WorldWideScience

Sample records for mobile primers progress

  1. Security Issues for Mobile Medical Imaging: A Primer.

    Science.gov (United States)

    Choudhri, Asim F; Chatterjee, Arindam R; Javan, Ramin; Radvany, Martin G; Shih, George

    2015-10-01

    The end-user of mobile device apps in the practice of clinical radiology should be aware of security measures that prevent unauthorized use of the device, including passcode policies, methods for dealing with failed login attempts, network manager-controllable passcode enforcement, and passcode enforcement for the protection of the mobile device itself. Protection of patient data must be in place that complies with the Health Insurance Portability and Accountability Act and U.S. Federal Information Processing Standards. Device security measures for data protection include methods for locally stored data encryption, hardware encryption, and the ability to locally and remotely clear data from the device. As these devices transfer information over both local wireless networks and public cell phone networks, wireless network security protocols, including wired equivalent privacy and Wi-Fi protected access, are important components in the chain of security. Specific virtual private network protocols, Secure Sockets Layer and related protocols (especially in the setting of hypertext transfer protocols), native apps, virtual desktops, and nonmedical commercial off-the-shelf apps require consideration in the transmission of medical data over both private and public networks. Enterprise security and management of both personal and enterprise mobile devices are discussed. Finally, specific standards for hardware and software platform security, including prevention of hardware tampering, protection from malicious software, and application authentication methods, are vital components in establishing a secure platform for the use of mobile devices in the medical field. © RSNA, 2015.

  2. [Progress in research of mobile health intervention].

    Science.gov (United States)

    Huang, Z; Ning, P S; Cheng, P X; Hu, G Q

    2016-10-10

    With the rapid development of mobile communication technology and the growing popularity of smartphones worldwide, mobile health has become an extension of e-Health and Tele-Health, and is of value in the research and practice of public health. In this paper, we systematically assessed research literature of mobile health' s application on disease prevention and control as well as health promotion. Based on the characteristics of current literature, this paper focused on the application of mobile health in maternal health promotion, chronic disease management, and communicable disease prevention and control to provide reference for the mobile health intervention research in China.

  3. Residential mobility : Towards progress in mobility health research

    NARCIS (Netherlands)

    Morris, T.; Manley, D.J.; Sabel, C.E.

    2016-01-01

    Research into health disparities has long recognized the importance of residential mobility as a crucial factor in determining health outcomes. However, a lack of connectivity between the health and mobility literatures has led to a stagnation of theory and application on the health side, which

  4. Mobile technologies in progress of teaching and learning: teaching mobility?

    Directory of Open Access Journals (Sweden)

    Osmar Hélio Alves Araújo

    2016-04-01

    Full Text Available The article is a survey of basic education teachers in the municipality of Iguatu/CE and aimed to verify if teachers use mobile technology in the classroom as an educational resource, as well as investigate to what extent the professional qualifications of these professionals drives an authentic, autonomous teaching action before the harvest of mobile technologies. The subjects are teachers who work in elementary school. Methodologically, constitutes in a field research, with retaining the qualitative approach, aiming to enhance the school in contemporary times is addressed by changes brought to the company by the technological revolution, especially the proliferation of mobile technologies, which are driving changes in processes teaching and learning. We used semi structured and reflective interview as a technique for data collection. They have as the theoretical studies of Alarcão (2001, Freire (1987, 1992, 2001, Libâneo (2001, 2002, 2005, 2011, Nóvoa (2009, Tardif (2001 UNESCO (2013, Veen and Vrakking (2009. The results of the research showed that teachers, for the most part, do not use the apparatus of mobile technologies in pedagogical practice, and point to the picture of insufficient professional qualification for a teaching practice in the context of safe and educationally effectively technologies. However, this split ends, so in need of a continuous training process that deepens also in reality and knowledge that teachers have. As regard as pillars the changes that the current social context has experienced, among which we highlight the technological changes that proliferate dramatically.

  5. Primer-Independent DNA Synthesis by a Family B DNA Polymerase from Self-Replicating Mobile Genetic Elements

    Directory of Open Access Journals (Sweden)

    Modesto Redrejo-Rodríguez

    2017-11-01

    Full Text Available Family B DNA polymerases (PolBs play a central role during replication of viral and cellular chromosomes. Here, we report the discovery of a third major group of PolBs, which we denote primer-independent PolB (piPolB, that might be a link between the previously known protein-primed and RNA/DNA-primed PolBs. PiPolBs are encoded by highly diverse mobile genetic elements, pipolins, integrated in the genomes of diverse bacteria and also present as circular plasmids in mitochondria. Biochemical characterization showed that piPolB displays efficient DNA polymerization activity that can use undamaged and damaged templates and is endowed with proofreading and strand displacement capacities. Remarkably, the protein is also capable of template-dependent de novo DNA synthesis, i.e., DNA-priming activity, thereby breaking the long-standing dogma that replicative DNA polymerases require a pre-existing primer for DNA synthesis. We suggest that piPolBs are involved in self-replication of pipolins and may also contribute to bacterial DNA damage tolerance.

  6. Mobility as Progressivity: Ranking Income Processes According to Equality of Opportunity

    OpenAIRE

    Roland Benabou; Efe A. Ok

    2001-01-01

    Interest in economic mobility stems largely from its perceived role as an equalizer of opportunities, though not necessarily of outcomes. In this paper we show that this view leads very naturally to a methodology for the measurement of social mobility which has strong parallels with the theory of progressive taxation. We characterize opportunity--equalizing mobility processes, and provide simple criteria to determine when one process is more equalizing than another. We then explain how this m...

  7. SINEs of progress: Mobile element applications to molecular ecology.

    Science.gov (United States)

    Ray, David A

    2007-01-01

    Mobile elements represent a unique and under-utilized set of tools for molecular ecologists. They are essentially homoplasy-free characters with the ability to be genotyped in a simple and efficient manner. Interpretation of the data generated using mobile elements can be simple compared to other genetic markers. They exist in a wide variety of taxa and are useful over a wide selection of temporal ranges within those taxa. Furthermore, their mode of evolution instills them with another advantage over other types of multilocus genotype data: the ability to determine loci applicable to a range of time spans in the history of a taxon. In this review, I discuss the application of mobile element markers, especially short interspersed elements (SINEs), to phylogenetic and population data, with an emphasis on potential applications to molecular ecology.

  8. Carotid Artery Stenting Successfully Prevents Progressive Stroke Due to Mobile Plaque

    Directory of Open Access Journals (Sweden)

    Masahiro Oomura

    2015-05-01

    Full Text Available We report a case of progressive ischemic stroke due to a mobile plaque, in which carotid artery stenting successfully prevented further infarctions. A 78-year-old man developed acute multiple infarcts in the right hemisphere, and a duplex ultrasound showed a mobile plaque involving the bifurcation of the left common carotid artery. Maximal medical therapy failed to prevent further infarcts, and the number of infarcts increased with his neurological deterioration. Our present case suggests that the deployment of a closed-cell stent is effective to prevent the progression of the ischemic stroke due to the mobile plaque.

  9. Human Exploration Systems and Mobility Capability Roadmap Progress Review

    Science.gov (United States)

    Culbert, Chris; Taylor, Jeff

    2005-01-01

    Contents include the following: Capability Roadmap Team. Capability Description and Capability Breakdown Structure. Benefits of the Human Systems and Mobility Capability. Roadmap Process and Approach. Drivers and Assumptions for the whole team. Current State-of-the-Art, Assumptions and Requirements will be covered in the appropriate sections. Capability Presentations by Leads under Roadmap (Repeated for each capability under roadmap). Capability Description, Benefits, Current State-of-the-Art. Capability Requirements and Assumptions. Roadmap for Capability. Capability Readiness Level. Technology Readiness Level. Figures of Merit. Summary of Top Level Capability. Significant Technical Challenges. Summary and Forward Work.

  10. Evaluation of a Progressive Mobility Protocol in Postoperative Cardiothoracic Surgical Patients.

    Science.gov (United States)

    Floyd, Shawn; Craig, Sarah W; Topley, Darla; Tullmann, Dorothy

    2016-01-01

    Cardiothoracic surgical patients are at high risk for complications related to immobility, such as increased intensive care and hospital length of stay, intensive care unit readmission, pressure ulcer development, and deep vein thrombosis/pulmonary embolus. A progressive mobility protocol was started in the thoracic cardiovascular intensive care unit in a rural academic medical center. The purpose of the progressive mobility protocol was to increase mobilization of postoperative patients and decrease complications related to immobility in this unique patient population. A matched-pairs design was used to compare a randomly selected sample of the preintervention group (n = 30) to a matched postintervention group (n = 30). The analysis compared outcomes including intensive care unit and hospital length of stay, intensive care unit readmission occurrence, pressure ulcer prevalence, and deep vein thrombosis/pulmonary embolism prevalence between the 2 groups. Although this comparison does not achieve statistical significance (P mobility. This study has implications for nursing, hospital administration, and therapy services with regard to staffing and cost savings related to fewer complications of immobility. Future studies with a larger sample size and other populations are warranted.

  11. MRI Primer

    International Nuclear Information System (INIS)

    Oldendorf, W.; Oldendorf, W. Jr.

    1991-01-01

    Designed for studies, radiologists, and clinicians at all levels of training, this book provides a basic introduction to the principles, physics, and instrumentation of magnetic resonance imaging. The fundamental concepts that are essential for the optimal clinical use of MRI are thoroughly explained in easily accessible terms. To facilitate the reader's comprehension, the material is presented nonmathematically, using no equations and a minimum of symbols and abbreviations. MRI Primer presents a clear account of the phenomenon of nuclear magnetic resonance and the use of gradient magnetic fields to create clinically useful images of cross-sectional slices. Close attention is given to the magnetization vector as a means of expressing nuclear behavior, the role of T 1 and T 2 weighing in imaging, the use of contrast agents, and the pulse sequences most often used in clinical practice, as well as to the relative capabilities and limitations of MRI and CT. The basic hardware components of an MRI scanner are described in detail. Sample MRI scans illustrate how MRI characterizes tissue. An appendix provides a brief introduction to quantum processes in MRI

  12. Use of optokinetics based OKCSIB protocol in restoring mobility in primary progressive MS.

    Science.gov (United States)

    Chitambira, Benjamin; McConaghy, Ciara

    2017-10-04

    The case is of a mid-40s patient who developed progressive muscle weakness and loss of mobility over 6 weeks due to primary progressive multiple sclerosis. 2.5 days before admission, she became bed bound with weakness of 1/5 on the Oxford scale. She normally rested for a couple of days after similar periods of worsening symptoms and then got back on her feet although with worse balance. She was treated with optokinetic chart stimulation and sensory interaction for balance (OKCSIB) protocol. Within 2 days of intervention, she was mobile with a delta frame and supervision of one. By the end of a week, she was independently mobile with her delta frame. It is recommended that instead of just practising function, the OKCSIB protocol be used to regain antigravity extensor control loss of which leads to deteriorating function in neurological conditions. © BMJ Publishing Group Ltd (unless otherwise stated in the text of the article) 2017. All rights reserved. No commercial use is permitted unless otherwise expressly granted.

  13. Progressive friction mobilization and enhanced Janssen's screening in confined granular rafts

    Science.gov (United States)

    Saavedra V., Oscar; Elettro, Hervé; Melo, Francisco

    2018-04-01

    Confined two-dimensional assemblies of floating particles, known as granular rafts, are prone to develop a highly nonlinear response under compression. Here we investigate the transition to the friction-dominated jammed state and map the gradual development of the internal stress profile with flexible pressure sensors distributed along the raft surface. Surprisingly, we observe that the surface stress screening builds up much more slowly than previously thought and that the typical screening distance later dramatically decreases. We explain this behavior in terms of progressive friction mobilization, where the full amplitude of the frictional forces is only reached after a macroscopic local displacement. At further stages of compression, rafts of large length-to-width aspect ratio experience much stronger screenings than the full mobilization limit described by the Janssen's model. We solve this paradox using a simple mathematical analysis and show that such enhanced screening can be attributed to a localized compaction front, essentially shielding the far field from compressive stresses.

  14. Mobilities Mobilities

    Directory of Open Access Journals (Sweden)

    César Pompeyo

    2011-12-01

    Full Text Available Urry, John (2007 Mobilities.Oxford: Polity Press.Urry, John (2007 Mobilities.Oxford: Polity Press.John Urry (1946-, profesor en la Universidad de Lancaster, es un sociólogo de sobra conocido y altamente reputado en el panorama internacional de las ciencias sociales. Su dilatada carrera, aparentemente dispersa y diversificada, ha seguido senderos bastante bien definidos dejando tras de sí un catálogo extenso de obras sociológicas de primer nivel. Sus primeros trabajos se centraban en el campo de la teoría social y la filosofía de las ciencias sociales o de la sociología del poder [...

  15. The Economic and Clinical Impact of Sustained Use of a Progressive Mobility Program in a Neuro-ICU.

    Science.gov (United States)

    Hester, Jeannette M; Guin, Peggy R; Danek, Gale D; Thomas, Jaime R; Titsworth, William L; Reed, Richard K; Vasilopoulos, Terrie; Fahy, Brenda G

    2017-06-01

    To investigate a progressive mobility program in a neurocritical care population with the hypothesis that the benefits and outcomes of the program (e.g., decreased length of stay) would have a significant positive economic impact. Retrospective analysis of economic and clinical outcome data before, immediately following, and 2 years after implementation of the Progressive Upright Mobility Protocol Plus program (UF Health Shands Hospital, Gainesville, FL) involving a series of planned movements in a sequential manner with an additional six levels of rehabilitation in the neuro-ICU at UF Health Shands Hospital. Thirty-bed neuro-ICU in an academic medical center. Adult neurologic and neurosurgical patients: 1,118 patients in the pre period, 731 patients in the post period, and 796 patients in the sustained period. Implementation of Progressive Upright Mobility Protocol Plus. ICU length of stay decreased from 6.5 to 5.8 days in the immediate post period and 5.9 days in the sustained period (F(2,2641) = 3.1; p = 0.045). Hospital length of stay was reduced from 11.3 ± 14.1 days to 8.6 ± 8.8 post days and 8.8 ± 9.3 days sustained (F(2,2641) = 13.0; p mobility program in the neurocritical care population has clinical and financial benefits associated with its implementation and should be considered.

  16. Polyacid macromolecule primers

    Science.gov (United States)

    Sugama, Toshifumi.

    1989-12-26

    Hydrophilic polyacids are described, such as macromolecules of polyitaconic acid and polyacrylic acid, where such macromolecules have molecular weights >50,000 as primers between a polymeric top coating, such as polyurethane, and an oxidized aluminum or aluminum alloy. A near monolayer of primer is used in polymeric adhesive/oxidized aluminum adhered joint systems in 0.05% primer concentration to give superior results in standard peel tests. 2 figs.

  17. Mobilities

    DEFF Research Database (Denmark)

    to social networks, personal identities, and our relationship to the built environment. The omnipresence of mobilities within everyday life, high politics, technology, and tourism (to mention but a few) all point to a key insight harnessed by the ‘mobilities turn’. Namely that mobilities is much more than......The world is on the move. This is a widespread understanding by many inhabitants of contemporary society across the Globe. But what does it actually mean? During over one decade the ‘mobilities turn’ within the social sciences have provided a new set of insights into the repercussions of mobilities...... and environmental degradation. The spaces and territories marked by mobilities as well as the sites marked by the bypassing of such are explored. Moreover, the architectural and technological dimensions to infrastructures and sites of mobilities will be included as well as the issues of power, social exclusion...

  18. MPprimer: a program for reliable multiplex PCR primer design

    Directory of Open Access Journals (Sweden)

    Wang Xiaolei

    2010-03-01

    Full Text Available Abstract Background Multiplex PCR, defined as the simultaneous amplification of multiple regions of a DNA template or multiple DNA templates using more than one primer set (comprising a forward primer and a reverse primer in one tube, has been widely used in diagnostic applications of clinical and environmental microbiology studies. However, primer design for multiplex PCR is still a challenging problem and several factors need to be considered. These problems include mis-priming due to nonspecific binding to non-target DNA templates, primer dimerization, and the inability to separate and purify DNA amplicons with similar electrophoretic mobility. Results A program named MPprimer was developed to help users for reliable multiplex PCR primer design. It employs the widely used primer design program Primer3 and the primer specificity evaluation program MFEprimer to design and evaluate the candidate primers based on genomic or transcript DNA database, followed by careful examination to avoid primer dimerization. The graph-expanding algorithm derived from the greedy algorithm was used to determine the optimal primer set combinations (PSCs for multiplex PCR assay. In addition, MPprimer provides a virtual electrophotogram to help users choose the best PSC. The experimental validation from 2× to 5× plex PCR demonstrates the reliability of MPprimer. As another example, MPprimer is able to design the multiplex PCR primers for DMD (dystrophin gene which caused Duchenne Muscular Dystrophy, which has 79 exons, for 20×, 20×, 20×, 14×, and 5× plex PCR reactions in five tubes to detect underlying exon deletions. Conclusions MPprimer is a valuable tool for designing specific, non-dimerizing primer set combinations with constrained amplicons size for multiplex PCR assays.

  19. Quick spacecraft charging primer

    International Nuclear Information System (INIS)

    Larsen, Brian Arthur

    2014-01-01

    This is a presentation in PDF format which is a quick spacecraft charging primer, meant to be used for program training. It goes into detail about charging physics, RBSP examples, and how to identify charging.

  20. Nanotechnology: A Policy Primer

    Science.gov (United States)

    2013-06-24

    savings in the United States of 24 million barrels of oil.4 • Universal access to clean water. Nanotechnology water desalination and filtration...CRS Report for Congress Prepared for Members and Committees of Congress Nanotechnology : A Policy Primer John F. Sargent Jr. Specialist...COVERED 00-00-2013 to 00-00-2013 4. TITLE AND SUBTITLE Nanotechnology : A Policy Primer 5a. CONTRACT NUMBER 5b. GRANT NUMBER 5c. PROGRAM ELEMENT

  1. Long-term risk from actinides in the environment: Modes of mobility. 1998 annual progress report

    International Nuclear Information System (INIS)

    Breshears, D.D.; Hakonson, T.E.; Ibrahim, S.A.; Whicker, F.W.; Whicker, J.J.

    1998-01-01

    'The mobility of actinides in surface soils is a key issue of concern at several DOE facilities in arid and semiarid environments, including Rocky Flats, Hanford, Nevada Test Site, Idaho National Engineering Laboratory, and Los Alamos National Laboratory and the Waste Isolation Pilot Plant (WIPP). Key sources of uncertainty in assessing Pu mobility are the magnitudes of mobility resulting from three modes of transport: (1) wind erosion, (2) water erosion, and (3) vertical migration. Each of these three processes depend on numerous environmental factors and they compete with one another, particularly for actinides in very shallow soils (∼ 1 mm). The overall goal of the study is to quantify the mobility of soil actinides from all three modes. The authors study is using field measurements, laboratory experiments, and ecological modeling to address these three processes at three DOE facilities where actinide kinetics are of concern: WIPP, Rocky Flats, and Hanford. Wind erosion is being measured with suite of monitoring equipment, water erosion is being studied with rainfall simulation experiments, vertical migration is being studied in controlled laboratory experiments, and the three processes are being integrated using ecological modeling. Estimates for clean up of soil actinides for the extensive tracts of DOE land range to hundreds of billion $ in the US. Without studies of these processes, unnecessary clean-up of these areas may waste billions of dollars and cause irreparable ecological damage through the soil removal. Further, the outcomes of litigation against DOE are dependent on quantifying the mobility of actinides in surface soils.'

  2. Progress on Broadband Access to the Internet and Use of Mobile Devices in the United States.

    Science.gov (United States)

    Serrano, Katrina J; Thai, Chan L; Greenberg, Alexandra J; Blake, Kelly D; Moser, Richard P; Hesse, Bradford W

    Healthy People 2020 (HP2020) aims to improve population health outcomes through several objectives, including health communication and health information technology. We used 7 administrations of the Health Information National Trends Survey to examine HP2020 goals toward access to the Internet through broadband and mobile devices (N = 34 080). We conducted descriptive analyses and obtained predicted marginals, also known as model-adjusted risks, to estimate the association between demographic characteristics and use of mobile devices. The HP2020 target (7.7% of the US population) for accessing the Internet through a cellular network was surpassed in 2014 (59.7%), but the HP2020 target (83.2%) for broadband access fell short (63.8%). Sex and age were associated with accessing the Internet through a cellular network throughout the years (Wald F test, P Internet through mobile devices presents an opportunity for technology-based health interventions that should be explored.

  3. Connecting the New World. Nets, mobility and progress in the Age of Alexander von Humboldt

    Directory of Open Access Journals (Sweden)

    Moritz von Brescius

    2012-12-01

    Beschleunigung“ analytisch verbunden werden, da diese Faktoren eine zentrale Rolle für die „Verwandlung der Welt“ im 19. Jahrhundert spielten. Abstract This article explores the link between the profound technological transformations of the nineteenth century and the life and work of the Prussian scholar Alexander von Humboldt (1769-1859. It analyses how Humboldt sought to appropriate the revolutionary new communication and transportation technologies of the time in order to integrate the American continent into global networks of commercial, intellectual and material exchange. Recent scholarship on Humboldt’s expedition to the New World (1799-1804 has claimed that his descriptions of tropical landscapes opened up South America to a range of „transformative interventions“ (Pratt by European capitalists and investors. These studies, however, have not analysed the motivations underlying Humboldt’s support for such intrusions into nature. Furthermore, they have not explored the role that such projects played in shaping Humboldt’s understanding of the forces behind the progress of societies. To comprehend Humboldt’s approval for human interventions in America’s natural world, this study first explores the role that eighteenth-century theories of progress and the notion of geographical determinism played in shaping his conception of civilisational development. It will look at concrete examples of transformative interventions in the American hemisphere that were actively proposed by Humboldt and intended to overcome natural obstacles to human interaction. These were the use of steamships, electric telegraphy, railroads and large-scale canals that together enabled global trade and communication to occur at an unprecedented pace. All these contemporary innovations will be linked to the four motifs of nets, mobility, progress and acceleration, which were driving forces behind the „transformation of the world“ that took place in the course of the nineteenth century. Resumen

  4. New Homes, New Neighborhoods, New Schools: A Progress Report on the Baltimore Housing Mobility Program

    Science.gov (United States)

    Engdahl, Lora

    2009-01-01

    In the Baltimore region, a successful housing mobility program is providing families living in very disadvantaged inner city communities with a new home and a chance for a new life. Minority voucher holders in the federal Housing Choice Voucher Program (formerly titled Section 8) have often been limited to living in "voucher submarkets"…

  5. The Pathways to Enterprise Mobile Readiness: Analysis of Perceptions, Pressures, Preparedness, and Progression

    Science.gov (United States)

    Johnson, James Nathaniel

    2013-01-01

    Ubiquitous computing is a near reality in both the private and public arena. Business and personal spaces are seeing a proliferation of mobile computing devices and pervasive computing technologies. This phenomenon is creating a unique set of challenges for organizational IT professionals, specifically in the numerous spillover effects of having…

  6. The Los Alamos primer

    CERN Document Server

    Serber, Robert

    2018-01-01

    Unabridged declassified value reproduction of The Los Alamos Primer by Robert Serber, in full color with all censor markings. This is the booklet given to new workers at Los Alamos during World War II, to catch them up on how to build a practical fission bomb. The Primer was driven by Robert Oppenheimer asking his protégé Robert Serber to summarize all knowledge and possible solutions known as of April 1943 in a series of lectures. Serber did such an excellent job that the notes from the series was turned into The Los Alamos Primer. Serber was known as an expert that bridged theory and reality, and so was also chosen to be one of the first Americans to enter Hiroshima and Nagasaki to assess the atomic damage in 1945.

  7. China Energy Primer

    Energy Technology Data Exchange (ETDEWEB)

    Ni, Chun Chun

    2009-11-16

    Based on extensive analysis of the 'China Energy Databook Version 7' (October 2008) this Primer for China's Energy Industry draws a broad picture of China's energy industry with the two goals of helping users read and interpret the data presented in the 'China Energy Databook' and understand the historical evolution of China's energy inustry. Primer provides comprehensive historical reviews of China's energy industry including its supply and demand, exports and imports, investments, environment, and most importantly, its complicated pricing system, a key element in the analysis of China's energy sector.

  8. Mobil Oil Canada annual progress report to the Voluntary Challenge and Registry Program 1998

    International Nuclear Information System (INIS)

    1998-10-01

    Mobil Oil Canada has prepared estimates of its emissions of major greenhouse gases for the years 1994, 1995, 1996 and 1997. While the Voluntary Challenge and Registry (VCR) encouraged an inventory of emissions for 1990 to the present, data are not present for earlier than 1994. An inventory summary is included that outlines the quantity of emissions due to the following sources for each facility: combustion of fuel gas for heaters, boilers and compressors, flaring and venting of natural gas, and consumption of coal generated electricity. For all Mobil operated facilities in 1997, GHG emissions existed in the following fractions: 43% due to fuel gas use, 42% due to gas flaring and venting, and 15% from electricity consumption. In 1996, emissions were more evenly distributed amongst the three major sources. A discussion is included of emissions produced and energy used by each process type with data shown in tables. This includes: heavy oil facilities, light oil facilities, sulfur recovery facilities, a sour gas facility, a sweet gas facility, and a thermal heavy oil facility. Various projects were undertaken at each Mobil operated facility to increase energy efficiency and reduce emissions. A summary of the fuel gas, electricity and emission savings for each facility is described, as well as the main actions responsible for each emission saving. These cover: light oil facilities, sulfur recovery facilities, a thermal heavy oil facility, a conventional heavy oil facility, a sweet gas facility, and a sour gas facility. 5 tabs., 9 figs

  9. Semantic Web Primer

    NARCIS (Netherlands)

    Antoniou, Grigoris; Harmelen, Frank van

    2004-01-01

    The development of the Semantic Web, with machine-readable content, has the potential to revolutionize the World Wide Web and its use. A Semantic Web Primer provides an introduction and guide to this still emerging field, describing its key ideas, languages, and technologies. Suitable for use as a

  10. Final Technical Progress Report Long term risk from actinides in the environment: Modes of mobility; FINAL

    International Nuclear Information System (INIS)

    Thomas B. Kirchner

    2002-01-01

    The key source of uncertainty in assessing actinide mobility is the relative importance of transport by: (1) wind erosion, (2) water erosion, and (3) vertical migration. Each of these three processes depends on several environmental factors and they compete with one another. A scientific assessment of the long-term risks associated with actinides in surface soils depends on better quantifying each of these three modes of mobility. The objective from our EMSP study was to quantify the mobility of soil actinides by wind erosion, water erosion, and vertical migration at three semiarid sites where actinide mobility is a key technical, social and legal issue. This EMSP project was the first to evaluate all three factors at a site. The approach has been to investigate both short- and long-term issues based on field and lab studies and model comparisons. Our results demonstrate the importance of incorporating threshold responses into a modeling framework that accounts for environmental factors and natural disturbances that trigger large changes in actinide mobility. The study measured erosional losses of sediment and fallout cesium (an actinide analogue) from field plots located near WIPP in 1998. The results highlight the large effect of burning as a disturbance on contaminant transport and mobility via runoff and erosion. The results show that runoff, erosion, and actinide transport are (1) strongly site specific-differences in radionuclide transport between WIPP and Rocky Flats differed by a factor of twelve because of soil and vegetation differences, and (2) are strongly impacted by disturbances such as fire, which can increase runoff, erosion, and actinide transport by more than an order of magnitude. In addition, a laboratory experiment using soil columns was conducted to investigate the vertical transport of contaminants in sandy soils. Nine columns of soil collected from the vicinity of the WIPP site were prepared. The column consisted of a piece of PVC pipe 20 cm

  11. Final Technical Progress Report Long term risk from actinides in the environment: Modes of mobility

    International Nuclear Information System (INIS)

    Kirchner, Thomas B.

    2002-01-01

    The key source of uncertainty in assessing actinide mobility is the relative importance of transport by: (1) wind erosion, (2) water erosion, and (3) vertical migration. Each of these three processes depends on several environmental factors and they compete with one another. A scientific assessment of the long-term risks associated with actinides in surface soils depends on better quantifying each of these three modes of mobility. The objective from our EMSP study was to quantify the mobility of soil actinides by wind erosion, water erosion, and vertical migration at three semiarid sites where actinide mobility is a key technical, social and legal issue. This EMSP project was the first to evaluate all three factors at a site. The approach has been to investigate both short- and long-term issues based on field and lab studies and model comparisons. Our results demonstrate the importance of incorporating threshold responses into a modeling framework that accounts for environmental factors and natural disturbances that trigger large changes in actinide mobility. The study measured erosional losses of sediment and fallout cesium (an actinide analogue) from field plots located near WIPP in 1998. The results highlight the large effect of burning as a disturbance on contaminant transport and mobility via runoff and erosion. The results show that runoff, erosion, and actinide transport are (1) strongly site specific-differences in radionuclide transport between WIPP and Rocky Flats differed by a factor of twelve because of soil and vegetation differences, and (2) are strongly impacted by disturbances such as fire, which can increase runoff, erosion, and actinide transport by more than an order of magnitude. In addition, a laboratory experiment using soil columns was conducted to investigate the vertical transport of contaminants in sandy soils. Nine columns of soil collected from the vicinity of the WIPP site were prepared. The column consisted of a piece of PVC pipe 20 cm

  12. Final Technical Progress Report Long term risk from actinides in the environment: Modes of mobility

    Energy Technology Data Exchange (ETDEWEB)

    Thomas B. Kirchner

    2002-03-22

    The key source of uncertainty in assessing actinide mobility is the relative importance of transport by: (1) wind erosion, (2) water erosion, and (3) vertical migration. Each of these three processes depends on several environmental factors and they compete with one another. A scientific assessment of the long-term risks associated with actinides in surface soils depends on better quantifying each of these three modes of mobility. The objective from our EMSP study was to quantify the mobility of soil actinides by wind erosion, water erosion, and vertical migration at three semiarid sites where actinide mobility is a key technical, social and legal issue. This EMSP project was the first to evaluate all three factors at a site. The approach has been to investigate both short- and long-term issues based on field and lab studies and model comparisons. Our results demonstrate the importance of incorporating threshold responses into a modeling framework that accounts for environmental factors and natural disturbances that trigger large changes in actinide mobility. The study measured erosional losses of sediment and fallout cesium (an actinide analogue) from field plots located near WIPP in 1998. The results highlight the large effect of burning as a disturbance on contaminant transport and mobility via runoff and erosion. The results show that runoff, erosion, and actinide transport are (1) strongly site specific-differences in radionuclide transport between WIPP and Rocky Flats differed by a factor of twelve because of soil and vegetation differences, and (2) are strongly impacted by disturbances such as fire, which can increase runoff, erosion, and actinide transport by more than an order of magnitude. In addition, a laboratory experiment using soil columns was conducted to investigate the vertical transport of contaminants in sandy soils. Nine columns of soil collected from the vicinity of the WIPP site were prepared. The column consisted of a piece of PVC pipe 20 cm

  13. Defense Primer: DOD Contractors

    Science.gov (United States)

    2017-02-10

    functions, from intelligence analysis or software development to landscaping or food service. Why does DOD use individual contractors? Going back to...that provide professional services, from research to management support. The bulk of contractors—more than 70%—provide products, and these include...10 U.S.C. Part IV: Service, Supply, and Procurement. CRS Products CRS In Focus IF10548, Defense Primer: U.S. Defense Industrial Base, by Daniel

  14. Coal Bed Methane Primer

    Energy Technology Data Exchange (ETDEWEB)

    Dan Arthur; Bruce Langhus; Jon Seekins

    2005-05-25

    During the second half of the 1990's Coal Bed Methane (CBM) production increased dramatically nationwide to represent a significant new source of income and natural gas for many independent and established producers. Matching these soaring production rates during this period was a heightened public awareness of environmental concerns. These concerns left unexplained and under-addressed have created a significant growth in public involvement generating literally thousands of unfocused project comments for various regional NEPA efforts resulting in the delayed development of public and fee lands. The accelerating interest in CBM development coupled to the growth in public involvement has prompted the conceptualization of this project for the development of a CBM Primer. The Primer is designed to serve as a summary document, which introduces and encapsulates information pertinent to the development of Coal Bed Methane (CBM), including focused discussions of coal deposits, methane as a natural formed gas, split mineral estates, development techniques, operational issues, producing methods, applicable regulatory frameworks, land and resource management, mitigation measures, preparation of project plans, data availability, Indian Trust issues and relevant environmental technologies. An important aspect of gaining access to federal, state, tribal, or fee lands involves education of a broad array of stakeholders, including land and mineral owners, regulators, conservationists, tribal governments, special interest groups, and numerous others that could be impacted by the development of coal bed methane. Perhaps the most crucial aspect of successfully developing CBM resources is stakeholder education. Currently, an inconsistent picture of CBM exists. There is a significant lack of understanding on the parts of nearly all stakeholders, including industry, government, special interest groups, and land owners. It is envisioned the Primer would being used by a variety of

  15. Predictive maintenance primer

    International Nuclear Information System (INIS)

    Flude, J.W.; Nicholas, J.R.

    1991-04-01

    This Predictive Maintenance Primer provides utility plant personnel with a single-source reference to predictive maintenance analysis methods and technologies used successfully by utilities and other industries. It is intended to be a ready reference to personnel considering starting, expanding or improving a predictive maintenance program. This Primer includes a discussion of various analysis methods and how they overlap and interrelate. Additionally, eighteen predictive maintenance technologies are discussed in sufficient detail for the user to evaluate the potential of each technology for specific applications. This document is designed to allow inclusion of additional technologies in the future. To gather the information necessary to create this initial Primer the Nuclear Maintenance Applications Center (NMAC) collected experience data from eighteen utilities plus other industry and government sources. NMAC also contacted equipment manufacturers for information pertaining to equipment utilization, maintenance, and technical specifications. The Primer includes a discussion of six methods used by analysts to study predictive maintenance data. These are: trend analysis; pattern recognition; correlation; test against limits or ranges; relative comparison data; and statistical process analysis. Following the analysis methods discussions are detailed descriptions for eighteen technologies analysts have found useful for predictive maintenance programs at power plants and other industrial facilities. Each technology subchapter has a description of the operating principles involved in the technology, a listing of plant equipment where the technology can be applied, and a general description of the monitoring equipment. Additionally, these descriptions include a discussion of results obtained from actual equipment users and preferred analysis techniques to be used on data obtained from the technology. 5 refs., 30 figs

  16. MethPrimer: designing primers for methylation PCRs.

    Science.gov (United States)

    Li, Long-Cheng; Dahiya, Rajvir

    2002-11-01

    DNA methylation is an epigenetic mechanism of gene regulation. Bisulfite- conversion-based PCR methods, such as bisulfite sequencing PCR (BSP) and methylation specific PCR (MSP), remain the most commonly used techniques for methylation mapping. Existing primer design programs developed for standard PCR cannot handle primer design for bisulfite-conversion-based PCRs due to changes in DNA sequence context caused by bisulfite treatment and many special constraints both on the primers and the region to be amplified for such experiments. Therefore, the present study was designed to develop a program for such applications. MethPrimer, based on Primer 3, is a program for designing PCR primers for methylation mapping. It first takes a DNA sequence as its input and searches the sequence for potential CpG islands. Primers are then picked around the predicted CpG islands or around regions specified by users. MethPrimer can design primers for BSP and MSP. Results of primer selection are delivered through a web browser in text and in graphic view.

  17. A Quantum Groups Primer

    Science.gov (United States)

    Majid, Shahn

    2002-05-01

    Here is a self-contained introduction to quantum groups as algebraic objects. Based on the author's lecture notes for the Part III pure mathematics course at Cambridge University, the book is suitable as a primary text for graduate courses in quantum groups or supplementary reading for modern courses in advanced algebra. The material assumes knowledge of basic and linear algebra. Some familiarity with semisimple Lie algebras would also be helpful. The volume is a primer for mathematicians but it will also be useful for mathematical physicists.

  18. The R primer

    CERN Document Server

    Ekstrom, Claus Thorn

    2011-01-01

    Newcomers to R are often intimidated by the command-line interface, the vast number of functions and packages, or the processes of importing data and performing a simple statistical analysis. The R Primer provides a collection of concise examples and solutions to R problems frequently encountered by new users of this statistical software.Rather than explore the many options available for every command as well as the ever-increasing number of packages, the book focuses on the basics of data preparation and analysis and gives examples that can be used as a starting point. The numerous examples i

  19. Primer on Health Surveys

    Directory of Open Access Journals (Sweden)

    David L Nordstrom

    2012-06-01

    Full Text Available The aim of this paper is to introduce novice researchers to surveys as a method of data collection. It starts with the definition of a survey, its major purposes and types as well as changes in the goals surveys have helped to achieve over time. Advantages and disadvantages of surveys over population censuses and medical examinations are discussed. Approaches to questionnaire construction are introduced along with properties that questionnaires are evaluated for. Modes of administration, sample size issues, and data analysis approaches are also introduced. The primer is illustrated with examples of surveys conducted in different countries with various public health purposes.

  20. Math primer for engineers

    CERN Document Server

    Cryer, CW

    2014-01-01

    Mathematics and engineering are inevitably interrelated, and this interaction will steadily increase as the use of mathematical modelling grows. Although mathematicians and engineers often misunderstand one another, their basic approach is quite similar, as is the historical development of their respective disciplines. The purpose of this Math Primer is to provide a brief introduction to those parts of mathematics which are, or could be, useful in engineering, especially bioengineering. The aim is to summarize the ideas covered in each subject area without going into exhaustive detail. Formula

  1. El primer virreinato americano

    Directory of Open Access Journals (Sweden)

    Cassá, Roberto

    2006-12-01

    Full Text Available This article explores the government of viceroy Christopher Columbus in the American territories. We return to the first Spanish settlement in Santo Domingo and the contradictions inherent to this expansionist proyect. The contradictions were part of the logic of the absolutist state and Columbus’ reaction against the controls imposed by the monarchs. Secondly, we look into the dificulties that the Admiral encountered to develop a mercantilist model. In this context, we examine the rationale behind the first government of the Indies and the features that defined the new West Indian society.

    El artículo trata sobre el gobierno de Cristóbal Colón en tierras americanas. Retomamos el tema del primer emplazamiento español en Santo Domingo y las contradicciones que tuvo aquel proyecto debido a la lógica del estado absolutista, a la ambición desmedida del descubridor y a su reacción ante los controles que desde un principio impusieron los monarcas. En un segundo momento analizamos las dificultades que encontró el Almirante para desarrollar un modelo mercantilista acorde a sus ideas y a los acuerdos a que llegó con la Corona. En ese contexto analizamos la lógica del primer gobierno colombinista en las Indias y los rasgos que definieron la nueva sociedad antillana.

  2. COMPARISON OF EFFECTIVENESS OF A PROGRESSIVE MOBILIZATION AND MOZART MUSIC THERAPY ON NON-INVASIVE HEMODYNAMIC STATUS CHANGES IN PATIENTS WITH HEAD INJURY IN THE INTENSIVE CARE UNIT

    Directory of Open Access Journals (Sweden)

    Novi Indriani

    2018-05-01

    Full Text Available Background: The instability of hemodynamic status in patients with head injury with decreased consciousness has an effect on the increase of intracranial pressure. The recovery of hemodynamic status can be done through nursing intervention either by providing a sensory stimulus (music therapy or motor stimulus (progressive mobilization. Objective: To compare the effectiveness of progressive mobilization of level I with Mozart's music therapy on non-invasive hemodynamic status changes in patients with head injury with decreased awareness. Methods: This was a quasy-experimental study with pretest-posttest design. There were 34 samples selected using consecutive sampling, which 17 samples assigned in a group of progressive mobilization and group of music therapy. Paired t-test and Wilcoxon test were used for paired group, and Independent t-test and Mann-Whitney test for unpaired group. Results: Progressive mobilization of level I had significant effect on changes in systolic blood pressure (p = 0.0001, diastolic blood pressure (p = 0.002 and MAP (p = 0.019, and no significant effect on heart rate (p = 0.155, respiration (p = 0.895 and oxygen saturation (p = 0.248. Mozart's music therapy had a significant effect on changes in systolic blood pressure (p = 0.0001, diastolic blood pressure (p = 0.0001, respiration (p= 0.032 and oxygen saturation (p = 0.008, but no effect on MAP (p = 0.561. There was a significant difference between the two interventions in the systolic blood pressure and heart rate variables (p 0.05. Conclusion: The Mozart's music therapy is more effective on non-invasive hemodynamic status changes in patients with head injury with decreased consciousness compared with progressive mobilization of level I.

  3. A primer on water

    Science.gov (United States)

    Leopold, Luna Bergere; Langbein, Walter Basil

    1960-01-01

    When you open the faucet you expect water to flow. And you expect it to flow night or day, summer or winter, whether you want to fill a glass or water the lawn. It should be clean and pure, without any odor.You have seen or read about places where the water doesn't have these qualities. You may have lived in a city where you were allowed to water the lawn only during a few hours of certain days. We know a large town where the water turns brown after every big rainstorm.Beginning shortly after World War II, large areas in the Southwestern United States had a 10-year drought, and newspapers published a lot of information about its effects. Some people say that the growing demand for water will cause serious shortages over much of the country in the next 10 to 40 years. But it has always been true that while water wells and springs dry up in some places, floods may be occurring in other places at the same time.Nearly every month news stories are published describing floods somewhere in the country. In fact, every year, on the average, 75,000 persons are forced from their homes by floods. In some years, as in 1951 when the lower Kansas River experienced a great flood, half a million people are affected. To understand the reasons for such recurring distress, it is necessary to know something about rivers and about the flat land or flood plain that borders the river.Interest in water and related problems is growing as our population increases and as the use of water becomes steadily greater. To help meet this heightened interest in general information about water and its use and control is the reason this primer was written. The primer is in two parts. The first part tells about hydrology, or the science that concerns the relation of water to our earth, and the second part describes the development of water supplies and the use of water. The Geological Survey is publishing this primer in nontechnical language in the hope that it will enable the general reader to

  4. Validation of mobile eye tracking as novel and efficient means for differentiating progressive supranuclear palsy from Parkinson’s disease

    Directory of Open Access Journals (Sweden)

    Svenja eMarx

    2012-12-01

    Full Text Available Background: The decreased ability to carry out vertical saccades is a key symptom of Progressive Supranuclear Palsy (PSP. Objective measurement devices can help to reliably detect subtle eye-movement disturbances to improve sensitivity and specificity of the clinical diagnosis. The present study aims at transferring findings from restricted stationary video-oculography to a wearable head-mounted device, which can be readily applied in clinical practice.Methods: We investigated the eye movements in 10 possible or probable PSP patients, 11 Parkinson’s disease (PD patients and 10 age-matched healthy controls (HC using a mobile, gaze-driven video camera setup (EyeSeeCam. Ocular movements were analyzed during a standardized fixation protocol and in an unrestricted real-life scenario while walking along a corridor.Results: The EyeSeeCam detected prominent impairment of both saccade velocity and amplitude in PSP patients, differentiating them from PD and HCs. Differences were particularly evident for saccades in the vertical plane, and stronger for saccades than for other eye movements. Differences were more pronounced during the standardized protocol than in the real-life scenario. Conclusions: Combined analysis of saccade velocity and saccade amplitude during the fixation protocol with the EyeSeeCam provides a simple, rapid (< 20s and reliable tool to differentiate clinically established PSP patients from PD and HCs. As such, our findings prepare the ground for using wearable eye-tracking in patients with uncertain diagnoses.

  5. Promotion primer. Foerderfibel

    Energy Technology Data Exchange (ETDEWEB)

    1981-01-01

    This revised edition of the promotion primer is to serve as a topical orientation aid for industrial firms, unions, boards and other bodies interested where the actions of governmental R and D and innovation policy are compiled and clearly arranged. It is important for the success of governmental aids that the institutions concerned are informed about all possibilities of the promotion, financing and advisory programme. Beyond the presentation of the research promotion sectors, the fiscal measures and the contractual as well as the joint research this revised edition focussess on the fields of consultative services for innovation and information. For many firms the access to qualified information and guidance is of particular importance. That is why this brochure points out the ways towards governmental research promotion. The BMFT has provided a remarkable contribution to research promotion by establishing information and consultative services for trade and industry.

  6. Metabolomics: A Primer.

    Science.gov (United States)

    Liu, Xiaojing; Locasale, Jason W

    2017-04-01

    Metabolomics generates a profile of small molecules that are derived from cellular metabolism and can directly reflect the outcome of complex networks of biochemical reactions, thus providing insights into multiple aspects of cellular physiology. Technological advances have enabled rapid and increasingly expansive data acquisition with samples as small as single cells; however, substantial challenges in the field remain. In this primer we provide an overview of metabolomics, especially mass spectrometry (MS)-based metabolomics, which uses liquid chromatography (LC) for separation, and discuss its utilities and limitations. We identify and discuss several areas at the frontier of metabolomics. Our goal is to give the reader a sense of what might be accomplished when conducting a metabolomics experiment, now and in the near future. Copyright © 2017 Elsevier Ltd. All rights reserved.

