WorldWideScience

Sample records for modeling gene regulation

  1. Mathematical Models of Gene Regulation

    Science.gov (United States)

    Mackey, Michael C.

    2004-03-01

    This talk will focus on examples of mathematical models for the regulation of repressible operons (e.g. the tryptophan operon), inducible operons (e.g. the lactose operon), and the lysis/lysogeny switch in phage λ. These ``simple" gene regulatory elements can display characteristics experimentally of rapid response to perturbations and bistability, and biologically accurate mathematical models capture these aspects of the dynamics. The models, if realistic, are always nonlinear and contain significant time delays due to transcriptional and translational delays that pose substantial problems for the analysis of the possible ranges of dynamics.

  2. Thermodynamics-based models of transcriptional regulation with gene sequence.

    Science.gov (United States)

    Wang, Shuqiang; Shen, Yanyan; Hu, Jinxing

    2015-12-01

    Quantitative models of gene regulatory activity have the potential to improve our mechanistic understanding of transcriptional regulation. However, the few models available today have been based on simplistic assumptions about the sequences being modeled or heuristic approximations of the underlying regulatory mechanisms. In this work, we have developed a thermodynamics-based model to predict gene expression driven by any DNA sequence. The proposed model relies on a continuous time, differential equation description of transcriptional dynamics. The sequence features of the promoter are exploited to derive the binding affinity which is derived based on statistical molecular thermodynamics. Experimental results show that the proposed model can effectively identify the activity levels of transcription factors and the regulatory parameters. Comparing with the previous models, the proposed model can reveal more biological sense.

  3. Statistical modelling of transcript profiles of differentially regulated genes

    Directory of Open Access Journals (Sweden)

    Sergeant Martin J

    2008-07-01

    Full Text Available Abstract Background The vast quantities of gene expression profiling data produced in microarray studies, and the more precise quantitative PCR, are often not statistically analysed to their full potential. Previous studies have summarised gene expression profiles using simple descriptive statistics, basic analysis of variance (ANOVA and the clustering of genes based on simple models fitted to their expression profiles over time. We report the novel application of statistical non-linear regression modelling techniques to describe the shapes of expression profiles for the fungus Agaricus bisporus, quantified by PCR, and for E. coli and Rattus norvegicus, using microarray technology. The use of parametric non-linear regression models provides a more precise description of expression profiles, reducing the "noise" of the raw data to produce a clear "signal" given by the fitted curve, and describing each profile with a small number of biologically interpretable parameters. This approach then allows the direct comparison and clustering of the shapes of response patterns between genes and potentially enables a greater exploration and interpretation of the biological processes driving gene expression. Results Quantitative reverse transcriptase PCR-derived time-course data of genes were modelled. "Split-line" or "broken-stick" regression identified the initial time of gene up-regulation, enabling the classification of genes into those with primary and secondary responses. Five-day profiles were modelled using the biologically-oriented, critical exponential curve, y(t = A + (B + CtRt + ε. This non-linear regression approach allowed the expression patterns for different genes to be compared in terms of curve shape, time of maximal transcript level and the decline and asymptotic response levels. Three distinct regulatory patterns were identified for the five genes studied. Applying the regression modelling approach to microarray-derived time course data

  4. Dynamic model of gene regulation for the lac operon

    Science.gov (United States)

    Angelova, Maia; Ben-Halim, Asma

    2011-03-01

    Gene regulatory network is a collection of DNA which interact with each other and with other matter in the cell. The lac operon is an example of a relatively simple genetic network and is one of the best-studied structures in the Escherichia coli bacteria. In this work we consider a deterministic model of the lac operon with a noise term, representing the stochastic nature of the regulation. The model is written in terms of a system of simultaneous first order differential equations with delays. We investigate an analytical and numerical solution and analyse the range of values for the parameters corresponding to a stable solution.

  5. Dynamic model of gene regulation for the lac operon

    International Nuclear Information System (INIS)

    Angelova, Maia; Ben-Halim, Asma

    2011-01-01

    Gene regulatory network is a collection of DNA which interact with each other and with other matter in the cell. The lac operon is an example of a relatively simple genetic network and is one of the best-studied structures in the Escherichia coli bacteria. In this work we consider a deterministic model of the lac operon with a noise term, representing the stochastic nature of the regulation. The model is written in terms of a system of simultaneous first order differential equations with delays. We investigate an analytical and numerical solution and analyse the range of values for the parameters corresponding to a stable solution.

  6. Reconstructing nonlinear dynamic models of gene regulation using stochastic sampling

    Directory of Open Access Journals (Sweden)

    Reinelt Gerhard

    2009-12-01

    Full Text Available Abstract Background The reconstruction of gene regulatory networks from time series gene expression data is one of the most difficult problems in systems biology. This is due to several reasons, among them the combinatorial explosion of possible network topologies, limited information content of the experimental data with high levels of noise, and the complexity of gene regulation at the transcriptional, translational and post-translational levels. At the same time, quantitative, dynamic models, ideally with probability distributions over model topologies and parameters, are highly desirable. Results We present a novel approach to infer such models from data, based on nonlinear differential equations, which we embed into a stochastic Bayesian framework. We thus address both the stochasticity of experimental data and the need for quantitative dynamic models. Furthermore, the Bayesian framework allows it to easily integrate prior knowledge into the inference process. Using stochastic sampling from the Bayes' posterior distribution, our approach can infer different likely network topologies and model parameters along with their respective probabilities from given data. We evaluate our approach on simulated data and the challenge #3 data from the DREAM 2 initiative. On the simulated data, we study effects of different levels of noise and dataset sizes. Results on real data show that the dynamics and main regulatory interactions are correctly reconstructed. Conclusions Our approach combines dynamic modeling using differential equations with a stochastic learning framework, thus bridging the gap between biophysical modeling and stochastic inference approaches. Results show that the method can reap the advantages of both worlds, and allows the reconstruction of biophysically accurate dynamic models from noisy data. In addition, the stochastic learning framework used permits the computation of probability distributions over models and model parameters

  7. A Bayesian model for pooling gene expression studies that incorporates co-regulation information.

    Directory of Open Access Journals (Sweden)

    Erin M Conlon

    Full Text Available Current Bayesian microarray models that pool multiple studies assume gene expression is independent of other genes. However, in prokaryotic organisms, genes are arranged in units that are co-regulated (called operons. Here, we introduce a new Bayesian model for pooling gene expression studies that incorporates operon information into the model. Our Bayesian model borrows information from other genes within the same operon to improve estimation of gene expression. The model produces the gene-specific posterior probability of differential expression, which is the basis for inference. We found in simulations and in biological studies that incorporating co-regulation information improves upon the independence model. We assume that each study contains two experimental conditions: a treatment and control. We note that there exist environmental conditions for which genes that are supposed to be transcribed together lose their operon structure, and that our model is best carried out for known operon structures.

  8. Trans gene regulation in adaptive evolution: a genetic algorithm model.

    Science.gov (United States)

    Behera, N; Nanjundiah, V

    1997-09-21

    This is a continuation of earlier studies on the evolution of infinite populations of haploid genotypes within a genetic algorithm framework. We had previously explored the evolutionary consequences of the existence of indeterminate-"plastic"-loci, where a plastic locus had a finite probability in each generation of functioning (being switched "on") or not functioning (being switched "off"). The relative probabilities of the two outcomes were assigned on a stochastic basis. The present paper examines what happens when the transition probabilities are biased by the presence of regulatory genes. We find that under certain conditions regulatory genes can improve the adaptation of the population and speed up the rate of evolution (on occasion at the cost of lowering the degree of adaptation). Also, the existence of regulatory loci potentiates selection in favour of plasticity. There is a synergistic effect of regulatory genes on plastic alleles: the frequency of such alleles increases when regulatory loci are present. Thus, phenotypic selection alone can be a potentiating factor in a favour of better adaptation. Copyright 1997 Academic Press Limited.

  9. Hypothalamic gene expression of appetite regulators in a cancer-cachectic mouse model [Dataset 2

    OpenAIRE

    Dwarkasing, Jvalini; Dijk, Francina J.; Boekschoten, Mark; Faber, Joyce; Argilès, Josep M.; Lavianio, Alessandro; Muller, Michael; Witkamp, Renger; Norren, van, Klaske

    2013-01-01

    Appetite is frequently affected in cancer patients, leading to anorexia and consequently insufficient food intake. In this study, we report on hypothalamic gene expression profile of a cancer cachectic mouse model with increased food intake. In this model, mice bearing C26 colon adenocarcinoma have an increased food intake subsequently to the loss of body weight. We hypothesize that in this model, appetite regulating systems in the hypothalamus, which apparently fail in anorexia, are still ab...

  10. Hypothalamic gene expression of appetite regulators in a cancer-cachectic mouse model [Dataset 1

    OpenAIRE

    Dwarkasing, Jvalini; Dijk, Francina J.; Boekschoten, Mark; Faber, Joyce; Argilès, Josep M.; Lavianio, Alessandro; Muller, Michael; Witkamp, Renger; Norren, van, Klaske

    2013-01-01

    Appetite is frequently affected in cancer patients, leading to anorexia and consequently insufficient food intake. In this study, we report on hypothalamic gene expression profile of a cancer cachectic mouse model with increased food intake. In this model, mice bearing C26 colon adenocarcinoma have an increased food intake subsequently to the loss of body weight. We hypothesize that in this model, appetite regulating systems in the hypothalamus, which apparently fail in anorexia, are still ab...

  11. Stochastic modeling for the expression of a gene regulated by competing transcription factors.

    Directory of Open Access Journals (Sweden)

    Hsih-Te Yang

    Full Text Available It is widely accepted that gene expression regulation is a stochastic event. The common approach for its computer simulation requires detailed information on the interactions of individual molecules, which is often not available for the analyses of biological experiments. As an alternative approach, we employed a more intuitive model to simulate the experimental result, the Markov-chain model, in which a gene is regulated by activators and repressors, which bind the same site in a mutually exclusive manner. Our stochastic simulation in the presence of both activators and repressors predicted a Hill-coefficient of the dose-response curve closer to the experimentally observed value than the calculated value based on the simple additive effects of activators alone and repressors alone. The simulation also reproduced the heterogeneity of gene expression levels among individual cells observed by Fluorescence Activated Cell Sorting analysis. Therefore, our approach may help to apply stochastic simulations to broader experimental data.

  12. A systems level predictive model for global gene regulation of methanogenesis in a hydrogenotrophic methanogen.

    Science.gov (United States)

    Yoon, Sung Ho; Turkarslan, Serdar; Reiss, David J; Pan, Min; Burn, June A; Costa, Kyle C; Lie, Thomas J; Slagel, Joseph; Moritz, Robert L; Hackett, Murray; Leigh, John A; Baliga, Nitin S

    2013-11-01

    Methanogens catalyze the critical methane-producing step (called methanogenesis) in the anaerobic decomposition of organic matter. Here, we present the first predictive model of global gene regulation of methanogenesis in a hydrogenotrophic methanogen, Methanococcus maripaludis. We generated a comprehensive list of genes (protein-coding and noncoding) for M. maripaludis through integrated analysis of the transcriptome structure and a newly constructed Peptide Atlas. The environment and gene-regulatory influence network (EGRIN) model of the strain was constructed from a compendium of transcriptome data that was collected over 58 different steady-state and time-course experiments that were performed in chemostats or batch cultures under a spectrum of environmental perturbations that modulated methanogenesis. Analyses of the EGRIN model have revealed novel components of methanogenesis that included at least three additional protein-coding genes of previously unknown function as well as one noncoding RNA. We discovered that at least five regulatory mechanisms act in a combinatorial scheme to intercoordinate key steps of methanogenesis with different processes such as motility, ATP biosynthesis, and carbon assimilation. Through a combination of genetic and environmental perturbation experiments we have validated the EGRIN-predicted role of two novel transcription factors in the regulation of phosphate-dependent repression of formate dehydrogenase-a key enzyme in the methanogenesis pathway. The EGRIN model demonstrates regulatory affiliations within methanogenesis as well as between methanogenesis and other cellular functions.

  13. Models of Aire-Dependent Gene Regulation for Thymic Negative Selection

    OpenAIRE

    Danso-Abeam, Dina; Humblet-Baron, Stephanie; Dooley, James; Liston, Adrian

    2011-01-01

    Mutations in the autoimmune regulator (AIRE) gene lead to autoimmune polyendocrinopathy syndrome type 1 (APS1), characterized by the development of multi-organ autoimmune damage. The mechanism by which defects in AIRE result in autoimmunity has been the subject of intense scrutiny. At the cellular level, the working model explains most of the clinical and immunological characteristics of APS1, with AIRE driving the expression of tissue-restricted antigens (TRAs) in the epithelial cells of the...

  14. Sinorhizobium meliloti putA gene regulation: a new model within the family Rhizobiaceae.

    Science.gov (United States)

    Soto, M J; Jiménez-Zurdo, J I; van Dillewijn, P; Toro, N

    2000-04-01

    Proline dehydrogenase (PutA) is a bifunctional enzyme that catalyzes the oxidation of proline to glutamate. In Sinorhizobium meliloti, as in other microorganisms, the putA gene is transcriptionally activated in response to proline. In Rhodobacter capsulatus, Agrobacterium, and most probably in Bradyrhizobium, this activation is dependent on an Lrp-like protein encoded by the putR gene, located immediately upstream of putA. Interestingly, sequence and genetic analysis of the region upstream of the S. meliloti putA gene did not reveal such a putR locus or any other encoded transcriptional activator of putA. Furthermore, results obtained with an S. meliloti putA null mutation indicate the absence of any proline-responsive transcriptional activator and that PutA serves as an autogenous repressor. Therefore, the model of S. meliloti putA regulation completely diverges from that of its Rhizobiaceae relatives and resembles more that of enteric bacteria. However, some differences have been found with the latter model: (i) S. meliloti putA gene is not catabolite repressed, and (ii) the gene encoding for the major proline permease (putP) does not form part of an operon with the putA gene.

  15. Models of Aire-dependent gene regulation for thymic negative selection

    Directory of Open Access Journals (Sweden)

    Dina eDanso-Abeam

    2011-05-01

    Full Text Available Mutations in the Autoimmune Regulator (AIRE gene lead to Autoimmune Polyendocrinopathy Syndrome type 1 (APS1, characterized by the development of multi-organ autoimmune damage. The mechanism by which defects in AIRE result in autoimmunity has been the subject of intense scrutiny. At the cellular level, the working model explains most of the clinical and immunological characteristics of APS1, with AIRE driving the expression of tissue restricted antigens (TRAs in the epithelial cells of the thymic medulla. This TRA expression results in effective negative selection of TRA-reactive thymocytes, preventing autoimmune disease. At the molecular level, the mechanism by which AIRE initiates TRA expression in the thymic medulla remains unclear. Multiple different models for the molecular mechanism have been proposed, ranging from classical transcriptional activity, to random induction of gene expression, to epigenetic tag recognition effect, to altered cell biology. In this review, we evaluate each of these models and discuss their relative strengths and weaknesses.

  16. A framework for modelling gene regulation which accommodates non-equilibrium mechanisms.

    Science.gov (United States)

    Ahsendorf, Tobias; Wong, Felix; Eils, Roland; Gunawardena, Jeremy

    2014-12-05

    Gene regulation has, for the most part, been quantitatively analysed by assuming that regulatory mechanisms operate at thermodynamic equilibrium. This formalism was originally developed to analyse the binding and unbinding of transcription factors from naked DNA in eubacteria. Although widely used, it has made it difficult to understand the role of energy-dissipating, epigenetic mechanisms, such as DNA methylation, nucleosome remodelling and post-translational modification of histones and co-regulators, which act together with transcription factors to regulate gene expression in eukaryotes. Here, we introduce a graph-based framework that can accommodate non-equilibrium mechanisms. A gene-regulatory system is described as a graph, which specifies the DNA microstates (vertices), the transitions between microstates (edges) and the transition rates (edge labels). The graph yields a stochastic master equation for how microstate probabilities change over time. We show that this framework has broad scope by providing new insights into three very different ad hoc models, of steroid-hormone responsive genes, of inherently bounded chromatin domains and of the yeast PHO5 gene. We find, moreover, surprising complexity in the regulation of PHO5, which has not yet been experimentally explored, and we show that this complexity is an inherent feature of being away from equilibrium. At equilibrium, microstate probabilities do not depend on how a microstate is reached but, away from equilibrium, each path to a microstate can contribute to its steady-state probability. Systems that are far from equilibrium thereby become dependent on history and the resulting complexity is a fundamental challenge. To begin addressing this, we introduce a graph-based concept of independence, which can be applied to sub-systems that are far from equilibrium, and prove that history-dependent complexity can be circumvented when sub-systems operate independently. As epigenomic data become increasingly

  17. Differential regulation of the PGC family of genes in a mouse model of Staphylococcus aureus sepsis.

    Directory of Open Access Journals (Sweden)

    Timothy E Sweeney

    2010-07-01

    Full Text Available The PGC family of transcriptional co-activators (PGC-1alpha [Ppargc1a], PGC-1beta [Ppargc1b], and PRC [Pprc] coordinates the upregulation of mitochondrial biogenesis, and Ppargc1a is known to be activated in response to mitochondrial damage in sepsis. Therefore, we postulated that the PGC family is regulated by the innate immune system. We investigated whether mitochondrial biogenesis and PGC gene expression are disrupted in an established model of Staphylococcus aureus sepsis both in mice with impaired innate immune function (TLR2-/- and TLR4-/- and in wild-type controls. We found an early up-regulation of Ppargc1a and Ppargc1b post-infection (at 6 h in WT mice, but the expression of both genes was concordantly dysregulated in TLR2-/- mice (no increase at 6 h and in TLR4-/- mice (amplified at 6 h. However, the third family member, PRC, was regulated differently, and its expression increased significantly at 24 h in all three mouse strains (WT, TLR2-/-, and TLR4-/-. In silico analyses showed that Ppargc1a and Ppargc1b share binding sites for microRNA mmu-mir-202-3p. Thus, miRNA-mediated post-transcriptional mRNA degradation could account for the failure to increase the expression of both genes in TLR2-/- mice. The expression of mmu-mir-202-3p was measured by real-time PCR and found to be significantly increased in TLR2-/- but not in WT or TLR4-/- mice. In addition, it was found that mir-202-3p functionally decreases Ppargc1a mRNA in vitro. Thus, both innate immune signaling through the TLRs and mir-202-3p-mediated mRNA degradation are implicated in the co-regulation of Ppargc1a and Ppargc1b during inflammation. Moreover, the identification of mir-202-3p as a potential factor for Ppargc1a and Ppargc1b repression in acute inflammation may open new avenues for mitochondrial research and, potentially, therapy.

  18. Estradiol and progesterone exhibit similar patterns of hepatic gene expression regulation in the bovine model.

    Directory of Open Access Journals (Sweden)

    Carla A Piccinato

    Full Text Available Female sex steroid hormones, estradiol-17β (E2-17β and progesterone (P4 regulate reproductive function and gene expression in a broad range of tissues. Given the central role of the liver in regulating homeostasis including steroid hormone metabolism, we sought to understand how E2-17β and P4 interact to affect global gene expression in liver. Ovariectomized cows (n = 8 were randomly assigned to 4 treatment groups applied in a replicated Latin Square design: 1 No hormone supplementation, 2 E2-17β treatment (ear implant, 3 P4 treatment (intravaginal inserts, and 4 E2-17β combined with P4. After 14 d of treatment, liver biopsies were collected, allowing 28 d intervals between periods. Changes in gene expression in the liver biopsies were monitored using bovine-specific arrays. Treatment with E2-17β altered expression of 479 genes, P4 472 genes, and combined treatment significantly altered expression of 468 genes. In total, 578 genes exhibited altered expression including a remarkable number (346 genes that responded similarly to E2-17β, P4, or combined treatment. Additional evidence for similar gene expression actions of E2-17ß and/or P4 were: principal component analysis placed almost every treatment array at a substantial distance from controls; Venn diagrams indicated overall treatment effects for most regulated genes; clustering analysis indicated the two major clusters had all treatments up-regulating (172 genes or down-regulating (173 genes expression. Thus, unexpectedly, common biological pathways were regulated by E2-17β and/or P4 in liver. This indicates that the mechanism of action of these steroid hormones in the liver might be either indirect or might occur through non-genomic pathways. This unusual pattern of gene expression in response to steroid hormones is consistent with the idea that there are classical and non-classical tissue-specific responses to steroid hormone actions. Future studies are needed to elucidate

  19. MicroRNA 429 Regulates Mucin Gene Expression and Secretion in Murine Model of Colitis.

    Science.gov (United States)

    Mo, Ji-Su; Alam, Khondoker Jahengir; Kim, Hun-Soo; Lee, Young-Mi; Yun, Ki-Jung; Chae, Soo-Cheon

    2016-07-01

    miRNAs are non-coding RNAs that play important roles in the pathogenesis of human diseases by regulating target gene expression in specific cells or tissues. We aimed to detect miRNAs related to ulcerative colitis [UC], identify their target molecules, and analyse the correlation between the miRNAs and their target genes in colorectal cells and dextran sulphate sodium [DSS]-induced mouse colitis. UC-associated miRNAs were identified by miRNA microarray analysis using DSS-induced colitis and normal colon tissues. The results were validated by quantitative real-time polymerase chain reaction [RT-PCR]. We identified target genes of MIR429, a colitis-associated miRNA, from our screen by comparing the mRNA microarray analysis in MIR429-overexpressed cells with predicted candidate target genes. We constructed luciferase reporter plasmids to confirm the effect of MIR429 on target gene expression. The protein expression of the target genes was measured by western blot,enzyme-linked immunosorbent assay [ELISA] analysis, or immunohistochemistry. We identified 37 DSS-induced colitis associated miRNAs. We investigated MIR429 that is down-regulated in DSS-induced colitis, and identified 41 target genes of MIR429. We show that the myristoylated alanine-rich protein kinase C substrate [MARCKS] is a direct target of MIR429. MARCKS mRNA and protein expression levels are down-regulated by MIR429, and MIR429 regulates the expression of MARCKS and MARCKS-mediated mucin secretion in colorectal cells and DSS-induced colitis. In addition, anti-MIR429 up-regulates MARCKS expression in colorectal cell lines. Our findings suggest that MIR429 modulates mucin secretion in human colorectal cells and mouse colitis tissues by up-regulating of MARCKS expression, thereby making MIR429 a candidate for anti-colitis therapy in human UC. Copyright © 2016 European Crohn’s and Colitis Organisation (ECCO). Published by Oxford University Press. All rights reserved. For permissions, please email

  20. Hypothalamic gene expression of appetite regulators in a cancer-cachectic mouse model [Dataset 1

    NARCIS (Netherlands)

    Dwarkasing, Jvalini; Dijk, Francina J.; Boekschoten, Mark; Faber, Joyce; Argilès, Josep M.; Lavianio, Alessandro; Muller, Michael; Witkamp, Renger; Norren, van Klaske

    2013-01-01

    Appetite is frequently affected in cancer patients, leading to anorexia and consequently insufficient food intake. In this study, we report on hypothalamic gene expression profile of a cancer cachectic mouse model with increased food intake. In this model, mice bearing C26 colon adenocarcinoma have

  1. Hypothalamic gene expression of appetite regulators in a cancer-cachectic mouse model [Dataset 2

    NARCIS (Netherlands)

    Dwarkasing, Jvalini; Dijk, Francina J.; Boekschoten, Mark; Faber, Joyce; Argilès, Josep M.; Lavianio, Alessandro; Muller, Michael; Witkamp, Renger; Norren, van Klaske

    2013-01-01

    Appetite is frequently affected in cancer patients, leading to anorexia and consequently insufficient food intake. In this study, we report on hypothalamic gene expression profile of a cancer cachectic mouse model with increased food intake. In this model, mice bearing C26 colon adenocarcinoma have

  2. Identification of genes regulating migration and invasion using a new model of metastatic prostate cancer

    International Nuclear Information System (INIS)

    Banyard, Jacqueline; Chung, Ivy; Migliozzi, Matthew; Phan, Derek T; Wilson, Arianne M; Zetter, Bruce R; Bielenberg, Diane R

    2014-01-01

    Understanding the complex, multistep process of metastasis remains a major challenge in cancer research. Metastasis models can reveal insights in tumor development and progression and provide tools to test new intervention strategies. To develop a new cancer metastasis model, we used DU145 human prostate cancer cells and performed repeated rounds of orthotopic prostate injection and selection of subsequent lymph node metastases. Tumor growth, metastasis, cell migration and invasion were analyzed. Microarray analysis was used to identify cell migration- and cancer-related genes correlating with metastasis. Selected genes were silenced using siRNA, and their roles in cell migration and invasion were determined in transwell migration and Matrigel invasion assays. Our in vivo cycling strategy created cell lines with dramatically increased tumorigenesis and increased ability to colonize lymph nodes (DU145LN1-LN4). Prostate tumor xenografts displayed increased vascularization, enlarged podoplanin-positive lymphatic vessels and invasive margins. Microarray analysis revealed gene expression profiles that correlated with metastatic potential. Using gene network analysis we selected 3 significantly upregulated cell movement and cancer related genes for further analysis: EPCAM (epithelial cell adhesion molecule), ITGB4 (integrin β4) and PLAU (urokinase-type plasminogen activator (uPA)). These genes all showed increased protein expression in the more metastatic DU145-LN4 cells compared to the parental DU145. SiRNA knockdown of EpCAM, integrin-β4 or uPA all significantly reduced cell migration in DU145-LN4 cells. In contrast, only uPA siRNA inhibited cell invasion into Matrigel. This role of uPA in cell invasion was confirmed using the uPA inhibitors, amiloride and UK122. Our approach has identified genes required for the migration and invasion of metastatic tumor cells, and we propose that our new in vivo model system will be a powerful tool to interrogate the metastatic

  3. QB1 - Stochastic Gene Regulation

    Energy Technology Data Exchange (ETDEWEB)

    Munsky, Brian [Los Alamos National Laboratory

    2012-07-23

    Summaries of this presentation are: (1) Stochastic fluctuations or 'noise' is present in the cell - Random motion and competition between reactants, Low copy, quantization of reactants, Upstream processes; (2) Fluctuations may be very important - Cell-to-cell variability, Cell fate decisions (switches), Signal amplification or damping, stochastic resonances; and (3) Some tools are available to mode these - Kinetic Monte Carlo simulations (SSA and variants), Moment approximation methods, Finite State Projection. We will see how modeling these reactions can tell us more about the underlying processes of gene regulation.

  4. Dynamics of bacterial gene regulation

    Science.gov (United States)

    Narang, Atul

    2009-03-01

    The phenomenon of diauxic growth is a classical problem of bacterial gene regulation. The most well studied example of this phenomenon is the glucose-lactose diauxie, which occurs because the expression of the lac operon is strongly repressed in the presence of glucose. This repression is often explained by appealing to molecular mechanisms such as cAMP activation and inducer exclusion. I will begin by analyzing data showing that these molecular mechanisms cannot explain the strong lac repression because they exert a relatively weak effect. I will then present a minimal model accounting only for enzyme induction and dilution, which yields strong repression despite the absence of catabolite repression and inducer exclusion. The model also explains the growth patterns observed in batch and continuous cultures of various bacterial strains and substrate mixtures. The talk will conclude with a discussion of the experimental evidence regarding positive feedback, the key component of the minimal model.

  5. Regulation of eucaryotic gene expression

    Energy Technology Data Exchange (ETDEWEB)

    Brent, R.; Ptashne, M.S

    1989-05-23

    This patent describes a method of regulating the expression of a gene in a eucaryotic cell. The method consists of: providing in the eucaryotic cell, a peptide, derived from or substantially similar to a peptide of a procaryotic cell able to bind to DNA upstream from or within the gene, the amount of the peptide being sufficient to bind to the gene and thereby control expression of the gene.

  6. A Biophysical Model of CRISPR/Cas9 Activity for Rational Design of Genome Editing and Gene Regulation

    Science.gov (United States)

    Farasat, Iman; Salis, Howard M.

    2016-01-01

    The ability to precisely modify genomes and regulate specific genes will greatly accelerate several medical and engineering applications. The CRISPR/Cas9 (Type II) system binds and cuts DNA using guide RNAs, though the variables that control its on-target and off-target activity remain poorly characterized. Here, we develop and parameterize a system-wide biophysical model of Cas9-based genome editing and gene regulation to predict how changing guide RNA sequences, DNA superhelical densities, Cas9 and crRNA expression levels, organisms and growth conditions, and experimental conditions collectively control the dynamics of dCas9-based binding and Cas9-based cleavage at all DNA sites with both canonical and non-canonical PAMs. We combine statistical thermodynamics and kinetics to model Cas9:crRNA complex formation, diffusion, site selection, reversible R-loop formation, and cleavage, using large amounts of structural, biochemical, expression, and next-generation sequencing data to determine kinetic parameters and develop free energy models. Our results identify DNA supercoiling as a novel mechanism controlling Cas9 binding. Using the model, we predict Cas9 off-target binding frequencies across the lambdaphage and human genomes, and explain why Cas9’s off-target activity can be so high. With this improved understanding, we propose several rules for designing experiments for minimizing off-target activity. We also discuss the implications for engineering dCas9-based genetic circuits. PMID:26824432

  7. Functional models for large-scale gene regulation networks: realism and fiction.

    Science.gov (United States)

    Lagomarsino, Marco Cosentino; Bassetti, Bruno; Castellani, Gastone; Remondini, Daniel

    2009-04-01

    High-throughput experiments are shedding light on the topology of large regulatory networks and at the same time their functional states, namely the states of activation of the nodes (for example transcript or protein levels) in different conditions, times, environments. We now possess a certain amount of information about these two levels of description, stored in libraries, databases and ontologies. A current challenge is to bridge the gap between topology and function, i.e. developing quantitative models aimed at characterizing the expression patterns of large sets of genes. However, approaches that work well for small networks become impossible to master at large scales, mainly because parameters proliferate. In this review we discuss the state of the art of large-scale functional network models, addressing the issue of what can be considered as "realistic" and what the main limitations may be. We also show some directions for future work, trying to set the goals that future models should try to achieve. Finally, we will emphasize the possible benefits in the understanding of biological mechanisms underlying complex multifactorial diseases, and in the development of novel strategies for the description and the treatment of such pathologies.

  8. Differential expression of appetite-regulating genes in avian models of anorexia and obesity.

    Science.gov (United States)

    Yi, J; Yuan, J; Gilbert, E R; Siegel, P B; Cline, M A

    2017-08-01

    Chickens from lines that have been selected for low (LWS) or high (HWS) juvenile body weight for more than 57 generations provide a unique model by which to research appetite regulation. The LWS display different severities of anorexia, whereas all HWS become obese. In the present study, we measured mRNA abundance of various factors in appetite-associated nuclei in the hypothalamus. The lateral hypothalamus (LHA), paraventricular nucleus (PVN), ventromedial hypothalamus (VMH), dorsomedial nucleus (DMN) and arcuate nucleus (ARC) were collected from 5 day-old chicks that were fasted for 180 minutes or provided with continuous access to food. Fasting increased neuropeptide Y receptor subtype 1 (NPYR1) mRNA in the LHA and c-Fos in the VMH, at the same time as decreasing c-Fos in the LHA, neuropeptide Y receptor subtype 5 and ghrelin in the PVN, and neuropeptide Y receptor subtype 2 in the ARC. Fasting increased melanocortin receptor subtype 3 (MC3R) expression in the DMN and NPY in the ARC of LWS but not HWS chicks. Expression of NPY was greater in LWS than HWS in the DMN. neuropeptide Y receptor subtype 5 mRNA was greater in LWS than HWS in the LHA, PVN and ARC. Expression of orexin was greater in LWS than HWS in the LHA. There was greater expression of NPYR1, melanocortin receptor subtype 4 and cocaine- and amphetamine-regulated transcript in HWS than LWS and mesotocin in LWS than HWS in the PVN. In the ARC, agouti-related peptide and MC3R were greater in LWS than HWS and, in the VMH, orexin receptor 2 and leptin receptor were greater in LWS than HWS. Greater mesotocin in the PVN, orexin in the LHA and ORXR2 in the VMH of LWS may contribute to their increased sympathetic tone and anorexic phenotype. The results of the present study also suggest that an increased hypothalamic anorexigenic tone in the LWS over-rides orexigenic factors such as NPY and AgRP that were more highly expressed in LWS than HWS in several nuclei. Published 2017. This article is a U

  9. Sinorhizobium meliloti putA Gene Regulation: a New Model within the Family Rhizobiaceae

    OpenAIRE

    Soto, María José; Jiménez-Zurdo, José Ignacio; van Dillewijn, Pieter; Toro, Nicolás

    2000-01-01

    Proline dehydrogenase (PutA) is a bifunctional enzyme that catalyzes the oxidation of proline to glutamate. In Sinorhizobium meliloti, as in other microorganisms, the putA gene is transcriptionally activated in response to proline. In Rhodobacter capsulatus, Agrobacterium, and most probably in Bradyrhizobium, this activation is dependent on an Lrp-like protein encoded by the putR gene, located immediately upstream of putA. Interestingly, sequence and genetic analysis of the region upstream of...

  10. The use of a hands-on model in learning the regulation of an inducible operon and the development of a gene regulation concept inventory

    Science.gov (United States)

    Stefanski, Katherine M.

    A central concept in genetics is the regulation of gene expression. Inducible gene expression is often taught in undergraduate biology courses using the lac operon of Escherichia coli (E. coli ). With national calls for reform in undergraduate biology education and a body of literature that supports the use of active learning techniques including hands-on learning and analogies we were motivated to develop a hands-on analogous model of the lac operon. The model was developed over two iterations and was administered to genetics students. To determine the model's worth as a learning tool a concept inventory (CI) was developed using rigorous protocols. Concept inventories are valuable tools which can be used to assess students' understanding of a topic and pinpoint commonly held misconceptions as well as the value of educational tools. Through in-class testing (n =115) the lac operon concept inventory (LOCI) was demonstrated to be valid, predictive, and reliable (? coefficient = 0.994). LOCI scores for students who participated in the hands-on activity (n = 67) were 7.5% higher (t = -2.281, P operon. We were able to determine the efficacy of the activity and identify misconceptions held by students about the lac operon because of the use of a valid and reliable CI.

  11. Gene regulation by growth factors

    International Nuclear Information System (INIS)

    Metz, R.; Gorham, J.; Siegfried, Z.; Leonard, D.; Gizang-Ginsberg, E.; Thompson, M.A.; Lawe, D.; Kouzarides, T.; Vosatka, R.; MacGregor, D.; Jamal, S.; Greenberg, M.E.; Ziff, E.B.

    1988-01-01

    To coordinate the proliferation and differentiation of diverse cell types, cells of higher eukaryotes communicate through the release of growth factors. These peptides interact with specific transmembrane receptors of other cells and thereby generate intracellular messengers. The many changes in cellular physiology and activity that can be induced by growth factors imply that growth factor-induced signals can reach the nucleus and control gene activity. Moreover, current evidence also suggests that unregulated signaling along such pathways can induce aberrant proliferation and the formation of tumors. This paper reviews investigations of growth factor regulation of gene expression conducted by the authors' laboratory

  12. The neuronal ceroid lipofuscinosis Cln8 gene expression is developmentally regulated in mouse brain and up-regulated in the hippocampal kindling model of epilepsy

    Directory of Open Access Journals (Sweden)

    Kuronen Mervi

    2005-04-01

    Full Text Available Abstract Background The neuronal ceroid lipofuscinoses (NCLs are a group of inherited neurodegenerative disorders characterized by accumulation of autofluorescent material in many tissues, especially in neurons. Mutations in the CLN8 gene, encoding an endoplasmic reticulum (ER transmembrane protein of unknown function, underlie NCL phenotypes in humans and mice. The human phenotype is characterized by epilepsy, progressive psychomotor deterioration and visual loss, while motor neuron degeneration (mnd mice with a Cln8 mutation show progressive motor neuron dysfunction and retinal degeneration. Results We investigated spatial and temporal expression of Cln8 messenger ribonucleic acid (mRNA using in situ hybridization, reverse transcriptase polymerase chain reaction (RT-PCR and northern blotting. Cln8 is ubiquitously expressed at low levels in embryonic and adult tissues. In prenatal embryos Cln8 is most prominently expressed in the developing gastrointestinal tract, dorsal root ganglia (DRG and brain. In postnatal brain the highest expression is in the cortex and hippocampus. Expression of Cln8 mRNA in the central nervous system (CNS was also analyzed in the hippocampal electrical kindling model of epilepsy, in which Cln8 expression was rapidly up-regulated in hippocampal pyramidal and granular neurons. Conclusion Expression of Cln8 in the developing and mature brain suggests roles for Cln8 in maturation, differentiation and supporting the survival of different neuronal populations. The relevance of Cln8 up-regulation in hippocampal neurons of kindled mice should be further explored.

  13. [Quercetin regulates cell cycle-related gene expression in a model of glucose-oxygen deprivation in astrocytes].

    Science.gov (United States)

    Yao, Fang; Zhang, Lanlan; Yuan, Zhaohu; Zeng, Yong; Wu, Bingyi

    2013-09-01

    To study the effect of quercetin on gene expression in astrocytes after glucose-oxygen deprivation and the underlying mechanism. The primary cultured astrocytes were randomly divided into glucose-oxygen deprivation group (only treated with glucose-oxygen deprivation for 4 hours) and glucose-oxygen deprivation combined with quercetin-treated group (glucose-oxygen deprivation for 4 hours combined with quercetin treatment for 24 hours). Their mRNA expressions were analyzed by the large-scale oligo microarray. The differential genes obtained were further confirmed by real-time quantitative PCR (qRT-PCR). Compared with the glucose-oxygen deprivation group, the glucose-oxygen deprivation combined with quercetin-treated group presented the changes in the expressions of 31 genes that were related to cell cycle, of which 5 genes were up-regulated and 26 were down-regulated. Six of those differential genes were confirmed by qRT-PCR and the result of their differential expressions was consistent with that by large-scale oligo microarray. Quercetin can regulate some of cell cycle-related genes in astrocytes after glucose-oxygen deprivation.

  14. Genome-wide Analysis of Gene Regulation

    DEFF Research Database (Denmark)

    Chen, Yun

    cells are capable of regulating their gene expression, so that each cell can only express a particular set of genes yielding limited numbers of proteins with specialized functions. Therefore a rigid control of differential gene expression is necessary for cellular diversity. On the other hand, aberrant...... gene regulation will disrupt the cell’s fundamental processes, which in turn can cause disease. Hence, understanding gene regulation is essential for deciphering the code of life. Along with the development of high throughput sequencing (HTS) technology and the subsequent large-scale data analysis......, genome-wide assays have increased our understanding of gene regulation significantly. This thesis describes the integration and analysis of HTS data across different important aspects of gene regulation. Gene expression can be regulated at different stages when the genetic information is passed from gene...

  15. Microarray analysis of androgen-regulated gene expression in testis: the use of the androgen-binding protein (ABP-transgenic mouse as a model

    Directory of Open Access Journals (Sweden)

    Grossman Gail

    2005-12-01

    Full Text Available Abstract Background Spermatogenesis is an androgen-dependent process, yet the molecular mechanisms of androgens' actions in testis are poorly understood. Transgenic mice overexpressing rat androgen-binding protein (ABP in their testes have reduced levels of intratesticular androgens and, as a result, show a progressive impairment of spermatogenesis. We used this model to characterize changes in global gene expression in testis in response to reduced bioavailability of androgens. Methods Total RNA was extracted from testes of 30-day old transgenic and wild-type control mice, converted to cRNA, labeled with biotin, and hybridized to oligonucleotide microarrays. Microarray results were confirmed by real-time reverse transcription polymerase chain reaction. Results Three-hundred-eighty-one genes (3.05% of all transcripts represented on the chips were up-regulated and 198 genes (1.59% were down-regulated by at least a factor of 2 in the androgen-deficient animals compared to controls. Genes encoding membrane proteins, intracellular signaling molecules, enzymes, proteins participating in the immune response, and those involved in cytoskeleton organization were significantly overrepresented in the up-regulated group. Among the down-regulated transcripts, those coding for extracellular proteins were overrepresented most dramatically, followed by those related to proteolysis, cell adhesion, immune response, and growth factor, cytokine, and ion channel activities. Transcripts with the greatest potential impact on cellular activities included several transcription factors, intracellular signal transducers, secreted signaling molecules and enzymes, and various cell surface molecules. Major nodes in the up-regulated network were IL-6, AGT, MYC, and A2M, those in the down-regulated network were IL-2, -4, and -10, MAPK8, SOCS1, and CREB1. Conclusion Microarray analysis followed by gene ontology profiling and connectivity analysis identified several functional

  16. Identification of genes potentially regulated by human polynucleotide phosphorylase (hPNPase old-35 using melanoma as a model.

    Directory of Open Access Journals (Sweden)

    Upneet K Sokhi

    Full Text Available Human Polynucleotide Phosphorylase (hPNPase(old-35 or PNPT1 is an evolutionarily conserved 3'→ 5' exoribonuclease implicated in the regulation of numerous physiological processes including maintenance of mitochondrial homeostasis, mtRNA import and aging-associated inflammation. From an RNase perspective, little is known about the RNA or miRNA species it targets for degradation or whose expression it regulates; except for c-myc and miR-221. To further elucidate the functional implications of hPNPase(old-35 in cellular physiology, we knocked-down and overexpressed hPNPase(old-35 in human melanoma cells and performed gene expression analyses to identify differentially expressed transcripts. Ingenuity Pathway Analysis indicated that knockdown of hPNPase(old-35 resulted in significant gene expression changes associated with mitochondrial dysfunction and cholesterol biosynthesis; whereas overexpression of hPNPase(old-35 caused global changes in cell-cycle related functions. Additionally, comparative gene expression analyses between our hPNPase(old-35 knockdown and overexpression datasets allowed us to identify 77 potential "direct" and 61 potential "indirect" targets of hPNPase(old-35 which formed correlated networks enriched for cell-cycle and wound healing functional association, respectively. These results provide a comprehensive database of genes responsive to hPNPase(old-35 expression levels; along with the identification new potential candidate genes offering fresh insight into cellular pathways regulated by PNPT1 and which may be used in the future for possible therapeutic intervention in mitochondrial- or inflammation-associated disease phenotypes.

  17. Comparative Analysis of Muscle Hypertrophy Models Reveals Divergent Gene Transcription Profiles and Points to Translational Regulation of Muscle Growth through Increased mTOR Signaling

    Directory of Open Access Journals (Sweden)

    Marcelo G. Pereira

    2017-12-01

    Full Text Available Skeletal muscle mass is a result of the balance between protein breakdown and protein synthesis. It has been shown that multiple conditions of muscle atrophy are characterized by the common regulation of a specific set of genes, termed atrogenes. It is not known whether various models of muscle hypertrophy are similarly regulated by a common transcriptional program. Here, we characterized gene expression changes in three different conditions of muscle growth, examining each condition during acute and chronic phases. Specifically, we compared the transcriptome of Extensor Digitorum Longus (EDL muscles collected (1 during the rapid phase of postnatal growth at 2 and 4 weeks of age, (2 24 h or 3 weeks after constitutive activation of AKT, and (3 24 h or 3 weeks after overload hypertrophy caused by tenotomy of the Tibialis Anterior muscle. We observed an important overlap between significantly regulated genes when comparing each single condition at the two different timepoints. Furthermore, examining the transcriptional changes occurring 24 h after a hypertrophic stimulus, we identify an important role for genes linked to a stress response, despite the absence of muscle damage in the AKT model. However, when we compared all different growth conditions, we did not find a common transcriptional fingerprint. On the other hand, all conditions showed a marked increase in mTORC1 signaling and increased ribosome biogenesis, suggesting that muscle growth is characterized more by translational, than transcriptional regulation.

  18. Limb development: a paradigm of gene regulation.

    Science.gov (United States)

    Petit, Florence; Sears, Karen E; Ahituv, Nadav

    2017-04-01

    The limb is a commonly used model system for developmental biology. Given the need for precise control of complex signalling pathways to achieve proper patterning, the limb is also becoming a model system for gene regulation studies. Recent developments in genomic technologies have enabled the genome-wide identification of regulatory elements that control limb development, yielding insights into the determination of limb morphology and forelimb versus hindlimb identity. The modulation of regulatory interactions - for example, through the modification of regulatory sequences or chromatin architecture - can lead to morphological evolution, acquired regeneration capacity or limb malformations in diverse species, including humans.

  19. Down-regulation of selected Blood-brain Barrier Specific Genes from Capillaries to Bovine In Vitro Models

    DEFF Research Database (Denmark)

    Goldeman, Charlotte; Saaby, Lasse; Brodin, Birger

    Cultures of primary bovine brain endothelial cells (BECs) grown, often together with astrocytes, on permeable supports in two-compartment culture systems are commonly used as an in vitro model of the blood-brain barrier (BBB). While trans-endothelial electrical resistance, restriction...... the in vivo gene expression of brain capillary endothelial cells. Primary bovine endothelial cells and rat astrocytes were cultured in different culture configurations and the mRNA expression of selected genes (vWF, Glut-1, P-gp, claudin-1,-5, occludin, JAM-1, LAT-1, SLC16A1, MRP-1,-4, BCRP, ZO-1, AP, TPA...

  20. QTLminer: identifying genes regulating quantitative traits

    Directory of Open Access Journals (Sweden)

    Schughart Klaus

    2010-10-01

    Full Text Available Abstract Background Quantitative trait locus (QTL mapping identifies genomic regions that likely contain genes regulating a quantitative trait. However, QTL regions may encompass tens to hundreds of genes. To find the most promising candidate genes that regulate the trait, the biologist typically collects information from multiple resources about the genes in the QTL interval. This process is very laborious and time consuming. Results QTLminer is a bioinformatics tool that automatically performs QTL region analysis. It is available in GeneNetwork and it integrates information such as gene annotation, gene expression and sequence polymorphisms for all the genes within a given genomic interval. Conclusions QTLminer substantially speeds up discovery of the most promising candidate genes within a QTL region.

  1. Investigation of Endogenous Retrovirus Sequences in the Neighborhood of Genes Up-regulated in a Neuroblastoma Model after Treatment with Hypoxia-Mimetic Cobalt Chloride.

    Science.gov (United States)

    Brütting, Christine; Narasimhan, Harini; Hoffmann, Frank; Kornhuber, Malte E; Staege, Martin S; Emmer, Alexander

    2018-01-01

    Human endogenous retroviruses (ERVs) have been found to be associated with different diseases, e.g., multiple sclerosis (MS). Most human ERVs integrated in our genome are not competent to replicate and these sequences are presumably silent. However, transcription of human ERVs can be reactivated, e.g., by hypoxia. Interestingly, MS has been linked to hypoxia since decades. As some patterns of demyelination are similar to white matter ischemia, hypoxic damage is discussed. Therefore, we are interested in the association between hypoxia and ERVs. As a model, we used human SH-SY5Y neuroblastoma cells after treatment with the hypoxia-mimetic cobalt chloride and analyzed differences in the gene expression profiles in comparison to untreated cells. The vicinity of up-regulated genes was scanned for endogenous retrovirus-derived sequences. Five genes were found to be strongly up-regulated in SH-SY5Y cells after treatment with cobalt chloride: clusterin, glutathione peroxidase 3, insulin-like growth factor 2, solute carrier family 7 member 11, and neural precursor cell expressed developmentally down-regulated protein 9. In the vicinity of these genes we identified large (>1,000 bp) open reading frames (ORFs). Most of these ORFs showed only low similarities to proteins from retro-transcribing viruses. However, we found very high similarity between retrovirus envelope sequences and a sequence in the vicinity of neural precursor cell expressed developmentally down-regulated protein 9. This sequence encodes the human endogenous retrovirus group FRD member 1, the encoded protein product is called syncytin 2. Transfection of syncytin 2 into the well-characterized Ewing sarcoma cell line A673 was not able to modulate the low immunostimulatory activity of this cell line. Future research is needed to determine whether the identified genes and the human endogenous retrovirus group FRD member 1 might play a role in the etiology of MS.

  2. Identification of let-7-regulated oncofetal genes

    DEFF Research Database (Denmark)

    Boyerinas, Benjamin; Park, Sun-Mi; Shomron, Noam

    2008-01-01

    -regulated at the end of embryonic development. Let-7 is often down-regulated early during cancer development, suggesting that let-7-regulated oncofetal genes (LOG) may become reexpressed in cancer cells. Using comparative bioinformatics, we have identified 12 conserved LOGs that include HMGA2 and IMP-1/CRD-BP. IMP-1...

  3. Mining significant high utility gene regulation sequential patterns.

    Science.gov (United States)

    Zihayat, Morteza; Davoudi, Heidar; An, Aijun

    2017-12-14

    Mining frequent gene regulation sequential patterns in time course microarray datasets is an important mining task in bioinformatics. Although finding such patterns are of paramount important for studying a disease, most existing work do not consider gene-disease association during gene regulation sequential pattern discovery. Moreover, they consider more absent/existence effects of genes during the mining process than taking the degrees of genes expression into account. Consequently, such techniques discover too many patterns which may not represent important information to biologists to investigate the relationships between the disease and underlying reasons hidden in gene regulation sequences. We propose a utility model by considering both the gene-disease association score and their degrees of expression levels under a biological investigation. We propose an efficient method called Top-HUGS, for discoverying significant high utility gene regulation sequential patterns from a time-course microarray dataset. In this study, the proposed methods were evaluated on a publicly available time course microarray dataset. The experimental results show higher accuracies compared to the baseline methods. Our proposed methods found that several new gene regulation sequential patterns involved in such patterns were useful for biologists and provided further insights into the mechanisms underpinning biological processes. To effectively work with the proposed method, a web interface is developed to our system using Java. To the best of our knowledge, this is the first demonstration for significant high utility gene regulation sequential pattern discovery.

  4. Discovering Genes Essential to the Hypothalamic Regulation of Human Reproduction Using a Human Disease Model: Adjusting to Life in the "-Omics" Era.

    Science.gov (United States)

    Stamou, M I; Cox, K H; Crowley, William F

    2016-02-01

    The neuroendocrine regulation of reproduction is an intricate process requiring the exquisite coordination of an assortment of cellular networks, all converging on the GnRH neurons. These neurons have a complex life history, migrating mainly from the olfactory placode into the hypothalamus, where GnRH is secreted and acts as the master regulator of the hypothalamic-pituitary-gonadal axis. Much of what we know about the biology of the GnRH neurons has been aided by discoveries made using the human disease model of isolated GnRH deficiency (IGD), a family of rare Mendelian disorders that share a common failure of secretion and/or action of GnRH causing hypogonadotropic hypogonadism. Over the last 30 years, research groups around the world have been investigating the genetic basis of IGD using different strategies based on complex cases that harbor structural abnormalities or single pleiotropic genes, endogamous pedigrees, candidate gene approaches as well as pathway gene analyses. Although such traditional approaches, based on well-validated tools, have been critical to establish the field, new strategies, such as next-generation sequencing, are now providing speed and robustness, but also revealing a surprising number of variants in known IGD genes in both patients and healthy controls. Thus, before the field moves forward with new genetic tools and continues discovery efforts, we must reassess what we know about IGD genetics and prepare to hold our work to a different standard. The purpose of this review is to: 1) look back at the strategies used to discover the "known" genes implicated in the rare forms of IGD; 2) examine the strengths and weaknesses of the methodologies used to validate genetic variation; 3)substantiate the role of known genes in the pathophysiology of the disease; and 4) project forward as we embark upon a widening use of these new and powerful technologies for gene discovery. (Endocrine Reviews 36: 603-621, 2015).

  5. Discovering Genes Essential to the Hypothalamic Regulation of Human Reproduction Using a Human Disease Model: Adjusting to Life in the “-Omics” Era

    Science.gov (United States)

    Stamou, M. I.; Cox, K. H.

    2015-01-01

    The neuroendocrine regulation of reproduction is an intricate process requiring the exquisite coordination of an assortment of cellular networks, all converging on the GnRH neurons. These neurons have a complex life history, migrating mainly from the olfactory placode into the hypothalamus, where GnRH is secreted and acts as the master regulator of the hypothalamic-pituitary-gonadal axis. Much of what we know about the biology of the GnRH neurons has been aided by discoveries made using the human disease model of isolated GnRH deficiency (IGD), a family of rare Mendelian disorders that share a common failure of secretion and/or action of GnRH causing hypogonadotropic hypogonadism. Over the last 30 years, research groups around the world have been investigating the genetic basis of IGD using different strategies based on complex cases that harbor structural abnormalities or single pleiotropic genes, endogamous pedigrees, candidate gene approaches as well as pathway gene analyses. Although such traditional approaches, based on well-validated tools, have been critical to establish the field, new strategies, such as next-generation sequencing, are now providing speed and robustness, but also revealing a surprising number of variants in known IGD genes in both patients and healthy controls. Thus, before the field moves forward with new genetic tools and continues discovery efforts, we must reassess what we know about IGD genetics and prepare to hold our work to a different standard. The purpose of this review is to: 1) look back at the strategies used to discover the “known” genes implicated in the rare forms of IGD; 2) examine the strengths and weaknesses of the methodologies used to validate genetic variation; 3) substantiate the role of known genes in the pathophysiology of the disease; and 4) project forward as we embark upon a widening use of these new and powerful technologies for gene discovery. PMID:26394276

  6. Trasferrin receptor 2 gene regulation by microRNA 221 in SH-SY5Y cells treated with MPP⁺ as Parkinson's disease cellular model.

    Science.gov (United States)

    Asci, Roberta; Vallefuoco, Fara; Andolfo, Immacolata; Bruno, Mariasole; De Falco, Luigia; Iolascon, Achille

    2013-11-01

    Parkinson's disease (PD) is one of the most frequent human neurodegenerations. The neurodegeneration in PD is related to cellular iron increase but the mechanisms involved in iron accumulation remain unclear. Transferrin receptor type 2 (TFR2) is a protein expressed on cell membrane and involved in the cellular iron uptake. We hypothesized that microRNA 221 could regulate the expression of TfR2 in an in vitro model of Parkinson's disease, SH-SY5Y cells treated with MPP⁺. The miRNA 221 was selected by in silico analysis of several miRNAs predicted to target the TFR2 gene in SHSY5Y cells treated with MPP⁺. Taqman miRNA assay was used to evaluate the expression of the selected miRNAs. Using a luciferase assay we demonstrated the inhibition of TFR2 by miRNA 221. We show that in PD cellular model, TFR2 expression is regulated by miRNA 221. TFR2 and miR 221 are inversely correlated in SHSY5Y cells during the treatment with MPP⁺. Moreover, overexpression of miRNA 221 decreases the expression of TFR2, respectively, at the mRNA and protein levels. The inhibition of endogenous miRNA 221 also is able to regulate TFR2. These data suggest that miRNA 221 regulate TFR2 in PD model. Copyright © 2013 Elsevier Ireland Ltd and the Japan Neuroscience Society. All rights reserved.

  7. Generation of a double binary transgenic zebrafish model to study myeloid gene regulation in response to oncogene activation in melanocytes.

    Science.gov (United States)

    Kenyon, Amy; Gavriouchkina, Daria; Zorman, Jernej; Chong-Morrison, Vanessa; Napolitani, Giorgio; Cerundolo, Vincenzo; Sauka-Spengler, Tatjana

    2018-04-06

    A complex network of inflammatory genes is closely linked to somatic cell transformation and malignant disease. Immune cells and their associated molecules are responsible for detecting and eliminating cancer cells as they establish themselves as the precursors of a tumour. By the time a patient has a detectable solid tumour, cancer cells have escaped the initial immune response mechanisms. Here, we describe the development of a double binary zebrafish model that enables regulatory programming of the myeloid cells as they respond to oncogene-activated melanocytes to be explored, focussing on the initial phase when cells become the precursors of cancer. A hormone-inducible binary system allows for temporal control of expression of different Ras oncogenes ( NRas Q61K , HRas G12V and KRas G12V ) in melanocytes, leading to proliferation and changes in morphology of the melanocytes. This model was coupled to binary cell-specific biotagging models allowing in vivo biotinylation and subsequent isolation of macrophage or neutrophil nuclei for regulatory profiling of their active transcriptomes. Nuclear transcriptional profiling of neutrophils, performed as they respond to the earliest precursors of melanoma in vivo , revealed an intricate landscape of regulatory factors that may promote progression to melanoma, including Serpinb1l4, Fgf1, Fgf6, Cathepsin H, Galectin 1 and Galectin 3. The model presented here provides a powerful platform to study the myeloid response to the earliest precursors of melanoma. © 2018. Published by The Company of Biologists Ltd.

  8. Divergent regulation of Arabidopsis SAUR genes

    NARCIS (Netherlands)

    Mourik, van Hilda; Dijk, van Aalt D.J.; Stortenbeker, Niek; Angenent, Gerco C.; Bemer, Marian

    2017-01-01

    Background: Small Auxin-Upregulated RNA (SAUR) genes encode growth regulators that induce cell elongation. Arabidopsis contains more than 70 SAUR genes, of which the growth-promoting function has been unveiled in seedlings, while their role in other tissues remained largely unknown. Here, we

  9. A new model involving ethylene, nitric oxide and Fe to explain the regulation of Fe-acquisition genes in Strategy I plants.

    Science.gov (United States)

    García, María J; Suárez, Vicente; Romera, Francisco J; Alcántara, Esteban; Pérez-Vicente, Rafael

    2011-05-01

    In previous work it has been shown that both ethylene and NO (nitric oxide) participate in a similar way in the up-regulation of several Fe-acquisition genes of Arabidopsis and other Strategy I plants. This raises the question as to whether NO acts through ethylene or ethylene acts through NO, or whether both act in conjunction. One possibility is that NO could increase ethylene production. Conversely, ethylene could increase NO production. By using Arabidopsis and cucumber plants, we have found that both possibilities occur: NO greatly induces the expression in roots of genes involved in ethylene synthesis: AtSAM1, AtSAM2, AtACS4, AtACS6, AtACO1, AtACO2, AtMTK; CsACS2 and CsACO2; on the other hand, ethylene greatly enhances NO production in the subapical region of the roots. These results suggest that each substance influences the production of the other and that both substances could be necessary for up-regulation of Fe-acquisition genes. This has been further confirmed in experiments with simultaneous application of the NO donor GSNO (S-nitrosoglutathione) and ethylene inhibitors; or with simultaneous application of the ethylene precursor ACC (1-aminocyclopropane-1-carboxylic acid) and an NO scavenger. Both GSNO and ACC enhanced ferric reductase activity in control plants, but not in those plants simultaneously treated with the ethylene inhibitors or the NO scavenger, respectively. To explain all these results and previous ones we have proposed a new model involving ethylene, NO, and Fe in the up-regulation of Fe-acquisition genes of Strategy I plants. Copyright © 2011 Elsevier Masson SAS. All rights reserved.

  10. Small RNA regulation of rice homeobox genes.

    Science.gov (United States)

    Jain, Mukesh; Khurana, Jitendra P

    2008-11-01

    Recently, we reported the genome-wide identification of 107 homeobox genes in rice and classified them into ten distinct subfamilies based upon their domain composition and phylogenetic analysis. Microarray analysis revealed the tissue-specific and overlapping expression profiles of these genes during various stages of floral transition, panicle development and seed set. Several homeobox genes were also found to be differentially expressed under abiotic stress conditions. Based on massively parallel signature sequencing (MPSS) data analysis, we report here that a large number of small RNA signatures are associated with rice homeobox genes, which may be involved in their tissue-specific/developmental regulation and stress responses. The association of a very large number of small RNA signatures suggested an unusually high degree of regulation of homeobox genes by small RNAs during inflorescence development.

  11. Gene regulation by steroid hormones III

    Energy Technology Data Exchange (ETDEWEB)

    Roy, A.K.; Clark, J.H.

    1987-01-01

    In this book, the authors discuss the latest advances in molecular endocrinology: - steroid receptor binding to DNA sequences of hormonally controlled genes, - structure of genes controlled by steroid hormones, - heterogeneity of steroid receptors, - immunochemical approaches to receptor studies, and - the most recent approaches to steroid hormone action and biological response. The Contents discussed are: Biochemical Evidence for the Exclusive Nuclear Localization of the Estrogen Receptor. - Structure, Dynamics, and Cloning of the Estrogen Receptor. - Structure, Dynamics, and Cloning of the Estrogen Receptor - Physical and Functional Parameters of Isolated Estrogen Receptor - Type II Binding Sites: Cellular Origin and an Endogeneous Ligand. - The Two Phosphorylation Reactions of the Progesterone Receptor. - Receptor Mediated Action of the Vitamin D Hormone. - Characterization of the Nuclear Binding Sites (Acceptor Sites) for a Steroid Receptor. Antibodies in Estrogen, Progesterone, Glucocorticoid, Vitamin D Receptors and Autoantibodies to Antrogene Receptor. - Isolation and Characterization of cDNA probes for Human CBG and Rat ABP. Ornithine Decarboxy lase mRNAs in Murine Kidney: Structure and Regulation by Androgens - Glucocorticoid Receptors and the Control of Gene Expression. - Activation and Regulation of the Vitellogenin Gene Family. - Intra- and Intercellular Aspects of the Hormonal Regulation of the ..cap alpha..2..mu.. Globulin Gene Expression. - Hormonal Regulation of Sexually Differentiated Isozymes of Cytochrome P-450 in Rat Liver. - Interaction of Thyroid Hormone and Carbohydrates on Hepatic Gene Expression.

  12. Combined exposure to Maneb and Paraquat alters transcriptional regulation of neurogenesis-related genes in mice models of Parkinson’s disease

    Directory of Open Access Journals (Sweden)

    Desplats Paula

    2012-09-01

    Full Text Available Abstract Background Parkinson's disease (PD is a multifactorial disease where environmental factors act on genetically predisposed individuals. Although only 5% of PD manifestations are associated with specific mutations, majority of PD cases are of idiopathic origin, where environment plays a prominent role. Concurrent exposure to Paraquat (PQ and Maneb (MB in rural workers increases the risk for PD and exposure of adult mice to MB/PQ results in dopamine fiber loss and decreased locomotor activity. While PD is characterized by neuronal loss in the substantia nigra, we previously showed that accumulation of α-synuclein in the limbic system contributes to neurodegeneration by interfering with adult neurogenesis. Results We investigated the effect of pesticides on adult hippocampal neurogenesis in two transgenic models: Line 61, expressing the human wild type SNCA gene and Line LRRK2(G2019S, expressing the human LRRK2 gene with the mutation G2019S. Combined exposure to MB/PQ resulted in significant reduction of neuronal precursors and proliferating cells in non-transgenic animals, and this effect was increased in transgenic mice, in particular for Line 61, suggesting that α-synuclein accumulation and environmental toxins have a synergistic effect. We further investigated the transcription of 84 genes with direct function on neurogenesis. Overexpresion of α-synuclein resulted in the downregulation of 12% of target genes, most of which were functionally related to cell differentiation, while LRRK2 mutation had a minor impact on gene expression. MB/PQ also affected transcription in non-transgenic backgrounds, but when transgenic mice were exposed to the pesticides, profound alterations in gene expression affecting 27% of the studied targets were observed in both transgenic lines. Gene enrichment analysis showed that 1:3 of those genes were under the regulation of FoxF2 and FoxO3A, suggesting a primary role of these proteins in the response to

  13. Identification of Human HK Genes and Gene Expression Regulation Study in Cancer from Transcriptomics Data Analysis

    Science.gov (United States)

    Zhang, Zhang; Liu, Jingxing; Wu, Jiayan; Yu, Jun

    2013-01-01

    The regulation of gene expression is essential for eukaryotes, as it drives the processes of cellular differentiation and morphogenesis, leading to the creation of different cell types in multicellular organisms. RNA-Sequencing (RNA-Seq) provides researchers with a powerful toolbox for characterization and quantification of transcriptome. Many different human tissue/cell transcriptome datasets coming from RNA-Seq technology are available on public data resource. The fundamental issue here is how to develop an effective analysis method to estimate expression pattern similarities between different tumor tissues and their corresponding normal tissues. We define the gene expression pattern from three directions: 1) expression breadth, which reflects gene expression on/off status, and mainly concerns ubiquitously expressed genes; 2) low/high or constant/variable expression genes, based on gene expression level and variation; and 3) the regulation of gene expression at the gene structure level. The cluster analysis indicates that gene expression pattern is higher related to physiological condition rather than tissue spatial distance. Two sets of human housekeeping (HK) genes are defined according to cell/tissue types, respectively. To characterize the gene expression pattern in gene expression level and variation, we firstly apply improved K-means algorithm and a gene expression variance model. We find that cancer-associated HK genes (a HK gene is specific in cancer group, while not in normal group) are expressed higher and more variable in cancer condition than in normal condition. Cancer-associated HK genes prefer to AT-rich genes, and they are enriched in cell cycle regulation related functions and constitute some cancer signatures. The expression of large genes is also avoided in cancer group. These studies will help us understand which cell type-specific patterns of gene expression differ among different cell types, and particularly for cancer. PMID:23382867

  14. Gene regulation by dietary microRNAs.

    Science.gov (United States)

    Zempleni, Janos; Baier, Scott R; Howard, Katherine M; Cui, Juan

    2015-12-01

    MicroRNAs (miRNAs) silence genes through destabilizing mRNA or preventing translation of mRNA, thereby playing an essential role in gene silencing. Traditionally, miRNAs have been considered endogenous regulators of genes, i.e., miRNAs synthesized by an organism regulate the genes in that organism. Recently, that dogma has been challenged in studies suggesting that food-borne miRNAs are bioavailable and affect gene expression in mice and humans. While the evidence in support of this theory may be considered weak for miRNAs that originate in plants, there is compelling evidence to suggest that humans use bovine miRNAs in cow's milk and avian miRNAs in chicken eggs for gene regulation. Importantly, evidence also suggests that mice fed a miRNA-depleted diet cannot compensate for dietary depletion by increased endogenous synthesis. Bioinformatics predictions implicate bovine miRNAs in the regulation of genes that play roles in human health and development. Current challenges in this area of research include that some miRNAs are unable to establish a cause-and-effect between miRNA depletion and disease in miRNA knockout mice, and sequence similarities and identities for bovine and human miRNAs render it difficult to distinguish between exogenous and endogenous miRNAs. Based on what is currently known about dietary miRNAs, the body of evidence appears to be sufficient to consider milk miRNA bioactive compounds in foods, and to increase research activities in this field.

  15. Expression regulation of design process gene in product design

    DEFF Research Database (Denmark)

    Li, Bo; Fang, Lusheng; Li, Bo

    2011-01-01

    is proposed and analyzed, as well as its three categories i.e., the operator gene, the structural gene and the regulator gene. Second, the trigger mechanism that design objectives and constraints trigger the operator gene is constructed. Third, the expression principle of structural gene is analyzed...... with the example of design management gene. Last, the regulation mode that the regulator gene regulates the expression of the structural gene is established and it is illustrated by taking the design process management gene as an example. © (2011) Trans Tech Publications....

  16. Gene expression regulation in roots under drought.

    Science.gov (United States)

    Janiak, Agnieszka; Kwaśniewski, Mirosław; Szarejko, Iwona

    2016-02-01

    Stress signalling and regulatory networks controlling expression of target genes are the basis of plant response to drought. Roots are the first organs exposed to water deficiency in the soil and are the place of drought sensing. Signalling cascades transfer chemical signals toward the shoot and initiate molecular responses that lead to the biochemical and morphological changes that allow plants to be protected against water loss and to tolerate stress conditions. Here, we present an overview of signalling network and gene expression regulation pathways that are actively induced in roots under drought stress. In particular, the role of several transcription factor (TF) families, including DREB, AP2/ERF, NAC, bZIP, MYC, CAMTA, Alfin-like and Q-type ZFP, in the regulation of root response to drought are highlighted. The information provided includes available data on mutual interactions between these TFs together with their regulation by plant hormones and other signalling molecules. The most significant downstream target genes and molecular processes that are controlled by the regulatory factors are given. These data are also coupled with information about the influence of the described regulatory networks on root traits and root development which may translate to enhanced drought tolerance. This is the first literature survey demonstrating the gene expression regulatory machinery that is induced by drought stress, presented from the perspective of roots. © The Author 2015. Published by Oxford University Press on behalf of the Society for Experimental Biology. All rights reserved. For permissions, please email: journals.permissions@oup.com.

  17. Developmentally regulated expression of reporter gene in adult ...

    Indian Academy of Sciences (India)

    Introduction. The genetic regulation of adult brain development has re- mained enigmatic to developmental biologists since long. The practical difficulty in understanding the adult brain de- velopment is that most of the mutational searches done for genes in different model systems yield mutations inducing embryonic ...

  18. Ectopic Pregnancy as a Model to Identify Endometrial Genes and Signaling Pathways Important in Decidualization and Regulated by Local Trophoblast

    Science.gov (United States)

    Burgess, Stewart; McDonald, Sarah E.; Critchley, Hilary O. D.; Horne, Andrew W.

    2011-01-01

    The endometrium in early pregnancy undergoes decidualization and functional changes induced by local trophoblast, which are not fully understood. We hypothesized that endometrium from tubal ectopic pregnancy (EP) could be interrogated to identify novel genes and pathways involved in these processes. Gestation-matched endometrium was collected from women with EP (n = 11) and intrauterine pregnancies (IUP) (n = 13). RNA was extracted from the tissue. In addition, tissues were prepared for histological analysis for degree of decidualization. We compared a) the samples from EP that were decidualized (n = 6) with non-decidualized samples (n = 5), and b) the decidualized EP (n = 6) with decidualization-matched IUP (n = 6) samples using an Affymetrix gene array platform, with Ingenuity Pathway Analysis, combined with quantitative RT-PCR. Expression of PRL and IGFBP1 was used to confirm the degree of decidualization in each group. There were no differences in PRL or IGFBP1 expression in the decidualization-matched samples but a marked reduction (Ppregnancy. PMID:21858178

  19. Genome-wide Analysis of Gene Regulation

    DEFF Research Database (Denmark)

    Chen, Yun

    gene regulation will disrupt the cell’s fundamental processes, which in turn can cause disease. Hence, understanding gene regulation is essential for deciphering the code of life. Along with the development of high throughput sequencing (HTS) technology and the subsequent large-scale data analysis...... and temporal alterations of histone modifications (Papers I and II). Coupling the data with machine learning approaches, we established a prediction framework to assess the most informative histone marks as well as their most influential nucleosome positions in predicting the promoter usages. (Papers I......). Focusing on the same promoter across the cell cycle, we observed that histone modification undergoes very distinct temporal lterations compared to their regulatory functions spatially at different promoters (Papers II). By aggregating different HTS methods including CAGE, 3’end-seq, GRO-seq, RNAPII Ch...

  20. Regulation of lipogenic genes in obesity

    OpenAIRE

    Mandard, Stéphane; Kersten, Sander

    2006-01-01

    Lipogenesis describes the process of fatty acid and triglyceride synthesis. Lipogenesis mainly occurs in liver and fat tissue and is under the coordinated control of hormonal, nutritional and transcription factors. Several transcription factors have been identified as critical regulators that mediate the effect of hormones and nutrients on gene transcription. This includes the Sterol Regulatory Element Binding Protein-1c “SREBP-1c”, the CCAAT/Enhancer-Binding Protein-alpha “C/EBPalpha”, the n...

