Characteristics of the population employed in primer sector in Turkey

Directory of Open Access Journals (Sweden)

Bayar Rüya

2006-01-01

Full Text Available Activities related to the production of raw material like agriculture husbandry, forestry, fishery are called as primer activities. Especially people living in rural areas earn their livings on primer activities, mainly agriculture. Rural planning is inevitable for providing rural development which has an important place in all development of a country. And achievement of this planning depends on putting forth the characteristics of the population living in rural areas with its different aspects. Therefore, the requirements will be introduced more clearly and the increase in the welfare levels of the people living in rural areas will have been achieved. To achieve the rural development and progress, in addition to the features like the size of agricultural products, products that are cultivated, activities like husbandry, forestry, hunting, etc. and the qualities of the enterprises in which these activities are carried out, policies applied, capital, market and technology, the characteristics of the population employed in this sector is also of importance. Considering these points, what is aimed in this study is to put forth the characteristics of the population employed in primer sector in Turkey. According to the census results of the year 2000 in Turkey 38% of the population is employed, and 48% of this work is in primer sector.

Progressive friction mobilization and enhanced Janssen's screening in confined granular rafts

Science.gov (United States)

Saavedra V., Oscar; Elettro, Hervé; Melo, Francisco

2018-04-01

Confined two-dimensional assemblies of floating particles, known as granular rafts, are prone to develop a highly nonlinear response under compression. Here we investigate the transition to the friction-dominated jammed state and map the gradual development of the internal stress profile with flexible pressure sensors distributed along the raft surface. Surprisingly, we observe that the surface stress screening builds up much more slowly than previously thought and that the typical screening distance later dramatically decreases. We explain this behavior in terms of progressive friction mobilization, where the full amplitude of the frictional forces is only reached after a macroscopic local displacement. At further stages of compression, rafts of large length-to-width aspect ratio experience much stronger screenings than the full mobilization limit described by the Janssen's model. We solve this paradox using a simple mathematical analysis and show that such enhanced screening can be attributed to a localized compaction front, essentially shielding the far field from compressive stresses.

Low-copy nuclear primers and ycf1 primers in Cactaceae.

Science.gov (United States)

Franck, Alan R; Cochrane, Bruce J; Garey, James R

2012-10-01

To increase the number of variable regions available for phylogenetic study in the Cactaceae, primers were developed for a portion of the plastid ycf1 gene and intron-spanning regions of two low-copy nuclear genes (isi1, nhx1). • Primers were tested on several families within Caryophyllales, focusing on the Cactaceae. Gel electrophoresis indicated positive amplification in most samples. Sequences of these three regions (isi1, nhx1, ycf1) from Harrisia exhibited variation similar to or greater than two plastid regions (atpB-rbcL intergenic spacer and rpl16 intron). • The isi, nhx, and ycf1 primers amplify phylogenetically useful information applicable to the Cactaceae and other families in the Caryophyllales.

[Progress in research of mobile health intervention].

Science.gov (United States)

Huang, Z; Ning, P S; Cheng, P X; Hu, G Q

2016-10-10

With the rapid development of mobile communication technology and the growing popularity of smartphones worldwide, mobile health has become an extension of e-Health and Tele-Health, and is of value in the research and practice of public health. In this paper, we systematically assessed research literature of mobile health' s application on disease prevention and control as well as health promotion. Based on the characteristics of current literature, this paper focused on the application of mobile health in maternal health promotion, chronic disease management, and communicable disease prevention and control to provide reference for the mobile health intervention research in China.

CRISPR Primer Designer: Design primers for knockout and chromosome imaging CRISPR-Cas system.

Science.gov (United States)

Yan, Meng; Zhou, Shi-Rong; Xue, Hong-Wei

2015-07-01

The clustered regularly interspaced short palindromic repeats (CRISPR)-associated system enables biologists to edit genomes precisely and provides a powerful tool for perturbing endogenous gene regulation, modulation of epigenetic markers, and genome architecture. However, there are concerns about the specificity of the system, especially the usages of knocking out a gene. Previous designing tools either were mostly built-in websites or ran as command-line programs, and none of them ran locally and acquired a user-friendly interface. In addition, with the development of CRISPR-derived systems, such as chromosome imaging, there were still no tools helping users to generate specific end-user spacers. We herein present CRISPR Primer Designer for researchers to design primers for CRISPR applications. The program has a user-friendly interface, can analyze the BLAST results by using multiple parameters, score for each candidate spacer, and generate the primers when using a certain plasmid. In addition, CRISPR Primer Designer runs locally and can be used to search spacer clusters, and exports primers for the CRISPR-Cas system-based chromosome imaging system. © 2014 Institute of Botany, Chinese Academy of Sciences.

Bioinformatic tools for PCR Primer design

African Journals Online (AJOL)

ES

reaction (PCR), oligo hybridization and DNA sequencing. Proper primer design is actually one of the most important factors/steps in successful DNA sequencing. Various bioinformatics programs are available for selection of primer pairs from a template sequence. The plethora programs for PCR primer design reflects the.

30 CFR 56.6304 - Primer protection.

Science.gov (United States)

2010-07-01

... 30 Mineral Resources 1 2010-07-01 2010-07-01 false Primer protection. 56.6304 Section 56.6304 Mineral Resources MINE SAFETY AND HEALTH ADMINISTRATION, DEPARTMENT OF LABOR METAL AND NONMETAL MINE... Primer protection. (a) Tamping shall not be done directly on a primer. (b) Rigid cartridges of explosives...

KENO-VI Primer: A Primer for Criticality Calculations with SCALE/KENO-VI Using GeeWiz

International Nuclear Information System (INIS)

Bowman, Stephen M.

2008-01-01

The SCALE (Standardized Computer Analyses for Licensing Evaluation) computer software system developed at Oak Ridge National Laboratory is widely used and accepted around the world for criticality safety analyses. The well-known KENO-VI three-dimensional Monte Carlo criticality computer code is one of the primary criticality safety analysis tools in SCALE. The KENO-VI primer is designed to help a new user understand and use the SCALE/KENO-VI Monte Carlo code for nuclear criticality safety analyses. It assumes that the user has a college education in a technical field. There is no assumption of familiarity with Monte Carlo codes in general or with SCALE/KENO-VI in particular. The primer is designed to teach by example, with each example illustrating two or three features of SCALE/KENO-VI that are useful in criticality analyses. The primer is based on SCALE 6, which includes the Graphically Enhanced Editing Wizard (GeeWiz) Windows user interface. Each example uses GeeWiz to provide the framework for preparing input data and viewing output results. Starting with a Quickstart section, the primer gives an overview of the basic requirements for SCALE/KENO-VI input and allows the user to quickly run a simple criticality problem with SCALE/KENO-VI. The sections that follow Quickstart include a list of basic objectives at the beginning that identifies the goal of the section and the individual SCALE/KENO-VI features that are covered in detail in the sample problems in that section. Upon completion of the primer, a new user should be comfortable using GeeWiz to set up criticality problems in SCALE/KENO-VI. The primer provides a starting point for the criticality safety analyst who uses SCALE/KENO-VI. Complete descriptions are provided in the SCALE/KENO-VI manual. Although the primer is self-contained, it is intended as a companion volume to the SCALE/KENO-VI documentation. (The SCALE manual is provided on the SCALE installation DVD.) The primer provides specific examples of

Mobile technologies in progress of teaching and learning: teaching mobility?

Directory of Open Access Journals (Sweden)

Osmar Hélio Alves Araújo

2016-04-01

Full Text Available The article is a survey of basic education teachers in the municipality of Iguatu/CE and aimed to verify if teachers use mobile technology in the classroom as an educational resource, as well as investigate to what extent the professional qualifications of these professionals drives an authentic, autonomous teaching action before the harvest of mobile technologies. The subjects are teachers who work in elementary school. Methodologically, constitutes in a field research, with retaining the qualitative approach, aiming to enhance the school in contemporary times is addressed by changes brought to the company by the technological revolution, especially the proliferation of mobile technologies, which are driving changes in processes teaching and learning. We used semi structured and reflective interview as a technique for data collection. They have as the theoretical studies of Alarcão (2001, Freire (1987, 1992, 2001, Libâneo (2001, 2002, 2005, 2011, Nóvoa (2009, Tardif (2001 UNESCO (2013, Veen and Vrakking (2009. The results of the research showed that teachers, for the most part, do not use the apparatus of mobile technologies in pedagogical practice, and point to the picture of insufficient professional qualification for a teaching practice in the context of safe and educationally effectively technologies. However, this split ends, so in need of a continuous training process that deepens also in reality and knowledge that teachers have. As regard as pillars the changes that the current social context has experienced, among which we highlight the technological changes that proliferate dramatically.

The Los Alamos primer

CERN Document Server

Serber, Robert

2018-01-01

Unabridged declassified value reproduction of The Los Alamos Primer by Robert Serber, in full color with all censor markings. This is the booklet given to new workers at Los Alamos during World War II, to catch them up on how to build a practical fission bomb. The Primer was driven by Robert Oppenheimer asking his protégé Robert Serber to summarize all knowledge and possible solutions known as of April 1943 in a series of lectures. Serber did such an excellent job that the notes from the series was turned into The Los Alamos Primer. Serber was known as an expert that bridged theory and reality, and so was also chosen to be one of the first Americans to enter Hiroshima and Nagasaki to assess the atomic damage in 1945.

Complementation of a primer binding site-impaired murine leukemia virus-derived retroviral vector by a genetically engineered tRNA-like primer

DEFF Research Database (Denmark)

Lund, Anders Henrik; Duch, M; Lovmand, J

1997-01-01

, but not with a noncomplementary tRNA-like molecule. The engineered primer was shown to be involved in both the initiation of first-strand synthesis and second-strand transfer. These results provide an in vivo demonstration that the retroviral replication machinery may recognize sequence complementarity rather than actual primer...... binding site and 3' primer sequences. Use of mutated primer binding site vectors replicating via engineered primers may add additional control features to retroviral gene transfer technology....

Nanotechnology: A Policy Primer

Science.gov (United States)

2013-06-24

savings in the United States of 24 million barrels of oil.4 • Universal access to clean water. Nanotechnology water desalination and filtration...CRS Report for Congress Prepared for Members and Committees of Congress Nanotechnology : A Policy Primer John F. Sargent Jr. Specialist...COVERED 00-00-2013 to 00-00-2013 4. TITLE AND SUBTITLE Nanotechnology : A Policy Primer 5a. CONTRACT NUMBER 5b. GRANT NUMBER 5c. PROGRAM ELEMENT

Mobile Multicast in Hierarchical Proxy Mobile IPV6

Science.gov (United States)

Hafizah Mohd Aman, Azana; Hashim, Aisha Hassan A.; Mustafa, Amin; Abdullah, Khaizuran

2013-12-01

Mobile Internet Protocol Version 6 (MIPv6) environments have been developing very rapidly. Many challenges arise with the fast progress of MIPv6 technologies and its environment. Therefore the importance of improving the existing architecture and operations increases. One of the many challenges which need to be addressed is the need for performance improvement to support mobile multicast. Numerous approaches have been proposed to improve mobile multicast performance. This includes Context Transfer Protocol (CXTP), Hierarchical Mobile IPv6 (HMIPv6), Fast Mobile IPv6 (FMIPv6) and Proxy Mobile IPv6 (PMIPv6). This document describes multicast context transfer in hierarchical proxy mobile IPv6 (H-PMIPv6) to provide better multicasting performance in PMIPv6 domain.

Mobile Marketing

OpenAIRE

Luengo Cascudo, Alberto

2010-01-01

El principal objetivo de este proyecto es explicar y entender la importancia del Mobile Marketing como nueva herramienta de negocio en el Marketing empresarial. Para ello, el primer objetivo es entender los dos factores que para mí son la clave de su importancia: la evolución del entorno tecnológico y el cambio en los hábitos del consumidor. Debido a la novedad de esta nueva forma de Marketing y al hecho de que está en constante definición, es básico exponer de la forma más cla...

Predictive maintenance primer

International Nuclear Information System (INIS)

Flude, J.W.; Nicholas, J.R.

1991-04-01

This Predictive Maintenance Primer provides utility plant personnel with a single-source reference to predictive maintenance analysis methods and technologies used successfully by utilities and other industries. It is intended to be a ready reference to personnel considering starting, expanding or improving a predictive maintenance program. This Primer includes a discussion of various analysis methods and how they overlap and interrelate. Additionally, eighteen predictive maintenance technologies are discussed in sufficient detail for the user to evaluate the potential of each technology for specific applications. This document is designed to allow inclusion of additional technologies in the future. To gather the information necessary to create this initial Primer the Nuclear Maintenance Applications Center (NMAC) collected experience data from eighteen utilities plus other industry and government sources. NMAC also contacted equipment manufacturers for information pertaining to equipment utilization, maintenance, and technical specifications. The Primer includes a discussion of six methods used by analysts to study predictive maintenance data. These are: trend analysis; pattern recognition; correlation; test against limits or ranges; relative comparison data; and statistical process analysis. Following the analysis methods discussions are detailed descriptions for eighteen technologies analysts have found useful for predictive maintenance programs at power plants and other industrial facilities. Each technology subchapter has a description of the operating principles involved in the technology, a listing of plant equipment where the technology can be applied, and a general description of the monitoring equipment. Additionally, these descriptions include a discussion of results obtained from actual equipment users and preferred analysis techniques to be used on data obtained from the technology. 5 refs., 30 figs

COMPARISON OF EFFECTIVENESS OF A PROGRESSIVE MOBILIZATION AND MOZART MUSIC THERAPY ON NON-INVASIVE HEMODYNAMIC STATUS CHANGES IN PATIENTS WITH HEAD INJURY IN THE INTENSIVE CARE UNIT

Directory of Open Access Journals (Sweden)

Novi Indriani

2018-05-01

Full Text Available Background: The instability of hemodynamic status in patients with head injury with decreased consciousness has an effect on the increase of intracranial pressure. The recovery of hemodynamic status can be done through nursing intervention either by providing a sensory stimulus (music therapy or motor stimulus (progressive mobilization. Objective: To compare the effectiveness of progressive mobilization of level I with Mozart's music therapy on non-invasive hemodynamic status changes in patients with head injury with decreased awareness. Methods: This was a quasy-experimental study with pretest-posttest design. There were 34 samples selected using consecutive sampling, which 17 samples assigned in a group of progressive mobilization and group of music therapy. Paired t-test and Wilcoxon test were used for paired group, and Independent t-test and Mann-Whitney test for unpaired group. Results: Progressive mobilization of level I had significant effect on changes in systolic blood pressure (p = 0.0001, diastolic blood pressure (p = 0.002 and MAP (p = 0.019, and no significant effect on heart rate (p = 0.155, respiration (p = 0.895 and oxygen saturation (p = 0.248. Mozart's music therapy had a significant effect on changes in systolic blood pressure (p = 0.0001, diastolic blood pressure (p = 0.0001, respiration (p= 0.032 and oxygen saturation (p = 0.008, but no effect on MAP (p = 0.561. There was a significant difference between the two interventions in the systolic blood pressure and heart rate variables (p 0.05. Conclusion: The Mozart's music therapy is more effective on non-invasive hemodynamic status changes in patients with head injury with decreased consciousness compared with progressive mobilization of level I.

China Energy Primer

Energy Technology Data Exchange (ETDEWEB)

Ni, Chun Chun

2009-11-16

Based on extensive analysis of the 'China Energy Databook Version 7' (October 2008) this Primer for China's Energy Industry draws a broad picture of China's energy industry with the two goals of helping users read and interpret the data presented in the 'China Energy Databook' and understand the historical evolution of China's energy inustry. Primer provides comprehensive historical reviews of China's energy industry including its supply and demand, exports and imports, investments, environment, and most importantly, its complicated pricing system, a key element in the analysis of China's energy sector.

MCMC-ODPR: Primer design optimization using Markov Chain Monte Carlo sampling

Directory of Open Access Journals (Sweden)

Kitchen James L

2012-11-01

Full Text Available Abstract Background Next generation sequencing technologies often require numerous primer designs that require good target coverage that can be financially costly. We aimed to develop a system that would implement primer reuse to design degenerate primers that could be designed around SNPs, thus find the fewest necessary primers and the lowest cost whilst maintaining an acceptable coverage and provide a cost effective solution. We have implemented Metropolis-Hastings Markov Chain Monte Carlo for optimizing primer reuse. We call it the Markov Chain Monte Carlo Optimized Degenerate Primer Reuse (MCMC-ODPR algorithm. Results After repeating the program 1020 times to assess the variance, an average of 17.14% fewer primers were found to be necessary using MCMC-ODPR for an equivalent coverage without implementing primer reuse. The algorithm was able to reuse primers up to five times. We compared MCMC-ODPR with single sequence primer design programs Primer3 and Primer-BLAST and achieved a lower primer cost per amplicon base covered of 0.21 and 0.19 and 0.18 primer nucleotides on three separate gene sequences, respectively. With multiple sequences, MCMC-ODPR achieved a lower cost per base covered of 0.19 than programs BatchPrimer3 and PAMPS, which achieved 0.25 and 0.64 primer nucleotides, respectively. Conclusions MCMC-ODPR is a useful tool for designing primers at various melting temperatures at good target coverage. By combining degeneracy with optimal primer reuse the user may increase coverage of sequences amplified by the designed primers at significantly lower costs. Our analyses showed that overall MCMC-ODPR outperformed the other primer-design programs in our study in terms of cost per covered base.

MCMC-ODPR: primer design optimization using Markov Chain Monte Carlo sampling.

Science.gov (United States)

Kitchen, James L; Moore, Jonathan D; Palmer, Sarah A; Allaby, Robin G

2012-11-05

Next generation sequencing technologies often require numerous primer designs that require good target coverage that can be financially costly. We aimed to develop a system that would implement primer reuse to design degenerate primers that could be designed around SNPs, thus find the fewest necessary primers and the lowest cost whilst maintaining an acceptable coverage and provide a cost effective solution. We have implemented Metropolis-Hastings Markov Chain Monte Carlo for optimizing primer reuse. We call it the Markov Chain Monte Carlo Optimized Degenerate Primer Reuse (MCMC-ODPR) algorithm. After repeating the program 1020 times to assess the variance, an average of 17.14% fewer primers were found to be necessary using MCMC-ODPR for an equivalent coverage without implementing primer reuse. The algorithm was able to reuse primers up to five times. We compared MCMC-ODPR with single sequence primer design programs Primer3 and Primer-BLAST and achieved a lower primer cost per amplicon base covered of 0.21 and 0.19 and 0.18 primer nucleotides on three separate gene sequences, respectively. With multiple sequences, MCMC-ODPR achieved a lower cost per base covered of 0.19 than programs BatchPrimer3 and PAMPS, which achieved 0.25 and 0.64 primer nucleotides, respectively. MCMC-ODPR is a useful tool for designing primers at various melting temperatures at good target coverage. By combining degeneracy with optimal primer reuse the user may increase coverage of sequences amplified by the designed primers at significantly lower costs. Our analyses showed that overall MCMC-ODPR outperformed the other primer-design programs in our study in terms of cost per covered base.

High-speed measurement of firearm primer blast waves

OpenAIRE

Courtney, Michael; Daviscourt, Joshua; Eng, Jonathan; Courtney, Amy

2012-01-01

This article describes a method and results for direct high-speed measurements of firearm primer blast waves employing a high-speed pressure transducer located at the muzzle to record the blast pressure wave produced by primer ignition. Key findings are: 1) Most of the lead styphnate based primer models tested show 5.2-11.3% standard deviation in the magnitudes of their peak pressure. 2) In contrast, lead-free diazodinitrophenol (DDNP) based primers had standard deviations of the peak blast p...

Hexavalent Chromium IV-Free Primer Development

Science.gov (United States)

Alldredge, Michael J.; Buck, Amy L.

2015-01-01

Primer materials provide corrosion protection for metal parts as well as an increased adhesion between metallic substrates and thermal protection systems (TPSs). Current primers for use in cryogenic applications contain hexavalent chromium. This hexavalent chromium provides excellent corrosion protection even in a cryogenic environment, but it is a carcinogen that requires special equipment and waste control procedures to use. The hazardous nature of hexavalent chromium makes it an obsolescence risk in the future. This study included two phases of evaluation. Thirteen primers were initially identified as candidates and twelve of those primers were tested in phase 1. Four of the best performing candidates from phase 1 continued into phase 2 testing. Phase 1 testing consisted mostly of liquid constituent and physical property testing. Cryoflex and salt fog testing were included in phase 1 because of their importance to the overall success of a candidate material. Phase 2 consisted of physical, thermal, and mechanical properties for nominally processed and fabricated specimens.

Multiplexing Short Primers for Viral Family PCR

Energy Technology Data Exchange (ETDEWEB)

Gardner, S N; Hiddessen, A L; Hara, C A; Williams, P L; Wagner, M; Colston, B W

2008-06-26

We describe a Multiplex Primer Prediction (MPP) algorithm to build multiplex compatible primer sets for large, diverse, and unalignable sets of target sequences. The MPP algorithm is scalable to larger target sets than other available software, and it does not require a multiple sequence alignment. We applied it to questions in viral detection, and demonstrated that there are no universally conserved priming sequences among viruses and that it could require an unfeasibly large number of primers ({approx}3700 18-mers or {approx}2000 10-mers) to generate amplicons from all sequenced viruses. We then designed primer sets separately for each viral family, and for several diverse species such as foot-and-mouth disease virus, hemagglutinin and neuraminidase segments of influenza A virus, Norwalk virus, and HIV-1.

Cytotoxic and genotoxic evaluation of orthodontic adhesives with primer and without primer exposed to electron beam irradiation - an in-vitro study

International Nuclear Information System (INIS)

Ravi, M.S.; Panchasara, Chirag; Vijay, R.; Suchetha Kumari, N.; Sanjeev, Ganesh

2013-01-01

To evaluate the in vitro genotoxicity and cytotoxicity of two visible light-cured adhesives. The materials tested were 1. orthodontic adhesive with primer (Transbond XT3M) and 2. Orthodontic adhesive without primer (Heliosit, Ivoclar Vivadent AG), Cured sterile individual masses were exposed to 2 kGy electron beam radiation, both irradiated and non irradiated materials were immersed in Phosphate buffer saline and left at 370℃ for 24 hr. Then a volume of 200 μL of the extract medium was mixed with human peripheral blood lymphocyte tested for comet assay by single cell DNA Damage assay and Apoptosis by DNA diffusion agar assay. Evaluation of cytotoxicity was carried out by Hemolysis assay method. Haemolytic activity of orthodontic adhesive without primer (53.34±3.12) was slightly more than that of orthodontic adhesive with primer (52.9±.88). In case of Apoptosis, adhesive with primer (188.92±55.05) and adhesives without primer (186.75±101.83) showed increased diffusion of DNA compared to normal lymphocyte (111.22±8.78). However the level of DNA diffusion was not significantly different between the two adhesives. Both adhesives were cytotoxic and induced apoptosis. Adhesives without primer were found to be slightly toxic than that of adhesive with primer. Both the adhesives had no significant effect on the percentage of DNA tail and olive tail moment of DNA exposed to electron beam radiation. (author)

KENO V.a Primer: A Primer for Criticality Calculations with SCALE/KENO V.a Using CSPAN for Input

International Nuclear Information System (INIS)

Busch, R.D.

2003-01-01

The SCALE (Standardized Computer Analyses for Licensing Evaluation) computer software system developed at Oak Ridge National Laboratory (ORNL) is widely used and accepted around the world for criticality safety analyses. The well-known KENO V.a three-dimensional Monte Carlo criticality computer code is the primary criticality safety analysis tool in SCALE. The KENO V.a primer is designed to help a new user understand and use the SCALE/KENO V.a Monte Carlo code for nuclear criticality safety analyses. It assumes that the user has a college education in a technical field. There is no assumption of familiarity with Monte Carlo codes in general or with SCALE/KENO V.a in particular. The primer is designed to teach by example, with each example illustrating two or three features of SCALE/KENO V.a that are useful in criticality analyses. The primer is based on SCALE 4.4a, which includes the Criticality Safety Processor for Analysis (CSPAN) input processor for Windows personal computers (PCs). A second edition of the primer, which uses the new KENO Visual Editor, is currently under development at ORNL and is planned for publication in late 2003. Each example in this first edition of the primer uses CSPAN to provide the framework for data input. Starting with a Quickstart section, the primer gives an overview of the basic requirements for SCALE/KENO V.a input and allows the user to quickly run a simple criticality problem with SCALE/KENO V.a. The sections that follow Quickstart include a list of basic objectives at the beginning that identifies the goal of the section and the individual SCALE/KENO V.a features which are covered in detail in the example problems in that section. Upon completion of the primer, a new user should be comfortable using CSPAN to set up criticality problems in SCALE/KENO V.a

Primer on spontaneous heating and pyrophoricity

Energy Technology Data Exchange (ETDEWEB)

1994-12-01

This primer was prepared as an information resource for personnel responsible for operation of DOE nuclear facilities. It has sections on combustion principles, spontaneous heating/ignition of hydrocarbons and organics, pyrophoric gases and liquids, pyrophoric nonmetallic solids, pyrophoric metals (including Pu and U), and accident case studies. Although the information in this primer is not all-encompassing, it should provide the reader with a fundamental knowledge level sufficient to recognize most spontaneous combustion hazards and how to prevent ignition and widespread fires. This primer is provided as an information resource only, and is not intended to replace any fire protection or hazardous material training.

30 CFR 57.6304 - Primer protection.

Science.gov (United States)

2010-07-01

... 30 Mineral Resources 1 2010-07-01 2010-07-01 false Primer protection. 57.6304 Section 57.6304 Mineral Resources MINE SAFETY AND HEALTH ADMINISTRATION, DEPARTMENT OF LABOR METAL AND NONMETAL MINE... Transportation-Surface and Underground § 57.6304 Primer protection. (a) Tamping shall not be done directly on a...

Rust transformation/rust compatible primers

Science.gov (United States)

Emeric, Dario A.; Miller, Christopher E.

1993-01-01

Proper surface preparation has been the key to obtain good performance by a surface coating. The major obstacle in preparing a corroded or rusted surface is the complete removal of the contaminants and the corrosion products. Sandblasting has been traditionally used to remove the corrosion products before painting. However, sandblasting can be expensive, may be prohibited by local health regulations and is not applicable in every situation. To get around these obstacles, Industry developed rust converters/rust transformers and rust compatible primers (high solids epoxies). The potential use of these products for military equipment led personnel of the Belvoir Research, Development and Engineering Center (BRDEC) to evaluate the commercially available rust transformers and rust compatible primers. Prior laboratory experience with commercially available rust converters, as well as field studies in Hawaii and Puerto Rico, revealed poor performance, several inherent limitations, and lack of reliability. It was obvious from our studies that the performance of rust converting products was more dependent on the amount and type of rust present, as well as the degree of permeability of the coating, than on the product's ability to form an organometallic complex with the rust. Based on these results, it was decided that the Military should develop their own rust converter formulation and specification. The compound described in the specification is for use on a rusted surface before the application of an organic coating (bituminous compounds, primer or topcoat). These coatings should end the need for sandblasting or the removing of the adherent corrosion products. They also will prepare the surface for the application of the organic coating. Several commercially available rust compatible primers (RCP) were also tested using corroded surfaces. All of the evaluated RCP failed our laboratory tests for primers.

An iterative method for selecting degenerate multiplex PCR primers.

Science.gov (United States)

Souvenir, Richard; Buhler, Jeremy; Stormo, Gary; Zhang, Weixiong

2007-01-01

Single-nucleotide polymorphism (SNP) genotyping is an important molecular genetics process, which can produce results that will be useful in the medical field. Because of inherent complexities in DNA manipulation and analysis, many different methods have been proposed for a standard assay. One of the proposed techniques for performing SNP genotyping requires amplifying regions of DNA surrounding a large number of SNP loci. To automate a portion of this particular method, it is necessary to select a set of primers for the experiment. Selecting these primers can be formulated as the Multiple Degenerate Primer Design (MDPD) problem. The Multiple, Iterative Primer Selector (MIPS) is an iterative beam-search algorithm for MDPD. Theoretical and experimental analyses show that this algorithm performs well compared with the limits of degenerate primer design. Furthermore, MIPS outperforms an existing algorithm that was designed for a related degenerate primer selection problem.

Determination of the species specificity of the primers for the detection of chicken and turkey meat by realtime PCR method

Directory of Open Access Journals (Sweden)

Lenka Maršálková

2014-07-01

Full Text Available The aim of this work was to use TaqMan Real-Time PCR for quantitative authentication of chicken and turkey meat. To meet this purpose, a specific pair of primers and TaqMan probe was used. The test was aimed at identifying the reaction cycle of turkey and chicken meat using by two sets of primers. With first set of primer designed for chicken we obtained the following results: Cp = 16.18 for 100% chicken DNA Cp = 29, 18 100% turkey DNA It was also amplified DNA of pig that exceeded the detection threshold fluorescence intensities in the 31.07 cycle (Cp = 31.07. Using primers designed for turkey we obtained the following results Cp = 31.16 for 100% CHDNA, Cp =16.18 100% TDNA. It was also amplified the 100% DNA of rabbit in 31.63 cycle (Cp = 31.63 and deer in cycle 32 (Cp = 32. The DNA of all other animal species was amplificated after more than 35 cycles (Cp >35. It follows that the second detection primer pair is specific enough to unrelated species of animals by 30 cycles of the reaction. Species authentication based on DNA analysis from this perspective overcomes all the shortcomings of proteins. At present, DNA analysis use different types of PCR. Is the most progressive Real-time PCR, which is suitable for the specific use of detection (primers and TaqMan probe. The TaqMan Real-time PCR is within the sensitivity and specificity, clearly one of the best methods for identifying the species of chicken and turkey meat. The specificity of this method, however, depends primarily on the specificity of the primers and TaqMan probe. The 30 cycle reaction was chosen by us as the threshold for specificity using primers for authentication chicken and turkey meat.

A plastome primer set for comprehensive quantitative real time RT-PCR analysis of Zea mays: a starter primer set for other Poaceae species

Directory of Open Access Journals (Sweden)

Dunn Sade N

2008-06-01

Full Text Available Abstract Background Quantitative Real Time RT-PCR (q2(RTPCR is a maturing technique which gives researchers the ability to quantify and compare very small amounts of nucleic acids. Primer design and optimization is an essential yet time consuming aspect of using q2(RTPCR. In this paper we describe the design and empirical optimization of primers to amplify and quantify plastid RNAs from Zea mays that are robust enough to use with other closely related species. Results Primers were designed and successfully optimized for 57 of the 104 reported genes in the maize plastome plus two nuclear genes. All 59 primer pairs produced single amplicons after end-point reverse transcriptase polymerase chain reactions (RT-PCR as visualized on agarose gels and subsequently verified by q2(RTPCR. Primer pairs were divided into several categories based on the optimization requirements or the uniqueness of the target gene. An in silico test suggested the majority of the primer sets should work with other members of the Poaceae family. An in vitro test of the primer set on two unsequenced species (Panicum virgatum and Miscanthus sinensis supported this assumption by successfully producing single amplicons for each primer pair. Conclusion Due to the highly conserved chloroplast genome in plant families it is possible to utilize primer pairs designed against one genomic sequence to detect the presence and abundance of plastid genes or transcripts from genomes that have yet to be sequenced. Analysis of steady state transcription of vital system genes is a necessary requirement to comprehensively elucidate gene expression in any organism. The primer pairs reported in this paper were designed for q2(RTPCR of maize chloroplast genes but should be useful for other members of the Poaceae family. Both in silico and in vitro data are presented to support this assumption.

Efficient Mobility Management Signalling in Network Mobility Supported PMIPV6.

Science.gov (United States)

Samuelraj, Ananthi Jebaseeli; Jayapal, Sundararajan

2015-01-01

Proxy Mobile IPV6 (PMIPV6) is a network based mobility management protocol which supports node's mobility without the contribution from the respective mobile node. PMIPV6 is initially designed to support individual node mobility and it should be enhanced to support mobile network movement. NEMO-BSP is an existing protocol to support network mobility (NEMO) in PMIPV6 network. Due to the underlying differences in basic protocols, NEMO-BSP cannot be directly applied to PMIPV6 network. Mobility management signaling and data structures used for individual node's mobility should be modified to support group nodes' mobility management efficiently. Though a lot of research work is in progress to implement mobile network movement in PMIPV6, it is not yet standardized and each suffers with different shortcomings. This research work proposes modifications in NEMO-BSP and PMIPV6 to achieve NEMO support in PMIPV6. It mainly concentrates on optimizing the number and size of mobility signaling exchanged while mobile network or mobile network node changes its access point.

Efficient Mobility Management Signalling in Network Mobility Supported PMIPV6

Directory of Open Access Journals (Sweden)

Ananthi Jebaseeli Samuelraj

2015-01-01

Full Text Available Proxy Mobile IPV6 (PMIPV6 is a network based mobility management protocol which supports node’s mobility without the contribution from the respective mobile node. PMIPV6 is initially designed to support individual node mobility and it should be enhanced to support mobile network movement. NEMO-BSP is an existing protocol to support network mobility (NEMO in PMIPV6 network. Due to the underlying differences in basic protocols, NEMO-BSP cannot be directly applied to PMIPV6 network. Mobility management signaling and data structures used for individual node’s mobility should be modified to support group nodes’ mobility management efficiently. Though a lot of research work is in progress to implement mobile network movement in PMIPV6, it is not yet standardized and each suffers with different shortcomings. This research work proposes modifications in NEMO-BSP and PMIPV6 to achieve NEMO support in PMIPV6. It mainly concentrates on optimizing the number and size of mobility signaling exchanged while mobile network or mobile network node changes its access point.

Bioinformatic tools and guideline for PCR primer design | Abd ...

African Journals Online (AJOL)

Bioinformatics has become an essential tool not only for basic research but also for applied research in biotechnology and biomedical sciences. Optimal primer sequence and appropriate primer concentration are essential for maximal specificity and efficiency of PCR. A poorly designed primer can result in little or no ...

Medium Caliber Lead-Free Electric Primer. Version 2

Science.gov (United States)

2012-09-01

2008). Safe Drinking Water Act of 1986 lists lead compounds as carcinogens (27 CCR 27001 – Dec. 2008). EPA began a Phase I assessment to determine...primer cups was our standard method, wet loading using solvents (hexane and iso -propanol) was investigated to reduce risk of accidental ignition...LOADING OPERATION (Single Die) Wet primer mix charge with solvent (Hexane/ Iso -Propanol) and stir to mix to a uniform slurry Insert primer cup in

Simple sequence repeat marker loci discovery using SSR primer.

Science.gov (United States)

Robinson, Andrew J; Love, Christopher G; Batley, Jacqueline; Barker, Gary; Edwards, David

2004-06-12

Simple sequence repeats (SSRs) have become important molecular markers for a broad range of applications, such as genome mapping and characterization, phenotype mapping, marker assisted selection of crop plants and a range of molecular ecology and diversity studies. With the increase in the availability of DNA sequence information, an automated process to identify and design PCR primers for amplification of SSR loci would be a useful tool in plant breeding programs. We report an application that integrates SPUTNIK, an SSR repeat finder, with Primer3, a PCR primer design program, into one pipeline tool, SSR Primer. On submission of multiple FASTA formatted sequences, the script screens each sequence for SSRs using SPUTNIK. The results are parsed to Primer3 for locus-specific primer design. The script makes use of a Web-based interface, enabling remote use. This program has been written in PERL and is freely available for non-commercial users by request from the authors. The Web-based version may be accessed at http://hornbill.cspp.latrobe.edu.au/

Value for money assessment for public-private partnerships : a primer.

Science.gov (United States)

2015-01-01

This primer addresses Value for Money Assessment for public-private partnerships (P3s). Companion : primers on Financial Assessment and Risk Assessment for P3s are also available as part of this series of : primers.

Economics : pricing, demand, and economic efficiency : a primer.

Science.gov (United States)

2008-11-01

The Congestion Pricing Primer Series is part of : FHWAs outreach efforts to introduce the various : aspects of congestion pricing to decision-makers and : transportation professionals in the United States. The : primers are intended to lay out the...

Semantic Web Primer

NARCIS (Netherlands)

Antoniou, Grigoris; Harmelen, Frank van

2004-01-01

The development of the Semantic Web, with machine-readable content, has the potential to revolutionize the World Wide Web and its use. A Semantic Web Primer provides an introduction and guide to this still emerging field, describing its key ideas, languages, and technologies. Suitable for use as a

Coal Bed Methane Primer

Energy Technology Data Exchange (ETDEWEB)

Dan Arthur; Bruce Langhus; Jon Seekins

2005-05-25

During the second half of the 1990's Coal Bed Methane (CBM) production increased dramatically nationwide to represent a significant new source of income and natural gas for many independent and established producers. Matching these soaring production rates during this period was a heightened public awareness of environmental concerns. These concerns left unexplained and under-addressed have created a significant growth in public involvement generating literally thousands of unfocused project comments for various regional NEPA efforts resulting in the delayed development of public and fee lands. The accelerating interest in CBM development coupled to the growth in public involvement has prompted the conceptualization of this project for the development of a CBM Primer. The Primer is designed to serve as a summary document, which introduces and encapsulates information pertinent to the development of Coal Bed Methane (CBM), including focused discussions of coal deposits, methane as a natural formed gas, split mineral estates, development techniques, operational issues, producing methods, applicable regulatory frameworks, land and resource management, mitigation measures, preparation of project plans, data availability, Indian Trust issues and relevant environmental technologies. An important aspect of gaining access to federal, state, tribal, or fee lands involves education of a broad array of stakeholders, including land and mineral owners, regulators, conservationists, tribal governments, special interest groups, and numerous others that could be impacted by the development of coal bed methane. Perhaps the most crucial aspect of successfully developing CBM resources is stakeholder education. Currently, an inconsistent picture of CBM exists. There is a significant lack of understanding on the parts of nearly all stakeholders, including industry, government, special interest groups, and land owners. It is envisioned the Primer would being used by a variety of

Quick spacecraft charging primer

International Nuclear Information System (INIS)

Larsen, Brian Arthur

2014-01-01

This is a presentation in PDF format which is a quick spacecraft charging primer, meant to be used for program training. It goes into detail about charging physics, RBSP examples, and how to identify charging.

SINEs of progress: Mobile element applications to molecular ecology.

Science.gov (United States)

Ray, David A

2007-01-01

Mobile elements represent a unique and under-utilized set of tools for molecular ecologists. They are essentially homoplasy-free characters with the ability to be genotyped in a simple and efficient manner. Interpretation of the data generated using mobile elements can be simple compared to other genetic markers. They exist in a wide variety of taxa and are useful over a wide selection of temporal ranges within those taxa. Furthermore, their mode of evolution instills them with another advantage over other types of multilocus genotype data: the ability to determine loci applicable to a range of time spans in the history of a taxon. In this review, I discuss the application of mobile element markers, especially short interspersed elements (SINEs), to phylogenetic and population data, with an emphasis on potential applications to molecular ecology.

Primer design for a prokaryotic differential display RT-PCR.

Science.gov (United States)

Fislage, R; Berceanu, M; Humboldt, Y; Wendt, M; Oberender, H

1997-05-01

We have developed a primer set for a prokaryotic differential display of mRNA in the Enterobacteriaceae group. Each combination of ten 10mer and ten 11mer primers generates up to 85 bands from total Escherichia coli RNA, thus covering expressed sequences of a complete bacterial genome. Due to the lack of polyadenylation in prokaryotic RNA the type T11VN anchored oligonucleotides for the reverse transcriptase reaction had to be replaced with respect to the original method described by Liang and Pardee [ Science , 257, 967-971 (1992)]. Therefore, the sequences of both the 10mer and the new 11mer oligonucleotides were determined by a statistical evaluation of species-specific coding regions extracted from the EMBL database. The 11mer primers used for reverse transcription were selected for localization in the 3'-region of the bacterial RNA. The 10mer primers preferentially bind to the 5'-end of the RNA. None of the primers show homology to rRNA or other abundant small RNA species. Randomly sampled cDNA bands were checked for their bacterial origin either by re-amplification, cloning and sequencing or by re-amplification and direct sequencing with 10mer and 11mer primers after asymmetric PCR.

Climate Change, Health, and Communication: A Primer.

Science.gov (United States)

Chadwick, Amy E

2016-01-01

Climate change is one of the most serious and pervasive challenges facing us today. Our changing climate has implications not only for the ecosystems upon which we depend, but also for human health. Health communication scholars are well-positioned to aid in the mitigation of and response to climate change and its health effects. To help theorists, researchers, and practitioners engage in these efforts, this primer explains relevant issues and vocabulary associated with climate change and its impacts on health. First, this primer provides an overview of climate change, its causes and consequences, and its impacts on health. Then, the primer describes ways to decrease impacts and identifies roles for health communication scholars in efforts to address climate change and its health effects.

Marketing Information Products and Services : A Primer for ...

International Development Research Centre (IDRC) Digital Library (Canada)

Marketing Information Products and Services : A Primer for Librarians and Information Professionals. Couverture du livre Marketing Information Products and Services : A Primer for Librarians and Information Professionals. Directeur(s) : Abhinandan K. Jain, Ashok Jambhekar, T.P.Rama Rao et S. Sreenivas Rao. Maison(s) ...

An environmentally acceptable primer for galvanized steel: Formulation and evaluation by SVET

Energy Technology Data Exchange (ETDEWEB)

Simoes, A.M.P., E-mail: alda.simoes@ist.utl.p [CIDEPINT - Centro de Investigacion y Desarrollo en Tecnologia de Pinturas (CIC-CONICET), Calle 52 e/121 y 122, 1900 La Plata (Argentina); TULisbon, Instituto Superior Tecnico, DEQB, Av. Rovisco Pais, 1049-001 Lisboa (Portugal); Carbonari, R.O.; Di Sarli, A.R.; Amo, B. del [CIDEPINT - Centro de Investigacion y Desarrollo en Tecnologia de Pinturas (CIC-CONICET), Calle 52 e/121 y 122, 1900 La Plata (Argentina); TULisbon, Instituto Superior Tecnico, DEQB, Av. Rovisco Pais, 1049-001 Lisboa (Portugal); Romagnoli, R., E-mail: estelectro@cidepint.gov.a [CIDEPINT - Centro de Investigacion y Desarrollo en Tecnologia de Pinturas (CIC-CONICET), Calle 52 e/121 y 122, 1900 La Plata (Argentina); TULisbon, Instituto Superior Tecnico, DEQB, Av. Rovisco Pais, 1049-001 Lisboa (Portugal)

2011-01-15

Research highlights: {yields} Chromates can be replaced successfully by aluminium phosphosilicate in paint systems. {yields} The solvents of the primer are eco-friendly ones. {yields} The primer adheres on galvanized steel and allows top-coating. {yields} The binder of the primer is compatible with other binders for top-coating. - Abstract: The object of this paper was to formulate a two-pack wash primer employing aluminium phosphosilicate as active anticorrosive pigment instead of basic zinc chromate. The anticorrosive action of the primer was evaluated by the polarization technique and the scanning vibrating electrode technique (SVET). The exposed surface was then examined by scanning electron microscopy (SEM) and the surface composition determined by energy dispersive X-ray (EDX) analysis. The primer was finally integrated in a complete paint scheme whose anticorrosive performance was evaluated by the salt spray chamber and electrochemical impedance spectroscopy. The adhesion of the primer plus a painting system was also evaluated by standard ASTM D 3359-90 test method. The wash primer pigmented with zinc chromate was used as reference. Results indicated that basic zinc chromate could be replaced by the more eco-friendly wash-primer containing aluminium phosphosilicate.

Microsatellite primers for fungus-growing ants

DEFF Research Database (Denmark)

Villesen, Palle; Gertsch, P J; Boomsma, JJ

2002-01-01

We isolated five polymorphic microsatellite loci from a library of two thousand recombinant clones of two fungus-growing ant species, Cyphomyrmex longiscapus and Trachymyrmex cf. zeteki. Amplification and heterozygosity were tested in five species of higher attine ants using both the newly...... developed primers and earlier published primers that were developed for fungus-growing ants. A total of 20 variable microsatellite loci, developed for six different species of fungus-growing ants, are now available for studying the population genetics and colony kin-structure of these ants....

Microsatellite Primers for Fungus-Growing Ants

DEFF Research Database (Denmark)

Villesen Fredsted, Palle; Gertsch, Pia J.; Boomsma, Jacobus Jan (Koos)

2002-01-01

We isolated five polymorphic microsatellite loci from a library of two thousand recombinant clones of two fungus-growing ant species, Cyphomyrmex longiscapus and Trachymyrmex cf. zeteki. Amplification and heterozygosity were tested in five species of higher attine ants using both the newly...... developed primers and earlier published primers that were developed for fungus-growing ants. A total of 20 variable microsatellite loci, developed for six different species of fungus-growing ants, are now available for studying the population genetics and colony kin-structure of these ants....

A physicists guide to The Los Alamos Primer

International Nuclear Information System (INIS)

Reed, B Cameron

2016-01-01

In April 1943, a group of scientists at the newly established Los Alamos Laboratory were given a series of lectures by Robert Serber on what was then known of the physics and engineering issues involved in developing fission bombs. Serber’s lectures were recorded in a 24 page report titled The Los Alamos Primer , which was subsequently declassified and published in book form. This paper describes the background to the Primer and analyzes the physics contained in its 22 sections. The motivation for this paper is to provide a firm foundation of the background and contents of the Primer for physicists interested in the Manhattan Project and nuclear weapons. (invited comment)

Building Evacuation with Mobile Devices

OpenAIRE

Merkel, Sabrina

2014-01-01

The rapidly growing world population and increasingly dense settlements demand ever-larger and more complex buildings from today's engineers. In comparison to this technological progress, a building's equipment for emergency evacuation has been hardly developed further. This work presents a concept for a building evacuation system based on mobile devices. Furthermore, various algorithms for route planning with mobile devices and for indoor localization of mobile devices are addressed.

Clinical outcomes of patient mobility in a neuroscience intensive care unit.

Science.gov (United States)

Mulkey, Malissa; Bena, James F; Albert, Nancy M

2014-06-01

Patients treated in a neuroscience intensive care unit (NICU) are often viewed as too sick to tolerate physical activity. In this study, mobility status in NICU was assessed, and factors and outcomes associated with mobility were examined. Using a prospective design, daily mobility status, medical history, demographics, Acute Physiology and Chronic Health Evaluation (APACHE) III score, and clinical outcomes were collected by medical records and database review. Depression, anxiety, and hostility were assessed before NICU discharge. Analyses included comparative statistics and multivariable modeling. In 228 unique patients, median (minimum, maximum) age was 64.0 (20, 95) years, 66.4% were Caucasian, and 53.6% were men. Of 246 admissions, median NICU stay was 4 (1, 61) days; APACHE III score was 56 (16, 145). Turning, range of motion, and head of bed of >30° were uniformly applied (n = 241), but 94 patients (39%) never progressed; 94 (39%) progressed to head of bed of >45° or dangling legs, 29 (12%) progressed to standing or pivoting to chair, and 24 (10%) progressed to walking. Female gender (p = .019), mechanical ventilation (p Psychological profile characteristics were not associated with mobility level. Nearly 40% of patients never progressed beyond bed movement, and only 10% walked. Although limited mobility progression was not associated with many patient factors, it was associated with poorer clinical outcomes. Implementation and evaluation of a progressive mobility protocol are needed in NICU patients. For more insights from the authors, see Supplemental Digital Content 1, at http://link.lww.com/JNN/A10.

ANALISIS FAKTOR-FAKTOR YANG MEMPENGARUHI KONSUMEN DALAM MEMILIH MOBIL MERK TOYOTA RUSH PADA PT. HADJI KALLA CABANG URIP SUMIHARJO MAKASSAR

OpenAIRE

PRABUANA H.P, MOCH.

2013-01-01

2012 Penelitian ini bertujuan untuk menganalisis Pengaruh Faktor bauran Bauran pemasaran (marketing mix) terhadap keputusan pembelian mobil merek Toyota Rush pada PT. Hadji Kalla cabang Urip Sumiharjo Makassar. Data penelitian ini diperoleh dari kuisioner (primer) dan beberapa observasi serta wawancara langsung dengan pihak terkait dengan produk mobil Toyota Rush. Temuan penelitian ini menunjukkan bahwa variabel bauran pemasaran yang terdiri dari faktor Produk (kualitas), Harga, promosi, d...

Programa de acompañamiento para estudiantes de primer ingreso : Marco de referencia y propuesta de trabajo para primer semestre de 2002

OpenAIRE

Chinchilla-Brenes, Sonia; Sánchez-Oller, Sylvia

2001-01-01

Proyecto de Investigación El problema de la deserción estudiantil es un fenómeno mundial que involucra principalmente a alumnos de primer ingreso a los centros educativos y de manera particular a las instituciones de educación superior las cuales reportan índices de deserción de alrededor del 30% en el primer año. Ante esta situación se hace necesaria la atención de la población de primer ingreso con programas específicos que acompañen a los y las estudiantes en este proceso de ajuste al m...

RUCS: Rapid identification of PCR primers for unique core sequences

DEFF Research Database (Denmark)

Thomsen, Martin Christen Frølund; Hasman, Henrik; Westh, Henrik

2017-01-01

Designing PCR primers to target a specific selection of whole genome sequenced strains can be a long, arduous, and sometimes impractical task. Such tasks would benefit greatly from an automated tool to both identify unique targets, and to validate the vast number of potential primer pairs...... for the targets in silico . Here we present RUCS, a program that will find PCR primer pairs and probes for the unique core sequences of a positive genome dataset complement to a negative genome dataset. The resulting primer pairs and probes are in addition to simple selection also validated through a complex...... in silico PCR simulation. We compared our method, which identifies the unique core sequences, against an existing tool called ssGeneFinder, and found that our method was 6.5-20 times more sensitive. We used RUCS to design primer pairs that would target a set of genomes known to contain the mcr-1 colistin...

Mobile communications – on standards, classifications and generations

DEFF Research Database (Denmark)

Tadayoni, Reza; Henten, Anders; Sørensen, Jannick Kirk

2018-01-01

The research question addressed in this paper is concerned with the manners in which the general technological progress in mobile communications is characterized and the reasons for the differences in these modes of manifestation. The relevance of this research question is that the different......, the paper discusses the role of the International Telecommunication Union (ITU) in the processes of mobile standardization. In common parlance, progress in mobile technologies is mostly referred to as generations. In ITU, the classification terminology is that of International Mobile Telecommunication (IMT......) standards. In the specialized standards body with a central position in the standardization of core mobile technologies, namely 3GPP (3rd Generation Partnership Project), the terminology of ‘releases’ is used. In order to address the research question, the paper uses an analytical framework based...

Do we need primer for orthodontic bonding? A randomized controlled trial.

Science.gov (United States)

Nandhra, Sarabjit Singh; Littlewood, Simon J; Houghton, Nadine; Luther, Friedy; Prabhu, Jagadish; Munyombwe, Theresa; Wood, Simon R

2015-04-01

To evaluate the clinical performance of APC™II Victory Series™ (3M Unitek) brackets in direct orthodontic bonding with and without the use of primer. A single-operator, two-centre prospective, non-inferiority randomized controlled clinical trial. The Orthodontic departments at the Leeds Dental Institute and St Luke's Hospital, Bradford, UK. Ethical approval was granted by Leeds (East) Research Ethics Committee on 18th of December 2009 (Reference 09/H1306/102). The protocol was not published prior to trial commencement. Ninety-two patients requiring orthodontic treatment with fixed appliances were randomly allocated to the control (bonded with primer) or test groups (bonded without primer). Patients were randomly allocated to either the control or experimental group. This was performed by preparing opaque numbered sealed envelopes in advance using a random numbers table generated by a computer by an independent third party . Once the envelopes were opened, blinding of the operator and the patient was no longer possible due to the nature of the intervention. Patients were approached for inclusion in the trial if they qualified for NHS orthodontic treatment requiring fixed appliances and had no previous orthodontic treatment. Number of bracket failures, time to bond-up appliances, and the adhesive remnant index (ARI) when bracket failure occurred, over a 12-month period Failure rate with primer was 11.1 per cent and without primer was 15.8 per cent. Bonding without primer was shown statistically to be non-inferior to bonding with primer odds ratio 0.95-2.25 (P = 0.08). Mean difference in bond-up time per bracket was 0.068 minutes (4 seconds), which was not statistically significant (P = 0.402). There was a statistically significant difference in the Adhesive Remnant Index - ARI 0 with primer 49.4 per cent, no primer 76.5 per cent, (P failure rate of 2% to be clinically significant. When bonding with APC™II Victory Series™ brackets without primer was shown

Primer on consumer marketing research : procedures, methods, and tools

Science.gov (United States)

1994-03-01

The Volpe Center developed a marketing research primer which provides a guide to the approach, procedures, and research tools used by private industry in predicting consumer response. The final two chapters of the primer focus on the challenges of do...

Optimization of ISSR-PCR reaction system and selection of primers in Bryum argenteum

Directory of Open Access Journals (Sweden)

Ma Xiaoying

2017-02-01

Full Text Available In order to determine optimum ISSR-PCR reaction system for moss Bryum argenteum,the concentrations of template DNA primers,dNTPs,Mg2+ and Taq DNA polymerase were optimized in four levels by PCR orthogonal experimental method. The appropriate primers were screened from 100 primers by temperature gradient PCR,and the optimal anneal temperature of the screened primers were determined. The results showed that the optimized 20 μL ISSR-PCR reaction system was as follows:template DNA 20 ng/20 μL,primers 0.45 μmol/L,Mg2+2.65 mmol/L,Taq DNA polymerase 0.4 U/20 μL,dNTPs 0.45 mmol/L. Using this system,50 primers with clear bands,repeatability well and polymorphism highly were selected from 100 primers. The establishment of this system,the screened primers and the annealing temperature could provide a theoretical basis for further research on the genetic diversity of bryophytes using ISSR molecular markers.

Disclosing bias in bisulfite assay: MethPrimers underestimate high DNA methylation.

Directory of Open Access Journals (Sweden)

Andrea Fuso

Full Text Available Discordant results obtained in bisulfite assays using MethPrimers (PCR primers designed using MethPrimer software or assuming that non-CpGs cytosines are non methylated versus primers insensitive to cytosine methylation lead us to hypothesize a technical bias. We therefore used the two kinds of primers to study different experimental models and methylation statuses. We demonstrated that MethPrimers negatively select hypermethylated DNA sequences in the PCR step of the bisulfite assay, resulting in CpG methylation underestimation and non-CpG methylation masking, failing to evidence differential methylation statuses. We also describe the characteristics of "Methylation-Insensitive Primers" (MIPs, having degenerated bases (G/A to cope with the uncertain C/U conversion. As CpG and non-CpG DNA methylation patterns are largely variable depending on the species, developmental stage, tissue and cell type, a variable extent of the bias is expected. The more the methylome is methylated, the greater is the extent of the bias, with a prevalent effect of non-CpG methylation. These findings suggest a revision of several DNA methylation patterns so far documented and also point out the necessity of applying unbiased analyses to the increasing number of epigenomic studies.

Criticality calculations with MCNP trademark: A primer

International Nuclear Information System (INIS)

Harmon, C.D. II; Busch, R.D.; Briesmeister, J.F.; Forster, R.A.

1994-01-01

With the closure of many experimental facilities, the nuclear criticality safety analyst increasingly is required to rely on computer calculations to identify safe limits for the handling and storage of fissile materials. However, in many cases, the analyst has little experience with the specific codes available at his/her facility. This primer will help you, the analyst, understand and use the MCNP Monte Carlo code for nuclear criticality safety analyses. It assumes that you have a college education in a technical field. There is no assumption of familiarity with Monte Carlo codes in general or with MCNP in particular. Appendix A gives an introduction to Monte Carlo techniques. The primer is designed to teach by example, with each example illustrating two or three features of MCNP that are useful in criticality analyses. Beginning with a Quickstart chapter, the primer gives an overview of the basic requirements for MCNP input and allows you to run a simple criticality problem with MCNP. This chapter is not designed to explain either the input or the MCNP options in detail; but rather it introduces basic concepts that are further explained in following chapters. Each chapter begins with a list of basic objectives that identify the goal of the chapter, and a list of the individual MCNP features that are covered in detail in the unique chapter example problems. It is expected that on completion of the primer you will be comfortable using MCNP in criticality calculations and will be capable of handling 80 to 90 percent of the situations that normally arise in a facility. The primer provides a set of basic input files that you can selectively modify to fit the particular problem at hand

UniPrime2: a web service providing easier Universal Primer design.

Science.gov (United States)

Boutros, Robin; Stokes, Nicola; Bekaert, Michaël; Teeling, Emma C

2009-07-01

The UniPrime2 web server is a publicly available online resource which automatically designs large sets of universal primers when given a gene reference ID or Fasta sequence input by a user. UniPrime2 works by automatically retrieving and aligning homologous sequences from GenBank, identifying regions of conservation within the alignment, and generating suitable primers that can be used to amplify variable genomic regions. In essence, UniPrime2 is a suite of publicly available software packages (Blastn, T-Coffee, GramAlign, Primer3), which reduces the laborious process of primer design, by integrating these programs into a single software pipeline. Hence, UniPrime2 differs from previous primer design web services in that all steps are automated, linked, saved and phylogenetically delimited, only requiring a single user-defined gene reference ID or input sequence. We provide an overview of the web service and wet-laboratory validation of the primers generated. The system is freely accessible at: http://uniprime.batlab.eu. UniPrime2 is licenced under a Creative Commons Attribution Noncommercial-Share Alike 3.0 Licence.

Optimal pcr primers for rapid and accurate detection of Aspergillus flavus isolates.