  7. A Brief Taxometrics Primer

    Science.gov (United States)

    Beauchaine, Theodore P.

    2009-01-01

    Taxometric procedures provide an empirical means of determining which psychiatric disorders are typologically distinct from normal behavioral functioning. Although most disorders reflect extremes along continuously distributed behavioral traits, identifying those that are discrete has important implications for accurate diagnosis, effective treatment, early identification of risk, and improved understanding of etiology. This article provides (a) brief descriptions of the conceptual bases of several taxometric procedures, (b) example analyses using simulated data, and (c) strategies for avoiding common pitfalls that are often observed in taxometrics research. To date, most taxometrics studies have appeared in the adult psychopathology literature. It is hoped that this primer will encourage interested readers to extend taxometrics research to child and adolescent populations. PMID:18088222

  8. Quantitative Experimental Determination of Primer-Dimer Formation Risk by Free-Solution Conjugate Electrophoresis

    Science.gov (United States)

    Desmarais, Samantha M.; Leitner, Thomas; Barron, Annelise E.

    2012-01-01

    DNA barcodes are short, unique ssDNA primers that “mark” individual biomolecules. To gain better understanding of biophysical parameters constraining primer-dimer formation between primers that incorporate barcode sequences, we have developed a capillary electrophoresis method that utilizes drag-tag-DNA conjugates to quantify dimerization risk between primer-barcode pairs. Results obtained with this unique free-solution conjugate electrophoresis (FSCE) approach are useful as quantitatively precise input data to parameterize computation models of dimerization risk. A set of fluorescently labeled, model primer-barcode conjugates were designed with complementary regions of differing lengths to quantify heterodimerization as a function of temperature. Primer-dimer cases comprised two 30-mer primers, one of which was covalently conjugated to a lab-made, chemically synthesized poly-N-methoxyethylglycine drag-tag, which reduced electrophoretic mobility of ssDNA to distinguish it from ds primer-dimers. The drag-tags also provided a shift in mobility for the dsDNA species, which allowed us to quantitate primer-dimer formation. In the experimental studies, pairs of oligonucleotide primer-barcodes with fully or partially complementary sequences were annealed, and then separated by free-solution conjugate CE at different temperatures, to assess effects on primer-dimer formation. When less than 30 out of 30 basepairs were bonded, dimerization was inversely correlated to temperature. Dimerization occurred when more than 15 consecutive basepairs formed, yet non-consecutive basepairs did not create stable dimers even when 20 out of 30 possible basepairs bonded. The use of free-solution electrophoresis in combination with a peptoid drag-tag and different fluorophores enabled precise separation of short DNA fragments to establish a new mobility shift assay for detection of primer-dimer formation. PMID:22331820

  9. Radiation protection primer

    International Nuclear Information System (INIS)

    Aigner, R.; Melzer, E.; Seissler, H.

    1986-01-01

    This 'radiation protection primer' does not pretend to give absolute, final answers to the many questions that have been arising after the Chernobyl accident. What it is intended to supply, as a schematic overview of problems resulting from nuclear accidents, and a likewise systematic outline of possible solutions and sensible reactions to such an event. The book takes up questions such as: What has happened to the soil. Will future harvests be 'clean' again. What does radioactivity to our drinking water and other waters. What are the effects of a radioactive fallout on food. What may we eat or drink. What happens to the human body after intake of radioactive air, or - even only slightly - contaminated food or water. What can we do to protect our health, and the health of our children. Is there anything else we can do in order to avoid such a disaster in future, except from shutting-off all reactors. The book itself presents some answers and advice, along with a list of terms and explanations, and addresses to apply to for further advice and information. (orig./HP) [de

  10. A Primer on Concepts and Applications of Proteomics in Neuroscience

    DEFF Research Database (Denmark)

    Hosp, Fabian; Mann, Matthias

    2017-01-01

    The enormous complexity of the central nervous system has impeded its systemic exploration for decades but powerful "omic" technologies are now pushing forward the frontiers of neuroscience research at an increasing pace. This Primer reviews the most recent progress in mass spectrometry (MS...

  11. A primer on metagenomics.

    Directory of Open Access Journals (Sweden)

    John C Wooley

    2010-02-01

    Full Text Available Metagenomics is a discipline that enables the genomic study of uncultured microorganisms. Faster, cheaper sequencing technologies and the ability to sequence uncultured microbes sampled directly from their habitats are expanding and transforming our view of the microbial world. Distilling meaningful information from the millions of new genomic sequences presents a serious challenge to bioinformaticians. In cultured microbes, the genomic data come from a single clone, making sequence assembly and annotation tractable. In metagenomics, the data come from heterogeneous microbial communities, sometimes containing more than 10,000 species, with the sequence data being noisy and partial. From sampling, to assembly, to gene calling and function prediction, bioinformatics faces new demands in interpreting voluminous, noisy, and often partial sequence data. Although metagenomics is a relative newcomer to science, the past few years have seen an explosion in computational methods applied to metagenomic-based research. It is therefore not within the scope of this article to provide an exhaustive review. Rather, we provide here a concise yet comprehensive introduction to the current computational requirements presented by metagenomics, and review the recent progress made. We also note whether there is software that implements any of the methods presented here, and briefly review its utility. Nevertheless, it would be useful if readers of this article would avail themselves of the comment section provided by this journal, and relate their own experiences. Finally, the last section of this article provides a few representative studies illustrating different facets of recent scientific discoveries made using metagenomics.

  12. Freshwater Wetlands: A Citizen's Primer.

    Science.gov (United States)

    Catskill Center for Conservation and Development, Inc., Hobart, NY.

    The purpose of this "primer" for the general public is to describe the general characteristics of wetlands and how wetland alteration adversely affects the well-being of humans. Particular emphasis is placed on wetlands in New York State and the northeast. Topics discussed include wetland values, destruction of wetlands, the costs of…

  13. A Hearing Aid Primer 1

    Science.gov (United States)

    Yetter, Carol J.

    2009-01-01

    This hearing aid primer is designed to define the differences among the three levels of hearing instrument technology: conventional analog circuit technology (most basic), digitally programmable/analog circuit technology (moderately advanced), and fully digital technology (most advanced). Both moderate and advanced technologies mean that hearing…

  14. DNA Extraction and Primer Selection

    DEFF Research Database (Denmark)

    Karst, Søren Michael; Nielsen, Per Halkjær; Albertsen, Mads

    Talk regarding pitfalls in DNA extraction and 16S amplicon primer choice when performing community analysis of complex microbial communities. The talk was a part of Workshop 2 "Principles, Potential, and Limitations of Novel Molecular Methods in Water Engineering; from Amplicon Sequencing to -omics...

  15. A classical primer for QCD

    International Nuclear Information System (INIS)

    Moriyasu, K.

    1981-01-01

    A basic primer for QCD is presented using a semiclassical approach to the colour Maxwell equations. The non-Abelian nature of colour symmetry and the violation of superposition by colour fields is compared with QED. A simple discussion of asymptotic freedom is also presented. (author)

  16. Mobile Marketing

    OpenAIRE

    Luengo Cascudo, Alberto

    2010-01-01

    El principal objetivo de este proyecto es explicar y entender la importancia del Mobile Marketing como nueva herramienta de negocio en el Marketing empresarial. Para ello, el primer objetivo es entender los dos factores que para mí son la clave de su importancia: la evolución del entorno tecnológico y el cambio en los hábitos del consumidor. Debido a la novedad de esta nueva forma de Marketing y al hecho de que está en constante definición, es básico exponer de la forma más cla...

  17. Mobile computing handbook

    CERN Document Server

    Ilyas, Mohammad

    2004-01-01

    INTRODUCTION AND APPLICATIONS OF MOBILE COMPUTING Wearable Computing,A. Smailagic and D.P. Siewiorek Developing Mobile Applications: A Lime Primer,G.P. Picco, A.L. Murphy, and G.-C. Roman Pervasive Application Development: Approaches and Pitfalls,G. Banavar, N. Cohen, and D. Soroker ISAM, Joining Context-Awareness and Mobility to Building Pervasive Applications,I. Augustin, A. Corrêa Yamin, J.L. Victória Barbosa, L. Cavalheiro da Silva, R. Araújo Real, G. Frainer, G.G. Honrich Cavalheiro, and C.F. Resin Geyer Integrating Mobile Wireless Devices into the Computational Grid,T. Phan, L. Huan

  18. Bioinformatic tools for PCR Primer design

    African Journals Online (AJOL)

    ES

    reaction (PCR), oligo hybridization and DNA sequencing. Proper primer design is actually one of the most important factors/steps in successful DNA sequencing. Various bioinformatics programs are available for selection of primer pairs from a template sequence. The plethora programs for PCR primer design reflects the.

  19. 30 CFR 56.6304 - Primer protection.

    Science.gov (United States)

    2010-07-01

    ... 30 Mineral Resources 1 2010-07-01 2010-07-01 false Primer protection. 56.6304 Section 56.6304 Mineral Resources MINE SAFETY AND HEALTH ADMINISTRATION, DEPARTMENT OF LABOR METAL AND NONMETAL MINE... Primer protection. (a) Tamping shall not be done directly on a primer. (b) Rigid cartridges of explosives...

  20. A Primer to Slow Light

    OpenAIRE

    Leonhardt, U.

    2001-01-01

    Laboratory-based optical analogs of astronomical objects such as black holes rely on the creation of light with an extremely low or even vanishing group velocity (slow light). These brief notes represent a pedagogical attempt towards elucidating this extraordinary form of light. This paper is a contribution to the book Artificial Black Holes edited by Mario Novello, Matt Visser and Grigori Volovik. The paper is intended as a primer, an introduction to the subject for non-experts, not as a det...

  1. Experimental determination of contaminant metal mobility as a function of temperature, time and solution chemistry. 1997 annual progress report

    International Nuclear Information System (INIS)

    Bruton, C.; Carroll, S.; O'Day, P.; Sahai, N.

    1997-01-01

    'Strontium is significantly more mobile than other hazardous radioactive metals. Its partitioning between aqueous and solid phases is controlled by reactions that occur at the interface between natural waters and minerals. At a groundwater site in Hanford (200-BP-5), the aerial extent of the 90 Sr plume is 100 times larger than the aerial extent of the 137 Cs and the 239 Pu plumes. Similarly, contaminated, perched watertables at INEL have much higher aqueous concentrations of 90 Sr than 137 Cs, presumably because Cs is preferentially sorbed to solids (Duncan 1995). Under high physical flow conditions, such as those in the highly fractured rock at Hanford and INEL, 90 Sr present in plumes may spread off-site and cause contamination of aquifers or other water sources. Geochemical factors that may contribute to the overall mobility of Sr in natural waters are the solubilities of phases such as strontianite (SrCO 3 ) and formation of strong complexes with sulfate and nitrate. Although 90 Sr is mobilized in natural waters in these examples, significant concentrations may also be present in solid phases. Sorption experiments using a wide variety of substrates at room temperature have shown that Sr is removed from solution under certain conditions. Additionally, strontianite (SrCO 3 ) may precipitate at low Sr concentrations in the pH range of waters in contact with basaltic rocks, which varies between pH 8 and 10. Waters contain variable amounts of carbonate owing to atmospheric interactions; the partial pressure of CO 2 is about 10 x 3.5 atm in air and commonly as high as 10 x 2.5 atm in soils. The objective of this work is to determine the fundamental data needed to predict the behavior of strontium at temperature and time scales appropriate to thermal remediation. The authors approach combines macroscopic sorption/precipitation and desorption/dissolution kinetic experiments, which track changes in solution composition, with direct molecular characterization of

  2. Progress on mobility and instability of research personnel in Japan: scientometrics on a job-posting database for monitoring the academic job market

    Energy Technology Data Exchange (ETDEWEB)

    Kawashima, H.; Yamashita, Y.

    2016-07-01

    This study has two purposes. The first purpose is to extract statistics from a database of jobposting cards, previously little-used as a data source, to assess the academic job market. The second purpose is to connect statistics on the academic job market with monitoring of indicators of policy progress related to the mobility and instability of research personnel. The data source used in this study is a job-posting database named JREC-IN Portal, which is the de facto standard for academic job seeking in Japan. The present results show a growing proportion of fixed-term researchers in the Japanese academic job market and that job information is increasingly diverse. (Author)

  3. Characteristics of the population employed in primer sector in Turkey

    Directory of Open Access Journals (Sweden)

    Bayar Rüya

    2006-01-01

    Full Text Available Activities related to the production of raw material like agriculture husbandry, forestry, fishery are called as primer activities. Especially people living in rural areas earn their livings on primer activities, mainly agriculture. Rural planning is inevitable for providing rural development which has an important place in all development of a country. And achievement of this planning depends on putting forth the characteristics of the population living in rural areas with its different aspects. Therefore, the requirements will be introduced more clearly and the increase in the welfare levels of the people living in rural areas will have been achieved. To achieve the rural development and progress, in addition to the features like the size of agricultural products, products that are cultivated, activities like husbandry, forestry, hunting, etc. and the qualities of the enterprises in which these activities are carried out, policies applied, capital, market and technology, the characteristics of the population employed in this sector is also of importance. Considering these points, what is aimed in this study is to put forth the characteristics of the population employed in primer sector in Turkey. According to the census results of the year 2000 in Turkey 38% of the population is employed, and 48% of this work is in primer sector.

  4. Overexpression of high mobility group box 1 contributes to progressive clinicopathological features and poor prognosis of human bladder urothelial carcinoma

    Directory of Open Access Journals (Sweden)

    Huang CK

    2018-04-01

    Full Text Available Changkun Huang,* Zhichao Huang,* Xiaokun Zhao, Yinhuai Wang, Hongqing Zhao, Zhaohui Zhong, Lang Wang Department of Urology, The Second Xiangya Hospital, Central South University, Changsha, Hunan, People’s Republic of China *These authors contributed equally to this work Background: High mobility group box 1 (HMGB1, a versatile protein with intranuclear and extracellular functions, plays an important role in a variety of human cancers. However, the clinical/prognostic significance of HMGB1 expression in human bladder urothelial carcinoma (BUC remains unclear. The aim of this study was to investigate the HMGB1 expression in human BUC with regard to its clinical and prognostic significance.Patients and methods: HMGB1 mRNA and protein expressions in tumor and paired normal bladder tissues were detected in 20 BUC cases by quantitative real-time polymerase chain reaction (qRT-PCR and Western blot. HMGB1 protein expression in 165 primary BUC tissues was evaluated by immunohistochemistry (IHC, and its correlations with clinicopathological characteristics and prognosis were also analyzed. Student’s t-test, χ2 test, Kaplan–Meier plots, and Cox proportional hazard regression model were performed to analyze the data. Results: By using qRT-PCR and Western blot, the upregulated expression of HMGB1 mRNA and protein was detected in BUC, compared with paired normal tissue (P<0.05. By using IHC, high HMGB1 expression was examined in 84 of 165 (51.0% BUC cases. High HMGB1 expression was significantly correlated with poorer differentiation and higher T and N classification (all P<0.05. Univariate analysis showed that high HMGB1 expression was significantly associated with a shortened patients’ overall survival (OS and disease-free survival (DFS; both P<0.001. In different subgroups of BUC patients, HMGB1 expression was a prognostic factor in patients with different histological grades or T classification (all P<0.05, pN− (both P<0.001 for OS and DFS, and

  5. UniPrimer: A Web-Based Primer Design Tool for Comparative Analyses of Primate Genomes

    Directory of Open Access Journals (Sweden)

    Nomin Batnyam

    2012-01-01

    Full Text Available Whole genome sequences of various primates have been released due to advanced DNA-sequencing technology. A combination of computational data mining and the polymerase chain reaction (PCR assay to validate the data is an excellent method for conducting comparative genomics. Thus, designing primers for PCR is an essential procedure for a comparative analysis of primate genomes. Here, we developed and introduced UniPrimer for use in those studies. UniPrimer is a web-based tool that designs PCR- and DNA-sequencing primers. It compares the sequences from six different primates (human, chimpanzee, gorilla, orangutan, gibbon, and rhesus macaque and designs primers on the conserved region across species. UniPrimer is linked to RepeatMasker, Primer3Plus, and OligoCalc softwares to produce primers with high accuracy and UCSC In-Silico PCR to confirm whether the designed primers work. To test the performance of UniPrimer, we designed primers on sample sequences using UniPrimer and manually designed primers for the same sequences. The comparison of the two processes showed that UniPrimer was more effective than manual work in terms of saving time and reducing errors.

  6. Unique case of oligoastrocytoma with recurrence and grade progression: Exhibiting differential expression of high mobility group-A1 and human telomerase reverse transcriptase

    Science.gov (United States)

    Gandhi, Puneet; Khare, Richa; Niraj, Kavita; Garg, Nitin; Sorte, Sandeep K; Gulwani, Hanni

    2016-01-01

    Mixed gliomas, primarily oligoastrocytomas, account for about 5%-10% of all gliomas. Distinguishing oligoastrocytoma based on histological features alone has limitations in predicting the exact biological behavior, necessitating ancillary markers for greater specificity. In this case report, human telomerase reverse transcriptase (hTERT) and high mobility group-A1 (HMGA1); markers of proliferation and stemness, have been quantitatively analyzed in formalin-fixed paraffin-embedded tissue samples of a 34 years old patient with oligoastrocytoma. Customized florescence-based immunohistochemistry protocol with enhanced sensitivity and specificity is used in the study. The patient presented with a history of generalized seizures and his magnetic resonance imaging scans revealed infiltrative ill-defined mass lesion with calcified foci within the left frontal white matter, suggestive of glioma. He was surgically treated at our center for four consecutive clinical events. Histopathologically, the tumor was identified as oligoastrocytoma-grade II followed by two recurrence events and final progression to grade III. Overall survival of the patient without adjuvant therapy was more than 9 years. Glial fibrillary acidic protein, p53, Ki-67, nuclear atypia index, pre-operative neutrophil-lymphocyte ratio, are the other parameters assessed. Findings suggest that hTERT and HMGA1 are linked to tumor recurrence and progression. Established markers can assist in defining precise histopathological grade in conjuction with conventional markers in clinical setup. PMID:27672647

  7. A primer of multivariate statistics

    CERN Document Server

    Harris, Richard J

    2014-01-01

    Drawing upon more than 30 years of experience in working with statistics, Dr. Richard J. Harris has updated A Primer of Multivariate Statistics to provide a model of balance between how-to and why. This classic text covers multivariate techniques with a taste of latent variable approaches. Throughout the book there is a focus on the importance of describing and testing one's interpretations of the emergent variables that are produced by multivariate analysis. This edition retains its conversational writing style while focusing on classical techniques. The book gives the reader a feel for why

  8. PHUSER (Primer Help for USER): a novel tool for USER fusion primer design

    DEFF Research Database (Denmark)

    Olsen, Lars Rønn; Hansen, Niels Bjørn; Bonde, Mads

    2011-01-01

    containing a customizable USER cassette. Designing primers using PHUSER ensures that the primers have similar annealing temperature (Tm), which is essential for efficient PCR. PHUSER also avoids identical overhangs, thereby ensuring correct order of assembly of DNA fragments. All possible primers...

  9. A primer on pseudorandom generators

    CERN Document Server

    Goldreich, Oded

    2010-01-01

    A fresh look at the question of randomness was taken in the theory of computing: A distribution is pseudorandom if it cannot be distinguished from the uniform distribution by any efficient procedure. This paradigm, originally associating efficient procedures with polynomial-time algorithms, has been applied with respect to a variety of natural classes of distinguishing procedures. The resulting theory of pseudorandomness is relevant to science at large and is closely related to central areas of computer science, such as algorithmic design, complexity theory, and cryptography. This primer surveys the theory of pseudorandomness, starting with the general paradigm, and discussing various incarnations while emphasizing the case of general-purpose pseudorandom generators (withstanding any polynomial-time distinguisher). Additional topics include the "derandomization" of arbitrary probabilistic polynomial-time algorithms, pseudorandom generators withstanding space-bounded distinguishers, and several natural notions...

  10. A Primer on Observational Measurement.

    Science.gov (United States)

    Girard, Jeffrey M; Cohn, Jeffrey F

    2016-08-01

    Observational measurement plays an integral role in a variety of scientific endeavors within biology, psychology, sociology, education, medicine, and marketing. The current article provides an interdisciplinary primer on observational measurement; in particular, it highlights recent advances in observational methodology and the challenges that accompany such growth. First, we detail the various types of instrument that can be used to standardize measurements across observers. Second, we argue for the importance of validity in observational measurement and provide several approaches to validation based on contemporary validity theory. Third, we outline the challenges currently faced by observational researchers pertaining to measurement drift, observer reactivity, reliability analysis, and time/expense. Fourth, we describe recent advances in computer-assisted measurement, fully automated measurement, and statistical data analysis. Finally, we identify several key directions for future observational research to explore.

  11. A primer on quantum fluids

    CERN Document Server

    Barenghi, Carlo

    2016-01-01

    The aim of this primer is to cover the essential theoretical information, quickly and concisely, in order to enable senior undergraduate and beginning graduate students to tackle projects in topical research areas of quantum fluids, for example, solitons, vortices and collective modes. The selection of the material, both regarding the content and level of presentation, draws on the authors analysis of the success of relevant research projects with newcomers to the field, as well as of the students feedback from many taught and self-study courses on the subject matter. Starting with a brief historical overview, this text covers particle statistics, weakly interacting condensates and their dynamics and finally superfluid helium and quantum turbulence. At the end of each chapter (apart from the first) there will be some exercises. Detailed solutions can be made available to instructors upon request to the authors. .

  12. 30 CFR 57.6304 - Primer protection.

    Science.gov (United States)

    2010-07-01

    ... 30 Mineral Resources 1 2010-07-01 2010-07-01 false Primer protection. 57.6304 Section 57.6304 Mineral Resources MINE SAFETY AND HEALTH ADMINISTRATION, DEPARTMENT OF LABOR METAL AND NONMETAL MINE... Transportation-Surface and Underground § 57.6304 Primer protection. (a) Tamping shall not be done directly on a...

  13. A pilot investigation of a mobile phone application and progressive reminder system to improve adherence to daily prevention treatment in adolescents and young adults with migraine.

    Science.gov (United States)

    Ramsey, Rachelle R; Holbein, Christina E; Powers, Scott W; Hershey, Andrew D; Kabbouche, Marielle A; O'Brien, Hope L; Kacperski, Joanne; Shepard, Jeffrey; Hommel, Kevin A

    2018-01-01

    Background Effective management of migraine requires adherence to treatment recommendations; however, adolescents with migraine take their daily medications only 75% of the time. Low-cost adherence-focused interventions using technology may improve adherence, but have not been investigated. Methods Thirty-five adolescents and young adults (13-21 years) with migraine participated in an AB-design pilot study to assess the use of a mobile phone adherence-promotion application ("app") and progressive reminder system. Adherence was calculated using electronic monitoring during the baseline period and medication adherence intervention. Results Relative to baseline, adherence significantly improved during the first month of the intervention. Specifically, improvements existed for older participants with lower baseline adherence. Self-reported app-based adherence rates were significantly lower than electronically monitored adherence rates. Participants rated the intervention as acceptable and easy to use. Conclusions "Apps" have the potential to improve medication adherence and are a promising intervention for adolescents and young adults with low adherence. Involving parents in the intervention is also helpful. Providers should assess barriers to adherence and use of technology-based interventions, encourage parents to incorporate behavioral incentives, and provide referrals for more intensive interventions to improve long-term outcomes. Further, tracking adherence in an app may result in an underestimation of adherence. Future full-scale studies should be conducted to examine adherence promotion app interventions.

  14. Primer3_masker: integrating masking of template sequence with primer design software.

    Science.gov (United States)

    Kõressaar, Triinu; Lepamets, Maarja; Kaplinski, Lauris; Raime, Kairi; Andreson, Reidar; Remm, Maido

    2018-06-01

    Designing PCR primers for amplifying regions of eukaryotic genomes is a complicated task because the genomes contain a large number of repeat sequences and other regions unsuitable for amplification by PCR. We have developed a novel k-mer based masking method that uses a statistical model to detect and mask failure-prone regions on the DNA template prior to primer design. We implemented the software as a standalone software primer3_masker and integrated it into the primer design program Primer3. The standalone version of primer3_masker is implemented in C. The source code is freely available at https://github.com/bioinfo-ut/primer3_masker/ (standalone version for Linux and macOS) and at https://github.com/primer3-org/primer3/ (integrated version). Primer3 web application that allows masking sequences of 196 animal and plant genomes is available at http://primer3.ut.ee/. maido.remm@ut.ee. Supplementary data are available at Bioinformatics online.

  15. KULTUR PRIMER FIBROBLAS: PENELITIAN PENDAHULUAN

    Directory of Open Access Journals (Sweden)

    Yuli Kurniawati

    2015-05-01

    Full Text Available AbstrakKultur sel fibroblas banyak digunakan untuk penelitian proses penyembuhan luka dan penuaankulit. Metode ini digunakan untuk melihat perkembangan sel, proliferasi kinetik seluler, sertabiosintesis komponen matriks ekstraseluler. Penelitian pendahuluan ini dilakukan untuk optimasiteknik laboratorium serta berbagai kendala yang didapatkan saat kultur fibroblas. Kultur primerfibroblas dibagi menjadi 2 jenis sampel yaitu sampel yang berasal dari embrio mencit usia 7,5–9,5 hari, dan kulit pasien keloid. Sampel dari embrio mencit dilakukan kultur primer denganmetode dissociated fibroblast. Sampel jaringan keloid dan kulit normal dikultur dengan metodeskin explant. Fibroblas yang berasal dari kultur primer embrio mencit tumbuh baik sehinggadapat dilakukan subkultur dan disimpan di dalam nitrogen cair suhu -198°C. Fibroblas yangberasal dari sampel keloid pertama tumbuh sesuai pola pertumbuhan fibroblas, namun padasampel kedua terdapat kontaminasi Paecilomyces sp. yang merupakan salah satu jenis jamurkontaminan. Sel fibroblas mudah untuk dikultur karena memiliki kemampuan tumbuh danmelekat yang tinggi serta regenerasi cepat, namun penelitian lebih lanjut untuk optimasi teknikkultur dan pencegahan kontaminasi masih dibutuhkan sehingga sel dapat tumbuh baik.AbstractFibroblast cell culture method has been used for wound healing and skin aging studies. Thismethod was used for cell development imaging study, celullar kinetic proliferation andextracelullar matrix component biosynthesis. This preeliminary study was done for laboratoricaltechnic optimation as well as problems appeared in fibroblast culture. Fibroblasts primary culturewas divided into 2 type of samples, from 7.5-9.5-day-mice embryo and keloid-patient skin.Primary culture with dissociated fibroblast method was done for mice embryo sample. Keloidtissue sample and normal skin were cultured with skin explant method. Fibroblasts that weretaken from mice embryo primary culture grew well

  16. Thinking in systems a primer

    CERN Document Server

    Meadows, Donella H

    2008-01-01

    In the years following her role as the lead author of the international bestseller, "Limits to Growth"-the first book to show the consequences of unchecked growth on a finite planet- Donella Meadows remained a pioneer of environmental and social analysis until her untimely death in 2001. Meadows' newly released manuscript, "Thinking in Systems", is a concise and crucial book offering insight for problem solving on scales ranging from the personal to the global. Edited by the Sustainability Institute's Diana Wright, this essential primer brings systems thinking out of the realm of computers and equations and into the tangible world, showing readers how to develop the systems-thinking skills that thought leaders across the globe consider critical for 21st-century life. Some of the biggest problems facing the world-war, hunger, poverty, and environmental degradation-are essentially system failures. They cannot be solved by fixing one piece in isolation from the others, because even seemingly minor details have e...

  17. Primers-4-Yeast: a comprehensive web tool for planning primers for Saccharomyces cerevisiae.

    Science.gov (United States)

    Yofe, Ido; Schuldiner, Maya

    2014-02-01

    The budding yeast Saccharomyces cerevisiae is a key model organism of functional genomics, due to its ease and speed of genetic manipulations. In fact, in this yeast, the requirement for homologous sequences for recombination purposes is so small that 40 base pairs (bp) are sufficient. Hence, an enormous variety of genetic manipulations can be performed by simply planning primers with the correct homology, using a defined set of transformation plasmids. Although designing primers for yeast transformations and for the verification of their correct insertion is a common task in all yeast laboratories, primer planning is usually done manually and a tool that would enable easy, automated primer planning for the yeast research community is still lacking. Here we introduce Primers-4-Yeast, a web tool that allows primers to be designed in batches for S. cerevisiae gene-targeting transformations, and for the validation of correct insertions. This novel tool enables fast, automated, accurate primer planning for large sets of genes, introduces consistency in primer planning and is therefore suggested to serve as a standard in yeast research. Primers-4-Yeast is available at: http://www.weizmann.ac.il/Primers-4-Yeast Copyright © 2013 John Wiley & Sons, Ltd.

  18. Primer on spontaneous heating and pyrophoricity

    Energy Technology Data Exchange (ETDEWEB)

    1994-12-01

    This primer was prepared as an information resource for personnel responsible for operation of DOE nuclear facilities. It has sections on combustion principles, spontaneous heating/ignition of hydrocarbons and organics, pyrophoric gases and liquids, pyrophoric nonmetallic solids, pyrophoric metals (including Pu and U), and accident case studies. Although the information in this primer is not all-encompassing, it should provide the reader with a fundamental knowledge level sufficient to recognize most spontaneous combustion hazards and how to prevent ignition and widespread fires. This primer is provided as an information resource only, and is not intended to replace any fire protection or hazardous material training.

  19. A practical primer on geostatistics

    Science.gov (United States)

    Olea, Ricardo A.

    2009-01-01

    has significant methodological implications.Historical Remarks—As a discipline, geostatistics was firmly established in the 1960s by the French engineer Georges Matheron, who was interested in the appraisal of ore reserves in mining. Geostatistics did not develop overnight. Like other disciplines, it has built on previous results, many of which were formulated with different objectives in various fields.Pioneers—Seminal ideas conceptually related to what today we call geostatistics or spatial statistics are found in the work of several pioneers, including: 1940s: A.N. Kolmogorov in turbulent flow and N. Wiener in stochastic processing; 1950s: D. Krige in mining; 1960s: B. Mathern in forestry and L.S. Gandin in meteorologyCalculations—Serious applications of geostatistics require the use of digital computers. Although for most geostatistical techniques rudimentary implementation from scratch is fairly straightforward, coding programs from scratch is recommended only as part of a practice that may help users to gain a better grasp of the formulations.Software—For professional work, the reader should employ software packages that have been thoroughly tested to handle any sampling scheme, that run as efficiently as possible, and that offer graphic capabilities for the analysis and display of results. This primer employs primarily the package Stanford Geomodeling Software (SGeMS) - recently developed at the Energy Resources Engineering Department at Stanford University - as a way to show how to obtain results practically. This applied side of the primer should not be interpreted as the notes being a manual for the use of SGeMS. The main objective of the primer is to help the reader gain an understanding of the fundamental concepts and tools in geostatistics.Organization of the Primer—The chapters of greatest importance are those covering kriging and simulation. All other materials are peripheral and are included for better comprehension of these main

  20. Tools for Ultraspecific Probe/Primer Design

    National Research Council Canada - National Science Library

    Fofanov, Yurly

    2006-01-01

    .... Our approach will deliver DNA probes and PCR primers that have an unprecedentedly low probability of false positives or confusion by environmental background, and which resist evasion by threat agent engineering...

  1. Bioinformatic tools for PCR Primer design

    African Journals Online (AJOL)

    ES

    Bioinformatics is an emerging scientific discipline that uses information ... complex biological questions. ... and computer programs for various purposes of primer ..... polymerase chain reaction: Human Immunodeficiency Virus 1 model studies.

  2. Hexavalent Chromium IV-Free Primer Development

    Science.gov (United States)

    Alldredge, Michael J.; Buck, Amy L.

    2015-01-01

    Primer materials provide corrosion protection for metal parts as well as an increased adhesion between metallic substrates and thermal protection systems (TPSs). Current primers for use in cryogenic applications contain hexavalent chromium. This hexavalent chromium provides excellent corrosion protection even in a cryogenic environment, but it is a carcinogen that requires special equipment and waste control procedures to use. The hazardous nature of hexavalent chromium makes it an obsolescence risk in the future. This study included two phases of evaluation. Thirteen primers were initially identified as candidates and twelve of those primers were tested in phase 1. Four of the best performing candidates from phase 1 continued into phase 2 testing. Phase 1 testing consisted mostly of liquid constituent and physical property testing. Cryoflex and salt fog testing were included in phase 1 because of their importance to the overall success of a candidate material. Phase 2 consisted of physical, thermal, and mechanical properties for nominally processed and fabricated specimens.

  3. Quantitative Microbial Risk Assessment Tutorial - Primer

    Science.gov (United States)

    This document provides a Quantitative Microbial Risk Assessment (QMRA) primer that organizes QMRA tutorials. The tutorials describe functionality of a QMRA infrastructure, guide the user through software use and assessment options, provide step-by-step instructions for implementi...

  4. Menopause 101: A Primer for the Perimenopausal

    Science.gov (United States)

    ... Abstracts Media Award Recipients Media Policy Media Requests Menopause 101: A primer for the perimenopausal The information ... about 2 years earlier. Common Body Changes at Menopause Each woman’s experience of menopause is different. Many ...

  5. Multiplexing Short Primers for Viral Family PCR

    Energy Technology Data Exchange (ETDEWEB)

    Gardner, S N; Hiddessen, A L; Hara, C A; Williams, P L; Wagner, M; Colston, B W

    2008-06-26

    We describe a Multiplex Primer Prediction (MPP) algorithm to build multiplex compatible primer sets for large, diverse, and unalignable sets of target sequences. The MPP algorithm is scalable to larger target sets than other available software, and it does not require a multiple sequence alignment. We applied it to questions in viral detection, and demonstrated that there are no universally conserved priming sequences among viruses and that it could require an unfeasibly large number of primers ({approx}3700 18-mers or {approx}2000 10-mers) to generate amplicons from all sequenced viruses. We then designed primer sets separately for each viral family, and for several diverse species such as foot-and-mouth disease virus, hemagglutinin and neuraminidase segments of influenza A virus, Norwalk virus, and HIV-1.

  6. VizPrimer: a web server for visualized PCR primer design based on known gene structure.

    Science.gov (United States)

    Zhou, Yang; Qu, Wubin; Lu, Yiming; Zhang, Yanchun; Wang, Xiaolei; Zhao, Dongsheng; Yang, Yi; Zhang, Chenggang

    2011-12-15

    The visualization of gene structure plays an important role in polymerase chain reaction (PCR) primer design, especially for eukaryotic genes with a number of splice variants that users need to distinguish between via PCR. Here, we describe a visualized web server for primer design named VizPrimer. It utilizes the new information technology (IT) tools, HTML5 to display gene structure and JavaScript to interact with the users. In VizPrimer, the users can focus their attention on the gene structure and primer design strategy, without wasting time calculating the exon positions of splice variants or manually configuring complicated parameters. In addition, VizPrimer is also suitable for the design of PCR primers for amplifying open reading frames and detecting single nucleotide polymorphisms (SNPs). VizPrimer is freely available at http://biocompute.bmi.ac.cn/CZlab/VizPrimer/. The web server supported browsers: Chrome (≥5.0), Firefox (≥3.0), Safari (≥4.0) and Opera (≥10.0). zhangcg@bmi.ac.cn; yangyi528@vip.sina.com.

  7. Canadian municipal carbon trading primer

    International Nuclear Information System (INIS)

    Seskus, A.

    2002-01-01

    The trading of greenhouse gas (GHG) emissions is being suggested as an effective economic way to meet Canada's Kyoto target. Emissions trading is a market-based instrument that can help achieve environmental improvements while using the market to absorb the economical and effective measures to achieve emissions reductions. Placing a value on emissions means that in order to minimize costs, companies will be motivated to apply the lowest-cost emission reductions possible for regulatory approval. The two main types of emissions trading that exist in Canada are the trading of emissions that lead to the formation of smog or acid rain, and the trading of greenhouse gas emissions that lead to climate change. Since carbon dioxide is the most prevalent GHG, making up approximately 75 per cent of Canadian GHG emissions, the trading of units of GHGs is often referred to as carbon trading. The impact that emissions trading will have on municipal operations was the focus of this primer. The trading of GHG involves buying and selling of allowances of GHGs between contracting parties, usually between one party that is short of GHG credits and another that has excess credits. The 3 common approaches to emissions trading include allowance trading (cap and trade), credit trading (baseline and credit), and a hybrid system which combines both credit and allowance trading systems. The issues that impact municipalities include the debate regarding who owns the credits from landfills, particularly if power is generated using landfill gas and the power is sold as green power. Other viable questions were also addressed, including who can claim emission reduction credits if a city implements energy efficiency projects, or fuel substitution programs. Also, will municipalities be allowed to trade internationally, for example, with municipalities in the United States, and how should they spend their money earned from selling credits. This report also presents highlights from 3 emissions

  8. A primer for workers' compensation.

    Science.gov (United States)

    Bible, Jesse E; Spengler, Dan M; Mir, Hassan R

    2014-07-01

    A physician's role within a workers' compensation injury extends far beyond just evaluation and treatment with several socioeconomic and psychological factors at play compared with similar injuries occurring outside of the workplace. Although workers' compensation statutes vary among states, all have several basic features with the overall goal of returning the injured worker to maximal function in the shortest time period, with the least residual disability and shortest time away from work. To help physicians unfamiliar with the workers' compensation process accomplish these goals. Review. Educational review. The streamlined review addresses the topics of why is workers' compensation necessary; what does workers' compensation cover; progression after work injury; impairment and maximum medical improvement, including how to use the sixth edition of American Medical Association's (AMA) Guides to the evaluation of permanent impairment (Guides); completion of work injury claim after impairment rating; independent medical evaluation; and causation. In the "no-fault" workers' compensation system, physicians play a key role in progressing the claim along and, more importantly, getting the injured worker back to work as soon as safely possible. Physicians should remain familiar with the workers' compensation process, along with how to properly use the AMA Guides. Copyright © 2014 Elsevier Inc. All rights reserved.

  9. Climate Change, Health, and Communication: A Primer.

    Science.gov (United States)

    Chadwick, Amy E

    2016-01-01

    Climate change is one of the most serious and pervasive challenges facing us today. Our changing climate has implications not only for the ecosystems upon which we depend, but also for human health. Health communication scholars are well-positioned to aid in the mitigation of and response to climate change and its health effects. To help theorists, researchers, and practitioners engage in these efforts, this primer explains relevant issues and vocabulary associated with climate change and its impacts on health. First, this primer provides an overview of climate change, its causes and consequences, and its impacts on health. Then, the primer describes ways to decrease impacts and identifies roles for health communication scholars in efforts to address climate change and its health effects.

  10. Microsatellite Primers for Fungus-Growing Ants

    DEFF Research Database (Denmark)

    Villesen Fredsted, Palle; Gertsch, Pia J.; Boomsma, Jacobus Jan (Koos)

    2002-01-01

    We isolated five polymorphic microsatellite loci from a library of two thousand recombinant clones of two fungus-growing ant species, Cyphomyrmex longiscapus and Trachymyrmex cf. zeteki. Amplification and heterozygosity were tested in five species of higher attine ants using both the newly...... developed primers and earlier published primers that were developed for fungus-growing ants. A total of 20 variable microsatellite loci, developed for six different species of fungus-growing ants, are now available for studying the population genetics and colony kin-structure of these ants....

  11. Microsatellite primers for fungus-growing ants

    DEFF Research Database (Denmark)

    Villesen, Palle; Gertsch, P J; Boomsma, JJ

    2002-01-01

    We isolated five polymorphic microsatellite loci from a library of two thousand recombinant clones of two fungus-growing ant species, Cyphomyrmex longiscapus and Trachymyrmex cf. zeteki. Amplification and heterozygosity were tested in five species of higher attine ants using both the newly...... developed primers and earlier published primers that were developed for fungus-growing ants. A total of 20 variable microsatellite loci, developed for six different species of fungus-growing ants, are now available for studying the population genetics and colony kin-structure of these ants....

  12. Mobile marketing for mobile games

    OpenAIRE

    Vu, Giang

    2016-01-01

    Highly developed mobile technology and devices enable the rise of mobile game industry and mobile marketing. Hence mobile marketing for mobile game is an essential key for a mobile game success. Even though there are many articles on marketing for mobile games, there is a need of highly understanding mobile marketing strategies, how to launch a mobile campaign for a mobile game. Besides that, it is essential to understand the relationship between mobile advertising and users behaviours. There...

  13. A primer on motor vehicle air pollution.

    Science.gov (United States)

    1973-01-01

    This primer presents a brief state-of-the art review of motor vehicle air pollution. Its purpose is to aid highway personnel in understanding the nature of this environmental problem on our highways and to present possible solutions for its abatement...

  14. A Primer on Basic Effect Size Concepts.

    Science.gov (United States)

    Elmore, Patricia B.; Rotou, Ourania

    The increased interest in reporting effect sizes means that it is necessary to consider what should be included in a primer on effect sizes. A review of papers on effect sizes and commonly repeated statistical analyses suggests that it is important to discuss effect sizes relative to bivariate correlation, t-tests, analysis of variance/covariance,…

  15. Scrimer: designing primers from transcriptome data

    Czech Academy of Sciences Publication Activity Database

    Mořkovský, Libor; Pačes, Jan; Rídl, Jakub; Reifová, R.

    2015-01-01

    Roč. 15, č. 6 (2015), s. 1415-1420 ISSN 1755-098X R&D Projects: GA MŠk EE2.3.20.0303 Institutional support: RVO:68081766 ; RVO:68378050 Keywords : next-generation sequencing * primer design * SNaPshot * SNP genotyping * transcriptome Subject RIV: EB - Genetics ; Molecular Biology Impact factor: 5.298, year: 2015

  16. Forest Interpreter's Primer on Fire Management.

    Science.gov (United States)

    Zelker, Thomas M.

    Specifically prepared for the use of Forest Service field-based interpreters of the management, protection, and use of forest and range resources and the associated human, cultural, and natural history found on these lands, this book is the second in a series of six primers on the multiple use of forest and range resources. Following an…

  17. Criticality calculations with MCNP trademark: A primer

    International Nuclear Information System (INIS)

    Harmon, C.D. II; Busch, R.D.; Briesmeister, J.F.; Forster, R.A.

    1994-01-01

    With the closure of many experimental facilities, the nuclear criticality safety analyst increasingly is required to rely on computer calculations to identify safe limits for the handling and storage of fissile materials. However, in many cases, the analyst has little experience with the specific codes available at his/her facility. This primer will help you, the analyst, understand and use the MCNP Monte Carlo code for nuclear criticality safety analyses. It assumes that you have a college education in a technical field. There is no assumption of familiarity with Monte Carlo codes in general or with MCNP in particular. Appendix A gives an introduction to Monte Carlo techniques. The primer is designed to teach by example, with each example illustrating two or three features of MCNP that are useful in criticality analyses. Beginning with a Quickstart chapter, the primer gives an overview of the basic requirements for MCNP input and allows you to run a simple criticality problem with MCNP. This chapter is not designed to explain either the input or the MCNP options in detail; but rather it introduces basic concepts that are further explained in following chapters. Each chapter begins with a list of basic objectives that identify the goal of the chapter, and a list of the individual MCNP features that are covered in detail in the unique chapter example problems. It is expected that on completion of the primer you will be comfortable using MCNP in criticality calculations and will be capable of handling 80 to 90 percent of the situations that normally arise in a facility. The primer provides a set of basic input files that you can selectively modify to fit the particular problem at hand

  18. Rust transformation/rust compatible primers

    Science.gov (United States)

    Emeric, Dario A.; Miller, Christopher E.

    1993-01-01

    Proper surface preparation has been the key to obtain good performance by a surface coating. The major obstacle in preparing a corroded or rusted surface is the complete removal of the contaminants and the corrosion products. Sandblasting has been traditionally used to remove the corrosion products before painting. However, sandblasting can be expensive, may be prohibited by local health regulations and is not applicable in every situation. To get around these obstacles, Industry developed rust converters/rust transformers and rust compatible primers (high solids epoxies). The potential use of these products for military equipment led personnel of the Belvoir Research, Development and Engineering Center (BRDEC) to evaluate the commercially available rust transformers and rust compatible primers. Prior laboratory experience with commercially available rust converters, as well as field studies in Hawaii and Puerto Rico, revealed poor performance, several inherent limitations, and lack of reliability. It was obvious from our studies that the performance of rust converting products was more dependent on the amount and type of rust present, as well as the degree of permeability of the coating, than on the product's ability to form an organometallic complex with the rust. Based on these results, it was decided that the Military should develop their own rust converter formulation and specification. The compound described in the specification is for use on a rusted surface before the application of an organic coating (bituminous compounds, primer or topcoat). These coatings should end the need for sandblasting or the removing of the adherent corrosion products. They also will prepare the surface for the application of the organic coating. Several commercially available rust compatible primers (RCP) were also tested using corroded surfaces. All of the evaluated RCP failed our laboratory tests for primers.