  1. Regulation of methane genes and genome expression

    Energy Technology Data Exchange (ETDEWEB)

    John N. Reeve

    2009-09-09

    At the start of this project, it was known that methanogens were Archaeabacteria (now Archaea) and were therefore predicted to have gene expression and regulatory systems different from Bacteria, but few of the molecular biology details were established. The goals were then to establish the structures and organizations of genes in methanogens, and to develop the genetic technologies needed to investigate and dissect methanogen gene expression and regulation in vivo. By cloning and sequencing, we established the gene and operon structures of all of the “methane” genes that encode the enzymes that catalyze methane biosynthesis from carbon dioxide and hydrogen. This work identified unique sequences in the methane gene that we designated mcrA, that encodes the largest subunit of methyl-coenzyme M reductase, that could be used to identify methanogen DNA and establish methanogen phylogenetic relationships. McrA sequences are now the accepted standard and used extensively as hybridization probes to identify and quantify methanogens in environmental research. With the methane genes in hand, we used northern blot and then later whole-genome microarray hybridization analyses to establish how growth phase and substrate availability regulated methane gene expression in Methanobacterium thermautotrophicus ΔH (now Methanothermobacter thermautotrophicus). Isoenzymes or pairs of functionally equivalent enzymes catalyze several steps in the hydrogen-dependent reduction of carbon dioxide to methane. We established that hydrogen availability determine which of these pairs of methane genes is expressed and therefore which of the alternative enzymes is employed to catalyze methane biosynthesis under different environmental conditions. As were unable to establish a reliable genetic system for M. thermautotrophicus, we developed in vitro transcription as an alternative system to investigate methanogen gene expression and regulation. This led to the discovery that an archaeal protein

  2. Regulation of gene expression in human tendinopathy

    Directory of Open Access Journals (Sweden)

    Archambault Joanne M

    2011-05-01

    Full Text Available Abstract Background Chronic tendon injuries, also known as tendinopathies, are common among professional and recreational athletes. These injuries result in a significant amount of morbidity and health care expenditure, yet little is known about the molecular mechanisms leading to tendinopathy. Methods We have used histological evaluation and molecular profiling to determine gene expression changes in 23 human patients undergoing surgical procedures for the treatment of chronic tendinopathy. Results Diseased tendons exhibit altered extracellular matrix, fiber disorientation, increased cellular content and vasculature, and the absence of inflammatory cells. Global gene expression profiling identified 983 transcripts with significantly different expression patterns in the diseased tendons. Global pathway analysis further suggested altered expression of extracellular matrix proteins and the lack of an appreciable inflammatory response. Conclusions Identification of the pathways and genes that are differentially regulated in tendinopathy samples will contribute to our understanding of the disease and the development of novel therapeutics.

  3. Light and auxin responsive cytochrome P450s from Withania somnifera Dunal: cloning, expression and molecular modelling of two pairs of homologue genes with differential regulation.

    Science.gov (United States)

    Srivastava, Sudhakar; Sangwan, Rajender Singh; Tripathi, Sandhya; Mishra, Bhawana; Narnoliya, L K; Misra, L N; Sangwan, Neelam S

    2015-11-01

    Cytochrome P450s (CYPs) catalyse a wide variety of oxygenation/hydroxylation reactions that facilitate diverse metabolic functions in plants. Specific CYP families are essential for the biosynthesis of species-specialized metabolites. Therefore, we investigated the role of different CYPs related to secondary metabolism in Withania somnifera, a medicinally important plant of the Indian subcontinent. In this study, complete complementary DNAs (cDNAs) of four different CYP genes were isolated and christened as WSCYP93Id, WSCYP93Sm, WSCYP734B and WSCYP734R. These cDNAs encoded polypeptides comprising of 498, 496, 522 and 550 amino acid residues with their deduced molecular mass of 56.7, 56.9, 59.4 and 62.2 kDa, respectively. Phylogenetic study and molecular modelling analysis of the four cloned WSCYPs revealed their categorization into two CYP families (CYP83B1 and CYP734A1) belonging to CYP71 and CYP72 clans, respectively. BLASTp searches showed similarity of 75 and 56 %, respectively, between the two CYP members of CYP83B1 and CYP734A1 with major variances exhibited in their N-terminal regions. The two pairs of homologues exhibited differential expression profiles in the leaf tissues of selected chemotypes of W. somnifera as well as in response to treatments such as methyl jasmonate, wounding, light and auxin. Light and auxin regulated two pairs of WSCYP homologues in a developing seedling in an interesting differential manner. Their lesser resemblance and homology with other CYP sequences suggested these genes to be more specialized and distinct ones. The results on chemotype-specific expression patterns of the four genes strongly suggested their key/specialized involvement of the CYPs in the biosynthesis of chemotype-specific metabolites, though their further biochemical characterization would reveal the specificity in more detail. It is revealed that WSCYP93Id and WSCYP93Sm may be broadly involved in the oxygenation reactions in the plant and, thereby, control

  4. Dietary Methanol Regulates Human Gene Activity

    Science.gov (United States)

    Komarova, Tatiana V.; Sheshukova, Ekaterina V.; Kosorukov, Vyacheslav S.; Kiryanov, Gleb I.; Dorokhov, Yuri L.

    2014-01-01

    Methanol (MeOH) is considered to be a poison in humans because of the alcohol dehydrogenase (ADH)-mediated conversion of MeOH to formaldehyde (FA), which is toxic. Our recent genome-wide analysis of the mouse brain demonstrated that an increase in endogenous MeOH after ADH inhibition led to a significant increase in the plasma MeOH concentration and a modification of mRNA synthesis. These findings suggest endogenous MeOH involvement in homeostasis regulation by controlling mRNA levels. Here, we demonstrate directly that study volunteers displayed increasing concentrations of MeOH and FA in their blood plasma when consuming citrus pectin, ethanol and red wine. A microarray analysis of white blood cells (WBC) from volunteers after pectin intake showed various responses for 30 significantly differentially regulated mRNAs, most of which were somehow involved in the pathogenesis of Alzheimer's disease (AD). There was also a decreased synthesis of hemoglobin mRNA, HBA and HBB, the presence of which in WBC RNA was not a result of red blood cells contamination because erythrocyte-specific marker genes were not significantly expressed. A qRT-PCR analysis of volunteer WBCs after pectin and red wine intake confirmed the complicated relationship between the plasma MeOH content and the mRNA accumulation of both genes that were previously identified, namely, GAPDH and SNX27, and genes revealed in this study, including MME, SORL1, DDIT4, HBA and HBB. We hypothesized that human plasma MeOH has an impact on the WBC mRNA levels of genes involved in cell signaling. PMID:25033451

  5. Dietary methanol regulates human gene activity.

    Directory of Open Access Journals (Sweden)

    Anastasia V Shindyapina

    Full Text Available Methanol (MeOH is considered to be a poison in humans because of the alcohol dehydrogenase (ADH-mediated conversion of MeOH to formaldehyde (FA, which is toxic. Our recent genome-wide analysis of the mouse brain demonstrated that an increase in endogenous MeOH after ADH inhibition led to a significant increase in the plasma MeOH concentration and a modification of mRNA synthesis. These findings suggest endogenous MeOH involvement in homeostasis regulation by controlling mRNA levels. Here, we demonstrate directly that study volunteers displayed increasing concentrations of MeOH and FA in their blood plasma when consuming citrus pectin, ethanol and red wine. A microarray analysis of white blood cells (WBC from volunteers after pectin intake showed various responses for 30 significantly differentially regulated mRNAs, most of which were somehow involved in the pathogenesis of Alzheimer's disease (AD. There was also a decreased synthesis of hemoglobin mRNA, HBA and HBB, the presence of which in WBC RNA was not a result of red blood cells contamination because erythrocyte-specific marker genes were not significantly expressed. A qRT-PCR analysis of volunteer WBCs after pectin and red wine intake confirmed the complicated relationship between the plasma MeOH content and the mRNA accumulation of both genes that were previously identified, namely, GAPDH and SNX27, and genes revealed in this study, including MME, SORL1, DDIT4, HBA and HBB. We hypothesized that human plasma MeOH has an impact on the WBC mRNA levels of genes involved in cell signaling.

  6. Epigenetic regulation of inducible gene expression in the immune system.

    Science.gov (United States)

    Lim, Pek Siew; Li, Jasmine; Holloway, Adele F; Rao, Sudha

    2013-07-01

    T cells are exquisitely poised to respond rapidly to pathogens and have proved an instructive model for exploring the regulation of inducible genes. Individual genes respond to antigenic stimulation in different ways, and it has become clear that the interplay between transcription factors and the chromatin platform of individual genes governs these responses. Our understanding of the complexity of the chromatin platform and the epigenetic mechanisms that contribute to transcriptional control has expanded dramatically in recent years. These mechanisms include the presence/absence of histone modification marks, which form an epigenetic signature to mark active or inactive genes. These signatures are dynamically added or removed by epigenetic enzymes, comprising an array of histone-modifying enzymes, including the more recently recognized chromatin-associated signalling kinases. In addition, chromatin-remodelling complexes physically alter the chromatin structure to regulate chromatin accessibility to transcriptional regulatory factors. The advent of genome-wide technologies has enabled characterization of the chromatin landscape of T cells in terms of histone occupancy, histone modification patterns and transcription factor association with specific genomic regulatory regions, generating a picture of the T-cell epigenome. Here, we discuss the multi-layered regulation of inducible gene expression in the immune system, focusing on the interplay between transcription factors, and the T-cell epigenome, including the role played by chromatin remodellers and epigenetic enzymes. We will also use IL2, a key inducible cytokine gene in T cells, as an example of how the different layers of epigenetic mechanisms regulate immune responsive genes during T-cell activation. © 2013 John Wiley & Sons Ltd.

  7. Nuclear pore complexes as hubs for gene regulation.

    Science.gov (United States)

    D'Angelo, Maximiliano A

    2018-01-01

    Nuclear pore complexes (NPCs), the channels connecting the nucleus with the cytoplasm, are the largest protein structures of the nuclear envelope. In addition to their role in regulating nucleocytoplasmic transport, increasing evidence shows that these multiprotein structures play central roles in the regulation of gene activity. In light of recent discoveries, NPCs are emerging as scaffolds that mediate the regulation of specific gene sets at the nuclear periphery. The function of NPCs as genome organizers and hubs for transcriptional regulation provides additional evidence that the compartmentalization of genes and transcriptional regulators within the nuclear space is an important mechanism of gene expression regulation.

  8. Endogenous methanol regulates mammalian gene activity.

    Science.gov (United States)

    Komarova, Tatiana V; Petrunia, Igor V; Shindyapina, Anastasia V; Silachev, Denis N; Sheshukova, Ekaterina V; Kiryanov, Gleb I; Dorokhov, Yuri L

    2014-01-01

    We recently showed that methanol emitted by wounded plants might function as a signaling molecule for plant-to-plant and plant-to-animal communications. In mammals, methanol is considered a poison because the enzyme alcohol dehydrogenase (ADH) converts methanol into toxic formaldehyde. However, the detection of methanol in the blood and exhaled air of healthy volunteers suggests that methanol may be a chemical with specific functions rather than a metabolic waste product. Using a genome-wide analysis of the mouse brain, we demonstrated that an increase in blood methanol concentration led to a change in the accumulation of mRNAs from genes primarily involved in detoxification processes and regulation of the alcohol/aldehyde dehydrogenases gene cluster. To test the role of ADH in the maintenance of low methanol concentration in the plasma, we used the specific ADH inhibitor 4-methylpyrazole (4-MP) and showed that intraperitoneal administration of 4-MP resulted in a significant increase in the plasma methanol, ethanol and formaldehyde concentrations. Removal of the intestine significantly decreased the rate of methanol addition to the plasma and suggested that the gut flora may be involved in the endogenous production of methanol. ADH in the liver was identified as the main enzyme for metabolizing methanol because an increase in the methanol and ethanol contents in the liver homogenate was observed after 4-MP administration into the portal vein. Liver mRNA quantification showed changes in the accumulation of mRNAs from genes involved in cell signalling and detoxification processes. We hypothesized that endogenous methanol acts as a regulator of homeostasis by controlling the mRNA synthesis.

  9. Endogenous Methanol Regulates Mammalian Gene Activity

    Science.gov (United States)

    Komarova, Tatiana V.; Petrunia, Igor V.; Shindyapina, Anastasia V.; Silachev, Denis N.; Sheshukova, Ekaterina V.; Kiryanov, Gleb I.; Dorokhov, Yuri L.

    2014-01-01

    We recently showed that methanol emitted by wounded plants might function as a signaling molecule for plant-to-plant and plant-to-animal communications. In mammals, methanol is considered a poison because the enzyme alcohol dehydrogenase (ADH) converts methanol into toxic formaldehyde. However, the detection of methanol in the blood and exhaled air of healthy volunteers suggests that methanol may be a chemical with specific functions rather than a metabolic waste product. Using a genome-wide analysis of the mouse brain, we demonstrated that an increase in blood methanol concentration led to a change in the accumulation of mRNAs from genes primarily involved in detoxification processes and regulation of the alcohol/aldehyde dehydrogenases gene cluster. To test the role of ADH in the maintenance of low methanol concentration in the plasma, we used the specific ADH inhibitor 4-methylpyrazole (4-MP) and showed that intraperitoneal administration of 4-MP resulted in a significant increase in the plasma methanol, ethanol and formaldehyde concentrations. Removal of the intestine significantly decreased the rate of methanol addition to the plasma and suggested that the gut flora may be involved in the endogenous production of methanol. ADH in the liver was identified as the main enzyme for metabolizing methanol because an increase in the methanol and ethanol contents in the liver homogenate was observed after 4-MP administration into the portal vein. Liver mRNA quantification showed changes in the accumulation of mRNAs from genes involved in cell signalling and detoxification processes. We hypothesized that endogenous methanol acts as a regulator of homeostasis by controlling the mRNA synthesis. PMID:24587296

  10. The Prolactin Gene: A Paradigm of Tissue-Specific Gene Regulation with Complex Temporal Transcription Dynamics

    Science.gov (United States)

    Featherstone, K; White, M R H; Davis, J R E

    2012-01-01

    Transcription of numerous mammalian genes is highly pulsatile, with bursts of expression occurring with variable duration and frequency. The presence of this stochastic or ‘noisy’ expression pattern has been relatively unexplored in tissue systems. The prolactin gene provides a model of tissue-specific gene regulation resulting in pulsatile transcription dynamics in both cell lines and endocrine tissues. In most cell culture models, prolactin transcription appears to be highly variable between cells, with differences in transcription pulse duration and frequency. This apparently stochastic transcription is constrained by a transcriptional refractory period, which may be related to cycles of chromatin remodelling. We propose that prolactin transcription dynamics result from the summation of oscillatory cellular inputs and by regulation through chromatin remodelling cycles. Observations of transcription dynamics in cells within pituitary tissue show reduced transcriptional heterogeneity and can be grouped into a small number of distinct patterns. Thus, it appears that the tissue environment is able to reduce transcriptional noise to enable coordinated tissue responses to environmental change. We review the current knowledge on the complex tissue-specific regulation of the prolactin gene in pituitary and extra-pituitary sites, highlighting differences between humans and rodent experimental animal models. Within this context, we describe the transcription dynamics of prolactin gene expression and how this may relate to specific processes occurring within the cell. PMID:22420298

  11. Redox regulation of photosynthetic gene expression.

    Science.gov (United States)

    Queval, Guillaume; Foyer, Christine H

    2012-12-19

    Redox chemistry and redox regulation are central to the operation of photosynthesis and respiration. However, the roles of different oxidants and antioxidants in the regulation of photosynthetic or respiratory gene expression remain poorly understood. Leaf transcriptome profiles of a range of Arabidopsis thaliana genotypes that are deficient in either hydrogen peroxide processing enzymes or in low molecular weight antioxidant were therefore compared to determine how different antioxidant systems that process hydrogen peroxide influence transcripts encoding proteins targeted to the chloroplasts or mitochondria. Less than 10 per cent overlap was observed in the transcriptome patterns of leaves that are deficient in either photorespiratory (catalase (cat)2) or chloroplastic (thylakoid ascorbate peroxidase (tapx)) hydrogen peroxide processing. Transcripts encoding photosystem II (PSII) repair cycle components were lower in glutathione-deficient leaves, as were the thylakoid NAD(P)H (nicotinamide adenine dinucleotide (phosphate)) dehydrogenases (NDH) mRNAs. Some thylakoid NDH mRNAs were also less abundant in tAPX-deficient and ascorbate-deficient leaves. Transcripts encoding the external and internal respiratory NDHs were increased by low glutathione and low ascorbate. Regulation of transcripts encoding specific components of the photosynthetic and respiratory electron transport chains by hydrogen peroxide, ascorbate and glutathione may serve to balance non-cyclic and cyclic electron flow pathways in relation to oxidant production and reductant availability.

  12. Global regulation of nucleotide biosynthetic genes by c-Myc.

    Directory of Open Access Journals (Sweden)

    Yen-Chun Liu

    2008-07-01

    Full Text Available The c-Myc transcription factor is a master regulator and integrates cell proliferation, cell growth and metabolism through activating thousands of target genes. Our identification of direct c-Myc target genes by chromatin immunoprecipitation (ChIP coupled with pair-end ditag sequencing analysis (ChIP-PET revealed that nucleotide metabolic genes are enriched among c-Myc targets, but the role of Myc in regulating nucleotide metabolic genes has not been comprehensively delineated.Here, we report that the majority of genes in human purine and pyrimidine biosynthesis pathway were induced and directly bound by c-Myc in the P493-6 human Burkitt's lymphoma model cell line. The majority of these genes were also responsive to the ligand-activated Myc-estrogen receptor fusion protein, Myc-ER, in a Myc null rat fibroblast cell line, HO.15 MYC-ER. Furthermore, these targets are also responsive to Myc activation in transgenic mouse livers in vivo. To determine the functional significance of c-Myc regulation of nucleotide metabolism, we sought to determine the effect of loss of function of direct Myc targets inosine monophosphate dehydrogenases (IMPDH1 and IMPDH2 on c-Myc-induced cell growth and proliferation. In this regard, we used a specific IMPDH inhibitor mycophenolic acid (MPA and found that MPA dramatically inhibits c-Myc-induced P493-6 cell proliferation through S-phase arrest and apoptosis.Taken together, these results demonstrate the direct induction of nucleotide metabolic genes by c-Myc in multiple systems. Our finding of an S-phase arrest in cells with diminished IMPDH activity suggests that nucleotide pool balance is essential for c-Myc's orchestration of DNA replication, such that uncoupling of these two processes create DNA replication stress and apoptosis.

  13. Precise regulation of gene expression dynamics favors complex promoter architectures.

    Directory of Open Access Journals (Sweden)

    Dirk Müller

    2009-01-01

    Full Text Available Promoters process signals through recruitment of transcription factors and RNA polymerase, and dynamic changes in promoter activity constitute a major noise source in gene expression. However, it is barely understood how complex promoter architectures determine key features of promoter dynamics. Here, we employ prototypical promoters of yeast ribosomal protein genes as well as simplified versions thereof to analyze the relations among promoter design, complexity, and function. These promoters combine the action of a general regulatory factor with that of specific transcription factors, a common motif of many eukaryotic promoters. By comprehensively analyzing stationary and dynamic promoter properties, this model-based approach enables us to pinpoint the structural characteristics underlying the observed behavior. Functional tradeoffs impose constraints on the promoter architecture of ribosomal protein genes. We find that a stable scaffold in the natural design results in low transcriptional noise and strong co-regulation of target genes in the presence of gene silencing. This configuration also exhibits superior shut-off properties, and it can serve as a tunable switch in living cells. Model validation with independent experimental data suggests that the models are sufficiently realistic. When combined, our results offer a mechanistic explanation for why specific factors are associated with low protein noise in vivo. Many of these findings hold for a broad range of model parameters and likely apply to other eukaryotic promoters of similar structure.

  14. Evolution of stress-regulated gene expression in duplicate genes of Arabidopsis thaliana.

    Directory of Open Access Journals (Sweden)

    Cheng Zou

    2009-07-01

    Full Text Available Due to the selection pressure imposed by highly variable environmental conditions, stress sensing and regulatory response mechanisms in plants are expected to evolve rapidly. One potential source of innovation in plant stress response mechanisms is gene duplication. In this study, we examined the evolution of stress-regulated gene expression among duplicated genes in the model plant Arabidopsis thaliana. Key to this analysis was reconstructing the putative ancestral stress regulation pattern. By comparing the expression patterns of duplicated genes with the patterns of their ancestors, duplicated genes likely lost and gained stress responses at a rapid rate initially, but the rate is close to zero when the synonymous substitution rate (a proxy for time is > approximately 0.8. When considering duplicated gene pairs, we found that partitioning of putative ancestral stress responses occurred more frequently compared to cases of parallel retention and loss. Furthermore, the pattern of stress response partitioning was extremely asymmetric. An analysis of putative cis-acting DNA regulatory elements in the promoters of the duplicated stress-regulated genes indicated that the asymmetric partitioning of ancestral stress responses are likely due, at least in part, to differential loss of DNA regulatory elements; the duplicated genes losing most of their stress responses were those that had lost more of the putative cis-acting elements. Finally, duplicate genes that lost most or all of the ancestral responses are more likely to have gained responses to other stresses. Therefore, the retention of duplicates that inherit few or no functions seems to be coupled to neofunctionalization. Taken together, our findings provide new insight into the patterns of evolutionary changes in gene stress responses after duplication and lay the foundation for testing the adaptive significance of stress regulatory changes under highly variable biotic and abiotic environments.

  15. Integration of Genome Scale Metabolic Networks and Gene Regulation of Metabolic Enzymes With Physiologically Based Pharmacokinetics

    Science.gov (United States)

    Maldonado, Elaina M.; Leoncikas, Vytautas; Fisher, Ciarán P.; Moore, J. Bernadette; Plant, Nick J.

    2017-01-01

    The scope of physiologically based pharmacokinetic (PBPK) modeling can be expanded by assimilation of the mechanistic models of intracellular processes from systems biology field. The genome scale metabolic networks (GSMNs) represent a whole set of metabolic enzymes expressed in human tissues. Dynamic models of the gene regulation of key drug metabolism enzymes are available. Here, we introduce GSMNs and review ongoing work on integration of PBPK, GSMNs, and metabolic gene regulation. We demonstrate example models. PMID:28782239

  16. Human glucagon gene promoter sequences regulating tissue-specific versus nutrient-regulated gene expression.

    Science.gov (United States)

    Nian, Min; Gu, Jun; Irwin, David M; Drucker, Daniel J

    2002-01-01

    The glucagon-like peptides (GLPs) are synthesized and secreted in a nutrient-dependent manner in rodents; however, the factors regulating human GLP-1 and GLP-2 biosynthesis remain unclear. To understand how nutrients regulate human proglucagon gene expression, we studied the expression of a human proglucagon promoter-growth hormone (GH) transgene in 1.6 human glucagon-GH transgenic mice. Fasting-refeeding significantly decreased and increased the levels of circulating mouse insulin and transgene-derived hGH (P fasting vs. refeeding) and decreased and upregulated, respectively, the levels of endogenous mouse proglucagon RNA in the ileum but not in the jejunum or colon. High-fiber feeding significantly increased the levels of glucose-stimulated circulating hGH and upregulated levels of mouse intestinal proglucagon gene expression in the jejunum, ileum, and colon (P fasting-refeeding nor a high-fiber diet upregulated the expression of the human proglucagon promoter-hGH transgene. These findings demonstrate that human proglucagon gene regulatory sequences specifying tissue-specific expression in gut endocrine cells are not sufficient for recognition of energy-derived signals regulating murine glucagon gene expression in enteroendocrine cells in vivo.

  17. Fine mapping of gene regions regulating neurodegeneration.

    Directory of Open Access Journals (Sweden)

    Maria Swanberg

    Full Text Available BACKGROUND: Damage to nerve cells and axons leading to neurodegeneration is a characteristic feature of many neurological diseases. The degree of genetic influence on susceptibility to axotomy-induced neuronal death has so far been unknown. We have examined two gene regions, Vra1 and Vra2, previously linked to nerve cell loss after ventral root avulsion in a rat F2 intercross between the DA and PVG inbred rat strains. METHODOLOGY/PRINCIPAL FINDINGS: In this study, we use two generations (G8 and G10 cohorts of an advanced intercross line between DA and PVG(av1 to reproduce linkage to Vra1 and to fine-map this region. By isolating the effect from Vra1 in congenic strains, we demonstrate that Vra1 significantly regulates the loss of motoneurons after avulsion. The regulatory effect mediated by Vra1 thus resides in a congenic fragment of 9 megabases. Furthermore, we have used the advanced intercross lines to give more support to Vra2, originally detected as a suggestive QTL. CONCLUSIONS/SIGNIFICANCE: The results demonstrated here show that naturally occurring allelic variations affect susceptibility to axotomy-induced nerve cell death. Vra1 and Vra2 represent the first quantitative trait loci regulating this phenotype that are characterized and fine mapped in an advanced intercross line. In addition, congenic strains provide experimental evidence for the Vra1 effect on the extent of injury-induced neurodegeneration. Identification of the underlying genetic variations will increase our understanding of the regulation and mechanisms of neurodegeneration.

  18. FRUITING GENES OF SCHIZOPHYLLUM-COMMUNE ARE TRANSCRIPTIONALLY REGULATED

    NARCIS (Netherlands)

    SCHUREN, FHJ; VANDERLENDE, TR; WESSELS, JGH

    Fruiting genes in Schizophyllum commune are controlled by the mating-type genes and other regulatory genes. To examine whether differential accumulation of mRNAs for these fruiting genes is caused by transcriptional regulation, run-on transcription assaYs were performed with nuclei isolated from

  19. Regulation of clock-controlled genes in mammals.

    Directory of Open Access Journals (Sweden)

    Katarzyna Bozek

    Full Text Available The complexity of tissue- and day time-specific regulation of thousands of clock-controlled genes (CCGs suggests that many regulatory mechanisms contribute to the transcriptional output of the circadian clock. We aim to predict these mechanisms using a large scale promoter analysis of CCGs.Our study is based on a meta-analysis of DNA-array data from rodent tissues. We searched in the promoter regions of 2065 CCGs for highly overrepresented transcription factor binding sites. In order to compensate the relatively high GC-content of CCG promoters, a novel background model to avoid a bias towards GC-rich motifs was employed. We found that many of the transcription factors with overrepresented binding sites in CCG promoters exhibit themselves circadian rhythms. Among the predicted factors are known regulators such as CLOCKratioBMAL1, DBP, HLF, E4BP4, CREB, RORalpha and the recently described regulators HSF1, STAT3, SP1 and HNF-4alpha. As additional promising candidates of circadian transcriptional regulators PAX-4, C/EBP, EVI-1, IRF, E2F, AP-1, HIF-1 and NF-Y were identified. Moreover, GC-rich motifs (SP1, EGR, ZF5, AP-2, WT1, NRF-1 and AT-rich motifs (MEF-2, HMGIY, HNF-1, OCT-1 are significantly overrepresented in promoter regions of CCGs. Putative tissue-specific binding sites such as HNF-3 for liver, NKX2.5 for heart or Myogenin for skeletal muscle were found. The regulation of the erythropoietin (Epo gene was analysed, which exhibits many binding sites for circadian regulators. We provide experimental evidence for its circadian regulated expression in the adult murine kidney. Basing on a comprehensive literature search we integrate our predictions into a regulatory network of core clock and clock-controlled genes. Our large scale analysis of the CCG promoters reveals the complexity and extensiveness of the circadian regulation in mammals. Results of this study point to connections of the circadian clock to other functional systems including

  20. Gene regulation and noise reduction by coupling of stochastic processes.

    Science.gov (United States)

    Ramos, Alexandre F; Hornos, José Eduardo M; Reinitz, John

    2015-02-01

    Here we characterize the low-noise regime of a stochastic model for a negative self-regulating binary gene. The model has two stochastic variables, the protein number and the state of the gene. Each state of the gene behaves as a protein source governed by a Poisson process. The coupling between the two gene states depends on protein number. This fact has a very important implication: There exist protein production regimes characterized by sub-Poissonian noise because of negative covariance between the two stochastic variables of the model. Hence the protein numbers obey a probability distribution that has a peak that is sharper than those of the two coupled Poisson processes that are combined to produce it. Biochemically, the noise reduction in protein number occurs when the switching of the genetic state is more rapid than protein synthesis or degradation. We consider the chemical reaction rates necessary for Poisson and sub-Poisson processes in prokaryotes and eucaryotes. Our results suggest that the coupling of multiple stochastic processes in a negative covariance regime might be a widespread mechanism for noise reduction.

  1. Dissecting specific and global transcriptional regulation of bacterial gene expression

    NARCIS (Netherlands)

    Gerosa, Luca; Kochanowski, Karl; Heinemann, Matthias; Sauer, Uwe

    Gene expression is regulated by specific transcriptional circuits but also by the global expression machinery as a function of growth. Simultaneous specific and global regulation thus constitutes an additional-but often neglected-layer of complexity in gene expression. Here, we develop an

  2. Dynamical Processes in Ageing, Gene Regulation and Communication

    DEFF Research Database (Denmark)

    Bendtsen, Kristian Moss

    project we constructed a mathematical model and showed that if DNA damage is primarily caused by geno-toxic agents, it would be advantageous for cells to have a fragile DNA repair mechanism. The second part of my Ph.D. thesis covers gene regulation. In the first project we show how RNA polymerase can...... is that unstable activation and stable repression is a requirement for the motif to produce oscillations. The last part of this thesis studies the emergence of communication networks. In this study we constructed a simple e-mail game. E-mails from two session with 16 players, who had never met before, showed how...

  3. Dynamical Processes in Ageing, Gene Regulation and Communication

    DEFF Research Database (Denmark)

    Bendtsen, Kristian Moss

    My thesis consists of three parts. The first part covers ageing phenomena. In the first project I measured the mobility of two DNA repair proteins. Contrasting diffusion coefficients from literature I was able to classify DNA repair protein into either "scanners" or "responders". In a second...... project we constructed a mathematical model and showed that if DNA damage is primarily caused by geno-toxic agents, it would be advantageous for cells to have a fragile DNA repair mechanism. The second part of my Ph.D. thesis covers gene regulation. In the first project we show how RNA polymerase can...

  4. MTA3 regulates CGB5 and Snail genes in trophoblast

    International Nuclear Information System (INIS)

    Chen, Ying; Miyazaki, Jun; Nishizawa, Haruki; Kurahashi, Hiroki; Leach, Richard; Wang, Kai

    2013-01-01

    Highlights: •Impaired MTA3, raised CGB5 and Snail expression are associated with preeclampsia. •Knock-down of MTA3 causes up-regulation of CGB5 and Snail genes in BeWo cells. •MTA3 occupies CGB5 and Snail gene promoters in BeWo cells. -- Abstract: Secreted by the placental trophoblast, human chorionic gonadotropin (hCG) is an important hormone during pregnancy and is required for the maintenance of pregnancy. Previous studies have shown that dys-regulation of hCG expression is associated with preeclampsia. However, the exact relationship between altered hCG levels and development of preeclampsia is unknown. Metastasis associated protein 3 (MTA3), a chromatin remodeling protein, is abundantly expressed in the placental trophoblasts, but its function is unknown. In breast cancer, MTA3 has been shown to repress the expression of Snail and cell migration. However, whether MTA3 acts similarly in the trophoblast has not been investigated. In the present study, we examined the role of MTA3 in regulating the hCG β-subunit gene (gene name: CGB5) and Snail expression in the trophoblast cell line, BeWo, as well as its relevance to the high hCG expression levels seen in preeclampsia. First, we investigated MTA3 expression in preeclamptic placenta as compared to normal control placenta via gene expression microarray and qRT-PCR and found that MTA3 was significantly down-regulated, whereas both CGB5 and Snail were up-regulated in preeclamptic placenta. Secondly, we knocked down MTA3 gene in trophoblast cell line BeWo and found Snail and hCG were both up-regulated, suggesting that MTA3 represses Snail and hCG gene expression in trophoblasts. Next, we cloned the CGB5 and Snail promoters into the pGL3-basic vector individually and found that silencing of MTA3 by siRNA resulted in an increase of both CGB5 and Snail promoter activities. To confirm that this MTA3 inhibition is a direct effect, we performed a chromatin immune-precipitation (ChIP) assay and found that MTA3

  5. MTA3 regulates CGB5 and Snail genes in trophoblast

    Energy Technology Data Exchange (ETDEWEB)

    Chen, Ying [Department of Obstetrics, Gynecology and Reproductive Biology, Michigan State University, Grand Rapids, MI 49503 (United States); Miyazaki, Jun [Department of Obstetrics and Gynecology, Fujita Health University School of Medicine, Fujita Health University, Toyoake (Japan); Division of Molecular Genetics, Institute for Comprehensive Medical Science, Fujita Health University, Toyoake (Japan); Nishizawa, Haruki [Department of Obstetrics and Gynecology, Fujita Health University School of Medicine, Fujita Health University, Toyoake (Japan); Kurahashi, Hiroki [Division of Molecular Genetics, Institute for Comprehensive Medical Science, Fujita Health University, Toyoake (Japan); Leach, Richard, E-mail: Richard.Leach@hc.msu.edu [Department of Obstetrics, Gynecology and Reproductive Biology, Michigan State University, Grand Rapids, MI 49503 (United States); Department of Obstetrics, Gynecology and Women’s Health, Spectrum Health Medical Group, Grand Rapids, MI 49503 (United States); Wang, Kai, E-mail: Kai.Wang@hc.msu.edu [Department of Obstetrics, Gynecology and Reproductive Biology, Michigan State University, Grand Rapids, MI 49503 (United States)

    2013-04-19

    Highlights: •Impaired MTA3, raised CGB5 and Snail expression are associated with preeclampsia. •Knock-down of MTA3 causes up-regulation of CGB5 and Snail genes in BeWo cells. •MTA3 occupies CGB5 and Snail gene promoters in BeWo cells. -- Abstract: Secreted by the placental trophoblast, human chorionic gonadotropin (hCG) is an important hormone during pregnancy and is required for the maintenance of pregnancy. Previous studies have shown that dys-regulation of hCG expression is associated with preeclampsia. However, the exact relationship between altered hCG levels and development of preeclampsia is unknown. Metastasis associated protein 3 (MTA3), a chromatin remodeling protein, is abundantly expressed in the placental trophoblasts, but its function is unknown. In breast cancer, MTA3 has been shown to repress the expression of Snail and cell migration. However, whether MTA3 acts similarly in the trophoblast has not been investigated. In the present study, we examined the role of MTA3 in regulating the hCG β-subunit gene (gene name: CGB5) and Snail expression in the trophoblast cell line, BeWo, as well as its relevance to the high hCG expression levels seen in preeclampsia. First, we investigated MTA3 expression in preeclamptic placenta as compared to normal control placenta via gene expression microarray and qRT-PCR and found that MTA3 was significantly down-regulated, whereas both CGB5 and Snail were up-regulated in preeclamptic placenta. Secondly, we knocked down MTA3 gene in trophoblast cell line BeWo and found Snail and hCG were both up-regulated, suggesting that MTA3 represses Snail and hCG gene expression in trophoblasts. Next, we cloned the CGB5 and Snail promoters into the pGL3-basic vector individually and found that silencing of MTA3 by siRNA resulted in an increase of both CGB5 and Snail promoter activities. To confirm that this MTA3 inhibition is a direct effect, we performed a chromatin immune-precipitation (ChIP) assay and found that MTA3

  6. Quorum Sensing Gene Regulation by LuxR/HapR Master Regulators in Vibrios.

    Science.gov (United States)

    Ball, Alyssa S; Chaparian, Ryan R; van Kessel, Julia C

    2017-10-01

    The coordination of group behaviors in bacteria is accomplished via the cell-cell signaling process called quorum sensing. Vibrios have historically been models for studying bacterial communication due to the diverse and remarkable behaviors controlled by quorum sensing in these bacteria, including bioluminescence, type III and type VI secretion, biofilm formation, and motility. Here, we discuss the Vibrio LuxR/HapR family of proteins, the master global transcription factors that direct downstream gene expression in response to changes in cell density. These proteins are structurally similar to TetR transcription factors but exhibit distinct biochemical and genetic features from TetR that determine their regulatory influence on the quorum sensing gene network. We review here the gene groups regulated by LuxR/HapR and quorum sensing and explore the targets that are common and unique among Vibrio species. Copyright © 2017 American Society for Microbiology.

  7. Joint profiling of miRNAs and mRNAs reveals miRNA mediated gene regulation in the Göttingen minipig obesity model

    DEFF Research Database (Denmark)

    Mentzel, Caroline M. Junker; Alkan, Ferhat; Keinicke, Helle

    2016-01-01

    Obesity and its comorbidities are an increasing challenge for both affected individuals and health care systems, worldwide. In obese individuals, perturbation of expression of both protein-coding genes and microRNAs (miRNA) are seen in obesity-relevant tissues (i.e. adipose tissue, liver and skel......Obesity and its comorbidities are an increasing challenge for both affected individuals and health care systems, worldwide. In obese individuals, perturbation of expression of both protein-coding genes and microRNAs (miRNA) are seen in obesity-relevant tissues (i.e. adipose tissue, liver...... and skeletal muscle). miRNAs are small non-coding RNA molecules which have important regulatory roles in a wide range of biological processes, including obesity. Rodents are widely used animal models for human diseases including obesity. However, not all research is applicable for human health or diseases...... obesity, due to its capacity to develop severe obesity when fed ad libitum. The aim of this study was to identify differentially expressed of protein-coding genes and miRNAs in a Göttingen minipig obesity model. Liver, skeletal muscle and abdominal adipose tissue were sampled from 7 lean and 7 obese...

  8. Intron retention as a component of regulated gene expression programs.

    Science.gov (United States)

    Jacob, Aishwarya G; Smith, Christopher W J

    2017-09-01

    Intron retention has long been an exemplar of regulated splicing with case studies of individual events serving as models that provided key mechanistic insights into the process of splicing control. In organisms such as plants and budding yeast, intron retention is well understood as a major mechanism of gene expression regulation. In contrast, in mammalian systems, the extent and functional significance of intron retention have, until recently, remained greatly underappreciated. Technical challenges to the global detection and quantitation of transcripts with retained introns have often led to intron retention being overlooked or dismissed as "noise". Now, however, with the wealth of information available from high-throughput deep sequencing, combined with focused computational and statistical analyses, we are able to distinguish clear intron retention patterns in various physiological and pathological contexts. Several recent studies have demonstrated intron retention as a central component of gene expression programs during normal development as well as in response to stress and disease. Furthermore, these studies revealed various ways in which intron retention regulates protein isoform production, RNA stability and translation efficiency, and rapid induction of expression via post-transcriptional splicing of retained introns. In this review, we highlight critical findings from these transcriptomic studies and discuss commonalties in the patterns prevalent in intron retention networks at the functional and regulatory levels.

  9. Up-regulation of SNCA gene expression: implications to synucleinopathies.

    Science.gov (United States)

    Tagliafierro, L; Chiba-Falek, O

    2016-07-01

    Synucleinopathies are a group of neurodegenerative diseases that share a common pathological lesion of intracellular protein inclusions largely composed by aggregates of alpha-synuclein protein. Accumulating evidence, including genome wide association studies, has implicated alpha-synuclein (SNCA) gene in the etiology of synucleinopathies. However, the precise variants within SNCA gene that contribute to the sporadic forms of Parkinson's disease (PD), dementia with Lewy bodies (DLB), multiple system atrophy (MSA), and other synucleinopathies and their molecular mechanisms of action remain elusive. It has been suggested that SNCA expression levels are critical for the development of these diseases. Here, we review several model systems that have been developed to advance the understanding of the role of SNCA expression levels in the etiology of synucleinopathies. We also describe different molecular mechanisms that regulate SNCA gene expression and discuss possible strategies for SNCA down-regulation as means for therapeutic approaches. Finally, we highlight some examples that underscore the relationships between the genetic association findings and the regulatory mechanisms of SNCA expression, which suggest that genetic variability in SNCA locus is directly responsible, at least in part, to the changes in gene expression and explain the reported associations of SNCA with synucleinopathies. Future studies utilizing induced pluripotent stem cells (iPSCs)-derived neuronal lines and genome editing by CRISPR/Cas9, will allow us to validate, characterize, and manipulate the effects of particular cis-genetic variants on SNCA expression. Moreover, this model system will enable us to compare different neuronal and glial lineages involved in synucleinopathies representing an attractive strategy to elucidate-common and specific-SNCA-genetic variants, regulatory mechanisms, and vulnerable expression levels underlying synucleinopathy spectrum disorders. This forthcoming

  10. [Gene networks that regulate secondary metabolism in actinomycetes: pleiotropic regulators].

    Science.gov (United States)

    Rabyk, M V; Ostash, B O; Fedorenko, V O

    2014-01-01

    Current advances in the research and practical applications of pleiotropic regulatory genes for antibiotic production in actinomycetes are reviewed. The basic regulatory mechanisms found in these bacteria are outlined. Examples described in the review show the importance of the manipulation of regulatory systems that affect the synthesis of antibiotics for the metabolic engineering of the actinomycetes. Also, the study of these genes is the basis for the development of genetic engineering approaches towards the induction of "cryptic" part of the actinomycetes secondary metabolome, which capacity for production of biologically active compounds is much bigger than the diversity of antibiotics underpinned by traditional microbiological screening. Besides the practical problems, the study of regulatory genes for antibiotic biosynthesis will provide insights into the process of evolution of complex regulatory systems that coordinate the expression of gene operons, clusters and regulons, involved in the control of secondary metabolism and morphogenesis of actinomycetes.

  11. Shift in Food Intake and Changes in Metabolic Regulation and Gene Expression during Simulated Night-Shift Work: A Rat Model

    Directory of Open Access Journals (Sweden)

    Andrea Rørvik Marti

    2016-11-01

    Full Text Available Night-shift work is linked to a shift in food intake toward the normal sleeping period, and to metabolic disturbance. We applied a rat model of night-shift work to assess the immediate effects of such a shift in food intake on metabolism. Male Wistar rats were subjected to 8 h of forced activity during their rest (ZT2-10 or active (ZT14-22 phase. Food intake, body weight, and body temperature were monitored across four work days and eight recovery days. Food intake gradually shifted toward rest-work hours, stabilizing on work day three. A subgroup of animals was euthanized after the third work session for analysis of metabolic gene expression in the liver by real-time polymerase chain reaction (PCR. Results show that work in the rest phase shifted food intake to rest-work hours. Moreover, liver genes related to energy storage and insulin metabolism were upregulated, and genes related to energy breakdown were downregulated compared to non-working time-matched controls. Both working groups lost weight during the protocol and regained weight during recovery, but animals that worked in the rest phase did not fully recover, even after eight days of recovery. In conclusion, three to four days of work in the rest phase is sufficient to induce disruption of several metabolic parameters, which requires more than eight days for full recovery.

  12. Pharmacogenomics genes show varying perceptibility to microRNA regulation

    DEFF Research Database (Denmark)

    Rukov, Jakob Lewin; Vinther, Jeppe; Shomron, Noam

    2011-01-01

    The aim of pharmacogenomics is to identify individual differences in genome and transcriptome composition and their effect on drug efficacy. MicroRNAs (miRNAs) are short noncoding RNAs that negatively regulate expression of the majority of animal genes, including many genes involved in drug...... efficacy. Consequently, differences in the miRNA expression among individuals could be an important factor contributing to differential drug response. Pharmacogenomics genes can be divided into drug target genes termed as pharmacodynamics genes (PD) and genes involved in drug transport and metabolism...

  13. Mechanistic Multi-Tissue Modeling of Glucocorticoid-Induced Leucine Zipper Regulation: Integrating Circadian Gene Expression with Receptor-Mediated Corticosteroid Pharmacodynamics.

    Science.gov (United States)

    Ayyar, Vivaswath S; DuBois, Debra C; Almon, Richard R; Jusko, William J

    2017-10-01

    The glucocorticoid-induced leucine zipper (GILZ) is an important mediator of anti-inflammatory corticosteroid action. The pharmacokinetic/pharmacodynamic/pharmacogenomic effects of acute and chronic methylprednisolone (MPL) dosing on the tissue-specific dynamics of GILZ expression were examined in rats. A mechanism-based model was developed to investigate and integrate the role of MPL and circadian rhythms on the transcriptional enhancement of GILZ in multiple tissues. Animals received a single 50-mg/kg intramuscular bolus or a 7-day 0.3-mg/kg/h subcutaneous infusion of MPL and were euthanized at several time points. An additional group of rats were euthanized at several times and served as 24-hour light/dark (circadian) controls. Plasma MPL and corticosterone concentrations were measured by high-performance liquid chromatography. The expression of GILZ and glucocorticoid receptor (GR) mRNA was quantified in tissues using quantitative real-time reverse-transcription polymerase chain reaction. The pharmacokinetics of MPL were described using a two-compartment model. Mild-to-robust circadian oscillations in GR and GILZ mRNA expression were characterized in muscle, lung, and adipose tissues and modeled using Fourier harmonic functions. Acute MPL dosing caused significant down-regulation (40%-80%) in GR mRNA and enhancement of GILZ mRNA expression (500%-1080%) in the tissues examined. While GILZ returned to its rhythmic baseline following acute dosing, a new steady-state was observed upon enhancement by chronic dosing. The model captured the complex dynamics in all tissues for both dosing regimens. The model quantitatively integrates physiologic mechanisms, such as circadian processes and GR tolerance phenomena, which control the tissue-specific regulation of GILZ by corticosteroids. These studies characterize GILZ as a pharmacodynamic marker of corticosteroid actions in several tissues. Copyright © 2017 by The American Society for Pharmacology and Experimental

  14. Prediction of epigenetically regulated genes in breast cancer cell lines

    Energy Technology Data Exchange (ETDEWEB)

    Loss, Leandro A; Sadanandam, Anguraj; Durinck, Steffen; Nautiyal, Shivani; Flaucher, Diane; Carlton, Victoria EH; Moorhead, Martin; Lu, Yontao; Gray, Joe W; Faham, Malek; Spellman, Paul; Parvin, Bahram

    2010-05-04

    Methylation of CpG islands within the DNA promoter regions is one mechanism that leads to aberrant gene expression in cancer. In particular, the abnormal methylation of CpG islands may silence associated genes. Therefore, using high-throughput microarrays to measure CpG island methylation will lead to better understanding of tumor pathobiology and progression, while revealing potentially new biomarkers. We have examined a recently developed high-throughput technology for measuring genome-wide methylation patterns called mTACL. Here, we propose a computational pipeline for integrating gene expression and CpG island methylation profles to identify epigenetically regulated genes for a panel of 45 breast cancer cell lines, which is widely used in the Integrative Cancer Biology Program (ICBP). The pipeline (i) reduces the dimensionality of the methylation data, (ii) associates the reduced methylation data with gene expression data, and (iii) ranks methylation-expression associations according to their epigenetic regulation. Dimensionality reduction is performed in two steps: (i) methylation sites are grouped across the genome to identify regions of interest, and (ii) methylation profles are clustered within each region. Associations between the clustered methylation and the gene expression data sets generate candidate matches within a fxed neighborhood around each gene. Finally, the methylation-expression associations are ranked through a logistic regression, and their significance is quantified through permutation analysis. Our two-step dimensionality reduction compressed 90% of the original data, reducing 137,688 methylation sites to 14,505 clusters. Methylation-expression associations produced 18,312 correspondences, which were used to further analyze epigenetic regulation. Logistic regression was used to identify 58 genes from these correspondences that showed a statistically signifcant negative correlation between methylation profles and gene expression in the

  15. Expression profiling of genes regulated by TGF-beta: Differential regulation in normal and tumour cells

    Directory of Open Access Journals (Sweden)

    Takahashi Takashi

    2007-04-01

    Full Text Available Abstract Background TGF-beta is one of the key cytokines implicated in various disease processes including cancer. TGF-beta inhibits growth and promotes apoptosis in normal epithelial cells and in contrast, acts as a pro-tumour cytokine by promoting tumour angiogenesis, immune-escape and metastasis. It is not clear if various actions of TGF-beta on normal and tumour cells are due to differential gene regulations. Hence we studied the regulation of gene expression by TGF-beta in normal and cancer cells. Results Using human 19 K cDNA microarrays, we show that 1757 genes are exclusively regulated by TGF-beta in A549 cells in contrast to 733 genes exclusively regulated in HPL1D cells. In addition, 267 genes are commonly regulated in both the cell-lines. Semi-quantitative and real-time qRT-PCR analysis of some genes agrees with the microarray data. In order to identify the signalling pathways that influence TGF-beta mediated gene regulation, we used specific inhibitors of p38 MAP kinase, ERK kinase, JNK kinase and integrin signalling pathways. The data suggest that regulation of majority of the selected genes is dependent on at least one of these pathways and this dependence is cell-type specific. Interestingly, an integrin pathway inhibitor, RGD peptide, significantly affected TGF-beta regulation of Thrombospondin 1 in A549 cells. Conclusion These data suggest major differences with respect to TGF-beta mediated gene regulation in normal and transformed cells and significant role of non-canonical TGF-beta pathways in the regulation of many genes by TGF-beta.

  16. SYSTEMS MODELING OF PROSTATE REGULATION AND ...

    Science.gov (United States)

    The prostate is an androgen-dependent tissue that is an important site of disease in human males as well as an important indicator of androgen status in animals. The rat prostate is used for studying antiandrogenic drugs as well as for evaluation of endocrine disruption (e.g., Hershberger Assay). Pubertal changes in the prostate have been observed to be as sensitive to environmental antiandrogens as in utero effects. The goal of this research is to model the biology of prostate androgen function on a systems level to determine the factors responsible for the dose-response observable with androgens and antiandrogens in the male rat. This includes investigation of the roles of positive and negative feedback loops in prostatic response following castration and dosing with testosterone and/or antiandrogens. A biologically-based, systems-level model will be developed describing the regulation of the prostate by androgens. The model will extend an existing model for the male rat central axis, which describes feedback between luteinizing hormone and testosterone production in the testes, to include the prostate and conversion of testosterone to dihydrotestosterone (DHT). The prostate model will describe binding of androgens to the androgen receptor, 5α-reductase catalyzed production of DHT, and gene regulation affecting cell proliferation, apoptosis, and prostatic fluid production. The model will combine pharmacokinetic models for endogenous hormones (i.e., testost

  17. Epigenetic Regulation of Higher Order Chromatin Conformations and Gene Transcription

    OpenAIRE

    Göndör, Anita

    2007-01-01

    Epigenetic states constitute heritable features of the chromatin to regulate when, where and how genes are expressed in the developing conceptus. A special case of epigenetic regulation, genomic imprinting, is defined as parent of origin-dependent monoallelic expression. The Igf2-H19 locus is considered as paradigm of genomic imprinting with a growth-promoting gene, Igf2, expressed paternally and a growth antagonist, H19 encoding a non-coding transcript, expressed only from the maternal allel...

  18. Competition between target sites of regulators shapes post-transcriptional gene regulation.

    Science.gov (United States)

    Jens, Marvin; Rajewsky, Nikolaus

    2015-02-01

    Post-transcriptional gene regulation (PTGR) of mRNA turnover, localization and translation is mediated by microRNAs (miRNAs) and RNA-binding proteins (RBPs). These regulators exert their effects by binding to specific sequences within their target mRNAs. Increasing evidence suggests that competition for binding is a fundamental principle of PTGR. Not only can miRNAs be sequestered and neutralized by the targets with which they interact through a process termed 'sponging', but competition between binding sites on different RNAs may also lead to regulatory crosstalk between transcripts. Here, we quantitatively model competition effects under physiological conditions and review the role of endogenous sponges for PTGR in light of the key features that emerge.

  19. Unraveling the complex epigenetic mechanisms that regulate gene activity

    NARCIS (Netherlands)

    Bemer, Marian

    2018-01-01

    Our understanding of the epigenetic mechanisms that regulate gene expression has been largely increased in recent years by the development and refinement of different techniques. This has revealed that gene transcription is highly influenced by epigenetic mechanisms, i.e., those that do not involve

  20. Regulation of gene expression in entomopathogenic fungi in three ...

    African Journals Online (AJOL)

    The entomopathogenic fungi are subject to regulation system known as signal transduction that regulates the expression of the different genes required for each life stage, first comprising cuticle adhesion and degradation, later the survival in the hemolymph, and finally the fungal growth in soils. There are two ...

  1. Posttranscriptional Regulation of the Neurofibromatosis 2 Gene

    Science.gov (United States)

    2006-07-01

    S., Bertucci, F., Birnbaum, D., Nguyen, C., Harousseau, J.L., Bataille , R., Houlgatte, R., and Minvielle, S. 2003. Gene expression profiling of...role of Rho in cell transformation by oncogenic Ras. Oncogene 10:2289-2296. 182. Pykett, M.J., Murphy, M., Harnish, P.R., and George , D.L. 1994. The

  2. The Cpx System Regulates Virulence Gene Expression in Vibrio cholerae

    Science.gov (United States)

    Acosta, Nicole; Pukatzki, Stefan

    2015-01-01

    Bacteria possess signal transduction pathways capable of sensing and responding to a wide variety of signals. The Cpx envelope stress response, composed of the sensor histidine kinase CpxA and the response regulator CpxR, senses and mediates adaptation to insults to the bacterial envelope. The Cpx response has been implicated in the regulation of a number of envelope-localized virulence determinants across bacterial species. Here, we show that activation of the Cpx pathway in Vibrio cholerae El Tor strain C6706 leads to a decrease in expression of the major virulence factors in this organism, cholera toxin (CT) and the toxin-coregulated pilus (TCP). Our results indicate that this occurs through the repression of production of the ToxT regulator and an additional upstream transcription factor, TcpP. The effect of the Cpx response on CT and TCP expression is mostly abrogated in a cyclic AMP receptor protein (CRP) mutant, although expression of the crp gene is unaltered. Since TcpP production is controlled by CRP, our data suggest a model whereby the Cpx response affects CRP function, which leads to diminished TcpP, ToxT, CT, and TCP production. PMID:25824837

  3. Regulation of Clock Genes by Adrenergic Receptor Signaling in Osteoblasts.

    Science.gov (United States)

    Hirai, Takao

    2018-01-01

    The clock system has been identified as one of the major mechanisms controlling cellular functions. Circadian clock gene oscillations also actively participate in the functions of various cell types including bone-related cells. Previous studies demonstrated that clock genes were expressed in bone tissue and also that their expression exhibited circadian rhythmicity. Recent findings have shown that sympathetic tone plays a central role in biological oscillations in bone. Adrenergic receptor (AR) signaling regulates the expression of clock genes in cancellous bone. Furthermore, α 1 -AR signaling in osteoblasts is known to negatively regulate the expression of bone morphogenetic protein-4 (Bmp4) by up-regulating nuclear factor IL-3 (Nfil3)/e4 promoter-binding protein 4 (E4BP4). The ablation of α 1B -AR signaling also increases the expression of the Bmp4 gene in bone. The findings of transient overexpression and siRNA experiments have supported the involvement of the transcription factor CCAAT/enhancer-binding protein delta (C/EBPδ, Cebpd) in Nfil3 and Bmp4 expression in MC3T3-E1 cells. These findings suggest that the effects of Cebpd are due to the circadian regulation of Bmp4 expression, at least in part, by the up-regulated expression of the clock gene Nfil3 in response to α 1B -AR signaling in osteoblasts. Therefore, AR signaling appears to modulate cellular functionality through the expression of clock genes that are circadian rhythm regulators in osteoblasts. The expression of clock genes regulated by the sympathetic nervous system and clock-controlled genes that affect bone metabolism are described herein.

  4. Plant defense genes are regulated by ethylene

    Energy Technology Data Exchange (ETDEWEB)

    Ecker, J.R.; Davis, R.W.

    1987-08-01

    One of the earliest detectable events during plant-pathogen interaction is a rapid increase in ethylene biosynthesis. This gaseous plant stress hormone may be a signal for plants to activate defense mechanisms against invading pathogens such as bacteria, fungi, and viruses. The effect of ethylene on four plant genes involved in three separate plant defense response pathways was examined; these included (i and ii) genes that encode L-phenylalanine ammonia-lyase (EC 4.3.1.5) and 4-coumarate:CoA ligase (4-coumarate:CoA ligase (AMP-forming), EC 6.2.1.12), enzymes of the phenylpropanoid pathway, (iii) the gene encoding chalcone synthase, an enzyme of the flavonoid glycoside pathway, and (iv) the genes encoding hydroxyproline-rich glycoprotein, a major protein component(s) of plant cell walls. Blot hybridization analysis of mRNA from ethylene-treated carrot roots reveals marked increases in the levels of phenylalanine ammonia-lyase mRNA, 4-coumarate CoA ligase mRNA, chalcone synthase mRNA, and certain hydroxyproline-rich glycoprotein transcripts. The effect of ethylene on hydroxyproline-rich glycoprotein mRNA accumulation was different from that of wounding. Ethylene induces two hydroxyproline-rich glycoprotein mRNAs (1.8 and 4.0 kilobases), whereas wounding of carrot root leads to accumulation of an additional hydroxyproline-rich mRNA (1.5 kilobases). These results indicate that at least two distinct signals, ethylene and a wound signal, can affect the expression of plant defense-response genes.

  5. Regulation of bacterial gene expression by ribosome stalling and rescuing.

    Science.gov (United States)

    Jin, Yongxin; Jin, Shouguang; Wu, Weihui

    2016-05-01

    Ribosome is responsible for protein synthesis and is able to monitor the sequence and structure of the nascent peptide. Such ability plays an important role in determining overall gene expression profile of the bacteria through ribosome stalling and rescuing. In this review, we briefly summarize our current understanding of the regulation of gene expression through ribosome stalling and rescuing in bacteria, as well as mechanisms that modulate ribosome activity. Understanding the mechanisms of how bacteria modulate ribosome activity will provide not only fundamental insights into bacterial gene regulation, but also new candidate targets for the development of novel antimicrobial agents.

  6. Gene regulation by MAP kinase cascades

    DEFF Research Database (Denmark)

    Fiil, Berthe Katrine; Petersen, Klaus; Petersen, Morten

    2009-01-01

    Mitogen-activated protein kinase (MAPK) cascades are signaling modules that transduce extracellular stimuli to a range of cellular responses. Research in yeast and metazoans has shown that MAPK-mediated phosphorylation directly or indirectly regulates the activity of transcription factors. Plant ...

  7. Modeling the Activity of Single Genes

    Science.gov (United States)

    Mjolsness, Eric; Gibson, Michael

    1999-01-01

    the key questions in gene regulation are: What genes are expressed in a certain cell at a certain time? How does gene expression differ from cell to cell in a multicellular organism? Which proteins act as transcription factors, i.e., are important in regulating gene expression? From questions like these, we hope to understand which genes are important for various macroscopic processes. Nearly all of the cells of a multicellular organism contain the same DNA. Yet this same genetic information yields a large number of different cell types. The fundamental difference between a neuron and a liver cell, for example, is which genes are expressed. Thus understanding gene regulation is an important step in understanding development. Furthermore, understanding the usual genes that are expressed in cells may give important clues about various diseases. Some diseases, such as sickle cell anemia and cystic fibrosis, are caused by defects in single, non-regulatory genes; others, such as certain cancers, are caused when the cellular control circuitry malfunctions - an understanding of these diseases will involve pathways of multiple interacting gene products. There are numerous challenges in the area of understanding and modeling gene regulation. First and foremost, biologists would like to develop a deeper understanding of the processes involved, including which genes and families of genes are important, how they interact, etc. From a computation point of view, there has been embarrassingly little work done. In this chapter there are many areas in which we can phrase meaningful, non-trivial computational questions, but questions that have not been addressed. Some of these are purely computational (what is a good algorithm for dealing with a model of type X) and others are more mathematical (given a system with certain characteristics, what sort of model can one use? How does one find biochemical parameters from system-level behavior using as few experiments as possible?). In

  8. Glucose Regulates the Expression of the Apolipoprotein A5 Gene

    Energy Technology Data Exchange (ETDEWEB)

    Fruchart, Jamila; Nowak, Maxime; Helleboid-Chapman, Audrey; Jakel, Heidelinde; Moitrot, Emmanuelle; Rommens, Corinne; Pennacchio, Len A.; Fruchart-Najib, Jamila; Fruchart, Jean-Charles

    2008-04-07

    The apolipoprotein A5 gene (APOA5) is a key player in determining triglyceride concentrations in humans and mice. Since diabetes is often associated with hypertriglyceridemia, this study explores whether APOA5 gene expression is regulated by alteration in glucose homeostasis and the related pathways. D-glucose activates APOA5 gene expression in a time- and dose-dependent manner in hepatocytes, and the glycolytic pathway involved was determined using D-glucose analogs and metabolites. Together, transient transfections, electrophoretic mobility shift assays and chromatin immunoprecipitation assays show that this regulation occurs at the transcriptional level through an increase of USF1/2 binding to an E-box in the APOA5 promoter. We show that this phenomenon is not due to an increase of mRNA or protein expression levels of USF. Using protein phosphatases 1 and 2A inhibitor, we demonstrate that D-glucose regulates APOA5 gene via a dephosphorylation mechanism, thereby resulting in an enhanced USF1/2-promoter binding. Last, subsequent suppressions of USF1/2 and phosphatases mRNA through siRNA gene silencing abolished the regulation. We demonstrate that APOA5 gene is up regulated by D-glucose and USF through phosphatase activation. These findings may provide a new cross talk between glucose and lipid metabolism.

  9. Post-transcriptional regulation of gene expression in Yersinia species

    Directory of Open Access Journals (Sweden)

    Chelsea A Schiano

    2012-11-01

    Full Text Available Proper regulation of gene expression is required by bacterial pathogens to respond to continually changing environmental conditions and the host response during the infectious process. While transcriptional regulation is perhaps the most well understood form of controlling gene expression, recent studies have demonstrated the importance of post-transcriptional mechanisms of gene regulation that allow for more refined management of the bacterial response to host conditions. Yersinia species of bacteria are known to use various forms of post-transcriptional regulation for control of many virulence-associated genes. These include regulation by cis- and trans-acting small non-coding RNAs, RNA-binding proteins, RNases, and thermoswitches. The effects of these and other regulatory mechanisms on Yersinia physiology can be profound and have been shown to influence type III secretion, motility, biofilm formation, host cell invasion, intracellular survival and replication, and more. In this review, we will discuss these and other post-transcriptional mechanisms and their influence on virulence gene regulation, with a particular emphasis on how these processes influence the virulence of Yersinia in the host.

  10. Y Chromosome Regulation of Autism Susceptibility Genes

    Science.gov (United States)

    2009-06-01

    autistic children. Such distorted ratio could be as high as 8:1 in some populations [12, 13]. Sexual dimorphism in autism is a key and consistent... autism [18-24]. Recent studies in our laboratory suggest that genes on the Y chromosome could contribute to such sexual dimorphisms, thereby raising the...contribute to autism susceptibility, have provided a critical clue that the male-only chromosome is potentially a key player in the sexual dimorphism

  11. Does negative auto-regulation increase gene duplicability?

    Directory of Open Access Journals (Sweden)

    Lercher Martin J

    2009-08-01

    Full Text Available Abstract Background A prerequisite for a duplication to spread through and persist in a given population is retaining expression of both gene copies. Yet changing a gene's dosage is frequently detrimental to fitness. Consequently, dosage-sensitive genes are less likely to duplicate. However, in cases where the level of gene product is controlled, via negative feedback, by its own abundance, an increase in gene copy number can in principle be decoupled from an increase in protein while both copies remain expressed. Using data from the transcriptional networks of E. coli and S. cerevisiae, we test the hypothesis that genes under negative auto-regulation show enhanced duplicability. Results Controlling for several known correlates of duplicability, we find no statistically significant support in either E. coli or S. cerevisiae that transcription factors under negative auto-regulation hold a duplicability advantage over transcription factors with no auto-regulation. Conclusion Based on the analysis of transcriptional networks in E. coli and S. cerevisiae, there is no evidence that negative auto-regulation has contributed, on a genome-wide scale, to the variability in gene family sizes in these species.

  12. Quasi-Genes: The Many-Body Theory of Gene Regulation in the Presence of Decoys

    Science.gov (United States)

    Burger, Anat

    During transcriptional regulation, transcription factor proteins bind to particular sites in the genome in order to switch genes on or off. The regulatory binding site intended for a transcription factor is just one out of millions of potential sites where the transcription factor can bind. Specificity of a binding motif determines whether less than one or up to tens of thousands of strong affinity binding sites can be expected by pure chance. The roles that these additional "decoy" binding sites play in the functioning of a cell are currently unknown. We incorporate decoys into traditional mass action and stochastic models of a simple gene network-the self-regulated gene-and use numerical and analytical techniques to quantify the effects that these extra sites have on altering gene expression properties. Counter-intuitively, we find that if bound transcription factors are protected from degradation, the mean steady state concentration of unbound transcription factors, , is insensitive to the addition of decoys. Many other gene expression properties do change as decoys are added. Decoys linearly increase the time necessary to reach steady state. Noise buffering by decoys occurs because of a coupling between the unbound proteomic environment and the reservoir of sites that can be very large, but the noise reduction is limited Poisson statistics because of the inherent noise resulting from binding and unbinding of transcription factors to DNA. This noise buffering is optimized for a given protein concentration when decoys have a 1/2 probability of being occupied. Decoys are able to preferentially stabilize one state of a bimodal system over the other, and exponentially increase the time to epigenetically switch between these states. In the limit that binding and unbinding rates are fast compared to the fluctuations in transcription factor copy number, we exploit timescale differences to collapse the model and derive analytical expressions that explain our numerical

  13. Reverse-engineering of gene networks for regulating early blood development from single-cell measurements.

    Science.gov (United States)

    Wei, Jiangyong; Hu, Xiaohua; Zou, Xiufen; Tian, Tianhai

    2017-12-28

    Recent advances in omics technologies have raised great opportunities to study large-scale regulatory networks inside the cell. In addition, single-cell experiments have measured the gene and protein activities in a large number of cells under the same experimental conditions. However, a significant challenge in computational biology and bioinformatics is how to derive quantitative information from the single-cell observations and how to develop sophisticated mathematical models to describe the dynamic properties of regulatory networks using the derived quantitative information. This work designs an integrated approach to reverse-engineer gene networks for regulating early blood development based on singel-cell experimental observations. The wanderlust algorithm is initially used to develop the pseudo-trajectory for the activities of a number of genes. Since the gene expression data in the developed pseudo-trajectory show large fluctuations, we then use Gaussian process regression methods to smooth the gene express data in order to obtain pseudo-trajectories with much less fluctuations. The proposed integrated framework consists of both bioinformatics algorithms to reconstruct the regulatory network and mathematical models using differential equations to describe the dynamics of gene expression. The developed approach is applied to study the network regulating early blood cell development. A graphic model is constructed for a regulatory network with forty genes and a dynamic model using differential equations is developed for a network of nine genes. Numerical results suggests that the proposed model is able to match experimental data very well. We also examine the networks with more regulatory relations and numerical results show that more regulations may exist. We test the possibility of auto-regulation but numerical simulations do not support the positive auto-regulation. In addition, robustness is used as an importantly additional criterion to select candidate

  14. The NSL Complex Regulates Housekeeping Genes in Drosophila

    Science.gov (United States)

    Raja, Sunil Jayaramaiah; Holz, Herbert; Luscombe, Nicholas M.; Manke, Thomas; Akhtar, Asifa

    2012-01-01

    MOF is the major histone H4 lysine 16-specific (H4K16) acetyltransferase in mammals and Drosophila. In flies, it is involved in the regulation of X-chromosomal and autosomal genes as part of the MSL and the NSL complexes, respectively. While the function of the MSL complex as a dosage compensation regulator is fairly well understood, the role of the NSL complex in gene regulation is still poorly characterized. Here we report a comprehensive ChIP–seq analysis of four NSL complex members (NSL1, NSL3, MBD-R2, and MCRS2) throughout the Drosophila melanogaster genome. Strikingly, the majority (85.5%) of NSL-bound genes are constitutively expressed across different cell types. We find that an increased abundance of the histone modifications H4K16ac, H3K4me2, H3K4me3, and H3K9ac in gene promoter regions is characteristic of NSL-targeted genes. Furthermore, we show that these genes have a well-defined nucleosome free region and broad transcription initiation patterns. Finally, by performing ChIP–seq analyses of RNA polymerase II (Pol II) in NSL1- and NSL3-depleted cells, we demonstrate that both NSL proteins are required for efficient recruitment of Pol II to NSL target gene promoters. The observed Pol II reduction coincides with compromised binding of TBP and TFIIB to target promoters, indicating that the NSL complex is required for optimal recruitment of the pre-initiation complex on target genes. Moreover, genes that undergo the most dramatic loss of Pol II upon NSL knockdowns tend to be enriched in DNA Replication–related Element (DRE). Taken together, our findings show that the MOF-containing NSL complex acts as a major regulator of housekeeping genes in flies by modulating initiation of Pol II transcription. PMID:22723752

  15. Divergence of gene regulation through chromosomal rearrangements

    Directory of Open Access Journals (Sweden)

    Messing Joachim

    2010-11-01

    Full Text Available Abstract Background The molecular mechanisms that modify genome structures to give birth and death to alleles are still not well understood. To investigate the causative chromosomal rearrangements, we took advantage of the allelic diversity of the duplicated p1 and p2 genes in maize. Both genes encode a transcription factor involved in maysin synthesis, which confers resistance to corn earworm. However, p1 also controls accumulation of reddish pigments in floral tissues and has therefore acquired a new function after gene duplication. p1 alleles vary in their tissue-specific expression, which is indicated in their allele designation: the first suffix refers to red or white pericarp pigmentation and the second to red or white glume pigmentation. Results Comparing chromosomal regions comprising p1-ww[4Co63], P1-rw1077 and P1-rr4B2 alleles with that of the reference genome, P1-wr[B73], enabled us to reconstruct additive events of transposition, chromosome breaks and repairs, and recombination that resulted in phenotypic variation and chimeric regulatory signals. The p1-ww[4Co63] null allele is probably derived from P1-wr[B73] by unequal crossover between large flanking sequences. A transposon insertion in a P1-wr-like allele and NHEJ (non-homologous end-joining could have resulted in the formation of the P1-rw1077 allele. A second NHEJ event, followed by unequal crossover, probably led to the duplication of an enhancer region, creating the P1-rr4B2 allele. Moreover, a rather dynamic picture emerged in the use of polyadenylation signals by different p1 alleles. Interestingly, p1 alleles can be placed on both sides of a large retrotransposon cluster through recombination, while functional p2 alleles have only been found proximal to the cluster. Conclusions Allelic diversity of the p locus exemplifies how gene duplications promote phenotypic variability through composite regulatory signals. Transposition events increase the level of genomic complexity

  16. An integrated machine learning approach for predicting DosR-regulated genes in Mycobacterium tuberculosis

    Directory of Open Access Journals (Sweden)

    Bacon Joanna

    2010-03-01

    Full Text Available Abstract Background DosR is an important regulator of the response to stress such as limited oxygen availability in Mycobacterium tuberculosis. Time course gene expression data enable us to dissect this response on the gene regulatory level. The mRNA expression profile of a regulator, however, is not necessarily a direct reflection of its activity. Knowing the transcription factor activity (TFA can be exploited to predict novel target genes regulated by the same transcription factor. Various approaches have been proposed to reconstruct TFAs from gene expression data. Most of them capture only a first-order approximation to the complex transcriptional processes by assuming linear gene responses and linear dynamics in TFA, or ignore the temporal information in data from such systems. Results In this paper, we approach the problem of inferring dynamic hidden TFAs using Gaussian processes (GP. We are able to model dynamic TFAs and to account for both linear and nonlinear gene responses. To test the validity of the proposed approach, we reconstruct the hidden TFA of p53, a tumour suppressor activated by DNA damage, using published time course gene expression data. Our reconstructed TFA is closer to the experimentally determined profile of p53 concentration than that from the original study. We then apply the model to time course gene expression data obtained from chemostat cultures of M. tuberculosis under reduced oxygen availability. After estimation of the TFA of DosR based on a number of known target genes using the GP model, we predict novel DosR-regulated genes: the parameters of the model are interpreted as relevance parameters indicating an existing functional relationship between TFA and gene expression. We further improve the prediction by integrating promoter sequence information in a logistic regression model. Apart from the documented DosR-regulated genes, our prediction yields ten novel genes under direct control of DosR. Conclusions

  17. The international radioactive transportation regulations: A model for national regulations

    International Nuclear Information System (INIS)

    Pope, R.B.; Rawl, R.R.

    1990-06-01

    The International Atomic Energy Agency's (IAEA) Regulations for the Safe Transport of Radioactive Material, Safety Series No. 6 (herein after denoted as the ''International Regulations'') serve as the model for the regulations for individual countries and international modal organizations controlling the packaging and transportation of radioactive materials. The purpose of this paper is to outline the background and history of the International Regulations, the general principles behind the requirements of the International Regulations, the structure and general contents of the latest edition of the International Regulations, and the roles of various international bodies in the development and implementation of the International Regulations and the current status of regulatory and supportive document development at both the international and domestic level. This review will provide a basis for users and potential users to better understand the source and application of the International Regulations. 1 tab

  18. Alu Elements as Novel Regulators of Gene Expression in Type 1 Diabetes Susceptibility Genes?

    Science.gov (United States)

    Kaur, Simranjeet; Pociot, Flemming

    2015-07-13

    Despite numerous studies implicating Alu repeat elements in various diseases, there is sparse information available with respect to the potential functional and biological roles of the repeat elements in Type 1 diabetes (T1D). Therefore, we performed a genome-wide sequence analysis of T1D candidate genes to identify embedded Alu elements within these genes. We observed significant enrichment of Alu elements within the T1D genes (p-value genes harboring Alus revealed significant enrichment for immune-mediated processes (p-value genes harboring inverted Alus (IRAlus) within their 3' untranslated regions (UTRs) that are known to regulate the expression of host mRNAs by generating double stranded RNA duplexes. Our in silico analysis predicted the formation of duplex structures by IRAlus within the 3'UTRs of T1D genes. We propose that IRAlus might be involved in regulating the expression levels of the host T1D genes.