Science.gov (United States)

Al-Shuhaib, Mohammed Baqur S; Albakri, Ali H; Alwan, Sabah H; Almandil, Noor B; AbdulAzeez, Sayed; Borgio, J Francis

2018-03-01

Aspergillus flavus is among the most devastating opportunistic pathogens of several food crops including rice, due to its high production of carcinogenic aflatoxins. The presence of these organisms in economically important rice strip farming is a serious food safety concern. Several polymerase chain reaction (PCR) primers have been designed to detect this species; however, a comparative assessment of their accuracy has not been conducted. This study aims to identify the optimal diagnostic PCR primers for the identification of A. flavus, among widely available primers. We isolated 122 A. flavus native isolates from randomly collected rice strips (N = 300). We identified 109 isolates to the genus level using universal fungal PCR primer pairs. Nine pairs of primers were examined for their PCR diagnostic specificity on the 109 isolates. FLA PCR was found to be the optimal PCR primer pair for specific identification of the native isolates, over aflP(1), aflM, aflA, aflD, aflP(3), aflP(2), and aflR. The PEP primer pair was found to be the most unsuitable for A. flavus identification. In conclusion, the present study indicates the powerful specificity of the FLA PCR primer over other commonly available diagnostic primers for accurate, rapid, and large-scale identification of A. flavus native isolates. This study provides the first simple, practical comparative guide to PCR-based screening of A. flavus infection in rice strips. Copyright © 2018 Elsevier Ltd. All rights reserved.

Genus-specific PCR Primers Targeting Intracellular Parasite Euduboscquella (Dinoflagellata: Syndinea)

Science.gov (United States)

Jung, Jae-Ho; Choi, Jung Min; Kim, Young-Ok

2018-03-01

We designed a genus-specific primer pair targeting the intracellular parasite Euduboscquella. To increase target specificity and inhibit untargeted PCR, two nucleotides were added at the 3' end of the reverse primer, one being a complementary nucleotide to the Euduboscquella-specific SNP (single-nucleotide polymorphism) and the other a deliberately mismatched nucleotide. Target specificity of the primer set was verified experimentally using PCR of two Euduboscquella species (positive controls) and 15 related species (negative controls composed of ciliates, diatoms and dinoflagellates), and analytical comparison with SILVA SSU rRNA gene database (release 119) in silico. In addition, we applied the Euduboscquella-specific primer set to four environmental samples previously determined by cytological staining to be either positive or negative for Euduboscquella. As expected, only positive controls and environmental samples known to contain Euduboscquella were successfully amplified by the primer set. An inferred SSU rRNA gene phylogeny placed environmental samples containing aloricate ciliates infected by Euduboscquella in a cluster discrete from Euduboscquella groups a-d previously reported from loricate, tintinnid ciliates.

Laboratory and gas-fired furnace performance tests of epoxy primers for intumescent coatings

DEFF Research Database (Denmark)

Nørgaard, Kristian Petersen; Dam-Johansen, Kim; Catala, Pere

2014-01-01

, either to ensure adhesion of the intumescent coating to the steel or to provide corrosion resistance. It is essential to document the performance of the intumescent coating together with the primer to ensure the overall quality of coating system. In the present work, two epoxy primers were used...... to a gas-fired furnace following the ISO834 fire curve (a so-called cellulosic fire), one of the primers selected performed well and the other poorly. From tests in the electrically heated oven, it was found that both primers were sensitive to the film thickness employed and the presence of oxygen....... At oxygen-rich conditions, higher primer thicknesses gave weaker performance. In addition, a color change from red to black was observed in nitrogen, while the color remained red in the oxygen-nitrogen mixture. In summary, the results suggest that an adequate choice of primer, primer thickness...

A database of PCR primers for the chloroplast genomes of higher plants

Science.gov (United States)

Heinze, Berthold

2007-01-01

Background Chloroplast genomes evolve slowly and many primers for PCR amplification and analysis of chloroplast sequences can be used across a wide array of genera. In some cases 'universal' primers have been designed for the purpose of working across species boundaries. However, the essential information on these primer sequences is scattered throughout the literature. Results A database is presented here which assembles published primer information for chloroplast DNA. Additional primers were designed to fill gaps where little or no primer information could be found. Amplicons are either the genes themselves (typically useful in studies of sequence variation in higher-order phylogeny) or they are spacers, introns, and intergenic regions (for studies of phylogeographic patterns within and among species). The current list of 'generic' primers consists of more than 700 sequences. Wherever possible, we give the locations of the primers in the thirteen fully sequenced chloroplast genomes (Nicotiana tabacum, Atropa belladonna, Spinacia oleracea, Arabidopsis thaliana, Populus trichocarpa, Oryza sativa, Pinus thunbergii, Marchantia polymorpha, Zea mays, Oenothera elata, Acorus calamus, Eucalyptus globulus, Medicago trunculata). Conclusion The database described here is designed to serve as a resource for researchers who are venturing into the study of poorly described chloroplast genomes, whether for large- or small-scale DNA sequencing projects, to study molecular variation or to investigate chloroplast evolution. PMID:17326828

A database of PCR primers for the chloroplast genomes of higher plants

Directory of Open Access Journals (Sweden)

Heinze Berthold

2007-02-01

Full Text Available Abstract Background Chloroplast genomes evolve slowly and many primers for PCR amplification and analysis of chloroplast sequences can be used across a wide array of genera. In some cases 'universal' primers have been designed for the purpose of working across species boundaries. However, the essential information on these primer sequences is scattered throughout the literature. Results A database is presented here which assembles published primer information for chloroplast DNA. Additional primers were designed to fill gaps where little or no primer information could be found. Amplicons are either the genes themselves (typically useful in studies of sequence variation in higher-order phylogeny or they are spacers, introns, and intergenic regions (for studies of phylogeographic patterns within and among species. The current list of 'generic' primers consists of more than 700 sequences. Wherever possible, we give the locations of the primers in the thirteen fully sequenced chloroplast genomes (Nicotiana tabacum, Atropa belladonna, Spinacia oleracea, Arabidopsis thaliana, Populus trichocarpa, Oryza sativa, Pinus thunbergii, Marchantia polymorpha, Zea mays, Oenothera elata, Acorus calamus, Eucalyptus globulus, Medicago trunculata. Conclusion The database described here is designed to serve as a resource for researchers who are venturing into the study of poorly described chloroplast genomes, whether for large- or small-scale DNA sequencing projects, to study molecular variation or to investigate chloroplast evolution.

Evaluating primers for profiling anaerobic ammonia oxidizing bacteria within freshwater environments.

Directory of Open Access Journals (Sweden)

Puntipar Sonthiphand

Full Text Available Anaerobic ammonia oxidizing (anammox bacteria play an important role in transforming ammonium to nitrogen gas and contribute to fixed nitrogen losses in freshwater environments. Understanding the diversity and abundance of anammox bacteria requires reliable molecular tools, and these are not yet well established for these important Planctomycetes. To help validate PCR primers for the detection of anammox bacteria within freshwater ecosystems, we analyzed representative positive controls and selected samples from Grand River and groundwater sites, both from Ontario, Canada. The objectives of this study were to identify a suitable anammox denaturing gradient gel electrophoresis (DGGE fingerprint method by using GC-clamp modifications to existing primers, and to verify the specificity of anammox-specific primers used for DGGE, cloning and qPCR methods. Six primer combinations were tested from four published primer sets (i.e. A438f/A684r, Amx368f/Amx820r, An7f/An1388r, and Pla46/1392r for both direct and nested PCR amplifications. All PCR products were run subsequently on DGGE gels to compare the resulting patterns. Two anammox-specific primer combinations were also used to generate clone libraries and quantify anammox bacterial 16S rRNA genes with qPCR. The primer set A438f/A684r was highly specific to anammox bacteria, provided reliable DGGE fingerprints and generated a high proportion of anammox-related clones. A second primer set (Amx368f/Amx820r was anammox specific, based on clone library analysis, but PCR products from different candidate species of anammox bacteria resolved poorly using DGGE analysis. Both DGGE and cloning results revealed that Ca. Brocadia and an uncharacterized anammox bacterial cluster represented the majority of anammox bacteria found in Grand River sediment and groundwater samples, respectively. Together, our results demonstrate that although Amx368f/Amx820r was useful for anammox-specific qPCR and clone library

The ability of T2/B4 primers to detect Leishmania infantum among ...

African Journals Online (AJOL)

SERVER

2008-04-03

Apr 3, 2008 ... Reverse Primer (5`-CCT CTC TTT TTT CNC TGT GC-3`). (Schönian et al., 1996),. B. Forward Primer (RV1) (5`-GTG GGG GAG GGG CGT TCT-3`) and Reverse Primer (RV2) (5`-ATT TTA CAC CAA CCC CCA GTT-. 3`) (Lachaud et al., 2002; Reale et al., 1999),. C. Forward Primer (T2) (5`-CGG CTT CGC ...

Mobilization and Counter-mobilization Against LGBT Rights. Conservative Responses to the Recognition of Human Rights

Directory of Open Access Journals (Sweden)

Jairo Antonio López Pacheco

2017-10-01

Full Text Available This article analyzes the counter-mobilization against the institutionalization of lgbt rights in Colombia and Mexico. From an analytical framework that integrates the dimension of mobilization and counter-mobilization in the conflicts for rights, we show that the conservative reaction in Colombia and Mexico is a coordinated and active response against the conquests of sexual minorities, led by the churches, which has slowed the progress of effective recognition of human rights. We have identified similar strategies of mobilization of demand frameworks, mobilization structures and collective action repertories in both cases that have raised the political costs of institutional changes through two mechanisms of conflict: street and electoral activism and institutional activism.

Universal primers that amplify RNA from all three flavivirus subgroups

Directory of Open Access Journals (Sweden)

Barnard Ross T

2008-01-01

Full Text Available Abstract Background Species within the Flavivirus genus pose public health problems around the world. Increasing cases of Dengue and Japanese encephalitis virus in Asia, frequent outbreaks of Yellow fever virus in Africa and South America, and the ongoing spread of West Nile virus throughout the Americas, show the geographical burden of flavivirus diseases. Flavivirus infections are often indistinct from and confused with other febrile illnesses. Here we review the specificity of published primers, and describe a new universal primer pair that can detect a wide range of flaviviruses, including viruses from each of the recognised subgroups. Results Bioinformatic analysis of 257 published full-length Flavivirus genomes revealed conserved regions not previously targeted by primers. Two degenerate primers, Flav100F and Flav200R were designed from these regions and used to generate an 800 base pair cDNA product. The region amplified encoded part of the methyltransferase and most of the RNA-dependent-RNA-polymerase (NS5 coding sequence. One-step RT-PCR testing was successful using standard conditions with RNA from over 60 different flavivirus strains representing about 50 species. The cDNA from each virus isolate was sequenced then used in phylogenetic analyses and database searches to confirm the identity of the template RNA. Conclusion Comprehensive testing has revealed the broad specificity of these primers. We briefly discuss the advantages and uses of these universal primers.

Primers for phylogeny reconstruction in Bignonieae (Bignoniaceae) using herbarium samples.

Science.gov (United States)

Zuntini, Alexandre R; Fonseca, Luiz Henrique M; Lohmann, Lúcia G

2013-09-01

New primers were developed for Bignonieae to enable phylogenetic studies within this clade using herbarium samples. • Internal primers were designed based on available sequences of the plastid ndhF gene and the rpl32-trnL intergenic spacer region, and the nuclear gene PepC. The resulting primers were used to amplify DNA extracted from herbarium materials. High-quality data were obtained from herbarium samples up to 53 yr old. • The standardized methodology allows the inclusion of herbarium materials as alternative sources of DNA for phylogenetic studies in Bignonieae.

Mobile communications – on standards, classifications and generations

DEFF Research Database (Denmark)

Tadayoni, Reza; Henten, Anders; Sørensen, Jannick Kirk

The research question addressed in this paper is concerned with the manners in which the general technological progress in mobile communications is presented and the reasons for the differences in these manners of presentation. The relevance of this research question is that the different....... In common parlance, progress in mobile technologies is mostly referred to as generations. In the International Telecommunication Union (ITU), the classification terminology is that of International Mobile Telecommunication (IMT) standards. In the specialized standards body with a central position...... in the standardization of core mobile technologies, namely 3GPP (3rd Generation Partnership Project), the terminology of ‘releases’ is used. In order to address the research question, the paper uses an analytical framework based on the differences and relationships between the concepts of standards, classifications...

Facial primer provides immediate and long-term improvements in mild-to-moderate facial hyperpigmentation and fine lines associated with photoaging

Directory of Open Access Journals (Sweden)

Roberts WE

2015-09-01

Full Text Available Wendy E Roberts,1 Lily I Jiang,2 James H Herndon Jr3 1Generational and Cosmetic Dermatology, Rancho Mirage, CA, 2Thomas J Stephens and Associates, Richardson, 3Dermatology Center of Dallas, Dallas, TX, USA Background: Photoaged skin results from various environmental factors, most importantly chronic sun exposure. Dyschromia and fine lines/wrinkles are common clinical manifestations of photodamaged skin. Purpose: This single-center clinical trial was conducted to assess the efficacy and tolerability of a new multifunctional facial primer (camouflage, broad-spectrum SPF 50, and a treatment for hyperpigmentation when used by females with mild-to-moderate facial hyperpigmentation and fine lines due to photoaging over a course of 12 weeks. Patients and methods: Subjects were provided test material (Even Up-Clinical Pigment Perfector and supporting products to use on their face and neck. Products were used according to specific application instructions. Clinical grading for efficacy and tolerability assessments were performed by an expert grader at baseline, baseline (post-application primer, week 4, week 8, week 12, and week 12 (post-application primer. Standardized digital photographs were taken, and self-assessment questionnaires were conducted. Results: Twenty-eight female subjects completed the 12-week trial. The facial primer improved scores for the appearance of hyperpigmentation and other photoaging parameters immediately after the first application. The treatment also showed a progressive improvement in the clinical assessment of hyperpigmentation and other photoaging parameters over the 12-week trial. These long-term benefits can be attributed to an improvement in the underlying skin condition. The facial primer was well tolerated. Subject questionnaires showed that the product was highly rated at all visits. Conclusion: The facial primer was shown to be effective and well tolerated for immediate and long-term improvement in the appearance

Mobile X-ray radiographic systems

International Nuclear Information System (INIS)

Buchmann, F.

1990-01-01

Mobile X-ray radiography equipment consists of the X-ray source with the generator and the switching and control devices, mounted on a mobile unit for transport to the patient to be examined. These mobile systems, just as the stationary equipment, have been profiting from the technological progress made in the area of X-ray generation, and the considerable improvements thus achieved have altered not only the value of these systems, but also their applicability which frequently comes near that of stationary equipment. (orig./GDG) [de

Pengembangan Sejumlah Primer untuk Reverse Transcriptase Polymerase Chain Reaction Guna Melacak Virus Flu Burung di Indonesia (DEVELOPMENt OF PRIMERS FOR REVERSE TRANSCRIPTASE POLYMERASE CHAIN REACTION TO DETECT AVIAN INFLUENZA VIRUS IN INDONESIA

Directory of Open Access Journals (Sweden)

Ni Luh Putu Indi Dharmayanti

2016-07-01

Full Text Available Until recently, two clades of of avian influenza viruses (AIVs designated as 2.3.2 and 2.2.3 havebeen circulating in Indonesia. Mutations of AIV genes have cretaed many more variants of the virus. It istherefore important to evaluate the appropriate methods used for the detection and diagnosis of AI virusin the field. Reverse Transcriptase-Polymerase Chain Reaction (RT-PCR have been used as a standardmethod for detection of AIV in many laboratories in Indonesia. The success of RT-PCR for detection ofAIV virus is dependent on the nucleotide sequences of primer that match with the circulating of AIVs. Theaims of this study was to develop RT-PCR by designing primers for H5 subtype specific to the circulatingAIVs in the field. The primers were designed using Primer Design software, and optimization andvalidation of the primer were conducted using AIVs that have been characterized in the previous study.The primers were then used RT-PCR using AIV isolates from field samples and their sensitivity andspecificity were then determined. The results showed that the H5 primers designed in this study, H5-IDand H5-NLP, was able to detect the AIVs in field samples better than the H5-specific primers have beenused previously. In conclusion, H5 primers designed based on recent viruses in the field showed betterresults in the detection of AI virus as compared to the previous primers. As AIV-H5N1 subtype in the fieldwill continue to change and evolve, the use of primers designed in this study is recommended for diagnosisof H5 AIV.

Design of a Percussion and Electric Primer Gun Firing Power Supply

Science.gov (United States)

2014-07-01

solenoid failure. As new instrumentation techniques such as high-speed video and laser interferometry have been introduced into our gun testing...to drive a solenoid into a percussion primer or ignite the M52A3B1 electric primer. To reduce power requirements, it uses charged capacitor banks to...drive the solenoid or ignite the primer. This report details the design and construction of the power supplies. 15. SUBJECT TERMS power supply

Transferability of retrotransposon primers derived from Persimmon (Diospyros kaki Thunb.) across other plant species.

Science.gov (United States)

Du, X Y; Hu, Q N; Zhang, Q L; Wang, Y B; Luo, Z R

2013-06-06

Retrotransposon-based molecular markers are powerful molecular tools. However, these markers are not readily available due to the difficulty in obtaining species-specific retrotransposon primers. Although recent techniques enabling the rapid isolation of retrotransposon sequences have facilitated primer development, this process nonetheless remains time-consuming and costly. Therefore, research into the transferability of retrotransposon primers developed from one plant species onto others would be of great value. The present study investigated the transferability of retrotransposon primers derived from 'Luotian-tianshi' persimmon (Diospyros kaki Thunb.) across other fruit crops, as well as within the genus using inter-retrotransposon amplified polymorphism molecular marker. Fourteen of the 26 retrotransposon primers tested (53.85%) produced robust and reproducible amplification products across all fruit crops tested, indicating their applicability across plant species. Four of the 13 fruit crops showed the best transferability performances: persimmon, grape, citrus, and peach. Furthermore, similarity coefficients and UPGMA clustering indicated that these primers could further offer a potential tool for germplasm differentiation, parentage identification, genetic diversity assessment, classification, and phylogenetic studies across a variety of plant species. Transferability was further confirmed by examining published primers derived from Rosaceae, Gramineae, and Solanaceae. This study is one of the few currently available studies concerning the transferability of retrotransposon primers across plant species in general, and is the first successful study of the transferability of retrotransposon primers derived from persimmon. The primers presented here will help reduce costs for future retrotransposon primer development and therefore contribute to the popularization of retrotransposon molecular markers.

Comparison of shear bond strength of orthodontic brackets using various zirconia primers.

Science.gov (United States)

Lee, Ji-Yeon; Kim, Jin-Seok; Hwang, Chung-Ju

2015-07-01

The aim of this study was to compare the shear bond strength (SBS) of orthodontic brackets bonded to zirconia surfaces using three different zirconia primers and one silane primer, and subjected to thermocycling. We designed 10 experimental groups following the surface treatment and thermocycling. The surface was treated with one of the following method: no-primer (NP), Porcelain Conditioner (PC), Z-PRIME Plus (ZP), Monobond Plus (MP) and Zirconia Liner Premium (ZL) (n=20). Then each group was subdivided to non-thermocycled and thermocycled groups (NPT, PC, ZPT, MPT, ZLT) (n=10). Orthodontic brackets were bonded to the specimens using Transbond™ XT Paste and light cured for 15 s at 1,100 mW/cm(2). The SBS was measured at a 1 mm/min crosshead speed. The failure mode was assessed by examination with a stereomicroscope and the amount of bonding resin remaining on the zirconia surface was scored using the modified adhesive remnant index (ARI). The SBS of all experimental groups decreased after thermocycling. Before thermocycling, the SBS was ZL, ZP ≥ MP ≥ PC > NP but after thermocycling, the SBS was ZLT ≥ MPT ≥ ZPT > PCT = NPT (p > 0.05). For the ARI score, both of the groups lacking primer (NP and NPT) displayed adhesive failure modes, but the groups with zirconia primers (ZP, ZPT, MP, MPT, ZL, and ZLT) were associated with mixed failure modes. Surface treatment with a zirconia primer increases the SBS relative to no-primer or silane primer application between orthodontic brackets and zirconia prostheses.

Bioinformatic tools for PCR Primer design

African Journals Online (AJOL)

ES

Bioinformatics is an emerging scientific discipline that uses information ... complex biological questions. ... and computer programs for various purposes of primer ..... polymerase chain reaction: Human Immunodeficiency Virus 1 model studies.

Within- and Cross-Firm Mobility and Earnings Growth

DEFF Research Database (Denmark)

Frederiksen, Anders; Halliday, Timothy; Koch, Alexander Karl

It is widely accepted that promotions within firms and mobility across firms lead to significant earnings progression. Existing research generally examined cross-firm mobility separately from hierarchical advancement. Yet, as our descriptive evidence from Danish panel data shows, how the two type...... growth of promotions (either within or across firms) and subsequent mobility at a higher hierarchy level....

Primers for Phylogeny Reconstruction in Bignonieae (Bignoniaceae Using Herbarium Samples

Directory of Open Access Journals (Sweden)

Alexandre R. Zuntini

2013-08-01

Full Text Available Premise of the study: New primers were developed for Bignonieae to enable phylogenetic studies within this clade using herbarium samples. Methods and Results: Internal primers were designed based on available sequences of the plastid ndhF gene and the rpl32-trnL intergenic spacer region, and the nuclear gene PepC. The resulting primers were used to amplify DNA extracted from herbarium materials. High-quality data were obtained from herbarium samples up to 53 yr old. Conclusions: The standardized methodology allows the inclusion of herbarium materials as alternative sources of DNA for phylogenetic studies in Bignonieae.

Real-time PCR (qPCR) primer design using free online software.

Science.gov (United States)

Thornton, Brenda; Basu, Chhandak

2011-01-01

Real-time PCR (quantitative PCR or qPCR) has become the preferred method for validating results obtained from assays which measure gene expression profiles. The process uses reverse transcription polymerase chain reaction (RT-PCR), coupled with fluorescent chemistry, to measure variations in transcriptome levels between samples. The four most commonly used fluorescent chemistries are SYBR® Green dyes and TaqMan®, Molecular Beacon or Scorpion probes. SYBR® Green is very simple to use and cost efficient. As SYBR® Green dye binds to any double-stranded DNA product, its success depends greatly on proper primer design. Many types of online primer design software are available, which can be used free of charge to design desirable SYBR® Green-based qPCR primers. This laboratory exercise is intended for those who have a fundamental background in PCR. It addresses the basic fluorescent chemistries of real-time PCR, the basic rules and pitfalls of primer design, and provides a step-by-step protocol for designing SYBR® Green-based primers with free, online software. Copyright © 2010 Wiley Periodicals, Inc.

A Hearing Aid Primer 1

Science.gov (United States)

Yetter, Carol J.

2009-01-01

This hearing aid primer is designed to define the differences among the three levels of hearing instrument technology: conventional analog circuit technology (most basic), digitally programmable/analog circuit technology (moderately advanced), and fully digital technology (most advanced). Both moderate and advanced technologies mean that hearing…

DNA Extraction and Primer Selection

DEFF Research Database (Denmark)

Karst, Søren Michael; Nielsen, Per Halkjær; Albertsen, Mads

Talk regarding pitfalls in DNA extraction and 16S amplicon primer choice when performing community analysis of complex microbial communities. The talk was a part of Workshop 2 "Principles, Potential, and Limitations of Novel Molecular Methods in Water Engineering; from Amplicon Sequencing to -omics...

A classical primer for QCD

International Nuclear Information System (INIS)

Moriyasu, K.

1981-01-01

A basic primer for QCD is presented using a semiclassical approach to the colour Maxwell equations. The non-Abelian nature of colour symmetry and the violation of superposition by colour fields is compared with QED. A simple discussion of asymptotic freedom is also presented. (author)

GETPrime: a gene- or transcript-specific primer database for quantitative real-time PCR.

Science.gov (United States)

Gubelmann, Carine; Gattiker, Alexandre; Massouras, Andreas; Hens, Korneel; David, Fabrice; Decouttere, Frederik; Rougemont, Jacques; Deplancke, Bart

2011-01-01

The vast majority of genes in humans and other organisms undergo alternative splicing, yet the biological function of splice variants is still very poorly understood in large part because of the lack of simple tools that can map the expression profiles and patterns of these variants with high sensitivity. High-throughput quantitative real-time polymerase chain reaction (qPCR) is an ideal technique to accurately quantify nucleic acid sequences including splice variants. However, currently available primer design programs do not distinguish between splice variants and also differ substantially in overall quality, functionality or throughput mode. Here, we present GETPrime, a primer database supported by a novel platform that uniquely combines and automates several features critical for optimal qPCR primer design. These include the consideration of all gene splice variants to enable either gene-specific (covering the majority of splice variants) or transcript-specific (covering one splice variant) expression profiling, primer specificity validation, automated best primer pair selection according to strict criteria and graphical visualization of the latter primer pairs within their genomic context. GETPrime primers have been extensively validated experimentally, demonstrating high transcript specificity in complex samples. Thus, the free-access, user-friendly GETPrime database allows fast primer retrieval and visualization for genes or groups of genes of most common model organisms, and is available at http://updepla1srv1.epfl.ch/getprime/. Database URL: http://deplanckelab.epfl.ch.

Tools for Ultraspecific Probe/Primer Design

National Research Council Canada - National Science Library

Fofanov, Yurly

2006-01-01

.... Our approach will deliver DNA probes and PCR primers that have an unprecedentedly low probability of false positives or confusion by environmental background, and which resist evasion by threat agent engineering...

Diversity of internal structures in inhibited epoxy primers

Directory of Open Access Journals (Sweden)

Anthony E. Hughes

2015-10-01

Full Text Available Computed tomography is making a significant impact in the field of materials science in recent years. In this paper the authors report on advances made in three areas of characterization and also identified where further research needs to be focused. First we report on a new approach to data analysis called “Data Constrained Modelling (DCM” in which compositional tomography can be undertaken rather than adsorption or phase contrast tomography. This is achieved by collecting X-ray CT data at different energies and then combining the datasets to reconstruct 3D compositional tomography. Second, on the application of this approach to inhibited primers typical of those used in the aerospace industry. Aerospace primers are effectively composite materials containing inorganic phases which are bound together with a polymer. Understanding the materials science of these systems requires information over several orders of magnitude in length-scale. In this paper we report on how DCM can be used to extend our understanding at the smaller length scales at the limits of resolution of the technique. The third and final advance is in extending the approach to include 4-dimensional studies. In this case we examine the primer before and after leaching. This process causes changes in the primer which can be both detected and quantified using the above approach.

Preparation and Characterization of Acrylic Primer for Concrete Substrate Application

Directory of Open Access Journals (Sweden)

El-Sayed Negim

2016-01-01

Full Text Available This study dealt with the properties of acrylic primer for concrete substrate using acrylic syrup, made from a methyl methacrylate monomer solution of terpolymers. Terpolymer systems consisting of methyl methacrylate (MMA, 2-ethylhexyl acrylate (2-EHA, and methacrylic acid (MAA with different chemical composition ratios of MMA and 2-EHA were synthesized through bulk polymerization using azobisisobutyronitrile (AIBN as initiator. The terpolymer composition is characterized by FTIR, 1H NMR, DSC, TGA, and SEM. The glass transition temperature and the thermal stability increased with increasing amounts of MMA in the terpolymer backbone. The effect of chemical composition of terpolymers on physicomechanical properties of primer films was investigated. However, increasing the amount of MMA in terpolymer backbone increased tensile and contact angle of primer films while elongation at break, water absorption, and bond strength are decreased. In particular, the primer syrup containing 65% 2-EHA has good bonding strength with concrete substrate around 1.1 MPa.

Bond strength of compomers to dentin using acidic primers.

Science.gov (United States)

Tate, W H; You, C; Powers, J M

1999-10-01

To determine the in vitro bond strengths of seven compomer/bonding agent restorative systems to human dentin. Seven compomer/bonding agents were bonded to human dentin, stored in water at 37 degrees C for 24 hours, and debonded in tension. Bonding conditions were with and without phosphoric acid etching, with and without the use of combined primer/bonding agents, and under moist and wet bond interfaces. Without phosphoric acid etching, F2000/F2000 Compomer Primer/Adhesive and F2000/Single Bond Dental Adhesive System were less sensitive to dentin wetness. With moist dentin, bond strengths of Dyract/Prime & Bond 2.1, Dyract AP/Prime & Bond 2.1, Hytac/OSB light-curing, one-component bonding agent, F2000/Single Bond, and Freedom/STAE single component light-cured dentin/enamel adhesive system, were improved with phosphoric acid etching. Also, with moist dentin, the bond strength of F2000/F2000 Compomer Primer/Adhesive in the 3M Clicker dispensing system was higher without phosphoric acid etching, whereas bonds of Compoglass/Syntac Single-component were not affected by phosphoric acid etching. Bonding did not occur without primer/bonding agent, regardless of surface condition or use of phosphoric acid etching.

Performance testing of lead free primers: blast waves, velocity variations, and environmental testing

OpenAIRE

Courtney, Elya; Courtney, Amy; Summer, Peter David; Courtney, Michael

2014-01-01

Results are presented for lead free primers based on diazodinitrophenol (DDNP)compared with tests on lead styphnate based primers. First, barrel friction measurements in 5.56 mm NATO are presented. Second, shot to shot variations in blast waves are presented as determined by detonating primers in a 7.62x51mm rifle chamber with a firing pin, but without any powder or bullet loaded and measuring the blast wave at the muzzle with a high speed pressure transducer. Third, variations in primer blas...

Microsatellite Primers in the Lichen Symbiotic Alga Trebouxia decolorans (Trebouxiophyceae

Directory of Open Access Journals (Sweden)

Francesco Dal Grande

2013-03-01

Full Text Available Premise of the study: Polymorphic microsatellite markers were developed for the symbiotic green alga Trebouxia decolorans to study fine-scale population structure and clonal diversity. Methods and Results: Using Illumina pyrosequencing, 20 microsatellite primer sets were developed for T. decolorans. The primer sets were tested on 43 individuals sampled from four subpopulations in Germany. The primers amplified di-, tri-, and tetranucleotide repeats with three to 15 alleles per locus, and the unbiased haploid diversity per locus ranged from 0.636 to 0.821. Conclusions: The identified microsatellite markers will be useful to study the genetic diversity, dispersal, and reproductive mode of this common lichen photobiont.

40 CFR 63.745 - Standards: Primer and topcoat application operations.

Science.gov (United States)

2010-07-01

... CATEGORIES (CONTINUED) National Emission Standards for Aerospace Manufacturing and Rework Facilities § 63.745.../L (4.5 lb/gal) of primer (less water), as applied, for general aviation rework facilities; or 650 g... (4.5 lb/gal) of primer (less water and exempt solvents), as applied, for general aviation rework...

Employment of Near Full-Length Ribosome Gene TA-Cloning and Primer-Blast to Detect Multiple Species in a Natural Complex Microbial Community Using Species-Specific Primers Designed with Their Genome Sequences.

Science.gov (United States)

Zhang, Huimin; He, Hongkui; Yu, Xiujuan; Xu, Zhaohui; Zhang, Zhizhou

2016-11-01

It remains an unsolved problem to quantify a natural microbial community by rapidly and conveniently measuring multiple species with functional significance. Most widely used high throughput next-generation sequencing methods can only generate information mainly for genus-level taxonomic identification and quantification, and detection of multiple species in a complex microbial community is still heavily dependent on approaches based on near full-length ribosome RNA gene or genome sequence information. In this study, we used near full-length rRNA gene library sequencing plus Primer-Blast to design species-specific primers based on whole microbial genome sequences. The primers were intended to be specific at the species level within relevant microbial communities, i.e., a defined genomics background. The primers were tested with samples collected from the Daqu (also called fermentation starters) and pit mud of a traditional Chinese liquor production plant. Sixteen pairs of primers were found to be suitable for identification of individual species. Among them, seven pairs were chosen to measure the abundance of microbial species through quantitative PCR. The combination of near full-length ribosome RNA gene library sequencing and Primer-Blast may represent a broadly useful protocol to quantify multiple species in complex microbial population samples with species-specific primers.

Computational intelligence-based polymerase chain reaction primer selection based on a novel teaching-learning-based optimisation.

Science.gov (United States)

Cheng, Yu-Huei

2014-12-01

Specific primers play an important role in polymerase chain reaction (PCR) experiments, and therefore it is essential to find specific primers of outstanding quality. Unfortunately, many PCR constraints must be simultaneously inspected which makes specific primer selection difficult and time-consuming. This paper introduces a novel computational intelligence-based method, Teaching-Learning-Based Optimisation, to select the specific and feasible primers. The specified PCR product lengths of 150-300 bp and 500-800 bp with three melting temperature formulae of Wallace's formula, Bolton and McCarthy's formula and SantaLucia's formula were performed. The authors calculate optimal frequency to estimate the quality of primer selection based on a total of 500 runs for 50 random nucleotide sequences of 'Homo species' retrieved from the National Center for Biotechnology Information. The method was then fairly compared with the genetic algorithm (GA) and memetic algorithm (MA) for primer selection in the literature. The results show that the method easily found suitable primers corresponding with the setting primer constraints and had preferable performance than the GA and the MA. Furthermore, the method was also compared with the common method Primer3 according to their method type, primers presentation, parameters setting, speed and memory usage. In conclusion, it is an interesting primer selection method and a valuable tool for automatic high-throughput analysis. In the future, the usage of the primers in the wet lab needs to be validated carefully to increase the reliability of the method.

The Fluid Reading Primer: Animated Decoding Support for Emergent Readers.

Science.gov (United States)

Zellweger, Polle T.; Mackinlay, Jock D.

A prototype application called the Fluid Reading Primer was developed to help emergent readers with the process of decoding written words into their spoken forms. The Fluid Reading Primer is part of a larger research project called Fluid Documents, which is exploring the use of interactive animation of typography to show additional information in…

Targeted reduction of highly abundant transcripts using pseudo-random primers.

Science.gov (United States)

Arnaud, Ophélie; Kato, Sachi; Poulain, Stéphane; Plessy, Charles

2016-04-01

Transcriptome studies based on quantitative sequencing can estimate levels of gene expression by measuring target RNA abundance in sequencing libraries. Sequencing costs are proportional to the total number of sequenced reads, and in order to cover rare RNAs, considerable quantities of abundant and identical reads are needed. This major limitation can be addressed by depleting a proportion of the most abundant sequences from the library. However, such depletion strategies involve either extra handling of the input RNA sample or use of a large number of reverse transcription primers, termed not-so-random (NSR) primers, which are costly to synthesize. Taking advantage of the high tolerance of reverse transcriptase to mis-prime, we found that it is possible to use as few as 40 pseudo-random (PS) reverse transcription primers to decrease the rate of undesirable abundant sequences within a library without affecting the overall transcriptome diversity. PS primers are simple to design and can be used to deplete several undesirable RNAs simultaneously, thus creating a flexible tool for enriching transcriptome libraries for rare transcript sequences.

Defense Primer: DOD Contractors

Science.gov (United States)

2017-02-10

functions, from intelligence analysis or software development to landscaping or food service. Why does DOD use individual contractors? Going back to...that provide professional services, from research to management support. The bulk of contractors—more than 70%—provide products, and these include...10 U.S.C. Part IV: Service, Supply, and Procurement. CRS Products CRS In Focus IF10548, Defense Primer: U.S. Defense Industrial Base, by Daniel

Automated degenerate PCR primer design for high-throughput sequencing improves efficiency of viral sequencing

Directory of Open Access Journals (Sweden)

Li Kelvin

2012-11-01

Full Text Available Abstract Background In a high-throughput environment, to PCR amplify and sequence a large set of viral isolates from populations that are potentially heterogeneous and continuously evolving, the use of degenerate PCR primers is an important strategy. Degenerate primers allow for the PCR amplification of a wider range of viral isolates with only one set of pre-mixed primers, thus increasing amplification success rates and minimizing the necessity for genome finishing activities. To successfully select a large set of degenerate PCR primers necessary to tile across an entire viral genome and maximize their success, this process is best performed computationally. Results We have developed a fully automated degenerate PCR primer design system that plays a key role in the J. Craig Venter Institute’s (JCVI high-throughput viral sequencing pipeline. A consensus viral genome, or a set of consensus segment sequences in the case of a segmented virus, is specified using IUPAC ambiguity codes in the consensus template sequence to represent the allelic diversity of the target population. PCR primer pairs are then selected computationally to produce a minimal amplicon set capable of tiling across the full length of the specified target region. As part of the tiling process, primer pairs are computationally screened to meet the criteria for successful PCR with one of two described amplification protocols. The actual sequencing success rates for designed primers for measles virus, mumps virus, human parainfluenza virus 1 and 3, human respiratory syncytial virus A and B and human metapneumovirus are described, where >90% of designed primer pairs were able to consistently successfully amplify >75% of the isolates. Conclusions Augmenting our previously developed and published JCVI Primer Design Pipeline, we achieved similarly high sequencing success rates with only minor software modifications. The recommended methodology for the construction of the consensus

Freshwater Wetlands: A Citizen's Primer.

Science.gov (United States)

Catskill Center for Conservation and Development, Inc., Hobart, NY.

The purpose of this "primer" for the general public is to describe the general characteristics of wetlands and how wetland alteration adversely affects the well-being of humans. Particular emphasis is placed on wetlands in New York State and the northeast. Topics discussed include wetland values, destruction of wetlands, the costs of…

Microbial pathways for the mobilization of mercury as Hg(O) in anoxic subsurface environments

Energy Technology Data Exchange (ETDEWEB)

Barkay, Tamar

2005-06-01

The goal of our project which was initiated in June 2005 is focused on the presence of merA in microbial communities of anoxic environments and the effect of anaerobic respiratory pathways on MR expression and activities. The following progress has been made to date: PCR primers were designed to span the known phylogenetic range of merA genes of Gram-negative bacteria. In control experiments, these primers successfully amplified a 288 bp region at the 3? end of previously characterized merA genes from Shewanella putrefaciens pMERPH, Acidithiobacillus ferrooxidans, Pseudomonas stutzeri pPB, Tn5041, Pseudomonas sp. K-62, and Serratia marcescens pDU1358.

Quantitative Microbial Risk Assessment Tutorial - Primer

Science.gov (United States)

This document provides a Quantitative Microbial Risk Assessment (QMRA) primer that organizes QMRA tutorials. The tutorials describe functionality of a QMRA infrastructure, guide the user through software use and assessment options, provide step-by-step instructions for implementi...

A tool for design of primers for microRNA-specific quantitative RT-qPCR. BMC Bioinformatics

DEFF Research Database (Denmark)

Busk, Peter Kamp

2014-01-01

of formation of secondary structures and primer dimers. Testing of the primers showed that 76 out of 79 primers (96%) worked for quantification of microRNAs by miR-specific RT-qPCR of mammalian RNA samples. This success rate corresponds to the success rate of manual primer design. Furthermore, primers designed......Background MicroRNAs are small but biologically important RNA molecules. Although different methods can be used for quantification of microRNAs, quantitative PCR is regarded as the reference that is used to validate other methods. Several commercial qPCR assays are available but they often come...... at a high price and the sequences of the primers are not disclosed. An alternative to commercial assays is to manually design primers but this work is tedious and, hence, not practical for the design of primers for a larger number of targets. Results I have developed the software miRprimer for automatic...

Mobile Systems Development: An Empirical Study

DEFF Research Database (Denmark)

Hosbond, J. H.

As part of an ongoing study on mobile systems development (MSD), this paper presents preliminary findings of research-in-progress. The debate on mobility in research has so far been dominated by mobile HCI, technological innovations, and socio-technical issues related to new and emerging mobile...... work patterns. This paper is about the development of mobile systems.Based on an on-going empirical study I present four case studies of companies each with different products or services to offer and diverging ways of establishing and sustaining a successful business in the mobile industry. From...... the case studies I propose a five-layered framework for understanding the structure and segmentation of the industry. This leads to an analysis of the different modes of operation within the mobile industry, exemplified by the four case studies.The contribution of this paper is therefore two-fold: (1) I...

Improved group-specific primers based on the full SILVA 16S rRNA gene reference database.

Science.gov (United States)

Pfeiffer, Stefan; Pastar, Milica; Mitter, Birgit; Lippert, Kathrin; Hackl, Evelyn; Lojan, Paul; Oswald, Andreas; Sessitsch, Angela

2014-08-01

Quantitative PCR (qPCR) and community fingerprinting methods, such as the Terminal Restriction Fragment Length Polymorphism (T-RFLP) analysis,are well-suited techniques for the examination of microbial community structures. The use of phylum and class-specific primers can provide enhanced sensitivity and phylogenetic resolution as compared with domain-specific primers. To date, several phylum- and class-specific primers targeting the 16S ribosomal RNA gene have been published. However, many of these primers exhibit low discriminatory power against non-target bacteria in PCR. In this study, we evaluated the precision of certain published primers in silico and via specific PCR. We designed new qPCR and T-RFLP primer pairs (for the classes Alphaproteobacteria and Betaproteobacteria, and the phyla Bacteroidetes, Firmicutes and Actinobacteria) by combining the sequence information from a public dataset (SILVA SSU Ref 102 NR) with manual primer design. We evaluated the primer pairs via PCR using isolates of the above-mentioned groups and via screening of clone libraries from environmental soil samples and human faecal samples. As observed through theoretical and practical evaluation, the primers developed in this study showed a higher level of precision than previously published primers, thus allowing a deeper insight into microbial community dynamics.

Sensory reception of the primer pheromone ethyl oleate

Science.gov (United States)

Muenz, Thomas S.; Maisonnasse, Alban; Plettner, Erika; Le Conte, Yves; Rössler, Wolfgang

2012-05-01

Social work force distribution in honeybee colonies critically depends on subtle adjustments of an age-related polyethism. Pheromones play a crucial role in adjusting physiological and behavioral maturation of nurse bees to foragers. In addition to primer effects of brood pheromone and queen mandibular pheromone—both were shown to influence onset of foraging—direct worker-worker interactions influence adult behavioral maturation. These interactions were narrowed down to the primer pheromone ethyl oleate, which is present at high concentrations in foragers, almost absent in young bees and was shown to delay the onset of foraging. Based on chemical analyses, physiological recordings from the antenna (electroantennograms) and the antennal lobe (calcium imaging), and behavioral assays (associative conditioning of the proboscis extension response), we present evidence that ethyl oleate is most abundant on the cuticle, received by olfactory receptors on the antenna, processed in glomeruli of the antennal lobe, and learned in olfactory centers of the brain. The results are highly suggestive that the primer pheromone ethyl oleate is transmitted and perceived between individuals via olfaction at close range.

The Corrosion Protection of 2219-T87 Aluminum by Organic and Inorganic Zinc-Rich Primers

Science.gov (United States)

Danford, M. D.; Mendrek, M. J.; Walsh, D. W.

1995-01-01

The behavior of zinc-rich primer-coated 2219-T87 aluminum in a 3.5-percent Na-Cl was investigated using electrochemical techniques. The alternating current (ac) method of electrochemical impedance spectroscopy (EIS), in the frequency range of 0.001 to 40,000 Hz, and the direct current (dc) method of polarization resistance (PR) were used to evaluate the characteristics of an organic, epoxy zinc-rich primer and an inorganic, ethyl silicate zinc-rich primer. A dc electrochemical galvanic corrosion test was also used to determine the corrosion current of each zinc-rich primer anode coupled to a 2219-T87 aluminum cathode. Duration of the EIS/PR and galvanic testing was 21 days and 24 h, respectively. The galvanic test results demonstrated a very high galvanic current between the aluminum cathode and both zinc-rich primer anodes (37.9 pA/CM2 and 23.7 pA/CM2 for the organic and inorganic primers, respectively). The PR results demonstrated a much higher corrosion rate of the zinc in the inorganic primer than in the organic primer, due primarily to the higher porosity in the former. Based on this investigation, the inorganic zinc-rich primer appears to provide superior galvanic protection and is recommended for additional study for application in the solid rocket booster aft skirt.

PRIMEGENSw3: a web-based tool for high-throughput primer and probe design.

Science.gov (United States)

Kushwaha, Garima; Srivastava, Gyan Prakash; Xu, Dong

2015-01-01

Highly specific and efficient primer and probe design has been a major hurdle in many high-throughput techniques. Successful implementation of any PCR or probe hybridization technique depends on the quality of primers and probes used in terms of their specificity and cross-hybridization. Here we describe PRIMEGENSw3, a set of web-based utilities for high-throughput primer and probe design. These utilities allow users to select genomic regions and to design primer/probe for selected regions in an interactive, user-friendly, and automatic fashion. The system runs the PRIMEGENS algorithm in the back-end on the high-performance server with the stored genomic database or user-provided custom database for cross-hybridization check. Cross-hybridization is checked not only using BLAST but also by checking mismatch positions and energy calculation of potential hybridization hits. The results can be visualized online and also can be downloaded. The average success rate of primer design using PRIMEGENSw3 is ~90 %. The web server also supports primer design for methylated sequences, which is used in epigenetic studies. Stand-alone version of the software is also available for download at the website.

Security of Mobile Devices and Wi-Fi Networks

OpenAIRE

Hong, Zimeng

2015-01-01

Along with the progress of times and the development of science and technology, mobile devices have become more and more popular. At the same time, an increasing number of Wi-Fi networks are being built for the demand of mobile devices. Therefore, the security between mobile devices and Wi-Fi networks became a main object in the IT area. The purpose of the thesis is to analyze security threats and give relative advises for all the mobile device and Wi-Fi network users. The thesis mainly ta...

GST-PRIME: an algorithm for genome-wide primer design.

Science.gov (United States)

Leister, Dario; Varotto, Claudio

2007-01-01

The profiling of mRNA expression based on DNA arrays has become a powerful tool to study genome-wide transcription of genes in a number of organisms. GST-PRIME is a software package created to facilitate large-scale primer design for the amplification of probes to be immobilized on arrays for transcriptome analyses, even though it can be also applied in low-throughput approaches. GST-PRIME allows highly efficient, direct amplification of gene-sequence tags (GSTs) from genomic DNA (gDNA), starting from annotated genome or transcript sequences. GST-PRIME provides a customer-friendly platform for automatic primer design, and despite the relative simplicity of the algorithm, experimental tests in the model plant species Arabidopsis thaliana confirmed the reliability of the software. This chapter describes the algorithm used for primer design, its input and output files, and the installation of the standalone package and its use.

Empowering Learners with Mobile Open-Access Learning Initiatives

Science.gov (United States)

Mills, Michael, Ed.; Wake, Donna, Ed.

2017-01-01

Education has been progressing at a rapid pace ever since educators have been able to harness the power of mobile technology. Open-access learning techniques provide more students with the opportunity to engage in educational opportunities that may have been previously restricted. "Empowering Learners with Mobile Open-Access Learning…

Primer-dependent and primer-independent initiation of double stranded RNA synthesis by purified arabidopsis RNA-dependent RNA polymerases RDR2 and RDR6

DEFF Research Database (Denmark)

Devert, Anthony; Fabre, Nicolas; Floris, Maina Huguette Joséphine

2015-01-01

) targeted by RNA silencing. The dsRNA is subsequently cleaved by the ribonuclease DICER-like into secondary small interfering RNAs (siRNAs) that reinforce and/or maintain the silenced state of the target RNA. Models of RNA silencing propose that RDRs could use primer-independent and primer......Cellular RNA-dependent RNA polymerases (RDRs) are fundamental components of RNA silencing in plants and many other eukaryotes. In Arabidopsis thaliana genetic studies have demonstrated that RDR2 and RDR6 are involved in the synthesis of double stranded RNA (dsRNA) from single stranded RNA (ssRNA......-dependent initiation to generate dsRNA from a transcript targeted by primary siRNA or microRNA (miRNA). However, the biochemical activities of RDR proteins are still partly understood. Here, we obtained active recombinant RDR2 and RDR6 in a purified form. We demonstrate that RDR2 and RDR6 have primer...

Bioinspired Catecholic Primers for Rigid and Ductile Dental Resin Composites.

Science.gov (United States)

Shin, Eeseul; Ju, Sung Won; An, Larry; Ahn, Eungjin; Ahn, Jin-Soo; Kim, Byeong-Su; Ahn, B Kollbe

2018-01-17

In the construction of dental restorative polymer composite materials, surface priming on mineral fillers is essential to improve the mechanical performance of the composites. Here we present bioinspired catechol-functionalized primers for a tougher dental resin composite containing glass fillers. The catecholic primers with different polymerizable end groups were designed and then coated on glass surfaces using a simple drop-casting or dip-coating process. The surface binding ability and possible cross-linking (coupling or chemical bridging between the glass substrate and the dental resin) of the catecholic bifunctional primers were evaluated using atomic force microscopy, contact angle measurements, and the knife shear bonding test and compared to a state-of-the-art silane-based coupling agent. Various mechanical tests including shrinkage and compression tests of the dental resin composites were also conducted. Compression tests of the composites containing the catecholic primed fillers exhibited enhanced mechanical properties, owing to the bidentate hydrogen bonding of catechol moieties to the oxide mineral surface. Furthermore, the superior biocompatibility of the primed surface was confirmed via cell attachment assay, thus providing applicability of catecholic primers for practical dental and biomedical applications.

Nonspecific amplification of human DNA by Streptococcus pneumoniae LytA primer

Directory of Open Access Journals (Sweden)

Helen Hencida Thangamony

2018-01-01

Full Text Available Background: Determination of various analytical parameters is essential for the validation of primers used for in-house nucleic acid amplification tests. While standardising a high-resolution melt analysis (HRMA for detection of Streptococcus pneumoniae in acute pyogenic meningitis, we encountered non-specific amplification of certain base pair sequences of human DNA by Centers for Disease Control & Prevention, USA recommended S. pneumoniae LytA primer. Materials and Methods: HRMA was standardised using DNA extracted from an ATCC strain of S. pneumoniae using SP LytA F373 primer and Type-it HRMTM polymerase chain reaction kit in Rotor-Gene Q Thermal Cycler according to the manufacturer's instructions. Specificity of the primers was determined in dry and wet laboratory experiments against diverse related and unrelated microbial pathogens by HRMA and on DNA extracted from unspiked clinical samples negative for SP DNA. Sensitivity was determined by calculating lower limit of detection threshold in experiments with spiked samples. The amplicon from spiked experiments was sequenced and analysed through Gene Bank. Results: Our dry/wet laboratory experiments showed two separate curves and different Tm values indicating certain non-specific amplification by the primer. Basic Local Alignment Search Tool (BLAST analysis of the amplicon obtained in the spiked experiment showed sequences of human chromosome 20 associated with Homo sapiens protein tyrosine phosphatase, receptor type T gene. The problem was resolved by stopping the reaction at 30th Ct cycle and observing the Tm values. Conclusion: Since HRMA is done without a specific probe, one should be aware of non-specific amplifications while using primers for HRMA of human clinical samples.

The R primer

CERN Document Server

Ekstrom, Claus Thorn

2011-01-01

Newcomers to R are often intimidated by the command-line interface, the vast number of functions and packages, or the processes of importing data and performing a simple statistical analysis. The R Primer provides a collection of concise examples and solutions to R problems frequently encountered by new users of this statistical software.Rather than explore the many options available for every command as well as the ever-increasing number of packages, the book focuses on the basics of data preparation and analysis and gives examples that can be used as a starting point. The numerous examples i

Primer sets for cloning the human repertoire of T cell Receptor Variable regions.

Science.gov (United States)

Boria, Ilenia; Cotella, Diego; Dianzani, Irma; Santoro, Claudio; Sblattero, Daniele

2008-08-29

Amplification and cloning of naïve T cell Receptor (TR) repertoires or antigen-specific TR is crucial to shape immune response and to develop immuno-based therapies. TR variable (V) regions are encoded by several genes that recombine during T cell development. The cloning of expressed genes as large diverse libraries from natural sources relies upon the availability of primers able to amplify as many V genes as possible. Here, we present a list of primers computationally designed on all functional TR V and J genes listed in the IMGT, the ImMunoGeneTics information system. The list consists of unambiguous or degenerate primers suitable to theoretically amplify and clone the entire TR repertoire. We show that it is possible to selectively amplify and clone expressed TR V genes in one single RT-PCR step and from as little as 1000 cells. This new primer set will facilitate the creation of more diverse TR libraries than has been possible using currently available primer sets.

THE QUALITY IMPROVEMENT OF PRIMER PACKAGING PROCESS USING SIX SIGMA METHODOLOGY

Directory of Open Access Journals (Sweden)

Prima Ditahardiyani

2008-01-01

Full Text Available The implementation of Six Sigma has become a common theme in many organizations. This paper presents the Six Sigma methodology and its implementation in a primer packaging process of Cranberry drink. DMAIC (Define, Measure, Analyze, Improve and Control approach is used to analyze and to improve the primer packaging process, which have high variability and defects output. After the improvement, the results showed that there was an increasing sigma level. However, it is not significantly and has not achieved the world standard quality, yet. Therefore, the implementation of Six Sigma in primer packaging process of Cranberry drink still has a room for doing a further research.

Cross-kingdom amplification using bacteria-specific primers: complications for studies of coral microbial ecology.

Science.gov (United States)

Galkiewicz, Julia P; Kellogg, Christina A

2008-12-01

PCR amplification of pure bacterial DNA is vital to the study of bacterial interactions with corals. Commonly used Bacteria-specific primers 8F and 27F paired with the universal primer 1492R amplify both eukaryotic and prokaryotic rRNA genes. An alternative primer set, 63F/1542R, is suggested to resolve this problem.

Cross-Kingdom Amplification Using Bacteria-Specific Primers: Complications for Studies of Coral Microbial Ecology▿

OpenAIRE

Galkiewicz, Julia P.; Kellogg, Christina A.

2008-01-01

PCR amplification of pure bacterial DNA is vital to the study of bacterial interactions with corals. Commonly used Bacteria-specific primers 8F and 27F paired with the universal primer 1492R amplify both eukaryotic and prokaryotic rRNA genes. An alternative primer set, 63F/1542R, is suggested to resolve this problem.

Molecular passportization of clones of karelian birch using PCRwith semi-specific primers

Directory of Open Access Journals (Sweden)

Tatyana V Matveeva

2008-09-01

Full Text Available Using 4 clones of Karelian birch (Betula pendula Roth var caretica Merckl. from the collection of the karelian birch of the laboratory of genetics of Research Institute of Forest Genetics and Breeding, Voronezh, one normal tree of Betula pendula Roth, and one tree of B. pubescens Ehrh., collected from the nature, we have analyzed the possibility of application of PCR with semi-specific primers for molecular typing. We found primers with high percentage of polymorphic markers. These primers could be recommended for molecular typing of birch.

Cross-Kingdom Amplification Using Bacteria-Specific Primers: Complications for Studies of Coral Microbial Ecology▿

Science.gov (United States)

Galkiewicz, Julia P.; Kellogg, Christina A.

2008-01-01

PCR amplification of pure bacterial DNA is vital to the study of bacterial interactions with corals. Commonly used Bacteria-specific primers 8F and 27F paired with the universal primer 1492R amplify both eukaryotic and prokaryotic rRNA genes. An alternative primer set, 63F/1542R, is suggested to resolve this problem. PMID:18931299

Specific primer design of mitochondrial 12S rRNA for species identification in raw meats

Science.gov (United States)

Cahyadi, M.; Puruhita; Barido, F. H.; Hertanto, B. S.

2018-01-01

Polymerase chain reaction (PCR) is a molecular technique that widely used in agriculture area including species identification in animal-based products for halalness and food safety reasons. Amplification of DNA using PCR needs a primer pair (forward and reverse primers) to isolate specific DNA fragment in the genome. This objective of this study was to design specific primer from mitochondrial 12S rRNA region for species identification in raw beef, pork and chicken meat. Three published sequences, HQ184045, JN601075, and KT626857, were downloaded from National Center for Biotechnology Information (NCBI) website. Furthermore, those reference sequences were used to design specific primer for bovine, pig, and chicken species using primer3 v.0.4.0. A total of 15 primer pairs were picked up from primer3 software. Of these, an universal forward primer and three reverse primers which are specific for bovine, pig, and chicken species were selected to be optimized using multiplex-PCR technique. The selected primers were namely UNIF (5’-ACC GCG GTC ATA CGA TTA AC-3’), SPR (5’-AGT GCG TCG GCT ATT GTA GG-3’), BBR (5’-GAA TTG GCA AGG GTT GGT AA-3’), and AR (5’-CGG TAT GTA CGT GCC TCA GA-3’). In addition, the PCR products were visualized using 2% agarose gels under the UV light and sequenced to be aligned with reference sequences using Clustal Omega. The result showed that those primers were specifically amplified mitochondrial 12S rRNA regions from bovine, pig, and chicken using PCR. It was indicated by the existence of 155, 357, and 611 bp of DNA bands for bovine, pig, and chicken species, respectively. Moreover, sequence analysis revealed that our sequences were identically similar with reference sequences. It can be concluded that mitochondrial 12S rRNA may be used as a genetic marker for species identification in meat products.

El primer virreinato americano

Directory of Open Access Journals (Sweden)

Cassá, Roberto

2006-12-01

Full Text Available This article explores the government of viceroy Christopher Columbus in the American territories. We return to the first Spanish settlement in Santo Domingo and the contradictions inherent to this expansionist proyect. The contradictions were part of the logic of the absolutist state and Columbus’ reaction against the controls imposed by the monarchs. Secondly, we look into the dificulties that the Admiral encountered to develop a mercantilist model. In this context, we examine the rationale behind the first government of the Indies and the features that defined the new West Indian society.

El artículo trata sobre el gobierno de Cristóbal Colón en tierras americanas. Retomamos el tema del primer emplazamiento español en Santo Domingo y las contradicciones que tuvo aquel proyecto debido a la lógica del estado absolutista, a la ambición desmedida del descubridor y a su reacción ante los controles que desde un principio impusieron los monarcas. En un segundo momento analizamos las dificultades que encontró el Almirante para desarrollar un modelo mercantilista acorde a sus ideas y a los acuerdos a que llegó con la Corona. En ese contexto analizamos la lógica del primer gobierno colombinista en las Indias y los rasgos que definieron la nueva sociedad antillana.

