pathfinding in adjacent neuroepithelium. The main secondary organisers for the AP neuraxis are the midbrain-hindbrain boundary, zona limitans intrathalamica, and anterior neural ridge and for the DV neuraxis the notochord, floor plate, and roof plate. A search for homologous secondary organisers in nonvertebrate lineages has led to controversy over their phylogenetic origins. Based on a recent study in hemichordates, it has been suggested that the AP secondary organisers evolved at the base of the deuterostome superphylum, earlier than previously thought. According to this view, the lack of signalling centres in some deuterostome lineages is likely to reflect a secondary loss due to adaptive processes. We propose that the relative evolutionary flexibility of secondary organisers has contributed to a broader morphological complexity of nervous systems in different clades.

  3. Phylogenomic and MALDI-TOF MS analysis of Streptococcus sinensis HKU4T reveals a distinct phylogenetic clade in the genus Streptococcus.

    Science.gov (United States)

    Teng, Jade L L; Huang, Yi; Tse, Herman; Chen, Jonathan H K; Tang, Ying; Lau, Susanna K P; Woo, Patrick C Y

    2014-10-20

    Streptococcus sinensis is a recently discovered human pathogen isolated from blood cultures of patients with infective endocarditis. Its phylogenetic position, as well as those of its closely related species, remains inconclusive when single genes were used for phylogenetic analysis. For example, S. sinensis branched out from members of the anginosus, mitis, and sanguinis groups in the 16S ribosomal RNA gene phylogenetic tree, but it was clustered with members of the anginosus and sanguinis groups when groEL gene sequences used for analysis. In this study, we sequenced the draft genome of S. sinensis and used a polyphasic approach, including concatenated genes, whole genomes, and matrix-assisted laser desorption ionization-time of flight mass spectrometry to analyze the phylogeny of S. sinensis. The size of the S. sinensis draft genome is 2.06 Mb, with GC content of 42.2%. Phylogenetic analysis using 50 concatenated genes or whole genomes revealed that S. sinensis formed a distinct cluster with Streptococcus oligofermentans and Streptococcus cristatus, and these three streptococci were clustered with the "sanguinis group." As for phylogenetic analysis using hierarchical cluster analysis of the mass spectra of streptococci, S. sinensis also formed a distinct cluster with S. oligofermentans and S. cristatus, but these three streptococci were clustered with the "mitis group." On the basis of the findings, we propose a novel group, named "sinensis group," to include S. sinensis, S. oligofermentans, and S. cristatus, in the Streptococcus genus. Our study also illustrates the power of phylogenomic analyses for resolving ambiguities in bacterial taxonomy. © The Author(s) 2014. Published by Oxford University Press on behalf of the Society for Molecular Biology and Evolution.

  4. Complete mitochondrial genome of the Indian peafowl (Pavo cristatus), with phylogenetic analysis in phasianidae.

    Science.gov (United States)

    Zhou, Tai-Cheng; Sha, Tao; Irwin, David M; Zhang, Ya-Ping

    2015-01-01

    Pavo cristatus, known as the Indian peafowl, is endemic to India and Sri Lanka and has been domesticated for its ornamental and food value. However, its phylogenetic status is still debated. Here, to clarify the phylogenetic status of P. cristatus within Phasianidae, we analyzed its mitochondrial genome (mtDNA). The complete mitochondrial DNA (mtDNA) genome was determined using 34 pairs of primers. Our data show that the mtDNA genome of P. cristatus is 16,686 bp in length. Molecular phylogenetic analyses of P. cristatus was performed along with 22 complete mtDNA genomes belonging to other species in Phasianidae using Bayesian and maximum likelihood methods, where Aythya americana and Anas platyrhynchos were used as outgroups. Our results show that P. critatus has its closest genetic affinity with Pavo muticus and belongs to clade that contains Gallus, Bambusicola and Francolinus.

  5. Molecular Epidemiology and Phylogenetic Analyses of Influenza B Virus in Thailand during 2010 to 2014

    Science.gov (United States)

    Tewawong, Nipaporn; Suwannakarn, Kamol; Prachayangprecha, Slinporn; Korkong, Sumeth; Vichiwattana, Preeyaporn; Vongpunsawad, Sompong; Poovorawan, Yong

    2015-01-01

    Influenza B virus remains a major contributor to the seasonal influenza outbreak and its prevalence has increased worldwide. We investigated the epidemiology and analyzed the full genome sequences of influenza B virus strains in Thailand between 2010 and 2014. Samples from the upper respiratory tract were collected from patients diagnosed with influenza like-illness. All samples were screened for influenza A/B viruses by one-step multiplex real-time RT-PCR. The whole genome of 53 influenza B isolates were amplified, sequenced, and analyzed. From 14,418 respiratory samples collected during 2010 to 2014, a total of 3,050 tested positive for influenza virus. Approximately 3.27% (471/14,418) were influenza B virus samples. Fifty three isolates of influenza B virus were randomly chosen for detailed whole genome analysis. Phylogenetic analysis of the HA gene showed clusters in Victoria clades 1A, 1B, 3, 5 and Yamagata clades 2 and 3. Both B/Victoria and B/Yamagata lineages were found to co-circulate during this time. The NA sequences of all isolates belonged to lineage II and consisted of viruses from both HA Victoria and Yamagata lineages, reflecting possible reassortment of the HA and NA genes. No significant changes were seen in the NA protein. The phylogenetic trees generated through the analysis of the PB1 and PB2 genes closely resembled that of the HA gene, while trees generated from the analysis of the PA, NP, and M genes showed similar topology. The NS gene exhibited the pattern of genetic reassortment distinct from those of the PA, NP or M genes. Thus, antigenic drift and genetic reassortment among the influenza B virus strains were observed in the isolates examined. Our findings indicate that the co-circulation of two distinct lineages of influenza B viruses and the limitation of cross-protection of the current vaccine formulation provide support for quadrivalent influenza vaccine in this region. PMID:25602617

  6. Phylogenetically-informed priorities for amphibian conservation.

    Science.gov (United States)

    Isaac, Nick J B; Redding, David W; Meredith, Helen M; Safi, Kamran

    2012-01-01

    The amphibian decline and extinction crisis demands urgent action to prevent further large numbers of species extinctions. Lists of priority species for conservation, based on a combination of species' threat status and unique contribution to phylogenetic diversity, are one tool for the direction and catalyzation of conservation action. We describe the construction of a near-complete species-level phylogeny of 5713 amphibian species, which we use to create a list of evolutionarily distinct and globally endangered species (EDGE list) for the entire class Amphibia. We present sensitivity analyses to test the robustness of our priority list to uncertainty in species' phylogenetic position and threat status. We find that both sources of uncertainty have only minor impacts on our 'top 100' list of priority species, indicating the robustness of the approach. By contrast, our analyses suggest that a large number of Data Deficient species are likely to be high priorities for conservation action from the perspective of their contribution to the evolutionary history.

  7. Phylogenetically-informed priorities for amphibian conservation.

    Directory of Open Access Journals (Sweden)

    Nick J B Isaac

    Full Text Available The amphibian decline and extinction crisis demands urgent action to prevent further large numbers of species extinctions. Lists of priority species for conservation, based on a combination of species' threat status and unique contribution to phylogenetic diversity, are one tool for the direction and catalyzation of conservation action. We describe the construction of a near-complete species-level phylogeny of 5713 amphibian species, which we use to create a list of evolutionarily distinct and globally endangered species (EDGE list for the entire class Amphibia. We present sensitivity analyses to test the robustness of our priority list to uncertainty in species' phylogenetic position and threat status. We find that both sources of uncertainty have only minor impacts on our 'top 100' list of priority species, indicating the robustness of the approach. By contrast, our analyses suggest that a large number of Data Deficient species are likely to be high priorities for conservation action from the perspective of their contribution to the evolutionary history.

  8. Integration of morphological data sets for phylogenetic analysis of Amniota: the importance of integumentary characters and increased taxonomic sampling.

    Science.gov (United States)

    Hill, Robert V

    2005-08-01

    Several mutually exclusive hypotheses have been advanced to explain the phylogenetic position of turtles among amniotes. Traditional morphology-based analyses place turtles among extinct anapsids (reptiles with a solid skull roof), whereas more recent studies of both morphological and molecular data support an origin of turtles from within Diapsida (reptiles with a doubly fenestrated skull roof). Evaluation of these conflicting hypotheses has been hampered by nonoverlapping taxonomic samples and the exclusion of significant taxa from published analyses. Furthermore, although data from soft tissues and anatomical systems such as the integument may be particularly relevant to this problem, they are often excluded from large-scale analyses of morphological systematics. Here, conflicting hypotheses of turtle relationships are tested by (1) combining published data into a supermatrix of morphological characters to address issues of character conflict and missing data; (2) increasing taxonomic sampling by more than doubling the number of operational taxonomic units to test internal relationships within suprageneric ingroup taxa; and (3) increasing character sampling by approximately 25% by adding new data on the osteology and histology of the integument, an anatomical system that has been historically underrepresented in morphological systematics. The morphological data set assembled here represents the largest yet compiled for Amniota. Reevaluation of character data from prior studies of amniote phylogeny favors the hypothesis that turtles indeed have diapsid affinities. Addition of new ingroup taxa alone leads to a decrease in overall phylogenetic resolution, indicating that existing characters used for amniote phylogeny are insufficient to explain the evolution of more highly nested taxa. Incorporation of new data from the soft and osseous components of the integument, however, helps resolve relationships among both basal and highly nested amniote taxa. Analysis of a

  9. Phylogenetic utility of ribosomal genes for reconstructing the phylogeny of five Chinese satyrine tribes (Lepidoptera, Nymphalidae

    Directory of Open Access Journals (Sweden)

    Mingsheng Yang

    2015-03-01

    Full Text Available Satyrinae is one of twelve subfamilies of the butterfly family Nymphalidae, which currently includes nine tribes. However, phylogenetic relationships among them remain largely unresolved, though different researches have been conducted based on both morphological and molecular data. However, ribosomal genes have never been used in tribe level phylogenetic analyses of Satyrinae. In this study we investigate for the first time the phylogenetic relationships among the tribes Elymniini, Amathusiini, Zetherini and Melanitini which are indicated to be a monophyletic group, and the Satyrini, using two ribosomal genes (28s rDNA and 16s rDNA and four protein-coding genes (EF-1α, COI, COII and Cytb. We mainly aim to assess the phylogenetic informativeness of the ribosomal genes as well as clarify the relationships among different tribes. Our results show the two ribosomal genes generally have the same high phylogenetic informativeness compared with EF-1α; and we infer the 28s rDNA would show better informativeness if the 28s rDNA sequence data for each sampling taxon are obtained in this study. The placement of the monotypic genus Callarge Leech in Zetherini is confirmed for the first time based on molecular evidence. In addition, our maximum likelihood (ML and Bayesian inference (BI trees consistently show that the involved Satyrinae including the Amathusiini is monophyletic with high support values. Although the relationships among the five tribes are identical among ML and BI analyses and are mostly strongly-supported in BI analysis, those in ML analysis are lowly- or moderately- supported. Therefore, the relationships among the related five tribes recovered herein need further verification based on more sampling taxa.

  10. On the production of positive molecular ions in cometary comas

    International Nuclear Information System (INIS)

    Tarafdar, S.P.; Wickramasinghe, N.C.

    1977-01-01

    Positively charged molecular ions, such as H 2 O + , which have been observed in cometary comas, may be efficiently produced by the evaporation of positively charged clathrate grains of radii in the range approximately 10 -6 -10 -3 cm. Such grains may be expelled from nuclei of comets, along with gaseous molecules. Grain charging occurs via interaction with solar ultraviolet photons and/or solar wind protons. Observational data on the total quantities as well as the distributions of H 2 O and H 2 O + in cometary comas are shown to be in accord with detailed model calculations. (Auth.)

  11. Building Phylogenetic Trees from DNA Sequence Data: Investigating Polar Bear and Giant Panda Ancestry.

    Science.gov (United States)

    Maier, Caroline Alexandra

    2001-01-01

    Presents an activity in which students seek answers to questions about evolutionary relationships by using genetic databases and bioinformatics software. Students build genetic distance matrices and phylogenetic trees based on molecular sequence data using web-based resources. Provides a flowchart of steps involved in accessing, retrieving, and…

  12. Molecular phylogenetics, vocalizations, and species limits in Celeus woodpeckers (Aves: Picidae).

    Science.gov (United States)

    Benz, Brett W; Robbins, Mark B

    2011-10-01

    Species limits and the evolutionary mechanisms that have shaped diversification of woodpeckers and allies (Picidae) remain obscure, as inter and intraspecific phylogenetic relationships have yet to be comprehensively resolved for most genera. Herein, we analyzed 5020 base pairs of nucleotide sequence data from the mitochondrial and nuclear genomes to reconstruct the evolutionary history of Celeus woodpeckers. Broad geographic sampling was employed to assess species limits in phenotypically variable lineages and provide a first look at the evolution of song and plumage traits in this poorly known Neotropical genus. Our results strongly support the monophyly of Celeus and reveal several novel relationships across a shallow phylogenetic topology. We confirm the close sister relationship between Celeus spectabilis and the enigmatic Celeus obrieni, both of which form a clade with Celeus flavus. The Mesoamerican Celeus castaneus was placed as sister to a Celeus undatus-grammicus lineage, with the species status of the latter drawn into question given the lack of substantial genetic, morphological, and vocal variation in these taxa. We recovered paraphyly in Celeus elegans; however, this result appears to be the consequence of mitochondrial introgression from Celeus lugubris considering the monophyly of elegans at the ß-FIBI7 locus. A second instance of paraphyly was observed in Celeus flavescens with deep genetic splits and substantial phenotypic variation indicating the presence of two distinct species in this broadly distributed lineage. As such, we advocate elevation of Celeus flavescens ochraceus to species status. Our analysis of Celeus vocalizations and plumage characters demonstrates a pattern of lability consistent with a relatively recent origin of the genus and potentially rapid speciation history. Copyright © 2011 Elsevier Inc. All rights reserved.

  13. Phylogenetic analysis of canine distemper virus in South America clade 1 reveals unique molecular signatures of the local epidemic.

    Science.gov (United States)

    Fischer, Cristine D B; Gräf, Tiago; Ikuta, Nilo; Lehmann, Fernanda K M; Passos, Daniel T; Makiejczuk, Aline; Silveira, Marcos A T; Fonseca, André S K; Canal, Cláudio W; Lunge, Vagner R

    2016-07-01

    Canine distemper virus (CDV) is a highly contagious pathogen for domestic dogs and several wild carnivore species. In Brazil, natural infection of CDV in dogs is very high due to the large non-vaccinated dog population, a scenario that calls for new studies on the molecular epidemiology. This study investigates the phylodynamics and amino-acid signatures of CDV epidemic in South America by analyzing a large dataset compiled from publicly available sequences and also by collecting new samples from Brazil. A population of 175 dogs with canine distemper (CD) signs was sampled, from which 89 were positive for CDV, generating 42 new CDV sequences. Phylogenetic analysis of the new and publicly available sequences revealed that Brazilian sequences mainly clustered in South America 1 (SA1) clade, which has its origin estimated to the late 1980's. The reconstruction of the demographic history in SA1 clade showed an epidemic expanding until the recent years, doubling in size every nine years. SA1 clade epidemic distinguished from the world CDV epidemic by the emergence of the R580Q strain, a very rare and potentially detrimental substitution in the viral genome. The R580Q substitution was estimated to have happened in one single evolutionary step in the epidemic history in SA1 clade, emerging shortly after introduction to the continent. Moreover, a high prevalence (11.9%) of the Y549H mutation was observed among the domestic dogs sampled here. This finding was associated (p<0.05) with outcome-death and higher frequency in mixed-breed dogs, the later being an indicator of a continuous exchange of CDV strains circulating among wild carnivores and domestic dogs. The results reported here highlight the diversity of the worldwide CDV epidemic and reveal local features that can be valuable for combating the disease. Copyright © 2016 Elsevier B.V. All rights reserved.

  14. The adder (Vipera berus in Southern Altay Mountains: population characteristics, distribution, morphology and phylogenetic position

    Directory of Open Access Journals (Sweden)

    Shaopeng Cui

    2016-08-01

    Full Text Available As the most widely distributed snake in Eurasia, the adder (Vipera berus has been extensively investigated in Europe but poorly understood in Asia. The Southern Altay Mountains represent the adder’s southern distribution limit in Central Asia, whereas its population status has never been assessed. We conducted, for the first time, field surveys for the adder at two areas of Southern Altay Mountains using a combination of line transects and random searches. We also described the morphological characteristics of the collected specimens and conducted analyses of external morphology and molecular phylogeny. The results showed that the adder distributed in both survey sites and we recorded a total of 34 sightings. In Kanas river valley, the estimated encounter rate over a total of 137 km transects was 0.15 ± 0.05 sightings/km. The occurrence of melanism was only 17%. The small size was typical for the adders in Southern Altay Mountains in contrast to other geographic populations of the nominate subspecies. A phylogenetic tree obtained by Bayesian Inference based on DNA sequences of the mitochondrial cytochrome b (1,023 bp grouped them within the Northern clade of the species but failed to separate them from the subspecies V. b. sachalinensis. Our discovery extends the distribution range of V. berus and provides a basis for further researches. We discuss the hypothesis that the adder expands its distribution border to the southwest along the mountains’ elevation gradient, but the population abundance declines gradually due to a drying climate.

  15. Minimum variance rooting of phylogenetic trees and implications for species tree reconstruction.

    Science.gov (United States)

    Mai, Uyen; Sayyari, Erfan; Mirarab, Siavash

    2017-01-01

    Phylogenetic trees inferred using commonly-used models of sequence evolution are unrooted, but the root position matters both for interpretation and downstream applications. This issue has been long recognized; however, whether the potential for discordance between the species tree and gene trees impacts methods of rooting a phylogenetic tree has not been extensively studied. In this paper, we introduce a new method of rooting a tree based on its branch length distribution; our method, which minimizes the variance of root to tip distances, is inspired by the traditional midpoint rerooting and is justified when deviations from the strict molecular clock are random. Like midpoint rerooting, the method can be implemented in a linear time algorithm. In extensive simulations that consider discordance between gene trees and the species tree, we show that the new method is more accurate than midpoint rerooting, but its relative accuracy compared to using outgroups to root gene trees depends on the size of the dataset and levels of deviations from the strict clock. We show high levels of error for all methods of rooting estimated gene trees due to factors that include effects of gene tree discordance, deviations from the clock, and gene tree estimation error. Our simulations, however, did not reveal significant differences between two equivalent methods for species tree estimation that use rooted and unrooted input, namely, STAR and NJst. Nevertheless, our results point to limitations of existing scalable rooting methods.

  16. Phylogenetic climatic niche conservatism and evolution of climatic suitability in Neotropical Angraecinae (Vandeae, Orchidaceae) and their closest African relatives

    Czech Academy of Sciences Publication Activity Database

    Kolanowska, Marta; Grochocka, E.; Konowalik, K.

    2017-01-01

    Roč. 5, may (2017), č. článku e3328. ISSN 2167-8359 R&D Projects: GA ČR GB14-36098G Institutional support: RVO:86652079 Keywords : campylocentrum orchidaceae * molecular phylogenetics * environmental niches * costa-rica * diversity * models * speciation * ecology * pollination * divergence * Angraecinae * Ecological niche modeling * Orchidaceae * Phylogenetic niche conservatism * Angraecum * Campylocentrum * Dendrophylax Subject RIV: EH - Ecology, Behaviour OBOR OECD: Biodiversity conservation Impact factor: 2.177, year: 2016

  17. First phylogenetic analysis of Ehrlichia canis in dogs and ticks from Mexico. Preliminary study

    Directory of Open Access Journals (Sweden)

    Carolina G. Sosa-Gutiérrez

    2016-09-01

    Full Text Available Objective. Phylogenetic characterization of Ehrlichia canis in dogs naturally infected and ticks, diagnosed by PCR and sequencing of 16SrRNA gene; compare different isolates found in American countries. Materials and methods. Were collected Blood samples from 139 dogs with suggestive clinical manifestations of this disease and they were infested with ticks; part of 16SrRNA gene was sequenced and aligned, with 17 sequences reported in American countries. Two phylogenetic trees were constructed using the Maximum likelihood method, and Maximum parsimony. Results. They were positive to E. canis 25/139 (18.0% dogs and 29/139 (20.9% ticks. The clinical manifestations presented were fever, fatigue, depression and vomiting. Rhipicephalus sanguineus Dermacentor variabilis and Haemaphysalis leporis-palustris ticks were positive for E. canis. Phylogenetic analysis showed that the sequences of dogs and ticks in Mexico form a third group diverging of sequences from South America and USA. Conclusions. This is the first phylogenetic analysis of E. canis in Mexico. There are differences in the sequences of Mexico with those reported in South America and USA. This research lays the foundation for further study of genetic variability.

  18. The complete mitochondrial genome of Pallisentis celatus (Acanthocephala) with phylogenetic analysis of acanthocephalans and rotifers.

    Science.gov (United States)

    Pan, Ting Shuang; Nie, Pin

    2013-07-01

    Acanthocephalans are a small group of obligate endoparasites. They and rotifers are recently placed in a group called Syndermata. However, phylogenetic relationships within classes of acanthocephalans, and between them and rotifers, have not been well resolved, possibly due to the lack of molecular data suitable for such analysis. In this study, the mitochondrial (mt) genome was sequenced from Pallisentis celatus (Van Cleave, 1928), an acanthocephalan in the class Eoacanthocephala, an intestinal parasite of rice-field eel, Monopterus albus (Zuiew, 1793), in China. The complete mt genome sequence of P. celatus is 13 855 bp long, containing 36 genes including 12 protein-coding genes, 22 transfer RNAs (tRNAs) and 2 ribosomal RNAs (rRNAs) as reported for other acanthocephalan species. All genes are encoded on the same strand and in the same direction. Phylogenetic analysis indicated that acanthocephalans are closely related with a clade containing bdelloids, which then correlates with the clade containing monogononts. The class Eoacanthocephala, containing P. celatus and Paratenuisentis ambiguus (Van Cleave, 1921) was closely related to the Palaeacanthocephala. It is thus indicated that acanthocephalans may be just clustered among groups of rotifers. However, the resolving of phylogenetic relationship among all classes of acanthocephalans and between them and rotifers may require further sampling and more molecular data.

  19. Inferring 'weak spots' in phylogenetic trees: application to mosasauroid nomenclature.

    Science.gov (United States)

    Madzia, Daniel; Cau, Andrea

    2017-01-01

    Mosasauroid squamates represented the apex predators within the Late Cretaceous marine and occasionally also freshwater ecosystems. Proper understanding of the origin of their ecological adaptations or paleobiogeographic dispersals requires adequate knowledge of their phylogeny. The studies assessing the position of mosasauroids on the squamate evolutionary tree and their origins have long given conflicting results. The phylogenetic relationships within Mosasauroidea, however, have experienced only little changes throughout the last decades. Considering the substantial improvements in the development of phylogenetic methodology that have undergone in recent years, resulting, among others, in numerous alterations in the phylogenetic hypotheses of other fossil amniotes, we test the robustness in our understanding of mosasauroid beginnings and their evolutionary history. We re-examined a data set that results from modifications assembled in the course of the last 20 years and performed multiple parsimony analyses and Bayesian tip-dating analysis. Following the inferred topologies and the 'weak spots' in the phylogeny of mosasauroids, we revise the nomenclature of the 'traditionally' recognized mosasauroid clades, to acknowledge the overall weakness among branches and the alternative topologies suggested previously, and discuss several factors that might have an impact on the differing phylogenetic hypotheses and their statistical support.

  20. On Nakhleh's metric for reduced phylogenetic networks

    OpenAIRE

    Cardona, Gabriel; Llabrés, Mercè; Rosselló, Francesc; Valiente Feruglio, Gabriel Alejandro

    2009-01-01

    We prove that Nakhleh’s metric for reduced phylogenetic networks is also a metric on the classes of tree-child phylogenetic networks, semibinary tree-sibling time consistent phylogenetic networks, and multilabeled phylogenetic trees. We also prove that it separates distinguishable phylogenetic networks. In this way, it becomes the strongest dissimilarity measure for phylogenetic networks available so far. Furthermore, we propose a generalization of that metric that separates arbitrary phyl...

  1. The Phylogenetic Significance of Fruit Structural Variation in the Tribe Heteromorpheae (Apiaceae)

    International Nuclear Information System (INIS)

    Liu, M.; Lowry, P. P.; Magee, A. R.

    2016-01-01

    Fruit structure of Apiaceae was studied in 19 species representing the 10 genera of the tribe Heteromorpheae. Our results indicate this group has a woody habit, simple leaves, heteromorphic mericarps with lateral wings. fruits with bottle-shaped or bulging epidermal cells which have thickened and cutinized outer wall, regular vittae (one in furrow and two in commissure) and irregular vittae (short, dwarf, or branching and anatosmosing), and dispersed druse crystals. However, lateral winged mericarps, bottle-shaped epidermal cells, and branching and anatosmosing vittae are peculiar in the tribe Heteromorpheae of Apioideae sub family. Although many features share with other early-diverging groups of Apiaceae, including Annesorhiza clade, Saniculoideae sensu lato, Azorelloideae, Mackinlayoideae, as well as with Araliaceae. Our study shows that fruit anatomy can be used to define the tribe by molecular phylogenetic studies and support that Heteromorpheae are close to Annesorhiza clade and both are placed in the basal position of Apioideae. (author)

  2. On the phylogenetic position of Pseudophilomedinae within Sarsielloidea (Ostracoda, Myodocopida), with a description of one new Harbansus from Ningaloo Reef and redescription of H. paucichelatus from Yucatan

    Science.gov (United States)

    Karanovic, Ivana; Orduña-Martínez, Lorena; Ardisson, Pedro-Luis

    2015-03-01

    Previous studies have suggested incongruence between current systematics and molecular phylogenies of Sarsielloidea, with a possible polyphyly of the family Philomedidae. Here, we provide molecular phylogenetic analyses based on 18S rDNA and 28S rDNA. The former includes five new sequences and 12 from the GenBank, and the latter two new and six sequences from the GenBank. We use three methods, maximum likelihood, maximum parsimony, and neighbor joining, and all reconstructed phylogenies support previously suggested polyphyly, indicating a closer relationship of the subfamily Pseudophilomedinae with one subfamily of Sarsiellidae than with the nominotypical subfamily of Philomedidae. Morphological characters that may be key indicators of the phylogenetic relationships between three Sarsielloidea families are discussed. We also describe the 21st representative of the Pseudophilomedinae genus, Harbansus Kornicker, (Smith Contrib Zool 260:75, 1978), Harbansus ningalooi n. sp., from the Ningaloo Reef, Western Australia. This is the first Harbansus reported from the Australian west coast and the second from the Australian coral reef systems. It differs from all other congeners by peculiar claw-like processes on the posterior infold. Most Harbansus species have relatively restricted distributions, except Harbansus paucichelatus (Kornicker, in Inst Mar Sci 5:195-300, 1958), which has also been postulated to represent a species complex. We present a detailed morphological redescription of this species, based on the freshly collected material from the Yucatan Peninsula, as well as four mitochondrial COI sequences. These become the first COI sequences of the entire superfamily Sarsielloidea available on the GenBank. To facilitate future identification, we include a key to species of Harbansus.

  3. Combining phylogenomics and fossils in higher-level squamate reptile phylogeny: molecular data change the placement of fossil taxa.

    Science.gov (United States)

    Wiens, John J; Kuczynski, Caitlin A; Townsend, Ted; Reeder, Tod W; Mulcahy, Daniel G; Sites, Jack W

    2010-12-01

    Molecular data offer great potential to resolve the phylogeny of living taxa but can molecular data improve our understanding of relationships of fossil taxa? Simulations suggest that this is possible, but few empirical examples have demonstrated the ability of molecular data to change the placement of fossil taxa. We offer such an example here. We analyze the placement of snakes among squamate reptiles, combining published morphological data (363 characters) and new DNA sequence data (15,794 characters, 22 nuclear loci) for 45 living and 19 fossil taxa. We find several intriguing results. First, some fossil taxa undergo major changes in their phylogenetic position when molecular data are added. Second, most fossil taxa are placed with strong support in the expected clades by the combined data Bayesian analyses, despite each having >98% missing cells and despite recent suggestions that extensive missing data are problematic for Bayesian phylogenetics. Third, morphological data can change the placement of living taxa in combined analyses, even when there is an overwhelming majority of molecular characters. Finally, we find strong but apparently misleading signal in the morphological data, seemingly associated with a burrowing lifestyle in snakes, amphisbaenians, and dibamids. Overall, our results suggest promise for an integrated and comprehensive Tree of Life by combining molecular and morphological data for living and fossil taxa.

  4. A DNA-Based Assessment of the Phylogenetic Position of a Morphologically Distinct, Anchialine-Lake-Restricted Seahorse.

    Science.gov (United States)

    Rose, Emily; Masonjones, Heather D; Jones, Adam G

    2016-11-01

    Isolated populations provide special opportunities to study local adaptation and incipient speciation. In some cases, however, morphological evolution can obscure the taxonomic status of recently founded populations. Here, we use molecular markers to show that an anchialine-lake-restricted population of seahorses, originally identified as Hippocampus reidi, appears on the basis of DNA data to be Hippocampus erectus We collected seahorses from Sweetings Pond, on Eleuthera Island, Bahamas, during the summer of 2014. We measured morphological traits and sequenced 2 genes, cytochrome b and ribosomal protein S7, from 19 seahorses in our sample. On the basis of morphology, Sweetings Pond seahorses could not be assigned definitively to either of the 2 species of seahorse, H. reidi and H. erectus, that occur in marine waters surrounding the Bahamas. However, our DNA-based phylogenetic analysis showed that the Sweetings Pond fish were firmly nested within the H. erectus clade with a Bayesian posterior probability greater than 0.99. Thus, Sweetings Pond seahorses most recently shared a common ancestor with H. erectus populations from the Western Atlantic. Interestingly, the seahorses from Sweetings Pond differ morphologically from other marine populations of H. erectus in having a more even torso to tail length ratio. The substantial habitat differences between Sweetings Pond and the surrounding coastal habitat make Sweetings Pond seahorses particularly interesting from the perspectives of conservation, local adaptation, and incipient speciation. © The American Genetic Association 2016. All rights reserved. For permissions, please e-mail: journals.permissions@oup.com.

  5. Transforming phylogenetic networks: Moving beyond tree space.

    Science.gov (United States)

    Huber, Katharina T; Moulton, Vincent; Wu, Taoyang

    2016-09-07

    Phylogenetic networks are a generalization of phylogenetic trees that are used to represent reticulate evolution. Unrooted phylogenetic networks form a special class of such networks, which naturally generalize unrooted phylogenetic trees. In this paper we define two operations on unrooted phylogenetic networks, one of which is a generalization of the well-known nearest-neighbor interchange (NNI) operation on phylogenetic trees. We show that any unrooted phylogenetic network can be transformed into any other such network using only these operations. This generalizes the well-known fact that any phylogenetic tree can be transformed into any other such tree using only NNI operations. It also allows us to define a generalization of tree space and to define some new metrics on unrooted phylogenetic networks. To prove our main results, we employ some fascinating new connections between phylogenetic networks and cubic graphs that we have recently discovered. Our results should be useful in developing new strategies to search for optimal phylogenetic networks, a topic that has recently generated some interest in the literature, as well as for providing new ways to compare networks. Copyright © 2016 Elsevier Ltd. All rights reserved.

  6. Highly pathogenic avian influenza virus subtype H5N1 in Africa: a comprehensive phylogenetic analysis and molecular characterization of isolates.