  19. Regulation of gene expression in Escherichia coli and its bacteriophage

    International Nuclear Information System (INIS)

    Higgins, C.F.

    1986-01-01

    This chapter reviews the study of prokaryotic gene expression beginning with a look at the regulation of the lactose operon and the mechanism of attenuation in the tryptophan operon to the more recent development of recombinant DNA technology. The chapter deals almost entirely with escherichia coli and its bacteriophage. The only experimental technique which the authors explore in some detail is the construction and use of gene and operon fusions which have revolutionized the study of gene expression. Various mechanisms by which E. Coli regulate the cellular levels of individual messenger-RNA species are described. Translational regulation of the cellular levels of messenger-RNA include signals encoded within the messenger-RNA molecule itself and regulatory molecules which interact with the messenger-RNA and alter it translational efficiency

  20. Inferring Gene Regulatory Networks Using Conditional Regulation Pattern to Guide Candidate Genes.

    Directory of Open Access Journals (Sweden)

    Fei Xiao

    Full Text Available Combining path consistency (PC algorithms with conditional mutual information (CMI are widely used in reconstruction of gene regulatory networks. CMI has many advantages over Pearson correlation coefficient in measuring non-linear dependence to infer gene regulatory networks. It can also discriminate the direct regulations from indirect ones. However, it is still a challenge to select the conditional genes in an optimal way, which affects the performance and computation complexity of the PC algorithm. In this study, we develop a novel conditional mutual information-based algorithm, namely RPNI (Regulation Pattern based Network Inference, to infer gene regulatory networks. For conditional gene selection, we define the co-regulation pattern, indirect-regulation pattern and mixture-regulation pattern as three candidate patterns to guide the selection of candidate genes. To demonstrate the potential of our algorithm, we apply it to gene expression data from DREAM challenge. Experimental results show that RPNI outperforms existing conditional mutual information-based methods in both accuracy and time complexity for different sizes of gene samples. Furthermore, the robustness of our algorithm is demonstrated by noisy interference analysis using different types of noise.

  1. The dynamic landscape of gene regulation during Bombyx mori oogenesis.

    Science.gov (United States)

    Zhang, Qiang; Sun, Wei; Sun, Bang-Yong; Xiao, Yang; Zhang, Ze

    2017-09-11

    Oogenesis in the domestic silkworm (Bombyx mori) is a complex process involving previtellogenesis, vitellogenesis and choriogenesis. During this process, follicles show drastic morphological and physiological changes. However, the genome-wide regulatory profiles of gene expression during oogenesis remain to be determined. In this study, we obtained time-series transcriptome data and used these data to reveal the dynamic landscape of gene regulation during oogenesis. A total of 1932 genes were identified to be differentially expressed among different stages, most of which occurred during the transition from late vitellogenesis to early choriogenesis. Using weighted gene co-expression network analysis, we identified six stage-specific gene modules that correspond to multiple regulatory pathways. Strikingly, the biosynthesis pathway of the molting hormone 20-hydroxyecdysone (20E) was enriched in one of the modules. Further analysis showed that the ecdysteroid 20-hydroxylase gene (CYP314A1) of steroidgenesis genes was mainly expressed in previtellogenesis and early vitellogenesis. However, the 20E-inactivated genes, particularly the ecdysteroid 26-hydroxylase encoding gene (Cyp18a1), were highly expressed in late vitellogenesis. These distinct expression patterns between 20E synthesis and catabolism-related genes might ensure the rapid decline of the hormone titer at the transition point from vitellogenesis to choriogenesis. In addition, we compared landscapes of gene regulation between silkworm (Lepidoptera) and fruit fly (Diptera) oogeneses. Our results show that there is some consensus in the modules of gene co-expression during oogenesis in these insects. The data presented in this study provide new insights into the regulatory mechanisms underlying oogenesis in insects with polytrophic meroistic ovaries. The results also provide clues for further investigating the roles of epigenetic reconfiguration and circadian rhythm in insect oogenesis.

  2. Epigenetic regulation on the gene expression signature in esophagus adenocarcinoma.

    Science.gov (United States)

    Xi, Ting; Zhang, Guizhi

    2017-02-01

    Understanding the molecular mechanisms represents an important step in the development of diagnostic and therapeutic measures of esophagus adenocarcinoma (NOS). The objective of this study is to identify the epigenetic regulation on gene expression in NOS, shedding light on the molecular mechanisms of NOS. In this study, 78 patients with NOS were included and the data of mRNA, miRNA and DNA methylation of were downloaded from The Cancer Genome Atlas (TCGA). Differential analysis between NOS and controls was performed in terms of gene expression, miRNA expression, and DNA methylation. Bioinformatic analysis was followed to explore the regulation mechanisms of miRNA and DNA methylationon gene expression. Totally, up to 1320 differentially expressed genes (DEGs) and 32 differentially expressed miRNAs were identified. 240 DEGs that were not only the target genes but also negatively correlated with the screened differentially expressed miRNAs. 101 DEGs were found to be highlymethylated in CpG islands. Then, 8 differentially methylated genes (DMGs) were selected, which showed down-regulated expression in NOS. Among of these genes, 6 genes including ADHFE1, DPP6, GRIA4, CNKSR2, RPS6KA6 and ZNF135 were target genes of differentially expressed miRNAs (hsa-mir-335, hsa-mir-18a, hsa-mir-93, hsa-mir-106b and hsa-mir-21). The identified altered miRNA, genes and DNA methylation site may be applied as biomarkers for diagnosis and prognosis of NOS. Copyright © 2016 Elsevier GmbH. All rights reserved.

  3. Co-regulation of metabolic genes is better explained by flux coupling than by network distance.

    Directory of Open Access Journals (Sweden)

    Richard A Notebaart

    2008-01-01

    Full Text Available To what extent can modes of gene regulation be explained by systems-level properties of metabolic networks? Prior studies on co-regulation of metabolic genes have mainly focused on graph-theoretical features of metabolic networks and demonstrated a decreasing level of co-expression with increasing network distance, a naïve, but widely used, topological index. Others have suggested that static graph representations can poorly capture dynamic functional associations, e.g., in the form of dependence of metabolic fluxes across genes in the network. Here, we systematically tested the relative importance of metabolic flux coupling and network position on gene co-regulation, using a genome-scale metabolic model of Escherichia coli. After validating the computational method with empirical data on flux correlations, we confirm that genes coupled by their enzymatic fluxes not only show similar expression patterns, but also share transcriptional regulators and frequently reside in the same operon. In contrast, we demonstrate that network distance per se has relatively minor influence on gene co-regulation. Moreover, the type of flux coupling can explain refined properties of the regulatory network that are ignored by simple graph-theoretical indices. Our results underline the importance of studying functional states of cellular networks to define physiologically relevant associations between genes and should stimulate future developments of novel functional genomic tools.

  4. Late regulation of immune genes and microRNAs in circulating leukocytes in a pig model of influenza A (H1N2) infection

    DEFF Research Database (Denmark)

    Brogaard, Louise; Heegaard, Peter M. H.; E. Larsen, Lars

    2016-01-01

    and biological implications of miRNA regulation in circulating leukocytes, we collected blood samples before and after (1, 3, and 14 days) IAV challenge of pigs. Differential expression of miRNAs and innate immune factor mRNA transcripts was analysed using RT-qPCR. A total of 20 miRNAs were regulated after IAV...... points to a protracted effect of IAV infection, potentially affecting the host’s ability to respond to secondary infections. In conclusion, experimental IAV infection of pigs demonstrated the dynamic nature of miRNA and mRNA regulation in circulating leukocytes during and after infection, and revealed...

  5. [Regulation of extramitochondrial malic enzyme gene expression in lipogenic tissues].

    Science.gov (United States)

    Stelmańska, Ewa

    2007-11-06

    Extramitochondrial malic enzyme is widely distributed in mammalian tissues, including humans. The major role of this protein in the liver and white adipose tissue is the production of NADPH required for fatty-acid synthesis. Malic enzyme thus belongs to the family of lipogenic enzymes. Malic enzyme activity is regulated both by gene transcription and mRNA stability. Malic enzyme gene expression is tightly controlled by hormonal (i.e. insulin, glucagon, triiodothyronine) and nutritional conditions. There are many transcription factors which recognize special response elements present in the malic enzyme gene promoter. In this paper some important information about the structure and regulation of malic enzyme gene expression in mammalian lipogenic tissues is presented.

  6. Gene profile analysis of osteoblast genes differentially regulated by histone deacetylase inhibitors

    Directory of Open Access Journals (Sweden)

    Lamblin Anne-Francoise

    2007-10-01

    Full Text Available Abstract Background Osteoblast differentiation requires the coordinated stepwise expression of multiple genes. Histone deacetylase inhibitors (HDIs accelerate the osteoblast differentiation process by blocking the activity of histone deacetylases (HDACs, which alter gene expression by modifying chromatin structure. We previously demonstrated that HDIs and HDAC3 shRNAs accelerate matrix mineralization and the expression of osteoblast maturation genes (e.g. alkaline phosphatase, osteocalcin. Identifying other genes that are differentially regulated by HDIs might identify new pathways that contribute to osteoblast differentiation. Results To identify other osteoblast genes that are altered early by HDIs, we incubated MC3T3-E1 preosteoblasts with HDIs (trichostatin A, MS-275, or valproic acid for 18 hours in osteogenic conditions. The promotion of osteoblast differentiation by HDIs in this experiment was confirmed by osteogenic assays. Gene expression profiles relative to vehicle-treated cells were assessed by microarray analysis with Affymetrix GeneChip 430 2.0 arrays. The regulation of several genes by HDIs in MC3T3-E1 cells and primary osteoblasts was verified by quantitative real-time PCR. Nine genes were differentially regulated by at least two-fold after exposure to each of the three HDIs and six were verified by PCR in osteoblasts. Four of the verified genes (solute carrier family 9 isoform 3 regulator 1 (Slc9a3r1, sorbitol dehydrogenase 1, a kinase anchor protein, and glutathione S-transferase alpha 4 were induced. Two genes (proteasome subunit, beta type 10 and adaptor-related protein complex AP-4 sigma 1 were suppressed. We also identified eight growth factors and growth factor receptor genes that are significantly altered by each of the HDIs, including Frizzled related proteins 1 and 4, which modulate the Wnt signaling pathway. Conclusion This study identifies osteoblast genes that are regulated early by HDIs and indicates pathways that

  7. TET-catalyzed 5-hydroxymethylcytosine regulates gene expression in differentiating colonocytes and colon cancer

    Science.gov (United States)

    Chapman, Christopher G.; Mariani, Christopher J.; Wu, Feng; Meckel, Katherine; Butun, Fatma; Chuang, Alice; Madzo, Jozef; Bissonette, Marc B.; Kwon, John H.; Godley, Lucy A.

    2015-01-01

    The formation of differentiated cell types from pluripotent progenitors involves epigenetic regulation of gene expression. DNA hydroxymethylation results from the enzymatic oxidation of 5-methylcytosine (5-mC) to 5-hydroxymethylcytosine (5-hmC) by the ten-eleven translocation (TET) 5-mC dioxygenase enzymes. Previous work has mapped changes in 5-mC during differentiation of intestinal stem cells. However, whether or not 5-hmC regulates colonocyte differentiation is unknown. Here we show that 5-hmC regulates gene expression during colonocyte differentiation and controls gene expression in human colon cancers. Genome-wide profiling of 5-hmC during in vitro colonic differentiation demonstrated that 5-hmC is gained at highly expressed and induced genes and is associated with intestinal transcription factor binding sites, including those for HNF4A and CDX2. TET1 induction occurred during differentiation, and TET1 knockdown altered gene expression and inhibited barrier formation of colonocytes. We find that the 5-hmC distribution in primary human colonocytes parallels the distribution found in differentiated cells in vitro, and that gene-specific 5-hmC changes in human colon cancers are directly correlated with changes in gene expression. Our results support a model in which 5-hmC regulates differentiation of adult human intestine and 5-hmC alterations contribute to the disrupted gene expression in colon cancer. PMID:26631571

  8. TET-catalyzed 5-hydroxymethylcytosine regulates gene expression in differentiating colonocytes and colon cancer.

    Science.gov (United States)

    Chapman, Christopher G; Mariani, Christopher J; Wu, Feng; Meckel, Katherine; Butun, Fatma; Chuang, Alice; Madzo, Jozef; Bissonette, Marc B; Kwon, John H; Godley, Lucy A

    2015-12-03

    The formation of differentiated cell types from pluripotent progenitors involves epigenetic regulation of gene expression. DNA hydroxymethylation results from the enzymatic oxidation of 5-methylcytosine (5-mC) to 5-hydroxymethylcytosine (5-hmC) by the ten-eleven translocation (TET) 5-mC dioxygenase enzymes. Previous work has mapped changes in 5-mC during differentiation of intestinal stem cells. However, whether or not 5-hmC regulates colonocyte differentiation is unknown. Here we show that 5-hmC regulates gene expression during colonocyte differentiation and controls gene expression in human colon cancers. Genome-wide profiling of 5-hmC during in vitro colonic differentiation demonstrated that 5-hmC is gained at highly expressed and induced genes and is associated with intestinal transcription factor binding sites, including those for HNF4A and CDX2. TET1 induction occurred during differentiation, and TET1 knockdown altered gene expression and inhibited barrier formation of colonocytes. We find that the 5-hmC distribution in primary human colonocytes parallels the distribution found in differentiated cells in vitro, and that gene-specific 5-hmC changes in human colon cancers are directly correlated with changes in gene expression. Our results support a model in which 5-hmC regulates differentiation of adult human intestine and 5-hmC alterations contribute to the disrupted gene expression in colon cancer.

  9. PARP-1 and gene regulation: progress and puzzles.

    Science.gov (United States)

    Kraus, W Lee; Hottiger, Michael O

    2013-12-01

    Poly(ADP-ribose) polymerase-1 (PARP-1), also referred to as ADP-ribosyltransferase Diphtheria toxin-like 1 (ARTD1), is an abundant nuclear protein that plays key roles in a variety of nuclear processes, including the regulation of transcription. PARP-1 possesses an intrinsic enzymatic activity that catalyzes the transfer of ADP-ribose (ADPR) units from nicotinamide adenine dinucleotide (NAD(+)) onto target gene regulatory proteins, thereby modulating their activities. Although great strides have been made in the past decade in deciphering the seemingly opposing and varied roles of PARP-1 in gene regulation, many puzzles remain. In this review, we discuss the current state of understanding in this area, especially how PARP-1 interfaces with various components of gene regulatory pathways (e.g., the basal transcription machinery, DNA-binding transcription factors, coregulators, chromatin remodeling, histone modifications, and DNA methylation). In addition, we discuss some gene-specific, cell type-specific, and cell state-specific effects of PARP-1 on gene regulation, which might contribute to its biological functions. Finally, we review some of the recent progress targeting PARPs using chemical inhibitors, some of which may alter PARP-1-dependent gene regulatory programs to promote therapeutic outcomes. Copyright © 2013 Elsevier Ltd. All rights reserved.

  10. Decapping of long noncoding RNAs regulates inducible genes.

    Science.gov (United States)

    Geisler, Sarah; Lojek, Lisa; Khalil, Ahmad M; Baker, Kristian E; Coller, Jeff

    2012-02-10

    Decapping represents a critical control point in regulating expression of protein coding genes. Here, we demonstrate that decapping also modulates expression of long noncoding RNAs (lncRNAs). Specifically, levels of >100 lncRNAs in yeast are controlled by decapping and are degraded by a pathway that occurs independent of decapping regulators. We find many lncRNAs degraded by DCP2 are expressed proximal to inducible genes. Of these, we show several genes required for galactose utilization are associated with lncRNAs that have expression patterns inversely correlated with their mRNA counterpart. Moreover, decapping of these lncRNAs is critical for rapid and robust induction of GAL gene expression. Failure to destabilize a lncRNA known to exert repressive histone modifications results in perpetuation of a repressive chromatin state that contributes to reduced plasticity of gene activation. We propose that decapping and lncRNA degradation serve a vital role in transcriptional regulation specifically at inducible genes. Copyright © 2012 Elsevier Inc. All rights reserved.

  11. Clustering gene expression regulators: new approach to disease subtyping.

    Directory of Open Access Journals (Sweden)

    Mikhail Pyatnitskiy

    Full Text Available One of the main challenges in modern medicine is to stratify different patient groups in terms of underlying disease molecular mechanisms as to develop more personalized approach to therapy. Here we propose novel method for disease subtyping based on analysis of activated expression regulators on a sample-by-sample basis. Our approach relies on Sub-Network Enrichment Analysis algorithm (SNEA which identifies gene subnetworks with significant concordant changes in expression between two conditions. Subnetwork consists of central regulator and downstream genes connected by relations extracted from global literature-extracted regulation database. Regulators found in each patient separately are clustered together and assigned activity scores which are used for final patients grouping. We show that our approach performs well compared to other related methods and at the same time provides researchers with complementary level of understanding of pathway-level biology behind a disease by identification of significant expression regulators. We have observed the reasonable grouping of neuromuscular disorders (triggered by structural damage vs triggered by unknown mechanisms, that was not revealed using standard expression profile clustering. For another experiment we were able to suggest the clusters of regulators, responsible for colorectal carcinoma vs adenoma discrimination and identify frequently genetically changed regulators that could be of specific importance for the individual characteristics of cancer development. Proposed approach can be regarded as biologically meaningful feature selection, reducing tens of thousands of genes down to dozens of clusters of regulators. Obtained clusters of regulators make possible to generate valuable biological hypotheses about molecular mechanisms related to a clinical outcome for individual patient.

  12. Androgen regulated genes in human prostate xenografts in mice: relation to BPH and prostate cancer.

    Directory of Open Access Journals (Sweden)

    Harold D Love

    2009-12-01

    Full Text Available Benign prostatic hyperplasia (BPH and prostate carcinoma (CaP are linked to aging and the presence of androgens, suggesting that androgen regulated genes play a major role in these common diseases. Androgen regulation of prostate growth and development depends on the presence of intact epithelial-stromal interactions. Further, the prostatic stroma is implicated in BPH. This suggests that epithelial cell lines are inadequate to identify androgen regulated genes that could contribute to BPH and CaP and which could serve as potential clinical biomarkers. In this study, we used a human prostate xenograft model to define a profile of genes regulated in vivo by androgens, with an emphasis on identifying candidate biomarkers. Benign transition zone (TZ human prostate tissue from radical prostatectomies was grafted to the sub-renal capsule site of intact or castrated male immunodeficient mice, followed by the removal or addition of androgens, respectively. Microarray analysis of RNA from these tissues was used to identify genes that were; 1 highly expressed in prostate, 2 had significant expression changes in response to androgens, and, 3 encode extracellular proteins. A total of 95 genes meeting these criteria were selected for analysis and validation of expression in patient prostate tissues using quantitative real-time PCR. Expression levels of these genes were measured in pooled RNAs from human prostate tissues with varying severity of BPH pathologic changes and CaP of varying Gleason score. A number of androgen regulated genes were identified. Additionally, a subset of these genes were over-expressed in RNA from clinical BPH tissues, and the levels of many were found to correlate with disease status. Our results demonstrate the feasibility, and some of the problems, of using a mouse xenograft model to characterize the androgen regulated expression profiles of intact human prostate tissues.

  13. Gravity-regulated gene expression in Arabidopsis thaliana

    Science.gov (United States)

    Sederoff, Heike; Brown, Christopher S.; Heber, Steffen; Kajla, Jyoti D.; Kumar, Sandeep; Lomax, Terri L.; Wheeler, Benjamin; Yalamanchili, Roopa

    Plant growth and development is regulated by changes in environmental signals. Plants sense environmental changes and respond to them by modifying gene expression programs to ad-just cell growth, differentiation, and metabolism. Functional expression of genes comprises many different processes including transcription, translation, post-transcriptional and post-translational modifications, as well as the degradation of RNA and proteins. Recently, it was discovered that small RNAs (sRNA, 18-24 nucleotides long), which are heritable and systemic, are key elements in regulating gene expression in response to biotic and abiotic changes. Sev-eral different classes of sRNAs have been identified that are part of a non-cell autonomous and phloem-mobile network of regulators affecting transcript stability, translational kinetics, and DNA methylation patterns responsible for heritable transcriptional silencing (epigenetics). Our research has focused on gene expression changes in response to gravistimulation of Arabidopsis roots. Using high-throughput technologies including microarrays and 454 sequencing, we iden-tified rapid changes in transcript abundance of genes as well as differential expression of small RNA in Arabidopsis root apices after minutes of reorientation. Some of the differentially regu-lated transcripts are encoded by genes that are important for the bending response. Functional mutants of those genes respond faster to reorientation than the respective wild type plants, indicating that these proteins are repressors of differential cell elongation. We compared the gravity responsive sRNAs to the changes in transcript abundances of their putative targets and identified several potential miRNA: target pairs. Currently, we are using mutant and transgenic Arabidopsis plants to characterize the function of those miRNAs and their putative targets in gravitropic and phototropic responses in Arabidopsis.

  14. Regulation of human autoimmune regulator (AIRE) gene translation by miR-220b.

    Science.gov (United States)

    Matsuo, Tomohito; Noguchi, Yukiko; Shindo, Mieko; Morita, Yoshifumi; Oda, Yoshie; Yoshida, Eiko; Hamada, Hiroko; Harada, Mine; Shiokawa, Yuichi; Nishida, Takahiro; Tominaga, Ryuji; Kikushige, Yoshikane; Akashi, Koichi; Kudoh, Jun; Shimizu, Nobuyoshi; Tanaka, Yuka; Umemura, Tsukuru; Taniguchi, Taketoshi; Yoshimura, Akihiko; Kobayashi, Takashi; Mitsuyama, Masao; Kurisaki, Hironori; Katsuta, Hitoshi; Nagafuchi, Seiho

    2013-11-01

    Although mutations of autoimmune regulator (AIRE) gene are responsible for autoimmune polyendocrinopathy-candidiasis-ectodermal dystrophy (APECED), presenting a wide spectrum of many characteristic and non-characteristic clinical features, some patients lack AIRE gene mutations. Therefore, something other than a mutation, such as dysregulation of AIRE gene, may be a causal factor for APECED or its related diseases. However, regulatory mechanisms for AIRE gene expression and/or translation have still remained elusive. We found that IL-2-stimulated CD4(+) T (IL-2T) cells showed a high expression of AIRE gene, but very low AIRE protein production, while Epstein-Barr virus-transformed B (EBV-B) cells express both AIRE gene and AIRE protein. By using microarray analysis, we could identify miR-220b as a possible regulatory mechanism for AIRE gene translation in IL-2T cells. Here we report that miR-220b significantly reduced the expression of AIRE protein in AIRE gene with 3'UTR region transfected 293T cells, whereas no alteration of AIRE protein production was observed in the open reading frame of AIRE gene alone transfected cells. In addition, anti-miR-220b reversed the inhibitory function of miR-220b for the expression of AIRE protein in AIRE gene with 3'UTR region transfected cells. Moreover, when AIRE gene transfected cells with mutated 3'UTR were transfected with miR-220b, no reduction of AIRE protein production was observed. Taken together, it was concluded that miR-220b inhibited the AIRE gene translation through the 3'UTR region of AIRE gene, indicating that miR-220b could serve as a regulator for human AIRE gene translation. © 2013.

  15. [Regulation of heat shock gene expression in response to stress].

    Science.gov (United States)

    Garbuz, D G

    2017-01-01

    Heat shock (HS) genes, or stress genes, code for a number of proteins that collectively form the most ancient and universal stress defense system. The system determines the cell capability of adaptation to various adverse factors and performs a variety of auxiliary functions in normal physiological conditions. Common stress factors, such as higher temperatures, hypoxia, heavy metals, and others, suppress transcription and translation for the majority of genes, while HS genes are upregulated. Transcription of HS genes is controlled by transcription factors of the HS factor (HSF) family. Certain HSFs are activated on exposure to higher temperatures or other adverse factors to ensure stress-induced HS gene expression, while other HSFs are specifically activated at particular developmental stages. The regulation of the main mammalian stress-inducible factor HSF1 and Drosophila melanogaster HSF includes many components, such as a variety of early warning signals indicative of abnormal cell activity (e.g., increases in intracellular ceramide, cytosolic calcium ions, or partly denatured proteins); protein kinases, which phosphorylate HSFs at various Ser residues; acetyltransferases; and regulatory proteins, such as SUMO and HSBP1. Transcription factors other than HSFs are also involved in activating HS gene transcription; the set includes D. melanogaster GAF, mammalian Sp1 and NF-Y, and other factors. Transcription of several stress genes coding for molecular chaperones of the glucose-regulated protein (GRP) family is predominantly regulated by another stress-detecting system, which is known as the unfolded protein response (UPR) system and is activated in response to massive protein misfolding in the endoplasmic reticulum and mitochondrial matrix. A translational fine tuning of HS protein expression occurs via changing the phosphorylation status of several proteins involved in translation initiation. In addition, specific signal sequences in the 5'-UTRs of some HS

  16. Genes, epigenetics and miRNA regulation in the placenta.

    Science.gov (United States)

    Vaiman, Daniel

    2017-04-01

    This text reviews briefly the context in which epigenetics regulate gene expression in trophoblast development and function. It is an attempt to focus on a limited number of recent papers that, according to the author, shed new light on placental development, and constitute possible trails for improving knowledge and women follow-up in pathological pregnancies. Copyright © 2016. Published by Elsevier Ltd.

  17. What DNA sequence tells us about gene regulation - The ...

    Indian Academy of Sciences (India)

    Rahul Siddharthan

    2007-11-03

    Nov 3, 2007 ... Predicting cis-regulatory modules: eve enhancers. Performance, even without prior WMs, comparable to dedicated CRM prediction programs like Stubb. Rahul Siddharthan. (The Institute of Mathematical Sciences, Chennai 600 113. What DNA sequence tells us about gene regulation. 03/11/2007. 27 / 34 ...

  18. Gene Expression Profiling of Apoptosis Regulators in Patients with Sepsis

    NARCIS (Netherlands)

    Hoogerwerf, Jacobien J.; van Zoelen, Marieke A.; Wiersinga, W. Joost; van 't Veer, Cornelis; de Vos, Alex F.; de Boer, Anita; Schultz, Marcus J.; Hooibrink, Berend; de Jonge, Evert; van der Poll, Tom

    2010-01-01

    Introduction: Sepsis is associated with a dysregulation of apoptosis in immune cells, which has been implicated in both immunosuppression and multiple organ failure. We describe the expression profiles of genes encoding key regulators of apoptosis in highly purified monocytes, granulocytes and CD4+

  19. ApoM: gene regulation and effects on HDL metabolism

    DEFF Research Database (Denmark)

    Nielsen, Lars B; Christoffersen, Christina; Ahnström, Josefin

    2009-01-01

    The recently discovered apolipoprotein M (apoM) is a plasma protein of the lipocalin family associated with the lipoproteins (mainly high-density lipoproteins, or HDLs). Expression of the apoM gene in the liver is regulated by transcription factors that control key steps in hepatic lipid and gluc...

  20. LncRNAs: emerging players in gene regulation and disease ...

    Indian Academy of Sciences (India)

    2Flinders Centre for Innovation in Cancer, School of Medicine, Flinders University, Flinders Medical Centre,. Adelaide 5042, Australia .... gene regulation mechanisms, lncRNAs have distinct features from other regulatory ncRNAs ...... blastoma (RB) in human colorectal cancer (Tsang et al. 2010; Hauptman and Glavac 2013) ...

  1. Early development of Moniliophthora perniciosa basidiomata and developmentally regulated genes

    Directory of Open Access Journals (Sweden)

    Pereira Gonçalo AG

    2009-08-01

    Full Text Available Abstract Background The hemibiotrophic fungus Moniliophthora perniciosa is the causal agent of Witches' broom, a disease of Theobroma cacao. The pathogen life cycle ends with the production of basidiocarps in dead tissues of the infected host. This structure generates millions of basidiospores that reinfect young tissues of the same or other plants. A deeper understanding of the mechanisms underlying the sexual phase of this fungus may help develop chemical, biological or genetic strategies to control the disease. Results Mycelium was morphologically analyzed prior to emergence of basidiomata by stereomicroscopy, light microscopy and scanning electron microscopy. The morphological changes in the mycelium before fructification show a pattern similar to other members of the order Agaricales. Changes and appearance of hyphae forming a surface layer by fusion were correlated with primordia emergence. The stages of hyphal nodules, aggregation, initial primordium and differentiated primordium were detected. The morphological analysis also allowed conclusions on morphogenetic aspects. To analyze the genes involved in basidiomata development, the expression of some selected EST genes from a non-normalized cDNA library, representative of the fruiting stage of M. perniciosa, was evaluated. A macroarray analysis was performed with 192 selected clones and hybridized with two distinct RNA pools extracted from mycelium in different phases of basidiomata formation. This analysis showed two groups of up and down-regulated genes in primordial phases of mycelia. Hydrophobin coding, glucose transporter, Rho-GEF, Rheb, extensin precursor and cytochrome p450 monooxygenase genes were grouped among the up-regulated. In the down-regulated group relevant genes clustered coding calmodulin, lanosterol 14 alpha demethylase and PIM1. In addition, 12 genes with more detailed expression profiles were analyzed by RT-qPCR. One aegerolysin gene had a peak of expression in

  2. Early development of Moniliophthora perniciosa basidiomata and developmentally regulated genes

    Science.gov (United States)

    2009-01-01

    Background The hemibiotrophic fungus Moniliophthora perniciosa is the causal agent of Witches' broom, a disease of Theobroma cacao. The pathogen life cycle ends with the production of basidiocarps in dead tissues of the infected host. This structure generates millions of basidiospores that reinfect young tissues of the same or other plants. A deeper understanding of the mechanisms underlying the sexual phase of this fungus may help develop chemical, biological or genetic strategies to control the disease. Results Mycelium was morphologically analyzed prior to emergence of basidiomata by stereomicroscopy, light microscopy and scanning electron microscopy. The morphological changes in the mycelium before fructification show a pattern similar to other members of the order Agaricales. Changes and appearance of hyphae forming a surface layer by fusion were correlated with primordia emergence. The stages of hyphal nodules, aggregation, initial primordium and differentiated primordium were detected. The morphological analysis also allowed conclusions on morphogenetic aspects. To analyze the genes involved in basidiomata development, the expression of some selected EST genes from a non-normalized cDNA library, representative of the fruiting stage of M. perniciosa, was evaluated. A macroarray analysis was performed with 192 selected clones and hybridized with two distinct RNA pools extracted from mycelium in different phases of basidiomata formation. This analysis showed two groups of up and down-regulated genes in primordial phases of mycelia. Hydrophobin coding, glucose transporter, Rho-GEF, Rheb, extensin precursor and cytochrome p450 monooxygenase genes were grouped among the up-regulated. In the down-regulated group relevant genes clustered coding calmodulin, lanosterol 14 alpha demethylase and PIM1. In addition, 12 genes with more detailed expression profiles were analyzed by RT-qPCR. One aegerolysin gene had a peak of expression in mycelium with primordia and a

  3. Hox gene regulation in the central nervous system of Drosophila

    Directory of Open Access Journals (Sweden)

    Maheshwar eGummalla

    2014-04-01

    Full Text Available Hox genes specify the structures that form along the anteroposterior (AP axis of bilateria. Within the genome, they often form clusters where, remarkably enough, their position within the clusters reflects the relative positions of the structures they specify along the AP axis. This correspondence between genomic organization and gene expression pattern has been conserved through evolution and provides a unique opportunity to study how chromosomal context affects gene regulation. In Drosophila, a general rule, often called posterior dominance, states that Hox genes specifying more posterior structures repress the expression of more anterior Hox genes. This rule explains the apparent spatial complementarity of Hox gene expression patterns in Drosophila. Here we review a noticeable exception to this rule where the more-posteriorly expressed Abd-B hox gene fails to repress the more-anterior abd-A gene in cells of the central nervous system (CNS. While Abd-B is required to repress ectopic expression of abd-A in the posterior epidermis, abd-A repression in the posterior CNS is accomplished by a different mechanism that involves a large 92kb long non-coding RNA (lncRNA encoded by the intergenic region separating abd-A and Abd-B (the iab8ncRNA. Dissection of this lncRNA revealed that abd-A is repressed by the lncRNA using two redundant mechanisms. The 1st mechanism is mediated by a microRNA (mir-iab-8 encoded by intronic sequence within the large iab8-ncRNA. Meanwhile, the second mechanism seems to involve transcriptional interference by the long iab-8 ncRNA on the abd-A promoter. Recent work demonstrating CNS-specific regulation of genes by ncRNAs in Drosophila, seem to highlight a potential role for the iab-8-ncRNA in the evolution of the Drosophila hox complexes

  4. Identification of Master Regulator Genes in Human Periodontitis.

    Science.gov (United States)

    Sawle, A D; Kebschull, M; Demmer, R T; Papapanou, P N

    2016-08-01

    Analytic approaches confined to fold-change comparisons of gene expression patterns between states of health and disease are unable to distinguish between primary causal disease drivers and secondary noncausal events. Genome-wide reverse engineering approaches can facilitate the identification of candidate genes that may distinguish between causal and associative interactions and may account for the emergence or maintenance of pathologic phenotypes. In this work, we used the algorithm for the reconstruction of accurate cellular networks (ARACNE) to analyze a large gene expression profile data set (313 gingival tissue samples from a cross-sectional study of 120 periodontitis patients) obtained from clinically healthy (n = 70) or periodontitis-affected (n = 243) gingival sites. The generated transcriptional regulatory network of the gingival interactome was subsequently interrogated with the master regulator inference algorithm (MARINA) and gene expression signature data from healthy and periodontitis-affected gingiva. Our analyses identified 41 consensus master regulator genes (MRs), the regulons of which comprised between 25 and 833 genes. Regulons of 7 MRs (HCLS1, ZNF823, XBP1, ZNF750, RORA, TFAP2C, and ZNF57) included >500 genes each. Gene set enrichment analysis indicated differential expression of these regulons in gingival health versus disease with a type 1 error between 2% and 0.5% and with >80% of the regulon genes in the leading edge. Ingenuity pathway analysis showed significant enrichment of 36 regulons for several pathways, while 6 regulons (those of MRs HCLS1, IKZF3, ETS1, NHLH2, POU2F2, and VAV1) were enriched for >10 pathways. Pathways related to immune system signaling and development were the ones most frequently enriched across all regulons. The unbiased analysis of genome-wide regulatory networks can enhance our understanding of the pathobiology of human periodontitis and, after appropriate validation, ultimately identify target molecules of

  5. DNA context represents transcription regulation of the gene in mouse embryonic stem cells

    Science.gov (United States)

    Ha, Misook; Hong, Soondo

    2016-04-01

    Understanding gene regulatory information in DNA remains a significant challenge in biomedical research. This study presents a computational approach to infer gene regulatory programs from primary DNA sequences. Using DNA around transcription start sites as attributes, our model predicts gene regulation in the gene. We find that H3K27ac around TSS is an informative descriptor of the transcription program in mouse embryonic stem cells. We build a computational model inferring the cell-type-specific H3K27ac signatures in the DNA around TSS. A comparison of embryonic stem cell and liver cell-specific H3K27ac signatures in DNA shows that the H3K27ac signatures in DNA around TSS efficiently distinguish the cell-type specific H3K27ac peaks and the gene regulation. The arrangement of the H3K27ac signatures inferred from the DNA represents the transcription regulation of the gene in mESC. We show that the DNA around transcription start sites is associated with the gene regulatory program by specific interaction with H3K27ac.

  6. Mutations in some Polycomb group genes of Drosophila interfere with regulation of segmentation genes.

    Science.gov (United States)

    McKeon, J; Slade, E; Sinclair, D A; Cheng, N; Couling, M; Brock, H W

    1994-09-01

    Mutations in several Polycomb (Pc) group genes cause maternal-effect or zygotic segmentation defects, suggesting that Pc group genes may regulate the segmentation genes of Drosophila. We show that individuals doubly heterozygous for mutations in polyhomeotic and six other Pc group genes show gap, pair rule, and segment polarity segmentation defects. We examined double heterozygous combinations of Pc group and segmentation mutations for enhancement of adult and embryonic segmentation defects. Posterior sex combs and polyhomeotic interact with Krüppel and enhance embryonic phenotypes of hunchback and knirps, and polyhomeotic enhances even-skipped. Surprisingly, flies carrying duplications of extra sex combs (esc), that were heterozygous for mutations of even-skipped (eve), were extremely subvital. Embryos and surviving adults of this genotype showed strong segmentation defects in even-numbered segments. Antibody studies confirm that expression of eve is suppressed by duplications of esc. However, esc duplications have no effect on other gap or pair rule genes tested. To our knowledge, this is only the second triplo-abnormal phenotype associated with Pc group genes. Duplications of nine other Pc group genes have no detectable effect on eve. Expression of engrailed (en) was abnormal in the central nervous systems of most Pc group mutants. These results support a role for Pc genes in regulation of some segmentation genes, and suggest that esc may act differently from other Pc group genes.

  7. A Novel Gonadotropin-Releasing Hormone 1 (Gnrh1 Enhancer-Derived Noncoding RNA Regulates Gnrh1 Gene Expression in GnRH Neuronal Cell Models.

    Directory of Open Access Journals (Sweden)

    Polly P Huang

    Full Text Available Gonadotropin-releasing hormone (GnRH, a neuropeptide released from a small population of neurons in the hypothalamus, is the central mediator of the hypothalamic-pituitary-gonadal axis, and is required for normal reproductive development and function. Evolutionarily conserved regulatory elements in the mouse, rat, and human Gnrh1 gene include three enhancers and the proximal promoter, which confer Gnrh1 gene expression specifically in GnRH neurons. In immortalized mouse hypothalamic GnRH (GT1-7 neurons, which show pulsatile GnRH release in culture, RNA sequencing and RT-qPCR revealed that expression of a novel long noncoding RNA at Gnrh1 enhancer 1 correlates with high levels of GnRH mRNA expression. In GT1-7 neurons, which contain a transgene carrying 3 kb of the rat Gnrh1 regulatory region, both the mouse and rat Gnrh1 enhancer-derived noncoding RNAs (GnRH-E1 RNAs are expressed. We investigated the characteristics and function of the endogenous mouse GnRH-E1 RNA. Strand-specific RT-PCR analysis of GnRH-E1 RNA in GT1-7 cells revealed GnRH-E1 RNAs that are transcribed in the sense and antisense directions from distinct 5' start sites, are 3' polyadenylated, and are over 2 kb in length. These RNAs are localized in the nucleus and have a half-life of over 8 hours. In GT1-7 neurons, siRNA knockdown of mouse GnRH-E1 RNA resulted in a significant decrease in the expression of the Gnrh1 primary transcript and Gnrh1 mRNA. Over-expression of either the sense or antisense mouse GnRH-E1 RNA in immature, migratory GnRH (GN11 neurons, which do not express either GnRH-E1 RNA or GnRH mRNA, induced the transcriptional activity of co-transfected rat Gnrh1 gene regulatory elements, where the induction requires the presence of the rat Gnrh1 promoter. Together, these data indicate that GnRH-E1 RNA is an inducer of Gnrh1 gene expression. GnRH-E1 RNA may play an important role in the development and maturation of GnRH neurons.

  8. A Novel Gonadotropin-Releasing Hormone 1 (Gnrh1) Enhancer-Derived Noncoding RNA Regulates Gnrh1 Gene Expression in GnRH Neuronal Cell Models.

    Science.gov (United States)

    Huang, Polly P; Brusman, Liza E; Iyer, Anita K; Webster, Nicholas J G; Mellon, Pamela L

    2016-01-01

    Gonadotropin-releasing hormone (GnRH), a neuropeptide released from a small population of neurons in the hypothalamus, is the central mediator of the hypothalamic-pituitary-gonadal axis, and is required for normal reproductive development and function. Evolutionarily conserved regulatory elements in the mouse, rat, and human Gnrh1 gene include three enhancers and the proximal promoter, which confer Gnrh1 gene expression specifically in GnRH neurons. In immortalized mouse hypothalamic GnRH (GT1-7) neurons, which show pulsatile GnRH release in culture, RNA sequencing and RT-qPCR revealed that expression of a novel long noncoding RNA at Gnrh1 enhancer 1 correlates with high levels of GnRH mRNA expression. In GT1-7 neurons, which contain a transgene carrying 3 kb of the rat Gnrh1 regulatory region, both the mouse and rat Gnrh1 enhancer-derived noncoding RNAs (GnRH-E1 RNAs) are expressed. We investigated the characteristics and function of the endogenous mouse GnRH-E1 RNA. Strand-specific RT-PCR analysis of GnRH-E1 RNA in GT1-7 cells revealed GnRH-E1 RNAs that are transcribed in the sense and antisense directions from distinct 5' start sites, are 3' polyadenylated, and are over 2 kb in length. These RNAs are localized in the nucleus and have a half-life of over 8 hours. In GT1-7 neurons, siRNA knockdown of mouse GnRH-E1 RNA resulted in a significant decrease in the expression of the Gnrh1 primary transcript and Gnrh1 mRNA. Over-expression of either the sense or antisense mouse GnRH-E1 RNA in immature, migratory GnRH (GN11) neurons, which do not express either GnRH-E1 RNA or GnRH mRNA, induced the transcriptional activity of co-transfected rat Gnrh1 gene regulatory elements, where the induction requires the presence of the rat Gnrh1 promoter. Together, these data indicate that GnRH-E1 RNA is an inducer of Gnrh1 gene expression. GnRH-E1 RNA may play an important role in the development and maturation of GnRH neurons.

  9. Dynamical Analysis of bantam-Regulated Drosophila Circadian Rhythm Model

    Science.gov (United States)

    Li, Ying; Liu, Zengrong

    MicroRNAs (miRNAs) interact with 3‧untranslated region (UTR) elements of target genes to regulate mRNA stability or translation, and play a crucial role in regulating many different biological processes. bantam, a conserved miRNA, is involved in several functions, such as regulating Drosophila growth and circadian rhythm. Recently, it has been discovered that bantam plays a crucial role in the core circadian pacemaker. In this paper, based on experimental observations, a detailed dynamical model of bantam-regulated circadian clock system is developed to show the post-transcriptional behaviors in the modulation of Drosophila circadian rhythm, in which the regulation of bantam is incorporated into a classical model. The dynamical behaviors of the model are consistent with the experimental observations, which shows that bantam is an important regulator of Drosophila circadian rhythm. The sensitivity analysis of parameters demonstrates that with the regulation of bantam the system is more sensitive to perturbations, indicating that bantam regulation makes it easier for the organism to modulate its period against the environmental perturbations. The effectiveness in rescuing locomotor activity rhythms of mutated flies shows that bantam is necessary for strong and sustained rhythms. In addition, the biological mechanisms of bantam regulation are analyzed, which may help us more clearly understand Drosophila circadian rhythm regulated by other miRNAs.

  10. Dynamics of chromatin accessibility and gene regulation by MADS-domain transcription factors in flower development.

    Science.gov (United States)

    Pajoro, Alice; Madrigal, Pedro; Muiño, Jose M; Matus, José Tomás; Jin, Jian; Mecchia, Martin A; Debernardi, Juan M; Palatnik, Javier F; Balazadeh, Salma; Arif, Muhammad; Ó'Maoiléidigh, Diarmuid S; Wellmer, Frank; Krajewski, Pawel; Riechmann, José-Luis; Angenent, Gerco C; Kaufmann, Kerstin

    2014-03-03

    Development of eukaryotic organisms is controlled by transcription factors that trigger specific and global changes in gene expression programs. In plants, MADS-domain transcription factors act as master regulators of developmental switches and organ specification. However, the mechanisms by which these factors dynamically regulate the expression of their target genes at different developmental stages are still poorly understood. We characterized the relationship of chromatin accessibility, gene expression, and DNA binding of two MADS-domain proteins at different stages of Arabidopsis flower development. Dynamic changes in APETALA1 and SEPALLATA3 DNA binding correlated with changes in gene expression, and many of the target genes could be associated with the developmental stage in which they are transcriptionally controlled. We also observe dynamic changes in chromatin accessibility during flower development. Remarkably, DNA binding of APETALA1 and SEPALLATA3 is largely independent of the accessibility status of their binding regions and it can precede increases in DNA accessibility. These results suggest that APETALA1 and SEPALLATA3 may modulate chromatin accessibility, thereby facilitating access of other transcriptional regulators to their target genes. Our findings indicate that different homeotic factors regulate partly overlapping, yet also distinctive sets of target genes in a partly stage-specific fashion. By combining the information from DNA-binding and gene expression data, we are able to propose models of stage-specific regulatory interactions, thereby addressing dynamics of regulatory networks throughout flower development. Furthermore, MADS-domain TFs may regulate gene expression by alternative strategies, one of which is modulation of chromatin accessibility.

  11. Functional Enhancers As Master Regulators of Tissue-Specific Gene Regulation and Cancer Development

    Science.gov (United States)

    Ko, Je Yeong; Oh, Sumin; Yoo, Kyung Hyun

    2017-01-01

    Tissue-specific transcription is critical for normal development, and abnormalities causing undesirable gene expression may lead to diseases such as cancer. Such highly organized transcription is controlled by enhancers with specific DNA sequences recognized by transcription factors. Enhancers are associated with chromatin modifications that are distinct epigenetic features in a tissue-specific manner. Recently, super-enhancers comprising enhancer clusters co-occupied by lineage-specific factors have been identified in diverse cell types such as adipocytes, hair follicle stem cells, and mammary epithelial cells. In addition, noncoding RNAs, named eRNAs, are synthesized at super-enhancer regions before their target genes are transcribed. Many functional studies revealed that super-enhancers and eRNAs are essential for the regulation of tissue-specific gene expression. In this review, we summarize recent findings concerning enhancer function in tissue-specific gene regulation and cancer development. PMID:28359147

  12. Signal Transduction Pathways that Regulate CAB Gene Expression

    Energy Technology Data Exchange (ETDEWEB)

    Chory, Joanne

    2004-12-31

    The process of chloroplast differentiation, involves the coordinate regulation of many nuclear and chloroplast genes. The cues for the initiation of this developmental program are both extrinsic (e.g., light) and intrinsic (cell-type and plastid signals). During this project period, we utilized a molecular genetic approach to select for Arabidopsis mutants that did not respond properly to environmental light conditions, as well as mutants that were unable to perceive plastid damage. These latter mutants, called gun mutants, define two retrograde signaling pathways that regulate nuclear gene expression in response to chloroplasts. A major finding was to identify a signal from chloroplasts that regulates nuclear gene transcription. This signal is the build-up of Mg-Protoporphyrin IX, a key intermediate of the chlorophyll biosynthetic pathway. The signaling pathways downstream of this signal are currently being studied. Completion of this project has provided an increased understanding of the input signals and retrograde signaling pathways that control nuclear gene expression in response to the functional state of chloroplasts. These studies should ultimately influence our abilities to manipulate plant growth and development, and will aid in the understanding of the developmental control of photosynthesis.

  13. Signal Transduction Pathways that Regulate CAB Gene Expression

    Energy Technology Data Exchange (ETDEWEB)

    Chory, Joanne

    2006-01-16

    The process of chloroplast differentiation, involves the coordinate regulation of many nuclear and chloroplast genes. The cues for the initiation of this developmental program are both extrinsic (e.g., light) and intrinsic (cell-type and plastid signals). During this project period, we utilized a molecular genetic approach to select for Arabidopsis mutants that did not respond properly to environmental light conditions, as well as mutants that were unable to perceive plastid damage. These latter mutants, called gun mutants, define two retrograde signaling pathways that regulate nuclear gene expression in response to chloroplasts. A major finding was to identify a signal from chloroplasts that regulates nuclear gene transcription. This signal is the build-up of Mg-Protoporphyrin IX, a key intermediate of the chlorophyll biosynthetic pathway. The signaling pathways downstream of this signal are currently being studied. Completion of this project has provided an increased understanding of the input signals and retrograde signaling pathways that control nuclear gene expression in response to the functional state of chloroplasts. These studies should ultimately influence our abilities to manipulate plant growth and development, and will aid in the understanding of the developmental control of photosynthesis.

  14. Gene Regulation System of Vasopressin and Corticotoropin-Releasing Hormone

    Directory of Open Access Journals (Sweden)

    Masanori Yoshida

    2008-01-01

    Full Text Available The neurohypophyseal hormones, arginine vasopressin and corticotropin-releasing hormone (CRH, play a crucial role in the physiological and behavioral response to various kinds of stresses. Both neuropeptides activate the hypophysialpituitary-adrenal (HPA axis, which is a central mediator of the stress response in the body. Conversely, they receive the negative regulation by glucocorticoid, which is an end product of the HPA axis. Vasopressin and CRH are closely linked to immune response; they also interact with pro-inflammatory cytokines. Moreover, as for vasopressin, it has another important role, which is the regulation of water balance through its potent antidiuretic effect. Hence, it is conceivable that vasopressin and CRH mediate the homeostatic responses for survival and protect organisms from the external world. A tight and elaborate regulation system of the vasopressin and CRH gene is required for the rapid and flexible response to the alteration of the surrounding environments. Several important regulatory elements have been identified in the proximal promoter region in the vasopressin and CRH gene. Many transcription factors and intracellular signaling cascades are involved in the complicated gene regulation system. This review focuses on the current status of the basic research of vasopressin and CRH. In addition to the numerous known facts about their divergent physiological roles, the recent topics of promoter analyses will be discussed.

  15. Brucella abortus: pathogenicity and gene regulation of virulence

    Directory of Open Access Journals (Sweden)

    Olga Rivas-Solano

    2015-06-01

    Full Text Available Brucella abortus is a zoonotic intracellular facultative pathogen belonging to the subdivision α2 of class Proteobacteria. It causes a worldwide distributed zoonotic disease called brucellosis. The main symptoms are abortion and sterility in cattle, as well as an undulant febrile condition in humans. In endemic regions like Central America, brucellosis has a high socioeconomic impact. A basic research project was recently conducted at the ITCR with the purpose of studying gene regulation of virulence, structure and immunogenicity in B. abortus. The present review was written as part of this project. B. abortus virulence seems to be determined by its ability to invade, survive and replicate inside professional and non-professional phagocytes. It reaches its intracellular replicative niche without the activation of host antimicrobial mechanisms of innate immunity. It also has gene regulation mechanisms for a rapid adaptation to an intracellular environment such as the two-component signal transduction system BvrR/BvrS and the quorum sensing regulator called Vjbr, as well as other transcription factors. All of them integrate a complex gene regulation network.

  16. Epigenetic Modification of the Repair Donor Regulates Targeted Gene Correction

    Directory of Open Access Journals (Sweden)

    Olivier Humbert

    2012-01-01

    Full Text Available Optimizing design of vectors is critical to effective gene therapy. In targeted gene correction (TGC, cleavage of chromosomal DNA near a mutation stimulates homology-directed repair of a target gene using a donor provided in trans. We have systematically addressed epigenetic parameters of donor design, using a flow-based assay to quantify correction frequencies and expression levels of a green fluorescent protein (GFP reporter gene in a human cell line. We show that active transcription of the donor increased correction frequency by threefold, establishing that a proximal promoter enhances donor use. Conversely, CpG methylation of the donor diminished correction frequency and reduced expression of the repaired gene. However, bisulfite sequencing of the target revealed no transfer of methylation marks during repair with a methylated donor. Treatment with histone deacetylase (HDAC inhibitors can partially compensate for epigenetic inactivation, suggesting a role for class I and II HDACs in regulation of donor use. These results establish that epigenetic status of a trans-donor determines both the efficiency and outcome of gene correction, and identify and clarify parameters that should guide donor design for targeted gene therapy.

  17. Carbon Catabolite Repression Regulates Glyoxylate Cycle Gene Expression in Cucumber.

    Science.gov (United States)

    Graham, I. A.; Denby, K. J.; Leaver, C. J.

    1994-01-01

    We have previously proposed that metabolic status is important in the regulation of cucumber malate synthase (MS) and isocitrate lyase (ICL) gene expression during plant development. In this article, we used a cell culture system to demonstrate that intracellular metabolic status does influence expression of both of these genes. Starvation of cucumber cell cultures resulted in the coordinate induction of the expression of MS and ICL genes, and this effect was reversed when sucrose was returned to the culture media. The induction of gene expression was closely correlated with a drop in intracellular sucrose, glucose, and fructose below threshold concentrations, but it was not correlated with a decrease in respiration rate. Glucose, fructose, or raffinose in the culture media also resulted in repression of MS and ICL. Both 2-deoxyglucose and mannose, which are phosphorylated by hexokinase but not further metabolized, specifically repressed MS and ICL gene expression relative to a third glyoxylate cycle gene, malate dehydrogenase. However, the addition of 3-methylglucose, an analog of glucose that is not phosphorylated, did not result in repression of either MS or ICL. It is proposed that the signal giving rise to a change in gene expression originates from the intracellular concentration of hexose sugars or the flux of hexose sugars into glycolysis. PMID:12244257

  18. Proposed Regulation of Gene Expression by Glucose in Rodent Heart

    Directory of Open Access Journals (Sweden)

    Martin E. Young

    2007-01-01

    Full Text Available Background: During pressure overload-induced hypertrophy, unloading-induced atrophy, and diabetes mellitus, the heart induces ‘fetal’ genes (e.g. myosin heavy chain β; mhcβ.Hypothesis: We propose that altered glucose homeostasis within the cardiomyocyte acts as a central mechanism for the regulation of gene expression in response to environmental stresses. The evidence is as follows. Methods and Results: Forced glucose uptake both ex vivo and in vivo results in mhc isoform switching. Restricting dietary glucose prevents mhc isoform switching in hearts of both GLUT1-Tg mice and rats subjected to pressure overload-induced hypertrophy. Thus, glucose availability correlates with mhc isoform switching under all conditions investigated. A potential mechanism by which glucose affects gene expression is through O-linked glycosylation of specific transcription factors. Glutamine:fructose-6-phosphate amidotransferase (GFAT catalyzes the flux generating step in UDP-N-acetylglucosamine biosynthesis, the rate determining metabolite in protein glycosylation. Ascending aortic constriction increased intracellular levels of UDP-N-acetylglucosamine, and the expression of gfat2, but not gfat1, in the rat heart.Conclusions: Collectively, the results strongly suggest glucose-regulated gene expression in the heart, and the involvement of glucose metabolites in isoform switching of sarcomeric proteins characteristic for the fetal gene program.

  19. RNAi-Based Identification of Gene-Specific Nuclear Cofactor Networks Regulating Interleukin-1 Target Genes

    Directory of Open Access Journals (Sweden)

    Johanna Meier-Soelch

    2018-04-01

    Full Text Available The potent proinflammatory cytokine interleukin (IL-1 triggers gene expression through the NF-κB signaling pathway. Here, we investigated the cofactor requirements of strongly regulated IL-1 target genes whose expression is impaired in p65 NF-κB-deficient murine embryonic fibroblasts. By two independent small-hairpin (shRNA screens, we examined 170 genes annotated to encode nuclear cofactors for their role in Cxcl2 mRNA expression and identified 22 factors that modulated basal or IL-1-inducible Cxcl2 levels. The functions of 16 of these factors were validated for Cxcl2 and further analyzed for their role in regulation of 10 additional IL-1 target genes by RT-qPCR. These data reveal that each inducible gene has its own (quantitative requirement of cofactors to maintain basal levels and to respond to IL-1. Twelve factors (Epc1, H2afz, Kdm2b, Kdm6a, Mbd3, Mta2, Phf21a, Ruvbl1, Sin3b, Suv420h1, Taf1, and Ube3a have not been previously implicated in inflammatory cytokine functions. Bioinformatics analysis indicates that they are components of complex nuclear protein networks that regulate chromatin functions and gene transcription. Collectively, these data suggest that downstream from the essential NF-κB signal each cytokine-inducible target gene has further subtle requirements for individual sets of nuclear cofactors that shape its transcriptional activation profile.

  20. The ASK1 gene regulates B function gene expression in cooperation with UFO and LEAFY in Arabidopsis.

    Science.gov (United States)

    Zhao, D; Yu, Q; Chen, M; Ma, H

    2001-07-01

    The Arabidopsis floral regulatory genes APETALA3 (AP3) and PISTILLATA (PI) are required for the B function according to the ABC model for floral organ identity. AP3 and PI expression are positively regulated by the LEAFY (LFY) and UNUSUAL FLORAL ORGANS (UFO) genes. UFO encodes an F-box protein, and we have shown previously that UFO genetically interacts with the ASK1 gene encoding a SKP1 homologue; both the F-box containing protein and SKP1 are subunits of ubiquitin ligases. We show here that the ask1-1 mutation can enhance the floral phenotypes of weak lfy and ap3 mutants; therefore, like UFO, ASK1 also interacts with LFY and AP3 genetically. Furthermore, our results from RNA in situ hybridizations indicate that ASK1 regulates early AP3 and PI expression. These results support the idea that UFO and ASK1 together positively regulate AP3 and PI expression. We propose that the UFO and ASK1 proteins are components of a ubiquitin ligase that mediates the proteolysis of a repressor of AP3 and PI expression. Our genetic studies also indicate that ASK1 and UFO play a role in regulating the number of floral organ primordia, and we discuss possible mechanisms for such a regulation.

  1. Drosha regulates gene expression independently of RNA cleavage function

    DEFF Research Database (Denmark)

    Gromak, Natalia; Dienstbier, Martin; Macias, Sara

    2013-01-01

    Drosha is the main RNase III-like enzyme involved in the process of microRNA (miRNA) biogenesis in the nucleus. Using whole-genome ChIP-on-chip analysis, we demonstrate that, in addition to miRNA sequences, Drosha specifically binds promoter-proximal regions of many human genes in a transcription......-terminal protein-interaction domain, which associates with the RNA-binding protein CBP80 and RNA Polymerase II. Consequently, we uncover a previously unsuspected RNA cleavage-independent function of Drosha in the regulation of human gene expression....

  2. Differential regulation of NAB corepressor genes in Schwann cells

    Directory of Open Access Journals (Sweden)

    Sachdev Shrikesh

    2007-12-01

    Full Text Available Abstract Background Myelination of peripheral nerves by Schwann cells requires not only the Egr2/Krox-20 transactivator, but also the NGFI-A/Egr-binding (NAB corepressors, which modulate activity of Egr2. Previous work has shown that axon-dependent expression of Egr2 is mediated by neuregulin stimulation, and NAB corepressors are co-regulated with Egr2 expression in peripheral nerve development. NAB corepressors have also been implicated in macrophage development, cardiac hypertrophy, prostate carcinogenesis, and feedback regulation involved in hindbrain development. Results To test the mechanism of NAB regulation in Schwann cells, transfection assays revealed that both Nab1 and Nab2 promoters are activated by Egr2 expression. Furthermore, direct binding of Egr2 at these promoters was demonstrated in vivo by chromatin immunoprecipitation analysis of myelinating sciatic nerve, and binding of Egr2 to the Nab2 promoter was stimulated by neuregulin in primary Schwann cells. Although Egr2 expression activates the Nab2 promoter more highly than Nab1, we surprisingly found that only Nab1 – but not Nab2 – expression levels were reduced in sciatic nerve from Egr2 null mice. Analysis of the Nab2 promoter showed that it is also activated by ETS proteins (Ets2 and Etv1/ER81 and is bound by Ets2 in vivo. Conclusion Overall, these results indicate that induction of Nab2 expression in Schwann cells involves not only Egr2, but also ETS proteins that are activated by neuregulin stimulation. Although Nab1 and Nab2 play partially redundant roles, regulation of Nab2 expression by ETS factors explains several observations regarding regulation of NAB genes. Finally, these data suggest that NAB proteins are not only feedback inhibitors of Egr2, but rather that co-induction of Egr2 and NAB genes is involved in forming an Egr2/NAB complex that is crucial for regulation of gene expression.

  3. Mechanisms of biotin-regulated gene expression in microbes

    Directory of Open Access Journals (Sweden)

    J. Satiaputra

    2016-03-01

    Full Text Available Biotin is an essential micronutrient that acts as a co-factor for biotin-dependent metabolic enzymes. In bacteria, the supply of biotin can be achieved by de novo synthesis or import from exogenous sources. Certain bacteria are able to obtain biotin through both mechanisms while others can only fulfill their biotin requirement through de novo synthesis. Inability to fulfill their cellular demand for biotin can have detrimental consequences on cell viability and virulence. Therefore understanding the transcriptional mechanisms that regulate biotin biosynthesis and transport will extend our knowledge about bacterial survival and metabolic adaptation during pathogenesis when the supply of biotin is limited. The most extensively characterized protein that regulates biotin synthesis and uptake is BirA. In certain bacteria, such as Escherichia coli and Staphylococcus aureus, BirA is a bi-functional protein that serves as a transcriptional repressor to regulate biotin biosynthesis genes, as well as acting as a ligase to catalyze the biotinylation of biotin-dependent enzymes. Recent studies have identified two other proteins that also regulate biotin synthesis and transport, namely BioQ and BioR. This review summarizes the different transcriptional repressors and their mechanism of action. Moreover, the ability to regulate the expression of target genes through the activity of a vitamin, such as biotin, may have biotechnological applications in synthetic biology.

  4. Utilizing evolutionary information and gene expression data for estimating gene networks with bayesian network models.

    Science.gov (United States)

    Tamada, Yoshinori; Bannai, Hideo; Imoto, Seiya; Katayama, Toshiaki; Kanehisa, Minoru; Miyano, Satoru

    2005-12-01

    Since microarray gene expression data do not contain sufficient information for estimating accurate gene networks, other biological information has been considered to improve the estimated networks. Recent studies have revealed that highly conserved proteins that exhibit similar expression patterns in different organisms, have almost the same function in each organism. Such conserved proteins are also known to play similar roles in terms of the regulation of genes. Therefore, this evolutionary information can be used to refine regulatory relationships among genes, which are estimated from gene expression data. We propose a statistical method for estimating gene networks from gene expression data by utilizing evolutionarily conserved relationships between genes. Our method simultaneously estimates two gene networks of two distinct organisms, with a Bayesian network model utilizing the evolutionary information so that gene expression data of one organism helps to estimate the gene network of the other. We show the effectiveness of the method through the analysis on Saccharomyces cerevisiae and Homo sapiens cell cycle gene expression data. Our method was successful in estimating gene networks that capture many known relationships as well as several unknown relationships which are likely to be novel. Supplementary information is available at http://bonsai.ims.u-tokyo.ac.jp/~tamada/bayesnet/.

  5. Expression Profiles of Fsh-Regulated Ovarian Genes during Oogenesis in Coho Salmon

    Science.gov (United States)

    Guzmán, José M.; Luckenbach, J. Adam; Yamamoto, Yoji; Swanson, Penny

    2014-01-01

    The function of follicle-stimulating hormone (Fsh) during oogenesis in fishes is poorly understood. Using coho salmon as a fish model, we recently identified a suite of genes regulated by Fsh in vitro and involved in ovarian processes mostly unexplored in fishes, like cell proliferation, differentiation, survival or extracellular matrix (ECM) remodeling. To better understand the role of these Fsh-regulated genes during oocyte growth in fishes, we characterized their mRNA levels at discrete stages of the ovarian development in coho salmon. While most of the transcripts were expressed at low levels during primary growth (perinucleolus stage), high expression of genes associated with cell proliferation (pim1, pcna, and mcm4) and survival (ddit4l) was found in follicles at this stage. The transition to secondary oocyte growth (cortical alveolus and lipid droplet stage ovarian follicles) was characterized by a marked increase in the expression of genes related to cell survival (clu1, clu2 and ivns1abpa). Expression of genes associated with cell differentiation and growth (wt2l and adh8l), growth factor signaling (inha), steroidogenesis (cyp19a1a) and the ECM (col1a1, col1a2 and dcn) peaked in vitellogenic follicles, showing a strong and positive correlation with transcripts for fshr. Other genes regulated by Fsh and associated with ECM function (ctgf, wapl and fn1) and growth factor signaling (bmp16 and smad5l) peaked in maturing follicles, along with increases in steroidogenesis-related gene transcripts. In conclusion, ovarian genes regulated by Fsh showed marked differences in their expression patterns during oogenesis in coho salmon. Our results suggest that Fsh regulates different ovarian processes at specific stages of development, likely through interaction with other intra- or extra-ovarian factors. PMID:25485989

  6. Using riboswitches to regulate gene expression and define gene function in mycobacteria.

    Science.gov (United States)

    Van Vlack, Erik R; Seeliger, Jessica C

    2015-01-01

    Mycobacteria include both environmental species and many pathogenic species such as Mycobacterium tuberculosis, an intracellular pathogen that is the causative agent of tuberculosis in humans. Inducible gene expression is a powerful tool for examining gene function and essentiality, both in in vitro culture and in host cell infections. The theophylline-inducible artificial riboswitch has recently emerged as an alternative to protein repressor-based systems. The riboswitch is translationally regulated and is combined with a mycobacterial promoter that provides transcriptional control. We here provide methods used by our laboratory to characterize the riboswitch response to theophylline in reporter strains, recombinant organisms containing riboswitch-regulated endogenous genes, and in host cell infections. These protocols should facilitate the application of both existing and novel artificial riboswitches to the exploration of gene function in mycobacteria. © 2015 Elsevier Inc. All rights reserved.

  7. Gene regulation in the immune system by long noncoding RNAs.

    Science.gov (United States)

    Chen, Y Grace; Satpathy, Ansuman T; Chang, Howard Y

    2017-08-22

    Long noncoding RNAs (lncRNAs) are emerging as critical regulators of gene expression in the immune system. Studies have shown that lncRNAs are expressed in a highly lineage-specific manner and control the differentiation and function of innate and adaptive cell types. In this Review, we focus on mechanisms used by lncRNAs to regulate genes encoding products involved in the immune response, including direct interactions with chromatin, RNA and proteins. In addition, we address new areas of lncRNA biology, such as the functions of enhancer RNAs, circular RNAs and chemical modifications to RNA in cellular processes. We emphasize critical gaps in knowledge and future prospects for the roles of lncRNAs in the immune system and autoimmune disease.

  8. Bacterial translational regulations: high diversity between all mRNAs and major role in gene expression

    Directory of Open Access Journals (Sweden)

    Picard Flora

    2012-10-01

    Full Text Available Abstract Background In bacteria, the weak correlations at the genome scale between mRNA and protein levels suggest that not all mRNAs are translated with the same efficiency. To experimentally explore mRNA translational level regulation at the systemic level, the detailed translational status (translatome of all mRNAs was measured in the model bacterium Lactococcus lactis in exponential phase growth. Results Results demonstrated that only part of the entire population of each mRNA species was engaged in translation. For transcripts involved in translation, the polysome size reached a maximum of 18 ribosomes. The fraction of mRNA engaged in translation (ribosome occupancy and ribosome density were not constant for all genes. This high degree of variability was analyzed by bioinformatics and statistical modeling in order to identify general rules of translational regulation. For most of the genes, the ribosome density was lower than the maximum value revealing major control of translation by initiation. Gene function was a major translational regulatory determinant. Both ribosome occupancy and ribosome density were particularly high for transcriptional regulators, demonstrating the positive role of translational regulation in the coordination of transcriptional networks. mRNA stability was a negative regulatory factor of ribosome occupancy and ribosome density, suggesting antagonistic regulation of translation and mRNA stability. Furthermore, ribosome occupancy was identified as a key component of intracellular protein levels underlining the importance of translational regulation. Conclusions We have determined, for the first time in a bacterium, the detailed translational status for all mRNAs present in the cell. We have demonstrated experimentally the high diversity of translational states allowing individual gene differentiation and the importance of translation-level regulation in the complex process linking gene expression to protein

  9. Characterization of Gravity Regulated Osteoprotegerin Expression in Fish Models

    Science.gov (United States)

    Renn, J.; Nourizadeh-Lillabadi, R.; Alestrom, P.; Seibt, D.; Goerlich, R.; Schartl, M.; Winkler, C.

    Human osteoprotegerin (opg) is a secreted protein of 401 amino acids that acts as a decoy receptor for RANKL (receptor activator of NFB ligand). Opg prevents binding of RANKL to its receptor, which is present on osteoclasts and their precursors. Thereby, opg blocks the formation, differentiation and activation of osteoclasts and stimulates apoptosis of mature osteoclasts. As a consequence, opg regulates the degree of bone resorption in order to keep a constant bone mass under normal gravity conditions. Recently, clinorotation experiments using mammalian cell cultures have shown that the opg gene is down-regulated in simulated microgravity at the transcriptional level (Kanematsu et al., Bone 30, 2002). We have identified opg genes in the fish models Medaka and zebrafish to study gravity regulation of opg expression in these models at the organismal level. In Medaka embryos, opg expression starts at stages when first skeletal elements are already detectable. Putative consensus binding sites for transcription factors were identified in the promoter region of the Medaka opg gene indicating possible evolutionary conservation of gene regulatory mechanisms between fish and mammals. To analyze, whether model fish species are suitable tools to study microgravity induced changes at the molecular level in vivo, we investigated regulation of fish opg genes as a consequence of altered gravity. For this, we performed centrifugation and clinorotation experiments, subjecting fish larvae to hypergravity and simulated microgravity, and analyzed expression profiles of skeletal genes by real-time PCR. Our data represent the first experiments using whole animal model organisms to study gravity induced alteration of skeletal factors at the molecular level. Acknowledgement: This work is supported by the German Aerospace Center (DLR) (50 WB 0152) and the European Space Agency (AO-LS-99-MAP-LSS-003).

  10. Chromosome-biased binding and gene regulation by the Caenorhabditis elegans DRM complex.

    Science.gov (United States)

    Tabuchi, Tomoko M; Deplancke, Bart; Osato, Naoki; Zhu, Lihua J; Barrasa, M Inmaculada; Harrison, Melissa M; Horvitz, H Robert; Walhout, Albertha J M; Hagstrom, Kirsten A

    2011-05-01

    DRM is a conserved transcription factor complex that includes E2F/DP and pRB family proteins and plays important roles in development and cancer. Here we describe new aspects of DRM binding and function revealed through genome-wide analyses of the Caenorhabditis elegans DRM subunit LIN-54. We show that LIN-54 DNA-binding activity recruits DRM to promoters enriched for adjacent putative E2F/DP and LIN-54 binding sites, suggesting that these two DNA-binding moieties together direct DRM to its target genes. Chromatin immunoprecipitation and gene expression profiling reveals conserved roles for DRM in regulating genes involved in cell division, development, and reproduction. We find that LIN-54 promotes expression of reproduction genes in the germline, but prevents ectopic activation of germline-specific genes in embryonic soma. Strikingly, C. elegans DRM does not act uniformly throughout the genome: the DRM recruitment motif, DRM binding, and DRM-regulated embryonic genes are all under-represented on the X chromosome. However, germline genes down-regulated in lin-54 mutants are over-represented on the X chromosome. We discuss models for how loss of autosome-bound DRM may enhance germline X chromosome silencing. We propose that autosome-enriched binding of DRM arose in C. elegans as a consequence of germline X chromosome silencing and the evolutionary redistribution of germline-expressed and essential target genes to autosomes. Sex chromosome gene regulation may thus have profound evolutionary effects on genome organization and transcriptional regulatory networks.

  11. Down-Regulation of Gene Expression by RNA-Induced Gene Silencing

    Science.gov (United States)

    Travella, Silvia; Keller, Beat

    Down-regulation of endogenous genes via post-transcriptional gene silencing (PTGS) is a key to the characterization of gene function in plants. Many RNA-based silencing mechanisms such as post-transcriptional gene silencing, co-suppression, quelling, and RNA interference (RNAi) have been discovered among species of different kingdoms (plants, fungi, and animals). One of the most interesting discoveries was RNAi, a sequence-specific gene-silencing mechanism initiated by the introduction of double-stranded RNA (dsRNA), homologous in sequence to the silenced gene, which triggers degradation of mRNA. Infection of plants with modified viruses can also induce RNA silencing and is referred to as virus-induced gene silencing (VIGS). In contrast to insertional mutagenesis, these emerging new reverse genetic approaches represent a powerful tool for exploring gene function and for manipulating gene expression experimentally in cereal species such as barley and wheat. We examined how RNAi and VIGS have been used to assess gene function in barley and wheat, including molecular mechanisms involved in the process and available methodological elements, such as vectors, inoculation procedures, and analysis of silenced phenotypes.