  19. A clinical study on mobility of teeth as assessed through their damping characteristics and progress of periodontal disease using advanced diagnostic aids: Mobilometer and florida probe

    Directory of Open Access Journals (Sweden)

    Yogesh Doshi

    2010-01-01

    Full Text Available Aims and Objectives: Decision regarding the option to treat tooth mobility should be based on the etiology and detected severity of tooth mobility. The most widely used method of mobility assessment is to tap the tooth between two extreme positions. The study was designed to evaluate the association of Periotest values (PTV with the amount of bone, clinical attachment loss, and various clinical indices. The aim of the present study was to evaluate the association between bone loss and Periotest values. Also we evaluated the effects of attachment loss and tooth position on the Periotest values. Materials and Methods: A total number of 60 patients between the age group of 18 and 55 years were divided into subjects with healthy periodontium (Group A, and those with Chronic Generalized Periodontitis (Group B, having a generalized pocket probing depth of 3 - 8 mm, respectively. With the help of the Periotest, Florida probe, and radiographs the assessment was carried out. The data was statistically analyzed using the Student′s unpaired t-test. Results: It was found that the values were highly significant in the incisor, premolar, and molar areas. However, the value was found to be insignificant in the canine region. The anterior teeth showed higher PTV compared to the posterior teeth; and the mandibular teeth showed higher PTV compared to the maxillary teeth. There was no association between the clinical indices and Periotest values. Conclusion: The study showed that tooth mobility was dependent on bone support as well as the clinical attachment level.

  20. Economics : pricing, demand, and economic efficiency : a primer.

    Science.gov (United States)

    2008-11-01

    The Congestion Pricing Primer Series is part of : FHWAs outreach efforts to introduce the various : aspects of congestion pricing to decision-makers and : transportation professionals in the United States. The : primers are intended to lay out the...

  1. Primer on consumer marketing research : procedures, methods, and tools

    Science.gov (United States)

    1994-03-01

    The Volpe Center developed a marketing research primer which provides a guide to the approach, procedures, and research tools used by private industry in predicting consumer response. The final two chapters of the primer focus on the challenges of do...

  2. Bioinformatic tools and guideline for PCR primer design | Abd ...

    African Journals Online (AJOL)

    Bioinformatics has become an essential tool not only for basic research but also for applied research in biotechnology and biomedical sciences. Optimal primer sequence and appropriate primer concentration are essential for maximal specificity and efficiency of PCR. A poorly designed primer can result in little or no ...

  3. Development and deployment of a low-cost, mobile-ready, air quality sensor system: progress toward distributed networks and autonomous aerial sampling

    Science.gov (United States)

    Hersey, S. P.; DiVerdi, R.; Gadtaula, P.; Sheneman, T.; Flores, K.; Chen, Y. H.; Jayne, J. T.; Cross, E. S.

    2017-12-01

    Throughout the 2016-2017 academic year, a new partnership between Olin College of Engineering and Aerodyne Research, Inc. developed an affordable, self-contained air quality monitoring instrument called Modulair. The Modulair instrument is based on the same operating principles as Aerodyne's newly-developed ARISense integrated sensor system, employing electrochemical sensors for gas-phase measurements of CO, NO, NO2, and O3 and an off-the-shelf optical particle counter for particle concentration, number, and size distribution information (0.4 backend with a mobile, cloud-based data management system for real-time data posting and analysis. Open source tools and software were utilized in the development of the instrument. All initial work was completed by a team of undergraduate students as part of the Senior Capstone Program in Engineering (SCOPE) at Olin College. Deployment strategies for Modulair include distributed, mobile measurements and drone-based aerial sampling. Design goals for the drone integration include maximizing airborne sampling time and laying the foundation for software integration with the drone's autopilot system to allow for autonomous plume sampling across concentration gradients. Modulair and its flexible deployments enable real-time mapping of air quality data at exposure-relevant spatial scales, as well as regular, autonomous characterization of sources and dispersion of atmospheric pollutants. We will present an overview of the Modulair instrument and results from benchtop and field validation, including mobile and drone-based plume sampling in the Boston area.

  4. CRISPR Primer Designer: Design primers for knockout and chromosome imaging CRISPR-Cas system.

    Science.gov (United States)

    Yan, Meng; Zhou, Shi-Rong; Xue, Hong-Wei

    2015-07-01

    The clustered regularly interspaced short palindromic repeats (CRISPR)-associated system enables biologists to edit genomes precisely and provides a powerful tool for perturbing endogenous gene regulation, modulation of epigenetic markers, and genome architecture. However, there are concerns about the specificity of the system, especially the usages of knocking out a gene. Previous designing tools either were mostly built-in websites or ran as command-line programs, and none of them ran locally and acquired a user-friendly interface. In addition, with the development of CRISPR-derived systems, such as chromosome imaging, there were still no tools helping users to generate specific end-user spacers. We herein present CRISPR Primer Designer for researchers to design primers for CRISPR applications. The program has a user-friendly interface, can analyze the BLAST results by using multiple parameters, score for each candidate spacer, and generate the primers when using a certain plasmid. In addition, CRISPR Primer Designer runs locally and can be used to search spacer clusters, and exports primers for the CRISPR-Cas system-based chromosome imaging system. © 2014 Institute of Botany, Chinese Academy of Sciences.

  5. Determination of the species specificity of the primers for the detection of chicken and turkey meat by realtime PCR method

    Directory of Open Access Journals (Sweden)

    Lenka Maršálková

    2014-07-01

    Full Text Available The aim of this work was to use TaqMan Real-Time PCR for quantitative authentication of chicken and turkey meat. To meet this purpose, a specific pair of primers and TaqMan probe was used. The test was aimed at identifying the reaction cycle of turkey and chicken meat using by two sets of primers. With first set of primer designed for chicken we obtained the following results: Cp = 16.18 for 100% chicken DNA Cp = 29, 18 100% turkey DNA It was also amplified DNA of pig that exceeded the detection threshold fluorescence intensities in the 31.07 cycle (Cp = 31.07. Using primers designed for turkey we obtained the following results Cp = 31.16 for 100% CHDNA, Cp =16.18 100% TDNA. It was also amplified the 100% DNA of rabbit in 31.63 cycle (Cp = 31.63 and deer in cycle 32 (Cp = 32. The DNA of all other animal species was amplificated after more than 35 cycles (Cp >35. It follows that the second detection primer pair is specific enough to unrelated species of animals by 30 cycles of the reaction. Species authentication based on DNA analysis from this perspective overcomes all the shortcomings of proteins. At present, DNA analysis use different types of PCR. Is the most progressive Real-time PCR, which is suitable for the specific use of detection (primers and TaqMan probe. The TaqMan Real-time PCR is within the sensitivity and specificity, clearly one of the best methods for identifying the species of chicken and turkey meat. The specificity of this method, however, depends primarily on the specificity of the primers and TaqMan probe. The 30 cycle reaction was chosen by us as the threshold for specificity using primers for authentication chicken and turkey meat.

  6. Low-copy nuclear primers and ycf1 primers in Cactaceae.

    Science.gov (United States)

    Franck, Alan R; Cochrane, Bruce J; Garey, James R

    2012-10-01

    To increase the number of variable regions available for phylogenetic study in the Cactaceae, primers were developed for a portion of the plastid ycf1 gene and intron-spanning regions of two low-copy nuclear genes (isi1, nhx1). • Primers were tested on several families within Caryophyllales, focusing on the Cactaceae. Gel electrophoresis indicated positive amplification in most samples. Sequences of these three regions (isi1, nhx1, ycf1) from Harrisia exhibited variation similar to or greater than two plastid regions (atpB-rbcL intergenic spacer and rpl16 intron). • The isi, nhx, and ycf1 primers amplify phylogenetically useful information applicable to the Cactaceae and other families in the Caryophyllales.

  7. Progressive mobility program and technology to increase the level of physical activity and its benefits in respiratory, muscular system, and functionality of ICU patients: study protocol for a randomized controlled trial.

    Science.gov (United States)

    Schujmann, Debora Stripari; Lunardi, Adriana Claudia; Fu, Carolina

    2018-05-10

    Enhanced mobility in the Intensive Care Unit (ICU) could minimize the negative effects of critical illness, such as declines in cognitive, muscular, respiratory, and functional capacity. We aim to compare the functional status at ICU discharge of patients who underwent a progressive mobilization protocol versus patients who received conventional physiotherapy. We also examine the level of physical activity in the ICU, the degree of pulmonary and muscle function, and the length of stay to analyze correlations between these variables. This is a protocol for a randomized controlled trial with blind evaluation. Ninety-six ICU patients will be recruited from a single center and randomly assigned to a control group or an intervention group. To determine the level of protocol activity the patient will receive, the patients' ability to participate actively and their muscle strength will be considered. The protocol consists of five phases, ranging from passive therapies to walking and climbing stairs. The primary outcome will be the functional status at ICU discharge, measured with the Barthel Index and the ICU Mobility Scale (IMS). Measured secondary outcomes will include the level of physical activity, maximal inspiratory and expiratory pressures, forced expiratory volume in 1 second, maximum voluntary ventilation, handgrip strength, surface electromyography of the lower limb muscles, and results of the Timed Up and Go and 2-Minute Walk tests. Evaluations will be made within 2 days of ICU discharge except for the level of activity, which will be evaluated daily. Physiological variables and activity level will be analyzed by chi-square and t tests, according to the intention-to-treat paradigm. Mobility and exercise in the ICU should be undertaken with intensity, quantity, duration, and frequency adjusted according to the patients' status. The results of this study may contribute to new knowledge of early mobility in the ICU, activity level, and varying benefits in critical

  8. Progressive failure site generation in AlGaN/GaN high electron mobility transistors under OFF-state stress: Weibull statistics and temperature dependence

    International Nuclear Information System (INIS)

    Sun, Huarui; Bajo, Miguel Montes; Uren, Michael J.; Kuball, Martin

    2015-01-01

    Gate leakage degradation of AlGaN/GaN high electron mobility transistors under OFF-state stress is investigated using a combination of electrical, optical, and surface morphology characterizations. The generation of leakage “hot spots” at the edge of the gate is found to be strongly temperature accelerated. The time for the formation of each failure site follows a Weibull distribution with a shape parameter in the range of 0.7–0.9 from room temperature up to 120 °C. The average leakage per failure site is only weakly temperature dependent. The stress-induced structural degradation at the leakage sites exhibits a temperature dependence in the surface morphology, which is consistent with a surface defect generation process involving temperature-associated changes in the breakdown sites

  9. Bayesian models a statistical primer for ecologists

    CERN Document Server

    Hobbs, N Thompson

    2015-01-01

    Bayesian modeling has become an indispensable tool for ecological research because it is uniquely suited to deal with complexity in a statistically coherent way. This textbook provides a comprehensive and accessible introduction to the latest Bayesian methods-in language ecologists can understand. Unlike other books on the subject, this one emphasizes the principles behind the computations, giving ecologists a big-picture understanding of how to implement this powerful statistical approach. Bayesian Models is an essential primer for non-statisticians. It begins with a definition of probabili

  10. Signals and systems primer with Matlab

    CERN Document Server

    Poularikas, Alexander D

    2006-01-01

    Signals and Systems Primer with MATLAB® equally emphasizes the fundamentals of both analog and digital signals and systems. To ensure insight into the basic concepts and methods, the text presents a variety of examples that illustrate a wide range of applications, from microelectromechanical to worldwide communication systems. It also provides MATLAB functions and procedures for practice and verification of these concepts.Taking a pedagogical approach, the author builds a solid foundation in signal processing as well as analog and digital systems. The book first introduces orthogonal signals,

  11. Using voice to create hospital progress notes: Description of a mobile application and supporting system integrated with a commercial electronic health record.

    Science.gov (United States)

    Payne, Thomas H; Alonso, W David; Markiel, J Andrew; Lybarger, Kevin; White, Andrew A

    2018-01-01

    We describe the development and design of a smartphone app-based system to create inpatient progress notes using voice, commercial automatic speech recognition software, with text processing to recognize spoken voice commands and format the note, and integration with a commercial EHR. This new system fits hospital rounding workflow and was used to support a randomized clinical trial testing whether use of voice to create notes improves timeliness of note availability, note quality, and physician satisfaction with the note creation process. The system was used to create 709 notes which were placed in the corresponding patient's EHR record. The median time from pressing the Send button to appearance of the formatted note in the Inbox was 8.8 min. It was generally very reliable, accepted by physician users, and secure. This approach provides an alternative to use of keyboard and templates to create progress notes and may appeal to physicians who prefer voice to typing. Copyright © 2017 Elsevier Inc. All rights reserved.

  12. An iterative method for selecting degenerate multiplex PCR primers.

    Science.gov (United States)

    Souvenir, Richard; Buhler, Jeremy; Stormo, Gary; Zhang, Weixiong

    2007-01-01

    Single-nucleotide polymorphism (SNP) genotyping is an important molecular genetics process, which can produce results that will be useful in the medical field. Because of inherent complexities in DNA manipulation and analysis, many different methods have been proposed for a standard assay. One of the proposed techniques for performing SNP genotyping requires amplifying regions of DNA surrounding a large number of SNP loci. To automate a portion of this particular method, it is necessary to select a set of primers for the experiment. Selecting these primers can be formulated as the Multiple Degenerate Primer Design (MDPD) problem. The Multiple, Iterative Primer Selector (MIPS) is an iterative beam-search algorithm for MDPD. Theoretical and experimental analyses show that this algorithm performs well compared with the limits of degenerate primer design. Furthermore, MIPS outperforms an existing algorithm that was designed for a related degenerate primer selection problem.

  13. Primer on CDM programme of activities

    Energy Technology Data Exchange (ETDEWEB)

    Hinostroza, M. (UNEP Risoe Centre, Roskilde (Denmark)); Lescano, A.D. (A2G Carbon Partners (Peru)); Alvarez, J.M. (Ministerio del Ambiente del Peru (Peru)); Avendano, F.M. (EEA Fund Management Ltd. (United Kingdom)

    2009-07-01

    As an advanced modality introduced in 2005, the Programmatic CDM (POA) is expected to address asymmetries of participation, especially of very small-scale project activities in certain areas, key sectors and many countries with considerable potential for greenhouse gas emission reductions, not reached by the traditional single-project-based CDM. Latest experiences with POAs and the recently finalized official guidance governing the Programmatic CDM are the grassroots of this Primer, which has the purpose of supporting the fully understanding of rules and procedures of POAs by interpreting them and analyzing real POA cases. Professional and experts from the public and private entities have contributed to the development of this Primer, produced by the UNEP Risoe Centre, as part of knowledge support activities for the Capacity Development for the CDM (CD4CDM) project. The overall objective of the CD4CDM is to develop the capacities of host countries to identify, design, approve, finance, implement CDM projects and commercialize CERs in participating countries. The CDM4CDM is funded by the Netherlands Ministry of Foreign Affairs. (author)

  14. Bayesian models: A statistical primer for ecologists

    Science.gov (United States)

    Hobbs, N. Thompson; Hooten, Mevin B.

    2015-01-01

    Bayesian modeling has become an indispensable tool for ecological research because it is uniquely suited to deal with complexity in a statistically coherent way. This textbook provides a comprehensive and accessible introduction to the latest Bayesian methods—in language ecologists can understand. Unlike other books on the subject, this one emphasizes the principles behind the computations, giving ecologists a big-picture understanding of how to implement this powerful statistical approach.Bayesian Models is an essential primer for non-statisticians. It begins with a definition of probability and develops a step-by-step sequence of connected ideas, including basic distribution theory, network diagrams, hierarchical models, Markov chain Monte Carlo, and inference from single and multiple models. This unique book places less emphasis on computer coding, favoring instead a concise presentation of the mathematical statistics needed to understand how and why Bayesian analysis works. It also explains how to write out properly formulated hierarchical Bayesian models and use them in computing, research papers, and proposals.This primer enables ecologists to understand the statistical principles behind Bayesian modeling and apply them to research, teaching, policy, and management.Presents the mathematical and statistical foundations of Bayesian modeling in language accessible to non-statisticiansCovers basic distribution theory, network diagrams, hierarchical models, Markov chain Monte Carlo, and moreDeemphasizes computer coding in favor of basic principlesExplains how to write out properly factored statistical expressions representing Bayesian models

  15. Efficient Mobility Management Signalling in Network Mobility Supported PMIPV6

    Directory of Open Access Journals (Sweden)

    Ananthi Jebaseeli Samuelraj

    2015-01-01

    Full Text Available Proxy Mobile IPV6 (PMIPV6 is a network based mobility management protocol which supports node’s mobility without the contribution from the respective mobile node. PMIPV6 is initially designed to support individual node mobility and it should be enhanced to support mobile network movement. NEMO-BSP is an existing protocol to support network mobility (NEMO in PMIPV6 network. Due to the underlying differences in basic protocols, NEMO-BSP cannot be directly applied to PMIPV6 network. Mobility management signaling and data structures used for individual node’s mobility should be modified to support group nodes’ mobility management efficiently. Though a lot of research work is in progress to implement mobile network movement in PMIPV6, it is not yet standardized and each suffers with different shortcomings. This research work proposes modifications in NEMO-BSP and PMIPV6 to achieve NEMO support in PMIPV6. It mainly concentrates on optimizing the number and size of mobility signaling exchanged while mobile network or mobile network node changes its access point.

  16. Efficient Mobility Management Signalling in Network Mobility Supported PMIPV6.

    Science.gov (United States)

    Samuelraj, Ananthi Jebaseeli; Jayapal, Sundararajan

    2015-01-01

    Proxy Mobile IPV6 (PMIPV6) is a network based mobility management protocol which supports node's mobility without the contribution from the respective mobile node. PMIPV6 is initially designed to support individual node mobility and it should be enhanced to support mobile network movement. NEMO-BSP is an existing protocol to support network mobility (NEMO) in PMIPV6 network. Due to the underlying differences in basic protocols, NEMO-BSP cannot be directly applied to PMIPV6 network. Mobility management signaling and data structures used for individual node's mobility should be modified to support group nodes' mobility management efficiently. Though a lot of research work is in progress to implement mobile network movement in PMIPV6, it is not yet standardized and each suffers with different shortcomings. This research work proposes modifications in NEMO-BSP and PMIPV6 to achieve NEMO support in PMIPV6. It mainly concentrates on optimizing the number and size of mobility signaling exchanged while mobile network or mobile network node changes its access point.

  17. Medium Caliber Lead-Free Electric Primer. Version 2

    Science.gov (United States)

    2012-09-01

    2008). Safe Drinking Water Act of 1986 lists lead compounds as carcinogens (27 CCR 27001 – Dec. 2008). EPA began a Phase I assessment to determine...primer cups was our standard method, wet loading using solvents (hexane and iso -propanol) was investigated to reduce risk of accidental ignition...LOADING OPERATION (Single Die) Wet primer mix charge with solvent (Hexane/ Iso -Propanol) and stir to mix to a uniform slurry Insert primer cup in

  18. Mobile Learning Using Mobile Phones

    Science.gov (United States)

    Vicente, Paula

    2013-01-01

    The participation in mobile learning programs is conditioned by having/using mobile communication technology. Those who do not have or use such technology cannot participate in mobile learning programs. This study evaluates who are the most likely participants of mobile learning programs by examining the demographic profile and mobile phone usage…

  19. High-speed measurement of firearm primer blast waves

    OpenAIRE

    Courtney, Michael; Daviscourt, Joshua; Eng, Jonathan; Courtney, Amy

    2012-01-01

    This article describes a method and results for direct high-speed measurements of firearm primer blast waves employing a high-speed pressure transducer located at the muzzle to record the blast pressure wave produced by primer ignition. Key findings are: 1) Most of the lead styphnate based primer models tested show 5.2-11.3% standard deviation in the magnitudes of their peak pressure. 2) In contrast, lead-free diazodinitrophenol (DDNP) based primers had standard deviations of the peak blast p...

  20. Brownfields Technology Primer: Selecting and Using Phytoremediation for Site Cleanup

    Science.gov (United States)

    This primer explains the phytoremediation process, discusses the potential advantages and considerations in selecting phytoremediation to clean up brownfields sites, and provides information on additional resources about phytoremediation.

  1. Staging Mobilities / Designing Mobilities

    DEFF Research Database (Denmark)

    Jensen, Ole B.

    2015-01-01

    , and systems 'hosting' these multiple and complex mobilities are designed and how they are staging these in terms of their physical layout. By analysing specific cases of ‘mobilities design’ related to the four modes of moving; Walk, Bike, Train, and Car, the book uncover important and until now neglected...... is more than movement between point A and B. It explores how the movement of people, goods, information, and signs influences human understandings of self, other and the built environment. Moving towards a new understanding of the relationship between movement, interaction and environments, the project...

  2. Great Lakes rivermouths: a primer for managers

    Science.gov (United States)

    Pebbles, Victoria; Larson, James; Seelbach, Paul; Pebbles, Victoria; Larson, James; Seelbach, Paul

    2013-01-01

    Between the North American Great Lakes and their tributaries are the places where the confluence of river and lake waters creates a distinct ecosystem: the rivermouth ecosystem. Human development has often centered around these rivermouths, in part, because they provide a rich array of ecosystem services. Not surprisingly, centuries of intense human activity have led to substantial pressures on, and alterations to, these ecosystems, often diminishing or degrading their ecological functions and associated ecological services. Many Great Lakes rivermouths are the focus of intense restoration efforts. For example, 36 of the active Great Lakes Areas of Concern (AOCs) are rivermouths or areas that include one or more rivermouths. Historically, research of rivermouth ecosystems has been piecemeal, focused on the Great Lakes proper or on the upper reaches of tributaries, with little direct study of the rivermouth itself. Researchers have been divided among disciplines, agencies and institutions; and they often work independently and use disparate venues to communicate their work. Management has also been fragmented with a focus on smaller, localized, sub-habitat units and socio-political or economic elements, rather than system-level consideration. This Primer presents the case for a more holistic approach to rivermouth science and management that can enable restoration of ecosystem services with multiple benefits to humans and the Great Lakes ecosystem. A conceptual model is presented with supporting text that describes the structures and processes common to all rivermouths, substantiating the case for treating these ecosystems as an identifiable class.1 Ecological services provided by rivermouths and changes in how humans value those services over time are illustrated through case studies of two Great Lakes rivermouths—the St. Louis River and the Maumee River. Specific ecosystem services are identified in italics throughout this Primer and follow definitions described

  3. Bearing Dislocation and Progression of Osteoarthritis After Mobile-bearing Unicompartmental Knee Arthroplasty Vary Between Asian and Western Patients: A Meta-analysis.

    Science.gov (United States)

    Ro, Kyung-Han; Heo, Jae-Won; Lee, Dae-Hee

    2018-05-01

    Implant survivorship is reported to be lower and complications, particularly bearing dislocation, are reported to be more frequent in Asian than in Western patients with medial knee osteoarthritis (OA) undergoing Oxford® Phase III unicompartmental knee arthroplasty (UKA). To date, however, these complications have not been compared between these groups of patients. The purpose of this study was to perform a meta-analysis comparing the standardized incidence rates of (1) all-cause reoperation; (2) reoperation related to bearing dislocation; and (3) reoperation related to progression of lateral compartment arthritis in Asian and Western patients with medial knee OA who underwent Oxford Phase III UKA. We searched MEDLINE® (January 1, 1976, to May 31, 2017), EMBASE® (January 1, 1985, to May 31, 2017), and the Cochrane Library (January 1, 1987, to May 31, 2017) for studies that reported complications of Oxford Phase III UKAs. Studies were included if they reported reoperation rates attributable to bearing dislocation and/or progression of lateral knee OA after surgery with this implant. Twenty-seven studies were included in this systematic review and 16 studies with followups > 5 years were included in the meta-analysis. These rates were converted to standardized incidence rate (that is, reoperations per 100 observed component years) based on mean followup and number of involved knees in each study. After applying prespecified inclusion and exclusion criteria, the studies were categorized into two groups, Asian and Western, based on hospital location. Twenty-five studies, containing 3152 Asian patients and 5455 Western patients, were evaluated. Study quality was assessed by the modified Coleman Methodology score (MCMS). Although all studies were Level IV, their mean MCMS score was 66.92 (SD, 8.7; 95% confidence interval [CI], 63.5-70.3), indicating fair quality. Because the heterogeneity of all subgroup meta-analyses was high, a random-effects model was used with

  4. Complex and adaptive dynamical systems a primer

    CERN Document Server

    Gros, Claudius

    2015-01-01

    This primer offers readers an introduction to the central concepts that form our modern understanding of complex and emergent behavior, together with detailed coverage of accompanying mathematical methods. All calculations are presented step by step and are easy to follow. This new fourth edition has been fully reorganized and includes new chapters, figures and exercises. The core aspects of modern complex system sciences are presented in the first chapters, covering network theory, dynamical systems, bifurcation and catastrophe theory, chaos and adaptive processes, together with the principle of self-organization in reaction-diffusion systems and social animals. Modern information theoretical principles are treated in further chapters, together with the concept of self-organized criticality, gene regulation networks, hypercycles and coevolutionary avalanches, synchronization phenomena, absorbing phase transitions and the cognitive system approach to the brain. Technical course prerequisites are the standard ...

  5. Complex and adaptive dynamical systems a primer

    CERN Document Server

    Gros, Claudius

    2007-01-01

    We are living in an ever more complex world, an epoch where human actions can accordingly acquire far-reaching potentialities. Complex and adaptive dynamical systems are ubiquitous in the world surrounding us and require us to adapt to new realities and the way of dealing with them. This primer has been developed with the aim of conveying a wide range of "commons-sense" knowledge in the field of quantitative complex system science at an introductory level, providing an entry point to this both fascinating and vitally important subject. The approach is modular and phenomenology driven. Examples of emerging phenomena of generic importance treated in this book are: -- The small world phenomenon in social and scale-free networks. -- Phase transitions and self-organized criticality in adaptive systems. -- Life at the edge of chaos and coevolutionary avalanches resulting from the unfolding of all living. -- The concept of living dynamical systems and emotional diffusive control within cognitive system theory. Techn...

  6. Complex and Adaptive Dynamical Systems A Primer

    CERN Document Server

    Gros, Claudius

    2011-01-01

    We are living in an ever more complex world, an epoch where human actions can accordingly acquire far-reaching potentialities. Complex and adaptive dynamical systems are ubiquitous in the world surrounding us and require us to adapt to new realities and the way of dealing with them. This primer has been developed with the aim of conveying a wide range of "commons-sense" knowledge in the field of quantitative complex system science at an introductory level, providing an entry point to this both fascinating and vitally important subject. The approach is modular and phenomenology driven. Examples of emerging phenomena of generic importance treated in this book are: -- The small world phenomenon in social and scale-free networks. -- Phase transitions and self-organized criticality in adaptive systems. -- Life at the edge of chaos and coevolutionary avalanches resulting from the unfolding of all living. -- The concept of living dynamical systems and emotional diffusive control within cognitive system theory. Techn...

  7. Complex and adaptive dynamical systems a primer

    CERN Document Server

    Gros, Claudius

    2013-01-01

    Complex system theory is rapidly developing and gaining importance, providing tools and concepts central to our modern understanding of emergent phenomena. This primer offers an introduction to this area together with detailed coverage of the mathematics involved. All calculations are presented step by step and are straightforward to follow. This new third edition comes with new material, figures and exercises. Network theory, dynamical systems and information theory, the core of modern complex system sciences, are developed in the first three chapters, covering basic concepts and phenomena like small-world networks, bifurcation theory and information entropy. Further chapters use a modular approach to address the most important concepts in complex system sciences, with the emergence and self-organization playing a central role. Prominent examples are self-organized criticality in adaptive systems, life at the edge of chaos, hypercycles and coevolutionary avalanches, synchronization phenomena, absorbing phase...

  8. MCNPTM criticality primer and training experiences

    International Nuclear Information System (INIS)

    Briesmeister, J.; Forster, R.A.; Busch, R.

    1995-01-01

    With the closure of many experimental facilities, the nuclear criticality safety analyst is increasingly required to rely on computer calculations to identify safe limits for the handling and storage of fissile materials. However, the analyst may have little experience with the specific codes available at his or her facility. Usually, the codes are quite complex, black boxes capable of analyzing numerous problems with a myriad of input options. Documentation for these codes is designed to cover all the possible configurations and types of analyses but does not give much detail on any particular type of analysis. For criticality calculations, the user of a code is primarily interested in the value of the effective multiplication factor for a system (k eff ). Most codes will provide this, and truckloads of other information that may be less pertinent to criticality calculations. Based on discussions with code users in the nuclear criticality safety community, it was decided that a simple document discussing the ins and outs of criticality calculations with specific codes would be quite useful. The Transport Methods Group, XTM, at Los Alamos National Laboratory (LANL) decided to develop a primer for criticality calculations with their Monte Carlo code, MCNP. This was a joint task between LANL with a knowledge and understanding of the nuances and capabilities of MCNP and the University of New Mexico with a knowledge and understanding of nuclear criticality safety calculations and educating first time users of neutronics calculations. The initial problem was that the MCNP manual just contained too much information. Almost everything one needs to know about MCNP can be found in the manual; the problem is that there is more information than a user requires to do a simple k eff calculation. The basic concept of the primer was to distill the manual to create a document whose only focus was criticality calculations using MCNP

  9. Primer for criticality calculations with DANTSYS

    International Nuclear Information System (INIS)

    Busch, R.D.

    1996-01-01

    With the closure of many experimental facilities, the nuclear criticality safety analyst is increasingly required to rely on computer calculations to identify safe limits for the handling and storage of fissile materials. However, in many cases, the analyst has little experience with the specific codes available at his or her facility. Typically, two types of codes are available: deterministic codes such as ANISN or DANTSYS that solve an approximate model exactly and Monte Carlo Codes such as KENO or MCNP that solve an exact model approximately. Often, the analyst feels that the deterministic codes are too simple and will not provide the necessary information, so most modeling uses Monte Carlo methods. This sometimes means that hours of effort are expended to produce results available in minutes from deterministic codes. A substantial amount of reliable information on nuclear systems can be obtained using deterministic methods if the user understands their limitations. To guide criticality specialists in this area, the Nuclear Criticality Safety Group at the University of New Mexico in cooperation with the Radiation Transport Group at Los Alamos National Laboratory has designed a primer to help the analyst understand and use the DANTSYS deterministic transport code for nuclear criticality safety analyses. (DANTSYS is the name of a suite of codes that users more commonly know as ONEDANT, TWODANT, TWOHEX, and THREEDANT.) It assumes a college education in a technical field, but there is no assumption of familiarity with neutronics codes in general or with DANTSYS in particular. The primer is designed to teach by example, with each example illustrating two or three DANTSYS features useful in criticality analyses

  10. Mobility management in mobile IP

    Science.gov (United States)

    Medidi, Sirisha; Golshani, Forouzan

    2002-07-01

    There is an emerging interest in integrating mobile wireless communication with the Internet based on the Ipv6 technology. Many issues introduced by the mobility of users arise when such an integration is attempted. This paper addresses the problem of mobility management, i.e., that of tracking the current IP addresses of mobile terminals and sustaining active IP connections as mobiles move. The paper presents some architectural and mobility management options for integrating wireless access to the Internet. We then present performance results for Mobile IPv4, route optimization and Mobile IPv6.

  11. Building Evacuation with Mobile Devices

    OpenAIRE

    Merkel, Sabrina

    2014-01-01

    The rapidly growing world population and increasingly dense settlements demand ever-larger and more complex buildings from today's engineers. In comparison to this technological progress, a building's equipment for emergency evacuation has been hardly developed further. This work presents a concept for a building evacuation system based on mobile devices. Furthermore, various algorithms for route planning with mobile devices and for indoor localization of mobile devices are addressed.

  12. The Fluid Reading Primer: Animated Decoding Support for Emergent Readers.

    Science.gov (United States)

    Zellweger, Polle T.; Mackinlay, Jock D.

    A prototype application called the Fluid Reading Primer was developed to help emergent readers with the process of decoding written words into their spoken forms. The Fluid Reading Primer is part of a larger research project called Fluid Documents, which is exploring the use of interactive animation of typography to show additional information in…

  13. Marketing Information Products and Services : A Primer for ...

    International Development Research Centre (IDRC) Digital Library (Canada)

    Marketing Information Products and Services : A Primer for Librarians and Information Professionals. Couverture du livre Marketing Information Products and Services : A Primer for Librarians and Information Professionals. Directeur(s) : Abhinandan K. Jain, Ashok Jambhekar, T.P.Rama Rao et S. Sreenivas Rao. Maison(s) ...

  14. RUCS: Rapid identification of PCR primers for unique core sequences

    DEFF Research Database (Denmark)

    Thomsen, Martin Christen Frølund; Hasman, Henrik; Westh, Henrik

    2017-01-01

    Designing PCR primers to target a specific selection of whole genome sequenced strains can be a long, arduous, and sometimes impractical task. Such tasks would benefit greatly from an automated tool to both identify unique targets, and to validate the vast number of potential primer pairs...... for the targets in silico . Here we present RUCS, a program that will find PCR primer pairs and probes for the unique core sequences of a positive genome dataset complement to a negative genome dataset. The resulting primer pairs and probes are in addition to simple selection also validated through a complex...... in silico PCR simulation. We compared our method, which identifies the unique core sequences, against an existing tool called ssGeneFinder, and found that our method was 6.5-20 times more sensitive. We used RUCS to design primer pairs that would target a set of genomes known to contain the mcr-1 colistin...

  15. Mobile Multicast in Hierarchical Proxy Mobile IPV6

    Science.gov (United States)

    Hafizah Mohd Aman, Azana; Hashim, Aisha Hassan A.; Mustafa, Amin; Abdullah, Khaizuran

    2013-12-01

    Mobile Internet Protocol Version 6 (MIPv6) environments have been developing very rapidly. Many challenges arise with the fast progress of MIPv6 technologies and its environment. Therefore the importance of improving the existing architecture and operations increases. One of the many challenges which need to be addressed is the need for performance improvement to support mobile multicast. Numerous approaches have been proposed to improve mobile multicast performance. This includes Context Transfer Protocol (CXTP), Hierarchical Mobile IPv6 (HMIPv6), Fast Mobile IPv6 (FMIPv6) and Proxy Mobile IPv6 (PMIPv6). This document describes multicast context transfer in hierarchical proxy mobile IPv6 (H-PMIPv6) to provide better multicasting performance in PMIPv6 domain.

  16. Mobile Election

    OpenAIRE

    Long, Elena; Lovitskii, Vladimir; Thrasher, Michael; Traynor, David

    2009-01-01

    Mobile phones have the potential of fostering political mobilisation. There is a significant political power in mobile technology. Like the Internet, mobile phones facilitate communication and rapid access to information. Compared to the Internet, however, mobile phone diffusion has reached a larger proportion of the population in most countries, and thus the impact of this new medium is conceivably greater. There are now more mobile phones in the UK than there are people (ave...

  17. Mobile Advertising

    OpenAIRE

    Alamuri, Lavanya

    2009-01-01

    The aim of this project was to get an understanding of how companies adopt mobile as an advertising medium. The literature review aided in framing a draft of the factors that affect mobile advertising adoption and possible forms of mobile advertising. Considering the scope of the thesis work, branding strategy, service costs, personalization and privacy and platform were considered to be the factors that could affect the mobile advertising adoption. A few possible forms on mobile device we...

  18. Relativistic Astrophysics and Cosmology: A Primer

    International Nuclear Information System (INIS)

    Abramowicz, Marek A

    2007-01-01

    'Relativistic Astrophysics and Cosmology: A Primer' by Peter Hoyng, was published last year by Springer. The book is based on lectures given by the author at University of Utrecht to advanced undergraduates. This is a short and scholarly book. In about 300 pages, the author has covered the most interesting and important applications of Albert Einstein's general relativity in present-day astrophysics and cosmology: black holes, neutron stars, gravitational waves, and the cosmic microwave background. The book stresses theory, but also discusses several experimental and observational topics, such as the Gravity Probe B mission, interferometer detectors of gravitational waves and the power spectrum of the cosmic microwave background. The coverage is not uniform. Some topics are discussed in depth, others are only briefly mentioned. The book obviously reflects the author's own research interests and his preferences for specific mathematical methods, and the choice of the original artwork that illustrates the book (and appears on its cover) is a very personal one. I consider this personal touch an advantage, even if I do not always agree with the author's choices. For example, I employ Killing vectors as a very useful mathematical tool not only in my research on black holes, but also in my classes. I find that my students prefer it when discussions of particle, photon and fluid motion in the Schwarzschild and Kerr spacetimes are based explicitly and directly on the Killing vectors rather than on coordinate calculations. The latter approach is, of course, the traditional one, and is used in Peter Hoyng's book. Reading the book is a stimulating experience, because the reader can almost feel the author's presence. The author's opinions, his mathematical taste, his research pleasures, and his pedagogical passion are apparent everywhere. Lecturers contemplating a new course on relativistic astrophysics could adopt Hoyng's book as the text. Their students will be in the author

  19. Value for money assessment for public-private partnerships : a primer.

    Science.gov (United States)

    2015-01-01

    This primer addresses Value for Money Assessment for public-private partnerships (P3s). Companion : primers on Financial Assessment and Risk Assessment for P3s are also available as part of this series of : primers.

  20. Mobilities Design

    DEFF Research Database (Denmark)

    Lanng, Ditte Bendix; Wind, Simon; Jensen, Ole B.

    2017-01-01

    Mobilities comprise a large part of our world and everyday lives, and the mobilities spaces in which we travel are ubiquitous. Yet, ordinary mobilities spaces – such as parking lots, pedestrian tunnels, and road lay-bys – tend to be criticized as typologies that lack consideration for the people...... who use them and for their wider social, aesthetic, cultural, and ecological agency in the city. This is clearly not an unambiguous characterization. But from it follows an urgency to re-examine unheeded mobilities spaces and extend demands of their agency beyond standards of technical efficiency....... This article draws on the recent “mobilities turn” in social science to support such re-examination of mobilities spaces. In social-scientific mobilities research, mobilities are considered the departure point for understanding the socio-material world in which we live. Mobilities are regarded as far more than...

  1. Complementation of a primer binding site-impaired murine leukemia virus-derived retroviral vector by a genetically engineered tRNA-like primer

    DEFF Research Database (Denmark)

    Lund, Anders Henrik; Duch, M; Lovmand, J

    1997-01-01

    , but not with a noncomplementary tRNA-like molecule. The engineered primer was shown to be involved in both the initiation of first-strand synthesis and second-strand transfer. These results provide an in vivo demonstration that the retroviral replication machinery may recognize sequence complementarity rather than actual primer...... binding site and 3' primer sequences. Use of mutated primer binding site vectors replicating via engineered primers may add additional control features to retroviral gene transfer technology....

  2. Primer on electricity futures and other derivatives

    Energy Technology Data Exchange (ETDEWEB)

    Stoft, S.; Belden, T.; Goldman, C.; Pickle, S.

    1998-01-01

    Increased competition in bulk power and retail electricity markets is likely to lower electricity prices, but will also result in greater price volatility as the industry moves away from administratively determined, cost-based rates and encourages market-driven prices. Price volatility introduces new risks for generators, consumers, and marketers. Electricity futures and other derivatives can help each of these market participants manage, or hedge, price risks in a competitive electricity market. Futures contracts are legally binding and negotiable contracts that call for the future delivery of a commodity. In most cases, physical delivery does not take place, and the futures contract is closed by buying or selling a futures contract on or near the delivery date. Other electric rate derivatives include options, price swaps, basis swaps, and forward contracts. This report is intended as a primer for public utility commissioners and their staff on futures and other financial instruments used to manage price risks. The report also explores some of the difficult choices facing regulators as they attempt to develop policies in this area.

  3. A primer on systematic reviews in toxicology.

    Science.gov (United States)

    Hoffmann, Sebastian; de Vries, Rob B M; Stephens, Martin L; Beck, Nancy B; Dirven, Hubert A A M; Fowle, John R; Goodman, Julie E; Hartung, Thomas; Kimber, Ian; Lalu, Manoj M; Thayer, Kristina; Whaley, Paul; Wikoff, Daniele; Tsaioun, Katya

    2017-07-01

    Systematic reviews, pioneered in the clinical field, provide a transparent, methodologically rigorous and reproducible means of summarizing the available evidence on a precisely framed research question. Having matured to a well-established approach in many research fields, systematic reviews are receiving increasing attention as a potential tool for answering toxicological questions. In the larger framework of evidence-based toxicology, the advantages and obstacles of, as well as the approaches for, adapting and adopting systematic reviews to toxicology are still being explored. To provide the toxicology community with a starting point for conducting or understanding systematic reviews, we herein summarized available guidance documents from various fields of application. We have elaborated on the systematic review process by breaking it down into ten steps, starting with planning the project, framing the question, and writing and publishing the protocol, and concluding with interpretation and reporting. In addition, we have identified the specific methodological challenges of toxicological questions and have summarized how these can be addressed. Ultimately, this primer is intended to stimulate scientific discussions of the identified issues to fuel the development of toxicology-specific methodology and to encourage the application of systematic review methodology to toxicological issues.

  4. Primer on electricity futures and other derivatives

    International Nuclear Information System (INIS)

    Stoft, S.; Belden, T.; Goldman, C.; Pickle, S.

    1998-01-01

    Increased competition in bulk power and retail electricity markets is likely to lower electricity prices, but will also result in greater price volatility as the industry moves away from administratively determined, cost-based rates and encourages market-driven prices. Price volatility introduces new risks for generators, consumers, and marketers. Electricity futures and other derivatives can help each of these market participants manage, or hedge, price risks in a competitive electricity market. Futures contracts are legally binding and negotiable contracts that call for the future delivery of a commodity. In most cases, physical delivery does not take place, and the futures contract is closed by buying or selling a futures contract on or near the delivery date. Other electric rate derivatives include options, price swaps, basis swaps, and forward contracts. This report is intended as a primer for public utility commissioners and their staff on futures and other financial instruments used to manage price risks. The report also explores some of the difficult choices facing regulators as they attempt to develop policies in this area

  5. Mobile Workforce, Mobile Technology, Mobile Threats

    International Nuclear Information System (INIS)

    Garcia, J.

    2015-01-01

    Mobile technologies' introduction into the world of safeguards business processes such as inspection creates tremendous opportunity for novel approaches and could result in a number of improvements to such processes. Mobile applications are certainly the wave of the future. The success of the application ecosystems has shown that users want full fidelity, highly-usable, simple purpose applications with simple installation, quick responses and, of course, access to network resources at all times. But the counterpart to opportunity is risk, and the widespread adoption of mobile technologies requires a deep understanding of the threats and vulnerabilities inherent in mobile technologies. Modern mobile devices can be characterized as small computers. As such, the threats against computing infrastructure apply to mobile devices. Meanwhile, the attributes of mobile technology that make it such an obvious benefit over traditional computing platforms all have elements of risk: pervasive, always-on networking; diverse ecosystems; lack of centralized control; constantly shifting technological foundations; intense competition among competitors in the marketplace; the scale of the installation base (from millions to billions); and many more. This paper will explore the diverse and massive environment of mobile, the number of attackers and vast opportunities for compromise. The paper will explain how mobile devices prove valuable targets to both advanced and persistent attackers as well as less-skilled casual hackers. Organized crime, national intelligence agencies, corporate espionage are all part of the landscape. (author)

  6. Primers for phylogeny reconstruction in Bignonieae (Bignoniaceae) using herbarium samples.

    Science.gov (United States)

    Zuntini, Alexandre R; Fonseca, Luiz Henrique M; Lohmann, Lúcia G

    2013-09-01

    New primers were developed for Bignonieae to enable phylogenetic studies within this clade using herbarium samples. • Internal primers were designed based on available sequences of the plastid ndhF gene and the rpl32-trnL intergenic spacer region, and the nuclear gene PepC. The resulting primers were used to amplify DNA extracted from herbarium materials. High-quality data were obtained from herbarium samples up to 53 yr old. • The standardized methodology allows the inclusion of herbarium materials as alternative sources of DNA for phylogenetic studies in Bignonieae.

  7. Primers for Phylogeny Reconstruction in Bignonieae (Bignoniaceae Using Herbarium Samples

    Directory of Open Access Journals (Sweden)

    Alexandre R. Zuntini

    2013-08-01

    Full Text Available Premise of the study: New primers were developed for Bignonieae to enable phylogenetic studies within this clade using herbarium samples. Methods and Results: Internal primers were designed based on available sequences of the plastid ndhF gene and the rpl32-trnL intergenic spacer region, and the nuclear gene PepC. The resulting primers were used to amplify DNA extracted from herbarium materials. High-quality data were obtained from herbarium samples up to 53 yr old. Conclusions: The standardized methodology allows the inclusion of herbarium materials as alternative sources of DNA for phylogenetic studies in Bignonieae.