Sediment transport primer: estimating bed-material transport in gravel-bed rivers

Science.gov (United States)

Peter Wilcock; John Pitlick; Yantao Cui

2009-01-01

This primer accompanies the release of BAGS, software developed to calculate sediment transport rate in gravel-bed rivers. BAGS and other programs facilitate calculation and can reduce some errors, but cannot ensure that calculations are accurate or relevant. This primer was written to help the software user define relevant and tractable problems, select appropriate...

Generation of sequence signatures from DNA amplification fingerprints with mini-hairpin and microsatellite primers.

Science.gov (United States)

Caetano-Anollés, G; Gresshoff, P M

1996-06-01

DNA amplification fingerprinting (DAF) with mini-hairpins harboring arbitrary "core" sequences at their 3' termini were used to fingerprint a variety of templates, including PCR products and whole genomes, to establish genetic relationships between plant tax at the interspecific and intraspecific level, and to identify closely related fungal isolates and plant accessions. No correlation was observed between the sequence of the arbitrary core, the stability of the mini-hairpin structure and DAF efficiency. Mini-hairpin primers with short arbitrary cores and primers complementary to simple sequence repeats present in microsatellites were also used to generate arbitrary signatures from amplification profiles (ASAP). The ASAP strategy is a dual-step amplification procedure that uses at least one primer in each fingerprinting stage. ASAP was able to reproducibly amplify DAF products (representing about 10-15 kb of sequence) following careful optimization of amplification parameters such as primer and template concentration. Avoidance of primer sequences partially complementary to DAF product termini was necessary in order to produce distinct fingerprints. This allowed the combinatorial use of oligomers in nucleic acid screening, with numerous ASAP fingerprinting reactions based on a limited number of primer sequences. Mini-hairpin primers and ASAP analysis significantly increased detection of polymorphic DNA, separating closely related bermudagrass (Cynodon) cultivars and detecting putatively linked markers in bulked segregant analysis of the soybean (Glycine max) supernodulation (nitrate-tolerant symbiosis) locus.

Microsatellite Primers in the Foundation Tree Species Pinus edulis and P. monophylla (Pinaceae

Directory of Open Access Journals (Sweden)

Andrew L. Krohn

2013-07-01

Full Text Available Premise of the study: Microsatellite primers were developed in the foundational tree species Pinus edulis to investigate population differentiation of P. edulis and hybridization among closely related species. Methods and Results: Using a hybridization protocol, primer sets for 11 microsatellite loci were developed using megagametophyte tissue from P. edulis and scored for polymorphism in three populations of P. edulis and a single P. monophylla population. The primers amplified simple and compound di-, tri-, and pentanucleotide repeats with two to 18 alleles per locus. Conclusions: These results demonstrate the utility of the described primers for studies of population differentiation within and among P. edulis populations as well as across putative hybrid zones where P. edulis may coexist with sister species.

In vivo effect of a self-etching primer on dentin.

Science.gov (United States)

Milia, E; Lallai, M R; García-Godoy, F

1999-08-01

To determine the ultrastructural aspects of the dentin collagen area in the cavity preparation floor produced in vivo after phosphoric acid acid-etching or after using Clearfil Liner Bond 2 self-etching primer (LB2 Primer). Twenty-four non-carious third molars scheduled for extraction from young adult patients (16-30 years old) were used. Conventional Class I cavities (+/- 2 mm deep) were prepared on the occlusal surfaces of all teeth using a cylindrical diamond bur on a high-speed handpiece with copious water spray. To avoid dehydration of the dentin, the smear layer-covered dentin was briefly air-dried for 2 seconds. Cavities were assigned at random to the following groups: Group A: Dentin etched for 15 seconds with 34% phosphoric acid, rinsed for 20 seconds and then briefly air-dried for 2 seconds with oil-free compressed air leaving the surfaces slightly moist. Group B: LB2 Primer was applied to the cavity surfaces for 30 seconds and then briefly air-dried to remove the solvent. Group C: The untreated dentin smear layer was used as a control. In all three groups, the cavities were filled incrementally with a resin-based composite (APX), light curing every increment for 40 seconds. After 30 minutes, the teeth were extracted atraumatically and the samples immediately prepared for evaluation with the transmission electron microscope. The use of a self-etching primer did not produce significant morphological changes in the moist dentin substrate. Adverse morphological conditions where observed when there was an excess water on the dentin surface. Phosphoric acid altered the collagen more severely than the self-etching primer.

Comparison among amoA Primers Suited for Quantification and Diversity Analyses of Ammonia-Oxidizing Bacteria in Soil

Science.gov (United States)

Shimomura, Yumi; Morimoto, Sho; Hoshino, Yuko Takada; Uchida, Yoshitaka; Akiyama, Hiroko; Hayatsu, Masahito

2012-01-01

Ammonia monooxygenase subunit A gene (amoA) is frequently used as a functional gene marker for diversity analysis of ammonia-oxidizing bacteria (AOB). To select a suitable amoA primer for real-time PCR and PCR-denaturing gradient gel electrophoresis (DGGE), three reverse primers (degenerate primer amoA-2R; non-degenerate primers amoA-2R-GG and amoA-2IR) were examined. No significant differences were observed among the three primers in terms of quantitative values of amoA from environmental samples using real-time PCR. We found that PCR-DGGE analysis with the amoA-2IR primer gave the best results in this studied soil. These results indicate that amoA-2IR is a suitable primer for community analysis of AOB in the environment. PMID:22075625

Mobile Devices and Mobile Learning: Shifting the Mindset of Teachers and Learners

Science.gov (United States)

Smith, Philippa K.; Grant, Lynn; Conway, Clare; Narayan, Vickel

2016-01-01

Incorporating new media technologies that enable mobile learning to be part of educational practice poses challenges to those used to teaching in a traditional classroom environment. In this article three lecturers and a learning advisor from a New Zealand university reflect on their experiences in the progressive redesign of a Bachelor of Arts…

Menopause 101: A Primer for the Perimenopausal

Science.gov (United States)

... Abstracts Media Award Recipients Media Policy Media Requests Menopause 101: A primer for the perimenopausal The information ... about 2 years earlier. Common Body Changes at Menopause Each woman’s experience of menopause is different. Many ...

Polyadenylated Sequencing Primers Enable Complete Readability of PCR Amplicons Analyzed by Dideoxynucleotide Sequencing

Directory of Open Access Journals (Sweden)

Martin Beránek

2012-01-01

Full Text Available Dideoxynucleotide DNA sequencing is one of the principal procedures in molecular biology. Loss of an initial part of nucleotides behind the 3' end of the sequencing primer limits the readability of sequenced amplicons. We present a method which extends the readability by using sequencing primers modified by polyadenylated tails attached to their 5' ends. Performing a polymerase chain reaction, we amplified eight amplicons of six human genes (AMELX, APOE, HFE, MBL2, SERPINA1 and TGFB1 ranging from 106 bp to 680 bp. Polyadenylation of the sequencing primers minimized the loss of bases in all amplicons. Complete sequences of shorter products (AMELX 106 bp, SERPINA1 121 bp, HFE 208 bp, APOE 244 bp, MBL2 317 bp were obtained. In addition, in the case of TGFB1 products (366 bp, 432 bp, and 680 bp, respectively, the lengths of sequencing readings were significantly longer if adenylated primers were used. Thus, single strand dideoxynucleotide sequencing with adenylated primers enables complete or near complete readability of short PCR amplicons.

Primer sets for cloning the human repertoire of T cell Receptor Variable regions

Directory of Open Access Journals (Sweden)

Santoro Claudio

2008-08-01

Full Text Available Abstract Background Amplification and cloning of naïve T cell Receptor (TR repertoires or antigen-specific TR is crucial to shape immune response and to develop immuno-based therapies. TR variable (V regions are encoded by several genes that recombine during T cell development. The cloning of expressed genes as large diverse libraries from natural sources relies upon the availability of primers able to amplify as many V genes as possible. Results Here, we present a list of primers computationally designed on all functional TR V and J genes listed in the IMGT®, the ImMunoGeneTics information system®. The list consists of unambiguous or degenerate primers suitable to theoretically amplify and clone the entire TR repertoire. We show that it is possible to selectively amplify and clone expressed TR V genes in one single RT-PCR step and from as little as 1000 cells. Conclusion This new primer set will facilitate the creation of more diverse TR libraries than has been possible using currently available primer sets.

An Integrated Mobile Phone Payment System Based on 3G Network

OpenAIRE

Weihui Dai; Xiang Cai; Haifeng Wu; Weidong Zhao; Xuan Li

2011-01-01

Along with globally approaching of the 3G era, the progress of mobile communication technology and the development of mobile terminal devices will rapidly promote the mobilization development of traditional E-commerce. In order to ensure it to achieve further development, secure, flexible and reliable mobile payment system is becoming more and more important. Compared with the payment pattern of ordinary commerce, there will be profound changes in the mobile payment, such as special payment c...

A Decentralized Interactive Architecture for Aerial and Ground Mobile Robots Cooperation

OpenAIRE

Harik, El Houssein Chouaib; Guérin, François; Guinand, Frédéric; Brethé, Jean-François; Pelvillain, Hervé

2014-01-01

International audience; —This paper presents a novel decentralized interactive architecture for aerial and ground mobile robots cooperation. The aerial mobile robot is used to provide a global coverage during an area inspection, while the ground mobile robot is used to provide a local coverage of ground features. We include a human-in-the-loop to provide waypoints for the ground mobile robot to progress safely in the inspected area. The aerial mobile robot follows continuously the ground mobi...

Genus-Specific Primers for Study of Fusarium Communities in Field Samples

Science.gov (United States)

Edel-Hermann, Véronique; Gautheron, Nadine; Durling, Mikael Brandström; Kolseth, Anna-Karin; Steinberg, Christian; Persson, Paula; Friberg, Hanna

2015-01-01

Fusarium is a large and diverse genus of fungi of great agricultural and economic importance, containing many plant pathogens and mycotoxin producers. To date, high-throughput sequencing of Fusarium communities has been limited by the lack of genus-specific primers targeting regions with high discriminatory power at the species level. In the present study, we evaluated two Fusarium-specific primer pairs targeting translation elongation factor 1 (TEF1). We also present the new primer pair Fa+7/Ra+6. Mock Fusarium communities reflecting phylogenetic diversity were used to evaluate the accuracy of the primers in reflecting the relative abundance of the species. TEF1 amplicons were subjected to 454 high-throughput sequencing to characterize Fusarium communities. Field samples from soil and wheat kernels were included to test the method on more-complex material. For kernel samples, a single PCR was sufficient, while for soil samples, nested PCR was necessary. The newly developed primer pairs Fa+7/Ra+6 and Fa/Ra accurately reflected Fusarium species composition in mock DNA communities. In field samples, 47 Fusarium operational taxonomic units were identified, with the highest Fusarium diversity in soil. The Fusarium community in soil was dominated by members of the Fusarium incarnatum-Fusarium equiseti species complex, contradicting findings in previous studies. The method was successfully applied to analyze Fusarium communities in soil and plant material and can facilitate further studies of Fusarium ecology. PMID:26519387

Cross-kingdom amplification using Bacteria-specific primers: Complications for studies of coral microbial ecology

Science.gov (United States)

Galkiewicz, J.P.; Kellogg, C.A.

2008-01-01

PCR amplification of pure bacterial DNA is vital to the study of bacterial interactions with corals. Commonly used Bacteria-specific primers 8F and 27F paired with the universal primer 1492R amplify both eukaryotic and prokaryotic rRNA genes. An alternative primer set, 63F/1542R, is suggested to resolve this problem. Copyright ?? 2008, American Society for Microbiology. All Rights Reserved.

Math primer for engineers

CERN Document Server

Cryer, CW

2014-01-01

Mathematics and engineering are inevitably interrelated, and this interaction will steadily increase as the use of mathematical modelling grows. Although mathematicians and engineers often misunderstand one another, their basic approach is quite similar, as is the historical development of their respective disciplines. The purpose of this Math Primer is to provide a brief introduction to those parts of mathematics which are, or could be, useful in engineering, especially bioengineering. The aim is to summarize the ideas covered in each subject area without going into exhaustive detail. Formula

A Quantum Groups Primer

Science.gov (United States)

Majid, Shahn

2002-05-01

Here is a self-contained introduction to quantum groups as algebraic objects. Based on the author's lecture notes for the Part III pure mathematics course at Cambridge University, the book is suitable as a primary text for graduate courses in quantum groups or supplementary reading for modern courses in advanced algebra. The material assumes knowledge of basic and linear algebra. Some familiarity with semisimple Lie algebras would also be helpful. The volume is a primer for mathematicians but it will also be useful for mathematical physicists.

A comprehensive collection of experimentally validated primers for Polymerase Chain Reaction quantitation of murine transcript abundance

Directory of Open Access Journals (Sweden)

Wang Xiaowei

2008-12-01

Full Text Available Abstract Background Quantitative polymerase chain reaction (QPCR is a widely applied analytical method for the accurate determination of transcript abundance. Primers for QPCR have been designed on a genomic scale but non-specific amplification of non-target genes has frequently been a problem. Although several online databases have been created for the storage and retrieval of experimentally validated primers, only a few thousand primer pairs are currently present in existing databases and the primers are not designed for use under a common PCR thermal profile. Results We previously reported the implementation of an algorithm to predict PCR primers for most known human and mouse genes. We now report the use of that resource to identify 17483 pairs of primers that have been experimentally verified to amplify unique sequences corresponding to distinct murine transcripts. The primer pairs have been validated by gel electrophoresis, DNA sequence analysis and thermal denaturation profile. In addition to the validation studies, we have determined the uniformity of amplification using the primers and the technical reproducibility of the QPCR reaction using the popular and inexpensive SYBR Green I detection method. Conclusion We have identified an experimentally validated collection of murine primer pairs for PCR and QPCR which can be used under a common PCR thermal profile, allowing the evaluation of transcript abundance of a large number of genes in parallel. This feature is increasingly attractive for confirming and/or making more precise data trends observed from experiments performed with DNA microarrays.

Mobile Transcripts and Intercellular Communication in Plants.

Science.gov (United States)

Saplaoura, E; Kragler, F

2016-01-01

Phloem serves as a highway for mobile signals in plants. Apart from sugars and hormones, proteins and RNAs are transported via the phloem and contribute to the intercellular communication coordinating growth and development. Different classes of RNAs have been found mobile and in the phloem exudate such as viral RNAs, small interfering RNAs (siRNAs), microRNAs, transfer RNAs, and messenger RNAs (mRNAs). Their transport is considered to be mediated via ribonucleoprotein complexes formed between phloem RNA-binding proteins and mobile RNA molecules. Recent advances in the analysis of the mobile transcriptome indicate that thousands of transcripts move along the plant axis. Although potential RNA mobility motifs were identified, research is still in progress on the factors triggering siRNA and mRNA mobility. In this review, we discuss the approaches used to identify putative mobile mRNAs, the transport mechanism, and the significance of mRNA trafficking. © 2016 Elsevier Inc. All rights reserved.

Scrimer: designing primers from transcriptome data

Czech Academy of Sciences Publication Activity Database

Mořkovský, Libor; Pačes, Jan; Rídl, Jakub; Reifová, R.

2015-01-01

Roč. 15, č. 6 (2015), s. 1415-1420 ISSN 1755-098X R&D Projects: GA MŠk EE2.3.20.0303 Institutional support: RVO:68081766 ; RVO:68378050 Keywords : next-generation sequencing * primer design * SNaPshot * SNP genotyping * transcriptome Subject RIV: EB - Genetics ; Molecular Biology Impact factor: 5.298, year: 2015

Microsatellite primers in the white proteas (Protea section Exsertae, Proteaceae), a rapidly radiating lineage.

Science.gov (United States)

Prunier, Rachel; Latimer, Andrew

2010-01-01

Microsatellite primers were developed in the South African sclerophyllous shrub Protea punctata to investigate the degree of population differentiation within and between P. punctata and closely related species. • 10 primer pairs were identified from three individuals of Protea punctata. The primers amplified di- and tri-nucleotide repeats. Across all P. punctata samples, the loci have 8-49 alleles. All primers also amplified in Protea section Exsertae (P. aurea, P. aurea subsp. potbergensis, P. mundii, P. venusta, P. lacticolor, and P. subvestita). The loci had 14-69 alleles across the subgenus. • These results show the broad utility of microsatellite loci for future studies of population genetics in the white proteas and their potential utility across the entire genus.

Profitability primer: a guide to profitability analysis in the electric power industry

International Nuclear Information System (INIS)

Woo, C.K.; Lloyd-Zannetti, D.; Martin, J.; Price, S.

1996-06-01

As the electric power industry is opened to forces of competition, increased attention must be focused to develop products and services that deliver good value to customers and to identify customer segments that are profitable to serve. This primer introduces the concept of profitability analysis and its application to the electric power industry. The primer recognizes that some segments of the business will remain monopolistic and subject to regulations, while other segments will become competitive. The primer also recognizes that customer profitability is critically dependent on a host of related issues such as how internal costs are allocated to various functions and how revenues are collected and allocated

Evaluation of highly conserved hsp65-specific nested PCR primers for diagnosing Mycobacterium tuberculosis.

Science.gov (United States)

Priyadarshini, P; Tiwari, K; Das, A; Kumar, D; Mishra, M N; Desikan, P; Nath, G

2017-02-01

To evaluate the sensitivity and specificity of a new nested set of primers designed for the detection of Mycobacterium tuberculosis complex targeting a highly conserved heat shock protein gene (hsp65). The nested primers were designed using multiple sequence alignment assuming the nucleotide sequence of the M. tuberculosis H37Rv hsp65 genome as base. Multidrug-resistant Mycobacterium species along with other non-mycobacterial and fungal species were included to evaluate the specificity of M. tuberculosis hsp65 gene-specific primers. The sensitivity of the primers was determined using serial 10-fold dilutions, and was 100% as shown by the bands in the case of M. tuberculosis complex. None of the other non M. tuberculosis complex bacterial and fungal species yielded any band on nested polymerase chain reaction (PCR). The first round of amplification could amplify 0.3 ng of the template DNA, while nested PCR could detect 0.3 pg. The present hsp65-specific primers have been observed to be sensitive, specific and cost-effective, without requiring interpretation of biochemical tests, real-time PCR, sequencing or high-performance liquid chromatography. These primer sets do not have the drawbacks associated with those protocols that target insertion sequence 6110, 16S rDNA, rpoB, recA and MPT 64.

Temas de Física para Ingeniería: Primer principio de la termodinámica

OpenAIRE

Beléndez Vázquez, Augusto

1992-01-01

Acústica, fluidos y termodinámica: "Primer principio de la termodinámica". Objetivos y caracteres generales de la termodinámica. Conceptos fundamentales de la termodinámica. Capacidad calorífica, calor específico y calor latente. Trabajo. Primer principio de la termodinámica: energía interna. Algunas aplicaciones del primer principio.

A primer on motor vehicle air pollution.

Science.gov (United States)

1973-01-01

This primer presents a brief state-of-the art review of motor vehicle air pollution. Its purpose is to aid highway personnel in understanding the nature of this environmental problem on our highways and to present possible solutions for its abatement...

Primer on CDM programme of activities

Energy Technology Data Exchange (ETDEWEB)

Hinostroza, M. (UNEP Risoe Centre, Roskilde (Denmark)); Lescano, A.D. (A2G Carbon Partners (Peru)); Alvarez, J.M. (Ministerio del Ambiente del Peru (Peru)); Avendano, F.M. (EEA Fund Management Ltd. (United Kingdom)

2009-07-01

As an advanced modality introduced in 2005, the Programmatic CDM (POA) is expected to address asymmetries of participation, especially of very small-scale project activities in certain areas, key sectors and many countries with considerable potential for greenhouse gas emission reductions, not reached by the traditional single-project-based CDM. Latest experiences with POAs and the recently finalized official guidance governing the Programmatic CDM are the grassroots of this Primer, which has the purpose of supporting the fully understanding of rules and procedures of POAs by interpreting them and analyzing real POA cases. Professional and experts from the public and private entities have contributed to the development of this Primer, produced by the UNEP Risoe Centre, as part of knowledge support activities for the Capacity Development for the CDM (CD4CDM) project. The overall objective of the CD4CDM is to develop the capacities of host countries to identify, design, approve, finance, implement CDM projects and commercialize CERs in participating countries. The CDM4CDM is funded by the Netherlands Ministry of Foreign Affairs. (author)

Video games and mobile learning: A Spanish developers approach

OpenAIRE

Fernández Gómez, Carlos; Martí Parreño, José

2016-01-01

This research presents a work in progress aiming to map Spanish video games developers’ production in the area of mobile educational video games. A sample of 30 Spanish video games developers was analyzed in order to explore the weight that educational video games for mobile devices represents in their product portfolio. Primary findings suggest that Spanish video games developers’ production of educational video games for mobile devices is very scarce. While 23,3% of the analyzed video games...

Forest Interpreter's Primer on Fire Management.

Science.gov (United States)

Zelker, Thomas M.

Specifically prepared for the use of Forest Service field-based interpreters of the management, protection, and use of forest and range resources and the associated human, cultural, and natural history found on these lands, this book is the second in a series of six primers on the multiple use of forest and range resources. Following an…

Designing for transportation management and operations : a primer.

Science.gov (United States)

2013-02-01

This primer is focused on the collaborative and systematic consideration of management and operations during transportation : project design and development. This is termed designing for operations. Effectively designing for operations involves...

Evaluation of genetic diversity in open pollinated guava by iPBS primers

International Nuclear Information System (INIS)

Mehmood, A.; Jaskani, M.J.; Ahmad, S.; Ahmad, R.

2013-01-01

DNA markers are important tools for assessing genetic diversity and relationships among species, cultivars and breeding materials. Many horticultural species are lacking genomic information. DNA markers that do not require prior knowledge of DNA sequences are therefore appealing for horticultural research. A retrotransposon-based DNA marker system, iPBS (inter primer binding sites) developed from conserved primer binding sites within retrotransposons, was used to study the genetic variation and relationships in ornamental guava. PCR from 6 iPBS primers (dominant markers) produced a total of 113 bands (52.38-100% polymorphic) ranging from 150 bp to 3000 bp, and the mean PIC value for each primer ranging from 0.1245 to 0.3698. Molecular information generated from both iPBS was separately scored in a matrix for phylogenetic dendrogram construction. The phylogenetic dendrogram based on iPBS markers reflected morphologic classifications of the accessions that were studied. The iPBS PCR-based genome fingerprinting technology in this study is low-cost and provides another effective alternative in differentiation of accessions in guava (Psidium guajava Linn.) and related species or genera. (author)

The UVM primer a step-by-step introduction to the universal verification methodology

CERN Document Server

Salemi, Ray

2013-01-01

The UVM Primer uses simple, runnable code examples, accessible analogies, and an easy-to-read style to introduce you to the foundation of the Universal Verification Methodology. You will learn the basics of object-oriented programming with SystemVerilog and build upon that foundation to learn how to design testbenches using the UVM. Use the UVM Primer to brush up on your UVM knowledge before a job interview to be able to confidently answer questions such as "What is a uvm_agent?" , "How do you use uvm_sequences?", and "When do you use the UVM's factory." The UVM Primer's downloadable code examples give you hands-on experience with real UVM code. Ray Salemi uses online videos (on www.uvmprimer.com) to walk through the code from each chapter and build your confidence. Read The UVM Primer today and start down the path to the UVM.

A Primer on Electric Utilities, Deregulation, and Restructuring of U.S. Electricity Markets

Energy Technology Data Exchange (ETDEWEB)

Warwick, William M.

2002-06-03

This primer is offered as an introduction to utility restructuring to better prepare readers for ongoing changes in public utilities and associated energy markets. It is written for use by individuals with responsibility for the management of facilities that use energy, including energy managers, procurement staff, and managers with responsibility for facility operations and budgets. The primer was prepared by the Pacific Northwest National Laboratory under sponsorship from the U.S. Department of Energy?s Federal Energy Management Program. The impetus for this primer originally came from the Government Services Administration who supported its initial development.

Within- and cross-firm mobility and earnings growth

DEFF Research Database (Denmark)

Frederiksen, Anders; Halliday, Timothy; Koch, Alexander Karl

While it is well established that both promotions within firms and mobility across firms lead to substantial earnings progression, few studies offer an integrated analysis of the effects of these two types of mobility on earnings growth. To do this, we exploit a large Danish panel data set and te...... deductable pension contributions and more expensive real estate or financed consumption where interest is tax deductable....

Cytochrome c oxidase I primers for corbiculate bees: DNA barcode and mini-barcode.

Science.gov (United States)

Françoso, E; Arias, M C

2013-09-01

Bees (Apidae), of which there are more than 19 900 species, are extremely important for ecosystem services and economic purposes, so taxon identity is a major concern. The goal of this study was to optimize the DNA barcode technique based on the Cytochrome c oxidase (COI) mitochondrial gene region. This approach has previously been shown to be useful in resolving taxonomic inconsistencies and for species identification when morphological data are poor. Specifically, we designed and tested new primers and standardized PCR conditions to amplify the barcode region for bees, focusing on the corbiculate Apids. In addition, primers were designed to amplify small COI amplicons and tested with pinned specimens. Short barcode sequences were easily obtained for some Bombus century-old museum specimens and shown to be useful as mini-barcodes. The new primers and PCR conditions established in this study proved to be successful for the amplification of the barcode region for all species tested, regardless of the conditions of tissue preservation. We saw no evidence of Wolbachia or numts amplification by these primers, and so we suggest that these new primers are of broad value for corbiculate bee identification through DNA barcode. © 2013 John Wiley & Sons Ltd.

Inteligencia emocional y autoconcepto en los estudiantes de primer ciclo

OpenAIRE

Castillo Canales, Braulio

2017-01-01

En nuestra investigación se tuvo como problema: ¿Qué relación existe entre inteligencia emocional y autoconcepto en los estudiantes de primer ciclo de Administración en Turismo y Hotelería de la Universidad César Vallejo, Lima 2015-II? Además el objetivo fue: Determinar la relación entre inteligencia emocional y autoconcepto en los estudiantes de primer ciclo de Administración en Turismo y Hotelería de la Universidad César Vallejo, Lima 2015-II. El tipo de estudio fue básica...

Teaching Thermal Hydraulics & Numerical Methods: An Introductory Control Volume Primer

Energy Technology Data Exchange (ETDEWEB)

Lucas, D.S.

2004-10-03

This paper covers the basics of the implementation of the control volume method in the context of the Homogeneous Equilibrium Model (HEM)(T/H) code using the conservation equations of mass, momentum, and energy. This primer uses the advection equation as a template. The discussion will cover the basic equations of the control volume portion of the course in the primer, which includes the advection equation, numerical methods, along with the implementation of the various equations via FORTRAN into computer programs and the final result for a three equation HEM code and its validation.

Móvil remisión de V. cinta del primer móvil.

OpenAIRE

2011-01-01

[ES] Definición del término Móvil remisión de V. cinta del primer móvil. en el diccionario Dicter. [EN] Definition of the word Móvil remisión de V. cinta del primer móvil. in the dictionary Dicter.

A primer on water

Science.gov (United States)

Leopold, Luna Bergere; Langbein, Walter Basil

1960-01-01

When you open the faucet you expect water to flow. And you expect it to flow night or day, summer or winter, whether you want to fill a glass or water the lawn. It should be clean and pure, without any odor.You have seen or read about places where the water doesn't have these qualities. You may have lived in a city where you were allowed to water the lawn only during a few hours of certain days. We know a large town where the water turns brown after every big rainstorm.Beginning shortly after World War II, large areas in the Southwestern United States had a 10-year drought, and newspapers published a lot of information about its effects. Some people say that the growing demand for water will cause serious shortages over much of the country in the next 10 to 40 years. But it has always been true that while water wells and springs dry up in some places, floods may be occurring in other places at the same time.Nearly every month news stories are published describing floods somewhere in the country. In fact, every year, on the average, 75,000 persons are forced from their homes by floods. In some years, as in 1951 when the lower Kansas River experienced a great flood, half a million people are affected. To understand the reasons for such recurring distress, it is necessary to know something about rivers and about the flat land or flood plain that borders the river.Interest in water and related problems is growing as our population increases and as the use of water becomes steadily greater. To help meet this heightened interest in general information about water and its use and control is the reason this primer was written. The primer is in two parts. The first part tells about hydrology, or the science that concerns the relation of water to our earth, and the second part describes the development of water supplies and the use of water. The Geological Survey is publishing this primer in nontechnical language in the hope that it will enable the general reader to

The replisome uses mRNA as a primer after colliding with RNA polymerase.

Science.gov (United States)

Pomerantz, Richard T; O'Donnell, Mike

2008-12-11

Replication forks are impeded by DNA damage and protein-nucleic acid complexes such as transcribing RNA polymerase. For example, head-on collision of the replisome with RNA polymerase results in replication fork arrest. However, co-directional collision of the replisome with RNA polymerase has little or no effect on fork progression. Here we examine co-directional collisions between a replisome and RNA polymerase in vitro. We show that the Escherichia coli replisome uses the RNA transcript as a primer to continue leading-strand synthesis after the collision with RNA polymerase that is displaced from the DNA. This action results in a discontinuity in the leading strand, yet the replisome remains intact and bound to DNA during the entire process. These findings underscore the notable plasticity by which the replisome operates to circumvent obstacles in its path and may explain why the leading strand is synthesized discontinuously in vivo.

Adhesion and thermal stability enhancement of IZO films by adding a primer layer on polycarbonate substrate

Energy Technology Data Exchange (ETDEWEB)

Zhang, Xuan; Zhang, Xiaofeng; Yan, Yue; Zhong, Yanli; Li, Lei; Zhang, Guanli [Beijing Institute of Aeronautical Materials (BIAM), Haidian District, Beijing, 100095 (China)

2015-04-01

A silicone-based primer layer was developed to improve the adhesion and thermal stability of amorphous transparent indium zinc oxide (IZO) films on polycarbonate (PC). The IZO films deposited by direct current magnetron sputtering at room temperature on primer-treated and untreated PCs were evaluated ex situ in terms of surface morphology, adhesion, optical, and electrical properties during annealing at 120 C in air. Nano-scratch tests indicated the adhesion of IZO films on primer-treated substrates was superior to that on untreated PCs. This superior adhesion can be attributed to the strong Si-O-Si inorganic bonds abundant in the primer layer and better matches of the primer layer in the terms of thermal expansion to the IZO. Moreover, the electrical resistivity of IZO films prepared on primer-treated PCs remained stable during the annealing treatment, whereas those of IZO films on untreated PCs presented a continuously increasing trend, which was attributed to the decrease in carrier concentration that resulted from oxygen adsorption. (copyright 2015 WILEY-VCH Verlag GmbH and Co. KGaA, Weinheim)

Mobile genetic elements in Methanobacterium thermoformicicum

NARCIS (Netherlands)

Noelling, J.

1993-01-01

The identification of the Archaea as a third primary lineage of life and their adaptation to extreme environmental conditions have generated considerable interest in the molecular biology of these organisms. Most progress in the investigation of archaeal mobile genetic

Characterization of a nucleocapsid-like region and of two distinct primer tRNALys,2 binding sites in the endogenous retrovirus Gypsy.

Science.gov (United States)

Gabus, Caroline; Ivanyi-Nagy, Roland; Depollier, Julien; Bucheton, Alain; Pelisson, Alain; Darlix, Jean-Luc

2006-01-01

Mobile LTR-retroelements comprising retroviruses and LTR-retrotransposons form a large part of eukaryotic genomes. Their mode of replication and abundance favour the notion that they are major actors in eukaryote evolution. The Gypsy retroelement can spread in the germ line of the fruit fly Drosophila melanogaster via both env-independent and env-dependent processes. Thus, Gypsy is both an active retrotransposon and an infectious retrovirus resembling the gammaretrovirus MuLV. However, unlike gammaretroviruses, the Gypsy Gag structural precursor is not processed into Matrix, Capsid and Nucleocapsid (NC) proteins. In contrast, it has features in common with Gag of the ancient yeast TY1 retroelement. These characteristics of Gypsy make it a very interesting model to study replication of a retroelement at the frontier between ancient retrotransposons and retroviruses. We investigated Gypsy replication using an in vitro model system and transfection of insect cells. Results show that an unstructured domain of Gypsy Gag has all the properties of a retroviral NC. This NC-like peptide forms ribonucleoparticle-like complexes upon binding Gypsy RNA and directs the annealing of primer tRNA(Lys,2) to two distinct primer binding sites (PBS) at the genome 5' and 3' ends. Only the 5' PBS is indispensable for cDNA synthesis in vitro and in Drosophila cells.

A secure wireless mobile-to-server link

Science.gov (United States)

Kumar, Abhinav; Akopian, David; Agaian, Sos; Creutzburg, Reiner

2009-02-01

Modern mobile devices are some of the most technologically advanced devices that people use on a daily basis and the current trends indicate continuous growth in mobile phone applications. Nowadays phones are equipped with cameras that can capture still images and video, they are equipped with software that can read, convert, manipulate, communicate and save multimedia in multiple formats. This tremendous progress increased the volumes of communicated sensitive information which should be protected against unauthorized access. This paper discusses two general approaches for data protection, steganography and cryptography, and demonstrates how to integrate such algorithms with a mobile-toserver link being used by many applications.

Functional genes to assess nitrogen cycling and aromatic hydrocarbon degradation: primers and processing matter

Directory of Open Access Journals (Sweden)

Christopher Ryan Penton

2013-09-01

Full Text Available Targeting sequencing to genes involved in key environmental processes, i.e. ecofunctional genes, provides an opportunity to sample nature’s gene guilds to greater depth and help link community structure to process-level outcomes. Vastly different approaches have been implemented for sequence processing and, ultimately, for taxonomic placement of these gene reads. The overall quality of next generation sequence analysis of functional genes is dependent on multiple steps and assumptions of unknown diversity. To illustrate current issues surrounding amplicon read processing we provide examples for three ecofunctional gene groups. A combination of in-silico, environmental and cultured strain sequences was used to test new primers targeting the dioxin and dibenzofuran degrading genes dxnA1, dbfA1, and carAa. The majority of obtained environmental sequences were classified into novel sequence clusters, illustrating the discovery value of the approach. For the nitrite reductase step in denitrification, the well-known nirK primers exhibited deficiencies in reference database coverage, illustrating the need to refine primer-binding sites and/or to design multiple primers, while nirS primers exhibited bias against five phyla. Amino acid-based OTU clustering of these two N-cycle genes from soil samples yielded only 114 unique nirK and 45 unique nirS genus-level groupings, likely a reflection of constricted primer coverage. Finally, supervised and non-supervised OTU analysis methods were compared using the nifH gene of nitrogen fixation, with generally similar outcomes, but the clustering (non-supervised method yielded higher diversity estimates and stronger site-based differences. High throughput amplicon sequencing can provide inexpensive and rapid access to nature’s related sequences by circumventing the culturing barrier, but each unique gene requires individual considerations in terms of primer design and sequence processing and classification.

Optimization of β-glucan synthase gene primers for molecular DNA fingerprinting in Pleurotus pulmonarious

Science.gov (United States)

Kadir, Zaiton Abdul; Daud, Fauzi; Mohamad, Azhar; Senafi, Sahidan; Jamaludin, Ferlynda Fazleen

2015-09-01

Pleurotus pulmonarius is an edible mushroom in Malaysia and commonly known as Oyster mushroom. The species are important not only for nutritional values but also for pharmaceutical importance related to bioactive compounds in polysaccharides such as β glucan. Hence, β-glucan synthase gene (BGS) pathways which are related to the production of the β-glucan might be useful as marker for molecular DNA fingerprinting in P. pulmonarius. Conserved regions of β-glucan gene were mined from public database and aligned. Consensus from the alignment was used to design the primers by using Primer 3 software. Eight primers were designed and a single primer pair (BGF3: 5' TCTTGGCGAGTTCGAAGAAT 3'; BGR3: 5' TTCCGATCTTGGTCTGGAAG 3') was optimized at Ta (annealing temperature) 57.1°C to produce PCR product ranging from 400-500 bp. Optimum components for PCR reactions were 5.0 µl of 10× PCR buffer, 1.5 µl of 25 mM MgCl2, 1 µl of 10 mM dNTP, 1 µl of β-glucan primers, 0.1 µl of 5 units/ml Taq polymerase and 2 µl DNA template. PCR program was set at 34 PCR cycles by using Bio-Rad T100 Thermal Cycler. Initial denaturation was set at 94°C for 2 min, denaturation at 94°C for 1 minute, primer annealing at 45°C to 60°C (gradient temperature) for 50 seconds, followed by elongation at 72°C for 1 minute and further extension 5 minutes for last cycle PCR prior to end the program cycle. Thus, this information revealed that the primer of β-glucan gene designed could be used as targeted markers in screening population strains of P. pulmonarius.

Family-specific vs. universal PCR primers for the study of mitochondrial DNA in plants

Directory of Open Access Journals (Sweden)

Aleksić Jelena M.

2016-01-01

Full Text Available Mitochondrial genomes (mtDNAs or mitogenomes of seed plants are characterized by a notoriously unstable organization on account of which available so-called universal or consensus primers may fail to fulfil their foreseen function - amplification of various mtDNA regions in a broad range of plant taxa. Thus, the primers developed for groups assumed to have similar organization of their mitogenomes, such as families, may facilitate a broader usage of more variable non-coding portions of these genomes in group members. Using in silico PCR method and six available complete mitogenomes of Fabaceae, it has been demonstrated that only three out of 36 published universal primer and three Medicago sativa-specific primer pairs that amplify various mtDNA regions are suitable for six representatives of the Fabaceae family upon minor modifications, and develop 21 Fabaceae-specific primer pairs for amplification of all 14 cis-splicing introns in genes of NADH subunits (nad genes which represent the most commonly used non-coding mtDNA regions in various studies in plants. Using the same method and six available complete mitogenomes of representatives of related families Cucurbitaceae, Euphorbiaceae and Rosaceae and a model plant, Arabidopsis thaliana, it has further been demonstrated that applicability of newly developed primer pairs for amplification of nad introns in more or less related taxa was dependent not only on species evolutionary distances but also on their genome sizes. A reported set of 24 primer pairs is a valuable resource which may facilitate a broader usage of mtDNA variability in future studies at both intra- and inter-specific levels in Fabaceae, which is the third largest family of flowering plants rarely studied at the mtDNA level, and in other more or less related taxa. [Projekat Ministarstva nauke Republike Srbije, br. 173005

Formulation and Assessment of a Wash-Primer Containing Lanthanum "Tannate" for Steel Temporary Protection

Science.gov (United States)

D'Alessandro, Oriana; Selmi, Gonzalo J.; Deyá, Cecilia; Di Sarli, Alejandro; Romagnoli, Roberto

2018-02-01

Tannins are polyphenols synthesized by plants and useful for the coating industry as corrosion inhibitors. In addition, lanthanum salts have a great inhibitory effect on steel corrosion. The aim of this study was to obtain lanthanum "tannate" with adequate solubility to be incorporated as the corrosion inhibitor in a wash-primer. The "tannate" was obtained from commercial "Quebracho" tannin and 0.1 M La(NO3)3. The soluble tannin was determined by the Folin-Denis reagent, while the concentration of Lanthanum was obtained by a gravimetric procedure. The protective action of "tannate" on SAE 1010 steel was evaluated by linear polarization curves and corrosion potential measurements. Lanthanum "tannate" was incorporated in a wash-primer formulation and tested by corrosion potential and ionic resistance measurements. The corrosion rate was also determined by the polarization resistance technique. Besides, the primer was incorporated in an alkyd paint system and its anticorrosion performance assessed in the salt spray cabinet and by electrochemical impedance spectroscopy. Results showed that lanthanum "tannate" primer inhibits the development of deleterious iron oxyhydroxides on the steel substrate and incorporated into a paint system had a similar behavior to the primer formulated with zinc tetroxychromate.

The use of a fluoropolymer containing primer to enhance adhesion of rotolined fluoropolymer coatings

Energy Technology Data Exchange (ETDEWEB)

Lech, L.M. [DuPont, Parkersburg, WV (United States)

1999-11-01

Fluoropolymers such as PFA and ETFE are often used in rotolining applications. A common source of failure for rotolined coatings is delamination from the metal substrate. Extensive thermal cycling of the coated part, permeation of the contained liquid to the substrate, or a combination of both thermal cycling and permeation causes this. Rotolined coatings are typically applied directly to the metal part. It has been found that applying an aqueous fluoropolymer based primer to the metal substrate prior to applying the rotolined resin increases the time before delamination is observed. The primer is applied by conventional spray techniques and can either be force dried at low temperature or air-dried under ambient conditions. The primer consists primarily of a fluoropolymer such as ETFE or PFA and a bonding agent such as polyamide-imide, polyphenylene sulfide, or polyether sulfone. After the primer is applied to the metal part, the fluoropolymer in the primer melt blends with the fluoropolymer rotolining resin during the rotolining process. The bonding agent enhances the adhesion of the entire coating system to the metal part. This extends the lifetime of the rotolined coatings.

Generation and confinement of mobile charges in buried oxide of SOI substrates; Generation et confinement de charges mobiles dans les oxydes enterres de substrats SOI

Energy Technology Data Exchange (ETDEWEB)

Gruber, O.; Krawiec, S.; Musseau, O.; Paillet, Ph.; Courtot-Descharles, A. [CEA Bruyeres-le-Chatel, DIF, 91 (France)

1999-07-01

We analyze the mechanisms of generation and confinement of mobile protons resulting from hydrogen annealing of SOI buried oxides. This study of the mechanisms of generation and confinement of mobile protons in the buried oxide of SOI wafers emphasizes the importance of H+ diffusion in the oxide in the formation of a mobile charge. Under specific electric field conditions the irradiation of these devices results in a pinning of this mobile charge at the bottom Si-SiO{sub 2} interface. Ab initio calculations are in progress to investigate the possible precursor defects in the oxide and detail the mechanism for mobile proton generation and confinement. (authors)

A Primer to Slow Light

OpenAIRE

Leonhardt, U.

2001-01-01

Laboratory-based optical analogs of astronomical objects such as black holes rely on the creation of light with an extremely low or even vanishing group velocity (slow light). These brief notes represent a pedagogical attempt towards elucidating this extraordinary form of light. This paper is a contribution to the book Artificial Black Holes edited by Mario Novello, Matt Visser and Grigori Volovik. The paper is intended as a primer, an introduction to the subject for non-experts, not as a det...

The state of ergonomics for mobile computing technology.

Science.gov (United States)

Dennerlein, Jack T

2015-01-01

Because mobile computing technologies, such as notebook computers, smart mobile phones, and tablet computers afford users many different configurations through their intended mobility, there is concern about their effects on musculoskeletal pain and a need for usage recommendations. Therefore the main goal of this paper to determine which best practices surrounding the use of mobile computing devices can be gleaned from current field and laboratory studies of mobile computing devices. An expert review was completed. Field studies have documented various user configurations, which often include non-neutral postures, that users adopt when using mobile technology, along with some evidence suggesting that longer duration of use is associated with more discomfort. It is therefore prudent for users to take advantage of their mobility and not get stuck in any given posture for too long. The use of accessories such as appropriate cases or riser stands, as well as external keyboards and pointing devices, can also improve postures and comfort. Overall, the state of ergonomics for mobile technology is a work in progress and there are more research questions to be addressed.

A Study on Improving the Efficiency of Mobile Phone Use in Classroom

Institute of Scientific and Technical Information of China (English)

顾铭; 刘乃美

2016-01-01

Mobile phone’s ubiquitous presence is clearly an indication of its significance and indispensability in the modern soci-ety. Although nobody doubts the necessity of mobile phone in daily life, a heated debate over impacts of mobile phone use on student’s learning have been discussing. University students are progressively turning to their mobile phones in communication, searching information in learning, and then their mobile phone use in classroom becomes the topic of this study. Based on the findings, some strategies related to negative use and overuse are provided.

Specific and sensitive quantitative RT-PCR of miRNAs with DNA primers

DEFF Research Database (Denmark)

Balcells, Ingrid; Cirera Salicio, Susanna; Busk, Peter K.

2011-01-01

BACKGROUND: MicroRNAs are important regulators of gene expression at the post-transcriptional level and play an important role in many biological processes. Due to the important biological role it is of great interest to quantitatively determine their expression level in different biological...... be designed with a success rate of 94%. The method was able to quantify synthetic templates over eight orders of magnitude and readily discriminated between microRNAs with single nucleotide differences. Importantly, PCR with DNA primers yielded significantly higher amplification efficiencies of biological...... samples than a similar method based on locked nucleic acids-spiked primers, which is in agreement with the observation that locked nucleic acid interferes with efficient amplification of short templates. The higher amplification efficiency of DNA primers translates into higher sensitivity and precision...

The study of a Mg-rich epoxy primer for protection of AZ91D magnesium alloy

Energy Technology Data Exchange (ETDEWEB)

Lu Xiangyu [School of Materials Science and Engineering, Beijing University of Chemical Technology, Beijing 100029 (China); Zuo Yu, E-mail: zuoy@mail.buct.edu.c [School of Materials Science and Engineering, Beijing University of Chemical Technology, Beijing 100029 (China); Zhao Xuhui; Tang Yuming; Feng Xingguo [School of Materials Science and Engineering, Beijing University of Chemical Technology, Beijing 100029 (China)

2011-01-15

Research highlights: {yields} A Mg-rich epoxy primer was prepared by adding pure magnesium particles in epoxy coating. Cross scratch testing results showed that in 3% NaCl solution the Mg-rich primer showed better protection for AZ91D magnesium alloy than the same epoxy primer without Mg addition. {yields} The open circuit potential of AZ91D alloy in NaCl solution decreased after coated with Mg-rich coating, suggesting that cathodic protection effect of the Mg-rich coating on AZ91D alloy was present. {yields} EIS studies showed that during the immersion tests of AZ91D alloy with Mg-rich coating the magnesium particles in coating dissolved with the charge-transfer resistance R{sub ct} at the magnesium particle/coating interface decreased and the double-layer capacitance Q{sub dl} increased. While the coating resistance remained stable for a long time and corrosion of the AZ91D alloy substrate was obviously delayed. - Abstract: A Mg-rich epoxy primer was prepared by adding pure magnesium particles to an epoxy coating. The coating properties were studied with electrochemical impedance spectroscopy (EIS), scanning electronic microscopy (SEM) and X-ray diffraction (XRD). The Mg-rich primer showed better protection for AZ91D magnesium alloy than the same epoxy primer without Mg addition. The open circuit potential measurements showed cathodic protection effect of the Mg-rich primer on AZ91D alloy. Cross scratch testing showed that the Mg-rich primer provided better protection for the substrate than original epoxy coating. The precipitation of Mg(OH){sub 2} in the coating also provided some degree of barrier protection.

The study of a Mg-rich epoxy primer for protection of AZ91D magnesium alloy

International Nuclear Information System (INIS)

Lu Xiangyu; Zuo Yu; Zhao Xuhui; Tang Yuming; Feng Xingguo

2011-01-01

Research highlights: → A Mg-rich epoxy primer was prepared by adding pure magnesium particles in epoxy coating. Cross scratch testing results showed that in 3% NaCl solution the Mg-rich primer showed better protection for AZ91D magnesium alloy than the same epoxy primer without Mg addition. → The open circuit potential of AZ91D alloy in NaCl solution decreased after coated with Mg-rich coating, suggesting that cathodic protection effect of the Mg-rich coating on AZ91D alloy was present. → EIS studies showed that during the immersion tests of AZ91D alloy with Mg-rich coating the magnesium particles in coating dissolved with the charge-transfer resistance R ct at the magnesium particle/coating interface decreased and the double-layer capacitance Q dl increased. While the coating resistance remained stable for a long time and corrosion of the AZ91D alloy substrate was obviously delayed. - Abstract: A Mg-rich epoxy primer was prepared by adding pure magnesium particles to an epoxy coating. The coating properties were studied with electrochemical impedance spectroscopy (EIS), scanning electronic microscopy (SEM) and X-ray diffraction (XRD). The Mg-rich primer showed better protection for AZ91D magnesium alloy than the same epoxy primer without Mg addition. The open circuit potential measurements showed cathodic protection effect of the Mg-rich primer on AZ91D alloy. Cross scratch testing showed that the Mg-rich primer provided better protection for the substrate than original epoxy coating. The precipitation of Mg(OH) 2 in the coating also provided some degree of barrier protection.

Metabolomics: A Primer.

Science.gov (United States)

Liu, Xiaojing; Locasale, Jason W

2017-04-01

Metabolomics generates a profile of small molecules that are derived from cellular metabolism and can directly reflect the outcome of complex networks of biochemical reactions, thus providing insights into multiple aspects of cellular physiology. Technological advances have enabled rapid and increasingly expansive data acquisition with samples as small as single cells; however, substantial challenges in the field remain. In this primer we provide an overview of metabolomics, especially mass spectrometry (MS)-based metabolomics, which uses liquid chromatography (LC) for separation, and discuss its utilities and limitations. We identify and discuss several areas at the frontier of metabolomics. Our goal is to give the reader a sense of what might be accomplished when conducting a metabolomics experiment, now and in the near future. Copyright © 2017 Elsevier Ltd. All rights reserved.

Physiological Effects of Early Incremental Mobilization of a Patient with Acute Intracerebral and Intraventricular Hemorrhage Requiring Dual External Ventricular Drainage.

Science.gov (United States)

Kumble, Sowmya; Zink, Elizabeth K; Burch, Mackenzie; Deluzio, Sandra; Stevens, Robert D; Bahouth, Mona N

2017-08-01

Recent trials have challenged the notion that very early mobility benefits patients with acute stroke. It is unclear how cerebral autoregulatory impairments, prevalent in this population, could be affected by mobilization. The safety of mobilizing patients who have external ventricular drainage (EVD) devices for cerebrospinal fluid diversion and intracranial pressure (ICP) monitoring is another concern due to risk of device dislodgment and potential elevation in ICP. We report hemodynamic and ICP responses during progressive, device-assisted mobility interventions performed in a critically ill patient with intracerebral hemorrhage (ICH) requiring two EVDs. A 55-year-old man was admitted to the Neuroscience Critical Care Unit with an acute thalamic ICH and complex intraventricular hemorrhage requiring placement of two EVDs. Progressive mobilization was achieved using mobility technology devices. Range of motion exercises were performed initially, progressing to supine cycle ergometry followed by incremental verticalization using a tilt table. Physiological parameters were recorded before and after the interventions. All mobility interventions were completed without any adverse event or clinically detectable change in the patient's neurological state. Physiological parameters including hemodynamic variables and ICP remained within prescribed goals throughout. Progressive, device-assisted early mobilization was feasible and safe in this critically ill patient with hemorrhagic stroke when titrated by an interdisciplinary team of skilled healthcare professionals. Studies are needed to gain insight into the hemodynamic and neurophysiological responses associated with early mobility in acute stroke to identify subsets of patients who are most likely to benefit from this intervention.

Primer on Health Surveys

Directory of Open Access Journals (Sweden)

David L Nordstrom

2012-06-01

Full Text Available The aim of this paper is to introduce novice researchers to surveys as a method of data collection. It starts with the definition of a survey, its major purposes and types as well as changes in the goals surveys have helped to achieve over time. Advantages and disadvantages of surveys over population censuses and medical examinations are discussed. Approaches to questionnaire construction are introduced along with properties that questionnaires are evaluated for. Modes of administration, sample size issues, and data analysis approaches are also introduced. The primer is illustrated with examples of surveys conducted in different countries with various public health purposes.

Hubungan Stres dengan Kejadian Dismenore Primer pada Mahasiswi Pendidikan Dokter Fakultas Kedokteran Universitas Andalas

Directory of Open Access Journals (Sweden)

Diana Sari

2015-05-01

Full Text Available AbstrakDismenore primer merupakan nyeri menstruasi yang dijumpai tanpa kelainan yang nyata pada alat-alat genital. Lebih dari 50% wanita mengalami dismenore primer dan 15% diantaranya mengalami nyeri yang hebat.Tujuan penelitian ini adalah untuk menentukan hubungan tingkat stres dengan derajat dismenore primer. Penelitian dilakukan pada mahasiswi pendidikan dokter Fakultas Kedokteran Universitas Andalas angkatan 2009 dan 2010. Desain penelitian ini menggunakan cross sectional study dengan jumlah subjek 165 orang. Pengumpulan data dari responden dilakukan dengan wawancara terpimpin (pengisian kuesioner. Analisa statistik yang digunakan adalah uji chi-square dan uji koefisien korelasi sederhana. Uji chi-square menunjukan ada hubungan yang bermakna antara stres dengan kejadian dismenore primer dan uji statistik koefisien korelasi sederhana menunjukkan ada hubungan yang bermakna dengan korelasi agak lemah antara tingkat stres dengan derajat dismenore primer.Kata kunci: stres, dismenore primer, mahasiswi fakultas kedokteran AbstractPrimary dysmenorrhoea is menstrual pain founded without real abnormalities in genital organs. More than 50% woman experiance it and 15% had severe pain. The objective of this study was to determine relationship between stress and primary dysmenorrhoea. Research was executed to education medical female students medical faculty of Andalas University class of 2009 and 2010. This research use cross sectional study design with 165 subjects. Data was collected by guided interview. Statistic analysis use chi-square test and simple correlation test. Chi-square test show there is significant relationship between stress and primary dysmenorrhoea and simple coefficient test show there is weak correlation between stress levels and degree of primary dysmenorrhoea.Keywords: stress, primary dysmenorrhoea, female student of medical faculty

Mobile Music, Sensors, Physical Modeling, and Digital Fabrication: Articulating the Augmented Mobile Instrument

Directory of Open Access Journals (Sweden)

Romain Michon

2017-12-01

Full Text Available Two concepts are presented, extended, and unified in this paper: mobile device augmentation towards musical instruments design and the concept of hybrid instruments. The first consists of using mobile devices at the heart of novel musical instruments. Smartphones and tablets are augmented with passive and active elements that can take part in the production of sound (e.g., resonators, exciter, etc., add new affordances to the device, or change its global aesthetics and shape. Hybrid instruments combine physical/acoustical and “physically informed” virtual/digital elements. Recent progress in physical modeling of musical instruments and digital fabrication is exploited to treat instrument parts in a multidimensional way, allowing any physical element to be substituted with a virtual one and vice versa (as long as it is physically possible. A wide range of tools to design mobile hybrid instruments is introduced and evaluated. Aesthetic and design considerations when making such instruments are also presented through a series of examples.

Qualification and Flight Test of Non-Chrome Primers for C-130 Aircraft

Science.gov (United States)

2011-08-17

system  Significant hexavalent chrome reduction in finish system  Potential exposure level of spray applied chromated conversion coating not as...Lockheed Martin Aeronautics Company Qualification and Flight Test of Non- Chrome Primers for C-130 Aircraft Scott Jones Lockheed Martin...00-2011 to 00-00-2011 4. TITLE AND SUBTITLE Qualification and Flight Test of Non- Chrome Primers for C-130 Aircraft 5a. CONTRACT NUMBER 5b. GRANT

A two primers random amplified polymorphic DNA procedure to obtain polymerase chain reaction fingerprints of bacterial species.

Science.gov (United States)

Rivas, R; Velázquez, E; Valverde, A; Mateos, P F; Martínez-Molina, E

2001-04-01

Polymerase chain reation (PCR) fingerprints are used to characterize and recognize bacteria and are generally obtained using universal primers that generate an array of DNA amplicons, which can be separated by electrophoresis. Universal primers 8F and 1491 R have been used to amplify specifically 16S rDNA. We have used these primers at an annealing temperature of 50 degrees C. Agarose gel electrophoresis of PCR products revealed several bands. The band pattern of each bacterial species was different and the strains belonging to the same species shared an identical pattern. The patterns obtained did not show variations with plasmid DNA content or the growth stage of the bacteria. The peculiarity of the randomly amplified polymorphic DNA (RAPD) described in this work lies in the use of two large primers (proximately 20 nt) to obtain the pattern, since normally a only smaller primer is used, and in the new application for the primers used to amplify 16S rDNA. This new procedure, called two primers (TP)-RAPD fingerprinting, is thus rapid, sensitive, reliable, highly reproducible and suitable for experiments with a large number of microorganisms, and can be applied to bacterial taxonomy, ecological studies and for the detection of new bacterial species.

A novel photoinduced electron transfer (PET) primer technique for rapid real-time PCR detection of Cryptosporidium spp

Energy Technology Data Exchange (ETDEWEB)

Jothikumar, N., E-mail: jin2@cdc.gov; Hill, Vincent R.

2013-06-28

Highlights: •Uses a single-labeled fluorescent primer for real-time PCR. •The detection sensitivity of PET PCR was comparable to TaqMan PCR. •Melt curve analysis can be performed to confirm target amplicon production. •Conventional PCR primers can be converted to PET PCR primers. -- Abstract: We report the development of a fluorescently labeled oligonucleotide primer that can be used to monitor real-time PCR. The primer has two parts, the 3′-end of the primer is complimentary to the target and a universal 17-mer stem loop at the 5′-end forms a hairpin structure. A fluorescent dye is attached to 5′-end of either the forward or reverse primer. The presence of guanosine residues at the first and second position of the 3′ dangling end effectively quenches the fluorescence due to the photo electron transfer (PET) mechanism. During the synthesis of nucleic acid, the hairpin structure is linearized and the fluorescence of the incorporated primer increases several-fold due to release of the fluorescently labeled tail and the absence of guanosine quenching. As amplicons are synthesized during nucleic acid amplification, the fluorescence increase in the reaction mixture can be measured with commercially available real-time PCR instruments. In addition, a melting procedure can be performed to denature the double-stranded amplicons, thereby generating fluorescence peaks that can differentiate primer dimers and other non-specific amplicons if formed during the reaction. We demonstrated the application of PET-PCR for the rapid detection and quantification of Cryptosporidium parvum DNA. Comparison with a previously published TaqMan® assay demonstrated that the two real-time PCR assays exhibited similar sensitivity for a dynamic range of detection of 6000–0.6 oocysts per reaction. PET PCR primers are simple to design and less-expensive than dual-labeled probe PCR methods, and should be of interest for use by laboratories operating in resource

A novel photoinduced electron transfer (PET) primer technique for rapid real-time PCR detection of Cryptosporidium spp

International Nuclear Information System (INIS)

Jothikumar, N.; Hill, Vincent R.