  12. Alternative RNA Structure-Coupled Gene Regulations in Tumorigenesis

    Directory of Open Access Journals (Sweden)

    Feng-Chi Chen

    2014-12-01

    Full Text Available Alternative RNA structures (ARSs, or alternative transcript isoforms, are critical for regulating cellular phenotypes in humans. In addition to generating functionally diverse protein isoforms from a single gene, ARS can alter the sequence contents of 5'/3' untranslated regions (UTRs and intronic regions, thus also affecting the regulatory effects of these regions. ARS may introduce premature stop codon(s into a transcript, and render the transcript susceptible to nonsense-mediated decay, which in turn can influence the overall gene expression level. Meanwhile, ARS can regulate the presence/absence of upstream open reading frames and microRNA targeting sites in 5'UTRs and 3'UTRs, respectively, thus affecting translational efficiencies and protein expression levels. Furthermore, since ARS may alter exon-intron structures, it can influence the biogenesis of intronic microRNAs and indirectly affect the expression of the target genes of these microRNAs. The connections between ARS and multiple regulatory mechanisms underline the importance of ARS in determining cell fate. Accumulating evidence indicates that ARS-coupled regulations play important roles in tumorigenesis. Here I will review our current knowledge in this field, and discuss potential future directions.

  13. Globalisation reaches gene regulation: the case for vertebrate limb development.

    Science.gov (United States)

    Zuniga, Aimée

    2005-08-01

    Analysis of key regulators of vertebrate limb development has revealed that the cis-regulatory regions controlling their expression are often located several hundred kilobases upstream of the transcription units. These far up- or down-stream cis-regulatory regions tend to reside within rather large, functionally and structurally unrelated genes. Molecular analysis is beginning to reveal the complexity of these large genomic landscapes, which control the co-expression of clusters of diverse genes by this novel type of long-range and globally acting cis-regulatory region. An increasing number of spontaneous mutations in vertebrates, including humans, are being discovered inactivating or altering such global control regions. Thereby, the functions of a seemingly distant but essential gene are disrupted rather than the closest.

  14. Regulation of vesicular trafficking by Parkinson's disease-associated genes

    Directory of Open Access Journals (Sweden)

    Tsuyoshi Inoshita

    2015-10-01

    Full Text Available The regulatory mechanisms that control intracellular vesicular trafficking play important roles in cellular function and viability. Neurons have specific vesicular trafficking systems for synaptic vesicle formation, release and recycling. Synaptic vesicular trafficking impairments induce neuronal dysfunction and physiological and behavioral disorders. Parkinson's disease (PD is an age-dependent neurodegenerative disorder characterized by dopamine depletion and loss of dopamine neurons in the midbrain. The molecular mechanism responsible for the neurodegeneration that occurs during PD is still not understood; however, recent functional analyses of familial PD causative genes suggest that a number of PD causative genes regulate intracellular vesicular trafficking, including synaptic vesicular dynamics. This review focuses on recent insights regarding the functions of PD causative genes, their relationship with vesicular trafficking and how mutations associated with PD affect vesicular dynamics and neuronal survival.

  15. Methods and compositions for regulating gene expression in plant cells

    Science.gov (United States)

    Beachy, Roger N. (Inventor); Luis, Maria Isabel Ordiz (Inventor); Dai, Shunhong (Inventor)

    2010-01-01

    Novel chimeric plant promoter sequences are provided, together with plant gene expression cassettes comprising such sequences. In certain preferred embodiments, the chimeric plant promoters comprise the BoxII cis element and/or derivatives thereof. In addition, novel transcription factors are provided, together with nucleic acid sequences encoding such transcription factors and plant gene expression cassettes comprising such nucleic acid sequences. In certain preferred embodiments, the novel transcription factors comprise the acidic domain, or fragments thereof, of the RF2a transcription factor. Methods for using the chimeric plant promoter sequences and novel transcription factors in regulating the expression of at least one gene of interest are provided, together with transgenic plants comprising such chimeric plant promoter sequences and novel transcription factors.

  16. LEF-1 Regulates Tyrosinase Gene Transcription In Vitro.

    Directory of Open Access Journals (Sweden)

    Xueping Wang

    Full Text Available TYR, DCT and MITF are three important genes involved in maintaining the mature phenotype and producing melanin; they therefore participate in neural crest cell development into melanocytes. Previous studies have revealed that the Wnt signaling factor lymphoid enhancer-binding factor (LEF-1 can enhance DCT and MITF gene expression. However, whether LEF-1 also affects TYR gene expression remains unclear. In the present study, we found that LEF-1 regulated TYR transcription in vitro. LEF-1 overexpression increased TYR gene promoter activity, whereas LEF-1 knockdown by RNA interference significantly decreased TYR expression. Moreover, the core GTTTGAT sequence (-56 to -50 within the TYR promoter is essential for the effect of LEF-1 on TYR expression, and chromatin immunoprecipitation (ChIP assay indicated that endogenous LEF-1 interacts with the TYR promoter. In addition, we observed a synergistic transactivation of the TYR promoter by LEF-1 and MITF. These data suggest that Wnt signaling plays an important role in regulating melanocyte development and differentiation.

  17. Gene regulation networks generate diverse pigmentation patterns in plants.

    Science.gov (United States)

    Albert, Nick W; Davies, Kevin M; Schwinn, Kathy E

    2014-01-01

    The diversity of pigmentation patterns observed in plants occurs due to the spatial distribution and accumulation of colored compounds, which may also be associated with structural changes to the tissue. Anthocyanins are flavonoids that provide red/purple/blue coloration to plants, often forming complex patterns such as spots, stripes, and vein-associated pigmentation, particularly in flowers. These patterns are determined by the activity of MYB-bHLH-WDR (MBW) transcription factor complexes, which activate the anthocyanin biosynthesis genes, resulting in anthocyanin pigment accumulation. Recently, we established that the MBW complex controlling anthocyanin synthesis acts within a gene regulation network that is conserved within at least the Eudicots. This network involves hierarchy, reinforcement, and feedback mechanisms that allow for stringent and responsive regulation of the anthocyanin biosynthesis genes. The gene network and mobile nature of the WDR and R3-MYB proteins provide exciting new opportunities to explore the basis of pigmentation patterning, and to investigate the evolutionary history of the MBW components in land plants.

  18. From genes to milk: genomic organization and epigenetic regulation of the mammary transcriptome.

    Science.gov (United States)

    Lemay, Danielle G; Pollard, Katherine S; Martin, William F; Freeman Zadrowski, Courtneay; Hernandez, Joseph; Korf, Ian; German, J Bruce; Rijnkels, Monique

    2013-01-01

    Even in genomes lacking operons, a gene's position in the genome influences its potential for expression. The mechanisms by which adjacent genes are co-expressed are still not completely understood. Using lactation and the mammary gland as a model system, we explore the hypothesis that chromatin state contributes to the co-regulation of gene neighborhoods. The mammary gland represents a unique evolutionary model, due to its recent appearance, in the context of vertebrate genomes. An understanding of how the mammary gland is regulated to produce milk is also of biomedical and agricultural importance for human lactation and dairying. Here, we integrate epigenomic and transcriptomic data to develop a comprehensive regulatory model. Neighborhoods of mammary-expressed genes were determined using expression data derived from pregnant and lactating mice and a neighborhood scoring tool, G-NEST. Regions of open and closed chromatin were identified by ChIP-Seq of histone modifications H3K36me3, H3K4me2, and H3K27me3 in the mouse mammary gland and liver tissue during lactation. We found that neighborhoods of genes in regions of uniquely active chromatin in the lactating mammary gland, compared with liver tissue, were extremely rare. Rather, genes in most neighborhoods were suppressed during lactation as reflected in their expression levels and their location in regions of silenced chromatin. Chromatin silencing was largely shared between the liver and mammary gland during lactation, and what distinguished the mammary gland was mainly a small tissue-specific repertoire of isolated, expressed genes. These findings suggest that an advantage of the neighborhood organization is in the collective repression of groups of genes via a shared mechanism of chromatin repression. Genes essential to the mammary gland's uniqueness are isolated from neighbors, and likely have less tolerance for variation in expression, properties they share with genes responsible for an organism's survival.

  19. Gene expression regulation of Bcl2, Bax and cytochrome-C by geraniol on chronic MPTP/probenecid induced C57BL/6 mice model of Parkinson's disease.

    Science.gov (United States)

    Rekha, Karamkolly R; Selvakumar, Govindasamy P

    2014-06-25

    Parkinson's disease (PD) is a common disabling movement disorder owing to progressive depletion of dopamine in nigrostriatal region, and can be experimentally accelerated by the neurotoxin 1-methyl-4-phenyl-1, 2, 3, 6-tetrahydropyridine (MPTP). MPTP-treated mice are a representative animal model for searching for the therapeutic agents for PD without adverse effect. In this study we investigated the effect of geraniol (GE) on chronic MPTP/probenecid (MPTP/p) induced apoptotic changes in nigrostriatal region. We observed that chronic exposure to MPTP/p led to increased expression of apoptotic markers, results in neurodegeneration and motor behavioral impairments in mice. Pretreatment with GE to MPTP/p significantly improved motor functions and ameliorated striatal antioxidant balance. In addition, GE attenuated the expression of apoptotic markers evident by the normalized Bcl-2/Bax ratio and decreased expression of cytochrome-C and caspase-9 in the substantia nigra and striatum of MPTP/p induced mice model of PD. The findings of the present study suggested that GE, a new therapeutic potential avenue may have beneficial effects in slowing or preventing the progression of PD and other neurodegenerative disorders. Copyright © 2014 Elsevier Ireland Ltd. All rights reserved.

  20. Decorin gene expression and its regulation in human keratinocytes

    International Nuclear Information System (INIS)

    Highlights: → We showed that cultured human diploid epidermal keratinocytes express and synthesize decorin. → Decorin is found intracytoplasmic in suprabasal cells of cultures and in human epidermis. → Decorin mRNA expression in cHEK is regulated by pro-inflammatory and proliferative cytokines. → Decorin immunostaining of psoriatic lesions showed a lower intensity and altered intracytoplasmic arrangements. -- Abstract: In various cell types, including cancer cells, decorin is involved in regulation of cell attachment, migration and proliferation. In skin, decorin is seen in dermis, but not in keratinocytes. We show that decorin gene (DCN) is expressed in the cultured keratinocytes, and the protein is found in the cytoplasm of differentiating keratinocytes and in suprabasal layers of human epidermis. RT-PCR experiments showed that DCN expression is regulated by pro-inflammatory and proliferative cytokines. Our data suggest that decorin should play a significant role in keratinocyte terminal differentiation, cutaneous homeostasis and dermatological diseases.

  1. Decorin gene expression and its regulation in human keratinocytes

    Energy Technology Data Exchange (ETDEWEB)

    Velez-DelValle, Cristina; Marsch-Moreno, Meytha; Castro-Munozledo, Federico [Department of Cell Biology, Centro de Investigacion y de Estudios Avanzados del IPN, Apdo. Postal 14-740, Mexico D.F. 07000 (Mexico); Kuri-Harcuch, Walid, E-mail: walidkuri@gmail.com [Department of Cell Biology, Centro de Investigacion y de Estudios Avanzados del IPN, Apdo. Postal 14-740, Mexico D.F. 07000 (Mexico)

    2011-07-22

    Highlights: {yields} We showed that cultured human diploid epidermal keratinocytes express and synthesize decorin. {yields} Decorin is found intracytoplasmic in suprabasal cells of cultures and in human epidermis. {yields} Decorin mRNA expression in cHEK is regulated by pro-inflammatory and proliferative cytokines. {yields} Decorin immunostaining of psoriatic lesions showed a lower intensity and altered intracytoplasmic arrangements. -- Abstract: In various cell types, including cancer cells, decorin is involved in regulation of cell attachment, migration and proliferation. In skin, decorin is seen in dermis, but not in keratinocytes. We show that decorin gene (DCN) is expressed in the cultured keratinocytes, and the protein is found in the cytoplasm of differentiating keratinocytes and in suprabasal layers of human epidermis. RT-PCR experiments showed that DCN expression is regulated by pro-inflammatory and proliferative cytokines. Our data suggest that decorin should play a significant role in keratinocyte terminal differentiation, cutaneous homeostasis and dermatological diseases.

  2. Detection and sequence analysis of accessory gene regulator genes of Staphylococcus pseudintermedius isolates

    Directory of Open Access Journals (Sweden)

    M. Ananda Chitra

    2015-07-01

    Full Text Available Background: Staphylococcus pseudintermedius (SP is the major pathogenic species of dogs involved in a wide variety of skin and soft tissue infections. The accessory gene regulator (agr locus of Staphylococcus aureus has been extensively studied, and it influences the expression of many virulence genes. It encodes a two-component signal transduction system that leads to down-regulation of surface proteins and up-regulation of secreted proteins during in vitro growth of S. aureus. The objective of this study was to detect and sequence analyzing the AgrA, B, and D of SP isolated from canine skin infections. Materials and Methods: In this study, we have isolated and identified SP from canine pyoderma and otitis cases by polymerase chain reaction (PCR and confirmed by PCR-restriction fragment length polymorphism. Primers for SP agrA and agrBD genes were designed using online primer designing software and BLAST searched for its specificity. Amplification of the agr genes was carried out for 53 isolates of SP by PCR and sequencing of agrA, B, and D were carried out for five isolates and analyzed using DNAstar and Mega5.2 software. Results: A total of 53 (59% SP isolates were obtained from 90 samples. 15 isolates (28% were confirmed to be methicillinresistant SP (MRSP with the detection of the mecA gene. Accessory gene regulator A, B, and D genes were detected in all the SP isolates. Complete nucleotide sequences of the above three genes for five isolates were submitted to GenBank, and their accession numbers are from KJ133557 to KJ133571. AgrA amino acid sequence analysis showed that it is mainly made of alpha-helices and is hydrophilic in nature. AgrB is a transmembrane protein, and AgrD encodes the precursor of the autoinducing peptide (AIP. Sequencing of the agrD gene revealed that the 5 canine SP strains tested could be divided into three Agr specificity groups (RIPTSTGFF, KIPTSTGFF, and RIPISTGFF based on the putative AIP produced by each strain

  3. Nicotinamide riboside restores cognition through an upregulation of proliferator-activated receptor-γ coactivator 1α regulated β-secretase 1 degradation and mitochondrial gene expression in Alzheimer’s mouse models

    Science.gov (United States)

    Gong, Bing; Pan, Yong; Vempati, Prashant; Zhao, Wei; Knable, Lindsay; Ho, Lap; Wang, Jun; Sastre, Magdalena; Ono, Kenjiro; Sauve, Anthony A.; Pasinetti, Giulio M.

    2013-01-01

    Nicotinamide adenine dinucleotide (NAD)+, a coenzyme involved in redox activities in the mitochondrial electron transport chain, has been identified as a key regulator of the lifespan-extending effects, and the activation of NAD+ expression has been linked with a decrease in beta-amyloid (Aβ) toxicity in Alzheimer’s disease (AD). Nicotinamide riboside (NR) is a NAD+ precursor, it promotes peroxisome proliferator-activated receptor-γ coactivator 1 (PGC)-1α expression in the brain. Evidence has shown that PGC-1α is a crucial regulator of Aβ generation because it affects β-secretase (BACE1) degradation. In this study we tested the hypothesis that NR treatment in an AD mouse model could attenuate Aβ toxicity through the activation of PGC-1α-mediated BACE1 degradation. Using the Tg2576 AD mouse model, using in vivo behavioral analyses, biochemistry assays, small hairpin RNA (shRNA) gene silencing and electrophysiological recording, we found (1) dietary treatment of Tg2576 mice with 250 mg/kg/day of NR for 3 months significantly attenuates cognitive deterioration in Tg2576 mice and coincides with an increase in the steady-state levels of NAD+ in the cerebral cortex; (2) application of NR to hippocampal slices (10 µM) for 4 hours abolishes the deficits in long-term potentiation recorded in the CA1 region of Tg2576 mice; (3) NR treatment promotes PGC-1α expression in the brain coinciding with enhanced degradation of BACE1 and the reduction of Aβ production in Tg2576 mice. Further in vitro studies confirmed that BACE1 protein content is decreased by NR treatment in primary neuronal cultures derived from Tg2576 embryos, in which BACE1 degradation was prevented by PGC-1α-shRNA gene silencing; and (4) NR treatment and PGC-1α overexpression enhance BACE1 ubiquitination and proteasomal degradation. Our studies suggest that dietary treatment with NR might benefit AD cognitive function and synaptic plasticity, inpart by promoting PGC-1α-mediated BACE1

  4. Nicotinamide riboside restores cognition through an upregulation of proliferator-activated receptor-γ coactivator 1α regulated β-secretase 1 degradation and mitochondrial gene expression in Alzheimer's mouse models.

    Science.gov (United States)

    Gong, Bing; Pan, Yong; Vempati, Prashant; Zhao, Wei; Knable, Lindsay; Ho, Lap; Wang, Jun; Sastre, Magdalena; Ono, Kenjiro; Sauve, Anthony A; Pasinetti, Giulio M

    2013-06-01

    Nicotinamide adenine dinucleotide (NAD)(+), a coenzyme involved in redox activities in the mitochondrial electron transport chain, has been identified as a key regulator of the lifespan-extending effects, and the activation of NAD(+) expression has been linked with a decrease in beta-amyloid (Aβ) toxicity in Alzheimer's disease (AD). Nicotinamide riboside (NR) is a NAD(+) precursor, it promotes peroxisome proliferator-activated receptor-γ coactivator 1 (PGC)-1α expression in the brain. Evidence has shown that PGC-1α is a crucial regulator of Aβ generation because it affects β-secretase (BACE1) degradation. In this study we tested the hypothesis that NR treatment in an AD mouse model could attenuate Aβ toxicity through the activation of PGC-1α-mediated BACE1 degradation. Using the Tg2576 AD mouse model, using in vivo behavioral analyses, biochemistry assays, small hairpin RNA (shRNA) gene silencing and electrophysiological recording, we found (1) dietary treatment of Tg2576 mice with 250 mg/kg/day of NR for 3 months significantly attenuates cognitive deterioration in Tg2576 mice and coincides with an increase in the steady-state levels of NAD(+) in the cerebral cortex; (2) application of NR to hippocampal slices (10 μM) for 4 hours abolishes the deficits in long-term potentiation recorded in the CA1 region of Tg2576 mice; (3) NR treatment promotes PGC-1α expression in the brain coinciding with enhanced degradation of BACE1 and the reduction of Aβ production in Tg2576 mice. Further in vitro studies confirmed that BACE1 protein content is decreased by NR treatment in primary neuronal cultures derived from Tg2576 embryos, in which BACE1 degradation was prevented by PGC-1α-shRNA gene silencing; and (4) NR treatment and PGC-1α overexpression enhance BACE1 ubiquitination and proteasomal degradation. Our studies suggest that dietary treatment with NR might benefit AD cognitive function and synaptic plasticity, in part by promoting PGC-1α-mediated BACE1

  5. Distinguishing the Transcription Regulation Patterns in Promoters of Human Genes with Different Function or Evolutionary Age

    KAUST Repository

    Alam, Tanvir

    2012-07-01

    Distinguishing transcription regulatory patterns of different gene groups is a common problem in various bioinformatics studies. In this work we developed a methodology to deal with such a problem based on machine learning techniques. We applied our method to two biologically important problems related to detecting a difference in transcription regulation of: a/ protein-coding and long non-coding RNAs (lncRNAs) in human, as well as b/ a difference between primate-specific and non-primate-specific long non-coding RNAs. Our method is capable to classify RNAs using various regulatory features of genes that transcribe into these RNAs, such as nucleotide frequencies, transcription factor binding sites, de novo sequence motifs, CpG islands, repetitive elements, histone modification marks, and others. Ten-fold cross-validation tests suggest that our model can distinguish protein-coding and non-coding RNAs with accuracy above 80%. Twenty-fold cross-validation tests suggest that our model can distinguish primate-specific from non-primate-specific promoters of lncRNAs with accuracy above 80%. Consequently, we can hypothesize that transcription of the groups of genes mentioned above are regulated by different mechanisms. Feature selection techniques allowed us to reduce the number of features significantly while keeping the accuracy around 80%. Consequently, we can conclude that selected features play significant role in transcription regulation of coding and non-coding genes, as well as primate-specific and non-primate-specific lncRNA genes.

  6. Phasevarion mediated epigenetic gene regulation in Helicobacter pylori.

    Directory of Open Access Journals (Sweden)

    Yogitha N Srikhanta

    Full Text Available Many host-adapted bacterial pathogens contain DNA methyltransferases (mod genes that are subject to phase-variable expression (high-frequency reversible ON/OFF switching of gene expression. In Haemophilus influenzae and pathogenic Neisseria, the random switching of the modA gene, associated with a phase-variable type III restriction modification (R-M system, controls expression of a phase-variable regulon of genes (a "phasevarion", via differential methylation of the genome in the modA ON and OFF states. Phase-variable type III R-M systems are also found in Helicobacter pylori, suggesting that phasevarions may also exist in this key human pathogen. Phylogenetic studies on the phase-variable type III modH gene revealed that there are 17 distinct alleles in H. pylori, which differ only in their DNA recognition domain. One of the most commonly found alleles was modH5 (16% of isolates. Microarray analysis comparing the wild-type P12modH5 ON strain to a P12ΔmodH5 mutant revealed that six genes were either up- or down-regulated, and some were virulence-associated. These included flaA, which encodes a flagella protein important in motility and hopG, an outer membrane protein essential for colonization and associated with gastric cancer. This study provides the first evidence of this epigenetic mechanism of gene expression in H. pylori. Characterisation of H. pylori modH phasevarions to define stable immunological targets will be essential for vaccine development and may also contribute to understanding H. pylori pathogenesis.

  7. DMPD: Interferon gene regulation: not all roads lead to Tolls. [Dynamic Macrophage Pathway CSML Database

    Lifescience Database Archive (English)

    Full Text Available 16095970 Interferon gene regulation: not all roads lead to Tolls. Jefferies CA, Fit...zgerald KA. Trends Mol Med. 2005 Sep;11(9):403-11. (.png) (.svg) (.html) (.csml) Show Interferon gene regulation: not all roads lead... to Tolls. PubmedID 16095970 Title Interferon gene regulation: not all roads lead to

  8. Strategies to identify long noncoding RNAs involved in gene regulation

    Directory of Open Access Journals (Sweden)

    Lee Catherine

    2012-11-01

    Full Text Available Abstract Long noncoding RNAs (lncRNAs have been detected in nearly every cell type and found to be fundamentally involved in many biological processes. The characterization of lncRNAs has immense potential to advance our comprehensive understanding of cellular processes and gene regulation, along with implications for the treatment of human disease. The recent ENCODE (Encyclopedia of DNA Elements study reported 9,640 lncRNA loci in the human genome, which corresponds to around half the number of protein-coding genes. Because of this sheer number and their functional diversity, it is crucial to identify a pool of potentially relevant lncRNAs early on in a given study. In this review, we evaluate the methods for isolating lncRNAs by immunoprecipitation and review the advantages, disadvantages, and applications of three widely used approaches – microarray, tiling array, and RNA-seq – for identifying lncRNAs involved in gene regulation. We also look at ways in which data from publicly available databases such as ENCODE can support the study of lncRNAs.

  9. Regulation of Flavonoid Biosynthetic Genes in Germinating Arabidopsis Seedlings.

    Science.gov (United States)

    Kubasek, WL; Shirley, BW; McKillop, A; Goodman, HM; Briggs, W; Ausubel, FM

    1992-01-01

    Many higher plants, including Arabidopsis, transiently display purple anthocyanin pigments just after seed germination. We observed that steady state levels of mRNAs encoded by four flavonoid biosynthetic genes, PAL1 (encoding phenylalanine ammonia-lyase 1), CHS (encoding chalcone synthase), CHI (encoding chalcone isomerase), and DFR (encoding dihydroflavonol reductase), were temporally regulated, peaking in 3-day-old seedlings grown in continuous white light. Except for the case of PAL1 mRNA, mRNA levels for these flavonoid genes were very low in seedlings grown in darkness. Light induction studies using seedlings grown in darkness showed that PAL1 mRNA began to accumulate before CHS and CHI mRNAs, which, in turn, began to accumulate before DFR mRNA. This order of induction is the same as the order of the biosynthetic steps in flavonoid biosynthesis. Our results suggest that the flavonoid biosynthetic pathway is coordinately regulated by a developmental timing mechanism during germination. Blue light and UVB light induction experiments using red light- and dark-grown seedlings showed that the flavonoid biosynthetic genes are induced most effectively by UVB light and that blue light induction is mediated by a specific blue light receptor. PMID:12297632

  10. Synthetic RNAs for Gene Regulation: Design Principles and Computational Tools

    International Nuclear Information System (INIS)

    Laganà, Alessandro; Shasha, Dennis; Croce, Carlo Maria

    2014-01-01

    The use of synthetic non-coding RNAs for post-transcriptional regulation of gene expression has not only become a standard laboratory tool for gene functional studies but it has also opened up new perspectives in the design of new and potentially promising therapeutic strategies. Bioinformatics has provided researchers with a variety of tools for the design, the analysis, and the evaluation of RNAi agents such as small-interfering RNA (siRNA), short-hairpin RNA (shRNA), artificial microRNA (a-miR), and microRNA sponges. More recently, a new system for genome engineering based on the bacterial CRISPR-Cas9 system (Clustered Regularly Interspaced Short Palindromic Repeats), was shown to have the potential to also regulate gene expression at both transcriptional and post-transcriptional level in a more specific way. In this mini review, we present RNAi and CRISPRi design principles and discuss the advantages and limitations of the current design approaches.

  11. Feedback regulation of DNA methyltransferase gene expression by methylation.

    Science.gov (United States)

    Slack, A; Cervoni, N; Pinard, M; Szyf, M

    1999-08-01

    This paper tests the hypothesis that expression of the DNA methyltransferase, dnmt1, gene is regulated by a methylation-sensitive DNA element. Methylation of DNA is an attractive system for feedback regulation of DNA methyltransferase as the final product of the reaction, methylated DNA, can regulate gene expression in cis. We show that an AP-1-dependent regulatory element of dnmt1 is heavily methylated in most somatic tissues and in the mouse embryonal cell line, P19, and completely unmethylated in a mouse adrenal carcinoma cell line, Y1. dnmt1 is highly over expressed in Y1 relative to P19 cell lines. Global inhibition of DNA methylation in P19 cells by 5-azadeoxycytidine results in demethylation of the AP-1 regulatory region and induction of dnmt1 expression in P19cells, but not Y1 cells. We propose that this regulatory region of dnmt1 acts as a sensor of the DNA methylation capacity of the cell. These results provide an explanation for the documented coexistence of global hypomethylation and high levels of DNA methyltransferase activity in many cancer cells and for the carcinogenic effect of hypomethylating diets.

  12. Integrative analysis of a cross-loci regulation network identifies App as a gene regulating insulin secretion from pancreatic islets.

    Directory of Open Access Journals (Sweden)

    Zhidong Tu

    Full Text Available Complex diseases result from molecular changes induced by multiple genetic factors and the environment. To derive a systems view of how genetic loci interact in the context of tissue-specific molecular networks, we constructed an F2 intercross comprised of >500 mice from diabetes-resistant (B6 and diabetes-susceptible (BTBR mouse strains made genetically obese by the Leptin(ob/ob mutation (Lep(ob. High-density genotypes, diabetes-related clinical traits, and whole-transcriptome expression profiling in five tissues (white adipose, liver, pancreatic islets, hypothalamus, and gastrocnemius muscle were determined for all mice. We performed an integrative analysis to investigate the inter-relationship among genetic factors, expression traits, and plasma insulin, a hallmark diabetes trait. Among five tissues under study, there are extensive protein-protein interactions between genes responding to different loci in adipose and pancreatic islets that potentially jointly participated in the regulation of plasma insulin. We developed a novel ranking scheme based on cross-loci protein-protein network topology and gene expression to assess each gene's potential to regulate plasma insulin. Unique candidate genes were identified in adipose tissue and islets. In islets, the Alzheimer's gene App was identified as a top candidate regulator. Islets from 17-week-old, but not 10-week-old, App knockout mice showed increased insulin secretion in response to glucose or a membrane-permeant cAMP analog, in agreement with the predictions of the network model. Our result provides a novel hypothesis on the mechanism for the connection between two aging-related diseases: Alzheimer's disease and type 2 diabetes.

  13. Hedgehog signaling regulates gene expression in planarian glia.

    Science.gov (United States)

    Wang, Irving E; Lapan, Sylvain W; Scimone, M Lucila; Clandinin, Thomas R; Reddien, Peter W

    2016-09-09

    Hedgehog signaling is critical for vertebrate central nervous system (CNS) development, but its role in CNS biology in other organisms is poorly characterized. In the planarian Schmidtea mediterranea, hedgehog (hh ) is expressed in medial cephalic ganglia neurons, suggesting a possible role in CNS maintenance or regeneration. We performed RNA sequencing of planarian brain tissue following RNAi of hh and patched (ptc) , which encodes the Hh receptor. Two misregulated genes, intermediate filament-1 (if-1 ) and calamari (cali ), were expressed in a previously unidentified non-neural CNS cell type. These cells expressed orthologs of astrocyte-associated genes involved in neurotransmitter uptake and metabolism, and extended processes enveloping regions of high synapse concentration. We propose that these cells are planarian glia. Planarian glia were distributed broadly, but only expressed if-1 and cali in the neuropil near hh + neurons. Planarian glia and their regulation by Hedgehog signaling present a novel tractable system for dissection of glia biology.

  14. Dynamic regulation of cerebral DNA repair genes by psychological stress

    DEFF Research Database (Denmark)

    Forsberg, Kristin; Aalling, Nadia; Wörtwein, Gitta

    2015-01-01

    for maintaining genomic integrity. The aim of the present study was to characterize the pattern of cerebral DNA repair enzyme regulation after stress through the quantification of a targeted range of gene products involved in different types of DNA repair. 72 male Sprague-Dawley rats were subjected to either......Neuronal genotoxic insults from oxidative stress constitute a putative molecular link between stress and depression on the one hand, and cognitive dysfunction and dementia risk on the other. Oxidative modifications to DNA are repaired by specific enzymes; a process that plays a critical role...... restraint stress (6h/day) or daily handling (controls), and sacrificed after 1, 7 or 21 stress sessions. The mRNA expression of seven genes (Ogg1, Ape1, Ung1, Neil1, Xrcc1, Ercc1, Nudt1) involved in the repair of oxidatively damaged DNA was determined by quantitative real time polymerase chain reaction...

  15. Application of Gene Shaving and Mixture Models to Cluster Microarray Gene Expression Data

    Directory of Open Access Journals (Sweden)

    S. Wen

    2007-01-01

    Full Text Available Researchers are frequently faced with the analysis of microarray data of a relatively large number of genes using a small number of tissue samples. We examine the application of two statistical methods for clustering such microarray expression data: EMMIX-GENE and GeneClust. EMMIX-GENE is a mixture-model based clustering approach, designed primarily to cluster tissue samples on the basis of the genes. GeneClust is an implementation of the gene shaving methodology, motivated by research to identify distinct sets of genes for which variation in expression could be related to a biological property of the tissue samples. We illustrate the use of these two methods in the analysis of Affymetrix oligonucleotide arrays of well-known data sets from colon tissue samples with and without tumors, and of tumor tissue samples from patients with leukemia. Although the two approaches have been developed from different perspectives, the results demonstrate a clear correspondence between gene clusters produced by GeneClust and EMMIX-GENE for the colon tissue data. It is demonstrated, for the case of ribosomal proteins and smooth muscle genes in the colon data set, that both methods can classify genes into co-regulated families. It is further demonstrated that tissue types (tumor and normal can be separated on the basis of subtle distributed patterns of genes. Application to the leukemia tissue data produces a division of tissues corresponding closely to the external classification, acute myeloid leukemia (AML and acute lymphoblastic leukaemia (ALL, for both methods. In addition, we also identify genes specifi c for the subgroup of ALL-T cell samples. Overall, we find that the gene shaving method produces gene clusters at great speed; allows variable cluster sizes and can incorporate partial or full supervision; and finds clusters of genes in which the gene expression varies greatly over the tissue samples while maintaining a high level of coherence between the

  16. Gene networks and the neuroendocrine regulation of puberty.

    Science.gov (United States)

    Ojeda, Sergio R; Dubay, Christopher; Lomniczi, Alejandro; Kaidar, Gabi; Matagne, Valerie; Sandau, Ursula S; Dissen, Gregory A

    2010-08-05

    A sustained increase in pulsatile release of gonadotrophin releasing hormone (GnRH) from the hypothalamus is an essential, final event that defines the initiation of mammalian puberty. This increase depends on coordinated changes in transsynaptic and glial-neuronal communication, consisting of activating neuronal and glial excitatory inputs to the GnRH neuronal network and the loss of transsynaptic inhibitory tone. It is now clear that the prevalent excitatory systems stimulating GnRH secretion involve a neuronal component consisting of excitatory amino acids (glutamate) and at least one peptide (kisspeptin), and a glial component that uses growth factors and small molecules for cell-cell signaling. GABAergic and opiatergic neurons provide transsynaptic inhibitory control to the system, but GABA neurons also exert direct excitatory effects on GnRH neurons. The molecular mechanisms that provide encompassing coordination to this cellular network are not known, but they appear to involve a host of functionally related genes hierarchically arranged. We envision that, as observed in other gene networks, the highest level of control in this network is provided by transcriptional regulators that, by directing expression of key subordinate genes, impose an integrative level of coordination to the neuronal and glial subsets involved in initiating the pubertal process. The use of high-throughput and gene manipulation approaches coupled to systems biology strategies should provide not only the experimental bases supporting this concept, but also unveil the existence of crucial components of network control not yet identified. Copyright (c) 2009 Elsevier Ireland Ltd. All rights reserved.

  17. Different promoter affinities account for specificity in MYC-dependent gene regulation

    Science.gov (United States)

    Lorenzin, Francesca; Benary, Uwe; Baluapuri, Apoorva; Walz, Susanne; Jung, Lisa Anna; von Eyss, Björn; Kisker, Caroline; Wolf, Jana; Eilers, Martin; Wolf, Elmar

    2016-01-01

    Enhanced expression of the MYC transcription factor is observed in the majority of tumors. Two seemingly conflicting models have been proposed for its function: one proposes that MYC enhances expression of all genes, while the other model suggests gene-specific regulation. Here, we have explored the hypothesis that specific gene expression profiles arise since promoters differ in affinity for MYC and high-affinity promoters are fully occupied by physiological levels of MYC. We determined cellular MYC levels and used RNA- and ChIP-sequencing to correlate promoter occupancy with gene expression at different concentrations of MYC. Mathematical modeling showed that binding affinities for interactions of MYC with DNA and with core promoter-bound factors, such as WDR5, are sufficient to explain promoter occupancies observed in vivo. Importantly, promoter affinity stratifies different biological processes that are regulated by MYC, explaining why tumor-specific MYC levels induce specific gene expression programs and alter defined biological properties of cells. DOI: http://dx.doi.org/10.7554/eLife.15161.001 PMID:27460974

  18. SUPERMAN, a regulator of floral homeotic genes in Arabidopsis.

    Science.gov (United States)

    Bowman, J L; Sakai, H; Jack, T; Weigel, D; Mayer, U; Meyerowitz, E M

    1992-03-01

    We describe a locus, SUPERMAN, mutations in which result in extra stamens developing at the expense of the central carpels in the Arabidopsis thaliana flower. The development of superman flowers, from initial primordium to mature flower, is described by scanning electron microscopy. The development of doubly and triply mutant strains, constructed with superman alleles and previously identified homeotic mutations that cause alterations in floral organ identity, is also described. Essentially additive phenotypes are observed in superman agamous and superman apetala2 double mutants. The epistatic relationships observed between either apetala3 or pistillata and superman alleles suggest that the SUPERMAN gene product could be a regulator of these floral homeotic genes. To test this, the expression patterns of AGAMOUS and APETALA3 were examined in superman flowers. In wild-type flowers, APETALA3 expression is restricted to the second and third whorls where it is required for the specification of petals and stamens. In contrast, in superman flowers, APETALA3 expression expands to include most of the cells that would normally constitute the fourth whorl. This ectopic APETALA3 expression is proposed to be one of the causes of the development of the extra stamens in superman flowers. The spatial pattern of AGAMOUS expression remains unaltered in superman flowers as compared to wild-type flowers. Taken together these data indicate that one of the functions of the wild-type SUPERMAN gene product is to negatively regulate APETALA3 in the fourth whorl of the flower. In addition, superman mutants exhibit a loss of determinacy of the floral meristem, an effect that appears to be mediated by the APETALA3 and PISTILLATA gene products.

  19. Gene Regulation and Quality Control in Murine Polyomavirus Infection

    Directory of Open Access Journals (Sweden)

    Gordon G. Carmichael

    2016-10-01

    Full Text Available Murine polyomavirus (MPyV infects mouse cells and is highly oncogenic in immunocompromised hosts and in other rodents. Its genome is a small, circular DNA molecule of just over 5000 base pairs and it encodes only seven polypeptides. While seemingly simply organized, this virus has adopted an unusual genome structure and some unusual uses of cellular quality control pathways that, together, allow an amazingly complex and varied pattern of gene regulation. In this review we discuss how MPyV leverages these various pathways to control its life cycle.

  20. Shh regulates chick Ebf1 gene expression in somite development.

    Science.gov (United States)

    El-Magd, Mohammed Abu; Allen, Steve; McGonnell, Imelda; Mansour, Ali A; Otto, Anthony; Patel, Ketan

    2015-01-01

    The chick early B-cell factor 1 (cEbf1) is a member of EBF family of helix loop helix transcription factors. Recently, we have proved that cEbf1 expression in feather is regulated by Shh. It is therefore possible that the somitic expression of cEbf1 is controlled by Shh signals from the notochord. To assess this hypothesis, the expression profile of cEbf1 was first detailed in somites of chick embryos (from HH8 to HH28). cEbf1 expression was mainly localised in the medial sclerotome and later around the vertebral cartilage anlagen of body and pedicles. Tissue manipulations (notochord ablation) and Shh gain and loss of function experiments were then performed to analyse whether the notochord and/or Shh regulate cEbf1 expression. Results from these experiments confirmed our hypothesis that the medial somitic expression of cEbf1 is regulated by Shh from the notochord. In conclusion, cEbf1 gene is considered as a medial sclerotome marker, downstream to and regulated by the notochord derived Shh, which may be functionally involved in somitogenesis. Copyright © 2014 Elsevier B.V. All rights reserved.

  1. A precisely regulated gene expression cassette potently modulates metastasis and survival in multiple solid cancers.

    Directory of Open Access Journals (Sweden)

    Kun Yu

    2008-07-01

    Full Text Available Successful tumor development and progression involves the complex interplay of both pro- and anti-oncogenic signaling pathways. Genetic components balancing these opposing activities are likely to require tight regulation, because even subtle alterations in their expression may disrupt this balance with major consequences for various cancer-associated phenotypes. Here, we describe a cassette of cancer-specific genes exhibiting precise transcriptional control in solid tumors. Mining a database of tumor gene expression profiles from six different tissues, we identified 48 genes exhibiting highly restricted levels of gene expression variation in tumors (n = 270 compared to nonmalignant tissues (n = 71. Comprising genes linked to multiple cancer-related pathways, the restricted expression of this "Poised Gene Cassette" (PGC was robustly validated across 11 independent cohorts of approximately 1,300 samples from multiple cancer types. In three separate experimental models, subtle alterations in PGC expression were consistently associated with significant differences in metastatic and invasive potential. We functionally confirmed this association in siRNA knockdown experiments of five PGC genes (p53CSV, MAP3K11, MTCH2, CPSF6, and SKIP, which either directly enhanced the invasive capacities or inhibited the proliferation of AGS cancer cells. In primary tumors, similar subtle alterations in PGC expression were also repeatedly associated with clinical outcome in multiple cohorts. Taken collectively, these findings support the existence of a common set of precisely controlled genes in solid tumors. Since inducing small activity changes in these genes may prove sufficient to potently influence various tumor phenotypes such as metastasis, targeting such precisely regulated genes may represent a promising avenue for novel anti-cancer therapies.

  2. Controlling illegal stimulants: a regulated market model

    Directory of Open Access Journals (Sweden)

    Haden Mark

    2008-01-01

    Full Text Available Abstract Prohibition of illegal drugs is a failed social policy and new models of regulation of these substances are needed. This paper explores a proposal for a post-prohibition, public health based model for the regulation of the most problematic drugs, the smokable and injectable stimulants. The literature on stimulant maintenance is explored. Seven foundational principles are suggested that could support this regulatory model of drug control that would reduce both health and social problems related to illegal stimulants. Some details of this model are examined and the paper concludes that drug policies need to be subject to research and based on evidence.

  3. Gene expression in human hippocampus from cocaine abusers identifies genes which regulate extracellular matrix remodeling.

    Directory of Open Access Journals (Sweden)

    Deborah C Mash

    2007-11-01

    Full Text Available The chronic effects of cocaine abuse on brain structure and function are blamed for the inability of most addicts to remain abstinent. Part of the difficulty in preventing relapse is the persisting memory of the intense euphoria or cocaine "rush". Most abused drugs and alcohol induce neuroplastic changes in brain pathways subserving emotion and cognition. Such changes may account for the consolidation and structural reconfiguration of synaptic connections with exposure to cocaine. Adaptive hippocampal plasticity could be related to specific patterns of gene expression with chronic cocaine abuse. Here, we compare gene expression profiles in the human hippocampus from cocaine addicts and age-matched drug-free control subjects. Cocaine abusers had 151 gene transcripts upregulated, while 91 gene transcripts were downregulated. Topping the list of cocaine-regulated transcripts was RECK in the human hippocampus (FC = 2.0; p<0.05. RECK is a membrane-anchored MMP inhibitor that is implicated in the coordinated regulation of extracellular matrix integrity and angiogenesis. In keeping with elevated RECK expression, active MMP9 protein levels were decreased in the hippocampus from cocaine abusers. Pathway analysis identified other genes regulated by cocaine that code for proteins involved in the remodeling of the cytomatrix and synaptic connections and the inhibition of blood vessel proliferation (PCDH8, LAMB1, ITGB6, CTGF and EphB4. The observed microarray phenotype in the human hippocampus identified RECK and other region-specific genes that may promote long-lasting structural changes with repeated cocaine abuse. Extracellular matrix remodeling in the hippocampus may be a persisting effect of chronic abuse that contributes to the compulsive and relapsing nature of cocaine addiction.

  4. Early gene regulation of osteogenesis in embryonic stem cells

    KAUST Repository

    Kirkham, Glen R.

    2012-01-01

    The early gene regulatory networks (GRNs) that mediate stem cell differentiation are complex, and the underlying regulatory associations can be difficult to map accurately. In this study, the expression profiles of the genes Dlx5, Msx2 and Runx2 in mouse embryonic stem cells were monitored over a 48 hour period after exposure to the growth factors BMP2 and TGFβ1. Candidate GRNs of early osteogenesis were constructed based on published experimental findings and simulation results of Boolean and ordinary differential equation models were compared with our experimental data in order to test the validity of these models. Three gene regulatory networks were found to be consistent with the data, one of these networks exhibited sustained oscillation, a behaviour which is consistent with the general view of embryonic stem cell plasticity. The work cycle presented in this paper illustrates how mathematical modelling can be used to elucidate from gene expression profiles GRNs that are consistent with experimental data. © 2012 The Royal Society of Chemistry.

  5. PREFACE: Physics approaches to protein interactions and gene regulation Physics approaches to protein interactions and gene regulation

    Science.gov (United States)

    Nussinov, Ruth; Panchenko, Anna R.; Przytycka, Teresa

    2011-06-01

    networks have been identified, including scale free distribution of the vertex degree, network motifs, and modularity, to name a few. These studies of network organization require the network to be as complete as possible, which given the limitations of experimental techniques is not currently the case. Therefore, experimental procedures for detecting biomolecular interactions should be complemented by computational approaches. The paper by Lees et al provides a review of computational methods, integrating multiple independent sources of data to infer physical and functional protein-protein interaction networks. One of the important aspects of protein interactions that should be accounted for in the prediction of protein interaction networks is that many proteins are composed of distinct domains. Protein domains may mediate protein interactions while proteins and their interaction networks may gain complexity through gene duplication and expansion of existing domain architectures via domain rearrangements. The latter mechanisms have been explored in detail in the paper by Cohen-Gihon et al. Protein-protein interactions are not the only component of the cell's interactome. Regulation of cell activity can be achieved at the level of transcription and involve a transcription factor—DNA binding which typically requires recognition of a specific DNA sequence motif. Chip-Chip and the more recent Chip-Seq technologies allow in vivo identification of DNA binding sites and, together with novel in vitro approaches, provide data necessary for deciphering the corresponding binding motifs. Such information, complemented by structures of protein-DNA complexes and knowledge of the differences in binding sites among homologs, opens the door to constructing predictive binding models. The paper by Persikov and Singh provides an example of such a model in the Cys2His2 zinc finger family. Recent studies have indicated that the presence of such binding motifs is, however, neither necessary

  6. Developmental Toxicity of Diclofenac and Elucidation of Gene Regulation in zebrafish (Danio rerio)

    Science.gov (United States)

    Chen, Jia-Bin; Gao, Hong-Wen; Zhang, Ya-Lei; Zhang, Yong; Zhou, Xue-Fei; Li, Chun-Qi; Gao, Hai-Ping

    2014-05-01

    Environmental pollution by emerging contaminants, e.g. pharmaceuticals, has become a matter of widespread concern in recent years. We investigated the membrane transport of diclofenac and its toxic effects on gene expression and the development of zebrafish embryos. The association of diclofenac with the embryos conformed to the general partition model at low concentration, the partition coefficient being 0.0033 ml per embryo. At high concentration, the interaction fitted the Freundlich model. Most of the diclofenac remained in the extracellular aqueous solution with less than 5% interacting with the embryo, about half of which was adsorbed on the membranes while the rest entered the cytoplasm. Concentrations of diclofenac over 10.13 μM were lethal to all the embryos, while 3.78 μM diclofenac was teratogenic. The development abnormalities at 4 day post treatment (dpt) include shorter body length, smaller eye, pericardial and body edema, lack of liver, intestine and circulation, muscle degeneration, and abnormal pigmentation. The portion of the diclofenac transferred into the embryo altered the expression of certain genes, e.g. down-regulation of Wnt3a and Gata4 and up-regulation of Wnt8a. The alteration of expression of such genes or the regulation of downstream genes could cause defects in the cardiovascular and nervous systems.

  7. Neuronal identity genes regulated by super-enhancers are preferentially down-regulated in the striatum of Huntington's disease mice.

    Science.gov (United States)

    Achour, Mayada; Le Gras, Stéphanie; Keime, Céline; Parmentier, Frédéric; Lejeune, François-Xavier; Boutillier, Anne-Laurence; Néri, Christian; Davidson, Irwin; Merienne, Karine

    2015-06-15

    Huntington's disease (HD) is a neurodegenerative disease associated with extensive down-regulation of genes controlling neuronal function, particularly in the striatum. Whether altered epigenetic regulation underlies transcriptional defects in HD is unclear. Integrating RNA-sequencing (RNA-seq) and chromatin-immunoprecipitation followed by massively parallel sequencing (ChIP-seq), we show that down-regulated genes in HD mouse striatum associate with selective decrease in H3K27ac, a mark of active enhancers, and RNA Polymerase II (RNAPII). In addition, we reveal that decreased genes in HD mouse striatum display a specific epigenetic signature, characterized by high levels and broad patterns of H3K27ac and RNAPII. Our results indicate that this signature is that of super-enhancers, a category of broad enhancers regulating genes defining tissue identity and function. Specifically, we reveal that striatal super-enhancers display extensive H3K27 acetylation within gene bodies, drive transcription characterized by low levels of paused RNAPII, regulate neuronal function genes and are enriched in binding motifs for Gata transcription factors, such as Gata2 regulating striatal identity genes. Together, our results provide evidence for preferential down-regulation of genes controlled by super-enhancers in HD striatum and indicate that enhancer topography is a major parameter determining the propensity of a gene to be deregulated in a neurodegenerative disease. © The Author 2015. Published by Oxford University Press. All rights reserved. For Permissions, please email: journals.permissions@oup.com.

  8. Expression of conjoined genes: another mechanism for gene regulation in eukaryotes.

    Directory of Open Access Journals (Sweden)

    Tulika Prakash

    Full Text Available From the ENCODE project, it is realized that almost every base of the entire human genome is transcribed. One class of transcripts resulting from this arises from the conjoined gene, which is formed by combining the exons of two or more distinct (parent genes lying on the same strand of a chromosome. Only a very limited number of such genes are known, and the definition and terminologies used for them are highly variable in the public databases. In this work, we have computationally identified and manually curated 751 conjoined genes (CGs in the human genome that are supported by at least one mRNA or EST sequence available in the NCBI database. 353 representative CGs, of which 291 (82% could be confirmed, were subjected to experimental validation using RT-PCR and sequencing methods. We speculate that these genes are arising out of novel functional requirements and are not merely artifacts of transcription, since more than 70% of them are conserved in other vertebrate genomes. The unique splicing patterns exhibited by CGs reveal their possible roles in protein evolution or gene regulation. Novel CGs, for which no transcript is available, could be identified in 80% of randomly selected potential CG forming regions, indicating that their formation is a routine process. Formation of CGs is not only limited to human, as we have also identified 270 CGs in mouse and 227 in drosophila using our approach. Additionally, we propose a novel mechanism for the formation of CGs. Finally, we developed a database, ConjoinG, which contains detailed information about all the CGs (800 in total identified in the human genome. In summary, our findings reveal new insights about the functionality of CGs in terms of another possible mechanism for gene regulation and genomic evolution and the mechanism leading to their formation.

  9. Myeloid translocation genes differentially regulate colorectal cancer programs

    Science.gov (United States)

    Parang, Bobak; Bradley, Amber M.; Mittal, Mukul K.; Short, Sarah P.; Thompson, Joshua J.; Barrett, Caitlyn W.; Naik, Rishi D.; Bilotta, Anthony J.; Washington, Mary K.; Revetta, Frank L.; Smith, Jesse J.; Chen, Xi; Wilson, Keith T.; Hiebert, Scott W.; Williams, Christopher S.

    2016-01-01

    Myeloid translocation genes (MTGs), originally identified as chromosomal translocations in acute myelogenous leukemia, are transcriptional corepressors that regulate hematopoietic stem cell programs. Analysis of The Cancer Genome Atlas (TCGA) database revealed that MTGs were mutated in epithelial malignancy and suggested that loss of function might promote tumorigenesis. Genetic deletion of MTGR1 and MTG16 in the mouse has revealed unexpected and unique roles within the intestinal epithelium. Mtgr1−/− mice have progressive depletion of all intestinal secretory cells, and Mtg16−/− mice have a decrease in goblet cells. Furthermore, both Mtgr1−/− and Mtg16−/− mice have increased intestinal epithelial cell proliferation. We thus hypothesized that loss of MTGR1 or MTG16 would modify Apc1638/+-dependent intestinal tumorigenesis. Mtgr1−/− mice, but not Mtg16−/− mice, had a 10-fold increase in tumor multiplicity. This was associated with more advanced dysplasia, including progression to invasive adenocarcinoma, and augmented intratumoral proliferation. Analysis of ChIP-seq datasets for MTGR1 and MTG16 targets indicated that MTGR1 can regulate Wnt and Notch signaling. In support of this, immunohistochemistry and gene expression analysis revealed that both Wnt and Notch signaling pathways were hyperactive in Mtgr1−/− tumors. Furthermore, in human colorectal cancer (CRC) samples MTGR1 was downregulated at both the transcript and protein level. Overall our data indicates that MTGR1 has a context dependent effect on intestinal tumorigenesis. PMID:27270437

  10. A novel role for Tm7sf2 gene in regulating TNFα expression.

    Directory of Open Access Journals (Sweden)

    Ilaria Bellezza

    Full Text Available We have explored the role of Tm7sf2 gene, which codifies for 3β-hydroxysterol Δ14-reductase, an endoplasmic reticulum resident protein, in the sensitivity to endoplasmic reticulum stress and in the resulting inflammatory response. We used mouse embryonic fibroblasts, derived from Tm7sf2(+/+ and Tm7sf2(-/- mice, to determine the in vitro effects of thapsigargin on NF-κB activation. Our results show that the Tm7sf2 gene controls the launch of the unfolded protein response and presides an anti-inflammatory loop thus its absence correlates with NF-κB activation and TNFα up-regulation. Our data also show that Tm7sf2 gene regulates liver X receptor activation and its absence inhibits LXR signalling. By expressing the hTm7sf2 gene in KO MEFs and observing a reduced NF-κB activation, we have confirmed that Tm7sf2 gene is linked to NF-κB activation. Finally we used genetically modified mice in an in vivo model of ER stress and of inflammation. Our results show a significant increase in renal TNFα expression after tunicamycin exposure and in the oedematogenic response in Tm7sf2(-/- mice. In conclusion, we have shown that the Tm7sf2 gene, to date involved only in cholesterol biosynthesis, also controls an anti-inflammatory loop thereby confirming the existence of cross talk between metabolic pathways and inflammatory response.

  11. A role for calcium in the regulation of ATP-binding cassette, sub-family C, member 3 (ABCC3) gene expression in a model of epidermal growth factor-mediated breast cancer epithelial-mesenchymal transition.

    Science.gov (United States)

    Stewart, Teneale A; Azimi, Iman; Thompson, Erik W; Roberts-Thomson, Sarah J; Monteith, Gregory R

    2015-03-13

    Epithelial-mesenchymal transition (EMT), a process implicated in cancer metastasis, is associated with the transcriptional regulation of members of the ATP-binding cassette superfamily of efflux pumps, and drug resistance in breast cancer cells. Epidermal growth factor (EGF)-induced EMT in MDA-MB-468 breast cancer cells is calcium signal dependent. In this study induction of EMT was shown to result in the transcriptional up-regulation of ATP-binding cassette, subfamily C, member 3 (ABCC3), a member of the ABC transporter superfamily, which has a recognized role in multidrug resistance. Buffering of cytosolic free calcium inhibited EGF-mediated ABCC3 increases, indicating a calcium-dependent mode of regulation. Silencing of TRPM7 (an ion channel involved in EMT associated vimentin induction) did not inhibit ABCC3 up-regulation. Silencing of the store operated calcium entry (SOCE) pathway components ORAI1 and STIM1 also did not alter ABCC3 induction by EGF. However, the calcium permeable ion channel transient receptor potential cation channel, subfamily C, member 1 (TRPC1) appears to contribute to the regulation of both basal and EGF-induced ABCC3 mRNA. Improved understanding of the relationship between calcium signaling, EMT and the regulation of genes important in therapeutic resistance may help identify novel therapeutic targets for breast cancer. Copyright © 2015 Elsevier Inc. All rights reserved.

  12. Regulation of Corticosteroidogenic Genes by MicroRNAs

    Directory of Open Access Journals (Sweden)

    Stacy Robertson

    2017-01-01

    Full Text Available The loss of normal regulation of corticosteroid secretion is important in the development of cardiovascular disease. We previously showed that microRNAs regulate the terminal stages of corticosteroid biosynthesis. Here, we assess microRNA regulation across the whole corticosteroid pathway. Knockdown of microRNA using Dicer1 siRNA in H295R adrenocortical cells increased levels of CYP11A1, CYP21A1, and CYP17A1 mRNA and the secretion of cortisol, corticosterone, 11-deoxycorticosterone, 18-hydroxycorticosterone, and aldosterone. Bioinformatic analysis of genes involved in corticosteroid biosynthesis or metabolism identified many putative microRNA-binding sites, and some were selected for further study. Manipulation of individual microRNA levels demonstrated a direct effect of miR-125a-5p and miR-125b-5p on CYP11B2 and of miR-320a-3p levels on CYP11A1 and CYP17A1 mRNA. Finally, comparison of microRNA expression profiles from human aldosterone-producing adenoma and normal adrenal tissue showed levels of various microRNAs, including miR-125a-5p to be significantly different. This study demonstrates that corticosteroidogenesis is regulated at multiple points by several microRNAs and that certain of these microRNAs are differentially expressed in tumorous adrenal tissue, which may contribute to dysregulation of corticosteroid secretion. These findings provide new insights into the regulation of corticosteroid production and have implications for understanding the pathology of disease states where abnormal hormone secretion is a feature.

  13. Quorum activation at a distance: spatiotemporal patterns of gene regulation from diffusion of an autoinducer signal

    Science.gov (United States)

    Dilanji, Gabriel; Langebrake, Jessica; Deleenheer, Patrick; Hagen, Stephen J.

    2012-02-01

    Bacteria in colonies coordinate gene regulation through the exchange of diffusible signal molecules known as autoinducers (AI). This ``quorum signaling'' often occurs in physically heterogeneous and spatially extended environments such as biofilms. Under these conditions the space and time scales for diffusion of the signal limit the range and timing of effective gene regulation. We expect that spatial and temporal patterns of gene expression will reflect physical environmental constraints as well as nonlinear transcriptional activation and feedback within the gene regulatory system. We have combined experiments and modeling to investigate how these spatiotemporal patterns develop. We embed engineered plasmid/GFP quorum sensor strains or wild type strains in a long narrow agar lane, and then introduce AI signal at one terminus of the lane. Diffusion of the AI initiates reporter expression along the length of the lane, extending to macroscopic distances of mm-cm. Resulting patterns are captured quantitatively by a mathematical model that incorporates logistic growth of the population, diffusion of AI, and nonlinear transcriptional activation. Our results show that a diffusing quorum signal can coordinate gene expression over distances of order 1cm on time scales of order 10 hrs.

  14. Feeding Regulates the Expression of Pancreatic Genes in Gastric Mucosa

    Directory of Open Access Journals (Sweden)

    Maria Rita De Giorgio

    2010-01-01

    Full Text Available The ineffective short-term control of feeding behavior compromises energy homeostasis and can lead to obesity. The gastrointestinal tract secretes several regulatory peptides. However, little is known about the stomach peptide contribution to the acute regulation of intake. In an attempt to identify new gastric signals, the serial analysis of gene expression (SAGE method was used for the transcription profiling of stomach mucosa in 7 groups of mice: fasting and sacrificed 30 minutes, 1 hour, 3 hours after a low-fat (LF or high-fat (HF ad libitum meal. In total, 35 genes were differentially modulated by LF and HF meals compared to fasting, including 15 mRNAs coding for digestive enzymes/secretory proteins, and 10 novel transcripts. Although the basic expression profile did not undergo substantial variations, both LF and HF meals influenced the transcription. This study represents the first global analysis of stomach transcriptome as induced by different nutritional stimuli. Further studies including the characterization of novel genes may help to identify new targets for the therapy and prevention of obesity.

  15. The Evolution of gene regulation research in Lactococcus lactis.

    Science.gov (United States)

    Kok, Jan; van Gijtenbeek, Lieke A; de Jong, Anne; van der Meulen, Sjoerd B; Solopova, Ana; Kuipers, Oscar P

    2017-08-01

    Lactococcus lactis is a major microbe. This lactic acid bacterium (LAB) is used worldwide in the production of safe, healthy, tasteful and nutritious milk fermentation products. Its huge industrial importance has led to an explosion of research on the organism, particularly since the early 1970s. The upsurge in the research on L. lactis coincided not accidentally with the advent of recombinant DNA technology in these years. The development of methods to take out and re-introduce DNA in L. lactis, to clone genes and to mutate the chromosome in a targeted way, to control (over)expression of proteins and, ultimately, the availability of the nucleotide sequence of its genome and the use of that information in transcriptomics and proteomics research have enabled to peek deep into the functioning of the organism. Among many other things, this has provided an unprecedented view of the major gene regulatory pathways involved in nitrogen and carbon metabolism and their overlap, and has led to the blossoming of the field of L. lactis systems biology. All of these advances have made L. lactis the paradigm of the LAB. This review will deal with the exciting path along which the research on the genetics of and gene regulation in L. lactis has trodden. © FEMS 2017.

  16. H-ferritin-regulated microRNAs modulate gene expression in K562 cells.

    Directory of Open Access Journals (Sweden)

    Flavia Biamonte

    Full Text Available In a previous study, we showed that the silencing of the heavy subunit (FHC offerritin, the central iron storage molecule in the cell, is accompanied by a modification in global gene expression. In this work, we explored whether different FHC amounts might modulate miRNA expression levels in K562 cells and studied the impact of miRNAs in gene expression profile modifications. To this aim, we performed a miRNA-mRNA integrative analysis in K562 silenced for FHC (K562shFHC comparing it with K562 transduced with scrambled RNA (K562shRNA. Four miRNAs, namely hsa-let-7g, hsa-let-7f, hsa-let-7i and hsa-miR-125b, were significantly up-regulated in silenced cells. The remarkable down-regulation of these miRNAs, following FHC expression rescue, supports a specific relation between FHC silencing and miRNA-modulation. The integration of target predictions with miRNA and gene expression profiles led to the identification of a regulatory network which includes the miRNAs up-regulated by FHC silencing, as well as91 down-regulated putative target genes. These genes were further classified in 9 networks; the highest scoring network, "Cell Death and Survival, Hematological System Development and Function, Hematopoiesis", is composed by 18 focus molecules including RAF1 and ERK1/2. We confirmed that, following FHC silencing, ERK1/2 phosphorylation is severely impaired and that RAF1 mRNA is significantly down-regulated. Taken all together, our data indicate that, in our experimental model, FHC silencing may affect RAF1/pERK1/2 levels through the modulation of a specific set of miRNAs and add new insights in to the relationship among iron homeostasis and miRNAs.

  17. Pitx2, an atrial fibrillation predisposition gene, directly regulates ion transport and intercalated disc genes.

    Science.gov (United States)

    Tao, Ye; Zhang, Min; Li, Lele; Bai, Yan; Zhou, Yuefang; Moon, Anne M; Kaminski, Henry J; Martin, James F

    2014-02-01

    Pitx2 is the homeobox gene located in proximity to the human 4q25 familial atrial fibrillation (AF) locus. When deleted in the mouse germline, Pitx2 haploinsufficiency predisposes to pacing-induced AF, indicating that reduced Pitx2 promotes an arrhythmogenic substrate. Previous work focused on Pitx2 developmental functions that predispose to AF. Although Pitx2 is expressed in postnatal left atrium, it is unknown whether Pitx2 has distinct postnatal and developmental functions. To investigate Pitx2 postnatal function, we conditionally inactivated Pitx2 in the postnatal atrium while leaving its developmental function intact. Unstressed adult Pitx2 homozygous mutant mice display variable R-R interval with diminished P-wave amplitude characteristic of sinus node dysfunction, an AF risk factor in human patients. An integrated genomics approach in the adult heart revealed Pitx2 target genes encoding cell junction proteins, ion channels, and critical transcriptional regulators. Importantly, many Pitx2 target genes have been implicated in human AF by genome-wide association studies. Immunofluorescence and transmission electron microscopy studies in adult Pitx2 mutant mice revealed structural remodeling of the intercalated disc characteristic of human patients with AF. Our findings, revealing that Pitx2 has genetically separable postnatal and developmental functions, unveil direct Pitx2 target genes that include channel and calcium handling genes, as well as genes that stabilize the intercalated disc in postnatal atrium.

  18. Independent regulation of gene expression level and noise by histone modifications.

    Science.gov (United States)

    Wu, Shaohuan; Li, Ke; Li, Yingshu; Zhao, Tong; Li, Ting; Yang, Yu-Fei; Qian, Wenfeng

    2017-06-01

    The inherent stochasticity generates substantial gene expression variation among isogenic cells under identical conditions, which is frequently referred to as gene expression noise or cell-to-cell expression variability. Similar to (average) expression level, expression noise is also subject to natural selection. Yet it has been observed that noise is negatively correlated with expression level, which manifests as a potential constraint for simultaneous optimization of both. Here, we studied expression noise in human embryonic cells with computational analysis on single-cell RNA-seq data and in yeast with flow cytometry experiments. We showed that this coupling is overcome, to a certain degree, by a histone modification strategy in multiple embryonic developmental stages in human, as well as in yeast. Importantly, this epigenetic strategy could fit into a burst-like gene expression model: promoter-localized histone modifications (such as H3K4 methylation) are associated with both burst size and burst frequency, which together influence expression level, while gene-body-localized ones (such as H3K79 methylation) are more associated with burst frequency, which influences both expression level and noise. We further knocked out the only "writer" of H3K79 methylation in yeast, and observed that expression noise is indeed increased. Consistently, dosage sensitive genes, such as genes in the Wnt signaling pathway, tend to be marked with gene-body-localized histone modifications, while stress responding genes, such as genes regulating autophagy, tend to be marked with promoter-localized ones. Our findings elucidate that the "division of labor" among histone modifications facilitates the independent regulation of expression level and noise, extend the "histone code" hypothesis to include expression noise, and shed light on the optimization of transcriptome in evolution.

  19. Model Regulations for Decommissioning of Facilities

    International Nuclear Information System (INIS)

    2017-07-01

    The IAEA has systematic programmes to provide Member States with the guidance, services and training necessary for establishing a legal and regulatory framework, including the planning and implementation of decommissioning. The model regulations provided in this publication cover all aspects of the planning, conduct and termination of the decommissioning of facilities and management of the associated waste, in accordance with the relevant requirements of the IAEA safety standards. They provide a framework for establishing regulatory requirements and conditions of authorization to be incorporated into individual authorizations for the decommissioning of specific facilities. The model regulations also establish criteria to be used for assessing compliance with regulatory requirements. The publication will be of assistance to Member States in appraising the adequacy of their existing regulations and regulatory guides, and serves as a reference for those Member States developing regulations for the first time.

  20. Mobile gene silencing in Arabidopsis is regulated by hydrogen peroxide

    Directory of Open Access Journals (Sweden)

    Dacheng Liang

    2014-12-01

    Full Text Available In plants and nematodes, RNAi can spread from cells from which it is initiated to other cells in the organism. The underlying mechanism controlling the mobility of RNAi signals is not known, especially in the case of plants. A genetic screen designed to recover plants impaired in the movement but not the production or effectiveness of the RNAi signal identified RCI3, which encodes a hydrogen peroxide (H2O2-producing type III peroxidase, as a key regulator of silencing mobility in Arabidopsis thaliana. Silencing initiated in the roots of rci3 plants failed to spread into leaf tissue or floral tissue. Application of exogenous H2O2 reinstated the spread in rci3 plants and accelerated it in wild-type plants. The addition of catalase or MnO2, which breaks down H2O2, slowed the spread of silencing in wild-type plants. We propose that endogenous H2O2, under the control of peroxidases, regulates the spread of gene silencing by altering plasmodesmata permeability through remodelling of local cell wall structure, and may play a role in regulating systemic viral defence.

  1. Regulation of gene expression by PRA-910, a novel progesterone receptor modulator, in T47D cells.

    Science.gov (United States)

    Bray, Jeffrey D; Zhang, Zhiming; Winneker, Richard C; Lyttle, C Richard

    2003-11-01

    Progestins play an important role in women's health and are used in oral contraception, hormone therapy, and treatment of reproductive disorders. The effects of progestins upon gene expression in breast epithelium are poorly understood. In an attempt to characterize the molecular mechanism of progestin action, we used a gene expression profiling approach to examine the action of a novel progestin in the T47D cell model, a human breast cancer cell line. PRA-910 is a novel, nonsteroidal progesterone receptor modulator (PRM) with species-specific activities identified in a screen for selective PRMs. To understand the mechanism of action for PRA-910 in T47D cells, we compared its gene regulation to progesterone (P4) and RU486 through Affymetrix U95A GeneChip analysis and TaqMan RT-PCR. PRA-910, P4, and RU486 regulated 50, 108, and 16 genes by threefold or greater versus vehicle, respectively, with 18 genes having similar regulation for P4 and PRA-910. These data confirm and extend previous findings for T47D cells. We also obtained time course, concentration-response, cyclohexamide sensitivity, and PR-specificity data for two progestin-regulated genes, ATP1A1 and CLDN8. Our data demonstrate that PRA-910 has a unique gene regulation profile distinct from both P4 and RU486. Further investigation of the underlying mechanism for these differences is ongoing.

  2. Current approaches to gene regulatory network modelling

    Directory of Open Access Journals (Sweden)

    Brazma Alvis

    2007-09-01

    Full Text Available Abstract Many different approaches have been developed to model and simulate gene regulatory networks. We proposed the following categories for gene regulatory network models: network parts lists, network topology models, network control logic models, and dynamic models. Here we will describe some examples for each of these categories. We will study the topology of gene regulatory networks in yeast in more detail, comparing a direct network derived from transcription factor binding data and an indirect network derived from genome-wide expression data in mutants. Regarding the network dynamics we briefly describe discrete and continuous approaches to network modelling, then describe a hybrid model called Finite State Linear Model and demonstrate that some simple network dynamics can be simulated in this model.

  3. Molecular Mechanisms of Stress-Induced Proenkephalin Gene Regulation: CREB Interacts with the Proenkephalin Gene in the Mouse Hypothalamus and Is Phosphorylated in Response to Hyperosmolar Stress

    Science.gov (United States)

    Borsook, David; Konradi, Christine; Falkowski, Olga; Comb, Michael; Hyman, Steven E.

    2014-01-01

    We have established a transgenic model to facilitate the study of stress-induced gene regulation in the hypothalamus. This model, which uses a human proenkephalin-β-galactosidase fusion gene, readily permits anatomic and cellular colocalization of stress-regulated immediate early gene products (e.g. Fos) and other transcription factors [e.g. cAMP response element-binding protein (CREB)] with the product of a potential target gene. Moreover, Fos provides a marker of cellular activation that is independent of the transgene. Hypertonic saline stress induced Fos in almost all cells in the PVN that exhibited basal expression of the proenkephalin transgene; however, all cells in which the transgene was activated by stress also expressed Fos. CREB was found in essentially all neurons. Gel shift analysis with and without antisera to Fos and CREB showed that AP-1 binding activity, containing Fos protein, was induced by hyperosmotic stress. However, Fos was not detected binding to the proenkephalin second messenger-inducible enhancer even in hypothalamic cell extracts from stressed animals. In contrast, CREB formed specific complexes with both the proenkephalin enhancer and a cAMP- and calcium-regulated element (CaRE) within the c-fos gene. Moreover, we found that hypertonic saline induced CREB phosphorylation in cells that express the transgene within the paraventricular nucleus and supraoptic nucleus. These results suggest a model in which proenkephalin gene expression in the paraventricular nucleus is regulated by CREB in response to hypertonic stress. PMID:8170480

  4. A chain reaction approach to modelling gene pathways.

    Science.gov (United States)

    Cheng, Gary C; Chen, Dung-Tsa; Chen, James J; Soong, Seng-Jaw; Lamartiniere, Coral; Barnes, Stephen

    2012-08-01

    nutrient-containing diets regulate gene expression in the estrogen synthesis pathway during puberty; (II) global tests to assess an overall association of this particular pathway with time factor by utilizing generalized linear models to analyze microarray data; and (III) a chain reaction model to simulate the pathway. This is a novel application because we are able to translate the gene pathway into the chemical reactions in which each reaction channel describes gene-gene relationship in the pathway. In the chain reaction model, the implicit scheme is employed to efficiently solve the differential equations. Data analysis results show the proposed model is capable of predicting gene expression changes and demonstrating the effect of nutrient-containing diets on gene expression changes in the pathway. One of the objectives of this study is to explore and develop a numerical approach for simulating the gene expression change so that it can be applied and calibrated when the data of more time slices are available, and thus can be used to interpolate the expression change at a desired time point without conducting expensive experiments for a large amount of time points. Hence, we are not claiming this is either essential or the most efficient way for simulating this problem, rather a mathematical/numerical approach that can model the expression change of a large set of genes of a complex pathway. In addition, we understand the limitation of this experiment and realize that it is still far from being a complete model of predicting nutrient-gene interactions. The reason is that in the present model, the reaction rates were estimated based on available data at two time points; hence, the gene expression change is dependent upon the reaction rates and a linear function of the gene expressions. More data sets containing gene expression at various time slices are needed in order to improve the present model so that a non-linear variation of gene expression changes at different time

  5. [Prediction and bioinformatics analysis of human gene expression profiling regulated by amifostine].