  8. Microsatellite Primers in the Lichen Symbiotic Alga Trebouxia decolorans (Trebouxiophyceae

    Directory of Open Access Journals (Sweden)

    Francesco Dal Grande

    2013-03-01

    Full Text Available Premise of the study: Polymorphic microsatellite markers were developed for the symbiotic green alga Trebouxia decolorans to study fine-scale population structure and clonal diversity. Methods and Results: Using Illumina pyrosequencing, 20 microsatellite primer sets were developed for T. decolorans. The primer sets were tested on 43 individuals sampled from four subpopulations in Germany. The primers amplified di-, tri-, and tetranucleotide repeats with three to 15 alleles per locus, and the unbiased haploid diversity per locus ranged from 0.636 to 0.821. Conclusions: The identified microsatellite markers will be useful to study the genetic diversity, dispersal, and reproductive mode of this common lichen photobiont.

  9. A physicists guide to The Los Alamos Primer

    International Nuclear Information System (INIS)

    Reed, B Cameron

    2016-01-01

    In April 1943, a group of scientists at the newly established Los Alamos Laboratory were given a series of lectures by Robert Serber on what was then known of the physics and engineering issues involved in developing fission bombs. Serber’s lectures were recorded in a 24 page report titled The Los Alamos Primer , which was subsequently declassified and published in book form. This paper describes the background to the Primer and analyzes the physics contained in its 22 sections. The motivation for this paper is to provide a firm foundation of the background and contents of the Primer for physicists interested in the Manhattan Project and nuclear weapons. (invited comment)

  10. Mobilities Design

    DEFF Research Database (Denmark)

    Jensen, Ole B.; Lanng, Ditte Bendix

    Contemporary society is marked and defined by the ways in which mobile goods, bodies, vehicles, objects, and data are organized, moved and staged. On the background of the ‘mobilities turn’ (e.g. Cresswell 2006, Urry 2007) this book articulates a new and emerging research field, namely that of ‘m......Contemporary society is marked and defined by the ways in which mobile goods, bodies, vehicles, objects, and data are organized, moved and staged. On the background of the ‘mobilities turn’ (e.g. Cresswell 2006, Urry 2007) this book articulates a new and emerging research field, namely...... that of ‘mobilities design’. The book revolves around the following research question: How are design decisions and interventions staging mobilities? It builds upon the Staging Mobilities model (Jensen 2013) in an explorative inquiry into the problems and potentials of the design of mobilities. The exchange value...

  11. Mobile economy

    OpenAIRE

    Turowski, Klaus

    2004-01-01

    Mobile economy : Transaktionen, Prozesse, Anwendungen und Dienste ; 4. Workshop Mobile Commerce, 02.-03. Februar 2004, Univ. Augsburg / K. Turowski ... (Hrsg.). - Bonn : Ges. für Informatik, 2004. - 189 S. : Ill., graph. Darst. - (GI-Edition : Proceedings ; 42)

  12. Mobile marketing

    OpenAIRE

    Gause, Matěj

    2012-01-01

    The goal of bachelor's thesis on the theme "Mobile marketing" is to outline its development and why is this new phenomen so important for all modern companies around the world. The work is not about simple description of mobile marketing media but it vividly informs about the latest trends and news from the world of mobile apps and games. It presents the most successful mobile apps which registered more than billion downloads and from their unique characteristics it unveils great potential of...

  13. Mobile marketing

    OpenAIRE

    KLEČKOVÁ, Zuzana

    2013-01-01

    The main aim of this thesis was to provide a comprehensive overview of the mobile marketing and analyze selected campaigns of Czech mobile marketing in comparison to world successful campaigns. The research contained studying of available literature about the theme to gain general knowledge about the issue. The theoretical part of the thesis contains predominantly various definitions of mobile marketing and its tools, advantages of these tools and some information about Mobile Marketing Assoc...

  14. Staging Mobilities

    DEFF Research Database (Denmark)

    Jensen, Ole B.

    and lived as people are “staging themselves” (from below). Staging mobilities is a dynamic process between “being staged” (for example, being stopped at traffic lights) and the “mobile staging” of interacting individuals (negotiating a passage on the pavement). Staging Mobilities is about the fact...

  15. Subversive Mobilities

    DEFF Research Database (Denmark)

    Thelle, Mikkel

    2013-01-01

    The article approaches mobility through a cultural history of urban conflict. Using a case of “The Copenhagen Trouble,“ a series of riots in the Danish capital around 1900, a space of subversive mobilities is delineated. These turn-of-the-century riots points to a new pattern of mobile gathering...

  16. Preparation and Characterization of Acrylic Primer for Concrete Substrate Application

    Directory of Open Access Journals (Sweden)

    El-Sayed Negim

    2016-01-01

    Full Text Available This study dealt with the properties of acrylic primer for concrete substrate using acrylic syrup, made from a methyl methacrylate monomer solution of terpolymers. Terpolymer systems consisting of methyl methacrylate (MMA, 2-ethylhexyl acrylate (2-EHA, and methacrylic acid (MAA with different chemical composition ratios of MMA and 2-EHA were synthesized through bulk polymerization using azobisisobutyronitrile (AIBN as initiator. The terpolymer composition is characterized by FTIR, 1H NMR, DSC, TGA, and SEM. The glass transition temperature and the thermal stability increased with increasing amounts of MMA in the terpolymer backbone. The effect of chemical composition of terpolymers on physicomechanical properties of primer films was investigated. However, increasing the amount of MMA in terpolymer backbone increased tensile and contact angle of primer films while elongation at break, water absorption, and bond strength are decreased. In particular, the primer syrup containing 65% 2-EHA has good bonding strength with concrete substrate around 1.1 MPa.

  17. Designing for transportation management and operations : a primer.

    Science.gov (United States)

    2013-02-01

    This primer is focused on the collaborative and systematic consideration of management and operations during transportation : project design and development. This is termed designing for operations. Effectively designing for operations involves...

  18. Mobile Probes in Mobile Learning

    DEFF Research Database (Denmark)

    Ørngreen, Rikke; Blomhøj, Ulla; Duvaa, Uffe

    In this paper experiences from using mobile probes in educational design of a mobile learning application is presented. The probing process stems from the cultural probe method, and was influenced by qualitative interview and inquiry approaches. In the project, the mobile phone was not only acting...... as an agent for acquiring empirical data (as the situation in hitherto mobile probe settings) but was also the technological medium for which data should say something about (mobile learning). Consequently, not only the content of the data but also the ways in which data was delivered and handled, provided...... a valuable dimension for investigating mobile use. The data was collected at the same time as design activities took place and the collective data was analysed based on user experience goals and cognitive processes from interaction design and mobile learning. The mobile probe increased the knowledge base...

  19. Mobile Semiotics

    DEFF Research Database (Denmark)

    Jensen, Ole B.

    2013-01-01

    This chapter aims to understand the mobile condition of contemporary life with a particular view to the signifying dimension of the environment and its ‘readability’. The chapter explores the potentials of semiotics and its relationship to the new mobilities literature. What takes place...... is a ‘mobile sense making’ where signs and materially situated meanings connect to the moving human body and thus create particular challenges and complexities of making sense of the world. The chapter includes notions of mobility systems and socio-technical networks in order to show how a ‘semiotic layer’ may...... work to afford or restrict mobile practices....

  20. Emerging technologies a primer for librarians

    CERN Document Server

    Koerber, Jennifer

    2015-01-01

    Here's a one-stop snapshot of emerging technologies every librarian should know about and examples that illustrate how the technologies are being used in libraries today! The e-book includes videos of interviews with librarians that are using them. The videos are available on a web site for people who purchase the print book. The first four chapters-Audio & Video, Self- and Micro-Publishing, Mobile Technology, and Crowdfunding-all look at older technologies reinvented and reimagined through significant advances in quality, scale, or hardware. Many libraries were already

  1. Primer design for a prokaryotic differential display RT-PCR.

    Science.gov (United States)

    Fislage, R; Berceanu, M; Humboldt, Y; Wendt, M; Oberender, H

    1997-05-01

    We have developed a primer set for a prokaryotic differential display of mRNA in the Enterobacteriaceae group. Each combination of ten 10mer and ten 11mer primers generates up to 85 bands from total Escherichia coli RNA, thus covering expressed sequences of a complete bacterial genome. Due to the lack of polyadenylation in prokaryotic RNA the type T11VN anchored oligonucleotides for the reverse transcriptase reaction had to be replaced with respect to the original method described by Liang and Pardee [ Science , 257, 967-971 (1992)]. Therefore, the sequences of both the 10mer and the new 11mer oligonucleotides were determined by a statistical evaluation of species-specific coding regions extracted from the EMBL database. The 11mer primers used for reverse transcription were selected for localization in the 3'-region of the bacterial RNA. The 10mer primers preferentially bind to the 5'-end of the RNA. None of the primers show homology to rRNA or other abundant small RNA species. Randomly sampled cDNA bands were checked for their bacterial origin either by re-amplification, cloning and sequencing or by re-amplification and direct sequencing with 10mer and 11mer primers after asymmetric PCR.

  2. Simple sequence repeat marker loci discovery using SSR primer.

    Science.gov (United States)

    Robinson, Andrew J; Love, Christopher G; Batley, Jacqueline; Barker, Gary; Edwards, David

    2004-06-12

    Simple sequence repeats (SSRs) have become important molecular markers for a broad range of applications, such as genome mapping and characterization, phenotype mapping, marker assisted selection of crop plants and a range of molecular ecology and diversity studies. With the increase in the availability of DNA sequence information, an automated process to identify and design PCR primers for amplification of SSR loci would be a useful tool in plant breeding programs. We report an application that integrates SPUTNIK, an SSR repeat finder, with Primer3, a PCR primer design program, into one pipeline tool, SSR Primer. On submission of multiple FASTA formatted sequences, the script screens each sequence for SSRs using SPUTNIK. The results are parsed to Primer3 for locus-specific primer design. The script makes use of a Web-based interface, enabling remote use. This program has been written in PERL and is freely available for non-commercial users by request from the authors. The Web-based version may be accessed at http://hornbill.cspp.latrobe.edu.au/

  3. Universal primers that amplify RNA from all three flavivirus subgroups

    Directory of Open Access Journals (Sweden)

    Barnard Ross T

    2008-01-01

    Full Text Available Abstract Background Species within the Flavivirus genus pose public health problems around the world. Increasing cases of Dengue and Japanese encephalitis virus in Asia, frequent outbreaks of Yellow fever virus in Africa and South America, and the ongoing spread of West Nile virus throughout the Americas, show the geographical burden of flavivirus diseases. Flavivirus infections are often indistinct from and confused with other febrile illnesses. Here we review the specificity of published primers, and describe a new universal primer pair that can detect a wide range of flaviviruses, including viruses from each of the recognised subgroups. Results Bioinformatic analysis of 257 published full-length Flavivirus genomes revealed conserved regions not previously targeted by primers. Two degenerate primers, Flav100F and Flav200R were designed from these regions and used to generate an 800 base pair cDNA product. The region amplified encoded part of the methyltransferase and most of the RNA-dependent-RNA-polymerase (NS5 coding sequence. One-step RT-PCR testing was successful using standard conditions with RNA from over 60 different flavivirus strains representing about 50 species. The cDNA from each virus isolate was sequenced then used in phylogenetic analyses and database searches to confirm the identity of the template RNA. Conclusion Comprehensive testing has revealed the broad specificity of these primers. We briefly discuss the advantages and uses of these universal primers.

  4. Mobile Lexicography

    DEFF Research Database (Denmark)

    Køhler Simonsen, Henrik

    2014-01-01

    Users are already mobile, but the question is to which extent knowledge-based dictionary apps are designed for the mobile user situation. The objective of this article is to analyse the characteristics of the mobile user situation and to look further into the stationary user situation and the mob......Users are already mobile, but the question is to which extent knowledge-based dictionary apps are designed for the mobile user situation. The objective of this article is to analyse the characteristics of the mobile user situation and to look further into the stationary user situation...... and the mobile user situation. The analysis is based on an empirical survey involving ten medical doctors and a monolingual app designed to support cognitive lexicographic functions, cf. (Tarp 2006:61-64). In test A the doctors looked up five medical terms while sitting down at a desk and in test B the doctors...

  5. Mobility Divides

    DEFF Research Database (Denmark)

    Jensen, Ole B.

    Contemporary mobilities are cultural and social manifestations, and the mobile practices in the everyday life of billions of humans are re-configuring senses of place, self, other and relationships to the built environment. The way ‘mobile situations’ are staged in designed and built environments......’ in the everyday life and cast light on how design and ‘materialities of mobilites’ are creating differential mobilities across societies, social networks, and communities of practices.......Contemporary mobilities are cultural and social manifestations, and the mobile practices in the everyday life of billions of humans are re-configuring senses of place, self, other and relationships to the built environment. The way ‘mobile situations’ are staged in designed and built environments...

  6. Mobile Semiotics - signs and mobilities

    DEFF Research Database (Denmark)

    Jensen, Ole B.

    a potential for mobilities studies if the awareness of seeing the environment as a semiotic layer and system can be sensitized to the insights of the ‘mobilities turn’. Empirically the paper tentatively explores the usefulness of a mobile semiotics approach to cases such as street signage, airport design...

  7. Mobile Clouds

    DEFF Research Database (Denmark)

    Fitzek, Frank; Katz, Marcos

    A mobile cloud is a cooperative arrangement of dynamically connected communication nodes sharing opportunistic resources. In this book, authors provide a comprehensive and motivating overview of this rapidly emerging technology. The book explores how distributed resources can be shared by mobile...... users in very different ways and for various purposes. The book provides many stimulating examples of resource-sharing applications. Enabling technologies for mobile clouds are also discussed, highlighting the key role of network coding. Mobile clouds have the potential to enhance communications...... performance, improve utilization of resources and create flexible platforms to share resources in very novel ways. Energy efficient aspects of mobile clouds are discussed in detail, showing how being cooperative can bring mobile users significant energy saving. The book presents and discusses multiple...

  8. Mobilities Design

    DEFF Research Database (Denmark)

    Jensen, Ole B.; Lanng, Ditte Bendix; Wind, Simon

    2016-01-01

    In this paper, we identify the nexus between design (architecture, urban design, service design, etc.) and mobilities as a new and emerging research field. In this paper, we apply a “situational mobilities” perspective and take point of departure in the pragmatist question: “What design decisions...... and interventions affords this particular mobile situation?” The paper presents the contours of an emerging research agenda within mobilities research. The advent of “mobilities design” as an emerging research field points towards a critical interest in the material as well as practical consequences of contemporary......-making. The paper proposes that increased understanding of the material affordances facilitated through design provides important insight to planning and policymaking that at times might be in risk of becoming too detached from the everyday life of the mobile subject within contemporary mobilities landscapes....

  9. Wireless Cellular Mobile Communications

    OpenAIRE

    Zalud, V.

    2002-01-01

    In this article is briefly reviewed the history of wireless cellular mobile communications, examined the progress in current second generation (2G) cellular standards and discussed their migration to the third generation (3G). The European 2G cellular standard GSM and its evolution phases GPRS and EDGE are described somewhat in detail. The third generation standard UMTS taking up on GSM/GPRS core network and equipped with a new advanced access network on the basis of code division multiple ac...

  10. Mobiles Robotersystem

    OpenAIRE

    Schmierer, G.; Wolf, A.

    1999-01-01

    DE 19816893 A UPAB: 20000203 NOVELTY - An optical and or acoustic noticeable advertising and or information carrier (10) is fixed permitting detachment in such a manner at the mobile platform (8), that the advertising and or information carrier does not impair the movability of the mobile platform. The advertising is provided at an exposed place on the mobile platform. USE - Advertising or information communication. ADVANTAGE - Advertising or information is imparted in prominent positioning w...

  11. MCMC-ODPR: Primer design optimization using Markov Chain Monte Carlo sampling

    Directory of Open Access Journals (Sweden)

    Kitchen James L

    2012-11-01

    Full Text Available Abstract Background Next generation sequencing technologies often require numerous primer designs that require good target coverage that can be financially costly. We aimed to develop a system that would implement primer reuse to design degenerate primers that could be designed around SNPs, thus find the fewest necessary primers and the lowest cost whilst maintaining an acceptable coverage and provide a cost effective solution. We have implemented Metropolis-Hastings Markov Chain Monte Carlo for optimizing primer reuse. We call it the Markov Chain Monte Carlo Optimized Degenerate Primer Reuse (MCMC-ODPR algorithm. Results After repeating the program 1020 times to assess the variance, an average of 17.14% fewer primers were found to be necessary using MCMC-ODPR for an equivalent coverage without implementing primer reuse. The algorithm was able to reuse primers up to five times. We compared MCMC-ODPR with single sequence primer design programs Primer3 and Primer-BLAST and achieved a lower primer cost per amplicon base covered of 0.21 and 0.19 and 0.18 primer nucleotides on three separate gene sequences, respectively. With multiple sequences, MCMC-ODPR achieved a lower cost per base covered of 0.19 than programs BatchPrimer3 and PAMPS, which achieved 0.25 and 0.64 primer nucleotides, respectively. Conclusions MCMC-ODPR is a useful tool for designing primers at various melting temperatures at good target coverage. By combining degeneracy with optimal primer reuse the user may increase coverage of sequences amplified by the designed primers at significantly lower costs. Our analyses showed that overall MCMC-ODPR outperformed the other primer-design programs in our study in terms of cost per covered base.

  12. MCMC-ODPR: primer design optimization using Markov Chain Monte Carlo sampling.

    Science.gov (United States)

    Kitchen, James L; Moore, Jonathan D; Palmer, Sarah A; Allaby, Robin G

    2012-11-05

    Next generation sequencing technologies often require numerous primer designs that require good target coverage that can be financially costly. We aimed to develop a system that would implement primer reuse to design degenerate primers that could be designed around SNPs, thus find the fewest necessary primers and the lowest cost whilst maintaining an acceptable coverage and provide a cost effective solution. We have implemented Metropolis-Hastings Markov Chain Monte Carlo for optimizing primer reuse. We call it the Markov Chain Monte Carlo Optimized Degenerate Primer Reuse (MCMC-ODPR) algorithm. After repeating the program 1020 times to assess the variance, an average of 17.14% fewer primers were found to be necessary using MCMC-ODPR for an equivalent coverage without implementing primer reuse. The algorithm was able to reuse primers up to five times. We compared MCMC-ODPR with single sequence primer design programs Primer3 and Primer-BLAST and achieved a lower primer cost per amplicon base covered of 0.21 and 0.19 and 0.18 primer nucleotides on three separate gene sequences, respectively. With multiple sequences, MCMC-ODPR achieved a lower cost per base covered of 0.19 than programs BatchPrimer3 and PAMPS, which achieved 0.25 and 0.64 primer nucleotides, respectively. MCMC-ODPR is a useful tool for designing primers at various melting temperatures at good target coverage. By combining degeneracy with optimal primer reuse the user may increase coverage of sequences amplified by the designed primers at significantly lower costs. Our analyses showed that overall MCMC-ODPR outperformed the other primer-design programs in our study in terms of cost per covered base.

  13. Mobil marketing

    OpenAIRE

    Engelová, Kateřina

    2006-01-01

    Mobil marketing - reklama a podpora prodeje prostřednictvím mobilních telefonů. Technologické a kulturní předpoklady vzniku tohoto odvětví. Mobil marketing a marketingový mix, možnosti synergie. Nástroje mobil marketingu - reklamní SMS a MMS, lokační služby, soutěže, ankety a hlasování, věrnostní systémy, mobilní obsah. Subjekty mobil marketingu. M-komerce. Využití pro podnikové aplikace.

  14. Mobile phones and mobile communication

    DEFF Research Database (Denmark)

    Ling, Richard; Donner, Jonathan

    With staggering swiftness, the mobile phone has become a fixture of daily life in almost every society on earth. In 2007, the world had over 3 billion mobile subscriptions. Prosperous nations boast of having more subscriptions than people. In the developing world, hundreds of millions of people who...... could never afford a landline telephone now have a mobile number of their own. With a mobile in our hand many of us feel safer, more productive, and more connected to loved ones, but perhaps also more distracted and less involved with things happening immediately around us. Written by two leading...... researchers in the field, this volume presents an overview of the mobile telephone as a social and cultural phenomenon. Research is summarized and made accessible though detailed descriptions of ten mobile users from around the world. These illustrate popular debates, as well as deeper social forces at work...

  15. Urban Mobility

    DEFF Research Database (Denmark)

    2017-01-01

    This anthology is the proceedings publication from the 2015 NAF Symposium in Malmö, Sweden. The aim of the 2015 NAF Symposium “Urban Mobility – Architectures, Geographies and Social Space” was to facilitate a cross-disciplinary discussion on urban mobility in which the juxtaposition of different...

  16. Urban Mobility

    DEFF Research Database (Denmark)

    2017-01-01

    This anthology is the proceedings publication from the 2015 NAF Symposium in Malmö, Sweden. The aim of the 2015 NAF Symposium “Urban Mobility – Architectures, Geographies and Social Space” was to facilitate a cross-disciplinary discussion on urban mobility in which the juxtaposition of different ...

  17. Mobile phone

    International Nuclear Information System (INIS)

    2009-01-01

    Almost the entire Norwegian population has cell phone. The usefulness of the cell phone is great, but can use a mobile phone to health or discomfort? How can exposure be reduced? NRPA follows research and provides advice on mobile phone use. (AG)

  18. KENO-VI Primer: A Primer for Criticality Calculations with SCALE/KENO-VI Using GeeWiz

    International Nuclear Information System (INIS)

    Bowman, Stephen M.

    2008-01-01

    The SCALE (Standardized Computer Analyses for Licensing Evaluation) computer software system developed at Oak Ridge National Laboratory is widely used and accepted around the world for criticality safety analyses. The well-known KENO-VI three-dimensional Monte Carlo criticality computer code is one of the primary criticality safety analysis tools in SCALE. The KENO-VI primer is designed to help a new user understand and use the SCALE/KENO-VI Monte Carlo code for nuclear criticality safety analyses. It assumes that the user has a college education in a technical field. There is no assumption of familiarity with Monte Carlo codes in general or with SCALE/KENO-VI in particular. The primer is designed to teach by example, with each example illustrating two or three features of SCALE/KENO-VI that are useful in criticality analyses. The primer is based on SCALE 6, which includes the Graphically Enhanced Editing Wizard (GeeWiz) Windows user interface. Each example uses GeeWiz to provide the framework for preparing input data and viewing output results. Starting with a Quickstart section, the primer gives an overview of the basic requirements for SCALE/KENO-VI input and allows the user to quickly run a simple criticality problem with SCALE/KENO-VI. The sections that follow Quickstart include a list of basic objectives at the beginning that identifies the goal of the section and the individual SCALE/KENO-VI features that are covered in detail in the sample problems in that section. Upon completion of the primer, a new user should be comfortable using GeeWiz to set up criticality problems in SCALE/KENO-VI. The primer provides a starting point for the criticality safety analyst who uses SCALE/KENO-VI. Complete descriptions are provided in the SCALE/KENO-VI manual. Although the primer is self-contained, it is intended as a companion volume to the SCALE/KENO-VI documentation. (The SCALE manual is provided on the SCALE installation DVD.) The primer provides specific examples of

  19. Intensive mobilities

    DEFF Research Database (Denmark)

    Vannini, Phillip; Bissell, David; Jensen, Ole B.

    with fieldwork conducted in Canada, Denmark and Australia to develop our understanding of the experiential politics of long distance workers. Rather than focusing on the extensive dimensions of mobilities that are implicated in patterns and trends, our paper turns to the intensive dimensions of this experience......This paper explores the intensities of long distance commuting journeys as a way of exploring how bodily sensibilities are being changed by the mobilities that they undertake. The context of this paper is that many people are travelling further to work than ever before owing to a variety of factors...... which relate to transport, housing and employment. Yet we argue that the experiential dimensions of long distance mobilities have not received the attention that they deserve within geographical research on mobilities. This paper combines ideas from mobilities research and contemporary social theory...

  20. Designing Mobilities

    DEFF Research Database (Denmark)

    Jensen, Ole B.

    are often still not engaged with in a sufficiently manner. Often social sciences keep distance to the physical and material as if the social was still to be understood as a realm separate of technology, architecture, and design (for a critique of this see; Latour 2005 and Urry 2000). This paper takes point......Within the so-called ‘mobilities turn’ (Adey 2010; Cresswell 2006; Urry 2007) much research has taken place during the last decade bringing mobilities into the centre of sociological analysis. However, the materiality and spatiality of artefacts, infrastructures, and sites hosting mobilities...... of departure in the sociological perspective termed ‘Staging Mobilities’ (Jensen 2013a) and utilizes this as an analytical frame for exploring cases of mobility design. The paper put focus on how the material shape, design and architectures of technologies, spaces and sites influence mobilities practices...

  1. Mobile probes

    DEFF Research Database (Denmark)

    Ørngreen, Rikke; Jørgensen, Anna Neustrup; Noesgaard, Signe Schack

    2016-01-01

    A project investigating the effectiveness of a collection of online resources for teachers' professional development used mobile probes as a data collection method. Teachers received questions and tasks on their mobile in a dialogic manner while in their everyday context as opposed...... to in an interview. This method provided valuable insight into the contextual use, i.e. how did the online resource transfer to the work practice. However, the research team also found that mobile probes may provide the scaffolding necessary for individual and peer learning at a very local (intra-school) community...... level. This paper is an initial investigation of how the mobile probes process proved to engage teachers in their efforts to improve teaching. It also highlights some of the barriers emerging when applying mobile probes as a scaffold for learning....

  2. Mobilities Design

    DEFF Research Database (Denmark)

    Jensen, Ole B.; Lanng, Ditte Bendix

    2016-01-01

    of life’ for billions of people in the everyday life. This paper is structured in three parts. After the general introduction we present the mobilities theory perspective of ‘staging mobilities’ and connects this to the empirical phenomenon of parking lots and their design. The paper ends in section three......Contemporary society is marked and defined by the ways in which mobile goods, bodies, vehicles, objects, and data are organized, moved and staged. On the backgound of the ‘mobilities turn’ (for short review paper on this see; Sheller 2011, Vannini 2010) this paper proposes a further development...... of the perspective in the direction of a material and design oriented turn. In order to fulfill this purpose we articulate a new and emerging research field, namely that of ‘mobilities design’. In our understanding time has come to articulate ‘Mobilities Design’ as a dedicated research field in and of its own...

  3. Mobile Lexicography

    DEFF Research Database (Denmark)

    Køhler Simonsen, Henrik

    2015-01-01

    are already mobile – but lexicography is not yet fully ready for the mobile challenge, mobile users and mobile user situations. The article is based on empirical data from two surveys comprising 10 medical doctors, who were asked to look up five medical substances with the medical dictionary app Medicin.......dk and five students, who were asked to look up five terms with the dictionary app Gyldendal Engelsk-Dansk. The empirical data comprise approximately 15 hours of recordings of user behavior, think-aloud data and interview data. The data indicate that there is still much to be done in this area...... and that lexicographic innovation is needed. A new type of users, new user situations and new access methods call for new lexicographic solutions, and this article proposes a six-pointed hexagram model, which can be used during dictionary app design to lexicographically calibrate the six dimensions in mobile...

  4. Restricted Mobilities

    DEFF Research Database (Denmark)

    Nielsen, Mette; Lassen, Claus

    2012-01-01

    communities and shopping centres through mobility lenses. The article shows how different mobility systems enable and restrict the public access to private-public spaces, and it points out that proprietary communities create an unequal potential for human movement and access in the city. The main argument......Privatisation of public spaces in the contemporary city has increased during the last decades but only few studies have approached this field from a mobility perspective. Therefore the article seeks to rectify this by exploring two Australian examples of private spaces in the city; gated...... and stratification mechanisms. In conclusion the article therefore suggests that future urban research and planning also needs a mobile understanding of spaces in the cities and how different mobility systems play an important role to sustain the exclusiveness that often characterises the private/public spaces...

  5. Mobility Work

    DEFF Research Database (Denmark)

    Bardram, Jakob Eyvind; Bossen, Claus

    2005-01-01

    We posit the concept of Mobility Work to describe efforts of moving about people and things as part of accomplishing tasks. Mobility work can be seen as a spatial parallel to the concept of articulation work proposed by the sociologist Anselm Strauss. Articulation work describes efforts of coordi....../or resources. To accomplish their work, actors have to make the right configuration of these four aspects emerge.......We posit the concept of Mobility Work to describe efforts of moving about people and things as part of accomplishing tasks. Mobility work can be seen as a spatial parallel to the concept of articulation work proposed by the sociologist Anselm Strauss. Articulation work describes efforts...... of coordination necessary in cooperative work, but focuses, we argue, mainly on the temporal aspects of cooperative work. As a supplement, the concept of mobility work focuses on the spatial aspects of cooperative work. Whereas actors seek to diminish the amount of articulation work needed in collaboration...

  6. Mobility Challenges

    DEFF Research Database (Denmark)

    Jensen, Ole B.; Lassen, Claus

    2011-01-01

    This article takes point of departure in the challenges to understand the importance of contemporary mobility. The approach advocated is a cross-disciplinary one drawing on sociology, geography, urban planning and design, and cultural studies. As such the perspective is to be seen as a part...... of the so-called ‘mobility turn’ within social science. The perspective is illustrative for the research efforts at the Centre for Mobility and Urban Studies (C-MUS), Aalborg University. The article presents the contours of a theoretical perspective meeting the challenges to research into contemporary urban...... mobilities. In particular the article discusses 1) the physical city, its infrastructures and technological hardware/software, 2) policies and planning strategies for urban mobility and 3) the lived everyday life in the city and the region....

  7. Inteligencia emocional y autoconcepto en los estudiantes de primer ciclo

    OpenAIRE

    Castillo Canales, Braulio

    2017-01-01

    En nuestra investigación se tuvo como problema: ¿Qué relación existe entre inteligencia emocional y autoconcepto en los estudiantes de primer ciclo de Administración en Turismo y Hotelería de la Universidad César Vallejo, Lima 2015-II? Además el objetivo fue: Determinar la relación entre inteligencia emocional y autoconcepto en los estudiantes de primer ciclo de Administración en Turismo y Hotelería de la Universidad César Vallejo, Lima 2015-II. El tipo de estudio fue básica...

  8. Teaching Thermal Hydraulics & Numerical Methods: An Introductory Control Volume Primer

    Energy Technology Data Exchange (ETDEWEB)

    Lucas, D.S.

    2004-10-03

    This paper covers the basics of the implementation of the control volume method in the context of the Homogeneous Equilibrium Model (HEM)(T/H) code using the conservation equations of mass, momentum, and energy. This primer uses the advection equation as a template. The discussion will cover the basic equations of the control volume portion of the course in the primer, which includes the advection equation, numerical methods, along with the implementation of the various equations via FORTRAN into computer programs and the final result for a three equation HEM code and its validation.

  9. Sustainable Mobility

    DEFF Research Database (Denmark)

    Kjærulff, Aslak Aamot

    This paper combines strands of mobilities theory and planning theory, and develops a qualitative approach to look across emerging planning practices. By actively following 8 Danish urban and transport planners, over the course of 2 years, we learn how their practices have changed, inspired...... by mobility management, a concept aiming to reduce carbon emissions from transportation in western societies. The article focuses on how municipal planners formulate the role of mobility management activities organized around private companies, and how their practices are connected to wider ideas on planning....

  10. Primers As Socializing Agents in American and Finnish Schools.

    Science.gov (United States)

    Hyona, Jukka; And Others

    1995-01-01

    Content analysis of 12 Finnish and 18 American primers for grades 3 through 6 published primarily during the 1980s examined story type, plot setting, protagonist's characteristics, dramatic tasks, portrayals of family structure and parental responsibility, and extrafamilial peer and adult relationships. Results suggest that a nation's cultural…

  11. Bond strength of compomers to dentin using acidic primers.

    Science.gov (United States)

    Tate, W H; You, C; Powers, J M

    1999-10-01

    To determine the in vitro bond strengths of seven compomer/bonding agent restorative systems to human dentin. Seven compomer/bonding agents were bonded to human dentin, stored in water at 37 degrees C for 24 hours, and debonded in tension. Bonding conditions were with and without phosphoric acid etching, with and without the use of combined primer/bonding agents, and under moist and wet bond interfaces. Without phosphoric acid etching, F2000/F2000 Compomer Primer/Adhesive and F2000/Single Bond Dental Adhesive System were less sensitive to dentin wetness. With moist dentin, bond strengths of Dyract/Prime & Bond 2.1, Dyract AP/Prime & Bond 2.1, Hytac/OSB light-curing, one-component bonding agent, F2000/Single Bond, and Freedom/STAE single component light-cured dentin/enamel adhesive system, were improved with phosphoric acid etching. Also, with moist dentin, the bond strength of F2000/F2000 Compomer Primer/Adhesive in the 3M Clicker dispensing system was higher without phosphoric acid etching, whereas bonds of Compoglass/Syntac Single-component were not affected by phosphoric acid etching. Bonding did not occur without primer/bonding agent, regardless of surface condition or use of phosphoric acid etching.

  12. Single primer amplification reaction methods reveal exotic and ...

    Indian Academy of Sciences (India)

    Unknown

    mulberry varieties using three different PCR based single primer amplification ..... the results of a multi- variate analysis using Mahalanobis D2 statistic in case of .... Rajan M V, Chaturvedi H K and Sarkar A 1997 Multivariate analysis as an aid ...

  13. Diversity of internal structures in inhibited epoxy primers

    Directory of Open Access Journals (Sweden)

    Anthony E. Hughes

    2015-10-01

    Full Text Available Computed tomography is making a significant impact in the field of materials science in recent years. In this paper the authors report on advances made in three areas of characterization and also identified where further research needs to be focused. First we report on a new approach to data analysis called “Data Constrained Modelling (DCM” in which compositional tomography can be undertaken rather than adsorption or phase contrast tomography. This is achieved by collecting X-ray CT data at different energies and then combining the datasets to reconstruct 3D compositional tomography. Second, on the application of this approach to inhibited primers typical of those used in the aerospace industry. Aerospace primers are effectively composite materials containing inorganic phases which are bound together with a polymer. Understanding the materials science of these systems requires information over several orders of magnitude in length-scale. In this paper we report on how DCM can be used to extend our understanding at the smaller length scales at the limits of resolution of the technique. The third and final advance is in extending the approach to include 4-dimensional studies. In this case we examine the primer before and after leaching. This process causes changes in the primer which can be both detected and quantified using the above approach.

  14. Development of specific primers for genus Fusarium and F. solani ...

    African Journals Online (AJOL)

    Yomi

    2012-01-05

    Jan 5, 2012 ... reproductive parts of plants. They are ... plant species in most parts of the world. .... 20 µl 2.5X master mix (Eppendorf) and 1 µl of each forward and ... List of primers developed for rapid detection of Fusarium sp. and F. solani.

  15. Development of a microsatellite primer set to investigate the genetic ...

    Indian Academy of Sciences (India)

    Development of a microsatellite primer set to investigate the genetic population structure of Armadillidium nasatum (Crustacea, Oniscidea). Séverine Masson, Cédric Faivre, Isabelle Giraud, Catherine Souty-Grosset, Richard Cordaux, Carine Delaunay,. Didier Bouchon and Nicolas Bech. J. Genet. 93, 545-549. Table 1.

  16. Blood Donation and Transfusion: A Primer for Health Educators.

    Science.gov (United States)

    Felts, W. Michael; Glascoff, Mary A.

    1991-01-01

    Presents a primer for health educators about blood donation and transfusion, examining the nature of human blood, the background of blood transfusion, blood donation criteria, risks related to homologous blood transfusion, directed blood donation, potential alternatives to homologous transfusion, and resources for education on the subject. (SM)

  17. Bioinspired Catecholic Primers for Rigid and Ductile Dental Resin Composites.

    Science.gov (United States)

    Shin, Eeseul; Ju, Sung Won; An, Larry; Ahn, Eungjin; Ahn, Jin-Soo; Kim, Byeong-Su; Ahn, B Kollbe

    2018-01-17

    In the construction of dental restorative polymer composite materials, surface priming on mineral fillers is essential to improve the mechanical performance of the composites. Here we present bioinspired catechol-functionalized primers for a tougher dental resin composite containing glass fillers. The catecholic primers with different polymerizable end groups were designed and then coated on glass surfaces using a simple drop-casting or dip-coating process. The surface binding ability and possible cross-linking (coupling or chemical bridging between the glass substrate and the dental resin) of the catecholic bifunctional primers were evaluated using atomic force microscopy, contact angle measurements, and the knife shear bonding test and compared to a state-of-the-art silane-based coupling agent. Various mechanical tests including shrinkage and compression tests of the dental resin composites were also conducted. Compression tests of the composites containing the catecholic primed fillers exhibited enhanced mechanical properties, owing to the bidentate hydrogen bonding of catechol moieties to the oxide mineral surface. Furthermore, the superior biocompatibility of the primed surface was confirmed via cell attachment assay, thus providing applicability of catecholic primers for practical dental and biomedical applications.

  18. Note: Primer Amysat 001; Fragment size is 211bp

    Indian Academy of Sciences (India)

    Renuka

    Bhandara : Lanes 1–14 represent different strains of Bhandara Ecorace. Note: Primer Amysat 001; Fragment size is 211bp. Fig. 1. SSR profiles generated from genomic DNA of 16 strains from different individuals of (A.L, D. TV, D. BV, Modal, Sukinda, Raily, Bhandara) ecoraces of tasar silk worm, Antheraea mylitta using the.

  19. Controlling Air Pollution; A Primer on Stationary Source Control Techniques.

    Science.gov (United States)

    Corman, Rena

    This companion document to "Air Pollution Primer" is written for the nonexpert in air pollution; however, it does assume a familiarity with air pollution problems. This work is oriented toward providing the reader with knowledge about current and proposed air quality legislation and knowledge about available technology to meet these standards for…

  20. Progress Report

    DEFF Research Database (Denmark)

    Duer, Karsten

    1999-01-01

    Progress report describing the work carried out by the Danish participant in the ALTSET project in the period January 1999 to July 1999.......Progress report describing the work carried out by the Danish participant in the ALTSET project in the period January 1999 to July 1999....

  1. Progress Report

    Science.gov (United States)

    2018-05-16

    This report summarizes the annual progress of EPA’s Clean Air Markets Programs such as the Acid Rain Program (ARP) and the Cross-State Air Pollution Rule (CSAPR). EPA systematically collects data on emissions, compliance, and environmental effects, these data are highlighted in our Progress Reports.

  2. NAVAIR Progress in Assessing, Validating and Implementing Non-Chromate Primers (Briefing charts)

    Science.gov (United States)

    2011-02-09

    logistics for any new coating or coating system NAVAIR Application Areas for Hexavalent Chromium Alternatives: Status Components/ Structure... Hexavalent chromium alternatives Sacrificial Coating Post Treatment MIL-A-8625 Anodize Avionics/ Electronics Magnesium/Titanium Conversion Aluminum Anodizing...Aluminum Pretreatment Type IC Seal Type IIB Seal Type II Seal Phosphating Rinse (Aluminum)Rinse (Steel) Cadmium Zinc-Nickel Aluminum Bonding Chrome

  3. The replisome uses mRNA as a primer after colliding with RNA polymerase.

    Science.gov (United States)

    Pomerantz, Richard T; O'Donnell, Mike

    2008-12-11

    Replication forks are impeded by DNA damage and protein-nucleic acid complexes such as transcribing RNA polymerase. For example, head-on collision of the replisome with RNA polymerase results in replication fork arrest. However, co-directional collision of the replisome with RNA polymerase has little or no effect on fork progression. Here we examine co-directional collisions between a replisome and RNA polymerase in vitro. We show that the Escherichia coli replisome uses the RNA transcript as a primer to continue leading-strand synthesis after the collision with RNA polymerase that is displaced from the DNA. This action results in a discontinuity in the leading strand, yet the replisome remains intact and bound to DNA during the entire process. These findings underscore the notable plasticity by which the replisome operates to circumvent obstacles in its path and may explain why the leading strand is synthesized discontinuously in vivo.

  4. The ability of T2/B4 primers to detect Leishmania infantum among ...

    African Journals Online (AJOL)

    SERVER

    2008-04-03

    Apr 3, 2008 ... Reverse Primer (5`-CCT CTC TTT TTT CNC TGT GC-3`). (Schönian et al., 1996),. B. Forward Primer (RV1) (5`-GTG GGG GAG GGG CGT TCT-3`) and Reverse Primer (RV2) (5`-ATT TTA CAC CAA CCC CCA GTT-. 3`) (Lachaud et al., 2002; Reale et al., 1999),. C. Forward Primer (T2) (5`-CGG CTT CGC ...

  5. Mobile Systems Development: An Empirical Study

    DEFF Research Database (Denmark)

    Hosbond, J. H.

    As part of an ongoing study on mobile systems development (MSD), this paper presents preliminary findings of research-in-progress. The debate on mobility in research has so far been dominated by mobile HCI, technological innovations, and socio-technical issues related to new and emerging mobile...... work patterns. This paper is about the development of mobile systems.Based on an on-going empirical study I present four case studies of companies each with different products or services to offer and diverging ways of establishing and sustaining a successful business in the mobile industry. From...... the case studies I propose a five-layered framework for understanding the structure and segmentation of the industry. This leads to an analysis of the different modes of operation within the mobile industry, exemplified by the four case studies.The contribution of this paper is therefore two-fold: (1) I...

  6. Progressive Business

    DEFF Research Database (Denmark)

    Christiansen, Christian O.

    2016-01-01

    Guest Post to the Society for U.S. Intellectual History Blog. Brief introduction to the book Progressive Business: An Intellectual History of the Role of Business in American Society, Oxford U.P., 2015.......Guest Post to the Society for U.S. Intellectual History Blog. Brief introduction to the book Progressive Business: An Intellectual History of the Role of Business in American Society, Oxford U.P., 2015....

  7. Cross-kingdom amplification using bacteria-specific primers: complications for studies of coral microbial ecology.

    Science.gov (United States)

    Galkiewicz, Julia P; Kellogg, Christina A

    2008-12-01

    PCR amplification of pure bacterial DNA is vital to the study of bacterial interactions with corals. Commonly used Bacteria-specific primers 8F and 27F paired with the universal primer 1492R amplify both eukaryotic and prokaryotic rRNA genes. An alternative primer set, 63F/1542R, is suggested to resolve this problem.

  8. Cross-Kingdom Amplification Using Bacteria-Specific Primers: Complications for Studies of Coral Microbial Ecology▿

    OpenAIRE

    Galkiewicz, Julia P.; Kellogg, Christina A.

    2008-01-01

    PCR amplification of pure bacterial DNA is vital to the study of bacterial interactions with corals. Commonly used Bacteria-specific primers 8F and 27F paired with the universal primer 1492R amplify both eukaryotic and prokaryotic rRNA genes. An alternative primer set, 63F/1542R, is suggested to resolve this problem.

  9. Cross-Kingdom Amplification Using Bacteria-Specific Primers: Complications for Studies of Coral Microbial Ecology▿

    Science.gov (United States)

    Galkiewicz, Julia P.; Kellogg, Christina A.

    2008-01-01

    PCR amplification of pure bacterial DNA is vital to the study of bacterial interactions with corals. Commonly used Bacteria-specific primers 8F and 27F paired with the universal primer 1492R amplify both eukaryotic and prokaryotic rRNA genes. An alternative primer set, 63F/1542R, is suggested to resolve this problem. PMID:18931299

  10. Semantics in mobile sensing

    CERN Document Server

    Yan, Zhixian

    2014-01-01

    The dramatic progress of smartphone technologies has ushered in a new era of mobile sensing, where traditional wearable on-body sensors are being rapidly superseded by various embedded sensors in our smartphones. For example, a typical smartphone today, has at the very least a GPS, WiFi, Bluetooth, triaxial accelerometer, and gyroscope. Alongside, new accessories are emerging such as proximity, magnetometer, barometer, temperature, and pressure sensors. Even the default microphone can act as an acoustic sensor to track noise exposure for example. These sensors act as a ""lens"" to understand t

  11. Wireless Cellular Mobile Communications

    Directory of Open Access Journals (Sweden)

    V. Zalud

    2002-12-01

    Full Text Available In this article is briefly reviewed the history of wireless cellularmobile communications, examined the progress in current secondgeneration (2G cellular standards and discussed their migration to thethird generation (3G. The European 2G cellular standard GSM and itsevolution phases GPRS and EDGE are described somewhat in detail. Thethird generation standard UMTS taking up on GSM/GPRS core network andequipped with a new advanced access network on the basis of codedivision multiple access (CDMA is investigated too. A sketch of theperspective of mobile communication beyond 3G concludes this article.