    Directory of Open Access Journals (Sweden)

    Giovanni Cattoli

    Full Text Available Highly pathogenic avian influenza virus A/H5N1 was first officially reported in Africa in early 2006. Since the first outbreak in Nigeria, this virus spread rapidly to other African countries. From its emergence to early 2008, 11 African countries experienced A/H5N1 outbreaks in poultry and human cases were also reported in three of these countries. At present, little is known of the epidemiology and molecular evolution of A/H5N1 viruses in Africa. We have generated 494 full gene sequences from 67 African isolates and applied molecular analysis tools to a total of 1,152 A/H5N1 sequences obtained from viruses isolated in Africa, Europe and the Middle East between 2006 and early 2008. Detailed phylogenetic analyses of the 8 gene viral segments confirmed that 3 distinct sublineages were introduced, which have persisted and spread across the continent over this 2-year period. Additionally, our molecular epidemiological studies highlighted the association between genetic clustering and area of origin in a majority of cases. Molecular signatures unique to strains isolated in selected areas also gave us a clearer picture of the spread of A/H5N1 viruses across the continent. Mutations described as typical of human influenza viruses in the genes coding for internal proteins or associated with host adaptation and increased resistance to antiviral drugs have also been detected in the genes coding for transmembrane proteins. These findings raise concern for the possible human health risk presented by viruses with these genetic properties and highlight the need for increased efforts to monitor the evolution of A/H5N1 viruses across the African continent. They further stress how imperative it is to implement sustainable control strategies to improve animal and public health at a global level.

  7. Functional and phylogenetic ecology in R

    CERN Document Server

    Swenson, Nathan G

    2014-01-01

    Functional and Phylogenetic Ecology in R is designed to teach readers to use R for phylogenetic and functional trait analyses. Over the past decade, a dizzying array of tools and methods were generated to incorporate phylogenetic and functional information into traditional ecological analyses. Increasingly these tools are implemented in R, thus greatly expanding their impact. Researchers getting started in R can use this volume as a step-by-step entryway into phylogenetic and functional analyses for ecology in R. More advanced users will be able to use this volume as a quick reference to understand particular analyses. The volume begins with an introduction to the R environment and handling relevant data in R. Chapters then cover phylogenetic and functional metrics of biodiversity; null modeling and randomizations for phylogenetic and functional trait analyses; integrating phylogenetic and functional trait information; and interfacing the R environment with a popular C-based program. This book presents a uni...

  8. Molecular phylogenetics, historical biogeography, and chromosome number evolution of Portulaca (Portulacaceae).

    Science.gov (United States)

    Ocampo, Gilberto; Columbus, J Travis

    2012-04-01

    Portulaca is the only genus in Portulacaceae and has ca. 100 species distributed worldwide, mainly in the tropics and subtropics. Molecular data place the genus as one of the closest relatives of Cactaceae, but phylogenetic relationships within Portulaca are barely known. This study samples 59 species of Portulaca, 10 infraspecific taxa, and three cultivars, including multiple samples of widespread species. The sampled taxa represent all subgenera in the classifications of von Poellnitz (1934), Legrand (1958), and Geesink (1969) and come from around the world. Nuclear ITS and chloroplast ndhF, trnT-psbD intergenic spacer, and ndhA intron DNA sequences were analyzed using maximum likelihood and Bayesian methods to produce a hypothesis of relationships within Portulaca. Divergence times were estimated using Hawaiian endemics for calibration, and biogeographical patterns were examined using a Bayes-DIVA approach. In addition, the evolution of chromosome numbers in the genus was investigated using probabilistic models. The analyses strongly support the monophyly of Portulaca, with an age of the most recent common ancestor (MRCA) of 23 Myr. Within Portulaca are two major lineages: the OL clade (comprising opposite-leaved species) distributed in Africa, Asia, and Australia, and the AL clade (comprising alternate to subopposite-leaved species), which is more widespread and originated in the New World. Sedopsis, a genus sometimes recognized as distinct from Portulaca based on a long corolla tube, is nested within the OL clade and does not merit taxonomic recognition. Samples of Portulaca grandiflora, Portulaca halimoides, and Portulaca oleracea were found to be non-monophyletic. It is hypothesized that the ancestral distribution area of Portulaca included southern hemisphere continents and Asia. The OL clade remained restricted to the Old World (except Portulaca quadrifida, a pantropical weed), while the AL clade, with a South American origin, was able to disperse multiple

  9. A Molecular Phylogeny of Hemiptera Inferred from Mitochondrial Genome Sequences

    Science.gov (United States)

    Song, Nan; Liang, Ai-Ping; Bu, Cui-Ping

    2012-01-01

    Classically, Hemiptera is comprised of two suborders: Homoptera and Heteroptera. Homoptera includes Cicadomorpha, Fulgoromorpha and Sternorrhyncha. However, according to previous molecular phylogenetic studies based on 18S rDNA, Fulgoromorpha has a closer relationship to Heteroptera than to other hemipterans, leaving Homoptera as paraphyletic. Therefore, the position of Fulgoromorpha is important for studying phylogenetic structure of Hemiptera. We inferred the evolutionary affiliations of twenty-five superfamilies of Hemiptera using mitochondrial protein-coding genes and rRNAs. We sequenced three mitogenomes, from Pyrops candelaria, Lycorma delicatula and Ricania marginalis, representing two additional families in Fulgoromorpha. Pyrops and Lycorma are representatives of an additional major family Fulgoridae in Fulgoromorpha, whereas Ricania is a second representative of the highly derived clade Ricaniidae. The organization and size of these mitogenomes are similar to those of the sequenced fulgoroid species. Our consensus phylogeny of Hemiptera largely supported the relationships (((Fulgoromorpha,Sternorrhyncha),Cicadomorpha),Heteroptera), and thus supported the classic phylogeny of Hemiptera. Selection of optimal evolutionary models (exclusion and inclusion of two rRNA genes or of third codon positions of protein-coding genes) demonstrated that rapidly evolving and saturated sites should be removed from the analyses. PMID:23144967

  10. A molecular phylogeny of Hemiptera inferred from mitochondrial genome sequences.

    Directory of Open Access Journals (Sweden)

    Nan Song

    Full Text Available Classically, Hemiptera is comprised of two suborders: Homoptera and Heteroptera. Homoptera includes Cicadomorpha, Fulgoromorpha and Sternorrhyncha. However, according to previous molecular phylogenetic studies based on 18S rDNA, Fulgoromorpha has a closer relationship to Heteroptera than to other hemipterans, leaving Homoptera as paraphyletic. Therefore, the position of Fulgoromorpha is important for studying phylogenetic structure of Hemiptera. We inferred the evolutionary affiliations of twenty-five superfamilies of Hemiptera using mitochondrial protein-coding genes and rRNAs. We sequenced three mitogenomes, from Pyrops candelaria, Lycorma delicatula and Ricania marginalis, representing two additional families in Fulgoromorpha. Pyrops and Lycorma are representatives of an additional major family Fulgoridae in Fulgoromorpha, whereas Ricania is a second representative of the highly derived clade Ricaniidae. The organization and size of these mitogenomes are similar to those of the sequenced fulgoroid species. Our consensus phylogeny of Hemiptera largely supported the relationships (((Fulgoromorpha,Sternorrhyncha,Cicadomorpha,Heteroptera, and thus supported the classic phylogeny of Hemiptera. Selection of optimal evolutionary models (exclusion and inclusion of two rRNA genes or of third codon positions of protein-coding genes demonstrated that rapidly evolving and saturated sites should be removed from the analyses.

  11. Host-range phylogenetic grouping of capripoxviruses. Genetic typing of CaPVs

    International Nuclear Information System (INIS)

    Le Goff, C.; Chadeyras, A.; Libeau, G.; Albina, E.; Fakhfakh, E.; Hammami, S.; Elexpeter Aba Adulugba; Diallo, A.

    2005-01-01

    Because of their close relationship, specific identification of the CaPVs genus inside the Poxviridae family relies mainly on molecular tools rather than on classical serology. We describe the suitability of the G protein-coupled chemokine receptor (GPCR), for host range phylogenetic grouping. The analysis of 26 CaPVs shows 3 tight genetic clusters consisting of goatpox virus (GPV), lumpy skin disease virus (LSDV), and sheeppox virus (SPV). (author)

  12. A format for phylogenetic placements.

    Directory of Open Access Journals (Sweden)

    Frederick A Matsen

    Full Text Available We have developed a unified format for phylogenetic placements, that is, mappings of environmental sequence data (e.g., short reads into a phylogenetic tree. We are motivated to do so by the growing number of tools for computing and post-processing phylogenetic placements, and the lack of an established standard for storing them. The format is lightweight, versatile, extensible, and is based on the JSON format, which can be parsed by most modern programming languages. Our format is already implemented in several tools for computing and post-processing parsimony- and likelihood-based phylogenetic placements and has worked well in practice. We believe that establishing a standard format for analyzing read placements at this early stage will lead to a more efficient development of powerful and portable post-analysis tools for the growing applications of phylogenetic placement.

  13. Phylogenetic inertia and Darwin's higher law.

    Science.gov (United States)

    Shanahan, Timothy

    2011-03-01

    The concept of 'phylogenetic inertia' is routinely deployed in evolutionary biology as an alternative to natural selection for explaining the persistence of characteristics that appear sub-optimal from an adaptationist perspective. However, in many of these contexts the precise meaning of 'phylogenetic inertia' and its relationship to selection are far from clear. After tracing the history of the concept of 'inertia' in evolutionary biology, I argue that treating phylogenetic inertia and natural selection as alternative explanations is mistaken because phylogenetic inertia is, from a Darwinian point of view, simply an expected effect of selection. Although Darwin did not discuss 'phylogenetic inertia,' he did assert the explanatory priority of selection over descent. An analysis of 'phylogenetic inertia' provides a perspective from which to assess Darwin's view. Copyright © 2010 Elsevier Ltd. All rights reserved.

  14. Evaluation of atpB nucleotide sequences for phylogenetic studies of ferns and other pteridophytes.

    Science.gov (United States)

    Wolf, P

    1997-10-01

    Inferring basal relationships among vascular plants poses a major challenge to plant systematists. The divergence events that describe these relationships occurred long ago and considerable homoplasy has since accrued for both molecular and morphological characters. A potential solution is to examine phylogenetic analyses from multiple data sets. Here I present a new source of phylogenetic data for ferns and other pteridophytes. I sequenced the chloroplast gene atpB from 23 pteridophyte taxa and used maximum parsimony to infer relationships. A 588-bp region of the gene appeared to contain a statistically significant amount of phylogenetic signal and the resulting trees were largely congruent with similar analyses of nucleotide sequences from rbcL. However, a combined analysis of atpB plus rbcL produced a better resolved tree than did either data set alone. In the shortest trees, leptosporangiate ferns formed a monophyletic group. Also, I detected a well-supported clade of Psilotaceae (Psilotum and Tmesipteris) plus Ophioglossaceae (Ophioglossum and Botrychium). The demonstrated utility of atpB suggests that sequences from this gene should play a role in phylogenetic analyses that incorporate data from chloroplast genes, nuclear genes, morphology, and fossil data.

  15. Photic niche invasions: phylogenetic history of the dim-light foraging augochlorine bees (Halictidae).

    Science.gov (United States)

    Tierney, Simon M; Sanjur, Oris; Grajales, Grethel G; Santos, Leandro M; Bermingham, Eldredge; Wcislo, William T

    2012-02-22

    Most bees rely on flowering plants and hence are diurnal foragers. From this ancestral state, dim-light foraging in bees requires significant adaptations to a new photic environment. We used DNA sequences to evaluate the phylogenetic history of the most diverse clade of Apoidea that is adapted to dim-light environments (Augochlorini: Megalopta, Megaloptidia and Megommation). The most speciose lineage, Megalopta, is distal to the remaining dim-light genera, and its closest diurnal relative (Xenochlora) is recovered as a lineage that has secondarily reverted to diurnal foraging. Tests for adaptive protein evolution indicate that long-wavelength opsin shows strong evidence of stabilizing selection, with no more than five codons (2%) under positive selection, depending on analytical procedure. In the branch leading to Megalopta, the amino acid of the single positively selected codon is conserved among ancestral Halictidae examined, and is homologous to codons known to influence molecular structure at the chromophore-binding pocket. Theoretically, such mutations can shift photopigment λ(max) sensitivity and enable visual transduction in alternate photic environments. Results are discussed in light of the available evidence on photopigment structure, morphological specialization and biogeographic distributions over geological time.

  16. Molecular taxonomy provides new insights into anopheles species of the neotropical arribalzagia series.

    Directory of Open Access Journals (Sweden)

    Giovan F Gómez

    Full Text Available Phylogenetic analysis of partial mitochondrial cytochrome oxidase c subunit I (COI and nuclear internal transcribed spacer 2 (ITS2 sequences were used to evaluate initial identification and to investigate phylogenetic relationships of seven Anopheles morphospecies of the Arribalzagia Series from Colombia. Phylogenetic trees recovered highly supported clades for An. punctimaculas.s., An. calderoni, An. malefactor s.l., An. neomaculipalpus, An. apicimacula s.l., An. mattogrossensis and An. peryassui. This study provides the first molecular confirmation of An. malefactorfrom Colombia and discovered conflicting patterns of divergence for the molecular markers among specimens from northeast and northern Colombia suggesting the presence of two previously unrecognized Molecular Operational Taxonomic Units (MOTUs. Furthermore, two highly differentiated An. apicimacula MOTUs previously found in Panama were detected. Overall, the combined molecular dataset facilitated the detection of known and new Colombian evolutionary lineages, and constitutes the baseline for future research on their bionomics, ecology and potential role as malaria vectors.

  17. An outbreak of Leishmania major from an endemic to a non-endemic region posed a public health threat in Iraq from 2014-2017: Epidemiological, molecular and phylogenetic studies.

    Directory of Open Access Journals (Sweden)

    Mariwan M M Al-Bajalan

    2018-03-01

    Full Text Available Cutaneous leishmaniasis (CL is a neglected worldwide, zoonotic, vector-borne, tropical disease that is a threat to public health. This threat may spread from endemic to non-endemic areas. Current research has exploited epidemiological, molecular and phylogenetical studies to determine the danger of an outbreak of CL in the borderline area between northern and central Iraq from 2014-2017.For the first time, using sequence analysis of the cytochrome b gene, the occurrence of CL in the borderline area between northern and central Iraq was confirmed to be due to Leishmania major. The phylogenetic analysis indicated that it was closely related to the L. major MRHO/IR/75/ER strain in Iran.In conclusion, the genotype confirmation of the L. major strain will improve our understanding of the epidemiology of the disease. This is important for facilitating control programs to prevent the further spread of CL. Furthermore, this area could be considered as a model for further research on the risk of global CL epidemics in other non-endemic countries where both reservoir hosts and sandfly vectors are present.

  18. An outbreak of Leishmania major from an endemic to a non-endemic region posed a public health threat in Iraq from 2014-2017: Epidemiological, molecular and phylogenetic studies.

    Science.gov (United States)

    Al-Bajalan, Mariwan M M; Al-Jaf, Sirwan M A; Niranji, Sherko S; Abdulkareem, Dler R; Al-Kayali, Khudhair K; Kato, Hirotomo

    2018-03-01

    Cutaneous leishmaniasis (CL) is a neglected worldwide, zoonotic, vector-borne, tropical disease that is a threat to public health. This threat may spread from endemic to non-endemic areas. Current research has exploited epidemiological, molecular and phylogenetical studies to determine the danger of an outbreak of CL in the borderline area between northern and central Iraq from 2014-2017. For the first time, using sequence analysis of the cytochrome b gene, the occurrence of CL in the borderline area between northern and central Iraq was confirmed to be due to Leishmania major. The phylogenetic analysis indicated that it was closely related to the L. major MRHO/IR/75/ER strain in Iran. In conclusion, the genotype confirmation of the L. major strain will improve our understanding of the epidemiology of the disease. This is important for facilitating control programs to prevent the further spread of CL. Furthermore, this area could be considered as a model for further research on the risk of global CL epidemics in other non-endemic countries where both reservoir hosts and sandfly vectors are present.

  19. The transposition distance for phylogenetic trees

    OpenAIRE

    Rossello, Francesc; Valiente, Gabriel

    2006-01-01

    The search for similarity and dissimilarity measures on phylogenetic trees has been motivated by the computation of consensus trees, the search by similarity in phylogenetic databases, and the assessment of clustering results in bioinformatics. The transposition distance for fully resolved phylogenetic trees is a recent addition to the extensive collection of available metrics for comparing phylogenetic trees. In this paper, we generalize the transposition distance from fully resolved to arbi...

  20. Phylogenetic Trees From Sequences

    Science.gov (United States)

    Ryvkin, Paul; Wang, Li-San

    In this chapter, we review important concepts and approaches for phylogeny reconstruction from sequence data.We first cover some basic definitions and properties of phylogenetics, and briefly explain how scientists model sequence evolution and measure sequence divergence. We then discuss three major approaches for phylogenetic reconstruction: distance-based phylogenetic reconstruction, maximum parsimony, and maximum likelihood. In the third part of the chapter, we review how multiple phylogenies are compared by consensus methods and how to assess confidence using bootstrapping. At the end of the chapter are two sections that list popular software packages and additional reading.

  1. Phylogenetic trends in phenolic metabolism of milkweeds (Asclepias): evidence for escalation.

    Science.gov (United States)

    Agrawal, Anurag A; Salminen, Juha-Pekka; Fishbein, Mark

    2009-03-01

    Although plant-defense theory has long predicted patterns of chemical defense across taxa, we know remarkably little about the evolution of defense, especially in the context of directional phylogenetic trends. Here we contrast the production of phenolics and cardenolides in 35 species of milkweeds (Asclepias and Gomphocarpus). Maximum-likelihood analyses of character evolution revealed three major patterns. First, consistent with the defense-escalation hypothesis, the diversification of the milkweeds was associated with a trend for increasing phenolic production; this pattern was reversed (a declining evolutionary trend) for cardenolides, toxins sequestered by specialist herbivores. Second, phylogenetically independent correlations existed among phenolic classes across species. For example, coumaric acid derivatives showed negatively correlated evolution with caffeic acid derivatives, and this was likely driven by the fact that the former are used as precursors for the latter. In contrast, coumaric acid derivatives were positively correlated with flavonoids, consistent with competition for the precursor p-coumaric acid. Finally, of the phenolic classes, only flavonoids showed correlated evolution (positive) with cardenolides, consistent with a physiological and evolutionary link between the two via malonate. Thus, this study presents a rigorous test of the defense-escalation hypothesis and a novel phylogenetic approach to understanding the long-term persistence of physiological constraints on secondary metabolism.

  2. The phylogenetic likelihood library.

    Science.gov (United States)

    Flouri, T; Izquierdo-Carrasco, F; Darriba, D; Aberer, A J; Nguyen, L-T; Minh, B Q; Von Haeseler, A; Stamatakis, A

    2015-03-01

    We introduce the Phylogenetic Likelihood Library (PLL), a highly optimized application programming interface for developing likelihood-based phylogenetic inference and postanalysis software. The PLL implements appropriate data structures and functions that allow users to quickly implement common, error-prone, and labor-intensive tasks, such as likelihood calculations, model parameter as well as branch length optimization, and tree space exploration. The highly optimized and parallelized implementation of the phylogenetic likelihood function and a thorough documentation provide a framework for rapid development of scalable parallel phylogenetic software. By example of two likelihood-based phylogenetic codes we show that the PLL improves the sequential performance of current software by a factor of 2-10 while requiring only 1 month of programming time for integration. We show that, when numerical scaling for preventing floating point underflow is enabled, the double precision likelihood calculations in the PLL are up to 1.9 times faster than those in BEAGLE. On an empirical DNA dataset with 2000 taxa the AVX version of PLL is 4 times faster than BEAGLE (scaling enabled and required). The PLL is available at http://www.libpll.org under the GNU General Public License (GPL). © The Author(s) 2014. Published by Oxford University Press, on behalf of the Society of Systematic Biologists.

  3. Locating a tree in a phylogenetic network

    NARCIS (Netherlands)

    Iersel, van L.J.J.; Semple, C.; Steel, M.A.

    2010-01-01

    Phylogenetic trees and networks are leaf-labelled graphs that are used to describe evolutionary histories of species. The Tree Containment problem asks whether a given phylogenetic tree is embedded in a given phylogenetic network. Given a phylogenetic network and a cluster of species, the Cluster

  4. Phylogenetic footprint of the plant clock system in angiosperms: evolutionary processes of Pseudo-Response Regulators

    Directory of Open Access Journals (Sweden)

    Saito Shigeru

    2010-05-01

    Full Text Available Abstract Background Plant circadian clocks regulate many photoperiodic and diurnal responses that are conserved among plant species. The plant circadian clock system has been uncovered in the model plant, Arabidopsis thaliana, using genetics and systems biology approaches. However, it is still not clear how the clock system had been organized in the evolutionary history of plants. We recently revealed the molecular phylogeny of LHY/CCA1 genes, one of the essential components of the clock system. The aims of this study are to reconstruct the phylogenetic relationships of angiosperm clock-associated PRR genes, the partner of the LHY/CCA1 genes, and to clarify the evolutionary history of the plant clock system in angiosperm lineages. Results In the present study, to investigate the molecular phylogeny of PRR genes, we performed two approaches: reconstruction of phylogenetic trees and examination of syntenic relationships. Phylogenetic analyses revealed that PRR genes had diverged into three clades prior to the speciation of monocots and eudicots. Furthermore, copy numbers of PRR genes have been independently increased in monocots and eudicots as a result of ancient chromosomal duplication events. Conclusions Based on the molecular phylogenies of both PRR genes and LHY/CCA1 genes, we inferred the evolutionary process of the plant clock system in angiosperms. This scenario provides evolutionary information that a common ancestor of monocots and eudicots had retained the basic components required for reconstructing a clock system and that the plant circadian clock may have become a more elaborate mechanism after the speciation of monocots and eudicots because of the gene expansion that resulted from polyploidy events.

  5. Evolutionary history determines how plant productivity responds to phylogenetic diversity and species richness

    Directory of Open Access Journals (Sweden)

    Mark A. Genung

    2014-03-01

    Full Text Available The relationship between biodiversity and ecosystem function has received a great deal of attention in ecological research and recent results, from re-analyses, suggest that ecosystem function improves with increases in phylogenetic diversity. However, many of these results have been generalized across a range of different species and clades, and plants with different evolutionary histories could display different relationships between biodiversity and ecosystem function. To experimentally test this hypothesis, we manipulated species richness and phylogenetic diversity using 26 species from two subgenera of the genus Eucalyptus (subgenus Eucalyptus and subgenus Symphyomyrtus. We found that plant biomass (a measurement of ecosystem function sometimes, but not always, responded to increases in species richness and phylogenetic diversity. Specifically, Symphyomyrtus plants showed a positive response while no comparable effect was observed for Eucalyptus plants, showing that responses to biodiversity can vary across different phylogenetic groups. Our results show that the impacts of evolutionary history may complicate the relationship between the diversity of plant communities and plant biomass.

  6. Molecular prevalence and characterization of Hepatozoon ursi infection in Indian sloth bears (Melursus ursinus).

    Science.gov (United States)

    Pawar, Rahul Mohanchandra; Poornachandar, Anantula; Arun, Attur Shanmugam; Manikandan, Santhanam; Shivaji, Sisinthy

    2011-12-15

    Hepatozoon species are parasites that infect a wide variety of domestic and wild animals. The objective of the study was to detect the occurrence of Hepatozoon ursi in Indian sloth bears and to characterize the parasite based on phylogenetic analysis of the partial 18S rRNA gene sequence. Hepatozoon infection could be detected in 38 (70%) out of fifty-four blood samples of Indian sloth bears (captive and wild), suggestive of high prevalence of Hepatozoon infection in Indian sloth bears. Sequencing of partial 18S rRNA gene of the positive samples and BLAST analysis indicated that the nearest phylogenetic neighbour was H. ursi with which they exhibited 99-100% similarity. Additionally, Hepatozoon sp. isolated from wild sloth bears of India were identical to those in captive sloth bears and phylogenetically related to H. ursi reported from Japanese black bears from Japan. To our knowledge, this is the first report on the molecular characterization of H. ursi infection in Indian sloth bears. Copyright © 2011 Elsevier B.V. All rights reserved.

  7. The phylogenetic significance of leaf anatomical traits of southern African Oxalis

    Czech Academy of Sciences Publication Activity Database

    Jooste, M.; Dreyer, L. L.; Oberlander, Kenneth

    2016-01-01

    Roč. 16, č. 1 (2016), s. 1-19, č. článku 225. ISSN 1471-2148 Institutional support: RVO:67985939 Keywords : ancestral state reconstruction * eEpistomaty * leaf anatomy * stomatal position * phylogenetics Subject RIV: EF - Botanics Impact factor: 3.221, year: 2016

  8. Complex phylogenetic placement of ilex species (aquifoliaceae): a case study of molecular phylogeny

    International Nuclear Information System (INIS)

    Yi, F.; Sun, L.; Xiao, P.G.; Hao, D.C.

    2017-01-01

    To investigate the phylogenetic relationships among Ilex species distributed in China, we analyzed two alignments including 4,698 characters corresponding to six plastid sequences (matK, rbcL, atpB-rbcL, trnL-F, psbA-trnH, and rpl32-trnL) and 1,748 characters corresponding to two nuclear sequences (ITS and nepGS). Using different partitioning strategies and approaches (i.e., Bayesian inference, maximum likelihood, and maximum parsimony) for phylogeny reconstruction, different topologies and clade supports were determined. A total of 18 Ilex species was divided into two major groups (group I and II) in both plastid and nuclear phylogenies with some incongruences. Potential hybridization events may account, in part, for those phylogenetic uncertainties. The analyses, together with previously identified sequences, indicated that all 18 species were recovered within Eurasia or Asia/North America groups based on plastid data. Meanwhile, the species in group II in the nuclear phylogeny were placed in the Aquifolium clade, as inferred from traditional classification, whereas the species in group I belonged to several other clades. The divergence time of most of the 18 Ilex species was estimated to be not more than 10 million years ago. Based on the results of this study, we concluded that paleogeographical events and past climate changes during the same period might have played important roles in these diversifications. (author)

  9. Molecular phylogenetic implications in Brassica napus based on ...

    Indian Academy of Sciences (India)

    Brassica napus L. (canola, rapeseed) is one of the most important oil crops in many countries (Abdelmigid 2012;. Fayyaz et al. 2014), and thought to have originated from a cross where the maternal donor was closely related to two diploid species, B. oleracea (CC, 2n = 18) and B. rapa (AA, 2n = 20). Here, molecular ...

  10. Locating a tree in a phylogenetic network

    OpenAIRE

    van Iersel, Leo; Semple, Charles; Steel, Mike

    2010-01-01

    Phylogenetic trees and networks are leaf-labelled graphs that are used to describe evolutionary histories of species. The Tree Containment problem asks whether a given phylogenetic tree is embedded in a given phylogenetic network. Given a phylogenetic network and a cluster of species, the Cluster Containment problem asks whether the given cluster is a cluster of some phylogenetic tree embedded in the network. Both problems are known to be NP-complete in general. In this article, we consider t...

  11. Nonbinary tree-based phylogenetic networks

    OpenAIRE

    Jetten, Laura; van Iersel, Leo

    2016-01-01

    Rooted phylogenetic networks are used to describe evolutionary histories that contain non-treelike evolutionary events such as hybridization and horizontal gene transfer. In some cases, such histories can be described by a phylogenetic base-tree with additional linking arcs, which can for example represent gene transfer events. Such phylogenetic networks are called tree-based. Here, we consider two possible generalizations of this concept to nonbinary networks, which we call tree-based and st...

  12. Encoding phylogenetic trees in terms of weighted quartets.

    Science.gov (United States)

    Grünewald, Stefan; Huber, Katharina T; Moulton, Vincent; Semple, Charles

    2008-04-01

    One of the main problems in phylogenetics is to develop systematic methods for constructing evolutionary or phylogenetic trees. For a set of species X, an edge-weighted phylogenetic X-tree or phylogenetic tree is a (graph theoretical) tree with leaf set X and no degree 2 vertices, together with a map assigning a non-negative length to each edge of the tree. Within phylogenetics, several methods have been proposed for constructing such trees that work by trying to piece together quartet trees on X, i.e. phylogenetic trees each having four leaves in X. Hence, it is of interest to characterise when a collection of quartet trees corresponds to a (unique) phylogenetic tree. Recently, Dress and Erdös provided such a characterisation for binary phylogenetic trees, that is, phylogenetic trees all of whose internal vertices have degree 3. Here we provide a new characterisation for arbitrary phylogenetic trees.

  13. MOLECULAR-PHYLOGENETIC CHARACTERIZATION AND ANTIMICROBIAL RESISTANCE OF Escherichia coli ISOLATED FROM GOATS WITH DIARRHEA

    Directory of Open Access Journals (Sweden)

    Rodrigo Almeida Guimarães

    2015-10-01

    Full Text Available Neonatal diarrhea determines significant changes in feed conversion, causing productivity loss in caprine herds. The antimicrobial resistance in bacteria is characterized as an important public health issue; therefore, Escherichia coli may be characterized as an important pathogen due to expressing virulence mechanisms responsible for significant clinical conditions in humans and animals. The present study evaluated the presence of E. coli among 117 caprine fecal samples and analyzed the isolates for antimicrobial resistance. Suggestive colonies were submitted to biochemical screening followed by genotypic group determination and phylogenetic analysis; further, the samples were submitted to antimicrobials susceptibility test. E. coli, Salmonella spp, Shigella sonnei and Enterobacter aerogenes were identified. E. coli isolates were phylogenetically classified as B2 (9/39, D (19/39, B1 (7/39 e A (4/29 groups. The analysis of the isolates also revealed the presence of K99 (04/39 and Stx (02/39 virulence factors. Antimicrobial susceptibility test revealed sensitive isolates to Chloramphenicol, Streptomycin, Amoxicillin and Ciprofloxacin, being all resistant to Lincomycin, Vancomycin and Penicillin. The results support the need of establishing restricted protocols for antimicrobial use, a fundamental procedure for health improvement in Brazilian caprine herds.

  14. Molecular evidence on the evolutionary and biogeographical patterns of European cyprinids.

    Science.gov (United States)

    Zardoya, R; Doadrio, I

    1999-08-01

    The phylogenetic relationships of 106 European cyprinid taxa were determined based on the complete nucleotide sequence (1140 bp) of the mitochondrial cytochrome b gene. The molecular phylogeny was used (1) to revise the current systematics of European cyprinids, (2) to establish the phylogenetic utility of traditional morphological characters that are widely used in Cyprinidae systematics, and (3) to discuss alternative hypotheses on the biogeography of the family in Europe. The age of the major lineages within European cyprinids was tentatively estimated with a molecular clock and showed full agreement with the fossil record of the group. Moreover, the results provided unambiguous evidence for a close phylogenetic affinity of some Caucasian and Greek endemic cyprinid taxa (e.g., B. capito and B. brachycephalus and Leuciscus keadicus, Barbus graecus, and B. albanicus, respectively) to Iberian and North African, but not Central European, cyprinids. The existence of such unexpected phylogenetic relationships refutes the classical hypothesis on the biogeography of European cyprinids, which assumes a dispersal of the cyprinid fauna from central Europe to southern Europe and northern Africa during the Miocene (and, hence, predicts a close phylogenetic relationship of all Caucasian, Greek, Iberian, and North African cyprinids to central European taxa). Instead, the existence of a Mediterranean realm independent of the central European route seems plausible based on the molecular evidence. It is likely that the new biogeographical scenario proposed here might apply to other primary freshwater European animals with low dispersal abilities, including fish, amphibians, and invertebrates.

  15. Phylogenetic analysis of hepatitis B virus in pakistan

    International Nuclear Information System (INIS)

    Baig, S.; Hasnain, N.U.