2013-01-01

Highlights: •Uses a single-labeled fluorescent primer for real-time PCR. •The detection sensitivity of PET PCR was comparable to TaqMan PCR. •Melt curve analysis can be performed to confirm target amplicon production. •Conventional PCR primers can be converted to PET PCR primers. -- Abstract: We report the development of a fluorescently labeled oligonucleotide primer that can be used to monitor real-time PCR. The primer has two parts, the 3′-end of the primer is complimentary to the target and a universal 17-mer stem loop at the 5′-end forms a hairpin structure. A fluorescent dye is attached to 5′-end of either the forward or reverse primer. The presence of guanosine residues at the first and second position of the 3′ dangling end effectively quenches the fluorescence due to the photo electron transfer (PET) mechanism. During the synthesis of nucleic acid, the hairpin structure is linearized and the fluorescence of the incorporated primer increases several-fold due to release of the fluorescently labeled tail and the absence of guanosine quenching. As amplicons are synthesized during nucleic acid amplification, the fluorescence increase in the reaction mixture can be measured with commercially available real-time PCR instruments. In addition, a melting procedure can be performed to denature the double-stranded amplicons, thereby generating fluorescence peaks that can differentiate primer dimers and other non-specific amplicons if formed during the reaction. We demonstrated the application of PET-PCR for the rapid detection and quantification of Cryptosporidium parvum DNA. Comparison with a previously published TaqMan® assay demonstrated that the two real-time PCR assays exhibited similar sensitivity for a dynamic range of detection of 6000–0.6 oocysts per reaction. PET PCR primers are simple to design and less-expensive than dual-labeled probe PCR methods, and should be of interest for use by laboratories operating in resource

Single primer amplification reaction methods reveal exotic and ...

Indian Academy of Sciences (India)

Unknown

mulberry varieties using three different PCR based single primer amplification ..... the results of a multi- variate analysis using Mahalanobis D2 statistic in case of .... Rajan M V, Chaturvedi H K and Sarkar A 1997 Multivariate analysis as an aid ...

MSP-HTPrimer: a high-throughput primer design tool to improve assay design for DNA methylation analysis in epigenetics.

Science.gov (United States)

Pandey, Ram Vinay; Pulverer, Walter; Kallmeyer, Rainer; Beikircher, Gabriel; Pabinger, Stephan; Kriegner, Albert; Weinhäusel, Andreas

2016-01-01

Bisulfite (BS) conversion-based and methylation-sensitive restriction enzyme (MSRE)-based PCR methods have been the most commonly used techniques for locus-specific DNA methylation analysis. However, both methods have advantages and limitations. Thus, an integrated approach would be extremely useful to quantify the DNA methylation status successfully with great sensitivity and specificity. Designing specific and optimized primers for target regions is the most critical and challenging step in obtaining the adequate DNA methylation results using PCR-based methods. Currently, no integrated, optimized, and high-throughput methylation-specific primer design software methods are available for both BS- and MSRE-based methods. Therefore an integrated, powerful, and easy-to-use methylation-specific primer design pipeline with great accuracy and success rate will be very useful. We have developed a new web-based pipeline, called MSP-HTPrimer, to design primers pairs for MSP, BSP, pyrosequencing, COBRA, and MSRE assays on both genomic strands. First, our pipeline converts all target sequences into bisulfite-treated templates for both forward and reverse strand and designs all possible primer pairs, followed by filtering for single nucleotide polymorphisms (SNPs) and known repeat regions. Next, each primer pairs are annotated with the upstream and downstream RefSeq genes, CpG island, and cut sites (for COBRA and MSRE). Finally, MSP-HTPrimer selects specific primers from both strands based on custom and user-defined hierarchical selection criteria. MSP-HTPrimer produces a primer pair summary output table in TXT and HTML format for display and UCSC custom tracks for resulting primer pairs in GTF format. MSP-HTPrimer is an integrated, web-based, and high-throughput pipeline and has no limitation on the number and size of target sequences and designs MSP, BSP, pyrosequencing, COBRA, and MSRE assays. It is the only pipeline, which automatically designs primers on both genomic

Human Exploration Systems and Mobility Capability Roadmap Progress Review

Science.gov (United States)

Culbert, Chris; Taylor, Jeff

2005-01-01

Contents include the following: Capability Roadmap Team. Capability Description and Capability Breakdown Structure. Benefits of the Human Systems and Mobility Capability. Roadmap Process and Approach. Drivers and Assumptions for the whole team. Current State-of-the-Art, Assumptions and Requirements will be covered in the appropriate sections. Capability Presentations by Leads under Roadmap (Repeated for each capability under roadmap). Capability Description, Benefits, Current State-of-the-Art. Capability Requirements and Assumptions. Roadmap for Capability. Capability Readiness Level. Technology Readiness Level. Figures of Merit. Summary of Top Level Capability. Significant Technical Challenges. Summary and Forward Work.

Guidelines - A Primer for Communicating Effectively with NABIR Stakeholders

Energy Technology Data Exchange (ETDEWEB)

Bilyard, G.R.; Word, C.J.; Weber, J.R.; Harding, A.K.

2000-09-27

This primer is a tool to help prepare scientists for meetings with stakeholders. It was prepared for staff involved with the Natural and Accelerated Bioremediation Research (NABIR) program, sponsored by the U.S. Department of Energy. It discusses why some efforts in science communication may succeed while others fail, provides methods of approaching group interactions about science that may better orient expert participants, and summarizes experience drawn from observations of groups interacting about topics in bioremediation or the NABIR program. The primer also provides brief, useful models for interacting with either expert or non-expert groups. Finally, it identifies topical areas that may help scientists prepare for public meetings, based on the developers' ongoing research in science communication in public forums.

Guidelines - A Primer for Communicating Effectively with NABIR Stakeholders

Energy Technology Data Exchange (ETDEWEB)

A Harding; B Metting; C Word; G Bilyard; G Hund; J Amaya; J Weber; S Gajewski; S Underriner; T Peterson

1998-12-10

This primer is a tool to help prepare scientists for meetings with stakeholders. It was prepared for staff involved with the Natural and Accelerated Bioremediation Research (NABIR) program, sponsored by the U.S. Department of Energy. It discusses why some efforts in science communication may succeed while others fail, provides methods of approaching group interactions about science that may better orient expert participants, and summarizes experience drawn from observations of @oups interacting about topics in bioremediation or the NABIR program. The primer also provides briez usefid models for interacting with either expert or non-expert groups. Finally, it identifies topical areas that may help scientists prepare for public meetings, based on the developers' ongoing research in science communication in public forums.

Summary of the primer on tumor immunology and the biological therapy of cancer

Directory of Open Access Journals (Sweden)

Margolin Kim

2009-01-01

Full Text Available Abstract The International Society for Biological Therapy of Cancer (iSBTc is one of the "premier destinations for interaction and innovation in the cancer biologics community". It provides a primer course each year during the annual meeting to address the most important areas of tumor immunology and immunotherapy. The course has been given by prominent investigators in the area of interest, covering the core principles of cancer immunology and immunotherapy. The target audience for this program includes investigators from academic, regulatory, and biopharmaceutical venues. The program goal is to enable the attendees to learn the current status and the most recent advances in biologic therapies, and to leverage this knowledge towards the improvement of cancer therapy. The 2008 immunologic primer course was held on October 30 at the 23rd Annual meeting of iSBTc in San Diego, CA. Nine internationally renowned investigators gave excellent presentations on different topics. The topics covered in this primer included: (1 cytokines in cancer immunology; (2 anti-angiogenic therapy; (3 end stage: immune killing of tumors; (4 blocking T cell checkpoints; (5 approach to identification and therapeutic exploitation of tumor antigens; (6 T regulatory cells; (7 adoptive T cell therapy; (8 immune monitoring of cancer immunotherapy; and (9 immune adjuvants. We summarized the topics in this primer for public education. The related topic slides and schedule can be accessed online http://www.isbtc.org/meetings/am08/primer08.

Screening for Residual Disease in Pediatric Burkitt Lymphoma Using Consensus Primer Pools

Directory of Open Access Journals (Sweden)

Melissa Agsalda

2009-01-01

Full Text Available Assessing molecular persistent or minimal residual disease (PD/MRD in childhood Burkitt lymphoma (BL is challenging because access to original tumor is usually needed to design patient-specific primers (PSPs. Because BL is characterized by rearranged immunoglobulin heavy chain (IgVH genes, IgVH primer pools from IgVH1–IgVH7 regions were tested to detect PD/MRD, thus eliminating the need for original tumor. The focus of the current study was to assess the feasibility of using IgVH primer pools to detect disease in clinical specimens. Fourteen children diagnosed with B-NHL had follow-up repository specimens available to assess PD/MRD. Of the 14 patients, 12 were PD/MRD negative after 2 months of therapy and remained in remission at the end of therapy; 2/14 patients were PD/MRD positive at 2-3 months and later relapsed. PSP-based assays from these 14 patients showed 100% concordance with the current assay. This feasibility study warrants further investigation to assess PD/MRD using IgVH primer pools, which could have clinical significance as a real-time assessment tool to monitor pediatric BL and possibly other B-cell non-Hodgkin lymphoma therapy.

Screening for residual disease in pediatric burkitt lymphoma using consensus primer pools.

Science.gov (United States)

Agsalda, Melissa; Kusao, Ian; Troelstrup, David; Shiramizu, Bruce

2009-01-01

Assessing molecular persistent or minimal residual disease (PD/MRD) in childhood Burkitt lymphoma (BL) is challenging because access to original tumor is usually needed to design patient-specific primers (PSPs). Because BL is characterized by rearranged immunoglobulin heavy chain (IgV(H)) genes, IgV(H) primer pools from IgV(H1)-IgV(H7) regions were tested to detect PD/MRD, thus eliminating the need for original tumor. The focus of the current study was to assess the feasibility of using IgV(H) primer pools to detect disease in clinical specimens. Fourteen children diagnosed with B-NHL had follow-up repository specimens available to assess PD/MRD. Of the 14 patients, 12 were PD/MRD negative after 2 months of therapy and remained in remission at the end of therapy; 2/14 patients were PD/MRD positive at 2-3 months and later relapsed. PSP-based assays from these 14 patients showed 100% concordance with the current assay. This feasibility study warrants further investigation to assess PD/MRD using IgV(H) primer pools, which could have clinical significance as a real-time assessment tool to monitor pediatric BL and possibly other B-cell non-Hodgkin lymphoma therapy.

MRI Primer

International Nuclear Information System (INIS)

Oldendorf, W.; Oldendorf, W. Jr.

1991-01-01

Designed for studies, radiologists, and clinicians at all levels of training, this book provides a basic introduction to the principles, physics, and instrumentation of magnetic resonance imaging. The fundamental concepts that are essential for the optimal clinical use of MRI are thoroughly explained in easily accessible terms. To facilitate the reader's comprehension, the material is presented nonmathematically, using no equations and a minimum of symbols and abbreviations. MRI Primer presents a clear account of the phenomenon of nuclear magnetic resonance and the use of gradient magnetic fields to create clinically useful images of cross-sectional slices. Close attention is given to the magnetization vector as a means of expressing nuclear behavior, the role of T 1 and T 2 weighing in imaging, the use of contrast agents, and the pulse sequences most often used in clinical practice, as well as to the relative capabilities and limitations of MRI and CT. The basic hardware components of an MRI scanner are described in detail. Sample MRI scans illustrate how MRI characterizes tissue. An appendix provides a brief introduction to quantum processes in MRI

A primer of multivariate statistics

CERN Document Server

Harris, Richard J

2014-01-01

Drawing upon more than 30 years of experience in working with statistics, Dr. Richard J. Harris has updated A Primer of Multivariate Statistics to provide a model of balance between how-to and why. This classic text covers multivariate techniques with a taste of latent variable approaches. Throughout the book there is a focus on the importance of describing and testing one's interpretations of the emergent variables that are produced by multivariate analysis. This edition retains its conversational writing style while focusing on classical techniques. The book gives the reader a feel for why

Rapid and sensitive electrochemiluminescence detection of rotavirus by magnetic primer based reverse transcription-polymerase chain reaction

International Nuclear Information System (INIS)

Zhan Fangfang; Zhou Xiaoming; Xing Da

2013-01-01

Graphical abstract: In this work, we have developed and demonstrated a magnetic primer based RT-PCR assay for ECL detection of rotavirus. In the presence of two functional primers (magnetic primer and TBR-primer) and PCR reagents, cDNA from RT was amplified directly onto MPs during PCR cycles of denaturation, annealing and extension. The resulting MPs–TBR complexes were easily loaded on the electrode surface and produced a concentrated ECL signal. The figure shows the schematic illustration of magnetic primer RT-PCR based ECL assay for rotavirus detection. Highlights: ► A novel method for detection of rotavirus has been developed. ► In the presence of magnetic primer, TBR-primer and PCR reagents, cDNA form RT was amplified directly onto MPs. ► To obtain the best sensing and efficient performance, important parameters associated with the efficiency were investigated carefully. ► The proposed method will find numerous applications in food safety field and clinical diagnosis. - Abstract: A novel method for detection of rotavirus has been developed by integrating magnetic primer based reverse transcription-polymerase chain reaction (RT-PCR) with electrochemiluminescence (ECL) detection. This is realized by accomplishing RT of rotavirus RNA in traditional way and performing PCR of the resulting cDNA fragment on the surface of magnetic particles (MPs). In order to implement PCR on MPs and achieve rapid ECL detection, forward and reverse primers are bounded to MPs and tris-(2,2′-bipyridyl) ruthenium (TBR), respectively. After RT-PCR amplification, the TBR labels are directly enriched onto the surface of MPs. Then the MPs–TBR complexes can be loaded on the electrode surface and analyzed by magnetic ECL platform without any post-modification or post-incubation process. So some laborious manual operations can be avoided to achieve rapid yet sensitive detection. In this study, rotavirus in fecal specimens was successfully detected within 1.5 h. Experimental

A Primer on Basic Effect Size Concepts.

Science.gov (United States)

Elmore, Patricia B.; Rotou, Ourania

The increased interest in reporting effect sizes means that it is necessary to consider what should be included in a primer on effect sizes. A review of papers on effect sizes and commonly repeated statistical analyses suggests that it is important to discuss effect sizes relative to bivariate correlation, t-tests, analysis of variance/covariance,…

Teachers and Students Poised to Use Mobile Phones in the Classroom

Science.gov (United States)

O'Bannon, B. W.; Waters, S.; Lubke, J.; Cady, J.; Rearden, K.

2017-01-01

This study examined the perceptions of 15 teachers and 103 middle school students at a progressive private school located in Mumbai, India to determine their support for the use of mobile phones in the classroom, their perceptions of the mobile phone features that are beneficial for school-related work, and the instructional benefits and barriers…

The Relationship between School Mobility and the Acquisition of Early Literacy Skills

Science.gov (United States)

Franco, Amy C.

2013-01-01

The relationship between frequent mobility and student achievement is complex. While studies have shown that frequent mobility may have a detrimental effect on student achievement, the suggestion that poverty is an underlying cause for poor academic progress has been proposed (Buerkle & Christenson, 1999; United States GAO Report, 2010). The…

The Universal Primer - An open source solution for archiving, organizing and streaming live lectures

DEFF Research Database (Denmark)

Christoffersen, Marc Juul; Panton, Hans Christian Hansen; Krajowski-Kukiel, Maciej

2011-01-01

. The goal of the Universal Primer is to address these problems, and allow anyone, anywhere, to teach or learn anything that can be reasonably taught or learned through a computer. The Universal Primer is 1: A fully open source solution for streaming live lectures. And 2: A Wikipedia-like website...

A Brief Taxometrics Primer

Science.gov (United States)

Beauchaine, Theodore P.

2009-01-01

Taxometric procedures provide an empirical means of determining which psychiatric disorders are typologically distinct from normal behavioral functioning. Although most disorders reflect extremes along continuously distributed behavioral traits, identifying those that are discrete has important implications for accurate diagnosis, effective treatment, early identification of risk, and improved understanding of etiology. This article provides (a) brief descriptions of the conceptual bases of several taxometric procedures, (b) example analyses using simulated data, and (c) strategies for avoiding common pitfalls that are often observed in taxometrics research. To date, most taxometrics studies have appeared in the adult psychopathology literature. It is hoped that this primer will encourage interested readers to extend taxometrics research to child and adolescent populations. PMID:18088222

Magnesium-Based Sacrificial Anode Cathodic Protection Coatings (Mg-Rich Primers for Aluminum Alloys

Directory of Open Access Journals (Sweden)

Michael D. Blanton

2012-09-01

Full Text Available Magnesium is electrochemically the most active metal employed in common structural alloys of iron and aluminum. Mg is widely used as a sacrificial anode to provide cathodic protection of underground and undersea metallic structures, ships, submarines, bridges, decks, aircraft and ground transportation systems. Following the same principle of utilizing Mg characteristics in engineering advantages in a decade-long successful R&D effort, Mg powder is now employed in organic coatings (termed as Mg-rich primers as a sacrificial anode pigment to protect aerospace grade aluminum alloys against corrosion. Mg-rich primers have performed very well on aluminum alloys when compared against the current chromate standard, but the carcinogenic chromate-based coatings/pretreatments are being widely used by the Department of Defense (DoD to protect its infrastructure and fleets against corrosion damage. Factors such as reactivity of Mg particles in the coating matrix during exposure to aggressive corrosion environments, interaction of atmospheric gases with Mg particles and the impact of Mg dissolution, increases in pH and hydrogen gas liberation at coating-metal interface, and primer adhesion need to be considered for further development of Mg-rich primer technology.

Measuring the post-adoption customer perception of mobile banking services.

Science.gov (United States)

Yu, Tai-Kuei; Fang, Kwoting

2009-02-01

With liberalization and internalization in the financial market and progress in information technology, banks face dual competitive pressures to provide service quality and administrative efficiency. That these recent developments are fueled by technology might misleadingly suggest that the adoption of mobile banking is largely based on technological criteria. The purpose of this study is to establish a better measurement model for postadoption user perception of mobile banking services. Based on 458 valid responses of mobile banking users, the results show that the instrument, consisting of 21 items and 6 factors, is a reliable, valid, and useful measurement for assessing the postadoption perception of mobile banking.

Invading stacking primer: A trigger for high-efficiency isothermal amplification reaction with superior selectivity for detecting microRNA variants.

Science.gov (United States)

Liu, Weipeng; Zhu, Minjun; Liu, Hongxing; Wei, Jitao; Zhou, Xiaoming; Xing, Da

2016-07-15

Searching for a strategy to enhance the efficiency of nucleic acid amplification and achieve exquisite discrimination of nucleic acids at the single-base level for biological detection has become an exciting research direction in recent years. Here, we have developed a simple and universal primer design strategy which produces a fascinating effect on isothermal strand displacement amplification (iSDA). We refer to the resultant primer as "invading stacking primer (IS-Primer)" which is based on contiguous stacking hybridization and toehold-mediated exchange reaction and function by merely changing the hybridization location of the primer. Using the IS-Primer, the sensitivity in detecting the target miR-21 is improved approximately five fold compared with the traditional iSDA reaction. It was further demonstrated that the IS-Primer acts as an invading strand to initiate branch migration which can increase the efficiency of the untwisting of the hairpin probe. This effect is equivalent to reducing the free energy of the stem, and the technique shows superior selectivity for single-base mismatches. By demonstrating the enhanced effect of the IS-Primer in the iSDA reaction, this work may provide a potentially new avenue for developing more sensitive and selective nucleic acids assays. Copyright © 2016 Elsevier B.V. All rights reserved.

Progress on mobility and instability of research personnel in Japan: scientometrics on a job-posting database for monitoring the academic job market

Energy Technology Data Exchange (ETDEWEB)

Kawashima, H.; Yamashita, Y.

2016-07-01

This study has two purposes. The first purpose is to extract statistics from a database of jobposting cards, previously little-used as a data source, to assess the academic job market. The second purpose is to connect statistics on the academic job market with monitoring of indicators of policy progress related to the mobility and instability of research personnel. The data source used in this study is a job-posting database named JREC-IN Portal, which is the de facto standard for academic job seeking in Japan. The present results show a growing proportion of fixed-term researchers in the Japanese academic job market and that job information is increasingly diverse. (Author)

Taxon-specific PCR primers to detect two inconspicuous arbuscular mycorrhizal fungi from temperate agricultural grassland

NARCIS (Netherlands)

Gamper, H.A.; Leuchtmann, A.

2007-01-01

Taxon-specific polymerase chain reaction (PCR) primers enable detection of arbuscular mycorrhizal fungi (AMF, Glomeromycota) in plant roots where the fungi lack discriminative morphological and biochemical characters. We designed and validated pairs of new PCR primers targeted to the flanking

Development and evaluation of new primers for PCR-based identification of Prevotella intermedia.

Science.gov (United States)

Zhou, Yanbin; Liu, Dali; Wang, Yiwei; Zhu, Cailian; Liang, Jingping; Shu, Rong

2014-08-01

The aim of this study was to develop new Prevotella intermedia-specific PCR primers based on the 16S rRNA. The new primer set, Pi-192 and Pi-468, increased the accuracy of PCR-based P. intermedia identification and could be useful in the detection of P. intermedia as well as epidemiological studies on periodontal disease. Copyright © 2014 Elsevier Ltd. All rights reserved.

Molecular Basis for DNA Double-Strand Break Annealing and Primer Extension by an NHEJ DNA Polymerase

Directory of Open Access Journals (Sweden)

Nigel C. Brissett

2013-11-01

Full Text Available Nonhomologous end-joining (NHEJ is one of the major DNA double-strand break (DSB repair pathways. The mechanisms by which breaks are competently brought together and extended during NHEJ is poorly understood. As polymerases extend DNA in a 5′-3′ direction by nucleotide addition to a primer, it is unclear how NHEJ polymerases fill in break termini containing 3′ overhangs that lack a primer strand. Here, we describe, at the molecular level, how prokaryotic NHEJ polymerases configure a primer-template substrate by annealing the 3′ overhanging strands from opposing breaks, forming a gapped intermediate that can be extended in trans. We identify structural elements that facilitate docking of the 3′ ends in the active sites of adjacent polymerases and reveal how the termini act as primers for extension of the annealed break, thus explaining how such DSBs are extended in trans. This study clarifies how polymerases couple break-synapsis to catalysis, providing a molecular mechanism to explain how primer extension is achieved on DNA breaks.

Technologies of Mobility in the Americas: Introduction

DEFF Research Database (Denmark)

Vannini, Phillip; Budd, Lucy; Jensen, Ole B.

2012-01-01

Technics, technicians, and techniques form the three basic cornerstones of what this book is about. Whether it is cell phones or airplanes, passengers or magazine advertisements, what the chapters collected here have in common is a basic orientation towards technology as a set of relations....... This relational approach to technology demonstrates that technology is neither a utopian nor a dystopian force driving the universe towards progress or involution. For all the contributors to this book, what mobile communication technologies like smart phones and spatial mobility technologies like cars and ferry...

A Sharing Mind Map-Oriented Approach to Enhance Collaborative Mobile Learning with Digital Archiving Systems

Science.gov (United States)

Chang, Jui-Hung; Chiu, Po-Sheng; Huang, Yueh-Min

2018-01-01

With the advances in mobile network technology, the use of portable devices and mobile networks for learning is not limited by time and space. Such use, in combination with appropriate learning strategies, can achieve a better effect. Despite the effectiveness of mobile learning, students' learning direction, progress, and achievement may differ.…

Typing of multiple single-nucleotide polymorphisms using ribonuclease cleavage of DNA/RNA chimeric single-base extension primers and detection by MALDI-TOF mass spectrometry

DEFF Research Database (Denmark)

Mengel-From, Jonas; Sanchez Sanchez, Juan Jose; Børsting, Claus

2005-01-01

A novel single-base extension (SBE) assay using cleavable and noncleavable SBE primers in the same reaction mix is described. The cleavable SBE primers consisted of deoxyribonucleotides and one ribonucleotide (hereafter denoted chimeric primers), whereas the noncleavable SBE primers consisted....... A ribonuclease mix was developed to specifically cleave the chimeric primers, irrespective of the base of the ribonucleotide, whereas standard primers without a ribonucleotide were unaffected by the ribonuclease treatment. The SBE products were analyzed in linear mode using a matrix-assisted laser desorption...... containing 9 chimeric primers and 8 standard primers....

The astrobiology primer: an outline of general knowledge--version 1, 2006.

Science.gov (United States)

Billings, L; Cameron, V; Claire, M; Dick, G J; Domagal-Goldman, S D; Javaux, E J; Johnson, O J; Laws, C; Race, M S; Rask, J; Rummel, J D; Schelble, R T; Vance, S

2006-10-01

The Astrobiology Primer has been created as a reference tool for those who are interested in the interdisciplinary field of astrobiology. The field incorporates many diverse research endeavors, but it is our hope that this slim volume will present the reader with all he or she needs to know to become involved and to understand, at least at a fundamental level, the state of the art. Each section includes a brief overview of a topic and a short list of readable and important literature for those interested in deeper knowledge. Because of the great diversity of material, each section was written by a different author with a different expertise. Contributors, authors, and editors are listed at the beginning, along with a list of those chapters and sections for which they were responsible. We are deeply indebted to the NASA Astrobiology Institute (NAI), in particular to Estelle Dodson, David Morrison, Ed Goolish, Krisstina Wilmoth, and Rose Grymes for their continued enthusiasm and support. The Primer came about in large part because of NAI support for graduate student research, collaboration, and inclusion as well as direct funding. We have entitled the Primer version 1 in hope that it will be only the first in a series, whose future volumes will be produced every 3-5 years. This way we can insure that the Primer keeps up with the current state of research. We hope that it will be a great resource for anyone trying to stay abreast of an ever-changing field.

One fungus, which genes? Development and assessment of universal primers for potential secondary fungal DNA barcodes.

Science.gov (United States)

Stielow, J B; Lévesque, C A; Seifert, K A; Meyer, W; Iriny, L; Smits, D; Renfurm, R; Verkley, G J M; Groenewald, M; Chaduli, D; Lomascolo, A; Welti, S; Lesage-Meessen, L; Favel, A; Al-Hatmi, A M S; Damm, U; Yilmaz, N; Houbraken, J; Lombard, L; Quaedvlieg, W; Binder, M; Vaas, L A I; Vu, D; Yurkov, A; Begerow, D; Roehl, O; Guerreiro, M; Fonseca, A; Samerpitak, K; van Diepeningen, A D; Dolatabadi, S; Moreno, L F; Casaregola, S; Mallet, S; Jacques, N; Roscini, L; Egidi, E; Bizet, C; Garcia-Hermoso, D; Martín, M P; Deng, S; Groenewald, J Z; Boekhout, T; de Beer, Z W; Barnes, I; Duong, T A; Wingfield, M J; de Hoog, G S; Crous, P W; Lewis, C T; Hambleton, S; Moussa, T A A; Al-Zahrani, H S; Almaghrabi, O A; Louis-Seize, G; Assabgui, R; McCormick, W; Omer, G; Dukik, K; Cardinali, G; Eberhardt, U; de Vries, M; Robert, V

2015-12-01

The aim of this study was to assess potential candidate gene regions and corresponding universal primer pairs as secondary DNA barcodes for the fungal kingdom, additional to ITS rDNA as primary barcode. Amplification efficiencies of 14 (partially) universal primer pairs targeting eight genetic markers were tested across > 1 500 species (1 931 strains or specimens) and the outcomes of almost twenty thousand (19 577) polymerase chain reactions were evaluated. We tested several well-known primer pairs that amplify: i) sections of the nuclear ribosomal RNA gene large subunit (D1-D2 domains of 26/28S); ii) the complete internal transcribed spacer region (ITS1/2); iii) partial β -tubulin II (TUB2); iv) γ-actin (ACT); v) translation elongation factor 1-α (TEF1α); and vi) the second largest subunit of RNA-polymerase II (partial RPB2, section 5-6). Their PCR efficiencies were compared with novel candidate primers corresponding to: i) the fungal-specific translation elongation factor 3 (TEF3); ii) a small ribosomal protein necessary for t-RNA docking; iii) the 60S L10 (L1) RP; iv) DNA topoisomerase I (TOPI); v) phosphoglycerate kinase (PGK); vi) hypothetical protein LNS2; and vii) alternative sections of TEF1α. Results showed that several gene sections are accessible to universal primers (or primers universal for phyla) yielding a single PCR-product. Barcode gap and multi-dimensional scaling analyses revealed that some of the tested candidate markers have universal properties providing adequate infra- and inter-specific variation that make them attractive barcodes for species identification. Among these gene sections, a novel high fidelity primer pair for TEF1α, already widely used as a phylogenetic marker in mycology, has potential as a supplementary DNA barcode with superior resolution to ITS. Both TOPI and PGK show promise for the Ascomycota, while TOPI and LNS2 are attractive for the Pucciniomycotina, for which universal primers for ribosomal subunits often fail.

Promotion primer. Foerderfibel

Energy Technology Data Exchange (ETDEWEB)

1981-01-01

This revised edition of the promotion primer is to serve as a topical orientation aid for industrial firms, unions, boards and other bodies interested where the actions of governmental R and D and innovation policy are compiled and clearly arranged. It is important for the success of governmental aids that the institutions concerned are informed about all possibilities of the promotion, financing and advisory programme. Beyond the presentation of the research promotion sectors, the fiscal measures and the contractual as well as the joint research this revised edition focussess on the fields of consultative services for innovation and information. For many firms the access to qualified information and guidance is of particular importance. That is why this brochure points out the ways towards governmental research promotion. The BMFT has provided a remarkable contribution to research promotion by establishing information and consultative services for trade and industry.

Gold nanoparticle-assisted primer walking for closing the human chromosomal gap

DEFF Research Database (Denmark)

Li, H; Shi, B; Li, X

2013-01-01

The finished sequence of the human genome still contains 260 euchromatic gaps. All the PCR-based genome walking techniques used to close gaps have common limitations, such as low efficiency and low specificity. We herein describe a strategy to solve this problem by employing gold nanoparticles (Au......NPs) to improve the efficiency in primer walking amplification. We used this strategy to close a gap in human chromosome 5 containing a DNA stretch composed of the 12SAT repeat. The obtained gap sequence is highly conserved among several mammalian genomes. The demonstrated AuNP-assisted primer walking strategy...

Conservative fragments in bacterial 16S rRNA genes and primer design for 16S ribosomal DNA amplicons in metagenomic studies

KAUST Repository

Wang, Yong

2009-10-09

Bacterial 16S ribosomal DNA (rDNA) amplicons have been widely used in the classification of uncultured bacteria inhabiting environmental niches. Primers targeting conservative regions of the rDNAs are used to generate amplicons of variant regions that are informative in taxonomic assignment. One problem is that the percentage coverage and application scope of the primers used in previous studies are largely unknown. In this study, conservative fragments of available rDNA sequences were first mined and then used to search for candidate primers within the fragments by measuring the coverage rate defined as the percentage of bacterial sequences containing the target. Thirty predicted primers with a high coverage rate (>90%) were identified, which were basically located in the same conservative regions as known primers in previous reports, whereas 30% of the known primers were associated with a coverage rate of <90%. The application scope of the primers was also examined by calculating the percentages of failed detections in bacterial phyla. Primers A519-539, E969- 983, E1063-1081, U515 and E517, are highly recommended because of their high coverage in almost all phyla. As expected, the three predominant phyla, Firmicutes, Gemmatimonadetes and Proteobacteria, are best covered by the predicted primers. The primers recommended in this report shall facilitate a comprehensive and reliable survey of bacterial diversity in metagenomic studies. © 2009 Wang, Qian.

Rapid and sensitive electrochemiluminescence detection of rotavirus by magnetic primer based reverse transcription-polymerase chain reaction

Energy Technology Data Exchange (ETDEWEB)

Zhan Fangfang; Zhou Xiaoming [MOE Key Laboratory of Laser Life Science and Institute of Laser Life Science, College of Biophotonics, South China Normal University, Guangzhou 510631 (China); Xing Da, E-mail: xingda@scnu.edu.cn [MOE Key Laboratory of Laser Life Science and Institute of Laser Life Science, College of Biophotonics, South China Normal University, Guangzhou 510631 (China)

2013-01-25

Graphical abstract: In this work, we have developed and demonstrated a magnetic primer based RT-PCR assay for ECL detection of rotavirus. In the presence of two functional primers (magnetic primer and TBR-primer) and PCR reagents, cDNA from RT was amplified directly onto MPs during PCR cycles of denaturation, annealing and extension. The resulting MPs-TBR complexes were easily loaded on the electrode surface and produced a concentrated ECL signal. The figure shows the schematic illustration of magnetic primer RT-PCR based ECL assay for rotavirus detection. Highlights: Black-Right-Pointing-Pointer A novel method for detection of rotavirus has been developed. Black-Right-Pointing-Pointer In the presence of magnetic primer, TBR-primer and PCR reagents, cDNA form RT was amplified directly onto MPs. Black-Right-Pointing-Pointer To obtain the best sensing and efficient performance, important parameters associated with the efficiency were investigated carefully. Black-Right-Pointing-Pointer The proposed method will find numerous applications in food safety field and clinical diagnosis. - Abstract: A novel method for detection of rotavirus has been developed by integrating magnetic primer based reverse transcription-polymerase chain reaction (RT-PCR) with electrochemiluminescence (ECL) detection. This is realized by accomplishing RT of rotavirus RNA in traditional way and performing PCR of the resulting cDNA fragment on the surface of magnetic particles (MPs). In order to implement PCR on MPs and achieve rapid ECL detection, forward and reverse primers are bounded to MPs and tris-(2,2 Prime -bipyridyl) ruthenium (TBR), respectively. After RT-PCR amplification, the TBR labels are directly enriched onto the surface of MPs. Then the MPs-TBR complexes can be loaded on the electrode surface and analyzed by magnetic ECL platform without any post-modification or post-incubation process. So some laborious manual operations can be avoided to achieve rapid yet sensitive detection

Effect of oligonucleotide primers in determining viral variability within hosts

Directory of Open Access Journals (Sweden)

Moya Andrés

2004-12-01

Full Text Available Abstract Background Genetic variability in viral populations is usually estimated by means of polymerase chain reaction (PCR based methods in which the relative abundance of each amplicon is assumed to be proportional to the frequency of the corresponding template in the initial sample. Although bias in template-to-product ratios has been described before, its relevance in describing viral genetic variability at the intrapatient level has not been fully assessed yet. Results To investigate the role of oligonucleotide design in estimating viral variability within hosts, genetic diversity in hepatitis C virus (HCV populations from eight infected patients was characterised by two parallel PCR amplifications performed with two slightly different sets of primers, followed by cloning and sequencing (mean = 89 cloned sequences per patient. Population genetics analyses of viral populations recovered by pairs of amplifications revealed that in seven patients statistically significant differences were detected between populations sampled with different set of primers. Conclusions Genetic variability analyses demonstrates that PCR selection due to the choice of primers, differing in their degeneracy degree at some nucleotide positions, can eclipse totally or partially viral variants, hence yielding significant different estimates of viral variability within a single patient and therefore eventually producing quite different qualitative and quantitative descriptions of viral populations within each host.

Effect of oligonucleotide primers in determining viral variability within hosts.

Science.gov (United States)

Bracho, Maria Alma; García-Robles, Inmaculada; Jiménez, Nuria; Torres-Puente, Manuela; Moya, Andrés; González-Candelas, Fernando

2004-12-09

Genetic variability in viral populations is usually estimated by means of polymerase chain reaction (PCR) based methods in which the relative abundance of each amplicon is assumed to be proportional to the frequency of the corresponding template in the initial sample. Although bias in template-to-product ratios has been described before, its relevance in describing viral genetic variability at the intrapatient level has not been fully assessed yet. To investigate the role of oligonucleotide design in estimating viral variability within hosts, genetic diversity in hepatitis C virus (HCV) populations from eight infected patients was characterised by two parallel PCR amplifications performed with two slightly different sets of primers, followed by cloning and sequencing (mean = 89 cloned sequences per patient). Population genetics analyses of viral populations recovered by pairs of amplifications revealed that in seven patients statistically significant differences were detected between populations sampled with different set of primers. Genetic variability analyses demonstrates that PCR selection due to the choice of primers, differing in their degeneracy degree at some nucleotide positions, can eclipse totally or partially viral variants, hence yielding significant different estimates of viral variability within a single patient and therefore eventually producing quite different qualitative and quantitative descriptions of viral populations within each host.

Generation and confinement of mobile charges in buried oxide of SOI substrates

International Nuclear Information System (INIS)

Gruber, O.; Krawiec, S.; Musseau, O.; Paillet, Ph.; Courtot-Descharles, A.

1999-01-01

We analyze the mechanisms of generation and confinement of mobile protons resulting from hydrogen annealing of SOI buried oxides. This study of the mechanisms of generation and confinement of mobile protons in the buried oxide of SOI wafers emphasizes the importance of H+ diffusion in the oxide in the formation of a mobile charge. Under specific electric field conditions the irradiation of these devices results in a pinning of this mobile charge at the bottom Si-SiO 2 interface. Ab initio calculations are in progress to investigate the possible precursor defects in the oxide and detail the mechanism for mobile proton generation and confinement. (authors)

Mobile applications and Virtual Observatory

Science.gov (United States)

Schaaff, A.; Jagade, S.

2015-06-01

Within a few years, smartphones and Internet tablets have become the devices to access Web or standalone applications from everywhere, with a rapid development of the bandwidth of the mobile networks (e.g. 4G). Internet tablets are used to take notes during meetings or conferences, to read scientific papers in public transportation, etc. A smartphone is for example a way to have your data in the pocket or to control, from everywhere, the progress of a heavy workflow process. These mobile devices have enough powerful hardware to run more and more complex applications for many use cases. In the field of astronomy it is possible to use these tools to access data via a simple browser, but also to develop native applications reusing libraries (written in Java for Android or Objective-C/Swift for iOS) developed for desktops/laptops. We describe the experiments conducted in this domain, at CDS and IUCAA, considering a mobile application as a native application as well as a Web application.

The emergence of Smartphones: An exploratory study of consumer attitude and intention to redeem mobile coupons

OpenAIRE

Lao, Ka Man

2012-01-01

Purpose - The prevalence of mobile phones, especially the development of smartphones, has attracted numerous companies to exploit the potential in mobile marketing. One notable mobile marketing tool that is progressively gaining interest is the mobile coupon. The aim of this study is to build a conceptual model to explain consumers’ attitude and intention to redeem mobile coupon in the emergence of smartphones. Design/methodology/approach – This study is based on an online survey questionn...

Brownfields Technology Primer: Selecting and Using Phytoremediation for Site Cleanup

Science.gov (United States)

This primer explains the phytoremediation process, discusses the potential advantages and considerations in selecting phytoremediation to clean up brownfields sites, and provides information on additional resources about phytoremediation.

DESAIN PRIMER UNTUK AMPLIFIKASI FRAGMEN GEN inhA ISOLAT 134 MULTIDRUG RESISTANCE TUBERCULOSIS (MDR-TB DENGAN METODE POLYMERASE CHAIN REACTION

Directory of Open Access Journals (Sweden)

Luk Ketut Budi Maitriani

2015-10-01

Full Text Available ABSTRAK    : Penelitian ini bertujuan untuk memperoleh sepasang primer terbaik hasil desain secara in silico menggunakan program Clone Manager Suite 6 (University of Groningen. Primer ini didesain untuk digunakan dalam mengamplifikasi fragmen gen inhA isolat klinis Multidrug Resistance Tuberculosis (MDR-TB mencakup kodon 94 (nukleotida 280-282. Kodon 94 gen inhA merupakan posisi yang sering mengalami mutasi dan mengakibatkan koresisten terhadap isoniazid dan ethionamid. Desain primer menggunakan sekuen gen inhA Mycobacterium tuberculosis yang diperoleh dari situs www.ncbi.nlm.nih.gov (GenBank : AF106077. Hasil desain diperoleh sepasang primer terbaik dan diuji secara in vitro menggunakan metode Polymerase Chain Reaction (PCR. Template DNA yang digunakan adalah isolat klinis MDR-TB. Proses amplifikasi diawali dengan denaturasi awal pada 95°C selama 15 menit dan diikuti oleh 45 siklus amplifikasi (denaturasi pada suhu 94°C selama 1 menit, annealing pada 56°C selama 1 menit 20 detik dan elongasi pada 72°C selama 2 menit serta diakhiri dengan elongasi akhir pada 72°C selama 10 menit. Produk PCR dideteksi menggunakan elektroforesis gel agarosa 1,5%. Kesimpulan penelitian adalah diperoleh sepasang primer terbaik berdasarkan kriteria pada program Clone Manager Suite 6 (University of Groningen, meliputi: panjang primer, %GC, Tm (melting temperature, interaksi primer (dimers dan hairpins, stabilitas primer, repeats, runs dan false priming. Primer tersebut meliputi, primer forward (pF-inhA 5’ CTGGTTAGCGGAATCATCAC 3’ dan primer reverse (pR-inhA 5’ CGACCGTCATCCA-GTTGTA 3’ dengan ukuran produk 460 pb.   ABSTRACT: The aim of this study was to obtain the best pair of primer as result in silico design using Clone Manager Suite 6 program (University of Groningen. The primer was designed for amplifying inhA gene fragment of Multidrug Resistance Tuberculosis (MDR-TB clinical isolates include codon 94 (nucleotide 280-282. Codon 94 of inhA gene is

FullSSR: Microsatellite Finder and Primer Designer

Directory of Open Access Journals (Sweden)

Sebastián Metz

2016-01-01

Full Text Available Microsatellites are genomic sequences comprised of tandem repeats of short nucleotide motifs widely used as molecular markers in population genetics. FullSSR is a new bioinformatic tool for microsatellite (SSR loci detection and primer design using genomic data from NGS assay. The software was tested with 2000 sequences of Oryza sativa shotgun sequencing project from the National Center of Biotechnology Information Trace Archive and with partial genome sequencing with ROCHE 454® from Caiman latirostris, Salvator merianae, Aegla platensis, and Zilchiopsis collastinensis. FullSSR performance was compared against other similar SSR search programs. The results of the use of this kind of approach depend on the parameters set by the user. In addition, results can be affected by the analyzed sequences because of differences among the genomes. FullSSR simplifies the detection of SSRs and primer design on a big data set. The command line interface of FullSSR was intended to be used as part of genomic analysis tools pipeline; however, it can be used as a stand-alone program because the results are easily interpreted for a nonexpert user.

Conserved PCR primer set designing for closely-related species to complete mitochondrial genome sequencing using a sliding window-based PSO algorithm.

Directory of Open Access Journals (Sweden)

Cheng-Hong Yang

Full Text Available BACKGROUND: Complete mitochondrial (mt genome sequencing is becoming increasingly common for phylogenetic reconstruction and as a model for genome evolution. For long template sequencing, i.e., like the entire mtDNA, it is essential to design primers for Polymerase Chain Reaction (PCR amplicons which are partly overlapping each other. The presented chromosome walking strategy provides the overlapping design to solve the problem for unreliable sequencing data at the 5' end and provides the effective sequencing. However, current algorithms and tools are mostly focused on the primer design for a local region in the genomic sequence. Accordingly, it is still challenging to provide the primer sets for the entire mtDNA. METHODOLOGY/PRINCIPAL FINDINGS: The purpose of this study is to develop an integrated primer design algorithm for entire mt genome in general, and for the common primer sets for closely-related species in particular. We introduce ClustalW to generate the multiple sequence alignment needed to find the conserved sequences in closely-related species. These conserved sequences are suitable for designing the common primers for the entire mtDNA. Using a heuristic algorithm particle swarm optimization (PSO, all the designed primers were computationally validated to fit the common primer design constraints, such as the melting temperature, primer length and GC content, PCR product length, secondary structure, specificity, and terminal limitation. The overlap requirement for PCR amplicons in the entire mtDNA is satisfied by defining the overlapping region with the sliding window technology. Finally, primer sets were designed within the overlapping region. The primer sets for the entire mtDNA sequences were successfully demonstrated in the example of two closely-related fish species. The pseudo code for the primer design algorithm is provided. CONCLUSIONS/SIGNIFICANCE: In conclusion, it can be said that our proposed sliding window-based PSO

Detection of Mycosphaerella graminicola in Wheat Leaves by a Microsatellite Dinucleotide Specific-Primer

Directory of Open Access Journals (Sweden)

Joseph-Alexander Verreet

2011-01-01

Full Text Available Early detection of infection is very important for efficient management of Mycosphaerella graminicola leaf blotch. To monitor and quantify the occurrence of this fungus during the growing season, a diagnostic method based on real-time PCR was developed. Standard and real-time PCR assays were developed using SYBR Green chemistry to quantify M. graminicola in vitro or in wheat samples. Microsatellite dinucleotide specific-primers were designed based on microsatellite repeats of sequences present in the genome of M. graminicola. Specificity was checked by analyzing DNA of 55 M. graminicola isolates obtained from different geographical origins. The method appears to be highly specific for detecting M. graminicola; no fluorescent signals were observed from 14 other closely related taxa. Primer (CT 7 G amplified a specific amplicon of 570 bp from all M. graminicola isolates. The primers did not amplify DNA extracted from 14 other fungal species. The approximate melting temperature (Tm of the (CT 7 G primer was 84.2 °C. The detection limit of the real-time PCR assay with the primer sets (CT 7 G is 10 fg/25 µL, as compared to 10 pg/25 µL using conventional PCR technology. From symptomless leaves, a PCR fragment could be generated two days after inoculation. Both conventional and real-time PCR could successfully detect the fungus from artificially inoculated wheat leaves. However, real-time PCR appeared much more sensitive than conventional PCR. The developed quantitative real-time PCR method proved to be rapid, sensitive, specific, cost-effective and reliable for the identification and quantification of M. graminicola in wheat.

An Optimal Mobile Service for Telecare Data Synchronization using a Role-based Access Control Model and Mobile Peer-to-Peer Technology.

Science.gov (United States)

Ke, Chih-Kun; Lin, Zheng-Hua

2015-09-01

The progress of information and communication technologies (ICT) has promoted the development of healthcare which has enabled the exchange of resources and services between organizations. Organizations want to integrate mobile devices into their hospital information systems (HIS) due to the convenience to employees who are then able to perform specific healthcare processes from any location. The collection and merage of healthcare data from discrete mobile devices are worth exploring possible ways for further use, especially in remote districts without public data network (PDN) to connect the HIS. In this study, we propose an optimal mobile service which automatically synchronizes the telecare file resources among discrete mobile devices. The proposed service enforces some technical methods. The role-based access control model defines the telecare file resources accessing mechanism; the symmetric data encryption method protects telecare file resources transmitted over a mobile peer-to-peer network. The multi-criteria decision analysis method, ELECTRE (Elimination Et Choice Translating Reality), evaluates multiple criteria of the candidates' mobile devices to determine a ranking order. This optimizes the synchronization of telecare file resources among discrete mobile devices. A prototype system is implemented to examine the proposed mobile service. The results of the experiment show that the proposed mobile service can automatically and effectively synchronize telecare file resources among discrete mobile devices. The contribution of this experiment is to provide an optimal mobile service that enhances the security of telecare file resource synchronization and strengthens an organization's mobility.

Specific amplification of bacterial DNA by optimized so-called universal bacterial primers in samples rich of plant DNA.

Science.gov (United States)

Dorn-In, Samart; Bassitta, Rupert; Schwaiger, Karin; Bauer, Johann; Hölzel, Christina S

2015-06-01

Universal primers targeting the bacterial 16S-rRNA-gene allow quantification of the total bacterial load in variable sample types by qPCR. However, many universal primer pairs also amplify DNA of plants or even of archaea and other eukaryotic cells. By using these primers, the total bacterial load might be misevaluated, whenever samples contain high amounts of non-target DNA. Thus, this study aimed to provide primer pairs which are suitable for quantification and identification of bacterial DNA in samples such as feed, spices and sample material from digesters. For 42 primers, mismatches to the sequence of chloroplasts and mitochondria of plants were evaluated. Six primer pairs were further analyzed with regard to the question whether they anneal to DNA of archaea, animal tissue and fungi. Subsequently they were tested with sample matrix such as plants, feed, feces, soil and environmental samples. To this purpose, the target DNA in the samples was quantified by qPCR. The PCR products of plant and feed samples were further processed for the Single Strand Conformation Polymorphism method followed by sequence analysis. The sequencing results revealed that primer pair 335F/769R amplified only bacterial DNA in samples such as plants and animal feed, in which the DNA of plants prevailed. Copyright © 2015 Elsevier B.V. All rights reserved.

Detection of enteroviruses and hepatitis a virus in water by consensus primer multiplex RT-PCR

Science.gov (United States)

Li, Jun-Wen; Wang, Xin-Wei; Yuan, Chang-Qing; Zheng, Jin-Lai; Jin, Min; Song, Nong; Shi, Xiu-Quan; Chao, Fu-Huan

2002-01-01

AIM: To develop a rapid detection method of enteroviruses and Hepatitis A virus (HAV). METHODS: A one-step, single-tube consensus primers multiplex RT-PCR was developed to simultaneously detect Poliovirus, Coxsackie virus, Echovirus and HAV. A general upstream primer and a HAV primer and four different sets of primers (5 primers) specific for Poliovirus, Coxsacki evirus, Echovirus and HAV cDNA were mixed in the PCR mixture to reverse transcript and amplify the target DNA. Four distinct amplified DNA segments representing Poliovirus, Coxsackie virus, Echovirus and HAV were identified by gel electrophoresis as 589-, 671-, 1084-, and 1128 bp sequences, respectively. Semi-nested PCR was used to confirm the amplified products for each enterovirus and HAV. RESULTS: All four kinds of viral genome RNA were detected, and producing four bands which could be differentiated by the band size on the gel. To confirm the specificity of the multiplex PCR products, semi-nested PCR was performed. For all the four strains tested gave positive results. The detection sensitivity of multiplex PCR was similar to that of monoplex RT-PCR which was 24 PFU for Poliovrus, 21 PFU for Coxsackie virus, 60 PFU for Echovirus and 105 TCID50 for HAV. The minimum amount of enteric viral RNA detected by semi-nested PCR was equivalent to 2.4 PFU for Poliovrus, 2.1 PFU for Coxsackie virus, 6.0 PFU for Echovirus and 10.5 TCID50 for HAV. CONCLUSION: The consensus primers multiplex RT-PCR has more advantages over monoplex RT-PCR for enteric viruses detection, namely, the rapid turnaround time and cost effectiveness. PMID:12174381

Hemopathologic consequences of protracted gamma irradiation: alterations in granulocyte reserves and granulocyte mobilization

International Nuclear Information System (INIS)

Seed, T.M.; Cullen, S.M.; Kaspar, L.V.; Tolle, D.V.; Fritz, T.E.

1980-01-01

Aplastic anemia and myelogenous leukemia are prominent pathologic effects in beagles exposed to continuous, daily, low-dose gamma irradiation. In the present work, granulocyte reserves and related mobilization functions have been sequentially assessed by the endotoxin stress assay during the preclinical and clinical phases of these hemopoietic disorders. Characteristic patterns of granulocyte reserve mobilization are described that reflect given stages of pathologic progression. For radiation-induced leukemia, a five-stage pattern has been proposed. In contrast, a simple pattern of progressive, time-dependent contraction of granulocyte reserves and mobilization capacity was noted in the development of terminal aplastic anemia. Early preclinical phases of radiation-induced leukemia appear to involve an extensive depletion of the granulocyte reserves (phase I) during the first approx. 200 days of exposure followed by a partial renewal of the reserves and associated mobilization functions between approx. 200 and 400 days (phase II). Sustained, subnormal granulocyte mobilizations (phase III) following endotoxin stress typify the responses of dogs during the intermediate phase, whereas late preclinical, preleukemic stages (phase IV) are characterized by a further expansion of the reserves and in the mobilization capacities, particularly of the less mature granulocytes. Such late alterations in the pattern of granulocyte mobilization, together with other noted cellular aberrancies in the peripheral blood and marrow, appear to indicate leukemia (phase V) onset

Contributions of mobile technologies to addiction research.

Science.gov (United States)

Swendsen, Joel

2016-06-01

Mobile technologies are revolutionizing the field of mental health, and particular progress has been made in their application to addiction research and treatment. The use of smartphones and other mobile devices has been shown to be feasible with individuals addicted to any of a wide range of substances, with few biases being observed concerning the repeated monitoring of daily life experiences, craving, or substance use. From a methodological point of view, the use of mobile technologies overcomes longstanding limitations of traditional clinical research protocols, including the more accurate assessment of temporal relationships among variables, as well as the reduction in both contextual constraints and discipline-specific methodological isolation. The present article presents a conceptual review of these advances while using illustrations of research applications that are capable of overcoming specific methodological barriers. Finally, a brief review of both the benefits and risks of mobile technology use for the treatment of patients will be addressed.

PIPEMicroDB: microsatellite database and primer generation tool for pigeonpea genome.

Science.gov (United States)

Sarika; Arora, Vasu; Iquebal, M A; Rai, Anil; Kumar, Dinesh

2013-01-01

Molecular markers play a significant role for crop improvement in desirable characteristics, such as high yield, resistance to disease and others that will benefit the crop in long term. Pigeonpea (Cajanus cajan L.) is the recently sequenced legume by global consortium led by ICRISAT (Hyderabad, India) and been analysed for gene prediction, synteny maps, markers, etc. We present PIgeonPEa Microsatellite DataBase (PIPEMicroDB) with an automated primer designing tool for pigeonpea genome, based on chromosome wise as well as location wise search of primers. Total of 123 387 Short Tandem Repeats (STRs) were extracted from pigeonpea genome, available in public domain using MIcroSAtellite tool (MISA). The database is an online relational database based on 'three-tier architecture' that catalogues information of microsatellites in MySQL and user-friendly interface is developed using PHP. Search for STRs may be customized by limiting their location on chromosome as well as number of markers in that range. This is a novel approach and is not been implemented in any of the existing marker database. This database has been further appended with Primer3 for primer designing of selected markers with left and right flankings of size up to 500 bp. This will enable researchers to select markers of choice at desired interval over the chromosome. Furthermore, one can use individual STRs of a targeted region over chromosome to narrow down location of gene of interest or linked Quantitative Trait Loci (QTLs). Although it is an in silico approach, markers' search based on characteristics and location of STRs is expected to be beneficial for researchers. Database URL: http://cabindb.iasri.res.in/pigeonpea/

Guidelines - A Primer for Communicating Effectively with NABIR Stakeholders; FINAL

International Nuclear Information System (INIS)

Bilyard, G.R.; Word, C.J.; Weber, J.R.; Harding, A.K.

2000-01-01

This primer is a tool to help prepare scientists for meetings with stakeholders. It was prepared for staff involved with the Natural and Accelerated Bioremediation Research (NABIR) program, sponsored by the U.S. Department of Energy. It discusses why some efforts in science communication may succeed while others fail, provides methods of approaching group interactions about science that may better orient expert participants, and summarizes experience drawn from observations of groups interacting about topics in bioremediation or the NABIR program. The primer also provides brief, useful models for interacting with either expert or non-expert groups. Finally, it identifies topical areas that may help scientists prepare for public meetings, based on the developers' ongoing research in science communication in public forums

Multicolor-based discrimination of 21 short tandem repeats and amelogenin using four fluorescent universal primers.

Science.gov (United States)

Asari, Masaru; Okuda, Katsuhiro; Hoshina, Chisato; Omura, Tomohiro; Tasaki, Yoshikazu; Shiono, Hiroshi; Matsubara, Kazuo; Shimizu, Keiko

2016-02-01

The aim of this study was to develop a cost-effective genotyping method using high-quality DNA for human identification. A total of 21 short tandem repeats (STRs) and amelogenin were selected, and fluorescent fragments at 22 loci were simultaneously amplified in a single-tube reaction using locus-specific primers with 24-base universal tails and four fluorescent universal primers. Several nucleotide substitutions in universal tails and fluorescent universal primers enabled the detection of specific fluorescent fragments from the 22 loci. Multiplex polymerase chain reaction (PCR) produced intense FAM-, VIC-, NED-, and PET-labeled fragments ranging from 90 to 400 bp, and these fragments were discriminated using standard capillary electrophoretic analysis. The selected 22 loci were also analyzed using two commercial kits (the AmpFLSTR Identifiler Kit and the PowerPlex ESX 17 System), and results for two loci (D19S433 and D16S539) were discordant between these kits due to mutations at the primer binding sites. All genotypes from the 100 samples were determined using 2.5 ng of DNA by our method, and the expected alleles were completely recovered. Multiplex 22-locus genotyping using four fluorescent universal primers effectively reduces the costs to less than 20% of genotyping using commercial kits, and our method would be useful to detect silent alleles from commercial kit analysis. Copyright © 2015 Elsevier Inc. All rights reserved.

Primers for polymerase chain reaction to detect genomic DNA of Toxocara canis and T. cati.

Science.gov (United States)

Wu, Z; Nagano, I; Xu, D; Takahashi, Y

1997-03-01

Primers for polymerase chain reaction to amplify genomic DNA of both Toxocara canis and T. cati were constructed by adapting cloning and sequencing random amplified polymorphic DNA. The primers are expected to detect eggs and/or larvae of T. canis and T. cati, both of which are known to cause toxocariasis in humans.