  12. Mobile Marketing

    OpenAIRE

    竹安, 数博; Takeyasu, Kazuhiro

    2005-01-01

    This article deals with one of the modern trends in marketing communication, which is mobile marketing. Towards the end of 2008, several projects which use mobile phones for target marketing communication were launched. Commercial SMS´s are sent on the base of agreement or registration of the consumers on special websites, for example hellomobil.cz. The benefit for the consumers is the bonus which can have more forms - not only sending money to the account, free SMS´s/MMS´s and minutes but al...

  13. Mobile Usability

    DEFF Research Database (Denmark)

    Aryana, Bijan; Clemmensen, Torkil

    2013-01-01

    In this article, a country specific comparative mobile usability study is presented, using Iran and Turkey as the two chosen emerging/emergent nation exemplars of smartphone usage and adoption. In a focus group study, three mobile applications were selected by first-time users of smartphones...... personal contacts. The results and analysis establish the existence of country specific issues and concerns, as well as reveal generic usability issues. The article concludes that the source of these issues is most likely due to a combination of certain contextual features endemic to both Iran and Turkey...

  14. Within- and Cross-Firm Mobility and Earnings Growth

    DEFF Research Database (Denmark)

    Frederiksen, Anders; Halliday, Timothy; Koch, Alexander Karl

    It is widely accepted that promotions within firms and mobility across firms lead to significant earnings progression. Existing research generally examined cross-firm mobility separately from hierarchical advancement. Yet, as our descriptive evidence from Danish panel data shows, how the two type...... growth of promotions (either within or across firms) and subsequent mobility at a higher hierarchy level....

  15. Guidelines - A Primer for Communicating Effectively with NABIR Stakeholders

    Energy Technology Data Exchange (ETDEWEB)

    Bilyard, G.R.; Word, C.J.; Weber, J.R.; Harding, A.K.

    2000-09-27

    This primer is a tool to help prepare scientists for meetings with stakeholders. It was prepared for staff involved with the Natural and Accelerated Bioremediation Research (NABIR) program, sponsored by the U.S. Department of Energy. It discusses why some efforts in science communication may succeed while others fail, provides methods of approaching group interactions about science that may better orient expert participants, and summarizes experience drawn from observations of groups interacting about topics in bioremediation or the NABIR program. The primer also provides brief, useful models for interacting with either expert or non-expert groups. Finally, it identifies topical areas that may help scientists prepare for public meetings, based on the developers' ongoing research in science communication in public forums.

  16. Guidelines - A Primer for Communicating Effectively with NABIR Stakeholders

    Energy Technology Data Exchange (ETDEWEB)

    A Harding; B Metting; C Word; G Bilyard; G Hund; J Amaya; J Weber; S Gajewski; S Underriner; T Peterson

    1998-12-10

    This primer is a tool to help prepare scientists for meetings with stakeholders. It was prepared for staff involved with the Natural and Accelerated Bioremediation Research (NABIR) program, sponsored by the U.S. Department of Energy. It discusses why some efforts in science communication may succeed while others fail, provides methods of approaching group interactions about science that may better orient expert participants, and summarizes experience drawn from observations of @oups interacting about topics in bioremediation or the NABIR program. The primer also provides briez usefid models for interacting with either expert or non-expert groups. Finally, it identifies topical areas that may help scientists prepare for public meetings, based on the developers' ongoing research in science communication in public forums.

  17. Guidelines - A Primer for Communicating Effectively with NABIR Stakeholders; FINAL

    International Nuclear Information System (INIS)

    Bilyard, G.R.; Word, C.J.; Weber, J.R.; Harding, A.K.

    2000-01-01

    This primer is a tool to help prepare scientists for meetings with stakeholders. It was prepared for staff involved with the Natural and Accelerated Bioremediation Research (NABIR) program, sponsored by the U.S. Department of Energy. It discusses why some efforts in science communication may succeed while others fail, provides methods of approaching group interactions about science that may better orient expert participants, and summarizes experience drawn from observations of groups interacting about topics in bioremediation or the NABIR program. The primer also provides brief, useful models for interacting with either expert or non-expert groups. Finally, it identifies topical areas that may help scientists prepare for public meetings, based on the developers' ongoing research in science communication in public forums

  18. Facial primer provides immediate and long-term improvements in mild-to-moderate facial hyperpigmentation and fine lines associated with photoaging

    Directory of Open Access Journals (Sweden)

    Roberts WE

    2015-09-01

    Full Text Available Wendy E Roberts,1 Lily I Jiang,2 James H Herndon Jr3 1Generational and Cosmetic Dermatology, Rancho Mirage, CA, 2Thomas J Stephens and Associates, Richardson, 3Dermatology Center of Dallas, Dallas, TX, USA Background: Photoaged skin results from various environmental factors, most importantly chronic sun exposure. Dyschromia and fine lines/wrinkles are common clinical manifestations of photodamaged skin. Purpose: This single-center clinical trial was conducted to assess the efficacy and tolerability of a new multifunctional facial primer (camouflage, broad-spectrum SPF 50, and a treatment for hyperpigmentation when used by females with mild-to-moderate facial hyperpigmentation and fine lines due to photoaging over a course of 12 weeks. Patients and methods: Subjects were provided test material (Even Up-Clinical Pigment Perfector and supporting products to use on their face and neck. Products were used according to specific application instructions. Clinical grading for efficacy and tolerability assessments were performed by an expert grader at baseline, baseline (post-application primer, week 4, week 8, week 12, and week 12 (post-application primer. Standardized digital photographs were taken, and self-assessment questionnaires were conducted. Results: Twenty-eight female subjects completed the 12-week trial. The facial primer improved scores for the appearance of hyperpigmentation and other photoaging parameters immediately after the first application. The treatment also showed a progressive improvement in the clinical assessment of hyperpigmentation and other photoaging parameters over the 12-week trial. These long-term benefits can be attributed to an improvement in the underlying skin condition. The facial primer was well tolerated. Subject questionnaires showed that the product was highly rated at all visits. Conclusion: The facial primer was shown to be effective and well tolerated for immediate and long-term improvement in the appearance

  19. Profil Gangguan Kognitif pada Tumor Intrakranial Primer dan Metastasis

    OpenAIRE

    Kartika Maharani; Andira Larasari; Tiara Aninditha; Yetty Ramli

    2015-01-01

    Gangguan kognitif sering menyertai pasien tumor intrakranial dan menjadi penyebab utama disabilitas. Perbedaan patofisiologi tumor intrakranial primer (TIP) dan metastasis (TM) menyebabkan perbedaan gambaran klinis dan derajat  gangguan kognitif. Tujuan penelitian ini untuk mengetahui prevalensi dan profil gangguan kognitif pasien TIP dan TM. Disain penelitian potong-lintang retrospektif menggunakan data sekunder dari Poliklinik Saraf RSCM pada bulan Januari 2011-Desember 2013. Subjek b...

  20. A primer on the mortgage market and mortgage finance

    OpenAIRE

    Daniel J. McDonald; Daniel L. Thornton

    2008-01-01

    This article is a primer on mortgage finance. It discusses the basics of the mortgage market and mortgage finance. In so doing, it provides useful information that can aid individuals in making better mortgage finance decisions. The discussion and the tools are presented within the context of mortgage finance; however, these same principles and tools can be applied to a wide range of financial decisions.

  1. Primer on molecular genetics. DOE Human Genome Program

    Energy Technology Data Exchange (ETDEWEB)

    1992-04-01

    This report is taken from the April 1992 draft of the DOE Human Genome 1991--1992 Program Report, which is expected to be published in May 1992. The primer is intended to be an introduction to basic principles of molecular genetics pertaining to the genome project. The material contained herein is not final and may be incomplete. Techniques of genetic mapping and DNA sequencing are described.

  2. Transient Heat Transfer Model for Car Body Primer Curing

    OpenAIRE

    D. Zabala; N. Sánchez; J. Pinto

    2010-01-01

    A transient heat transfer mathematical model for the prediction of temperature distribution in the car body during primer baking has been developed by considering the thermal radiation and convection in the furnace chamber and transient heat conduction governing equations in the car framework. The car cockpit is considered like a structure with six flat plates, four vertical plates representing the car doors and the rear and front panels. The other two flat plates are the...

  3. Small Commercial Building Re-tuning: A Primer

    Energy Technology Data Exchange (ETDEWEB)

    Cort, Katherine A.; Hostick, Donna J.; Underhill, Ronald M.; Fernandez, Nicholas; Katipamula, Srinivas

    2013-09-30

    To help building owners and managers address issues related to energy-efficient operation of small buildings, DOE has developed a Small Building Re-tuning training curriculum. This "primer" provides additional background information to understand some of the concepts presented in the Small Building Re-tuning training. The intent is that those who are less familiar with the buidling energy concepts will review this material before taking the building re-tuning training class.

  4. Effect of oligonucleotide primers in determining viral variability within hosts

    Directory of Open Access Journals (Sweden)

    Moya Andrés

    2004-12-01

    Full Text Available Abstract Background Genetic variability in viral populations is usually estimated by means of polymerase chain reaction (PCR based methods in which the relative abundance of each amplicon is assumed to be proportional to the frequency of the corresponding template in the initial sample. Although bias in template-to-product ratios has been described before, its relevance in describing viral genetic variability at the intrapatient level has not been fully assessed yet. Results To investigate the role of oligonucleotide design in estimating viral variability within hosts, genetic diversity in hepatitis C virus (HCV populations from eight infected patients was characterised by two parallel PCR amplifications performed with two slightly different sets of primers, followed by cloning and sequencing (mean = 89 cloned sequences per patient. Population genetics analyses of viral populations recovered by pairs of amplifications revealed that in seven patients statistically significant differences were detected between populations sampled with different set of primers. Conclusions Genetic variability analyses demonstrates that PCR selection due to the choice of primers, differing in their degeneracy degree at some nucleotide positions, can eclipse totally or partially viral variants, hence yielding significant different estimates of viral variability within a single patient and therefore eventually producing quite different qualitative and quantitative descriptions of viral populations within each host.

  5. Effect of oligonucleotide primers in determining viral variability within hosts.

    Science.gov (United States)

    Bracho, Maria Alma; García-Robles, Inmaculada; Jiménez, Nuria; Torres-Puente, Manuela; Moya, Andrés; González-Candelas, Fernando

    2004-12-09

    Genetic variability in viral populations is usually estimated by means of polymerase chain reaction (PCR) based methods in which the relative abundance of each amplicon is assumed to be proportional to the frequency of the corresponding template in the initial sample. Although bias in template-to-product ratios has been described before, its relevance in describing viral genetic variability at the intrapatient level has not been fully assessed yet. To investigate the role of oligonucleotide design in estimating viral variability within hosts, genetic diversity in hepatitis C virus (HCV) populations from eight infected patients was characterised by two parallel PCR amplifications performed with two slightly different sets of primers, followed by cloning and sequencing (mean = 89 cloned sequences per patient). Population genetics analyses of viral populations recovered by pairs of amplifications revealed that in seven patients statistically significant differences were detected between populations sampled with different set of primers. Genetic variability analyses demonstrates that PCR selection due to the choice of primers, differing in their degeneracy degree at some nucleotide positions, can eclipse totally or partially viral variants, hence yielding significant different estimates of viral variability within a single patient and therefore eventually producing quite different qualitative and quantitative descriptions of viral populations within each host.

  6. Sensory reception of the primer pheromone ethyl oleate

    Science.gov (United States)

    Muenz, Thomas S.; Maisonnasse, Alban; Plettner, Erika; Le Conte, Yves; Rössler, Wolfgang

    2012-05-01

    Social work force distribution in honeybee colonies critically depends on subtle adjustments of an age-related polyethism. Pheromones play a crucial role in adjusting physiological and behavioral maturation of nurse bees to foragers. In addition to primer effects of brood pheromone and queen mandibular pheromone—both were shown to influence onset of foraging—direct worker-worker interactions influence adult behavioral maturation. These interactions were narrowed down to the primer pheromone ethyl oleate, which is present at high concentrations in foragers, almost absent in young bees and was shown to delay the onset of foraging. Based on chemical analyses, physiological recordings from the antenna (electroantennograms) and the antennal lobe (calcium imaging), and behavioral assays (associative conditioning of the proboscis extension response), we present evidence that ethyl oleate is most abundant on the cuticle, received by olfactory receptors on the antenna, processed in glomeruli of the antennal lobe, and learned in olfactory centers of the brain. The results are highly suggestive that the primer pheromone ethyl oleate is transmitted and perceived between individuals via olfaction at close range.

  7. Teaching Thermal Hydraulics & Numerical Methods: An Introductory Control Volume Primer

    Energy Technology Data Exchange (ETDEWEB)

    D. S. Lucas

    2004-10-01

    A graduate level course for Thermal Hydraulics (T/H) was taught through Idaho State University in the spring of 2004. A numerical approach was taken for the content of this course since the students were employed at the Idaho National Laboratory and had been users of T/H codes. The majority of the students had expressed an interest in learning about the Courant Limit, mass error, semi-implicit and implicit numerical integration schemes in the context of a computer code. Since no introductory text was found the author developed notes taught from his own research and courses taught for Westinghouse on the subject. The course started with a primer on control volume methods and the construction of a Homogeneous Equilibrium Model (HEM) (T/H) code. The primer was valuable for giving the students the basics behind such codes and their evolution to more complex codes for Thermal Hydraulics and Computational Fluid Dynamics (CFD). The course covered additional material including the Finite Element Method and non-equilibrium (T/H). The control volume primer and the construction of a three-equation (mass, momentum and energy) HEM code are the subject of this paper . The Fortran version of the code covered in this paper is elementary compared to its descendants. The steam tables used are less accurate than the available commercial version written in C Coupled to a Graphical User Interface (GUI). The Fortran version and input files can be downloaded at www.microfusionlab.com.

  8. Designing Mobilities

    DEFF Research Database (Denmark)

    Jensen, Ole B.

    How is the width of the pavement shaping the urban experience? How is the material design of transport infrastructure and mobile technology affording social interaction in everyday life spaces? How do people inhabit these spaces with their bodies and in accordance to social and cultural norms...

  9. Mobile IP

    NARCIS (Netherlands)

    Heijenk, Geert; Sallent, S.; Pras, Aiko

    1999-01-01

    The Internet is growing exponentially, both in the amount of traffic carried, and in the amount of hosts connected. IP technology is becoming more and more important, in company networks (Intranets), and also in the core networks for the next generation mobile networks. Further, wireless access to

  10. Mobile Misfortune

    DEFF Research Database (Denmark)

    Vigh, Henrik Erdman

    2015-01-01

    of the mobility it enables. This article, thus, looks at the motives and manners in which young men in Bissau become caught up in transnational flows of cocaine. It shows how motion is emotively anchored and affectively bound: tied to and directed toward a feeling of worth and realisation of being, and how...

  11. Going Mobile?

    DEFF Research Database (Denmark)

    Tallon, Loic; Froes, Isabel Cristina G.

    2011-01-01

    If the future is mobile, how is the museum community developing within that future? What are the challenges museums face within it? In which directions should we be seeking to evolve our collective knowledge share? It was to gain observations on questions such as these that the 2011 Museums & Mob...

  12. Resource Mobilization

    International Development Research Centre (IDRC) Digital Library (Canada)

    Annex 1: The Scoping Study on Donor Funding for. Development Research in ... publication of the Resource Mobilization: A Practical Guide for Research .... applied the concept or technique, which validates the practical application of ... some other staff member would write up a grant application addressed to one, two, or a ...

  13. Mobile Phone

    Institute of Scientific and Technical Information of China (English)

    籍万杰

    2004-01-01

    Your mobile phone rings.and instead of usual electronic signals,it's playing your favorite music.A friend sends your favorite song to cheer you up.One day,a record company might forward new records and music videos to your phone.

  14. Transferability of retrotransposon primers derived from Persimmon (Diospyros kaki Thunb.) across other plant species.

    Science.gov (United States)

    Du, X Y; Hu, Q N; Zhang, Q L; Wang, Y B; Luo, Z R

    2013-06-06

    Retrotransposon-based molecular markers are powerful molecular tools. However, these markers are not readily available due to the difficulty in obtaining species-specific retrotransposon primers. Although recent techniques enabling the rapid isolation of retrotransposon sequences have facilitated primer development, this process nonetheless remains time-consuming and costly. Therefore, research into the transferability of retrotransposon primers developed from one plant species onto others would be of great value. The present study investigated the transferability of retrotransposon primers derived from 'Luotian-tianshi' persimmon (Diospyros kaki Thunb.) across other fruit crops, as well as within the genus using inter-retrotransposon amplified polymorphism molecular marker. Fourteen of the 26 retrotransposon primers tested (53.85%) produced robust and reproducible amplification products across all fruit crops tested, indicating their applicability across plant species. Four of the 13 fruit crops showed the best transferability performances: persimmon, grape, citrus, and peach. Furthermore, similarity coefficients and UPGMA clustering indicated that these primers could further offer a potential tool for germplasm differentiation, parentage identification, genetic diversity assessment, classification, and phylogenetic studies across a variety of plant species. Transferability was further confirmed by examining published primers derived from Rosaceae, Gramineae, and Solanaceae. This study is one of the few currently available studies concerning the transferability of retrotransposon primers across plant species in general, and is the first successful study of the transferability of retrotransposon primers derived from persimmon. The primers presented here will help reduce costs for future retrotransposon primer development and therefore contribute to the popularization of retrotransposon molecular markers.

  15. Laboratory and gas-fired furnace performance tests of epoxy primers for intumescent coatings

    DEFF Research Database (Denmark)

    Nørgaard, Kristian Petersen; Dam-Johansen, Kim; Catala, Pere

    2014-01-01

    , either to ensure adhesion of the intumescent coating to the steel or to provide corrosion resistance. It is essential to document the performance of the intumescent coating together with the primer to ensure the overall quality of coating system. In the present work, two epoxy primers were used...... to a gas-fired furnace following the ISO834 fire curve (a so-called cellulosic fire), one of the primers selected performed well and the other poorly. From tests in the electrically heated oven, it was found that both primers were sensitive to the film thickness employed and the presence of oxygen....... At oxygen-rich conditions, higher primer thicknesses gave weaker performance. In addition, a color change from red to black was observed in nitrogen, while the color remained red in the oxygen-nitrogen mixture. In summary, the results suggest that an adequate choice of primer, primer thickness...

  16. Mobile Customer Relationship Management and Mobile Security

    Science.gov (United States)

    Sanayei, Ali; Mirzaei, Abas

    The purpose of this study is twofold. First, in order to guarantee a coherent discussion about mobile customer relationship management (mCRM), this paper presents a conceptualization of mCRM delineating its unique characteristics because of Among the variety of mobile services, considerable attention has been devoted to mobile marketing and in particular to mobile customer relationship management services. Second, the authors discusses the security risks in mobile computing in different level(user, mobile device, wireless network,...) and finally we focus on enterprise mobile security and it's subgroups with a series of suggestion and solution for improve mobile computing security.

  17. The African Mobile Story

    DEFF Research Database (Denmark)

    This book identifies the factors that has enabled the growth of mobile telephony in Africa. The book covers the regulatory factors, the development and usage of mobile application, mobile security and sustainable power source for mobile networks...

  18. Cytotoxic and genotoxic evaluation of orthodontic adhesives with primer and without primer exposed to electron beam irradiation - an in-vitro study

    International Nuclear Information System (INIS)

    Ravi, M.S.; Panchasara, Chirag; Vijay, R.; Suchetha Kumari, N.; Sanjeev, Ganesh

    2013-01-01

    To evaluate the in vitro genotoxicity and cytotoxicity of two visible light-cured adhesives. The materials tested were 1. orthodontic adhesive with primer (Transbond XT3M) and 2. Orthodontic adhesive without primer (Heliosit, Ivoclar Vivadent AG), Cured sterile individual masses were exposed to 2 kGy electron beam radiation, both irradiated and non irradiated materials were immersed in Phosphate buffer saline and left at 370℃ for 24 hr. Then a volume of 200 μL of the extract medium was mixed with human peripheral blood lymphocyte tested for comet assay by single cell DNA Damage assay and Apoptosis by DNA diffusion agar assay. Evaluation of cytotoxicity was carried out by Hemolysis assay method. Haemolytic activity of orthodontic adhesive without primer (53.34±3.12) was slightly more than that of orthodontic adhesive with primer (52.9±.88). In case of Apoptosis, adhesive with primer (188.92±55.05) and adhesives without primer (186.75±101.83) showed increased diffusion of DNA compared to normal lymphocyte (111.22±8.78). However the level of DNA diffusion was not significantly different between the two adhesives. Both adhesives were cytotoxic and induced apoptosis. Adhesives without primer were found to be slightly toxic than that of adhesive with primer. Both the adhesives had no significant effect on the percentage of DNA tail and olive tail moment of DNA exposed to electron beam radiation. (author)

  19. Mobile weatherstation

    International Nuclear Information System (INIS)

    Hahn, H.; Koutny, P.; Schwabach, H.; Eisenwagner, H.

    1981-01-01

    A mobile weatherstation is described which allows to measure the following parameters: airtemperature, relative humidity, winddirection and windspeed. The station consists of three main units: the central station METEODAT, the multiplexer and the weather measure tower with the sensors. The measured data are displayed in digital form in the central unit and can be printed on a teletype. The power supply is either 220 Volt AC or 24 Volt DC. (author)

  20. Structural Mobility, Exchange Mobility and Subgroup Consistent Mobility Measurement – US–German Mobility Measurements Revisited

    OpenAIRE

    C. SCHLUTER; D. VAN DE GAER

    2008-01-01

    We formalize the concept of structural mobility and use the framework of subgroup consistent mobility measurement to derive a relative and an absolute measure of mobility that is increasing both in upward structural mobility and exchange mobility. In our empirical illustration, we contribute substantively to the ongoing debate about mobility rankings between the USA and Germany.

  1. A plastome primer set for comprehensive quantitative real time RT-PCR analysis of Zea mays: a starter primer set for other Poaceae species

    Directory of Open Access Journals (Sweden)

    Dunn Sade N

    2008-06-01

    Full Text Available Abstract Background Quantitative Real Time RT-PCR (q2(RTPCR is a maturing technique which gives researchers the ability to quantify and compare very small amounts of nucleic acids. Primer design and optimization is an essential yet time consuming aspect of using q2(RTPCR. In this paper we describe the design and empirical optimization of primers to amplify and quantify plastid RNAs from Zea mays that are robust enough to use with other closely related species. Results Primers were designed and successfully optimized for 57 of the 104 reported genes in the maize plastome plus two nuclear genes. All 59 primer pairs produced single amplicons after end-point reverse transcriptase polymerase chain reactions (RT-PCR as visualized on agarose gels and subsequently verified by q2(RTPCR. Primer pairs were divided into several categories based on the optimization requirements or the uniqueness of the target gene. An in silico test suggested the majority of the primer sets should work with other members of the Poaceae family. An in vitro test of the primer set on two unsequenced species (Panicum virgatum and Miscanthus sinensis supported this assumption by successfully producing single amplicons for each primer pair. Conclusion Due to the highly conserved chloroplast genome in plant families it is possible to utilize primer pairs designed against one genomic sequence to detect the presence and abundance of plastid genes or transcripts from genomes that have yet to be sequenced. Analysis of steady state transcription of vital system genes is a necessary requirement to comprehensively elucidate gene expression in any organism. The primer pairs reported in this paper were designed for q2(RTPCR of maize chloroplast genes but should be useful for other members of the Poaceae family. Both in silico and in vitro data are presented to support this assumption.

  2. Plan de negocio de una escuela infantil (primer ciclo)

    OpenAIRE

    San Román Gómez, Ana de

    2014-01-01

    El presente documento establece los pasos a seguir para poner en marcha una escuela infantil en el barrio de Butarque, en Madrid. En un primer lugar se han realizado diversos estudios, tanto sobre el sector como sobre el área geográfica, ya que se partía de una situación de absoluto desconocimiento. En el análisis del sector se ha puesto de manifiesto que las competencias en educación en España están reguladas por el Ministerio en primera instancia, pero las Autonomías tienen también una g...

  3. A primer on physical-layer network coding

    CERN Document Server

    Liew, Soung Chang; Zhang, Shengli

    2015-01-01

    The concept of physical-layer network coding (PNC) was proposed in 2006 for application in wireless networks. Since then it has developed into a subfield of communications and networking with a wide following. This book is a primer on PNC. It is the outcome of a set of lecture notes for a course for beginning graduate students at The Chinese University of Hong Kong. The target audience is expected to have some prior background knowledge in communication theory and wireless communications, but not working knowledge at the research level. Indeed, a goal of this book/course is to allow the reader

  4. Guidelines - A Primer for Communicating Effectively with NABIR Stakeholders

    Energy Technology Data Exchange (ETDEWEB)

    Weber, James R.; Schell, Charlotte J.; Marino, T; Bilyard, Gordon R.

    2004-02-10

    This version of the communication primer comprises two interlocking parts: Pat 1, a practical section, intended to prepare you for public interactions, and Part 2, a theoretical section that provides social and technical bases for the practices recommended in Part 1. The mutual support of practice and theory is very familiar in science and clearly requires a willingness to observe and revise our prior assumptions--in this document, we invoke both. We hope that is offering will represent a step both towards improving practice and maturing the theory of practical science communication.

  5. [Design of primers to DNA of lactic acid bacteria].

    Science.gov (United States)

    Lashchevskiĭ, V V; Kovalenko, N K

    2003-01-01

    Primers LP1-LP2 to the gene 16S rRNA have been developed, which permit to differentiate lactic acid bacteria: Lactobacillus plantarum, L. delbrueckii subsp. bulgaricus and Streptococcus salivarius subsp. thermophilus. The strain-specific and species-specific differentiations are possible under different annealing temperature. Additional fragments, which are synthesized outside the framework of gene 16S rRNA reading, provide for the strain-specific type of differentiation, and the fragment F864 read in the gene 16S rRNA permits identifying L. plantarum.

  6. A finite element primer for beginners the basics

    CERN Document Server

    Zohdi, Tarek I

    2014-01-01

    The purpose of this primer is to provide the basics of the Finite Element Method, primarily illustrated through a classical model problem, linearized elasticity. The topics covered are:(1) Weighted residual methods and Galerkin approximations,(2) A model problem for one-dimensional?linear elastostatics,(3) Weak formulations in one dimension,(4) Minimum principles in one dimension,(5) Error estimation in one dimension,(5) Construction of Finite Element basis functions in one dimension,(6) Gaussian Quadrature,(7) Iterative solvers and element by element data structures,(8) A model problem for th

  7. Discrete random signal processing and filtering primer with Matlab

    CERN Document Server

    Poularikas, Alexander D

    2013-01-01

    Engineers in all fields will appreciate a practical guide that combines several new effective MATLAB® problem-solving approaches and the very latest in discrete random signal processing and filtering.Numerous Useful Examples, Problems, and Solutions - An Extensive and Powerful ReviewWritten for practicing engineers seeking to strengthen their practical grasp of random signal processing, Discrete Random Signal Processing and Filtering Primer with MATLAB provides the opportunity to doubly enhance their skills. The author, a leading expert in the field of electrical and computer engineering, offe

  8. Accelerating MATLAB with GPU computing a primer with examples

    CERN Document Server

    Suh, Jung W

    2013-01-01

    Beyond simulation and algorithm development, many developers increasingly use MATLAB even for product deployment in computationally heavy fields. This often demands that MATLAB codes run faster by leveraging the distributed parallelism of Graphics Processing Units (GPUs). While MATLAB successfully provides high-level functions as a simulation tool for rapid prototyping, the underlying details and knowledge needed for utilizing GPUs make MATLAB users hesitate to step into it. Accelerating MATLAB with GPUs offers a primer on bridging this gap. Starting with the basics, setting up MATLAB for

  9. Automated guided vehicle systems a primer with practical applications

    CERN Document Server

    Ullrich, Günter

    2015-01-01

    This primer is directed at experts and practitioners in intralogistics who are concerned with optimizing material flows. The presentation is comprehensive covering both, practical and theoretical aspects with a moderate degree of specialization, using clear and concise language. Areas of operation as well as technical standards of all relevant components and functions are described. Recent developments in technology and in the markets are taken into account. The goal of this book is to further stronger use of automated guided transport systems and the enhancement of their future performance.

  10. Atmel AVR Microcontroller Primer Programming and Interfacing, Second Edition

    CERN Document Server

    Barrett, Steven F

    2012-01-01

    This textbook provides practicing scientists and engineers a primer on the Atmel AVR microcontroller. In this second edition we highlight the popular ATmega164 microcontroller and other pin-for-pin controllers in the family with a complement of flash memory up to 128 kbytes. The second edition also adds a chapter on embedded system design fundamentals and provides extended examples on two different autonomous robots. Our approach is to provide the fundamental skills to quickly get up and operating with this internationally popular microcontroller. We cover the main subsystems aboard the ATmega

  11. Adhesion of epoxy primer to hydrotalcite conversion coated AA2024

    Science.gov (United States)

    Leggat, Robert Benton, III

    Hydrotalcite-based (HT) conversion coatings are being developed as an environmentally benign alternative to chromate conversion coatings (CCC). Accelerated exposure tests were conducted on epoxy primed, HT-modified AA2024 to gauge service performance. HT-based conversion coatings did not perform as well as the CCC when used with an epoxy primer. The current HT chemistries are optimized for stand-alone corrosion protection, however additional research into the primer/HT interactions is necessary before they can be implemented within a coating scheme. The relative contribution of mechanical and physico-chemical interactions in controlling adhesion has been investigated in this study. Practical adhesion tests were used to assess the dry and wet bond strength of epoxy primer on HT coatings using the pull-off tensile strength (POTS) as the figure of merit. The practical adhesion of HT coated samples generally fell between that observed for the CCC and bare AA2024. Laboratory testing was done to assess the physical and chemical properties of HT coatings. Contact angle measurements were performed using powders representative of different HT chemistries to evaluate the dispersive and acid-base character of the surface. The wet POTS correlated with the electrodynamic (dipole + dispersive) parameter of the surface tension. The HT surfaces were found to be predominantly basic. Given the basicity of epoxy, these results indicate that increasing the acidic character of HT coatings may increase the adhesion performance. This was supported by electrokinetic measurements in which the dry POTS was found to increase with decreasing conversion coating iso-electric point. The correlations with the dry and wet state adhesion are interpreted as indicating that dry state adhesion is optimized by minimizing unfavorable polar interactions between the basic epoxy and HT interfaces. Wet state adhesion, where polar interactions are disrupted, is dictated by non-polar bonding. FTIR

  12. Transport phenomena in Newtonian fluids a concise primer

    CERN Document Server

    Olsson, Per

    2013-01-01

    This short primer provides a concise and tutorial-style introduction to transport phenomena in Newtonian fluids , in particular the transport of mass, energy and momentum.  The reader will find detailed derivations of the transport equations for these phenomena, as well as selected analytical solutions to the transport equations in some simple geometries. After a brief introduction to the basic mathematics used in the text, Chapter 2, which deals with momentum transport, presents a derivation of the Navier-Stokes-Duhem equation describing the basic flow in a Newtonian fluid.  Also provided at

  13. Mobile Termination and Mobile Penetration

    OpenAIRE

    Hurkens, Sjaak; Jeon, Doh-Shin

    2009-01-01

    In this paper, we study how access pricing affects network competition when subscription demand is elastic and each network uses non-linear prices and can apply termination-based price discrimination. In the case of a fixed per minute termination charge, we find that a reduction of the termination charge below cost has two oppos- ing effects: it softens competition but helps to internalize network externalities. The former reduces mobile penetration while the latter boosts it. We find that fi...

  14. Mobile termination and mobile penetration

    OpenAIRE

    Hurkens, Sjaak

    2009-01-01

    In this paper, we study how access pricing affects network competition when subscription demand is elastic and each network uses non-linear prices and can apply termination-based price discrimination. In the case of a fixed per minute termination charge, we find that a reduction of the termination charge below cost has two opposing effects: it softens competition but helps to internalize network externalities. The former reduces mobile penetration while the latter boosts it. We find that firm...

  15. Mobile Payments : Comparison of Mobile Wallet Concepts

    OpenAIRE

    Narayan, Srikant

    2013-01-01

    Mobile payments are an emerging trend and an alternative to traditional payment methods. Mobile payments involve the usage of the mobile phone to handle credit transfers during purchase of goods and peer to peer money transfers referred to as mobile wallet service, instead of depending on bank cards and cash. In this scenario, while the mobile wallet industry still being in its infancy there exist a few drivers of mobile wallet solutions aiming to create a de-facto standard in the mobile mark...

  16. Wapice News Mobile Application

    OpenAIRE

    Söylemez, Ilke

    2017-01-01

    Since the mobile phones started to have an increasingly significant role in daily life, the mobile application development also started to be an important area in the software industry. The problem for mobile application developers is to develop a mobile application which supports all the devices and platforms on the market. This issue created a need for cross platform mobile applications. The cross platform mobile development refers to the development of mobile applications that could be use...

  17. Primer: Fracture mechanics in the nuclear power industry

    International Nuclear Information System (INIS)

    Wessel, E.T.; Server, W.L.; Kennedy, E.L.

    1990-01-01

    This Primer is intended to familiarize utility engineers with the fracture mechanics technology and to provide the basis for a working knowledge of the subject. It is directed towards all the engineering disciplines that are involved either directly or indirectly with the structural reliability of electrical power generation equipment and systems. These engineering disciplines include such areas as: design and stress analysis, metallurgy and materials, nondestructive inspection and quality control, structural analysis and reliability engineering, chemical engineering and water chemistry control, and architectural engineering. This Primer does not provide a comprehensive, in-depth treatment of all the detailed aspects involved in fracture mechanics. It does, however, provide sufficient information and a common vocabulary that should enable engineers to: read and converse intelligently about the subject, understand and utilize ASME Codes and Regulatory Guides involving fracture mechanics, absorb technical information presented and discussed at various technical meetings, and begin to apply this technology towards actual engineering problems encountered in the course of their work. Example problems are provided to further enhance an understanding of fracture mechanics. Also, Appendix A describes fracture mechanics computer codes available through EPRI to analyze rotors, reactor pressure vessels and piping

  18. De neurocirujano a primer ministro de Salud de la Argentina

    Directory of Open Access Journals (Sweden)

    Karina Inés Ramacciotti

    2008-01-01

    Full Text Available La trayectoria y los vínculos que entabló Ramón Carrillo con anterioridad a ejercer el cargo de primer secretario de Salud Pública en la Argentina (1946 no han sido objeto de estudio pormenorizado. Así pues en este artículo se analizarán en primer lugar, una serie de cartas de lectores publicadas en La Semana Médica en los primeros años de la década del '40 del siglo XX. Estas notas permiten comprender las disputas internas que se produjeron en la Facultad de Ciencias Médicas al producirse el concurso de Titular de Neurocirugía de la Universidad de Buenos Aires. En segundo lugar, se revisará cómo Carrillo pasa de ocupar este prestigioso cargo académico a convertirse en decano interi- no de la Facultad de Ciencias Médicas. Son las relaciones que anuda durante estos años las que lo posicionan en un escenario político privilegiado para alcanzar un relevante puesto en la administración pública.

  19. FullSSR: Microsatellite Finder and Primer Designer

    Directory of Open Access Journals (Sweden)

    Sebastián Metz

    2016-01-01

    Full Text Available Microsatellites are genomic sequences comprised of tandem repeats of short nucleotide motifs widely used as molecular markers in population genetics. FullSSR is a new bioinformatic tool for microsatellite (SSR loci detection and primer design using genomic data from NGS assay. The software was tested with 2000 sequences of Oryza sativa shotgun sequencing project from the National Center of Biotechnology Information Trace Archive and with partial genome sequencing with ROCHE 454® from Caiman latirostris, Salvator merianae, Aegla platensis, and Zilchiopsis collastinensis. FullSSR performance was compared against other similar SSR search programs. The results of the use of this kind of approach depend on the parameters set by the user. In addition, results can be affected by the analyzed sequences because of differences among the genomes. FullSSR simplifies the detection of SSRs and primer design on a big data set. The command line interface of FullSSR was intended to be used as part of genomic analysis tools pipeline; however, it can be used as a stand-alone program because the results are easily interpreted for a nonexpert user.

  20. Primer Extension Mutagenesis Powered by Selective Rolling Circle Amplification

    Science.gov (United States)

    Huovinen, Tuomas; Brockmann, Eeva-Christine; Akter, Sultana; Perez-Gamarra, Susan; Ylä-Pelto, Jani; Liu, Yuan; Lamminmäki, Urpo

    2012-01-01

    Primer extension mutagenesis is a popular tool to create libraries for in vitro evolution experiments. Here we describe a further improvement of the method described by T.A. Kunkel using uracil-containing single-stranded DNA as the template for the primer extension by additional uracil-DNA glycosylase treatment and rolling circle amplification (RCA) steps. It is shown that removal of uracil bases from the template leads to selective amplification of the nascently synthesized circular DNA strand carrying the desired mutations by phi29 DNA polymerase. Selective RCA (sRCA) of the DNA heteroduplex formed in Kunkel's mutagenesis increases the mutagenesis efficiency from 50% close to 100% and the number of transformants 300-fold without notable diversity bias. We also observed that both the mutated and the wild-type DNA were present in at least one third of the cells transformed directly with Kunkel's heteroduplex. In contrast, the cells transformed with sRCA product contained only mutated DNA. In sRCA, the complex cell-based selection for the mutant strand is replaced with the more controllable enzyme-based selection and less DNA is needed for library creation. Construction of a gene library of ten billion members is demonstrated with the described method with 240 nanograms of DNA as starting material. PMID:22355397

  1. Microsatellite Primer Development for Post Oak, Quercus stellata (Fagaceae

    Directory of Open Access Journals (Sweden)

    Warren B. Chatwin

    2014-10-01

    Full Text Available Premise of the study: The American Cross Timbers forest ecosystem runs from southeastern Kansas to Central Texas and is primarily composed of post oak (Quercus stellata. This old-growth forest currently occupies only about 2% of its ancestral range. To facilitate genetic research on this species, we developed microsatellite primers specific to post oak from reduced genomic libraries. Methods and Results: Two Q. stellata individuals, sampled from the northern and southern range of the post oak forest, were subject to genomic reduction and 454 pyrosequencing. Bioinformatic analysis identified putative microsatellites from which 12 polymorphic primer sets were screened on three populations. The number of alleles observed ranged from five to 20 across all populations, while observed and expected heterozygosity values ranged from 0.05 to 0.833 and 0.236 to 0.893, respectively, within individual populations. Conclusions: We report the development of microsatellite markers, specific to post oak, to aid the study of genetic diversity and population structure of extant forest remnants.

  2. Measuring progress

    DEFF Research Database (Denmark)

    Wahlberg, Ayo

    2007-01-01

    In recent years, sociological examinations of genetics, therapeutic cloning, neuroscience and tissue engineering have suggested that 'life itself' is currently being transformed through technique with profound implications for the ways in which we understand and govern ourselves and others...... in much the same way that mortality rates, life expectancy or morbidity rates can. By analysing the concrete ways in which human progress has been globally measured and taxonomised in the past two centuries or so, I will show how global stratifications of countries according to their states...

  3. Cross-kingdom amplification using Bacteria-specific primers: Complications for studies of coral microbial ecology

    Science.gov (United States)

    Galkiewicz, J.P.; Kellogg, C.A.

    2008-01-01

    PCR amplification of pure bacterial DNA is vital to the study of bacterial interactions with corals. Commonly used Bacteria-specific primers 8F and 27F paired with the universal primer 1492R amplify both eukaryotic and prokaryotic rRNA genes. An alternative primer set, 63F/1542R, is suggested to resolve this problem. Copyright ?? 2008, American Society for Microbiology. All Rights Reserved.

  4. Design of a Percussion and Electric Primer Gun Firing Power Supply

    Science.gov (United States)

    2014-07-01

    solenoid failure. As new instrumentation techniques such as high-speed video and laser interferometry have been introduced into our gun testing...to drive a solenoid into a percussion primer or ignite the M52A3B1 electric primer. To reduce power requirements, it uses charged capacitor banks to...drive the solenoid or ignite the primer. This report details the design and construction of the power supplies. 15. SUBJECT TERMS power supply

  5. Progressivity Enhanced

    Directory of Open Access Journals (Sweden)

    Marko Hren

    2013-09-01

    Full Text Available Rather than a scientific text, the author contributes a concise memorandum from the originator of the idea who has managed the campaign for the conversion of the military barracks into a creative cluster between 1988 and 2002, when he parted ways with Metelkova due to conflicting views on the center’s future. His views shed light on a distant period of time from a perspective of a participant–observer. The information is abundantly supported by primary sources, also available online. However, some of the presented hypotheses are heavily influenced by his personal experiences of xenophobia, elitism, and predatorial behavior, which were already then discernible on the so-called alternative scene as well – so much so that they obstructed the implementation of progressive programs. The author claims that, in spite of the substantially different reality today, the myths and prejudices concerning Metelkova must be done away with in order to enhance its progressive nature. Above all, the paper calls for an objective view on internal antagonisms, mainly originating in deep class divisions between the users. These make a clear distinction between truly marginal ndividuals and the overambitious beau-bourgeois, as the author labels the large part of users of Metelkova of »his« time. On these grounds, he argues for a robust approach to ban all forms of xenophobia and self-ghettoization.

  6. Performance testing of lead free primers: blast waves, velocity variations, and environmental testing

    OpenAIRE

    Courtney, Elya; Courtney, Amy; Summer, Peter David; Courtney, Michael

    2014-01-01

    Results are presented for lead free primers based on diazodinitrophenol (DDNP)compared with tests on lead styphnate based primers. First, barrel friction measurements in 5.56 mm NATO are presented. Second, shot to shot variations in blast waves are presented as determined by detonating primers in a 7.62x51mm rifle chamber with a firing pin, but without any powder or bullet loaded and measuring the blast wave at the muzzle with a high speed pressure transducer. Third, variations in primer blas...

  7. Optimal pcr primers for rapid and accurate detection of Aspergillus flavus isolates.

    Science.gov (United States)

    Al-Shuhaib, Mohammed Baqur S; Albakri, Ali H; Alwan, Sabah H; Almandil, Noor B; AbdulAzeez, Sayed; Borgio, J Francis

    2018-03-01

    Aspergillus flavus is among the most devastating opportunistic pathogens of several food crops including rice, due to its high production of carcinogenic aflatoxins. The presence of these organisms in economically important rice strip farming is a serious food safety concern. Several polymerase chain reaction (PCR) primers have been designed to detect this species; however, a comparative assessment of their accuracy has not been conducted. This study aims to identify the optimal diagnostic PCR primers for the identification of A. flavus, among widely available primers. We isolated 122 A. flavus native isolates from randomly collected rice strips (N = 300). We identified 109 isolates to the genus level using universal fungal PCR primer pairs. Nine pairs of primers were examined for their PCR diagnostic specificity on the 109 isolates. FLA PCR was found to be the optimal PCR primer pair for specific identification of the native isolates, over aflP(1), aflM, aflA, aflD, aflP(3), aflP(2), and aflR. The PEP primer pair was found to be the most unsuitable for A. flavus identification. In conclusion, the present study indicates the powerful specificity of the FLA PCR primer over other commonly available diagnostic primers for accurate, rapid, and large-scale identification of A. flavus native isolates. This study provides the first simple, practical comparative guide to PCR-based screening of A. flavus infection in rice strips. Copyright © 2018 Elsevier Ltd. All rights reserved.

  8. A comprehensive collection of experimentally validated primers for Polymerase Chain Reaction quantitation of murine transcript abundance

    Directory of Open Access Journals (Sweden)

    Wang Xiaowei

    2008-12-01

    Full Text Available Abstract Background Quantitative polymerase chain reaction (QPCR is a widely applied analytical method for the accurate determination of transcript abundance. Primers for QPCR have been designed on a genomic scale but non-specific amplification of non-target genes has frequently been a problem. Although several online databases have been created for the storage and retrieval of experimentally validated primers, only a few thousand primer pairs are currently present in existing databases and the primers are not designed for use under a common PCR thermal profile. Results We previously reported the implementation of an algorithm to predict PCR primers for most known human and mouse genes. We now report the use of that resource to identify 17483 pairs of primers that have been experimentally verified to amplify unique sequences corresponding to distinct murine transcripts. The primer pairs have been validated by gel electrophoresis, DNA sequence analysis and thermal denaturation profile. In addition to the validation studies, we have determined the uniformity of amplification using the primers and the technical reproducibility of the QPCR reaction using the popular and inexpensive SYBR Green I detection method. Conclusion We have identified an experimentally validated collection of murine primer pairs for PCR and QPCR which can be used under a common PCR thermal profile, allowing the evaluation of transcript abundance of a large number of genes in parallel. This feature is increasingly attractive for confirming and/or making more precise data trends observed from experiments performed with DNA microarrays.