    Science.gov (United States)

    Yang, Bo; Cai, Li-Li; Chi, Xiao-Hua; Lu, Xue-Chun; Zhang, Feng; Tuo, Shuai; Zhu, Hong-Li; Liu, Li-Hong; Yan, Jiang-Wei; Tuo, Chao-Wei

    2011-06-01

    Objective of this study was to perform bioinformatics analysis of the characteristics of gene expression profiling regulated by amifostine and predict its novel potential biological function to provide a direction for further exploring pharmacological actions of amifostine and study methods. Amifostine was used as a key word to search internet-based free gene expression database including GEO, affymetrix gene chip database, GenBank, SAGE, GeneCard, InterPro, ProtoNet, UniProt and BLOCKS and the sifted amifostine-regulated gene expression profiling data was subjected to validity testing, gene expression difference analysis and functional clustering and gene annotation. The results showed that only one data of gene expression profiling regulated by amifostine was sifted from GEO database (accession: GSE3212). Through validity testing and gene expression difference analysis, significant difference (p < 0.01) was only found in 2.14% of the whole genome (460/192000). Gene annotation analysis showed that 139 out of 460 genes were known genes, in which 77 genes were up-regulated and 62 genes were down-regulated. 13 out of 139 genes were newly expressed following amifostine treatment of K562 cells, however expression of 5 genes was completely inhibited. Functional clustering displayed that 139 genes were divided into 11 categories and their biological function was involved in hematopoietic and immunologic regulation, apoptosis and cell cycle. It is concluded that bioinformatics method can be applied to analysis of gene expression profiling regulated by amifostine. Amifostine has a regulatory effect on human gene expression profiling and this action is mainly presented in biological processes including hematopoiesis, immunologic regulation, apoptosis and cell cycle and so on. The effect of amifostine on human gene expression need to be further testified in experimental condition.

  6. Gene expression dosage regulation in an allopolyploid fish.

    Directory of Open Access Journals (Sweden)

    I Matos

    Full Text Available How allopolyploids are able not only to cope but profit from their condition is a question that remains elusive, but is of great importance within the context of successful allopolyploid evolution. One outstanding example of successful allopolyploidy is the endemic Iberian cyprinid Squalius alburnoides. Previously, based on the evaluation of a few genes, it was reported that the transcription levels between diploid and triploid S. alburnoides were similar. If this phenomenon occurs on a full genomic scale, a wide functional ''diploidization'' could be related to the success of these polyploids. We generated RNA-seq data from whole juvenile fish and from adult livers, to perform the first comparative quantitative transcriptomic analysis between diploid and triploid individuals of a vertebrate allopolyploid. Together with an assay to estimate relative expression per cell, it was possible to infer the relative sizes of transcriptomes. This showed that diploid and triploid S. alburnoides hybrids have similar liver transcriptome sizes. This in turn made it valid to directly compare the S. alburnoides RNA-seq transcript data sets and obtain a profile of dosage responses across the S. alburnoides transcriptome. We found that 64% of transcripts in juveniles' samples and 44% in liver samples differed less than twofold between diploid and triploid hybrids (similar expression. Yet, respectively 29% and 15% of transcripts presented accurate dosage compensation (PAA/PA expression ratio of 1 instead of 1.5. Therefore, an exact functional diploidization of the triploid genome does not occur, but a significant down regulation of gene expression in triploids was observed. However, for those genes with similar expression levels between diploids and triploids, expression is not globally strictly proportional to gene dosage nor is it set to a perfect diploid level. This quantitative expression flexibility may be a strong contributor to overcome the genomic shock

  7. Bistability in self-activating genes regulated by non-coding RNAs

    International Nuclear Information System (INIS)

    Miro-Bueno, Jesus

    2015-01-01

    Non-coding RNA molecules are able to regulate gene expression and play an essential role in cells. On the other hand, bistability is an important behaviour of genetic networks. Here, we propose and study an ODE model in order to show how non-coding RNA can produce bistability in a simple way. The model comprises a single gene with positive feedback that is repressed by non-coding RNA molecules. We show how the values of all the reaction rates involved in the model are able to control the transitions between the high and low states. This new model can be interesting to clarify the role of non-coding RNA molecules in genetic networks. As well, these results can be interesting in synthetic biology for developing new genetic memories and biomolecular devices based on non-coding RNAs

  8. Linkage mapping of putative regulator genes of barley grain development characterized by expression profiling

    Directory of Open Access Journals (Sweden)

    Wobus Ulrich

    2009-01-01

    Full Text Available Abstract Background Barley (Hordeum vulgare L. seed development is a highly regulated process with fine-tuned interaction of various tissues controlling distinct physiological events during prestorage, storage and dessication phase. As potential regulators involved within this process we studied 172 transcription factors and 204 kinases for their expression behaviour and anchored a subset of them to the barley linkage map to promote marker-assisted studies on barley grains. Results By a hierachical clustering of the expression profiles of 376 potential regulatory genes expressed in 37 different tissues, we found 50 regulators preferentially expressed in one of the three grain tissue fractions pericarp, endosperm and embryo during seed development. In addition, 27 regulators found to be expressed during both seed development and germination and 32 additional regulators are characteristically expressed in multiple tissues undergoing cell differentiation events during barley plant ontogeny. Another 96 regulators were, beside in the developing seed, ubiquitously expressed among all tissues of germinating seedlings as well as in reproductive tissues. SNP-marker development for those regulators resulted in anchoring 61 markers on the genetic linkage map of barley and the chromosomal assignment of another 12 loci by using wheat-barley addition lines. The SNP frequency ranged from 0.5 to 1.0 SNP/kb in the parents of the various mapping populations and was 2.3 SNP/kb over all eight lines tested. Exploration of macrosynteny to rice revealed that the chromosomal orders of the mapped putative regulatory factors were predominantly conserved during evolution. Conclusion We identified expression patterns of major transcription factors and signaling related genes expressed during barley ontogeny and further assigned possible functions based on likely orthologs functionally well characterized in model plant species. The combined linkage map and reference

  9. Post-transcriptional bursting in genes regulated by small RNA molecules

    Science.gov (United States)

    Rodrigo, Guillermo

    2018-03-01

    Gene expression programs in living cells are highly dynamic due to spatiotemporal molecular signaling and inherent biochemical stochasticity. Here we study a mechanism based on molecule-to-molecule variability at the RNA level for the generation of bursts of protein production, which can lead to heterogeneity in a cell population. We develop a mathematical framework to show numerically and analytically that genes regulated post transcriptionally by small RNA molecules can exhibit such bursts due to different states of translation activity (on or off), mostly revealed in a regime of few molecules. We exploit this framework to compare transcriptional and post-transcriptional bursting and also to illustrate how to tune the resulting protein distribution with additional post-transcriptional regulations. Moreover, because RNA-RNA interactions are predictable with an energy model, we define the kinetic constants of on-off switching as functions of the two characteristic free-energy differences of the system, activation and formation, with a nonequilibrium scheme. Overall, post-transcriptional bursting represents a distinctive principle linking gene regulation to gene expression noise, which highlights the importance of the RNA layer beyond the simple information transfer paradigm and significantly contributes to the understanding of the intracellular processes from a first-principles perspective.

  10. Regulation and function of small heat shock protein genes during amphibian development.

    Science.gov (United States)

    Heikkila, John J

    2004-11-01

    Small heat shock proteins (shsps) are molecular chaperones that are inducible by environmental stress such as elevated temperature or exposure to heavy metals or arsenate. Recent interest in shsps has been propelled by the finding that shsp synthesis or mutations are associated with various human diseases. While much is known about shsps in cultured cells, less is known about their expression and function during early animal development. In amphibian model systems, shsp genes are developmentally regulated under both normal and environmental stress conditions. For example, in Xenopus, the shsp gene family, hsp30, is repressed and not heat-inducible until the late neurula/early tailbud stage whereas other hsps are inducible at the onset of zygotic genome activation at the midblastula stage. Furthermore, these shsp genes are preferentially induced in selected tissues. Recent studies suggest that the developmental regulation of these shsp genes is controlled, in part, at the level of chromatin structure. Some shsps including Xenopus and Rana hsp30 are synthesized constitutively in selected tissues where they may function in the prevention of apoptosis. During environmental stress, amphibian multimeric shsps bind to denatured target protein, inhibittheir aggregation and maintain them in a folding-competent state until reactivated by other cellular chaperones. Phosphorylation of shsps appears to play a major role in the regulation of their function.

  11. Regulation of Plastid Gene Expression during Photooxidative Stress.

    Science.gov (United States)

    Tonkyn, J C; Deng, X W; Gruissem, W

    1992-08-01

    We have used the carotenoid biosynthesis inhibitor norflurazon to study the relationship between chloroplast and nuclear gene expression and the mechanisms by which plastid mRNA accumulation is regulated in response to photooxidative stress. By treating 4-week-old hydroponic spinach plants (Spinacea oleracea), we were able to determine the response at two distinct stages of chloroplast development. For all parameters studied, differences were found between the norflurazon-treated young and mature leaves. Young leaves lost essentially all pigment content in the presence of norflurazon, whereas mature leaves retained more than 60% of their chlorophyll and carotenoids. The accumulation of plastid mRNA was determined for several genes, and we found a decrease in mRNA levels for all genes except psbA in herbicide-treated young leaves. For genes such as atpB, psbB, and psaA, there was a corresponding change in the relative level of transcription, but for psbA and rbcL, transcription and mRNA accumulation were uncoupled. In norflurazon-treated mature leaves, all plastid mRNAs except psaA accumulated to normal levels, and transcription levels were either normal or higher than corresponding controls. This led to the conclusion that plastid mRNA accumulation is regulated both transcriptionally and posttranscriptionally in response to photooxidative stress. Although direct photooxidative damage is confined to the plastid and peroxisome, there is a feedback of information controlling the transcription of nuclear-encoded plastid proteins. Considerable evidence has accumulated implicating a "plastid factor" in this control. Therefore, the expression of several nuclear-encoded plastid proteins and the corresponding mRNAs were determined. Although the levels of both the small subunit of ribulose-1,5-bisphosphate carboxylase and the light harvesting chlorophyll a/b-binding protein and corresponding mRNAs were reduced, a 28-kilodalton chloroplast RNA-binding protein and

  12. Regulation of Plastid Gene Expression during Photooxidative Stress 1

    Science.gov (United States)

    Tonkyn, John C.; Deng, Xing-Wang; Gruissem, Wilhelm

    1992-01-01

    We have used the carotenoid biosynthesis inhibitor norflurazon to study the relationship between chloroplast and nuclear gene expression and the mechanisms by which plastid mRNA accumulation is regulated in response to photooxidative stress. By treating 4-week-old hydroponic spinach plants (Spinacea oleracea), we were able to determine the response at two distinct stages of chloroplast development. For all parameters studied, differences were found between the norflurazon-treated young and mature leaves. Young leaves lost essentially all pigment content in the presence of norflurazon, whereas mature leaves retained more than 60% of their chlorophyll and carotenoids. The accumulation of plastid mRNA was determined for several genes, and we found a decrease in mRNA levels for all genes except psbA in herbicide-treated young leaves. For genes such as atpB, psbB, and psaA, there was a corresponding change in the relative level of transcription, but for psbA and rbcL, transcription and mRNA accumulation were uncoupled. In norflurazon-treated mature leaves, all plastid mRNAs except psaA accumulated to normal levels, and transcription levels were either normal or higher than corresponding controls. This led to the conclusion that plastid mRNA accumulation is regulated both transcriptionally and posttranscriptionally in response to photooxidative stress. Although direct photooxidative damage is confined to the plastid and peroxisome, there is a feedback of information controlling the transcription of nuclear-encoded plastid proteins. Considerable evidence has accumulated implicating a “plastid factor” in this control. Therefore, the expression of several nuclear-encoded plastid proteins and the corresponding mRNAs were determined. Although the levels of both the small subunit of ribulose-1,5-bisphosphate carboxylase and the light harvesting chlorophyll a/b-binding protein and corresponding mRNAs were reduced, a 28-kilodalton chloroplast RNA-binding protein and

  13. Genome-wide identification of genes regulated in trans by transposable element small interfering RNAs

    Science.gov (United States)

    McCue, Andrea D; Nuthikattu, Saivageethi; Slotkin, R Keith

    2013-01-01

    Transposable elements (TEs) are known to influence the regulation of neighboring genes through a variety of mechanisms. Additionally, it was recently discovered that TEs can regulate non-neighboring genes through the trans-acting nature of small interfering RNAs (siRNAs). When the epigenetic repression of TEs is lost, TEs become transcriptionally active, and the host cell acts to repress mutagenic transposition by degrading TE mRNAs into siRNAs. In this study, we have performed a genome-wide analysis in the model plant Arabidopsis thaliana and found that TE siRNA-based regulation of genic mRNAs is more pervasive than the two formerly characterized proof-of-principle examples. We identified 27 candidate genic mRNAs that do not contain a TE fragment but are regulated through partial complementarity by the accumulation of TE siRNAs and are therefore influenced by TE epigenetic activation. We have experimentally confirmed several gene targets and demonstrated that they respond to the accumulation of specific 21 nucleotide TE siRNAs that are incorporated into the Arabidopsis Argonaute1 protein. Additionally, we found that one TE siRNA specifically targets and inhibits the formation of a host protein that acts to repress TE activity, suggesting that TEs harbor and potentially evolutionarily select short sequences to act as suppressors of host TE repression. PMID:23863322

  14. Substrate availability and transcriptional regulation of metabolic genes in human skeletal muscle during recovery from exercise

    DEFF Research Database (Denmark)

    Pilegaard, Henriette; Osada, Takuya; Andersen, Lisbeth Tingsted

    2005-01-01

    In skeletal muscle of humans, transcription of several metabolic genes is transiently induced during recovery from exercise when no food is consumed. To determine the potential influence of substrate availability on the transcriptional regulation of metabolic genes during recovery from exercise, 9...... the transcriptional regulation of metabolic genes in skeletal muscle of humans during recovery from exercise....

  15. Clock genes and their genomic distributions in three species of salmonid fishes: Associations with genes regulating sexual maturation and cell cycling

    Directory of Open Access Journals (Sweden)

    Ferguson Moira M

    2010-07-01

    Full Text Available Abstract Background Clock family genes encode transcription factors that regulate clock-controlled genes and thus regulate many physiological mechanisms/processes in a circadian fashion. Clock1 duplicates and copies of Clock3 and NPAS2-like genes were partially characterized (genomic sequencing and mapped using family-based indels/SNPs in rainbow trout (RT(Oncorhynchus mykiss, Arctic charr (AC(Salvelinus alpinus, and Atlantic salmon (AS(Salmo salar mapping panels. Results Clock1 duplicates mapped to linkage groups RT-8/-24, AC-16/-13 and AS-2/-18. Clock3/NPAS2-like genes mapped to RT-9/-20, AC-20/-43, and AS-5. Most of these linkage group regions containing the Clock gene duplicates were derived from the most recent 4R whole genome duplication event specific to the salmonids. These linkage groups contain quantitative trait loci (QTL for life history and growth traits (i.e., reproduction and cell cycling. Comparative synteny analyses with other model teleost species reveal a high degree of conservation for genes in these chromosomal regions suggesting that functionally related or co-regulated genes are clustered in syntenic blocks. For example, anti-müllerian hormone (amh, regulating sexual maturation, and ornithine decarboxylase antizymes (oaz1 and oaz2, regulating cell cycling, are contained within these syntenic blocks. Conclusions Synteny analyses indicate that regions homologous to major life-history QTL regions in salmonids contain many candidate genes that are likely to influence reproduction and cell cycling. The order of these genes is highly conserved across the vertebrate species examined, and as such, these genes may make up a functional cluster of genes that are likely co-regulated. CLOCK, as a transcription factor, is found within this block and therefore has the potential to cis-regulate the processes influenced by these genes. Additionally, clock-controlled genes (CCGs are located in other life-history QTL regions within

  16. Regulation and Function of Adult Neurogenesis: From Genes to Cognition

    Science.gov (United States)

    Aimone, James B.; Li, Yan; Lee, Star W.; Clemenson, Gregory D.; Deng, Wei; Gage, Fred H.

    2014-01-01

    Adult neurogenesis in the hippocampus is a notable process due not only to its uniqueness and potential impact on cognition but also to its localized vertical integration of different scales of neuroscience, ranging from molecular and cellular biology to behavior. This review summarizes the recent research regarding the process of adult neurogenesis from these different perspectives, with particular emphasis on the differentiation and development of new neurons, the regulation of the process by extrinsic and intrinsic factors, and their ultimate function in the hippocampus circuit. Arising from a local neural stem cell population, new neurons progress through several stages of maturation, ultimately integrating into the adult dentate gyrus network. The increased appreciation of the full neurogenesis process, from genes and cells to behavior and cognition, makes neurogenesis both a unique case study for how scales in neuroscience can link together and suggests neurogenesis as a potential target for therapeutic intervention for a number of disorders. PMID:25287858

  17. ROG, repressor of GATA, regulates the expression of cytokine genes.

    Science.gov (United States)

    Miaw, S C; Choi, A; Yu, E; Kishikawa, H; Ho, I C

    2000-03-01

    GATA-3 is a T cell-specific transcription factor and is essential for the development of the T cell lineage. Recently, it was shown that the expression of GATA-3 is further induced in CD4+ helper T cells upon differentiation into type 2 but not type 1 effector cells. Here, we report the molecular cloning of a GATA-3 interacting protein, repressor of GATA (ROG). ROG is a lymphoid-specific gene and is rapidly induced in Th cells upon stimulation with anti-CD3. In in vitro assays, ROG represses the GATA-3-induced transactivation. Furthermore, overexpression of ROG in Th clones inhibits the production of Th cytokines. Taken together, our results suggest that ROG might play a critical role in regulating the differentiation and activation of Th cells.

  18. Adipose genes down-regulated during experimental endotoxemia are also suppressed in obesity.

    Science.gov (United States)

    Shah, Rachana; Hinkle, Christine C; Haris, Lalarukh; Shah, Rhia; Mehta, Nehal N; Putt, Mary E; Reilly, Muredach P

    2012-11-01

    Adipose inflammation is a crucial link between obesity and its metabolic complications. Human experimental endotoxemia is a controlled model for the study of inflammatory cardiometabolic responses in vivo. We hypothesized that adipose genes down-regulated during endotoxemia would approximate changes observed with obesity-related inflammation and reveal novel candidates in cardiometabolic disease. Healthy volunteers (n = 14) underwent a 3 ng/kg endotoxin challenge; adipose biopsies were taken at 0, 4, 12, and 24 h for mRNA microarray. A priority list of highly down-regulated and biologically relevant genes was validated by RT-PCR in an independent sample of adipose from healthy subjects (n = 7) undergoing a subclinical 0.6 ng/kg endotoxemia protocol. Expression of validated genes was screened in adipose of lean and severely obese individuals (n = 11 per group), and cellular source was probed in cultured adipocytes and macrophages. Endotoxemia (3 ng/kg) suppressed expression of 353 genes (to endotoxemia revealed suppression of genes involved in cell development and differentiation. A majority of candidates were also suppressed in endogenous human obesity, suggesting a potential pathophysiological role in human obesity-related adipose inflammation.

  19. Multiplex Enhancer Interference Reveals Collaborative Control of Gene Regulation by Estrogen Receptor α-Bound Enhancers.

    Science.gov (United States)

    Carleton, Julia B; Berrett, Kristofer C; Gertz, Jason

    2017-10-25

    Multiple regulatory regions have the potential to regulate a single gene, yet how these elements combine to affect gene expression remains unclear. To uncover the combinatorial relationships between enhancers, we developed Enhancer-interference (Enhancer-i), a CRISPR interference-based approach that uses 2 different repressive domains, KRAB and SID, to prevent enhancer activation simultaneously at multiple regulatory regions. We applied Enhancer-i to promoter-distal estrogen receptor α binding sites (ERBS), which cluster around estradiol-responsive genes and therefore may collaborate to regulate gene expression. Targeting individual sites revealed predominant ERBS that are completely required for the transcriptional response, indicating a lack of redundancy. Simultaneous interference of different ERBS combinations identified supportive ERBS that contribute only when predominant sites are active. Using mathematical modeling, we find strong evidence for collaboration between predominant and supportive ERBS. Overall, our findings expose a complex functional hierarchy of enhancers, where multiple loci bound by the same transcription factor combine to fine-tune the expression of target genes. Copyright © 2017 Elsevier Inc. All rights reserved.

  20. CORECLUST: identification of the conserved CRM grammar together with prediction of gene regulation.

    Science.gov (United States)

    Nikulova, Anna A; Favorov, Alexander V; Sutormin, Roman A; Makeev, Vsevolod J; Mironov, Andrey A

    2012-07-01

    Identification of transcriptional regulatory regions and tracing their internal organization are important for understanding the eukaryotic cell machinery. Cis-regulatory modules (CRMs) of higher eukaryotes are believed to possess a regulatory 'grammar', or preferred arrangement of binding sites, that is crucial for proper regulation and thus tends to be evolutionarily conserved. Here, we present a method CORECLUST (COnservative REgulatory CLUster STructure) that predicts CRMs based on a set of positional weight matrices. Given regulatory regions of orthologous and/or co-regulated genes, CORECLUST constructs a CRM model by revealing the conserved rules that describe the relative location of binding sites. The constructed model may be consequently used for the genome-wide prediction of similar CRMs, and thus detection of co-regulated genes, and for the investigation of the regulatory grammar of the system. Compared with related methods, CORECLUST shows better performance at identification of CRMs conferring muscle-specific gene expression in vertebrates and early-developmental CRMs in Drosophila.

  1. Transnational models for regulation of nanotechnology.

    Science.gov (United States)

    Marchant, Gary E; Sylvester, Douglas J

    2006-01-01

    Like all technologies, nanotechnology will inevitably present risks, whether they result from unintentional effects of otherwise beneficial applications, or from the malevolent misuse of technology. Increasingly, risks from new and emerging technologies are being regulated at the international level, although governments and private experts are only beginning to consider the appropriate international responses to nanotechnology. In this paper, we explore both the potential risks posed by nanotechnology and potential regulatory frameworks that law may impose. In so doing, we also explore the various rationales for international regulation including the potential for cross-boundary harms, sharing of regulatory expertise and resources, controlling protectionism and trade conflicts, avoiding a "race to the bottom" in which governments seek economic advantage through lax regulation, and limiting the "nano divide" between North and South. Finally, we examine some models for international regulation and offer tentative thoughts on the prospects for each.

  2. The role of miRNAs in regulating gene expression networks.

    Science.gov (United States)

    Gurtan, Allan M; Sharp, Phillip A

    2013-10-09

    MicroRNAs (miRNAs) are key regulators of gene expression. They are conserved across species, expressed across cell types, and active against a large proportion of the transcriptome. The sequence-complementary mechanism of miRNA activity exploits combinatorial diversity, a property conducive to network-wide regulation of gene expression, and functional evidence supporting this hypothesized systems-level role has steadily begun to accumulate. The emerging models are exciting and will yield deep insight into the regulatory architecture of biology. However, because of the technical challenges facing the network-based study of miRNAs, many gaps remain. Here, we review mammalian miRNAs by describing recent advances in understanding their molecular activity and network-wide function. Copyright © 2013 Elsevier Ltd. All rights reserved.

  3. The Schizophrenia-Associated BRD1 Gene Regulates Behavior, Neurotransmission, and Expression of Schizophrenia Risk Enriched Gene Sets in Mice.

    Science.gov (United States)

    Qvist, Per; Christensen, Jane Hvarregaard; Vardya, Irina; Rajkumar, Anto Praveen; Mørk, Arne; Paternoster, Veerle; Füchtbauer, Ernst-Martin; Pallesen, Jonatan; Fryland, Tue; Dyrvig, Mads; Hauberg, Mads Engel; Lundsberg, Birgitte; Fejgin, Kim; Nyegaard, Mette; Jensen, Kimmo; Nyengaard, Jens Randel; Mors, Ole; Didriksen, Michael; Børglum, Anders Dupont

    2017-07-01

    The schizophrenia-associated BRD1 gene encodes a transcriptional regulator whose comprehensive chromatin interactome is enriched with schizophrenia risk genes. However, the biology underlying the disease association of BRD1 remains speculative. This study assessed the transcriptional drive of a schizophrenia-associated BRD1 risk variant in vitro. Accordingly, to examine the effects of reduced Brd1 expression, we generated a genetically modified Brd1 +/- mouse and subjected it to behavioral, electrophysiological, molecular, and integrative genomic analyses with focus on schizophrenia-relevant parameters. Brd1 +/- mice displayed cerebral histone H3K14 hypoacetylation and a broad range of behavioral changes with translational relevance to schizophrenia. These behaviors were accompanied by striatal dopamine/serotonin abnormalities and cortical excitation-inhibition imbalances involving loss of parvalbumin immunoreactive interneurons. RNA-sequencing analyses of cortical and striatal micropunches from Brd1 +/- and wild-type mice revealed differential expression of genes enriched for schizophrenia risk, including several schizophrenia genome-wide association study risk genes (e.g., calcium channel subunits [Cacna1c and Cacnb2], cholinergic muscarinic receptor 4 [Chrm4)], dopamine receptor D 2 [Drd2], and transcription factor 4 [Tcf4]). Integrative analyses further found differentially expressed genes to cluster in functional networks and canonical pathways associated with mental illness and molecular signaling processes (e.g., glutamatergic, monoaminergic, calcium, cyclic adenosine monophosphate [cAMP], dopamine- and cAMP-regulated neuronal phosphoprotein 32 kDa [DARPP-32], and cAMP responsive element binding protein signaling [CREB]). Our study bridges the gap between genetic association and pathogenic effects and yields novel insights into the unfolding molecular changes in the brain of a new schizophrenia model that incorporates genetic risk at three levels: allelic

  4. Stimuli-Regulated Smart Polymeric Systems for Gene Therapy

    Directory of Open Access Journals (Sweden)

    Ansuja Pulickal Mathew

    2017-04-01

    Full Text Available The physiological condition of the human body is a composite of different environments, each with its own parameters that may differ under normal, as well as diseased conditions. These environmental conditions include factors, such as pH, temperature and enzymes that are specific to a type of cell, tissue or organ or a pathological state, such as inflammation, cancer or infection. These conditions can act as specific triggers or stimuli for the efficient release of therapeutics at their destination by overcoming many physiological and biological barriers. The efficacy of conventional treatment modalities can be enhanced, side effects decreased and patient compliance improved by using stimuli-responsive material that respond to these triggers at the target site. These stimuli or triggers can be physical, chemical or biological and can be internal or external in nature. Many smart/intelligent stimuli-responsive therapeutic gene carriers have been developed that can respond to either internal stimuli, which may be normally present, overexpressed or present in decreased levels, owing to a disease, or to stimuli that are applied externally, such as magnetic fields. This review focuses on the effects of various internal stimuli, such as temperature, pH, redox potential, enzymes, osmotic activity and other biomolecules that are present in the body, on modulating gene expression by using stimuli-regulated smart polymeric carriers.

  5. Coenzyme Recognition and Gene Regulation by a Flavin Mononucleotide Riboswitch

    Energy Technology Data Exchange (ETDEWEB)

    Serganov, A.; Huang, L; Patel, D

    2009-01-01

    The biosynthesis of several protein cofactors is subject to feedback regulation by riboswitches. Flavin mononucleotide (FMN)-specific riboswitches also known as RFN elements, direct expression of bacterial genes involved in the biosynthesis and transport of riboflavin (vitamin B2) and related compounds. Here we present the crystal structures of the Fusobacterium nucleatum riboswitch bound to FMN, riboflavin and antibiotic roseoflavin. The FMN riboswitch structure, centred on an FMN-bound six-stem junction, does not fold by collinear stacking of adjacent helices, typical for folding of large RNAs. Rather, it adopts a butterfly-like scaffold, stapled together by opposingly directed but nearly identically folded peripheral domains. FMN is positioned asymmetrically within the junctional site and is specifically bound to RNA through interactions with the isoalloxazine ring chromophore and direct and Mg{sup 2+}-mediated contacts with the phosphate moiety. Our structural data, complemented by binding and footprinting experiments, imply a largely pre-folded tertiary RNA architecture and FMN recognition mediated by conformational transitions within the junctional binding pocket. The inherent plasticity of the FMN-binding pocket and the availability of large openings make the riboswitch an attractive target for structure-based design of FMN-like antimicrobial compounds. Our studies also explain the effects of spontaneous and antibiotic-induced deregulatory mutations and provided molecular insights into FMN-based control of gene expression in normal and riboflavin-overproducing bacterial strains.

  6. Flg22-triggered immunity negatively regulates key BR biosynthetic genes

    Directory of Open Access Journals (Sweden)

    Tamara eJiménez-Góngora

    2015-11-01

    Full Text Available In plants, activation of growth and activation of immunity are opposing processes that define a trade-off. In the past few years, the growth-promoting hormones brassinosteroids (BR have emerged as negative regulators of pathogen-associated molecular pattern (PAMP-triggered immunity (PTI, promoting growth at the expense of defence. The crosstalk between BR and PTI signalling was described as negative and unidirectional, since activation of PTI does not affect several analysed steps in the BR signalling pathway. In this work, we describe that activation of PTI by the bacterial PAMP flg22 results in the reduced expression of BR biosynthetic genes. This effect does not require BR perception or signalling, and occurs within 15 minutes of flg22 treatment. Since the described PTI-induced repression of gene expression may result in a reduction in BR biosynthesis, the crosstalk between PTI and BR could actually be negative and bidirectional, a possibility that should be taken into account when considering the interaction between these two pathways.

  7. Microbial regulation of the soil carbon cycle: evidence from gene-enzyme relationships.

    Science.gov (United States)

    Trivedi, Pankaj; Delgado-Baquerizo, Manuel; Trivedi, Chanda; Hu, Hangwei; Anderson, Ian C; Jeffries, Thomas C; Zhou, Jizhong; Singh, Brajesh K

    2016-11-01

    A lack of empirical evidence for the microbial regulation of ecosystem processes, including carbon (C) degradation, hinders our ability to develop a framework to directly incorporate the genetic composition of microbial communities in the enzyme-driven Earth system models. Herein we evaluated the linkage between microbial functional genes and extracellular enzyme activity in soil samples collected across three geographical regions of Australia. We found a strong relationship between different functional genes and their corresponding enzyme activities. This relationship was maintained after considering microbial community structure, total C and soil pH using structural equation modelling. Results showed that the variations in the activity of enzymes involved in C degradation were predicted by the functional gene abundance of the soil microbial community (R 2 >0.90 in all cases). Our findings provide a strong framework for improved predictions on soil C dynamics that could be achieved by adopting a gene-centric approach incorporating the abundance of functional genes into process models.

  8. TiGER: a database for tissue-specific gene expression and regulation.

    Science.gov (United States)

    Liu, Xiong; Yu, Xueping; Zack, Donald J; Zhu, Heng; Qian, Jiang

    2008-06-09

    Understanding how genes are expressed and regulated in different tissues is a fundamental and challenging question. However, most of currently available biological databases do not focus on tissue-specific gene regulation. The recent development of computational methods for tissue-specific combinational gene regulation, based on transcription factor binding sites, enables us to perform a large-scale analysis of tissue-specific gene regulation in human tissues. The results are stored in a web database called TiGER (Tissue-specific Gene Expression and Regulation). The database contains three types of data including tissue-specific gene expression profiles, combinatorial gene regulations, and cis-regulatory module (CRM) detections. At present the database contains expression profiles for 19,526 UniGene genes, combinatorial regulations for 7,341 transcription factor pairs and 6,232 putative CRMs for 2,130 RefSeq genes. We have developed and made publicly available a database, TiGER, which summarizes and provides large scale data sets for tissue-specific gene expression and regulation in a variety of human tissues. This resource is available at 1.

  9. TiGER: A database for tissue-specific gene expression and regulation

    Directory of Open Access Journals (Sweden)

    Zack Donald J

    2008-06-01

    Full Text Available Abstract Background Understanding how genes are expressed and regulated in different tissues is a fundamental and challenging question. However, most of currently available biological databases do not focus on tissue-specific gene regulation. Results The recent development of computational methods for tissue-specific combinational gene regulation, based on transcription factor binding sites, enables us to perform a large-scale analysis of tissue-specific gene regulation in human tissues. The results are stored in a web database called TiGER (Tissue-specific Gene Expression and Regulation. The database contains three types of data including tissue-specific gene expression profiles, combinatorial gene regulations, and cis-regulatory module (CRM detections. At present the database contains expression profiles for 19,526 UniGene genes, combinatorial regulations for 7,341 transcription factor pairs and 6,232 putative CRMs for 2,130 RefSeq genes. Conclusion We have developed and made publicly available a database, TiGER, which summarizes and provides large scale data sets for tissue-specific gene expression and regulation in a variety of human tissues. This resource is available at 1.

  10. A copula method for modeling directional dependence of genes

    Directory of Open Access Journals (Sweden)

    Park Changyi

    2008-05-01

    our results with those from other methods in the literature. Although microarray results show a transcriptional co-regulation pattern and do not imply that the gene products are physically interactive, this tight genetic connection may suggest that each gene product has either direct or indirect connections between the other gene products. Indeed, recent comprehensive analysis of a protein interaction map revealed that those histone genes are physically connected with each other, supporting the results obtained by our method. Conclusion The results illustrate that our method can be an alternative to Bayesian networks in modeling gene interactions. One advantage of our approach is that dependence between genes is not assumed to be linear. Another advantage is that our approach can detect directional dependence. We expect that our study may help to design artificial drug candidates, which can block or activate biologically meaningful pathways. Moreover, our copula approach can be extended to investigate the effects of local environments on protein-protein interactions. The copula mutual information approach will help to propose the new variant of ARACNE (Algorithm for the Reconstruction of Accurate Cellular Networks: an algorithm for the reconstruction of gene regulatory networks.

  11. Burkholderia cenocepacia ShvR-regulated genes that influence colony morphology, biofilm formation, and virulence.

    Science.gov (United States)

    Subramoni, Sujatha; Nguyen, David T; Sokol, Pamela A

    2011-08-01

    Burkholderia cenocepacia is an opportunistic pathogen that primarily infects cystic fibrosis (CF) patients. Previously, we reported that ShvR, a LysR regulator, influences colony morphology, virulence, and biofilm formation and regulates the expression of an adjacent 24-kb genomic region encoding 24 genes. In this study, we report the functional characterization of selected genes in this region. A Tn5 mutant with shiny colony morphology was identified with a polar mutation in BCAS0208, predicted to encode an acyl-coenzyme A dehydrogenase. Mutagenesis of BCAS0208 and complementation analyses revealed that BCAS0208 is required for rough colony morphology, biofilm formation, and virulence on alfalfa seedlings. It was not possible to complement with BCAS0208 containing a mutation in the catalytic site. BCAS0201, encoding a putative flavin adenine dinucleotide (FAD)-dependent oxidoreductase, and BCAS0207, encoding a putative citrate synthase, do not influence colony morphology but are required for optimum levels of biofilm formation and virulence. Both BCAS0208 and BCAS0201 contribute to pellicle formation, although individual mutations in each of these genes had no appreciable effect on pellicle formation. A mutant with a polar insertion in BCAS0208 was significantly less virulent in a rat model of chronic lung infection as well as in the alfalfa model. Genes in this region were shown to influence utilization of branched-chain fatty acids, tricarboxylic acid cycle substrates, l-arabinose, and branched-chain amino acids. Together, our data show that the ShvR-regulated genes BCAS0208 to BCAS0201 are required for the rough colony morphotype, biofilm and pellicle formation, and virulence in B. cenocepacia.

  12. Motif analysis unveils the possible co-regulation of chloroplast genes and nuclear genes encoding chloroplast proteins.

    Science.gov (United States)

    Wang, Ying; Ding, Jun; Daniell, Henry; Hu, Haiyan; Li, Xiaoman

    2012-09-01

    Chloroplasts play critical roles in land plant cells. Despite their importance and the availability of at least 200 sequenced chloroplast genomes, the number of known DNA regulatory sequences in chloroplast genomes are limited. In this paper, we designed computational methods to systematically study putative DNA regulatory sequences in intergenic regions near chloroplast genes in seven plant species and in promoter sequences of nuclear genes in Arabidopsis and rice. We found that -35/-10 elements alone cannot explain the transcriptional regulation of chloroplast genes. We also concluded that there are unlikely motifs shared by intergenic sequences of most of chloroplast genes, indicating that these genes are regulated differently. Finally and surprisingly, we found five conserved motifs, each of which occurs in no more than six chloroplast intergenic sequences, are significantly shared by promoters of nuclear-genes encoding chloroplast proteins. By integrating information from gene function annotation, protein subcellular localization analyses, protein-protein interaction data, and gene expression data, we further showed support of the functionality of these conserved motifs. Our study implies the existence of unknown nuclear-encoded transcription factors that regulate both chloroplast genes and nuclear genes encoding chloroplast protein, which sheds light on the understanding of the transcriptional regulation of chloroplast genes.

  13. Actiotope model and self-regulated learning

    OpenAIRE

    Robert Grassinger; Heidrun Stoeger; Albert Ziegler

    2011-01-01

    Research on self-regulated learning takes two central perspectives on the learning process, that of the learning individual and that of the accompanying environmental factors. We suggest combining both of these perspectives in a systemic model, the actiotope model. 399 pupils in fifth and sixth grade were examined at three points in time: prior to the introduction of a new subject (Latin, French, or physics), three to five weeks after the introduction, and, finally, about twelve weeks after t...

  14. A control engineering model of calcium regulation.

    Science.gov (United States)

    Christie, Christopher R; Achenie, Luke E K; Ogunnaike, Babatunde A

    2014-08-01

    A control engineering perspective provides a framework for representing important mechanistic details of the calcium (Ca) regulatory system efficiently. The resulting model facilitates the testing of hypotheses about mechanisms underlying the emergence of known Ca-related pathologies. The objective of this work is to develop a comprehensive computational model that will enable quantitative understanding of plasma Ca regulation under normal and pathological conditions. Ca regulation is represented as an engineering control system where physiological subprocesses are mapped onto corresponding block components (sensor, controller, actuator, and process), and underlying mechanisms are represented by differential equations. The resulting model is validated with clinical observations of induced hypo- or hypercalcemia in healthy subjects, and its applicability is demonstrated by comparing model predictions of Ca-related pathologies to corresponding clinical data. Our model accurately predicts clinical responses to induced hypo- and hypercalcemia in healthy subjects within a framework that facilitates the representation of Ca-related pathologies in terms of control system component defects. The model also enables a deeper understanding of the emergence of pathologies and the testing of hypotheses about related features of Ca regulation-for example, why primary hyperparathyroidism and hypoparathyroidism arise from "controller defects." The control engineering framework provides an efficient means of organizing the subprocesses constituting Ca regulation, thereby facilitating a fundamental understanding of this complex process. The resulting validated model's predictions are consistent with clinically observed short- and long-term dynamic characteristics of the Ca regulatory system in both healthy and diseased patients. The model also enables simulation of currently infeasible clinical tests and generates predictions of physiological variables that are currently not

  15. Orthogonal Cas9 proteins for RNA-guided gene regulation and editing

    Science.gov (United States)

    Church, George M.; Esvelt, Kevin; Mali, Prashant

    2017-03-07

    Methods of modulating expression of a target nucleic acid in a cell are provided including use of multiple orthogonal Cas9 proteins to simultaneously and independently regulate corresponding genes or simultaneously and independently edit corresponding genes.

  16. Gene regulation and genetics in neurochemistry, past to future.

    Science.gov (United States)

    Barger, Steven W

    2016-10-01

    Ask any neuroscientist to name the most profound discoveries in the field in the past 60 years, and at or near the top of the list will be a phenomenon or technique related to genes and their expression. Indeed, our understanding of genetics and gene regulation has ushered in whole new systems of knowledge and new empirical approaches, many of which could not have even been imagined prior to the molecular biology boon of recent decades. Neurochemistry, in the classic sense, intersects with these concepts in the manifestation of neuropeptides, obviously dependent upon the central dogma (the established rules by which DNA sequence is eventually converted into protein primary structure) not only for their conformation but also for their levels and locales of expression. But, expanding these considerations to non-peptide neurotransmitters illustrates how gene regulatory events impact neurochemistry in a much broader sense, extending beyond the neurochemicals that translate electrical signals into chemical ones in the synapse, to also include every aspect of neural development, structure, function, and pathology. From the beginning, the mutability - yet relative stability - of genes and their expression patterns were recognized as potential substrates for some of the most intriguing phenomena in neurobiology - those instances of plasticity required for learning and memory. Near-heretical speculation was offered in the idea that perhaps the very sequence of the genome was altered to encode memories. A fascinating component of the intervening progress includes evidence that the central dogma is not nearly as rigid and consistent as we once thought. And this mutability extends to the potential to manipulate that code for both experimental and clinical purposes. Astonishing progress has been made in the molecular biology of neurochemistry during the 60 years since this journal debuted. Many of the gains in conceptual understanding have been driven by methodological

  17. Inferring gene regression networks with model trees

    Directory of Open Access Journals (Sweden)

    Aguilar-Ruiz Jesus S

    2010-10-01

    Full Text Available Abstract Background Novel strategies are required in order to handle the huge amount of data produced by microarray technologies. To infer gene regulatory networks, the first step is to find direct regulatory relationships between genes building the so-called gene co-expression networks. They are typically generated using correlation statistics as pairwise similarity measures. Correlation-based methods are very useful in order to determine whether two genes have a strong global similarity but do not detect local similarities. Results We propose model trees as a method to identify gene interaction networks. While correlation-based methods analyze each pair of genes, in our approach we generate a single regression tree for each gene from the remaining genes. Finally, a graph from all the relationships among output and input genes is built taking into account whether the pair of genes is statistically significant. For this reason we apply a statistical procedure to control the false discovery rate. The performance of our approach, named REGNET, is experimentally tested on two well-known data sets: Saccharomyces Cerevisiae and E.coli data set. First, the biological coherence of the results are tested. Second the E.coli transcriptional network (in the Regulon database is used as control to compare the results to that of a correlation-based method. This experiment shows that REGNET performs more accurately at detecting true gene associations than the Pearson and Spearman zeroth and first-order correlation-based methods. Conclusions REGNET generates gene association networks from gene expression data, and differs from correlation-based methods in that the relationship between one gene and others is calculated simultaneously. Model trees are very useful techniques to estimate the numerical values for the target genes by linear regression functions. They are very often more precise than linear regression models because they can add just different linear

  18. Transcriptomic analysis in the developing zebrafish embryo after compound exposure: Individual gene expression and pathway regulation

    Energy Technology Data Exchange (ETDEWEB)

    Hermsen, Sanne A.B., E-mail: Sanne.Hermsen@rivm.nl [Centre for Health Protection, National Institute for Public Health and the Environment (RIVM), P.O. Box 1, 3720 BA Bilthoven (Netherlands); Department of Toxicogenomics, Maastricht University, P.O. Box 616, 6200 MD, Maastricht (Netherlands); Institute for Risk Assessment Sciences (IRAS), Utrecht University, P.O. Box 80.178, 3508 TD, Utrecht (Netherlands); Pronk, Tessa E. [Centre for Health Protection, National Institute for Public Health and the Environment (RIVM), P.O. Box 1, 3720 BA Bilthoven (Netherlands); Department of Toxicogenomics, Maastricht University, P.O. Box 616, 6200 MD, Maastricht (Netherlands); Brandhof, Evert-Jan van den [Centre for Environmental Quality, National Institute for Public Health and the Environment (RIVM), P.O. Box 1, 3720 BA Bilthoven (Netherlands); Ven, Leo T.M. van der [Centre for Health Protection, National Institute for Public Health and the Environment (RIVM), P.O. Box 1, 3720 BA Bilthoven (Netherlands); Piersma, Aldert H. [Centre for Health Protection, National Institute for Public Health and the Environment (RIVM), P.O. Box 1, 3720 BA Bilthoven (Netherlands); Institute for Risk Assessment Sciences (IRAS), Utrecht University, P.O. Box 80.178, 3508 TD, Utrecht (Netherlands)

    2013-10-01

    The zebrafish embryotoxicity test is a promising alternative assay for developmental toxicity. Classically, morphological assessment of the embryos is applied to evaluate the effects of compound exposure. However, by applying differential gene expression analysis the sensitivity and predictability of the test may be increased. For defining gene expression signatures of developmental toxicity, we explored the possibility of using gene expression signatures of compound exposures based on commonly expressed individual genes as well as based on regulated gene pathways. Four developmental toxic compounds were tested in concentration-response design, caffeine, carbamazepine, retinoic acid and valproic acid, and two non-embryotoxic compounds, D-mannitol and saccharin, were included. With transcriptomic analyses we were able to identify commonly expressed genes, which were mostly development related, after exposure to the embryotoxicants. We also identified gene pathways regulated by the embryotoxicants, suggestive of their modes of action. Furthermore, whereas pathways may be regulated by all compounds, individual gene expression within these pathways can differ for each compound. Overall, the present study suggests that the use of individual gene expression signatures as well as pathway regulation may be useful starting points for defining gene biomarkers for predicting embryotoxicity. - Highlights: • The zebrafish embryotoxicity test in combination with transcriptomics was used. • We explored two approaches of defining gene biomarkers for developmental toxicity. • Four compounds in concentration-response design were tested. • We identified commonly expressed individual genes as well as regulated gene pathways. • Both approaches seem suitable starting points for defining gene biomarkers.

  19. Genome-wide association study identifies candidate genes for starch content regulation in maize kernels

    Directory of Open Access Journals (Sweden)

    Na Liu

    2016-07-01

    Full Text Available Kernel starch content is an important trait in maize (Zea mays L. as it accounts for 65% to 75% of the dry kernel weight and positively correlates with seed yield. A number of starch synthesis-related genes have been identified in maize in recent years. However, many loci underlying variation in starch content among maize inbred lines still remain to be identified. The current study is a genome-wide association study that used a set of 263 maize inbred lines. In this panel, the average kernel starch content was 66.99%, ranging from 60.60% to 71.58% over the three study years. These inbred lines were genotyped with the SNP50 BeadChip maize array, which is comprised of 56,110 evenly spaced, random SNPs. Population structure was controlled by a mixed linear model (MLM as implemented in the software package TASSEL. After the statistical analyses, four SNPs were identified as significantly associated with starch content (P ≤ 0.0001, among which one each are located on chromosomes 1 and 5 and two are on chromosome 2. Furthermore, 77 candidate genes associated with starch synthesis were found within the 100-kb intervals containing these four QTLs, and four highly associated genes were within 20-kb intervals of the associated SNPs. Among the four genes, Glucose-1-phosphate adenylyltransferase (APS1; Gene ID GRMZM2G163437 is known as an important regulator of kernel starch content. The identified SNPs, QTLs, and candidate genes may not only be readily used for germplasm improvement by marker-assisted selection in breeding, but can also elucidate the genetic basis of starch content. Further studies on these identified candidate genes may help determine the molecular mechanisms regulating kernel starch content in maize and other important cereal crops.

  20. Expression and chromatin structures of cellulolytic enzyme gene regulated by heterochromatin protein 1

    OpenAIRE

    Zhang, Xiujun; Qu, Yinbo; Qin, Yuqi

    2016-01-01

    Background Heterochromatin protein 1 (HP1, homologue HepA in Penicillium oxalicum) binding is associated with a highly compact chromatin state accompanied by gene silencing or repression. HP1 loss leads to the derepression of gene expression. We investigated HepA roles in regulating cellulolytic enzyme gene expression, as an increasingly number of studies have suggested that cellulolytic enzyme gene expression is not only regulated by transcription factors, but is also affected by the chromat...

  1. A systems biology model of the regulatory network in Populus leaves reveals interacting regulators and conserved regulation

    Directory of Open Access Journals (Sweden)

    Hvidsten Torgeir R

    2011-01-01

    Full Text Available Abstract Background Green plant leaves have always fascinated biologists as hosts for photosynthesis and providers of basic energy to many food webs. Today, comprehensive databases of gene expression data enable us to apply increasingly more advanced computational methods for reverse-engineering the regulatory network of leaves, and to begin to understand the gene interactions underlying complex emergent properties related to stress-response and development. These new systems biology methods are now also being applied to organisms such as Populus, a woody perennial tree, in order to understand the specific characteristics of these species. Results We present a systems biology model of the regulatory network of Populus leaves. The network is reverse-engineered from promoter information and expression profiles of leaf-specific genes measured over a large set of conditions related to stress and developmental. The network model incorporates interactions between regulators, such as synergistic and competitive relationships, by evaluating increasingly more complex regulatory mechanisms, and is therefore able to identify new regulators of leaf development not found by traditional genomics methods based on pair-wise expression similarity. The approach is shown to explain available gene function information and to provide robust prediction of expression levels in new data. We also use the predictive capability of the model to identify condition-specific regulation as well as conserved regulation between Populus and Arabidopsis. Conclusions We outline a computationally inferred model of the regulatory network of Populus leaves, and show how treating genes as interacting, rather than individual, entities identifies new regulators compared to traditional genomics analysis. Although systems biology models should be used with care considering the complexity of regulatory programs and the limitations of current genomics data, methods describing interactions

  2. Iron homeostasis in Arabidopsis thaliana: transcriptomic analyses reveal novel FIT-regulated genes, iron deficiency marker genes and functional gene networks.

    Science.gov (United States)

    Mai, Hans-Jörg; Pateyron, Stéphanie; Bauer, Petra

    2016-10-03

    FIT (FER-LIKE IRON DEFICIENCY-INDUCED TRANSCRIPTION FACTOR) is the central regulator of iron uptake in Arabidopsis thaliana roots. We performed transcriptome analyses of six day-old seedlings and roots of six week-old plants using wild type, a fit knock-out mutant and a FIT over-expression line grown under iron-sufficient or iron-deficient conditions. We compared genes regulated in a FIT-dependent manner depending on the developmental stage of the plants. We assembled a high likelihood dataset which we used to perform co-expression and functional analysis of the most stably iron deficiency-induced genes. 448 genes were found FIT-regulated. Out of these, 34 genes were robustly FIT-regulated in root and seedling samples and included 13 novel FIT-dependent genes. Three hundred thirty-one genes showed differential regulation in response to the presence and absence of FIT only in the root samples, while this was the case for 83 genes in the seedling samples. We assembled a virtual dataset of iron-regulated genes based on a total of 14 transcriptomic analyses of iron-deficient and iron-sufficient wild-type plants to pinpoint the best marker genes for iron deficiency and analyzed this dataset in depth. Co-expression analysis of this dataset revealed 13 distinct regulons part of which predominantly contained functionally related genes. We could enlarge the list of FIT-dependent genes and discriminate between genes that are robustly FIT-regulated in roots and seedlings or only in one of those. FIT-regulated genes were mostly induced, few of them were repressed by FIT. With the analysis of a virtual dataset we could filter out and pinpoint new candidates among the most reliable marker genes for iron deficiency. Moreover, co-expression and functional analysis of this virtual dataset revealed iron deficiency-induced and functionally distinct regulons.

  3. Aspects of gene structure and functional regulation of the isozymes of Na,K-ATPase

    DEFF Research Database (Denmark)

    Jorgensen, P.L.

    2001-01-01

    Gaps in our understanding of the complex regulated expression of isozymes of Na,K-ATPase and the diverse systems for posttranslational modification and short term regulation of active Na,K-transport in animals and humans are the main problems in comprehensive Na,K-pump physiology. In mammalian...... genomes, the genes of four alpha-subunit and at least three beta-subunit isoforms of Na,K-ATPase are identified and two gamma-subunits are expressed in kidney. The isoforms combine in a number of Na,K-ATPase isozymes that are expressed in a tissue and cell specific manner. Models of the molecular...... mechanism of regulation of these isozymes have become more reliable due to progress in understanding the three-dimensional protein structure and conformational transitions mediating transfer of energy from the P-domain to intramembrane Na+ and K+ binding sites....

  4. Sex Differences in Drosophila Somatic Gene Expression: Variation and Regulation by doublesex

    Directory of Open Access Journals (Sweden)

    Michelle N. Arbeitman

    2016-07-01

    Full Text Available Sex differences in gene expression have been widely studied in Drosophila melanogaster. Sex differences vary across strains, but many molecular studies focus on only a single strain, or on genes that show sexually dimorphic expression in many strains. How extensive variability is and whether this variability occurs among genes regulated by sex determination hierarchy terminal transcription factors is unknown. To address these questions, we examine differences in sexually dimorphic gene expression between two strains in Drosophila adult head tissues. We also examine gene expression in doublesex (dsx mutant strains to determine which sex-differentially expressed genes are regulated by DSX, and the mode by which DSX regulates expression. We find substantial variation in sex-differential expression. The sets of genes with sexually dimorphic expression in each strain show little overlap. The prevalence of different DSX regulatory modes also varies between the two strains. Neither the patterns of DSX DNA occupancy, nor mode of DSX regulation explain why some genes show consistent sex-differential expression across strains. We find that the genes identified as regulated by DSX in this study are enriched with known sites of DSX DNA occupancy. Finally, we find that sex-differentially expressed genes and genes regulated by DSX are highly enriched on the fourth chromosome. These results provide insights into a more complete pool of potential DSX targets, as well as revealing the molecular flexibility of DSX regulation.

  5. Novel Sfp1 Transcriptional Regulation of Saccharomyces cerevisiae Gene Expression Changes During Spaceflight

    Science.gov (United States)

    Coleman, Chasity B.; Allen, Patricia L.; Rupert, Mark; Goulart, Carla; Hoehn, Alexander; Stodieck, Louis S.; Hammond, Timothy G.

    2008-12-01

    This study identifies transcriptional regulation of stress response element (STRE) genes in space in the model eukaryotic organism, Saccharomyces cerevisiae. To determine transcription-factor dependence, gene expression changes in space were examined in strains bearing green fluorescent protein tagged (GFP-tagged) reporters for YIL052C (Sfp1 dependent with stress), YST-2 (Sfp1/Rap1 dependent with stress), or SSA4 (Msn4 dependent with stress), along with strains of SSA4-GFP and YIL052C-GFP with individual deletions of the Msn4 or Sfp1. When compared to parallel ground controls, spaceflight induces significant gene expression changes in SSA4 (35% decrease) and YIL052C (45% decrease), while expression of YST-2 (0.08% decrease) did not change. In space, deletion of Sfp1 reversed the SSA4 gene expression effect (0.00% change), but Msn4 deletion yielded a similar decrease in SSA4 expression (34% change), which indicates that SSA4 gene expression is dependent on the Sfp1 transcription factor in space, unlike other stresses. For YIL052C, deletion of Sfp1 reversed the effect (0.01% change), and the Msn4 deletion maintained the decrease in expression (30% change), which indicates that expression of YIL052C is also dependent on Sfp1 in space. Spaceflight has selective and specific effects on SSA4 and YIL052C gene expression, indicated by novel dependence on Sfp1.

  6. Co-ordinate regulation of genes involved in storage lipid mobilization in Arabidopsis thaliana.

    Science.gov (United States)

    Rylott, E L; Hooks, M A; Graham, I A

    2001-05-01

    Molecular genetic approaches in the model plant Arabidopsis thaliana (Col0) are shedding new light on the role and control of the pathways associated with the mobilization of lipid reserves during oilseed germination and post-germinative growth. Numerous independent studies have reported on the expression of individual genes encoding enzymes from the three major pathways: beta-oxidation, the glyoxylate cycle and gluconeogenesis. However, a single comprehensive study of representative genes and enzymes from the different pathways in a single plant species has not been done. Here we present results from Arabidopsis that demonstrate the co-ordinate regulation of gene expression and enzyme activities for the acyl-CoA oxidase- and 3-ketoacyl-CoA thiolase-mediated steps of beta-oxidation, the isocitrate lyase and malate synthase steps of the glyoxylate cycle and the phosphoenolpyruvate carboxykinase step of gluconeogenesis. The mRNA abundance and enzyme activities increase to a peak at stage 2, 48 h after the onset of seed germination, and decline thereafter either to undetectable levels (for malate synthase and isocitrate lyase) or low basal levels (for the genes of beta-oxidation and gluconeogenesis). The co-ordinate induction of all these genes at the onset of germination raises the possibility that a global regulatory mechanism operates to induce the expression of genes associated with the mobilization of storage reserves during the heterotrophic growth period.

  7. Members of the barley NAC transcription factor gene family show differential co-regulation with senescence-associated genes during senescence of flag leaves

    DEFF Research Database (Denmark)

    Christiansen, Michael W; Gregersen, Per L.

    2014-01-01

    activation of degradation processes in senescing barley leaf tissues. This picture was confirmed in a detailed quantitative reverse transcription–PCR (qRT–PCR) experiment, which also showed distinct gene expression patterns for different members of the NAC gene family, suggesting a group of ~15 out of the 47...... in the NAC transcription factor family during senescence of barley flag leaves was studied. Several members of the NAC transcription factor gene family were up-regulated during senescence in a microarray experiment, together with a large range of senescence-associated genes, reflecting the coordinated...... studied NAC genes to be important for signalling processes and for the execution of degradation processes during leaf senescence in barley. Seven models for DNA-binding motifs for NAC transcription factors were designed based on published motifs, and available promoter sequences of barley genes were...

  8. Regulation of per and cry genes reveals a central role for the D-box enhancer in light-dependent gene expression.

    Directory of Open Access Journals (Sweden)

    Philipp Mracek

    Full Text Available Light serves as a key environmental signal for synchronizing the circadian clock with the day night cycle. The zebrafish represents an attractive model for exploring how light influences the vertebrate clock mechanism. Direct illumination of most fish tissues and cell lines induces expression of a broad range of genes including DNA repair, stress response and key clock genes. We have previously identified D- and E-box elements within the promoter of the zebrafish per2 gene that together direct light-induced gene expression. However, is the combined regulation by E- and D-boxes a general feature for all light-induced gene expression? We have tackled this question by examining the regulation of additional light-inducible genes. Our results demonstrate that with the exception of per2, all other genes tested are not induced by light upon blocking of de novo protein synthesis. We reveal that a single D-box serves as the principal light responsive element within the cry1a promoter. Furthermore, upon inhibition of protein synthesis D-box mediated gene expression is abolished while the E-box confers light driven activation as observed in the per2 gene. Given the existence of different photoreceptors in fish cells, our results implicate the D-box enhancer as a general convergence point for light driven signaling.

  9. Unique structure and regulation of the nematode detoxification gene regulator SKN-1: implications to understanding and controlling drug resistance

    Science.gov (United States)

    Choe, Keith P.; Leung, Chi K.; Miyamoto, Michael M.

    2012-01-01

    Nematodes parasitize an alarming number of people and agricultural animals globally and cause debilitating morbidity and mortality. Anthelmintics have been the primary tools used to control parasitic nematodes for the past several decades, but drug resistance is becoming a major obstacle. Xenobiotic detoxification pathways defend against drugs and other foreign chemicals in diverse organisms, and evidence is accumulating that they play a role in mediating resistance to anthelmintics in nematodes. Related anti-oxidation pathways may also provide filarial parasites protection against host free radical-mediated immune responses. Upstream regulatory pathways have received almost no attention in nematode parasites despite their potential to co-regulate multiple detoxification and anti-oxidation genes. The NRF2 transcription factor mediates inducible detoxification and anti-oxidation defenses in mammals and recent studies have demonstrated that it promotes multidrug resistance in some human tumors. Recent studies in the free-living model nematode Caenorhabditis elegans have defined the homologous transcription factor SKN-1 as a master regulator of detoxification and anti-oxidation genes. Despite similar functions, SKN-1 and NRF2 have important differences in structure and regulatory pathways. Protein alignment and phylogenetic analyses indicate that these differences are shared among many nematodes making SKN-1 a candidate for specifically targeting nematode detoxification and anti-oxidation. PMID:22656429

  10. Transcriptional and Posttranscriptional Regulations of the HLA-G Gene

    Science.gov (United States)

    Castelli, Erick C.; Veiga-Castelli, Luciana C.; Yaghi, Layale; Donadi, Eduardo A.

    2014-01-01

    HLA-G has a relevant role in immune response regulation. The overall structure of the HLA-G coding region has been maintained during the evolution process, in which most of its variable sites are synonymous mutations or coincide with introns, preserving major functional HLA-G properties. The HLA-G promoter region is different from the classical class I promoters, mainly because (i) it lacks regulatory responsive elements for IFN-γ and NF-κB, (ii) the proximal promoter region (within 200 bases from the first translated ATG) does not mediate transactivation by the principal HLA class I transactivation mechanisms, and (iii) the presence of identified alternative regulatory elements (heat shock, progesterone and hypoxia-responsive elements) and unidentified responsive elements for IL-10, glucocorticoids, and other transcription factors is evident. At least three variable sites in the 3′ untranslated region have been studied that may influence HLA-G expression by modifying mRNA stability or microRNA binding sites, including the 14-base pair insertion/deletion, +3142C/G and +3187A/G polymorphisms. Other polymorphic sites have been described, but there are no functional studies on them. The HLA-G coding region polymorphisms might influence isoform production and at least two null alleles with premature stop codons have been described. We reviewed the structure of the HLA-G promoter region and its implication in transcriptional gene control, the structure of the HLA-G 3′UTR and the major actors of the posttranscriptional gene control, and, finally, the presence of regulatory elements in the coding region. PMID:24741620

  11. Transcriptional and Posttranscriptional Regulations of the HLA-G Gene

    Directory of Open Access Journals (Sweden)

    Erick C. Castelli

    2014-01-01

    Full Text Available HLA-G has a relevant role in immune response regulation. The overall structure of the HLA-G coding region has been maintained during the evolution process, in which most of its variable sites are synonymous mutations or coincide with introns, preserving major functional HLA-G properties. The HLA-G promoter region is different from the classical class I promoters, mainly because (i it lacks regulatory responsive elements for IFN-γ and NF-κB, (ii the proximal promoter region (within 200 bases from the first translated ATG does not mediate transactivation by the principal HLA class I transactivation mechanisms, and (iii the presence of identified alternative regulatory elements (heat shock, progesterone and hypoxia-responsive elements and unidentified responsive elements for IL-10, glucocorticoids, and other transcription factors is evident. At least three variable sites in the 3′ untranslated region have been studied that may influence HLA-G expression by modifying mRNA stability or microRNA binding sites, including the 14-base pair insertion/deletion, +3142C/G and +3187A/G polymorphisms. Other polymorphic sites have been described, but there are no functional studies on them. The HLA-G coding region polymorphisms might influence isoform production and at least two null alleles with premature stop codons have been described. We reviewed the structure of the HLA-G promoter region and its implication in transcriptional gene control, the structure of the HLA-G 3′UTR and the major actors of the posttranscriptional gene control, and, finally, the presence of regulatory elements in the coding region.

  12. Gravity regulated genes in Arabidopsis thaliana (GENARA experiment)

    Science.gov (United States)

    Boucheron-Dubuisson, Elodie; Carnero-D&íaz, Eugénie; Medina, Francisco Javier; Gasset, Gilbert; Pereda-Loth, Veronica; Graziana, Annick; Mazars, Christian; Le Disquet, Isabelle; Eche, Brigitte; Grat, Sabine; Gauquelin-Koch, Guillemette

    2012-07-01

    In higher plants, post-embryonic development is possible through the expression of a set of genes constituting the morphogenetic program that contribute to the production of tissues and organs during the whole plant life cycle. Plant development is mainly controlled by internal factors such as phytohormones, as well as by environmental factors, among which gravity plays a key role (gravi-morphogenetic program). The GENARA space experiment has been designed with the goal of contributing to a better understanding of this gravi-morphogenetic program through the identification and characterization of some gravity regulated proteins (GR proteins) by using quantitative proteomic methods, and through the study of the impact of plant hormones on the expression of this program. Among plant hormones, auxin is the major regulator of organogenesis. In fact, it affects numerous plant developmental processes, e.g. cell division and elongation, autumnal loss of leaves, and the formation of buds, roots, flowers and fruits. Furthermore, it also plays a key role in the mechanisms of different tropisms (including gravitropism) that modulate fundamental features of plant growth. The expression of significant genes involved in auxin transport and in auxin signal perception in root cells is being studied in space-grown seedlings and compared with the corresponding ground controls. This experiment was scheduled to be performed in The European Modular Cultivation System (EMCS), a new facility for plant cultivation and Plant Molecular Biology studies, at ISS. However only one aspect of this experiment was flown and concerns the qualitative and quantitative changes in membrane proteins supposed to be mainly associated with cell signaling and has been called GENARA A. The second part dealing with the function of auxin in the gravi-morphogenetic program and the alterations induced by microgravity will be studied through mutants affected on biosynthesis, transport or perception of auxin in a

  13. Coordinate regulation of stromelysin and collagenase genes determined with cDNA probes

    International Nuclear Information System (INIS)

    Frisch, S.M.; Clark, E.J.; Werb, Z.

    1987-01-01

    Secreted proteinases are required for tumor metastasis, angiogenesis, and tissue remodeling during wound healing and embryonic growth. Thus, the regulation of the genes of secreted proteinases may serve as an interesting model for growth-controlled genes in general. The authors studied the genes of the secreted proteinases stromelysin and collagenase by using molecularly cloned cDNAs from each proteinase. Stromelysin cDNA was cloned by differential screening of a total cDNA library from rabbit synovial cells treated with phorbol 12-myristate 13-acetate, which yielded a clone of 1.2 kilobase pairs; collagenase cDNA was obtained by cloning reverse transcripts of anti-collagenase-immunoadsorbed polysomal mRNA, which yielded a clone of 0.8 kilobase pairs. Stromelysin and collagenase mRNA species of 2.2 and 2.4 kilobases, respectively, were detected on hybridization blots of RNA from phorbol 12-myristate 13-acetate-treated but not untreated rabbit synovial cells. Expression of stromelysin mRNA was also induced in rabbit alveolar macrophages and rabbit brain capillary endothelial cells treated with phorbol 12-myristate 13-acetate. Stromelysin and collagenase mRNA were both induced by phorbol 12-myristate 13-acetate and cytochalasin B at a constant ratio of the two gene products; this suggest coordinate regulation. The fact that induction was blocked after inhibition of protein synthesis by cycloheximide implicates an indirect signal transduction pathway that requires new protein synthesis

  14. Extracellular Matrix-Regulated Gene Expression RequiresCooperation of SWI/SNF and Transcription Factors

    Energy Technology Data Exchange (ETDEWEB)

    Xu, Ren; Spencer, Virginia A.; Bissell, Mina J.

    2006-05-25

    Extracellular cues play crucial roles in the transcriptional regulation of tissue-specific genes, but whether and how these signals lead to chromatin remodeling is not understood and subject to debate. Using chromatin immunoprecipitation (ChIP) assays and mammary-specific genes as models, we show here that extracellular matrix (ECM) molecules and prolactin cooperate to induce histone acetylation and binding of transcription factors and the SWI/SNF complex to the {beta}- and ?-casein promoters. Introduction of a dominant negative Brg1, an ATPase subunit of SWI/SNF complex, significantly reduced both {beta}- and ?-casein expression, suggesting that SWI/SNF-dependent chromatin remodeling is required for transcription of mammary-specific genes. ChIP analyses demonstrated that the ATPase activity of SWI/SNF is necessary for recruitment of RNA transcriptional machinery, but not for binding of transcription factors or for histone acetylation. Coimmunoprecipitation analyses showed that the SWI/SNF complex is associated with STAT5, C/EBP{beta}, and glucocorticoid receptor (GR). Thus, ECM- and prolactin-regulated transcription of the mammary-specific casein genes requires the concerted action of chromatin remodeling enzymes and transcription factors.

  15. Characterization of a Clp protease gene regulator and the reaeration response in Mycobacterium tuberculosis.

    Directory of Open Access Journals (Sweden)

    Ashley M Sherrid

    Full Text Available Mycobacterium tuberculosis (MTB enters a non-replicating state when exposed to low oxygen tension, a condition the bacillus encounters in granulomas during infection. Determining how mycobacteria enter and maintain this state is a major focus of research. However, from a public health standpoint the importance of latent TB is its ability to reactivate. The mechanism by which mycobacteria return to a replicating state upon re-exposure to favorable conditions is not understood. In this study, we utilized reaeration from a defined hypoxia model to characterize the adaptive response of MTB following a return to favorable growth conditions. Global transcriptional analysis identified the approximately 100 gene Reaeration Response, induced relative to both log-phase and hypoxic MTB. This response includes chaperones and proteases, as well as the transcription factor Rv2745c, which we characterize as a Clp protease gene regulator (ClgR orthologue. During reaeration, genes repressed during hypoxia are also upregulated in a wave of transcription that includes genes crucial to transcription, translation and oxidative phosphorylation and culminates in bacterial replication. In sum, this study defines a new transcriptional response of MTB with potential relevance to disease, and implicates ClgR as a regulator involved in resumption of replication following hypoxia.

  16. Mining protein kinases regulation using graphical models.

    Science.gov (United States)

    Chen, Qingfeng; Chen, Yi-Ping Phoebe

    2011-03-01

    Abnormal kinase activity is a frequent cause of diseases, which makes kinases a promising pharmacological target. Thus, it is critical to identify the characteristics of protein kinases regulation by studying the activation and inhibition of kinase subunits in response to varied stimuli. Bayesian network (BN) is a formalism for probabilistic reasoning that has been widely used for learning dependency models. However, for high-dimensional discrete random vectors the set of plausible models becomes large and a full comparison of all the posterior probabilities related to the competing models becomes infeasible. A solution to this problem is based on the Markov Chain Monte Carlo (MCMC) method. This paper proposes a BN-based framework to discover the dependency correlations of kinase regulation. Our approach is to apply the MCMC method to generate a sequence of samples from a probability distribution, by which to approximate the distribution. The frequent connections (edges) are identified from the obtained sampling graphical models. Our results point to a number of novel candidate regulation patterns that are interesting in biology and include inferred associations that were unknown.

  17. Distinct pathways of insulin-regulated versus diabetes-regulated gene expression: an in vivo analysis in MIRKO mice.

    Science.gov (United States)

    Yechoor, Vijay K; Patti, Mary-Elizabeth; Ueki, Kohjiro; Laustsen, Palle G; Saccone, Robert; Rauniyar, Ravi; Kahn, C Ronald

    2004-11-23

    Diabetes mellitus is a complex metabolic disorder accompanied by alterations in cellular physiology, metabolism, and gene expression. These alterations can be primary (due to loss of direct insulin action) or secondary (due to the metabolic perturbations associated with the disease). To dissect and quantitate these two separate effects, we compared the skeletal muscle gene-expression profiles of muscle insulin receptor knockout (MIRKO) mice and their Lox controls in the basal, streptozotocin-induced diabetic, and insulin-treated diabetic states. Pure deficiency of insulin action as present in the MIRKO mouse results in regulation of 130 genes, with down-regulation of NSF (N-ethylmaleimide-sensitive fusion protein) and VAMP-2 (vesicle-associated membrane protein 2), stearoyl CoA desaturase 1, and cAMP-specific phosphodiesterase 4B, as well as up-regulation of some signaling-related genes, such as Akt2, and the fatty-acid transporter CD36. In diabetes, additional transcriptional mechanisms are activated, resulting in alterations in expression of approximately 500 genes, including a highly coordinated down-regulation of genes of the mitochondrial electron-transport chain and one of the mammalian homologues of the histone deacetylase Sir2, which has been implicated in the link between nutrition and longevity. These distinct pathways of direct and indirect regulation of gene expression provide insights into the complex mechanisms of transcriptional control in diabetes and areas of potential therapeutic targeting.

  18. Coordinate gene regulation by fimbriae-induced signal transduction

    DEFF Research Database (Denmark)

    Schembri, Mark; Klemm, Per

    2001-01-01

    whether fimbriae expression can affect expression of other genes, Analysis of gene expression in two E.coli strains, differing in the fim locus, indicated the flu gene to be affected. The flu gene encodes the antigen 43 (Ag43) surface protein, specifically involved in bacterial aggregation...