    2008-01-01

    To identify the distribution pattern of Hepatitis B Virus (HBV) genotype in a group of patients and to study its phylogenetic divergence. Two hundred and one HBV infected patients were genotyped for this study. All HbsAg positive individuals, either healthy carriers or suffering from conditions such as acute or chronic hepatitis, cirrhosis and hepatocellular carcinoma were included. Hepatitis B patients co-infected with other hepatic viruses were excluded. Hepatitis B virus DNA was extracted from serum, and subjected to a nested PCR, using the primers type-specific for genotype detection. Phylogenetic analysis was performed in the pre-S1 through S genes of HBV. The divergence was studied through 15 sequences of 967bp submitted to the DBJ/EMBL/GenBank databases accessible under accession number EF584640 through EF584654. Out of 201 patients tested, 156 were males and 45 were females. Genotype D was the predominant type found in 128 (64%) patients followed by A in 47 (23%) and mixed A/D in 26 (13%). Phylogenetic analysis confirmed the dominance of genotype D and subtype ayw2. There was dominance of genotype D subtype ayw2. It had a close resemblance with HBV strains that circulate in Iran, India and Japan. (author)

  16. Exploring Phylogenetic Relationships within Myriapoda and the Effects of Matrix Composition and Occupancy on Phylogenomic Reconstruction.

    Science.gov (United States)

    Fernández, Rosa; Edgecombe, Gregory D; Giribet, Gonzalo

    2016-09-01

    Myriapods, including the diverse and familiar centipedes and millipedes, are one of the dominant terrestrial arthropod groups. Although molecular evidence has shown that Myriapoda is monophyletic, its internal phylogeny remains contentious and understudied, especially when compared to those of Chelicerata and Hexapoda. Until now, efforts have focused on taxon sampling (e.g., by including a handful of genes from many species) or on maximizing matrix size (e.g., by including hundreds or thousands of genes in just a few species), but a phylogeny maximizing sampling at both levels remains elusive. In this study, we analyzed 40 Illumina transcriptomes representing 3 of the 4 myriapod classes (Diplopoda, Chilopoda, and Symphyla); 25 transcriptomes were newly sequenced to maximize representation at the ordinal level in Diplopoda and at the family level in Chilopoda. Ten supermatrices were constructed to explore the effect of several potential phylogenetic biases (e.g., rate of evolution, heterotachy) at 3 levels of gene occupancy per taxon (50%, 75%, and 90%). Analyses based on maximum likelihood and Bayesian mixture models retrieved monophyly of each myriapod class, and resulted in 2 alternative phylogenetic positions for Symphyla, as sister group to Diplopoda + Chilopoda, or closer to Diplopoda, the latter hypothesis having been traditionally supported by morphology. Within centipedes, all orders were well supported, but 2 deep nodes remained in conflict in the different analyses despite dense taxon sampling at the family level. Relationships among centipede orders in all analyses conducted with the most complete matrix (90% occupancy) are at odds not only with the sparser but more gene-rich supermatrices (75% and 50% supermatrices) and with the matrices optimizing phylogenetic informativeness or most conserved genes, but also with previous hypotheses based on morphology, development, or other molecular data sets. Our results indicate that a high percentage of ribosomal

  17. The influence of molecular markers and methods on inferring the phylogenetic relationships between the representatives of the Arini (parrots, Psittaciformes), determined on the basis of their complete mitochondrial genomes.

    Science.gov (United States)

    Urantowka, Adam Dawid; Kroczak, Aleksandra; Mackiewicz, Paweł

    2017-07-14

    Conures are a morphologically diverse group of Neotropical parrots classified as members of the tribe Arini, which has recently been subjected to a taxonomic revision. The previously broadly defined Aratinga genus of this tribe has been split into the 'true' Aratinga and three additional genera, Eupsittula, Psittacara and Thectocercus. Popular markers used in the reconstruction of the parrots' phylogenies derive from mitochondrial DNA. However, current phylogenetic analyses seem to indicate conflicting relationships between Aratinga and other conures, and also among other Arini members. Therefore, it is not clear if the mtDNA phylogenies can reliably define the species tree. The inconsistencies may result from the variable evolution rate of the markers used or their weak phylogenetic signal. To resolve these controversies and to assess to what extent the phylogenetic relationships in the tribe Arini can be inferred from mitochondrial genomes, we compared representative Arini mitogenomes as well as examined the usefulness of the individual mitochondrial markers and the efficiency of various phylogenetic methods. Single molecular markers produced inconsistent tree topologies, while different methods offered various topologies even for the same marker. A significant disagreement in these tree topologies occurred for cytb, nd2 and nd6 genes, which are commonly used in parrot phylogenies. The strongest phylogenetic signal was found in the control region and RNA genes. However, these markers cannot be used alone in inferring Arini phylogenies because they do not provide fully resolved trees. The most reliable phylogeny of the parrots under study is obtained only on the concatenated set of all mitochondrial markers. The analyses established significantly resolved relationships within the former Aratinga representatives and the main genera of the tribe Arini. Such mtDNA phylogeny can be in agreement with the species tree, owing to its match with synapomorphic features in

  18. Bringing molecules back into molecular evolution.

    Directory of Open Access Journals (Sweden)

    Claus O Wilke

    Full Text Available Much molecular-evolution research is concerned with sequence analysis. Yet these sequences represent real, three-dimensional molecules with complex structure and function. Here I highlight a growing trend in the field to incorporate molecular structure and function into computational molecular-evolution work. I consider three focus areas: reconstruction and analysis of past evolutionary events, such as phylogenetic inference or methods to infer selection pressures; development of toy models and simulations to identify fundamental principles of molecular evolution; and atom-level, highly realistic computational modeling of molecular structure and function aimed at making predictions about possible future evolutionary events.

  19. Tree-Based Unrooted Phylogenetic Networks.

    Science.gov (United States)

    Francis, A; Huber, K T; Moulton, V

    2018-02-01

    Phylogenetic networks are a generalization of phylogenetic trees that are used to represent non-tree-like evolutionary histories that arise in organisms such as plants and bacteria, or uncertainty in evolutionary histories. An unrooted phylogenetic network on a non-empty, finite set X of taxa, or network, is a connected, simple graph in which every vertex has degree 1 or 3 and whose leaf set is X. It is called a phylogenetic tree if the underlying graph is a tree. In this paper we consider properties of tree-based networks, that is, networks that can be constructed by adding edges into a phylogenetic tree. We show that although they have some properties in common with their rooted analogues which have recently drawn much attention in the literature, they have some striking differences in terms of both their structural and computational properties. We expect that our results could eventually have applications to, for example, detecting horizontal gene transfer or hybridization which are important factors in the evolution of many organisms.

  20. Emerging highly pathogenic H5 avian influenza viruses in France during winter 2015/16: phylogenetic analyses and markers for zoonotic potential.

    Science.gov (United States)

    Briand, François-Xavier; Schmitz, Audrey; Ogor, Katell; Le Prioux, Aurélie; Guillou-Cloarec, Cécile; Guillemoto, Carole; Allée, Chantal; Le Bras, Marie-Odile; Hirchaud, Edouard; Quenault, Hélène; Touzain, Fabrice; Cherbonnel-Pansart, Martine; Lemaitre, Evelyne; Courtillon, Céline; Gares, Hélène; Daniel, Patrick; Fediaevsky, Alexandre; Massin, Pascale; Blanchard, Yannick; Eterradossi, Nicolas; van der Werf, Sylvie; Jestin, Véronique; Niqueux, Eric

    2017-03-02

    Several new highly pathogenic (HP) H5 avian influenza virus (AIV) have been detected in poultry farms from south-western France since November 2015, among which an HP H5N1. The zoonotic potential and origin of these AIVs immediately became matters of concern. One virus of each subtype H5N1 (150169a), H5N2 (150233) and H5N9 (150236) was characterised. All proved highly pathogenic for poultry as demonstrated molecularly by the presence of a polybasic cleavage site in their HA protein - with a sequence (HQRRKR/GLF) previously unknown among avian H5 HPAI viruses - or experimentally by the in vivo demonstration of an intravenous pathogenicity index of 2.9 for the H5N1 HP isolate. Phylogenetic analyses based on the full genomes obtained by NGS confirmed that the eight viral segments of the three isolates were all part of avian Eurasian phylogenetic lineage but differed from the Gs/Gd/1/96-like lineage. The study of the genetic characteristics at specific amino acid positions relevant for modulating the adaptation to and the virulence for mammals showed that presently, these viruses possess most molecular features characteristic of AIV and lack some major characteristics required for efficient respiratory transmission to or between humans. The three isolates are therefore predicted to have no significant pandemic potential. This article is copyright of The Authors, 2017.

  1. Ecosystem productivity is associated with bacterial phylogenetic distance in surface marine waters.

    Science.gov (United States)

    Galand, Pierre E; Salter, Ian; Kalenitchenko, Dimitri

    2015-12-01

    Understanding the link between community diversity and ecosystem function is a fundamental aspect of ecology. Systematic losses in biodiversity are widely acknowledged but the impact this may exert on ecosystem functioning remains ambiguous. There is growing evidence of a positive relationship between species richness and ecosystem productivity for terrestrial macro-organisms, but similar links for marine micro-organisms, which help drive global climate, are unclear. Community manipulation experiments show both positive and negative relationships for microbes. These previous studies rely, however, on artificial communities and any links between the full diversity of active bacterial communities in the environment, their phylogenetic relatedness and ecosystem function remain hitherto unexplored. Here, we test the hypothesis that productivity is associated with diversity in the metabolically active fraction of microbial communities. We show in natural assemblages of active bacteria that communities containing more distantly related members were associated with higher bacterial production. The positive phylogenetic diversity-productivity relationship was independent of community diversity calculated as the Shannon index. From our long-term (7-year) survey of surface marine bacterial communities, we also found that similarly, productive communities had greater phylogenetic similarity to each other, further suggesting that the traits of active bacteria are an important predictor of ecosystem productivity. Our findings demonstrate that the evolutionary history of the active fraction of a microbial community is critical for understanding their role in ecosystem functioning. © 2015 John Wiley & Sons Ltd.

  2. Comparative mitogenomics of Braconidae (Insecta: Hymenoptera) and the phylogenetic utility of mitochondrial genomes with special reference to Holometabolous insects

    Science.gov (United States)

    2010-01-01

    Background Animal mitochondrial genomes are potential models for molecular evolution and markers for phylogenetic and population studies. Previous research has shown interesting features in hymenopteran mitochondrial genomes. Here, we conducted a comparative study of mitochondrial genomes of the family Braconidae, one of the largest families of Hymenoptera, and assessed the utility of mitochondrial genomic data for phylogenetic inference at three different hierarchical levels, i.e., Braconidae, Hymenoptera, and Holometabola. Results Seven mitochondrial genomes from seven subfamilies of Braconidae were sequenced. Three of the four sequenced A+T-rich regions are shown to be inverted. Furthermore, all species showed reversal of strand asymmetry, suggesting that inversion of the A+T-rich region might be a synapomorphy of the Braconidae. Gene rearrangement events occurred in all braconid species, but gene rearrangement rates were not taxonomically correlated. Most rearranged genes were tRNAs, except those of Cotesia vestalis, in which 13 protein-coding genes and 14 tRNA genes changed positions or/and directions through three kinds of gene rearrangement events. Remote inversion is posited to be the result of two independent recombination events. Evolutionary rates were lower in species of the cyclostome group than those of noncyclostomes. Phylogenetic analyses based on complete mitochondrial genomes and secondary structure of rrnS supported a sister-group relationship between Aphidiinae and cyclostomes. Many well accepted relationships within Hymenoptera, such as paraphyly of Symphyta and Evaniomorpha, a sister-group relationship between Orussoidea and Apocrita, and monophyly of Proctotrupomorpha, Ichneumonoidea and Aculeata were robustly confirmed. New hypotheses, such as a sister-group relationship between Evanioidea and Aculeata, were generated. Among holometabolous insects, Hymenoptera was shown to be the sister to all other orders. Mecoptera was recovered as the

  3. Comparative mitogenomics of Braconidae (Insecta: Hymenoptera and the phylogenetic utility of mitochondrial genomes with special reference to Holometabolous insects

    Directory of Open Access Journals (Sweden)

    Shi Min

    2010-06-01

    Full Text Available Abstract Background Animal mitochondrial genomes are potential models for molecular evolution and markers for phylogenetic and population studies. Previous research has shown interesting features in hymenopteran mitochondrial genomes. Here, we conducted a comparative study of mitochondrial genomes of the family Braconidae, one of the largest families of Hymenoptera, and assessed the utility of mitochondrial genomic data for phylogenetic inference at three different hierarchical levels, i.e., Braconidae, Hymenoptera, and Holometabola. Results Seven mitochondrial genomes from seven subfamilies of Braconidae were sequenced. Three of the four sequenced A+T-rich regions are shown to be inverted. Furthermore, all species showed reversal of strand asymmetry, suggesting that inversion of the A+T-rich region might be a synapomorphy of the Braconidae. Gene rearrangement events occurred in all braconid species, but gene rearrangement rates were not taxonomically correlated. Most rearranged genes were tRNAs, except those of Cotesia vestalis, in which 13 protein-coding genes and 14 tRNA genes changed positions or/and directions through three kinds of gene rearrangement events. Remote inversion is posited to be the result of two independent recombination events. Evolutionary rates were lower in species of the cyclostome group than those of noncyclostomes. Phylogenetic analyses based on complete mitochondrial genomes and secondary structure of rrnS supported a sister-group relationship between Aphidiinae and cyclostomes. Many well accepted relationships within Hymenoptera, such as paraphyly of Symphyta and Evaniomorpha, a sister-group relationship between Orussoidea and Apocrita, and monophyly of Proctotrupomorpha, Ichneumonoidea and Aculeata were robustly confirmed. New hypotheses, such as a sister-group relationship between Evanioidea and Aculeata, were generated. Among holometabolous insects, Hymenoptera was shown to be the sister to all other orders

  4. Phylogenetic inferences of Nepenthes species in Peninsular Malaysia revealed by chloroplast (trnL intron) and nuclear (ITS) DNA sequences.

    Science.gov (United States)

    Bunawan, Hamidun; Yen, Choong Chee; Yaakop, Salmah; Noor, Normah Mohd

    2017-01-26

    The chloroplastic trnL intron and the nuclear internal transcribed spacer (ITS) region were sequenced for 11 Nepenthes species recorded in Peninsular Malaysia to examine their phylogenetic relationship and to evaluate the usage of trnL intron and ITS sequences for phylogenetic reconstruction of this genus. Phylogeny reconstruction was carried out using neighbor-joining, maximum parsimony and Bayesian analyses. All the trees revealed two major clusters, a lowland group consisting of N. ampullaria, N. mirabilis, N. gracilis and N. rafflesiana, and another containing both intermediately distributed species (N. albomarginata and N. benstonei) and four highland species (N. sanguinea, N. macfarlanei, N. ramispina and N. alba). The trnL intron and ITS sequences proved to provide phylogenetic informative characters for deriving a phylogeny of Nepenthes species in Peninsular Malaysia. To our knowledge, this is the first molecular phylogenetic study of Nepenthes species occurring along an altitudinal gradient in Peninsular Malaysia.

  5. Phylogenetic Analysis of Canine Parvovirus VP2 Gene in China.

    Science.gov (United States)

    Yi, L; Tong, M; Cheng, Y; Song, W; Cheng, S

    2016-04-01

    In this study, a total of 37 samples (58.0%) were found through PCR assay to be positive for canine parvovirus (CPV) of 66 suspected faecal samples of dogs collected from various cities throughout China. Eight CPV isolates could be obtained in the CRFK cell line. The sequencing of the VP2 gene of CPV identified the predominant CPV strain as CPV-2a (Ser297Ala), with two CPV-2b (Ser297Ala). Sequence comparison revealed homologies of 99.3-99.9%, 99.9% and 99.3-99.7% within the CPV 2a isolates, within the CPV 2b isolates and between the CPV 2a and 2b isolates, respectively. In addition, several non-synonymous and synonymous mutations were also recorded. The phylogenetic tree revealed that most of the CPV strains from different areas in China were located in the formation of a large branch, which were grouped together along with the KU143-09 strain from Thailand and followed the same evolution. In this study, we provide an updated molecular characterization of CPV 2 circulation in China. © 2014 Blackwell Verlag GmbH.

  6. Molecular characteristics of bap-positive Staphylococcus aureus strains from dairy cow mastitis.

    Science.gov (United States)

    Snel, Gustavo G M; Monecke, Stefan; Ehricht, Ralf; Piccinini, Renata

    2015-08-01

    The biofilm-associated protein (Bap) of Staphylococcus aureus is a high molecular weight cell-wall-anchored protein involved in biofilm formation, first described in bovine mastitis strains from Spain. So far, studies regarding Bap were mainly based on the Spanish strain V329 and its mutants, but no information on the genetic variability of bap-positive Staph. aureus strains is yet available in the literature. The present study investigated the molecular characteristics of 8 bap-positive Staph. aureus strains from subclinical bovine mastitis, isolated in 5 herds; somatic cell counts (SCC) of milk samples were also registered. Strains were characterised using MLST, SPA typing and microarray and the results were compared with V329. All isolates from this study and V329 were assigned to ST126, t605, but some molecular differences were observed. Only herd A and B strains harboured the genes for β-lactams resistance; the leukocidin D/E gene, a type I site-specific deoxyribonuclease subunit, 3rd locus gene and serin-protease A and B were carried by all strains, but not by V329, while serin-protease E was absent in V329 and in another isolate. Four isolates and V329 harboured the fibronectin-binding protein B gene. SCC showed the highest value in the milk sample affected by the only strain carrying all the virulence factors considered. Potential large variability of virulence was evidenced among V329 and all bap-positive Staph. aureus strains considered: the carriage of fnb could enhance the accumulation of biofilm, but the lack of lukD/E and splA, B or E might decrease the invasiveness of strain.

  7. Suitability of cuticular pores and sensilla for harpacticoid copepod species delineation and phylogenetic reconstruction.

    Science.gov (United States)

    Karanovic, Tomislav; Kim, Kichoon

    2014-11-01

    Cuticular organs have not been described systematically in harpacticoids until recently, and they haven ever been used as characters for reconstructing phylogenetic relationships in any crustacean group. We survey cuticular pores and sensilla on somites in ten Miraciidae species, belonging to six genera, from Korea, Australia, and Russia. Nine species belong to the subfamily Stenheliinae, while the outgroup belongs to the subfamily Diosaccinae. We aim to compare phylogenetic trees reconstructed for these harpactioids based on: 1) cuticular organs (with 76 characters scored, 71% of them phylogenetically informative); 2) traditionally used macro-morphological characters (66 scored, 77% of them informative);and 3) mtCOI DNA data. All analyses suggest that cuticular organs are useful characters for harpacticoid species delineation, although not as sensitive as some fast-evolving molecular markers. Reconstructed cladograms based on all three datasets show very high bootstrap values for clades representing distinct genera, suggesting that cuticular organs are suitable characters for studying phylogenetic relationships. Bootstrap values for the more basal nodes differ among the different cladograms,as do the sister-group relationships they suggest, indicating that cuticular organs probably have different evolutionary constraints from macro-morphological characters. Cuticular organs could be quite useful in the study of old museum specimens and fossil crustaceans.

  8. Prokaryotic diversity, composition structure, and phylogenetic analysis of microbial communities in leachate sediment ecosystems.

    Science.gov (United States)

    Liu, Jingjing; Wu, Weixiang; Chen, Chongjun; Sun, Faqian; Chen, Yingxu

    2011-09-01

    In order to obtain insight into the prokaryotic diversity and community in leachate sediment, a culture-independent DNA-based molecular phylogenetic approach was performed with archaeal and bacterial 16S rRNA gene clone libraries derived from leachate sediment of an aged landfill. A total of 59 archaeal and 283 bacterial rDNA phylotypes were identified in 425 archaeal and 375 bacterial analyzed clones. All archaeal clones distributed within two archaeal phyla of the Euryarchaeota and Crenarchaeota, and well-defined methanogen lineages, especially Methanosaeta spp., are the most numerically dominant species of the archaeal community. Phylogenetic analysis of the bacterial library revealed a variety of pollutant-degrading and biotransforming microorganisms, including 18 distinct phyla. A substantial fraction of bacterial clones showed low levels of similarity with any previously documented sequences and thus might be taxonomically new. Chemical characteristics and phylogenetic inferences indicated that (1) ammonium-utilizing bacteria might form consortia to alleviate or avoid the negative influence of high ammonium concentration on other microorganisms, and (2) members of the Crenarchaeota found in the sediment might be involved in ammonium oxidation. This study is the first to report the composition of the microbial assemblages and phylogenetic characteristics of prokaryotic populations extant in leachate sediment. Additional work on microbial activity and contaminant biodegradation remains to be explored.

  9. Genetic signature of strong recent positive selection at interleukin-32 gene in goat

    Directory of Open Access Journals (Sweden)

    Akhtar Rasool Asif

    2017-07-01

    Full Text Available Objective Identification of the candidate genes that play key roles in phenotypic variations can provide new information about evolution and positive selection. Interleukin (IL-32 is involved in many biological processes, however, its role for the immune response against various diseases in mammals is poorly understood. Therefore, the current investigation was performed for the better understanding of the molecular evolution and the positive selection of single nucleotide polymorphisms in IL-32 gene. Methods By using fixation index (FST based method, IL-32 (9375 gene was found to be outlier and under significant positive selection with the provisional combined allocation of mean heterozygosity and FST. Using nucleotide sequences of 11 mammalian species from National Center for Biotechnology Information database, the evolutionary selection of IL-32 gene was determined using Maximum likelihood model method, through four models (M1a, M2a, M7, and M8 in Codeml program of phylogenetic analysis by maximum liklihood. Results IL-32 is detected under positive selection using the FST simulations method. The phylogenetic tree revealed that goat IL-32 was in close resemblance with sheep IL-32. The coding nucleotide sequences were compared among 11 species and it was found that the goat IL-32 gene shared identity with sheep (96.54%, bison (91.97%, camel (58.39%, cat (56.59%, buffalo (56.50%, human (56.13%, dog (50.97%, horse (54.04%, and rabbit (53.41% respectively. Conclusion This study provides evidence for IL-32 gene as under significant positive selection in goat.

  10. The Development of Three Long Universal Nuclear Protein-Coding Locus Markers and Their Application to Osteichthyan Phylogenetics with Nested PCR

    Science.gov (United States)

    Zhang, Peng

    2012-01-01

    Background Universal nuclear protein-coding locus (NPCL) markers that are applicable across diverse taxa and show good phylogenetic discrimination have broad applications in molecular phylogenetic studies. For example, RAG1, a representative NPCL marker, has been successfully used to make phylogenetic inferences within all major osteichthyan groups. However, such markers with broad working range and high phylogenetic performance are still scarce. It is necessary to develop more universal NPCL markers comparable to RAG1 for osteichthyan phylogenetics. Methodology/Principal Findings We developed three long universal NPCL markers (>1.6 kb each) based on single-copy nuclear genes (KIAA1239, SACS and TTN) that possess large exons and exhibit the appropriate evolutionary rates. We then compared their phylogenetic utilities with that of the reference marker RAG1 in 47 jawed vertebrate species. In comparison with RAG1, each of the three long universal markers yielded similar topologies and branch supports, all in congruence with the currently accepted osteichthyan phylogeny. To compare their phylogenetic performance visually, we also estimated the phylogenetic informativeness (PI) profile for each of the four long universal NPCL markers. The PI curves indicated that SACS performed best over the whole timescale, while RAG1, KIAA1239 and TTN exhibited similar phylogenetic performances. In addition, we compared the success of nested PCR and standard PCR when amplifying NPCL marker fragments. The amplification success rate and efficiency of the nested PCR were overwhelmingly higher than those of standard PCR. Conclusions/Significance Our work clearly demonstrates the superiority of nested PCR over the conventional PCR in phylogenetic studies and develops three long universal NPCL markers (KIAA1239, SACS and TTN) with the nested PCR strategy. The three markers exhibit high phylogenetic utilities in osteichthyan phylogenetics and can be widely used as pilot genes for

  11. Ant-Based Phylogenetic Reconstruction (ABPR: A new distance algorithm for phylogenetic estimation based on ant colony optimization

    Directory of Open Access Journals (Sweden)

    Karla Vittori

    2008-12-01

    Full Text Available We propose a new distance algorithm for phylogenetic estimation based on Ant Colony Optimization (ACO, named Ant-Based Phylogenetic Reconstruction (ABPR. ABPR joins two taxa iteratively based on evolutionary distance among sequences, while also accounting for the quality of the phylogenetic tree built according to the total length of the tree. Similar to optimization algorithms for phylogenetic estimation, the algorithm allows exploration of a larger set of nearly optimal solutions. We applied the algorithm to four empirical data sets of mitochondrial DNA ranging from 12 to 186 sequences, and from 898 to 16,608 base pairs, and covering taxonomic levels from populations to orders. We show that ABPR performs better than the commonly used Neighbor-Joining algorithm, except when sequences are too closely related (e.g., population-level sequences. The phylogenetic relationships recovered at and above species level by ABPR agree with conventional views. However, like other algorithms of phylogenetic estimation, the proposed algorithm failed to recover expected relationships when distances are too similar or when rates of evolution are very variable, leading to the problem of long-branch attraction. ABPR, as well as other ACO-based algorithms, is emerging as a fast and accurate alternative method of phylogenetic estimation for large data sets.

  12. Unique phylogenetic position of the African truffle-like fungus, Octaviania ivoryana (Boletaceae, Boletales), and the proposal of a new genus, Afrocastellanoa.

    Science.gov (United States)

    Orihara, Takamichi; Smith, Matthew E

    2017-01-01

    The sequestrate (truffle-like) basidiomycete Octaviania ivoryana was originally described based on collections from Zimbabwe, Kenya, Guinea, and Senegal. This species has basidiomes that stain blue-green and basidiospores with crowded spines that are characteristic of the genus Octaviania. However, O. ivoryana is the only Octaviania species described from sub-Saharan Africa, and the phylogenetic relationship of the species to other species of Octaviania sensu stricto has not been previously investigated. We examined the phylogenetic position of the isotype and paratype specimens of O. ivoryana based on two nuc rDNA loci-ITS1-5.8S-ITS2 (internal transcribed spacer [ITS]) and partial 28S-and the translation elongation factor 1-α gene. The resultant phylogenies indicate that O. ivoryana does not belong to Octaviania s. s. but instead forms a clade with the epigeous bolete genus, Porphyrellus sensu stricto (i.e., P. porphyrosporus and allies). The internal transcribed spacer phylogeny also recovers a monophyletic clade that includes sequences from O. ivoryana basidiomes as well as sequences from ectomycorrhizal root tips of Uapaca, Anthonotha, and assorted ectomycorrhizal Fabaceae species, suggesting that there is likely additional undescribed diversity within the lineage. We accordingly propose a new genus, Afrocastellanoa M.E. Sm. & Orihara, to accommodate the species O. ivoryana. Afrocastellanoa is morphologically distinct from Octaviania in the combination of a solid gleba, multilayered peridium, and the lack of distinct hymenium within the gleba. Our data suggest that the genus Afrocastellanoa is a unique sequestrate lineage with one described species and several undescribed species, all of which likely form ectomycorrhizas with African trees.

  13. Biogeography in deep time - What do phylogenetics, geology, and paleoclimate tell us about early platyrrhine evolution?

    Science.gov (United States)

    Kay, Richard F

    2015-01-01

    Molecular data have converged on a consensus about the genus-level phylogeny of extant platyrrhine monkeys, but for most extinct taxa and certainly for those older than the Pleistocene we must rely upon morphological evidence from fossils. This raises the question as to how well anatomical data mirror molecular phylogenies and how best to deal with discrepancies between the molecular and morphological data as we seek to extend our phylogenies to the placement of fossil taxa. Here I present parsimony-based phylogenetic analyses of extant and fossil platyrrhines based on an anatomical dataset of 399 dental characters and osteological features of the cranium and postcranium. I sample 16 extant taxa (one from each platyrrhine genus) and 20 extinct taxa of platyrrhines. The tree structure is constrained with a "molecular scaffold" of extant species as implemented in maximum parsimony using PAUP with the molecular-based 'backbone' approach. The data set encompasses most of the known extinct species of platyrrhines, ranging in age from latest Oligocene (∼26 Ma) to the Recent. The tree is rooted with extant catarrhines, and Late Eocene and Early Oligocene African anthropoids. Among the more interesting patterns to emerge are: (1) known early platyrrhines from the Late Oligocene through Early Miocene (26-16.5Ma) represent only stem platyrrhine taxa; (2) representatives of the three living platyrrhine families first occur between 15.7 Ma and 13.5 Ma; and (3) recently extinct primates from the Greater Antilles (Cuba, Jamaica, Hispaniola) are sister to the clade of extant platyrrhines and may have diverged in the Early Miocene. It is probable that the crown platyrrhine clade did not originate before about 20-24 Ma, a conclusion consistent with the phylogenetic analysis of fossil taxa presented here and with recent molecular clock estimates. The following biogeographic scenario is consistent with the phylogenetic findings and climatic and geologic evidence: Tropical South

  14. Evaluation of positive Rift Valley fever virus formalin-fixed paraffin embedded samples as a source of sequence data for retrospective phylogenetic analysis.

    Science.gov (United States)

    Mubemba, B; Thompson, P N; Odendaal, L; Coetzee, P; Venter, E H

    2017-05-01

    Rift Valley fever (RVF), caused by an arthropod borne Phlebovirus in the family Bunyaviridae, is a haemorrhagic disease that affects ruminants and humans. Due to the zoonotic nature of the virus, a biosafety level 3 laboratory is required for isolation of the virus. Fresh and frozen samples are the preferred sample type for isolation and acquisition of sequence data. However, these samples are scarce in addition to posing a health risk to laboratory personnel. Archived formalin-fixed, paraffin-embedded (FFPE) tissue samples are safe and readily available, however FFPE derived RNA is in most cases degraded and cross-linked in peptide bonds and it is unknown whether the sample type would be suitable as reference material for retrospective phylogenetic studies. A RT-PCR assay targeting a 490 nt portion of the structural G N glycoprotein encoding gene of the RVFV M-segment was applied to total RNA extracted from archived RVFV positive FFPE samples. Several attempts to obtain target amplicons were unsuccessful. FFPE samples were then analysed using next generation sequencing (NGS), i.e. Truseq ® (Illumina) and sequenced on the Miseq ® genome analyser (Illumina). Using reference mapping, gapped virus sequence data of varying degrees of shallow depth was aligned to a reference sequence. However, the NGS did not yield long enough contigs that consistently covered the same genome regions in all samples to allow phylogenetic analysis. Copyright © 2017 Elsevier B.V. All rights reserved.

  15. A new earthworm species within a controversial genus: Eiseniona gerardoi sp. n. (Annelida, Lumbricidae - description based on morphological and molecular data

    Directory of Open Access Journals (Sweden)

    Dario Diaz Cosin

    2014-04-01

    Full Text Available The morphological and anatomical simplicity of soil dwelling animals, such as earthworms, has limited the establishment of a robust taxonomy making it sometimes subjective to authors’ criteria. Within this context, integrative approaches including molecular information are becoming more popular to solve the phylogenetic positioning of conflictive taxa. Here we present the description of a new lumbricid species from the region of Extremadura (Spain, Eiseniona gerardoi sp. n. The assignment to this genus is based on both a morphological and a phylogenetic study. The validity of the genus Eiseniona, one of the most controversial within Lumbricidae, is discussed. A synopsis of the differences between the type species and the west-European members of the genus is provided.