Genome-Wide Characterization of Simple Sequence Repeat (SSR) Loci in Chinese Jujube and Jujube SSR Primer Transferability

Science.gov (United States)

Xiao, Jing; Zhao, Jin; Liu, Mengjun; Liu, Ping; Dai, Li; Zhao, Zhihui

2015-01-01

Chinese jujube (Ziziphus jujuba), an economically important species in the Rhamnaceae family, is a popular fruit tree in Asia. Here, we surveyed and characterized simple sequence repeats (SSRs) in the jujube genome. A total of 436,676 SSR loci were identified, with an average distance of 0.93 Kb between the loci. A large proportion of the SSRs included mononucleotide, dinucleotide and trinucleotide repeat motifs, which accounted for 64.87%, 24.40%, and 8.74% of all repeats, respectively. Among the mononucleotide repeats, A/T was the most common, whereas AT/TA was the most common dinucleotide repeat. A total of 30,565 primer pairs were successfully designed and screened using a series of criteria. Moreover, 725 of 1,000 randomly selected primer pairs were effective among 6 cultivars, and 511 of these primer pairs were polymorphic. Sequencing the amplicons of two SSRs across three jujube cultivars revealed variations in the repeats. The transferability of jujube SSR primers proved that 35/64 SSRs could be transferred across family boundary. Using jujube SSR primers, clustering analysis results from 15 species were highly consistent with the Angiosperm Phylogeny Group (APGIII) System. The genome-wide characterization of SSRs in Chinese jujube is very valuable for whole-genome characterization and marker-assisted selection in jujube breeding. In addition, the transferability of jujube SSR primers could provide a solid foundation for their further utilization. PMID:26000739

Signals and systems primer with Matlab

CERN Document Server

Poularikas, Alexander D

2006-01-01

Signals and Systems Primer with MATLAB® equally emphasizes the fundamentals of both analog and digital signals and systems. To ensure insight into the basic concepts and methods, the text presents a variety of examples that illustrate a wide range of applications, from microelectromechanical to worldwide communication systems. It also provides MATLAB functions and procedures for practice and verification of these concepts.Taking a pedagogical approach, the author builds a solid foundation in signal processing as well as analog and digital systems. The book first introduces orthogonal signals,

Mobile marketing for mobile games

OpenAIRE

Vu, Giang

2016-01-01

Highly developed mobile technology and devices enable the rise of mobile game industry and mobile marketing. Hence mobile marketing for mobile game is an essential key for a mobile game success. Even though there are many articles on marketing for mobile games, there is a need of highly understanding mobile marketing strategies, how to launch a mobile campaign for a mobile game. Besides that, it is essential to understand the relationship between mobile advertising and users behaviours. There...

indCAPS: A tool for designing screening primers for CRISPR/Cas9 mutagenesis events.

Science.gov (United States)

Hodgens, Charles; Nimchuk, Zachary L; Kieber, Joseph J

2017-01-01

Genetic manipulation of organisms using CRISPR/Cas9 technology generally produces small insertions/deletions (indels) that can be difficult to detect. Here, we describe a technique to easily and rapidly identify such indels. Sequence-identified mutations that alter a restriction enzyme recognition site can be readily distinguished from wild-type alleles using a cleaved amplified polymorphic sequence (CAPS) technique. If a restriction site is created or altered by the mutation such that only one allele contains the restriction site, a polymerase chain reaction (PCR) followed by a restriction digest can be used to distinguish the two alleles. However, in the case of most CRISPR-induced alleles, no such restriction sites are present in the target sequences. In this case, a derived CAPS (dCAPS) approach can be used in which mismatches are purposefully introduced in the oligonucleotide primers to create a restriction site in one, but not both, of the amplified templates. Web-based tools exist to aid dCAPS primer design, but when supplied sequences that include indels, the current tools often fail to suggest appropriate primers. Here, we report the development of a Python-based, species-agnostic web tool, called indCAPS, suitable for the design of PCR primers used in dCAPS assays that is compatible with indels. This tool should have wide utility for screening editing events following CRISPR/Cas9 mutagenesis as well as for identifying specific editing events in a pool of CRISPR-mediated mutagenesis events. This tool was field-tested in a CRISPR mutagenesis experiment targeting a cytokinin receptor (AHK3) in Arabidopsis thaliana. The tool suggested primers that successfully distinguished between wild-type and edited alleles of a target locus and facilitated the isolation of two novel ahk3 null alleles. Users can access indCAPS and design PCR primers to employ dCAPS to identify CRISPR/Cas9 alleles at http://indcaps.kieber.cloudapps.unc.edu/.

Transfer of primer binding site-mutated simian immunodeficiency virus vectors by genetically engineered artificial and hybrid tRNA-like primers

DEFF Research Database (Denmark)

Hansen, A C; Grunwald, T; Lund, Anders Henrik

2001-01-01

could be obtained by cotransfection of a gene for an engineered tRNA(Pro)-tRNA hybrid with a match to PBS-Pro. The importance of tRNA backbone identity was further analyzed by complementing the PBS-X2 vector with a gene for a matching x2 primer with a tRNA backbone, which led to three- to fourfold...

Structure of Hepatitis C Virus Polymerase in Complex with Primer-Template RNA

Energy Technology Data Exchange (ETDEWEB)

Mosley, Ralph T.; Edwards, Thomas E.; Murakami, Eisuke; Lam, Angela M.; Grice, Rena L.; Du, Jinfa; Sofia, Michael J.; Furman, Philip A.; Otto, Michael J. (Pharmasset); (Emerald)

2012-08-01

The replication of the hepatitis C viral (HCV) genome is accomplished by the NS5B RNA-dependent RNA polymerase (RdRp), for which mechanistic understanding and structure-guided drug design efforts have been hampered by its propensity to crystallize in a closed, polymerization-incompetent state. The removal of an autoinhibitory {beta}-hairpin loop from genotype 2a HCV NS5B increases de novo RNA synthesis by >100-fold, promotes RNA binding, and facilitated the determination of the first crystallographic structures of HCV polymerase in complex with RNA primer-template pairs. These crystal structures demonstrate the structural realignment required for primer-template recognition and elongation, provide new insights into HCV RNA synthesis at the molecular level, and may prove useful in the structure-based design of novel antiviral compounds. Additionally, our approach for obtaining the RNA primer-template-bound structure of HCV polymerase may be generally applicable to solving RNA-bound complexes for other viral RdRps that contain similar regulatory {beta}-hairpin loops, including bovine viral diarrhea virus, dengue virus, and West Nile virus.

Microsatellite primers for a species of South African everlasting daisy (Helichrysum odoratissimum; Gnaphalieae, Asteraceae).

Science.gov (United States)

Glennon, Kelsey L; Cron, Glynis V

2016-05-01

Microsatellites were developed for the widespread Helichrysum odoratissimum (Asteraceae) to estimate gene flow across diploid populations and to test if gene flow occurs among other closely related lineages within this genus. Ten primer pairs were developed and tested using populations across South Africa; however, only seven primer pairs were polymorphic for the target species. The seven polymorphic primers amplified di- and trinucleotide repeats with up to 16 alleles per locus among 125 diploid individuals used for analyses. These markers can be used to estimate gene flow among populations of known ploidy level of H. odoratissimum to test evolutionary hypotheses. Furthermore, these markers amplify successfully in other Helichrysum species, including the other three taxonomic Group 4 species, and therefore can be used to inform taxonomic work on these species.

One fungus , which genes ? Development and assessment of universal primers for potential secondary fungal DNA barcodes

NARCIS (Netherlands)

Stielow, J B; Lévesque, C A; Seifert, K A; Meyer, W; Irinyi, L; Smits, D; Renfurm, R; Verkley, G J M; Groenewald, M; Chaduli, D; Lomascolo, A; Welti, S; Lesage-Meessen, L; Favel, A; Al-Hatmi, A M S; Damm, U; Yilmaz, N.; Houbraken, J.; Lombard, L.; Quaedvlieg, W.; Binder, M.; Vaas, L.A.I.; Vu, D.; Yurkov, A.; Begerow, D.; Roehl, O.; Guerreiro, M.; Fonseca, A.; Samerpitak, K.; Diepeningen, A.D. van; Dolatabadi, S.; Moreno, L.F.; Casaregola, S.; Mallet, S.; Jacques, N.; Roscini, L.; Egidi, E.; Bizet, C.; Garcia-Hermoso, D.; Martín, M.P.; Deng, S.; Groenewald, J.Z.; Boekhout, T.; Beer, Z.W. de; Barnes, I.; Duong, T.A.; Wingfield, M.J.; Hoog, G.S. de; Crous, P.W.; Lewis, C.T.; Hambleton, S.; Moussa, T.A.A.; Al-Zahrani, H.S.; Almaghrabi, O.A.; Louis-Seize, G.; Assabgui, R.; McCormick, W.; Omer, G.; Dukik, K.; Cardinali, G.; Eberhardt, U.; Vries, M. de; Robert, V.

2015-01-01

The aim of this study was to assess potential candidate gene regions and corresponding universal primer pairs as secondary DNA barcodes for the fungal kingdom, additional to ITS rDNA as primary barcode. Amplification efficiencies of 14 (partially) universal primer pairs targeting eight genetic

Detection of Ophiocordyceps sinensis and Its Common Adulterates Using Species-Specific Primers

Science.gov (United States)

Liu, Yang; Wang, Xiao-yue; Gao, Zi-tong; Han, Jian-ping; Xiang, Li

2017-01-01

Ophiocordyceps sinensis is a fungus that infects Hepialidae caterpillars, mummifying the larvae and producing characteristic fruiting bodies (stromata) that are processed into one of the most valued traditional Chinese medicines (TCM). The product commands a very high price due to a high demand but a very limited supply. Adulteration with other fungi is a common problem and there is a need to test preparation for the presence of the correct fungus. In the current study, a PCR-based approach for the identification of O. sinensis based on a segment of the internal transcribed spacer (ITS) region was developed. The segments is 146-bp in size and is likely to be amplified even in materials where processing led to DNA fragmentation. Primer development was based on the alignment of sequence data generated from a total of 89 samples of O. sinensis and potential adulterants as well as sequences date from 41 Ophiocordyceps species and 26 Cordyceps species available in GenBank. Tests with primer pair, DCF4/DCR4, demonstrated generation of an amplicon from DNA extracted from O. sinensis stromata, but not from extracts derived from adulterants. Species-specific primer pairs were also developed and tested for detection of the common adulterants, Cordyceps gunnii, Cordyceps cicadae, Cordyceps militaris, Cordyceps liangshanensis and Ophiocordyceps nutans. The collection of primers developed in the present study will be useful for the authentication of preparation claiming to only contain O. sinensis and for the detection of fungi used as adulterants in these preparations. PMID:28680424

Novel oligonucleotide primers reveal a high diversity of microbes which drive phosphorous turnover in soil.

Science.gov (United States)

Bergkemper, Fabian; Kublik, Susanne; Lang, Friederike; Krüger, Jaane; Vestergaard, Gisle; Schloter, Michael; Schulz, Stefanie

2016-06-01

Phosphorus (P) is of central importance for cellular life but likewise a limiting macronutrient in numerous environments. Certainly microorganisms have proven their ability to increase the phosphorus bioavailability by mineralization of organic-P and solubilization of inorganic-P. On the other hand they efficiently take up P and compete with other biota for phosphorus. However the actual microbial community that is associated to the turnover of this crucial macronutrient in different ecosystems remains largely anonymous especially taking effects of seasonality and spatial heterogeneity into account. In this study seven oligonucleotide primers are presented which target genes coding for microbial acid and alkaline phosphatases (phoN, phoD), phytases (appA), phosphonatases (phnX) as well as the quinoprotein glucose dehydrogenase (gcd) and different P transporters (pitA, pstS). Illumina amplicon sequencing of soil genomic DNA underlined the high rate of primer specificity towards the respective target gene which usually ranged between 98% and 100% (phoN: 87%). As expected the primers amplified genes from a broad diversity of distinct microorganisms. Using DNA from a beech dominated forest soil, the highest microbial diversity was detected for the alkaline phosphatase (phoD) gene which was amplified from 15 distinct phyla respectively 81 families. Noteworthy the primers also allowed amplification of phoD from 6 fungal orders. The genes coding for acid phosphatase (phoN) and the quinoprotein glucose dehydrogenase (gcd) were amplified from 20 respectively 17 different microbial orders. In comparison the phytase and phosphonatase (appA, phnX) primers covered 13 bacterial orders from 2 different phyla respectively. Although the amplified microbial diversity was apparently limited both primers reliably detected all orders that contributed to the P turnover in the investigated soil as revealed by a previous metagenomic approach. Genes that code for microbial P transporter

Long-term risk from actinides in the environment: Modes of mobility. 1998 annual progress report

International Nuclear Information System (INIS)

Breshears, D.D.; Hakonson, T.E.; Ibrahim, S.A.; Whicker, F.W.; Whicker, J.J.

1998-01-01

'The mobility of actinides in surface soils is a key issue of concern at several DOE facilities in arid and semiarid environments, including Rocky Flats, Hanford, Nevada Test Site, Idaho National Engineering Laboratory, and Los Alamos National Laboratory and the Waste Isolation Pilot Plant (WIPP). Key sources of uncertainty in assessing Pu mobility are the magnitudes of mobility resulting from three modes of transport: (1) wind erosion, (2) water erosion, and (3) vertical migration. Each of these three processes depend on numerous environmental factors and they compete with one another, particularly for actinides in very shallow soils (∼ 1 mm). The overall goal of the study is to quantify the mobility of soil actinides from all three modes. The authors study is using field measurements, laboratory experiments, and ecological modeling to address these three processes at three DOE facilities where actinide kinetics are of concern: WIPP, Rocky Flats, and Hanford. Wind erosion is being measured with suite of monitoring equipment, water erosion is being studied with rainfall simulation experiments, vertical migration is being studied in controlled laboratory experiments, and the three processes are being integrated using ecological modeling. Estimates for clean up of soil actinides for the extensive tracts of DOE land range to hundreds of billion $ in the US. Without studies of these processes, unnecessary clean-up of these areas may waste billions of dollars and cause irreparable ecological damage through the soil removal. Further, the outcomes of litigation against DOE are dependent on quantifying the mobility of actinides in surface soils.'

One fungus, which genes? Development and assessment of universal primers for potential secondary fungal DNA barcodes

NARCIS (Netherlands)

Stielow, J.B.; Lévesque, C.A.; Seifert, K.A.; Meyer, W.; Irinyi, L.; Smits, D.; Renfurm, R.; Verkley, G.J.M.; Groenewald, M.; Chaduli, D.; Lomascolo, A.; Welti, S.; Lesage-Meessen, L.; Favel, A.; Al-Hatmi, A.M.S.; Damm, U.; Yilmaz, N.; Houbraken, J.; Lombard, L.; Quaedvlieg, W.; Binder, M.; Vaas, L.A.I.; Vu, D.; Yurkov, A.; Begerow, D.; Roehl, O.; Guerreiro, M.; Fonseca, A.; Samerpitak, K.; Diepeningen, van A.D.; Dolatabadi, S.; Moreno, L.F.; Casaregola, S.; Mallet, S.; Jacques, N.; Roscini, L.; Egidi, E.; Bizet, C.; Garcia-Hermoso, D.; Martin, M.P.; Deng, S.; Groenewald, J.Z.; Boekhout, T.; Beer, de Z.W.; Barnes, I.; Duong, T.A.; Wingfield, M.J.; Hoog, de G.S.; Crous, P.W.; Lewis, C.T.; Hambleton, S.; Moussa, T.A.A.; Al-Zahrani, H.S.; Almaghrabi, O.A.; Louis-Seize, G.; Assabgui, R.; McCormick, W.; Omer, G.; Dukik, K.; Cardinali, G.; Eberhardt, U.; Vries, de M.; Robert, V.

2015-01-01

The aim of this study was to assess potential candidate gene regions and corresponding universal primer pairs as secondary DNA barcodes for the fungal kingdom, additional to ITS rDNA as primary barcode. Amplification efficiencies of 14 (partially) universal primer pairs targeting eight genetic markers

Primer retention owing to the absence of RNase H1 is catastrophic for mitochondrial DNA replication.

Science.gov (United States)

Holmes, J Bradley; Akman, Gokhan; Wood, Stuart R; Sakhuja, Kiran; Cerritelli, Susana M; Moss, Chloe; Bowmaker, Mark R; Jacobs, Howard T; Crouch, Robert J; Holt, Ian J

2015-07-28

Encoding ribonuclease H1 (RNase H1) degrades RNA hybridized to DNA, and its function is essential for mitochondrial DNA maintenance in the developing mouse. Here we define the role of RNase H1 in mitochondrial DNA replication. Analysis of replicating mitochondrial DNA in embryonic fibroblasts lacking RNase H1 reveals retention of three primers in the major noncoding region (NCR) and one at the prominent lagging-strand initiation site termed Ori-L. Primer retention does not lead immediately to depletion, as the persistent RNA is fully incorporated in mitochondrial DNA. However, the retained primers present an obstacle to the mitochondrial DNA polymerase γ in subsequent rounds of replication and lead to the catastrophic generation of a double-strand break at the origin when the resulting gapped molecules are copied. Hence, the essential role of RNase H1 in mitochondrial DNA replication is the removal of primers at the origin of replication.

The effect of various primers on shear bond strength of zirconia ceramic and resin composite.

Science.gov (United States)

Sanohkan, Sasiwimol; Kukiattrakoon, Boonlert; Larpboonphol, Narongrit; Sae-Yib, Taewalit; Jampa, Thibet; Manoppan, Satawat

2013-11-01

To determine the in vitro shear bond strengths (SBS) of zirconia ceramic to resin composite after various primer treatments. Forty zirconia ceramic (Zeno, Wieland Dental) specimens (10 mm in diameter and 2 mm thick) were prepared, sandblasted with 50 μm alumina, and divided into four groups (n = 10). Three experimental groups were surface treated with three primers; CP (RelyX Ceramic Primer, 3M ESPE), AP (Alloy Primer, Kuraray Medical), and MP (Monobond Plus, Ivoclar Vivadent AG). One group was not treated and served as the control. All specimens were bonded to a resin composite (Filtek Supreme XT, 3M ESPE) cylinder with an adhesive system (Adper Scotchbond Multi-Purpose Plus Adhesive, 3M ESPE) and then stored in 100% humidity at 37°C for 24 h before SBS testing in a universal testing machine. Mean SBS (MPa) were analyzed with one-way analysis of variance (ANOVA) and the Tukey's Honestly Significant Difference (HSD) test (α = 0.05). Group AP yielded the highest mean and standard deviation (SD) value of SBS (16.8 ± 2.5 MPa) and Group C presented the lowest mean and SD value (15.4 ± 1.6 MPa). The SBS did not differ significantly among the groups (P = 0.079). Within the limitations of this study, the SBS values between zirconia ceramic to resin composite using various primers and untreated surface were not significantly different.

Blood Donation and Transfusion: A Primer for Health Educators.

Science.gov (United States)

Felts, W. Michael; Glascoff, Mary A.

1991-01-01

Presents a primer for health educators about blood donation and transfusion, examining the nature of human blood, the background of blood transfusion, blood donation criteria, risks related to homologous blood transfusion, directed blood donation, potential alternatives to homologous transfusion, and resources for education on the subject. (SM)

Small Commercial Building Re-tuning: A Primer

Energy Technology Data Exchange (ETDEWEB)

Cort, Katherine A.; Hostick, Donna J.; Underhill, Ronald M.; Fernandez, Nicholas; Katipamula, Srinivas

2013-09-30

To help building owners and managers address issues related to energy-efficient operation of small buildings, DOE has developed a Small Building Re-tuning training curriculum. This "primer" provides additional background information to understand some of the concepts presented in the Small Building Re-tuning training. The intent is that those who are less familiar with the buidling energy concepts will review this material before taking the building re-tuning training class.

STRATEGIC IMPACT OF MOBILITY ON ORGANIZATIONS

Directory of Open Access Journals (Sweden)

Anna Golovkova

2014-01-01

Full Text Available Purpose. The current rapid social and economic developments show mobility as the most important factor of economic growth, social and cultural progress. Mobile technology has undergone a sea change over the past ten years. The evolution of mobility is about creating better ways to change the world. It will increasingly shape our lives and thinking in ways we cannot fully anticipate. Mobile revolution is a global reality which creates new opportunities and challenges for all companies in the world. Methodology. Proposed methodological approach is based on a comprehensive assessment of the strategic impact of mobility on the organization as a major tool to improve competitiveness and efficiency of the company. During the research have been used both qualitative and quantitative methods. As a result, the article provides bridges between the field of mobility, organization science, information systems, and certain aspects of philosophy. Findings. This research provides a glimpse into the fast-evolving world of mobile technology and maybe even faster evolving world of organizations. The research is designed to understand the strategic impact of mobility on organizations, and evaluate the benefits of integration of these new technologies into the company. The research comprised of an extensive literature review, observation of existing practices, and semi-structured interviews geared toward understanding the strategic impact of mobility on organization and its employees. Originality. The research findings suggest three main strategic implications of mobility: (1 improve working process; (2 increase internal communication and knowledge sharing; and (3 enhance sales and marketing effectiveness. Practical value. The use of mobile technology and it impact on organizational change and strategy, stability and development of competitive advantage allow the company to ensure the effectiveness of its business. Mobility can dramatically transform the company by

Microsatellite Primer Development for Post Oak, Quercus stellata (Fagaceae

Directory of Open Access Journals (Sweden)

Warren B. Chatwin

2014-10-01

Full Text Available Premise of the study: The American Cross Timbers forest ecosystem runs from southeastern Kansas to Central Texas and is primarily composed of post oak (Quercus stellata. This old-growth forest currently occupies only about 2% of its ancestral range. To facilitate genetic research on this species, we developed microsatellite primers specific to post oak from reduced genomic libraries. Methods and Results: Two Q. stellata individuals, sampled from the northern and southern range of the post oak forest, were subject to genomic reduction and 454 pyrosequencing. Bioinformatic analysis identified putative microsatellites from which 12 polymorphic primer sets were screened on three populations. The number of alleles observed ranged from five to 20 across all populations, while observed and expected heterozygosity values ranged from 0.05 to 0.833 and 0.236 to 0.893, respectively, within individual populations. Conclusions: We report the development of microsatellite markers, specific to post oak, to aid the study of genetic diversity and population structure of extant forest remnants.

Wireless Cellular Mobile Communications

OpenAIRE

Zalud, V.

2002-01-01

In this article is briefly reviewed the history of wireless cellular mobile communications, examined the progress in current second generation (2G) cellular standards and discussed their migration to the third generation (3G). The European 2G cellular standard GSM and its evolution phases GPRS and EDGE are described somewhat in detail. The third generation standard UMTS taking up on GSM/GPRS core network and equipped with a new advanced access network on the basis of code division multiple ac...

Penerapan Action RPG pada Perangkat Mobile Berbasiskan iOS

Directory of Open Access Journals (Sweden)

Budi Yulianto

2011-12-01

Full Text Available Mobile games develop along with technological developments. Gaming applications by applying special graphics technologies optimizes any mobile device. The purpose of this study is to design an Action RPG game application by applying Cocos2d technology to be implemented on mobile devices based on IOS operating system. This study performs data collecting and analyzing, interface designing, application implementation, and application evaluation using the Waterfall Model. Data collection is withdrawn from several surveys related to user needs and similar games. Progressing the study, gameplay design is performed using UML, the data storage structure, and interface design. The study results in an Action RPG game application that is implemented on mobile devices. The results showes that Action RPG games can be developed by incorporating elements of art, graphics, and stories that enhance user's interests. 

De-MetaST-BLAST: a tool for the validation of degenerate primer sets and data mining of publicly available metagenomes.

Directory of Open Access Journals (Sweden)

Christopher A Gulvik

Full Text Available Development and use of primer sets to amplify nucleic acid sequences of interest is fundamental to studies spanning many life science disciplines. As such, the validation of primer sets is essential. Several computer programs have been created to aid in the initial selection of primer sequences that may or may not require multiple nucleotide combinations (i.e., degeneracies. Conversely, validation of primer specificity has remained largely unchanged for several decades, and there are currently few available programs that allows for an evaluation of primers containing degenerate nucleotide bases. To alleviate this gap, we developed the program De-MetaST that performs an in silico amplification using user defined nucleotide sequence dataset(s and primer sequences that may contain degenerate bases. The program returns an output file that contains the in silico amplicons. When De-MetaST is paired with NCBI's BLAST (De-MetaST-BLAST, the program also returns the top 10 nr NCBI database hits for each recovered in silico amplicon. While the original motivation for development of this search tool was degenerate primer validation using the wealth of nucleotide sequences available in environmental metagenome and metatranscriptome databases, this search tool has potential utility in many data mining applications.

Beneath sci-fi sound: primer, science fiction sound design, and American independent cinema

OpenAIRE

Johnston, Nessa

2012-01-01

Primer is a very low budget science-fiction film that deals with the subject of time travel; however, it looks and sounds quite distinctively different from other films associated with the genre. While Hollywood blockbuster sci-fi relies on “sound spectacle” as a key attraction, in contrast Primer sounds “lo-fi” and screen-centred, mixed to two channel stereo rather than the now industry-standard 5.1 surround sound. Although this is partly a consequence of the economics of its production, the...

Mobile Workforce, Mobile Technology, Mobile Threats

International Nuclear Information System (INIS)

Garcia, J.

2015-01-01

Mobile technologies' introduction into the world of safeguards business processes such as inspection creates tremendous opportunity for novel approaches and could result in a number of improvements to such processes. Mobile applications are certainly the wave of the future. The success of the application ecosystems has shown that users want full fidelity, highly-usable, simple purpose applications with simple installation, quick responses and, of course, access to network resources at all times. But the counterpart to opportunity is risk, and the widespread adoption of mobile technologies requires a deep understanding of the threats and vulnerabilities inherent in mobile technologies. Modern mobile devices can be characterized as small computers. As such, the threats against computing infrastructure apply to mobile devices. Meanwhile, the attributes of mobile technology that make it such an obvious benefit over traditional computing platforms all have elements of risk: pervasive, always-on networking; diverse ecosystems; lack of centralized control; constantly shifting technological foundations; intense competition among competitors in the marketplace; the scale of the installation base (from millions to billions); and many more. This paper will explore the diverse and massive environment of mobile, the number of attackers and vast opportunities for compromise. The paper will explain how mobile devices prove valuable targets to both advanced and persistent attackers as well as less-skilled casual hackers. Organized crime, national intelligence agencies, corporate espionage are all part of the landscape. (author)

Primers As Socializing Agents in American and Finnish Schools.

Science.gov (United States)

Hyona, Jukka; And Others

1995-01-01

Content analysis of 12 Finnish and 18 American primers for grades 3 through 6 published primarily during the 1980s examined story type, plot setting, protagonist's characteristics, dramatic tasks, portrayals of family structure and parental responsibility, and extrafamilial peer and adult relationships. Results suggest that a nation's cultural…

Teaching Thermal Hydraulics & Numerical Methods: An Introductory Control Volume Primer

Energy Technology Data Exchange (ETDEWEB)

D. S. Lucas

2004-10-01

A graduate level course for Thermal Hydraulics (T/H) was taught through Idaho State University in the spring of 2004. A numerical approach was taken for the content of this course since the students were employed at the Idaho National Laboratory and had been users of T/H codes. The majority of the students had expressed an interest in learning about the Courant Limit, mass error, semi-implicit and implicit numerical integration schemes in the context of a computer code. Since no introductory text was found the author developed notes taught from his own research and courses taught for Westinghouse on the subject. The course started with a primer on control volume methods and the construction of a Homogeneous Equilibrium Model (HEM) (T/H) code. The primer was valuable for giving the students the basics behind such codes and their evolution to more complex codes for Thermal Hydraulics and Computational Fluid Dynamics (CFD). The course covered additional material including the Finite Element Method and non-equilibrium (T/H). The control volume primer and the construction of a three-equation (mass, momentum and energy) HEM code are the subject of this paper . The Fortran version of the code covered in this paper is elementary compared to its descendants. The steam tables used are less accurate than the available commercial version written in C Coupled to a Graphical User Interface (GUI). The Fortran version and input files can be downloaded at www.microfusionlab.com.

FTRA 4th International Conference on Mobile, Ubiquitous, and Intelligent Computing

CERN Document Server

Adeli, Hojjat; Park, Namje; Woungang, Isaac

2014-01-01

MUSIC 2013 will be the most comprehensive text focused on the various aspects of Mobile, Ubiquitous and Intelligent computing. MUSIC 2013 provides an opportunity for academic and industry professionals to discuss the latest issues and progress in the area of intelligent technologies in mobile and ubiquitous computing environment. MUSIC 2013 is the next edition of the 3rd International Conference on Mobile, Ubiquitous, and Intelligent Computing (MUSIC-12, Vancouver, Canada, 2012) which was the next event in a series of highly successful International Workshop on Multimedia, Communication and Convergence technologies MCC-11 (Crete, Greece, June 2011), MCC-10 (Cebu, Philippines, August 2010).

Detection and typing of human papillomavirus in archival cervical cancer specimens by DNA amplification with consensus primers

NARCIS (Netherlands)

RESNICK, R. M.; Cornelissen, M. T.; WRIGHT, D. K.; EICHINGER, G. H.; FOX, H. S.; ter Schegget, J.; MANOS, M. M.

1990-01-01

We developed a polymerase chain reaction DNA amplification system using two distinct consensus oligonucleotide primer sets for the improved detection and typing of a broad spectrum of human genital papillomavirus (HPV) sequences, including those of novel viruses. The system incorporates one primer

New strategies for designing inexpensive but selective bioadsorbants for environmental pollutants: Selection of specific ligands and their cell surface expression. Technical progress report, September 15, 1996 -September 14, 1997

International Nuclear Information System (INIS)

Iverson, B.

1997-01-01

'Progress for the last twelve months has revolved around setting up an antibody engineering and surface display system for use with a metal-complex binding antibody. (1) The author has isolated genes for the V regions of the heavy and light chains for the Ru(bpy)3 specific monoclonal AC1106 (Shreder, K S., Hariman, A., and Iverson, B.L., J. Am. Chem. Soc. 1996, 118, 3192-3201). This antibody binds Ru(bpy), derivatives with better than nanomolar affinity, and will serve as the generic metal-complex binding pocket. Cloning antibody genes from hybridomas is complicated by the fact that primers must be found that amplify the particular heavy and light chain genes in the hybridoma of interest. Antibody gene amplification primers are generally designed to amplify antibody repertoires from lymphocyte mRNA isolated from animals. While cloning repertoires from animals is routinely successful due to the diverse population of target m RNA, hybridomas have a single target sequence. Therefore, multiple primers and conditions must be tried before the correct primer combination is identified.'

Effects of three silane primers and five adhesive agents on the bond strength of composite material for a computer-aided design and manufacturing system.

Science.gov (United States)

Shinohara, Ayano; Taira, Yohsuke; Sakihara, Michino; Sawase, Takashi

2018-01-01

Objective The objective of this study was to evaluate the effects of combinations of silane primers and adhesive agents on the bond strength of a composite block for a computer-aided design and manufacturing system. Material and Methods Three silane primers [Clearfil Ceramic Primer (CP), Super-Bond PZ Primer (PZ), and GC Ceramic Primer II (GP)] were used in conjunction with five adhesive agents [G-Premio Bond (P-Bond), Repair Adhe Adhesive (R-Adhesive), Super-Bond D-Liner Dual (SB-Dual), Super-Bond C&B (SB-Self), and SB-Dual without tributylborane derivative (SB-Light)]. The surface of a composite block (Gradia Block) was ground with silicon carbide paper. After treatment with a silane primer, a adhesive agent was applied to each testing specimen. The specimens were then bonded with a light-curing resin composite. After 24 h, the shear bond strength values were determined and compared using a post hoc test (α=0.05, n=8/group). We also prepared control specimens without primer (No primer) and/or without adhesive agent (No adhesive). Results PZ/SB-Dual and GP/SB-Dual presented the highest bond strength, followed by GP/P-Bond, CP/SB-Dual, CP/R-Adhesive, No primer/SB-Dual, GP/R-Adhesive, CP/P-Bond, No primer/R-Adhesive, PZ/R-Adhesive, CP/SB-Self, PZ/P-Bond, PZ/SB-Self, and GP/SB-Self in descending order of bond strength. No primer/P-Bond, No primer/SB-Self, and all specimens in the SB-Light and No adhesive groups presented the lowest bond strengths. Conclusion A dual-curing adhesive agent (SB-Dual) containing a tributylborane derivative in combination with a silane primer (GP or PZ) presents a greater bond strength between the composite block and the repairing resin composite than the comparators used in the study.

Effect of a metal primer on the bond strength of the resin-metal interface Efeito de um primer para metais sobre a força de união da interface metal-resina

Directory of Open Access Journals (Sweden)

Anderson Pinheiro de Freitas

2004-06-01

Full Text Available To evaluate the effect of different surface treatments on shear bond strength between a metallic alloy (Co-Cr-Mo - Remanium CD and a resin cement (Rely X TM and to evaluate the mode of fracture after testing, forty couples of metallic-alloy disks were melted, regularized, polished, submitted to four thermal cycles (Vacuum, 960ºC, 8 minutes and randomly separated into four groups. Each group received a different type of treatment: Group PSP: Polished with sandpaper 600; Group PCP: Polished with sandpaper 600 and application of the metal primer Alloy Primer (Kuraray; Group JSP: Sandblasted with 100µm aluminum oxide; Group JCP: Sandblasted with 100mm aluminum oxide and treated with a metal Primer. The groups were cemented and stored in distilled water at 37ºC for 36 hours and submitted to the shear bond strength test. The mean and standard deviation (in Kgf/cm² obtained for each group was: PSP 4.0/0.4; PCP 88.9/33.6; JSP 163.2/27.6; JCP 144.5/54.0. After the statistical analysis the authors concluded that: the highest values were obtained for the sandblasted groups (JSP, JCP, regardless of the primer application; the Alloy Primer increased the retention between the Rely X cement and the polished surface of the Co-Cr-Mo alloy, yet its bond strength was not greater than that obtained with sandblasting; all specimens showed adhesive failures in the tested interface.Para avaliar o efeito de diferentes tratamentos superficiais sobre a resistência ao cisalhamento da união entre uma liga metálica (Co-Cr-Mo - Remanium CD e um cimento resinoso (Rely X TM e analisar o tipo de fratura durante a separação dos espécimes, quarenta pares de discos metálicos foram fundidos, regularizados e polidos, submetidos a quatro ciclos térmicos (vácuo, 960ºC, 8 minutos e divididos aleatoriamente em quatro grupos. Cada grupo recebeu um tipo de tratamento: Grupo PSP: Polimento com lixa d'água Nº 600; Grupo PCP: Polimento com lixa 600 e aplicação do

Primer: Fracture mechanics in the nuclear power industry

International Nuclear Information System (INIS)

Wessel, E.T.; Server, W.L.; Kennedy, E.L.

1990-01-01

This Primer is intended to familiarize utility engineers with the fracture mechanics technology and to provide the basis for a working knowledge of the subject. It is directed towards all the engineering disciplines that are involved either directly or indirectly with the structural reliability of electrical power generation equipment and systems. These engineering disciplines include such areas as: design and stress analysis, metallurgy and materials, nondestructive inspection and quality control, structural analysis and reliability engineering, chemical engineering and water chemistry control, and architectural engineering. This Primer does not provide a comprehensive, in-depth treatment of all the detailed aspects involved in fracture mechanics. It does, however, provide sufficient information and a common vocabulary that should enable engineers to: read and converse intelligently about the subject, understand and utilize ASME Codes and Regulatory Guides involving fracture mechanics, absorb technical information presented and discussed at various technical meetings, and begin to apply this technology towards actual engineering problems encountered in the course of their work. Example problems are provided to further enhance an understanding of fracture mechanics. Also, Appendix A describes fracture mechanics computer codes available through EPRI to analyze rotors, reactor pressure vessels and piping

Colagem ortodôntica em esmalte com presença ou ausência de contaminação salivar: é necessário o uso de adesivo auto-condicionante ou de adesivo hidrofílico? Orthodontic bonding in dry and saliva contaminated enamel: is a self-etching primer or a moisture-insensitive primer necessary?

Directory of Open Access Journals (Sweden)

Cristiane Becher Rosa

2008-06-01

Full Text Available OBJETIVO: o objetivo deste trabalho foi avaliar a resistência ao cisalhamento da colagem ortodôntica de um adesivo hidrofílico (Transbond Moisture-Insensitive Primer, 3M Unitek, Monrovia, Califórnia, de um adesivo auto-condicionante (Transbond Self-Etching Primer, 3M Unitek, Monrovia, Califórnia, e sem uso de adesivo, em superfícies de esmalte secas ou contaminadas por saliva. METODOLOGIA: incisivos bovinos (60 foram divididos em 6 grupos: (1 controle sem contaminação salivar (sem adesivo, (2 controle com contaminação salivar (sem adesivo, (3 adesivo auto-condicionante sem contaminação salivar, (4 adesivo auto-condicionante com contaminação salivar antes do adesivo, (5 adesivo hidrofílico sem contaminação salivar e (6 adesivo hidrofílico com contaminação salivar antes do adesivo. Braquetes metálicos foram colados com compósito (Transbond XT, 3M Unitek, Monrovia, Califórnia. Após a colagem, os corpos-de prova foram armazenados a 37±1ºC em ambiente úmido até a realização do teste de cisalhamento. Diferença estatística foi determinada com valor de probabilidade de 0,05 ou menos (p AIM: The purpose of this study was to evaluate the shear bond strength of orthodontic bonding with the use of a hydrophilic primer (Transbond Moisture-Insensitive Primer, 3M Unitek, Monrovia, Calif., a self-etching primer (Transbond Plus Self-etching Primer, 3M Unitek, Monrovia, Calif. and without primer application, in dry and saliva contaminated enamel surfaces. METHODS: Bovine incisors (60 were divided into 6 groups: (1 uncontaminated control (no primer, (2 control with saliva contamination (no primer, (3 uncontaminated self-etching primer, (4 saliva contamination before self-etching primer, (5 uncontaminated hydrophilic primer and (6 saliva contamination before hydrophilic primer. Stainless steel brackets were bonded with composite resin (Transbond XT, 3M Unitek, Monrovia, Calif.. After bonding, all samples were stored at 37±1°C in a

Feasibility of progressive sit-to-stand training among older hospitalized patients

DEFF Research Database (Denmark)

Pedersen, Mette Merete; Petersen, Janne; Bean, Jonathan F

2015-01-01

hospitalization and once following discharge in their own homes. A structured interview including assessment of possible modifiers (cognitive status by the Short Orientation Memory test and mobility by the De Morton Mobility Index) was administered both on admission to the hospital and in the home setting...... was independent of cognitive status. Conclusions. We found a simple progression model for loaded sit-to-stands (STAND) feasible in acutely admitted older medical patients (≥65 yrs), based on our pre-specified criteria for feasibility....... and dose for older patients. Therefore, our aim was to test the feasibility of a progression model for loaded sit-to-stand training among older hospitalized patients. Methods. This is a prospective cohort study conducted as a feasibility study prior to a full-scale trial. We included twenty-four older...

A method for automatically extracting infectious disease-related primers and probes from the literature

Directory of Open Access Journals (Sweden)

Pérez-Rey David

2010-08-01

Full Text Available Abstract Background Primer and probe sequences are the main components of nucleic acid-based detection systems. Biologists use primers and probes for different tasks, some related to the diagnosis and prescription of infectious diseases. The biological literature is the main information source for empirically validated primer and probe sequences. Therefore, it is becoming increasingly important for researchers to navigate this important information. In this paper, we present a four-phase method for extracting and annotating primer/probe sequences from the literature. These phases are: (1 convert each document into a tree of paper sections, (2 detect the candidate sequences using a set of finite state machine-based recognizers, (3 refine problem sequences using a rule-based expert system, and (4 annotate the extracted sequences with their related organism/gene information. Results We tested our approach using a test set composed of 297 manuscripts. The extracted sequences and their organism/gene annotations were manually evaluated by a panel of molecular biologists. The results of the evaluation show that our approach is suitable for automatically extracting DNA sequences, achieving precision/recall rates of 97.98% and 95.77%, respectively. In addition, 76.66% of the detected sequences were correctly annotated with their organism name. The system also provided correct gene-related information for 46.18% of the sequences assigned a correct organism name. Conclusions We believe that the proposed method can facilitate routine tasks for biomedical researchers using molecular methods to diagnose and prescribe different infectious diseases. In addition, the proposed method can be expanded to detect and extract other biological sequences from the literature. The extracted information can also be used to readily update available primer/probe databases or to create new databases from scratch.

Mobility management in mobile IP

Science.gov (United States)

Medidi, Sirisha; Golshani, Forouzan

2002-07-01

There is an emerging interest in integrating mobile wireless communication with the Internet based on the Ipv6 technology. Many issues introduced by the mobility of users arise when such an integration is attempted. This paper addresses the problem of mobility management, i.e., that of tracking the current IP addresses of mobile terminals and sustaining active IP connections as mobiles move. The paper presents some architectural and mobility management options for integrating wireless access to the Internet. We then present performance results for Mobile IPv4, route optimization and Mobile IPv6.

Primer on molecular genetics. DOE Human Genome Program

Energy Technology Data Exchange (ETDEWEB)

1992-04-01

This report is taken from the April 1992 draft of the DOE Human Genome 1991--1992 Program Report, which is expected to be published in May 1992. The primer is intended to be an introduction to basic principles of molecular genetics pertaining to the genome project. The material contained herein is not final and may be incomplete. Techniques of genetic mapping and DNA sequencing are described.

Adhesion of epoxy primer to hydrotalcite conversion coated AA2024

Science.gov (United States)

Leggat, Robert Benton, III

Hydrotalcite-based (HT) conversion coatings are being developed as an environmentally benign alternative to chromate conversion coatings (CCC). Accelerated exposure tests were conducted on epoxy primed, HT-modified AA2024 to gauge service performance. HT-based conversion coatings did not perform as well as the CCC when used with an epoxy primer. The current HT chemistries are optimized for stand-alone corrosion protection, however additional research into the primer/HT interactions is necessary before they can be implemented within a coating scheme. The relative contribution of mechanical and physico-chemical interactions in controlling adhesion has been investigated in this study. Practical adhesion tests were used to assess the dry and wet bond strength of epoxy primer on HT coatings using the pull-off tensile strength (POTS) as the figure of merit. The practical adhesion of HT coated samples generally fell between that observed for the CCC and bare AA2024. Laboratory testing was done to assess the physical and chemical properties of HT coatings. Contact angle measurements were performed using powders representative of different HT chemistries to evaluate the dispersive and acid-base character of the surface. The wet POTS correlated with the electrodynamic (dipole + dispersive) parameter of the surface tension. The HT surfaces were found to be predominantly basic. Given the basicity of epoxy, these results indicate that increasing the acidic character of HT coatings may increase the adhesion performance. This was supported by electrokinetic measurements in which the dry POTS was found to increase with decreasing conversion coating iso-electric point. The correlations with the dry and wet state adhesion are interpreted as indicating that dry state adhesion is optimized by minimizing unfavorable polar interactions between the basic epoxy and HT interfaces. Wet state adhesion, where polar interactions are disrupted, is dictated by non-polar bonding. FTIR

Embodiment of activity progress: The temporalities of service evaluation

DEFF Research Database (Denmark)

Oshima, Sae

2017-01-01

their satisfaction. Yet, an efficient progress of this activity is crucial, as there are often subsequent customers waiting. My analysis shows that this dilemma of taking enough time without taking too much time is managed by the participants’ embodiment of valid activity progress, which is realized through...... their (sometimes asynchronous) mobilization of multimodal resources. I argue that such activity organization helps participants not only to embody the meaningful (versus wasted) consumption of time, but also to secure the customer’s enhanced appreciation of the service outcome....

The effects of pH on N-methacryloyl glycine primer on bond strength to acid-etched dentin.

Science.gov (United States)

Nishiyama, N; Suzuki, K; Asakura, T; Nakai, H; Yasuda, S; Nemoto, K

1996-07-01

To develop a more effective adhesive primer, it is imperative to understand the adhesion mechanisms of the resin to the demineralized dentin through a dentin primer. When the bonding agent was directly applied to the dentin etched by 40 wt % phosphoric acid without a primer pretreatment, the bond strength of the resin to the dentin was 5 MPa. Conversely, when the demineralized dentin was pretreated with the N-methacryloyl glycine (NM alpha A) primer solution with a pH value of 1.5, the bond strength increased considerably to 15 MPa. However, the bond strength dropped dramatically from 15 to 3 MPa when the sodium salt of NM alpha A was added, thereby increasing the pH value of the NM alpha A primer solution from 3.2 to 5.0. When the pH value was increased above 3.5 (pKa value), the number of ionized NM alpha A species increased in the solution. As a result, the bond strength of the resin fell to approximately 3 MPa. This result was obtained despite the 5-micron-thick hybrid layer that was created in the subsurface of the intertubular dentin. The number of unionized NM alpha A species increased by lowering the pH value below 3.5. As a result, the NM alpha A primer provided a higher bond strength of the resin to the demineralized dentin. In contrast, when 10 wt % citric acid containing 3 wt % ferric chloride was applied to the dentin, maximum bond strength was obtained when the pH value of the NM alpha A primer solution was 3.5. The pH dependency of the bond strength obtained following 10 wt % citric acid containing 3 wt % ferric chloride etching is different from the results obtained from 40 wt % phosphoric acid etching. This can be attributed to the difference in the characteristics of the demineralized collageous layer.

Transportation Management Area Planning Certification Review Primer: Revised January 18, 2018

Science.gov (United States)

2018-01-18

This primer outlines key concepts and expectations of a Transportation Management Area (TMA) Planning Certification Review. Reflecting on the collective experiences of past Certification Reviews, this includes references to relevant laws and regulati...

Structural Mobility, Exchange Mobility and Subgroup Consistent Mobility Measurement – US–German Mobility Measurements Revisited

OpenAIRE

C. SCHLUTER; D. VAN DE GAER

2008-01-01

We formalize the concept of structural mobility and use the framework of subgroup consistent mobility measurement to derive a relative and an absolute measure of mobility that is increasing both in upward structural mobility and exchange mobility. In our empirical illustration, we contribute substantively to the ongoing debate about mobility rankings between the USA and Germany.

HYPOTHETIC FIVE-DIMESION SPACE OF BASIC FACTORS EXTRACTED FROM THE FACTOR ANLYSIS OF CERTAIN NUMBERS OF MORPHOLOGIC, MOBILE AND MANIFEST MOBILE VARIABLES

Directory of Open Access Journals (Sweden)

Goran Šekeljić

2008-08-01

Full Text Available This research was made on sample of 183 schoolboys and school girls attending the fourth grade of the elementary school. It was conducted in order to examine the possibilities of the adoption of an alternative curriculum which contains the elemements of basket ball game. After an experimental treatament, the effects of the teaching were estmated in these segments of antropological space: antropometrical, mobile and manifest mobile space concerning the basic elements of basketball technique. It was applicated the method of canonic corelated analysis which means that there were determined statistically important coefficient of correlation based on certain number of prmal and basic vectors of morphological, mobile and manifest mobile variables. According to the results of the research we can expect that five-dimension hypothetic model should present some kind of base for an eventual progress: methods of Teaching Physical Education, cibernetic navigation of the training technology such as the selection of the pupils who are able to play basketball.

Note: Primer Amysat 001; Fragment size is 211bp

Indian Academy of Sciences (India)

Renuka

Bhandara : Lanes 1–14 represent different strains of Bhandara Ecorace. Note: Primer Amysat 001; Fragment size is 211bp. Fig. 1. SSR profiles generated from genomic DNA of 16 strains from different individuals of (A.L, D. TV, D. BV, Modal, Sukinda, Raily, Bhandara) ecoraces of tasar silk worm, Antheraea mylitta using the.

A mobility program for an inpatient acute care medical unit.

Science.gov (United States)

Wood, Winnie; Tschannen, Dana; Trotsky, Alyssa; Grunawalt, Julie; Adams, Danyell; Chang, Robert; Kendziora, Sandra; Diccion-MacDonald, Stephanie

2014-10-01

For many patients, hospitalization brings prolonged periods of bed rest, which are associated with such adverse health outcomes as increased length of stay, increased risk of falls, functional decline, and extended-care facility placement. Most studies of progressive or early mobility protocols designed to minimize these adverse effects have been geared toward specific patient populations and conducted by multidisciplinary teams in either ICUs or surgical units. Very few mobility programs have been developed for and implemented on acute care medical units. This evidence-based quality improvement project describes how a mobility program, devised for and put to use on a general medical unit in a large Midwestern academic health care system, improved patient outcomes.

Microsatellite Primers for Parkia biglobosa (Fabaceae: Mimosoideae) Reveal that a Single Plant Sires All Seeds Per Pod

DEFF Research Database (Denmark)

Lassen, Kristin Marie; Kjær, Erik Dahl; Ouédraogo, Moussa

2014-01-01

Premise of the study: Microsatellite primers were developed for an indigenous fruit tree, Parkia biglobosa, as a tool to study reproductive biology and population structure. Here we use the primers to determine the number of fathers per pod.  Methods and Results: Microsatellite loci were enriched...

Effect of clearfil protect bond and transbond plus self-etch primer on shear bond strength of orthodontic brackets

Directory of Open Access Journals (Sweden)

S Hamid Raji

2011-01-01

Conclusion: The shear bond strength of clearfil protect bond and transbond plus self-etch primer was enough for bonding the orthodontic brackets. The mode of failure of bonded brackets with these two self-etch primers is safe for enamel.

Progress in Group III nitride semiconductor electronic devices

International Nuclear Information System (INIS)

Hao Yue; Zhang Jinfeng; Shen Bo; Liu Xinyu

2012-01-01

Recently there has been a rapid domestic development in group III nitride semiconductor electronic materials and devices. This paper reviews the important progress in GaN-based wide bandgap microelectronic materials and devices in the Key Program of the National Natural Science Foundation of China, which focuses on the research of the fundamental physical mechanisms of group III nitride semiconductor electronic materials and devices with the aim to enhance the crystal quality and electric performance of GaN-based electronic materials, develop new GaN heterostructures, and eventually achieve high performance GaN microwave power devices. Some remarkable progresses achieved in the program will be introduced, including those in GaN high electron mobility transistors (HEMTs) and metal—oxide—semiconductor high electron mobility transistors (MOSHEMTs) with novel high-k gate insulators, and material growth, defect analysis and material properties of InAlN/GaN heterostructures and HEMT fabrication, and quantum transport and spintronic properties of GaN-based heterostructures, and high-electric-field electron transport properties of GaN material and GaN Gunn devices used in terahertz sources. (invited papers)

Detection of gunshot primer residue on bone in an experimental setting-an unexpected finding.

Science.gov (United States)

Berryman, Hugh E; Kutyla, Alicja K; Russell Davis, J

2010-03-01

Pork ribs with intact muscle tissue were used in an experimental attempt to identify bullet wipe on bone at distances from 1 to 6 feet with 0.45 caliber, full metal jacket ammunition. This resulted in the unexpected finding of primer-derived gunshot residue (GSR) deep within the wound tract. Of significance is the fact that the GSR was deposited on the bone, under the periosteum, after the bullet passed through a Ziploc bag and c. 1 inch of muscle tissue. It is also important to note that the GSR persisted on the bone after the periosteum was forcibly removed. The presence of primer-derived GSR on bone provides the potential to differentiate gunshot trauma from blunt trauma when the bone presents an atypical gunshot wound. In this study, the presence of gunshot primer residue at a distance of 6 feet demonstrates the potential for establishing maximum gun-to-target distance for remote shootings.

An anti-steroidogenic inhibitory primer pheromone in male sea lamprey (Petromyzon marinus)

Science.gov (United States)

Chung-Davidson, Yu-Wen; Wang, Huiyong; Bryan, Mara B.; Wu, Hong; Johnson, Nicholas S.; Li, Weiming

2013-01-01

Reproductive functions can be modulated by both stimulatory and inhibitory primer pheromones released by conspecifics. Many stimulatory primer pheromones have been documented, but relatively few inhibitory primer pheromones have been reported in vertebrates. The sea lamprey male sex pheromone system presents an advantageous model to explore the stimulatory and inhibitory primer pheromone functions in vertebrates since several pheromone components have been identified. We hypothesized that a candidate sex pheromone component, 7α, 12α-dihydroxy-5α-cholan-3-one-24-oic acid (3 keto-allocholic acid or 3kACA), exerts priming effects through the hypothalamic-pituitary-gonadal (HPG) axis. To test this hypothesis, we measured the peptide concentrations and gene expressions of lamprey gonadotropin releasing hormones (lGnRH) and the HPG output in immature male sea lamprey exposed to waterborne 3kACA. Exposure to waterborne 3kACA altered neuronal activation markers such as jun and jun N-terminal kinase (JNK), and lGnRH mRNA levels in the brain. Waterborne 3kACA also increased lGnRH-III, but not lGnRH-I or -II, in the forebrain. In the plasma, 3kACA exposure decreased all three lGnRH peptide concentrations after 1 h exposure. After 2 h exposure, 3kACA increased lGnRHI and -III, but decreased lGnRH-II peptide concentrations in the plasma. Plasma lGnRH peptide concentrations showed differential phasic patterns. Group housing condition appeared to increase the averaged plasma lGnRH levels in male sea lamprey compared to isolated males. Interestingly, 15α-hydroxyprogesterone (15α-P) concentrations decreased after prolonged 3kACA exposure (at least 24 h). To our knowledge, this is the only known synthetic vertebrate pheromone component that inhibits steroidogenesis in males.

Validation of a Non-Specific Dye Real-Time PCR Assay for Porcine Adulteration in Meatball Using ND5 Primer

Directory of Open Access Journals (Sweden)

Tri Joko Raharjo

2017-07-01

Full Text Available Porcine adulteration in meatball samples were analyzed using real-time polymerase chain reaction (RT-PCR, based on the ND5 primer obtained by previous study. This work consisted of three stages which were annealing temperature optimization, method validation, and application. DNA template was extracted using phenol-CIAA (chloroform-iso amyl alcohol method. The optimum annealing temperature for ND5 primers (forward primer 5'-CATTCGCCTCACTCACATTAACC-3' and reverse primer 5'-AAGAGAGAGTTCTACGGTCTGTAG-3' was 58.0 °C, obtained after testing annealing at 50.5 to 59.5 °C gradient temperature with 5 °C interval. Melting curve analysis was done at 65.0 to 95.0 °C, with increasing temperature for 0.5 °C per 2 sec. Method was validated for its specificity, precision and limit of detection. RT-PCR method with ND5 primers produced 227 bp DNA fragment with 78.50 °C Tm value. From eight commercial meatball samples, one was detected containing porcine. The methods showed high specificity and precision, with experimentally determined limits for porcine were no less than 1%.

Development of a microsatellite primer set to investigate the genetic ...

Indian Academy of Sciences (India)

Development of a microsatellite primer set to investigate the genetic population structure of Armadillidium nasatum (Crustacea, Oniscidea). Séverine Masson, Cédric Faivre, Isabelle Giraud, Catherine Souty-Grosset, Richard Cordaux, Carine Delaunay,. Didier Bouchon and Nicolas Bech. J. Genet. 93, 545-549. Table 1.

Development of specific primers for genus Fusarium and F. solani ...

African Journals Online (AJOL)

Yomi

2012-01-05

Jan 5, 2012 ... reproductive parts of plants. They are ... plant species in most parts of the world. .... 20 µl 2.5X master mix (Eppendorf) and 1 µl of each forward and ... List of primers developed for rapid detection of Fusarium sp. and F. solani.

HTP-OligoDesigner: An Online Primer Design Tool for High-Throughput Gene Cloning and Site-Directed Mutagenesis.

Science.gov (United States)

Camilo, Cesar M; Lima, Gustavo M A; Maluf, Fernando V; Guido, Rafael V C; Polikarpov, Igor

2016-01-01

Following burgeoning genomic and transcriptomic sequencing data, biochemical and molecular biology groups worldwide are implementing high-throughput cloning and mutagenesis facilities in order to obtain a large number of soluble proteins for structural and functional characterization. Since manual primer design can be a time-consuming and error-generating step, particularly when working with hundreds of targets, the automation of primer design process becomes highly desirable. HTP-OligoDesigner was created to provide the scientific community with a simple and intuitive online primer design tool for both laboratory-scale and high-throughput projects of sequence-independent gene cloning and site-directed mutagenesis and a Tm calculator for quick queries.

Semantics in mobile sensing

CERN Document Server

Yan, Zhixian

2014-01-01

The dramatic progress of smartphone technologies has ushered in a new era of mobile sensing, where traditional wearable on-body sensors are being rapidly superseded by various embedded sensors in our smartphones. For example, a typical smartphone today, has at the very least a GPS, WiFi, Bluetooth, triaxial accelerometer, and gyroscope. Alongside, new accessories are emerging such as proximity, magnetometer, barometer, temperature, and pressure sensors. Even the default microphone can act as an acoustic sensor to track noise exposure for example. These sensors act as a ""lens"" to understand t

Wireless Cellular Mobile Communications

Directory of Open Access Journals (Sweden)

V. Zalud

2002-12-01

Full Text Available In this article is briefly reviewed the history of wireless cellularmobile communications, examined the progress in current secondgeneration (2G cellular standards and discussed their migration to thethird generation (3G. The European 2G cellular standard GSM and itsevolution phases GPRS and EDGE are described somewhat in detail. Thethird generation standard UMTS taking up on GSM/GPRS core network andequipped with a new advanced access network on the basis of codedivision multiple access (CDMA is investigated too. A sketch of theperspective of mobile communication beyond 3G concludes this article.