  9. An environmentally acceptable primer for galvanized steel: Formulation and evaluation by SVET

    Energy Technology Data Exchange (ETDEWEB)

    Simoes, A.M.P., E-mail: alda.simoes@ist.utl.p [CIDEPINT - Centro de Investigacion y Desarrollo en Tecnologia de Pinturas (CIC-CONICET), Calle 52 e/121 y 122, 1900 La Plata (Argentina); TULisbon, Instituto Superior Tecnico, DEQB, Av. Rovisco Pais, 1049-001 Lisboa (Portugal); Carbonari, R.O.; Di Sarli, A.R.; Amo, B. del [CIDEPINT - Centro de Investigacion y Desarrollo en Tecnologia de Pinturas (CIC-CONICET), Calle 52 e/121 y 122, 1900 La Plata (Argentina); TULisbon, Instituto Superior Tecnico, DEQB, Av. Rovisco Pais, 1049-001 Lisboa (Portugal); Romagnoli, R., E-mail: estelectro@cidepint.gov.a [CIDEPINT - Centro de Investigacion y Desarrollo en Tecnologia de Pinturas (CIC-CONICET), Calle 52 e/121 y 122, 1900 La Plata (Argentina); TULisbon, Instituto Superior Tecnico, DEQB, Av. Rovisco Pais, 1049-001 Lisboa (Portugal)

    2011-01-15

    Research highlights: {yields} Chromates can be replaced successfully by aluminium phosphosilicate in paint systems. {yields} The solvents of the primer are eco-friendly ones. {yields} The primer adheres on galvanized steel and allows top-coating. {yields} The binder of the primer is compatible with other binders for top-coating. - Abstract: The object of this paper was to formulate a two-pack wash primer employing aluminium phosphosilicate as active anticorrosive pigment instead of basic zinc chromate. The anticorrosive action of the primer was evaluated by the polarization technique and the scanning vibrating electrode technique (SVET). The exposed surface was then examined by scanning electron microscopy (SEM) and the surface composition determined by energy dispersive X-ray (EDX) analysis. The primer was finally integrated in a complete paint scheme whose anticorrosive performance was evaluated by the salt spray chamber and electrochemical impedance spectroscopy. The adhesion of the primer plus a painting system was also evaluated by standard ASTM D 3359-90 test method. The wash primer pigmented with zinc chromate was used as reference. Results indicated that basic zinc chromate could be replaced by the more eco-friendly wash-primer containing aluminium phosphosilicate.

  10. The Corrosion Protection of 2219-T87 Aluminum by Organic and Inorganic Zinc-Rich Primers

    Science.gov (United States)

    Danford, M. D.; Mendrek, M. J.; Walsh, D. W.

    1995-01-01

    The behavior of zinc-rich primer-coated 2219-T87 aluminum in a 3.5-percent Na-Cl was investigated using electrochemical techniques. The alternating current (ac) method of electrochemical impedance spectroscopy (EIS), in the frequency range of 0.001 to 40,000 Hz, and the direct current (dc) method of polarization resistance (PR) were used to evaluate the characteristics of an organic, epoxy zinc-rich primer and an inorganic, ethyl silicate zinc-rich primer. A dc electrochemical galvanic corrosion test was also used to determine the corrosion current of each zinc-rich primer anode coupled to a 2219-T87 aluminum cathode. Duration of the EIS/PR and galvanic testing was 21 days and 24 h, respectively. The galvanic test results demonstrated a very high galvanic current between the aluminum cathode and both zinc-rich primer anodes (37.9 pA/CM2 and 23.7 pA/CM2 for the organic and inorganic primers, respectively). The PR results demonstrated a much higher corrosion rate of the zinc in the inorganic primer than in the organic primer, due primarily to the higher porosity in the former. Based on this investigation, the inorganic zinc-rich primer appears to provide superior galvanic protection and is recommended for additional study for application in the solid rocket booster aft skirt.

  11. Advertising on mobile applications

    OpenAIRE

    Sobolevsky, Alexandr

    2015-01-01

    The article analyzes the new method of mobile advertising. Advertising in mobile applications - a subspecies of mobile marketing, where advertising is distributed using mobile phones and smartphones. Ad placement is going on inside of applications and games for smartphones. It has a high potential due to the large number of mobile phone users (over 6.5 billion in 2013).

  12. Mobility Balance Sheet 2009

    International Nuclear Information System (INIS)

    Jorritsma, P.; Derriks, H.; Francke, J.; Gordijn, H.; Groot, W.; Harms, L.; Van der Loop, H.; Peer, S.; Savelberg, F.; Wouters, P.

    2009-06-01

    The Mobility Balance Sheet provides an overview of the state of the art of mobility in the Netherlands. In addition to describing the development of mobility this report also provides explanations for the growth of passenger and freight transport. Moreover, the Mobility Balance Sheet also focuses on a topical theme: the effects of economic crises on mobility. [nl

  13. Mobile video with mobile IPv6

    CERN Document Server

    Minoli, Daniel

    2012-01-01

    Increased reliance on mobile devices and streaming of video content are two of the most recent changes that have led those in the video distribution industry to be concerned about the shifting or erosion of traditional advertising revenues. Infrastructure providers also need to position themselves to take advantage of these trends. Mobile Video with Mobile IPv6provides an overview of the current mobile landscape, then delves specifically into the capabilities and operational details of IPv6. The book also addresses 3G and 4G services, the application of Mobile IPv6 to streaming and other mobil

  14. Progress report

    International Nuclear Information System (INIS)

    Brumovsky, M.

    1979-01-01

    Progress Report, covering the period up to the end of 1979 year, was sent to the IAEA according to the research agreement No. 1971 /CF. This work covered the following fields: preparation and dummy irradiation experiments with a new experimental capsule of ''CHOUCA-M'' type; measurement of temperature fields and design of specimen holders; measurement of neutron energy spectrum in the irradiation place in our experimental reactor of VVR-S type (Nuclear Research Institute) using a set of activation detectors; unification and calibration of the measurement of neutron fluence with the use of Fe, Cu, Mn-Mg and Co-Al monitors; development and improvement of the measuring apparatus and technique for the dynamic testing of pre-cracked specimens with determination of dynamic parameters of fracture mechanics; preparation and manufacture of testing specimens from the Japanese steels - forging, plate and weld metal; preparation of the irradiation capsule for assembling

  15. [Social mobilization].

    Science.gov (United States)

    Bop, C

    1990-04-01

    One of the principal recommendations from Alma Ata and the Bamako Initiative was the need for communities to take responsibility for their own health--a recommendation that still remains unmet and in need of reform in Africa because of the severe economic recession and lack of resources allocated for health care in the region. The mobilization of communities "is the opposite of passivity and submission." People must demystify the notion that health care is the exclusive right of health professionals and should realize that they themselves can bring about changes from the household to the village levels; community mobilization is an integral component of development planning. African societies have developed very centralized structures requiring changes that only their own communities can bring about. Because women remain the principal agents for the family's health they should be informed, about the multiple dimensions leading to good health care to enable them to provide the rest of the family with good nourishment and health care follow-up. Children are a vulnerable and important group that require preventive care. A UNICEF experiment in Senegal is training 10-13 year old school children to visit the parents of 5 children, inform them about vaccinating their children, and to follow-up on their activities with these "adopted families." The need for short and long-term IEC interventions in Africa are a priority and effective strategies must be found to reach the majority of the rural populations where all obstacles such as the lack of infrastructure and illiteracy exist. Mali has used traditional theatre "Koteba" to reach the rural populations on a variety of health issues such as oral rehydration and diarrhea as well as the Rural Audio Library (it used cassettes rather than books) to reach villagers in their own languages. The worst obstacle facing Africa today is the refusal of officials in power to allow people to manage their own lives, of which health is a

  16. Mobile X-ray radiographic systems

    International Nuclear Information System (INIS)

    Buchmann, F.

    1990-01-01

    Mobile X-ray radiography equipment consists of the X-ray source with the generator and the switching and control devices, mounted on a mobile unit for transport to the patient to be examined. These mobile systems, just as the stationary equipment, have been profiting from the technological progress made in the area of X-ray generation, and the considerable improvements thus achieved have altered not only the value of these systems, but also their applicability which frequently comes near that of stationary equipment. (orig./GDG) [de

  17. Specific primer design of mitochondrial 12S rRNA for species identification in raw meats

    Science.gov (United States)

    Cahyadi, M.; Puruhita; Barido, F. H.; Hertanto, B. S.

    2018-01-01

    Polymerase chain reaction (PCR) is a molecular technique that widely used in agriculture area including species identification in animal-based products for halalness and food safety reasons. Amplification of DNA using PCR needs a primer pair (forward and reverse primers) to isolate specific DNA fragment in the genome. This objective of this study was to design specific primer from mitochondrial 12S rRNA region for species identification in raw beef, pork and chicken meat. Three published sequences, HQ184045, JN601075, and KT626857, were downloaded from National Center for Biotechnology Information (NCBI) website. Furthermore, those reference sequences were used to design specific primer for bovine, pig, and chicken species using primer3 v.0.4.0. A total of 15 primer pairs were picked up from primer3 software. Of these, an universal forward primer and three reverse primers which are specific for bovine, pig, and chicken species were selected to be optimized using multiplex-PCR technique. The selected primers were namely UNIF (5’-ACC GCG GTC ATA CGA TTA AC-3’), SPR (5’-AGT GCG TCG GCT ATT GTA GG-3’), BBR (5’-GAA TTG GCA AGG GTT GGT AA-3’), and AR (5’-CGG TAT GTA CGT GCC TCA GA-3’). In addition, the PCR products were visualized using 2% agarose gels under the UV light and sequenced to be aligned with reference sequences using Clustal Omega. The result showed that those primers were specifically amplified mitochondrial 12S rRNA regions from bovine, pig, and chicken using PCR. It was indicated by the existence of 155, 357, and 611 bp of DNA bands for bovine, pig, and chicken species, respectively. Moreover, sequence analysis revealed that our sequences were identically similar with reference sequences. It can be concluded that mitochondrial 12S rRNA may be used as a genetic marker for species identification in meat products.

  18. Automated degenerate PCR primer design for high-throughput sequencing improves efficiency of viral sequencing

    Directory of Open Access Journals (Sweden)

    Li Kelvin

    2012-11-01

    Full Text Available Abstract Background In a high-throughput environment, to PCR amplify and sequence a large set of viral isolates from populations that are potentially heterogeneous and continuously evolving, the use of degenerate PCR primers is an important strategy. Degenerate primers allow for the PCR amplification of a wider range of viral isolates with only one set of pre-mixed primers, thus increasing amplification success rates and minimizing the necessity for genome finishing activities. To successfully select a large set of degenerate PCR primers necessary to tile across an entire viral genome and maximize their success, this process is best performed computationally. Results We have developed a fully automated degenerate PCR primer design system that plays a key role in the J. Craig Venter Institute’s (JCVI high-throughput viral sequencing pipeline. A consensus viral genome, or a set of consensus segment sequences in the case of a segmented virus, is specified using IUPAC ambiguity codes in the consensus template sequence to represent the allelic diversity of the target population. PCR primer pairs are then selected computationally to produce a minimal amplicon set capable of tiling across the full length of the specified target region. As part of the tiling process, primer pairs are computationally screened to meet the criteria for successful PCR with one of two described amplification protocols. The actual sequencing success rates for designed primers for measles virus, mumps virus, human parainfluenza virus 1 and 3, human respiratory syncytial virus A and B and human metapneumovirus are described, where >90% of designed primer pairs were able to consistently successfully amplify >75% of the isolates. Conclusions Augmenting our previously developed and published JCVI Primer Design Pipeline, we achieved similarly high sequencing success rates with only minor software modifications. The recommended methodology for the construction of the consensus

  19. Mobile OS Comparative Study

    OpenAIRE

    Joseph, Jyothy; K, Shinto Kurian

    2013-01-01

    In the fast growing mobile revolutionary era, many operating systems are playing vital role in present market. This study is intending to identify the apt and secure mobile based on mobile operating systems capability and user requirements.

  20. Mobile Inquiry Based Learning

    NARCIS (Netherlands)

    Specht, Marcus

    2012-01-01

    Specht, M. (2012, 8 November). Mobile Inquiry Based Learning. Presentation given at the Workshop "Mobile inquiry-based learning" at the Mobile Learning Day 2012 at the Fernuniversität Hagen, Hagen, Germany.

  1. MOBILITY: A SYSTEMS APPROACH

    Directory of Open Access Journals (Sweden)

    Mykola I. Striuk

    2015-10-01

    Full Text Available A comprehensive study on the problem of mobility in the socio-educational and technical systems was carried out: the evolution of the concept of mobility in scientific sources of XIX–XXI centuries was analyzed and the new sources on the issue of mobility introduced into scientific circulation, the interrelation of the types of mobility in the socio-pedagogical and technical systems are theoretically grounded, an integrative model of mobility in the information society is proposed. The major trends in academic mobility are identified (the transition from student mobility to mobility programs and educational services providers, the new mobility programs (franchising, double/joint degrees, combinations, nostrification etc. are characterized. The new types of mobility providers are reviewed and attention is focused on virtual universities that are now the basis of virtual mobility of students and activities which are based on the use of new ICT in higher education, especially – the Internet and mobile learning environments.

  2. Micro Mobility Marketing

    DEFF Research Database (Denmark)

    Hosbond, Jens Henrik; Skov, Mikael B.

    2008-01-01

    , in our case a medium-sized retail supermarket. Two prototypes based on push and pull marketing strategies are implemented and evaluated. Taking outset in a synthesis of central issues in contemporary research on mobile marketing, we discuss their role in micro mobility marketing to point to similarities......Mobile marketing refers to marketing of services or goods using mobile technology and mobile marketing holds potentially great economical opportunities. Traditionally, mobile marketing has been viewed as mobility in the large taking place virtually anywhere, anytime. Further, research shows...... considerable number of studies on push-based SMS mobile marketing campaigns. This paper explores a related yet different form of mobile marketing namely micro mobility marketing. Micro mobility marketing denotes mobility in the small, meaning that promotion of goods takes place within a circumscribed location...

  3. Primer Vector Optimization: Survey of Theory, new Analysis and Applications

    Science.gov (United States)

    Guzman

    This paper presents a preliminary study in developing a set of optimization tools for orbit rendezvous, transfer and station keeping. This work is part of a large scale effort undergoing at NASA Goddard Space Flight Center and a.i. solutions, Inc. to build generic methods, which will enable missions with tight fuel budgets. Since no single optimization technique can solve efficiently all existing problems, a library of tools where the user could pick the method most suited for the particular mission is envisioned. The first trajectory optimization technique explored is Lawden's primer vector theory [Ref. 1]. Primer vector theory can be considered as a byproduct of applying Calculus of Variations (COV) techniques to the problem of minimizing the fuel usage of impulsive trajectories. For an n-impulse trajectory, it involves the solution of n-1 two-point boundary value problems. In this paper, we look at some of the different formulations of the primer vector (dependent on the frame employed and on the force model). Also, the applicability of primer vector theory is examined in effort to understand when and why the theory can fail. Specifically, since COV is based on "small variations", singularities in the linearized (variational) equations of motion along the arcs must be taken into account. These singularities are a recurring problem in analyzes that employ "small variations" [Refs. 2, 3]. For example, singularities in the (2-body problem) variational equations along elliptic arcs occur when [Ref. 4], 1) the difference between the initial and final times is a multiple of the reference orbit period, 2) the difference between the initial and final true anomalies are given by k, for k= 0, 1, 2, 3,..., note that this cover the 3) the time of flight is a minimum for the given difference in true anomaly. For the N-body problem, the situation is more complex and is still under investigation. Several examples, such as the initialization of an orbit (ascent trajectory) and

  4. Primer and interviews: The dynamic stem cell niche.

    Science.gov (United States)

    Kiefer, Julie C

    2011-03-01

    A stem cell niche is a microenvironment that supports self-renewal of a population of stem cells, and their production of differentiated cells. While the definition evokes images of a stem cell Shangri-La-where a serene stem cell pool nestles within a niche that shelters and sustains it-the reality is much more tumultuous. Niches are subject to an ever-changing maelstrom of environmental factors, the ravages of old age, and the sly tactics of disease. Presented here is a basic overview of the different ways in which stem cell niches respond to local and systemic environments, and their impact on stem cell behavior. The primer culminates with a discussion of the topic with stem cell and niche biologists D. Leanne Jones, Ph.D., and Tudorita Tumbar, Ph.D. Copyright © 2011 Wiley-Liss, Inc.

  5. Demystifying eResearch a primer for librarians

    CERN Document Server

    Martin, Victoria

    2014-01-01

    Today's librarians need to be technology-savvy information experts who understand how to manage datasets. Demystifying eResearch: A Primer for Librarians prepares librarians for careers that involve eResearch, clearly defining what it is and how it impacts library services and collections, explaining key terms and concepts, and explaining the importance of the field. You will come to understand exactly how the use of networked computing technologies enhances and supports collaboration and innovative methods particularly in scientific research, learn about eResearch library initiatives and best practices, and recognize the professional development opportunities that eResearch offers. This book takes the broad approach to the complex topic of eResearch and how it pertains to the library community, providing an introduction that will be accessible to readers without a background in electronic research. The author presents a conceptual overview of eResearch with real-world examples of electronic research activit...

  6. Primer Part 1-The building blocks of epilepsy genetics.

    Science.gov (United States)

    Helbig, Ingo; Heinzen, Erin L; Mefford, Heather C

    2016-06-01

    This is the first of a two-part primer on the genetics of the epilepsies within the Genetic Literacy Series of the Genetics Commission of the International League Against Epilepsy. In Part 1, we cover the foundations of epilepsy genetics including genetic epidemiology and the range of genetic variants that can affect the risk for developing epilepsy. We discuss various epidemiologic study designs that have been applied to the genetics of the epilepsies including population studies, which provide compelling evidence for a strong genetic contribution in many epilepsies. We discuss genetic risk factors varying in size, frequency, inheritance pattern, effect size, and phenotypic specificity, and provide examples of how genetic risk factors within the various categories increase the risk for epilepsy. We end by highlighting trends in epilepsy genetics including the increasing use of massive parallel sequencing technologies. Wiley Periodicals, Inc. © 2016 International League Against Epilepsy.

  7. ITS primers for the identification of marketable Boletus.

    Science.gov (United States)

    Mello, Antonietta; Ghignone, Stefano; Vizzini, Alfredo; Sechi, Clizia; Ruiu, Pino; Bonfante, Paola

    2006-02-10

    Boletus species belonging to the section Boletus are the most frequently eaten fungi among those harvested in natural conditions in Europe. This section groups 10 taxa which are hardly distinguishable on the basis of their morphology. Some of them have been shown to induce allergic IgE-mediated symptoms either through inhalation, ingestion or contact. Since questions relating to the presence of allergens in any of the species most in demand (B. edulis, B. aereus, B. pinophilus, B. aestivalis, all classified as B. edulis s.l.) remain open, together with the absence of tools which distinguish the species, we sequenced the ITS region of 28 Boletus samples and then we designed specific primers. These allowed the effective separation of the taxa. In addition, the phylogenetic tree obtained from the sequences alignment revealed that B. violaceofuscus, a spectacular Chinese fungus considered belonging to the section Boletus and often sold intermixed with B. edulis s.l. specimens, clusters outside the section Boletus.

  8. A matter of degrees: A primer on global warming

    International Nuclear Information System (INIS)

    1993-01-01

    A primer on global warming is presented in order to provide information to Canadians on making environmentally responsible decisions. The fundamentals of natural climate change, the atmospheric environment, factors that influence climate, and the greenhouse effect are explained. Global warming is then discussed with reference to paleoclimatic research, the influence of human activity on increased concentrations of greenhouse gases, and predictions of future climates. The possible impacts of global warming on Canada are described for such sectors as forests, fisheries, agriculture, sea levels, health, energy supply and demand, and the Arctic regions. The actions that citizens and governments can take in order to mitigate or adapt to global warming are then presented. A glossary and index are included. 55 refs., 17 figs

  9. A health and safety primer for the practicing health physicist

    International Nuclear Information System (INIS)

    Hylko, J.M.; Bradshaw, M.C.; Ross, L.E.; Brennan, M.J.; Pomatto, C.B.; Shelly, F.C.

    1996-01-01

    Environmental restoration (ER) is the process of removing a facility from service, the demolition of structures the identification and disposal of all hazardous and radioactive wastes, the decontamination of equipment and materials, and the restoration of a site for unrestricted use. The number of ER projects encompassing hazardous, industrial, and radiological conditions is expected to increase in response to various program requirements or mission changes. As a result, the practicing health physicist (HP) may have to address unique health and safety (H and S) issues beyond those of performing routine radiological activities. These unique H and S issues could include, but are not limited to the razing of buildings, the removal of radioactive materials and hazardous chemicals, below-grade excavation, confined space entry, storing flammable or combustible liquids, monitoring exposure to hazardous substances, contacting energized systems (e.g., electricity, hydraulics), noise abatement, the nullification of manufacturer warranties, and the operation and movement of heavy equipment. The purpose of this paper is to educate the practicing HP about these issues by reviewing specific regulations governing all H and S activities, and to provide an example of a site-specific H and S primer (e.g., Health and Safety Plan [HASP]). This primer advices the practicing HP about sound H and S principles, furnishes basic strategies for performing a hazard assessment/job safety analysis (HA/JSA) that can be applied to any ER project, and describes various engineering and administrative controls to mitigate hazardous exposures to ER personnel. In addition, 26 inspection checklist topics are available from the primary author to evaluate the adequacy of the engineering and administrative controls, or to necessitate the use of personal protective equipment (PPE) thereby mitigating the corresponding hazard. (author)

  10. Mobile Search and Advertising

    OpenAIRE

    Lovitskii, Vladimir; McCaffery, Colin; Thrasher, Michael; Traynor, David; Wright, Peter

    2009-01-01

    Mobile advertising is a rapidly growing sector providing brands and marketing agencies the opportunity to connect with consumers beyond traditional and digital media and instead communicate directly on their mobile phones. Mobile advertising will be intrinsically linked with mobile search, which has transported from the internet to the mobile and is identified as an area of potential growth. The result of mobile searching show that as a general rule such search result exceed 1...

  11. Trends in Mobile Marketing

    OpenAIRE

    Chocholová, Petra

    2010-01-01

    The principal aim of this thesis is to assess the state of the mobile marketing as of the first quarter of 2011 and to discuss various scenarios of the future development. This thesis defines the terms "mobile marketing" and "mobile advertising" and identifies the main players in the industry. It explores the main categories of mobile advertising such as mobile messaging, in-content and mobile internet advertising. Later, it analyzes the latest trends in the industry and describes in detail t...

  12. 40 CFR 63.745 - Standards: Primer and topcoat application operations.

    Science.gov (United States)

    2010-07-01

    ... CATEGORIES (CONTINUED) National Emission Standards for Aerospace Manufacturing and Rework Facilities § 63.745.../L (4.5 lb/gal) of primer (less water), as applied, for general aviation rework facilities; or 650 g... (4.5 lb/gal) of primer (less water and exempt solvents), as applied, for general aviation rework...

  13. Sediment transport primer: estimating bed-material transport in gravel-bed rivers

    Science.gov (United States)

    Peter Wilcock; John Pitlick; Yantao Cui

    2009-01-01

    This primer accompanies the release of BAGS, software developed to calculate sediment transport rate in gravel-bed rivers. BAGS and other programs facilitate calculation and can reduce some errors, but cannot ensure that calculations are accurate or relevant. This primer was written to help the software user define relevant and tractable problems, select appropriate...

  14. Móvil remisión de V. cinta del primer móvil.

    OpenAIRE

    2011-01-01

    [ES] Definición del término Móvil remisión de V. cinta del primer móvil. en el diccionario Dicter. [EN] Definition of the word Móvil remisión de V. cinta del primer móvil. in the dictionary Dicter.

  15. The Universal Primer - An open source solution for archiving, organizing and streaming live lectures

    DEFF Research Database (Denmark)

    Christoffersen, Marc Juul; Panton, Hans Christian Hansen; Krajowski-Kukiel, Maciej

    2011-01-01

    . The goal of the Universal Primer is to address these problems, and allow anyone, anywhere, to teach or learn anything that can be reasonably taught or learned through a computer. The Universal Primer is 1: A fully open source solution for streaming live lectures. And 2: A Wikipedia-like website...

  16. One fungus , which genes ? Development and assessment of universal primers for potential secondary fungal DNA barcodes

    NARCIS (Netherlands)

    Stielow, J B; Lévesque, C A; Seifert, K A; Meyer, W; Irinyi, L; Smits, D; Renfurm, R; Verkley, G J M; Groenewald, M; Chaduli, D; Lomascolo, A; Welti, S; Lesage-Meessen, L; Favel, A; Al-Hatmi, A M S; Damm, U; Yilmaz, N.; Houbraken, J.; Lombard, L.; Quaedvlieg, W.; Binder, M.; Vaas, L.A.I.; Vu, D.; Yurkov, A.; Begerow, D.; Roehl, O.; Guerreiro, M.; Fonseca, A.; Samerpitak, K.; Diepeningen, A.D. van; Dolatabadi, S.; Moreno, L.F.; Casaregola, S.; Mallet, S.; Jacques, N.; Roscini, L.; Egidi, E.; Bizet, C.; Garcia-Hermoso, D.; Martín, M.P.; Deng, S.; Groenewald, J.Z.; Boekhout, T.; Beer, Z.W. de; Barnes, I.; Duong, T.A.; Wingfield, M.J.; Hoog, G.S. de; Crous, P.W.; Lewis, C.T.; Hambleton, S.; Moussa, T.A.A.; Al-Zahrani, H.S.; Almaghrabi, O.A.; Louis-Seize, G.; Assabgui, R.; McCormick, W.; Omer, G.; Dukik, K.; Cardinali, G.; Eberhardt, U.; Vries, M. de; Robert, V.

    2015-01-01

    The aim of this study was to assess potential candidate gene regions and corresponding universal primer pairs as secondary DNA barcodes for the fungal kingdom, additional to ITS rDNA as primary barcode. Amplification efficiencies of 14 (partially) universal primer pairs targeting eight genetic

  17. One fungus, which genes? Development and assessment of universal primers for potential secondary fungal DNA barcodes

    NARCIS (Netherlands)

    Stielow, J.B.; Lévesque, C.A.; Seifert, K.A.; Meyer, W.; Irinyi, L.; Smits, D.; Renfurm, R.; Verkley, G.J.M.; Groenewald, M.; Chaduli, D.; Lomascolo, A.; Welti, S.; Lesage-Meessen, L.; Favel, A.; Al-Hatmi, A.M.S.; Damm, U.; Yilmaz, N.; Houbraken, J.; Lombard, L.; Quaedvlieg, W.; Binder, M.; Vaas, L.A.I.; Vu, D.; Yurkov, A.; Begerow, D.; Roehl, O.; Guerreiro, M.; Fonseca, A.; Samerpitak, K.; Diepeningen, van A.D.; Dolatabadi, S.; Moreno, L.F.; Casaregola, S.; Mallet, S.; Jacques, N.; Roscini, L.; Egidi, E.; Bizet, C.; Garcia-Hermoso, D.; Martin, M.P.; Deng, S.; Groenewald, J.Z.; Boekhout, T.; Beer, de Z.W.; Barnes, I.; Duong, T.A.; Wingfield, M.J.; Hoog, de G.S.; Crous, P.W.; Lewis, C.T.; Hambleton, S.; Moussa, T.A.A.; Al-Zahrani, H.S.; Almaghrabi, O.A.; Louis-Seize, G.; Assabgui, R.; McCormick, W.; Omer, G.; Dukik, K.; Cardinali, G.; Eberhardt, U.; Vries, de M.; Robert, V.

    2015-01-01

    The aim of this study was to assess potential candidate gene regions and corresponding universal primer pairs as secondary DNA barcodes for the fungal kingdom, additional to ITS rDNA as primary barcode. Amplification efficiencies of 14 (partially) universal primer pairs targeting eight genetic markers

  18. Taxon-specific PCR primers to detect two inconspicuous arbuscular mycorrhizal fungi from temperate agricultural grassland

    NARCIS (Netherlands)

    Gamper, H.A.; Leuchtmann, A.

    2007-01-01

    Taxon-specific polymerase chain reaction (PCR) primers enable detection of arbuscular mycorrhizal fungi (AMF, Glomeromycota) in plant roots where the fungi lack discriminative morphological and biochemical characters. We designed and validated pairs of new PCR primers targeted to the flanking

  19. A database of PCR primers for the chloroplast genomes of higher plants

    Science.gov (United States)

    Heinze, Berthold

    2007-01-01

    Background Chloroplast genomes evolve slowly and many primers for PCR amplification and analysis of chloroplast sequences can be used across a wide array of genera. In some cases 'universal' primers have been designed for the purpose of working across species boundaries. However, the essential information on these primer sequences is scattered throughout the literature. Results A database is presented here which assembles published primer information for chloroplast DNA. Additional primers were designed to fill gaps where little or no primer information could be found. Amplicons are either the genes themselves (typically useful in studies of sequence variation in higher-order phylogeny) or they are spacers, introns, and intergenic regions (for studies of phylogeographic patterns within and among species). The current list of 'generic' primers consists of more than 700 sequences. Wherever possible, we give the locations of the primers in the thirteen fully sequenced chloroplast genomes (Nicotiana tabacum, Atropa belladonna, Spinacia oleracea, Arabidopsis thaliana, Populus trichocarpa, Oryza sativa, Pinus thunbergii, Marchantia polymorpha, Zea mays, Oenothera elata, Acorus calamus, Eucalyptus globulus, Medicago trunculata). Conclusion The database described here is designed to serve as a resource for researchers who are venturing into the study of poorly described chloroplast genomes, whether for large- or small-scale DNA sequencing projects, to study molecular variation or to investigate chloroplast evolution. PMID:17326828

  20. Primers for polymerase chain reaction to detect genomic DNA of Toxocara canis and T. cati.

    Science.gov (United States)

    Wu, Z; Nagano, I; Xu, D; Takahashi, Y

    1997-03-01

    Primers for polymerase chain reaction to amplify genomic DNA of both Toxocara canis and T. cati were constructed by adapting cloning and sequencing random amplified polymorphic DNA. The primers are expected to detect eggs and/or larvae of T. canis and T. cati, both of which are known to cause toxocariasis in humans.

  1. A database of PCR primers for the chloroplast genomes of higher plants

    Directory of Open Access Journals (Sweden)

    Heinze Berthold

    2007-02-01

    Full Text Available Abstract Background Chloroplast genomes evolve slowly and many primers for PCR amplification and analysis of chloroplast sequences can be used across a wide array of genera. In some cases 'universal' primers have been designed for the purpose of working across species boundaries. However, the essential information on these primer sequences is scattered throughout the literature. Results A database is presented here which assembles published primer information for chloroplast DNA. Additional primers were designed to fill gaps where little or no primer information could be found. Amplicons are either the genes themselves (typically useful in studies of sequence variation in higher-order phylogeny or they are spacers, introns, and intergenic regions (for studies of phylogeographic patterns within and among species. The current list of 'generic' primers consists of more than 700 sequences. Wherever possible, we give the locations of the primers in the thirteen fully sequenced chloroplast genomes (Nicotiana tabacum, Atropa belladonna, Spinacia oleracea, Arabidopsis thaliana, Populus trichocarpa, Oryza sativa, Pinus thunbergii, Marchantia polymorpha, Zea mays, Oenothera elata, Acorus calamus, Eucalyptus globulus, Medicago trunculata. Conclusion The database described here is designed to serve as a resource for researchers who are venturing into the study of poorly described chloroplast genomes, whether for large- or small-scale DNA sequencing projects, to study molecular variation or to investigate chloroplast evolution.

  2. Optimization of ISSR-PCR reaction system and selection of primers in Bryum argenteum

    Directory of Open Access Journals (Sweden)

    Ma Xiaoying

    2017-02-01

    Full Text Available In order to determine optimum ISSR-PCR reaction system for moss Bryum argenteum,the concentrations of template DNA primers,dNTPs,Mg2+ and Taq DNA polymerase were optimized in four levels by PCR orthogonal experimental method. The appropriate primers were screened from 100 primers by temperature gradient PCR,and the optimal anneal temperature of the screened primers were determined. The results showed that the optimized 20 μL ISSR-PCR reaction system was as follows:template DNA 20 ng/20 μL,primers 0.45 μmol/L,Mg2+2.65 mmol/L,Taq DNA polymerase 0.4 U/20 μL,dNTPs 0.45 mmol/L. Using this system,50 primers with clear bands,repeatability well and polymorphism highly were selected from 100 primers. The establishment of this system,the screened primers and the annealing temperature could provide a theoretical basis for further research on the genetic diversity of bryophytes using ISSR molecular markers.

  3. GETPrime: a gene- or transcript-specific primer database for quantitative real-time PCR.

    Science.gov (United States)

    Gubelmann, Carine; Gattiker, Alexandre; Massouras, Andreas; Hens, Korneel; David, Fabrice; Decouttere, Frederik; Rougemont, Jacques; Deplancke, Bart

    2011-01-01

    The vast majority of genes in humans and other organisms undergo alternative splicing, yet the biological function of splice variants is still very poorly understood in large part because of the lack of simple tools that can map the expression profiles and patterns of these variants with high sensitivity. High-throughput quantitative real-time polymerase chain reaction (qPCR) is an ideal technique to accurately quantify nucleic acid sequences including splice variants. However, currently available primer design programs do not distinguish between splice variants and also differ substantially in overall quality, functionality or throughput mode. Here, we present GETPrime, a primer database supported by a novel platform that uniquely combines and automates several features critical for optimal qPCR primer design. These include the consideration of all gene splice variants to enable either gene-specific (covering the majority of splice variants) or transcript-specific (covering one splice variant) expression profiling, primer specificity validation, automated best primer pair selection according to strict criteria and graphical visualization of the latter primer pairs within their genomic context. GETPrime primers have been extensively validated experimentally, demonstrating high transcript specificity in complex samples. Thus, the free-access, user-friendly GETPrime database allows fast primer retrieval and visualization for genes or groups of genes of most common model organisms, and is available at http://updepla1srv1.epfl.ch/getprime/. Database URL: http://deplanckelab.epfl.ch.

  4. An Integrated Mobile Phone Payment System Based on 3G Network

    OpenAIRE

    Weihui Dai; Xiang Cai; Haifeng Wu; Weidong Zhao; Xuan Li

    2011-01-01

    Along with globally approaching of the 3G era, the progress of mobile communication technology and the development of mobile terminal devices will rapidly promote the mobilization development of traditional E-commerce. In order to ensure it to achieve further development, secure, flexible and reliable mobile payment system is becoming more and more important. Compared with the payment pattern of ordinary commerce, there will be profound changes in the mobile payment, such as special payment c...

  5. A Decentralized Interactive Architecture for Aerial and Ground Mobile Robots Cooperation

    OpenAIRE

    Harik, El Houssein Chouaib; Guérin, François; Guinand, Frédéric; Brethé, Jean-François; Pelvillain, Hervé

    2014-01-01

    International audience; —This paper presents a novel decentralized interactive architecture for aerial and ground mobile robots cooperation. The aerial mobile robot is used to provide a global coverage during an area inspection, while the ground mobile robot is used to provide a local coverage of ground features. We include a human-in-the-loop to provide waypoints for the ground mobile robot to progress safely in the inspected area. The aerial mobile robot follows continuously the ground mobi...

  6. The emergence of Smartphones: An exploratory study of consumer attitude and intention to redeem mobile coupons

    OpenAIRE

    Lao, Ka Man

    2012-01-01

    Purpose - The prevalence of mobile phones, especially the development of smartphones, has attracted numerous companies to exploit the potential in mobile marketing. One notable mobile marketing tool that is progressively gaining interest is the mobile coupon. The aim of this study is to build a conceptual model to explain consumers’ attitude and intention to redeem mobile coupon in the emergence of smartphones. Design/methodology/approach – This study is based on an online survey questionn...

  7. Edge computing technologies for Internet of Things: a primer

    Directory of Open Access Journals (Sweden)

    Yuan Ai

    2018-04-01

    Full Text Available With the rapid development of mobile internet and Internet of Things applications, the conventional centralized cloud computing is encountering severe challenges, such as high latency, low Spectral Efficiency (SE, and non-adaptive machine type of communication. Motivated to solve these challenges, a new technology is driving a trend that shifts the function of centralized cloud computing to edge devices of networks. Several edge computing technologies originating from different backgrounds to decrease latency, improve SE, and support the massive machine type of communication have been emerging. This paper comprehensively presents a tutorial on three typical edge computing technologies, namely mobile edge computing, cloudlets, and fog computing. In particular, the standardization efforts, principles, architectures, and applications of these three technologies are summarized and compared. From the viewpoint of radio access network, the differences between mobile edge computing and fog computing are highlighted, and the characteristics of fog computing-based radio access network are discussed. Finally, open issues and future research directions are identified as well. Keywords: Internet of Things (IoT, Mobile edge computing, Cloudlets, Fog computing

  8. Video games and mobile learning: A Spanish developers approach

    OpenAIRE

    Fernández Gómez, Carlos; Martí Parreño, José

    2016-01-01

    This research presents a work in progress aiming to map Spanish video games developers’ production in the area of mobile educational video games. A sample of 30 Spanish video games developers was analyzed in order to explore the weight that educational video games for mobile devices represents in their product portfolio. Primary findings suggest that Spanish video games developers’ production of educational video games for mobile devices is very scarce. While 23,3% of the analyzed video games...

  9. A tool for design of primers for microRNA-specific quantitative RT-qPCR. BMC Bioinformatics

    DEFF Research Database (Denmark)

    Busk, Peter Kamp

    2014-01-01

    of formation of secondary structures and primer dimers. Testing of the primers showed that 76 out of 79 primers (96%) worked for quantification of microRNAs by miR-specific RT-qPCR of mammalian RNA samples. This success rate corresponds to the success rate of manual primer design. Furthermore, primers designed......Background MicroRNAs are small but biologically important RNA molecules. Although different methods can be used for quantification of microRNAs, quantitative PCR is regarded as the reference that is used to validate other methods. Several commercial qPCR assays are available but they often come...... at a high price and the sequences of the primers are not disclosed. An alternative to commercial assays is to manually design primers but this work is tedious and, hence, not practical for the design of primers for a larger number of targets. Results I have developed the software miRprimer for automatic...

  10. KENO V.a Primer: A Primer for Criticality Calculations with SCALE/KENO V.a Using CSPAN for Input

    International Nuclear Information System (INIS)

    Busch, R.D.

    2003-01-01

    The SCALE (Standardized Computer Analyses for Licensing Evaluation) computer software system developed at Oak Ridge National Laboratory (ORNL) is widely used and accepted around the world for criticality safety analyses. The well-known KENO V.a three-dimensional Monte Carlo criticality computer code is the primary criticality safety analysis tool in SCALE. The KENO V.a primer is designed to help a new user understand and use the SCALE/KENO V.a Monte Carlo code for nuclear criticality safety analyses. It assumes that the user has a college education in a technical field. There is no assumption of familiarity with Monte Carlo codes in general or with SCALE/KENO V.a in particular. The primer is designed to teach by example, with each example illustrating two or three features of SCALE/KENO V.a that are useful in criticality analyses. The primer is based on SCALE 4.4a, which includes the Criticality Safety Processor for Analysis (CSPAN) input processor for Windows personal computers (PCs). A second edition of the primer, which uses the new KENO Visual Editor, is currently under development at ORNL and is planned for publication in late 2003. Each example in this first edition of the primer uses CSPAN to provide the framework for data input. Starting with a Quickstart section, the primer gives an overview of the basic requirements for SCALE/KENO V.a input and allows the user to quickly run a simple criticality problem with SCALE/KENO V.a. The sections that follow Quickstart include a list of basic objectives at the beginning that identifies the goal of the section and the individual SCALE/KENO V.a features which are covered in detail in the example problems in that section. Upon completion of the primer, a new user should be comfortable using CSPAN to set up criticality problems in SCALE/KENO V.a

  11. Empowering Learners with Mobile Open-Access Learning Initiatives

    Science.gov (United States)

    Mills, Michael, Ed.; Wake, Donna, Ed.

    2017-01-01

    Education has been progressing at a rapid pace ever since educators have been able to harness the power of mobile technology. Open-access learning techniques provide more students with the opportunity to engage in educational opportunities that may have been previously restricted. "Empowering Learners with Mobile Open-Access Learning…

  12. Mobile Operating Systems

    OpenAIRE

    Vipin Kamboj; Hitesh Gupta

    2012-01-01

    Mobile phones are used by every people in today’s life. We use mobile phones without knowing the different factors that a mobile used including its technology, operating system, CPU ,RAM etc. Many types of operating system are used by different mobile. Every operating system has their advantage

  13. Mobile Africa : an introduction

    NARCIS (Netherlands)

    Bruijn, de M.E.; Dijk, van R.A.; Foeken, D.W.J.

    2001-01-01

    The case studies in this book on mobility in sub-Saharan Africa critically discuss dichotomous interpretations of mobility and reject the idea that migration indicates a breakdown in society. They adopt the approach that sedentary and mobile worlds converge and that mobility is part of the

  14. A Primer on Alberta’s Oil sands Royalties

    Directory of Open Access Journals (Sweden)

    Sarah Dobson

    2015-12-01

    Full Text Available Fulfilling its campaign promise, the new NDP government announced a review of Alberta’s royalty framework in June 2015. The province receives royalty revenue from three main sources – natural gas, crude oil, and oil sands. Since the 2009-10 fiscal year the largest contributor to Alberta’s royalty revenues has been the oil sands. If you want a sense of how important oil sands royalties have been for Alberta’s finances, consider this: In the 2014–15 fiscal year, the government collected just over $5 billion from oil sands royalties. These royalties covered over 10 per cent of the province’s operational expenses of $48.6 billion in the same fiscal year. Over the last six fiscal years the oil sands have contributed an average of 10 per cent of revenues to provincial coffers. This makes oil sands royalties the fourth largest contributor behind personal income taxes (23 per cent, federal transfers (13 per cent and corporate income taxes (11 per cent. But how many Albertans really understand how the royalty system works? What do we mean when we say “royalty”? How does the Alberta Government calculate royalties on oil sands producers? If the system is going to change, it’s important that Albertans understand how the current system works. That is what this paper is designed to do. For Albertans to properly judge the impact of new policy, they need a solid understanding of the current policy environment. We all know that oil prices have dropped and oil sands producers are losing profitability. As such, changes to the royalty system could have a deep and profound impact on the sector. Here are some of the issues this primer will study: • Pre-payout projects vs. post-payout projects, in other words, the classification of projects for royalty purposes based on whether the cumulative costs of a project exceed its cumulative revenues • Monthly payment of royalties vs. annual payment • Understanding the unit price of bitumen and how that

  15. Smart mobility in smart cities

    Energy Technology Data Exchange (ETDEWEB)

    Baucells, Aleta N.

    2016-07-01

    Cities are currently undergoing a transformation into the Smart concept, like Smartphones or SmartTV. Many initiatives are being developed in the framework of the Smart Cities projects, however, there is a lack of consistent indicators and methodologies to assess, finance, prioritize and implement this kind of projects. Smart Cities projects are classified according to six axes: Government, Mobility, Environment, Economy, People and Living. (Giffinger, 2007). The main objective of this research is to develop an evaluation model in relation to the mobility concept as one of the six axes of the Smart City classification and apply it to the Spanish cities. The evaluation was carried out in the 62 cities that made up in September 2015 the Spanish Network of Smart Cities (RECI- Red Española de Ciudades Inteligentes). This research is part of a larger project about Smart Cities’ evaluation (+CITIES), the project evaluates RECI’s cities in all the axes. The analysis was carried out taking into account sociodemographic indicators such as the size of the city or the municipal budget per inhabitant. The mobility’s evaluation in those cities has been focused in: sustainability mobility urban plans and measures to reduce the number of vehicles. The 62 cities from the RECI have been evaluated according to their degree of progress in several Smart Cities’ initiatives related to smart mobility. The applied methodology has been specifically made for this project. The grading scale has different ranks depending on the deployment level of smart cities’ initiatives. (Author)

  16. Evolution of Mobile Applications

    Directory of Open Access Journals (Sweden)

    Phongtraychack Anachack

    2018-01-01

    Full Text Available Currently, we can see the rapid evolution of mobile technology, which involves mobile communication, mobile hardware, and mobile software. Features of mobile phones largely depend on software. In contemporary information and communication age [1–4], mobile application is one of the most concerned and rapidly developing areas. At the same time, the development of mobile application undergoes great changes with the introduction of new software, service platforms and software development kits (SDK. These changes lead to appearance of many new service platforms such as Google with Android and Apple with iOS. This article presents the information about the evolution of mobile application, gives some statistical data on the past and present situation, demonstrates how individual users of mobile devices can benefit, and shows how mobile applications affect society from the ethical perspective.