  16. A Consistent Phylogenetic Backbone for the Fungi

    Science.gov (United States)

    Ebersberger, Ingo; de Matos Simoes, Ricardo; Kupczok, Anne; Gube, Matthias; Kothe, Erika; Voigt, Kerstin; von Haeseler, Arndt

    2012-01-01

    The kingdom of fungi provides model organisms for biotechnology, cell biology, genetics, and life sciences in general. Only when their phylogenetic relationships are stably resolved, can individual results from fungal research be integrated into a holistic picture of biology. However, and despite recent progress, many deep relationships within the fungi remain unclear. Here, we present the first phylogenomic study of an entire eukaryotic kingdom that uses a consistency criterion to strengthen phylogenetic conclusions. We reason that branches (splits) recovered with independent data and different tree reconstruction methods are likely to reflect true evolutionary relationships. Two complementary phylogenomic data sets based on 99 fungal genomes and 109 fungal expressed sequence tag (EST) sets analyzed with four different tree reconstruction methods shed light from different angles on the fungal tree of life. Eleven additional data sets address specifically the phylogenetic position of Blastocladiomycota, Ustilaginomycotina, and Dothideomycetes, respectively. The combined evidence from the resulting trees supports the deep-level stability of the fungal groups toward a comprehensive natural system of the fungi. In addition, our analysis reveals methodologically interesting aspects. Enrichment for EST encoded data—a common practice in phylogenomic analyses—introduces a strong bias toward slowly evolving and functionally correlated genes. Consequently, the generalization of phylogenomic data sets as collections of randomly selected genes cannot be taken for granted. A thorough characterization of the data to assess possible influences on the tree reconstruction should therefore become a standard in phylogenomic analyses. PMID:22114356

  17. Complete plastid genomes from Ophioglossum californicum, Psilotum nudum, and Equisetum hyemale reveal an ancestral land plant genome structure and resolve the position of Equisetales among monilophytes

    Directory of Open Access Journals (Sweden)

    Grewe Felix

    2013-01-01

    Full Text Available Abstract Background Plastid genome structure and content is remarkably conserved in land plants. This widespread conservation has facilitated taxon-rich phylogenetic analyses that have resolved organismal relationships among many land plant groups. However, the relationships among major fern lineages, especially the placement of Equisetales, remain enigmatic. Results In order to understand the evolution of plastid genomes and to establish phylogenetic relationships among ferns, we sequenced the plastid genomes from three early diverging species: Equisetum hyemale (Equisetales, Ophioglossum californicum (Ophioglossales, and Psilotum nudum (Psilotales. A comparison of fern plastid genomes showed that some lineages have retained inverted repeat (IR boundaries originating from the common ancestor of land plants, while other lineages have experienced multiple IR changes including expansions and inversions. Genome content has remained stable throughout ferns, except for a few lineage-specific losses of genes and introns. Notably, the losses of the rps16 gene and the rps12i346 intron are shared among Psilotales, Ophioglossales, and Equisetales, while the gain of a mitochondrial atp1 intron is shared between Marattiales and Polypodiopsida. These genomic structural changes support the placement of Equisetales as sister to Ophioglossales + Psilotales and Marattiales as sister to Polypodiopsida. This result is augmented by some molecular phylogenetic analyses that recover the same relationships, whereas others suggest a relationship between Equisetales and Polypodiopsida. Conclusions Although molecular analyses were inconsistent with respect to the position of Marattiales and Equisetales, several genomic structural changes have for the first time provided a clear placement of these lineages within the ferns. These results further demonstrate the power of using rare genomic structural changes in cases where molecular data fail to provide strong phylogenetic

  18. On Tree-Based Phylogenetic Networks.

    Science.gov (United States)

    Zhang, Louxin

    2016-07-01

    A large class of phylogenetic networks can be obtained from trees by the addition of horizontal edges between the tree edges. These networks are called tree-based networks. We present a simple necessary and sufficient condition for tree-based networks and prove that a universal tree-based network exists for any number of taxa that contains as its base every phylogenetic tree on the same set of taxa. This answers two problems posted by Francis and Steel recently. A byproduct is a computer program for generating random binary phylogenetic networks under the uniform distribution model.

  19. Phylogenetic relationships in the "grossulariae" species group of the genus Aphis (Hemiptera: Sternorrhyncha: Aphididae): Molecular evidence

    DEFF Research Database (Denmark)

    Turcinaviciene, Jorga; Rakauskas, Rimantas; Pedersen, Bo Vest

    2006-01-01

    Phylogenetic relationships among Palaearctic Ribes and/or Onagraceae inhabiting Aphis species from five countries were examined using mitochondrial gene cytochrome oxidase I (CO-I) and nuclear gene elongation factor 1 a (EF-1a) sequences. There was no major conflict between the trees obtained fro...

  20. Phylogenetic Conflict in Bears Identified by Automated Discovery of Transposable Element Insertions in Low-Coverage Genomes.

    Science.gov (United States)

    Lammers, Fritjof; Gallus, Susanne; Janke, Axel; Nilsson, Maria A

    2017-10-01

    Phylogenetic reconstruction from transposable elements (TEs) offers an additional perspective to study evolutionary processes. However, detecting phylogenetically informative TE insertions requires tedious experimental work, limiting the power of phylogenetic inference. Here, we analyzed the genomes of seven bear species using high-throughput sequencing data to detect thousands of TE insertions. The newly developed pipeline for TE detection called TeddyPi (TE detection and discovery for Phylogenetic Inference) identified 150,513 high-quality TE insertions in the genomes of ursine and tremarctine bears. By integrating different TE insertion callers and using a stringent filtering approach, the TeddyPi pipeline produced highly reliable TE insertion calls, which were confirmed by extensive in vitro validation experiments. Analysis of single nucleotide substitutions in the flanking regions of the TEs shows that these substitutions correlate with the phylogenetic signal from the TE insertions. Our phylogenomic analyses show that TEs are a major driver of genomic variation in bears and enabled phylogenetic reconstruction of a well-resolved species tree, despite strong signals for incomplete lineage sorting and introgression. The analyses show that the Asiatic black, sun, and sloth bear form a monophyletic clade, in which phylogenetic incongruence originates from incomplete lineage sorting. TeddyPi is open source and can be adapted to various TE and structural variation callers. The pipeline makes it possible to confidently extract thousands of TE insertions even from low-coverage genomes (∼10×) of nonmodel organisms. This opens new possibilities for biologists to study phylogenies and evolutionary processes as well as rates and patterns of (retro-)transposition and structural variation. © The Author 2017. Published by Oxford University Press on behalf of the Society for Molecular Biology and Evolution.

  1. [Comparative leaf anatomy and phylogenetic relationships of 11 species of Laeliinae with emphasis on Brassavola (Orchidaceae)].

    Science.gov (United States)

    Noguera-Savelli, Eliana; Jáuregui, Damelis

    2011-09-01

    Brassavola inhabits a wide altitude range and habitat types from Northern Mexico to Northern Argentina. Classification schemes in plants have normally used vegetative and floral characters, but when species are very similar, as in this genus, conflicts arise in species delimitation, and alternative methods should be applied. In this study we explored the taxonomic and phylogenetic value of the anatomical structure of leaves in Brassavola; as ingroup, seven species of Brassavola were considered, and as an outgroup Guarianthe skinneri, Laelia anceps, Rhyncholaelia digbyana and Rhyncholaelia glauca were evaluated. Leaf anatomical characters were studied in freehand cross sections of the middle portion with a light microscope. Ten vegetative anatomical characters were selected and coded for the phylogenetic analysis. Phylogenetic reconstruction was carried out under maximum parsimony using the program NONA through WinClada. Overall, Brassavola species reveal a wide variety of anatomical characters, many of them associated with xeromorphic plants: thick cuticle, hypodermis and cells of the mesophyll with spiral thickenings in the secondary wall. Moreover, mesophyll is either homogeneous or heterogeneous, often with extravascular bundles of fibers near the epidermis at both terete and flat leaves. All vascular bundles are collateral, arranged in more than one row in the mesophyll. The phylogenetic analysis did not resolve internal relationships of the genus; we obtained a polytomy, indicating that the anatomical characters by themselves have little phylogenetic value in Brassavola. We concluded that few anatomical characters are phylogenetically important; however, they would provide more support to elucidate the phylogenetic relantionships in the Orchidaceae and other plant groups if they are used in conjunction with morphological and/or molecular characters.

  2. PHYLOGENETIC RELATIONSHIP OF THE RED TIDE DINOFLAGELLATE GYMNODINIUM BREVE TO OTHER MEMBERS OF THE GENERA GYMNODINIUM AND GYRODINIUM

    Science.gov (United States)

    Phylogenetic relationships between the red-tide dinoflagellate Gymnodinium breve and other members of the genera Gymnodinium and Gyrodinium have not been studied at the molecular level. G. breve is most noted for its production of brevetoxin, which has been linked to extensive f...

  3. Phylogenetic diversity and relationships among species of genus ...

    African Journals Online (AJOL)

    Fifty six Nicotiana species were used to construct phylogenetic trees and to asses the genetic relationships between them. Genetic distances estimated from RAPD analysis was used to construct phylogenetic trees using Phylogenetic Inference Package (PHYLIP). Since phylogenetic relationships estimated for closely ...

  4. Position sensitive detection coupled to high-resolution time-of-flight mass spectrometry: Imaging for molecular beam deflection experiments

    International Nuclear Information System (INIS)

    Abd El Rahim, M.; Antoine, R.; Arnaud, L.; Barbaire, M.; Broyer, M.; Clavier, Ch.; Compagnon, I.; Dugourd, Ph.; Maurelli, J.; Rayane, D.

    2004-01-01

    We have developed and tested a high-resolution time-of-flight mass spectrometer coupled to a position sensitive detector for molecular beam deflection experiments. The major achievement of this new spectrometer is to provide a three-dimensional imaging (X and Y positions and time-of-flight) of the ion packet on the detector, with a high acquisition rate and a high resolution on both the mass and the position. The calibration of the experimental setup and its application to molecular beam deflection experiments are discussed

  5. Time spans and spacers : Molecular phylogenetic explorations in the Cladophora complex (Chlorophyta) from the perspective of rDNA gene and spacer sequences

    NARCIS (Netherlands)

    Bakker, Frederik Theodoor

    1995-01-01

    In this study, phylogenetic relationships among genera, species and biogeographic representatives of single Cladophora species within the Cladophorales were analyzed using rDNA gene and spacer sequences. Based on phylogenetic analysis of 18S rRNA gene sequences, the Cladophora complex is shown to be

  6. Molecular phylogenetic identification of Fasciola flukes in Nepal.

    Science.gov (United States)

    Shoriki, Takuya; Ichikawa-Seki, Madoka; Devkota, Bhuminand; Rana, Hari B; Devkota, Shiva P; Humagain, Sudeep K; Itagaki, Tadashi

    2014-12-01

    Eighty-one Fasciola flukes collected from 8 districts in Nepal were analyzed for their species identification on the basis of their spermatogenic status and nuclear ribosomal internal transcribed spacer 1 (ITS1) and for their phylogenetic relation with Fasciola flukes from other Asian countries on the basis of the mitochondrial NADH dehydrogenase subunit 1 (nad1) gene. Sixty-one flukes (75.3%) were aspermic Fasciola sp., and 20 flukes (24.7%) were identified as Fasciola gigantica. All of the aspermic flukes displayed the Fh/Fg type in ITS1, which was predominant in aspermic Fasciola sp. from China, and most (60 flukes) displayed the Fsp-ND1-N1 haplotype in the nad1, which had an identical nucleotide sequence to the major haplotype (Fg-C2) of the aspermic flukes from China. These results suggest that aspermic Fasciola sp. was introduced into Nepal from China. Furthermore, the results of the diversity indices, neutrality indices, and median-joining network analysis with reference haplotypes from Asian countries suggest that aspermic Fasciola sp. rapidly expanded its distribution. In contrasts, F. gigantica displayed 10 nad1 haplotypes, which showed higher population diversity indices than the haplotypes of aspermic flukes, indicating that the F. gigantica population was clearly distributed in Nepal earlier than the aspermic Fasciola population. Although the F. gigantica haplotypes from Nepal formed a star-like phylogeny consisting of a main founder haplotype (Fg-ND1-N1), together with some F. gigantica haplotypes from Myanmar and Thailand, the Nepal population differed genetically from F. gigantica populations of neighboring countries as each country had distinct founder haplotype(s). Copyright © 2014 Elsevier Inc. All rights reserved.

  7. PHYTOCHEMICAL AND PHYLOGENETIC ANALYSIS OF Spondias(Anacardiaceae

    Directory of Open Access Journals (Sweden)

    Cristiane Pereira

    2015-07-01

    Full Text Available This paper describes the correlation between the phenolic composition and the molecular phylogenetic reconstruction of five Spondias species (Anacardiaceae. Two of these species (S. venulosa and Spondias sp. occur in rainforest areas and the other three are widely distributed in Brazil (S. dulcis, S.mombin, and S. purpurea. The flavonoid enriched fraction of the S. venulosa leaf extract also underwent a chemical study. The results indicate that the presence of flavonol 3-O-glycosides are a synapomorphic character of the studied American Spondias and the production of rhamnetin 3-O-rutinoside is a synapomorphy of the Atlantic forest species. This is the first report of flavonoids in S. venulosa, an endemic species from the Brazilian Atlantic rainforest.

  8. Molecular characterization and phylogenetic relationship of wild type 1 poliovirus strains circulating across Pakistan and Afghanistan bordering areas during 2010-2012.

    Directory of Open Access Journals (Sweden)

    Shahzad Shaukat

    Full Text Available Pakistan and Afghanistan share a long uncontrolled border with extensive population movement on both sides. Wild poliovirus transmission has never been interrupted in this block due to war against terrorism, poor public health infrastructure, misconceptions about polio vaccines and inadequate immunization activities. All these issues complicate the eradication operations and reinforce the complexity of wiping out poliomyelitis from this region. This study illustrates the origins and routes of cross-border wild poliovirus type 1 (WPV1 transmission during 2010-2012 between Pakistan and Afghanistan. Sequence analyses were conducted based on complete VP1 capsid protein sequences for WPV1 study strains to determine the origin of poliovirus genetic lineages and their evolutionary relationships. Phylogenetic tree was constructed from VP1 gene sequences applying Maximum Likelihood method using Kimura 2- parameter model in MEGA program v 5.0. A total of 72 (14.3% out of 502 wild-type 1 polioviruses were found circulating in border areas of both countries during 2010-2012. Molecular phylogenetic analysis classified these strains in to two sub-genotypes with four clusters and 18 lineages. Genetic data confirmed that the most of WPV1 lineages (12; 66.6% were transmitted from Pakistan to Afghanistan. However, the genetic diversity was significantly reduced during 2012 as most of the lineages were completely eliminated. In conclusion, Pakistan-Afghanistan block has emerged as a single poliovirus reservoir sharing the multiple poliovirus lineages due to uncontrolled movement of people across the borders between two countries. If it is neglected, it can jeopardize the extensive global efforts done so-far to eradicate the poliovirus infection. Our data will be helpful to devise the preventive strategies for effective control of wild poliovirus transmission in this region.

  9. Nonbinary Tree-Based Phylogenetic Networks

    NARCIS (Netherlands)

    Jetten, L.; van Iersel, L.J.J.

    2018-01-01

    Rooted phylogenetic networks are used to describe evolutionary histories that contain non-treelike evolutionary events such as hybridization and horizontal gene transfer. In some cases, such histories can be described by a phylogenetic base-tree with additional linking arcs, which can for example

  10. Improved abundance sensitivity of molecular ions in positive-ion APCI MS analysis of petroleum in toluene.

    Science.gov (United States)

    Kim, Young Hwan; Kim, Sunghwan

    2010-03-01

    Positive-ion atmospheric pressure chemical ionization (APCI) Fourier transform ion cyclotron resonance mass spectrometry (FT-ICR MS) analyses of petroleum sample were performed with higher sensitivity by switching the solvent composition from toluene and methanol or acetonitrile to a one-component system consisting only of toluene. In solvent blends, molecular ions were more abundant than were protonated ions with increasing percentages of toluene. In 100% toluene, the double-bond equivalence (DBE) distributions of molecular ions obtained by APCI MS for each compound class were very similar to those obtained in dopant assisted atmospheric pressure photo ionization (APPI) MS analyses. Therefore, it was concluded that charge-transfer reaction, which is important in toluene-doped APPI processes, also plays a major role in positive-ion APCI. In the DBE distributions of S(1), S(2), and SO heteroatom classes, a larger enhancement in the relative abundance of molecular ions at fairly specific DBE values was observed as the solvent was progressively switched to toluene. This enhanced abundance of molecular ions was likely dependent on molecular structure. Copyright 2010 American Society for Mass Spectrometry. Published by Elsevier Inc. All rights reserved.

  11. Serological detection and molecular characterization of piroplasmids in equids in Brazil.

    Science.gov (United States)

    Vieira, Maria Isabel Botelho; Costa, Márcio Machado; de Oliveira, Mateus Tonial; Gonçalves, Luiz Ricardo; André, Marcos Rogério; Machado, Rosangela Zacarias

    2018-03-01

    Equine piroplasmosis is a disease caused by the hemoparasites Babesia caballi and Theileria equi and is considered to be the most important parasitic infection affecting Equidae. The objective of the present study was to carry out an epidemiological molecular and serological survey for the presence of these two protozoal organisms in equids from the northwestern region of the State of Rio Grande do Sul (RS), south Brazil. For this purpose, blood samples were collected from 90 equids in the city of Passo Fundo, RS, Brazil. Those were animals used for sport activities, outdoor recreational riding, and work including cattle herding and mounted patrol. Anti-T. equi and anti-B. caballi IgG antibodies were detected in the sera of those animals by commercial ELISA kits. The molecular diagnosis of equine piroplasmosis due to T. equi or B. caballi (or both) consisted in the amplification of the 18S rRNA gene by nested PCR followed by sequencing of the amplified PCR product and sequence comparison and phylogenetic analysis of the isolates; 17 (18.9%) and 5 (5.55%) out of the 90 serum samples tested in this study were positive for T. equi and B. caballi, respectively. Piroplasmid 18S rRNA gene fragments were detected by PCR in 24.4% (22/90) of the samples analysed and shared 99-100% identity with sequences of T. equi by BLASTn. Samples for the phylogenetic analysis were divided into 2 groups. In group A, there was close phylogenetic relationship between 4 sequences and sequences previously reported along the US-Mexico border, in South Africa, and in Brazil. There was a phylogenetic proximity between 5 samples from group B and samples tested by other authors in the US and Spain. Variation of the 18S rRNA gene allowed the identification of 9 new T. equi genotypes in the geographical region studied. Copyright © 2017 Elsevier B.V. All rights reserved.

  12. Complete mitochondrial genome and phylogenetic position of the Sicklefin weasel shark Hemigaleus microstoma.

    Science.gov (United States)

    Mai, Quanfa; Li, Weidong; Chen, Hao; Ai, Weiming; Chen, Xiao

    2016-09-01

    The complete mitochondrial genome of the Sicklefin weasel shark Hemigaleus microstoma was first presented in this study. It was 16 701 bp in length with the typical gene arrangement in vertebrates. A total of 25 bp short intergenic spaces and 33 bp overlaps located in 12 and 9 gene junctions, respectively. The overall nucleotide composition was 31.0% A, 26.4% C, 13.5% G and 29.1% T. Two start (ATG and GTG) and three stop (TAG, AGG and TAA/T) codons were found in the protein-coding genes. The size of 22 tRNA genes ranged from 67 to 75 bp. In the phylogenetic tree, H. microstoma (Hemigaleidae) was placed as sister to Galeocerdo cuvier (Carcharhinidae).

  13. Ultrafast Approximation for Phylogenetic Bootstrap

    NARCIS (Netherlands)

    Bui Quang Minh, [No Value; Nguyen, Thi; von Haeseler, Arndt

    Nonparametric bootstrap has been a widely used tool in phylogenetic analysis to assess the clade support of phylogenetic trees. However, with the rapidly growing amount of data, this task remains a computational bottleneck. Recently, approximation methods such as the RAxML rapid bootstrap (RBS) and

  14. Molecular phylogenetic analysis of Fasciola flukes from eastern India.

    Science.gov (United States)

    Hayashi, Kei; Ichikawa-Seki, Madoka; Mohanta, Uday Kumar; Singh, T Shantikumar; Shoriki, Takuya; Sugiyama, Hiromu; Itagaki, Tadashi

    2015-10-01

    Fasciola flukes from eastern India were characterized on the basis of spermatogenesis status and nuclear ITS1. Both Fasciola gigantica and aspermic Fasciola flukes were detected in Imphal, Kohima, and Gantoku districts. The sequences of mitochondrial nad1 were analyzed to infer their phylogenetical relationship with neighboring countries. The haplotypes of aspermic Fasciola flukes were identical or showed a single nucleotide substitution compared to those from populations in the neighboring countries, corroborating the previous reports that categorized them in the same lineage. However, the prevalence of aspermic Fasciola flukes in eastern India was lower than those in the neighboring countries, suggesting that they have not dispersed throughout eastern India. In contrast, F. gigantica was predominant and well diversified, and the species was thought to be distributed in the area for a longer time than the aspermic Fasciola flukes. Fasciola gigantica populations from eastern India were categorized into two distinct haplogroups A and B. The level of their genetic diversity suggests that populations belonging to haplogroup A have dispersed from the west side of the Indian subcontinent to eastern India with the artificial movement of domestic cattle, Bos indicus, whereas populations belonging to haplogroup B might have spread from Myanmar to eastern India with domestic buffaloes, Bubalus bubalis. Copyright © 2015 Elsevier Ireland Ltd. All rights reserved.

  15. Phylogenetic Information Content of Copepoda Ribosomal DNA Repeat Units: ITS1 and ITS2 Impact

    Science.gov (United States)

    Zagoskin, Maxim V.; Lazareva, Valentina I.; Grishanin, Andrey K.; Mukha, Dmitry V.

    2014-01-01

    The utility of various regions of the ribosomal repeat unit for phylogenetic analysis was examined in 16 species representing four families, nine genera, and two orders of the subclass Copepoda (Crustacea). Fragments approximately 2000 bp in length containing the ribosomal DNA (rDNA) 18S and 28S gene fragments, the 5.8S gene, and the internal transcribed spacer regions I and II (ITS1 and ITS2) were amplified and analyzed. The DAMBE (Data Analysis in Molecular Biology and Evolution) software was used to analyze the saturation of nucleotide substitutions; this test revealed the suitability of both the 28S gene fragment and the ITS1/ITS2 rDNA regions for the reconstruction of phylogenetic trees. Distance (minimum evolution) and probabilistic (maximum likelihood, Bayesian) analyses of the data revealed that the 28S rDNA and the ITS1 and ITS2 regions are informative markers for inferring phylogenetic relationships among families of copepods and within the Cyclopidae family and associated genera. Split-graph analysis of concatenated ITS1/ITS2 rDNA regions of cyclopoid copepods suggested that the Mesocyclops, Thermocyclops, and Macrocyclops genera share complex evolutionary relationships. This study revealed that the ITS1 and ITS2 regions potentially represent different phylogenetic signals. PMID:25215300

  16. Phylogenetic analysis of HSP70 and cyt b gene sequences for Chinese Leishmania isolates and ultrastructural characteristics of Chinese Leishmania sp.

    Science.gov (United States)

    Yuan, Dongmei; Qin, Hanxiao; Zhang, Jianguo; Liao, Lin; Chen, Qiwei; Chen, Dali; Chen, Jianping

    2017-02-01

    Leishmaniasis is a worldwide epidemic disease caused by the genus Leishmania, which is still endemic in the west and northwest areas of China. Some viewpoints of the traditional taxonomy of Chinese Leishmania have been challenged by recent phylogenetic researches based on different molecular markers. However, the taxonomic positions and phylogenetic relationships of Chinese Leishmania isolates remain controversial, which need for more data and further analysis. In this study, the heat shock protein 70 (HSP70) gene and cytochrome b (cyt b) gene were used for phylogenetic analysis of Chinese Leishmania isolates from patients, dogs, gerbils, and sand flies in different geographic origins. Besides, for the interesting Leishmania sp. in China, the ultrastructure of three Chinese Leishmania sp. strains (MHOM/CN/90/SC10H2, SD, GL) were observed by transmission electron microscopy. Bayesian trees from HSP70 and cyt b congruently indicated that the 14 Chinese Leishmania isolates belong to three Leishmania species including L. donovani complex, L. gerbilli, and L. (Sauroleishmania) sp. Their identity further confirmed that the undescribed Leishmania species causing visceral Leishmaniasis (VL) in China is closely related to L. tarentolae. The phylogenetic results from HSP70 also suggested the classification of subspecies within L. donovani complex: KXG-918, KXG-927, KXG-Liu, KXG-Xu, 9044, SC6, and KXG-65 belong to L. donovani; Cy, WenChuan, and 801 were proposed to be L. infantum. Through transmission electron microscopy, unexpectedly, the Golgi apparatus were not observed in SC10H2, SD, and GL, which was similar to previous reports of reptilian Leishmania. The statistical analysis of microtubule counts separated SC10H2, SD, and GL as one group from any other reference strain (L. donovani MHOM/IN/80/DD8; L. tropica MHOM/SU/74/K27; L. gerbilli MRHO/CN/60/GERBILLI). The ultrastructural characteristics of Leishmania sp. partly lend support to the phylogenetic inference that

  17. Undergraduate Students’ Difficulties in Reading and Constructing Phylogenetic Tree

    Science.gov (United States)

    Sa'adah, S.; Tapilouw, F. S.; Hidayat, T.

    2017-02-01

    Representation is a very important communication tool to communicate scientific concepts. Biologists produce phylogenetic representation to express their understanding of evolutionary relationships. The phylogenetic tree is visual representation depict a hypothesis about the evolutionary relationship and widely used in the biological sciences. Phylogenetic tree currently growing for many disciplines in biology. Consequently, learning about phylogenetic tree become an important part of biological education and an interesting area for biology education research. However, research showed many students often struggle with interpreting the information that phylogenetic trees depict. The purpose of this study was to investigate undergraduate students’ difficulties in reading and constructing a phylogenetic tree. The method of this study is a descriptive method. In this study, we used questionnaires, interviews, multiple choice and open-ended questions, reflective journals and observations. The findings showed students experiencing difficulties, especially in constructing a phylogenetic tree. The students’ responds indicated that main reasons for difficulties in constructing a phylogenetic tree are difficult to placing taxa in a phylogenetic tree based on the data provided so that the phylogenetic tree constructed does not describe the actual evolutionary relationship (incorrect relatedness). Students also have difficulties in determining the sister group, character synapomorphy, autapomorphy from data provided (character table) and comparing among phylogenetic tree. According to them building the phylogenetic tree is more difficult than reading the phylogenetic tree. Finding this studies provide information to undergraduate instructor and students to overcome learning difficulties of reading and constructing phylogenetic tree.

  18. Phylogenetic structure in tropical hummingbird communities

    DEFF Research Database (Denmark)

    Graham, Catherine H; Parra, Juan L; Rahbek, Carsten

    2009-01-01

    How biotic interactions, current and historical environment, and biogeographic barriers determine community structure is a fundamental question in ecology and evolution, especially in diverse tropical regions. To evaluate patterns of local and regional diversity, we quantified the phylogenetic...... composition of 189 hummingbird communities in Ecuador. We assessed how species and phylogenetic composition changed along environmental gradients and across biogeographic barriers. We show that humid, low-elevation communities are phylogenetically overdispersed (coexistence of distant relatives), a pattern...... that is consistent with the idea that competition influences the local composition of hummingbirds. At higher elevations communities are phylogenetically clustered (coexistence of close relatives), consistent with the expectation of environmental filtering, which may result from the challenge of sustaining...

  19. Constructing phylogenetic trees using interacting pathways.

    Science.gov (United States)

    Wan, Peng; Che, Dongsheng

    2013-01-01

    Phylogenetic trees are used to represent evolutionary relationships among biological species or organisms. The construction of phylogenetic trees is based on the similarities or differences of their physical or genetic features. Traditional approaches of constructing phylogenetic trees mainly focus on physical features. The recent advancement of high-throughput technologies has led to accumulation of huge amounts of biological data, which in turn changed the way of biological studies in various aspects. In this paper, we report our approach of building phylogenetic trees using the information of interacting pathways. We have applied hierarchical clustering on two domains of organisms-eukaryotes and prokaryotes. Our preliminary results have shown the effectiveness of using the interacting pathways in revealing evolutionary relationships.

  20. Is invasion success of Australian trees mediated by their native biogeography, phylogenetic history, or both?

    Science.gov (United States)

    Miller, Joseph T; Hui, Cang; Thornhill, Andrew; Gallien, Laure; Le Roux, Johannes J; Richardson, David M

    2016-12-30

    For a plant species to become invasive it has to progress along the introduction-naturalization-invasion (INI) continuum which reflects the joint direction of niche breadth. Identification of traits that correlate with and drive species invasiveness along the continuum is a major focus of invasion biology. If invasiveness is underlain by heritable traits, and if such traits are phylogenetically conserved, then we would expect non-native species with different introduction status (i.e. position along the INI continuum) to show phylogenetic signal. This study uses two clades that contain a large number of invasive tree species from the genera Acacia and Eucalyptus to test whether geographic distribution and a novel phylogenetic conservation method can predict which species have been introduced, became naturalized, and invasive. Our results suggest that no underlying phylogenetic signal underlie the introduction status for both groups of trees, except for introduced acacias. The more invasive acacia clade contains invasive species that have smoother geographic distributions and are more marginal in the phylogenetic network. The less invasive eucalyptus group contains invasive species that are more clustered geographically, more centrally located in the phylogenetic network and have phylogenetic distances between invasive and non-invasive species that are trending toward the mean pairwise distance. This suggests that highly invasive groups may be identified because they have invasive species with smoother and faster expanding native distributions and are located more to the edges of phylogenetic networks than less invasive groups. Published by Oxford University Press on behalf of the Annals of Botany Company.

  1. Inferring Phylogenetic Networks Using PhyloNet.

    Science.gov (United States)

    Wen, Dingqiao; Yu, Yun; Zhu, Jiafan; Nakhleh, Luay

    2018-07-01

    PhyloNet was released in 2008 as a software package for representing and analyzing phylogenetic networks. At the time of its release, the main functionalities in PhyloNet consisted of measures for comparing network topologies and a single heuristic for reconciling gene trees with a species tree. Since then, PhyloNet has grown significantly. The software package now includes a wide array of methods for inferring phylogenetic networks from data sets of unlinked loci while accounting for both reticulation (e.g., hybridization) and incomplete lineage sorting. In particular, PhyloNet now allows for maximum parsimony, maximum likelihood, and Bayesian inference of phylogenetic networks from gene tree estimates. Furthermore, Bayesian inference directly from sequence data (sequence alignments or biallelic markers) is implemented. Maximum parsimony is based on an extension of the "minimizing deep coalescences" criterion to phylogenetic networks, whereas maximum likelihood and Bayesian inference are based on the multispecies network coalescent. All methods allow for multiple individuals per species. As computing the likelihood of a phylogenetic network is computationally hard, PhyloNet allows for evaluation and inference of networks using a pseudolikelihood measure. PhyloNet summarizes the results of the various analyzes and generates phylogenetic networks in the extended Newick format that is readily viewable by existing visualization software.

  2. Complete mitochondrial genomes elucidate phylogenetic relationships of the deep-sea octocoral families Coralliidae and Paragorgiidae

    Science.gov (United States)

    Figueroa, Diego F.; Baco, Amy R.