Microsatellite primers for a species of South African everlasting daisy (Helichrysum odoratissimum; Gnaphalieae, Asteraceae)1

Science.gov (United States)

Glennon, Kelsey L.; Cron, Glynis V.

2016-01-01

Premise of the study: Microsatellites were developed for the widespread Helichrysum odoratissimum (Asteraceae) to estimate gene flow across diploid populations and to test if gene flow occurs among other closely related lineages within this genus. Methods and Results: Ten primer pairs were developed and tested using populations across South Africa; however, only seven primer pairs were polymorphic for the target species. The seven polymorphic primers amplified di- and trinucleotide repeats with up to 16 alleles per locus among 125 diploid individuals used for analyses. Conclusions: These markers can be used to estimate gene flow among populations of known ploidy level of H. odoratissimum to test evolutionary hypotheses. Furthermore, these markers amplify successfully in other Helichrysum species, including the other three taxonomic Group 4 species, and therefore can be used to inform taxonomic work on these species. PMID:27213125

FACTORES AMBIENTALES Y GENÉTICOS QUE INFLUYEN SOBRE LA EDAD AL PRIMER PARTO EN HEMBRAS DE LA RAZA ROMOSINUANO

Directory of Open Access Journals (Sweden)

Marco Suárez

2006-05-01

Full Text Available Objetivo. Estudiar los factores ambientales y genéticos que influyen sobre la edad al primer parto dehembras romosinuano. Materiales y métodos. Fueron estudiados 932 datos de la edad al primer partode hembras de la raza Romosinuano, nacidas en el Centro de Investigación Turipaná de CORPOICA,Cereté, Colombia, en el período de 1980 a 2001. Para el estudio de los factores ambientales se utilizóel análisis de varianza mediante modelos lineales utilizando el procedimiento GLM de SAS (1995.Resultados. La edad al primer parto fue de 1162.3±4.2 días, con un coeficiente de variación del 11.19%.El análisis de varianza reveló que el año y mes de nacimiento fueron causas estadísticamente significativasde variación de la edad al primer parto. La heredabilidad, calculada por la correlación intraclase entremedias hermanas paternas fue de 0.16±0.08. Conclusión. El año y mes de nacimiento influyeron en laedad al primer parto de hembras romosinuano, pero la heredabilidad de la edad al primer parto y elsexo de la cría no se constituyen en características importantes a tener en cuenta.

Ares, Janus, Globalization: A Primer For The Military Leader in NATO

National Research Council Canada - National Science Library

Clemons, Dean

2002-01-01

...: international military and commercial investment; dual-use technologies; and export control. As a primer on these stakes for the rising military leader within the North Atlantic Treaty, the study elucidates the issue of cooperation vs...

Bayesian models a statistical primer for ecologists

CERN Document Server

Hobbs, N Thompson

2015-01-01

Bayesian modeling has become an indispensable tool for ecological research because it is uniquely suited to deal with complexity in a statistically coherent way. This textbook provides a comprehensive and accessible introduction to the latest Bayesian methods-in language ecologists can understand. Unlike other books on the subject, this one emphasizes the principles behind the computations, giving ecologists a big-picture understanding of how to implement this powerful statistical approach. Bayesian Models is an essential primer for non-statisticians. It begins with a definition of probabili

Mobile Learning Using Mobile Phones

Science.gov (United States)

Vicente, Paula

2013-01-01

The participation in mobile learning programs is conditioned by having/using mobile communication technology. Those who do not have or use such technology cannot participate in mobile learning programs. This study evaluates who are the most likely participants of mobile learning programs by examining the demographic profile and mobile phone usage…

Primer for criticality calculations with DANTSYS

International Nuclear Information System (INIS)

Busch, R.D.

1996-01-01

With the closure of many experimental facilities, the nuclear criticality safety analyst is increasingly required to rely on computer calculations to identify safe limits for the handling and storage of fissile materials. However, in many cases, the analyst has little experience with the specific codes available at his or her facility. Typically, two types of codes are available: deterministic codes such as ANISN or DANTSYS that solve an approximate model exactly and Monte Carlo Codes such as KENO or MCNP that solve an exact model approximately. Often, the analyst feels that the deterministic codes are too simple and will not provide the necessary information, so most modeling uses Monte Carlo methods. This sometimes means that hours of effort are expended to produce results available in minutes from deterministic codes. A substantial amount of reliable information on nuclear systems can be obtained using deterministic methods if the user understands their limitations. To guide criticality specialists in this area, the Nuclear Criticality Safety Group at the University of New Mexico in cooperation with the Radiation Transport Group at Los Alamos National Laboratory has designed a primer to help the analyst understand and use the DANTSYS deterministic transport code for nuclear criticality safety analyses. (DANTSYS is the name of a suite of codes that users more commonly know as ONEDANT, TWODANT, TWOHEX, and THREEDANT.) It assumes a college education in a technical field, but there is no assumption of familiarity with neutronics codes in general or with DANTSYS in particular. The primer is designed to teach by example, with each example illustrating two or three DANTSYS features useful in criticality analyses

A web-based adaptive tutor to teach PCR primer design

NARCIS (Netherlands)

van Seters, Janneke R.; Wellink, Joan; Tramper, Johannes; Goedhart, Martin J.; Ossevoort, Miriam A.

2012-01-01

When students have varying prior knowledge, personalized instruction is desirable. One way to personalize instruction is by using adaptive e-learning to offer training of varying complexity. In this study, we developed a web-based adaptive tutor to teach PCR primer design: the PCR Tutor. We used

A Web-based Adaptive Tutor to Teach PCR Primer Design

NARCIS (Netherlands)

Seters, van J.R.; Wellink, J.; Tramper, J.; Goedhart, M.J.; Ossevoort, M.A.

2012-01-01

When students have varying prior knowledge, personalized instruction is desirable. One way to personalize instruction is by using adaptive e-learning to offer training of varying complexity. In this study, we developed a web-based adaptive tutor to teach PCR primer design: the PCR Tutor. We used

Developing the Medication Reminder Mobile Application "Seeb".

Science.gov (United States)

Saghaeiannejad-Isfahani, Sakineh; Ehteshami, Asghar; Savari, Ebtesam; Samimi, Ali

2017-06-01

Today, the structure of comprehensive health care emphasizes self-care more than therapy. Medication therapy is a strong instrument for therapy received through the health setting, especially in medication area. Error in medication administration has produced different problems and they cost billions of dollars every year. Regarding mobile phone extensions, we developed a local medication reminder mobile application called "Seeb" as a suitable solution for decreasing medication errors for Iranians. We conducted a mixed methods study in three Phases: 1) Comparative study of existing mobile applications; 2) developed its object-oriented model; 3) Developed the initial version of "Seeb" that was approved for production. This application was designed for the appropriate medication administration including time and dosages through: recording patient and medication data; scheduling patients' medication; and reporting medication administration on progress. "Seeb" has been designed in compliance with Iranian health information technologists and pharmacists requirements. It is expected to reduce medication error and improve patient adherence to medical prescriptions.

Radiation protection primer

International Nuclear Information System (INIS)

Aigner, R.; Melzer, E.; Seissler, H.

1986-01-01

This 'radiation protection primer' does not pretend to give absolute, final answers to the many questions that have been arising after the Chernobyl accident. What it is intended to supply, as a schematic overview of problems resulting from nuclear accidents, and a likewise systematic outline of possible solutions and sensible reactions to such an event. The book takes up questions such as: What has happened to the soil. Will future harvests be 'clean' again. What does radioactivity to our drinking water and other waters. What are the effects of a radioactive fallout on food. What may we eat or drink. What happens to the human body after intake of radioactive air, or - even only slightly - contaminated food or water. What can we do to protect our health, and the health of our children. Is there anything else we can do in order to avoid such a disaster in future, except from shutting-off all reactors. The book itself presents some answers and advice, along with a list of terms and explanations, and addresses to apply to for further advice and information. (orig./HP) [de

Bond strength of primer/cement systems to zirconia subjected to artificial aging.

Science.gov (United States)

Zhao, Li; Jian, Yu-Tao; Wang, Xiao-Dong; Zhao, Ke

2016-11-01

Creating reliable and durable adhesion to the nonactive zirconia surface is difficult and has limited zirconia use. The introduction of functional monomers such as 10-methacryloyloxydecyl dihydrogen phosphate (MDP) appears to have enhanced bond strength to zirconia. The purpose of this in vitro study was to evaluate the long-term bond strength of several MDP-containing primer/cement systems to zirconia. Zirconia blocks were divided into 6 groups (n=24) according to the 3 primers/cements to be bonded, as follows: Scotchbond Universal/RelyX Ultimate (SU/RU; consisting of MDP-containing primer/MDP-free cement); Clearfil ceramic primer/Panavia F (CCP/PAN; consisting ofMDP-containing/MDP-containing); and Z-Prime Plus/Duo-Link (ZP/DUO; consisting ofMDP-containing/MDP-free), which were compared with 3 nonprimed groups, RU, PAN, and DUO. After bonding, each group was further divided into 3 subgroups (n=8) according to the level of aging: 24-hour storage in water at 37°C (24H); 30-day storage at 37°C (30D); and 30-day storage at 37°C followed by 3000 thermal cycles (30D/TC). After aging, a shear bond strength test and failure mode analysis were performed. The data were analyzed using 2-way ANOVA (α=.05). After aging, nearly all primer/cement groups presented significantly higher bond strength than the related nonprimed groups for each level of aging (P<.05), except for CCP/PAN versus PAN with 24H (P=.741). SU/RU had the highest bond strength among the groups for all treatments (P<.05), except for CCP/PAN versus SU/RU with 30D/TC (P=.171). Among the nonprimed groups, only RU went through 30D/TC without premature debonding. With 24H and 30D, the failure modes in SU/RU and CCP/PAN were purely mixed, whereas those in the other groups were mainly adhesive, except for RU. The superiority of the initial bond strength in SU/RU may result from some functional components other than MDP. The presence of MDP in the cement did not appear to have a positive effect on long-term bond

Incorporating travel-time reliability into the congestion management process : a primer.

Science.gov (United States)

2015-02-01

This primer explains the value of incorporating travel-time reliability into the Congestion Management Process (CMP) : and identifies the most current tools available to assist with this effort. It draws from applied research and best practices : fro...

Bayesian models: A statistical primer for ecologists

Science.gov (United States)

Hobbs, N. Thompson; Hooten, Mevin B.

2015-01-01

Bayesian modeling has become an indispensable tool for ecological research because it is uniquely suited to deal with complexity in a statistically coherent way. This textbook provides a comprehensive and accessible introduction to the latest Bayesian methods—in language ecologists can understand. Unlike other books on the subject, this one emphasizes the principles behind the computations, giving ecologists a big-picture understanding of how to implement this powerful statistical approach.Bayesian Models is an essential primer for non-statisticians. It begins with a definition of probability and develops a step-by-step sequence of connected ideas, including basic distribution theory, network diagrams, hierarchical models, Markov chain Monte Carlo, and inference from single and multiple models. This unique book places less emphasis on computer coding, favoring instead a concise presentation of the mathematical statistics needed to understand how and why Bayesian analysis works. It also explains how to write out properly formulated hierarchical Bayesian models and use them in computing, research papers, and proposals.This primer enables ecologists to understand the statistical principles behind Bayesian modeling and apply them to research, teaching, policy, and management.Presents the mathematical and statistical foundations of Bayesian modeling in language accessible to non-statisticiansCovers basic distribution theory, network diagrams, hierarchical models, Markov chain Monte Carlo, and moreDeemphasizes computer coding in favor of basic principlesExplains how to write out properly factored statistical expressions representing Bayesian models

Experimental primers containing synthetic and natural compounds reduce enzymatic activity at the dentin–adhesive interface under cyclic loading

Science.gov (United States)

Sousa, Ana Beatriz Silva; de Mattos Pimenta Vidal, Cristina; Leme-Kraus, Ariene Arcas; de Carvalho Panzeri Pires-de-Souza, Fernanda; Bedran-Russo, Ana K.

2016-01-01

Objective To evaluate the effect of experimental primers (chlorhexidine, enriched mixture of proanthocyanidins and doxycycline) on the adhesive properties and gelatinolytic activity at dentin-resin interfaces of occlusal Class I restorations. Methods The inactivation of enzymes by the experimental primers was assessed by fluorescence assay and gelatin zymography. To assess the adhesive properties, occlusal Class I cavities were prepared in sound human molars, etched with phosphoric acid and restored with one of the primers and an etch-and-rinse adhesive system (Adper Single Bond Plus - 3M ESPE). After the restorative procedures, the specimens were divided into two subgroups (n = 6) consisting of storage in incubation buffer or axial cyclic loading at 50 N and 1,000,000 cycles. Then, the sectioned and sliced specimens were assigned to in situ zymography assay and microtensile bond strength (TBS) test. Results Fluorescence assay and gelatin zymography revealed that the experimental primers inactivated rMMPs. In situ zymography (2-way ANOVA, Tukey, p 0.05). Significance The use of experimental primers impaired the enzymatic activity at the dentin-adhesive interface after cyclic loading and the activity of rMMPs. Cyclic loading did not have a significant effect on the bond strength. PMID:27524231

Efficient One-Step Fusion PCR Based on Dual-Asymmetric Primers and Two-Step Annealing

DEFF Research Database (Denmark)

Liu, Yilan; Chen, Jinjin; Thygesen, Anders

2018-01-01

Gene splicing by fusion PCR is a versatile and widely used methodology, especially in synthetic biology. We here describe a rapid method for splicing two fragments by one-round fusion PCR with a dual-asymmetric primers and two-step annealing (ODT) method. During the process, the asymmetric...... intermediate fragments were generated in the early stage. Thereafter, they were hybridized in the subsequent cycles to serve as template for the target full-length product. The process parameters such as primer ratio, elongation temperature and cycle numbers were optimized. In addition, the fusion products...

El primer encuentro del padre con el bebé prematuro en la Unidad de Cuidados Intensivos Neonatales

Directory of Open Access Journals (Sweden)

Fernanda Martins Castro

2015-06-01

Full Text Available Objetivo: Describir el primer encuentro del padre con el hijo en la Unidad de Cuidados Intensivos Neonatales (UCIN y analizar el significado de este momento en la perspectiva de los padres. Método: estudio cualitativo, con ocho padres de niños prematuros, a través de entrevistas semi-estructuradas. Los datos se analizaron a través del análisis temático. Resultados: Surgieron tres núcleos temáticos: "primer encuentro con hijo prematuro: sentimientos paternales y emociones", "construcción de la relación entre los profesionales y los padres de los recién nacidos a partir del primer encuentro" y reconocimiento de la paternidad en el contexto de la UCIN. Conclusión: El primer encuentro del padre con su hijo en la UCIN provoca sentimientos y sorpresa, dolor, incertidumbre, alegría y esperanza. El equipo de salud debe estar preparado para brindar apoyo emocional, información y establecer una comunicación efectiva desde la primera visita.

Teaching Thermal Hydraulics and Numerical Methods: An Introductory Control Volume Primer

International Nuclear Information System (INIS)

D. S. Lucas

2004-01-01

A graduate level course for Thermal Hydraulics (T/H) was taught through Idaho State University in the spring of 2004. A numerical approach was taken for the content of this course since the students were employed at the Idaho National Laboratory and had been users of T/H codes. The majority of the students had expressed an interest in learning about the Courant Limit, mass error, semi-implicit and implicit numerical integration schemes in the context of a computer code. Since no introductory text was found the author developed notes taught from his own research and courses taught for Westinghouse on the subject. The course started with a primer on control volume methods and the construction of a Homogeneous Equilibrium Model (HEM) (T/H) code. The primer was valuable for giving the students the basics behind such codes and their evolution to more complex codes for Thermal Hydraulics and Computational Fluid Dynamics (CFD). The course covered additional material including the Finite Element Method and non-equilibrium (T/H). The control volume primer and the construction of a three-equation (mass, momentum and energy) HEM code are the subject of this paper . The Fortran version of the code covered in this paper is elementary compared to its descendants. The steam tables used are less accurate than the available commercial version written in C Coupled to a Graphical User Interface (GUI). The Fortran version and input files can be downloaded at www.microfusionlab.com

Comparison of Self-Etch Primers with Conventional Acid Etching System on Orthodontic Brackets

Science.gov (United States)

Zope, Amit; Zope-Khalekar, Yogita; Chitko, Shrikant S.; Kerudi, Veerendra V.; Patil, Harshal Ashok; Jaltare, Pratik; Dolas, Siddhesh G

2016-01-01

Introduction The self-etching primer system consists of etchant and primer dispersed in a single unit. The etching and priming are merged as a single step leading to fewer stages in bonding procedure and reduction in the number of steps that also reduces the chance of introduction of error, resulting in saving time for the clinician. It also results in smaller extent of enamel decalcification. Aim To compare the Shear Bond Strength (SBS) of orthodontic bracket bonded with Self-Etch Primers (SEP) and conventional acid etching system and to study the surface appearance of teeth after debonding; etching with conventional acid etch and self-etch priming, using stereomicroscope. Materials and Methods Five Groups (n=20) were created randomly from a total of 100 extracted premolars. In a control Group A, etching of enamel was done with 37% phosphoric acid and bonding of stainless steel brackets with Transbond XT (3M Unitek, Monrovia, California). Enamel conditioning in left over four Groups was done with self-etching primers and adhesives as follows: Group B-Transbond Plus (3M Unitek), Group C Xeno V+ (Dentsply), Group D-G-Bond (GC), Group E-One-Coat (Coltene). The Adhesive Remnant Index (ARI) score was also evaluated. Additionally, the surface roughness using profilometer were observed. Results Mean SBS of Group A was 18.26±7.5MPa, Group B was 10.93±4.02MPa, Group C was 6.88±2.91MPa while of Group D was 7.78±4.13MPa and Group E was 10.39±5.22MPa respectively. In conventional group ARI scores shows that over half of the adhesive was remaining on the surface of tooth (score 1 to 3). In self-etching primer groups ARI scores show that there was no or minor amount of adhesive remaining on the surface of tooth (score 4 and 5). SEP produces a lesser surface roughness on the enamel than conventional etching. However, statistical analysis shows significant correlation (pbracket bonding after enamel conditioning with any of the SEPs tested. The SEPs used in Groups C (Xeno V

A comparison of orthodontic bracket shear bond strength on enamel deproteinized by 5.25% sodium hypochlorite using total etch and self-etch primer

Science.gov (United States)

Ongkowidjaja, F.; Soegiharto, B. M.; Purbiati, M.

2017-08-01

The shear bond strength (SBS) can be increased by removing protein pellicles from the enamel surface by deproteinization using 5.25% sodium hypochlorite (NaOCl). The SBS of a self-etch primer is lower than that of a total etch primer; nonetheless, it prevents white spot lesions. This study aimed to assess the SBS of the Anyetch (AE) total etch primer and FL-Bond II Shofu (FL) self-etch primer after enamel deproteinization using 5.25% NaOCl. Forty eight human maxillary first premolars were extracted, cleaned, and divided into four groups. In group A, brackets were bonded to the enamel without deproteinization before etching (A1: 10 teeth using total etch primer (AE); A2: 10 teeth using self-etch primer (FL)). In group B, brackets were bonded to the enamel after deproteinization with 5.25% NaOCl before etching (B1: 10 teeth using total etch primer (AE); B2: 10 teeth using self-etch primer (FL)). Brackets were bonded using Transbond XT, stored in artificial saliva for 24 h at 37°C, mounted on acrylic cylinders, and debonded using a Shimadzu AG-5000 universal testing machine. There were no significant differences in SBS between the total etch (AE) groups (p > 0.05) and between the self-etch (FL) groups (p > 0.05). There were significant differences in SBS between groups A and B. The mean SBS for groups A1, A2, B1, and B2 was 12.91±3.99, 4.46±2.47, 13.06±3.66, and 3.62±2.36 MPa, respectively. Deproteinization using NaOCl did not affect the SBS of the total etch primer (AE) group; it reduced the SBS of the self-etch primer (FL) group, but not with a statistically significant difference.

A Primer on Observational Measurement.

Science.gov (United States)

Girard, Jeffrey M; Cohn, Jeffrey F

2016-08-01

Observational measurement plays an integral role in a variety of scientific endeavors within biology, psychology, sociology, education, medicine, and marketing. The current article provides an interdisciplinary primer on observational measurement; in particular, it highlights recent advances in observational methodology and the challenges that accompany such growth. First, we detail the various types of instrument that can be used to standardize measurements across observers. Second, we argue for the importance of validity in observational measurement and provide several approaches to validation based on contemporary validity theory. Third, we outline the challenges currently faced by observational researchers pertaining to measurement drift, observer reactivity, reliability analysis, and time/expense. Fourth, we describe recent advances in computer-assisted measurement, fully automated measurement, and statistical data analysis. Finally, we identify several key directions for future observational research to explore.

Investigation of Using Analytics in Promoting Mobile Learning Support

Science.gov (United States)

Visali, Videhi; Swami, Niraj

2013-01-01

Learning analytics can promote pedagogically informed use of learner data, which can steer the progress of technology mediated learning across several learning contexts. This paper presents the application of analytics to a mobile learning solution and demonstrates how a pedagogical sense was inferred from the data. Further, this inference was…

Crecimiento longitudinal posnatal del primer metatarsiano. [Longitudinal postnatal growth of the first metatarsal bone

Directory of Open Access Journals (Sweden)

Julio J. Masquijo

2014-10-01

Full Text Available Introducción: si bien el crecimiento prenatal y posnatal del pie ha sido documentado hace varios años, el crecimiento longitudinal del primer metatarsiano en particular no ha sido estudiado previamente. El objetivo del estudio es determinar el patrón de crecimiento longitudinal posnatal de este hueso y compararlo con el del pie y los huesos largos del miembro inferior. Materiales y Métodos: mediante una búsqueda informatizada, se identificaron pacientes <18 años de edad con radiografías informadas como “normal” por el radiólogo. Se analizó una muestra de 886 pacientes divididos en 18 grupos según la edad (0-11 meses, 1 año, 2 años, etc. y el sexo. El análisis de las imágenes se realizó con un software de imágenes Kodak Carestream PACS. Resultados: el largo promedio en el primer grupo fue de 19,91 mm (3,20; 15,22-25,62. El largo promedio en el último grupo fue de 66,13 mm (5,33; 52,50-77,18. La tasa de crecimiento anual fue de 2,71 mm. La edad promedio al momento del cierre de la fisis fue de 14.85 años (± 1.64 para los varones y 14.77 años (± 3.63 para las niñas. Conclusión: el crecimiento del primer metatarsiano acompaña el crecimiento longitudinal del pie, pero no el de los huesos largos del miembro inferior. Las curvas de crecimiento del primer metatarsiano descritas en este artículo pueden ser aplicadas en patologías que afectan el desarrollo del pie o que requieren cirugía de corrección sobre el primer metatarsiano, o se las puede emplear como estándar de referencia en futuros estudios.

Comparative study on the use of specific and heterologous microsatellite primers in the stingless bees Melipona rufiventris and M. mondury (Hymenoptera, Apidae).

Science.gov (United States)

Lopes, Denilce Meneses; de Oliveira Campos, Lúcio Antônio; Salomão, Tânia Maria Fernandes; Tavares, Mara Garcia

2010-04-01

Due to their high degree of polymorphism, microsatellites are considered useful tools for studying population genetics. Nevertheless, studies of genetic diversity in stingless bees by means of these primers have revealed a low level of polymorphism, possibly the consequence of the heterologous primers used, since in most cases these were not specifically designed for the species under consideration. Herein we compared the number of polymorphic loci and alleles per locus, as well as observed heterozygosity in Melipona rufiventris and M. mondury populations, using specific and heterologous primers. The use of specific primers placed in evidence the greater frequency of polymorphic loci and alleles per locus, besides an expressive increase in observed heterozygosity in M. rufiventris and M. mondury, thereby reinforcing the idea that populational studies should be undertaken by preferably using species-specific microsatellite primers.

Mobile Probes in Mobile Learning

DEFF Research Database (Denmark)

Ørngreen, Rikke; Blomhøj, Ulla; Duvaa, Uffe

In this paper experiences from using mobile probes in educational design of a mobile learning application is presented. The probing process stems from the cultural probe method, and was influenced by qualitative interview and inquiry approaches. In the project, the mobile phone was not only acting...... as an agent for acquiring empirical data (as the situation in hitherto mobile probe settings) but was also the technological medium for which data should say something about (mobile learning). Consequently, not only the content of the data but also the ways in which data was delivered and handled, provided...... a valuable dimension for investigating mobile use. The data was collected at the same time as design activities took place and the collective data was analysed based on user experience goals and cognitive processes from interaction design and mobile learning. The mobile probe increased the knowledge base...

454-Pyrosequencing Analysis of Bacterial Communities from Autotrophic Nitrogen Removal Bioreactors Utilizing Universal Primers: Effect of Annealing Temperature.

Science.gov (United States)

Gonzalez-Martinez, Alejandro; Rodriguez-Sanchez, Alejandro; Rodelas, Belén; Abbas, Ben A; Martinez-Toledo, Maria Victoria; van Loosdrecht, Mark C M; Osorio, F; Gonzalez-Lopez, Jesus

2015-01-01

Identification of anaerobic ammonium oxidizing (anammox) bacteria by molecular tools aimed at the evaluation of bacterial diversity in autotrophic nitrogen removal systems is limited by the difficulty to design universal primers for the Bacteria domain able to amplify the anammox 16S rRNA genes. A metagenomic analysis (pyrosequencing) of total bacterial diversity including anammox population in five autotrophic nitrogen removal technologies, two bench-scale models (MBR and Low Temperature CANON) and three full-scale bioreactors (anammox, CANON, and DEMON), was successfully carried out by optimization of primer selection and PCR conditions (annealing temperature). The universal primer 530F was identified as the best candidate for total bacteria and anammox bacteria diversity coverage. Salt-adjusted optimum annealing temperature of primer 530F was calculated (47°C) and hence a range of annealing temperatures of 44-49°C was tested. Pyrosequencing data showed that annealing temperature of 45°C yielded the best results in terms of species richness and diversity for all bioreactors analyzed.

Development of Prevotella intermedia-specific PCR primers based on the nucleotide sequences of a DNA probe Pig27.

Science.gov (United States)

Kim, Min Jung; Hwang, Kyung Hwan; Lee, Young-Seok; Park, Jae-Yoon; Kook, Joong-Ki

2011-03-01

The aim of this study was to develop Prevotella intermedia-specific PCR primers based on the P. intermedia-specific DNA probe. The P. intermedia-specific DNA probe was screened by inverted dot blot hybridization and confirmed by Southern blot hybridization. The nucleotide sequences of the species-specific DNA probes were determined using a chain termination method. Southern blot analysis showed that the DNA probe, Pig27, detected only the genomic DNA of P. intermedia strains. PCR showed that the PCR primers, Pin-F1/Pin-R1, had species-specificity for P. intermedia. The detection limits of the PCR primer sets were 0.4pg of the purified genomic DNA of P. intermedia ATCC 49046. These results suggest that the PCR primers, Pin-F1/Pin-R1, could be useful in the detection of P. intermedia as well as in the development of a PCR kit in epidemiological studies related to periodontal diseases. Crown Copyright © 2010. Published by Elsevier B.V. All rights reserved.

Heterologous primer transferability and access to microsatellite loci polymorphism in ‘somnus’ passion fruit tree (Passiflora setacea DC

Directory of Open Access Journals (Sweden)

Douglas de Almeida Pereira

2015-09-01

Full Text Available Primer pairs that access microsatellite loci, initially constructed through the genome of Passiflora edulis Sims flavicarpa and P. alata, were tested concerning their ability to access microsatellite loci in ‘somnus’ passion fruit tree (P. setacea individuals. Seven out of the thirty one primer pairs tested were able to access DNA polymorphism in the genome of this wild Passiflora species, by evaluating six natural populations, located in a transition area between the biomes Caatinga and Cerrado, in the state of Bahia, Brazil. The number of alleles/loci was small, oscillating from 1 to 4. The average heterozygosity observed per locus in all populations ranged from 0.13 to 0.40. There was transference of heterologous microsatellite primer pairs from the Passiflora genus to ‘somnus’ passion fruit tree, constituting a new set of primers that access random co-dominant locus in this species, useful for conservationist purposes and pre-improvement of ‘somnus’ passion fruit tree.

The Pathways to Enterprise Mobile Readiness: Analysis of Perceptions, Pressures, Preparedness, and Progression

Science.gov (United States)

Johnson, James Nathaniel

2013-01-01

Ubiquitous computing is a near reality in both the private and public arena. Business and personal spaces are seeing a proliferation of mobile computing devices and pervasive computing technologies. This phenomenon is creating a unique set of challenges for organizational IT professionals, specifically in the numerous spillover effects of having…

Detection of polyoma virus in brain tissue of patients with progressive multifocal leukoencephalopathy by real-time PCR and pyrosequencing.

Science.gov (United States)

Beck, Rose C; Kohn, Debra J; Tuohy, Marion J; Prayson, Richard A; Yen-Lieberman, Belinda; Procop, Gary W

2004-03-01

We evaluated 2 methods, a LightCycler PCR assay and pyrosequencing for the detection of the JC polyoma virus (JCV) in fixed brain tissue of 10 patients with and 3 control patients without progressive multifocal leukoencephalopathy (PML). Nucleic acid extraction was performed after deparaffinization and proteinase K digestion. The LightCycler assay differentiates the BK virus (BKV), JCV, and SV40 using melt curve analysis. Conventional PCR was used with the same primers to generate products for pyrosequencing. Two sequencing primers were used that differentiate the polyoma viruses. Seven of 11 biopsies (1 patient had 2 biopsies) with PML were positive for JCV by real-time PCR and/or PCR/pyrosequencing. Three of 4 remaining biopsies were positive by real-time PCR but had melting points between JCV and SV40. The 4 specimens that were negative or atypical by LightCycler PCR were positive by traditional PCR, but 1 had an amplicon of lower molecular weight by gel electrophoresis. These were shown to represent JCV by at least 1 of the 2 pyrosequencing primers. The biopsies from patients without PML were PCR negative. Both the LightCycler and pyrosequencing assays are useful for confirming JCV in brain biopsies from patients with PML, but variant JCVs may require supplementary methods to confirm JCV infection.

Progress on Broadband Access to the Internet and Use of Mobile Devices in the United States.

Science.gov (United States)

Serrano, Katrina J; Thai, Chan L; Greenberg, Alexandra J; Blake, Kelly D; Moser, Richard P; Hesse, Bradford W

Healthy People 2020 (HP2020) aims to improve population health outcomes through several objectives, including health communication and health information technology. We used 7 administrations of the Health Information National Trends Survey to examine HP2020 goals toward access to the Internet through broadband and mobile devices (N = 34 080). We conducted descriptive analyses and obtained predicted marginals, also known as model-adjusted risks, to estimate the association between demographic characteristics and use of mobile devices. The HP2020 target (7.7% of the US population) for accessing the Internet through a cellular network was surpassed in 2014 (59.7%), but the HP2020 target (83.2%) for broadband access fell short (63.8%). Sex and age were associated with accessing the Internet through a cellular network throughout the years (Wald F test, P Internet through mobile devices presents an opportunity for technology-based health interventions that should be explored.

Phase out Mobile Communication Technology: An Analysis Based on Public Policy and Business Values

OpenAIRE

Huang, Kuang-Chiu; Houng, Ming-Wie

2017-01-01

Through the progress of communication technology, the mobile services have broughtlots of benefits for our daily lives. However, with the recent advances in cellular communications and new systems being deployed alongside existing ones, an emerging question aboutwhether there still is someneedsfor the legacy infrastructure, in particular the widely deployed GSMsystemsat this moment.Forthe evolution of mobile communication, we have embrace convenience and efficiency offered bymobile service.We...

Comparative study on the use of specific and heterologous microsatellite primers in the stingless bees Melipona rufiventris and M. mondury (Hymenoptera, Apidae

Directory of Open Access Journals (Sweden)

Denilce Meneses Lopes

2010-01-01

Full Text Available Due to their high degree of polymorphism, microsatellites are considered useful tools for studying population genetics. Nevertheless, studies of genetic diversity in stingless bees by means of these primers have revealed a low level of polymorphism, possibly the consequence of the heterologous primers used, since in most cases these were not specifically designed for the species under consideration. Herein we compared the number of polymorphic loci and alleles per locus, as well as observed heterozygosity in Melipona rufiventris and M. mondury populations, using specific and heterologous primers. The use of specific primers placed in evidence the greater frequency of polymorphic loci and alleles per locus, besides an expressive increase in observed heterozygosity in M. rufiventris and M. mondury, thereby reinforcing the idea that populational studies should be undertaken by preferably using species-specific microsatellite primers.

MCNPTM criticality primer and training experiences

International Nuclear Information System (INIS)

Briesmeister, J.; Forster, R.A.; Busch, R.

1995-01-01

With the closure of many experimental facilities, the nuclear criticality safety analyst is increasingly required to rely on computer calculations to identify safe limits for the handling and storage of fissile materials. However, the analyst may have little experience with the specific codes available at his or her facility. Usually, the codes are quite complex, black boxes capable of analyzing numerous problems with a myriad of input options. Documentation for these codes is designed to cover all the possible configurations and types of analyses but does not give much detail on any particular type of analysis. For criticality calculations, the user of a code is primarily interested in the value of the effective multiplication factor for a system (k eff ). Most codes will provide this, and truckloads of other information that may be less pertinent to criticality calculations. Based on discussions with code users in the nuclear criticality safety community, it was decided that a simple document discussing the ins and outs of criticality calculations with specific codes would be quite useful. The Transport Methods Group, XTM, at Los Alamos National Laboratory (LANL) decided to develop a primer for criticality calculations with their Monte Carlo code, MCNP. This was a joint task between LANL with a knowledge and understanding of the nuances and capabilities of MCNP and the University of New Mexico with a knowledge and understanding of nuclear criticality safety calculations and educating first time users of neutronics calculations. The initial problem was that the MCNP manual just contained too much information. Almost everything one needs to know about MCNP can be found in the manual; the problem is that there is more information than a user requires to do a simple k eff calculation. The basic concept of the primer was to distill the manual to create a document whose only focus was criticality calculations using MCNP

An Evolutionary/Biochemical Connection Between Promoter- and Primer-Dependent Polymerases Revealed by Selective Evolution of Ligands by Exponential Enrichment (SELEX).

Science.gov (United States)

Fenstermacher, Katherine J; Achuthan, Vasudevan; Schneider, Thomas D; DeStefano, Jeffrey J

2018-01-16

DNA polymerases (DNAPs) recognize 3' recessed termini on duplex DNA and carry out nucleotide catalysis. Unlike promoter-specific RNA polymerases (RNAPs), no sequence specificity is required for binding or initiation of catalysis. Despite this, previous results indicate that viral reverse transcriptases bind much more tightly to DNA primers that mimic the polypurine tract. In the current report, primer sequences that bind with high affinity to Taq and Klenow polymerases were identified using a modified Selective Evolution of Ligands by Exponential Enrichment (SELEX) approach. Two Taq -specific primers that bound ∼10 (Taq1) and over 100 (Taq2) times more stably than controls to Taq were identified. Taq1 contained 8 nucleotides (5' -CACTAAAG-3') that matched the phage T3 RNAP "core" promoter. Both primers dramatically outcompeted primers with similar binding thermodynamics in PCR reactions. Similarly, exonuclease minus Klenow polymerase also selected a high affinity primer that contained a related core promoter sequence from phage T7 RNAP (5' -ACTATAG-3'). For both Taq and Klenow, even small modifications to the sequence resulted in large losses in binding affinity suggesting that binding was highly sequence-specific. The results are discussed in the context of possible effects on multi-primer (multiplex) PCR assays, molecular information theory, and the evolution of RNAPs and DNAPs. Importance This work further demonstrates that primer-dependent DNA polymerases can have strong sequence biases leading to dramatically tighter binding to specific sequences. These may be related to biological function, or be a consequences of the structural architecture of the enzyme. New sequence specificity for Taq and Klenow polymerases were uncovered and among them were sequences that contained the core promoter elements from T3 and T7 phage RNA polymerase promoters. This suggests the intriguing possibility that phage RNA polymerases exploited intrinsic binding affinities of

Can previous acid etching increase the bond strength of a self-etching primer adhesive to enamel?

Directory of Open Access Journals (Sweden)

Ana Paula Morales Cobra Carvalho

2009-06-01

Full Text Available Because a greater research effort has been directed to analyzing the adhesive effectiveness of self etch primers to dentin, the aim of this study was to evaluate, by microtensile testing, the bond strength to enamel of a composite resin combined with a conventional adhesive system or with a self-etching primer adhesive, used according to its original prescription or used with previous acid etching. Thirty bovine teeth were divided into 3 groups with 10 teeth each (n= 10. In one of the groups, a self-etching primer (Clearfil SE Bond - Kuraray was applied in accordance with the manufacturer's instructions and, in the other, it was applied after previous acid etching. In the third group, a conventional adhesive system (Scotchbond Multipurpose Plus - 3M-ESPE was applied in accordance with the manufacturer's instructions. The results obtained by analysis of variance revealed significant differences between the adhesive systems (F = 22.31. The self-etching primer (Clearfil SE Bond presented lower enamel bond strength values than the conventional adhesive system (Scotchbond Multipurpose Plus (m = 39.70 ± 7.07 MPa both when used according to the original prescription (m = 27.81 ± 2.64 MPa and with previous acid etching (m = 25.08 ± 4.92 MPa.

Controlling Air Pollution; A Primer on Stationary Source Control Techniques.

Science.gov (United States)

Corman, Rena

This companion document to "Air Pollution Primer" is written for the nonexpert in air pollution; however, it does assume a familiarity with air pollution problems. This work is oriented toward providing the reader with knowledge about current and proposed air quality legislation and knowledge about available technology to meet these standards for…

Estimates of abundance and diversity of Shewanella genus in natural and engineered aqueous environments with newly designed primers.

Science.gov (United States)

Li, Bing-Bing; Cheng, Yuan-Yuan; Fan, Yang-Yang; Liu, Dong-Feng; Fang, Cai-Yun; Wu, Chao; Li, Wen-Wei; Yang, Zong-Chuang; Yu, Han-Qing

2018-05-12

Shewanella species have a diverse respiratory ability and wide distribution in environments and play an important role in bioremediation and the biogeochemical cycles of elements. Primers with more accuracy and broader coverage are required with consideration of the increasing number of Shewanella species and evaluation of their roles in various environments. In this work, a new primer set of 640F/815R was developed to quantify the abundance of Shewanella species in natural and engineered environments. In silico tools for primer evaluation, quantitative polymerase chain reaction (qPCR) and clone library results showed that 640F/815R had a higher specificity and coverage than the previous primers in quantitative analysis of Shewanella. Another newly developed primer pair of 211F/815cR was also adopted to analyze the Shewanella diversity and demonstrated to be the best candidate in terms of specificity and coverage. We detected more Shewanella-related species in freshwater environments and found them to be substantially different from those in marine environments. Abundance and diversity of Shewanella species in wastewater treatment plants were largely affected by the process and operating conditions. Overall, this study suggests that investigations of abundance and diversity of Shewanella in various environments are of great importance to evaluate their ecophysiology and potential ecological roles. Copyright © 2018 Elsevier B.V. All rights reserved.

Profil Gangguan Kognitif pada Tumor Intrakranial Primer dan Metastasis

OpenAIRE

Kartika Maharani; Andira Larasari; Tiara Aninditha; Yetty Ramli

2015-01-01

Gangguan kognitif sering menyertai pasien tumor intrakranial dan menjadi penyebab utama disabilitas. Perbedaan patofisiologi tumor intrakranial primer (TIP) dan metastasis (TM) menyebabkan perbedaan gambaran klinis dan derajat  gangguan kognitif. Tujuan penelitian ini untuk mengetahui prevalensi dan profil gangguan kognitif pasien TIP dan TM. Disain penelitian potong-lintang retrospektif menggunakan data sekunder dari Poliklinik Saraf RSCM pada bulan Januari 2011-Desember 2013. Subjek b...

A primer on the mortgage market and mortgage finance

OpenAIRE

Daniel J. McDonald; Daniel L. Thornton

2008-01-01

This article is a primer on mortgage finance. It discusses the basics of the mortgage market and mortgage finance. In so doing, it provides useful information that can aid individuals in making better mortgage finance decisions. The discussion and the tools are presented within the context of mortgage finance; however, these same principles and tools can be applied to a wide range of financial decisions.

Comparison of Alignment Correction Angles Between Fixed-Bearing and Mobile-Bearing UKA.

Science.gov (United States)

Inoue, Atsuo; Arai, Yuji; Nakagawa, Shuji; Inoue, Hiroaki; Yamazoe, Shoichi; Kubo, Toshikazu

2016-01-01

Good outcomes have been reported with both fixed-bearing and mobile-bearing unicompartmental knee arthroplasty (UKA). However, overcorrected alignment could induce the progression of arthritis on the non-arthroplasty side. Changes of limb alignment after UKA with both types of bearings (fixed bearing: 24 knees, mobile bearing: 28 knees) were investigated. The mean difference between the preoperative standing femoral-tibial angle (FTA) and postoperative standing FTA was significantly larger in mobile bearing UKA group. In fixed-bearing UKA, there must be some laxity in MCL tension so that a 2-mm tension gauge can be inserted. In mobile-bearing UKA, appropriate MCL tension is needed to prevent bearing dislocation. This difference in MCL tension may have caused the difference in the correction angle between the groups. Copyright © 2016 Elsevier Inc. All rights reserved.

Supporting Activity-Based Computingusing Dynamically (De)Composable Mobile Applications

DEFF Research Database (Denmark)

Schultz, Ulrik Pagh; Schougaard, Kari Rye

2004-01-01

the document-centered paradigm for pervasive computing: it crosscuts work with different kinds of entities and sets the focus on the user and the user's tasks. In domain such as healthcare, activities are fundamentally mobile: doctors and nurses move throughout the hospital as their work progresses. Hence......, the computer must support mobility of activities. For this reason, we consider it important to investigate whether a computing platform that embraces mobility at a fundamental level supports implementing software for this new paradigm. This paper describes our initial design ideas for supporting activity......-centered computing in the Pervasive Object Model Project (POMP), a project which concerns the development of a platform for pervasive computing applications. We first describe POMP, the present the notion of activity-based computing, and last investigate how activity-based computing can be implemented in POMP....

Comparison of bond strengths of ceramic brackets bonded to zirconia surfaces using different zirconia primers and a universal adhesive.

Science.gov (United States)

Lee, Ji-Yeon; Ahn, Jaechan; An, Sang In; Park, Jeong-Won

2018-02-01

The aim of this study is to compare the shear bond strengths of ceramic brackets bonded to zirconia surfaces using different zirconia primers and universal adhesive. Fifty zirconia blocks (15 × 15 × 10 mm, Zpex, Tosoh Corporation) were polished with 1,000 grit sand paper and air-abraded with 50 µm Al 2 O 3 for 10 seconds (40 psi). They were divided into 5 groups: control (CO), Metal/Zirconia primer (MZ, Ivoclar Vivadent), Z-PRIME Plus (ZP, Bisco), Zirconia Liner (ZL, Sun Medical), and Scotchbond Universal adhesive (SU, 3M ESPE). Transbond XT Primer (used for CO, MZ, ZP, and ZL) and Transbond XT Paste was used for bracket bonding (Gemini clear ceramic brackets, 3M Unitek). After 24 hours at 37°C storage, specimens underwent 2,000 thermocycles, and then, shear bond strengths were measured (1 mm/min). An adhesive remnant index (ARI) score was calculated. The data were analyzed using one-way analysis of variance and the Bonferroni test ( p = 0.05). Surface treatment with primers resulted in increased shear bond strength. The SU group showed the highest shear bond strength followed by the ZP, ZL, MZ, and CO groups, in that order. The median ARI scores were as follows: CO = 0, MZ = 0, ZP = 0, ZL = 0, and SU = 3 ( p < 0.05). Within this experiment, zirconia primer can increase the shear bond strength of bracket bonding. The highest shear bond strength is observed in SU group, even when no primer is used.

A primer on pseudorandom generators

CERN Document Server

Goldreich, Oded

2010-01-01

A fresh look at the question of randomness was taken in the theory of computing: A distribution is pseudorandom if it cannot be distinguished from the uniform distribution by any efficient procedure. This paradigm, originally associating efficient procedures with polynomial-time algorithms, has been applied with respect to a variety of natural classes of distinguishing procedures. The resulting theory of pseudorandomness is relevant to science at large and is closely related to central areas of computer science, such as algorithmic design, complexity theory, and cryptography. This primer surveys the theory of pseudorandomness, starting with the general paradigm, and discussing various incarnations while emphasizing the case of general-purpose pseudorandom generators (withstanding any polynomial-time distinguisher). Additional topics include the "derandomization" of arbitrary probabilistic polynomial-time algorithms, pseudorandom generators withstanding space-bounded distinguishers, and several natural notions...

A primer on quantum fluids

CERN Document Server

Barenghi, Carlo

2016-01-01

The aim of this primer is to cover the essential theoretical information, quickly and concisely, in order to enable senior undergraduate and beginning graduate students to tackle projects in topical research areas of quantum fluids, for example, solitons, vortices and collective modes. The selection of the material, both regarding the content and level of presentation, draws on the authors analysis of the success of relevant research projects with newcomers to the field, as well as of the students feedback from many taught and self-study courses on the subject matter. Starting with a brief historical overview, this text covers particle statistics, weakly interacting condensates and their dynamics and finally superfluid helium and quantum turbulence. At the end of each chapter (apart from the first) there will be some exercises. Detailed solutions can be made available to instructors upon request to the authors. .

Making the connection: advancing traffic incident management in transportation planning : a primer.

Science.gov (United States)

2013-07-01

"The intent of this primer is to inform and guide traffic incident management (TIM) professionals and transportation planners to initiate and develop collaborative relationships and advance TIM programs through the metropolitan planning process. The ...

Mobil Oil Canada annual progress report to the Voluntary Challenge and Registry Program 1998

International Nuclear Information System (INIS)

1998-10-01

Mobil Oil Canada has prepared estimates of its emissions of major greenhouse gases for the years 1994, 1995, 1996 and 1997. While the Voluntary Challenge and Registry (VCR) encouraged an inventory of emissions for 1990 to the present, data are not present for earlier than 1994. An inventory summary is included that outlines the quantity of emissions due to the following sources for each facility: combustion of fuel gas for heaters, boilers and compressors, flaring and venting of natural gas, and consumption of coal generated electricity. For all Mobil operated facilities in 1997, GHG emissions existed in the following fractions: 43% due to fuel gas use, 42% due to gas flaring and venting, and 15% from electricity consumption. In 1996, emissions were more evenly distributed amongst the three major sources. A discussion is included of emissions produced and energy used by each process type with data shown in tables. This includes: heavy oil facilities, light oil facilities, sulfur recovery facilities, a sour gas facility, a sweet gas facility, and a thermal heavy oil facility. Various projects were undertaken at each Mobil operated facility to increase energy efficiency and reduce emissions. A summary of the fuel gas, electricity and emission savings for each facility is described, as well as the main actions responsible for each emission saving. These cover: light oil facilities, sulfur recovery facilities, a thermal heavy oil facility, a conventional heavy oil facility, a sweet gas facility, and a sour gas facility. 5 tabs., 9 figs

Unique case of oligoastrocytoma with recurrence and grade progression: Exhibiting differential expression of high mobility group-A1 and human telomerase reverse transcriptase

Science.gov (United States)

Gandhi, Puneet; Khare, Richa; Niraj, Kavita; Garg, Nitin; Sorte, Sandeep K; Gulwani, Hanni

2016-01-01

Mixed gliomas, primarily oligoastrocytomas, account for about 5%-10% of all gliomas. Distinguishing oligoastrocytoma based on histological features alone has limitations in predicting the exact biological behavior, necessitating ancillary markers for greater specificity. In this case report, human telomerase reverse transcriptase (hTERT) and high mobility group-A1 (HMGA1); markers of proliferation and stemness, have been quantitatively analyzed in formalin-fixed paraffin-embedded tissue samples of a 34 years old patient with oligoastrocytoma. Customized florescence-based immunohistochemistry protocol with enhanced sensitivity and specificity is used in the study. The patient presented with a history of generalized seizures and his magnetic resonance imaging scans revealed infiltrative ill-defined mass lesion with calcified foci within the left frontal white matter, suggestive of glioma. He was surgically treated at our center for four consecutive clinical events. Histopathologically, the tumor was identified as oligoastrocytoma-grade II followed by two recurrence events and final progression to grade III. Overall survival of the patient without adjuvant therapy was more than 9 years. Glial fibrillary acidic protein, p53, Ki-67, nuclear atypia index, pre-operative neutrophil-lymphocyte ratio, are the other parameters assessed. Findings suggest that hTERT and HMGA1 are linked to tumor recurrence and progression. Established markers can assist in defining precise histopathological grade in conjuction with conventional markers in clinical setup. PMID:27672647

3G vector-primer plasmid for constructing full-length-enriched cDNA libraries.

Science.gov (United States)

Zheng, Dong; Zhou, Yanna; Zhang, Zidong; Li, Zaiyu; Liu, Xuedong

2008-09-01

We designed a 3G vector-primer plasmid for the generation of full-length-enriched complementary DNA (cDNA) libraries. By employing the terminal transferase activity of reverse transcriptase and the modified strand replacement method, this plasmid (assembled with a polydT end and a deoxyguanosine [dG] end) combines priming full-length cDNA strand synthesis and directional cDNA cloning. As a result, the number of steps involved in cDNA library preparation is decreased while simplifying downstream gene manipulation, sequencing, and subcloning. The 3G vector-primer plasmid method yields fully represented plasmid primed libraries that are equivalent to those made by the SMART (switching mechanism at 5' end of RNA transcript) approach.

High-throughput sequencing of 16S rRNA gene amplicons: effects of extraction procedure, primer length and annealing temperature.

Science.gov (United States)

Sergeant, Martin J; Constantinidou, Chrystala; Cogan, Tristan; Penn, Charles W; Pallen, Mark J

2012-01-01

The analysis of 16S-rDNA sequences to assess the bacterial community composition of a sample is a widely used technique that has increased with the advent of high throughput sequencing. Although considerable effort has been devoted to identifying the most informative region of the 16S gene and the optimal informatics procedures to process the data, little attention has been paid to the PCR step, in particular annealing temperature and primer length. To address this, amplicons derived from 16S-rDNA were generated from chicken caecal content DNA using different annealing temperatures, primers and different DNA extraction procedures. The amplicons were pyrosequenced to determine the optimal protocols for capture of maximum bacterial diversity from a chicken caecal sample. Even at very low annealing temperatures there was little effect on the community structure, although the abundance of some OTUs such as Bifidobacterium increased. Using shorter primers did not reveal any novel OTUs but did change the community profile obtained. Mechanical disruption of the sample by bead beating had a significant effect on the results obtained, as did repeated freezing and thawing. In conclusion, existing primers and standard annealing temperatures captured as much diversity as lower annealing temperatures and shorter primers.

Effects of non-thermal mobile phone radiation on breast adenocarcinoma cells

Directory of Open Access Journals (Sweden)

Zen Fourie

2011-09-01

Full Text Available Mobile phone usage currently exceeds landline communication in Africa. The extent of this usage has raised concerns about the long-term health effects of the ongoing use of mobile phones. To assess the physiological effects of radiation from mobile phones in vitro, MCF-7 breast adenocarcinoma cells were exposed to 2W/kg non-thermal 900-MHz mobile phone radiation. The effects investigated were those on metabolic activity, cell morphology, cell cycle progression, phosphatidylserine (PS externalisation and the generation of reactive oxygen species and nitrogen species. Statistically insignificant increases in mitochondrial dehydrogenase activity were observed in irradiated cells when compared to controls. Fluorescent detection of F-actin demonstrated an increase in F-actin stress fibre formation in irradiated MCF-7 cells. Cell cycle progression revealed no statistically significant variation. A small increase in early and late apoptotic events in irradiated MCF-7 cells was observed. No statistically significant changes were observed in reactive oxygen and reactive nitrogen species generation. In addition, quantitative and qualitative analyses of cell cycle activity and nuclear and cytosolic changes, respectively, revealed no significant changes. In conclusion, exposure to 1 h of 900-MHz irradiation induced an increase in PS externalisation and an increase in the formation of F-actin stress fibres in MCF-7 cells. Data obtained from this study, and their correlation with other studies, provides intriguing links between radio frequency radiation and cellular events and warrant further investigation.

Abrechnung mobiler Dienste im Mobile-Payment-Referenzmodell

OpenAIRE

Pousttchi, Key; Wiedemann, Dietmar Georg

2005-01-01

The purpose of the paper is to analyze mobile payments in the mobile commerce scenario. Therefore, we first classify the mobile payment in the mobile commerce scenario by explaining general offer models, charging concepts, and intermediaries. Second, we describe the mobile payment reference model, especially, the mobile payment reference organization model and different mobile payment standard types. Finally, we conclude our findings.

A Web-Based Adaptive Tutor to Teach PCR Primer Design

Science.gov (United States)

van Seters, Janneke R.; Wellink, Joan; Tramper, Johannes; Goedhart, Martin J.; Ossevoort, Miriam A.

2012-01-01

When students have varying prior knowledge, personalized instruction is desirable. One way to personalize instruction is by using adaptive e-learning to offer training of varying complexity. In this study, we developed a web-based adaptive tutor to teach PCR primer design: the PCR Tutor. We used part of the Taxonomy of Educational Objectives (the…

Development of specific primers for the detection of HVA1 from ...

African Journals Online (AJOL)

aghomotsegin

2014-01-22

Jan 22, 2014 ... can potentially improve the stress tolerance in plants. (Bajaj et al. ... protein) from barley was engineered in rice (Chandra et al., 2004; Rohila et al., .... US), 400 nM forward and reverse primers, 100 ng of DNA template in 25 µl ...

De neurocirujano a primer ministro de Salud de la Argentina

Directory of Open Access Journals (Sweden)

Karina Inés Ramacciotti

2008-01-01

Full Text Available La trayectoria y los vínculos que entabló Ramón Carrillo con anterioridad a ejercer el cargo de primer secretario de Salud Pública en la Argentina (1946 no han sido objeto de estudio pormenorizado. Así pues en este artículo se analizarán en primer lugar, una serie de cartas de lectores publicadas en La Semana Médica en los primeros años de la década del '40 del siglo XX. Estas notas permiten comprender las disputas internas que se produjeron en la Facultad de Ciencias Médicas al producirse el concurso de Titular de Neurocirugía de la Universidad de Buenos Aires. En segundo lugar, se revisará cómo Carrillo pasa de ocupar este prestigioso cargo académico a convertirse en decano interi- no de la Facultad de Ciencias Médicas. Son las relaciones que anuda durante estos años las que lo posicionan en un escenario político privilegiado para alcanzar un relevante puesto en la administración pública.

A primer on physical-layer network coding

CERN Document Server

Liew, Soung Chang; Zhang, Shengli

2015-01-01

The concept of physical-layer network coding (PNC) was proposed in 2006 for application in wireless networks. Since then it has developed into a subfield of communications and networking with a wide following. This book is a primer on PNC. It is the outcome of a set of lecture notes for a course for beginning graduate students at The Chinese University of Hong Kong. The target audience is expected to have some prior background knowledge in communication theory and wireless communications, but not working knowledge at the research level. Indeed, a goal of this book/course is to allow the reader

454-Pyrosequencing Analysis of Bacterial Communities from Autotrophic Nitrogen Removal Bioreactors Utilizing Universal Primers: Effect of Annealing Temperature

Directory of Open Access Journals (Sweden)

Alejandro Gonzalez-Martinez

2015-01-01

Full Text Available Identification of anaerobic ammonium oxidizing (anammox bacteria by molecular tools aimed at the evaluation of bacterial diversity in autotrophic nitrogen removal systems is limited by the difficulty to design universal primers for the Bacteria domain able to amplify the anammox 16S rRNA genes. A metagenomic analysis (pyrosequencing of total bacterial diversity including anammox population in five autotrophic nitrogen removal technologies, two bench-scale models (MBR and Low Temperature CANON and three full-scale bioreactors (anammox, CANON, and DEMON, was successfully carried out by optimization of primer selection and PCR conditions (annealing temperature. The universal primer 530F was identified as the best candidate for total bacteria and anammox bacteria diversity coverage. Salt-adjusted optimum annealing temperature of primer 530F was calculated (47°C and hence a range of annealing temperatures of 44–49°C was tested. Pyrosequencing data showed that annealing temperature of 45°C yielded the best results in terms of species richness and diversity for all bioreactors analyzed.

Great Lakes rivermouths: a primer for managers

Science.gov (United States)

Pebbles, Victoria; Larson, James; Seelbach, Paul; Pebbles, Victoria; Larson, James; Seelbach, Paul

2013-01-01

Between the North American Great Lakes and their tributaries are the places where the confluence of river and lake waters creates a distinct ecosystem: the rivermouth ecosystem. Human development has often centered around these rivermouths, in part, because they provide a rich array of ecosystem services. Not surprisingly, centuries of intense human activity have led to substantial pressures on, and alterations to, these ecosystems, often diminishing or degrading their ecological functions and associated ecological services. Many Great Lakes rivermouths are the focus of intense restoration efforts. For example, 36 of the active Great Lakes Areas of Concern (AOCs) are rivermouths or areas that include one or more rivermouths. Historically, research of rivermouth ecosystems has been piecemeal, focused on the Great Lakes proper or on the upper reaches of tributaries, with little direct study of the rivermouth itself. Researchers have been divided among disciplines, agencies and institutions; and they often work independently and use disparate venues to communicate their work. Management has also been fragmented with a focus on smaller, localized, sub-habitat units and socio-political or economic elements, rather than system-level consideration. This Primer presents the case for a more holistic approach to rivermouth science and management that can enable restoration of ecosystem services with multiple benefits to humans and the Great Lakes ecosystem. A conceptual model is presented with supporting text that describes the structures and processes common to all rivermouths, substantiating the case for treating these ecosystems as an identifiable class.1 Ecological services provided by rivermouths and changes in how humans value those services over time are illustrated through case studies of two Great Lakes rivermouths—the St. Louis River and the Maumee River. Specific ecosystem services are identified in italics throughout this Primer and follow definitions described

Schrodinger's scat: a critical review of the currently available tiger (Panthera Tigris) and leopard (Panthera pardus) specific primers in India, and a novel leopard specific primer.