  17. Mobile genetic elements in Methanobacterium thermoformicicum

    NARCIS (Netherlands)

    Noelling, J.

    1993-01-01

    The identification of the Archaea as a third primary lineage of life and their adaptation to extreme environmental conditions have generated considerable interest in the molecular biology of these organisms. Most progress in the investigation of archaeal mobile genetic

  18. MOBILITY: A SYSTEMS APPROACH

    OpenAIRE

    Mykola I. Striuk; Serhiy O. Semerikov; Andrii M. Striuk

    2015-01-01

    A comprehensive study on the problem of mobility in the socio-educational and technical systems was carried out: the evolution of the concept of mobility in scientific sources of XIX–XXI centuries was analyzed and the new sources on the issue of mobility introduced into scientific circulation, the interrelation of the types of mobility in the socio-pedagogical and technical systems are theoretically grounded, an integrative model of mobility in the information society is proposed. The major t...

  19. Mobile platform security

    CERN Document Server

    Asokan, N; Dmitrienko, Alexandra

    2013-01-01

    Recently, mobile security has garnered considerable interest in both the research community and industry due to the popularity of smartphones. The current smartphone platforms are open systems that allow application development, also for malicious parties. To protect the mobile device, its user, and other mobile ecosystem stakeholders such as network operators, application execution is controlled by a platform security architecture. This book explores how such mobile platform security architectures work. We present a generic model for mobile platform security architectures: the model illustrat

  20. Generation of sequence signatures from DNA amplification fingerprints with mini-hairpin and microsatellite primers.

    Science.gov (United States)

    Caetano-Anollés, G; Gresshoff, P M

    1996-06-01

    DNA amplification fingerprinting (DAF) with mini-hairpins harboring arbitrary "core" sequences at their 3' termini were used to fingerprint a variety of templates, including PCR products and whole genomes, to establish genetic relationships between plant tax at the interspecific and intraspecific level, and to identify closely related fungal isolates and plant accessions. No correlation was observed between the sequence of the arbitrary core, the stability of the mini-hairpin structure and DAF efficiency. Mini-hairpin primers with short arbitrary cores and primers complementary to simple sequence repeats present in microsatellites were also used to generate arbitrary signatures from amplification profiles (ASAP). The ASAP strategy is a dual-step amplification procedure that uses at least one primer in each fingerprinting stage. ASAP was able to reproducibly amplify DAF products (representing about 10-15 kb of sequence) following careful optimization of amplification parameters such as primer and template concentration. Avoidance of primer sequences partially complementary to DAF product termini was necessary in order to produce distinct fingerprints. This allowed the combinatorial use of oligomers in nucleic acid screening, with numerous ASAP fingerprinting reactions based on a limited number of primer sequences. Mini-hairpin primers and ASAP analysis significantly increased detection of polymorphic DNA, separating closely related bermudagrass (Cynodon) cultivars and detecting putatively linked markers in bulked segregant analysis of the soybean (Glycine max) supernodulation (nitrate-tolerant symbiosis) locus.

  1. Disclosing bias in bisulfite assay: MethPrimers underestimate high DNA methylation.

    Directory of Open Access Journals (Sweden)

    Andrea Fuso

    Full Text Available Discordant results obtained in bisulfite assays using MethPrimers (PCR primers designed using MethPrimer software or assuming that non-CpGs cytosines are non methylated versus primers insensitive to cytosine methylation lead us to hypothesize a technical bias. We therefore used the two kinds of primers to study different experimental models and methylation statuses. We demonstrated that MethPrimers negatively select hypermethylated DNA sequences in the PCR step of the bisulfite assay, resulting in CpG methylation underestimation and non-CpG methylation masking, failing to evidence differential methylation statuses. We also describe the characteristics of "Methylation-Insensitive Primers" (MIPs, having degenerated bases (G/A to cope with the uncertain C/U conversion. As CpG and non-CpG DNA methylation patterns are largely variable depending on the species, developmental stage, tissue and cell type, a variable extent of the bias is expected. The more the methylome is methylated, the greater is the extent of the bias, with a prevalent effect of non-CpG methylation. These findings suggest a revision of several DNA methylation patterns so far documented and also point out the necessity of applying unbiased analyses to the increasing number of epigenomic studies.

  2. Computational intelligence-based polymerase chain reaction primer selection based on a novel teaching-learning-based optimisation.

    Science.gov (United States)

    Cheng, Yu-Huei

    2014-12-01

    Specific primers play an important role in polymerase chain reaction (PCR) experiments, and therefore it is essential to find specific primers of outstanding quality. Unfortunately, many PCR constraints must be simultaneously inspected which makes specific primer selection difficult and time-consuming. This paper introduces a novel computational intelligence-based method, Teaching-Learning-Based Optimisation, to select the specific and feasible primers. The specified PCR product lengths of 150-300 bp and 500-800 bp with three melting temperature formulae of Wallace's formula, Bolton and McCarthy's formula and SantaLucia's formula were performed. The authors calculate optimal frequency to estimate the quality of primer selection based on a total of 500 runs for 50 random nucleotide sequences of 'Homo species' retrieved from the National Center for Biotechnology Information. The method was then fairly compared with the genetic algorithm (GA) and memetic algorithm (MA) for primer selection in the literature. The results show that the method easily found suitable primers corresponding with the setting primer constraints and had preferable performance than the GA and the MA. Furthermore, the method was also compared with the common method Primer3 according to their method type, primers presentation, parameters setting, speed and memory usage. In conclusion, it is an interesting primer selection method and a valuable tool for automatic high-throughput analysis. In the future, the usage of the primers in the wet lab needs to be validated carefully to increase the reliability of the method.

  3. Collider physics within the standard model a primer

    CERN Document Server

    Altarelli, Guido

    2017-01-01

    With this graduate-level primer, the principles of the standard model of particle physics receive a particular skillful, personal and enduring exposition by one of the great contributors to the field. In 2013 the late Prof. Altarelli wrote: The discovery of the Higgs boson and the non-observation of new particles or exotic phenomena have made a big step towards completing the experimental confirmation of the standard model of fundamental particle interactions. It is thus a good moment for me to collect, update and improve my graduate lecture notes on quantum chromodynamics and the theory of electroweak interactions, with main focus on collider physics. I hope that these lectures can provide an introduction to the subject for the interested reader, assumed to be already familiar with quantum field theory and some basic facts in elementary particle physics as taught in undergraduate courses. “These lecture notes are a beautiful example of Guido’s unique pedagogical abilities and scientific vision”. From...

  4. Neurociencia y bilingüismo: efecto del primer idioma

    Directory of Open Access Journals (Sweden)

    Germary Díaz-Sánchez

    2013-08-01

    Full Text Available Desde la perspectiva neurobiológica, en este trabajo abordamos los efectos del idioma materno sobre el aprendizaje de una segunda lengua. Aunque existen investigaciones en diferentes países sobre este problema, pocas tratan el enfoque de la neurobiología y, menos aún, cuando se trata del español como idioma materno. Para la investigación se recopiló literatura descriptiva y experimental, con el fin de obtener los datos necesarios para alcanzar los objetivos; se realizó un metaanálisis cualitativo de los datos obtenidos, utilizando tablas de correlación. Los datos reflejaron que la adquisición de un segundo idioma siempre va a estar mediatizada por los esquemas ya establecidos del primer idioma y que existen aspectos neurobiológicos que subyacen a algunos mecanismos de interferencia y a la adquisición de un segundo lenguaje. Además, encontramos que, mientras más similares sean los idiomas, los mecanismos neurales subyacentes facilitan la transferencia del uno al otro.

  5. Esteatosis en un burro (Equus asinus. Primer reporte en Colombia

    Directory of Open Access Journals (Sweden)

    José Cardona Á.

    2011-12-01

    Full Text Available Se describe un caso de esteatosis en un burro (Equus asinus, castrado, de 15 años de edad, procedente del municipio de San Antero (Córdoba, Colombia, al cual se le detectó ligamento nucal engrosado, duro y doloroso, dando la impresión de un doble cuello y edemas subcutáneos indurados en pared costal, abdominal y pectoral. Tambiénpresentó masas duras en la unión de músculos semimembranoso y semitendinoso. Por todo lo anterior, mostró dificultad para realizar movimientos coordinados del cuello, nuca y de traslado. Estos hallazgos obedecen principalmente a una deficiencia de selenio y vitamina E, sirviendo como parámetro diagnóstico para la identificación de esta enfermedad en equinos, por lo cual se determinó la actividad eritrocitica de la enzima glutatión peroxidada (GSH-Px, arrojando resultados muy bajos. Este cuadro es también conocido en equinos como enfermedad de la grasa amarilla o esteatitis, que produce degeneración del tejido adiposo, siendo reemplazado por tejido conectivo con depósitos de calcio. Puede estar asociada a miodegeneración nutricional o distrófica (enfermedad del músculo blanco. Es el primer reporte de esta enfermedad en burros(Equus asinus que se hace en Colombia.

  6. Primer reporte de alcaptonuria en el Perú

    Directory of Open Access Journals (Sweden)

    Daniel Guillén-Mendoza

    Full Text Available La alcaptonuria es un error innato del metabolismo causado por la deficiencia de la homogentisiato 1,2 dioxidasa (HGD, produciéndose un exceso de ácido homogentísico (HGA. Se presenta el caso de una mujer de 57 años quien, desde que nació, su orina se tornaba de color negro; desde hacía 9 años presentaba una pigmentación verdosa en los lechos ungueales que no mejoró con tratamientos antifúngicos y en los últimos 9 meses presentó artrosis de articulaciones grandes que fue empeorando, forzándola a usar una silla de ruedas por el intenso dolor generado por la artrosis de caderas y columna lumbar. Por la descripción de los síntomas se le solicitó la medición de HGA en orina lo que confirmó el diagnóstico de alcaptonuria. Se sugirieron analgésicos, dieta sin productos que contuvieran tirosina y fue referida para cirugía de reemplazo de cadera. Se trata del primer reporte de caso de alcaptonuria en el Perú.

  7. Genetic analysis of presbycusis by arrayed primer extension.

    Science.gov (United States)

    Rodriguez-Paris, Juan; Ballay, Charles; Inserra, Michelle; Stidham, Katrina; Colen, Tahl; Roberson, Joseph; Gardner, Phyllis; Schrijver, Iris

    2008-01-01

    Using the Hereditary Hearing Loss arrayed primer extension (APEX) array, which contains 198 mutations across 8 hearing loss-associated genes (GJB2, GJB6, GJB3, GJA1, SLC26A4, SLC26A5, 12S-rRNA, and tRNA Ser), we compared the frequency of sequence variants in 94 individuals with early presbycusis to 50 unaffected controls and aimed to identify possible genetic contributors. This cross-sectional study was performed at Stanford University with presbycusis samples from the California Ear Institute. The patients were between ages 20 and 65 yr, with adult-onset sensorineural hearing loss of unknown etiology, and carried a clinical diagnosis of early presbycusis. Exclusion criteria comprised known causes of hearing loss such as significant noise exposure, trauma, ototoxic medication, neoplasm, and congenital infection or syndrome, as well as congenital or pediatric onset. Sequence changes were identified in 11.7% and 10% of presbycusis and control alleles, respectively. Among the presbycusis group, these solely occurred within the GJB2 and SLC26A4 genes. Homozygous and compound heterozygous pathogenic mutations were exclusively seen in affected individuals. We were unable to detect a statistically significant difference between our control and affected populations regarding the frequency of sequence variants detected with the APEX array. Individuals who carry two mild mutations in the GJB2 gene possibly have an increased risk of developing early presbycusis.

  8. The corrosion mechanisms for primer coated 2219-T87 aluminum

    Science.gov (United States)

    Danford, Merlin D.; Knockemus, Ward W.

    1987-01-01

    To investigate metal surface corrosion and the breakdown of metal protective coatings, the ac Impedance Method was applied to zinc chromate primer coated 2219-T87 aluminum. The EG&GPARC Model 368 ac Impedance Measurement System, along with dc measurements with the same system using the Polarization Resistance Method, was used to monitor changing properties of coated aluminum disks immersed in 3.5 percent NaCl solutions buffered at pH 5.5 and pH 8.2 over periods of 40 days each. The corrosion system can be represented by an electronic analog called an equivalent circuit consisting of resistors and capacitors in specific arrangements. This equivalent circuit parallels the impedance behavior of the corrosion system during a frequency scan. Values for resistances and capacitances, that can be assigned in the equivalent circuit following a least squares analysis of the data, describe changes occurring on the corroding metal surface and in the protective coatings. A suitable equivalent circuit has been determined which predicts the correct Bode phase and magnitude for the experimental sample. The dc corrosion current density data are related to equivalent circuit element parameters.

  9. A primer on on-demand polymerase chain reaction technology.

    Science.gov (United States)

    Spencer, Maureen; Barnes, Sue; Parada, Jorge; Brown, Scott; Perri, Luci; Uettwiller-Geiger, Denise; Johnson, Helen Boehm; Graham, Denise

    2015-10-01

    Efforts to reduce health care-associated infections (HAIs) have grown in both scale and sophistication over the past few decades; however, the increasing threat of antimicrobial resistance and the impact of new legislation regarding HAIs on health care economics make the fight against them all the more urgent. On-demand polymerase chain reaction (PCR) technology has proven to be a highly effective weapon in this fight, offering the ability to accurately and efficiently identify disease-causing pathogens such that targeted and directed therapy can be initiated at the point of care. As a result, on-demand PCR technology has far-reaching influences on HAI rates, health care outcomes, hospital length of stay, isolation days, patient satisfaction, antibiotic stewardship, and health care economics. The basics of on-demand PCR technology and its potential to impact health care have not been widely incorporated into health care education and enrichment programs for many of those involved in infection control and prevention, however. This article serves as a primer on on-demand PCR technology and its ramifications. Copyright © 2015 Association for Professionals in Infection Control and Epidemiology, Inc. Published by Elsevier Inc. All rights reserved.

  10. Mobilization and Counter-mobilization Against LGBT Rights. Conservative Responses to the Recognition of Human Rights

    Directory of Open Access Journals (Sweden)

    Jairo Antonio López Pacheco

    2017-10-01

    Full Text Available This article analyzes the counter-mobilization against the institutionalization of lgbt rights in Colombia and Mexico. From an analytical framework that integrates the dimension of mobilization and counter-mobilization in the conflicts for rights, we show that the conservative reaction in Colombia and Mexico is a coordinated and active response against the conquests of sexual minorities, led by the churches, which has slowed the progress of effective recognition of human rights. We have identified similar strategies of mobilization of demand frameworks, mobilization structures and collective action repertories in both cases that have raised the political costs of institutional changes through two mechanisms of conflict: street and electoral activism and institutional activism.

  11. Typing of multiple single-nucleotide polymorphisms using ribonuclease cleavage of DNA/RNA chimeric single-base extension primers and detection by MALDI-TOF mass spectrometry

    DEFF Research Database (Denmark)

    Mengel-From, Jonas; Sanchez Sanchez, Juan Jose; Børsting, Claus

    2005-01-01

    A novel single-base extension (SBE) assay using cleavable and noncleavable SBE primers in the same reaction mix is described. The cleavable SBE primers consisted of deoxyribonucleotides and one ribonucleotide (hereafter denoted chimeric primers), whereas the noncleavable SBE primers consisted....... A ribonuclease mix was developed to specifically cleave the chimeric primers, irrespective of the base of the ribonucleotide, whereas standard primers without a ribonucleotide were unaffected by the ribonuclease treatment. The SBE products were analyzed in linear mode using a matrix-assisted laser desorption...... containing 9 chimeric primers and 8 standard primers....

  12. Abrechnung mobiler Dienste im Mobile-Payment-Referenzmodell

    OpenAIRE

    Pousttchi, Key; Wiedemann, Dietmar Georg

    2005-01-01

    The purpose of the paper is to analyze mobile payments in the mobile commerce scenario. Therefore, we first classify the mobile payment in the mobile commerce scenario by explaining general offer models, charging concepts, and intermediaries. Second, we describe the mobile payment reference model, especially, the mobile payment reference organization model and different mobile payment standard types. Finally, we conclude our findings.

  13. Charging of mobile services by mobile payment reference model

    OpenAIRE

    Pousttchi, Key; Wiedemann, Dietmar Georg

    2005-01-01

    The purpose of the paper is to analyze mobile payments in the mobile commerce scenario. Therefore, we first classify the mobile payment in the mobile commerce scenario by explaining general offer models, charging concepts, and intermediaries. Second, we describe the mobile payment reference model, especially, the mobile payment reference organization model and different mobile payment standard types. Finally, we conclude our findings.

  14. Profitability primer: a guide to profitability analysis in the electric power industry

    International Nuclear Information System (INIS)

    Woo, C.K.; Lloyd-Zannetti, D.; Martin, J.; Price, S.

    1996-06-01

    As the electric power industry is opened to forces of competition, increased attention must be focused to develop products and services that deliver good value to customers and to identify customer segments that are profitable to serve. This primer introduces the concept of profitability analysis and its application to the electric power industry. The primer recognizes that some segments of the business will remain monopolistic and subject to regulations, while other segments will become competitive. The primer also recognizes that customer profitability is critically dependent on a host of related issues such as how internal costs are allocated to various functions and how revenues are collected and allocated

  15. THE QUALITY IMPROVEMENT OF PRIMER PACKAGING PROCESS USING SIX SIGMA METHODOLOGY

    Directory of Open Access Journals (Sweden)

    Prima Ditahardiyani

    2008-01-01

    Full Text Available The implementation of Six Sigma has become a common theme in many organizations. This paper presents the Six Sigma methodology and its implementation in a primer packaging process of Cranberry drink. DMAIC (Define, Measure, Analyze, Improve and Control approach is used to analyze and to improve the primer packaging process, which have high variability and defects output. After the improvement, the results showed that there was an increasing sigma level. However, it is not significantly and has not achieved the world standard quality, yet. Therefore, the implementation of Six Sigma in primer packaging process of Cranberry drink still has a room for doing a further research.

  16. Molecular passportization of clones of karelian birch using PCRwith semi-specific primers

    Directory of Open Access Journals (Sweden)

    Tatyana V Matveeva

    2008-09-01

    Full Text Available Using 4 clones of Karelian birch (Betula pendula Roth var caretica Merckl. from the collection of the karelian birch of the laboratory of genetics of Research Institute of Forest Genetics and Breeding, Voronezh, one normal tree of Betula pendula Roth, and one tree of B. pubescens Ehrh., collected from the nature, we have analyzed the possibility of application of PCR with semi-specific primers for molecular typing. We found primers with high percentage of polymorphic markers. These primers could be recommended for molecular typing of birch.

  17. Do we need primer for orthodontic bonding? A randomized controlled trial.

    Science.gov (United States)

    Nandhra, Sarabjit Singh; Littlewood, Simon J; Houghton, Nadine; Luther, Friedy; Prabhu, Jagadish; Munyombwe, Theresa; Wood, Simon R

    2015-04-01

    To evaluate the clinical performance of APC™II Victory Series™ (3M Unitek) brackets in direct orthodontic bonding with and without the use of primer. A single-operator, two-centre prospective, non-inferiority randomized controlled clinical trial. The Orthodontic departments at the Leeds Dental Institute and St Luke's Hospital, Bradford, UK. Ethical approval was granted by Leeds (East) Research Ethics Committee on 18th of December 2009 (Reference 09/H1306/102). The protocol was not published prior to trial commencement. Ninety-two patients requiring orthodontic treatment with fixed appliances were randomly allocated to the control (bonded with primer) or test groups (bonded without primer). Patients were randomly allocated to either the control or experimental group. This was performed by preparing opaque numbered sealed envelopes in advance using a random numbers table generated by a computer by an independent third party . Once the envelopes were opened, blinding of the operator and the patient was no longer possible due to the nature of the intervention. Patients were approached for inclusion in the trial if they qualified for NHS orthodontic treatment requiring fixed appliances and had no previous orthodontic treatment. Number of bracket failures, time to bond-up appliances, and the adhesive remnant index (ARI) when bracket failure occurred, over a 12-month period Failure rate with primer was 11.1 per cent and without primer was 15.8 per cent. Bonding without primer was shown statistically to be non-inferior to bonding with primer odds ratio 0.95-2.25 (P = 0.08). Mean difference in bond-up time per bracket was 0.068 minutes (4 seconds), which was not statistically significant (P = 0.402). There was a statistically significant difference in the Adhesive Remnant Index - ARI 0 with primer 49.4 per cent, no primer 76.5 per cent, (P failure rate of 2% to be clinically significant. When bonding with APC™II Victory Series™ brackets without primer was shown

  18. A Primer on Electric Utilities, Deregulation, and Restructuring of U.S. Electricity Markets

    Energy Technology Data Exchange (ETDEWEB)

    Warwick, William M.

    2002-06-03

    This primer is offered as an introduction to utility restructuring to better prepare readers for ongoing changes in public utilities and associated energy markets. It is written for use by individuals with responsibility for the management of facilities that use energy, including energy managers, procurement staff, and managers with responsibility for facility operations and budgets. The primer was prepared by the Pacific Northwest National Laboratory under sponsorship from the U.S. Department of Energy?s Federal Energy Management Program. The impetus for this primer originally came from the Government Services Administration who supported its initial development.

  19. Contributions of mobile technologies to addiction research.

    Science.gov (United States)

    Swendsen, Joel

    2016-06-01

    Mobile technologies are revolutionizing the field of mental health, and particular progress has been made in their application to addiction research and treatment. The use of smartphones and other mobile devices has been shown to be feasible with individuals addicted to any of a wide range of substances, with few biases being observed concerning the repeated monitoring of daily life experiences, craving, or substance use. From a methodological point of view, the use of mobile technologies overcomes longstanding limitations of traditional clinical research protocols, including the more accurate assessment of temporal relationships among variables, as well as the reduction in both contextual constraints and discipline-specific methodological isolation. The present article presents a conceptual review of these advances while using illustrations of research applications that are capable of overcoming specific methodological barriers. Finally, a brief review of both the benefits and risks of mobile technology use for the treatment of patients will be addressed.

  20. Clean mobility; future strategy

    International Nuclear Information System (INIS)

    Unidad de Planeacion Minero Energetica, UPME

    2000-01-01

    As much the energy as the transport have been fundamental pillars of the humanity's development. Their importance is evidenced when observing the map of Colombia: our more old, bigger or more important cities are located along the axis demarcated by the natural access roads of our geography: the rivers Magdalena and Cauca. Regions of big natural wealth, as the oriental plains, are punctually developed and you only consent to the progress when roads that connect them with the rest of the country appear. The transport allows the connection among the sources of resources, the production complexes and the consumption centers. It is clear that it has deep relationship with the employment, the health, the education and other activities that impact in the quality of life of the towns and it also constitutes the essential nucleus of industrial and commercial processes to whose surroundings rotate the economic development of regions or countries. Without physical access to resources and markets is stagnation of the development and the mitigation of the poverty is untenable in the time. During the second half of the century nineteen, with the population's growth and of the trade activities, derived of the industrial revolution, the sector transports it was developed in two big fronts of a part, it gave answer to the necessities of mobility in the nascent cities and of another it connected the productive centers with the consumption centers in the whole orb. In that time, the commercialization of products to scale World cup demanded that they became more and more long journeys, in a quicker way and with more load. The appearance of the machine of vapor constituted an important answer for the challenge faced by the means of that time transport, because it substituted sources of low energy density as and wind in the marine sailing and the animal traction for the mobility of people and of terrestrial load. At the beginning of the present century, the motors of internal

  1. Informal learning with mobile devices

    DEFF Research Database (Denmark)

    Berth, Mette

    an analysis of my data I will centre my discussion around the value of this informal approach for learning purposes and discuss what kind of reflective competencies come into play here (Nesta Futurelab 2004a, 2004b). The theoretical framework for this article also draws on social learning theory (Lave......The paper describes the progression of a learning experiment with high school students producing moblogs (mobile weblogs) outside of the school environment and focuses especially on the reflective aspects of the moblogs as an expression of the reflective practicum (Schön 1987, DESECO 2003). Through...

  2. Primer-dependent and primer-independent initiation of double stranded RNA synthesis by purified arabidopsis RNA-dependent RNA polymerases RDR2 and RDR6

    DEFF Research Database (Denmark)

    Devert, Anthony; Fabre, Nicolas; Floris, Maina Huguette Joséphine

    2015-01-01

    ) targeted by RNA silencing. The dsRNA is subsequently cleaved by the ribonuclease DICER-like into secondary small interfering RNAs (siRNAs) that reinforce and/or maintain the silenced state of the target RNA. Models of RNA silencing propose that RDRs could use primer-independent and primer......Cellular RNA-dependent RNA polymerases (RDRs) are fundamental components of RNA silencing in plants and many other eukaryotes. In Arabidopsis thaliana genetic studies have demonstrated that RDR2 and RDR6 are involved in the synthesis of double stranded RNA (dsRNA) from single stranded RNA (ssRNA......-dependent initiation to generate dsRNA from a transcript targeted by primary siRNA or microRNA (miRNA). However, the biochemical activities of RDR proteins are still partly understood. Here, we obtained active recombinant RDR2 and RDR6 in a purified form. We demonstrate that RDR2 and RDR6 have primer...

  3. Programa de acompañamiento para estudiantes de primer ingreso : Marco de referencia y propuesta de trabajo para primer semestre de 2002

    OpenAIRE

    Chinchilla-Brenes, Sonia; Sánchez-Oller, Sylvia

    2001-01-01

    Proyecto de Investigación El problema de la deserción estudiantil es un fenómeno mundial que involucra principalmente a alumnos de primer ingreso a los centros educativos y de manera particular a las instituciones de educación superior las cuales reportan índices de deserción de alrededor del 30% en el primer año. Ante esta situación se hace necesaria la atención de la población de primer ingreso con programas específicos que acompañen a los y las estudiantes en este proceso de ajuste al m...

  4. A Sharing Mind Map-Oriented Approach to Enhance Collaborative Mobile Learning with Digital Archiving Systems

    Science.gov (United States)

    Chang, Jui-Hung; Chiu, Po-Sheng; Huang, Yueh-Min

    2018-01-01

    With the advances in mobile network technology, the use of portable devices and mobile networks for learning is not limited by time and space. Such use, in combination with appropriate learning strategies, can achieve a better effect. Despite the effectiveness of mobile learning, students' learning direction, progress, and achievement may differ.…

  5. Mobile Transcripts and Intercellular Communication in Plants.

    Science.gov (United States)

    Saplaoura, E; Kragler, F

    2016-01-01

    Phloem serves as a highway for mobile signals in plants. Apart from sugars and hormones, proteins and RNAs are transported via the phloem and contribute to the intercellular communication coordinating growth and development. Different classes of RNAs have been found mobile and in the phloem exudate such as viral RNAs, small interfering RNAs (siRNAs), microRNAs, transfer RNAs, and messenger RNAs (mRNAs). Their transport is considered to be mediated via ribonucleoprotein complexes formed between phloem RNA-binding proteins and mobile RNA molecules. Recent advances in the analysis of the mobile transcriptome indicate that thousands of transcripts move along the plant axis. Although potential RNA mobility motifs were identified, research is still in progress on the factors triggering siRNA and mRNA mobility. In this review, we discuss the approaches used to identify putative mobile mRNAs, the transport mechanism, and the significance of mRNA trafficking. © 2016 Elsevier Inc. All rights reserved.

  6. Head First Mobile Web

    CERN Document Server

    Gardner, Lyza; Grigsby, Jason

    2011-01-01

    Despite the huge number of mobile devices and apps in use today, your business still needs a website. You just need it to be mobile. Head First Mobile Web walks you through the process of making a conventional website work on a variety smartphones and tablets. Put your JavaScript, CSS media query, and HTML5 skills to work-then optimize your site to perform its best in the demanding mobile market. Along the way, you'll discover how to adapt your business strategy to target specific devices. Navigate the increasingly complex mobile landscapeTake both technical and strategic approaches to mobile

  7. Mobile Portal Implementation Strategy

    DEFF Research Database (Denmark)

    Gao, Ping; Damsgaard, Jan

    2005-01-01

    Mobile portal plays an important role in mobile commerce market. Current literature focuses on static analysis on the value chain of mobile portals. This article provides a dynamic perspective on mobile portal strategy. Drawing upon network economics, we describe mobile portal implementation...... as a fourphase process. In different phase, a portal provider has various challenges to overcome and adopt diverse strategies, and correspondingly the regulator has different foci. The conceptual framework proposed in this article offers a basis for further analyses on the market dynamics of mobile commerce......, and can be generalized to studying other networked technologies...

  8. Binary electrokinetic separation of target DNA from background DNA primers.

    Energy Technology Data Exchange (ETDEWEB)

    James, Conrad D.; Derzon, Mark Steven

    2005-10-01

    This report contains the summary of LDRD project 91312, titled ''Binary Electrokinetic Separation of Target DNA from Background DNA Primers''. This work is the first product of a collaboration with Columbia University and the Northeast BioDefense Center of Excellence. In conjunction with Ian Lipkin's lab, we are developing a technique to reduce false positive events, due to the detection of unhybridized reporter molecules, in a sensitive and multiplexed detection scheme for nucleic acids developed by the Lipkin lab. This is the most significant problem in the operation of their capability. As they are developing the tools for rapidly detecting the entire panel of hemorrhagic fevers this technology will immediately serve an important national need. The goal of this work was to attempt to separate nucleic acid from a preprocessed sample. We demonstrated the preconcentration of kilobase-pair length double-stranded DNA targets, and observed little preconcentration of 60 base-pair length single-stranded DNA probes. These objectives were accomplished in microdevice formats that are compatible with larger detection systems for sample pre-processing. Combined with Columbia's expertise, this technology would enable a unique, fast, and potentially compact method for detecting/identifying genetically-modified organisms and multiplexed rapid nucleic acid identification. Another competing approach is the DARPA funded IRIS Pharmaceutical TIGER platform which requires many hours for operation, and an 800k$ piece of equipment that fills a room. The Columbia/SNL system could provide a result in 30 minutes, at the cost of a few thousand dollars for the platform, and would be the size of a shoebox or smaller.

  9. A primer for trading greenhouse gas reductions from landfills

    International Nuclear Information System (INIS)

    2000-06-01

    This introductory level primer on domestic greenhouse gas emissions trading addresses the challenge of dealing with landfill gas emissions of carbon dioxide (CO 2 ) and methane (CH 4 ). It describes the first major emissions trading projects in Canada, the Pilot Emission Reduction Trading (PERT) and the Greenhouse Gas Emission Reduction Trading (GERT) pilot projects which calculate and document the GHG emission reductions that are available from landfill sites. PERT initially focused on nitrogen oxides, volatile organic compounds, carbon monoxide, sulphur dioxide and carbon dioxide. PERT uses the Clean Air Emission Reduction Registry for its emissions trading. Canada completed negotiations of the Kyoto Protocol in December 1997 along with 160 other countries. Upon ratification, Canada will commit to reducing 6 greenhouse gases by 6 per cent below 1990 levels in the period 2008 to 2012. Canada has recognized that it must reduce domestic greenhouse gas emissions to slow global warming which leads to climate change. It has been shown that the capture and destruction of landfill gas can profoundly contribute to meeting the target. One tool that can be used to help meet the objective of reducing GHG emissions is domestic GHG emission trading, or carbon trading, as a result of landfill gas capture and flaring. Landfill gas is generally composed of equal parts of carbon dioxide and methane with some other trace emissions. Accounting for quantities of greenhouse gas emissions is done in equivalent tonnes of carbon dioxide where one tonne of methane reduction is equivalent to 21 tonnes of carbon dioxide in terms of global warming potential. Organics in landfills which lead to the generation of methane are considered to be coming from renewable biomass, therefore, the collection and combustion of landfill gas is also considered to reduce GHG emissions from landfills by 100 per cent on a global basis. Destroying landfill gases can also reduce volatile organic compounds, which

  10. Pharmacological chaperoning: a primer on mechanism and pharmacology.

    Science.gov (United States)

    Leidenheimer, Nancy J; Ryder, Katelyn G

    2014-05-01

    Approximately forty percent of diseases are attributable to protein misfolding, including those for which genetic mutation produces misfolding mutants. Intriguingly, many of these mutants are not terminally misfolded since native-like folding, and subsequent trafficking to functional locations, can be induced by target-specific, small molecules variably termed pharmacological chaperones, pharmacoperones, or pharmacochaperones (PCs). PC targets include enzymes, receptors, transporters, and ion channels, revealing the breadth of proteins that can be engaged by ligand-assisted folding. The purpose of this review is to provide an integrated primer of the diverse mechanisms and pharmacology of PCs. In this regard, we examine the structural mechanisms that underlie PC rescue of misfolding mutants, including the ability of PCs to act as surrogates for defective intramolecular interactions and, at the intermolecular level, overcome oligomerization deficiencies and dominant negative effects, as well as influence the subunit stoichiometry of heteropentameric receptors. Not surprisingly, PC-mediated structural correction of misfolding mutants normalizes interactions with molecular chaperones that participate in protein quality control and forward-trafficking. A variety of small molecules have proven to be efficacious PCs and the advantages and disadvantages of employing orthostatic antagonists, active-site inhibitors, orthostatic agonists, and allosteric modulator PCs are considered. Also examined is the possibility that several therapeutic agents may have unrecognized activity as PCs, and this chaperoning activity may mediate/contribute to therapeutic action and/or account for adverse effects. Lastly, we explore evidence that pharmacological chaperoning exploits intrinsic ligand-assisted folding mechanisms. Given the widespread applicability of PC rescue of mutants associated with protein folding disorders, both in vitro and in vivo, the therapeutic potential of PCs is vast

  11. El menor infractor que comete su primer delito

    Directory of Open Access Journals (Sweden)

    Antonia Luzón García

    2014-10-01

    Full Text Available Existe un consenso social y la sociedad se posiciona al lado del menor maltratado, la cosa cambia cuando el menor es infractor, entonces es declarado culpable y merecedor de castigo. El menor aun siendo infractor es un ser humano con pleno derechos establecidos en la Declaración de Derechos del Niño y en los textos internacionales sobre Derechos Humanos. Mediante la socialización se estrechan los vínculos entre el individuo y el sistema social en el que vive. Por ello, la socialización y sus implicaciones son de nuestro interés para este estudio y conocer qué lleva a un menor a cometer su primer delito. Una correcta socialización, de asunción de normas y valores sociales, pautas, creencias, ritos, etc., posibilita la adaptación y previene de la exclusión social. La combinación de la influencia que ha ejercido los agentes de socialización en el menor y los factores de riesgo como el clima familiar, la adaptación escolar, los rasgos de personalidad y el grupo de iguales nos va a permitir pronosticar la probabilidad de que el menor lleve a cabo comportamientos infractores. En este estudio se intentará demostrar que la mayoría de menores que realizan infracciones penales carecen de un adecuado proceso de socialización con desestructuración familiar, inadaptación escolar y la influencia negativa del grupo de iguales que faciliten una socialización positiva y sana. Este proceso de socialización es importante si queremos comprender el comportamiento humano, entendido como la interiorización de normas y valores que han ido estructurando la personalidad del niño, su manera de pensar, de actuar, en resumidas cuentas su desarrollo mental y social

  12. Rasch Analysis: A Primer for School Psychology Researchers and Practitioners

    Science.gov (United States)

    Boone, William J.; Noltemeyer, Amity

    2017-01-01

    In order to progress as a field, school psychology research must be informed by effective measurement techniques. One approach to address the need for careful measurement is Rasch analysis. This technique can (a) facilitate the development of instruments that provide useful data, (b) provide data that can be used confidently for both descriptive…

  13. Making the connection: advancing traffic incident management in transportation planning : a primer.

    Science.gov (United States)

    2013-07-01

    "The intent of this primer is to inform and guide traffic incident management (TIM) professionals and transportation planners to initiate and develop collaborative relationships and advance TIM programs through the metropolitan planning process. The ...

  14. Primer retention owing to the absence of RNase H1 is catastrophic for mitochondrial DNA replication.

    Science.gov (United States)

    Holmes, J Bradley; Akman, Gokhan; Wood, Stuart R; Sakhuja, Kiran; Cerritelli, Susana M; Moss, Chloe; Bowmaker, Mark R; Jacobs, Howard T; Crouch, Robert J; Holt, Ian J

    2015-07-28

    Encoding ribonuclease H1 (RNase H1) degrades RNA hybridized to DNA, and its function is essential for mitochondrial DNA maintenance in the developing mouse. Here we define the role of RNase H1 in mitochondrial DNA replication. Analysis of replicating mitochondrial DNA in embryonic fibroblasts lacking RNase H1 reveals retention of three primers in the major noncoding region (NCR) and one at the prominent lagging-strand initiation site termed Ori-L. Primer retention does not lead immediately to depletion, as the persistent RNA is fully incorporated in mitochondrial DNA. However, the retained primers present an obstacle to the mitochondrial DNA polymerase γ in subsequent rounds of replication and lead to the catastrophic generation of a double-strand break at the origin when the resulting gapped molecules are copied. Hence, the essential role of RNase H1 in mitochondrial DNA replication is the removal of primers at the origin of replication.

  15. Microsatellite primers in the white proteas (Protea section Exsertae, Proteaceae), a rapidly radiating lineage.

    Science.gov (United States)

    Prunier, Rachel; Latimer, Andrew

    2010-01-01

    Microsatellite primers were developed in the South African sclerophyllous shrub Protea punctata to investigate the degree of population differentiation within and between P. punctata and closely related species. • 10 primer pairs were identified from three individuals of Protea punctata. The primers amplified di- and tri-nucleotide repeats. Across all P. punctata samples, the loci have 8-49 alleles. All primers also amplified in Protea section Exsertae (P. aurea, P. aurea subsp. potbergensis, P. mundii, P. venusta, P. lacticolor, and P. subvestita). The loci had 14-69 alleles across the subgenus. • These results show the broad utility of microsatellite loci for future studies of population genetics in the white proteas and their potential utility across the entire genus.

  16. Transportation Management Area Planning Certification Review Primer: Revised January 18, 2018

    Science.gov (United States)

    2018-01-18

    This primer outlines key concepts and expectations of a Transportation Management Area (TMA) Planning Certification Review. Reflecting on the collective experiences of past Certification Reviews, this includes references to relevant laws and regulati...

  17. Routes to effective evacuation planning primer series : evacuating populations with special needs.

    Science.gov (United States)

    2009-04-01

    Evacuation operations are conducted under the authority of, and based on decisions by, local and state authorities. The purpose of this primer, Evacuating Populations with Special Needs, is to provide local and state emergency managers, government of...

  18. Building a Foundation for Effective Technology Transfer through Integration with the Research Process : a Primer.

    Science.gov (United States)

    2016-03-01

    This primer aims to increase the effectiveness of T2 activity in transportation by describing how T2 practices can be successfully integrated into : the research process to capture the potential real-world benefits of our communitys research inves...

  19. Microsatellite Primers in the Foundation Tree Species Pinus edulis and P. monophylla (Pinaceae

    Directory of Open Access Journals (Sweden)

    Andrew L. Krohn

    2013-07-01

    Full Text Available Premise of the study: Microsatellite primers were developed in the foundational tree species Pinus edulis to investigate population differentiation of P. edulis and hybridization among closely related species. Methods and Results: Using a hybridization protocol, primer sets for 11 microsatellite loci were developed using megagametophyte tissue from P. edulis and scored for polymorphism in three populations of P. edulis and a single P. monophylla population. The primers amplified simple and compound di-, tri-, and pentanucleotide repeats with two to 18 alleles per locus. Conclusions: These results demonstrate the utility of the described primers for studies of population differentiation within and among P. edulis populations as well as across putative hybrid zones where P. edulis may coexist with sister species.

  20. Ares, Janus, Globalization: A Primer For The Military Leader in NATO

    National Research Council Canada - National Science Library

    Clemons, Dean

    2002-01-01

    ...: international military and commercial investment; dual-use technologies; and export control. As a primer on these stakes for the rising military leader within the North Atlantic Treaty, the study elucidates the issue of cooperation vs...

  1. Incorporating travel-time reliability into the congestion management process : a primer.

    Science.gov (United States)

    2015-02-01

    This primer explains the value of incorporating travel-time reliability into the Congestion Management Process (CMP) : and identifies the most current tools available to assist with this effort. It draws from applied research and best practices : fro...

  2. The UVM primer a step-by-step introduction to the universal verification methodology

    CERN Document Server

    Salemi, Ray

    2013-01-01

    The UVM Primer uses simple, runnable code examples, accessible analogies, and an easy-to-read style to introduce you to the foundation of the Universal Verification Methodology. You will learn the basics of object-oriented programming with SystemVerilog and build upon that foundation to learn how to design testbenches using the UVM. Use the UVM Primer to brush up on your UVM knowledge before a job interview to be able to confidently answer questions such as "What is a uvm_agent?" , "How do you use uvm_sequences?", and "When do you use the UVM's factory." The UVM Primer's downloadable code examples give you hands-on experience with real UVM code. Ray Salemi uses online videos (on www.uvmprimer.com) to walk through the code from each chapter and build your confidence. Read The UVM Primer today and start down the path to the UVM.

  3. Comparison among amoA Primers Suited for Quantification and Diversity Analyses of Ammonia-Oxidizing Bacteria in Soil

    Science.gov (United States)

    Shimomura, Yumi; Morimoto, Sho; Hoshino, Yuko Takada; Uchida, Yoshitaka; Akiyama, Hiroko; Hayatsu, Masahito

    2012-01-01

    Ammonia monooxygenase subunit A gene (amoA) is frequently used as a functional gene marker for diversity analysis of ammonia-oxidizing bacteria (AOB). To select a suitable amoA primer for real-time PCR and PCR-denaturing gradient gel electrophoresis (DGGE), three reverse primers (degenerate primer amoA-2R; non-degenerate primers amoA-2R-GG and amoA-2IR) were examined. No significant differences were observed among the three primers in terms of quantitative values of amoA from environmental samples using real-time PCR. We found that PCR-DGGE analysis with the amoA-2IR primer gave the best results in this studied soil. These results indicate that amoA-2IR is a suitable primer for community analysis of AOB in the environment. PMID:22075625

  4. STRATEGIC IMPACT OF MOBILITY ON ORGANIZATIONS

    Directory of Open Access Journals (Sweden)

    Anna Golovkova

    2014-01-01

    Full Text Available Purpose. The current rapid social and economic developments show mobility as the most important factor of economic growth, social and cultural progress. Mobile technology has undergone a sea change over the past ten years. The evolution of mobility is about creating better ways to change the world. It will increasingly shape our lives and thinking in ways we cannot fully anticipate. Mobile revolution is a global reality which creates new opportunities and challenges for all companies in the world. Methodology. Proposed methodological approach is based on a comprehensive assessment of the strategic impact of mobility on the organization as a major tool to improve competitiveness and efficiency of the company. During the research have been used both qualitative and quantitative methods. As a result, the article provides bridges between the field of mobility, organization science, information systems, and certain aspects of philosophy. Findings. This research provides a glimpse into the fast-evolving world of mobile technology and maybe even faster evolving world of organizations. The research is designed to understand the strategic impact of mobility on organizations, and evaluate the benefits of integration of these new technologies into the company. The research comprised of an extensive literature review, observation of existing practices, and semi-structured interviews geared toward understanding the strategic impact of mobility on organization and its employees. Originality. The research findings suggest three main strategic implications of mobility: (1 improve working process; (2 increase internal communication and knowledge sharing; and (3 enhance sales and marketing effectiveness. Practical value. The use of mobile technology and it impact on organizational change and strategy, stability and development of competitive advantage allow the company to ensure the effectiveness of its business. Mobility can dramatically transform the company by

  5. Qualification and Flight Test of Non-Chrome Primers for C-130 Aircraft

    Science.gov (United States)

    2011-08-17

    system  Significant hexavalent chrome reduction in finish system  Potential exposure level of spray applied chromated conversion coating not as...Lockheed Martin Aeronautics Company Qualification and Flight Test of Non- Chrome Primers for C-130 Aircraft Scott Jones Lockheed Martin...00-2011 to 00-00-2011 4. TITLE AND SUBTITLE Qualification and Flight Test of Non- Chrome Primers for C-130 Aircraft 5a. CONTRACT NUMBER 5b. GRANT

  6. Comparison of shear bond strength of orthodontic brackets using various zirconia primers.

    Science.gov (United States)

    Lee, Ji-Yeon; Kim, Jin-Seok; Hwang, Chung-Ju

    2015-07-01

    The aim of this study was to compare the shear bond strength (SBS) of orthodontic brackets bonded to zirconia surfaces using three different zirconia primers and one silane primer, and subjected to thermocycling. We designed 10 experimental groups following the surface treatment and thermocycling. The surface was treated with one of the following method: no-primer (NP), Porcelain Conditioner (PC), Z-PRIME Plus (ZP), Monobond Plus (MP) and Zirconia Liner Premium (ZL) (n=20). Then each group was subdivided to non-thermocycled and thermocycled groups (NPT, PC, ZPT, MPT, ZLT) (n=10). Orthodontic brackets were bonded to the specimens using Transbond™ XT Paste and light cured for 15 s at 1,100 mW/cm(2). The SBS was measured at a 1 mm/min crosshead speed. The failure mode was assessed by examination with a stereomicroscope and the amount of bonding resin remaining on the zirconia surface was scored using the modified adhesive remnant index (ARI). The SBS of all experimental groups decreased after thermocycling. Before thermocycling, the SBS was ZL, ZP ≥ MP ≥ PC > NP but after thermocycling, the SBS was ZLT ≥ MPT ≥ ZPT > PCT = NPT (p > 0.05). For the ARI score, both of the groups lacking primer (NP and NPT) displayed adhesive failure modes, but the groups with zirconia primers (ZP, ZPT, MP, MPT, ZL, and ZLT) were associated with mixed failure modes. Surface treatment with a zirconia primer increases the SBS relative to no-primer or silane primer application between orthodontic brackets and zirconia prostheses.