    2014-01-01

    In the past decade, molecular phylogenetic analyses of octocorals have shown that the current morphological taxonomic classification of these organisms needs to be revised. The latest phylogenetic analyses show that most octocorals can be divided into three main clades. One of these clades contains the families Coralliidae and Paragorgiidae. These families share several taxonomically important characters and it has been suggested that they may not be monophyletic; with the possibility of the Coralliidae being a derived branch of the Paragorgiidae. Uncertainty exists not only in the relationship of these two families, but also in the classification of the two genera that make up the Coralliidae, Corallium and Paracorallium. Molecular analyses suggest that the genus Corallium is paraphyletic, and it can be divided into two main clades, with the Paracorallium as members of one of these clades. In this study we sequenced the whole mitochondrial genome of five species of Paragorgia and of five species of Corallium to use in a phylogenetic analysis to achieve two main objectives; the first to elucidate the phylogenetic relationship between the Paragorgiidae and Coralliidae and the second to determine whether the genera Corallium and Paracorallium are monophyletic. Our results show that other members of the Coralliidae share the two novel mitochondrial gene arrangements found in a previous study in Corallium konojoi and Paracorallium japonicum; and that the Corallium konojoi arrangement is also found in the Paragorgiidae. Our phylogenetic reconstruction based on all the protein coding genes and ribosomal RNAs of the mitochondrial genome suggest that the Coralliidae are not a derived branch of the Paragorgiidae, but rather a monophyletic sister branch to the Paragorgiidae. While our manuscript was in review a study was published using morphological data and several fragments from mitochondrial genes to redefine the taxonomy of the Coralliidae. Paracorallium was subsumed

  3. Evolution of microgastropods (Ellobioidea, Carychiidae): integrating taxonomic, phylogenetic and evolutionary hypotheses

    Science.gov (United States)

    2013-01-01

    Background Current biodiversity patterns are considered largely the result of past climatic and tectonic changes. In an integrative approach, we combine taxonomic and phylogenetic hypotheses to analyze temporal and geographic diversification of epigean (Carychium) and subterranean (Zospeum) evolutionary lineages in Carychiidae (Eupulmonata, Ellobioidea). We explicitly test three hypotheses: 1) morphospecies encompass unrecognized evolutionary lineages, 2) limited dispersal results in a close genetic relationship of geographical proximally distributed taxa and 3) major climatic and tectonic events had an impact on lineage diversification within Carychiidae. Results Initial morphospecies assignments were investigated by different molecular delimitation approaches (threshold, ABGD, GMYC and SP). Despite a conservative delimitation strategy, carychiid morphospecies comprise a great number of unrecognized evolutionary lineages. We attribute this phenomenon to historic underestimation of morphological stasis and phenotypic variability amongst lineages. The first molecular phylogenetic hypothesis for the Carychiidae (based on COI, 16S and H3) reveals Carychium and Zospeum to be reciprocally monophyletic. Geographical proximally distributed lineages are often closely related. The temporal diversification of Carychiidae is best described by a constant rate model of diversification. The evolution of Carychiidae is characterized by relatively few (long distance) colonization events. We find support for an Asian origin of Carychium. Zospeum may have arrived in Europe before extant members of Carychium. Distantly related Carychium clades inhabit a wide spectrum of the available bioclimatic niche and demonstrate considerable niche overlap. Conclusions Carychiid taxonomy is in dire need of revision. An inferred wide distribution and variable phenotype suggest underestimated diversity in Zospeum. Several Carychium morphospecies are results of past taxonomic lumping. By collecting

  4. First μ-CT-based 3D reconstruction of a dipteran larva-the head morphology of Protanyderus (Tanyderidae) and its phylogenetic implications.

    Science.gov (United States)

    Wipfler, Benjamin; Courtney, Greg W; Craig, Douglas A; Beutel, Rolf G

    2012-09-01

    The larval head of Protanyderus was examined and documented using innovative techniques, with emphasis on internal structures. A chart listing all head muscles of dipteran larvae and other holometabolan groups is presented in the Supporting Information. The results are compared to conditions found in other nematoceran lineages. The larval head of Protanyderus is characterized mainly by plesiomorphic character states such as the complete and largely exposed head capsule, the long coronal suture, V-shaped frontal sutures, lateral antennal insertion areas, a transverse labrum, a nearly horizontal plane of mandibular movements, mandibles lacking a movable distal part, a mesal hook and mesal or distal combs, separated maxillary endite lobes, a comparatively complete array of muscles, and a brain only partly located within the head capsule. An anteriorly toothed hypostomal plate and dense labral brushes of microtrichiae are also likely groundplan features of Diptera. The pharyngeal filter is a possible apomorphy of Diptera excl. Deuterophlebiidae (or Deuterophlebiidae + Nymphomyiidae). The messors have also likely evolved early in the dipteran crown group but are absent in the groundplan. The phylogenetic interpretation of externolateral plates with growth lines is ambiguous. Autapomorphies of Tanyderidae are differences between the third and fourth instar larvae, the roof-like extension above the antennal insertion area, the dorsal endocarina, and the posterodorsal internal ridge. The phylogenetic position of Tanyderidae is controversial, but features of the larval head do not support a proposed sistergroup relationship between Tanyderidae and Psychodidae. Both groups differ in many features of the larval head, and we did not identify a single potential synapomorphy. Larval characters alone are insufficient for a reliable phylogenetic reconstruction, though they vary greatly and apparently contain phylogenetic information. The evaluation of these features in the context

  5. The space of ultrametric phylogenetic trees.

    Science.gov (United States)

    Gavryushkin, Alex; Drummond, Alexei J

    2016-08-21

    The reliability of a phylogenetic inference method from genomic sequence data is ensured by its statistical consistency. Bayesian inference methods produce a sample of phylogenetic trees from the posterior distribution given sequence data. Hence the question of statistical consistency of such methods is equivalent to the consistency of the summary of the sample. More generally, statistical consistency is ensured by the tree space used to analyse the sample. In this paper, we consider two standard parameterisations of phylogenetic time-trees used in evolutionary models: inter-coalescent interval lengths and absolute times of divergence events. For each of these parameterisations we introduce a natural metric space on ultrametric phylogenetic trees. We compare the introduced spaces with existing models of tree space and formulate several formal requirements that a metric space on phylogenetic trees must possess in order to be a satisfactory space for statistical analysis, and justify them. We show that only a few known constructions of the space of phylogenetic trees satisfy these requirements. However, our results suggest that these basic requirements are not enough to distinguish between the two metric spaces we introduce and that the choice between metric spaces requires additional properties to be considered. Particularly, that the summary tree minimising the square distance to the trees from the sample might be different for different parameterisations. This suggests that further fundamental insight is needed into the problem of statistical consistency of phylogenetic inference methods. Copyright © 2016 The Authors. Published by Elsevier Ltd.. All rights reserved.

  6. Expressed sequence tags as a tool for phylogenetic analysis of placental mammal evolution.

    Directory of Open Access Journals (Sweden)

    Morgan Kullberg

    Full Text Available BACKGROUND: We investigate the usefulness of expressed sequence tags, ESTs, for establishing divergences within the tree of placental mammals. This is done on the example of the established relationships among primates (human, lagomorphs (rabbit, rodents (rat and mouse, artiodactyls (cow, carnivorans (dog and proboscideans (elephant. METHODOLOGY/PRINCIPAL FINDINGS: We have produced 2000 ESTs (1.2 mega bases from a marsupial mouse and characterized the data for their use in phylogenetic analysis. The sequences were used to identify putative orthologous sequences from whole genome projects. Although most ESTs stem from single sequence reads, the frequency of potential sequencing errors was found to be lower than allelic variation. Most of the sequences represented slowly evolving housekeeping-type genes, with an average amino acid distance of 6.6% between human and mouse. Positive Darwinian selection was identified at only a few single sites. Phylogenetic analyses of the EST data yielded trees that were consistent with those established from whole genome projects. CONCLUSIONS: The general quality of EST sequences and the general absence of positive selection in these sequences make ESTs an attractive tool for phylogenetic analysis. The EST approach allows, at reasonable costs, a fast extension of data sampling from species outside the genome projects.

  7. Characterization of the complete mitochondrial genome of Marshallagia marshalli and phylogenetic implications for the superfamily Trichostrongyloidea.

    Science.gov (United States)

    Sun, Miao-Miao; Han, Liang; Zhang, Fu-Kai; Zhou, Dong-Hui; Wang, Shu-Qing; Ma, Jun; Zhu, Xing-Quan; Liu, Guo-Hua

    2018-01-01

    Marshallagia marshalli (Nematoda: Trichostrongylidae) infection can lead to serious parasitic gastroenteritis in sheep, goat, and wild ruminant, causing significant socioeconomic losses worldwide. Up to now, the study concerning the molecular biology of M. marshalli is limited. Herein, we sequenced the complete mitochondrial (mt) genome of M. marshalli and examined its phylogenetic relationship with selected members of the superfamily Trichostrongyloidea using Bayesian inference (BI) based on concatenated mt amino acid sequence datasets. The complete mt genome sequence of M. marshalli is 13,891 bp, including 12 protein-coding genes, 22 transfer RNA genes, and 2 ribosomal RNA genes. All protein-coding genes are transcribed in the same direction. Phylogenetic analyses based on concatenated amino acid sequences of the 12 protein-coding genes supported the monophylies of the families Haemonchidae, Molineidae, and Dictyocaulidae with strong statistical support, but rejected the monophyly of the family Trichostrongylidae. The determination of the complete mt genome sequence of M. marshalli provides novel genetic markers for studying the systematics, population genetics, and molecular epidemiology of M. marshalli and its congeners.

  8. Patterns and effects of GC3 heterogeneity and parsimony informative sites on the phylogenetic tree of genes.

    Science.gov (United States)

    Ma, Shuai; Wu, Qi; Hu, Yibo; Wei, Fuwen

    2018-05-20

    The explosive growth in genomic data has provided novel insights into the conflicting signals hidden in phylogenetic trees. Although some studies have explored the effects of the GC content and parsimony informative sites (PIS) on the phylogenetic tree, the effect of the heterogeneity of the GC content at the first/second/third codon position on parsimony informative sites (GC1/2/3 PIS ) among different species and the effect of PIS on phylogenetic tree construction remain largely unexplored. Here, we used two different mammal genomic datasets to explore the patterns of GC1/2/3 PIS heterogeneity and the effect of PIS on the phylogenetic tree of genes: (i) all GC1/2/3 PIS have obvious heterogeneity between different mammals, and the levels of heterogeneity are GC3 PIS  > GC2 PIS  > GC1 PIS ; (ii) the number of PIS is positively correlated with the metrics of "good" gene tree topologies, and excluding the third codon position (C3) decreases the quality of gene trees by removing too many PIS. These results provide novel insights into the heterogeneity pattern of GC1/2/3 PIS in mammals and the relationship between GC3/PIS and gene trees. Additionally, it is necessary to carefully consider whether to exclude C3 to improve the quality of gene trees, especially in the super-tree method. Copyright © 2018 Elsevier B.V. All rights reserved.

  9. Potential pitfalls of modelling ribosomal RNA data in phylogenetic tree reconstruction: evidence from case studies in the Metazoa.

    Science.gov (United States)

    Letsch, Harald O; Kjer, Karl M

    2011-05-27

    Failure to account for covariation patterns in helical regions of ribosomal RNA (rRNA) genes has the potential to misdirect the estimation of the phylogenetic signal of the data. Furthermore, the extremes of length variation among taxa, combined with regional substitution rate variation can mislead the alignment of rRNA sequences and thus distort subsequent tree reconstructions. However, recent developments in phylogenetic methodology now allow a comprehensive integration of secondary structures in alignment and tree reconstruction analyses based on rRNA sequences, which has been shown to correct some of these problems. Here, we explore the potentials of RNA substitution models and the interactions of specific model setups with the inherent pattern of covariation in rRNA stems and substitution rate variation among loop regions. We found an explicit impact of RNA substitution models on tree reconstruction analyses. The application of specific RNA models in tree reconstructions is hampered by interaction between the appropriate modelling of covarying sites in stem regions, and excessive homoplasy in some loop regions. RNA models often failed to recover reasonable trees when single-stranded regions are excessively homoplastic, because these regions contribute a greater proportion of the data when covarying sites are essentially downweighted. In this context, the RNA6A model outperformed all other models, including the more parametrized RNA7 and RNA16 models. Our results depict a trade-off between increased accuracy in estimation of interdependencies in helical regions with the risk of magnifying positions lacking phylogenetic signal. We can therefore conclude that caution is warranted when applying rRNA covariation models, and suggest that loop regions be independently screened for phylogenetic signal, and eliminated when they are indistinguishable from random noise. In addition to covariation and homoplasy, other factors, like non-stationarity of substitution rates

  10. Current Understanding of Ecdysozoa and its Internal Phylogenetic Relationships.

    Science.gov (United States)

    Giribet, Gonzalo; Edgecombe, Gregory D

    2017-09-01

    Twenty years after its proposal, the monophyly of molting protostomes-Ecdysozoa-is a well-corroborated hypothesis, but the interrelationships of its major subclades are more ambiguous than is commonly appreciated. Morphological and molecular support for arthropods, onychophorans and tardigrades as a clade (Panarthropoda) continues to be challenged by a grouping of tardigrades with Nematoida in some molecular analyses, although onychophorans are consistently recovered as the sister group of arthropods. The status of Cycloneuralia and Scalidophora, each proposed by morphologists in the 1990s and widely employed in textbooks, is in flux: Cycloneuralia is typically non-monophyletic in molecular analyses, and Scalidophora is either contradicted or incompletely tested because of limited genomic and transcriptomic data for Loricifera, Kinorhyncha, and Priapulida. However, novel genomic data across Ecdysozoa should soon be available to tackle these difficult phylogenetic questions. The Cambrian fossil record indicates crown-group members of various ecdysozoan phyla as well as stem-group taxa that assist with reconstructing the most recent common ancestor of panarthropods and cycloneuralians. © The Author 2017. Published by Oxford University Press on behalf of the Society for Integrative and Comparative Biology. All rights reserved. For permissions please email: journals.permissions@oup.com.

  11. Phylogenetic analyses place the monotypic Dryopolystichum within Lomariopsidaceae

    Directory of Open Access Journals (Sweden)

    Cheng-Wei Chen

    2017-04-01

    Full Text Available The monotypic fern genus Dryopolystichum Copel. combines a unique assortment of characters that obscures its relationship to other ferns. Its thin-walled sporangium with a vertical and interrupted annulus, round sorus with peltate indusium, and petiole with several vascular bundles place it in suborder Polypodiineae, but more precise placement has eluded previous authors. Here we investigate its phylogenetic position using three plastid DNA markers, rbcL, rps4-trnS, and trnL-F, and a broad sampling of Polypodiineae. We also provide new data on Dryopolystichum including spore number counts, reproductive mode, spore SEM images, and chromosome counts. Our maximum-likelihood and Bayesian-inference phylogenetic analyses unambiguously place Dryopolystichum within Lomariopsidaceae, a position not previously suggested. Dryopolystichum was resolved as sister to a clade comprising Dracoglossum and Lomariopsis, with Cyclopeltis as sister to these, but clade support is not robust. All examined sporangia of Dryopolystichum produced 32 spores, and the chromosome number of sporophyte somatic cells is ca. 164. Flow cytometric results indicated that the genome size in the spore nuclei is approximately half the size of those from sporophyte leaf tissues, suggesting that Dryopolystichum reproduces sexually. Our findings render Lomariopsidaceae as one of the most morphologically heterogeneous fern families. A recircumscription is provided for both Lomariopsidaceae and Dryopolystichum, and selected characters are briefly discussed considering the newly generated data.

  12. phangorn: phylogenetic analysis in R.

    Science.gov (United States)

    Schliep, Klaus Peter

    2011-02-15

    phangorn is a package for phylogenetic reconstruction and analysis in the R language. Previously it was only possible to estimate phylogenetic trees with distance methods in R. phangorn, now offers the possibility of reconstructing phylogenies with distance based methods, maximum parsimony or maximum likelihood (ML) and performing Hadamard conjugation. Extending the general ML framework, this package provides the possibility of estimating mixture and partition models. Furthermore, phangorn offers several functions for comparing trees, phylogenetic models or splits, simulating character data and performing congruence analyses. phangorn can be obtained through the CRAN homepage http://cran.r-project.org/web/packages/phangorn/index.html. phangorn is licensed under GPL 2.

  13. Molecular diversity of legume root-nodule bacteria in Kakadu National Park, Northern Territory, Australia.

    Directory of Open Access Journals (Sweden)

    Bénédicte Lafay

    2007-03-01

    Full Text Available Symbiotic relationships between leguminous plants (family Fabaceae and nodule-forming bacteria in Australia native ecosystems remain poorly characterized despite their importance. Most studies have focused on temperate parts of the country, where the use of molecular approaches have already revealed the presence of Bradyrhizobium, Ensifer (formerly Sinorhizobium, Mesorhizobium and Rhizobium genera of legume root-nodule bacteria. We here provide the first molecular characterization of nodulating bacteria from tropical Australia.45 nodule-forming bacterial strains, isolated from eight native legume hosts at eight locations in Kakadu National Park, Northern Territory, Australia, were examined for their genetic diversity and phylogenetic position. Using SSU rDNA PCR-RFLPs and phylogenetic analyses, our survey identified nine genospecies, two of which, Bradyrhizobium genospp. B and P, had been previously identified in south-eastern Australia and one, Mesorhizobium genospecies AA, in southern France. Three of the five newly characterized Bradyrhizobium genospecies were more closely related to B. japonicum USDA110, whereas the other two belonged to the B. elkanii group. All five were each more closely related to strains sampled in various tropical areas outside Australia than to strains known to occur in Australia. We also characterized an entirely novel nodule-forming lineage, phylogenetically distant from any previously described rhizobial and non-rhizobial legume-nodulating lineage within the Rhizobiales.Overall, the present results support the hypothesis of tropical areas being centres of biodiversity and diversification for legume root-nodule bacteria and confirm the widespread occurrence of Bradyrhizobium genosp. B in continental Australia.

  14. Molecular characterization and phylogenetic analysis of Fasciola hepatica from Peru.

    Science.gov (United States)

    Ichikawa-Seki, Madoka; Ortiz, Pedro; Cabrera, Maria; Hobán, Cristian; Itagaki, Tadashi

    2016-06-01

    The causative agent of fasciolosis in South America is thought to be Fasciola hepatica. In this study, Fasciola flukes from Peru were analyzed to investigate their genetic structure and phylogenetic relationships with those from other countries. Fasciola flukes were collected from the three definitive host species: cattle, sheep, and pigs. They were identified as F. hepatica because mature sperms were observed in their seminal vesicles, and also they displayed Fh type, which has an identical fragment pattern to F. hepatica in the nuclear internal transcribed spacer 1. Eight haplotypes were obtained from the mitochondrial NADH dehydrogenase subunit 1 (nad1) sequences of Peruvian F. hepatica; however, no special difference in genetic structure was observed between the three host species. Its extremely low genetic diversity suggests that the Peruvian population was introduced from other regions. Nad1 haplotypes identical to those of Peruvian F. hepatica were detected in China, Uruguay, Italy, Iran, and Australia. Our results indicate that F. hepatica rapidly expanded its range due to human migration. Future studies are required to elucidate dispersal route of F. hepatica from Europe, its probable origin, to other areas, including Peru. Copyright © 2015. Published by Elsevier Ireland Ltd.

  15. Molecular phylogeny of the hominoid primates as indicated by two-dimensional protein electrophoresis

    International Nuclear Information System (INIS)

    Goldman, D.; Giri, P.R.; O'Brien, J.O.

    1987-01-01

    A molecular phylogeny for the hominoid primates was constructed by using genetic distances from a survey of 383 radiolabeled fibroblast polypeptides resolved by two-dimensional electrophoresis (2DE). An internally consistent matrix of Nei genetic distances was generated on the basis of variants in electrophoretic position. The derived phylogenetic tree indicated a branching sequence, from oldest to most recent, of cercopithecoids (Macaca fascicularis), gibbon-siamang, orangutan, gorilla, and human-chimpanzee. A cladistic analysis of 240 electrophoretic characters that varied between ape species produced an identical tree. Genetic distance measures obtained by 2DE are largely consistent with those generated by other molecular procedures. In addition, the 2DE data set appears to resolve the human-chimpanzee-gorilla trichotomy in favor of a more recent association of chimpanzees and humans

  16. Phylogenetic & Physiological Profiling of Microbial Communities of Contaminated Soils/Sediments: Identifying Microbial consortia...

    Energy Technology Data Exchange (ETDEWEB)

    Terence L. Marsh

    2004-05-26

    The goals of this study were: (1) survey the microbial community in soil samples from a site contaminated with heavy metals using new rapid molecular techniques that are culture-independent; (2) identify phylogenetic signatures of microbial populations that correlate with metal ion contamination; and (3) cultivate these diagnostic strains using traditional as well as novel cultivation techniques in order to identify organisms that may be of value in site evaluation/management or bioremediation.

  17. Undergraduate Students’ Initial Ability in Understanding Phylogenetic Tree

    Science.gov (United States)

    Sa'adah, S.; Hidayat, T.; Sudargo, Fransisca

    2017-04-01

    The Phylogenetic tree is a visual representation depicts a hypothesis about the evolutionary relationship among taxa. Evolutionary experts use this representation to evaluate the evidence for evolution. The phylogenetic tree is currently growing for many disciplines in biology. Consequently, learning about the phylogenetic tree has become an important part of biological education and an interesting area of biology education research. Skill to understanding and reasoning of the phylogenetic tree, (called tree thinking) is an important skill for biology students. However, research showed many students have difficulty in interpreting, constructing, and comparing among the phylogenetic tree, as well as experiencing a misconception in the understanding of the phylogenetic tree. Students are often not taught how to reason about evolutionary relationship depicted in the diagram. Students are also not provided with information about the underlying theory and process of phylogenetic. This study aims to investigate the initial ability of undergraduate students in understanding and reasoning of the phylogenetic tree. The research method is the descriptive method. Students are given multiple choice questions and an essay that representative by tree thinking elements. Each correct answer made percentages. Each student is also given questionnaires. The results showed that the undergraduate students’ initial ability in understanding and reasoning phylogenetic tree is low. Many students are not able to answer questions about the phylogenetic tree. Only 19 % undergraduate student who answered correctly on indicator evaluate the evolutionary relationship among taxa, 25% undergraduate student who answered correctly on indicator applying concepts of the clade, 17% undergraduate student who answered correctly on indicator determines the character evolution, and only a few undergraduate student who can construct the phylogenetic tree.

  18. Improved Maximum Parsimony Models for Phylogenetic Networks.

    Science.gov (United States)

    Van Iersel, Leo; Jones, Mark; Scornavacca, Celine

    2018-05-01

    Phylogenetic networks are well suited to represent evolutionary histories comprising reticulate evolution. Several methods aiming at reconstructing explicit phylogenetic networks have been developed in the last two decades. In this article, we propose a new definition of maximum parsimony for phylogenetic networks that permits to model biological scenarios that cannot be modeled by the definitions currently present in the literature (namely, the "hardwired" and "softwired" parsimony). Building on this new definition, we provide several algorithmic results that lay the foundations for new parsimony-based methods for phylogenetic network reconstruction.

  19. Molecular phylogeny of Eriocaulon (Eriocaulaceae)

    DEFF Research Database (Denmark)

    Ito, Yu; Tanaka, Norio; Barfod, Anders

    Eriocaulon is a genus of about 400 species of monocotyledonous flowering plants in the family Eriocaulaceae. The genus is widely distributed in the world, with the centers of diversity in tropical regions, such as tropical Asia and tropical Africa. A previous molecular phylogeny implied an Africa...... the genus. In this talk, we provide preliminary results of our molecular phylogenetic analysis of the genus aiming to i) assess the biogeographic origin, ii) explore phylogenetic origins of submerged species, and iii) address the evolutionary role of polyploids.......Eriocaulon is a genus of about 400 species of monocotyledonous flowering plants in the family Eriocaulaceae. The genus is widely distributed in the world, with the centers of diversity in tropical regions, such as tropical Asia and tropical Africa. A previous molecular phylogeny implied an African...... origin for Eriocaulon as a sister relationship between the genus and an African endemic one was recovered. The species of Eriocaulon primarily grow in wetlands while some inhabit shallow rivers and streams with an apparent adaptive morphology of elongated submerged stems. Polyploidy is known from...

  20. Phylogenetic analysis of H9N2 avian influenza viruses in Afghanistan (2016-2017).

    Science.gov (United States)

    Hosseini, Hossein; Ghalyanchilangeroudi, Arash; Fallah Mehrabadi, Mohammad Hossein; Sediqian, Mohammad Saeed; Shayeganmehr, Arzhang; Ghafouri, Seyed Ali; Maghsoudloo, Hossein; Abdollahi, Hamed; Farahani, Reza Kh

    2017-10-01

    Avian influenza A virus (AIV) subtype H9N2 is the most prevalent subtype found in terrestrial poultry throughout Eurasia and has been isolated from poultry outbreaks worldwide. Tracheal tissue specimens from 100 commercial broiler flocks in Afghanistan were collected between 2016 and 2017. After real-time RT-PCR, AI-positive samples were further characterized. A part of the HA gene was amplified using RT-PCR and sequenced. The results of real-time RT-PCR showed that 40 percent of the flocks were AI positive. Phylogenetic studies showed that these H9N2 AIVs grouped within the Eurasian-lineage G1 AIVs and had a correlation with H9N2 AIV circulating in the poultry population of the neighboring countries over the past decade. Analysis of the amino acid sequence of HA revealed that the detected H9N2 viruses possessed molecular profiles suggestive of low pathogenicity and specificity for the avian-like SAα2,3 receptor, demonstrating their specificity for and adaptation to domestic poultry. The results of the current study provide great insights into H9N2 viruses circulating in Afghanistan's poultry industry and demonstrate the necessity of planning an applied policy aimed at controlling and managing H9N2 infection in Afghan poultry.

  1. Internal Transcribed Spacer 1 (ITS1 based sequence typing reveals phylogenetically distinct Ascaris population

    Directory of Open Access Journals (Sweden)

    Koushik Das

    2015-01-01

    Full Text Available Taxonomic differentiation among morphologically identical Ascaris species is a debatable scientific issue in the context of Ascariasis epidemiology. To explain the disease epidemiology and also the taxonomic position of different Ascaris species, genome information of infecting strains from endemic areas throughout the world is certainly crucial. Ascaris population from human has been genetically characterized based on the widely used genetic marker, internal transcribed spacer1 (ITS1. Along with previously reported and prevalent genotype G1, 8 new sequence variants of ITS1 have been identified. Genotype G1 was significantly present among female patients aged between 10 to 15 years. Intragenic linkage disequilibrium (LD analysis at target locus within our study population has identified an incomplete LD value with potential recombination events. A separate cluster of Indian isolates with high bootstrap value indicate their distinct phylogenetic position in comparison to the global Ascaris population. Genetic shuffling through recombination could be a possible reason for high population diversity and frequent emergence of new sequence variants, identified in present and other previous studies. This study explores the genetic organization of Indian Ascaris population for the first time which certainly includes some fundamental information on the molecular epidemiology of Ascariasis.

  2. Molecular identification and phylogenetic analysis of important medicinal plant species in genus Paeonia based on rDNA-ITS, matK, and rbcL DNA barcode sequences.

    Science.gov (United States)

    Kim, W J; Ji, Y; Choi, G; Kang, Y M; Yang, S; Moon, B C

    2016-08-05

    This study was performed to identify and analyze the phylogenetic relationship among four herbaceous species of the genus Paeonia, P. lactiflora, P. japonica, P. veitchii, and P. suffruticosa, using DNA barcodes. These four species, which are commonly used in traditional medicine as Paeoniae Radix and Moutan Radicis Cortex, are pharmaceutically defined in different ways in the national pharmacopoeias in Korea, Japan, and China. To authenticate the different species used in these medicines, we evaluated rDNA-internal transcribed spacers (ITS), matK and rbcL regions, which provide information capable of effectively distinguishing each species from one another. Seventeen samples were collected from different geographic regions in Korea and China, and DNA barcode regions were amplified using universal primers. Comparative analyses of these DNA barcode sequences revealed species-specific nucleotide sequences capable of discriminating the four Paeonia species. Among the entire sequences of three barcodes, marker nucleotides were identified at three positions in P. lactiflora, eleven in P. japonica, five in P. veitchii, and 25 in P. suffruticosa. Phylogenetic analyses also revealed four distinct clusters showing homogeneous clades with high resolution at the species level. The results demonstrate that the analysis of these three DNA barcode sequences is a reliable method for identifying the four Paeonia species and can be used to authenticate Paeoniae Radix and Moutan Radicis Cortex at the species level. Furthermore, based on the assessment of amplicon sizes, inter/intra-specific distances, marker nucleotides, and phylogenetic analysis, rDNA-ITS was the most suitable DNA barcode for identification of these species.

  3. A program for verification of phylogenetic network models.

    Science.gov (United States)

    Gunawan, Andreas D M; Lu, Bingxin; Zhang, Louxin

    2016-09-01

    Genetic material is transferred in a non-reproductive manner across species more frequently than commonly thought, particularly in the bacteria kingdom. On one hand, extant genomes are thus more properly considered as a fusion product of both reproductive and non-reproductive genetic transfers. This has motivated researchers to adopt phylogenetic networks to study genome evolution. On the other hand, a gene's evolution is usually tree-like and has been studied for over half a century. Accordingly, the relationships between phylogenetic trees and networks are the basis for the reconstruction and verification of phylogenetic networks. One important problem in verifying a network model is determining whether or not certain existing phylogenetic trees are displayed in a phylogenetic network. This problem is formally called the tree containment problem. It is NP-complete even for binary phylogenetic networks. We design an exponential time but efficient method for determining whether or not a phylogenetic tree is displayed in an arbitrary phylogenetic network. It is developed on the basis of the so-called reticulation-visible property of phylogenetic networks. A C-program is available for download on http://www.math.nus.edu.sg/∼matzlx/tcp_package matzlx@nus.edu.sg Supplementary data are available at Bioinformatics online. © The Author 2016. Published by Oxford University Press. All rights reserved. For Permissions, please e-mail: journals.permissions@oup.com.

  4. Extended mitogenomic phylogenetic analyses yield new insight into crocodylian evolution and their survival of the Cretaceous-Tertiary boundary.

    Science.gov (United States)

    Roos, Jonas; Aggarwal, Ramesh K; Janke, Axel

    2007-11-01

    The mitochondrial genomes of the dwarf crocodile, Osteolaemus tetraspis, and two species of dwarf caimans, the smooth-fronted caiman, Paleosuchus trigonatus, and Cuvier's dwarf caiman, Paleosuchus palpebrosus, were sequenced and included in a mitogenomic phylogenetic study. The phylogenetic analyses, which included a total of ten crocodylian species, yielded strong support to a basal split between Crocodylidae and Alligatoridae. Osteolaemus fell within the Crocodylidae as the sister group to Crocodylus. Gavialis and Tomistoma, which joined on a common branch, constituted a sister group to Crocodylus/Osteolaemus. This suggests that extant crocodylians are organized in two families: Alligatoridae and Crocodylidae. Within the Alligatoridae there was a basal split between Alligator and a branch that contained Paleosuchus and Caiman. The analyses also provided molecular estimates of various divergences applying recently established crocodylian and outgroup fossil calibration points. Molecular estimates based on amino acid data placed the divergence between Crocodylidae and Alligatoridae at 97-103 million years ago and that between Alligator and Caiman/Paleosuchus at 65-72 million years ago. Other crocodilian divergences were placed after the Cretaceous-Tertiary boundary. Thus, according to the molecular estimates, three extant crocodylian lineages have their roots in the Cretaceous. Considering the crocodylian diversification in the Cretaceous the molecular datings suggest that the extinction of the dinosaurs was also to some extent paralleled in the crocodylian evolution. However, for whatever reason, some crocodylian lineages survived into the Tertiary.