Science.gov (United States)

Maroju, Pranay Amruth; Yadav, Sonu; Kolipakam, Vishnupriya; Singh, Shweta; Qureshi, Qamar; Jhala, Yadvendradev

2016-02-09

Non-invasive sampling has opened avenues for the genetic study of elusive species, which has contributed significantly to their conservation. Where field based identity of non-invasive sample is ambiguous (e.g. carnivore scats), it is essential to establish identity of the species through molecular approaches. A cost effective procedure to ascertain species identity is to use species specific primers (SSP) for PCR amplification and subsequent resolution through agarose gel electrophoresis. However, SSPs if ill designed can often cross amplify non-target sympatric species. Herein we report the problem of cross amplification with currently published SSPs, which have been used in several recent scientific articles on tigers (Panthera tigris) and leopards (Panthera pardus) in India. Since these papers form pioneering research on which future work will be based, an early rectification is required so as to not propagate this error further. We conclusively show cross amplification of three of the four SSPs, in sympatric non-target species like tiger SSP amplifying leopard and striped hyena (Hyaena hyaena), and leopard SSP amplifying tiger, lion (Panthera leo persica) and clouded leopard (Neofelis nebulosa), with the same product size. We develop and test a non-cross-amplifying leopard specific primer pair within the mitochondrial cytochrome b region. We also standardize a duplex PCR method to screen tiger and leopard samples simultaneously in one PCR reaction to reduce cost and time. These findings suggest the importance of an often overlooked preliminary protocol of conclusive identification of species from non-invasive samples. The cross amplification of published primers in conspecifics suggests the need to revisit inferences drawn by earlier work.

Auditory Brainstem Responses and EMFs Generated by Mobile Phones.

Science.gov (United States)

Khullar, Shilpa; Sood, Archana; Sood, Sanjay

2013-12-01

There has been a manifold increase in the number of mobile phone users throughout the world with the current number of users exceeding 2 billion. However this advancement in technology like many others is accompanied by a progressive increase in the frequency and intensity of electromagnetic waves without consideration of the health consequences. The aim of our study was to advance our understanding of the potential adverse effects of GSM mobile phones on auditory brainstem responses (ABRs). 60 subjects were selected for the study and divided into three groups of 20 each based on their usage of mobile phones. Their ABRs were recorded and analysed for latency of waves I-V as well as interpeak latencies I-III, I-V and III-V (in ms). Results revealed no significant difference in the ABR parameters between group A (control group) and group B (subjects using mobile phones for maximum 30 min/day for 5 years). However the latency of waves was significantly prolonged in group C (subjects using mobile phones for 10 years for a maximum of 30 min/day) as compared to the control group. Based on our findings we concluded that long term exposure to mobile phones may affect conduction in the peripheral portion of the auditory pathway. However more research needs to be done to study the long term effects of mobile phones particularly of newer technologies like smart phones and 3G.

Human immunodeficiency virus uses tRNA(Lys,3) as primer for reverse transcription in HeLa-CD4+ cells

NARCIS (Netherlands)

Das, A. T.; Koken, S. E.; Essink, B. B.; van Wamel, J. L.; Berkhout, B.

1994-01-01

Significant amounts of different tRNA molecules are present in retroviral particles, but one specific tRNA species functions as primer in reverse transcription. It is generally believed that the HIV-1 virus uses the tRNA(Lys,3) molecule as primer. This is based on sequence complementarity between

Routes to effective evacuation planning primer series : evacuating populations with special needs.

Science.gov (United States)

2009-04-01

Evacuation operations are conducted under the authority of, and based on decisions by, local and state authorities. The purpose of this primer, Evacuating Populations with Special Needs, is to provide local and state emergency managers, government of...

An improved primer set and amplification protocol with increased specificity and sensitivity targeting the Symbiodinium ITS2 region

KAUST Repository

Hume, Benjamin C.C.; Ziegler, Maren; Poulain, Julie; Pochon, Xavier; Romac, Sarah; Boissin, Emilie; de Vargas, Colomban; Planes, Serge; Wincker, Patrick; Voolstra, Christian R.

2018-01-01

The Internal Transcribed Spacer 2 (ITS2) rRNA gene is a commonly targeted genetic marker to assess diversity of Symbiodinium, a dinoflagellate genus of algal endosymbionts that is pervasively associated with marine invertebrates, and notably reef-building corals. Here we tested three commonly used ITS2 primer pairs (SYM_VAR_5.8S2/SYM_VAR_REV, ITSintfor2/ITSReverse, and ITS-DINO/ITS2Rev2) with regard to amplification specificity and sensitivity towards Symbiodinium, as well as sub-genera taxonomic bias. We tested these primers over a range of sample types including three coral species, coral surrounding water, reef surface water, and open ocean water to assess their suitability for use in large-scale next generation sequencing projects and to develop a standardised PCR protocol. We found the SYM_VAR_5.8S2/SYM_VAR_REV primers to perform superior to the other tested ITS2 primers. We therefore used this primer pair to develop a standardised PCR protocol. To do this, we tested the effect of PCR-to-PCR variation, annealing temperature, cycle number, and different polymerase systems on the PCR efficacy. The Symbiodinium ITS2 PCR protocol developed here delivers improved specificity and sensitivity towards Symbiodinium with apparent minimal sub-genera taxonomic bias across all sample types. In particular, the protocol’s ability to amplify Symbiodinium from a range of environmental sources will facilitate the study of Symbiodinium populations across biomes.

An improved primer set and amplification protocol with increased specificity and sensitivity targeting the Symbiodinium ITS2 region

KAUST Repository

Hume, Benjamin C.C.

2018-05-23

The Internal Transcribed Spacer 2 (ITS2) rRNA gene is a commonly targeted genetic marker to assess diversity of Symbiodinium, a dinoflagellate genus of algal endosymbionts that is pervasively associated with marine invertebrates, and notably reef-building corals. Here we tested three commonly used ITS2 primer pairs (SYM_VAR_5.8S2/SYM_VAR_REV, ITSintfor2/ITSReverse, and ITS-DINO/ITS2Rev2) with regard to amplification specificity and sensitivity towards Symbiodinium, as well as sub-genera taxonomic bias. We tested these primers over a range of sample types including three coral species, coral surrounding water, reef surface water, and open ocean water to assess their suitability for use in large-scale next generation sequencing projects and to develop a standardised PCR protocol. We found the SYM_VAR_5.8S2/SYM_VAR_REV primers to perform superior to the other tested ITS2 primers. We therefore used this primer pair to develop a standardised PCR protocol. To do this, we tested the effect of PCR-to-PCR variation, annealing temperature, cycle number, and different polymerase systems on the PCR efficacy. The Symbiodinium ITS2 PCR protocol developed here delivers improved specificity and sensitivity towards Symbiodinium with apparent minimal sub-genera taxonomic bias across all sample types. In particular, the protocol’s ability to amplify Symbiodinium from a range of environmental sources will facilitate the study of Symbiodinium populations across biomes.

Effects of core instability strength training on trunk muscle strength, spinal mobility, dynamic balance and functional mobility in older adults.

Science.gov (United States)

Granacher, Urs; Lacroix, Andre; Muehlbauer, Thomas; Roettger, Katrin; Gollhofer, Albert

2013-01-01

Age-related postural misalignment, balance deficits and strength/power losses are associated with impaired functional mobility and an increased risk of falling in seniors. Core instability strength training (CIT) involves exercises that are challenging for both trunk muscles and postural control and may thus have the potential to induce benefits in trunk muscle strength, spinal mobility and balance performance. The objective was to investigate the effects of CIT on measures of trunk muscle strength, spinal mobility, dynamic balance and functional mobility in seniors. Thirty-two older adults were randomly assigned to an intervention group (INT; n = 16, aged 70.8 ± 4.1 years) that conducted a 9-week progressive CIT or to a control group (n = 16, aged 70.2 ± 4.5 years). Maximal isometric strength of the trunk flexors/extensors/lateral flexors (right, left)/rotators (right, left) as well as of spinal mobility in the sagittal and the coronal plane was measured before and after the intervention program. Dynamic balance (i.e. walking 10 m on an optoelectric walkway, the Functional Reach test) and functional mobility (Timed Up and Go test) were additionally tested. Program compliance was excellent with participants of the INT group completing 92% of the training sessions. Significant group × test interactions were found for the maximal isometric strength of the trunk flexors (34%, p training-related improvements were found for spinal mobility in the sagittal (11%, p velocity (9%, p velocity (31%, p training regimen could be used as an adjunct or even alternative to traditional balance and/or resistance training. Copyright © 2012 S. Karger AG, Basel.

Amplification of marine methanotrophic enrichment DNA with 16S rDNA PCR primers for type II alpha proteobacteria methanotrophs.

Science.gov (United States)

Rockne, Karl J; Strand, Stuart E

2003-09-01

Type II alpha proteobacteria methanotrophs are capable of a wide range of cometabolic transformations of chlorinated solvents and polycyclic aromatic hydrocarbons (PAHs), and this activity has been exploited in many terrestrial bioremediation systems. However, at present, all known obligately marine methanotrophic isolates are Type I gamma proteobacteria which do not have this activity to the extent of Type II methanotrophs. In previous work in our laboratory, determining the presence of Type II alpha proteobacteria methanotrophs in marine enrichment cultures that co-metabolized PAHs required a more sensitive assay. 16S rDNA PCR primers were designed based on oligonucleotide probes for serine pathway methanotrophs and serine pathway methylotrophs with an approximate amplification fragment size of 870 base pairs. Comparison of the primers using double primer BLAST searches in established nucleotide databases showed potential amplification with all Methylocystis and Methylosinus spp., as well as potential amplification with Methylocella palustrus. DNA from Methylosinus trichosporium OB3b, a Type II methanotroph, amplified with the primers with a fragment size of approximately 850 base pairs, whereas DNA extracted from Methylomonas methanica, a Type I methanotroph, did not. The primers were used to amplify DNA extracted from two marine methanotrophic enrichment cultures: a low nitrogen/low copper enrichment to select for Type II methanotrophs and a high nitrogen/high copper enrichment to select for Type I methanotrophs. Although DNA from both cultures amplified with the PCR primers, amplification was stronger in cultures that were specifically enriched for Type II methanotrophs, suggesting the presence of higher numbers of Type II methanotrophs. These results provide further evidence for the existence of Type II marine methanotrophs, suggesting the possibility of exploiting cometabolic activity in marine systems.

KULTUR PRIMER FIBROBLAS: PENELITIAN PENDAHULUAN

Directory of Open Access Journals (Sweden)

Yuli Kurniawati

2015-05-01

Full Text Available AbstrakKultur sel fibroblas banyak digunakan untuk penelitian proses penyembuhan luka dan penuaankulit. Metode ini digunakan untuk melihat perkembangan sel, proliferasi kinetik seluler, sertabiosintesis komponen matriks ekstraseluler. Penelitian pendahuluan ini dilakukan untuk optimasiteknik laboratorium serta berbagai kendala yang didapatkan saat kultur fibroblas. Kultur primerfibroblas dibagi menjadi 2 jenis sampel yaitu sampel yang berasal dari embrio mencit usia 7,5–9,5 hari, dan kulit pasien keloid. Sampel dari embrio mencit dilakukan kultur primer denganmetode dissociated fibroblast. Sampel jaringan keloid dan kulit normal dikultur dengan metodeskin explant. Fibroblas yang berasal dari kultur primer embrio mencit tumbuh baik sehinggadapat dilakukan subkultur dan disimpan di dalam nitrogen cair suhu -198°C. Fibroblas yangberasal dari sampel keloid pertama tumbuh sesuai pola pertumbuhan fibroblas, namun padasampel kedua terdapat kontaminasi Paecilomyces sp. yang merupakan salah satu jenis jamurkontaminan. Sel fibroblas mudah untuk dikultur karena memiliki kemampuan tumbuh danmelekat yang tinggi serta regenerasi cepat, namun penelitian lebih lanjut untuk optimasi teknikkultur dan pencegahan kontaminasi masih dibutuhkan sehingga sel dapat tumbuh baik.AbstractFibroblast cell culture method has been used for wound healing and skin aging studies. Thismethod was used for cell development imaging study, celullar kinetic proliferation andextracelullar matrix component biosynthesis. This preeliminary study was done for laboratoricaltechnic optimation as well as problems appeared in fibroblast culture. Fibroblasts primary culturewas divided into 2 type of samples, from 7.5-9.5-day-mice embryo and keloid-patient skin.Primary culture with dissociated fibroblast method was done for mice embryo sample. Keloidtissue sample and normal skin were cultured with skin explant method. Fibroblasts that weretaken from mice embryo primary culture grew well

Mobile Customer Relationship Management and Mobile Security

Science.gov (United States)

Sanayei, Ali; Mirzaei, Abas

The purpose of this study is twofold. First, in order to guarantee a coherent discussion about mobile customer relationship management (mCRM), this paper presents a conceptualization of mCRM delineating its unique characteristics because of Among the variety of mobile services, considerable attention has been devoted to mobile marketing and in particular to mobile customer relationship management services. Second, the authors discusses the security risks in mobile computing in different level(user, mobile device, wireless network,...) and finally we focus on enterprise mobile security and it's subgroups with a series of suggestion and solution for improve mobile computing security.

A Framework for (Tele-) Monitoring of the Rehabilitation Progress in Stroke Patients

Science.gov (United States)

David, V.; Haller, M.; Kotzian, S.; Hofmann, M.; Schlossarek, S.; Eichholzer, K.; Winkler, M.; Frohner, M.; Reichel, M.; Mayr, W.; Rafolt, D.

2015-01-01

Background Preservation of mobility in conjunction with an independent life style is one of the major goals of rehabilitation after stroke. Objectives The Rehab@Home framework shall support the continuation of rehabilitation at home. Methods The framework consists of instrumented insoles, connected wirelessly to a 3G ready tablet PC, a server, and a web-interface for medical experts. The rehabilitation progress is estimated via automated analysis of movement data from standardized assessment tests which are designed according to the needs of stroke patients and executed via the tablet PC application. Results The Rehab@Home framework’s implementation is finished and ready for the field trial (at five patients’ homes). Initial testing of the automated evaluation of the standardized mobility tests shows reproducible results. Conclusions Therefore it is assumed that the Rehab@Home framework is applicable as monitoring tool for the gait rehabilitation progress in stroke patients. PMID:26767068

Mobile Payments : Comparison of Mobile Wallet Concepts

OpenAIRE

Narayan, Srikant

2013-01-01

Mobile payments are an emerging trend and an alternative to traditional payment methods. Mobile payments involve the usage of the mobile phone to handle credit transfers during purchase of goods and peer to peer money transfers referred to as mobile wallet service, instead of depending on bank cards and cash. In this scenario, while the mobile wallet industry still being in its infancy there exist a few drivers of mobile wallet solutions aiming to create a de-facto standard in the mobile mark...

Primer Extension Mutagenesis Powered by Selective Rolling Circle Amplification

Science.gov (United States)

Huovinen, Tuomas; Brockmann, Eeva-Christine; Akter, Sultana; Perez-Gamarra, Susan; Ylä-Pelto, Jani; Liu, Yuan; Lamminmäki, Urpo

2012-01-01

Primer extension mutagenesis is a popular tool to create libraries for in vitro evolution experiments. Here we describe a further improvement of the method described by T.A. Kunkel using uracil-containing single-stranded DNA as the template for the primer extension by additional uracil-DNA glycosylase treatment and rolling circle amplification (RCA) steps. It is shown that removal of uracil bases from the template leads to selective amplification of the nascently synthesized circular DNA strand carrying the desired mutations by phi29 DNA polymerase. Selective RCA (sRCA) of the DNA heteroduplex formed in Kunkel's mutagenesis increases the mutagenesis efficiency from 50% close to 100% and the number of transformants 300-fold without notable diversity bias. We also observed that both the mutated and the wild-type DNA were present in at least one third of the cells transformed directly with Kunkel's heteroduplex. In contrast, the cells transformed with sRCA product contained only mutated DNA. In sRCA, the complex cell-based selection for the mutant strand is replaced with the more controllable enzyme-based selection and less DNA is needed for library creation. Construction of a gene library of ten billion members is demonstrated with the described method with 240 nanograms of DNA as starting material. PMID:22355397

Smart mobility in smart cities

Energy Technology Data Exchange (ETDEWEB)

Baucells, Aleta N.

2016-07-01

Cities are currently undergoing a transformation into the Smart concept, like Smartphones or SmartTV. Many initiatives are being developed in the framework of the Smart Cities projects, however, there is a lack of consistent indicators and methodologies to assess, finance, prioritize and implement this kind of projects. Smart Cities projects are classified according to six axes: Government, Mobility, Environment, Economy, People and Living. (Giffinger, 2007). The main objective of this research is to develop an evaluation model in relation to the mobility concept as one of the six axes of the Smart City classification and apply it to the Spanish cities. The evaluation was carried out in the 62 cities that made up in September 2015 the Spanish Network of Smart Cities (RECI- Red Española de Ciudades Inteligentes). This research is part of a larger project about Smart Cities’ evaluation (+CITIES), the project evaluates RECI’s cities in all the axes. The analysis was carried out taking into account sociodemographic indicators such as the size of the city or the municipal budget per inhabitant. The mobility’s evaluation in those cities has been focused in: sustainability mobility urban plans and measures to reduce the number of vehicles. The 62 cities from the RECI have been evaluated according to their degree of progress in several Smart Cities’ initiatives related to smart mobility. The applied methodology has been specifically made for this project. The grading scale has different ranks depending on the deployment level of smart cities’ initiatives. (Author)

Final Technical Progress Report Long term risk from actinides in the environment: Modes of mobility

International Nuclear Information System (INIS)

Kirchner, Thomas B.

2002-01-01

The key source of uncertainty in assessing actinide mobility is the relative importance of transport by: (1) wind erosion, (2) water erosion, and (3) vertical migration. Each of these three processes depends on several environmental factors and they compete with one another. A scientific assessment of the long-term risks associated with actinides in surface soils depends on better quantifying each of these three modes of mobility. The objective from our EMSP study was to quantify the mobility of soil actinides by wind erosion, water erosion, and vertical migration at three semiarid sites where actinide mobility is a key technical, social and legal issue. This EMSP project was the first to evaluate all three factors at a site. The approach has been to investigate both short- and long-term issues based on field and lab studies and model comparisons. Our results demonstrate the importance of incorporating threshold responses into a modeling framework that accounts for environmental factors and natural disturbances that trigger large changes in actinide mobility. The study measured erosional losses of sediment and fallout cesium (an actinide analogue) from field plots located near WIPP in 1998. The results highlight the large effect of burning as a disturbance on contaminant transport and mobility via runoff and erosion. The results show that runoff, erosion, and actinide transport are (1) strongly site specific-differences in radionuclide transport between WIPP and Rocky Flats differed by a factor of twelve because of soil and vegetation differences, and (2) are strongly impacted by disturbances such as fire, which can increase runoff, erosion, and actinide transport by more than an order of magnitude. In addition, a laboratory experiment using soil columns was conducted to investigate the vertical transport of contaminants in sandy soils. Nine columns of soil collected from the vicinity of the WIPP site were prepared. The column consisted of a piece of PVC pipe 20 cm

Final Technical Progress Report Long term risk from actinides in the environment: Modes of mobility

Energy Technology Data Exchange (ETDEWEB)

Thomas B. Kirchner

2002-03-22

The key source of uncertainty in assessing actinide mobility is the relative importance of transport by: (1) wind erosion, (2) water erosion, and (3) vertical migration. Each of these three processes depends on several environmental factors and they compete with one another. A scientific assessment of the long-term risks associated with actinides in surface soils depends on better quantifying each of these three modes of mobility. The objective from our EMSP study was to quantify the mobility of soil actinides by wind erosion, water erosion, and vertical migration at three semiarid sites where actinide mobility is a key technical, social and legal issue. This EMSP project was the first to evaluate all three factors at a site. The approach has been to investigate both short- and long-term issues based on field and lab studies and model comparisons. Our results demonstrate the importance of incorporating threshold responses into a modeling framework that accounts for environmental factors and natural disturbances that trigger large changes in actinide mobility. The study measured erosional losses of sediment and fallout cesium (an actinide analogue) from field plots located near WIPP in 1998. The results highlight the large effect of burning as a disturbance on contaminant transport and mobility via runoff and erosion. The results show that runoff, erosion, and actinide transport are (1) strongly site specific-differences in radionuclide transport between WIPP and Rocky Flats differed by a factor of twelve because of soil and vegetation differences, and (2) are strongly impacted by disturbances such as fire, which can increase runoff, erosion, and actinide transport by more than an order of magnitude. In addition, a laboratory experiment using soil columns was conducted to investigate the vertical transport of contaminants in sandy soils. Nine columns of soil collected from the vicinity of the WIPP site were prepared. The column consisted of a piece of PVC pipe 20 cm

Designing Polymerase Chain Reaction (PCR) Primer Multiplexes in the Forensic Laboratory

Science.gov (United States)

Elkins, Kelly M.

2011-01-01

The polymerase chain reaction (PCR) is a common experiment in upper-level undergraduate biochemistry, molecular biology, and forensic laboratory courses as reagents and thermocyclers have become more affordable for institutions. Typically, instructors design PCR primers to amplify the region of interest and the students prepare their samples for…

Mobile video with mobile IPv6

CERN Document Server

Minoli, Daniel

2012-01-01

Increased reliance on mobile devices and streaming of video content are two of the most recent changes that have led those in the video distribution industry to be concerned about the shifting or erosion of traditional advertising revenues. Infrastructure providers also need to position themselves to take advantage of these trends. Mobile Video with Mobile IPv6provides an overview of the current mobile landscape, then delves specifically into the capabilities and operational details of IPv6. The book also addresses 3G and 4G services, the application of Mobile IPv6 to streaming and other mobil

Modified Proofreading PCR for Detection of Point Mutations, Insertions and Deletions Using a ddNTP-Blocked Primer

Science.gov (United States)

Chen, Qianqian; Chen, Xiaoxiang; Zhang, Sichao; Lan, Ke; Lu, Jian; Zhang, Chiyu

2015-01-01

The development of simple, accurate, rapid and cost-effective technologies for mutation detection is crucial to the early diagnosis and prevention of numerous genetic diseases, pharmacogenetics, and drug resistance. Proofreading PCR (PR-PCR) was developed for mutation detection in 1998 but is rarely applied due to its low efficiency in allele discrimination. Here we developed a modified PR-PCR method using a ddNTP-blocked primer and a mixture of DNA polymerases with and without the 3'-5' proofreading function. The ddNTP-blocked primer exhibited the best blocking efficiency to avoid nonspecific primer extension while the mixture of a tiny amount of high-fidelity DNA polymerase with a routine amount of Taq DNA polymerase provided the best discrimination and amplification effects. The modified PR-PCR method is quite capable of detecting various mutation types, including point mutations and insertions/deletions (indels), and allows discrimination amplification when the mismatch is located within the last eight nucleotides from the 3'-end of the ddNTP-blocked primer. The modified PR-PCR has a sensitivity of 1-5 × 102 copies and a selectivity of 5 × 10-5 mutant among 107 copies of wild-type DNA. It showed a 100% accuracy rate in the detection of P72R germ-line mutation in the TP53 gene among 60 clinical blood samples, and a high potential to detect rifampin-resistant mutations at low frequency in Mycobacterium tuberculosis using an adaptor and a fusion-blocked primer. These results suggest that the modified PR-PCR technique is effective in detection of various mutations or polymorphisms as a simple, sensitive and promising approach. PMID:25915410

Nuclear Microsatellite Primers for the Endangered Relict Fir, Abies pinsapo (Pinaceae and Cross-Amplification in Related Mediterranean Species

Directory of Open Access Journals (Sweden)

Laura Navarro-Sampedro

2012-11-01

Full Text Available Twelve nuclear microsatellite primers (nSSR were developed for the endangered species Abies pinsapo Boiss. to enable the study of gene flow and genetic structure in the remaining distribution areas. Microsatellite primers were developed using next-generation sequencing (454 data from a single Abies pinsapo individual. Primers were applied to thirty individuals from the three extant localities. The number of alleles per locus ranged from one to four. Cross-amplification was tested for other Abies species from the Mediterranean Basin, and most of the loci showed higher polymorphisms in the Mediterranean species than in A. pinsapo. These microsatellite markers provide tools for conservation genetic studies in Abies pinsapo as well other Abies species from the Mediterranean Basin.

Designing universal primers for the isolation of DNA sequences encoding Proanthocyanidins biosynthetic enzymes in Crataegus aronia

Directory of Open Access Journals (Sweden)

Zuiter Afnan

2012-08-01

Full Text Available Abstract Background Hawthorn is the common name of all plant species in the genus Crataegus, which belongs to the Rosaceae family. Crataegus are considered useful medicinal plants because of their high content of proanthocyanidins (PAs and other related compounds. To improve PAs production in Crataegus tissues, the sequences of genes encoding PAs biosynthetic enzymes are required. Findings Different bioinformatics tools, including BLAST, multiple sequence alignment and alignment PCR analysis were used to design primers suitable for the amplification of DNA fragments from 10 candidate genes encoding enzymes involved in PAs biosynthesis in C. aronia. DNA sequencing results proved the utility of the designed primers. The primers were used successfully to amplify DNA fragments of different PAs biosynthesis genes in different Rosaceae plants. Conclusion To the best of our knowledge, this is the first use of the alignment PCR approach to isolate DNA sequences encoding PAs biosynthetic enzymes in Rosaceae plants.

Mobile phones affect multiple sperm quality traits: a meta-analysis [v1; ref status: indexed, http://f1000r.es/ny

Directory of Open Access Journals (Sweden)

Madhukar Shivajirao Dama

2013-02-01

Full Text Available As mobile phone usage is growing rapidly, there is a need for a comprehensive analysis of the literature to inform scientific debates about the adverse effects of mobile phone radiation on sperm quality traits. Therefore, we conducted a meta-analysis of the eligible published research studies on human males of reproductive age. Eleven studies were eligible for this analysis. Based on the meta-analysis, mobile phone use was significantly associated with deterioration in semen quality (Hedges’s g = -0.547; 95% CI: -0.713, -0.382; p < 0.001. The traits particularly affected adversely were sperm concentration, sperm morphology, sperm motility, proportion of non-progressive motile sperm (%, proportion of slow progressive motile sperm (%, and sperm viability. Direct exposure of spermatozoa to mobile phone radiation with in vitro study designs also significantly deteriorated the sperm quality (Hedges’s g = -2.233; 95% CI: -2.758, -1.708; p < 0.001, by reducing straight line velocity, fast progressive motility, Hypo-osmotic swelling (HOS test score, major axis (µm, minor axis (µm, total sperm motility, perimeter (µm, area (µm2, average path velocity, curvilinear velocity, motile spermatozoa, and  acrosome reacted spermatozoa (%. The strength of evidence for the different outcomes varied from very low to very high. The analysis shows that mobile phone use is possibly associated with a number of deleterious effects on the spermatozoa.

Content Delivery in Future Mobile Communication Networks

Science.gov (United States)

Jonas, Karl; Raber, Sergey

2003-07-01

With the fast progress in the deployment of wireless networks during the last few years, the global communication market requires the development of new methods for content delivery towards mobile users. It is currently characterised by the introduction of the 3rd generation of terrestrial mobile networks based on 3GPP's UMTS standard. It is expected that this will eventually lead to integrated all-IP-based infrastructures supporting a variety of radio access technologies (so-called beyond-3G-networks or 4th Generation networks). The integration of mobility support, security and accounting and provisioning of differentiated qualities of service are among the issues which are currently researched in the 4G framework.Since it is not possible to change network protocols and infrastructure at once in order to optimize them for mobile services, it is very important to find an appropriate way for the migration from the current infrastructure towards an integrated architecture, where fixed and mobile networks coexist and interoperate in the most effective and flexible way.The integration of satellite communication networks into the terrestrial mobile communication environment is the focus of R&D activities at the Competence Centre for Advanced Satellite Communication of the FhG FOKUS institute. These activities are presented in this article, with a focus on the CoDeSat Content Delivery over Satellite project.In the remainder of this article we first summarize services and service requirements as they are considered in our work. We then discuss the challenges derived from these requirements with respect to current network and protocol architectures. Finally, we describe our approach, and the current status of our prototype implementation.

Transient Heat Transfer Model for Car Body Primer Curing

OpenAIRE

D. Zabala; N. Sánchez; J. Pinto

2010-01-01

A transient heat transfer mathematical model for the prediction of temperature distribution in the car body during primer baking has been developed by considering the thermal radiation and convection in the furnace chamber and transient heat conduction governing equations in the car framework. The car cockpit is considered like a structure with six flat plates, four vertical plates representing the car doors and the rear and front panels. The other two flat plates are the...

Towards Indoor Transportation Mode Detection using Mobile Sensing

DEFF Research Database (Denmark)

Prentow, Thor Siiger; Blunck, Henrik; Kjærgaard, Mikkel Baun

2015-01-01

Transportation mode detection is a growing field of research, in which a variety of methods have been developed for detecting transportation modes foremost for outdoor travels. It has been employed in application areas such as public transportation, environmental footprint profiling, and context......-aware mobile assistants. For indoor travels the problem of transportation mode detection has received comparatively little attention, even though diverse transportation modes, such as biking, electric vehicles, and scooters, are used indoors, especially in large building complexes. The potential applications...... are diverse, may also extend beyond indoor variants of the above outdoor applications, and include, e.g., scheduling and progress tracking for mobile workers, management of vehicular resources, and navigation support. However, for indoor transportation mode detection, both the physical environment as well...

Hemorragias obstétricas en el primer y segundo trimestre del embarazo

OpenAIRE

García Rodríguez, Blanca

2013-01-01

Se aborda el tema de las hemorragias obstétricas en el primer y segundo trimestre del embarazo. Diagnóstico precoz de las mismas, la identificación de factores de riesgo, las causas y el tratamiento terapéutico

Forced selection of a human immunodeficiency virus type 1 variant that uses a non-self tRNA primer for reverse transcription: Involvement of viral RNA sequences and the reverse transcriptase enzyme

NARCIS (Netherlands)

Abbink, Truus E. M.; Beerens, Nancy; Berkhout, Ben

2004-01-01

Human immunodeficiency virus type 1 uses the tRNA(3)(Lys) molecule as a selective primer for reverse transcription. This primer specificity is imposed by sequence complementarity between the tRNA primer and two motifs in the viral RNA genome: the primer-binding site (PBS) and the primer activation

Influence of power density and primer application on polymerization of dual-cured resin cements monitored by ultrasonic measurement.

Science.gov (United States)

Takubo, Chikako; Yasuda, Genta; Murayama, Ryosuke; Ogura, Yukari; Tonegawa, Motoka; Kurokawa, Hiroyasu; Miyazaki, Masashi

2010-08-01

We used ultrasonic measurements to monitor the influence of power density and primer application on the polymerization reaction of dual-cured resin cements. The ultrasonic equipment comprised a pulser-receiver, transducers, and an oscilloscope. Resin cements were mixed and inserted into a transparent mould, and specimens were placed on the sample stage, onto which the primer, if used, was also applied. Power densities of 0 (no irradiation), 200, or 600 mW cm(-2) were used for curing. The transit time through the cement disk was divided by the specimen thickness to obtain the longitudinal sound velocity. When resin cements were light-irradiated, each curve displayed an initial plateau of approximately 1,500 m s(-1), which rapidly increased to a second plateau of 2,300-2,900 m s(-1). The rate of sound velocity increase was retarded when the cements were light-irradiated at lower power densities, and increased when the primer was applied. The polymerization behaviour of dual-cured resin cements was therefore shown to be affected by the power density of the curing unit and the application of self-etching primer. (c) 2010 The Authors. Journal compilation (c) 2010 Eur J Oral Sci.

Mobile phones and mobile communication

DEFF Research Database (Denmark)

Ling, Richard; Donner, Jonathan

With staggering swiftness, the mobile phone has become a fixture of daily life in almost every society on earth. In 2007, the world had over 3 billion mobile subscriptions. Prosperous nations boast of having more subscriptions than people. In the developing world, hundreds of millions of people who...... could never afford a landline telephone now have a mobile number of their own. With a mobile in our hand many of us feel safer, more productive, and more connected to loved ones, but perhaps also more distracted and less involved with things happening immediately around us. Written by two leading...... researchers in the field, this volume presents an overview of the mobile telephone as a social and cultural phenomenon. Research is summarized and made accessible though detailed descriptions of ten mobile users from around the world. These illustrate popular debates, as well as deeper social forces at work...

Evaluation of shear bond strength of metal bracket to enamel after application of primers over bracket base-an in vitro study

Directory of Open Access Journals (Sweden)

Firuzbakht MM

2011-04-01

Full Text Available "nBackground and Aims: The aim of this study was to evaluate the effect of application of two types of primers over bracket bases on the shear bond strength (SBS and mode of bond failure."nMaterials and Methods: In this study, 75 human premolar teeth were divided into three equal groups. In group 1 (control, after surface preparation of enamel by conventional method (acid etching+primer brackets were bonded with Transbond XT composite. In group 2 (TX, brackets were bonded to enamel same as the first group but Transbond XT primer were used on bracket bases before placement of composite. In group 3 (PL, Transbond plus primer was applied on bracket bases before placement of composite. After 24 h, the SBS test was performed by universal testing machine at crosshead speed of 0.5 mm/min. Then, adhesive remnant index (ARI scores and percentage of cohesive fracture were determined using stereomicroscopy. SBS data were analyzed by one-way ANOVA and Duncan tests. Kruskal-Wallis and Mann-Whitney tests were used to analyze ARI and cohesive fracture results."nResults: There was significant difference in SBS values among the groups (P<0.001. The highest SBS was shown in TX group and the lowest was seen in PL group. There was no significant difference between control and TX groups in ARI scores (P=0.199. No significant difference was found in cohesive fracture values between the groups (P=0.093. Both the control and TX groups showed significant difference in ARI scores and cohesive fracture compared with the PL group in all of the comparisons (P<0.001."nConclusion: Application of Transbond XT primer over bracket base affects the bond strength and failure mode. Transbond XT primer increased the bond strength but Transbond plus primer decreased it.

A finite element primer for beginners the basics

CERN Document Server

Zohdi, Tarek I

2014-01-01

The purpose of this primer is to provide the basics of the Finite Element Method, primarily illustrated through a classical model problem, linearized elasticity. The topics covered are:(1) Weighted residual methods and Galerkin approximations,(2) A model problem for one-dimensional?linear elastostatics,(3) Weak formulations in one dimension,(4) Minimum principles in one dimension,(5) Error estimation in one dimension,(5) Construction of Finite Element basis functions in one dimension,(6) Gaussian Quadrature,(7) Iterative solvers and element by element data structures,(8) A model problem for th

Transport phenomena in Newtonian fluids a concise primer

CERN Document Server

Olsson, Per

2013-01-01

This short primer provides a concise and tutorial-style introduction to transport phenomena in Newtonian fluids , in particular the transport of mass, energy and momentum.  The reader will find detailed derivations of the transport equations for these phenomena, as well as selected analytical solutions to the transport equations in some simple geometries. After a brief introduction to the basic mathematics used in the text, Chapter 2, which deals with momentum transport, presents a derivation of the Navier-Stokes-Duhem equation describing the basic flow in a Newtonian fluid.  Also provided at

Next-Generation DNA Sequencing of VH/VL Repertoires: A Primer and Guide to Applications in Single-Domain Antibody Discovery.

Science.gov (United States)

Henry, Kevin A

2018-01-01

Immunogenetic analyses of expressed antibody repertoires are becoming increasingly common experimental investigations and are critical to furthering our understanding of autoimmunity, infectious disease, and cancer. Next-generation DNA sequencing (NGS) technologies have now made it possible to interrogate antibody repertoires to unprecedented depths, typically by sequencing of cDNAs encoding immunoglobulin variable domains. In this chapter, we describe simple, fast, and reliable methods for producing and sequencing multiplex PCR amplicons derived from the variable regions (V H , V H H or V L ) of rearranged immunoglobulin heavy and light chain genes using the Illumina MiSeq platform. We include complete protocols and primer sets for amplicon sequencing of V H /V H H/V L repertoires directly from human, mouse, and llama lymphocytes as well as from phage-displayed V H /V H H/V L libraries; these can be easily be adapted to other types of amplicons with little modification. The resulting amplicons are diverse and representative, even using as few as 10 3 input B cells, and their generation is relatively inexpensive, requiring no special equipment and only a limited set of primers. In the absence of heavy-light chain pairing, single-domain antibodies are uniquely amenable to NGS analyses. We present a number of applications of NGS technology useful in discovery of single-domain antibodies from phage display libraries, including: (i) assessment of library functionality; (ii) confirmation of desired library randomization; (iii) estimation of library diversity; and (iv) monitoring the progress of panning experiments. While the case studies presented here are of phage-displayed single-domain antibody libraries, the principles extend to other types of in vitro display libraries.

Laboratory experiments in mobile robot navigation

International Nuclear Information System (INIS)

Kar, Asim; Pal, Prabir K.

1997-01-01

Mobile robots have potential applications in remote surveillance and operation in hazardous areas. To be effective, they must have the ability to navigate on their own to desired locations. Several experimental navigational runs of a mobile robot developed have been conducted. The robot has three wheels of which the front wheel is steered and the hind wheels are driven. The robot is equipped with an ultrasonic range sensor, which is turned around to get range data in all directions. The range data is fed to the input of a neural net, whose output steers the robot towards the goal. The robot is powered by batteries (12V 10Ah). It has an onboard stepper motor controller for driving the wheels and the ultrasonic setup. It also has an onboard computer which runs the navigation program NAV. This program sends the range data and configuration parameters to the operator''s console program OCP, running on a stationary PC, through radio communication on a serial line. Through OCP, an operator can monitor the progress of the robot from a distant control room and intervene if necessary. In this paper the control modules of the mobile robot, its ways of operation and also results of some of the experimental runs recorded are reported. It is seen that the trained net guides the mobile robot through gaps of 1m and above to its destination with about 84% success measured over a small sample of 38 runs

An evaluation of corrosion protection by two epoxy primers on 2219-T87 and 7075-T73 aluminum

Science.gov (United States)

Mendrek, M. J.

1992-01-01

A comparison of the corrosion protection provided by two amine epoxy primers was made using salt fog, alternate immersion, and total immersion as exposure media. The study is the result of a request to use an unqualified low volatile organic carbon (VOC) primer (AKZO 463-6-78) in place of the current primer (AKZO 463-6-3) because environmental regulations have eliminated use of the current primer in many states. Primed, scribed samples of 2219-T87 and 7075-T73 aluminum were exposed to 5-percent NaCl salt fog and 3.5-percent NaCl alternate immersion for a period of 90 days. In addition, electrode samples immersed in 3.5-percent NaCl were tested using electrochemical impedance spectroscopy (EIS). The EG&G model 368 ac impedance measurement system was used to monitor changing properties of AKZO 463-6-78 and AKZO 463-6-3 primed 2219-T87 aluminum for a period of 30 days. The response of the corroding system of a frequency scan can be modeled in terms of an equivalent circuit consisting of resistors and capacitors in a specific arrangement. Each resistor/capacitor combination represents physical processes taking place within the electrolyte, at the electrolyte/primer surface, within the coating, and at the coating/substrate surface. Values for the resistors and capacitors are assigned following a nonlinear least squares fit of the data to the equivalent circuit. Changes in the values of equivalent circuit parameters during the 30-day exposure allow assessment of the time to and mechanism of coating breakdown.

Mobile social phonebooks - Mobile phone user perceptions and practical implications for mobile operators

OpenAIRE

Karikoski, Juuso; Mäkinen, Olli

2012-01-01

Julkaisun kokoteksti on luettavissa vain Aalto-tunnuksilla. Please note that access to the fulltext is limited to Aalto staff and students. We introduce a term called mobile social phonebook, which refers to the integration of traditional mobile phone contacts with contacts from mobile Internet communication services that is happening in the mobile device’s phonebook. First, mobile phone user perceptions towards mobile social phonebooks are studied by means of semi-structured interviews...

Detection of Vibrio harveyi using hemolysin primer in tiger shrimp Penaeus monodon

Directory of Open Access Journals (Sweden)

Irma Suriyani

2015-05-01

Full Text Available ABSTRACT This study was aimed to analyze the sensitivity and ability of primer hemolysin in detecting pathogenetic Vibrio on tiger shrimp post-larvae (PL exposed under different exposure times in media inoculated with Vibrio harveyi. The PL of tiger shrimp were infected with 106 cfu/mL of V. harveyi by immersion method for three, six, 12, 24, 48 and 72 hours. The presence of hemolisin genes was detected by PCR techniques. The electrophoresis detected narrow hemolysin genes after PL were exposed for three and six hours. Clear visible bands of DNA Vibrio were observed for 12 hours of exposure. In contrast, no detected hemolysin gene of Vibrio was observed for PL exposed within 24, 48, and 72 hours. The rapid detection on Vibrio pathogenic for tiger shrimp PL should be conducted within three to 12 hours of exposure. No recommendation in utilizing this rapid detection for tiger shrimp PL exposed beyond 12 hours of V. harveyi. Keywords: specific primer, luminous Vibrio bacteria, pathogenic, PCR method, hemolysin gene  ABSTRAK Penelitian ini bertujuan untuk mengetahui kemampuan atau sensitivitas primer hemolisin dalam mendeteksi Vibrio patogen dengan lama pemaparan berbeda. Penelitian ini dilakukan dengan menginfeksikan Vibrio harveyi pada benur udang dengan metode perendaman pada konsentrasi 106 cfu/mL. Pengambilan sampel dilakukan pada waktu tiga, enam, 12, 24, 48, dan 72 jam pascainfeksi. Keberadaan gen hemolisin pada bakteri V. harveyi dideteksi menggunakan teknik polymerase chain reaction (PCR. Hasil elektroforesis memperlihatkan bahwa pada pemaparan tiga dan enam jam keberadaan gen hemolisin dari bakteri Vibrio patogen yang diinfeksikan sudah dapat terdeteksi pada benur walaupun masih terlihat tipis. Pada pemaparan 12 jam terlihat sangat jelas pita-pita DNA dari bakteri patogen. Sedangkan pada pemaparan 24, 48, dan 72 jam sudah tidak terdeteksi lagi gen hemolisin dari bakteri Vibrio. Hal ini diduga disebabkan terjadinya penurunan populasi

33 CFR 165.835 - Security Zone; Port of Mobile, Mobile Ship Channel, Mobile, AL.

Science.gov (United States)

2010-07-01

... 33 Navigation and Navigable Waters 2 2010-07-01 2010-07-01 false Security Zone; Port of Mobile, Mobile Ship Channel, Mobile, AL. 165.835 Section 165.835 Navigation and Navigable Waters COAST GUARD... § 165.835 Security Zone; Port of Mobile, Mobile Ship Channel, Mobile, AL. (a) Definition. As used in...

Specific and sensitive primers for the detection of predated olive fruit flies, Bactrocera oleae (Diptera: Tephritidae)

International Nuclear Information System (INIS)

Lantero, E.; Matallanas, B.; Ochando, M.D.; Pascual, S.; Callejas, C.

2017-01-01

Bactrocera oleae, the olive fruit fly, is a major pest of olive (Olea europaea L.) trees worldwide. Its presence can cause important losses, with consequences for the economies of countries that produce and export table olives and olive oil. Efforts to control olive fruit fly populations have, however, been insufficient. Now more than ever, environmentally friendly alternatives need to be considered in potential control programs. Generalist predators could provide a way of managing this pest naturally. However, the identification of candidate predator species is essential if such a management system is to be introduced. The present paper describes a set of species-specific primers for detecting the presence of B. oleae DNA in the gut of predatory arthropods. All primers were tested for checking cross-reactive amplification of other fruit fly DNA and evaluated in heterospecific mixes of nucleic acids. All were found to be very sensitive for B. oleae. Subsequent feeding trials were conducted using one of the most abundant species of ground dwelling carabids in olive groves in south-eastern Madrid, Spain. These trials allowed determining that 253F-334R and 334F-253R primer pairs had the highest detection efficiency with an ID50 of around 78 h. These primers therefore provide a very useful tool for screening the gut contents of potential predators of B. oleae, and can thus reveal candidate species for the pest's biological control.

Specific and sensitive primers for the detection of predated olive fruit flies, Bactrocera oleae (Diptera: Tephritidae

Directory of Open Access Journals (Sweden)

Esther Lantero

2017-07-01

Full Text Available Bactrocera oleae, the olive fruit fly, is a major pest of olive (Olea europaea L. trees worldwide. Its presence can cause important losses, with consequences for the economies of countries that produce and export table olives and olive oil. Efforts to control olive fruit fly populations have, however, been insufficient. Now more than ever, environmentally friendly alternatives need to be considered in potential control programs. Generalist predators could provide a way of managing this pest naturally. However, the identification of candidate predator species is essential if such a management system is to be introduced. The present paper describes a set of species-specific primers for detecting the presence of B. oleae DNA in the gut of predatory arthropods. All primers were tested for checking cross-reactive amplification of other fruit fly DNA and evaluated in heterospecific mixes of nucleic acids. All were found to be very sensitive for B. oleae. Subsequent feeding trials were conducted using one of the most abundant species of ground dwelling carabids in olive groves in south-eastern Madrid, Spain. These trials allowed determining that 253F-334R and 334F-253R primer pairs had the highest detection efficiency with an ID50 of around 78 h. These primers therefore provide a very useful tool for screening the gut contents of potential predators of B. oleae, and can thus reveal candidate species for the pest's biological control

Specific and sensitive primers for the detection of predated olive fruit flies, Bactrocera oleae (Diptera: Tephritidae)

Energy Technology Data Exchange (ETDEWEB)

Lantero, E.; Matallanas, B.; Ochando, M.D.; Pascual, S.; Callejas, C.

2017-07-01

Bactrocera oleae, the olive fruit fly, is a major pest of olive (Olea europaea L.) trees worldwide. Its presence can cause important losses, with consequences for the economies of countries that produce and export table olives and olive oil. Efforts to control olive fruit fly populations have, however, been insufficient. Now more than ever, environmentally friendly alternatives need to be considered in potential control programs. Generalist predators could provide a way of managing this pest naturally. However, the identification of candidate predator species is essential if such a management system is to be introduced. The present paper describes a set of species-specific primers for detecting the presence of B. oleae DNA in the gut of predatory arthropods. All primers were tested for checking cross-reactive amplification of other fruit fly DNA and evaluated in heterospecific mixes of nucleic acids. All were found to be very sensitive for B. oleae. Subsequent feeding trials were conducted using one of the most abundant species of ground dwelling carabids in olive groves in south-eastern Madrid, Spain. These trials allowed determining that 253F-334R and 334F-253R primer pairs had the highest detection efficiency with an ID50 of around 78 h. These primers therefore provide a very useful tool for screening the gut contents of potential predators of B. oleae, and can thus reveal candidate species for the pest's biological control.

Thinking in systems a primer

CERN Document Server

Meadows, Donella H

2008-01-01

In the years following her role as the lead author of the international bestseller, "Limits to Growth"-the first book to show the consequences of unchecked growth on a finite planet- Donella Meadows remained a pioneer of environmental and social analysis until her untimely death in 2001. Meadows' newly released manuscript, "Thinking in Systems", is a concise and crucial book offering insight for problem solving on scales ranging from the personal to the global. Edited by the Sustainability Institute's Diana Wright, this essential primer brings systems thinking out of the realm of computers and equations and into the tangible world, showing readers how to develop the systems-thinking skills that thought leaders across the globe consider critical for 21st-century life. Some of the biggest problems facing the world-war, hunger, poverty, and environmental degradation-are essentially system failures. They cannot be solved by fixing one piece in isolation from the others, because even seemingly minor details have e...

How Big Data Fast Tracked Human Mobility Research and the Lessons for Animal Movement Ecology

KAUST Repository

Thums, Michele; Ferná ndez-Gracia, Juan; Sequeira, Ana M. M.; Eguí luz, Ví ctor M.; Duarte, Carlos M.; Meekan, Mark G.

2018-01-01

The rise of the internet coupled with technological innovations such as smartphones have generated massive volumes of geo-referenced data (big data) on human mobility. This has allowed the number of studies of human mobility to rapidly overtake those of animal movement. Today, telemetry studies of animals are also approaching big data status. Here, we review recent advances in studies of human mobility and identify the opportunities they present for advancing our understanding of animal movement. We describe key analytical techniques, potential bottlenecks and a roadmap for progress toward a synthesis of movement patterns of wild animals.

How Big Data Fast Tracked Human Mobility Research and the Lessons for Animal Movement Ecology

Directory of Open Access Journals (Sweden)

Michele Thums

2018-02-01

Full Text Available The rise of the internet coupled with technological innovations such as smartphones have generated massive volumes of geo-referenced data (big data on human mobility. This has allowed the number of studies of human mobility to rapidly overtake those of animal movement. Today, telemetry studies of animals are also approaching big data status. Here, we review recent advances in studies of human mobility and identify the opportunities they present for advancing our understanding of animal movement. We describe key analytical techniques, potential bottlenecks and a roadmap for progress toward a synthesis of movement patterns of wild animals.

How Big Data Fast Tracked Human Mobility Research and the Lessons for Animal Movement Ecology

KAUST Repository

Thums, Michele

2018-02-13

The rise of the internet coupled with technological innovations such as smartphones have generated massive volumes of geo-referenced data (big data) on human mobility. This has allowed the number of studies of human mobility to rapidly overtake those of animal movement. Today, telemetry studies of animals are also approaching big data status. Here, we review recent advances in studies of human mobility and identify the opportunities they present for advancing our understanding of animal movement. We describe key analytical techniques, potential bottlenecks and a roadmap for progress toward a synthesis of movement patterns of wild animals.

Peran Keluarga dalam Pengelolaan Kasus di Layanan Primer Melalui Five Family Oriented Questions

Directory of Open Access Journals (Sweden)

Retno Asti Werdhani

2017-04-01

Full Text Available Pengelolaan kasus di layanan primer dengan pendekatan kedokteran keluarga memperhatikan potensi keluarga sebagai sumber daya pendukung dan atau penghambat keberhasilan penatalaksanaan pasien. Penelitian ini bertujuan untuk melihat gambaran kasus di layanan primer dan persepsi keluarga mengenai pasien melalui five family oriented question (FFOQ. Pengambilan data dilakukan menggunakan kuesioner pada 162 pasien Puskesmas dan Klinik di DKI Jakarta pada tahun 2015–2016. Kuesioner terdiri atas karakteristik pasien dan 5 pertanyaan terbuka FFOQ. Analisis dilakukan secara kuantitatif dan kualitatif. Hasilnya menunjukkan sebagian besar kasus di layanan primer adalah penyakit non-infeksi (82,7% dengan proporsi usia terbanyak adalah >40 tahun (76,5%. Persepsi pasien dan keluarga tentang penyebab penyakit dan cara mengatasinya masih bervariasi. Orang tua, pasangan, dan anak merupakan anggota keluarga yang paling menguatirkan kondisi pasien. Sebanyak 71,6% responden merasa ada stresor dalam keluarganya. Sumber stresor bervariasi antara lain sosial ekonomi, keluarga, pekerjaan, dan diri sendiri. Dukungan kepada pasien berupa dukungan emosional dan finansial yang diberikan oleh anggota keluarga sesuai kemampuan masing-masing. Disimpulkan keluarga berperan sebagai faktor pendukung dan penghambat dalam pengelolaan kasus di layanan primer untuk menunjang pengelolaan lebih berorientasi kepada pasien dan keluarga. Kata Kunci: five family oriented question, keluarga, layanan primer     Family Acts in Cases Management In Primary Care through The Five Family Oriented Question   Abstract Family oriented in primary care sees family as supporting resources/inhibiting case management accomplishment. The aim of this study was describing cases in primary care and family perception of the patient through the five family oriented question (FFOQ. Interviews were conducted in 162 patients from public health centers and clinics in DKI Jakarta year 2015–2016. Data were

Mobile Semiotics - signs and mobilities

DEFF Research Database (Denmark)

Jensen, Ole B.

a potential for mobilities studies if the awareness of seeing the environment as a semiotic layer and system can be sensitized to the insights of the ‘mobilities turn’. Empirically the paper tentatively explores the usefulness of a mobile semiotics approach to cases such as street signage, airport design...

Informal learning with mobile devices

DEFF Research Database (Denmark)

Berth, Mette

an analysis of my data I will centre my discussion around the value of this informal approach for learning purposes and discuss what kind of reflective competencies come into play here (Nesta Futurelab 2004a, 2004b). The theoretical framework for this article also draws on social learning theory (Lave......The paper describes the progression of a learning experiment with high school students producing moblogs (mobile weblogs) outside of the school environment and focuses especially on the reflective aspects of the moblogs as an expression of the reflective practicum (Schön 1987, DESECO 2003). Through...

Evaluation of the shear bond strength of lingual brackets manufactured by three different processes using two different adhesive primers: An in vitro study

Directory of Open Access Journals (Sweden)

Shrinivas Ashtekar

2016-01-01

Full Text Available Objective: To compare and evaluate the shear bond strength (SBS of lingual brackets, manufactured by three different processes, that is, laser sintering, milling, and casting, bonded with two different adhesive primers. Materials and Methods: One hundred and twenty premolars were selected, and three types of lingual brackets were used, namely, STB (milling, 7th Generation (casting, and lingualmatrix (laser sintering. Forty brackets per system were used half of which were sandblasted while the other half were used as available. Further, these were subdivided and bonded with Transbond XT primer and adhesive and 3M ESPE Primer and Transbond XT adhesive. Customization of STB and 7th Generation was done by Torque Angulation Reference Guide, Lingualmatrix had bases customized by Computer-aided design/computer-aided manufacturing. SBS was tested with universal testing machine and evaluated for adhesive remnant index (ARI. Results: Statistical analysis showed that surface treatment, use of different primers, method of customization influenced the SBS, and ARI suggested that the fracture occurred between composite and bracket interface. Conclusion: Lingualmatrix bracket showed greater SBS as compared to STB and 7th Generation, sandblasting increased SBS. 3M ESPE primer group showed increased SBS as that bonded with Transbond XT primer. The fracture was between the composite bracket interface.

A Mobile Augmented Reality Emulator for Android

Directory of Open Access Journals (Sweden)

Donald Munro

2017-07-01

Full Text Available Augmented Reality (AR provides a fusion of the real and virtual worlds by superimposing virtual objects on real world scenery. The implementation of AR on mobile devices is known as Mobile Augmented Reality (MAR. MAR is in its infancy and MAR development software is in the process of maturing. Dating back to the origin of Computer Science as an independent field, software development tools have been an integral part of the process of software creation. MAR, being a relatively new technology, is still lacking such related software development tools. With the rapid progression of mobile devices, the development of MAR applications fusing advanced Computer Vision techniques with mobile device sensors have become increasingly feasible. However, testing and debugging of MAR applications present a new challenge in that they require the developer be at the location that is being augmented at some point during the development process. In this research study, a MAR recorder application was developed as well as emulation class libraries for Android devices that allows the recording and off-site playback of video, location and motion sensor data. The research objective was to provide a software emulator which provides debugging, testing and prototyping capabilities for a MAR application including the ability to emulate the combination of computer vision with locational and motion sensors using previously recorded data. The emulator was evaluated using different mobile technologies. The results indicate that this research could assist developers of MAR applications to implement applications more rapidly, without being at the location.

Towards a global antibiotic resistance surveillance system : a primer for a roadmap

NARCIS (Netherlands)

Grundmann, Hajo

The need for global data about the scale of antibiotic resistance (ABR) in a geographical explicit and timely manner has been identified by many stakeholders, including the World Health Organization. This primer should help defining the objectives, scale, scope, and structure of possible future

Primer Vector Optimization: Survey of Theory, new Analysis and Applications

Science.gov (United States)

Guzman

This paper presents a preliminary study in developing a set of optimization tools for orbit rendezvous, transfer and station keeping. This work is part of a large scale effort undergoing at NASA Goddard Space Flight Center and a.i. solutions, Inc. to build generic methods, which will enable missions with tight fuel budgets. Since no single optimization technique can solve efficiently all existing problems, a library of tools where the user could pick the method most suited for the particular mission is envisioned. The first trajectory optimization technique explored is Lawden's primer vector theory [Ref. 1]. Primer vector theory can be considered as a byproduct of applying Calculus of Variations (COV) techniques to the problem of minimizing the fuel usage of impulsive trajectories. For an n-impulse trajectory, it involves the solution of n-1 two-point boundary value problems. In this paper, we look at some of the different formulations of the primer vector (dependent on the frame employed and on the force model). Also, the applicability of primer vector theory is examined in effort to understand when and why the theory can fail. Specifically, since COV is based on "small variations", singularities in the linearized (variational) equations of motion along the arcs must be taken into account. These singularities are a recurring problem in analyzes that employ "small variations" [Refs. 2, 3]. For example, singularities in the (2-body problem) variational equations along elliptic arcs occur when [Ref. 4], 1) the difference between the initial and final times is a multiple of the reference orbit period, 2) the difference between the initial and final true anomalies are given by k, for k= 0, 1, 2, 3,..., note that this cover the 3) the time of flight is a minimum for the given difference in true anomaly. For the N-body problem, the situation is more complex and is still under investigation. Several examples, such as the initialization of an orbit (ascent trajectory) and

Triazole-linked DNA as a primer surrogate in the synthesis of first-strand cDNA.