  19. Recent insights into the role and molecular mechanisms of the autoimmune regulator (AIRE) gene in autoimmunity.

    Science.gov (United States)

    Fierabracci, Alessandra

    2011-01-01

    Since many years immunologists have being tried to answer the tantalizing enigma of immunological tolerance. Complex mechanisms in both thymus (central tolerance) and peripheral lymphoid organs (peripheral tolerance) underly lymphocyte tolerance and its maintenance. The genesis of autoimmunity involves environmental and genetic mechanisms, both contributing to the disruption and deregulation of central and peripheral tolerance, allowing autoreactive pathogenetic T and B-cell clones arising. Among genetic factors the autoimmune regulator (AIRE) gene is one of the best candidates to understand the complex scenario of autoimmunity. Autoimmune polyendocrinopathy syndrome type 1 is a rare autosomal recessive disease caused by mutations in the AIRE gene. Therefore, the disorder has certainly been a powerful model to address the question concerning how a tolerant state is achieved or maintained and to explore how it has gone lost in the context of autoimmunity. AIRE has been proposed to function as a 'non classical' transcription factor, strongly implicated in the regulation of organ-specific antigen expression in thymic epithelial cells and in the imposition of T cell tolerance, thus regulating the negative selection of autoreactive T cell clones. A plethora of proposal have been suggested for AIRE's potential mechanism of action, thus regulating the negative selection of autoreactive T cells. In this review recent discoveries are presented into the role and molecular mechanisms of the AIRE protein in APECED and other autoimmune diseases. Copyright © 2010 Elsevier B.V. All rights reserved.

  20. Continuous versus cyclic progesterone exposure differentially regulates hippocampal gene expression and functional profiles.

    Directory of Open Access Journals (Sweden)

    Liqin Zhao

    Full Text Available This study investigated the impact of chronic exposure to continuous (CoP4 versus cyclic progesterone (CyP4 alone or in combination with 17β-estradiol (E2 on gene expression profiles targeting bioenergetics, metabolism and inflammation in the adult female rat hippocampus. High-throughput qRT-PCR analyses revealed that ovarian hormonal depletion induced by ovariectomy (OVX led to multiple significant gene expression alterations, which were to a great extent reversed by co-administration of E2 and CyP4. In contrast, co-administration of E2 and CoP4 induced a pattern highly resembling OVX. Bioinformatics analyses further revealed clear disparities in functional profiles associated with E2+CoP4 and E2+CyP4. Genes involved in mitochondrial energy (ATP synthase α subunit; Atp5a1, redox homeostasis (peroxiredoxin 5; Prdx5, insulin signaling (insulin-like growth factor I; Igf1, and cholesterol trafficking (liver X receptor α subtype; Nr1h3, differed in direction of regulation by E2+CoP4 (down-regulation relative to OVX and E2+CyP4 (up-regulation relative to OVX. In contrast, genes involved in amyloid metabolism (β-secretase; Bace1 differed only in degree of regulation, as both E2+CoP4 and E2+CyP4 induced down-regulation at different efficacy. E2+CyP4-induced changes could be associated with regulation of progesterone receptor membrane component 1(Pgrmc1. In summary, results from this study provide evidence at the molecular level that differing regimens of hormone therapy (HT can induce disparate gene expression profiles in brain. From a translational perspective, confirmation of these results in a model of natural menopause, would imply that the common regimen of continuous combined HT may have adverse consequences whereas a cyclic combined regimen, which is more physiological, could be an effective strategy to maintain neurological health and function throughout menopausal aging.

  1. Role of Hfq in iron-dependent and -independent gene regulation in Neisseria meningitidis.

    Science.gov (United States)

    Mellin, J R; McClure, Ryan; Lopez, Delia; Green, Olivia; Reinhard, Bjorn; Genco, Caroline

    2010-08-01

    In Neisseria meningitidis, iron-responsive gene regulation is mediated primarily by the ferric uptake regulator (Fur) protein. When complexed with iron, Fur represses gene expression by preventing transcription initiation. Fur can also indirectly activate gene expression via the repression of regulatory small RNAs (sRNA). One such Fur- and iron-regulated sRNA, NrrF, was previously identified in N. meningitidis and shown to repress expression of the sdhA and sdhC genes encoding subunits of the succinate dehydrogenase complex. In the majority of Gram-negative bacteria, sRNA-mediated regulation requires a cofactor RNA-binding protein (Hfq) for proper gene regulation and stabilization. In this study, we examined the role of Hfq in NrrF-mediated regulation of the succinate dehydrogenase genes in N. meningitidis and the effect of an hfq mutation on iron-responsive gene regulation more broadly. We first demonstrated that the stability of NrrF, as well as the regulation of sdhC and sdhA in vivo, was unaltered in the hfq mutant. Secondly, we established that iron-responsive gene regulation of the Fur-regulated sodB gene was dependent on Hfq. Finally, we demonstrated that in N. meningitidis, Hfq functions in a global manner to control expression of many ORFs and intergenic regions via iron-independent mechanisms. Collectively these studies demonstrate that in N. meningitidis, iron- and NrrF-mediated regulation of sdhC and sdhA can occur independently of Hfq, although Hfq functions more globally to control regulation of other N. meningitidis genes primarily by iron-independent mechanisms.

  2. A Hox Gene, Antennapedia, Regulates Expression of Multiple Major Silk Protein Genes in the Silkworm Bombyx mori*

    Science.gov (United States)

    Tsubota, Takuya; Tomita, Shuichiro; Uchino, Keiro; Kimoto, Mai; Takiya, Shigeharu; Kajiwara, Hideyuki; Yamazaki, Toshimasa; Sezutsu, Hideki

    2016-01-01

    Hox genes play a pivotal role in the determination of anteroposterior axis specificity during bilaterian animal development. They do so by acting as a master control and regulating the expression of genes important for development. Recently, however, we showed that Hox genes can also function in terminally differentiated tissue of the lepidopteran Bombyx mori. In this species, Antennapedia (Antp) regulates expression of sericin-1, a major silk protein gene, in the silk gland. Here, we investigated whether Antp can regulate expression of multiple genes in this tissue. By means of proteomic, RT-PCR, and in situ hybridization analyses, we demonstrate that misexpression of Antp in the posterior silk gland induced ectopic expression of major silk protein genes such as sericin-3, fhxh4, and fhxh5. These genes are normally expressed specifically in the middle silk gland as is Antp. Therefore, the evidence strongly suggests that Antp activates these silk protein genes in the middle silk gland. The putative sericin-1 activator complex (middle silk gland-intermolt-specific complex) can bind to the upstream regions of these genes, suggesting that Antp directly activates their expression. We also found that the pattern of gene expression was well conserved between B. mori and the wild species Bombyx mandarina, indicating that the gene regulation mechanism identified here is an evolutionarily conserved mechanism and not an artifact of the domestication of B. mori. We suggest that Hox genes have a role as a master control in terminally differentiated tissues, possibly acting as a primary regulator for a range of physiological processes. PMID:26814126

  3. Bayesian Computational Approaches for Gene Regulation Studies of Bioethanol and Biohydrogen Production. Final Scientific/Technical Report

    Energy Technology Data Exchange (ETDEWEB)

    Newberg, Lee; McCue, Lee Anne; Van Roey, Patrick

    2014-04-17

    The project developed mathematical models and first-version software tools for the understanding of gene regulation across multiple related species. The project lays the foundation for understanding how certain alpha-proteobacterial species control their own genes for bioethanol and biohydrogen production, and sets the stage for exploiting bacteria for the production of fuels. Enabling such alternative sources of fuel is a high priority for the Department of Energy and the public.

  4. The ERECTA gene regulates plant transpiration efficiency in Arabidopsis.

    Science.gov (United States)

    Masle, Josette; Gilmore, Scott R; Farquhar, Graham D

    2005-08-11

    Assimilation of carbon by plants incurs water costs. In the many parts of the world where water is in short supply, plant transpiration efficiency, the ratio of carbon fixation to water loss, is critical to plant survival, crop yield and vegetation dynamics. When challenged by variations in their environment, plants often seem to coordinate photosynthesis and transpiration, but significant genetic variation in transpiration efficiency has been identified both between and within species. This has allowed plant breeders to develop effective selection programmes for the improved transpiration efficiency of crops, after it was demonstrated that carbon isotopic discrimination, Delta, of plant matter was a reliable and sensitive marker negatively related to variation in transpiration efficiency. However, little is known of the genetic controls of transpiration efficiency. Here we report the isolation of a gene that regulates transpiration efficiency, ERECTA. We show that ERECTA, a putative leucine-rich repeat receptor-like kinase (LRR-RLK) known for its effects on inflorescence development, is a major contributor to a locus for Delta on Arabidopsis chromosome 2. Mechanisms include, but are not limited to, effects on stomatal density, epidermal cell expansion, mesophyll cell proliferation and cell-cell contact.

  5. Nitrogen regulates chitinase gene expression in a marine bacterium

    DEFF Research Database (Denmark)

    Delpin, Marina; Goodman, A.E.

    2009-01-01

    Ammonium concentration and nitrogen source regulate promoter activity and use for the transcription of chiA, the major chitinase gene of Pseudoalteromonas sp. S91 and S91CX, an S91 transposon lacZ fusion mutant. The activity of chiA was quantified by beta-galactosidase assay of S91CX cultures...... containing different ammonium concentrations (NH4+; 0, 9.5 or 191 mM) and with different nitrogen sources (N-acetylglucosamine (GlcNAc) or glutamate (glt)). S91 chiA expression was found to depend on both the NH4+ concentration and source of nitrogen in marine minimal medium (MMM). Pseudoalteromonas sp. S91...... and S91CX can use either GlcNAc or glt as a sole source of carbon in MMM containing a standard concentration of 9.5 mM NH4+. Adding excess NH4+, 20 times the standard concentration, to MMM significantly reduced chiA activity below that found in the presence of either GlcNAc or glt. When no NH4...

  6. Sleep regulation: physiological models and hypotheses.

    Science.gov (United States)

    Borbély, A A

    1995-06-01

    The elucidation of sleep regulation is not an easy task. On one side, there is a multitude of solid yet disparate data, on the other side, the topic is tempting for engaging in wild speculation, particularly with respect to the functions of sleep. Models may exert a moderating influence by mediating between the two extremes. However, also they navigate between the risk of banality in reformulating the obvious, and the peril of fancy in losing touch with empirical reality.

  7. Salicin regulates the expression of functional 'youth gene clusters' to reflect a more youthful gene expression profile.

    Science.gov (United States)

    Gopaul, R; Knaggs, H E; Lephart, J

    2011-10-01

    There are a variety of biological mechanisms that contribute to specific characteristics of ageing skin; for example, the loss of skin structure proteins, increased susceptibility to UV-induced pigmentation and/or loss of hydration. Each of these biological processes is influenced by specific groups of genes. In this research, we have identified groups of genes associated with specific clinical signs of skin ageing and refer to these as functional 'youth gene clusters'. In this study, quantitative real-time polymerase chain reaction (qPCR) was used to investigate the effects of topical application of salicin in regulating the expression of functional 'youth gene clusters' to reflect a more youthful skin profile and reduce the appearance of attributes associated with skin ageing. Results showed that salicin significantly influences the gene expression profiles of treated human equivalent full-thickness skin, by regulating the expression of genes associated with various biological processes involving skin structure, skin hydration, pigmentation and cellular differentiation. Based on the findings from this experiment, salicin was identified as a key ingredient that may regulate functional 'youth gene clusters' to reflect a more youthful gene expression profile by increasing the expression of genes responsible for youthful skin and decreasing the expression of genes responsible for the appearance of aged skin. © 2011 The Authors. ICS © 2011 Society of Cosmetic Scientists and the Société Française de Cosmétologie.

  8. Cholinergic regulation of VIP gene expression in human neuroblastoma cells

    DEFF Research Database (Denmark)

    Kristensen, Bo; Georg, Birgitte; Fahrenkrug, Jan

    1997-01-01

    Vasoactive intestinal polypeptide, muscarinic receptor, neuroblastoma cell, mRNA, gene expression, peptide processing......Vasoactive intestinal polypeptide, muscarinic receptor, neuroblastoma cell, mRNA, gene expression, peptide processing...

  9. NF-1 Dependent Gene Regulation in Drosophila Melanogaster

    National Research Council Canada - National Science Library

    Zhong, Yi

    2004-01-01

    .... We have used an Affymetrix whole genome chip, containing all 13,500 genes of the fruit fly Drosophila, to identify 93 genes with altered expression patterns in flies that have no NF1 protein compared...

  10. Left ventricular SERCA2a gene down-regulation does not parallel ANP gene up-regulation during post-MI remodelling in rats.

    Science.gov (United States)

    Prunier, Fabrice; Chen, Ying; Gellen, Barnabas; Heimburger, Michèle; Choqueux, Christine; Escoubet, Brigitte; Michel, Jean-Baptiste; Mercadier, Jean-Jacques

    2005-08-01

    In most animal models of chronic hemodynamic overload of the left ventricle (LV) as well as in human end stage heart failure, the sarcoplasmic reticulum (SR) Ca2+-ATPase (SERCA2a) mRNA levels are decreased in parallel with increased atrial natriuretic peptide (ANP) mRNA levels. The situation in the remote myocardium following myocardial infarction (MI) is unclear. (1) To examine SERCA2a mRNA levels in the non-infarcted LV myocardium of rats at the chronic stage of experimental MI and (2) To examine whether a negative linear correlation exists between SERCA2a and ANP mRNA levels in this model. Anesthetized adult male Wistar rats underwent left coronary artery ligation or sham operation. Three months later, the rats were divided into three groups: sham-operated rats (sham, n=21), HF-free rats with MI (non-failing (NF)-MI, n=29) and rats with both MI and HF (congestive heart failure (CHF)-MI, n=14). LV remodelling and function were assessed by echocardiography and hemodynamic measurements. SERCA2a and ANP mRNA levels were determined by Northern and dot blot analysis with specific cDNA probes. LV SERCA2a mRNA levels varied markedly in sham-operated rats (0.9-1.8). Mean ANP mRNA level increased markedly and mean SERCA2a mRNA level decreased moderately in the remote myocardium. In some NF-MI rats, SERCA2a mRNA levels were higher than those in some sham controls. Whereas ANP mRNA levels correlated well with MI severity (r2=0.79, p<0.001), this was not the case for SERCA2a mRNA levels (r2=0.42, p<0.01). We found no negative correlation between ANP and SERCA2a mRNA levels. SERCA2a gene down-regulation in the non-infarcted myocardium of rats with MI does not correlate with ANP gene up-regulation, suggesting that the two genes are not antithetically regulated.

  11. Simulating Results of Experiments on Gene Regulation of the Lactose Operon in Escherichia coli; a Problem-Solving Exercise.

    Science.gov (United States)

    Hitchen, Trevor; Metcalfe, Judith

    1987-01-01

    Describes a simulation of the results of real experiments which use different strains of Escherichia coli. Provides an inexpensive practical problem-solving exercise to aid the teaching and understanding of the Jacob and Monod model of gene regulation. (Author/CW)

  12. Analysis of clock-regulated genes in Neurospora reveals widespread posttranscriptional control of metabolic potential

    Science.gov (United States)

    Hurley, Jennifer M.; Dasgupta, Arko; Emerson, Jillian M.; Zhou, Xiaoying; Ringelberg, Carol S.; Knabe, Nicole; Lipzen, Anna M.; Lindquist, Erika A.; Daum, Christopher G.; Barry, Kerrie W.; Grigoriev, Igor V.; Smith, Kristina M.; Galagan, James E.; Bell-Pedersen, Deborah; Freitag, Michael; Cheng, Chao; Loros, Jennifer J.; Dunlap, Jay C.

    2014-01-01

    Neurospora crassa has been for decades a principal model for filamentous fungal genetics and physiology as well as for understanding the mechanism of circadian clocks. Eukaryotic fungal and animal clocks comprise transcription-translation–based feedback loops that control rhythmic transcription of a substantial fraction of these transcriptomes, yielding the changes in protein abundance that mediate circadian regulation of physiology and metabolism: Understanding circadian control of gene expression is key to understanding eukaryotic, including fungal, physiology. Indeed, the isolation of clock-controlled genes (ccgs) was pioneered in Neurospora where circadian output begins with binding of the core circadian transcription factor WCC to a subset of ccg promoters, including those of many transcription factors. High temporal resolution (2-h) sampling over 48 h using RNA sequencing (RNA-Seq) identified circadianly expressed genes in Neurospora, revealing that from ∼10% to as much 40% of the transcriptome can be expressed under circadian control. Functional classifications of these genes revealed strong enrichment in pathways involving metabolism, protein synthesis, and stress responses; in broad terms, daytime metabolic potential favors catabolism, energy production, and precursor assembly, whereas night activities favor biosynthesis of cellular components and growth. Discriminative regular expression motif elicitation (DREME) identified key promoter motifs highly correlated with the temporal regulation of ccgs. Correlations between ccg abundance from RNA-Seq, the degree of ccg-promoter activation as reported by ccg-promoter–luciferase fusions, and binding of WCC as measured by ChIP-Seq, are not strong. Therefore, although circadian activation is critical to ccg rhythmicity, posttranscriptional regulation plays a major role in determining rhythmicity at the mRNA level. PMID:25362047

  13. Stress, and pathogen response gene expression in modeled microgravity

    Science.gov (United States)

    Sundaresan, Alamelu; Pellis, Neal R.

    2006-01-01

    Purpose: Immune suppression in microgravity has been well documented. With the advent of human exploration and long-term space travel, the immune system of the astronaut must be optimally maintained. It is important to investigate the expression patterns of cytokine genes, because they are directly related to immune response. Heat shock proteins (HSPs), also called stress proteins, are a group of proteins that are present in the cells of every life form. These proteins are induced when a cell responds to stressors such as heat, cold and oxygen deprivation. Microgravity is another stressor that may regulate HSPs. Heat shock proteins trigger immune response through activities that occur both inside the cell (intracellular) and outside the cell (extracellular). Knowledge about these two gene groups could lead to establishment of a blueprint of the immune response and adaptation-related genes in the microgravity environment. Methods: Human peripheral blood cells were cultured in 1g (T flask) and modeled microgravity (MMG, rotating-wall vessel) for 24 and 72 hours. Cell samples were collected and subjected to gene array analysis using the Affymetrix HG_U95 array. Data was collected and subjected to a two-way analysis of variance. The genes related to immune and stress responses were analyzed. Results and Conclusions: HSP70 was up-regulated by more than two fold in microgravity culture, while HSP90 was significantly down-regulated. HSP70 is not typically expressed in all kinds of cells, but it is expressed at high levels in stress conditions. HSP70 participates in translation, protein translocation, proteolysis and protein folding, suppressing aggregation and reactivating denatured proteins. Increased serum HSP70 levels correlate with a better outcome for heat-stroke or severe trauma patients. At the same time, elevated serum levels of HSP70 have been detected in patients with peripheral or renal vascular disease. HSP90 has been identified in the cytosol, nucleus and

  14. Calcitonin gene-related peptide regulates type IV hypersensitivity through dendritic cell functions.

    Directory of Open Access Journals (Sweden)

    Norihisa Mikami

    Full Text Available Dendritic cells (DCs play essential roles in both innate and adaptive immune responses. In addition, mutual regulation of the nervous system and immune system is well studied. One of neuropeptides, calcitonin gene-related peptide (CGRP, is a potent regulator in immune responses; in particular, it has anti-inflammatory effects in innate immunity. For instance, a deficiency of the CGRP receptor component RAMP 1 (receptor activity-modifying protein 1 results in higher cytokine production in response to LPS (lipopolysaccharide. On the other hand, how CGRP affects DCs in adaptive immunity is largely unknown. In this study, we show that CGRP suppressed Th1 cell differentiation via inhibition of IL-12 production in DCs using an in vitro co-culture system and an in vivo ovalbumin-induced delayed-type hypersensitivity (DTH model. CGRP also down-regulated the expressions of chemokine receptor CCR2 and its ligands CCL2 and CCL12 in DCs. Intriguingly, the frequency of migrating CCR2(+ DCs in draining lymph nodes of RAMP1-deficient mice was higher after DTH immunization. Moreover, these CCR2(+ DCs highly expressed IL-12 and CD80, resulting in more effective induction of Th1 differentiation compared with CCR2(- DCs. These results indicate that CGRP regulates Th1 type reactions by regulating expression of cytokines, chemokines, and chemokine receptors in DCs.

  15. CsACO4, an ACC oxidase gene regulating male differentiation in ...

    African Journals Online (AJOL)

    DR TONUKARI NYEROVWO

    Arabidopsis ethylene-response gene ETR1: similarity of product to two- component regulators. Science, 262: 539-544. Chen YH, Zhang JH, Ouyang B, Li HX, Ye ZB (2005). Cloning of ACC oxidase gene and inhibition of endogenous gene expression with. RNAi in cauliflower. Acta Genetica Sinica, 32: 764-769. (in chinese).

  16. Genome-wide gene expression regulation as a function of genotype and age in C. elegans

    NARCIS (Netherlands)

    Viñuela Rodriguez, A.; Snoek, L.B.; Riksen, J.A.G.; Kammenga, J.E.

    2010-01-01

    Gene expression becomes more variable with age, and it is widely assumed that this is due to a decrease in expression regulation. But currently there is no understanding how gene expression regulatory patterns progress with age. Here we explored genome-wide gene expression variation and regulatory

  17. Nipbl and mediator cooperatively regulate gene expression to control limb development.

    Directory of Open Access Journals (Sweden)

    Akihiko Muto

    2014-09-01

    Full Text Available Haploinsufficiency for Nipbl, a cohesin loading protein, causes Cornelia de Lange Syndrome (CdLS, the most common "cohesinopathy". It has been proposed that the effects of Nipbl-haploinsufficiency result from disruption of long-range communication between DNA elements. Here we use zebrafish and mouse models of CdLS to examine how transcriptional changes caused by Nipbl deficiency give rise to limb defects, a common condition in individuals with CdLS. In the zebrafish pectoral fin (forelimb, knockdown of Nipbl expression led to size reductions and patterning defects that were preceded by dysregulated expression of key early limb development genes, including fgfs, shha, hand2 and multiple hox genes. In limb buds of Nipbl-haploinsufficient mice, transcriptome analysis revealed many similar gene expression changes, as well as altered expression of additional classes of genes that play roles in limb development. In both species, the pattern of dysregulation of hox-gene expression depended on genomic location within the Hox clusters. In view of studies suggesting that Nipbl colocalizes with the mediator complex, which facilitates enhancer-promoter communication, we also examined zebrafish deficient for the Med12 Mediator subunit, and found they resembled Nipbl-deficient fish in both morphology and gene expression. Moreover, combined partial reduction of both Nipbl and Med12 had a strongly synergistic effect, consistent with both molecules acting in a common pathway. In addition, three-dimensional fluorescent in situ hybridization revealed that Nipbl and Med12 are required to bring regions containing long-range enhancers into close proximity with the zebrafish hoxda cluster. These data demonstrate a crucial role for Nipbl in limb development, and support the view that its actions on multiple gene pathways result from its influence, together with Mediator, on regulation of long-range chromosomal interactions.

  18. Global profiling of alternative splicing events and gene expression regulated by hnRNPH/F.

    Science.gov (United States)

    Wang, Erming; Aslanzadeh, Vahid; Papa, Filomena; Zhu, Haiyan; de la Grange, Pierre; Cambi, Franca

    2012-01-01

    In this study, we have investigated the global impact of heterogeneous nuclear Ribonuclear Protein (hnRNP) H/F-mediated regulation of splicing events and gene expression in oligodendrocytes. We have performed a genome-wide transcriptomic analysis at the gene and exon levels in Oli-neu cells treated with siRNA that targets hnRNPH/F compared to untreated cells using Affymetrix Exon Array. Gene expression levels and regulated exons were identified with the GenoSplice EASANA algorithm. Bioinformatics analyses were performed to determine the structural properties of G tracts that correlate with the function of hnRNPH/F as enhancers vs. repressors of exon inclusion. Different types of alternatively spliced events are regulated by hnRNPH/F. Intronic G tracts density, length and proximity to the 5' splice site correlate with the hnRNPH/F enhancer function. Additionally, 6% of genes are differently expressed upon knock down of hnRNPH/F. Genes that regulate the transition of oligodendrocyte progenitor cells to oligodendrocytes are differentially expressed in hnRNPH/F depleted Oli-neu cells, resulting in a decrease of negative regulators and an increase of differentiation-inducing regulators. The changes were confirmed in developing oligodendrocytes in vivo. This is the first genome wide analysis of splicing events and gene expression regulated by hnRNPH/F in oligodendrocytes and the first report that hnRNPH/F regulate genes that are involved in the transition from oligodendrocyte progenitor cells to oligodendrocytes.

  19. A Genetic Mosaic Screen Reveals Ecdysone-Responsive Genes Regulating Drosophila Oogenesis.

    Science.gov (United States)

    Ables, Elizabeth T; Hwang, Grace H; Finger, Danielle S; Hinnant, Taylor D; Drummond-Barbosa, Daniela

    2016-08-09

    Multiple aspects of Drosophila oogenesis, including germline stem cell activity, germ cell differentiation, and follicle survival, are regulated by the steroid hormone ecdysone. While the transcriptional targets of ecdysone signaling during development have been studied extensively, targets in the ovary remain largely unknown. Early studies of salivary gland polytene chromosomes led to a model in which ecdysone stimulates a hierarchical transcriptional cascade, wherein a core group of ecdysone-sensitive transcription factors induce tissue-specific responses by activating secondary branches of transcriptional targets. More recently, genome-wide approaches have identified hundreds of putative ecdysone-responsive targets. Determining whether these putative targets represent bona fide targets in vivo, however, requires that they be tested via traditional mutant analysis in a cell-type specific fashion. To investigate the molecular mechanisms whereby ecdysone signaling regulates oogenesis, we used genetic mosaic analysis to screen putative ecdysone-responsive genes for novel roles in the control of the earliest steps of oogenesis. We identified a cohort of genes required for stem cell maintenance, stem and progenitor cell proliferation, and follicle encapsulation, growth, and survival. These genes encode transcription factors, chromatin modulators, and factors required for RNA transport, stability, and ribosome biogenesis, suggesting that ecdysone might control a wide range of molecular processes during oogenesis. Our results suggest that, although ecdysone target genes are known to have cell type-specific roles, many ecdysone response genes that control larval or pupal cell types at developmental transitions are used reiteratively in the adult ovary. These results provide novel insights into the molecular mechanisms by which ecdysone signaling controls oogenesis, laying new ground for future studies. Copyright © 2016 Ables et al.

  20. SuhB Is a Regulator of Multiple Virulence Genes and Essential for Pathogenesis of Pseudomonas aeruginosa

    Science.gov (United States)

    Li, Kewei; Xu, Chang; Jin, Yongxin; Sun, Ziyu; Liu, Chang; Shi, Jing; Chen, Gukui; Chen, Ronghao; Jin, Shouguang; Wu, Weihui

    2013-01-01

    ABSTRACT During initial colonization and chronic infection, pathogenic bacteria encounter distinct host environments. Adjusting gene expression accordingly is essential for the pathogenesis. Pseudomonas aeruginosa has evolved complicated regulatory networks to regulate different sets of virulence factors to facilitate colonization and persistence. The type III secretion system (T3SS) and motility are associated with acute infections, while biofilm formation and the type VI secretion system (T6SS) are associated with chronic persistence. To identify novel regulatory genes required for pathogenesis, we screened a P. aeruginosa transposon (Tn) insertion library and found suhB to be an essential gene for the T3SS gene expression. The expression of suhB was upregulated in a mouse acute lung infection model, and loss of suhB resulted in avirulence. Suppression of T3SS gene expression in the suhB mutant is linked to a defective translation of the T3SS master regulator, ExsA. Further studies demonstrated that suhB mutation led to the upregulation of GacA and its downstream small RNAs, RsmY and RsmZ, triggering T6SS expression and biofilm formation while inhibiting the T3SS. Our results demonstrate that an in vivo-inducible gene, suhB, reciprocally regulates genes associated with acute and chronic infections and plays an essential role in the pathogenesis of P. aeruginosa. PMID:24169572

  1. Bioinformatic Analysis of Gene Sets Regulated by Ligand-Activated and Dominant-Negative PPARγ in Mouse Aorta

    Science.gov (United States)

    Keen, Henry L.; Halabi, Carmen M.; Beyer, Andreas M.; de Lange, Willem J.; Liu, Xuebo; Maeda, Nobuyo; Faraci, Frank M.; Casavant, Thomas L.; Sigmund, Curt D.

    2010-01-01

    Objective Drugs that activate PPARγ improve glucose sensitivity and lower blood pressure, whereas dominant negative mutations in PPARγ cause severe insulin resistance and hypertension. We hypothesize that these PPARγ mutants regulate target genes opposite to that of ligand-mediated activation and tested this hypothesis on a genome-wide scale. Methods and Results We integrated gene expression data in aorta from mice treated with the PPARγ ligand rosiglitazone with data from mice containing a globally expressed knockin of the PPARγ P465L dominant negative mutation. We also integrated our data with publicly available datasets containing 1) gene expression profiles in many human tissues, 2) PPARγ target genes in 3T3-L1 adipocytes, and 3) experimentally validated PPARγ binding sites throughout the genome. Many classical PPARγ target genes were induced by rosiglitazone and repressed by dominant-negative PPARγ. A similar pattern was observed for about 90% of the gene sets regulated both by rosiglitazone and dominant-negative PPARγ. Genes exhibiting this pattern of contrasting regulation were significantly enriched for nearby PPARγ binding sites. Conclusions These results provide convincing evidence that the PPARγ P465L mutation causes transcriptional effects that are opposite to those mediated by PPARγ ligand thus validating mice carrying the mutation as a model of PPARγ interference. PMID:20018933

  2. Modeling Three-Dimensional Chromosome Structures Using Gene Expression Data.

    Science.gov (United States)

    Xiao, Guanghua; Wang, Xinlei; Khodursky, Arkady B

    2011-03-01

    Recent genomic studies have shown that significant chromosomal spatial correlation exists in gene expression of many organisms. Interestingly, coexpression has been observed among genes separated by a fixed interval in specific regions of a chromosome chain, which is likely caused by three-dimensional (3D) chromosome folding structures. Modeling such spatial correlation explicitly may lead to essential understandings of 3D chromosome structures and their roles in transcriptional regulation. In this paper, we explore chromosomal spatial correlation induced by 3D chromosome structures, and propose a hierarchical Bayesian method based on helical structures to formally model and incorporate the correlation into the analysis of gene expression microarray data. It is the first study to quantify and infer 3D chromosome structures in vivo using expression microarrays. Simulation studies show computing feasibility of the proposed method and that, under the assumption of helical chromosome structures, it can lead to precise estimation of structural parameters and gene expression levels. Real data applications demonstrate an intriguing biological phenomenon that functionally associated genes, which are far apart along the chromosome chain, are brought into physical proximity by chromosomal folding in 3D space to facilitate their coexpression. It leads to important biological insight into relationship between chromosome structure and function.

  3. Gene and functional up-regulation of the BCRP/ABCG2 transporter in hepatocellular carcinoma.

    Science.gov (United States)

    Sukowati, Caecilia Hc; Rosso, Natalia; Pascut, Devis; Anfuso, Beatrice; Torre, Giuliano; Francalanci, Paola; Crocè, Lory S; Tiribelli, Claudio

    2012-11-15

    The Breast Cancer Resistance Protein (BCRP/ABCG2) is one member of ABC transporters proteins super family responsible of drug resistance. Since data on ABCG2 expression in liver malignances are scanty, here we report the expression of ABCG2 in adult human hepatocellular carcinoma (HCC) in both in vivo and in vitro models with different degree of malignancy. In cell lines derived from human hepatocellular carcinoma, ABCG2 gene expression was assessed by reverse transcription quantitative real time PCR and function by Hoechst 33342 efflux assay; protein content was assessed by SDS-PAGE Western blot. ABCG2 expression was found to be highest in the most undifferentiated cell lines, and this was related with a higher functional activity. ABCG2 expression was sensitive to antineoplastic drugs since exposure to 5 μM doxorubicin for 24 hours resulted in significant up-regulations of ABCG2 in all cell lines, particularly in those lines with low basal ABCG2 expression (pexpression was also investigated in 51 adult liver tissues with HCC and related cirrhosis; normal liver tissue was used as control. ABCG2 gene expression was higher in HCC than both cirrhotic paired tissue and normal tissue. This up-regulation was greater (pexpression and differentiation stage both in human and HCC derived cell lines. The rapid up-regulation of ABCG2 to exposure to doxorubicin emphasizes the importance of this transporter in accounting for drug resistance in liver tumors.

  4. Accurate analytic solution of chemical master equations for gene regulation networks in a single cell

    Science.gov (United States)

    Huang, Guan-Rong; Saakian, David B.; Hu, Chin-Kun

    2018-01-01

    Studying gene regulation networks in a single cell is an important, interesting, and hot research topic of molecular biology. Such process can be described by chemical master equations (CMEs). We propose a Hamilton-Jacobi equation method with finite-size corrections to solve such CMEs accurately at the intermediate region of switching, where switching rate is comparable to fast protein production rate. We applied this approach to a model of self-regulating proteins [H. Ge et al., Phys. Rev. Lett. 114, 078101 (2015), 10.1103/PhysRevLett.114.078101] and found that as a parameter related to inducer concentration increases the probability of protein production changes from unimodal to bimodal, then to unimodal, consistent with phenotype switching observed in a single cell.

  5. Reranking candidate gene models with cross-species comparison for improved gene prediction

    Directory of Open Access Journals (Sweden)

    Pereira Fernando CN

    2008-10-01

    Full Text Available Abstract Background Most gene finders score candidate gene models with state-based methods, typically HMMs, by combining local properties (coding potential, splice donor and acceptor patterns, etc. Competing models with similar state-based scores may be distinguishable with additional information. In particular, functional and comparative genomics datasets may help to select among competing models of comparable probability by exploiting features likely to be associated with the correct gene models, such as conserved exon/intron structure or protein sequence features. Results We have investigated the utility of a simple post-processing step for selecting among a set of alternative gene models, using global scoring rules to rerank competing models for more accurate prediction. For each gene locus, we first generate the K best candidate gene models using the gene finder Evigan, and then rerank these models using comparisons with putative orthologous genes from closely-related species. Candidate gene models with lower scores in the original gene finder may be selected if they exhibit strong similarity to probable orthologs in coding sequence, splice site location, or signal peptide occurrence. Experiments on Drosophila melanogaster demonstrate that reranking based on cross-species comparison outperforms the best gene models identified by Evigan alone, and also outperforms the comparative gene finders GeneWise and Augustus+. Conclusion Reranking gene models with cross-species comparison improves gene prediction accuracy. This straightforward method can be readily adapted to incorporate additional lines of evidence, as it requires only a ranked source of candidate gene models.

  6. Simple mathematical models of gene regulatory dynamics

    CERN Document Server

    Mackey, Michael C; Tyran-Kamińska, Marta; Zeron, Eduardo S

    2016-01-01

    This is a short and self-contained introduction to the field of mathematical modeling of gene-networks in bacteria. As an entry point to the field, we focus on the analysis of simple gene-network dynamics. The notes commence with an introduction to the deterministic modeling of gene-networks, with extensive reference to applicable results coming from dynamical systems theory. The second part of the notes treats extensively several approaches to the study of gene-network dynamics in the presence of noise—either arising from low numbers of molecules involved, or due to noise external to the regulatory process. The third and final part of the notes gives a detailed treatment of three well studied and concrete examples of gene-network dynamics by considering the lactose operon, the tryptophan operon, and the lysis-lysogeny switch. The notes contain an index for easy location of particular topics as well as an extensive bibliography of the current literature. The target audience of these notes are mainly graduat...

  7. The Drosophila Huntington's disease gene ortholog dhtt influences chromatin regulation during development.

    Science.gov (United States)

    Dietz, Kevin N; Di Stefano, Luisa; Maher, Robert C; Zhu, Hui; Macdonald, Marcy E; Gusella, James F; Walker, James A

    2015-01-15

    Huntington's disease is an autosomal dominant neurodegenerative disorder caused by a CAG expansion mutation in HTT, the gene encoding huntingtin. Evidence from both human genotype-phenotype relationships and mouse model systems suggests that the mutation acts by dysregulating some normal activity of huntingtin. Recent work in the mouse has revealed a role for huntingtin in epigenetic regulation during development. Here, we examine the role of the Drosophila huntingtin ortholog (dhtt) in chromatin regulation in the development of the fly. Although null dhtt mutants display no overt phenotype, we found that dhtt acts as a suppressor of position-effect variegation (PEV), suggesting that it influences chromatin organization. We demonstrate that dhtt affects heterochromatin spreading in a PEV model by modulating histone H3K9 methylation levels at the heterochromatin-euchromatin boundary. To gain mechanistic insights into how dhtt influences chromatin function, we conducted a candidate genetic screen using RNAi lines targeting known PEV modifier genes. We found that dhtt modifies phenotypes caused by knockdown of a number of key epigenetic regulators, including chromatin-associated proteins, histone demethylases (HDMs) and methyltransferases. Notably, dhtt strongly modifies phenotypes resulting from loss of the HDM dLsd1, in both the ovary and wing, and we demonstrate that dhtt appears to act as a facilitator of dLsd1 function in regulating global histone H3K4 methylation levels. These findings suggest that a fundamental aspect of huntingtin function in heterochromatin/euchromatin organization is evolutionarily conserved across phyla. © The Author 2014. Published by Oxford University Press. All rights reserved. For Permissions, please email: journals.permissions@oup.com.

  8. Rapid male-specific regulatory divergence and down regulation of spermatogenesis genes in Drosophila species hybrids.

    Directory of Open Access Journals (Sweden)

    Jennifer Ferguson

    Full Text Available In most crosses between closely related species of Drosophila, the male hybrids are sterile and show postmeiotic abnormalities. A series of gene expression studies using genomic approaches have found significant down regulation of postmeiotic spermatogenesis genes in sterile male hybrids. These results have led some to suggest a direct relationship between down regulation in gene expression and hybrid sterility. An alternative explanation to a cause-and-effect relationship between misregulation of gene expression and male sterility is rapid divergence of male sex regulatory elements leading to incompatible interactions in an interspecies hybrid genome. To test the effect of regulatory divergence in spermatogenesis gene expression, we isolated 35 fertile D. simulans strains with D. mauritiana introgressions in either the X, second or third chromosome. We analyzed gene expression in these fertile hybrid strains for a subset of spermatogenesis genes previously reported as significantly under expressed in sterile hybrids relative to D. simulans. We found that fertile autosomal introgressions can cause levels of gene down regulation similar to that of sterile hybrids. We also found that X chromosome heterospecific introgressions cause significantly less gene down regulation than autosomal introgressions. Our results provide evidence that rapid male sex gene regulatory divergence can explain misexpression of spermatogenesis genes in hybrids.

  9. Gene therapy: Regulations, ethics and its practicalities in liver disease

    OpenAIRE

    Jin, Xi; Yang, Yi-Da; Li, You-Ming

    2008-01-01

    Gene therapy is a new and promising approach which opens a new door to the treatment of human diseases. By direct transfer of genetic materials to the target cells, it could exert functions on the level of genes and molecules. It is hoped to be widely used in the treatment of liver disease, especially hepatic tumors by using different vectors encoding the aim gene for anti-tumor activity by activating primary and adaptive immunity, inhibiting oncogene and angiogenesis. Despite the huge curati...

  10. Serum response factor: positive and negative regulation of an epithelial gene expression network in the destrin mutant cornea

    Science.gov (United States)

    Kawakami-Schulz, Sharolyn V.; Verdoni, Angela M.; Sattler, Shannon G.; Jessen, Erik; Kao, Winston W.-Y.; Ikeda, Akihiro

    2014-01-01

    Increased angiogenesis, inflammation, and proliferation are hallmarks of diseased tissues, and in vivo models of these disease phenotypes can provide insight into disease pathology. Dstncorn1 mice, deficient for the actin depolymerizing factor destrin (DSTN), display an increase of serum response factor (SRF) that results in epithelial hyperproliferation, inflammation, and neovascularization in the cornea. Previous work demonstrated that conditional ablation of Srf from the corneal epithelium of Dstncorn1 mice returns the cornea to a wild-type (WT) like state. This result implicated SRF as a major regulator of genes that contributes to abnormal phenotypes in Dstncorn1 cornea. The purpose of this study is to identify gene networks that are affected by increased expression of Srf in the Dstncorn1 cornea. Microarray analysis led to characterization of gene expression changes that occur when conditional knockout of Srf rescues mutant phenotypes in the cornea of Dstncorn1 mice. Comparison of gene expression values from WT, Dstncorn1 mutant, and Dstncorn1 rescued cornea identified >400 differentially expressed genes that are downstream from SRF. Srf ablation had a significant effect on genes associated with epithelial cell-cell junctions and regulation of actin dynamics. The majority of genes affected by SRF are downregulated in the Dstncorn1 mutant cornea, suggesting that increased SRF negatively affects transcription of SRF gene targets. ChIP-seq analysis on Dstncorn1 mutant and WT tissue revealed that, despite being present in higher abundance, SRF binding is significantly decreased in the Dstncorn1 mutant cornea. This study uses a unique model combining genetic and genomic approaches to identify genes that are regulated by SRF. These findings expand current understanding of the role of SRF in both normal and abnormal tissue homeostasis. PMID:24550211

  11. Serum response factor: positive and negative regulation of an epithelial gene expression network in the destrin mutant cornea.

    Science.gov (United States)

    Kawakami-Schulz, Sharolyn V; Verdoni, Angela M; Sattler, Shannon G; Jessen, Erik; Kao, Winston W-Y; Ikeda, Akihiro; Ikeda, Sakae

    2014-04-15

    Increased angiogenesis, inflammation, and proliferation are hallmarks of diseased tissues, and in vivo models of these disease phenotypes can provide insight into disease pathology. Dstn(corn1) mice, deficient for the actin depolymerizing factor destrin (DSTN), display an increase of serum response factor (SRF) that results in epithelial hyperproliferation, inflammation, and neovascularization in the cornea. Previous work demonstrated that conditional ablation of Srf from the corneal epithelium of Dstn(corn1) mice returns the cornea to a wild-type (WT) like state. This result implicated SRF as a major regulator of genes that contributes to abnormal phenotypes in Dstn(corn1) cornea. The purpose of this study is to identify gene networks that are affected by increased expression of Srf in the Dstn(corn1) cornea. Microarray analysis led to characterization of gene expression changes that occur when conditional knockout of Srf rescues mutant phenotypes in the cornea of Dstn(corn1) mice. Comparison of gene expression values from WT, Dstn(corn1) mutant, and Dstn(corn1) rescued cornea identified >400 differentially expressed genes that are downstream from SRF. Srf ablation had a significant effect on genes associated with epithelial cell-cell junctions and regulation of actin dynamics. The majority of genes affected by SRF are downregulated in the Dstn(corn1) mutant cornea, suggesting that increased SRF negatively affects transcription of SRF gene targets. ChIP-seq analysis on Dstn(corn1) mutant and WT tissue revealed that, despite being present in higher abundance, SRF binding is significantly decreased in the Dstn(corn1) mutant cornea. This study uses a unique model combining genetic and genomic approaches to identify genes that are regulated by SRF. These findings expand current understanding of the role of SRF in both normal and abnormal tissue homeostasis.

  12. Histone deacetylase regulation of immune gene expression in tumor cells

    Science.gov (United States)

    Tomasi, Thomas B.

    2011-01-01

    Epigenetic modifications of chromatin, such as histone acetylation, are involved in repression of tumor antigens and multiple immune genes that are thought to facilitate tumor escape. The status of acetylation in a cell is determined by the balance of the activities of histone acetyltransferases and histone deacetylases. Inhibitors of histone deacetylase (HDACi) can enhance the expression of immunologically important molecules in tumor cells and HDACi treated tumor cells are able to induce immune responses in vitro and in vivo. Systemic HDACi are in clinical trails in cancer and also being used in several autoimmune disease models. To date, 18 HDACs have been reported in human cells and more than thirty HDACi identified, although only a few immune targets of these inhibitors have been identified. Here, we discuss the molecular pathways employed by HDACi and their potential role in inducing immune responses against tumors. We review data suggesting that selection of target specific HDACi and combinations with other agents and modalities, including those that activate stress pathways, may further enhance the efficacy of epigenetic therapies. PMID:18213528

  13. Ascl1 Coordinately Regulates Gene Expression and the Chromatin Landscape during Neurogenesis

    Directory of Open Access Journals (Sweden)

    Alexandre A.S.F. Raposo

    2015-03-01

    Full Text Available The proneural transcription factor Ascl1 coordinates gene expression in both proliferating and differentiating progenitors along the neuronal lineage. Here, we used a cellular model of neurogenesis to investigate how Ascl1 interacts with the chromatin landscape to regulate gene expression when promoting neuronal differentiation. We find that Ascl1 binding occurs mostly at distal enhancers and is associated with activation of gene transcription. Surprisingly, the accessibility of Ascl1 to its binding sites in neural stem/progenitor cells remains largely unchanged throughout their differentiation, as Ascl1 targets regions of both readily accessible and closed chromatin in proliferating cells. Moreover, binding of Ascl1 often precedes an increase in chromatin accessibility and the appearance of new regions of open chromatin, associated with de novo gene expression during differentiation. Our results reveal a function of Ascl1 in promoting chromatin accessibility during neurogenesis, linking the chromatin landscape at Ascl1 target regions with the temporal progression of its transcriptional program.

  14. Thermodynamic state ensemble models of cis-regulation.

    Directory of Open Access Journals (Sweden)

    Marc S Sherman

    Full Text Available A major goal in computational biology is to develop models that accurately predict a gene's expression from its surrounding regulatory DNA. Here we present one class of such models, thermodynamic state ensemble models. We describe the biochemical derivation of the thermodynamic framework in simple terms, and lay out the mathematical components that comprise each model. These components include (1 the possible states of a promoter, where a state is defined as a particular arrangement of transcription factors bound to a DNA promoter, (2 the binding constants that describe the affinity of the protein-protein and protein-DNA interactions that occur in each state, and (3 whether each state is capable of transcribing. Using these components, we demonstrate how to compute a cis-regulatory function that encodes the probability of a promoter being active. Our intention is to provide enough detail so that readers with little background in thermodynamics can compose their own cis-regulatory functions. To facilitate this goal, we also describe a matrix form of the model that can be easily coded in any programming language. This formalism has great flexibility, which we show by illustrating how phenomena such as competition between transcription factors and cooperativity are readily incorporated into these models. Using this framework, we also demonstrate that Michaelis-like functions, another class of cis-regulatory models, are a subset of the thermodynamic framework with specific assumptions. By recasting Michaelis-like functions as thermodynamic functions, we emphasize the relationship between these models and delineate the specific circumstances representable by each approach. Application of thermodynamic state ensemble models is likely to be an important tool in unraveling the physical basis of combinatorial cis-regulation and in generating formalisms that accurately predict gene expression from DNA sequence.

  15. miRNA-mediated functional changes through co-regulating function related genes.

    Directory of Open Access Journals (Sweden)

    Jie He

    Full Text Available BACKGROUND: MicroRNAs play important roles in various biological processes involving fairly complex mechanism. Analysis of genome-wide miRNA microarray demonstrate that a single miRNA can regulate hundreds of genes, but the regulative extent on most individual genes is surprisingly mild so that it is difficult to understand how a miRNA provokes detectable functional changes with such mild regulation. RESULTS: To explore the internal mechanism of miRNA-mediated regulation, we re-analyzed the data collected from genome-wide miRNA microarray with bioinformatics assay, and found that the transfection of miR-181b and miR-34a in Hela and HCT-116 tumor cells regulated large numbers of genes, among which, the genes related to cell growth and cell death demonstrated high Enrichment scores, suggesting that these miRNAs may be important in cell growth and cell death. MiR-181b induced changes in protein expression of most genes that were seemingly related to enhancing cell growth and decreasing cell death, while miR-34a mediated contrary changes of gene expression. Cell growth assays further confirmed this finding. In further study on miR-20b-mediated osteogenesis in hMSCs, miR-20b was found to enhance osteogenesis by activating BMPs/Runx2 signaling pathway in several stages by co-repressing of PPARγ, Bambi and Crim1. CONCLUSIONS: With its multi-target characteristics, miR-181b, miR-34a and miR-20b provoked detectable functional changes by co-regulating functionally-related gene groups or several genes in the same signaling pathway, and thus mild regulation from individual miRNA targeting genes could have contributed to an additive effect. This might also be one of the modes of miRNA-mediated gene regulation.

  16. Analysis of mammary specific gene locus regulation in differentiated cells derived by somatic cell fusion

    International Nuclear Information System (INIS)

    Robinson, Claire; Kolb, Andreas F.

    2009-01-01

    The transcriptional regulation of a gene is best analysed in the context of its normal chromatin surroundings. However, most somatic cells, in contrast to embryonic stem cells, are refractory to accurate modification by homologous recombination. We show here that it is possible to introduce precise genomic modifications in ES cells and to analyse the phenotypic consequences in differentiated cells by using a combination of gene targeting, site-specific recombination and somatic cell fusion. To provide a proof of principle, we have analysed the regulation of the casein gene locus in mammary gland cells derived from modified murine ES cells by somatic cell fusion. A β-galactosidase reporter gene was inserted in place of the β-casein gene and the modified ES cells, which do not express the reporter gene, were fused with the mouse mammary gland cell line HC11. The resulting cell clones expressed the β-galactosidase gene to a similar extent and with similar hormone responsiveness as the endogenous gene. However, a reporter gene under the control of a minimal β-casein promoter (encompassing the two consensus STAT5 binding sites which mediate the hormone response of the casein genes) was unable to replicate expression levels or hormone responsiveness of the endogenous gene when inserted into the same site of the casein locus. As expected, these results implicate sequences other than the STAT5 sites in the regulation of the β-casein gene

  17. Modeling regulated water utility investment incentives

    Science.gov (United States)

    Padula, S.; Harou, J. J.

    2014-12-01

    This work attempts to model the infrastructure investment choices of privatized water utilities subject to rate of return and price cap regulation. The goal is to understand how regulation influences water companies' investment decisions such as their desire to engage in transfers with neighbouring companies. We formulate a profit maximization capacity expansion model that finds the schedule of new supply, demand management and transfer schemes that maintain the annual supply-demand balance and maximize a companies' profit under the 2010-15 price control process in England. Regulatory incentives for costs savings are also represented in the model. These include: the CIS scheme for the capital expenditure (capex) and incentive allowance schemes for the operating expenditure (opex) . The profit-maximizing investment program (what to build, when and what size) is compared with the least cost program (social optimum). We apply this formulation to several water companies in South East England to model performance and sensitivity to water network particulars. Results show that if companies' are able to outperform the regulatory assumption on the cost of capital, a capital bias can be generated, due to the fact that the capital expenditure, contrarily to opex, can be remunerated through the companies' regulatory capital value (RCV). The occurrence of the 'capital bias' or its entity depends on the extent to which a company can finance its investments at a rate below the allowed cost of capital. The bias can be reduced by the regulatory penalties for underperformances on the capital expenditure (CIS scheme); Sensitivity analysis can be applied by varying the CIS penalty to see how and to which extent this impacts the capital bias effect. We show how regulatory changes could potentially be devised to partially remove the 'capital bias' effect. Solutions potentially include allowing for incentives on total expenditure rather than separately for capex and opex and allowing

  18. Gene Expression in Pseudomonas aeruginosa: Evidence of Iron Override Effects on Quorum Sensing and Biofilm-Specific Gene Regulation

    Science.gov (United States)

    Bollinger, Nikki; Hassett, Daniel J.; Iglewski, Barbara H.; Costerton, J. William; McDermott, Timothy R.

    2001-01-01

    ) in the biofilm mode of growth, QS may also have negative regulatory functions; (iii) QS-based gene regulation models based on studies with planktonic cells must be modified in order to explain biofilm gene expression behavior; and (iv) gene expression in biofilms is dynamic. PMID:11222597

  19. Lymphocyte gene expression signatures from patients and mouse models of hereditary hemochromatosis reveal a function of HFE as a negative regulator of CD8+ T-lymphocyte activation and differentiation in vivo.

    Directory of Open Access Journals (Sweden)

    Mónica Costa

    Full Text Available Abnormally low CD8+ T-lymphocyte numbers is characteristic of some patients with hereditary hemochromatosis (HH, a MHC-linked disorder of iron overload. Both environmental and genetic components are known to influence CD8+ T-lymphocyte homeostasis but the role of the HH associated protein HFE is still insufficiently understood. Genome-wide expression profiling was performed in peripheral blood CD8+ T lymphocytes from HH patients selected according to CD8+ T-lymphocyte numbers and from Hfe-/- mice maintained either under normal or high iron diet conditions. In addition, T-lymphocyte apoptosis and cell cycle progression were analyzed by flow cytometry in HH patients. HH patients with low CD8+ T-lymphocyte numbers show a differential expression of genes related to lymphocyte differentiation and maturation namely CCR7, LEF1, ACTN1, NAA50, P2RY8 and FOSL2, whose expression correlates with the relative proportions of naïve, central and effector memory subsets. In addition, expression levels of LEF1 and P2RY8 in memory cells as well as the proportions of CD8+ T cells in G2/M cell cycle phase are significantly different in HH patients compared to controls. Hfe-/- mice do not show alterations in CD8+ T-lymphocyte numbers but differential gene response patterns. We found an increased expression of S100a8 and S100a9 that is most pronounced in high iron diet conditions. Similarly, CD8+ T lymphocytes from HH patients display higher S100a9 expression both at the mRNA and protein level. Altogether, our results support a role for HFE as a negative regulator of CD8+ T-lymphocyte activation. While the activation markers S100a8 and S100a9 are strongly increased in CD8+ T cells from both, Hfe-/- mice and HH patients, a differential profile of genes related to differentiation/maturation of CD8+ T memory cells is evident in HH patients only. This supports the notion that HFE contributes, at least in part, to the generation of low peripheral blood CD8+ T lymphocytes

  20. Regulation of mitochondrial gene expression, the epigenetic enigma

    NARCIS (Netherlands)

    Mposhi, Archibold; van der Wijst, Monique G. P.; Faber, Klaas Nico; Rots, Marianne G.

    2017-01-01

    Epigenetics provides an important layer of information on top of the DNA sequence and is essential for establishing gene expression profiles. Extensive studies have shown that nuclear DNA methylation and histone modifications influence nuclear gene expression. However, it remains unclear whether

  1. Gene program-specific regulation of PGC-1{alpha} activity

    DEFF Research Database (Denmark)

    Schmidt, Søren F; Mandrup, Susanne

    2011-01-01

    . 1232-1244) demonstrated that phosphorylation of PGC-1α by the p70 ribosomal protein S6 kinase 1 (S6K1) specifically interfered with the interaction between PGC-1α and HNF4α in liver and blocked the coactivation of the gluconeogenic target genes. This demonstrates how independent fine-tuning of gene...

  2. Anthocyanin biosynthesis in fruit tree crops: Genes and their regulation

    African Journals Online (AJOL)

    The anthocyanin biosynthesis pathway is a little complex with branches responsible for the synthesis of a variety of metabolites. In fruit tree crops, during the past decade, many structural genes encoding enzymes in the anthocyanin biosynthetic pathway and various regulatory genes encoding transcription factors that ...

  3. Stability and flexibility of epigenetic gene regulation in mammalian development.

    Science.gov (United States)

    Reik, Wolf

    2007-05-24

    During development, cells start in a pluripotent state, from which they can differentiate into many cell types, and progressively develop a narrower potential. Their gene-expression programmes become more defined, restricted and, potentially, 'locked in'. Pluripotent stem cells express genes that encode a set of core transcription factors, while genes that are required later in development are repressed by histone marks, which confer short-term, and therefore flexible, epigenetic silencing. By contrast, the methylation of DNA confers long-term epigenetic silencing of particular sequences--transposons, imprinted genes and pluripotency-associated genes--in somatic cells. Long-term silencing can be reprogrammed by demethylation of DNA, and this process might involve DNA repair. It is not known whether any of the epigenetic marks has a primary role in determining cell and lineage commitment during development.

  4. Highly sensitive inference of time-delayed gene regulation by network deconvolution.

    Science.gov (United States)

    Chen, Haifen; Mundra, Piyushkumar A; Zhao, Li Na; Lin, Feng; Zheng, Jie

    2014-01-01

    Gene regulatory network (GRN) is a fundamental topic in systems biology. The dynamics of GRN can shed light on the cellular processes, which facilitates the understanding of the mechanisms of diseases when the processes are dysregulated. Accurate reconstruction of GRN could also provide guidelines for experimental biologists. Therefore, inferring gene regulatory networks from high-throughput gene expression data is a central problem in systems biology. However, due to the inherent complexity of gene regulation, noise in measuring the data and the short length of time-series data, it is very challenging to reconstruct accurate GRNs. On the other hand, a better understanding into gene regulation could help to improve the performance of GRN inference. Time delay is one of the most important characteristics of gene regulation. By incorporating the information of time delays, we can achieve more accurate inference of GRN. In this paper, we propose a method to infer time-delayed gene regulation based on cross-correlation and network deconvolution (ND). First, we employ cross-correlation to obtain the probable time delays for the interactions between each target gene and its potential regulators. Then based on the inferred delays, the technique of ND is applied to identify direct interactions between the target gene and its regulators. Experiments on real-life gene expression datasets show that our method achieves overall better performance than existing methods for inferring time-delayed GRNs. By taking into account the time delays among gene interactions, our method is able to infer GRN more accurately. The effectiveness of our method has been shown by the experiments on three real-life gene expression datasets of yeast. Compared with other existing methods which were designed for learning time-delayed GRN, our method has significantly higher sensitivity without much reduction of specificity.

  5. The ULT1 and ULT2 trxG genes play overlapping roles in Arabidopsis development and gene regulation.

    Science.gov (United States)

    Monfared, Mona M; Carles, Cristel C; Rossignol, Pascale; Pires, Helena R; Fletcher, Jennifer C

    2013-09-01

    The epigenetic regulation of gene expression is critical for ensuring the proper deployment and stability of defined genome transcription programs at specific developmental stages. The cellular memory of stable gene expression states during animal and plant development is mediated by the opposing activities of Polycomb group (PcG) factors and trithorax group (trxG) factors. Yet, despite their importance, only a few trxG factors have been characterized in plants and their roles in regulating plant development are poorly defined. In this work, we report that the closely related Arabidopsis trxG genes ULTRAPETALA1 (ULT1) and ULT2 have overlapping functions in regulating shoot and floral stem cell accumulation, with ULT1 playing a major role but ULT2 also making a minor contribution. The two genes also have a novel, redundant activity in establishing the apical–basal polarity axis of the gynoecium, indicating that they function in differentiating tissues. Like ULT1 proteins, ULT2 proteins have a dual nuclear and cytoplasmic localization, and the two proteins physically associate in planta. Finally, we demonstrate that ULT1 and ULT2 have very similar overexpression phenotypes and regulate a common set of key development target genes, including floral MADS-box genes and class I KNOX genes. Our results reveal that chromatin remodeling mediated by the ULT1 and ULT2 proteins is necessary to control the development of meristems and reproductive organs. They also suggest that, like their animal counterparts, plant trxG proteins may function in multi-protein complexes to up-regulate the expression of key stage- and tissue-specific developmental regulatory genes.

  6. Stressing Escherichia coli to educate students about research: A CURE to investigate multiple levels of gene regulation.

    Science.gov (United States)

    McDonough, Janet; Goudsouzian, Lara K; Papaj, Agllai; Maceli, Ashley R; Klepac-Ceraj, Vanja; Peterson, Celeste N

    2017-09-01

    Course-based undergraduate research experiences (CUREs) have been shown to increase student retention and learning in the biological sciences. Most CURES cover only one aspect of gene regulation, such as transcriptional control. Here we present a new inquiry-based lab that engages understanding of gene expression from multiple perspectives. Students carry out a forward genetic screen to identify regulators of the stationary phase master regulator RpoS in the model organism Escherichia coli and then use a series of reporter fusions to determine if the regulation is at the level of transcription or the post-transcription level. This easy-to-implement course has been run both as a 9-week long project and a condensed 5-6 week version in three different schools and types of courses. A majority of the genes found in the screen are novel, thus giving students the opportunity to contribute to original findings to the field. Assessments of this CURE show student gains in learning in many knowledge areas. In addition, attitudinal surveys suggest the students are enthusiastic about the screen and their learning about gene regulation. In summary, this lab would be an appropriate addition to an intermediate or advanced level Molecular Biology, Genetics, or Microbiology curriculum. © 2017 by The International Union of Biochemistry and Molecular Biology, 45(5):449-458, 2017. © 2017 The International Union of Biochemistry and Molecular Biology.

  7. Identification and functional clustering of genes regulating muscle protein degradation from amongst the known C. elegans muscle mutants.

    Directory of Open Access Journals (Sweden)

    Freya Shephard

    Full Text Available Loss of muscle mass via protein degradation is an important clinical problem but we know little of how muscle protein degradation is regulated genetically. To gain insight our labs developed C. elegans into a model for understanding the regulation of muscle protein degradation. Past studies uncovered novel functional roles for genes affecting muscle and/or involved in signalling in other cells or tissues. Here we examine most of the genes previously identified as the sites of mutations affecting muscle for novel roles in regulating degradation. We evaluate genomic (RNAi knockdown approaches and combine them with our established genetic (mutant and pharmacologic (drugs approaches to examine these 159 genes. We find that RNAi usually recapitulates both organismal and sub-cellular mutant phenotypes but RNAi, unlike mutants, can frequently be used acutely to study gene function solely in differentiated muscle. In the majority of cases where RNAi does not produce organismal level phenotypes, sub-cellular defects can be detected; disrupted proteostasis is most commonly observed. We identify 48 genes in which mutation or RNAi knockdown causes excessive protein degradation; myofibrillar and/or mitochondrial morphologies are also disrupted in 19 of these 48 cases. These 48 genes appear to act via at least three sub-networks to control bulk degradation of protein in muscle cytosol. Attachment to the extracellular matrix regulates degradation via unidentified proteases and affects myofibrillar and mitochondrial morphology. Growth factor imbalance and calcium overload promote lysosome based degradation whereas calcium deficit promotes proteasome based degradation, in both cases myofibrillar and mitochondrial morphologies are largely unaffected. Our results provide a framework for effectively using RNAi to identify and functionally cluster novel regulators of degradation. This clustering allows prioritization of candidate genes/pathways for future

  8. Overexpression and Down-Regulation of Barley Lipoxygenase LOX2.2 Affects Jasmonate-Regulated Genes and Aphid Fecundity

    Directory of Open Access Journals (Sweden)

    Aleksandra Losvik

    2017-12-01

    Full Text Available Aphids are pests on many crops and depend on plant phloem sap as their food source. In an attempt to find factors improving plant resistance against aphids, we studied the effects of overexpression and down-regulation of the lipoxygenase gene LOX2.2 in barley (Hordeum vulgare L. on the performance of two aphid species. A specialist, bird cherry-oat aphid (Rhopalosiphum padi L. and a generalist, green peach aphid (Myzus persicae Sulzer were studied. LOX2.2 overexpressing lines showed up-regulation of some other jasmonic acid (JA-regulated genes, and antisense lines showed down-regulation of such genes. Overexpression or suppression of LOX2.2 did not affect aphid settling or the life span on the plants, but in short term fecundity tests, overexpressing plants supported lower aphid numbers and antisense plants higher aphid numbers. The amounts and composition of released volatile organic compounds did not differ between control and LOX2.2 overexpressing lines. Up-regulation of genes was similar for both aphid species. The results suggest that LOX2.2 plays a role in the activation of JA-mediated responses and indicates the involvement of LOX2.2 in basic defense responses.

  9. Vitamin A and feeding statuses modulate the insulin-regulated gene expression in Zucker lean and fatty primary rat hepatocytes.

    Directory of Open Access Journals (Sweden)

    Wei Chen

    Full Text Available Unattended hepatic insulin resistance predisposes individuals to dyslipidemia, type 2 diabetes and many other metabolic complications. The mechanism of hepatic insulin resistance at the gene expression level remains unrevealed. To examine the effects of vitamin A (VA, total energy intake and feeding conditions on the insulin-regulated gene expression in primary hepatocytes of Zucker lean (ZL and fatty (ZF rats, we analyze the expression levels of hepatic model genes in response to the treatments of insulin and retinoic acid (RA. We report that the insulin- and RA-regulated glucokinase, sterol regulatory element-binding protein-1c and cytosolic form of phosphoenolpyruvate carboxykinase expressions are impaired in hepatocytes of ZF rats fed chow or a VA sufficient (VAS diet ad libitum. The impairments are partially corrected when ZF rats are fed a VA deficient (VAD diet ad libitum or pair-fed a VAS diet to the intake of their VAD counterparts in non-fasting conditions. Interestingly in the pair-fed ZL and ZF rats, transient overeating on the last day of pair-feeding regimen changes the expression levels of some VA catabolic genes, and impairs the insulin- and RA-regulated gene expression in hepatocytes. These results demonstrate that VA and feeding statuses modulate the hepatic insulin sensitivity at the gene expression level.

  10. The Orphan Gene dauerless Regulates Dauer Development and Intraspecific Competition in Nematodes by Copy Number Variation.

    Science.gov (United States)

    Mayer, Melanie G; Rödelsperger, Christian; Witte, Hanh; Riebesell, Metta; Sommer, Ralf J

    2015-06-01

    Many nematodes form dauer larvae when exposed to unfavorable conditions, representing an example of phenotypic plasticity and a major survival and dispersal strategy. In Caenorhabditis elegans, the regulation of dauer induction is a model for pheromone, insulin, and steroid-hormone signaling. Recent studies in Pristionchus pacificus revealed substantial natural variation in various aspects of dauer development, i.e. pheromone production and sensing and dauer longevity and fitness. One intriguing example is a strain from Ohio, having extremely long-lived dauers associated with very high fitness and often forming the most dauers in response to other strains' pheromones, including the reference strain from California. While such examples have been suggested to represent intraspecific competition among strains, the molecular mechanisms underlying these dauer-associated patterns are currently unknown. We generated recombinant-inbred-lines between the Californian and Ohioan strains and used quantitative-trait-loci analysis to investigate the molecular mechanism determining natural variation in dauer development. Surprisingly, we discovered that the orphan gene dauerless controls dauer formation by copy number variation. The Ohioan strain has one dauerless copy causing high dauer formation, whereas the Californian strain has two copies, resulting in strongly reduced dauer formation. Transgenic animals expressing multiple copies do not form dauers. dauerless is exclusively expressed in CAN neurons, and both CAN ablation and dauerless mutations increase dauer formation. Strikingly, dauerless underwent several duplications and acts in parallel or downstream of steroid-hormone signaling but upstream of the nuclear-hormone-receptor daf-12. We identified the novel or fast-evolving gene dauerless as inhibitor of dauer development. Our findings reveal the importance of gene duplications and copy number variations for orphan gene function and suggest daf-12 as major target for

  11. From Biophysics to Evolutionary Genetics: Statistical Aspects of Gene Regulation

    Science.gov (United States)

    Lässig, Michael

    Genomic functions often cannot be understood at the level of single genes but require the study of gene networks. This systems biology credo is nearly commonplace by now. Evidence comes from the comparative analysis of entire genomes: current estimates put, for example, the number of human genes at around 22,000, hardly more than the 14,000 of the fruit fly, and not even an order of magnitude higher than the 6,000 of baker's yeast. The complexity and diversity of higher animals, therefore, cannot be explained in terms of their gene numbers. If, however, a biological function requires the concerted action of several genes, and conversely, a gene takes part in several functional contexts, an organism may be defined less by its individual genes but by their interactions. The emerging picture of the genome as a strongly interacting system with many degrees of freedom brings new challenges for experiment and theory, many of which are of a statistical nature. And indeed, this picture continues to make the subject attractive to a growing number of statistical physicists.

  12. The precise regulation of different COR genes by individual CBF transcription factors in Arabidopsis thaliana.

    Science.gov (United States)

    Shi, Yihao; Huang, Jiaying; Sun, Tianshu; Wang, Xuefei; Zhu, Chenqi; Ai, Yuxi; Gu, Hongya

    2017-02-01

    The transcription factors CBF1/2/3 are reported to play a dominant role in the cold responsive network of Arabidopsis by directly regulating the expression levels of cold responsive (COR) genes. In this study, we obtained CRISPR/Cas9-mediated loss-of-function mutants of cbf1∼3. Over 3,000 COR genes identified by RNA-seq analysis showed a slight but significant change in their expression levels in the mutants compared to the wild-type plants after being treated at 4 °C for 12 h. The C-repeat (CRT) motif (5'-CCGAC-3') was enriched in promoters of genes that were up-regulated by CBF2 and CBF3 but not in promoters of genes up-regulated by CBF1. These data suggest that CBF2 and CBF3 play a more important role in directing the cold response by regulating different sets of downstream COR genes. More than 2/3 of COR genes were co-regulated by two or three CBFs and were involved mainly in cellular signal transduction and metabolic processes; less than 1/3 of the genes were regulated by one CBF, and those genes up-regulated were enriched in cold-related abiotic stress responses. Our results indicate that CBFs play an important role in the trade-off between cold tolerance and plant growth through the precise regulation of COR genes in the complicated transcriptional network. © 2016 The Authors. Journal of Integrative Plant Biology Published by John Wiley & Sons Australia, Ltd on behalf of Institute of Botany, Chinese Academy of Sciences.

  13. Pyroglutamylated RF-amide peptide (QRFP) gene is regulated by metabolic endotoxemia.

    Science.gov (United States)

    Jossart, Christian; Mulumba, Mukandila; Granata, Riccarda; Gallo, Davide; Ghigo, Ezio; Marleau, Sylvie; Servant, Marc J; Ong, Huy

    2014-01-01

    Pyroglutamylated RF-amide peptide (QRFP) is involved in the regulation of food intake, thermogenesis, adipogenesis, and lipolysis. The expression of QRFP in adipose tissue is reduced in diet-induced obesity, a mouse model in which plasma concentrations of endotoxins are slightly elevated. The present study investigated the role of metabolic endotoxemia (ME) on QRFP gene regulation. Our results uncovered the expression of QRFP in murine macrophages and cell lines. This expression has been found to be decreased in mice with ME. Low doses of lipopolysaccharide (LPS) transiently down-regulated QRFP by 59% in RAW264.7 macrophages but not in 3T3-L1 adipocytes. The effect of LPS on QRFP expression in macrophages was dependent on the inhibitor of kB kinase and TIR-domain-containing adapter-inducing interferon (IFN)-β (TRIF) but not myeloid differentiation primary response gene 88. IFN-β was induced by ME in macrophages. IFN-β sustainably reduced QRFP expression in macrophages (64%) and adipocytes (49%). IFN-γ down-regulated QRFP (74%) in macrophages only. Both IFNs inhibited QRFP secretion from macrophages. LPS-stimulated macrophage-conditioned medium reduced QRFP expression in adipocytes, an effect blocked by IFN-β neutralizing antibody. The effect of IFN-β on QRFP expression was dependent on phosphoinositide 3-kinase, p38 MAPK, and histone deacetylases. The effect of IFN-γ was dependent on MAPK/ERK kinase 1/2 and histone deacetylases. Macrophage-conditioned medium containing increased amounts of QRFP preserved adipogenesis in adipocytes. In conclusion, LPS induces IFN-β release from macrophages, which reduces QRFP expression in both macrophages and adipocytes in an autocrine/paracrine-dependent manner, suggesting QRFP as a potential biomarker in ME.

  14. FOXA2 regulates a network of genes involved in critical functions of human intestinal epithelial cells.

    Science.gov (United States)

    Gosalia, Nehal; Yang, Rui; Kerschner, Jenny L; Harris, Ann

    2015-07-01

    The forkhead box A (FOXA) family of pioneer transcription factors is critical for the development of many endoderm-derived tissues. Their importance in regulating biological processes in the lung and liver is extensively characterized, though much less is known about their role in intestine. Here we investigate the contribution of FOXA2 to coordinating intestinal epithelial cell function using postconfluent Caco2 cells, differentiated into an enterocyte-like model. FOXA2 binding sites genome-wide were determined by ChIP-seq and direct targets of the factor were validated by ChIP-qPCR and siRNA-mediated depletion of FOXA1/2 followed by RT-qPCR. Peaks of FOXA2 occupancy were frequent at loci contributing to gene ontology pathways of regulation of cell migration, cell motion, and plasma membrane function. Depletion of both FOXA1 and FOXA2 led to a significant reduction in the expression of multiple transmembrane proteins including ion channels and transporters, which form a network that is essential for maintaining normal ion and solute transport. One of the targets was the adenosine A2B receptor, and reduced receptor mRNA levels were associated with a functional decrease in intracellular cyclic AMP. We also observed that 30% of FOXA2 binding sites contained a GATA motif and that FOXA1/A2 depletion reduced GATA-4, but not GATA-6 protein levels. These data show that FOXA2 plays a pivotal role in regulating intestinal epithelial cell function. Moreover, that the FOXA and GATA families of transcription factors may work cooperatively to regulate gene expression genome-wide in the intestinal epithelium. Copyright © 2015 the American Physiological Society.