  5. Increasing phylogenetic resolution at low taxonomic levels using massively parallel sequencing of chloroplast genomes

    Directory of Open Access Journals (Sweden)

    Cronn Richard

    2009-12-01

    Full Text Available Abstract Background Molecular evolutionary studies share the common goal of elucidating historical relationships, and the common challenge of adequately sampling taxa and characters. Particularly at low taxonomic levels, recent divergence, rapid radiations, and conservative genome evolution yield limited sequence variation, and dense taxon sampling is often desirable. Recent advances in massively parallel sequencing make it possible to rapidly obtain large amounts of sequence data, and multiplexing makes extensive sampling of megabase sequences feasible. Is it possible to efficiently apply massively parallel sequencing to increase phylogenetic resolution at low taxonomic levels? Results We reconstruct the infrageneric phylogeny of Pinus from 37 nearly-complete chloroplast genomes (average 109 kilobases each of an approximately 120 kilobase genome generated using multiplexed massively parallel sequencing. 30/33 ingroup nodes resolved with ≥ 95% bootstrap support; this is a substantial improvement relative to prior studies, and shows massively parallel sequencing-based strategies can produce sufficient high quality sequence to reach support levels originally proposed for the phylogenetic bootstrap. Resampling simulations show that at least the entire plastome is necessary to fully resolve Pinus, particularly in rapidly radiating clades. Meta-analysis of 99 published infrageneric phylogenies shows that whole plastome analysis should provide similar gains across a range of plant genera. A disproportionate amount of phylogenetic information resides in two loci (ycf1, ycf2, highlighting their unusual evolutionary properties. Conclusion Plastome sequencing is now an efficient option for increasing phylogenetic resolution at lower taxonomic levels in plant phylogenetic and population genetic analyses. With continuing improvements in sequencing capacity, the strategies herein should revolutionize efforts requiring dense taxon and character sampling

  6. Phylogenetic relationships between Sarcocystis species from reindeer and other Sarcocystidae deduced from ssu rRNA gene sequences

    DEFF Research Database (Denmark)

    Dahlgren, S.S.; Oliveira, Rodrigo Gouveia; Gjerde, B.

    2008-01-01

    any effect on previously inferred phylogenetic relationships within the Sarcocystidae. The complete small subunit (ssu) rRNA gene sequences of all six Sarcocystis species from reindeer were used in the phylogenetic analyses along with ssu rRNA gene sequences of 85 other members of the Coccidea. Trees...... the six species in phylogenetic analyses of the Sarcocystidae, and also to investigate the phylogenetic relationships between the species from reindeer and those from other hosts. The study also aimed at revealing whether the inclusion of six Sarcocystis species from the same intermediate host would have....... tarandivulpes, formed a sister group to other Sarcocystis species with a canine definitive host. The position of S. hardangeri on the tree suggested that it uses another type of definitive host than the other Sarcocystis species in this clade. Considering the geographical distribution and infection intensity...

  7. Are Ichthyosporea animals or fungi? Bayesian phylogenetic analysis of elongation factor 1alpha of Ichthyophonus irregularis.

    Science.gov (United States)

    Ragan, Mark A; Murphy, Colleen A; Rand, Thomas G

    2003-12-01

    Ichthyosporea is a recently recognized group of morphologically simple eukaryotes, many of which cause disease in aquatic organisms. Ribosomal RNA sequence analyses place Ichthyosporea near the divergence of the animal and fungal lineages, but do not allow resolution of its exact phylogenetic position. Some of the best evidence for a specific grouping of animals and fungi (Opisthokonta) has come from elongation factor 1alpha, not only phylogenetic analysis of sequences but also the presence or absence of short insertions and deletions. We sequenced the EF-1alpha gene from the ichthyosporean parasite Ichthyophonus irregularis and determined its phylogenetic position using neighbor-joining, parsimony and Bayesian methods. We also sequenced EF-1alpha genes from four chytrids to provide broader representation within fungi. Sequence analyses and the presence of a characteristic 12 amino acid insertion strongly indicate that I. irregularis is a member of Opisthokonta, but do not resolve whether I. irregularis is a specific relative of animals or of fungi. However, the EF-1alpha of I. irregularis exhibits a two amino acid deletion heretofore reported only among fungi.

  8. Molecular evolution of the polyamine oxidase gene family in Metazoa

    Directory of Open Access Journals (Sweden)

    Polticelli Fabio

    2012-06-01

    Full Text Available Abstract Background Polyamine oxidase enzymes catalyze the oxidation of polyamines and acetylpolyamines. Since polyamines are basic regulators of cell growth and proliferation, their homeostasis is crucial for cell life. Members of the polyamine oxidase gene family have been identified in a wide variety of animals, including vertebrates, arthropodes, nematodes, placozoa, as well as in plants and fungi. Polyamine oxidases (PAOs from yeast can oxidize spermine, N1-acetylspermine, and N1-acetylspermidine, however, in vertebrates two different enzymes, namely spermine oxidase (SMO and acetylpolyamine oxidase (APAO, specifically catalyze the oxidation of spermine, and N1-acetylspermine/N1-acetylspermidine, respectively. Little is known about the molecular evolutionary history of these enzymes. However, since the yeast PAO is able to catalyze the oxidation of both acetylated and non acetylated polyamines, and in vertebrates these functions are addressed by two specialized polyamine oxidase subfamilies (APAO and SMO, it can be hypothesized an ancestral reference for the former enzyme from which the latter would have been derived. Results We analysed 36 SMO, 26 APAO, and 14 PAO homologue protein sequences from 54 taxa including various vertebrates and invertebrates. The analysis of the full-length sequences and the principal domains of vertebrate and invertebrate PAOs yielded consensus primary protein sequences for vertebrate SMOs and APAOs, and invertebrate PAOs. This analysis, coupled to molecular modeling techniques, also unveiled sequence regions that confer specific structural and functional properties, including substrate specificity, by the different PAO subfamilies. Molecular phylogenetic trees revealed a basal position of all the invertebrates PAO enzymes relative to vertebrate SMOs and APAOs. PAOs from insects constitute a monophyletic clade. Two PAO variants sampled in the amphioxus are basal to the dichotomy between two well supported

  9. Big and slow: phylogenetic estimates of molecular evolution in baleen whales (suborder mysticeti).

    Science.gov (United States)

    Jackson, J A; Baker, C S; Vant, M; Steel, D J; Medrano-González, L; Palumbi, S R

    2009-11-01

    Baleen whales are the largest animals that have ever lived. To develop an improved estimation of substitution rate for nuclear and mitochondrial DNA for this taxon, we implemented a relaxed-clock phylogenetic approach using three fossil calibration dates: the divergence between odontocetes and mysticetes approximately 34 million years ago (Ma), between the balaenids and balaenopterids approximately 28 Ma, and the time to most recent common ancestor within the Balaenopteridae approximately 12 Ma. We examined seven mitochondrial genomes, a large number of mitochondrial control region sequences (219 haplotypes for 465 bp) and nine nuclear introns representing five species of whales, within which multiple species-specific alleles were sequenced to account for within-species diversity (1-15 for each locus). The total data set represents >1.65 Mbp of mitogenome and nuclear genomic sequence. The estimated substitution rate for the humpback whale control region (3.9%/million years, My) was higher than previous estimates for baleen whales but slow relative to other mammal species with similar generation times (e.g., human-chimp mean rate > 20%/My). The mitogenomic third codon position rate was also slow relative to other mammals (mean estimate 1%/My compared with a mammalian average of 9.8%/My for the cytochrome b gene). The mean nuclear genomic substitution rate (0.05%/My) was substantially slower than average synonymous estimates for other mammals (0.21-0.37%/My across a range of studies). The nuclear and mitogenome rate estimates for baleen whales were thus roughly consistent with an 8- to 10-fold slowing due to a combination of large body size and long generation times. Surprisingly, despite the large data set of nuclear intron sequences, there was only weak and conflicting support for alternate hypotheses about the phylogeny of balaenopterid whales, suggesting that interspecies introgressions or a rapid radiation has obscured species relationships in the nuclear genome.

  10. Molecular Identification and Phylogenetic Relationships of Pleurotus spp. Diversity in Malaysia by ITS Marker

    International Nuclear Information System (INIS)

    Zaiton Abdul Kadir; Azhar Mohamad; Nie, H.J.

    2016-01-01

    Pleurotus species is an edible mushroom in Malaysia which is commonly known as Oyster mushroom and grow by small holder farmers. This species is important for nutraceutical, pharmaceutical and cosmoceutical industries. However, there is some mis identification due to phenotypic variation in which the species shared some similarities due to environmental factors, and thus create troublesome. Thus, eleven isolates of Pleurotus sample which comprise of 4 different species were collected from different locations in Malaysia were used for strain and species identification including mutant line Pleurotus. Pleurotus pulmonarius coded as ATCC 62887 was used as a reference. Total genomic DNA was extracted, quantified and amplified by using rDNA-ITS (Ribosomal DNA Internal Transcribed Spacers) ITS8-F: 5"'AGTCGTAACAAGGTTTCCGTAGGTG3"' and ITS6-R: 5"'TTCCCGCTTCACTCGC-AGT3"'primers. The PCR products were directly sequenced for BLAST evaluation. Phylogenetic (UPGMA) was constructed by using CLC Sequence Viewer 6.8.1. It clearly shown distinct clades of the Pleurotus species and strains. Pleurotus pulmonarius were found to be grouped in one group while Pleurotus florida and Pleurotus columbinus were in the other different clade. For Pleurotus geesteranus, which has the most nucleotide similarity and morphology with Pleurotus pulmonarius, was grouped in its own clade and was single isolated. Thus, ITS marker found to be reliable, rapid, robust and reproducible approach in screening of Pleurotus species and its variants for taxonomical purposes and phylogenetic analysis. (author)

  11. Laboratory and Molecular Characterization of Dengue Viruses in a 2014 Outbreak in Guangfo Region, Southern China.

    Science.gov (United States)

    Luo, Zhao-Fan; Hu, Bo; Zhang, Feng-Yi; Lin, Xiang-Hua; Xie, Xiao-Ying; Pan, Kun-Yi; Li, Hong-Yu; Ren, Rui-Wen; Zhao, Wen-Zhong

    2017-09-25

    Non-specific symptoms and low viremia levels make early diagnosis of dengue virus (DENV) infection challenging. This study aimed to i) identify laboratory markers that can be used to predict a DENV-positive diagnosis and ii) perform a molecular characterization of DENVs from the 2014 Guangdong epidemic. This retrospective study analyzed 1,044 patients from the Guangdong epidemic who were clinically suspected cases of dengue. Viral RNA was detected by real-time RT-PCR, and viral-specific NS1 antigen was detected using enzyme-linked immuno sorbent assay. A molecular phylogenetic analysis was performed for the with the DENV C-prM gene junction. Patients with dengue infection had leukopenia (2.8 × 10 9 /L), thrombocytopenia (109.0 × 10 9 /L), elevated aspartate aminotransferase (56.0 IU/L) and alanine aminotransferase (43.5 IU/L), and prolonged activated partial thromboplastin time (APTT, 33.5 s) (all P < 0.001) compared to patients without dengue. The positive predictive value of leukopenia and thrombocytopenia for DENV infection were 96.9% and 93.0%, respectively. Leukopenia, thrombocytopenia, elevated aminotransferases, and prolonged APTT were useful predictive markers for an early diagnosis of DENV infection. Phylogenetic analysis indicated that the DENVs from the 2014 epidemic were closely related to a 2010 New Delhi strain and a 2013 Guangzhou strain. The 2014 epidemic consisted of co-circulating DENV-1 genotypes I and V from multiple origins. Efficient dengue surveillance can facilitate rapid response to future outbreaks.

  12. Phylogenetic and physiological diversity of microorganisms isolated from a deep greenland glacier ice core

    Science.gov (United States)

    Miteva, V. I.; Sheridan, P. P.; Brenchley, J. E.

    2004-01-01

    We studied a sample from the GISP 2 (Greenland Ice Sheet Project) ice core to determine the diversity and survival of microorganisms trapped in the ice at least 120,000 years ago. Previously, we examined the phylogenetic relationships among 16S ribosomal DNA (rDNA) sequences in a clone library obtained by PCR amplification from genomic DNA extracted from anaerobic enrichments. Here we report the isolation of nearly 800 aerobic organisms that were grouped by morphology and amplified rDNA restriction analysis patterns to select isolates for further study. The phylogenetic analyses of 56 representative rDNA sequences showed that the isolates belonged to four major phylogenetic groups: the high-G+C gram-positives, low-G+C gram-positives, Proteobacteria, and the Cytophaga-Flavobacterium-Bacteroides group. The most abundant and diverse isolates were within the high-G+C gram-positive cluster that had not been represented in the clone library. The Jukes-Cantor evolutionary distance matrix results suggested that at least 7 isolates represent new species within characterized genera and that 49 are different strains of known species. The isolates were further categorized based on the isolation conditions, temperature range for growth, enzyme activity, antibiotic resistance, presence of plasmids, and strain-specific genomic variations. A significant observation with implications for the development of novel and more effective cultivation methods was that preliminary incubation in anaerobic and aerobic liquid prior to plating on agar media greatly increased the recovery of CFU from the ice core sample.

  13. The relationships within the Chaitophorinae and Drepanosiphinae (Hemiptera, Aphididae) inferred from molecular-based phylogeny and comprehensive morphological data

    Science.gov (United States)

    Wieczorek, Karina; Lachowska-Cierlik, Dorota; Kajtoch, Łukasz; Kanturski, Mariusz

    2017-01-01

    The Chaitophorinae is a bionomically diverse Holarctic subfamily of Aphididae. The current classification includes two tribes: the Chaitophorini associated with deciduous trees and shrubs, and Siphini that feed on monocotyledonous plants. We present the first phylogenetic hypothesis for the subfamily, based on molecular and morphological datasets. Molecular analyses were based on the mitochondrial gene cytochrome oxidase subunit I (COI) and the nuclear gene elongation factor-1α (EF-1α). Phylogenetic inferences were obtained individually on each of genes and joined alignments using Bayesian inference (BI) and Maximum likelihood (ML). In phylogenetic trees reconstructed on the basis of nuclear and mitochondrial genes as well as a morphological dataset, the monophyly of Siphini and the genus Chaitophorus was supported. Periphyllus forms independent lineages from Chaitophorus and Siphini. Within this genus two clades comprising European and Asiatic species, respectively, were indicated. Concerning relationships within the subfamily, EF-1α and joined COI and EF-1α genes analysis strongly supports the hypothesis that Chaitophorini do not form a monophyletic clade. Periphyllus is a sister group to a clade containing Chaitophorus and Siphini. The Asiatic unit of Periphyllus also includes Trichaitophorus koyaensis. The analysis of morphological dataset under equally weighted parsimony also supports the view that Chaitophorini is an artificial taxon, as Lambersaphis pruinosae and Pseudopterocomma hughi, both traditionally included in the Chaitophorini, formed independent lineages. COI analyses support consistent groups within the subfamily, but relationships between groups are poorly resolved. These analyses were extended to include the species of closely related and phylogenetically unstudied subfamily Drepanosiphinae, which produced congruent results. Genera Drepanosiphum and Depanaphis are monophyletic and sister. The position of Yamatocallis tokyoensis differs in the

  14. Relationships among North American and Japanese Laetiporus isolates inferred from molecular phylogenetics and single-spore incompatibility reactions

    Science.gov (United States)

    Mark T. Banik; Daniel L. Lindner; Yuko Ota; Tsutomu Hattori

    2010-01-01

    Relationships were investigated among North American and Japanese isolates of Laetiporus using phylogenetic analysis of ITS sequences and single-spore isolate incompatibility. Single-spore isolate pairings revealed no significant compatibility between North American and Japanese isolates. ITS analysis revealed 12 clades within the core ...

  15. The cave beetle genus Anthroherpon is polyphyletic : molecular phylogenetics and description of Graciliella n. gen.(Leiodidae, Leptodirini)

    NARCIS (Netherlands)

    Njunji, Iva; Perreau, Michel; Hendriks, Kasper; Schilthuizen, Menno; Deharveng, Louis

    2016-01-01

    The subtribe Anthroherponina form an iconic group of obligate cave beetles, typical representatives of the Dinaric subterranean fauna, which is considered to be the richest in the world. Phylogenetic studies within this subtribe are scarce and based only on morphological characters, which, due to

  16. The cave beetle genus Anthroherpon is polyphyletic; molecular phylogenetics and description of Graciliella n. gen. (Leiodidae, Leptodirini)

    NARCIS (Netherlands)

    Njunjić, I.; Perreau, M.; Hendriks, K.; Schilthuizen, M.; Deharveng, L.

    2016-01-01

    The subtribe Anthroherponina form an iconic group of obligate cave beetles, typical representatives of the Dinaric subterranean fauna, which is considered to be the richest in the world. Phylogenetic studies within this subtribe are scarce and based only on morphological characters, which, due to

  17. Evidence for a close phylogenetic relationship between Melissococcus pluton, the causative agent of European foulbrood disease, and the genus Enterococcus.

    Science.gov (United States)

    Cai, J; Collins, M D

    1994-04-01

    The 16S rRNA gene sequence of Melissococcus pluton, the causative agent of European foulbrood disease, was determined in order to investigate the phylogenetic relationships between this organism and other low-G + C-content gram-positive bacteria. A comparative sequence analysis revealed that M. pluton is a close phylogenetic relative of the genus Enterococcus.

  18. Molecular evolution of glutamine synthetase II: Phylogenetic evidence of a non-endosymbiotic gene transfer event early in plant evolution

    Directory of Open Access Journals (Sweden)

    Tartar Aurélien

    2010-06-01

    Full Text Available Abstract Background Glutamine synthetase (GS is essential for ammonium assimilation and the biosynthesis of glutamine. The three GS gene families (GSI, GSII, and GSIII are represented in both prokaryotic and eukaryotic organisms. In this study, we examined the evolutionary relationship of GSII from eubacterial and eukaryotic lineages and present robust phylogenetic evidence that GSII was transferred from γ-Proteobacteria (Eubacteria to the Chloroplastida. Results GSII sequences were isolated from four species of green algae (Trebouxiophyceae, and additional green algal (Chlorophyceae and Prasinophytae and streptophyte (Charales, Desmidiales, Bryophyta, Marchantiophyta, Lycopodiophyta and Tracheophyta sequences were obtained from public databases. In Bayesian and maximum likelihood analyses, eubacterial (GSIIB and eukaryotic (GSIIE GSII sequences formed distinct clades. Both GSIIB and GSIIE were found in chlorophytes and early-diverging streptophytes. The GSIIB enzymes from these groups formed a well-supported sister clade with the γ-Proteobacteria, providing evidence that GSIIB in the Chloroplastida arose by horizontal gene transfer (HGT. Bayesian relaxed molecular clock analyses suggest that GSIIB and GSIIE coexisted for an extended period of time but it is unclear whether the proposed HGT happened prior to or after the divergence of the primary endosymbiotic lineages (the Archaeplastida. However, GSIIB genes have not been identified in glaucophytes or red algae, favoring the hypothesis that GSIIB was gained after the divergence of the primary endosymbiotic lineages. Duplicate copies of the GSIIB gene were present in Chlamydomonas reinhardtii, Volvox carteri f. nagariensis, and Physcomitrella patens. Both GSIIB proteins in C. reinhardtii and V. carteri f. nagariensis had N-terminal transit sequences, indicating they are targeted to the chloroplast or mitochondrion. In contrast, GSIIB proteins of P. patens lacked transit sequences, suggesting

  19. Soil phosphorus heterogeneity promotes tree species diversity and phylogenetic clustering in a tropical seasonal rainforest.

    Science.gov (United States)

    Xu, Wumei; Ci, Xiuqin; Song, Caiyun; He, Tianhua; Zhang, Wenfu; Li, Qiaoming; Li, Jie

    2016-12-01

    The niche theory predicts that environmental heterogeneity and species diversity are positively correlated in tropical forests, whereas the neutral theory suggests that stochastic processes are more important in determining species diversity. This study sought to investigate the effects of soil nutrient (nitrogen and phosphorus) heterogeneity on tree species diversity in the Xishuangbanna tropical seasonal rainforest in southwestern China. Thirty-nine plots of 400 m 2 (20 × 20 m) were randomly located in the Xishuangbanna tropical seasonal rainforest. Within each plot, soil nutrient (nitrogen and phosphorus) availability and heterogeneity, tree species diversity, and community phylogenetic structure were measured. Soil phosphorus heterogeneity and tree species diversity in each plot were positively correlated, while phosphorus availability and tree species diversity were not. The trees in plots with low soil phosphorus heterogeneity were phylogenetically overdispersed, while the phylogenetic structure of trees within the plots became clustered as heterogeneity increased. Neither nitrogen availability nor its heterogeneity was correlated to tree species diversity or the phylogenetic structure of trees within the plots. The interspecific competition in the forest plots with low soil phosphorus heterogeneity could lead to an overdispersed community. However, as heterogeneity increase, more closely related species may be able to coexist together and lead to a clustered community. Our results indicate that soil phosphorus heterogeneity significantly affects tree diversity in the Xishuangbanna tropical seasonal rainforest, suggesting that deterministic processes are dominant in this tropical forest assembly.

  20. Rearrangement moves on rooted phylogenetic networks.

    Science.gov (United States)

    Gambette, Philippe; van Iersel, Leo; Jones, Mark; Lafond, Manuel; Pardi, Fabio; Scornavacca, Celine

    2017-08-01

    Phylogenetic tree reconstruction is usually done by local search heuristics that explore the space of the possible tree topologies via simple rearrangements of their structure. Tree rearrangement heuristics have been used in combination with practically all optimization criteria in use, from maximum likelihood and parsimony to distance-based principles, and in a Bayesian context. Their basic components are rearrangement moves that specify all possible ways of generating alternative phylogenies from a given one, and whose fundamental property is to be able to transform, by repeated application, any phylogeny into any other phylogeny. Despite their long tradition in tree-based phylogenetics, very little research has gone into studying similar rearrangement operations for phylogenetic network-that is, phylogenies explicitly representing scenarios that include reticulate events such as hybridization, horizontal gene transfer, population admixture, and recombination. To fill this gap, we propose "horizontal" moves that ensure that every network of a certain complexity can be reached from any other network of the same complexity, and "vertical" moves that ensure reachability between networks of different complexities. When applied to phylogenetic trees, our horizontal moves-named rNNI and rSPR-reduce to the best-known moves on rooted phylogenetic trees, nearest-neighbor interchange and rooted subtree pruning and regrafting. Besides a number of reachability results-separating the contributions of horizontal and vertical moves-we prove that rNNI moves are local versions of rSPR moves, and provide bounds on the sizes of the rNNI neighborhoods. The paper focuses on the most biologically meaningful versions of phylogenetic networks, where edges are oriented and reticulation events clearly identified. Moreover, our rearrangement moves are robust to the fact that networks with higher complexity usually allow a better fit with the data. Our goal is to provide a solid basis for

  1. Rearrangement moves on rooted phylogenetic networks.

    Directory of Open Access Journals (Sweden)

    Philippe Gambette

    2017-08-01

    Full Text Available Phylogenetic tree reconstruction is usually done by local search heuristics that explore the space of the possible tree topologies via simple rearrangements of their structure. Tree rearrangement heuristics have been used in combination with practically all optimization criteria in use, from maximum likelihood and parsimony to distance-based principles, and in a Bayesian context. Their basic components are rearrangement moves that specify all possible ways of generating alternative phylogenies from a given one, and whose fundamental property is to be able to transform, by repeated application, any phylogeny into any other phylogeny. Despite their long tradition in tree-based phylogenetics, very little research has gone into studying similar rearrangement operations for phylogenetic network-that is, phylogenies explicitly representing scenarios that include reticulate events such as hybridization, horizontal gene transfer, population admixture, and recombination. To fill this gap, we propose "horizontal" moves that ensure that every network of a certain complexity can be reached from any other network of the same complexity, and "vertical" moves that ensure reachability between networks of different complexities. When applied to phylogenetic trees, our horizontal moves-named rNNI and rSPR-reduce to the best-known moves on rooted phylogenetic trees, nearest-neighbor interchange and rooted subtree pruning and regrafting. Besides a number of reachability results-separating the contributions of horizontal and vertical moves-we prove that rNNI moves are local versions of rSPR moves, and provide bounds on the sizes of the rNNI neighborhoods. The paper focuses on the most biologically meaningful versions of phylogenetic networks, where edges are oriented and reticulation events clearly identified. Moreover, our rearrangement moves are robust to the fact that networks with higher complexity usually allow a better fit with the data. Our goal is to provide

  2. Phylogenetic tests of distribution patterns in South Asia: towards

    Indian Academy of Sciences (India)

    The last four decades have seen an increasing integration of phylogenetics and biogeography. However, a dearth of phylogenetic studies has precluded such biogeographic analyses in South Asia until recently. Noting the increase in phylogenetic research and interest in phylogenetic biogeography in the region, we ...

  3. Molecular identification of endophytic fungi from Aquilaria sinensis ...

    African Journals Online (AJOL)

    Molecular phylogenetic analysis demonstrated that Botryosphaeria, Colletotrichum gloeosporioides, Phomopsis and Cylindrocladium species are members of the agarwood-producing wounded tree, while Phoma, Mycosphaerella, Sagenomella, Alternaria and Ramichloridium species is able to colonize the non-resinous ...

  4. Phylogenetic placement and taxonomy of the genus Hederorkis (Orchidaceae.

    Directory of Open Access Journals (Sweden)

    Joanna Mytnik-Ejsmont

    Full Text Available Three plastid regions, matK, rpl32-trnL and rpl16 intron and the ITS1-5.8S-ITS2 nuclear ribosomal DNA were used to demonstrate a phylogenetic placement of the genus Hederorkis (Orchidaceae for the first time. The taxonomic position of this genus has been unclear thus far. The phylogenetic and morphological relations of Hederorkis to the most closely related genera Sirhookera, Adrorhizon, Bromheadia and Polystachya are also discussed. A hypothesis concerning an origin and evolution of Hederorkis is proposed. Hederorkis is an epiphytic two-leaved orchid genus with lateral inflorescence, non-resupinate flowers, elongate gynostemium and rudimentary column foot. It is native to the Indian Ocean Islands. Two species of Hederorkis are recognized worldwide, H. scandens endemic to Mauritius and Réunion and H. seychellensis endemic to Seychelles. For each of the species treated a full synonymy, detailed description and illustration are included. The distribution map and dichotomous keys to the species have also been provided.

  5. Phylogenetic search through partial tree mixing

    Science.gov (United States)

    2012-01-01

    Background Recent advances in sequencing technology have created large data sets upon which phylogenetic inference can be performed. Current research is limited by the prohibitive time necessary to perform tree search on a reasonable number of individuals. This research develops new phylogenetic algorithms that can operate on tens of thousands of species in a reasonable amount of time through several innovative search techniques. Results When compared to popular phylogenetic search algorithms, better trees are found much more quickly for large data sets. These algorithms are incorporated in the PSODA application available at http://dna.cs.byu.edu/psoda Conclusions The use of Partial Tree Mixing in a partition based tree space allows the algorithm to quickly converge on near optimal tree regions. These regions can then be searched in a methodical way to determine the overall optimal phylogenetic solution. PMID:23320449

  6. Phylogenetic relationship of Hepatozoon blood parasites found in snakes from Africa, America and Asia.

    Science.gov (United States)

    Haklová, B; Majláthová, V; Majláth, I; Harris, D J; Petrilla, V; Litschka-Koen, T; Oros, M; Peťko, B

    2014-03-01

    The blood parasites from the genus Hepatozoon Miller, 1908 (Apicomplexa: Adeleida: Hepatozoidae) represent the most common intracellular protozoan parasites found in snakes. In the present study, we examined 209 individuals of snakes, from different zoogeographical regions (Africa, America, Asia and Europe), for the occurrence of blood parasites using both molecular and microscopic examination methods, and assess phylogenetic relationships of all Hepatozoon parasites from snakes for the first time. In total, 178 blood smears obtained from 209 individuals, representing 40 species, were examined, from which Hepatozoon unicellular parasites were found in 26 samples (14·6% prevalence). Out of 180 samples tested by molecular method polymerase chain reaction (PCR), the presence of parasites was observed in 21 individuals (prevalence 11·6%): 14 snakes from Africa belonging to six genera (Dendroaspis, Dispholidus, Mehelya, Naja, Philothamnus and Python), five snakes from Asia from the genus Morelia and two snakes from America, from two genera (Coluber and Corallus). The intensity of infection varied from one to 1433 infected cells per 10 000 erythrocytes. Results of phylogenetic analyses (Bayesian and Maximum Likelihood) revealed the existence of five haplotypes divided into four main lineages. The present data also indicate neither geographical pattern of studied Hepatozoon sp., nor congruency in the host association.

  7. How does cognition evolve? Phylogenetic comparative psychology

    Science.gov (United States)

    Matthews, Luke J.; Hare, Brian A.; Nunn, Charles L.; Anderson, Rindy C.; Aureli, Filippo; Brannon, Elizabeth M.; Call, Josep; Drea, Christine M.; Emery, Nathan J.; Haun, Daniel B. M.; Herrmann, Esther; Jacobs, Lucia F.; Platt, Michael L.; Rosati, Alexandra G.; Sandel, Aaron A.; Schroepfer, Kara K.; Seed, Amanda M.; Tan, Jingzhi; van Schaik, Carel P.; Wobber, Victoria

    2014-01-01

    Now more than ever animal studies have the potential to test hypotheses regarding how cognition evolves. Comparative psychologists have developed new techniques to probe the cognitive mechanisms underlying animal behavior, and they have become increasingly skillful at adapting methodologies to test multiple species. Meanwhile, evolutionary biologists have generated quantitative approaches to investigate the phylogenetic distribution and function of phenotypic traits, including cognition. In particular, phylogenetic methods can quantitatively (1) test whether specific cognitive abilities are correlated with life history (e.g., lifespan), morphology (e.g., brain size), or socio-ecological variables (e.g., social system), (2) measure how strongly phylogenetic relatedness predicts the distribution of cognitive skills across species, and (3) estimate the ancestral state of a given cognitive trait using measures of cognitive performance from extant species. Phylogenetic methods can also be used to guide the selection of species comparisons that offer the strongest tests of a priori predictions of cognitive evolutionary hypotheses (i.e., phylogenetic targeting). Here, we explain how an integration of comparative psychology and evolutionary biology will answer a host of questions regarding the phylogenetic distribution and history of cognitive traits, as well as the evolutionary processes that drove their evolution. PMID:21927850

  8. How does cognition evolve? Phylogenetic comparative psychology.

    Science.gov (United States)

    MacLean, Evan L; Matthews, Luke J; Hare, Brian A; Nunn, Charles L; Anderson, Rindy C; Aureli, Filippo; Brannon, Elizabeth M; Call, Josep; Drea, Christine M; Emery, Nathan J; Haun, Daniel B M; Herrmann, Esther; Jacobs, Lucia F; Platt, Michael L; Rosati, Alexandra G; Sandel, Aaron A; Schroepfer, Kara K; Seed, Amanda M; Tan, Jingzhi; van Schaik, Carel P; Wobber, Victoria

    2012-03-01

    Now more than ever animal studies have the potential to test hypotheses regarding how cognition evolves. Comparative psychologists have developed new techniques to probe the cognitive mechanisms underlying animal behavior, and they have become increasingly skillful at adapting methodologies to test multiple species. Meanwhile, evolutionary biologists have generated quantitative approaches to investigate the phylogenetic distribution and function of phenotypic traits, including cognition. In particular, phylogenetic methods can quantitatively (1) test whether specific cognitive abilities are correlated with life history (e.g., lifespan), morphology (e.g., brain size), or socio-ecological variables (e.g., social system), (2) measure how strongly phylogenetic relatedness predicts the distribution of cognitive skills across species, and (3) estimate the ancestral state of a given cognitive trait using measures of cognitive performance from extant species. Phylogenetic methods can also be used to guide the selection of species comparisons that offer the strongest tests of a priori predictions of cognitive evolutionary hypotheses (i.e., phylogenetic targeting). Here, we explain how an integration of comparative psychology and evolutionary biology will answer a host of questions regarding the phylogenetic distribution and history of cognitive traits, as well as the evolutionary processes that drove their evolution.