Science.gov (United States)

Fujino, Tomoko; Yasumoto, Ken-ichi; Yamazaki, Naomi; Hasome, Ai; Sogawa, Kazuhiro; Isobe, Hiroyuki

2011-11-04

A phosphate-eliminated nonnatural oligonucleotide serves as a primer surrogate in reverse transcription reaction of mRNA. Despite of the nonnatural triazole linkages in the surrogate, the reverse transcriptase effectively elongated cDNA sequences on the 3'-downstream of the primer by transcription of the complementary sequence of mRNA. A structure-activity comparison with the reference natural oligonucleotides shows the superior priming activity of the surrogate containing triazole-linkages. The nonnatural linkages also protect the transcribed cDNA from digestion reactions with 5'-exonuclease and enable us to remove noise transcripts of unknown origins. Copyright © 2011 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

Teachers' Attitudes toward the Usage of Mobile Devices in EFL Classroom

Science.gov (United States)

Dogan, Ali; Akbarov, Azamat

2016-01-01

Nowadays, technology is developing in a geometrically progressive manner. Its usage in different social areas is an imperative, rather than a choice. As expected, digital devices are applicable in the educational context, as well. Hence, the scope of the present study is to examine attitudes toward mobile learning among English teachers. For this…

A primer on polymer nomenclature: Structure-based, sourced-based and trade names

Science.gov (United States)

Polymer nomenclature is important because it is part of the language of polymer science and is needed for polymer identification, reference, and documentation. A primer on polymer nomenclature is provided herein for people new to the field or for instructional use. Both structure-based and source-...

Primer registro de Serratospiculum tendo (Nematoda: Diplotriaenidae para el Perú

Directory of Open Access Journals (Sweden)

Luis A. Gomez-Puerta

2014-05-01

Full Text Available Reportamos por primera vez la presencia del nematodo, Serratospiculum tendo Nitzsch, 1819, parasitando los sacos aéreos de un halcón peregrino (Falco peregrinus Tunstall, 1771. Seis nematodos (2 machos y 4 hembras fueron colectados e identificados como S. tendo. El hallazgo de este nematodo constituye el primer registro en el Perú.

PRIMER REGISTRO DEL FLEBOTOMÍNEO BRUMPTOMYIA PINTOI (DIPTERA: PSYCHODIDAE) EN COLOMBIA

OpenAIRE

BEJARANO EDUAR ELÍAS; DUQUE PATRICIA; VÉLEZ IVÁN DARÍO

2004-01-01

Durante un estudio entomológico de la leishmaniosis realizado en La Macarena,Departamento del Meta, Colombia, se colectó un espécimen macho de Brumptomyiapintoi, el cual constituye el primer registro de la especie para el país. Este flebotomíneofue capturado con un aspirador bucal mientras reposaba en el interior de una cuevade armadillo.

A new set of validated SSR primers for application in mulberry ...

Indian Academy of Sciences (India)

user

2018-01-11

Jan 11, 2018 ... We chose 37 genomic sequences that had high number of di, tri and tetra SSR motifs from ... primers failed to produce any amplification products and ... Sericulture is a cottage industry that employs 8.03 million people across ... The resolving power of the SSR markers ranged from 0.11 (MulSatG100717) to.

Fostering learners' interaction with content: A learner-centered mobile device interface

Science.gov (United States)

Abdous, M.

2015-12-01

With the ever-increasing omnipresence of mobile devices in student life, leveraging smart devices to foster students' interaction with course content is critical. Following a learner-centered design iterative approach, we designed a mobile interface that may enable learners to access and interact with online course content efficiently and intuitively. Our design process leveraged recent technologies, such as bootstrap, Google's Material Design, HTML5, and JavaScript to design an intuitive, efficient, and portable mobile interface with a variety of built-in features, including context sensitive bookmarking, searching, progress tracking, captioning, and transcript display. The mobile interface also offers students the ability to ask context-related questions and to complete self-checks as they watch audio/video presentations. Our design process involved ongoing iterative feedback from learners, allowing us to refine and tweak the interface to provide learners with a unified experience across platforms and devices. The innovative combination of technologies built around well-structured and well-designed content seems to provide an effective learning experience to mobile learners. Early feedback indicates a high level of satisfaction with the interface's efficiency, intuitiveness, and robustness from both students and faculty.

Modified Primers for the Identification of Nonpathogenic Fusarium oxysporum Isolates That Have Biological Control Potential against Fusarium Wilt of Cucumber in Taiwan

Science.gov (United States)

Wang, Chaojen; Lin, Yisheng; Lin, Yinghong; Chung, Wenhsin

2013-01-01

Previous investigations demonstrated that Fusarium oxysporum (Fo), which is not pathogenic to cucumbers, could serve as a biological control agent for managing Fusarium wilt of cucumber caused by Fo f. sp. cucumerinum (Foc) in Taiwan. However, thus far it has not been possible to separate the populations of pathogenic Fo from the nonpathogenic isolates that have biological control potential through their morphological characteristics. Although these two populations can be distinguished from one another using a bioassay, the work is laborious and time-consuming. In this study, a fragment of the intergenic spacer (IGS) region of ribosomal DNA from an Fo biological control agent, Fo366, was PCR-amplified with published general primers, FIGS11/FIGS12 and sequenced. A new primer, NPIGS-R, which was designed based on the IGS sequence, was paired with the FIGS11 primer. These primers were then evaluated for their specificity to amplify DNA from nonpathogenic Fo isolates that have biological control potential. The results showed that the modified primer pair, FIGS11/NPIGS-R, amplified a 500-bp DNA fragment from five of seven nonpathogenic Fo isolates. These five Fo isolates delayed symptom development of cucumber Fusarium wilt in greenhouse bioassay tests. Seventy-seven Fo isolates were obtained from the soil and plant tissues and then subjected to amplification using the modified primer pair; six samples showed positive amplification. These six isolates did not cause symptoms on cucumber seedlings when grown in peat moss infested with the isolates and delayed disease development when the same plants were subsequently inoculated with a virulent isolate of Foc. Therefore, the modified primer pair may prove useful for the identification of Fo isolates that are nonpathogenic to cucumber which can potentially act as biocontrol agents for Fusarium wilt of cucumber. PMID:23762289

Moessbauer spectroscopic study of corrosion products beneath primer coating containing anticorrosive pigments

International Nuclear Information System (INIS)

Kumar, A.V.R.; Nigam, R.K.

1998-01-01

The phase analysis of the rusts generated beneath the primer containing micaceous iron oxide (MIO) and micaceous iron oxide in combination with red lead (RL), zinc phosphate (ZP), basic lead silicochromate (BLSC) and zinc chromate (ZC) has been carried out by Moessbauer spectroscopy at room temperature. The rust beneath the coating obtained after immersion of the painted panel for six months in 3% NaCl, consists mainly of non-stoichiometric magnetite together with small fractions of γ-, α-FeOOH except in the case of panel painted with RL containing MIO showed only a central doublet indicating the formation of γ-FeOOH and SPM α-FeOOH. Non-stoichiometry of magnetite as calculated from the ratio of B/A sites of the peaks of magnetite in the spectrum has been found depending on the nature of anticorrosive pigment present in the primer coating. The order of non-stoichiometry has been found to be in order of ZC > BLSC > ZP > MIO. (author)

A degenerate primer MOB typing (DPMT method to classify gamma-proteobacterial plasmids in clinical and environmental settings.

Directory of Open Access Journals (Sweden)

Andrés Alvarado

Full Text Available Transmissible plasmids are responsible for the spread of genetic determinants, such as antibiotic resistance or virulence traits, causing a large ecological and epidemiological impact. Transmissible plasmids, either conjugative or mobilizable, have in common the presence of a relaxase gene. Relaxases were previously classified in six protein families according to their phylogeny. Degenerate primers hybridizing to coding sequences of conserved amino acid motifs were designed to amplify related relaxase genes from γ-Proteobacterial plasmids. Specificity and sensitivity of a selected set of 19 primer pairs were first tested using a collection of 33 reference relaxases, representing the diversity of γ-Proteobacterial plasmids. The validated set was then applied to the analysis of two plasmid collections obtained from clinical isolates. The relaxase screening method, which we call "Degenerate Primer MOB Typing" or DPMT, detected not only most known Inc/Rep groups, but also a plethora of plasmids not previously assigned to any Inc group or Rep-type.

Mobile lifestyles : Conceptualizing heterogeneity in mobile youth culture

NARCIS (Netherlands)

Vanden Abeele, M.M.P.

2014-01-01

Adolescents’ characteristic understanding and use of mobile phones have led observers to speak of a “mobile youth culture.” This article explores whether we can differentiate lifestyles within mobile youth culture. We construct a user typology of Flemish adolescent mobile phone users based on mobile

Variation in extragenic repetitive DNA sequences in Pseudomonas syringae and potential use of modified REP primers in the identification of closely related isolates

Directory of Open Access Journals (Sweden)

Elif Çepni

2012-01-01

Full Text Available In this study, Pseudomonas syringe pathovars isolated from olive, tomato and bean were identified by species-specific PCR and their genetic diversity was assessed by repetitive extragenic palindromic (REP-PCR. Reverse universal primers for REP-PCR were designed by using the bases of A, T, G or C at the positions of 1, 4 and 11 to identify additional polymorphism in the banding patterns. Binding of the primers to different annealing sites in the genome revealed additional fingerprint patterns in eight isolates of P. savastanoi pv. savastanoi and two isolates of P. syringae pv. tomato. The use of four different bases in the primer sequences did not affect the PCR reproducibility and was very efficient in revealing intra-pathovar diversity, particularly in P. savastanoi pv. savastanoi. At the pathovar level, the primer BOX1AR yielded shared fragments, in addition to five bands that discriminated among the pathovars P. syringae pv. phaseolicola, P. savastanoi pv. savastanoi and P. syringae pv. tomato. REP-PCR with a modified primer containing C produced identical bands among the isolates in a pathovar but separated three pathovars more distinctly than four other primers. Although REP-and BOX-PCRs have been successfully used in the molecular identification of Pseudomonas isolates from Turkish flora, a PCR based on inter-enterobacterial repetitive intergenic concensus (ERIC sequences failed to produce clear banding patterns in this study.

Charging of mobile services by mobile payment reference model

OpenAIRE

Pousttchi, Key; Wiedemann, Dietmar Georg

2005-01-01

The purpose of the paper is to analyze mobile payments in the mobile commerce scenario. Therefore, we first classify the mobile payment in the mobile commerce scenario by explaining general offer models, charging concepts, and intermediaries. Second, we describe the mobile payment reference model, especially, the mobile payment reference organization model and different mobile payment standard types. Finally, we conclude our findings.

Mobilities

DEFF Research Database (Denmark)

to social networks, personal identities, and our relationship to the built environment. The omnipresence of mobilities within everyday life, high politics, technology, and tourism (to mention but a few) all point to a key insight harnessed by the ‘mobilities turn’. Namely that mobilities is much more than......The world is on the move. This is a widespread understanding by many inhabitants of contemporary society across the Globe. But what does it actually mean? During over one decade the ‘mobilities turn’ within the social sciences have provided a new set of insights into the repercussions of mobilities...... and environmental degradation. The spaces and territories marked by mobilities as well as the sites marked by the bypassing of such are explored. Moreover, the architectural and technological dimensions to infrastructures and sites of mobilities will be included as well as the issues of power, social exclusion...

Comparative evaluation of self-etching primers and phosphoric acid effectiveness on composite to enamel bond: an in vitro study.

Science.gov (United States)

Patil, Basanagouda S; Rao, Bk Raghavendra; Sharathchandra, Sm; Hegde, Reshma; Kumar, G Vinay

2013-09-01

The aim of the present study was to investigate the effectiveness of the one total-etch self-priming adhesive, one two-step self-etching primer adhesive, and one 'all-in-one' self-etching adhesive system on the adhesion of a resin composite to enamel. Thirty-six freshly extracted human mandibular molars were selected for this study. A fat area about 5 mm in diameter was created on the exposed mesial surface of enamel of each tooth by moist grinding with 320, 420 and 600 grit silicon carbide paper. Twelve teeth were randomly assigned into three groups. In group 1, Adper Easy One (3M ESPE), a one step self-etching primer adhesive was applied and light curing unit for 10 seconds. In group 2, Adper SE Plus, a two-step self-etching primer with bottle A containing the aqueous primer and bottle B containing the acidic adhesive was applied and light cured for 10 seconds. Group 3 (control)-etchant 37% phosphoric acid is applied to the surface for 15 seconds and rinsed with water and air dried and adhesive (single bond 2) is applied to the surface and tube is placed and light cured for 20 seconds. Composite material (Z350) was placed in the tube and light cured for 40 seconds in all the groups. Bond strength testing was done using universal testing machine at the enamel-composite interface. The debonded enamel surface was evaluated in stereomicroscope to assess the cohesive, adhesive or mixed fracture. Data was statistically analyzed by one way analysis of variance (ANOVA). Group 1 performed least among all groups with a mean score of 19.46 MPa. Group 2 had a mean score of 25.67 MPa. Group 3 had a mean score of 27.16 MPa. Under the conditions of this in vitro study, the bond strength values of the two-step self-etching primer systems tested were similar to the total-etch. And, one step self-etching primers have lower bond strength compared to the total-etch.

Delaying mobility disability in people with Parkinson disease using a sensorimotor agility exercise program.

Science.gov (United States)

King, Laurie A; Horak, Fay B

2009-04-01

This article introduces a new framework for therapists to develop an exercise program to delay mobility disability in people with Parkinson disease (PD). Mobility, or the ability to efficiently navigate and function in a variety of environments, requires balance, agility, and flexibility, all of which are affected by PD. This article summarizes recent research identifying how constraints on mobility specific to PD, such as rigidity, bradykinesia, freezing, poor sensory integration, inflexible program selection, and impaired cognitive processing, limit mobility in people with PD. Based on these constraints, a conceptual framework for exercises to maintain and improve mobility is presented. An example of a constraint-focused agility exercise program, incorporating movement principles from tai chi, kayaking, boxing, lunges, agility training, and Pilates exercises, is presented. This new constraint-focused agility exercise program is based on a strong scientific framework and includes progressive levels of sensorimotor, resistance, and coordination challenges that can be customized for each patient while maintaining fidelity. Principles for improving mobility presented here can be incorporated into an ongoing or long-term exercise program for people with PD.

Parental Perception of Mobile Device Usage in Children and Social Competency

Science.gov (United States)

Topper, Christin

2017-01-01

Parents in the 21st century are concerned with the ubiquity of mobile devices and their effects on the progression of social development. A review of the literature indicated that although digital interaction has become more prominent, limited empirical data existed on whether children who spend more time interacting in the digital realm would…

In Silico PCR Tools for a Fast Primer, Probe, and Advanced Searching.

Science.gov (United States)

Kalendar, Ruslan; Muterko, Alexandr; Shamekova, Malika; Zhambakin, Kabyl

2017-01-01

The polymerase chain reaction (PCR) is fundamental to molecular biology and is the most important practical molecular technique for the research laboratory. The principle of this technique has been further used and applied in plenty of other simple or complex nucleic acid amplification technologies (NAAT). In parallel to laboratory "wet bench" experiments for nucleic acid amplification technologies, in silico or virtual (bioinformatics) approaches have been developed, among which in silico PCR analysis. In silico NAAT analysis is a useful and efficient complementary method to ensure the specificity of primers or probes for an extensive range of PCR applications from homology gene discovery, molecular diagnosis, DNA fingerprinting, and repeat searching. Predicting sensitivity and specificity of primers and probes requires a search to determine whether they match a database with an optimal number of mismatches, similarity, and stability. In the development of in silico bioinformatics tools for nucleic acid amplification technologies, the prospects for the development of new NAAT or similar approaches should be taken into account, including forward-looking and comprehensive analysis that is not limited to only one PCR technique variant. The software FastPCR and the online Java web tool are integrated tools for in silico PCR of linear and circular DNA, multiple primer or probe searches in large or small databases and for advanced search. These tools are suitable for processing of batch files that are essential for automation when working with large amounts of data. The FastPCR software is available for download at http://primerdigital.com/fastpcr.html and the online Java version at http://primerdigital.com/tools/pcr.html .

Mobility, Emotion, and Universality in Future Collaboration

Science.gov (United States)

Chignell, Mark; Hosono, Naotsune; Fels, Deborah; Lottridge, Danielle; Waterworth, John

The Graphical user interface has traditionally supported personal productivity, efficiency, and usability. With computer supported cooperative work, the focus has been on typical people, doing typical work in a highly rational model of interaction. Recent trends towards mobility, and emotional and universal design are extending the user interface paradigm beyond the routine. As computing moves into the hand and away from the desktop, there is a greater need for dealing with emotions and distractions. Busy and distracted people represent a new kind of disability, but one that will be increasingly prevalent. In this panel we examine the current state of the art, and prospects for future collaboration in non-normative computing requirements. This panel draws together researchers who are studying the problems of mobility, emotion and universality. The goal of the panel is to discuss how progress in these areas will change the nature of future collaboration.

Simultaneous identification and DNA barcoding of six Eimeria species infecting turkeys using PCR primers targeting the mitochondrial cytochrome c oxidase subunit I (mtCOI) locus.

Science.gov (United States)

Hafeez, Mian A; Shivaramaiah, Srichaitanya; Dorsey, Kristi Moore; Ogedengbe, Mosun E; El-Sherry, Shiem; Whale, Julia; Cobean, Julie; Barta, John R

2015-05-01

Species-specific PCR primers targeting the mitochondrial cytochrome c oxidase subunit I (mtCOI) locus were generated that allow for the specific identification of the most common Eimeria species infecting turkeys (i.e., Eimeria adenoeides, Eimeria meleagrimitis, Eimeria gallopavonis, Eimeria meleagridis, Eimeria dispersa, and Eimeria innocua). PCR reaction chemistries were optimized with respect to divalent cation (MgCl2) and dNTP concentrations, as well as PCR cycling conditions (particularly anneal temperature for primers). Genomic DNA samples from single oocyst-derived lines of six Eimeria species were tested to establish specificity and sensitivity of these newly designed primer pairs. A mixed 60-ng total DNA sample containing 10 ng of each of the six Eimeria species was used as DNA template to demonstrate specific amplification of the correct product using each of the species-specific primer pairs. Ten nanograms of each of the five non-target Eimeria species was pooled to provide a non-target, control DNA sample suitable to test the specificity of each primer pair. The amplifications of the COI region with species-specific primer pairs from pooled samples yielded products of expected sizes (209 to 1,012 bp) and no amplification of non-target Eimeria sp. DNA was detected using the non-target, control DNA samples. These primer pairs specific for Eimeria spp. of turkeys did not amplify any of the seven Eimeria species infecting chickens. The newly developed PCR primers can be used as a diagnostic tool capable of specifically identifying six turkey Eimeria species; additionally, sequencing of the PCR amplification products yields sequence-based genotyping data suitable for identification and molecular phylogenetics.

Final Technical Progress Report Long term risk from actinides in the environment: Modes of mobility; FINAL

International Nuclear Information System (INIS)

Thomas B. Kirchner

2002-01-01

The key source of uncertainty in assessing actinide mobility is the relative importance of transport by: (1) wind erosion, (2) water erosion, and (3) vertical migration. Each of these three processes depends on several environmental factors and they compete with one another. A scientific assessment of the long-term risks associated with actinides in surface soils depends on better quantifying each of these three modes of mobility. The objective from our EMSP study was to quantify the mobility of soil actinides by wind erosion, water erosion, and vertical migration at three semiarid sites where actinide mobility is a key technical, social and legal issue. This EMSP project was the first to evaluate all three factors at a site. The approach has been to investigate both short- and long-term issues based on field and lab studies and model comparisons. Our results demonstrate the importance of incorporating threshold responses into a modeling framework that accounts for environmental factors and natural disturbances that trigger large changes in actinide mobility. The study measured erosional losses of sediment and fallout cesium (an actinide analogue) from field plots located near WIPP in 1998. The results highlight the large effect of burning as a disturbance on contaminant transport and mobility via runoff and erosion. The results show that runoff, erosion, and actinide transport are (1) strongly site specific-differences in radionuclide transport between WIPP and Rocky Flats differed by a factor of twelve because of soil and vegetation differences, and (2) are strongly impacted by disturbances such as fire, which can increase runoff, erosion, and actinide transport by more than an order of magnitude. In addition, a laboratory experiment using soil columns was conducted to investigate the vertical transport of contaminants in sandy soils. Nine columns of soil collected from the vicinity of the WIPP site were prepared. The column consisted of a piece of PVC pipe 20 cm

In vitro shear bond strength of Y-TZP ceramics to different core materials with the use of three primer/resin cement systems.

Science.gov (United States)

Al-Harbi, Fahad A; Ayad, Neveen M; Khan, Zahid A; Mahrous, Amr A; Morgano, Steven M

2016-01-01

Durability of the bond between different core materials and zirconia retainers is an important predictor of the success of a dental prosthesis. Nevertheless, because of its polycrystalline structure, zirconia cannot be etched and bonded to a conventional resin cement. The purpose of this in vitro study was to compare the effects of 3 metal primer/resin cement systems on the shear bond strength (SBS) of 3 core materials bonded to yttria-stabilized tetragonal zirconia polycrystalline (Y-TZP) ceramic retainers. Zirconia ceramic (Cercon) disks (5×3 mm) were airborne-particle abraded, rinsed, and air-dried. Disk-shaped core specimens (7×7 mm) that were prepared of composite resin, Ni-Cr, and zirconia were bonded to the zirconia ceramic disks by using one of 3 metal primer/cement systems: (Z-Prime Plus/BisCem, Zirconia Primer/Multilink Automix, or Clearfil Ceramic Primer/Clearfil SA). SBS was tested in a universal testing machine. Stereomicroscopy was used to evaluate the failure mode of debonded specimens. Data were analyzed using 2-way ANOVA and post hoc analysis using the Scheffe procedure (α=.05). Clearfil SA/Clearfil Ceramic Primer system with an Ni-Cr core yielded the highest SBS value (19.03 MPa), whereas the lowest SBS value was obtained when Multilink Automix/Zirconia Primer system was used with the zirconia core group (4.09 MPa). Differences in mean SBS values among the cement/primer groups were statistically significant, except for Clearfil SA and BisCem with both composite resin and zirconia cores. Differences in mean SBS values among the core subgroups were not statistically significant, except for zirconia core with BisCem, Multilink, and Clearfil SA. The predominant failure mode was adhesive, except for Clearfil SA and BisCem luting agents with composite resin cores, which displayed cohesive failure, and Multilink Automix with a composite resin, core as well as Clearfil SA with Ni-Cr cores, where the debonded specimens of each group displayed a mixed

[Design of primers to DNA of lactic acid bacteria].

Science.gov (United States)

Lashchevskiĭ, V V; Kovalenko, N K

2003-01-01

Primers LP1-LP2 to the gene 16S rRNA have been developed, which permit to differentiate lactic acid bacteria: Lactobacillus plantarum, L. delbrueckii subsp. bulgaricus and Streptococcus salivarius subsp. thermophilus. The strain-specific and species-specific differentiations are possible under different annealing temperature. Additional fragments, which are synthesized outside the framework of gene 16S rRNA reading, provide for the strain-specific type of differentiation, and the fragment F864 read in the gene 16S rRNA permits identifying L. plantarum.

Accelerating MATLAB with GPU computing a primer with examples

CERN Document Server

Suh, Jung W

2013-01-01

Beyond simulation and algorithm development, many developers increasingly use MATLAB even for product deployment in computationally heavy fields. This often demands that MATLAB codes run faster by leveraging the distributed parallelism of Graphics Processing Units (GPUs). While MATLAB successfully provides high-level functions as a simulation tool for rapid prototyping, the underlying details and knowledge needed for utilizing GPUs make MATLAB users hesitate to step into it. Accelerating MATLAB with GPUs offers a primer on bridging this gap. Starting with the basics, setting up MATLAB for

Discrete random signal processing and filtering primer with Matlab

CERN Document Server

Poularikas, Alexander D

2013-01-01

Engineers in all fields will appreciate a practical guide that combines several new effective MATLAB® problem-solving approaches and the very latest in discrete random signal processing and filtering.Numerous Useful Examples, Problems, and Solutions - An Extensive and Powerful ReviewWritten for practicing engineers seeking to strengthen their practical grasp of random signal processing, Discrete Random Signal Processing and Filtering Primer with MATLAB provides the opportunity to doubly enhance their skills. The author, a leading expert in the field of electrical and computer engineering, offe

Career mobility: equipping nurses for health care beyond the year 2000.

Science.gov (United States)

Doswell, W M

1996-01-01

Nurses are faced with uncertain employment in today's rapidly changing work place. The key to survival in this environment is to provide innovative, cost-effective, yet outcome-oriented methods of patient care delivery. Professional nurses and nursing students should make career mobility their watchword. Career mobility defines a planned trajectory which is flexible, role-expandable, and capable of adjusting to the sudden changes in direction which arise as nurses progress through their professional career. Nursing students must carefully examine the educational program they chose, and, once graduated, should use an innovative approach to the health care job market, with emphasis on professional nursing careers outside the traditional employment roles.

Optimisation of the PCR-invA primers for the detection of Salmonella ...

African Journals Online (AJOL)

A polymerase chain reaction (PCR)-based method for the detection of Salmonella species in water samples was optimised and evaluated for speed, specificity and sensitivity. Optimisation of Mg2+ and primer concentrations and cycling parameters increased the sensitivity and limit of detection of PCR to 2.6 x 104 cfu/m.

Mobile Technology in Hospital Schools: What Are Hospital Teachers' Professional Learning Needs?

Science.gov (United States)

McCarthy, Aidan; Maor, Dorit; McConney, Andrew

2017-01-01

The aim of this study was to identify hospital teachers' professional learning needs to enable effective use of mobile technology in hospital schools. Hospitalized students cannot attend their regular schools and as a result their educational progress and development can suffer. In an attempt to address this, hospital schools provide learning…

Connecting Research on Retinitis Pigmentosa to the Practice of Orientation and Mobility.

Science.gov (United States)

Geruschat, Duane R.; Turano, Kathleen A.

2002-01-01

Retinitis pigmentosa (RP) causes restriction of the visual field, progressive vision loss, and night blindness. This article presents an overview of the most common problems in orientation and mobility (O&M) for individuals with RP, appropriate interventions, vision science discoveries related to RP, and the impact of RP on functional visual…

Client Mobile Software Design Principles for Mobile Learning Systems

Directory of Open Access Journals (Sweden)

Qing Tan

2009-01-01

Full Text Available In a client-server mobile learning system, client mobile software must run on the mobile phone to acquire, package, and send student’s interaction data via the mobile communications network to the connected mobile application server. The server will receive and process the client data in order to offer appropriate content and learning activities. To develop the mobile learning systems there are a number of very important issues that must be addressed. Mobile phones have scarce computing resources. They consist of heterogeneous devices and use various mobile operating systems, they have limitations with their user/device interaction capabilities, high data communications cost, and must provide for device mobility and portability. In this paper we propose five principles for designing Client mobile learning software. A location-based adaptive mobile learning system is presented as a proof of concept to demonstrate the applicability of these design principles.

手机技术现状及发展局限性%Mobile Phone Technology Status and Development Limitations Sexual

Institute of Scientific and Technical Information of China (English)

宁丽华

2013-01-01

Guangzhou new communications equipment limited company The technology continues to update promoted constantly update and progress of the mobile phone, mobile phone technology have gradually been widespread concern, At the same time, the development of mobile phone technology provides strong support for the progress of society. This article the author analyzes the current situation of the development of mobile phone technology, and then explore the limitations of the development of mobile phone technology, and the healthy development of the mobile phone technology strategy put forward some proposals, in order to provide guidance and reference for the development of mobile phone technology%　　技术的不断更新促进了手机的不断更新和进步，手机技术逐渐受到人们的普遍关注，同时，手机技术的发展为社会的进步提供了有力的支持。对手机技术的发展现状进行了分析，探讨了手机技术发展的局限性，并对手机技术的健康发展策略提出了一些建议，以便为手机技术的发展提供指导和借鉴。

Detection of bacterial soft-rot of crown imperial caused by Pectobacterium carotovorum subsp. carotovorum using specific PCR primers

Directory of Open Access Journals (Sweden)

E. Mahmoudi

2007-08-01

Full Text Available Pectobacterium is one of the major destructive causal agent in most crop plants throughout the world. During a survey in spring of 2005 in the rangeland of Kermanshah and Isfahan, provinces of Iran, samples of bulbs and stems of crown imperial with brown spot and soft rot were collected. Eight strains of pectolytic Erwinia were isolated and purified from these samples. Phenotypic tests indicated that the strains were gram-negative, facultative anaerobic, rod shaped, motile with peritrichous flagella. They were oxidase negative, catalase positive and also able to macerate potato slices. Pathogenicity of all the strains were confirmed on corn, philodendron and crown imperial by inoculation of these crops with a bacterial suspension and reisolation of the strain from symptomatic tissues. A pair of specific PCR primers was used to detect these bacterial strains. The primer set (EXPCCF/EXPCCR amplified a single fragment of the expected size (0.55 kb from genomic DNA of all strains used in this study. In nested PCR, the primer set (INPCCR/INPCCF amplified the expected single fragment (0.4 kb from the PCR product of first PCR amplification. On the basis of the biochemical and phenotypic characteristics and PCR amplification by the specific PCR primers, these strains were identified as Pectobacterium carotovorum subsp. carotovorum. This is the first report of occurrence of crown imperial bacterial soft-rot in Iran.

What Are the Odds of that? A Primer on Understanding Logistic Regression

Science.gov (United States)

Huang, Francis L.; Moon, Tonya R.

2013-01-01

The purpose of this Methodological Brief is to present a brief primer on logistic regression, a commonly used technique when modeling dichotomous outcomes. Using data from the National Education Longitudinal Study of 1988 (NELS:88), logistic regression techniques were used to investigate student-level variables in eighth grade (i.e., enrolled in a…

Characterization of highly informative cross-species microsatellite panels for the Australian dugong (Dugong dugon) and Florida manatee (Trichechus manatus latirostris) including five novel primers

Science.gov (United States)

Hunter, Margaret Kellogg; Broderick, Damien; Ovenden, Jennifer R.; Tucker, Kimberly Pause; Bonde, Robert K.; McGuire, Peter M.; Lanyon, Janet M.

2010-01-01

The Australian dugong (Dugong dugon) and Florida manatee (Trichechus manatus latirostris) are threatened species of aquatic mammals in the order Sirenia. Sirenian conservation and management actions would benefit from a more complete understanding of genetic diversity and population structure. Generally, species-specific microsatellite markers are employed in conservation genetic studies; however, robust markers can be difficult and costly to isolate. To increase the number of available markers, dugong and manatee microsatellite primers were evaluated for cross-species amplification. Furthermore, one manatee and four dugong novel primers are reported. After polymerase chain reaction optimization, 23 (92%) manatee primers successfully amplified dugong DNA, of which 11 (48%) were polymorphic. Of the 32 dugong primers tested, 27 (84%) yielded product in the manatee, of which 17 (63%) were polymorphic. Dugong and manatee primers were compared and the most informative markers were selected to create robust and informative marker-panels for each species. These crossspecies microsatellite marker-panels can be employed to assess other sirenian populations and can provide beneficial information for the protection and management of these unique mammals.

Universal and blocking primer mismatches limit the use of high-throughput DNA sequencing for the quantitative metabarcoding of arthropods.

Science.gov (United States)

Piñol, J; Mir, G; Gomez-Polo, P; Agustí, N

2015-07-01

The quantification of the biological diversity in environmental samples using high-throughput DNA sequencing is hindered by the PCR bias caused by variable primer-template mismatches of the individual species. In some dietary studies, there is the added problem that samples are enriched with predator DNA, so often a predator-specific blocking oligonucleotide is used to alleviate the problem. However, specific blocking oligonucleotides could coblock nontarget species to some degree. Here, we accurately estimate the extent of the PCR biases induced by universal and blocking primers on a mock community prepared with DNA of twelve species of terrestrial arthropods. We also compare universal and blocking primer biases with those induced by variable annealing temperature and number of PCR cycles. The results show that reads of all species were recovered after PCR enrichment at our control conditions (no blocking oligonucleotide, 45 °C annealing temperature and 40 cycles) and high-throughput sequencing. They also show that the four factors considered biased the final proportions of the species to some degree. Among these factors, the number of primer-template mismatches of each species had a disproportionate effect (up to five orders of magnitude) on the amplification efficiency. In particular, the number of primer-template mismatches explained most of the variation (~3/4) in the amplification efficiency of the species. The effect of blocking oligonucleotide concentration on nontarget species relative abundance was also significant, but less important (below one order of magnitude). Considering the results reported here, the quantitative potential of the technique is limited, and only qualitative results (the species list) are reliable, at least when targeting the barcoding COI region. © 2014 John Wiley & Sons Ltd.

In Vitro Evaluation of Shear Bond Strength of Self Etching Primers to Dentin

Directory of Open Access Journals (Sweden)

Reena Vora

2012-01-01

Full Text Available Objectives: To evaluate and compare the shear bond strength of four self etching primer adhesives to dentin. Materials & Methods: A total of 75 extracted human maxillary and mandibular molars were selected for the study. The teeth were divided into 5 groups of 15 teeth each, Group A- AdheSE (Ivoclar Vivadent, Group B-Adper prompt (3M ESPE, Group C- i bond (Heraeus-Kulzer, Group D-XenoIII (Dentsply, De Trey Group E-Single bond (3M ESPE was used and served as control. All the adhesives were applied according to the manufacturer′s instructions. Composite post was built on these bonded surfaces using Z-100 hybrid composite. The teeth were subjected to thermocycling for 500 cycles between 5°C to 55°C. The teeth were then mounted on universal testing machine and fractured under a shearing load, applied at a speed of 0.2mm/min. The readings were noted, tabulated and shear bond strength calculated in Mega Pascal (Mpa units. Results: There was significant difference in the mean shear bond strength of the four self etching primers, adhesives tested. Shear strength values were in the range of 16.57 to 21.73 Mpa. Xeno III gave the highest mean of shear bond strength whereas Adhe SE showed the lowest value of shear strength. Conclusion: Based on the results of the study, it can be concluded that contemporary self etching primer adhesives bond successfully to dentin. Moreover the bonding ability of Self Etching Systems seems to be comparable to the conventional Total Etch Systems.

Mobile technologies in medical education: AMEE Guide No. 105.

Science.gov (United States)

Masters, Ken; Ellaway, Rachel H; Topps, David; Archibald, Douglas; Hogue, Rebecca J

2016-06-01

Mobile technologies (including handheld and wearable devices) have the potential to enhance learning activities from basic medical undergraduate education through residency and beyond. In order to use these technologies successfully, medical educators need to be aware of the underpinning socio-theoretical concepts that influence their usage, the pre-clinical and clinical educational environment in which the educational activities occur, and the practical possibilities and limitations of their usage. This Guide builds upon the previous AMEE Guide to e-Learning in medical education by providing medical teachers with conceptual frameworks and practical examples of using mobile technologies in medical education. The goal is to help medical teachers to use these concepts and technologies at all levels of medical education to improve the education of medical and healthcare personnel, and ultimately contribute to improved patient healthcare. This Guide begins by reviewing some of the technological changes that have occurred in recent years, and then examines the theoretical basis (both social and educational) for understanding mobile technology usage. From there, the Guide progresses through a hierarchy of institutional, teacher and learner needs, identifying issues, problems and solutions for the effective use of mobile technology in medical education. This Guide ends with a brief look to the future.

Capital Income Taxation and Progressivity in a Global Economy

OpenAIRE

Rosanne Altshuler; Benjamin Harris; Eric Toder

2011-01-01

The increase in international capital mobility over the past two decades has put pressure on the tax treatment of corporate equity income. Corporate-level taxes distort investment flows across locations and create opportunities for tax avoidance by shifting income across jurisdictions. Outward flows of capital shift part of the burden of the corporate-level tax on equity income from capital to labor, thereby making its incidence less progressive. Individual-level taxes on corporate equity inc...

Guidelines - A Primer for Communicating Effectively with NABIR Stakeholders

Energy Technology Data Exchange (ETDEWEB)

Weber, James R.; Schell, Charlotte J.; Marino, T; Bilyard, Gordon R.

2004-02-10

This version of the communication primer comprises two interlocking parts: Pat 1, a practical section, intended to prepare you for public interactions, and Part 2, a theoretical section that provides social and technical bases for the practices recommended in Part 1. The mutual support of practice and theory is very familiar in science and clearly requires a willingness to observe and revise our prior assumptions--in this document, we invoke both. We hope that is offering will represent a step both towards improving practice and maturing the theory of practical science communication.

Atmel AVR Microcontroller Primer Programming and Interfacing, Second Edition

CERN Document Server

Barrett, Steven F

2012-01-01

This textbook provides practicing scientists and engineers a primer on the Atmel AVR microcontroller. In this second edition we highlight the popular ATmega164 microcontroller and other pin-for-pin controllers in the family with a complement of flash memory up to 128 kbytes. The second edition also adds a chapter on embedded system design fundamentals and provides extended examples on two different autonomous robots. Our approach is to provide the fundamental skills to quickly get up and operating with this internationally popular microcontroller. We cover the main subsystems aboard the ATmega

Mobilities Design

DEFF Research Database (Denmark)

Lanng, Ditte Bendix; Wind, Simon; Jensen, Ole B.

2017-01-01

Mobilities comprise a large part of our world and everyday lives, and the mobilities spaces in which we travel are ubiquitous. Yet, ordinary mobilities spaces – such as parking lots, pedestrian tunnels, and road lay-bys – tend to be criticized as typologies that lack consideration for the people...... who use them and for their wider social, aesthetic, cultural, and ecological agency in the city. This is clearly not an unambiguous characterization. But from it follows an urgency to re-examine unheeded mobilities spaces and extend demands of their agency beyond standards of technical efficiency....... This article draws on the recent “mobilities turn” in social science to support such re-examination of mobilities spaces. In social-scientific mobilities research, mobilities are considered the departure point for understanding the socio-material world in which we live. Mobilities are regarded as far more than...

Editorial aspects of the primer Caminho Suave and the participation of the publisher Caminho Suave Limitada in federal programs for school textbook

Directory of Open Access Journals (Sweden)

Eliane Teresinha Peres

2016-03-01

Full Text Available The main objective of this work was to present and analyze editorial aspects of the primer Caminho Suave, as well as the participation of the publishing house of the same name, in federal programs for school textbooks. The primer was published for the first time in 1948 and is edited until today, representing a landmark for Brazilian literacy, exerting influence over generations of teachers and students alike. Data analyzed were collected from official sources (Diário Oficial da União [Brazilian Official National Press] and Diário Oficial do Estado de São Paulo [São Paulo State Official Press], from periodical press (Veja Digital, Grupo Folha, and Hemeroteca Digital Brasileira [Brazilian Digital Periodical Press Collection], and from printings of the primer itself. In the research process, data indicated the primer Caminho Suave as one of the biggest editorial successes concerning books used to teach reading and writing inBrazil, as some studies in this field had already indicated.

Development and evaluation of specific PCR primers targeting the ribosomal DNA-internal transcribed spacer (ITS) region of peritrich ciliates in environmental samples

Science.gov (United States)

Su, Lei; Zhang, Qianqian; Gong, Jun

2017-07-01

Peritrich ciliates are highly diverse and can be important bacterial grazers in aquatic ecosystems. Morphological identifications of peritrich species and assemblages in the environment are time-consuming and expertise-demanding. In this study, two peritrich-specific PCR primers were newly designed to amplify a fragment including the internal transcribed spacer (ITS) region of ribosomal rDNA from environmental samples. The primers showed high specificity in silico, and in tests with peritrich isolates and environmental DNA. Application of these primers in clone library construction and sequencing yielded exclusively sequences of peritrichs for water and sediment samples. We also found the ITS1, ITS2, ITS, D1 region of 28S rDNA, and ITS+D1 region co-varied with, and generally more variable than, the V9 region of 18S rDNA in peritrichs. The newly designed specific primers thus provide additional tools to study the molecular diversity, community composition, and phylogeography of these ecologically important protists in different systems.

Primer on theory and operation of linear accelerators in radiation therapy

International Nuclear Information System (INIS)

Karzmark, C.J.; Morton, R.J.

1981-12-01

This primer is part of an educational package that also includes a series of 3 videotapes entitled Theory and Operation of Linear Accelerators in Radiation Therapy, Parts I, II, and III. This publication provides an overview of the components of the linear accelerator and how they function and interrelate. The auxiliary systems necessary to maintain the operation of the linear accelerator are also described

Facebook targeted advertisement for research recruitment: A primer for nurse researchers.

Science.gov (United States)

Carter-Harris, Lisa

2016-11-01

Recruiting participants for research studies can be challenging and costly. Innovative recruitment methods are needed. Facebook targeted advertisement offers a low-cost alternative to traditional methods that has been successfully used in research study recruitment. This primer offers nurse researchers a method utilizing social media as a recruitment tool and details Facebook targeted advertisement for research recruitment. Copyright © 2016 Elsevier Inc. All rights reserved.

Technical comparison of several global mobile satellite communications systems

Science.gov (United States)

Comparetto, Gary M.

The era of satellite-based mobile satellite communications (MSC) systems started with the first MARISAT satellite which was launched into a geostationary orbit over the Pacific Ocean in 1976 to provide communications between ships and shore stations. The combination of high cost and unacceptably large equipment has kept the space-based MSC systems from appealing to the wider market of personal mobile communications. The progress made over the last ten years, however, in digital voice processing, satellite technology, and component miniaturization has resulted in the viability of satellite-based mobile satellite communications systems to meet the growing market in personal mobile communications using handsets similar to those currently in use with land-based cellular systems. Three of the more mature LEO/MEO satellite systems are addressed in this paper including GLOBALSTAR, Iridium, and Odyssey. The system architectures of each system are presented along with a description of the satellite and user handset designs and the multiaccess techniques employed. It will be shown that, although a number of similarities exist among the system addressed, each system is unique in a variety of significant design areas. It is concluded that the technical feasibility of satellite-based mobile satellite communications systems seems to be secure. It will be challenging, however, for the vendors to actually develop and deploy these systems in a cost effective, timely, and reliable way that meets a continually evolving set of requirements based upon a rapidly changing technology base.

The prevalence and usage of mobile health applications among mental health patients in Saudi Arabia.

Science.gov (United States)

Atallah, Nora; Khalifa, Mohamed; El Metwally, Ashraf; Househ, Mowafa

2018-03-01

Mobile health (mHealth) applications provide new methods of engagement with patients and can help patients manage their mental health condition. The main objective of this study is to explore the prevalence of the use of mobile health applications for mental health patients in Saudi Arabia. A total of 376 participants with depression and/or anxiety completed an online survey distributed by social networks which asked questions relating to mobile phone ownership, uses of health applications, and utilization patterns to track mental health related issues. Approximately, 46% of the participants reported running one or two healthcare related applications on their mobile phones. In all age groups, 64% of the participants used their mobile phones to access information related to their own health. Also, 64% of the participants expressed interest in using their own mobile phones to track and follow the progression of their depression and/or anxiety. Developing mobile health applications for Saudi mental health patients is needed since it can offer opportunities for patients, researchers, caregivers, and legislators to work together to improve the state of mental health care in Saudi Arabia. Copyright © 2017 Elsevier B.V. All rights reserved.

Mobile Phone Penetration, Mobile Banking and Inclusive Development in Africa

OpenAIRE

Asongu, Simplice; Nwachukwu, Jacinta C.

2016-01-01

The study assesses the role of mobile phones and mobile banking in decreasing inequality in 52 African countries. The empirical procedure involves first, examining the income-redistributive effect of mobile phone penetration and then investigating the contribution of mobile banking services in this relationship. The findings suggest an equalizing income-redistributive effect of ‘mobile phone penetration’ and ‘mobile banking’, with a higher income-equalizing effect from mobile banking compared...

New Homes, New Neighborhoods, New Schools: A Progress Report on the Baltimore Housing Mobility Program

Science.gov (United States)

Engdahl, Lora

2009-01-01

In the Baltimore region, a successful housing mobility program is providing families living in very disadvantaged inner city communities with a new home and a chance for a new life. Minority voucher holders in the federal Housing Choice Voucher Program (formerly titled Section 8) have often been limited to living in "voucher submarkets"…

Mobility Divides

DEFF Research Database (Denmark)

Jensen, Ole B.

Contemporary mobilities are cultural and social manifestations, and the mobile practices in the everyday life of billions of humans are re-configuring senses of place, self, other and relationships to the built environment. The way ‘mobile situations’ are staged in designed and built environments......’ in the everyday life and cast light on how design and ‘materialities of mobilites’ are creating differential mobilities across societies, social networks, and communities of practices.......Contemporary mobilities are cultural and social manifestations, and the mobile practices in the everyday life of billions of humans are re-configuring senses of place, self, other and relationships to the built environment. The way ‘mobile situations’ are staged in designed and built environments...

Bioinspired Intelligent Algorithm and Its Applications for Mobile Robot Control: A Survey

Science.gov (United States)

Ni, Jianjun; Wu, Liuying; Fan, Xinnan; Yang, Simon X.

2016-01-01

Bioinspired intelligent algorithm (BIA) is a kind of intelligent computing method, which is with a more lifelike biological working mechanism than other types. BIAs have made significant progress in both understanding of the neuroscience and biological systems and applying to various fields. Mobile robot control is one of the main application fields of BIAs which has attracted more and more attention, because mobile robots can be used widely and general artificial intelligent algorithms meet a development bottleneck in this field, such as complex computing and the dependence on high-precision sensors. This paper presents a survey of recent research in BIAs, which focuses on the research in the realization of various BIAs based on different working mechanisms and the applications for mobile robot control, to help in understanding BIAs comprehensively and clearly. The survey has four primary parts: a classification of BIAs from the biomimetic mechanism, a summary of several typical BIAs from different levels, an overview of current applications of BIAs in mobile robot control, and a description of some possible future directions for research. PMID:26819582

Bioinspired Intelligent Algorithm and Its Applications for Mobile Robot Control: A Survey.

Science.gov (United States)

Ni, Jianjun; Wu, Liuying; Fan, Xinnan; Yang, Simon X

2016-01-01

Bioinspired intelligent algorithm (BIA) is a kind of intelligent computing method, which is with a more lifelike biological working mechanism than other types. BIAs have made significant progress in both understanding of the neuroscience and biological systems and applying to various fields. Mobile robot control is one of the main application fields of BIAs which has attracted more and more attention, because mobile robots can be used widely and general artificial intelligent algorithms meet a development bottleneck in this field, such as complex computing and the dependence on high-precision sensors. This paper presents a survey of recent research in BIAs, which focuses on the research in the realization of various BIAs based on different working mechanisms and the applications for mobile robot control, to help in understanding BIAs comprehensively and clearly. The survey has four primary parts: a classification of BIAs from the biomimetic mechanism, a summary of several typical BIAs from different levels, an overview of current applications of BIAs in mobile robot control, and a description of some possible future directions for research.

Bioinspired Intelligent Algorithm and Its Applications for Mobile Robot Control: A Survey

Directory of Open Access Journals (Sweden)

Jianjun Ni

2016-01-01

Full Text Available Bioinspired intelligent algorithm (BIA is a kind of intelligent computing method, which is with a more lifelike biological working mechanism than other types. BIAs have made significant progress in both understanding of the neuroscience and biological systems and applying to various fields. Mobile robot control is one of the main application fields of BIAs which has attracted more and more attention, because mobile robots can be used widely and general artificial intelligent algorithms meet a development bottleneck in this field, such as complex computing and the dependence on high-precision sensors. This paper presents a survey of recent research in BIAs, which focuses on the research in the realization of various BIAs based on different working mechanisms and the applications for mobile robot control, to help in understanding BIAs comprehensively and clearly. The survey has four primary parts: a classification of BIAs from the biomimetic mechanism, a summary of several typical BIAs from different levels, an overview of current applications of BIAs in mobile robot control, and a description of some possible future directions for research.

Nuclear waste management. Quarterly progress report, October-December 1979

Energy Technology Data Exchange (ETDEWEB)

Platt, A.M.; Powell, J.A. (comps.)

1980-04-01

Progress and activities are reported on the following: high-level waste immobilization, alternative waste forms, nuclear waste materials characterization, TRU waste immobilization programs, TRU waste decontamination, krypton solidification, thermal outgassing, iodine-129 fixation, monitoring of unsaturated zone transport, well-logging instrumentation development, mobile organic complexes of fission products, waste management system and safety studies, assessment of effectiveness of geologic isolation systems, waste/rock interactions technology, spent fuel and fuel pool integrity program, and engineered barriers. (DLC)

Characterization of Novel Di-, Tri-, and Tetranucleotide Microsatellite Primers Suitable for Genotyping Various Plant Pathogenic Fungi with Special Emphasis on Fusaria and Mycospherella graminicola

Directory of Open Access Journals (Sweden)

Joseph-Alexander Verreet

2012-03-01

Full Text Available The goals of this investigation were to identify and evaluate the use of polymorphic microsatellite marker (PMM analysis for molecular typing of seventeen plant pathogenic fungi. Primers for di-, tri-, and tetranucleotide loci were designed directly from the recently published genomic sequence of Mycospherlla graminicola and Fusarium graminearum. A total of 20 new microsatellite primers as easy-to-score markers were developed. Microsatellite primer PCR (MP-PCR yielded highly reproducible and complex genomic fingerprints, with several bands ranging in size from 200 to 3000 bp. Of the 20 primers tested, only (TAGG4, (TCC5 and (CA7T produced a high number of polymorphic bands from either F. graminearum or F. culmorum. (ATG5 led to successful amplifications in M. graminicola isolates collected from Germany. Percentage of polymorphic bands among Fusarium species ranged from 9 to 100%. Cluster analysis of banding patterns of the isolates corresponded well to the established species delineations based on morphology and other methods of phylogenetic analysis. The current research demonstrates that the newly designed microsatellite primers are reliable, sensitive and technically simple tools for assaying genetic variability in plant pathogenic fungi.

Characterization of highly informative cross-species microsatellite panels for the Australian dugong (Dugong dugon) and Florida manatee (Trichechus manatus latirostris) including five novel primers.

Science.gov (United States)

Hunter, Margaret Kellogg; Broderick, Damien; Ovenden, Jennifer R; Tucker, Kimberly Pause; Bonde, Robert K; McGuire, Peter M; Lanyon, Janet M

2010-03-01

The Australian dugong (Dugong dugon) and Florida manatee (Trichechus manatus latirostris) are threatened species of aquatic mammals in the order Sirenia. Sirenian conservation and management actions would benefit from a more complete understanding of genetic diversity and population structure. Generally, species-specific microsatellite markers are employed in conservation genetic studies; however, robust markers can be difficult and costly to isolate. To increase the number of available markers, dugong and manatee microsatellite primers were evaluated for cross-species amplification. Furthermore, one manatee and four dugong novel primers are reported. After polymerase chain reaction optimization, 23 (92%) manatee primers successfully amplified dugong DNA, of which 11 (48%) were polymorphic. Of the 32 dugong primers tested, 27 (84%) yielded product in the manatee, of which 17 (63%) were polymorphic. Dugong and manatee primers were compared and the most informative markers were selected to create robust and informative marker-panels for each species. These cross-species microsatellite marker-panels can be employed to assess other sirenian populations and can provide beneficial information for the protection and management of these unique mammals. Published 2009. This article is a US Government work and is in the public domain in the USA.

Micro Mobility Marketing

DEFF Research Database (Denmark)

Hosbond, Jens Henrik; Skov, Mikael B.

2008-01-01

, in our case a medium-sized retail supermarket. Two prototypes based on push and pull marketing strategies are implemented and evaluated. Taking outset in a synthesis of central issues in contemporary research on mobile marketing, we discuss their role in micro mobility marketing to point to similarities......Mobile marketing refers to marketing of services or goods using mobile technology and mobile marketing holds potentially great economical opportunities. Traditionally, mobile marketing has been viewed as mobility in the large taking place virtually anywhere, anytime. Further, research shows...... considerable number of studies on push-based SMS mobile marketing campaigns. This paper explores a related yet different form of mobile marketing namely micro mobility marketing. Micro mobility marketing denotes mobility in the small, meaning that promotion of goods takes place within a circumscribed location...

Detection of HCV-RNA by Reverse Transcription Polymerase Chain Reaction Using Biotinylated and Radioiodinated Primers

International Nuclear Information System (INIS)

Ryu, Jin Sook; Moon, Dae Hyuk; Cheon, Jun Hong; Chung, Yoon Young; Park, Hung Dong; Chung, Young Hwa; Lee, Young Sang

1994-01-01

This study was performed to evaluate the clinical applicability of the reverse transcription polymerase chain reaction (RT-PCR) kit of HCV-RNA using biotinylated and radioiodinated primers. Study subjects were 118 patients with positive anti-HCV. HCV-RNA in patients serum was extracted by guanidium thiocyanate method. After first amplification, the product was reamplified by primers labelled with biotin and I-125. The final amplification product was detected by counting the radioactivity after incubation in avidin coated tubes. In 51 samples, the test was repeated for evaluation of reproducibility. This new method was also compared with conventional RT-PCR methods in 34 samples from patients with chronic liver disease. The results were as follows, 1) HCV-RNA was positive in 85(97%)of 88 patients with chronic liver disease, and in 23 (73%) of 30 patients with normal liver function. 2) In comparison with conventional method, HCV-RNA was detected in 32(94%) of 34 patients with new method, whereas in 27(79% ) of the same group with conventional method 3) Repeated test with new method in 52 samples demonstrated 82% of concordant result. In conclusion, new method with biotinylated and radioiodinated primers was more sensitive than conventional method. However, great care must be taken for quality control because there were considerable interassay variation and possibility of false positivity and false negativity.

Detection of HCV-RNA by Reverse Transcription Polymerase Chain Reaction Using Biotinylated and Radioiodinated Primers

Energy Technology Data Exchange (ETDEWEB)

Ryu, Jin Sook; Moon, Dae Hyuk; Cheon, Jun Hong; Chung, Yoon Young; Park, Hung Dong; Chung, Young Hwa; Lee, Young Sang [Asan Medical Center, University of Ulsan, Seoul (Korea, Republic of)

1994-07-15

This study was performed to evaluate the clinical applicability of the reverse transcription polymerase chain reaction (RT-PCR) kit of HCV-RNA using biotinylated and radioiodinated primers. Study subjects were 118 patients with positive anti-HCV. HCV-RNA in patients serum was extracted by guanidium thiocyanate method. After first amplification, the product was reamplified by primers labelled with biotin and I-125. The final amplification product was detected by counting the radioactivity after incubation in avidin coated tubes. In 51 samples, the test was repeated for evaluation of reproducibility. This new method was also compared with conventional RT-PCR methods in 34 samples from patients with chronic liver disease. The results were as follows, 1) HCV-RNA was positive in 85(97%)of 88 patients with chronic liver disease, and in 23 (73%) of 30 patients with normal liver function. 2) In comparison with conventional method, HCV-RNA was detected in 32(94%) of 34 patients with new method, whereas in 27(79% ) of the same group with conventional method 3) Repeated test with new method in 52 samples demonstrated 82% of concordant result. In conclusion, new method with biotinylated and radioiodinated primers was more sensitive than conventional method. However, great care must be taken for quality control because there were considerable interassay variation and possibility of false positivity and false negativity.

Multimodal exercise training in multiple sclerosis: A randomized controlled trial in persons with substantial mobility disability.

Science.gov (United States)

Sandroff, Brian M; Bollaert, Rachel E; Pilutti, Lara A; Peterson, Melissa L; Baynard, Tracy; Fernhall, Bo; McAuley, Edward; Motl, Robert W

2017-10-01

Mobility disability is a common, debilitating feature of multiple sclerosis (MS). Exercise training has been identified as an approach to improve MS-related mobility disability. However, exercise randomized controlled trials (RCTs) on mobility in MS have generally not selectively targeted those with the onset of irreversible mobility disability. The current multi-site RCT compared the efficacy of 6-months of supervised, multimodal exercise training with an active control condition for improving mobility, gait, physical fitness, and cognitive outcomes in persons with substantial MS-related mobility disability. 83 participants with substantial MS-related mobility disability underwent initial mobility, gait, fitness, and cognitive processing speed assessments and were randomly assigned to 6-months of supervised multimodal (progressive aerobic, resistance, and balance) exercise training (intervention condition) or stretching-and-toning activities (control condition). Participants completed the same outcome assessments halfway through and immediately following the 6-month study period. There were statistically significant improvements in six-minute walk performance (F(2158)=3.12, p=0.05, η p 2 =0.04), peak power output (F(2150)=8.16, pmobility disability. This is critical for informing the development of multi-site exercise rehabilitation programs in larger samples of persons with MS-related mobility disability. Copyright © 2017 Elsevier Inc. All rights reserved.

New primers for amplification of cytochrome c oxidase subunit I barcode region designed for species of Decapoda (Crustacea

Directory of Open Access Journals (Sweden)

Fernando L. Mantelatto

Full Text Available Abstract We designed 14 new primers for amplification of the COI barcode region of decapod crustacean species. We tested, with high level of success, the generation of ~ 640 ± 49 base-pair sequences in selected groups of decapods (hermit crabs, squat lobsters, marine and freshwater crabs and shrimps, encompassing representatives of 27 genera of 15 families, 11 of Pleocyemata (Anomura, Brachyura, and Caridea and 4 of Dendrobranchiata. Based on the results we expect the applicability of these primers for several studies with different taxa within Decapoda.

A new set of primers for the detection of Toxoplasma gondii in amniotic fluid using polymerase chain reaction.