  15. COMPLEMENT REGULATION IN RENAL DISEASE MODELS

    Science.gov (United States)

    Naik, Abhijit; Sharma, Shweta; Quigg, Richard J.

    2014-01-01

    Activation of the complement system is tightly regulated by plasma and cell-associated complement regulatory proteins (CRPs), such as factor H (fH), decay-accelerating factor (DAF), and membrane cofactor protein (MCP). Animal models of disease have provided considerable insights into the important roles for CRPs in the kidney. Mice deficient in fH have excessive fluid phase C3 activation and inactivation leading to deposition of iC3b in glomerular capillary walls (GCW), comparable to dense deposit disease. In contrast, when fH lacks C-terminal surface targeting regions, local activation on the GCW leads to a disease reminiscent of thrombotic microangiopathy. The uniquely rodent protein, CR1-related y (Crry), has features analogous to human MCP. Defective Crry leads to unrestricted alternative pathway activation in the tubulointerstitium (TI) resulting in pathological features ranging from TMA, acute kidney injury and TI nephritis. In the presence of initiators of the classical or lectin pathways, commonly in the form of immune complexes in human glomerular diseases, complement regulation on self is stressed, with the potential for recruitment of the spontaneously active alternative pathway. The threshold for this activation is set by CRPs; pathology is more likely when complement regulation is defective. Within the endocapillary region of the GCW, fH is key, while DAF and Crry are protective on mesangial cells and podocytes. Arguably, acquired alterations in these CRPs is a more common event, extending from pathological states of cellular injury or production of inhibitory antibodies, to physiological fine tuning of the adaptive immune response. PMID:24161042

  16. Lipopolysaccharide triggers nuclear import of Lpcat1 to regulate inducible gene expression in lung epithelia.

    Science.gov (United States)

    Ellis, Bryon; Kaercher, Leah; Snavely, Courtney; Zhao, Yutong; Zou, Chunbin

    2012-07-26

    To report that Lpcat1 plays an important role in regulating lipopolysaccharide (LPS) inducible gene transcription. Gene expression in Murine Lung Epithelial MLE-12 cells with LPS treatment or Haemophilus influenza and Escherichia coli infection was analyzed by employing quantitative Reverse Transcription Polymerase Chain Reaction techniques. Nucleofection was used to deliver Lenti-viral system to express or knock down Lpcat1 in MLE cells. Subcellular protein fractionation and Western blotting were utilized to study Lpcat1 nuclear relocation. Lpcat1 translocates into the nucleus from the cytoplasm in murine lung epithelia (MLE) after LPS treatment. Haemophilus influenza and Escherichia coli, two LPS-containing pathogens that cause pneumonia, triggered Lpcat1 nuclear translocation from the cytoplasm. The LPS inducible gene expression profile was determined by quantitative reverse transcription polymerase chain reaction after silencing Lpcat1 or overexpression of the enzyme in MLE cells. We detected that 17 out of a total 38 screened genes were upregulated, 14 genes were suppressed, and 7 genes remained unchanged in LPS treated cells in comparison to controls. Knockdown of Lpcat1 by shRNA dramatically changed the spectrum of the LPS inducible gene transcription, as 18 genes out of 38 genes were upregulated, of which 20 genes were suppressed or unchanged. Notably, in Lpcat1 overexpressed cells, 25 genes out of 38 genes were reduced in the setting of LPS treatment. These observations suggest that Lpcat1 relocates into the nucleus in response to bacterial infection to differentially regulate gene transcriptional repression.

  17. Hormonal regulation of gluconeogenic gene transcription in the liver

    Indian Academy of Sciences (India)

    Prakash

    PEPCK) and glucose-6-phosphatase. (G6Pase), respectively. PEPCK gene expression is increased not only in diabetes but also in hyperthyroidism and in various nutritional states such as high protein diets and fasting (Hanson and Reshef 1997).

  18. LncRNAs: emerging players in gene regulation and disease ...

    Indian Academy of Sciences (India)

    that some of the ribosome-associated lncRNAs modulate the translation of protein-coding genes (Yoon et al. 2012). Genomic and cellular location of lncRNAs. LncRNAs can be located in either DNA strands or in both. (Wang et al. 2011a). Based on genomic distribution with respect to protein-coding genes, lncRNAs can be ...

  19. The rules of gene expression in plants: Organ identity and gene body methylation are key factors for regulation of gene expression in Arabidopsis thaliana

    Directory of Open Access Journals (Sweden)

    Gutiérrez Rodrigo A

    2008-09-01

    Full Text Available Abstract Background Microarray technology is a widely used approach for monitoring genome-wide gene expression. For Arabidopsis, there are over 1,800 microarray hybridizations representing many different experimental conditions on Affymetrix™ ATH1 gene chips alone. This huge amount of data offers a unique opportunity to infer the principles that govern the regulation of gene expression in plants. Results We used bioinformatics methods to analyze publicly available data obtained using the ATH1 chip from Affymetrix. A total of 1887 ATH1 hybridizations were normalized and filtered to eliminate low-quality hybridizations. We classified and compared control and treatment hybridizations and determined differential gene expression. The largest differences in gene expression were observed when comparing samples obtained from different organs. On average, ten-fold more genes were differentially expressed between organs as compared to any other experimental variable. We defined "gene responsiveness" as the number of comparisons in which a gene changed its expression significantly. We defined genes with the highest and lowest responsiveness levels as hypervariable and housekeeping genes, respectively. Remarkably, housekeeping genes were best distinguished from hypervariable genes by differences in methylation status in their transcribed regions. Moreover, methylation in the transcribed region was inversely correlated (R2 = 0.8 with gene responsiveness on a genome-wide scale. We provide an example of this negative relationship using genes encoding TCA cycle enzymes, by contrasting their regulatory responsiveness to nitrate and methylation status in their transcribed regions. Conclusion Our results indicate that the Arabidopsis transcriptome is largely established during development and is comparatively stable when faced with external perturbations. We suggest a novel functional role for DNA methylation in the transcribed region as a key determinant

  20. Autism and increased paternal age related changes in global levels of gene expression regulation.

    Directory of Open Access Journals (Sweden)

    Mark D Alter

    2011-02-01

    Full Text Available A causal role of mutations in multiple general transcription factors in neurodevelopmental disorders including autism suggested that alterations in global levels of gene expression regulation might also relate to disease risk in sporadic cases of autism. This premise can be tested by evaluating for changes in the overall distribution of gene expression levels. For instance, in mice, variability in hippocampal-dependent behaviors was associated with variability in the pattern of the overall distribution of gene expression levels, as assessed by variance in the distribution of gene expression levels in the hippocampus. We hypothesized that a similar change in variance might be found in children with autism. Gene expression microarrays covering greater than 47,000 unique RNA transcripts were done on RNA from peripheral blood lymphocytes (PBL of children with autism (n = 82 and controls (n = 64. Variance in the distribution of gene expression levels from each microarray was compared between groups of children. Also tested was whether a risk factor for autism, increased paternal age, was associated with variance. A decrease in the variance in the distribution of gene expression levels in PBL was associated with the diagnosis of autism and a risk factor for autism, increased paternal age. Traditional approaches to microarray analysis of gene expression suggested a possible mechanism for decreased variance in gene expression. Gene expression pathways involved in transcriptional regulation were down-regulated in the blood of children with autism and children of older fathers. Thus, results from global and gene specific approaches to studying microarray data were complimentary and supported the hypothesis that alterations at the global level of gene expression regulation are related to autism and increased paternal age. Global regulation of transcription, thus, represents a possible point of convergence for multiple etiologies of autism and other

  1. Stripy Ftz target genes are coordinately regulated by Ftz-F1.

    Science.gov (United States)

    Hou, Hui Ying; Heffer, Alison; Anderson, W Ray; Liu, Jingnan; Bowler, Timothy; Pick, Leslie

    2009-11-15

    During development, cascades of regulatory genes act in a hierarchical fashion to subdivide the embryo into increasingly specified body regions. This has been best characterized in Drosophila, where genes encoding regulatory transcription factors form a network to direct the development of the basic segmented body plan. The pair-rule genes are pivotal in this process as they are responsible for the first subdivision of the embryo into repeated metameric units. The Drosophila pair-rule gene fushi tarazu (ftz) is a derived Hox gene expressed in and required for the development of alternate parasegments. Previous studies suggested that Ftz achieves its distinct regulatory specificity as a segmentation protein by interacting with a ubiquitously expressed cofactor, the nuclear receptor Ftz-F1. However, the downstream target genes regulated by Ftz and other pair-rule genes to direct segment formation are not known. In this study, we selected candidate Ftz targets by virtue of their early expression in Ftz-like stripes. This identified two new Ftz target genes, drumstick (drm) and no ocelli (noc), and confirmed that Ftz regulates a serotonin receptor (5-HT2). These are the earliest Ftz targets identified to date and all are coordinately regulated by Ftz-F1. Engrailed (En), the best-characterized Ftz/Ftz-F1 downstream target, is not an intermediate in regulation. The drm genomic region harbors two separate seven-stripe enhancers, identified by virtue of predicted Ftz-F1 binding sites, and these sites are necessary for stripe expression in vivo. We propose that pair-rule genes, exemplified by Ftz/Ftz-F1, promote segmentation by acting at different hierarchical levels, regulating first, other segmentation genes; second, other regulatory genes that in turn control specific cellular processes such as tissue differentiation; and, third, 'segmentation realizator genes' that are directly involved in morphogenesis.

  2. Transcriptional similarity in couples reveals the impact of shared environment and lifestyle on gene regulation through modified cytosines

    Directory of Open Access Journals (Sweden)

    Ke Tang

    2016-06-01

    Full Text Available Gene expression is a complex and quantitative trait that is influenced by both genetic and non-genetic regulators including environmental factors. Evaluating the contribution of environment to gene expression regulation and identifying which genes are more likely to be influenced by environmental factors are important for understanding human complex traits. We hypothesize that by living together as couples, there can be commonly co-regulated genes that may reflect the shared living environment (e.g., diet, indoor air pollutants, behavioral lifestyle. The lymphoblastoid cell lines (LCLs derived from unrelated couples of African ancestry (YRI, Yoruba people from Ibadan, Nigeria from the International HapMap Project provided a unique model for us to characterize gene expression pattern in couples by comparing gene expression levels between husbands and wives. Strikingly, 778 genes were found to show much smaller variances in couples than random pairs of individuals at a false discovery rate (FDR of 5%. Since genetic variation between unrelated family members in a general population is expected to be the same assuming a random-mating society, non-genetic factors (e.g., epigenetic systems are more likely to be the mediators for the observed transcriptional similarity in couples. We thus evaluated the contribution of modified cytosines to those genes showing transcriptional similarity in couples as well as the relationships these CpG sites with other gene regulatory elements, such as transcription factor binding sites (TFBS. Our findings suggested that transcriptional similarity in couples likely reflected shared common environment partially mediated through cytosine modifications.

  3. Dynamics of chromatin accessibility and gene regulation by MADS-domain transcription factorsin flower development

    NARCIS (Netherlands)

    Pajoro, A.; Madrigal, P.; Muiño, J.M.; Tomas Matus, J.; Jin, J.; Mecchia, M.A.; Debernardi, J.M.; Palatnik, J.F.; Balazadeh, S.; Arif, M.; Ó’Maoiléidigh, D.S.; Wellmer, F.; Krajewski, P.; Riechmann, J.L.; Angenent, G.C.

    2014-01-01

    Background: Development of eukaryotic organisms is controlled by transcription factors that trigger specific and global changes in gene expression programs. In plants, MADS-domain transcription factors act as master regulators of developmental switches and organ specification. However, the

  4. Beijerinck Centennial Microbial Physiology and Gene Regulation : Emerging Principles and Applications

    NARCIS (Netherlands)

    Scheffers, W.A.; Van Dijken, J.P.

    1995-01-01

    Book of abstracts of Beijerinck Centennial Microbial Physiology and Gene Regulation: Emerging Principles and Applications, 10-14 December 1995 The Hague, The Netherlands. Under the auspices of the Netherlands Foundation for Biotechnology.

  5. The von Hippel-Lindau (VHL) tumor-suppressor gene is down-regulated by selenium deficiency in Caco-2 cells and rat colon mucosa

    Science.gov (United States)

    To test the hypothesis that selenium affects DNA methylation and hence gene regulation we employed a methylation array (Panomics) in the human colonic epithelial Caco-2 cell model. The array profiles DNA methylation from promoter regions of 82 human genes. After conditioning cells to repeatedly redu...

  6. A Probabilistic Genome-Wide Gene Reading Frame Sequence Model

    DEFF Research Database (Denmark)

    Have, Christian Theil; Mørk, Søren

    as output. The model can be used to obtain the most probable genome annotation based on a combination of i: a gene finder score of each gene candidate and ii: the sequence of the reading frames of gene candidates through a genome. The model --- as well as a higher order variant --- is developed and tested......We introduce a new type of probabilistic sequence model, that model the sequential composition of reading frames of genes in a genome. Our approach extends gene finders with a model of the sequential composition of genes at the genome-level -- effectively producing a sequential genome annotation...... using the probabilistic logic programming language and machine learning system PRISM - a fast and efficient model prototyping environment, using bacterial gene finding performance as a benchmark of signal strength. The model is used to prune a set of gene predictions from an underlying gene finder...

  7. An RbAp48-like gene regulates adult stem cells in planarians.

    Science.gov (United States)

    Bonuccelli, Lucia; Rossi, Leonardo; Lena, Annalisa; Scarcelli, Vittoria; Rainaldi, Giuseppe; Evangelista, Monica; Iacopetti, Paola; Gremigni, Vittorio; Salvetti, Alessandra

    2010-03-01

    Retinoblastoma-associated proteins 46 and 48 (RbAp46 and RbAp48) are factors that are components of different chromatin-modelling complexes, such as polycomb repressive complex 2, the activity of which is related to epigenetic gene regulation in stem cells. To date, no direct findings are available on the in vivo role of RbAp48 in stem-cell biology. We recently identified DjRbAp48 - a planarian (Dugesia japonica) homologue of human RBAP48 - expression of which is restricted to the neoblasts, the adult stem cells of planarians. In vivo silencing of DjRbAp48 induces lethality and inability to regenerate, even though neoblasts proliferate and accumulate after wounding. Despite a partial reduction in neoblast number, we were always able to detect a significant number of these cells in DjRbAp48 RNAi animals. Parallel to the decrease in neoblasts, a reduction in the number of differentiated cells and the presence of apoptotic-like neoblasts were detectable in RNAi animals. These findings suggest that DjRbAp48 is not involved in neoblast maintenance, but rather in the regulation of differentiation of stem-cell progeny. We discuss our data, taking into account the possibility that DjRbAp48 might control the expression of genes necessary for cell differentiation by influencing chromatin architecture.

  8. Regulation of supply and demand for maternal nutrients in mammals by imprinted genes

    Science.gov (United States)

    Reik, Wolf; Constância, Miguel; Fowden, Abigail; Anderson, Neil; Dean, Wendy; Ferguson-Smith, Anne; Tycko, Benjamin; Sibley, Colin

    2003-01-01

    The placenta has evolved in eutherian mammals primarily to provide nutrients for the developing fetus. The genetic control of the regulation of supply and demand for maternal nutrients is not understood. In this review we argue that imprinted genes have central roles in controlling both the fetal demand for, and the placental supply of, maternal nutrients. Recent studies on Igf2 (insulin-like growth factor 2) knockout mouse models provide experimental support for this hypothesis. These show effects on placental transport capacity consistent with a role of IGF-II in modulating both the placental supply and fetal demand for nutrients. Imprinting of genes with such functions may have coevolved with the placenta and new evidence suggests that transporter proteins, as well as the regulators themselves, may also be imprinted. These data and hypotheses are important, as deregulation of supply and demand affects fetal growth and has long term consequences for health in mammals both in the neonatal period and, as a result of fetal programming, in adulthood. PMID:12562908

  9. Identification of a cis-regulatory element by transient analysis of co-ordinately regulated genes

    Directory of Open Access Journals (Sweden)

    Allan Andrew C

    2008-07-01

    Full Text Available Abstract Background Transcription factors (TFs co-ordinately regulate target genes that are dispersed throughout the genome. This co-ordinate regulation is achieved, in part, through the interaction of transcription factors with conserved cis-regulatory motifs that are in close proximity to the target genes. While much is known about the families of transcription factors that regulate gene expression in plants, there are few well characterised cis-regulatory motifs. In Arabidopsis, over-expression of the MYB transcription factor PAP1 (PRODUCTION OF ANTHOCYANIN PIGMENT 1 leads to transgenic plants with elevated anthocyanin levels due to the co-ordinated up-regulation of genes in the anthocyanin biosynthetic pathway. In addition to the anthocyanin biosynthetic genes, there are a number of un-associated genes that also change in expression level. This may be a direct or indirect consequence of the over-expression of PAP1. Results Oligo array analysis of PAP1 over-expression Arabidopsis plants identified genes co-ordinately up-regulated in response to the elevated expression of this transcription factor. Transient assays on the promoter regions of 33 of these up-regulated genes identified eight promoter fragments that were transactivated by PAP1. Bioinformatic analysis on these promoters revealed a common cis-regulatory motif that we showed is required for PAP1 dependent transactivation. Conclusion Co-ordinated gene regulation by individual transcription factors is a complex collection of both direct and indirect effects. Transient transactivation assays provide a rapid method to identify direct target genes from indirect target genes. Bioinformatic analysis of the promoters of these direct target genes is able to locate motifs that are common to this sub-set of promoters, which is impossible to identify with the larger set of direct and indirect target genes. While this type of analysis does not prove a direct interaction between protein and DNA

  10. Time-dependent regulation analysis dissects shifts between metabolic and gene-expression regulation during nitrogen starvation in baker's yeast

    NARCIS (Netherlands)

    van Eunen, Karen; Bouwman, Jildau; Lindenbergh, Alexander; Westerhoff, Hans V.; Bakker, Barbara M.

    2009-01-01

    Time-dependent regulation analysis is a new methodology that allows us to unravel, both quantitatively and dynamically, how and when functional changes in the cell are brought about by the interplay of gene expression and metabolism. In this first experimental implementation, we dissect the initial

  11. Differential regulation of the period genes in striatal regions following cocaine exposure.

    Science.gov (United States)

    Falcon, Edgardo; Ozburn, Angela; Mukherjee, Shibani; Roybal, Kole; McClung, Colleen A

    2013-01-01

    Several studies have suggested that disruptions in circadian rhythms contribute to the pathophysiology of multiple psychiatric diseases, including drug addiction. In fact, a number of the genes involved in the regulation of circadian rhythms are also involved in modulating the reward value for drugs of abuse, like cocaine. Thus, we wanted to determine the effects of chronic cocaine on the expression of several circadian genes in the Nucleus Accumbens (NAc) and Caudate Putamen (CP), regions of the brain known to be involved in the behavioral responses to drugs of abuse. Moreover, we wanted to explore the mechanism by which these genes are regulated following cocaine exposure. Here we find that after repeated cocaine exposure, expression of the Period (Per) genes and Neuronal PAS Domain Protein 2 (Npas2) are elevated, in a somewhat regionally selective fashion. Moreover, NPAS2 (but not CLOCK (Circadian Locomotor Output Cycles Kaput)) protein binding at Per gene promoters was enhanced following cocaine treatment. Mice lacking a functional Npas2 gene failed to exhibit any induction of Per gene expression after cocaine, suggesting that NPAS2 is necessary for this cocaine-induced regulation. Examination of Per gene and Npas2 expression over twenty-four hours identified changes in diurnal rhythmicity of these genes following chronic cocaine, which were regionally specific. Taken together, these studies point to selective disruptions in Per gene rhythmicity in striatial regions following chronic cocaine treatment, which are mediated primarily by NPAS2.

  12. Differential regulation of the period genes in striatal regions following cocaine exposure.

    Directory of Open Access Journals (Sweden)

    Edgardo Falcon

    Full Text Available Several studies have suggested that disruptions in circadian rhythms contribute to the pathophysiology of multiple psychiatric diseases, including drug addiction. In fact, a number of the genes involved in the regulation of circadian rhythms are also involved in modulating the reward value for drugs of abuse, like cocaine. Thus, we wanted to determine the effects of chronic cocaine on the expression of several circadian genes in the Nucleus Accumbens (NAc and Caudate Putamen (CP, regions of the brain known to be involved in the behavioral responses to drugs of abuse. Moreover, we wanted to explore the mechanism by which these genes are regulated following cocaine exposure. Here we find that after repeated cocaine exposure, expression of the Period (Per genes and Neuronal PAS Domain Protein 2 (Npas2 are elevated, in a somewhat regionally selective fashion. Moreover, NPAS2 (but not CLOCK (Circadian Locomotor Output Cycles Kaput protein binding at Per gene promoters was enhanced following cocaine treatment. Mice lacking a functional Npas2 gene failed to exhibit any induction of Per gene expression after cocaine, suggesting that NPAS2 is necessary for this cocaine-induced regulation. Examination of Per gene and Npas2 expression over twenty-four hours identified changes in diurnal rhythmicity of these genes following chronic cocaine, which were regionally specific. Taken together, these studies point to selective disruptions in Per gene rhythmicity in striatial regions following chronic cocaine treatment, which are mediated primarily by NPAS2.

  13. Diurnal Transcriptome and Gene Network Represented through Sparse Modeling in Brachypodium distachyon

    Directory of Open Access Journals (Sweden)

    Satoru Koda

    2017-11-01

    Full Text Available We report the comprehensive identification of periodic genes and their network inference, based on a gene co-expression analysis and an Auto-Regressive eXogenous (ARX model with a group smoothly clipped absolute deviation (SCAD method using a time-series transcriptome dataset in a model grass, Brachypodium distachyon. To reveal the diurnal changes in the transcriptome in B. distachyon, we performed RNA-seq analysis of its leaves sampled through a diurnal cycle of over 48 h at 4 h intervals using three biological replications, and identified 3,621 periodic genes through our wavelet analysis. The expression data are feasible to infer network sparsity based on ARX models. We found that genes involved in biological processes such as transcriptional regulation, protein degradation, and post-transcriptional modification and photosynthesis are significantly enriched in the periodic genes, suggesting that these processes might be regulated by circadian rhythm in B. distachyon. On the basis of the time-series expression patterns of the periodic genes, we constructed a chronological gene co-expression network and identified putative transcription factors encoding genes that might be involved in the time-specific regulatory transcriptional network. Moreover, we inferred a transcriptional network composed of the periodic genes in B. distachyon, aiming to identify genes associated with other genes through variable selection by grouping time points for each gene. Based on the ARX model with the group SCAD regularization using our time-series expression datasets of the periodic genes, we constructed gene networks and found that the networks represent typical scale-free structure. Our findings demonstrate that the diurnal changes in the transcriptome in B. distachyon leaves have a sparse network structure, demonstrating the spatiotemporal gene regulatory network over the cyclic phase transitions in B. distachyon diurnal growth.

  14. Diurnal Transcriptome and Gene Network Represented through Sparse Modeling inBrachypodium distachyon.

    Science.gov (United States)

    Koda, Satoru; Onda, Yoshihiko; Matsui, Hidetoshi; Takahagi, Kotaro; Yamaguchi-Uehara, Yukiko; Shimizu, Minami; Inoue, Komaki; Yoshida, Takuhiro; Sakurai, Tetsuya; Honda, Hiroshi; Eguchi, Shinto; Nishii, Ryuei; Mochida, Keiichi

    2017-01-01

    We report the comprehensive identification of periodic genes and their network inference, based on a gene co-expression analysis and an Auto-Regressive eXogenous (ARX) model with a group smoothly clipped absolute deviation (SCAD) method using a time-series transcriptome dataset in a model grass, Brachypodium distachyon . To reveal the diurnal changes in the transcriptome in B. distachyon , we performed RNA-seq analysis of its leaves sampled through a diurnal cycle of over 48 h at 4 h intervals using three biological replications, and identified 3,621 periodic genes through our wavelet analysis. The expression data are feasible to infer network sparsity based on ARX models. We found that genes involved in biological processes such as transcriptional regulation, protein degradation, and post-transcriptional modification and photosynthesis are significantly enriched in the periodic genes, suggesting that these processes might be regulated by circadian rhythm in B. distachyon . On the basis of the time-series expression patterns of the periodic genes, we constructed a chronological gene co-expression network and identified putative transcription factors encoding genes that might be involved in the time-specific regulatory transcriptional network. Moreover, we inferred a transcriptional network composed of the periodic genes in B. distachyon , aiming to identify genes associated with other genes through variable selection by grouping time points for each gene. Based on the ARX model with the group SCAD regularization using our time-series expression datasets of the periodic genes, we constructed gene networks and found that the networks represent typical scale-free structure. Our findings demonstrate that the diurnal changes in the transcriptome in B. distachyon leaves have a sparse network structure, demonstrating the spatiotemporal gene regulatory network over the cyclic phase transitions in B. distachyon diurnal growth.

  15. The 5th Symposium on Post-Transcriptional Regulation of Plant Gene Expression (PTRoPGE)

    Energy Technology Data Exchange (ETDEWEB)

    Karen S. Browning; Marie Petrocek; Bonnie Bartel

    2006-06-01

    The 5th Symposium on Post-Transcriptional Regulation of Plant Gene Expression (PTRoPGE) will be held June 8-12, 2005 at the University of Texas at Austin. Exciting new and ongoing discoveries show significant regulation of gene expression occurs after transcription. These post-transcriptional control events in plants range from subtle regulation of transcribed genes and phosphorylation, to the processes of gene regulation through small RNAs. This meeting will focus on the regulatory role of RNA, from transcription, through translation and finally degradation. The cross-disciplinary design of this meeting is necessary to encourage interactions between researchers that have a common interest in post-transcriptional gene expression in plants. By bringing together a diverse group of plant molecular biologist and biochemists at all careers stages from across the world, this meeting will bring about more rapid progress in understanding how plant genomes work and how genes are finely regulated by post-transcriptional processes to ultimately regulate cells.

  16. Protein modelling of triterpene synthase genes from mangrove plants using Phyre2 and Swiss-model

    Science.gov (United States)

    Basyuni, M.; Wati, R.; Sulistiyono, N.; Hayati, R.; Sumardi; Oku, H.; Baba, S.; Sagami, H.

    2018-03-01

    Molecular cloning of five oxidosqualene cyclases (OSC) genes from Bruguiera gymnorrhiza, Kandelia candel, and Rhizophora stylosa had previously been cloned, characterized, and encoded mono and -multi triterpene synthases. The present study analyzed protein modelling of triterpene synthase genes from mangrove using Phyre2 and Swiss-model. The diversity was noted within protein modelling of triterpene synthases using Phyre2 from sequence identity (38-43%) and residue (696-703). RsM2 was distinguishable from others for template structure; it used lanosterol synthase as a template (PDB ID: w6j.1.A). By contrast, other genes used human lanosterol synthase (1w6k.1.A). The predicted bind sites were correlated with the product of triterpene synthase, the product of BgbAS was β-amyrin, while RsM1 contained a significant amount of β-amyrin. Similarly BgLUS and KcMS, both main products was lupeol, on the other hand, RsM2 with the outcome of taraxerol. Homology modelling revealed that 696 residues of BgbAS, BgLUS, RsM1, and RsM2 (91-92% of the amino acid sequence) had been modelled with 100% confidence by the single highest scoring template using Phyre2. This coverage was higher than Swiss-model (85-90%). The present study suggested that molecular cloning of triterpene genes provides useful tools for studying the protein modelling related regulation of isoprenoids biosynthesis in mangrove forests.

  17. Transcriptional regulation of cardiac genes balance pro- and anti-hypertrophic mechanisms in hypertrophic cardiomyopathy

    Directory of Open Access Journals (Sweden)

    Nina Gennebäck

    2012-06-01

    Full Text Available Hypertrophic cardiomyopathy (HCM is characterized by unexplained left ventricular hypertrophy. HCM is often hereditary, but our knowledge of the mechanisms leading from mutation to phenotype is incomplete. The transcriptional expression patterns in the myocar - dium of HCM patients may contribute to understanding the mechanisms that drive and stabilize the hypertrophy. Cardiac myectomies/biopsies from 8 patients with hypertrophic obstructive cardiomyopathy (HOCM and 5 controls were studied with whole genome Illumina microarray gene expression (detecting 18 189 mRNA. When comparing HOCM myocardium to controls, there was significant transcriptional down-regulation of the MYH6, EGR1, APOB and FOS genes, and significant transcriptional up-regulation of the ACE2, JAK2, NPPA (ANP, APOA1 and HDAC5 genes. The transcriptional regulation revealed both pro- and anti-hypertrophic mechanisms. The pro-hypertrophic response was explained by the transcriptional down-regulation of MYH6, indicating that the switch to the fetal gene program is maintained, and the transcriptional up-regulation of JAK2 in the JAK-STAT pathway. The anti-hypertrophic response was seen as a transcriptional down-regulation of the immediate early genes (IEGs, FOS and EGR1, and a transcriptional up-regulation of ACE2 and HDAC5. This can be interpreted as a transcriptional endogenous protection system in the heart of the HOCM patients, neither growing nor suppressing the already hypertrophic myocardium.

  18. Multilevel Regulation of Bacterial Gene Expression with the Combined STAR and Antisense RNA System.

    Science.gov (United States)

    Lee, Young Je; Kim, Soo-Jung; Moon, Tae Seok

    2018-02-16

    Synthetic small RNA regulators have emerged as a versatile tool to predictably control bacterial gene expression. Owing to their simple design principles, small size, and highly orthogonal behavior, these engineered genetic parts have been incorporated into genetic circuits. However, efforts to achieve more sophisticated cellular functions using RNA regulators have been hindered by our limited ability to integrate different RNA regulators into complex circuits. Here, we present a combined RNA regulatory system in Escherichia coli that uses small transcription activating RNA (STAR) and antisense RNA (asRNA) to activate or deactivate target gene expression in a programmable manner. Specifically, we demonstrated that the activated target output by the STAR system can be deactivated by expressing two different types of asRNAs: one binds to and sequesters the STAR regulator, affecting the transcription process, while the other binds to the target mRNA, affecting the translation process. We improved deactivation efficiencies (up to 96%) by optimizing each type of asRNA and then integrating the two optimized asRNAs into a single circuit. Furthermore, we demonstrated that the combined STAR and asRNA system can control gene expression in a reversible way and can regulate expression of a gene in the genome. Lastly, we constructed and simultaneously tested two A AND NOT B logic gates in the same cell to show sophisticated multigene regulation by the combined system. Our approach establishes a methodology for integrating multiple RNA regulators to rationally control multiple genes.

  19. Bioinformatic Prediction of Gene Functions Regulated by Quorum Sensing in the Bioleaching Bacterium Acidithiobacillus ferrooxidans

    Directory of Open Access Journals (Sweden)

    Alvaro Banderas

    2013-08-01

    Full Text Available The biomining bacterium Acidithiobacillus ferrooxidans oxidizes sulfide ores and promotes metal solubilization. The efficiency of this process depends on the attachment of cells to surfaces, a process regulated by quorum sensing (QS cell-to-cell signalling in many Gram-negative bacteria. At. ferrooxidans has a functional QS system and the presence of AHLs enhances its attachment to pyrite. However, direct targets of the QS transcription factor AfeR remain unknown. In this study, a bioinformatic approach was used to infer possible AfeR direct targets based on the particular palindromic features of the AfeR binding site. A set of Hidden Markov Models designed to maintain palindromic regions and vary non-palindromic regions was used to screen for putative binding sites. By annotating the context of each predicted binding site (PBS, we classified them according to their positional coherence relative to other putative genomic structures such as start codons, RNA polymerase promoter elements and intergenic regions. We further used the Multiple EM for Motif Elicitation algorithm (MEME to further filter out low homology PBSs. In summary, 75 target-genes were identified, 34 of which have a higher confidence level. Among the identified genes, we found afeR itself, zwf, genes encoding glycosyltransferase activities, metallo-beta lactamases, and active transport-related proteins. Glycosyltransferases and Zwf (Glucose 6-phosphate-1-dehydrogenase might be directly involved in polysaccharide biosynthesis and attachment to minerals by At. ferrooxidans cells during the bioleaching process.

  20. Co-regulation of a large and rapidly evolving repertoire of odorant receptor genes

    Directory of Open Access Journals (Sweden)

    Lane Robert P

    2007-09-01

    Full Text Available Abstract The olfactory system meets niche- and species-specific demands by an accelerated evolution of its odorant receptor repertoires. In this review, we describe evolutionary processes that have shaped olfactory and vomeronasal receptor gene families in vertebrate genomes. We emphasize three important periods in the evolution of the olfactory system evident by comparative genomics: the adaptation to land in amphibian ancestors, the decline of olfaction in primates, and the delineation of putative pheromone receptors concurrent with rodent speciation. The rapid evolution of odorant receptor genes, the sheer size of the repertoire, as well as their wide distribution in the genome, presents a developmental challenge: how are these ever-changing odorant receptor repertoires coordinated within the olfactory system? A central organizing principle in olfaction is the specialization of sensory neurons resulting from each sensory neuron expressing only ~one odorant receptor allele. In this review, we also discuss this mutually exclusive expression of odorant receptor genes. We have considered several models to account for co-regulation of odorant receptor repertoires, as well as discussed a new hypothesis that invokes important epigenetic properties of the system.

  1. The importance of topoisomerases for chromatin regulated genes

    DEFF Research Database (Denmark)

    Fredsøe, Jacob Christian; Pedersen, Jakob Madsen; Rødgaard, Morten Terpager

    2013-01-01

    DNA topoisomerases are enzymes, which function to relieve torsional stress in the DNA helix by introducing transient breaks into the DNA molecule. By use of Saccharomyces cerevisiae and microarray technology we have previously shown that topoisomerases are required for the activation of chromatin...... topoisomerases for optimal activation, but in contrast to the PHO5 gene, topoisomerases are not required for chromatin remodeling of the GAL1/10 promoter region, indicating a different role of the enzymes. We are currently performing a detailed investigation of the GAL genes to elucidate the precise role...

  2. Major genes regulating total serum immunoglobulin E levels in families with asthma

    NARCIS (Netherlands)

    Postma, DS; Howard, TD; Koppelman, GH; Zheng, SL; Stine, OC; Bleecker, ER; Meyers, DA

    2000-01-01

    Immunoglobulin E (IgE) has a major role in the pathogenesis of allergic disorders and asthma. Previous data from 92 families, each identified through a proband with asthma, showed evidence for two major genes regulating total serum IgE levels. One of these genes mapped to 5q31-33. In the current

  3. Estrogen regulates the expression of cathepsin E-A-like gene via ...

    Indian Academy of Sciences (India)

    徐春林

    by estrogen, and the regulative effect was predominantly mediated via ER-β in chicken liver. Keywords: Estrogen ... the RNA-seq technique to investigate the mechanism of hepatic lipid metabolism (Li et al. 2015). ... To clone the cathepsin E-A-like gene and investigate the effect of estrogen on expression of the gene, a total ...

  4. Honey Bee Aggression Supports a Link Between Gene Regulation and Behavioral Evolution

    Science.gov (United States)

    A prominent theory holds that animal phenotypes arise by evolutionary changes in the regulation of gene expression. Emerging from studies of animal development, evidence for this theory consists largely of differences in temporal or spatial patterns of gene expression that are related to morphologi...

  5. Conservation of the response regulator gene gacA in Pseudomonas species

    NARCIS (Netherlands)

    Souza, J.T.; Mazzola, M.; Raaijmakers, J.M.

    2003-01-01

    The response regulator gene gacA influences the production of several secondary metabolites in both pathogenic and beneficial Pseudomonas spp. In this study, we developed primers and a probe for the gacA gene of Pseudomonas species and sequenced a 425 bp fragment of gacA from ten Pseudomonas strains

  6. Splicing factor SR34b mutation reduces cadmium tolerance in Arabidopsis by regulating iron-regulated transporter 1 gene

    International Nuclear Information System (INIS)

    Zhang, Wentao; Du, Bojing; Liu, Di; Qi, Xiaoting

    2014-01-01

    Highlights: • Arabidopsis splicing factor SR34b gene is cadmium-inducible. • SR34b T-DNA insertion mutant is sensitive to cadmium due to high cadmium uptake. • SR34b is a regulator of cadmium transporter IRT1 at the posttranscription level. • These results highlight the roles of splicing factors in cadmium tolerance of plant. - Abstract: Serine/arginine-rich (SR) proteins are important splicing factors. However, the biological functions of plant SR proteins remain unclear especially in abiotic stresses. Cadmium (Cd) is a non-essential element that negatively affects plant growth and development. In this study, we provided clear evidence for SR gene involved in Cd tolerance in planta. Systemic expression analysis of 17 Arabidopsis SR genes revealed that SR34b is the only SR gene upregulated by Cd, suggesting its potential roles in Arabidopsis Cd tolerance. Consistent with this, a SR34b T-DNA insertion mutant (sr34b) was moderately sensitive to Cd, which had higher Cd 2+ uptake rate and accumulated Cd in greater amounts than wild-type. This was due to the altered expression of iron-regulated transporter 1 (IRT1) gene in sr34b mutant. Under normal growth conditions, IRT1 mRNAs highly accumulated in sr34b mutant, which was a result of increased stability of IRT1 mRNA. Under Cd stress, however, sr34b mutant plants had a splicing defect in IRT1 gene, thus reducing the IRT1 mRNA accumulation. Despite of this, sr34b mutant plants still constitutively expressed IRT1 proteins under Cd stress, thereby resulting in Cd stress-sensitive phenotype. We therefore propose the essential roles of SR34b in posttranscriptional regulation of IRT1 expression and identify it as a regulator of Arabidopsis Cd tolerance

  7. Splicing factor SR34b mutation reduces cadmium tolerance in Arabidopsis by regulating iron-regulated transporter 1 gene

    Energy Technology Data Exchange (ETDEWEB)

    Zhang, Wentao; Du, Bojing; Liu, Di; Qi, Xiaoting, E-mail: qixiaoting@cnu.edu.cn

    2014-12-12

    Highlights: • Arabidopsis splicing factor SR34b gene is cadmium-inducible. • SR34b T-DNA insertion mutant is sensitive to cadmium due to high cadmium uptake. • SR34b is a regulator of cadmium transporter IRT1 at the posttranscription level. • These results highlight the roles of splicing factors in cadmium tolerance of plant. - Abstract: Serine/arginine-rich (SR) proteins are important splicing factors. However, the biological functions of plant SR proteins remain unclear especially in abiotic stresses. Cadmium (Cd) is a non-essential element that negatively affects plant growth and development. In this study, we provided clear evidence for SR gene involved in Cd tolerance in planta. Systemic expression analysis of 17 Arabidopsis SR genes revealed that SR34b is the only SR gene upregulated by Cd, suggesting its potential roles in Arabidopsis Cd tolerance. Consistent with this, a SR34b T-DNA insertion mutant (sr34b) was moderately sensitive to Cd, which had higher Cd{sup 2+} uptake rate and accumulated Cd in greater amounts than wild-type. This was due to the altered expression of iron-regulated transporter 1 (IRT1) gene in sr34b mutant. Under normal growth conditions, IRT1 mRNAs highly accumulated in sr34b mutant, which was a result of increased stability of IRT1 mRNA. Under Cd stress, however, sr34b mutant plants had a splicing defect in IRT1 gene, thus reducing the IRT1 mRNA accumulation. Despite of this, sr34b mutant plants still constitutively expressed IRT1 proteins under Cd stress, thereby resulting in Cd stress-sensitive phenotype. We therefore propose the essential roles of SR34b in posttranscriptional regulation of IRT1 expression and identify it as a regulator of Arabidopsis Cd tolerance.

  8. The vertebrate RCAN gene family: novel insights into evolution, structure and regulation.

    Directory of Open Access Journals (Sweden)

    Eva Serrano-Candelas

    Full Text Available Recently there has been much interest in the Regulators of Calcineurin (RCAN proteins which are important endogenous modulators of the calcineurin-NFATc signalling pathway. They have been shown to have a crucial role in cellular programmes such as the immune response, muscle fibre remodelling and memory, but also in pathological processes such as cardiac hypertrophy and neurodegenerative diseases. In vertebrates, the RCAN family form a functional subfamily of three members RCAN1, RCAN2 and RCAN3 whereas only one RCAN is present in the rest of Eukarya. In addition, RCAN genes have been shown to collocate with RUNX and CLIC genes in ACD clusters (ACD21, ACD6 and ACD1. How the RCAN genes and their clustering in ACDs evolved is still unknown. After analysing RCAN gene family evolution using bioinformatic tools, we propose that the three RCAN vertebrate genes within the ACD clusters, which evolved from single copy genes present in invertebrates and lower eukaryotes, are the result of two rounds of whole genome duplication, followed by a segmental duplication. This evolutionary scenario involves the loss or gain of some RCAN genes during evolution. In addition, we have analysed RCAN gene structure and identified the existence of several characteristic features that can be involved in RCAN evolution and gene expression regulation. These included: several transposable elements, CpG islands in the 5' region of the genes, the existence of antisense transcripts (NAT associated with the three human genes, and considerable evidence for bidirectional promoters that regulate RCAN gene expression. Furthermore, we show that the CpG island associated with the RCAN3 gene promoter is unmethylated and transcriptionally active. All these results provide timely new insights into the molecular mechanisms underlying RCAN function and a more in depth knowledge of this gene family whose members are obvious candidates for the development of future therapies.

  9. Finding candidate genes under positive selection in Non-model species: examples of genes involved in host specialization in pathogens.

    Science.gov (United States)

    Aguileta, G; Lengelle, J; Marthey, S; Chiapello, H; Rodolphe, F; Gendrault, A; Yockteng, R; Vercken, E; Devier, B; Fontaine, M C; Wincker, P; Dossat, C; Cruaud, C; Couloux, A; Giraud, T

    2010-01-01

    Numerous genes in diverse organisms have been shown to be under positive selection, especially genes involved in reproduction, adaptation to contrasting environments, hybrid inviability, and host-pathogen interactions. Looking for genes under positive selection in pathogens has been a priority in efforts to investigate coevolution dynamics and to develop vaccines or drugs. To elucidate the functions involved in host specialization, here we aimed at identifying candidate sequences that could have evolved under positive selection among closely related pathogens specialized on different hosts. For this goal, we sequenced c. 17,000-32,000 ESTs from each of four Microbotryum species, which are fungal pathogens responsible for anther smut disease on host plants in the Caryophyllaceae. Forty-two of the 372 predicted orthologous genes showed significant signal of positive selection, which represents a good number of candidate genes for further investigation. Sequencing 16 of these genes in 9 additional Microbotryum species confirmed that they have indeed been rapidly evolving in the pathogen species specialized on different hosts. The genes showing significant signals of positive selection were putatively involved in nutrient uptake from the host, secondary metabolite synthesis and secretion, respiration under stressful conditions and stress response, hyphal growth and differentiation, and regulation of expression by other genes. Many of these genes had transmembrane domains and may therefore also be involved in pathogen recognition by the host. Our approach thus revealed fruitful and should be feasible for many non-model organisms for which candidate genes for diversifying selection are needed.

  10. Models and mechanisms of energy balance regulation in the young.

    Science.gov (United States)

    Mercer, Julian G

    2008-11-01

    The proportion of the child and adolescent population that is in appropriate energy balance is declining throughout the developed world, and childhood obesity is a particular problem in the UK relative to other northern European countries. Assessment of the underlying causes of obesity, and the different routes to its development, may assist in the definition of successful intervention strategies. The network of peripheral and central (brain) regulatory systems that underlie energy balance and body weight and composition can, for the most part, only be approached experimentally through the study of appropriate laboratory animal models. This problem is particularly acute when the target is overweight and obesity in the young. Some of the mechanisms underlying the development of energy imbalance and specifically the onset of overweight and obesity in the young, and the metabolic health consequences of obesity, can be addressed by examination of experimental rodent models in which mutation of a single gene causes early-onset extreme obesity, genetic susceptibility to obesity is revealed in an obesogenic environment or early-life nutritional experience programmes susceptibility to obesity or metabolic problems in later life. These studies highlight genes that are essential to normal body-weight regulation in rodents and man, the impact of diet and diet-induced obesity on regulatory systems in the young and the potential sensitivity of developing regulatory systems to nutritional experiences in utero and during early life.

  11. Transcriptional regulation of the Drosophila catalase gene by the DRE/DREF system

    OpenAIRE

    Park, So Young; Kim, Young-Shin; Yang, Dong-Jin; Yoo, Mi-Ae

    2004-01-01

    Reactive oxygen species (ROS) cause oxidative stress and aging. The catalase gene is a key component of the cellular antioxidant defense network. However, the molecular mechanisms that regulate catalase gene expression are poorly understood. In this study, we have identified a DNA replication-related element (DRE; 5′-TATCGATA) in the 5′-flanking region of the Drosophila catalase gene. Gel mobility shift assays revealed that a previously identified factor called DREF (DRE- binding factor) bind...

  12. Nup98 regulation of histone methylation promotes normal gene expression and may drive leukemogenesis.

    Science.gov (United States)

    Sump, Bethany; Brickner, Jason H

    2017-11-15

    Nuclear pore proteins (Nups) interact with chromosomes to regulate gene expression and chromatin structure. A new study by Franks and colleagues (pp. 2222-2234) provides new mechanistic insight into the molecular basis by which Nup98 promotes gene activation in normal hematopoietic cells and how that process is altered by translocations to cause excess expression of developmental genes in leukemia. © 2017 Sump and Brickner; Published by Cold Spring Harbor Laboratory Press.

  13. An Effective Tri-Clustering Algorithm Combining Expression Data with Gene Regulation Information

    Directory of Open Access Journals (Sweden)

    Ao Li

    2009-04-01

    Full Text Available Motivation: Bi-clustering algorithms aim to identify sets of genes sharing similar expression patterns across a subset of conditions. However direct interpretation or prediction of gene regulatory mechanisms may be difficult as only gene expression data is used. Information about gene regulators may also be available, most commonly about which transcription factors may bind to the promoter region and thus control the expression level of a gene. Thus a method to integrate gene expression and gene regulation information is desirable for clustering and analyzing. Methods: By incorporating gene regulatory information with gene expression data, we define regulated expression values (REV as indicators of how a gene is regulated by a specific factor. Existing bi-clustering methods are extended to a three dimensional data space by developing a heuristic TRI-Clustering algorithm. An additional approach named Automatic Boundary Searching algorithm (ABS is introduced to automatically determine the boundary threshold. Results: Results based on incorporating ChIP-chip data representing transcription factor-gene interactions show that the algorithms are efficient and robust for detecting tri-clusters. Detailed analysis of the tri-cluster extracted from yeast sporulation REV data shows genes in this cluster exhibited significant differences during the middle and late stages. The implicated regulatory network was then reconstructed for further study of defined regulatory mechanisms. Topological and statistical analysis of this network demonstrated evidence of significant changes of TF activities during the different stages of yeast sporulation, and suggests this approach might be a general way to study regulatory networks undergoing transformations.

  14. Mendelian and non-Mendelian regulation of gene expression in maize.

    Directory of Open Access Journals (Sweden)

    Lin Li

    Full Text Available Transcriptome variation plays an important role in affecting the phenotype of an organism. However, an understanding of the underlying mechanisms regulating transcriptome variation in segregating populations is still largely unknown. We sought to assess and map variation in transcript abundance in maize shoot apices in the intermated B73 × Mo17 recombinant inbred line population. RNA-based sequencing (RNA-seq allowed for the detection and quantification of the transcript abundance derived from 28,603 genes. For a majority of these genes, the population mean, coefficient of variation, and segregation patterns could be predicted by the parental expression levels. Expression quantitative trait loci (eQTL mapping identified 30,774 eQTL including 96 trans-eQTL "hotspots," each of which regulates the expression of a large number of genes. Interestingly, genes regulated by a trans-eQTL hotspot tend to be enriched for a specific function or act in the same genetic pathway. Also, genomic structural variation appeared to contribute to cis-regulation of gene expression. Besides genes showing Mendelian inheritance in the RIL population, we also found genes whose expression level and variation in the progeny could not be predicted based on parental difference, indicating that non-Mendelian factors also contribute to expression variation. Specifically, we found 145 genes that show patterns of expression reminiscent of paramutation such that all the progeny had expression levels similar to one of the two parents. Furthermore, we identified another 210 genes that exhibited unexpected patterns of transcript presence/absence. Many of these genes are likely to be gene fragments resulting from transposition, and the presence/absence of their transcripts could influence expression levels of their ancestral syntenic genes. Overall, our results contribute to the identification of novel expression patterns and broaden the understanding of transcriptional variation in

  15. An International Model for Antibiotics Regulation.

    Science.gov (United States)

    Aguirre, Emilie

    We face a global antibiotics resistance crisis. Antibiotic drugs are rapidly losing their effectiveness, potentially propelling us toward a post-antibiotic world. The largest use of antibiotics in the world is in food-producing animals. Food producers administer these drugs in routine, low doses—the types of doses that are incidentally the most conducive to breeding antibiotic resistance. In general, individual countries have been too slow to act in regulating misuse and overuse of antibiotics in foodproducing animals. This problem will only worsen with the significant projected growth in meat consumption and production expected in emerging economies in the near future. Although individual countries regulating antibiotics can have important effects, one country alone cannot insulate itself entirely from the effects of antibiotic resistance, nor can one country solve the crisis for itself or for the world. The global nature of the food system and the urgency of the problem require immediate global solutions. Adapting a democratic experimentalist approach at the international level can help achieve this goal. Using an international democratic experimentalist framework in conjunction with the World Organization for Animal Health (OIE) would provide for increased systematized data collection and lead to heightened, scientifically informed OIE standards, enforceable by the World Trade Organization (WTO), which could have a significant impact on the reduction of subtherapeutic use of antibiotics internationally. International democratic experimentalism addresses the global intricacy, time sensitivity, context- and culture-specificity, and knowledgeintensiveness of this problem. By encouraging more countries to experiment to solve this problem, the democratic experimentalist model would help develop a larger database of solutions to enable more meaningful cross-country comparisons across a wider range of contexts. This approach maintains democratic governance and

  16. Identification of Plagl1/Zac1 binding sites and target genes establishes its role in the regulation of extracellular matrix genes and the imprinted gene network.

    Science.gov (United States)

    Varrault, Annie; Dantec, Christelle; Le Digarcher, Anne; Chotard, Laëtitia; Bilanges, Benoit; Parrinello, Hugues; Dubois, Emeric; Rialle, Stéphanie; Severac, Dany; Bouschet, Tristan; Journot, Laurent

    2017-10-13

    PLAGL1/ZAC1 undergoes parental genomic imprinting, is paternally expressed, and is a member of the imprinted gene network (IGN). It encodes a zinc finger transcription factor with anti-proliferative activity and is a candidate tumor suppressor gene on 6q24 whose expression is frequently lost in various neoplasms. Conversely, gain of PLAGL1 function is responsible for transient neonatal diabetes mellitus, a rare genetic disease that results from defective pancreas development. In the present work, we showed that Plagl1 up-regulation was not associated with DNA damage-induced cell cycle arrest. It was rather associated with physiological cell cycle exit that occurred with contact inhibition, growth factor withdrawal, or cell differentiation. To gain insights into Plagl1 mechanism of action, we identified Plagl1 target genes by combining chromatin immunoprecipitation and genome-wide transcriptomics in transfected cell lines. Plagl1-elicited gene regulation correlated with multiple binding to the proximal promoter region through a GC-rich motif. Plagl1 target genes included numerous genes involved in signaling, cell adhesion, and extracellular matrix composition, including collagens. Plagl1 targets also included 22% of the 409 genes that make up the IGN. Altogether, this work identified Plagl1 as a transcription factor that coordinated the regulation of a subset of IGN genes and controlled extracellular matrix composition. © The Author(s) 2017. Published by Oxford University Press on behalf of Nucleic Acids Research.

  17. Tight regulation of the intS gene of the KplE1 prophage: a new paradigm for integrase gene regulation.

    Directory of Open Access Journals (Sweden)

    Gaël Panis

    2010-10-01

    Full Text Available Temperate phages have the ability to maintain their genome in their host, a process called lysogeny. For most, passive replication of the phage genome relies on integration into the host's chromosome and becoming a prophage. Prophages remain silent in the absence of stress and replicate passively within their host genome. However, when stressful conditions occur, a prophage excises itself and resumes the viral cycle. Integration and excision of phage genomes are mediated by regulated site-specific recombination catalyzed by tyrosine and serine recombinases. In the KplE1 prophage, site-specific recombination is mediated by the IntS integrase and the TorI recombination directionality factor (RDF. We previously described a sub-family of temperate phages that is characterized by an unusual organization of the recombination module. Consequently, the attL recombination region overlaps with the integrase promoter, and the integrase and RDF genes do not share a common activated promoter upon lytic induction as in the lambda prophage. In this study, we show that the intS gene is tightly regulated by its own product as well as by the TorI RDF protein. In silico analysis revealed that overlap of the attL region with the integrase promoter is widely encountered in prophages present in prokaryotic genomes, suggesting a general occurrence of negatively autoregulated integrase genes. The prediction that these integrase genes are negatively autoregulated was biologically assessed by studying the regulation of several integrase genes from two different Escherichia coli strains. Our results suggest that the majority of tRNA-associated integrase genes in prokaryotic genomes could be autoregulated and that this might be correlated with the recombination efficiency as in KplE1. The consequences of this unprecedented regulation for excessive recombination are discussed.

  18. LCGbase: A Comprehensive Database for Lineage-Based Co-regulated Genes.

    Science.gov (United States)

    Wang, Dapeng; Zhang, Yubin; Fan, Zhonghua; Liu, Guiming; Yu, Jun

    2012-01-01

    Animal genes of different lineages, such as vertebrates and arthropods, are well-organized and blended into dynamic chromosomal structures that represent a primary regulatory mechanism for body development and cellular differentiation. The majority of genes in a genome are actually clustered, which are evolutionarily stable to different extents and biologically meaningful when evaluated among genomes within and across lineages. Until now, many questions concerning gene organization, such as what is the minimal number of genes in a cluster and what is the driving force leading to gene co-regulation, remain to be addressed. Here, we provide a user-friendly database-LCGbase (a comprehensive database for lineage-based co-regulated genes)-hosting information on evolutionary dynamics of gene clustering and ordering within animal kingdoms in two different lineages: vertebrates and arthropods. The database is constructed on a web-based Linux-Apache-MySQL-PHP framework and effective interactive user-inquiry service. Compared to other gene annotation databases with similar purposes, our database has three comprehensible advantages. First, our database is inclusive, including all high-quality genome assemblies of vertebrates and representative arthropod species. Second, it is human-centric since we map all gene clusters from other genomes in an order of lineage-ranks (such as primates, mammals, warm-blooded, and reptiles) onto human genome and start the database from well-defined gene pairs (a minimal cluster where the two adjacent genes are oriented as co-directional, convergent, and divergent pairs) to large gene clusters. Furthermore, users can search for any adjacent genes and their detailed annotations. Third, the database provides flexible parameter definitions, such as the distance of transcription start sites between two adjacent genes, which is extendable to genes that flanking the cluster across species. We also provide useful tools for sequence alignment, gene

  19. Transcriptional Regulation of Apolipoprotein A5 Gene Expression by the Nuclear Receptor ROR alpha

    International Nuclear Information System (INIS)

    Genoux, Annelise; Dehondt, Helene; Helleboid-Chapman, Audrey; Duhem, Christian; Hum, Dean W.; Martin, Genevieve; Pennacchio, Len; Staels, Bart; Fruchart-Najib, Jamila; Fruchart, Jean-Charles

    2004-01-01

    Apolipoprotein A5 has recently been identified as a crucial determinant of plasma triglyceride levels. Our results showed that RORa up-regulates human APOA5 but has no effect on mouse apoa5 promoter. These data suggest an additional important physiological role for RORa in the regulation of genes involved in plasma triglyceride homeostasis in human and probably in the development of atherosclerosis

  20. Jarid1b targets genes regulating development and is involved in neural differentiation

    DEFF Research Database (Denmark)

    Schmitz, Sandra U; Albert, Mareike; Malatesta, Martina

    2011-01-01

    H3K4 methylation is associated with active transcription and in combination with H3K27me3 thought to keep genes regulating development in a poised state. The contribution of enzymes regulating trimethylation of lysine 4 at histone 3 (H3K4me3) levels to embryonic stem cell (ESC) self-renewal and d...

  1. E2Fs regulate the expression of genes involved in differentiation, development, proliferation, and apoptosis

    DEFF Research Database (Denmark)

    Müller, H; Bracken, A P; Vernell, R

    2001-01-01

    The retinoblastoma protein (pRB) and its two relatives, p107 and p130, regulate development and cell proliferation in part by inhibiting the activity of E2F-regulated promoters. We have used high-density oligonucleotide arrays to identify genes in which expression changed in response to activation...

  2. Transcriptional Regulation of Apolipoprotein A5 Gene Expression by the Nuclear Receptor ROR alpha

    Energy Technology Data Exchange (ETDEWEB)

    Genoux, Annelise; Dehondt, Helene; Helleboid-Chapman, Audrey; Duhem, Christian; Hum, Dean W.; Martin, Genevieve; Pennacchio, Len; Staels, Bart; Fruchart-Najib, Jamila; Fruchart, Jean-Charles

    2004-10-01

    Apolipoprotein A5 has recently been identified as a crucial determinant of plasma triglyceride levels. Our results showed that RORa up-regulates human APOA5 but has no effect on mouse apoa5 promoter. These data suggest an additional important physiological role for RORa in the regulation of genes involved in plasma triglyceride homeostasis in human and probably in the development of atherosclerosis

  3. Human nutrigenomics of gene regulation by dietary fatty acids

    NARCIS (Netherlands)

    Afman, L.A.; Muller, M.R.

    2012-01-01

    Nutrigenomics employs high-throughput genomics technologies to unravel how nutrients modulate gene and protein expression and ultimately influence cellular and organism metabolism. The most often-applied genomics technique so far is transcriptomics, which allows quantifying genome-wide changes in

  4. Identification of a novel submergence response gene regulated by ...

    African Journals Online (AJOL)

    Here, we report the identification of a novel submergence response (RS1) gene that is specifically induced in the Sub1A-mediated submergence tolerance response. Under submergence, RS1 was upregulated in M202 (Sub1A) but downregulated in M202 in RNA-seq and microarray assays. Expression analyses of various ...

  5. Genome Binding and Gene Regulation by Stem Cell Transcription Factors

    NARCIS (Netherlands)

    J.H. Brandsma (Johan)

    2016-01-01

    markdownabstractNearly all cells of an individual organism contain the same genome. However, each cell type transcribes a different set of genes due to the presence of different sets of cell type-specific transcription factors. Such transcription factors bind to regulatory regions such as promoters

  6. THE EUROPEAN MODEL OF STATE REGULATION OF TOURISM ACTIVITIES

    OpenAIRE

    О. Davydova

    2013-01-01

    In the article the existing model of state regulation of the development of tourism. Expediency of the European model of state regulation of tourism development in Ukraine. It is noted that the European model of state regulation of tourism activities based on the coordination of marketing activities and the development of cooperation between the public and private sectors. The basic forms of public-private partnerships and the advantages of using cluster model of development of tourism, namel...

  7. Model-based redesign of global transcription regulation

    Science.gov (United States)

    Carrera, Javier; Rodrigo, Guillermo; Jaramillo, Alfonso

    2009-01-01

    Synthetic biology aims to the design or redesign of biological systems. In particular, one possible goal could be the rewiring of the transcription regulation network by exchanging the endogenous promoters. To achieve this objective, we have adapted current methods to the inference of a model based on ordinary differential equations that is able to predict the network response after a major change in its topology. Our procedure utilizes microarray data for training. We have experimentally validated our inferred global regulatory model in Escherichia coli by predicting transcriptomic profiles under new perturbations. We have also tested our methodology in silico by providing accurate predictions of the underlying networks from expression data generated with artificial genomes. In addition, we have shown the predictive power of our methodology by obtaining the gene profile in experimental redesigns of the E. coli genome, where rewiring the transcriptional network by means of knockouts of master regulators or by upregulating transcription factors controlled by different promoters. Our approach is compatible with most network inference methods, allowing to explore computationally future genome-wide redesign experiments in synthetic biology. PMID:19188257

  8. Global profiling of alternative splicing events and gene expression regulated by hnRNPH/F.

    Directory of Open Access Journals (Sweden)

    Erming Wang

    Full Text Available In this study, we have investigated the global impact of heterogeneous nuclear Ribonuclear Protein (hnRNP H/F-mediated regulation of splicing events and gene expression in oligodendrocytes. We have performed a genome-wide transcriptomic analysis at the gene and exon levels in Oli-neu cells treated with siRNA that targets hnRNPH/F compared to untreated cells using Affymetrix Exon Array. Gene expression levels and regulated exons were identified with the GenoSplice EASANA algorithm. Bioinformatics analyses were performed to determine the structural properties of G tracts that correlate with the function of hnRNPH/F as enhancers vs. repressors of exon inclusion. Different types of alternatively spliced events are regulated by hnRNPH/F. Intronic G tracts density, length and proximity to the 5' splice site correlate with the hnRNPH/F enhancer function. Additionally, 6% of genes are differently expressed upon knock down of hnRNPH/F. Genes that regulate the transition of oligodendrocyte progenitor cells to oligodendrocytes are differentially expressed in hnRNPH/F depleted Oli-neu cells, resulting in a decrease of negative regulators and an increase of differentiation-inducing regulators. The changes were confirmed in developing oligodendrocytes in vivo. This is the first genome wide analysis of splicing events and gene expression regulated by hnRNPH/F in oligodendrocytes and the first report that hnRNPH/F regulate genes that are involved in the transition from oligodendrocyte progenitor cells to oligodendrocytes.

  9. Truncating PREX2 mutations activate its GEF activity and alter gene expression regulation in NRAS-mutant melanoma.

    Science.gov (United States)

    Lissanu Deribe, Yonathan; Shi, Yanxia; Rai, Kunal; Nezi, Luigi; Amin, Samir B; Wu, Chia-Chin; Akdemir, Kadir C; Mahdavi, Mozhdeh; Peng, Qian; Chang, Qing Edward; Hornigold, Kirsti; Arold, Stefan T; Welch, Heidi C E; Garraway, Levi A; Chin, Lynda

    2016-03-01

    PREX2 (phosphatidylinositol-3,4,5-triphosphate-dependent Rac-exchange factor 2) is a PTEN (phosphatase and tensin homolog deleted on chromosome 10) binding protein that is significantly mutated in cutaneous melanoma and pancreatic ductal adenocarcinoma. Here, genetic and biochemical analyses were conducted to elucidate the nature and mechanistic basis of PREX2 mutation in melanoma development. By generating an inducible transgenic mouse model we showed an oncogenic role for a truncating PREX2 mutation (PREX2(E824)*) in vivo in the context of mutant NRAS. Using integrative cross-species gene expression analysis, we identified deregulated cell cycle and cytoskeleton organization as significantly perturbed biological pathways in PREX2 mutant tumors. Mechanistically, truncation of PREX2 activated its Rac1 guanine nucleotide exchange factor activity, abolished binding to PTEN and activated the PI3K (phosphatidyl inositol 3 kinase)/Akt signaling pathway. We further showed that PREX2 truncating mutations or PTEN deletion induces down-regulation of the tumor suppressor and cell cycle regulator CDKN1C (also known as p57(KIP2)). This down-regulation occurs, at least partially, through DNA hypomethylation of a differentially methylated region in chromosome 11 that is a known regulatory region for expression of the CDKN1C gene. Together, these findings identify PREX2 as a mediator of NRAS-mutant melanoma development that acts through the PI3K/PTEN/Akt pathway to regulate gene expression of a cell cycle regulator.

  10. Truncating PREX2 mutations activate its GEF activity and alter gene expression regulation in NRAS-mutant melanoma

    KAUST Repository

    Lissanu Deribe, Yonathan

    2016-03-01

    PREX2 (phosphatidylinositol-3,4,5-triphosphate-dependent Rac-exchange factor 2) is a PTEN (phosphatase and tensin homolog deleted on chromosome 10) binding protein that is significantly mutated in cutaneous melanoma and pancreatic ductal adenocarcinoma. Here, genetic and biochemical analyses were conducted to elucidate the nature and mechanistic basis of PREX2 mutation in melanoma development. By generating an inducible transgenic mouse model we showed an oncogenic role for a truncating PREX2 mutation (PREX2E824*) in vivo in the context of mutant NRAS. Using integrative cross-species gene expression analysis, we identified deregulated cell cycle and cytoskeleton organization as significantly perturbed biological pathways in PREX2 mutant tumors. Mechanistically, truncation of PREX2 activated its Rac1 guanine nucleotide exchange factor activity, abolished binding to PTEN and activated the PI3K (phosphatidyl inositol 3 kinase)/Akt signaling pathway. We further showed that PREX2 truncating mutations or PTEN deletion induces down-regulation of the tumor suppressor and cell cycle regulator CDKN1C (also known as p57KIP2). This down-regulation occurs, at least partially, through DNA hypomethylation of a differentially methylated region in chromosome 11 that is a known regulatory region for expression of the CDKN1C gene. Together, these findings identify PREX2 as a mediator of NRAS-mutant melanoma development that acts through the PI3K/PTEN/Akt pathway to regulate gene expression of a cell cycle regulator.

  11. Regulation of gene expression in ovarian cancer cells by luteinizing hormone receptor expression and activation

    International Nuclear Information System (INIS)

    Cui, Juan; Miner, Brooke M; Eldredge, Joanna B; Warrenfeltz, Susanne W; Dam, Phuongan; Xu, Ying; Puett, David

    2011-01-01

    Since a substantial percentage of ovarian cancers express gonadotropin receptors and are responsive to the relatively high concentrations of pituitary gonadotropins during the postmenopausal years, it has been suggested that receptor activation may contribute to the etiology and/or progression of the neoplasm. The goal of the present study was to develop a cell model to determine the impact of luteinizing hormone (LH) receptor (LHR) expression and LH-mediated LHR activation on gene expression and thus obtain insights into the mechanism of gonadotropin action on ovarian surface epithelial (OSE) carcinoma cells. The human ovarian cancer cell line, SKOV-3, was stably transfected to express functional LHR and incubated with LH for various periods of time (0-20 hours). Transcriptomic profiling was performed on these cells to identify LHR expression/activation-dependent changes in gene expression levels and pathways by microarray and qRT-PCR analyses. Through comparative analysis on the LHR-transfected SKOV-3 cells exposed to LH, we observed the differential expression of 1,783 genes in response to LH treatment, among which five significant families were enriched, including those of growth factors, translation regulators, transporters, G-protein coupled receptors, and ligand-dependent nuclear receptors. The most highly induced early and intermediate responses were found to occupy a network impacting transcriptional regulation, cell growth, apoptosis, and multiple signaling transductions, giving indications of LH-induced apoptosis and cell growth inhibition through the significant changes in, for example, tumor necrosis factor, Jun and many others, supportive of the observed cell growth reduction in in vitro assays. However, other observations, e.g. the substantial up-regulation of the genes encoding the endothelin-1 subtype A receptor, stromal cell-derived factor 1, and insulin-like growth factor II, all of which are potential therapeutic targets, may reflect a positive

  12. Bacterial Competition Reveals Differential Regulation of the pks Genes by Bacillus subtilis

    Science.gov (United States)

    Vargas-Bautista, Carol; Rahlwes, Kathryn

    2014-01-01

    Bacillus subtilis is adaptable to many environments in part due to its ability to produce a broad range of bioactive compounds. One such compound, bacillaene, is a linear polyketide/nonribosomal peptide. The pks genes encode the enzymatic megacomplex that synthesizes bacillaene. The majority of pks genes appear to be organized as a giant operon (>74 kb from pksC-pksR). In previous work (P. D. Straight, M. A. Fischbach, C. T. Walsh, D. Z. Rudner, and R. Kolter, Proc. Natl. Acad. Sci. U. S. A. 104:305–310, 2007, doi:10.1073/pnas.0609073103), a deletion of the pks operon in B. subtilis was found to induce prodiginine production by Streptomyces coelicolor. Here, colonies of wild-type B. subtilis formed a spreading population that induced prodiginine production from Streptomyces lividans, suggesting differential regulation of pks genes and, as a result, bacillaene. While the parent colony showed widespread induction of pks expression among cells in the population, we found the spreading cells uniformly and transiently repressed the expression of the pks genes. To identify regulators that control pks genes, we first determined the pattern of pks gene expression in liquid culture. We next identified mutations in regulatory genes that disrupted the wild-type pattern of pks gene expression. We found that expression of the pks genes requires the master regulator of development, Spo0A, through its repression of AbrB and the stationary-phase regulator, CodY. Deletions of degU, comA, and scoC had moderate effects, disrupting the timing and level of pks gene expression. The observed patterns of expression suggest that complex regulation of bacillaene and other antibiotics optimizes competitive fitness for B. subtilis. PMID:24187085

  13. XIAP gene expression and function is regulated by autocrine and paracrine TGF-β signaling

    Directory of Open Access Journals (Sweden)

    Van Themsche Céline

    2010-08-01

    Full Text Available Abstract Background X-linked inhibitor of apoptosis protein (XIAP is often overexpressed in cancer cells, where it plays a key role in survival and also promotes invasiveness. To date however, the extracellular signals and intracellular pathways regulating its expression and activity remain incompletely understood. We have previously showed that exposure to each of the three TGF-β (transforming growth factor beta isoforms upregulates XIAP protein content in endometrial carcinoma cells in vitro. In the present study, we have investigated the clinical relevance of TGF-β isoforms in endometrial tumours and the mechanisms through which TGF-β isoforms regulate XIAP content in uterine cancer cells. Methods TGF-β isoforms immunoreactivity in clinical samples from endometrial tumours was assessed using immunofluorescence. Two model cancer cell lines (KLE endometrial carcinoma cells and HeLa cervical cancer cells and pharmacological inhibitors were used to investigate the signalling pathways regulating XIAP expression and activity in response to autocrine and paracrine TGF-β in cancer cell. Results We have found immunoreactivity for each TGF-β isoform in clinical samples from endometrial tumours, localizing to both stromal and epithelial/cancer cells. Blockade of autocrine TGF-β signaling in KLE endometrial carcinoma cells and HeLa cervical cancer cells reduced endogenous XIAP mRNA and protein levels. In addition, each TGF-β isoform upregulated XIAP gene expression when given exogenously, in a Smad/NF-κB dependent manner. This resulted in increased polyubiquitination of PTEN (phosphatase and tensin homolog on chromosome ten, a newly identified substrate for XIAP E3 ligase activity, and in a XIAP-dependent decrease of PTEN protein levels. Although each TGF-β isoform decreased PTEN content in a XIAP- and a Smad-dependent manner, decrease of PTEN levels in response to only one isoform, TGF-β3, was blocked by PI3-K inhibitor LY294002. Conclusions

  14. Arabidopsis MAP Kinase 4 regulates gene expression via transcription factor release in the nucleus

    DEFF Research Database (Denmark)

    Qiu, Jin-Long; Fiil, Berthe Katrine; Petersen, Klaus

    2008-01-01

    Plant and animal perception of microbes through pathogen surveillance proteins leads to MAP kinase signalling and the expression of defence genes. However, little is known about how plant MAP kinases regulate specific gene expression. We report that, in the absence of pathogens, Arabidopsis MAP...... supported by the suppression of PAD3 expression in mpk4-wrky33 double mutant backgrounds. Our data establish direct links between MPK4 and innate immunity and provide an example of how a plant MAP kinase can regulate gene expression by releasing transcription factors in the nucleus upon activation....