  9. PhyloExplorer: a web server to validate, explore and query phylogenetic trees

    Directory of Open Access Journals (Sweden)

    Auberval Nicolas

    2009-05-01

    Full Text Available Abstract Background Many important problems in evolutionary biology require molecular phylogenies to be reconstructed. Phylogenetic trees must then be manipulated for subsequent inclusion in publications or analyses such as supertree inference and tree comparisons. However, no tool is currently available to facilitate the management of tree collections providing, for instance: standardisation of taxon names among trees with respect to a reference taxonomy; selection of relevant subsets of trees or sub-trees according to a taxonomic query; or simply computation of descriptive statistics on the collection. Moreover, although several databases of phylogenetic trees exist, there is currently no easy way to find trees that are both relevant and complementary to a given collection of trees. Results We propose a tool to facilitate assessment and management of phylogenetic tree collections. Given an input collection of rooted trees, PhyloExplorer provides facilities for obtaining statistics describing the collection, correcting invalid taxon names, extracting taxonomically relevant parts of the collection using a dedicated query language, and identifying related trees in the TreeBASE database. Conclusion PhyloExplorer is a simple and interactive website implemented through underlying Python libraries and MySQL databases. It is available at: http://www.ncbi.orthomam.univ-montp2.fr/phyloexplorer/ and the source code can be downloaded from: http://code.google.com/p/taxomanie/.

  10. Rooting phylogenetic trees under the coalescent model using site pattern probabilities.

    Science.gov (United States)

    Tian, Yuan; Kubatko, Laura

    2017-12-19

    Phylogenetic tree inference is a fundamental tool to estimate ancestor-descendant relationships among different species. In phylogenetic studies, identification of the root - the most recent common ancestor of all sampled organisms - is essential for complete understanding of the evolutionary relationships. Rooted trees benefit most downstream application of phylogenies such as species classification or study of adaptation. Often, trees can be rooted by using outgroups, which are species that are known to be more distantly related to the sampled organisms than any other species in the phylogeny. However, outgroups are not always available in evolutionary research. In this study, we develop a new method for rooting species tree under the coalescent model, by developing a series of hypothesis tests for rooting quartet phylogenies using site pattern probabilities. The power of this method is examined by simulation studies and by application to an empirical North American rattlesnake data set. The method shows high accuracy across the simulation conditions considered, and performs well for the rattlesnake data. Thus, it provides a computationally efficient way to accurately root species-level phylogenies that incorporates the coalescent process. The method is robust to variation in substitution model, but is sensitive to the assumption of a molecular clock. Our study establishes a computationally practical method for rooting species trees that is more efficient than traditional methods. The method will benefit numerous evolutionary studies that require rooting a phylogenetic tree without having to specify outgroups.

  11. Molecular phylogeny of Ranunculaceae based on internal ...

    African Journals Online (AJOL)

    The botanical family Ranunculaceae contains important medicinal plants. To obtain new evolutionary evidence regarding the systematic classification of Ranunculaceae plants, we used molecular phylogenies to test relationships based on the internal transcribed spacer region. The results of phylogenetic analysis of 92 ...

  12. Phylogenetics links monster larva to deep-sea shrimp.

    Science.gov (United States)

    Bracken-Grissom, Heather D; Felder, Darryl L; Vollmer, Nicole L; Martin, Joel W; Crandall, Keith A

    2012-10-01

    Mid-water plankton collections commonly include bizarre and mysterious developmental stages that differ conspicuously from their adult counterparts in morphology and habitat. Unaware of the existence of planktonic larval stages, early zoologists often misidentified these unique morphologies as independent adult lineages. Many such mistakes have since been corrected by collecting larvae, raising them in the lab, and identifying the adult forms. However, challenges arise when the larva is remarkably rare in nature and relatively inaccessible due to its changing habitats over the course of ontogeny. The mid-water marine species Cerataspis monstrosa (Gray 1828) is an armored crustacean larva whose adult identity has remained a mystery for over 180 years. Our phylogenetic analyses, based in part on recent collections from the Gulf of Mexico, provide definitive evidence that the rare, yet broadly distributed larva, C. monstrosa, is an early developmental stage of the globally distributed deepwater aristeid shrimp, Plesiopenaeus armatus. Divergence estimates and phylogenetic relationships across five genes confirm the larva and adult are the same species. Our work demonstrates the diagnostic power of molecular systematics in instances where larval rearing seldom succeeds and morphology and habitat are not indicative of identity. Larval-adult linkages not only aid in our understanding of biodiversity, they provide insights into the life history, distribution, and ecology of an organism.

  13. Time spans and spacers: Molecular phylogenetic explorations in the Cladophora complex (Chlorophyta) from the perspective of rDNA gene and spacer sequences

    OpenAIRE

    Bakker, Frederik Theodoor

    1995-01-01

    In this study, phylogenetic relationships among genera, species and biogeographic representatives of single Cladophora species within the Cladophorales were analyzed using rDNA gene and spacer sequences. Based on phylogenetic analysis of 18S rRNA gene sequences, the Cladophora complex is shown to be paraphyletic with respect to Cladophora species and includes several genera shich werde traditionally ascribed to the Siphonocladales (Chapter 3). ... Zie: Summary/Samenvatting

  14. Herbarium collection-based phylogenetics of the ragweeds (Ambrosia, Asteraceae).

    Science.gov (United States)

    Martin, Michael D; Quiroz-Claros, Elva; Brush, Grace S; Zimmer, Elizabeth A

    2018-03-01

    Ambrosia (Asteraceae) is a taxonomically difficult genus of weedy, wind-pollinated plants with an apparent center of diversity in the Sonoran Desert of North America. Determining Ambrosia's evolutionary relationships has been the subject of much interest, with numerous studies using morphological characters, cytology, comparative phytochemistry, and chloroplast restriction site variation to produce conflicting accounts the relationships between Ambrosia species, as well as the classification of their close relatives in Franseria and Hymenoclea. To resolve undetermined intra-generic relationships within Ambrosia, we used DNA extracted from tissues obtained from seed banks and herbarium collections to generate multi-locus genetic data representing nearly all putative species, including four from South America. We performed Bayesian and Maximum-Likelihood phylogenetic analyses of six chloroplast-genome and two nuclear-genome markers, enabling us to infer monophyly for the genus, resolve major infra-generic species clusters, as well as to resolve open questions about the evolutionary relationships of several Ambrosia species and former members of Franseria. We also provide molecular data supporting the hypothesis that A. sandersonii formed through the hybridization of A. eriocentra and A. salsola. The topology of our chloroplast DNA phylogeny is almost entirely congruent with the most recent molecular work based on chloroplast restriction site variation of a much more limited sampling of 14 North American species of Ambrosia, although our improved sampling of global Ambrosia diversity enables us to draw additional conclusions. As our study is the first direct DNA sequence-based phylogenetic analyses of Ambrosia, we analyze the data in relation to previous taxonomic studies and discuss several instances of chloroplast/nuclear incongruence that leave the precise geographic center of origin of Ambrosia in question. Copyright © 2017 Elsevier Inc. All rights reserved.

  15. Phylogenetic species delimitation for crayfishes of the genus Pacifastacus.

    Science.gov (United States)

    Larson, Eric R; Castelin, Magalie; Williams, Bronwyn W; Olden, Julian D; Abbott, Cathryn L

    2016-01-01

    Molecular genetic approaches are playing an increasing role in conservation science by identifying biodiversity that may not be evident by morphology-based taxonomy and systematics. So-called cryptic species are particularly prevalent in freshwater environments, where isolation of dispersal-limited species, such as crayfishes, within dendritic river networks often gives rise to high intra- and inter-specific genetic divergence. We apply here a multi-gene molecular approach to investigate relationships among extant species of the crayfish genus Pacifastacus, representing the first comprehensive phylogenetic study of this taxonomic group. Importantly, Pacifastacus includes both the widely invasive signal crayfish Pacifastacus leniusculus, as well as several species of conservation concern like the Shasta crayfish Pacifastacus fortis. Our analysis used 83 individuals sampled across the four extant Pacifastacus species (omitting the extinct Pacifastacus nigrescens), representing the known taxonomic diversity and geographic distributions within this genus as comprehensively as possible. We reconstructed phylogenetic trees from mitochondrial (16S, COI) and nuclear genes (GAPDH), both separately and using a combined or concatenated dataset, and performed several species delimitation analyses (PTP, ABGD, GMYC) on the COI phylogeny to propose Primary Species Hypotheses (PSHs) within the genus. All phylogenies recovered the genus Pacifastacus as monophyletic, within which we identified a range of six to 21 PSHs; more abundant PSHs delimitations from GMYC and ABGD were always nested within PSHs delimited by the more conservative PTP method. Pacifastacus leniusculus included the majority of PSHs and was not monophyletic relative to the other Pacifastacus species considered. Several of these highly distinct P. leniusculus PSHs likely require urgent conservation attention. Our results identify research needs and conservation priorities for Pacifastacus crayfishes in western

  16. Evolution of oil-producing trichomes in Sisyrinchium (Iridaceae): insights from the first comprehensive phylogenetic analysis of the genus

    Science.gov (United States)

    Chauveau, Olivier; Eggers, Lilian; Raquin, Christian; Silvério, Adriano; Brown, Spencer; Couloux, Arnaud; Cruaud, Corine; Kaltchuk-Santos, Eliane; Yockteng, Roxana; Souza-Chies, Tatiana T.; Nadot, Sophie

    2011-01-01

    Background and Aims Sisyrinchium (Iridaceae: Iridoideae: Sisyrinchieae) is one of the largest, most widespread and most taxonomically complex genera in Iridaceae, with all species except one native to the American continent. Phylogenetic relationships within the genus were investigated and the evolution of oil-producing structures related to specialized oil-bee pollination examined. Methods Phylogenetic analyses based on eight molecular markers obtained from 101 Sisyrinchium accessions representing 85 species were conducted in the first extensive phylogenetic analysis of the genus. Total evidence analyses confirmed the monophyly of the genus and retrieved nine major clades weakly connected to the subdivisions previously recognized. The resulting phylogenetic hypothesis was used to reconstruct biogeographical patterns, and to trace the evolutionary origin of glandular trichomes present in the flowers of several species. Key Results and Conclusions Glandular trichomes evolved three times independently in the genus. In two cases, these glandular trichomes are oil-secreting, suggesting that the corresponding flowers might be pollinated by oil-bees. Biogeographical patterns indicate expansions from Central America and the northern Andes to the subandean ranges between Chile and Argentina and to the extended area of the Paraná river basin. The distribution of oil-flower species across the phylogenetic trees suggests that oil-producing trichomes may have played a key role in the diversification of the genus, a hypothesis that requires future testing. PMID:21527419

  17. A phylogenetic perspective on species diversity, β-diversity and biogeography for the microbial world.

    Science.gov (United States)

    Barberán, Albert; Casamayor, Emilio O

    2014-12-01

    There is an increasing interest to combine phylogenetic data with distributional and ecological records to assess how natural communities arrange under an evolutionary perspective. In the microbial world, there is also a need to go beyond the problematic species definition to deeply explore ecological patterns using genetic data. We explored links between evolution/phylogeny and community ecology using bacterial 16S rRNA gene information from a high-altitude lakes district data set. We described phylogenetic community composition, spatial distribution, and β-diversity and biogeographical patterns applying evolutionary relatedness without relying on any particular operational taxonomic unit definition. High-altitude lakes districts usually contain a large mosaic of highly diverse small water bodies and conform a fine biogeographical model of spatially close but environmentally heterogeneous ecosystems. We sampled 18 lakes in the Pyrenees with a selection criteria focused on capturing the maximum environmental variation within the smallest geographical area. The results showed highly diverse communities nonrandomly distributed with phylogenetic β-diversity patterns mainly shaped by the environment and not by the spatial distance. Community similarity based on both bacterial taxonomic composition and phylogenetic β-diversity shared similar patterns and was primarily structured by similar environmental drivers. We observed a positive relationship between lake area and phylogenetic diversity with a slope consistent with highly dispersive planktonic organisms. The phylogenetic approach incorporated patterns of common ancestry into bacterial community analysis and emerged as a very convenient analytical tool for direct inter- and intrabiome biodiversity comparisons and sorting out microbial habitats with potential application in conservation studies. © 2014 John Wiley & Sons Ltd.

  18. Molecular marker differences relate to developmental position and subsets of mesodiencephalic dopaminergic neurons.

    Directory of Open Access Journals (Sweden)

    Simone M Smits

    Full Text Available The development of mesodiencephalic dopaminergic (mdDA neurons located in the substantia nigra compacta (SNc and ventral tegmental area (VTA follow a number of stages marked by distinct events. After preparation of the region by signals that provide induction and patterning, several transcription factors have been identified, which are involved in specifying the neuronal fate of these cells. The specific vulnerability of SNc neurons is thought to root in these specific developmental programs. The present study examines the positions of young postmitotic mdDA neurons to relate developmental position to mdDA subset specific markers. MdDA neurons were mapped relative to the neuromeric domains (prosomeres 1-3 (P1-3, midbrain, and hindbrain as well as the longitudinal subdivisions (floor plate, basal plate, alar plate, as proposed by the prosomeric model. We found that postmitotic mdDA neurons are located mainly in the floorplate domain and very few in slightly more lateral domains. Moreover, mdDA neurons are present along a large proportion of the anterior/posterior axis extending from the midbrain to P3 in the diencephalon. The specific positions relate to some extent to the presence of specific subset markers as Ahd2. In the adult stage more of such subsets specific expressed genes are present and may represent a molecular map defining molecularly distinct groups of mdDA neurons.

  19. Origin and evolution of group XI secretory phospholipase A2 from flax (Linum usitatissimum) based on phylogenetic analysis of conserved domains.

    Science.gov (United States)

    Gupta, Payal; Saini, Raman; Dash, Prasanta K

    2017-07-01

    Phospholipase A 2 (PLA 2 ) belongs to class of lipolytic enzymes (EC 3.1.1.4). Lysophosphatidic acid (LPA) and free fatty acids (FFAs) are the products of PLA 2 catalyzed hydrolysis of phosphoglycerides at sn-2 position. LPA and FFA that act as second mediators involved in the development and maturation of plants and animals. Mining of flax genome identified two phospholipase A 2 encoding genes, viz., LusPLA 2 I and LusPLA 2 II (Linum usitatissimum secretory phospholipase A 2 ). Molecular simulation of LusPLA 2 s with already characterized plant sPLA 2 s revealed the presence of conserved motifs and signature domains necessary to classify them as secretory phospholipase A 2 . Phylogenetic analysis of flax sPLA 2 with representative sPLA 2 s from other organisms revealed that they evolved rapidly via gene duplication/deletion events and shares a common ancestor. Our study is the first report of detailed phylogenetic analysis for secretory phospholipase A 2 in flax. Comparative genomic analysis of two LusPLA 2 s with earlier reported plant sPLA 2 s, based on their gene architectures, sequence similarities, and domain structures are presented elucidating the uniqueness of flax sPLA 2 .

  20. Polyphasic characterization of Trichocoleus desertorum sp. nov. (Pseudanabaenales, Cyanobacteria) from desert soils and phylogenetic placement of the genus Trichocoleus

    Science.gov (United States)

    Radka Muhlsteinova; Jeffrey R. Johansen; Nicole Pietrasiak; Michael P. Martin; Karina Osorio-Santos; Steven D. Warren

    2014-01-01

    Little is known about the taxonomic diversity of cyanobacteria in deserts, despite their important ecological roles in these ecosystems. In this study, cyanobacterial strains from the Atacama, Colorado, and Mojave Deserts were isolated and characterized using molecular, morphological, and ecological information. Phylogenetic placement of these strains was revealed...

  1. Ancient paralogy in the cpDNA trnL-F region in Annonaceae: implications for plant molecular systematics

    NARCIS (Netherlands)

    Pirie, M.D.; Vargas, M.P.B.; Botermans, M.; Bakker, F.T.; Chatrou, L.W.

    2007-01-01

    The plastid trnL-F region has proved useful in molecular phylogenetic studies addressing diverse evolutionary questions from biogeographic history to character evolution in a broad range of plant groups. An important assumption for phylogenetic reconstruction is that data used in combined analyses

  2. Phylogenetic Relationships and Evolutionary Patterns of the Order Collodaria (Radiolaria)

    Science.gov (United States)

    Ishitani, Yoshiyuki; Ujiié, Yurika; de Vargas, Colomban; Not, Fabrice; Takahashi, Kozo

    2012-01-01

    Collodaria are the only group of Radiolaria that has a colonial lifestyle. This group is potentially the most important plankton in the oligotrophic ocean because of its large biomass and the high primary productivity associated with the numerous symbionts inside a cell or colony. The evolution of Collodaria could thus be related to the changes in paleo-productivity that have affected organic carbon fixation in the oligotrophic ocean. However, the fossil record of Collodaria is insufficient to trace their abundance through geological time, because most collodarians do not have silicified shells. Recently, molecular phylogeny based on nuclear small sub-unit ribosomal DNA (SSU rDNA) confirmed Collodaria to be one of five orders of Radiolaria, though the relationship among collodarians is still unresolved because of inadequate taxonomic sampling. Our phylogenetic analysis has revealed four novel collodarian sequences, on the basis of which collodarians can be divided into four clades that correspond to taxonomic grouping at the family level: Thalassicollidae, Collozoidae, Collosphaeridae, and Collophidae. Comparison of the results of our phylogenetic analyses with the morphological characteristics of each collodarian family suggests that the first ancestral collodarians had a solitary lifestyle and left no silica deposits. The timing of events estimated from molecular divergence calculations indicates that naked collodarian lineages first appeared around 45.6 million years (Ma) ago, coincident with the diversification of diatoms in the pelagic oceans. Colonial collodarians appeared after the formation of the present ocean circulation system and the development of oligotrophic conditions in the equatorial Pacific (ca. 33.4 Ma ago). The divergence of colonial collodarians probably caused a shift in the efficiency of primary production during this period. PMID:22567112

  3. Phylogenetic relationships and evolutionary patterns of the order Collodaria (Radiolaria.

    Directory of Open Access Journals (Sweden)

    Yoshiyuki Ishitani

    Full Text Available Collodaria are the only group of Radiolaria that has a colonial lifestyle. This group is potentially the most important plankton in the oligotrophic ocean because of its large biomass and the high primary productivity associated with the numerous symbionts inside a cell or colony. The evolution of Collodaria could thus be related to the changes in paleo-productivity that have affected organic carbon fixation in the oligotrophic ocean. However, the fossil record of Collodaria is insufficient to trace their abundance through geological time, because most collodarians do not have silicified shells. Recently, molecular phylogeny based on nuclear small sub-unit ribosomal DNA (SSU rDNA confirmed Collodaria to be one of five orders of Radiolaria, though the relationship among collodarians is still unresolved because of inadequate taxonomic sampling. Our phylogenetic analysis has revealed four novel collodarian sequences, on the basis of which collodarians can be divided into four clades that correspond to taxonomic grouping at the family level: Thalassicollidae, Collozoidae, Collosphaeridae, and Collophidae. Comparison of the results of our phylogenetic analyses with the morphological characteristics of each collodarian family suggests that the first ancestral collodarians had a solitary lifestyle and left no silica deposits. The timing of events estimated from molecular divergence calculations indicates that naked collodarian lineages first appeared around 45.6 million years (Ma ago, coincident with the diversification of diatoms in the pelagic oceans. Colonial collodarians appeared after the formation of the present ocean circulation system and the development of oligotrophic conditions in the equatorial Pacific (ca. 33.4 Ma ago. The divergence of colonial collodarians probably caused a shift in the efficiency of primary production during this period.

  4. Molecular Phylogenetics of Centrocestus formosanus (Digenea: Heterophyidae) Originated from Freshwater Fish from Chiang Mai Province, Thailand.

    Science.gov (United States)

    Wongsawad, Chalobol; Wongsawad, Pheravut; Sukontason, Kom; Maneepitaksanti, Worawit; Nantarat, Nattawadee

    2017-02-01

    This study aimed to investigate the morphology and reconstruct the phylogenetic relationships of Centrocestus formosanus originating from 5 species of freshwater fish, i.e., Esomus metallicus, Puntius brevis, Anabas testudineus, Parambassis siamensis , and Carassius auratus , in Chiang Mai province, Thailand. Sequence-related amplified polymorphism (SRAP) and phylogeny based on internal transcribed spacer 2 (ITS2) and mitochondrial cytochrome c oxidase subunit 1 (CO1) were performed. The results showed similar morphologies of adult C. formosanus from day 5 after infection in chicks. C. formosanus originated from 4 species of freshwater fish had the same number of circumoral spines on the oral sucker, except for those from C. auratus which revealed 34 circumoral spines. The phylogenetic tree obtained from SRAP profile and the combination of ITS2 and CO1 sequence showed similar results that were correlated with the number of circumoral spines in adult worms. Genetic variability of C. formosanus also occurred in different species of freshwater fish hosts. However, more details of adult worm morphologies and more sensitive genetic markers are needed to confirm the species validity of C. formosanus with 34 circumoral spines originating from C. auratus in the future.

  5. Prokaryotic phylogenetic diversity of Hungarian deep subsurface geothermal well waters.

    Science.gov (United States)

    Németh, Andrea; Szirányi, Barbara; Krett, Gergely; Janurik, Endre; Kosáros, Tünde; Pekár, Ferenc; Márialigeti, Károly; Borsodi, Andrea K

    2014-09-01

    Geothermal wells characterized by thermal waters warmer than 30°C can be found in more than 65% of the area of Hungary. The examined thermal wells located nearby Szarvas are used for heating industrial and agricultural facilities because of their relatively high hydrocarbon content. The aim of this study was to reveal the prokaryotic community structure of the water of SZR18, K87 and SZR21 geothermal wells using molecular cloning methods and Denaturing Gradient Gel Electrophoresis (DGGE). Water samples from the outflow pipes were collected in 2012 and 2013. The phylogenetic distribution of archaeal molecular clones was very similar in each sample, the most abundant groups belonged to the genera Methanosaeta, Methanothermobacter and Thermofilum. In contrast, the distribution of bacterial molecular clones was very diverse. Many of them showed the closest sequence similarities to uncultured clone sequences from similar thermal environments. From the water of the SZR18 well, phylotypes closely related to genera Fictibacillus and Alicyclobacillus (Firmicutes) were only revealed, while the bacterial diversity of the K87 well water was much higher. Here, the members of the phyla Thermodesulfobacteria, Proteobacteria, Nitrospira, Chlorobi, OP1 and OPB7 were also detected besides Firmicutes.

  6. Nucleotide diversity and phylogenetic relationships among ...

    Indian Academy of Sciences (India)

    NIRAJ SINGH

    for phylogenetic analysis of Gladiolus and related taxa using combined datasets from chloroplast genome. The psbA–trnH ... phylogenetic relationships among cultivars could be useful for hybridization programmes for further improvement of the crop. [Singh N. ... breeding in nature, and exhibited diverse pollination mech-.

  7. Molecular identification of the first local dengue fever outbreak in Shenzhen city, China: a potential imported vertical transmission from Southeast Asia?

    Science.gov (United States)

    Yang, F; Guo, G Z; Chen, J Q; Ma, H W; Liu, T; Huang, D N; Yao, C H; Zhang, R L; Xue, C F; Zhang, L

    2014-02-01

    A suspected dengue fever outbreak occurred in 2010 at a solitary construction site in Shenzhen city, China. To investigate this epidemic, we used serological, molecular biological, and bioinformatics techniques. Of nine serum samples from suspected patients, we detected seven positive for dengue virus (DENV) antibodies, eight for DENV-1 RNA, and three containing live viruses. The isolated virus, SZ1029 strain, was sequenced and confirmed as DENV-1, showing the highest E-gene homology to D1/Malaysia/36000/05 and SG(EHI)DED142808 strains recently reported in Southeast Asia. Further phylogenetic tree analysis confirmed their close relationship. At the epidemic site, we also detected 14 asymptomatic co-workers (out of 291) positive for DENV antibody, and DENV-1-positive mosquitoes. Thus, we concluded that DENV-1 caused the first local dengue fever outbreak in Shenzhen. Because no imported case was identified, the molecular fingerprints of the SZ1029 strain suggest this outbreak may be due to vertical transmission imported from Southeast Asia.

  8. The Nothoaspis amazoniensis Complete Mitogenome: A Comparative and Phylogenetic Analysis

    Directory of Open Access Journals (Sweden)

    Paulo H. C. Lima

    2018-03-01

    Full Text Available The molecular biology era, together with morphology, molecular phylogenetics, bioinformatics, and high-throughput sequencing technologies, improved the taxonomic identification of Argasidae family members, especially when considering specimens at different development stages, which remains a great difficulty for acarologists. These tools could provide important data and insights on the history and evolutionary relationships of argasids. To better understand these relationships, we sequenced and assembled the first complete mitochondrial genome of Nothoaspis amazoniensis. We used phylogenomics to identify the evolutionary history of this species of tick, comparing the data obtained with 26 complete mitochondrial sequences available in biological databases. The results demonstrated the absence of genetic rearrangements, high similarity and identity, and a close organizational link between the mitogenomes of N. amazoniensis and other argasids analyzed. In addition, the mitogenome had a monophyletic cladistic taxonomic arrangement, encompassed by representatives of the Afrotropical and Neotropical regions, with specific parasitism in bats, which may be indicative of an evolutionary process of cospeciation between vectors and the host.

  9. A New Perspective on Polyploid Fragaria (Strawberry) Genome Composition Based on Large-Scale, Multi-Locus Phylogenetic Analysis.

    Science.gov (United States)

    Yang, Yilong; Davis, Thomas M

    2017-12-01

    The subgenomic compositions of the octoploid (2n = 8× = 56) strawberry (Fragaria) species, including the economically important cultivated species Fragaria x ananassa, have been a topic of long-standing interest. Phylogenomic approaches utilizing next-generation sequencing technologies offer a new window into species relationships and the subgenomic compositions of polyploids. We have conducted a large-scale phylogenetic analysis of Fragaria (strawberry) species using the Fluidigm Access Array system and 454 sequencing platform. About 24 single-copy or low-copy nuclear genes distributed across the genome were amplified and sequenced from 96 genomic DNA samples representing 16 Fragaria species from diploid (2×) to decaploid (10×), including the most extensive sampling of octoploid taxa yet reported. Individual gene trees were constructed by different tree-building methods. Mosaic genomic structures of diploid Fragaria species consisting of sequences at different phylogenetic positions were observed. Our findings support the presence in octoploid species of genetic signatures from at least five diploid ancestors (F. vesca, F. iinumae, F. bucharica, F. viridis, and at least one additional allele contributor of unknown identity), and questions the extent to which distinct subgenomes are preserved over evolutionary time in the allopolyploid Fragaria species. In addition, our data support divergence between the two wild octoploid species, F. virginiana and F. chiloensis. © The Author 2017. Published by Oxford University Press on behalf of the Society for Molecular Biology and Evolution.

  10. A curated database of cyanobacterial strains relevant for modern taxonomy and phylogenetic studies.

    Science.gov (United States)

    Ramos, Vitor; Morais, João; Vasconcelos, Vitor M

    2017-04-25

    The dataset herein described lays the groundwork for an online database of relevant cyanobacterial strains, named CyanoType (http://lege.ciimar.up.pt/cyanotype). It is a database that includes categorized cyanobacterial strains useful for taxonomic, phylogenetic or genomic purposes, with associated information obtained by means of a literature-based curation. The dataset lists 371 strains and represents the first version of the database (CyanoType v.1). Information for each strain includes strain synonymy and/or co-identity, strain categorization, habitat, accession numbers for molecular data, taxonomy and nomenclature notes according to three different classification schemes, hierarchical automatic classification, phylogenetic placement according to a selection of relevant studies (including this), and important bibliographic references. The database will be updated periodically, namely by adding new strains meeting the criteria for inclusion and by revising and adding up-to-date metadata for strains already listed. A global 16S rDNA-based phylogeny is provided in order to assist users when choosing the appropriate strains for their studies.

  11. The phylogenetics of succession can guide restoration

    DEFF Research Database (Denmark)

    Shooner, Stephanie; Chisholm, Chelsea Lee; Davies, T. Jonathan

    2015-01-01

    Phylogenetic tools have increasingly been used in community ecology to describe the evolutionary relationships among co-occurring species. In studies of succession, such tools may allow us to identify the evolutionary lineages most suited for particular stages of succession and habitat...... rehabilitation. However, to date, these two applications have been largely separate. Here, we suggest that information on phylogenetic community structure might help to inform community restoration strategies following major disturbance. Our study examined phylogenetic patterns of succession based...... for species sorting along abiotic gradients (slope and aspect) on the mine sites that had been abandoned for the longest. Synthesis and applications. Understanding the trajectory of succession is critical for restoration efforts. Our results suggest that early colonizers represent a phylogenetically random...

  12. Effects of Phylogenetic Tree Style on Student Comprehension

    Science.gov (United States)

    Dees, Jonathan Andrew

    Phylogenetic trees are powerful tools of evolutionary biology that have become prominent across the life sciences. Consequently, learning to interpret and reason from phylogenetic trees is now an essential component of biology education. However, students often struggle to understand these diagrams, even after explicit instruction. One factor that has been observed to affect student understanding of phylogenetic trees is style (i.e., diagonal or bracket). The goal of this dissertation research was to systematically explore effects of style on student interpretations and construction of phylogenetic trees in the context of an introductory biology course. Before instruction, students were significantly more accurate with bracket phylogenetic trees for a variety of interpretation and construction tasks. Explicit instruction that balanced the use of diagonal and bracket phylogenetic trees mitigated some, but not all, style effects. After instruction, students were significantly more accurate for interpretation tasks involving taxa relatedness and construction exercises when using the bracket style. Based on this dissertation research and prior studies on style effects, I advocate for introductory biology instructors to use only the bracket style. Future research should examine causes of style effects and variables other than style to inform the development of research-based instruction that best supports student understanding of phylogenetic trees.