  15. The DAF-7 TGF-β signaling pathway regulates chemosensory receptor gene expression in C. elegans

    OpenAIRE

    Nolan, Katherine M.; Sarafi-Reinach, Trina R.; Horne, Jennifer G.; Saffer, Adam M.; Sengupta, Piali

    2002-01-01

    Regulation of chemoreceptor gene expression in response to environmental or developmental cues provides a mechanism by which animals can alter their sensory responses. Here we demonstrate a role for the daf-7 TGF-β pathway in the regulation of expression of a subset of chemoreceptor genes in Caenorhabditis elegans. We describe a novel role of this pathway in maintaining receptor gene expression in the adult and show that the DAF-4 type II TGF-β receptor functions cell-autonomously to modulate...

  16. Identification of a novel submergence response gene regulated by ...

    African Journals Online (AJOL)

    Tuoyo Aghomotsegin

    2016-12-07

    -regulation of RS1 in M202(Sub1A)×Kitaake lead to weaken submergence tolerance. We hypothesize that RS1 may ..... Each data point represents the mean±SD of 3 independent biological replicates. The student's t-test was ...

  17. Unsaturated fatty acid: Metabolism, synthesis and gene regulation ...

    African Journals Online (AJOL)

    In both plants and animals, unsaturated fatty acids are considered to be essential membrane components. Also they play key roles in many cellular events. The synthesis and metabolism of unsaturated fatty acid are very complex processes, involving a variety of enzymes and regulated pathways. Most recently, research has ...

  18. Mechanisms for the environmental regulation of gene expression ...

    Indian Academy of Sciences (India)

    Unknown

    The environment can play a significant role in the production of phenotypes. However, the ... phenotype production by the environment should be considered a normal component of development and devel- opmental biology. .... Hormonal regulation mediates the environmentally controlled pigmentation of Araschnia. In the.

  19. Hormonal regulation of gluconeogenic gene transcription in the liver

    Indian Academy of Sciences (India)

    Glucose homeostasis in mammals is achieved by the actions of counterregulatory hormones, namely insulin, glucagon and glucocorticoids. Glucose levels in the circulation are regulated by the liver, the metabolic centre which produces glucose when it is scarce in the blood. This process is catalysed by two rate-limiting ...

  20. The Self-Regulated Learning Model and Music Education

    OpenAIRE

    Maja Marijan

    2017-01-01

    Self-regulation and self-regulated learning (SRL) are important features in music education. In this research self-regulated learning model is presented as a complex, multidimensional structure. SRL starts with the self-regulation. Self-regulation is formed through interaction with the environment, thus self-learning, self-analysis, self-judgment, self-instruction, and self-monitoring are the main functions in self-regulatory structure. Co-regulation is needed, and helps self-regulation to be...

  1. An empirical Bayes model for gene expression and methylation profiles in antiestrogen resistant breast cancer

    Directory of Open Access Journals (Sweden)

    Huang Tim

    2010-11-01

    Full Text Available Abstract Background The nuclear transcription factor estrogen receptor alpha (ER-alpha is the target of several antiestrogen therapeutic agents for breast cancer. However, many ER-alpha positive patients do not respond to these treatments from the beginning, or stop responding after being treated for a period of time. Because of the association of gene transcription alteration and drug resistance and the emerging evidence on the role of DNA methylation on transcription regulation, understanding of these relationships can facilitate development of approaches to re-sensitize breast cancer cells to treatment by restoring DNA methylation patterns. Methods We constructed a hierarchical empirical Bayes model to investigate the simultaneous change of gene expression and promoter DNA methylation profiles among wild type (WT and OHT/ICI resistant MCF7 breast cancer cell lines. Results We found that compared with the WT cell lines, almost all of the genes in OHT or ICI resistant cell lines either do not show methylation change or hypomethylated. Moreover, the correlations between gene expression and methylation are quite heterogeneous across genes, suggesting the involvement of other factors in regulating transcription. Analysis of our results in combination with H3K4me2 data on OHT resistant cell lines suggests a clear interplay between DNA methylation and H3K4me2 in the regulation of gene expression. For hypomethylated genes with alteration of gene expression, most (~80% are up-regulated, consistent with current view on the relationship between promoter methylation and gene expression. Conclusions We developed an empirical Bayes model to study the association between DNA methylation in the promoter region and gene expression. Our approach generates both global (across all genes and local (individual gene views of the interplay. It provides important insight on future effort to develop therapeutic agent to re-sensitize breast cancer cells to treatment.

  2. An empirical Bayes model for gene expression and methylation profiles in antiestrogen resistant breast cancer.

    Science.gov (United States)

    Jeong, Jaesik; Li, Lang; Liu, Yunlong; Nephew, Kenneth P; Huang, Tim Hui-Ming; Shen, Changyu

    2010-11-25

    The nuclear transcription factor estrogen receptor alpha (ER-alpha) is the target of several antiestrogen therapeutic agents for breast cancer. However, many ER-alpha positive patients do not respond to these treatments from the beginning, or stop responding after being treated for a period of time. Because of the association of gene transcription alteration and drug resistance and the emerging evidence on the role of DNA methylation on transcription regulation, understanding of these relationships can facilitate development of approaches to re-sensitize breast cancer cells to treatment by restoring DNA methylation patterns. We constructed a hierarchical empirical Bayes model to investigate the simultaneous change of gene expression and promoter DNA methylation profiles among wild type (WT) and OHT/ICI resistant MCF7 breast cancer cell lines. We found that compared with the WT cell lines, almost all of the genes in OHT or ICI resistant cell lines either do not show methylation change or hypomethylated. Moreover, the correlations between gene expression and methylation are quite heterogeneous across genes, suggesting the involvement of other factors in regulating transcription. Analysis of our results in combination with H3K4me2 data on OHT resistant cell lines suggests a clear interplay between DNA methylation and H3K4me2 in the regulation of gene expression. For hypomethylated genes with alteration of gene expression, most (~80%) are up-regulated, consistent with current view on the relationship between promoter methylation and gene expression. We developed an empirical Bayes model to study the association between DNA methylation in the promoter region and gene expression. Our approach generates both global (across all genes) and local (individual gene) views of the interplay. It provides important insight on future effort to develop therapeutic agent to re-sensitize breast cancer cells to treatment.

  3. Intramacrophage Mycobacterium tuberculosis efflux pump gene regulation after rifampicin and verapamil exposure.

    Science.gov (United States)

    Canezin, Pedro Henrique; Caleffi-Ferracioli, Katiany Rizzieri; Scodro, Regiane Bertin de Lima; Siqueira, Vera Lúcia Dias; Pavan, Fernando Rogério; Barros, Isabella Letícia Esteves; Cardoso, Rosilene Fressatti

    2018-03-22

    Since resistance of Mycobacterium tuberculosis (Mtb) partially derives from efflux pumps (EPs) in the plasma membrane, the current study evaluates EPs in Mtb exposed to rifampicin in the presence of the EP inhibitor verapamil, within a macrophage environment. Human acute monocytic leukaemia cell line THP-1 was infected with Mtb H37Rv and exposed to rifampicin and verapamil alone and in combination for 24 and 72 h. After RNA extraction, quantitative PCR was carried out for 11 EP genes using SYBR green PCR master mix in the StepOne™ Real-Time PCR System. After 24 h of exposure to rifampicin, Mtb H37Rv showed that 10 EP genes were up-regulated when compared with the control. The rifampicin/verapamil combination induced down-regulation of 54.5% (6/11) of the EP genes. At 72 h, rifampicin exposure induced up-regulation of 10 EP genes and rifampicin/verapamil induced down-regulation of 8 EP genes, which suggests effective EP-inhibitory activity of verapamil against Mtb H37Rv in an intramacrophage environment. The current study demonstrated that rifampicin/verapamil caused down-regulation of several EP genes in Mtb inside the macrophage environment. In vivo trials may show that rifampicin/verapamil therapy could be of value in enhancing anti-TB treatment.

  4. Hormonal regulation of platypus Beta-lactoglobulin and monotreme lactation protein genes.

    Science.gov (United States)

    Enjapoori, Ashwantha Kumar; Lefèvre, Christophe M; Nicholas, Kevin R; Sharp, Julie A

    2017-02-01

    Endocrine regulation of milk protein gene expression in marsupials and eutherians is well studied. However, the evolution of this complex regulation that began with monotremes is unknown. Monotremes represent the oldest lineage of extant mammals and the endocrine regulation of lactation in these mammals has not been investigated. Here we characterised the proximal promoter and hormonal regulation of two platypus milk protein genes, Beta-lactoglobulin (BLG), a whey protein and monotreme lactation protein (MLP), a monotreme specific milk protein, using in vitro reporter assays and a bovine mammary epithelial cell line (BME-UV1). Insulin and dexamethasone alone provided partial induction of MLP, while the combination of insulin, dexamethasone and prolactin was required for maximal induction. Partial induction of BLG was achieved by insulin, dexamethasone and prolactin alone, with maximal induction using all three hormones. Platypus MLP and BLG core promoter regions comprised transcription factor binding sites (e.g. STAT5, NF-1 and C/EBPα) that were conserved in marsupial and eutherian lineages that regulate caseins and whey protein gene expression. Our analysis suggests that insulin, dexamethasone and/or prolactin alone can regulate the platypus MLP and BLG gene expression, unlike those of therian lineage. The induction of platypus milk protein genes by lactogenic hormones suggests they originated before the divergence of marsupial and eutherians. Copyright © 2015 Elsevier Inc. All rights reserved.

  5. Inter-chromosomal gene regulation in the mammalian cell nucleus.

    Science.gov (United States)

    de Laat, Wouter; Grosveld, Frank

    2007-10-01

    Cellular phenotypes can critically rely on mono-allelic gene expression. Recent studies suggest that in mammalian cells inter-chromosomal DNA interactions may mediate the decision which allele to activate and which to silence. Here, these findings are discussed in the context of knowledge on gene competition, chromatin dynamics, and nuclear organization. We argue that data obtained by 4C technology strongly support the idea that chromatin folds according to self-organizing principles. In this concept, the nuclear positioning of a given locus is probabilistic as it also depends on the properties of neighbouring DNA segments and, by extrapolation, the whole chromosome. The linear distribution of repetitive DNA sequences and of active and inactive DNA regions is important for the folding and relative positioning of chromosomes. This stochastic concept of nuclear organization predicts that tissue-specific interactions between two selected loci present on different chromosomes will be rare.

  6. An alternative pathway for gene regulation by Myc

    DEFF Research Database (Denmark)

    Peukert, K; Staller, P; Schneider, A

    1997-01-01

    The c-Myc protein activates transcription as part of a heteromeric complex with Max. However, Myc-transformed cells are characterized by loss of expression of several genes, suggesting that Myc may also repress gene expression. Two-hybrid cloning identifies a novel POZ domain Zn finger protein (Miz......-1; Myc-interacting Zn finger protein-1) that specifically interacts with Myc, but not with Max or USF. Miz-1 binds to start sites of the adenovirus major late and cyclin D1 promoters and activates transcription from both promoters. Miz-1 has a potent growth arrest function. Binding of Myc to Miz-1...... requires the helix-loop-helix domain of Myc and a short amphipathic helix located in the carboxy-terminus of Miz-1. Expression of Myc inhibits transactivation, overcomes Miz-1-induced growth arrest and renders Miz-1 insoluble in vivo. These processes depend on Myc and Miz-1 association and on the integrity...

  7. Uncovering transcriptional regulation of glycerol metabolism in Aspergilli through genome-wide gene expression data anlysis

    DEFF Research Database (Denmark)

    Salazar, Margarita Pena; Vongsangnak, Wanwipa; Panagiotou, Gianni

    2009-01-01

    Glycerol is catabolized by a wide range of microorganisms including Aspergillus species. To identify the transcriptional regulation of glycerol metabolism in Aspergillus, we analyzed data from triplicate batch fermentations of three different Aspergilli (Aspergillus nidulans, Aspergillus oryzae...... and Aspergillus niger) with glucose and glycerol as carbon sources. Protein comparisons and cross-analysis with gene expression data of all three species resulted in the identification of 88 genes having a conserved response across the three Aspergilli. A promoter analysis of the up-regulated genes led....... niger. Our transcriptome analysis indicated that genes involved in ethanol, glycerol, fatty acid, amino acids and formate utilization are putatively regulated by Adr1 in Aspergilli as in Saccharomyces cerevisiae and this transcription factor therefore is likely to be cross-species conserved among...

  8. Transcriptional regulation of the prolactin gene in turkeys

    OpenAIRE

    Kurima, Kiyoto

    1996-01-01

    Poor reproductive performance by turkey hens compared with chickens is partially due to the early cessation of egg production associated with the onset of incubation behavior. Prolactin (Prl) is involved in the induction and maintenance of incubation behavior in birds, and understanding the regulatory mechanism(s) of Prl gene expression will provide fundamental information to manipulate Prl production for better reproductive performance in turkey hens.

  9. Transcriptional regulation of the Kluyveromyces lactis beta-galactosidase gene.

    OpenAIRE

    Lacy, L R; Dickson, R C

    1981-01-01

    We examined the molecular basis for beta-D-galactosidase (EC 3.2.1.23) induction in the yeast Kluyveromyces lactis. The protein synthesis inhibitor anisomycin effectively blocked both protein synthesis and enzyme induction by lactose. Further, hybridization analysis with the cloned beta-galactosidase gene indicated coordinate increases in the concentration of beta-galactosidase messenger ribonucleic acid and enzyme activity. The half-life of beta-galactosidase messenger ribonucleic acid was t...

  10. NF-1 Dependent Gene Regulation in Drosophila Melanogaster

    Science.gov (United States)

    2004-04-01

    subclones used the Stratagene Chameleon kit with a pBSK-specific phosphorylated selection primer (50 pCCGCCACCGCGATGTAGCTCCAATTCGC 30) and mutation -specific...a P-element inserted in the first intron of the Nf1 gene. Both mutations abolish NF1 protein production (The et al., 1997). The k33 wild type...injections. The location of the six point mutations that were generated and successfully introduced into transgenic flies is diagrammed in Figure 1A

  11. Regulation of inflammatory gene expression in PBMCs by immunostimulatory botanicals.

    Directory of Open Access Journals (Sweden)

    Karen L Denzler

    Full Text Available Many hundreds of botanicals are used in complementary and alternative medicine for therapeutic use as antimicrobials and immune stimulators. While there exists many centuries of anecdotal evidence and few clinical studies on the activity and efficacy of these botanicals, limited scientific evidence exists on the ability of these botanicals to modulate the immune and inflammatory responses. Using botanogenomics (or herbogenomics, this study provides novel insight into inflammatory genes which are induced in peripheral blood mononuclear cells following treatment with immunomodulatory botanical extracts. These results may suggest putative genes involved in the physiological responses thought to occur following administration of these botanical extracts. Using extracts from immunostimulatory herbs (Astragalus membranaceus, Sambucus cerulea, Andrographis paniculata and an immunosuppressive herb (Urtica dioica, the data presented supports previous cytokine studies on these herbs as well as identifying additional genes which may be involved in immune cell activation and migration and various inflammatory responses, including wound healing, angiogenesis, and blood pressure modulation. Additionally, we report the presence of lipopolysaccharide in medicinally prepared extracts of these herbs which is theorized to be a natural and active component of the immunostimulatory herbal extracts. The data presented provides a more extensive picture on how these herbs may be mediating their biological effects on the immune and inflammatory responses.

  12. The homeobox gene Hex regulates hepatocyte differentiation from embryonic stem cell-derived endoderm.

    Science.gov (United States)

    Kubo, Atsushi; Kim, Yon Hui; Irion, Stefan; Kasuda, Shogo; Takeuchi, Mitsuaki; Ohashi, Kazuo; Iwano, Masayuki; Dohi, Yoshiko; Saito, Yoshihiko; Snodgrass, Ralph; Keller, Gordon

    2010-02-01

    We investigated the role of the hematopoietically expressed homeobox (Hex) in the differentiation and development of hepatocytes within embryonic stem cell (ESC)-derived embryoid bodies (EBs). Analyses of hepatic endoderm derived from Hex(-/-) EBs revealed a dramatic reduction in the levels of albumin (Alb) and alpha-fetoprotein (Afp) expression. In contrast, stage-specific forced expression of Hex in EBs from wild-type ESCs led to the up-regulation of Alb and Afp expression and secretion of Alb and transferrin. These inductive effects were restricted to c-kit(+) endoderm-enriched EB-derived populations, suggesting that Hex functions at the level of hepatic specification of endoderm in this model. Microarray analysis revealed that Hex regulated the expression of a broad spectrum of hepatocyte-related genes, including fibrinogens, apolipoproteins, and cytochromes. When added to the endoderm-induced EBs, bone morphogenetic protein 4 acted synergistically with Hex in the induction of expression of Alb, Afp, carbamoyl phosphate synthetase, transcription factor 1, and CCAAT/enhancer binding protein alpha. These findings indicate that Hex plays a pivotal role during induction of liver development from endoderm in this in vitro model and suggest that this strategy may provide important insight into the generation of functional hepatocytes from ESCs.

  13. Link between the causative genes of holoprosencephaly: Zic2 directly regulates Tgif1 expression.

    Science.gov (United States)

    Ishiguro, Akira; Hatayama, Minoru; Otsuka, Maky I; Aruga, Jun

    2018-02-01

    One of the causal genes for holoprosencephaly (HPE) is ZIC2 (HPE5). It belongs to the zinc finger protein of the cerebellum (Zic) family of genes that share a C2H2-type zinc finger domain, similar to the GLI family of genes. In order to clarify the role of Zic2 in gene regulation, we searched for its direct target genes using chromatin immunoprecipitation (ChIP). We identified TGIF1 (HPE4), another holoprosencephaly-causative gene in humans. We identified Zic2-binding sites (ZBS) on the 5' flanking region of Tgif1 by in vitro DNA binding assays. ZBS were essential for Zic2-dependent transcriptional activation in reporter gene assays. Zic2 showed a higher affinity to ZBS than GLI-binding sequences. Zic2-binding to the cis-regulatory element near the Tgif1 promoter may be involved in the mechanism underlying forebrain development and incidences of HPE.

  14. Investigation of epigenetic gene regulation in Arabidopsis modulated by gamma radiation

    International Nuclear Information System (INIS)

    Woo, Hye Ryun; Kim, Jae Sung; Lee, Myung Jin; Lee, Dong Joon; Kim, Young Min; Jung, Joon Yong; Han, Wan Keun; Kang, Soo Jin

    2011-12-01

    To investigate epigenetic gene regulation in Arabidopsis modulated by gamma radiation, we examined the changes in DNA methylation and histone modification after gamma radiation and investigated the effects of gamma radiation on epigenetic information and gene expression. We have selected 14 genes with changes in DNA methylation by gamma radiation, analyzed the changes of histone modification in the selected genes to reveal the relationship between DNA methylation and histone modification by gamma radiation. We have also analyzed the effects of gamma radiation on gene expression to investigate the relationship between epigenetic information and gene expression by gamma radiation. The results will be useful to reveal the effects of gamma radiation on DNA methylation, histone modification and gene expression. We anticipate that the information generated in this proposal will help to find out the mechanism underlying the changes in epigenetic information by gamma radiation

  15. JMJD2A attenuation affects cell cycle and tumourigenic inflammatory gene regulation in lipopolysaccharide stimulated neuroectodermal stem cells

    Energy Technology Data Exchange (ETDEWEB)

    Das, Amitabh, E-mail: amitabhdas.kn@gmail.com [Department of Bionanotechnology, Hanyang University, Seoul 133-791 (Korea, Republic of); Chai, Jin Choul, E-mail: jincchai@gmail.com [Department of Molecular and Life Science, Hanyang University, 1271 Sa 3-dong, Ansan 426-791, Gyeonggi-do (Korea, Republic of); Jung, Kyoung Hwa, E-mail: khjung2@gmail.com [Department of Molecular and Life Science, Hanyang University, 1271 Sa 3-dong, Ansan 426-791, Gyeonggi-do (Korea, Republic of); Das, Nando Dulal, E-mail: nando.hu@gmail.com [Clinical Research Centre, Inha University School of Medicine, Incheon 400-711 (Korea, Republic of); Kang, Sung Chul, E-mail: gujiju11@gmail.com [Department of Molecular and Life Science, Hanyang University, 1271 Sa 3-dong, Ansan 426-791, Gyeonggi-do (Korea, Republic of); Lee, Young Seek, E-mail: yslee@hanyang.ac.kr [Department of Molecular and Life Science, Hanyang University, 1271 Sa 3-dong, Ansan 426-791, Gyeonggi-do (Korea, Republic of); Seo, Hyemyung, E-mail: hseo@hanyang.ac.kr [Department of Molecular and Life Science, Hanyang University, 1271 Sa 3-dong, Ansan 426-791, Gyeonggi-do (Korea, Republic of); Chai, Young Gyu, E-mail: ygchai@hanyang.ac.kr [Department of Bionanotechnology, Hanyang University, Seoul 133-791 (Korea, Republic of); Department of Molecular and Life Science, Hanyang University, 1271 Sa 3-dong, Ansan 426-791, Gyeonggi-do (Korea, Republic of)

    2014-11-01

    JMJD2A is a lysine trimethyl-specific histone demethylase that is highly expressed in a variety of tumours. The role of JMJD2A in tumour progression remains unclear. The objectives of this study were to identify JMJD2A-regulated genes and understand the function of JMJD2A in p53-null neuroectodermal stem cells (p53{sup −/−} NE-4Cs). We determined the effect of LPS as a model of inflammation in p53{sup −/−} NE-4Cs and investigated whether the epigenetic modifier JMJD2A alter the expression of tumourigenic inflammatory genes. Global gene expression was measured in JMJD2A knockdown (kd) p53{sup −/−} NE-4Cs and in LPS-stimulated JMJD2A-kd p53{sup −/−} NE-4C cells. JMJD2A attenuation significantly down-regulated genes were Cdca2, Ccnd2, Ccnd1, Crebbp, IL6rα, and Stat3 related with cell cycle, proliferation, and inflammatory-disease responses. Importantly, some tumour-suppressor genes including Dapk3, Timp2 and TFPI were significantly up-regulated but were not affected by silencing of the JMJD2B. Furthermore, we confirmed the attenuation of JMJD2A also down-regulated Cdca2, Ccnd2, Crebbp, and Rest in primary NSCs isolated from the forebrains of E15 embryos of C57/BL6J mice with effective p53 inhibitor pifithrin-α (PFT-α). Transcription factor (TF) motif analysis revealed known binding patterns for CDC5, MYC, and CREB, as well as three novel motifs in JMJD2A-regulated genes. IPA established molecular networks. The molecular network signatures and functional gene-expression profiling data from this study warrants further investigation as an effective therapeutic target, and studies to elucidate the molecular mechanism of JMJD2A-kd-dependent effects in neuroectodermal stem cells should be performed. - Highlights: • Significant up-regulation of epigenetic modifier JMJD2A mRNA upon LPS treatment. • Inhibition of JMJD2A attenuated key inflammatory and tumourigenic genes. • Establishing IPA based functional genomics in JMJD2A-attenuated p53{sup

  16. RNA Binding Proteins Posttranscriptionally Regulate Genes Involved In Oncogenesis

    Science.gov (United States)

    2010-06-01

    lysed in triple- detergent RIPA buffer with protease inhibitor cocktail (Roche, Pleasanton, CA). For nuclear and cytoplasmic fractionation, the NE-PER kit...Posttranscriptional regulation of IL-13 in T cells: role of the RNA-binding protein HuR. The Journal of allergy and clinical immunology 2008, 121(4):853-859...and western blot analysis. Western analysis was performed as described previously.12 For detection of VEGFα and TSP1 from tumors, triple- detergent

  17. Growth hormone regulation of rat liver gene expression assessed by SSH and microarray.

    Science.gov (United States)

    Gardmo, Cissi; Swerdlow, Harold; Mode, Agneta

    2002-04-25

    The sexually dimorphic secretion of growth hormone (GH) that prevails in the rat leads to a sex-differentiated expression of GH target genes, particularly in the liver. We have used subtractive suppressive hybridization (SSH) to search for new target genes induced by the female-characteristic, near continuous, pattern of GH secretion. Microarrays and dot-blot hybridizations were used in an attempt to confirm differential ratios of expression of obtained SSH clones. Out of 173 unique SSH clones, 41 could be verified as differentially expressed. Among these, we identified 17 known genes not previously recognized as differentially regulated by the sex-specific GH pattern. Additional SSH clones may also represent genes subjected to sex-specific GH regulation since only transcripts abundantly expressed could be verified. Optimized analyses, specific for each gene, are required to fully characterize the degree of differential expression.

  18. Antisense long noncoding RNAs regulate var gene activation in the malaria parasite Plasmodium falciparum.

    Science.gov (United States)

    Amit-Avraham, Inbar; Pozner, Guy; Eshar, Shiri; Fastman, Yair; Kolevzon, Netanel; Yavin, Eylon; Dzikowski, Ron

    2015-03-03

    The virulence of Plasmodium falciparum, the causative agent of the deadliest form of human malaria, is attributed to its ability to evade human immunity through antigenic variation. These parasites alternate between expression of variable antigens, encoded by members of a multicopy gene family named var. Immune evasion through antigenic variation depends on tight regulation of var gene expression, ensuring that only a single var gene is expressed at a time while the rest of the family is maintained transcriptionally silent. Understanding how a single gene is chosen for activation is critical for understanding mutually exclusive expression but remains a mystery. Here, we show that antisense long noncoding RNAs (lncRNAs) initiating from var introns are associated with the single active var gene at the time in the cell cycle when the single var upstream promoter is active. We demonstrate that these antisense transcripts are incorporated into chromatin, and that expression of these antisense lncRNAs in trans triggers activation of a silent var gene in a sequence- and dose-dependent manner. On the other hand, interference with these lncRNAs using complement peptide nucleic acid molecules down-regulated the active var gene, erased the epigenetic memory, and induced expression switching. Altogether, our data provide evidence that these antisense lncRNAs play a key role in regulating var gene activation and mutually exclusive expression.

  19. Paralogous Genes as a Tool to Study the Regulation of Gene Expression

    DEFF Research Database (Denmark)

    Hoffmann, Robert D

    their duplicate were found to be under less purifying selection. A gene ontology (GO) term enrichment analysis showed that paralogs with similar expression levels were enriched in GO terms related to macromolecular complexes, whereas paralogs with different expression levels were enriched in terms associated...... new functions, or their gene products are in a dosage balance. Regulatory DNA elements - some of which are conserved across species and hence called conserved non-coding sequences (CNSs) - that control expression of duplicated genes are thus under similar purifying selection. In the present study, I...... have performed in-depth analyses of paralogous genes in Arabidopsis thaliana, their expression profile, their sequence conservation, and their functions, in order to investigate the relationship between gene expression and retention of paralogous genes. Paralogs with lower expression than...

  20. Hypothalamic food intake regulation in a cancer-cachectic mouse model

    OpenAIRE

    Dwarkasing, Jvalini T.; van Dijk, Miriam; Dijk, Francina J.; Boekschoten, Mark V.; Faber, Joyce; Argilès, Josep M.; Laviano, Alessandro; Müller, Michael; Witkamp, Renger F.; van Norren, Klaske

    2013-01-01

    Background Appetite is frequently affected in cancer patients leading to anorexia and consequently insufficient food intake. In this study, we report on hypothalamic gene expression profile of a cancer-cachectic mouse model with increased food intake. In this model, mice bearing C26 tumour have an increased food intake subsequently to the loss of body weight. We hypothesise that in this model, appetite-regulating systems in the hypothalamus, which apparently fail in anorexia, are still able t...

  1. Lineage-specific Evolutionary Histories and Regulation of Major Starch Metabolism Genes during Banana Ripening

    Directory of Open Access Journals (Sweden)

    Cyril Jourda

    2016-12-01

    Full Text Available Starch is the most widespread and abundant storage carbohydrate in plants. It is also a major feature of cultivated bananas as it accumulates to large amounts during banana fruit development before almost complete conversion to soluble sugars during ripening. Little is known about the structure of major gene families involved in banana starch metabolism and their evolution compared to other species. To identify genes involved in banana starch metabolism and investigate their evolutionary history, we analyzed six gene families playing a crucial role in plant starch biosynthesis and degradation: the ADP-glucose pyrophosphorylases (AGPases, starch synthases (SS, starch branching enzymes (SBE, debranching enzymes (DBE, -amylases (AMY and -amylases (BAM. Using comparative genomics and phylogenetic approaches, these genes were classified into families and sub-families and orthology relationships with functional genes in Eudicots and in grasses were identified. In addition to known ancestral duplications shaping starch metabolism gene families, independent evolution in banana and grasses also occurred through lineage-specific whole genome duplications for specific sub-families of AGPases, SS, SBE and BAM genes; and through gene-scale duplications for AMY genes. In particular, banana lineage duplications yielded a set of AGPases, SBE and BAM genes that were highly or specifically expressed in banana fruits. Gene expression analysis highlighted a complex transcriptional reprogramming of starch metabolism genes during ripening of banana fruits. A differential regulation of expression between banana gene duplicates was identified for SBE and BAM genes, suggesting that part of starch metabolism regulation in the fruit evolved in the banana lineage

  2. The Insect Prothoracic Gland as a Model for Steroid Hormone Biosynthesis and Regulation

    Directory of Open Access Journals (Sweden)

    Qiuxiang Ou

    2016-06-01

    Full Text Available Steroid hormones are ancient signaling molecules found in vertebrates and insects alike. Both taxa show intriguing parallels with respect to how steroids function and how their synthesis is regulated. As such, insects are excellent models for studying universal aspects of steroid physiology. Here, we present a comprehensive genomic and genetic analysis of the principal steroid hormone-producing organs in two popular insect models, Drosophila and Bombyx. We identified 173 genes with previously unknown specific expression in steroid-producing cells, 15 of which had critical roles in development. The insect neuropeptide PTTH and its vertebrate counterpart ACTH both regulate steroid production, but molecular targets of these pathways remain poorly characterized. Identification of PTTH-dependent gene sets identified the nuclear receptor HR4 as a highly conserved target in both Drosophila and Bombyx. We consider this study to be a critical step toward understanding how steroid hormone production and release are regulated in all animal models.

  3. Alu Elements as Novel Regulators of Gene Expression in Type 1 Diabetes Susceptibility Genes?

    DEFF Research Database (Denmark)

    Kaur, Simranjeet; Pociot, Flemming

    2015-01-01

    Despite numerous studies implicating Alu repeat elements in various diseases, there is sparse information available with respect to the potential functional and biological roles of the repeat elements in Type 1 diabetes (T1D). Therefore, we performed a genome-wide sequence analysis of T1D candidate...... genes to identify embedded Alu elements within these genes. We observed significant enrichment of Alu elements within the T1D genes (p-value

  4. Global identification of genes regulated by estrogen signaling and demethylation in MCF-7 breast cancer cells

    International Nuclear Information System (INIS)

    Putnik, Milica; Zhao, Chunyan; Gustafsson, Jan-Åke; Dahlman-Wright, Karin

    2012-01-01

    Highlights: ► Estrogen signaling and demethylation can both control gene expression in breast cancers. ► Cross-talk between these mechanisms is investigated in human MCF-7 breast cancer cells. ► 137 genes are influenced by both 17β-estradiol and demethylating agent 5-aza-2′-deoxycytidine. ► A set of genes is identified as targets of both estrogen signaling and demethylation. ► There is no direct molecular interplay of mediators of estrogen and epigenetic signaling. -- Abstract: Estrogen signaling and epigenetic modifications, in particular DNA methylation, are involved in regulation of gene expression in breast cancers. Here we investigated a potential regulatory cross-talk between these two pathways by identifying their common target genes and exploring underlying molecular mechanisms in human MCF-7 breast cancer cells. Gene expression profiling revealed that the expression of approximately 140 genes was influenced by both 17β-estradiol (E2) and a demethylating agent 5-aza-2′-deoxycytidine (DAC). Gene ontology (GO) analysis suggests that these genes are involved in intracellular signaling cascades, regulation of cell proliferation and apoptosis. Based on previously reported association with breast cancer, estrogen signaling and/or DNA methylation, CpG island prediction and GO analysis, we selected six genes (BTG3, FHL2, PMAIP1, BTG2, CDKN1A and TGFB2) for further analysis. Tamoxifen reverses the effect of E2 on the expression of all selected genes, suggesting that they are direct targets of estrogen receptor. Furthermore, DAC treatment reactivates the expression of all selected genes in a dose-dependent manner. Promoter CpG island methylation status analysis revealed that only the promoters of BTG3 and FHL2 genes are methylated, with DAC inducing demethylation, suggesting DNA methylation directs repression of these genes in MCF-7 cells. In a further analysis of the potential interplay between estrogen signaling and DNA methylation, E2 treatment

  5. Profiling of Hepatocellular Carcinoma Cell Cycle Regulating Genes Targeted by Calycosin

    OpenAIRE

    Zhang, Dongqing; Wang, Shufang; Zhu, Liguo; Tian, Yaping; Wang, Haibao; Zhuang, Yuan; Li, Yu; Wang, Deqing

    2013-01-01

    We cocultured calycosin with human hepatocellular carcinoma cell line (BEL-7402) to investigate the effect on cell proliferation. Calycosin can markedly block the cell growth in G1 phase (P < 0.01) on the IC50 concentration. There were seventeen genes involved in cell-cycle regulation showing differentially expressed in treated cells detected by gene chip. Eight genes were upregulated and nine genes were downregulated. Downregulated TFDP-1, CDKN2D, and SPK2 and upregulated CDC2 and CCNB1 migh...

  6. Differential regulation of the foraging gene associated with task behaviors in harvester ants

    Directory of Open Access Journals (Sweden)

    Kleeman Lindsay

    2011-08-01

    Full Text Available Abstract Background The division of labor in social insect colonies involves transitions by workers from one task to another and is critical to the organization and ecological success of colonies. The differential regulation of genetic pathways is likely to be a key mechanism involved in plasticity of social insect task behavior. One of the few pathways implicated in social organization involves the cGMP-activated protein kinase gene, foraging, a gene associated with foraging behavior in social insect species. The association of the foraging gene with behavior is conserved across diverse species, but the observed expression patterns and proposed functions of this gene vary across taxa. We compared the protein sequence of foraging across social insects and explored whether the differential regulation of this gene is associated with task behaviors in the harvester ant, Pogonomyrmex occidentalis. Results Phylogenetic analysis of the coding region of the foraging gene reveals considerable conservation in protein sequence across insects, particularly among hymenopteran species. The absence of amino acid variation in key active and binding sites suggests that differences in behaviors associated with this gene among species may be the result of changes in gene expression rather than gene divergence. Using real time qPCR analyses with a harvester ant ortholog to foraging (Pofor, we found that the brains of harvester ant foragers have a daily fluctuation in expression of foraging with mRNA levels peaking at midday. In contrast, young workers inside the nest have low levels of Pofor mRNA with no evidence of daily fluctuations in expression. As a result, the association of foraging expression with task behavior within a species changes depending on the time of day the individuals are sampled. Conclusions The amino acid protein sequence of foraging is highly conserved across social insects. Differences in foraging behaviors associated with this gene among

  7. A role for the clock period circadian regulator 2 gene in regulating the clock gene network in human oral squamous cell carcinoma cells.

    Science.gov (United States)

    Ao, Yiran; Zhao, Qin; Yang, Kai; Zheng, Gang; Lv, Xiaoqing; Su, Xiaoli

    2018-04-01

    Clock genes are the core of the circadian rhythms in the human body and are important in regulating normal physiological functions. To date, research has indicated that the clock gene, period circadian clock 2 ( PER2 ), is downregulated in numerous types of cancer, and that it is associated with cancer occurrence and progression via the regulation of various downstream cell cycle genes. However, it remains unclear whether the decreased expression of PER2 influences the expression of other clock genes in cancer cells. In the present study, short hairpin RNA interference was used to knockdown PER2 effectively in human oral squamous cell carcinoma SCC15 cells. Quantitative polymerase chain reaction was used to assess the mRNA expression levels of various clock genes and revealed that, following the knockdown of PER2 in SCC15 cells, the mRNA expression levels of PER3 , brain and muscle ARNT-like 1, deleted in esophageal cancer (DEC)1, DEC2 , cryptochrome circadian clock ( CRY )2, timeless circadian clock, retinoic acid receptor-related orphan receptor-alpha and neuronal PAS domain protein 2 were significantly downregulated, while the mRNA expression levels of PER1 and nuclear receptor subfamily 1 group D member 1 were significantly upregulated. In addition, flow cytometric analysis demonstrated that proliferation was enhanced and apoptosis was reduced following PER2 knockdown in SCC15 cells (Pclock genes of the clock gene network in cancer cells. This is of great significance in elucidating the molecular function and tumor suppression mechanism of PER2 .

  8. Mouse ribosomal RNA genes contain multiple differentially regulated variants.

    Directory of Open Access Journals (Sweden)

    Hung Tseng

    2008-03-01

    Full Text Available Previous cytogenetic studies suggest that various rDNA chromosomal loci are not equally active in different cell types. Consistent with this variability, rDNA polymorphism is well documented in human and mouse. However, attempts to identify molecularly rDNA variant types, which are regulated individually (i.e., independent of other rDNA variants and tissue-specifically, have not been successful. We report here the molecular cloning and characterization of seven mouse rDNA variants (v-rDNA. The identification of these v-rDNAs was based on restriction fragment length polymorphisms (RFLPs, which are conserved among individuals and mouse strains. The total copy number of the identified variants is less than 100 and the copy number of each individual variant ranges from 4 to 15. Sequence analysis of the cloned v-rDNA identified variant-specific single nucleotide polymorphisms (SNPs in the transcribed region. These SNPs were used to develop a set of variant-specific PCR assays, which permitted analysis of the v-rDNAs' expression profiles in various tissues. These profiles show that three v-rDNAs are expressed in all tissues (constitutively active, two are expressed in some tissues (selectively active, and two are not expressed (silent. These expression profiles were observed in six individuals from three mouse strains, suggesting the pattern is not randomly determined. Thus, the mouse rDNA array likely consists of genetically distinct variants, and some are regulated tissue-specifically. Our results provide the first molecular evidence for cell-type-specific regulation of a subset of rDNA.

  9. Desmin-regulated lentiviral vectors for skeletal muscle gene transfer.

    Science.gov (United States)

    Talbot, Gillian E; Waddington, Simon N; Bales, Olivia; Tchen, Rose C; Antoniou, Michael N

    2010-03-01

    Lentiviral vectors (LVs) are highly attractive as a gene therapy agent as they are able to stably integrate their genomes in both dividing and nondividing cells and, in principle, provide long-term therapeutic benefit. However, their performance in skeletal muscle in adult animals has, to date, been disappointing. In order to gain clearer insight into their utility in this tissue type, we have conducted an extensive quantitative comparison of constitutive and muscle-specific promoter activities in skeletal muscle and nonmuscle systems following LV delivery in cell lines and neonatal mice. Our data show that LV delivery to hind leg skeletal muscle of neonatal mouse results in long-term transgene expression in adulthood. We find that the human desmin (DES) promoter/enhancer is the first muscle-specific control region to match the activity of the highly active constitutive human cytomegalovirus (hCMV) promoter/enhancer in skeletal muscle within a LV context both in vitro and in vivo. Furthermore, the DES promoter/enhancer provides six- to eightfold greater expression per viral copy than the muscle-specific human muscle creatine kinase (CKM) promoter/enhancer. DES also confers a more reproducible and tissue-specific transgene expression profile compared to CKM and is therefore a highly attractive regulatory element for use in muscle gene therapy vectors.

  10. Regulation of Gene Expression with Double-Stranded Phosphorothioate Oligonucleotides

    Science.gov (United States)

    Bielinska, Anna; Shivdasani, Ramesh A.; Zhang, Liquan; Nabel, Gary J.

    1990-11-01

    Alteration of gene transcription by inhibition of specific transcriptional regulatory proteins is necessary for determining how these factors participate in cellular differentiation. The functions of these proteins can be antagonized by several methods, each with specific limitations. Inhibition of sequence-specific DNA-binding proteins was achieved with double-stranded (ds) phosphorothioate oligonucleotides that contained octamer or kappaB consensus sequences. The phosphorothioate oligonucleotides specifically bound either octamer transcription factor or nuclear factor (NF)-kappaB. The modified oligonucleotides accumulated in cells more effectively than standard ds oligonucleotides and modulated gene expression in a specific manner. Octamer-dependent activation of a reporter plasmid or NF-kappaB-dependent activation of the human immunodeficiency virus (HIV) enhancer was inhibited when the appropriate phosphorothioate oligonucleotide was added to a transiently transfected B cell line. Addition of phosphorothioate oligonucleotides that contained the octamer consensus to Jurkat T leukemia cells inhibited interleukin-2 (IL-2) secretion to a degree similar to that observed with a mutated octamer site in the IL-2 enhancer. The ds phosphorothioate oligonucleotides probably compete for binding of specific transcription factors and may provide anti-viral, immunosuppressive, or other therapeutic effects.

  11. Co-ordinate regulation of lactate metabolism genes in yeast: the role of the lactate permease gene JEN1.

    Science.gov (United States)

    Lodi, T; Fontanesi, F; Guiard, B

    2002-01-01

    In the yeast Saccharomyces cerevisiae, the first step in lactate metabolism is its transport across the plasma membrane, a proton symport process mediated by the product of the gene JEN1. Under aerobic conditions, the expression of JEN1 is regulated by the carbon source: the gene is repressed by glucose and induced by non-fermentable substrates. JEN1 expression is also controlled by oxygen availability, but is unaffected by the absence of haem biosynthesis. JEN1 is negatively regulated by the repressors Mig1p and Mig2p, and requires Cat8p for full derepression. In this report we demonstrate that, in addition to these regulators, the Hap2/3/4/5 complex interacts specifically with a CAAT-box element in the JEN1 promoter, and acts to derepress JEN1 expression. We also provide evidence for transcriptional stimulation of JEN1 by the protein kinase Snf1p. Data are presented which provide a better understanding of the molecular mechanisms implicated in the co-regulation of genes involved in the metabolism of lactate.

  12. Orthologous transcription factors in bacteria have different functions and regulate different genes.

    Directory of Open Access Journals (Sweden)

    Morgan N Price

    2007-09-01

    Full Text Available Transcription factors (TFs form large paralogous gene families and have complex evolutionary histories. Here, we ask whether putative orthologs of TFs, from bidirectional best BLAST hits (BBHs, are evolutionary orthologs with conserved functions. We show that BBHs of TFs from distantly related bacteria are usually not evolutionary orthologs. Furthermore, the false orthologs usually respond to different signals and regulate distinct pathways, while the few BBHs that are evolutionary orthologs do have conserved functions. To test the conservation of regulatory interactions, we analyze expression patterns. We find that regulatory relationships between TFs and their regulated genes are usually not conserved for BBHs in Escherichia coli K12 and Bacillus subtilis. Even in the much more closely related bacteria Vibrio cholerae and Shewanella oneidensis MR-1, predicting regulation from E. coli BBHs has high error rates. Using gene-regulon correlations, we identify genes whose expression pattern differs between E. coli and S. oneidensis. Using literature searches and sequence analysis, we show that these changes in expression patterns reflect changes in gene regulation, even for evolutionary orthologs. We conclude that the evolution of bacterial regulation should be analyzed with phylogenetic trees, rather than BBHs, and that bacterial regulatory networks evolve more rapidly than previously thought.

  13. Key gene regulating cell wall biosynthesis and recalcitrance in Populus, gene Y

    Energy Technology Data Exchange (ETDEWEB)

    Chen, Jay; Engle, Nancy; Gunter, Lee E.; Jawdy, Sara; Tschaplinski, Timothy J.; Tuskan, Gerald A.

    2015-12-08

    This disclosure provides methods and transgenic plants for improved production of renewable biofuels and other plant-derived biomaterials by altering the expression and/or activity of Gene Y, an O-acetyltransferase. This disclosure also provides expression vectors containing a nucleic acid (Gene Y) which encodes the polypeptide of SEQ ID NO: 1 and is operably linked to a heterologous promoter.

  14. Inducible gene expression and environmentally regulated genes in lactic acid bacteria

    NARCIS (Netherlands)

    Kok, Jan

    1996-01-01

    Relatively recently, a number of genes and operons have been identified in lactic acid bacteria that are inducible and respond to environmental factors. Some of these genes/operons had been isolated and analysed because of their importance in the fermentation industry and, consequently, their

  15. Transcriptional regulation of the Hansenula polymorpha GSH2 gene in the response to cadmium ion treatment

    Directory of Open Access Journals (Sweden)

    O. V. Blazhenko

    2014-02-01

    Full Text Available In a previous study we cloned GSH2 gene, encoding γ-glutamylcysteine synthetase (γGCS in the yeast Hansenula рolymorpha. In this study an analysis of molecular organisation of the H. рolymorpha GSH2 gene promoter was conducted and the potential binding sites of Yap1, Skn7, Creb/Atf1, and Cbf1 transcription factors were detected. It was established that full regulation of GSH2 gene expression in the response to cadmium and oxidative stress requires the length of GSH2 promoter to be longer than 450 bp from the start of translation initiation. To study the transcriptional regulation of H. polymorpha GSH2 gene recombinant strain, harbouring­ a reporter system, in which 1.832 kb regulatory region of GSH2 gene was fused to structural and terminatory regions of alcohol oxidase gene, was constructed. It was shown that maximum increase in H. polymorpha GSH2 gene transcription by 33% occurs in the rich medium under four-hour incubation with 1 μM concentration of cadmium ions. In the minimal medium the GSH2 gene expression does not correlate with the increased total cellular glutathione levels under cadmium ion treatment. We assume that the increased content of total cellular glutathione under cadmium stress in the yeast H. polymorpha probably is not controlled on the level of GSH2 gene transcription.

  16. dPORE-miRNA: Polymorphic regulation of microRNA genes

    KAUST Repository

    Schmeier, Sebastian

    2011-02-04

    Background: MicroRNAs (miRNAs) are short non-coding RNA molecules that act as post-transcriptional regulators and affect the regulation of protein-coding genes. Mostly transcribed by PolII, miRNA genes are regulated at the transcriptional level similarly to protein-coding genes. In this study we focus on human miRNAs. These miRNAs are involved in a variety of pathways and can affect many diseases. Our interest is on possible deregulation of the transcription initiation of the miRNA encoding genes, which is facilitated by variations in the genomic sequence of transcriptional control regions (promoters). Methodology: Our aim is to provide an online resource to facilitate the investigation of the potential effects of single nucleotide polymorphisms (SNPs) on miRNA gene regulation. We analyzed SNPs overlapped with predicted transcription factor binding sites (TFBSs) in promoters of miRNA genes. We also accounted for the creation of novel TFBSs due to polymorphisms not present in the reference genome. The resulting changes in the original TFBSs and potential creation of new TFBSs were incorporated into the Dragon Database of Polymorphic Regulation of miRNA genes (dPORE-miRNA). Conclusions: The dPORE-miRNA database enables researchers to explore potential effects of SNPs on the regulation of miRNAs. dPORE-miRNA can be interrogated with regards to: a/miRNAs (their targets, or involvement in diseases, or biological pathways), b/SNPs, or c/transcription factors. dPORE-miRNA can be accessed at http://cbrc.kaust.edu.sa/dpore and http://apps.sanbi.ac.za/dpore/. Its use is free for academic and non-profit users. © 2011 Schmeier et al.

  17. Enhancer-core-promoter specificity separates developmental and housekeeping gene regulation.

    Science.gov (United States)

    Zabidi, Muhammad A; Arnold, Cosmas D; Schernhuber, Katharina; Pagani, Michaela; Rath, Martina; Frank, Olga; Stark, Alexander

    2015-02-26

    Gene transcription in animals involves the assembly of RNA polymerase II at core promoters and its cell-type-specific activation by enhancers that can be located more distally. However, how ubiquitous expression of housekeeping genes is achieved has been less clear. In particular, it is unknown whether ubiquitously active enhancers exist and how developmental and housekeeping gene regulation is separated. An attractive hypothesis is that different core promoters might exhibit an intrinsic specificity to certain enhancers. This is conceivable, as various core promoter sequence elements are differentially distributed between genes of different functions, including elements that are predominantly found at either developmentally regulated or at housekeeping genes. Here we show that thousands of enhancers in Drosophila melanogaster S2 and ovarian somatic cells (OSCs) exhibit a marked specificity to one of two core promoters--one derived from a ubiquitously expressed ribosomal protein gene and another from a developmentally regulated transcription factor--and confirm the existence of these two classes for five additional core promoters from genes with diverse functions. Housekeeping enhancers are active across the two cell types, while developmental enhancers exhibit strong cell-type specificity. Both enhancer classes differ in their genomic distribution, the functions of neighbouring genes, and the core promoter elements of these neighbouring genes. In addition, we identify two transcription factors--Dref and Trl--that bind and activate housekeeping versus developmental enhancers, respectively. Our results provide evidence for a sequence-encoded enhancer-core-promoter specificity that separates developmental and housekeeping gene regulatory programs for thousands of enhancers and their target genes across the entire genome.

  18. Lateral Thinking: How Histone Modifications Regulate Gene Expression.

    Science.gov (United States)

    Lawrence, Moyra; Daujat, Sylvain; Schneider, Robert

    2016-01-01

    The DNA of each cell is wrapped around histone octamers, forming so-called 'nucleosomal core particles'. These histone proteins have tails that project from the nucleosome and many residues in these tails can be post-translationally modified, influencing all DNA-based processes, including chromatin compaction, nucleosome dynamics, and transcription. In contrast to those present in histone tails, modifications in the core regions of the histones had remained largely uncharacterised until recently, when some of these modifications began to be analysed in detail. Overall, recent work has shown that histone core modifications can not only directly regulate transcription, but also influence processes such as DNA repair, replication, stemness, and changes in cell state. In this review, we focus on the most recent developments in our understanding of histone modifications, particularly those on the lateral surface of the nucleosome. This region is in direct contact with the DNA and is formed by the histone cores. We suggest that these lateral surface modifications represent a key insight into chromatin regulation in the cell. Therefore, lateral surface modifications form a key area of interest and a focal point of ongoing study in epigenetics. Copyright © 2015 Elsevier Ltd. All rights reserved.

  19. A compendium of antibiotic-induced transcription profiles reveals broad regulation of Pasteurella multocida virulence genes.

    Science.gov (United States)

    Melnikow, E; Schoenfeld, C; Spehr, V; Warrass, R; Gunkel, N; Duszenko, M; Selzer, P M; Ullrich, H J

    2008-10-15

    The transcriptional responses of Pasteurella multocida to eight antibiotics with known mode of actions (MoAs) and one novel antibiotic compound with an unknown MoA were collected to create a compendium of transcriptional profiles for MoA studies. At minimal inhibitory concentration the three bactericidal compounds enrofloxacin, cefquinome and the novel compound had a minor impact on gene regulation with approximately 1% of the P. multocida genome affected, whilst the bacteriostatic compounds florfenicol, tilmicosin, rifampin, trimethoprim and brodimoprim regulated 20% of the genome. Novobiocin was special in that it regulated 40% of all P. multocida genes. Regulation of target genes was observed for novobiocin, rifampin, florfenicol and tilmicosin and signature genes were identified for most antibiotics. The transcriptional profile induced by the novel compound was unrelated to the compendium profiles suggesting a new MoA. The transcription of many P. multocida virulence factors, particularly genes involved in capsule synthesis and export, LPS synthesis, competence, adherence and iron transport were altered in the presence of antibiotics. Virulence gene transcription was mainly negatively affected, however the opposite effect was also observed in the case of rifampin where the up-regulation of the tad locus involved in tight adherence was seen. Novobiocin and trimethoprim caused a marked reduction in the transcription of capsule genes, which correlated with a concomitant reduction of the capsular layer on the surface of P. multocida. The broad negative impact on virulence gene transcription supports the notion that the therapeutic effect of some antibiotics could be a combination of growth and virulence inhibition.

  20. Identification of genes differentially regulated in rat alveolar bone wound healing by subtractive hybridization.

    Science.gov (United States)

    Ohira, T; Myokai, F; Shiomi, N; Yamashiro, K; Yamamoto, T; Murayama, Y; Arai, H; Nishimura, F; Takashiba, S

    2004-07-01

    Periodontal healing requires the participation of regulatory molecules, cells, and scaffold or matrix. Here, we hypothesized that a certain set of genes is expressed in alveolar bone wound healing. Reciprocal subtraction gave 400 clones from the injured alveolar bone of Wistar rats. Identification of 34 genes and analysis of their expression in injured tissue revealed several clusters of unique gene regulation patterns, including the up-regulation at 1 wk of cytochrome c oxidase regulating electron transfer and energy metabolism, presumably occurring at the site of inflammation; up-regulation at 2.5 wks of pro-alpha-2 type I collagen involving the formation of a connective tissue structure; and up-regulation at 1 and 2 wks and down-regulation at 2.5 and 4 wks of ubiquitin carboxyl-terminal hydrolase l3 involving cell cycle, DNA repair, and stress response. The differential expression of genes may be associated with the processes of inflammation, wound contraction, and formation of a connective tissue structure.

  1. Enhanced green fluorescent protein (egfp) gene expression in Tetraselmis subcordiformis chloroplast with endogenous regulators.

    Science.gov (United States)

    Cui, Yulin; Zhao, Jialin; Hou, Shichang; Qin, Song

    2016-05-01

    On the basis of fundamental genetic transformation technologies, the goal of this study was to optimize Tetraselmis subcordiformis chloroplast transformation through the use of endogenous regulators. The genes rrn16S, rbcL, psbA, and psbC are commonly highly expressed in chloroplasts, and the regulators of these genes are often used in chloroplast transformation. For lack of a known chloroplast genome sequence, the genome-walking method was used here to obtain full sequences of T. subcordiformis endogenous regulators. The resulting regulators, including three promoters, two terminators, and a ribosome combination sequence, were inserted into the previously constructed plasmid pPSC-R, with the egfp gene included as a reporter gene, and five chloroplast expression vectors prepared. These vectors were successfully transformed into T. subcordiformis by particle bombardment and the efficiency of each vector tested by assessing EGFP fluorescence via microscopy. The results showed that these vectors exhibited higher efficiency than the former vector pPSC-G carrying exogenous regulators, and the vector pRFA with Prrn, psbA-5'RE, and TpsbA showed the highest efficiency. This research provides a set of effective endogenous regulators for T. subcordiformis and will facilitate future fundamental studies of this alga.

  2. Candida albicans response regulator gene SSK1 regulates a subset of genes whose functions are associated with cell wall biosynthesis and adaptation to oxidative stress.

    Science.gov (United States)

    Chauhan, Neeraj; Inglis, Diane; Roman, Elvira; Pla, Jesus; Li, Dongmei; Calera, Jose A; Calderone, Richard

    2003-10-01

    Ssk1p of Candida albicans is a putative response regulator protein of the Hog1 two-component signal transduction system. In Saccharomyces cerevisiae, the phosphorylation state of Ssk1p determines whether genes that promote the adaptation of cells to osmotic stress are activated. We have previously shown that C. albicans SSK1 does not complement the ssk1 mutant of S. cerevisiae and that the ssk1 mutant of C. albicans is not sensitive to sorbitol. In this study, we show that the C. albicans ssk1 mutant is sensitive to several oxidants, including hydrogen peroxide, t-butyl hydroperoxide, menadione, and potassium superoxide when each is incorporated in yeast extract-peptone-dextrose (YPD) agar medium. We used DNA microarrays to identify genes whose regulation is affected by the ssk1 mutation. RNA from mutant cells (strain CSSK21) grown in YPD medium for 3 h at 30 degrees C was reverse transcribed and then compared with similarly prepared RNA from wild-type cells (CAF2). We observed seven genes from mutant cells that were consistently up regulated (three-fold or greater compared to CAF2). In S. cerevisiae, three (AHP1, HSP12, and PYC2) of the seven genes that were up regulated provide cells with an adaptation function in response to oxidative stress; another gene (GPH1) is regulated under stress conditions by Hog1p. Three other genes that are up regulated encode a cell surface protein (FLO1), a mannosyl transferase (MNN4-4), and a putative two-component histidine kinase (CHK1) that regulates cell wall biosynthesis in C. albicans. Of the down-regulated genes, ALS1 is a known cell adhesin in C. albicans. Verification of the microarray data was obtained by reverse transcription-PCR for HSP12, AHP1, CHK1, PYC2, GPH1, ALS1, MNN4-4, and FLO1. To further determine the function of Ssk1p in the Hog1p signal transduction pathway in C. albicans, we used Western blot analysis to measure phosphorylation of Hog1p in the ssk1 mutant of C. albicans when grown under either osmotic or

  3. ExsE Is a Negative Regulator for T3SS Gene Expression inVibrio alginolyticus.

    Science.gov (United States)

    Liu, Jinxin; Lu, Shao-Yeh; Orfe, Lisa H; Ren, Chun-Hua; Hu, Chao-Qun; Call, Douglas R; Avillan, Johannetsy J; Zhao, Zhe

    2016-01-01

    Type III secretion systems (T3SSs) contribute to microbial pathogenesis of Vibrio species, but the regulatory mechanisms are complex. We determined if the classic ExsACDE protein-protein regulatory model from Pseudomonas aeruginosa applies to Vibrio alginolyticus . Deletion mutants in V. alginolyticus demonstrated that, as expected, the T3SS is positively regulated by ExsA and ExsC and negatively regulated by ExsD and ExsE. Interestingly, deletion of exsE enhanced the ability of V. alginolyticus to induce host-cell death while cytotoxicity was inhibited by in trans complementation of this gene in a wild-type strain, a result that differs from a similar experiment with Vibrio parahaemolyticus ExsE. We further showed that ExsE is a secreted protein that does not contribute to adhesion to Fathead minnow epithelial cells. An in vitro co-immunoprecipitation assay confirmed that ExsE binds to ExsC to exert negative regulatory effect on T3SS genes. T3SS in V. alginolyticus can be activated in the absence of physical contact with host cells and a separate regulatory pathway appears to contribute to the regulation of ExsA. Consequently, like ExsE from P. aeruginosa , ExsE is a negative regulator for T3SS gene expression in V. alginolyticus . Unlike the V. parahaemolyticus orthologue, however, deletion of exsE from V. alginolyticus enhanced in vitro cytotoxicity.

  4. Control of intestinal promoter activity of the cellular migratory regulator gene ELMO3 by CDX2 and SP1

    DEFF Research Database (Denmark)

    Coskun, Mehmet; Boyd, Mette; Olsen, Jørgen

    2010-01-01

    in the differentiated human intestinal cancer cell line Caco-2 in order to identify CDX2-regulated genes involved in cellular migration. The engulfment and cell motility 3 (ELMO3) gene was identified as a potential CDX2 target gene. ELMO3 is an essential upstream regulator of the GTP-binding protein RAC during cell...

  5. Organization and regulation of the neurotoxin genes in Clostridium botulinum and Clostridium tetani.

    Science.gov (United States)

    Raffestin, Stéphanie; Marvaud, Jean Christophe; Cerrato, Rosario; Dupuy, Bruno; Popoff, Michel R

    2004-04-01

    Botulinum and tetanus neurotoxins are structurally and functionally related 150 kDa proteins that are potent inhibitors of neuroexocytosis. Botulinum neurotoxin associates with non-toxic proteins to form complexes of various sizes. The botulinum neurotoxin and non-toxic protein genes are clustered in a DNA segment called the botulinum locus. This locus is probably located on a mobile or degenerate mobile element, which accounts for the various genomic localizations (chromosome, plasmid, phage) in different Clostridium botulinum types. The botulinum neurotoxin and non-toxic protein genes are organized in two polycistronic operons (ntnh-bont and ha operons) transcribed in opposite orientations. The gene that separates the two operons of the botulinum locus in C. botulinum A encodes a 21 kDa protein BotR/A, which is a positive regulator of the expression of the botulinum locus genes. Similarly, in Clostridium tetani, the gene located immediately upstream of the tetanus toxin gene, encodes a positive regulatory protein, TetR. BotR and TetR are possibly alternative sigma factors related to TxeR and UviA, which regulate C. difficile toxin and C. perfringens bacteriocin production, respectively. TxeR and UviA define a new sub-group of the sigma(70) family of RNA polymerase initiation factors. In addition, the C. botulinum genome contains predicted two-component system genes, some of which are possibly involved in regulation of toxinogenesis.

  6. Expression Regulation of Polycistronic lee3 Genes of Enterohaemorrhagic Escherichia coli.

    Directory of Open Access Journals (Sweden)

    Wei-Sheng W Sun

    Full Text Available Enterohaemorrhagic Escherichia coli O157:H7 (EHEC carries a pathogenic island LEE that is consisted mainly of five polycistronic operons. In the lee3 operon, mpc is the first gene and has been reported to down regulate the type-3 secretion system of EHEC when its gene product is over-expressed. Furthermore, mpc has been suggested to have a regulation function via translation but the mechanism remains unclear. To clarify this hypothesis, we dissected the polycistron and examined the translated products. We conclude that translation of mpc detrimentally governs the translation of the second gene, escV, which in turn affects the translation of the third gene, escN. Then sequentially, escN affects the expression of the downstream genes. Furthermore, we located a critical cis element within the mpc open-reading frame that plays a negative role in the translation-dependent regulation of lee3. Using qRT-PCR, we found that the amount of mpc RNA transcript present in EHEC was relatively limited when compared to any other genes within lee3. Taken together, when the transcription of LEE is activated, expression of mpc is tightly controlled by a restriction of the RNA transcript of mpc, translation of which is then critical for the efficient production of the operon's downstream gene products.

  7. Targeted Epigenetic Remodeling of the Cdk5 Gene in Nucleus Accumbens Regulates Cocaine- and Stress-Evoked Behavior.

    Science.gov (United States)

    Heller, Elizabeth A; Hamilton, Peter J; Burek, Dominika D; Lombroso, Sonia I; Peña, Catherine J; Neve, Rachael L; Nestler, Eric J

    2016-04-27

    sequence variations that underlie this heritability. Gene regulation via epigenetic remodeling is an additional mechanism contributing to the neurobiological basis of drug and stress exposure. In particular, epigenetic regulation of the Cdk5 gene alters responses to cocaine and stress in mouse and rat models. In this study, we used a novel technology, zinc-finger engineered transcription factors, to remodel histone proteins specifically at the Cdk5 gene. We found that this is sufficient to regulate the expression of Cdk5 and results in altered behavioral responses to cocaine and social stress. These data provide compelling evidence of the significance of epigenetic regulation in the neurobiological basis of reward- and stress-related neuropsychiatric disease. Copyright © 2016 the authors 0270-6474/16/364690-08$15.00/0.

  8. Genome-wide identification of HrpL-regulated genes in the necrotrophic phytopathogen Dickeya dadantii 3937.

    Directory of Open Access Journals (Sweden)

    Shihui Yang

    Full Text Available BACKGROUND: Dickeya dadantii is a necrotrophic pathogen causing disease in many plants. Previous studies have demonstrated that the type III secretion system (T3SS of D. dadantii is required for full virulence. HrpL is an alternative sigma factor that binds to the hrp box promoter sequence of T3SS genes to up-regulate their expression. METHODOLOGY/PRINCIPAL FINDINGS: To explore the inventory of HrpL-regulated genes of D. dadantii 3937 (3937, transcriptome profiles of wild-type 3937 and a hrpL mutant grown in a T3SS-inducing medium were examined. Using a cut-off value of 1.5, significant differential expression was observed in sixty-three genes, which are involved in various cellular functions such as type III secretion, chemotaxis, metabolism, regulation, and stress response. A hidden Markov model (HMM was used to predict candidate hrp box binding sites in the intergenic regions of 3937, including the promoter regions of HrpL-regulated genes identified in the microarray assay. In contrast to biotrophic phytopathgens such as Pseudomonas syringae, among the HrpL up-regulated genes in 3937 only those within the T3SS were found to contain a hrp box sequence. Moreover, direct binding of purified HrpL protein to the hrp box was demonstrated for hrp box-containing DNA fragments of hrpA and hrpN using the electrophoretic mobility shift assay (EMSA. In this study, a putative T3SS effector DspA/E was also identified as a HrpL-upregulated gene, and shown to be translocated into plant cells in a T3SS-dependent manner. CONCLUSION/SIGNIFICANCES: We provide the genome-wide study of HrpL-regulated genes in a necrotrophic phytopathogen (D. dadantii 3937 through a combination of transcriptomics and bioinformatics, which led to identification of several effectors. Our study indicates the extent of differences for T3SS effector protein inventory requirements between necrotrophic and biotrophic pathogens, and may allow the development of different strategies for

  9. Eos negatively regulates human γ-globin gene transcription during erythroid differentiation.

    Directory of Open Access Journals (Sweden)

    Hai-Chuan Yu

    Full Text Available BACKGROUND: Human globin gene expression is precisely regulated by a complicated network of transcription factors and chromatin modifying activities during development and erythropoiesis. Eos (Ikaros family zinc finger 4, IKZF4, a member of the zinc finger transcription factor Ikaros family, plays a pivotal role as a repressor of gene expression. The aim of this study was to examine the role of Eos in globin gene regulation. METHODOLOGY/PRINCIPAL FINDINGS: Western blot and quantitative real-time PCR detected a gradual decrease in Eos expression during erythroid differentiation of hemin-induced K562 cells and Epo-induced CD34+ hematopoietic stem/progenitor cells (HPCs. DNA transfection and lentivirus-mediated gene transfer demonstrated that the enforced expression of Eos significantly represses the expression of γ-globin, but not other globin genes, in K562 cells and CD34+ HPCs. Consistent with a direct role of Eos in globin gene regulation, chromatin immunoprecipitaion and dual-luciferase reporter assays identified three discrete sites located in the DNase I hypersensitivity site 3 (HS3 of the β-globin locus control region (LCR, the promoter regions of the Gγ- and Aγ- globin genes, as functional binding sites of Eos protein. A chromosome conformation capture (3C assay indicated that Eos may repress the interaction between the LCR and the γ-globin gene promoter. In addition, erythroid differentiation was inhibited by enforced expression of Eos in K562 cells and CD34+ HPCs. CONCLUSIONS/SIGNIFICANCE: Our results demonstrate that Eos plays an important role in the transcriptional regulation of the γ-globin gene during erythroid differentiation.

  10. MDM2 negatively regulates the human telomerase RNA gene promoter

    Directory of Open Access Journals (Sweden)

    Keith W Nicol

    2005-01-01

    Full Text Available Abstract Background We have previously demonstrated that NF-Y and Sp1 interact with the human telomerase RNA (hTR promoter and play a central role in its regulation. We have also shown that pRB activates the hTR promoter, but the mechanism of pRb directed activation is unknown. It has recently been reported that pRB induces Sp1 activity by relieving inhibition mediated by mdm2. The aim was to investigate possible roles for mdm2 in hTR promoter regulation. Methods Chromatin immunoprecipitation was used to determine binding of mdm2 to the hTR promoter. Transfection and luciferase assays were used to investigate mdm2 repression of the promoter activity and interaction with known transcriptional modulators. Results Here we show using chromatin immunoprecipitation that mdm2 specifically binds the hTR promoter in vivo. Transient co-transfection experiments using an hTR promoter luciferase reporter construct show that hTR promoter activity is inhibited by over-expression of mdm2 in 5637 bladder carcinoma cells (p53 and pRB negative, low mdm2. Titration of mdm2 was able to antagonise activation of hTR promoter activity mediated by pRB or Sp1 over-expression, although in the presence of pRB, mdm2 could not repress promoter activity below basal levels. Using an Sp1 binding site mutation construct we showed that mdm2 repression did not absolutely require Sp1 binding sites in the hTR promoter, suggesting the possibility of pRB/Sp1 independent mechanisms of repression. Finally, we show that NF-Y mediated transactivation of the hTR promoter was also suppressed by mdm2 in a dose-dependent manner. Conclusions These studies suggest that mdm2 may inhibit the hTR promoter by multiple mechanisms. Mdm2 may directly repress activation by both pRB and Sp1, or activation by NF-Y. Furthermore, the ability of mdm2 to interact and interfere with components of the general transcription machinery might partly explain the general repressive effect seen here. Elucidation of

  11. DMPD: Genetic regulation of macrophage priming/activation: the Lsh gene story. [Dynamic Macrophage Pathway CSML Database

    Lifescience Database Archive (English)

    Full Text Available 1757110 Genetic regulation of macrophage priming/activation: the Lsh gene story. Bl... (.svg) (.html) (.csml) Show Genetic regulation of macrophage priming/activation: the Lsh gene story. Pubmed...ID 1757110 Title Genetic regulation of macrophage priming/activation: the Lsh gen

  12. Regulation of early signaling and gene expression in the α-particle and bystander response of IMR-90 human fibroblasts

    Directory of Open Access Journals (Sweden)

    Hei Tom K

    2010-07-01

    Full Text Available Abstract Background The existence of a radiation bystander effect, in which non-irradiated cells respond to signals from irradiated cells, is well established. To understand early signaling and gene regulation in bystander cells, we used a bio-informatics approach, measuring global gene expression at 30 minutes and signaling pathways between 30 minutes and 4 hours after exposure to α-particles in IMR-90 fibroblasts. Methods We used whole human genome microarrays and real time quantitative PCR to measure and validate gene expression. Microarray analysis was done using BRB-Array Tools; pathway and ontology analyses were done using Ingenuity Pathway Analysis and PANTHER, respectively. We studied signaling in irradiated and bystander cells using immunoblotting and semi-quantitative image analysis. Results Gene ontology suggested signal transduction and transcriptional regulation responding 30 minutes after treatment affected cell structure, motility and adhesion, and interleukin synthesis. We measured time-dependent expression of genes controlled by the NF-κB pathway; matrix metalloproteinases 1 and 3; chemokine ligands 2, 3 and 5 and interleukins 1β, 6 and 33. There was an increased response of this set of genes 30 minutes after treatment and another wave of induction at 4 hours. We investigated AKT-GSK3β signaling and found both AKT and GSK3β are hyper-phosphorylated 30 minutes after irradiation and this effect is maintained through 4 hours. In bystander cells, a similar response was seen with a delay of 30 minutes. We proposed a network model where the observed decrease in phosphorylation of β-catenin protein after GSK3β dependent inactivation can trigger target gene expression at later times after radiation exposure Conclusions These results are the first to show that the radiation induced bystander signal induces a widespread gene expression response at 30 minutes after treatment and these changes are accompanied by modification of

  13. Computational characterization of modes of transcriptional regulation of nuclear receptor genes.

    Directory of Open Access Journals (Sweden)

    Yogita Sharma

    Full Text Available Nuclear receptors are a large structural class of transcription factors that act with their co-regulators and repressors to maintain a variety of biological and physiological processes such as metabolism, development and reproduction. They are activated through the binding of small ligands, which can be replaced by drug molecules, making nuclear receptors promising drug targets. Transcriptional regulation of the genes that encode them is central to gaining a deeper understanding of the diversity of their biochemical and biophysical roles and their role in disease and therapy. Even though they share evolutionary history, nuclear receptor genes have fundamentally different expression patterns, ranging from ubiquitously expressed to tissue-specific and spatiotemporally complex. However, current understanding of regulation in nuclear receptor gene family is still nascent.In this study, we investigate the relationship between long-range regulation of nuclear receptor family and their known functionality. Towards this goal, we identify the nuclear receptor genes that are potential targets based on counts of highly conserved non-coding elements. We validate our results using publicly available expression (RNA-seq and histone modification (ChIP-seq data from the ENCODE project. We find that nuclear receptor genes involved in developmental roles show strong evidence of long-range mechanism of transcription regulation with distinct cis-regulatory content they feature clusters of highly conserved non-coding elements distributed in regions spanning several Megabases, long and multiple CpG islands, bivalent promoter marks and statistically significant higher enrichment of enhancer mark around their gene loci. On the other hand nuclear receptor genes that are involved in tissue-specific roles lack these features, having simple transcriptional controls and a greater variety of mechanisms for producing paralogs. We further examine the combinatorial patterns of

  14. PITX2-dependent gene regulation in atrial fibrillation and rhythm control.

    Science.gov (United States)

    Syeda, Fahima; Kirchhof, Paulus; Fabritz, Larissa

    2017-06-15

    Atrial fibrillation (AF) is a common arrhythmia. Better prevention and treatment of AF are needed to reduce AF-associated morbidity and mortality. There are several major mechanisms that cause AF in patients, including a genetic predisposition to dev