  13. Bayesian models for comparative analysis integrating phylogenetic uncertainty

    Directory of Open Access Journals (Sweden)

    Villemereuil Pierre de

    2012-06-01

    Full Text Available Abstract Background Uncertainty in comparative analyses can come from at least two sources: a phylogenetic uncertainty in the tree topology or branch lengths, and b uncertainty due to intraspecific variation in trait values, either due to measurement error or natural individual variation. Most phylogenetic comparative methods do not account for such uncertainties. Not accounting for these sources of uncertainty leads to false perceptions of precision (confidence intervals will be too narrow and inflated significance in hypothesis testing (e.g. p-values will be too small. Although there is some application-specific software for fitting Bayesian models accounting for phylogenetic error, more general and flexible software is desirable. Methods We developed models to directly incorporate phylogenetic uncertainty into a range of analyses that biologists commonly perform, using a Bayesian framework and Markov Chain Monte Carlo analyses. Results We demonstrate applications in linear regression, quantification of phylogenetic signal, and measurement error models. Phylogenetic uncertainty was incorporated by applying a prior distribution for the phylogeny, where this distribution consisted of the posterior tree sets from Bayesian phylogenetic tree estimation programs. The models were analysed using simulated data sets, and applied to a real data set on plant traits, from rainforest plant species in Northern Australia. Analyses were performed using the free and open source software OpenBUGS and JAGS. Conclusions Incorporating phylogenetic uncertainty through an empirical prior distribution of trees leads to more precise estimation of regression model parameters than using a single consensus tree and enables a more realistic estimation of confidence intervals. In addition, models incorporating measurement errors and/or individual variation, in one or both variables, are easily formulated in the Bayesian framework. We show that BUGS is a useful, flexible

  14. Bayesian models for comparative analysis integrating phylogenetic uncertainty

    Science.gov (United States)

    2012-01-01

    Background Uncertainty in comparative analyses can come from at least two sources: a) phylogenetic uncertainty in the tree topology or branch lengths, and b) uncertainty due to intraspecific variation in trait values, either due to measurement error or natural individual variation. Most phylogenetic comparative methods do not account for such uncertainties. Not accounting for these sources of uncertainty leads to false perceptions of precision (confidence intervals will be too narrow) and inflated significance in hypothesis testing (e.g. p-values will be too small). Although there is some application-specific software for fitting Bayesian models accounting for phylogenetic error, more general and flexible software is desirable. Methods We developed models to directly incorporate phylogenetic uncertainty into a range of analyses that biologists commonly perform, using a Bayesian framework and Markov Chain Monte Carlo analyses. Results We demonstrate applications in linear regression, quantification of phylogenetic signal, and measurement error models. Phylogenetic uncertainty was incorporated by applying a prior distribution for the phylogeny, where this distribution consisted of the posterior tree sets from Bayesian phylogenetic tree estimation programs. The models were analysed using simulated data sets, and applied to a real data set on plant traits, from rainforest plant species in Northern Australia. Analyses were performed using the free and open source software OpenBUGS and JAGS. Conclusions Incorporating phylogenetic uncertainty through an empirical prior distribution of trees leads to more precise estimation of regression model parameters than using a single consensus tree and enables a more realistic estimation of confidence intervals. In addition, models incorporating measurement errors and/or individual variation, in one or both variables, are easily formulated in the Bayesian framework. We show that BUGS is a useful, flexible general purpose tool for

  15. Molecular Characterization and Expression Analysis of Equine ( Gene in Horse (

    Directory of Open Access Journals (Sweden)

    Ki-Duk Song

    2014-05-01

    Full Text Available The objective of this study was to determine the molecular characteristics of the horse vascular endothelial growth factor alpha gene (VEGFα by constructing a phylogenetic tree, and to investigate gene expression profiles in tissues and blood leukocytes after exercise for development of suitable biomarkers. Using published amino acid sequences of other vertebrate species (human, chimpanzee, mouse, rat, cow, pig, chicken and dog, we constructed a phylogenetic tree which showed that equine VEGFα belonged to the same clade of the pig VEGFα. Analysis for synonymous (Ks and non-synonymous substitution ratios (Ka revealed that the horse VEGFα underwent positive selection. RNA was extracted from blood samples before and after exercise and different tissue samples of three horses. Expression analyses using reverse transcription-polymerase chain reaction (RT-PCR and quantitative-polymerase chain reaction (qPCR showed ubiquitous expression of VEGFα mRNA in skeletal muscle, kidney, thyroid, lung, appendix, colon, spinal cord, and heart tissues. Analysis of differential expression of VEGFα gene in blood leukocytes after exercise indicated a unimodal pattern. These results will be useful in developing biomarkers that can predict the recovery capacity of racing horses.

  16. Nucleotide diversity and phylogenetic relationships among ...

    Indian Academy of Sciences (India)

    Navya

    2 attached at the base of tree as the diverging Iridaceae relative's lineage. Present study revealed that psbA-trnH region are useful in addressing questions of phylogenetic relationships among the Gladiolus cultivars, as these intergenic spacers are more variable and have more phylogenetically informative sites than the ...

  17. Molecular sites for the positive allosteric modulation of glycine receptors by endocannabinoids.

    Directory of Open Access Journals (Sweden)

    Gonzalo E Yévenes

    Full Text Available Glycine receptors (GlyRs are transmitter-gated anion channels of the Cys-loop superfamily which mediate synaptic inhibition at spinal and selected supraspinal sites. Although they serve pivotal functions in motor control and sensory processing, they have yet to be exploited as drug targets partly because of hitherto limited possibilities for allosteric control. Endocannabinoids (ECs have recently been characterized as direct allosteric GlyR modulators, but the underlying molecular sites have remained unknown. Here, we show that chemically neutral ECs (e.g. anandamide, AEA are positive modulators of α(1, α(2 and α(3 GlyRs, whereas acidic ECs (e.g. N-arachidonoyl-glycine; NA-Gly potentiate α(1 GlyRs but inhibit α(2 and α(3. This subunit-specificity allowed us to identify the underlying molecular sites through analysis of chimeric and mutant receptors. We found that alanine 52 in extracellular loop 2, glycine 254 in transmembrane (TM region 2 and intracellular lysine 385 determine the positive modulation of α(1 GlyRs by NA-Gly. Successive substitution of non-conserved extracellular and TM residues in α(2 converted NA-Gly-mediated inhibition into potentiation. Conversely, mutation of the conserved lysine within the intracellular loop between TM3 and TM4 attenuated NA-Gly-mediated potentiation of α(1 GlyRs, without affecting inhibition of α(2 and α(3. Notably, this mutation reduced modulation by AEA of all three GlyRs. These results define molecular sites for allosteric control of GlyRs by ECs and reveal an unrecognized function for the TM3-4 intracellular loop in the allosteric modulation of Cys-loop ion channels. The identification of these sites may help to understand the physiological role of this modulation and facilitate the development of novel therapeutic approaches to diseases such as spasticity, startle disease and possibly chronic pain.

  18. Epitope discovery with phylogenetic hidden Markov models.

    LENUS (Irish Health Repository)

    Lacerda, Miguel

    2010-05-01

    Existing methods for the prediction of immunologically active T-cell epitopes are based on the amino acid sequence or structure of pathogen proteins. Additional information regarding the locations of epitopes may be acquired by considering the evolution of viruses in hosts with different immune backgrounds. In particular, immune-dependent evolutionary patterns at sites within or near T-cell epitopes can be used to enhance epitope identification. We have developed a mutation-selection model of T-cell epitope evolution that allows the human leukocyte antigen (HLA) genotype of the host to influence the evolutionary process. This is one of the first examples of the incorporation of environmental parameters into a phylogenetic model and has many other potential applications where the selection pressures exerted on an organism can be related directly to environmental factors. We combine this novel evolutionary model with a hidden Markov model to identify contiguous amino acid positions that appear to evolve under immune pressure in the presence of specific host immune alleles and that therefore represent potential epitopes. This phylogenetic hidden Markov model provides a rigorous probabilistic framework that can be combined with sequence or structural information to improve epitope prediction. As a demonstration, we apply the model to a data set of HIV-1 protein-coding sequences and host HLA genotypes.

  19. Tree phylogenetic diversity promotes host-parasitoid interactions.

    Science.gov (United States)

    Staab, Michael; Bruelheide, Helge; Durka, Walter; Michalski, Stefan; Purschke, Oliver; Zhu, Chao-Dong; Klein, Alexandra-Maria

    2016-07-13

    Evidence from grassland experiments suggests that a plant community's phylogenetic diversity (PD) is a strong predictor of ecosystem processes, even stronger than species richness per se This has, however, never been extended to species-rich forests and host-parasitoid interactions. We used cavity-nesting Hymenoptera and their parasitoids collected in a subtropical forest as a model system to test whether hosts, parasitoids, and their interactions are influenced by tree PD and a comprehensive set of environmental variables, including tree species richness. Parasitism rate and parasitoid abundance were positively correlated with tree PD. All variables describing parasitoids decreased with elevation, and were, except parasitism rate, dependent on host abundance. Quantitative descriptors of host-parasitoid networks were independent of the environment. Our study indicates that host-parasitoid interactions in species-rich forests are related to the PD of the tree community, which influences parasitism rates through parasitoid abundance. We show that effects of tree community PD are much stronger than effects of tree species richness, can cascade to high trophic levels, and promote trophic interactions. As during habitat modification phylogenetic information is usually lost non-randomly, even species-rich habitats may not be able to continuously provide the ecosystem process parasitism if the evolutionarily most distinct plant lineages vanish. © 2016 The Author(s).

  20. Point estimates in phylogenetic reconstructions

    OpenAIRE

    Benner, Philipp; Bacak, Miroslav; Bourguignon, Pierre-Yves

    2013-01-01

    Motivation: The construction of statistics for summarizing posterior samples returned by a Bayesian phylogenetic study has so far been hindered by the poor geometric insights available into the space of phylogenetic trees, and ad hoc methods such as the derivation of a consensus tree makeup for the ill-definition of the usual concepts of posterior mean, while bootstrap methods mitigate the absence of a sound concept of variance. Yielding satisfactory results with sufficiently concentrated pos...

  1. Transcriptional and phylogenetic analysis of five complete ambystomatid salamander mitochondrial genomes.

    Science.gov (United States)

    Samuels, Amy K; Weisrock, David W; Smith, Jeramiah J; France, Katherine J; Walker, John A; Putta, Srikrishna; Voss, S Randal

    2005-04-11

    salamander complex species also produced robustly supported trees. The D-loop, used in previous molecular phylogenetic studies of the complex, was found to contain a relatively low level of variation and we identified mitochondrial regions with higher rates of molecular evolution that are more useful in resolving relationships among species. Our results show the benefit of using complete genome mitochondrial information in studies of recently and rapidly diverged taxa.

  2. pplacer: linear time maximum-likelihood and Bayesian phylogenetic placement of sequences onto a fixed reference tree

    Directory of Open Access Journals (Sweden)

    Kodner Robin B

    2010-10-01

    Full Text Available Abstract Background Likelihood-based phylogenetic inference is generally considered to be the most reliable classification method for unknown sequences. However, traditional likelihood-based phylogenetic methods cannot be applied to large volumes of short reads from next-generation sequencing due to computational complexity issues and lack of phylogenetic signal. "Phylogenetic placement," where a reference tree is fixed and the unknown query sequences are placed onto the tree via a reference alignment, is a way to bring the inferential power offered by likelihood-based approaches to large data sets. Results This paper introduces pplacer, a software package for phylogenetic placement and subsequent visualization. The algorithm can place twenty thousand short reads on a reference tree of one thousand taxa per hour per processor, has essentially linear time and memory complexity in the number of reference taxa, and is easy to run in parallel. Pplacer features calculation of the posterior probability of a placement on an edge, which is a statistically rigorous way of quantifying uncertainty on an edge-by-edge basis. It also can inform the user of the positional uncertainty for query sequences by calculating expected distance between placement locations, which is crucial in the estimation of uncertainty with a well-sampled reference tree. The software provides visualizations using branch thickness and color to represent number of placements and their uncertainty. A simulation study using reads generated from 631 COG alignments shows a high level of accuracy for phylogenetic placement over a wide range of alignment diversity, and the power of edge uncertainty estimates to measure placement confidence. Conclusions Pplacer enables efficient phylogenetic placement and subsequent visualization, making likelihood-based phylogenetics methodology practical for large collections of reads; it is freely available as source code, binaries, and a web service.

  3. Molecular-signature analyses support the establishment of the actinobacterial genus Sphaerimonospora (Mingma et al. 2016).

    Science.gov (United States)

    Meyers, Paul R

    2017-10-01

    The genera Microbispora and Sphaerimonospora were examined for GyrB and RecA amino-acid signatures to determine whether molecular-signature analyses support the recent establishment of the genus Sphaerimonospora. The creation of Sphaerimonospora was based mainly upon morphological differences between Microbispora and Sphaerimonospora and the clustering of the type strains of the two genera in phylogenetic trees based on a multilocus sequence analysis. The molecular-signature analyses showed that all members of Sphaerimonospora can be distinguished from all members of Microbispora at 14 amino acid positions in the GyrB protein and at four positions in the shorter RecA protein. These amino acid differences can be used as signatures to differentiate the members of these genera from each other and thus provide support for the establishment of the genus Sphaerimonospora. This is the first demonstration of the use of molecular signatures to support the establishment of a new genus in the family Streptosporangiaceae. Following the transfer of Microbispora mesophila and Microbispora thailandensis from Microbispora to Sphaerimonospora, all species in the genus Microbispora are characterised by the insertion of a small, hydrophobic amino acid after position 208 in the GyrB protein. This insertion is absent from the GyrB protein of members of the genus Sphaerimonospora. Copyright © 2017 Elsevier GmbH. All rights reserved.

  4. Open Reading Frame Phylogenetic Analysis on the Cloud

    Directory of Open Access Journals (Sweden)

    Che-Lun Hung

    2013-01-01

    Full Text Available Phylogenetic analysis has become essential in researching the evolutionary relationships between viruses. These relationships are depicted on phylogenetic trees, in which viruses are grouped based on sequence similarity. Viral evolutionary relationships are identified from open reading frames rather than from complete sequences. Recently, cloud computing has become popular for developing internet-based bioinformatics tools. Biocloud is an efficient, scalable, and robust bioinformatics computing service. In this paper, we propose a cloud-based open reading frame phylogenetic analysis service. The proposed service integrates the Hadoop framework, virtualization technology, and phylogenetic analysis methods to provide a high-availability, large-scale bioservice. In a case study, we analyze the phylogenetic relationships among Norovirus. Evolutionary relationships are elucidated by aligning different open reading frame sequences. The proposed platform correctly identifies the evolutionary relationships between members of Norovirus.

  5. Archigregarines of the English Channel revisited: New molecular data on Selenidium species including early described and new species and the uncertainties of phylogenetic relationships.

    Directory of Open Access Journals (Sweden)

    Sonja Rueckert

    Full Text Available Gregarines represent an important transition step from free-living predatory (colpodellids s.l. and/or photosynthetic (Chromera and Vitrella apicomplexan lineages to the most important pathogens, obligate intracellular parasites of humans and domestic animals such as coccidians and haemosporidians (Plasmodium, Toxoplasma, Eimeria, Babesia, etc.. While dozens of genomes of other apicomplexan groups are available, gregarines are barely entering the molecular age. Among the gregarines, archigregarines possess a unique mixture of ancestral (myzocytosis and derived (lack of apicoplast, presence of subpellicular microtubules features.In this study we revisited five of the early-described species of the genus Selenidium including the type species Selenidium pendula, with special focus on surface ultrastructure and molecular data. We were also able to describe three new species within this genus. All species were characterized at morphological (light and scanning electron microscopy data and molecular (SSU rDNA sequence data levels. Gregarine specimens were isolated from polychaete hosts collected from the English Channel near the Station Biologique de Roscoff, France: Selenidium pendula from Scolelepis squamata, S. hollandei and S. sabellariae from Sabellaria alveolata, S. sabellae from Sabella pavonina, Selenidium fallax from Cirriformia tentaculata, S. spiralis sp. n. and S. antevariabilis sp. n. from Amphitritides gracilis, and S. opheliae sp. n. from Ophelia roscoffensis. Molecular phylogenetic analyses of these data showed archigregarines clustering into five separate clades and support previous doubts about their monophyly.Our phylogenies using the extended gregarine sampling show that the archigregarines are indeed not monophyletic with one strongly supported clade of Selenidium sequences around the type species S. pendula. We suggest the revision of the whole archigregarine taxonomy with only the species within this clade remaining in the genus

  6. Characterization of Escherichia coli Phylogenetic Groups ...

    African Journals Online (AJOL)

    Background: Escherichia coli strains mainly fall into four phylogenetic groups (A, B1, B2, and D) and that virulent extra‑intestinal strains mainly belong to groups B2 and D. Aim: The aim was to determine the association between phylogenetic groups of E. coli causing extraintestinal infections (ExPEC) regarding the site of ...

  7. New insights on the phylogenetic relationships among the traditional Philodendron subgenera and the other groups of the Homalomena clade (Araceae).

    Science.gov (United States)

    Vasconcelos, Santelmo; Soares, Maria de Lourdes; Sakuragui, Cássia M; Croat, Thomas B; Oliveira, Guilherme; Benko-Iseppon, Ana M

    2018-05-19

    Philodendron (Araceae) is one of the largest Neotropical plant genera, with approximately 500 species and at least 1000 species predicted. There is a considerable ecological diversity in the group, although most species occur in the humid forests of tropical America. Despite being relatively well-studied in taxonomic analyses, the relationships among the traditional morphological groups of the genus are not well-established, mainly regarding the three traditional subgenera, referred here as Philodendron sensu lato (s.l.), P. subg. Pteromischum, P. subg. Philodendron and P. subg. Meconostigma, which was recently recognized as a separate genus, Thaumatophyllum. Therefore, the present work evaluates the phylogenetic position and the monophyly of Philodendron s.l. and its three main subdivisions, and the sister groups within the Homalomena clade, which also includes the Neotropical genus Adelonema, the two Asian genera Homalomena and Furtadoa, and the two African genera Cercestis and Culcasia, by means of molecular phylogenetic approaches including chloroplast DNA (atpF-atpH, rpl32-trnL, trnQ-5'-rps16 and trnV-ndhC) and nuclear (ITS2) markers. The monophyly of Philodendron s.l. and its three lineages is confirmed and our analyses corroborate previous morphologic data indicating Thaumatophyllum as sister to the clade formed by P. subg. Pteromischum and P. subg. Philodendron. Copyright © 2018 Elsevier Inc. All rights reserved.

  8. A molecular phylogeny of the stingless bee genus Melipona (Hymenoptera: Apidae).

    Science.gov (United States)

    Ramírez, Santiago R; Nieh, James C; Quental, Tiago B; Roubik, David W; Imperatriz-Fonseca, Vera L; Pierce, Naomi E

    2010-08-01

    Stingless bees (Meliponini) constitute a diverse group of highly eusocial insects that occur throughout tropical regions around the world. The meliponine genus Melipona is restricted to the New World tropics and has over 50 described species. Melipona, like Apis, possesses the remarkable ability to use representational communication to indicate the location of foraging patches. Although Melipona has been the subject of numerous behavioral, ecological, and genetic studies, the evolutionary history of this genus remains largely unexplored. Here, we implement a multigene phylogenetic approach based on nuclear, mitochondrial, and ribosomal loci, coupled with molecular clock methods, to elucidate the phylogenetic relationships and antiquity of subgenera and species of Melipona. Our phylogenetic analysis resolves the relationship among subgenera and tends to agree with morphology-based classification hypotheses. Our molecular clock analysis indicates that the genus Melipona shared a most recent common ancestor at least approximately 14-17 million years (My) ago. These results provide the groundwork for future comparative analyses aimed at understanding the evolution of complex communication mechanisms in eusocial Apidae. Copyright 2010 Elsevier Inc. All rights reserved.

  9. TCS: a web server for multiple sequence alignment evaluation and phylogenetic reconstruction.

    Science.gov (United States)

    Chang, Jia-Ming; Di Tommaso, Paolo; Lefort, Vincent; Gascuel, Olivier; Notredame, Cedric

    2015-07-01

    This article introduces the Transitive Consistency Score (TCS) web server; a service making it possible to estimate the local reliability of protein multiple sequence alignments (MSAs) using the TCS index. The evaluation can be used to identify the aligned positions most likely to contain structurally analogous residues and also most likely to support an accurate phylogenetic reconstruction. The TCS scoring scheme has been shown to be accurate predictor of structural alignment correctness among commonly used methods. It has also been shown to outperform common filtering schemes like Gblocks or trimAl when doing MSA post-processing prior to phylogenetic tree reconstruction. The web server is available from http://tcoffee.crg.cat/tcs. © The Author(s) 2015. Published by Oxford University Press on behalf of Nucleic Acids Research.

  10. Towards a phylogenetic classification of reef corals: The Indo-Pacific genera Merulina, Goniastrea and Scapophyllia (Scleractinia, Merulinidae)

    KAUST Repository

    Huang, Danwei

    2014-06-03

    Recent advances in scleractinian systematics and taxonomy have been achieved through the integration of molecular and morphological data, as well as rigorous analysis using phylogenetic methods. In this study, we continue in our pursuit of a phylogenetic classification by examining the evolutionary relationships between the closely related reef coral genera Merulina, Goniastrea, Paraclavarina and Scapophyllia (Merulinidae). In particular, we address the extreme polyphyly of Favites and Goniastrea that was discovered a decade ago. We sampled 145 specimens belonging to 16 species from a wide geographic range in the Indo-Pacific, focusing especially on type localities, including the Red Sea, western Indian Ocean and central Pacific. Tree reconstructions based on both nuclear and mitochondrial markers reveal a novel lineage composed of three species previously placed in Favites and Goniastrea. Morphological analyses indicate that this clade, Paragoniastrea Huang, Benzoni & Budd, gen. n., has a unique combination of corallite and subcorallite features observable with scanning electron microscopy and thin sections. Molecular and morphological evidence furthermore indicates that the monotypic genus Paraclavarina is nested within Merulina, and the former is therefore synonymised. © 2014 Royal Swedish Academy of Sciences.

  11. A Practical Algorithm for Reconstructing Level-1 Phylogenetic Networks

    NARCIS (Netherlands)

    K.T. Huber; L.J.J. van Iersel (Leo); S.M. Kelk (Steven); R. Suchecki

    2010-01-01

    htmlabstractRecently much attention has been devoted to the construction of phylogenetic networks which generalize phylogenetic trees in order to accommodate complex evolutionary processes. Here we present an efficient, practical algorithm for reconstructing level-1 phylogenetic networks - a type of

  12. A practical algorithm for reconstructing level-1 phylogenetic networks

    NARCIS (Netherlands)

    Huber, K.T.; Iersel, van L.J.J.; Kelk, S.M.; Suchecki, R.

    2011-01-01

    Recently, much attention has been devoted to the construction of phylogenetic networks which generalize phylogenetic trees in order to accommodate complex evolutionary processes. Here, we present an efficient, practical algorithm for reconstructing level-1 phylogenetic networks-a type of network

  13. On the origin of the treponematoses: a phylogenetic approach.

    Directory of Open Access Journals (Sweden)

    Kristin N Harper

    2008-01-01

    Full Text Available Since the first recorded epidemic of syphilis in 1495, controversy has surrounded the origins of the bacterium Treponema pallidum subsp. pallidum and its relationship to the pathogens responsible for the other treponemal diseases: yaws, endemic syphilis, and pinta. Some researchers have argued that the syphilis-causing bacterium, or its progenitor, was brought from the New World to Europe by Christopher Columbus and his men, while others maintain that the treponematoses, including syphilis, have a much longer history on the European continent.We applied phylogenetics to this problem, using data from 21 genetic regions examined in 26 geographically disparate strains of pathogenic Treponema. Of all the strains examined, the venereal syphilis-causing strains originated most recently and were more closely related to yaws-causing strains from South America than to other non-venereal strains. Old World yaws-causing strains occupied a basal position on the tree, indicating that they arose first in human history, and a simian strain of T. pallidum was found to be indistinguishable from them.Our results lend support to the Columbian theory of syphilis's origin while suggesting that the non-sexually transmitted subspecies arose earlier in the Old World. This study represents the first attempt to address the problem of the origin of syphilis using molecular genetics, as well as the first source of information regarding the genetic make-up of non-venereal strains from the Western hemisphere.

  14. Folding and unfolding phylogenetic trees and networks.

    Science.gov (United States)

    Huber, Katharina T; Moulton, Vincent; Steel, Mike; Wu, Taoyang

    2016-12-01

    Phylogenetic networks are rooted, labelled directed acyclic graphswhich are commonly used to represent reticulate evolution. There is a close relationship between phylogenetic networks and multi-labelled trees (MUL-trees). Indeed, any phylogenetic network N can be "unfolded" to obtain a MUL-tree U(N) and, conversely, a MUL-tree T can in certain circumstances be "folded" to obtain aphylogenetic network F(T) that exhibits T. In this paper, we study properties of the operations U and F in more detail. In particular, we introduce the class of stable networks, phylogenetic networks N for which F(U(N)) is isomorphic to N, characterise such networks, and show that they are related to the well-known class of tree-sibling networks. We also explore how the concept of displaying a tree in a network N can be related to displaying the tree in the MUL-tree U(N). To do this, we develop aphylogenetic analogue of graph fibrations. This allows us to view U(N) as the analogue of the universal cover of a digraph, and to establish a close connection between displaying trees in U(N) and reconciling phylogenetic trees with networks.

  15. Identification and phylogenetic analysis of Dirofilaria ursi (Nematoda: Filarioidea) from Wisconsin black bears (Ursus americanus) and its Wolbachia endosymbiont.

    Science.gov (United States)

    Michalski, Michelle L; Bain, Odile; Fischer, Kerstin; Fischer, Peter U; Kumar, Sanjay; Foster, Jeremy M

    2010-04-01

    Dirofilaria ursi is a filarial nematode of American black bears (Ursus americanus Pallas, 1780) that is vectored by black flies (Simuliidae) in many parts of the United States. In northwestern Wisconsin, the prevalence of microfilaremic bears during the fall hunting season was 21% (n = 47). Unsheathed blood microfilariae from Wisconsin bears possess characters consistent with the original description of D. ursi, as do adult worms observed histologically and grossly. Immunohistochemistry was used to identify the Wolbachia endosymbiont in the hypodermis and lateral cords of an adult female D. ursi. Amplification of wsp, gatB, coxA, fbpA, and ftsZ bacterial sequences from parasite DNA confirmed the presence of Wolbachia, and molecular phylogenetic analysis of the Wolbachia ftsZ gene groups the endosymbiont with Wolbachia from D. immitis and D. repens. Phylogenetic analysis of D. ursi 5s rDNA sequence confirms the morphological observations grouping this parasite as a member of Dirofilaria, and within the Dirofilaria - Onchocerca clade of filarial nematodes. This is the first report of Wolbachia characterization and molecular phylogeny information for D. ursi.

  16. Phylogenetic reconstruction and shell evolution of the Diplommatinidae (Gastropoda: Caenogastropoda).

    Science.gov (United States)

    Webster, Nicole B; Van Dooren, Tom J M; Schilthuizen, Menno

    2012-06-01

    The fascinating and often unlikely shell shapes in the terrestrial micromollusc family Diplommatinidae (Gastropoda: Caenogastropoda) provide a particularly attractive set of multiple morphological traits to investigate evolutionary patterns of shape variation. Here, a molecular phylogenetic reconstruction, based on five genes and 2700 bp, was undertaken for this family, integrated with ancestral state reconstruction and phylogenetic PCA of discrete and quantitative traits, respectively. We found strong support for the Diplommatininae as a monophyletic group, separating the Cochlostomatidae into a separate family. Five main clades appear within the Diplommatininae, corresponding with both coiling direction and biogeographic patterns. A Belau clade (A) with highly diverse (but always sinistral) morphology comprised Hungerfordia, Palaina, and some Diplommatina. Arinia (dextral) and Opisthostoma (sinistroid) are sister groups in clade B. Clade C and D solely contain sinistral Diplommatina that are robust and little ornamented (clade C) or slender and sculptured (clade D). Clade E is dextral but biogeographically diverse with species from all sampled regions save the Caroline Islands. Adelopoma, Diplommatina, Palaina, and Hungerfordia require revision to allow taxonomy to reflect phylogeny, whereas Opisthostoma is clearly monophyletic. Ancestral state reconstruction suggests a sinistral origin for the Diplommatinidae, with three reversals to dextrality. Copyright © 2012 Elsevier Inc. All rights reserved.

  17. Molecular Diagnostics and Variability of Longidorid Nematodes

    Directory of Open Access Journals (Sweden)

    Francesca De Luca

    2004-08-01

    Full Text Available PCR-RFLP and sequencing approaches of ribosomal DNA are being used to study taxonomy, molecular identification and phylogeny of plant parasitic nematodes. In this paper, we discuss on the usefulness of ITS PCRRFLP analysis to differentiate among longidorid species. In addition, we examined how well ITS PCR-RFLP differentiated between longidorid species, and how well sequencing of two different ribosomal regions, the ITS containing region and D1-D2 domains of the 26S rDNA, were able to infer phylogenetic relationships among those same species. These methods and their advantages in identifying longidorids and establishing their phylogenetic relationships are examined and discussed.

  18. Activity and phylogenetic diversity of bacterial cells with high and low nucleic acid content and electron transport system activity in an upwelling ecosystem.

    Science.gov (United States)

    Longnecker, K; Sherr, B F; Sherr, E B

    2005-12-01

    We evaluated whether bacteria with higher cell-specific nucleic acid content (HNA) or an active electron transport system, i.e., positive for reduction of 5-cyano-2,3-ditolyl tetrazolium chloride (CTC), were responsible for the bulk of bacterioplankton metabolic activity. We also examined whether the phylogenetic diversity of HNA and CTC-positive cells differed from the diversity of Bacteria with low nucleic acid content (LNA). Bacterial assemblages were sampled both in eutrophic shelf waters and in mesotrophic offshore waters in the Oregon coastal upwelling region. Cytometrically sorted HNA, LNA, and CTC-positive cells were assayed for their cell-specific [3H]leucine incorporation rates. Phylogenetic diversity in sorted non-radioactively labeled samples was assayed using denaturing gradient gel electrophoresis (DGGE) of PCR-amplified 16S rRNA genes. Cell-specific rates of leucine incorporation of HNA and CTC-positive cells were on average only slightly greater than the cell-specific rates of LNA cells. HNA cells accounted for most bacterioplankton substrate incorporation due to high abundances, while the low abundances of CTC-positive cells resulted in only a small contribution by these cells to total bacterial activity. The proportion of the total bacterial leucine incorporation attributable to LNA cells was higher in offshore regions than in shelf waters. Sequence data obtained from DGGE bands showed broadly similar phylogenetic diversity across HNA, LNA, and CTC-positive cells, with between-sample and between-region variability in the distribution of phylotypes. Our results suggest that LNA bacteria are not substantially different from HNA bacteria in either cell-specific rates of substrate incorporation or phylogenetic composition and that they can be significant contributors to bacterial metabolism in the sea.

  19. Negative correlation between rates of molecular evolution and flowering cycles in temperate woody bamboos revealed by plastid phylogenomics.

    Science.gov (United States)

    Ma, Peng-Fei; Vorontsova, Maria S; Nanjarisoa, Olinirina Prisca; Razanatsoa, Jacqueline; Guo, Zhen-Hua; Haevermans, Thomas; Li, De-Zhu

    2017-12-21

    Heterogeneous rates of molecular evolution are universal across the tree of life, posing challenges for phylogenetic inference. The temperate woody bamboos (tribe Arundinarieae, Poaceae) are noted for their extremely slow molecular evolutionary rates, supposedly caused by their mysterious monocarpic reproduction. However, the correlation between substitution rates and flowering cycles has not been formally tested. Here we present 15 newly sequenced plastid genomes of temperate woody bamboos, including the first genomes ever sequenced from Madagascar representatives. A data matrix of 46 plastid genomes representing all 12 lineages of Arundinarieae was assembled for phylogenetic and molecular evolutionary analyses. We conducted phylogenetic analyses using different sequences (e.g., coding and noncoding) combined with different data partitioning schemes, revealing conflicting relationships involving internodes among several lineages. A great difference in branch lengths were observed among the major lineages, and topological inconsistency could be attributed to long-branch attraction (LBA). Using clock model-fitting by maximum likelihood and Bayesian approaches, we furthermore demonstrated extensive rate variation among these major lineages. Rate accelerations mainly occurred for the isolated lineages with limited species diversification, totaling 11 rate shifts during the tribe's evolution. Using linear regression analysis, we found a negative correlation between rates of molecular evolution and flowering cycles for Arundinarieae, notwithstanding that the correlation maybe insignificant when taking the phylogenetic structure into account. Using the temperate woody bamboos as an example, we found further evidence that rate heterogeneity is universal in plants, suggesting that this will pose a challenge for phylogenetic reconstruction of bamboos. The bamboos with longer flowering cycles tend to evolve more slowly than those with shorter flowering cycles, in accordance

  20. Topological variation in single-gene phylogenetic trees

    OpenAIRE

    Castresana, Jose

    2007-01-01

    A recent large-scale phylogenomic study has shown the great degree of topological variation that can be found among eukaryotic phylogenetic trees constructed from single genes, highlighting the problems that can be associated with gene sampling in phylogenetic studies.