  7. Development and evaluation of new primers for PCR-based identification of Prevotella intermedia.

    Science.gov (United States)

    Zhou, Yanbin; Liu, Dali; Wang, Yiwei; Zhu, Cailian; Liang, Jingping; Shu, Rong

    2014-08-01

    The aim of this study was to develop new Prevotella intermedia-specific PCR primers based on the 16S rRNA. The new primer set, Pi-192 and Pi-468, increased the accuracy of PCR-based P. intermedia identification and could be useful in the detection of P. intermedia as well as epidemiological studies on periodontal disease. Copyright © 2014 Elsevier Ltd. All rights reserved.

  8. Mobile communications – on standards, classifications and generations

    DEFF Research Database (Denmark)

    Tadayoni, Reza; Henten, Anders; Sørensen, Jannick Kirk

    2018-01-01

    The research question addressed in this paper is concerned with the manners in which the general technological progress in mobile communications is characterized and the reasons for the differences in these modes of manifestation. The relevance of this research question is that the different......, the paper discusses the role of the International Telecommunication Union (ITU) in the processes of mobile standardization. In common parlance, progress in mobile technologies is mostly referred to as generations. In ITU, the classification terminology is that of International Mobile Telecommunication (IMT......) standards. In the specialized standards body with a central position in the standardization of core mobile technologies, namely 3GPP (3rd Generation Partnership Project), the terminology of ‘releases’ is used. In order to address the research question, the paper uses an analytical framework based...

  9. Security of Mobile Devices and Wi-Fi Networks

    OpenAIRE

    Hong, Zimeng

    2015-01-01

    Along with the progress of times and the development of science and technology, mobile devices have become more and more popular. At the same time, an increasing number of Wi-Fi networks are being built for the demand of mobile devices. Therefore, the security between mobile devices and Wi-Fi networks became a main object in the IT area. The purpose of the thesis is to analyze security threats and give relative advises for all the mobile device and Wi-Fi network users. The thesis mainly ta...

  10. Adhesion and thermal stability enhancement of IZO films by adding a primer layer on polycarbonate substrate

    Energy Technology Data Exchange (ETDEWEB)

    Zhang, Xuan; Zhang, Xiaofeng; Yan, Yue; Zhong, Yanli; Li, Lei; Zhang, Guanli [Beijing Institute of Aeronautical Materials (BIAM), Haidian District, Beijing, 100095 (China)

    2015-04-01

    A silicone-based primer layer was developed to improve the adhesion and thermal stability of amorphous transparent indium zinc oxide (IZO) films on polycarbonate (PC). The IZO films deposited by direct current magnetron sputtering at room temperature on primer-treated and untreated PCs were evaluated ex situ in terms of surface morphology, adhesion, optical, and electrical properties during annealing at 120 C in air. Nano-scratch tests indicated the adhesion of IZO films on primer-treated substrates was superior to that on untreated PCs. This superior adhesion can be attributed to the strong Si-O-Si inorganic bonds abundant in the primer layer and better matches of the primer layer in the terms of thermal expansion to the IZO. Moreover, the electrical resistivity of IZO films prepared on primer-treated PCs remained stable during the annealing treatment, whereas those of IZO films on untreated PCs presented a continuously increasing trend, which was attributed to the decrease in carrier concentration that resulted from oxygen adsorption. (copyright 2015 WILEY-VCH Verlag GmbH and Co. KGaA, Weinheim)

  11. PRIMEGENSw3: a web-based tool for high-throughput primer and probe design.

    Science.gov (United States)

    Kushwaha, Garima; Srivastava, Gyan Prakash; Xu, Dong

    2015-01-01

    Highly specific and efficient primer and probe design has been a major hurdle in many high-throughput techniques. Successful implementation of any PCR or probe hybridization technique depends on the quality of primers and probes used in terms of their specificity and cross-hybridization. Here we describe PRIMEGENSw3, a set of web-based utilities for high-throughput primer and probe design. These utilities allow users to select genomic regions and to design primer/probe for selected regions in an interactive, user-friendly, and automatic fashion. The system runs the PRIMEGENS algorithm in the back-end on the high-performance server with the stored genomic database or user-provided custom database for cross-hybridization check. Cross-hybridization is checked not only using BLAST but also by checking mismatch positions and energy calculation of potential hybridization hits. The results can be visualized online and also can be downloaded. The average success rate of primer design using PRIMEGENSw3 is ~90 %. The web server also supports primer design for methylated sequences, which is used in epigenetic studies. Stand-alone version of the software is also available for download at the website.

  12. UniPrime2: a web service providing easier Universal Primer design.

    Science.gov (United States)

    Boutros, Robin; Stokes, Nicola; Bekaert, Michaël; Teeling, Emma C

    2009-07-01

    The UniPrime2 web server is a publicly available online resource which automatically designs large sets of universal primers when given a gene reference ID or Fasta sequence input by a user. UniPrime2 works by automatically retrieving and aligning homologous sequences from GenBank, identifying regions of conservation within the alignment, and generating suitable primers that can be used to amplify variable genomic regions. In essence, UniPrime2 is a suite of publicly available software packages (Blastn, T-Coffee, GramAlign, Primer3), which reduces the laborious process of primer design, by integrating these programs into a single software pipeline. Hence, UniPrime2 differs from previous primer design web services in that all steps are automated, linked, saved and phylogenetically delimited, only requiring a single user-defined gene reference ID or input sequence. We provide an overview of the web service and wet-laboratory validation of the primers generated. The system is freely accessible at: http://uniprime.batlab.eu. UniPrime2 is licenced under a Creative Commons Attribution Noncommercial-Share Alike 3.0 Licence.

  13. Evaluation of highly conserved hsp65-specific nested PCR primers for diagnosing Mycobacterium tuberculosis.

    Science.gov (United States)

    Priyadarshini, P; Tiwari, K; Das, A; Kumar, D; Mishra, M N; Desikan, P; Nath, G

    2017-02-01

    To evaluate the sensitivity and specificity of a new nested set of primers designed for the detection of Mycobacterium tuberculosis complex targeting a highly conserved heat shock protein gene (hsp65). The nested primers were designed using multiple sequence alignment assuming the nucleotide sequence of the M. tuberculosis H37Rv hsp65 genome as base. Multidrug-resistant Mycobacterium species along with other non-mycobacterial and fungal species were included to evaluate the specificity of M. tuberculosis hsp65 gene-specific primers. The sensitivity of the primers was determined using serial 10-fold dilutions, and was 100% as shown by the bands in the case of M. tuberculosis complex. None of the other non M. tuberculosis complex bacterial and fungal species yielded any band on nested polymerase chain reaction (PCR). The first round of amplification could amplify 0.3 ng of the template DNA, while nested PCR could detect 0.3 pg. The present hsp65-specific primers have been observed to be sensitive, specific and cost-effective, without requiring interpretation of biochemical tests, real-time PCR, sequencing or high-performance liquid chromatography. These primer sets do not have the drawbacks associated with those protocols that target insertion sequence 6110, 16S rDNA, rpoB, recA and MPT 64.

  14. Ion mobility sensor system

    Science.gov (United States)

    Xu, Jun; Watson, David B.; Whitten, William B.

    2013-01-22

    An ion mobility sensor system including an ion mobility spectrometer and a differential mobility spectrometer coupled to the ion mobility spectrometer. The ion mobility spectrometer has a first chamber having first end and a second end extending along a first direction, and a first electrode system that generates a constant electric field parallel to the first direction. The differential mobility spectrometer includes a second chamber having a third end and a fourth end configured such that a fluid may flow in a second direction from the third end to the fourth end, and a second electrode system that generates an asymmetric electric field within an interior of the second chamber. Additionally, the ion mobility spectrometer and the differential mobility spectrometer form an interface region. Also, the first end and the third end are positioned facing one another so that the constant electric field enters the third end and overlaps the fluid flowing in the second direction.

  15. Seasonality, mobility, and livability.

    Science.gov (United States)

    2012-01-31

    Signature project 4a, Seasonality, Mobility, and Livability investigated the effects of weather, season, built environment, community amenities, attitudes, and demographics on mobility and quality of life (QOL). A four season panel survey exami...

  16. Mobile IP: Security & application

    NARCIS (Netherlands)

    Tuquerres, G.; Salvador, M.R.; Sprenkels, Ron

    1999-01-01

    As required in the TGS Mobile IP Advanced Module, this paper presents a survey of common security threats which mobile IP networks are exposed to as well as some proposed solutions to deal with such threats.

  17. Mobile Phones on Campus

    Institute of Scientific and Technical Information of China (English)

    朴春宝

    2007-01-01

    After entering the 21st century, more and more people have mobile phones in China. At the end of 2002, there were 20 million mobile phone users. By the year 2005 the number has reached up to 30 million.

  18. Mobile Internet Protocol Analysis

    National Research Council Canada - National Science Library

    Brachfeld, Lawrence

    1999-01-01

    ...) and User Datagram Protocol (UDP). Mobile IP allows mobile computers to send and receive packets addressed with their home network IP address, regardless of the IP address of their current point of attachment on the Internet...

  19. Mobile Informal Learning

    NARCIS (Netherlands)

    Glahn, Christian; Börner, Dirk

    2010-01-01

    Glahn, C., & Börner, D. (2009). Mobile Informal Learning. Presented at Mobile Learning in Context Symposium at the Open University of the Netherlands. September, 11, 2009, Heerlen, The Netherlands: Open University of the Netherlands.

  20. Fixed mobile convergence handbook

    CERN Document Server

    Ahson, Syed A

    2010-01-01

    From basic concepts to future directions, this handbook provides technical information on all aspects of fixed-mobile convergence (FMC). The book examines such topics as integrated management architecture, business trends and strategic implications for service providers, personal area networks, mobile controlled handover methods, SIP-based session mobility, and supervisory and notification aggregator service. Case studies are used to illustrate technical and systematic implementation of unified and rationalized internet access by fixed-mobile network convergence. The text examines the technolo

  1. Ion mobility spectrometry

    CERN Document Server

    Eiceman, GA

    2005-01-01

    Key Developments for Faster, More Precise Detection Capabilities Driven by the demand for the rapid and advanced detection of explosives, chemical and biological warfare agents, and narcotics, ion mobility spectrometry (IMS) undergone significant refinements in technology, computational capabilities, and understanding of the principles of gas phase ion chemistry and mobility. Beginning with a thorough discussion of the fundamental theories and physics of ion mobility, Ion Mobility Spectrometry, Second Edition describes the recent advances in instrumentation and newly

  2. Mobile Marketing in Japan

    OpenAIRE

    Noah H. N. Lynn; Paul D. Berger

    2014-01-01

    In this paper we describe the state of mobile marketing in Japan. We consider the various aspects of mobile marketing in Japan and what has led to the overwhelming adoption by Japanese youth, and to a degree Japanese society as a whole, of social media and associated activities. This growth of mobile marketing has dramatic, positive implications for marketing, in general, as well as for the sale of selected product classes. We also consider markers for suggesting what the future of mobile mar...

  3. Mobile energy sharing futures

    DEFF Research Database (Denmark)

    Worgan, Paul; Knibbe, Jarrod; Plasencia, Diego Martinez

    2016-01-01

    We foresee a future where energy in our mobile devices can be shared and redistributed to suit our current task needs. Many of us are beginning to carry multiple mobile devices and we seek to re-evaluate the traditional view of a mobile device as only accepting energy. In our vision, we can...... sharing futures....

  4. CONCEPT OF MOBILE LEARNING

    Directory of Open Access Journals (Sweden)

    Г О Дуйсеева

    2016-12-01

    Full Text Available This article deals with the definition and the description of mobile learning. Ten years’ experience of the latest mobile technologies use and devices in educational process abroad is analyzed. Prospects and the possibilities of application of these technologies are considered. The basic concepts and development of mobile learning which proposed by scientists for the last years have been given.

  5. Marketing mobile imaging services.

    Science.gov (United States)

    McCue, P

    1987-09-01

    Competition in the mobile imaging arena has put radiologists, radiology directors, and other health care professionals in the unfamiliar position of being marketing agents for their services. Mobile imaging is being promoted through consumer advertising as well as through the traditional route of physician referral. This article offers some of the marketing lessons being learned in the mobile arena.

  6. Mobile Student Information System

    Science.gov (United States)

    Asif, Muhammad; Krogstie, John

    2011-01-01

    Purpose: A mobile student information system (MSIS) based on mobile computing and context-aware application concepts can provide more user-centric information services to students. The purpose of this paper is to describe a system for providing relevant information to students on a mobile platform. Design/methodology/approach: The research…

  7. Mobile applications and Virtual Observatory

    Science.gov (United States)

    Schaaff, A.; Jagade, S.

    2015-06-01

    Within a few years, smartphones and Internet tablets have become the devices to access Web or standalone applications from everywhere, with a rapid development of the bandwidth of the mobile networks (e.g. 4G). Internet tablets are used to take notes during meetings or conferences, to read scientific papers in public transportation, etc. A smartphone is for example a way to have your data in the pocket or to control, from everywhere, the progress of a heavy workflow process. These mobile devices have enough powerful hardware to run more and more complex applications for many use cases. In the field of astronomy it is possible to use these tools to access data via a simple browser, but also to develop native applications reusing libraries (written in Java for Android or Objective-C/Swift for iOS) developed for desktops/laptops. We describe the experiments conducted in this domain, at CDS and IUCAA, considering a mobile application as a native application as well as a Web application.

  8. The sorption of iodine by an inorganic zinc primer

    Energy Technology Data Exchange (ETDEWEB)

    Evans, G J; Bekeris, P A [Toronto Univ., ON (Canada). Dept. of Chemical Engineering and Applied Chemistry

    1996-12-01

    The purpose of this work was to identify and evaluate significant parameters in the sorption of I{sub 2}(g) onto Carbo Zinc 11 inorganic primer, a paint used in the containment structure of some CANDU reactors. Air containing known amounts of {sup 131}I{sub 2}(g) was passed through 0.64 cm diameter glass tubing coated on the inner surface with paint. The accumulation of iodine on the surface was continuously monitored using two scintillation detectors. The test parameters covered were relative humidity, flow rate, I{sub 2} concentration and paint temperature. Adsorption was rapid at 23{sup o}C and predominantly gas phase mass transfer limited: the deposition velocity of 0.7{+-}0.4 cm/s was similar to the gas phase mass transfer coefficient of 1.2 cm/s estimated for the system. The deposition velocity observed at a higher paint surface temperature was an order of magnitude smaller. A similar deposition velocity was observed at 23{sup o}C for adsorption of I{sub 2}(g) from essentially dry air suggesting that the low deposition velocity observed for high surface temperature was limited by the amount of water on the paint surface. The rate of adsorption on the paint was directly proportional to the I{sub 2}(g) concentration over the range in concentration studied. The majority of the iodine retained by the paint could not be removed by washing with methanol or chloroform, but it was removed by water indicating that it was in an ionic form. Analysis of the speciation of the iodine in the wash water indicated that only a third of it was in the form of I{sup -}; the form of the remaining iodine could not be resolved. Desorption from the paint was negligible at room temperature but was detectable at higher temperatures. These low desorption rates and the ionic nature of the surface iodine indicated that adsorption occurred predominantly through a chemisorption process. A number of possible mechanisms were proposed. (author) 5 figs., 2 tabs., 6 refs.

  9. Konjungtivitis Viral: Diagnosis dan Terapi di Pelayanan Kesehatan Primer

    Directory of Open Access Journals (Sweden)

    Ratna Sitompul

    2017-04-01

    Full Text Available Konjungtiva adalah membran mukosa tipis transparan yang melapisi bagian anterior bola mata dan bagian dalam palpebral. Konjungtiva berfungsi sebagai salah satu komponen sistem perlindungan mata dari peradangan dan infeksi. Peradangan konjungtiva disebut konjungtivitis dan infeksi virus merupakan etiologi peradangan akut tersering pada konjungtiva. Virus yang menyebabkan konjungtivitis adalah adenovirus, herpes simpleks, herpes zoster, pox virus, myxovirus, paramyxovirus, dan arbovirus. Konjungtivitis sering terjadi bersama atau sesudah infeksi saluran napas dan umumnya terdapat riwayat kontak dengan pasien konjungtivitis viral. Gejala konjungtivitis viral berupa mata merah, sekret mata berair dan dapat disertai pembesaran kelenjar limfe. Gejala konjungtivitis viral biasanya ringan, dapat sembuh sendiri dan tidak disertai penurunan tajam penglihatan sehingga dapat ditatalaksana di pelayanan kesehatan primer. Meskipun demikian, terdapat kasus-kasus yang bersifat mengancam penglihatan sehingga perlu segera dirujuk ke rumah sakit atau dokter spesialis mata. Konjungtivitis viral sangat menular sehingga pasien perlu mendapat edukasi untuk mengurangi kontak langsung dan tidak langsung agar tidak menjadi sumber infeksi bagi lingkungannya. Konjungtivitis viral dapat sembuh sendiri, namun pemberian air mata buatan, antihistamin topikal, atau kompres dingin berguna untuk meredakan gejala. Terapi antiviral tidak diperlukan untuk konjungtivitis virus, kecuali untuk konjungtivitis herpetik. Kata kunci: epidemi, konjungtivitis, virus.     Viral Conjunctivitis: Diagnosis and Therapy in Primary Health Care   Abstract Conjunctivae is a transparent thin mucosal membrane covering the outer anterior eye and inner palpebrae. This structure is vital for eye defense from inflammation and infection. Inflammation occurring on the conjunctivae is called conjunctivitis and virus is one of the most common etiologic agent. Such viruses are adenovirus, herpes simplex virus

  10. Distributed mobility management - framework & analysis

    NARCIS (Netherlands)

    Liebsch, M.; Seite, P.; Karagiannis, Georgios

    2013-01-01

    Mobile operators consider the distribution of mobility anchors to enable offloading some traffic from their core network. The Distributed Mobility Management (DMM) Working Group is investigating the impact of decentralized mobility management to existing protocol solutions, while taking into account

  11. Technologies of Mobility in the Americas: Introduction

    DEFF Research Database (Denmark)

    Vannini, Phillip; Budd, Lucy; Jensen, Ole B.

    2012-01-01

    Technics, technicians, and techniques form the three basic cornerstones of what this book is about. Whether it is cell phones or airplanes, passengers or magazine advertisements, what the chapters collected here have in common is a basic orientation towards technology as a set of relations....... This relational approach to technology demonstrates that technology is neither a utopian nor a dystopian force driving the universe towards progress or involution. For all the contributors to this book, what mobile communication technologies like smart phones and spatial mobility technologies like cars and ferry...

  12. Mobile Devices and Mobile Learning: Shifting the Mindset of Teachers and Learners

    Science.gov (United States)

    Smith, Philippa K.; Grant, Lynn; Conway, Clare; Narayan, Vickel

    2016-01-01

    Incorporating new media technologies that enable mobile learning to be part of educational practice poses challenges to those used to teaching in a traditional classroom environment. In this article three lecturers and a learning advisor from a New Zealand university reflect on their experiences in the progressive redesign of a Bachelor of Arts…

  13. Understanding pastoral mobility

    DEFF Research Database (Denmark)

    Adriansen, Hanne Kirstine

    2008-01-01

    Based on a case study from Sahelian Senegal, this paper analyses how various actors perceive the importance of pastoral mobility and presents issues of importance for understanding the use of mobility among Fulani of Ferlo. One knowledge system is a scientific one, the 'new rangeland paradigm...... territory, which they consider their place, but are unwilling to employ large-scale mobility themselves. Mobility is not of importance for their ethnic identity and some use paid herders to care for their livestock. By looking at both knowledge systems, we achieve a better understanding of pastoral mobility...

  14. Mobile Virtual Private Networking

    Science.gov (United States)

    Pulkkis, Göran; Grahn, Kaj; Mårtens, Mathias; Mattsson, Jonny

    Mobile Virtual Private Networking (VPN) solutions based on the Internet Security Protocol (IPSec), Transport Layer Security/Secure Socket Layer (SSL/TLS), Secure Shell (SSH), 3G/GPRS cellular networks, Mobile IP, and the presently experimental Host Identity Protocol (HIP) are described, compared and evaluated. Mobile VPN solutions based on HIP are recommended for future networking because of superior processing efficiency and network capacity demand features. Mobile VPN implementation issues associated with the IP protocol versions IPv4 and IPv6 are also evaluated. Mobile VPN implementation experiences are presented and discussed.

  15. European mobility cultures

    DEFF Research Database (Denmark)

    Haustein, Sonja; Nielsen, Thomas A. Sick

    2016-01-01

    More targeted European policies promoting green travel patterns require better knowledge on differing mobility cultures across European regions. As a basis for this, we clustered the EU population into eight mobility styles based on Eurobarometer data. The mobility styles - including, for example...... positions on the path towards sustainable mobility and therefore different requirements towards European platforms and support measures, e.g. for 'Sustainable Urban Mobility Plans'. The country clusters can provide a starting point for future communication and targeting of European efforts in sustainable...

  16. Improved group-specific primers based on the full SILVA 16S rRNA gene reference database.

    Science.gov (United States)

    Pfeiffer, Stefan; Pastar, Milica; Mitter, Birgit; Lippert, Kathrin; Hackl, Evelyn; Lojan, Paul; Oswald, Andreas; Sessitsch, Angela

    2014-08-01

    Quantitative PCR (qPCR) and community fingerprinting methods, such as the Terminal Restriction Fragment Length Polymorphism (T-RFLP) analysis,are well-suited techniques for the examination of microbial community structures. The use of phylum and class-specific primers can provide enhanced sensitivity and phylogenetic resolution as compared with domain-specific primers. To date, several phylum- and class-specific primers targeting the 16S ribosomal RNA gene have been published. However, many of these primers exhibit low discriminatory power against non-target bacteria in PCR. In this study, we evaluated the precision of certain published primers in silico and via specific PCR. We designed new qPCR and T-RFLP primer pairs (for the classes Alphaproteobacteria and Betaproteobacteria, and the phyla Bacteroidetes, Firmicutes and Actinobacteria) by combining the sequence information from a public dataset (SILVA SSU Ref 102 NR) with manual primer design. We evaluated the primer pairs via PCR using isolates of the above-mentioned groups and via screening of clone libraries from environmental soil samples and human faecal samples. As observed through theoretical and practical evaluation, the primers developed in this study showed a higher level of precision than previously published primers, thus allowing a deeper insight into microbial community dynamics.

  17. Geothermal progress monitor. Progress report No. 1

    Energy Technology Data Exchange (ETDEWEB)

    1979-12-01

    Progress is reported on the following: electrical uses, direct-heat uses, drilling activities, leases, geothermal loan guarantee program, general activities, and legal, institutional, and regulatory activites. (MHR)

  18. ANALISIS FAKTOR-FAKTOR YANG MEMPENGARUHI KONSUMEN DALAM MEMILIH MOBIL MERK TOYOTA RUSH PADA PT. HADJI KALLA CABANG URIP SUMIHARJO MAKASSAR

    OpenAIRE

    PRABUANA H.P, MOCH.

    2013-01-01

    2012 Penelitian ini bertujuan untuk menganalisis Pengaruh Faktor bauran Bauran pemasaran (marketing mix) terhadap keputusan pembelian mobil merek Toyota Rush pada PT. Hadji Kalla cabang Urip Sumiharjo Makassar. Data penelitian ini diperoleh dari kuisioner (primer) dan beberapa observasi serta wawancara langsung dengan pihak terkait dengan produk mobil Toyota Rush. Temuan penelitian ini menunjukkan bahwa variabel bauran pemasaran yang terdiri dari faktor Produk (kualitas), Harga, promosi, d...

  19. Markets and Molecules: A Pharmaceutical Primer from the South.

    Science.gov (United States)

    Banerjee, Dwaipayan

    2017-01-01

    The Indian pharmaceutical industry has historically manufactured low-cost drugs for the global poor. Activist mobilizations at the height of the HIV/AIDS epidemic revealed a vast cost gap between global brands and Indian generics, much to the embarrassment of Euro-American corporations that were in the habit of pricing drugs for only the wealthy or well insured. As new drug access controversies focus on anticancer therapies, they reveal new flows of international capital, emergent genetic technologies, and increasingly coercive trade regimes. Together these favor multinational corporate oligopolies, which imperil the legacy of HIV/AIDS activism and the future availability of essential life-saving drugs for the work of global public health. In this essay, I describe how the future of the right to drug access rests uneasily, and potentially calamitously, on a shifting balance of power between global south interests and Euro-American pharmaceutical capital.

  20. Engaging with mobile methods

    DEFF Research Database (Denmark)

    Jensen, Martin Trandberg

    2014-01-01

    This chapter showcases how mobile methods are more than calibrated techniques awaiting application by tourism researchers, but productive in the enactment of the mobile (Law and Urry, 2004). Drawing upon recent findings deriving from a PhD course on mobility and mobile methods it reveals...... the conceptual ambiguousness of the term ‘mobile methods’. In order to explore this ambiguousness the chapter provides a number of examples deriving from tourism research, to explore how mobile methods are always entangled in ideologies, predispositions, conventions and practice-realities. Accordingly......, the engagements with methods are acknowledged to be always political and contextual, reminding us to avoid essentialist discussions regarding research methods. Finally, the chapter draws on recent fieldwork to extend developments in mobilities-oriented tourism research, by employing auto-ethnography to call...

  1. Mobile systems development

    DEFF Research Database (Denmark)

    Pedersen, Ole; Kristiansen, Martin Lund; Kammersgaard, Marc N.

    2007-01-01

    in XP. In general, we find XP well-suited for mobile systems development projects. However, based on our experiences and an analytical comparison we propose the following modifications to XP: Make an essential design to avoid the worst time waste during refactoring. For faster development, reuse code......Development of mobile software is Surrounded by much uncertainty. Immature software platforms on mobile clients, a highly competitive market calling for innovation, efficiency and effectiveness in the development life cycle, and lacking end-user adoption are just some of the realities facing...... development teams in the mobile software industry. By taking a process view on development of mobile systems we seek to explore the strengths and limitations of eXtreme Programming (XP) in the context of mobile software development. Following an experimental approach a mobile systems development project...

  2. Functional genes to assess nitrogen cycling and aromatic hydrocarbon degradation: primers and processing matter

    Directory of Open Access Journals (Sweden)

    Christopher Ryan Penton

    2013-09-01

    Full Text Available Targeting sequencing to genes involved in key environmental processes, i.e. ecofunctional genes, provides an opportunity to sample nature’s gene guilds to greater depth and help link community structure to process-level outcomes. Vastly different approaches have been implemented for sequence processing and, ultimately, for taxonomic placement of these gene reads. The overall quality of next generation sequence analysis of functional genes is dependent on multiple steps and assumptions of unknown diversity. To illustrate current issues surrounding amplicon read processing we provide examples for three ecofunctional gene groups. A combination of in-silico, environmental and cultured strain sequences was used to test new primers targeting the dioxin and dibenzofuran degrading genes dxnA1, dbfA1, and carAa. The majority of obtained environmental sequences were classified into novel sequence clusters, illustrating the discovery value of the approach. For the nitrite reductase step in denitrification, the well-known nirK primers exhibited deficiencies in reference database coverage, illustrating the need to refine primer-binding sites and/or to design multiple primers, while nirS primers exhibited bias against five phyla. Amino acid-based OTU clustering of these two N-cycle genes from soil samples yielded only 114 unique nirK and 45 unique nirS genus-level groupings, likely a reflection of constricted primer coverage. Finally, supervised and non-supervised OTU analysis methods were compared using the nifH gene of nitrogen fixation, with generally similar outcomes, but the clustering (non-supervised method yielded higher diversity estimates and stronger site-based differences. High throughput amplicon sequencing can provide inexpensive and rapid access to nature’s related sequences by circumventing the culturing barrier, but each unique gene requires individual considerations in terms of primer design and sequence processing and classification.

  3. Optimization of β-glucan synthase gene primers for molecular DNA fingerprinting in Pleurotus pulmonarious

    Science.gov (United States)

    Kadir, Zaiton Abdul; Daud, Fauzi; Mohamad, Azhar; Senafi, Sahidan; Jamaludin, Ferlynda Fazleen

    2015-09-01

    Pleurotus pulmonarius is an edible mushroom in Malaysia and commonly known as Oyster mushroom. The species are important not only for nutritional values but also for pharmaceutical importance related to bioactive compounds in polysaccharides such as β glucan. Hence, β-glucan synthase gene (BGS) pathways which are related to the production of the β-glucan might be useful as marker for molecular DNA fingerprinting in P. pulmonarius. Conserved regions of β-glucan gene were mined from public database and aligned. Consensus from the alignment was used to design the primers by using Primer 3 software. Eight primers were designed and a single primer pair (BGF3: 5' TCTTGGCGAGTTCGAAGAAT 3'; BGR3: 5' TTCCGATCTTGGTCTGGAAG 3') was optimized at Ta (annealing temperature) 57.1°C to produce PCR product ranging from 400-500 bp. Optimum components for PCR reactions were 5.0 µl of 10× PCR buffer, 1.5 µl of 25 mM MgCl2, 1 µl of 10 mM dNTP, 1 µl of β-glucan primers, 0.1 µl of 5 units/ml Taq polymerase and 2 µl DNA template. PCR program was set at 34 PCR cycles by using Bio-Rad T100 Thermal Cycler. Initial denaturation was set at 94°C for 2 min, denaturation at 94°C for 1 minute, primer annealing at 45°C to 60°C (gradient temperature) for 50 seconds, followed by elongation at 72°C for 1 minute and further extension 5 minutes for last cycle PCR prior to end the program cycle. Thus, this information revealed that the primer of β-glucan gene designed could be used as targeted markers in screening population strains of P. pulmonarius.

  4. Family-specific vs. universal PCR primers for the study of mitochondrial DNA in plants

    Directory of Open Access Journals (Sweden)

    Aleksić Jelena M.

    2016-01-01

    Full Text Available Mitochondrial genomes (mtDNAs or mitogenomes of seed plants are characterized by a notoriously unstable organization on account of which available so-called universal or consensus primers may fail to fulfil their foreseen function - amplification of various mtDNA regions in a broad range of plant taxa. Thus, the primers developed for groups assumed to have similar organization of their mitogenomes, such as families, may facilitate a broader usage of more variable non-coding portions of these genomes in group members. Using in silico PCR method and six available complete mitogenomes of Fabaceae, it has been demonstrated that only three out of 36 published universal primer and three Medicago sativa-specific primer pairs that amplify various mtDNA regions are suitable for six representatives of the Fabaceae family upon minor modifications, and develop 21 Fabaceae-specific primer pairs for amplification of all 14 cis-splicing introns in genes of NADH subunits (nad genes which represent the most commonly used non-coding mtDNA regions in various studies in plants. Using the same method and six available complete mitogenomes of representatives of related families Cucurbitaceae, Euphorbiaceae and Rosaceae and a model plant, Arabidopsis thaliana, it has further been demonstrated that applicability of newly developed primer pairs for amplification of nad introns in more or less related taxa was dependent not only on species evolutionary distances but also on their genome sizes. A reported set of 24 primer pairs is a valuable resource which may facilitate a broader usage of mtDNA variability in future studies at both intra- and inter-specific levels in Fabaceae, which is the third largest family of flowering plants rarely studied at the mtDNA level, and in other more or less related taxa. [Projekat Ministarstva nauke Republike Srbije, br. 173005

  5. Connecting Mobile Users Through Mobile Social Networks

    Directory of Open Access Journals (Sweden)

    Faisal Alkhateeb

    2012-10-01

    Full Text Available Nowadays, social networks become popular with the emerging of web-based social networking services. Recently, several mobile services are developed to connect users to their favourite social networks such as Facebook, Twitter, Flickr, etc. However, these services depends upon the existing web-based social networks. In this paper, we present a mobile service for joining groups across communities. The originality of the work is that the framework of the service allows creating and joining social networks that are self-contained for mobile company servers. The service consists of several sub-services such as users invitation, group finding and others. Users, regardless of their disability, can use the service and its sub-services without the need to create their own accounts on social web sites and thus their own groups. We also propose a privacy control policy for mobile social networks.

  6. Characterization of a nucleocapsid-like region and of two distinct primer tRNALys,2 binding sites in the endogenous retrovirus Gypsy.

    Science.gov (United States)

    Gabus, Caroline; Ivanyi-Nagy, Roland; Depollier, Julien; Bucheton, Alain; Pelisson, Alain; Darlix, Jean-Luc

    2006-01-01

    Mobile LTR-retroelements comprising retroviruses and LTR-retrotransposons form a large part of eukaryotic genomes. Their mode of replication and abundance favour the notion that they are major actors in eukaryote evolution. The Gypsy retroelement can spread in the germ line of the fruit fly Drosophila melanogaster via both env-independent and env-dependent processes. Thus, Gypsy is both an active retrotransposon and an infectious retrovirus resembling the gammaretrovirus MuLV. However, unlike gammaretroviruses, the Gypsy Gag structural precursor is not processed into Matrix, Capsid and Nucleocapsid (NC) proteins. In contrast, it has features in common with Gag of the ancient yeast TY1 retroelement. These characteristics of Gypsy make it a very interesting model to study replication of a retroelement at the frontier between ancient retrotransposons and retroviruses. We investigated Gypsy replication using an in vitro model system and transfection of insect cells. Results show that an unstructured domain of Gypsy Gag has all the properties of a retroviral NC. This NC-like peptide forms ribonucleoparticle-like complexes upon binding Gypsy RNA and directs the annealing of primer tRNA(Lys,2) to two distinct primer binding sites (PBS) at the genome 5' and 3' ends. Only the 5' PBS is indispensable for cDNA synthesis in vitro and in Drosophila cells.

  7. Profil Gangguan Kognitif pada Tumor Intrakranial Primer dan Metastasis

    Directory of Open Access Journals (Sweden)

    Kartika Maharani

    2015-12-01

    Full Text Available Gangguan kognitif sering menyertai pasien tumor intrakranial dan menjadi penyebab utama disabilitas. Perbedaan patofisiologi tumor intrakranial primer (TIP dan metastasis (TM menyebabkan perbedaan gambaran klinis dan derajat  gangguan kognitif. Tujuan penelitian ini untuk mengetahui prevalensi dan profil gangguan kognitif pasien TIP dan TM. Disain penelitian potong-lintang retrospektif menggunakan data sekunder dari Poliklinik Saraf RSCM pada bulan Januari 2011-Desember 2013. Subjek berusia 18-65 tahun yang didiagnosis TIP dan TM berdasarkan anamnesis, pemeriksaan fisik, CT scan atau MRI kepala, dan atau histopatologi. Terdapat 121 subjek, 79 TIP dan 27 TM; usia rerata TIP 43,7 tahun dan TM 50,9 tahun. Pada kelompok TM mayoritas (40,7% memiliki lesi di kedua hemisfer sedangkan TIP hanya di satu hemisfer. Lokasi tumor pada TM lebih dari 1 lobus (51,9%. Gangguan kognitif lebih banyak pada TM (81,5% dibandingkan TIK (52,5% dengan domain tersering gangguan visuospasial. Subjek TM mengalami gangguan kognitif lebih berat dibandingkan TIP (rerata MMSE 20,96 dan 22,61. Gangguan kognitif lebih banyak pada kelompok TM dibandingkan TIP dengan gangguan kognitif lebih berat karena mayoritas lesi tumor mengenai lebih dari 1 lobus. Kata kunci: gangguan kognitif, tumor intrakranial, neuro-onkologi.   Cognitve Impairment in Primary and Metastatic Brain Tumors Abstract Brain tumor patients are often accompanied by a wide range of cognitive impairment as a major cause of disablility. The different pathophysiology of primary and metastatic brain tumor influences patients’ clinical signs and symptoms, and also the severity of cognitive impairment. To determine the prevalence and profile of cognitive impairment in patients with primary and metastatic brain tumors, this cross-sectional study was done on subjects of 18 to 65 years old with the diagnosis of primary and metastatic brain tumors based on anamnesis, physical examination, imaging modalities, and

  8. 33 CFR 165.835 - Security Zone; Port of Mobile, Mobile Ship Channel, Mobile, AL.

    Science.gov (United States)

    2010-07-01

    ... 33 Navigation and Navigable Waters 2 2010-07-01 2010-07-01 false Security Zone; Port of Mobile, Mobile Ship Channel, Mobile, AL. 165.835 Section 165.835 Navigation and Navigable Waters COAST GUARD... § 165.835 Security Zone; Port of Mobile, Mobile Ship Channel, Mobile, AL. (a) Definition. As used in...

  9. Evaluating primers for profiling anaerobic ammonia oxidizing bacteria within freshwater environments.

    Directory of Open Access Journals (Sweden)

    Puntipar Sonthiphand

    Full Text Available Anaerobic ammonia oxidizing (anammox bacteria play an important role in transforming ammonium to nitrogen gas and contribute to fixed nitrogen losses in freshwater environments. Understanding the diversity and abundance of anammox bacteria requires reliable molecular tools, and these are not yet well established for these important Planctomycetes. To help validate PCR primers for the detection of anammox bacteria within freshwater ecosystems, we analyzed representative positive controls and selected samples from Grand River and groundwater sites, both from Ontario, Canada. The objectives of this study were to identify a suitable anammox denaturing gradient gel electrophoresis (DGGE fingerprint method by using GC-clamp modifications to existing primers, and to verify the specificity of anammox-specific primers used for DGGE, cloning and qPCR methods. Six primer combinations were tested from four published primer sets (i.e. A438f/A684r, Amx368f/Amx820r, An7f/An1388r, and Pla46/1392r for both direct and nested PCR amplifications. All PCR products were run subsequently on DGGE gels to compare the resulting patterns. Two anammox-specific primer combinations were also used to generate clone libraries and quantify anammox bacterial 16S rRNA genes with qPCR. The primer set A438f/A684r was highly specific to anammox bacteria, provided reliable DGGE fingerprints and generated a high proportion of anammox-related clones. A second primer set (Amx368f/Amx820r was anammox specific, based on clone library analysis, but PCR products from different candidate species of anammox bacteria resolved poorly using DGGE analysis. Both DGGE and cloning results revealed that Ca. Brocadia and an uncharacterized anammox bacterial cluster represented the majority of anammox bacteria found in Grand River sediment and groundwater samples, respectively. Together, our results demonstrate that although Amx368f/Amx820r was useful for anammox-specific qPCR and clone library

  10. Mobile Phone Penetration, Mobile Banking and Inclusive Development in Africa

    OpenAIRE

    Asongu, Simplice; Nwachukwu, Jacinta C.

    2016-01-01

    The study assesses the role of mobile phones and mobile banking in decreasing inequality in 52 African countries. The empirical procedure involves first, examining the income-redistributive effect of mobile phone penetration and then investigating the contribution of mobile banking services in this relationship. The findings suggest an equalizing income-redistributive effect of ‘mobile phone penetration’ and ‘mobile banking’, with a higher income-equalizing effect from mobile banking compared...

  11. The use of a fluoropolymer containing primer to enhance adhesion of rotolined fluoropolymer coatings

    Energy Technology Data Exchange (ETDEWEB)

    Lech, L.M. [DuPont, Parkersburg, WV (United States)

    1999-11-01

    Fluoropolymers such as PFA and ETFE are often used in rotolining applications. A common source of failure for rotolined coatings is delamination from the metal substrate. Extensive thermal cycling of the coated part, permeation of the contained liquid to the substrate, or a combination of both thermal cycling and permeation causes this. Rotolined coatings are typically applied directly to the metal part. It has been found that applying an aqueous fluoropolymer based primer to the metal substrate prior to applying the rotolined resin increases the time before delamination is observed. The primer is applied by conventional spray techniques and can either be force dried at low temperature or air-dried under ambient conditions. The primer consists primarily of a fluoropolymer such as ETFE or PFA and a bonding agent such as polyamide-imide, polyphenylene sulfide, or polyether sulfone. After the primer is applied to the metal part, the fluoropolymer in the primer melt blends with the fluoropolymer rotolining resin during the rotolining process. The bonding agent enhances the adhesion of the entire coating system to the metal part. This extends the lifetime of the rotolined coatings.

  12. Formulation and Assessment of a Wash-Primer Containing Lanthanum "Tannate" for Steel Temporary Protection

    Science.gov (United States)

    D'Alessandro, Oriana; Selmi, Gonzalo J.; Deyá, Cecilia; Di Sarli, Alejandro; Romagnoli, Roberto

    2018-02-01

    Tannins are polyphenols synthesized by plants and useful for the coating industry as corrosion inhibitors. In addition, lanthanum salts have a great inhibitory effect on steel corrosion. The aim of this study was to obtain lanthanum "tannate" with adequate solubility to be incorporated as the corrosion inhibitor in a wash-primer. The "tannate" was obtained from commercial "Quebracho" tannin and 0.1 M La(NO3)3. The soluble tannin was determined by the Folin-Denis reagent, while the concentration of Lanthanum was obtained by a gravimetric procedure. The protective action of "tannate" on SAE 1010 steel was evaluated by linear polarization curves and corrosion potential measurements. Lanthanum "tannate" was incorporated in a wash-primer formulation and tested by corrosion potential and ionic resistance measurements. The corrosion rate was also determined by the polarization resistance technique. Besides, the primer was incorporated in an alkyd paint system and its anticorrosion performance assessed in the salt spray cabinet and by electrochemical impedance spectroscopy. Results showed that lanthanum "tannate" primer inhibits the development of deleterious iron oxyhydroxides on the steel substrate and incorporated into a paint system had a similar behavior to the primer formulated with zinc tetroxychromate.

  13. Genus-specific PCR Primers Targeting Intracellular Parasite Euduboscquella (Dinoflagellata: Syndinea)

    Science.gov (United States)

    Jung, Jae-Ho; Choi, Jung Min; Kim, Young-Ok

    2018-03-01

    We designed a genus-specific primer pair targeting the intracellular parasite Euduboscquella. To increase target specificity and inhibit untargeted PCR, two nucleotides were added at the 3' end of the reverse primer, one being a complementary nucleotide to the Euduboscquella-specific SNP (single-nucleotide polymorphism) and the other a deliberately mismatched nucleotide. Target specificity of the primer set was verified experimentally using PCR of two Euduboscquella species (positive controls) and 15 related species (negative controls composed of ciliates, diatoms and dinoflagellates), and analytical comparison with SILVA SSU rRNA gene database (release 119) in silico. In addition, we applied the Euduboscquella-specific primer set to four environmental samples previously determined by cytological staining to be either positive or negative for Euduboscquella. As expected, only positive controls and environmental samples known to contain Euduboscquella were successfully amplified by the primer set. An inferred SSU rRNA gene phylogeny placed environmental samples containing aloricate ciliates infected by Euduboscquella in a cluster discrete from Euduboscquella groups a-d previously reported from loricate, tintinnid ciliates.

  14. The effect of various primers on shear bond strength of zirconia ceramic and resin composite.

    Science.gov (United States)

    Sanohkan, Sasiwimol; Kukiattrakoon, Boonlert; Larpboonphol, Narongrit; Sae-Yib, Taewalit; Jampa, Thibet; Manoppan, Satawat

    2013-11-01

    To determine the in vitro shear bond strengths (SBS) of zirconia ceramic to resin composite after various primer treatments. Forty zirconia ceramic (Zeno, Wieland Dental) specimens (10 mm in diameter and 2 mm thick) were prepared, sandblasted with 50 μm alumina, and divided into four groups (n = 10). Three experimental groups were surface treated with three primers; CP (RelyX Ceramic Primer, 3M ESPE), AP (Alloy Primer, Kuraray Medical), and MP (Monobond Plus, Ivoclar Vivadent AG). One group was not treated and served as the control. All specimens were bonded to a resin composite (Filtek Supreme XT, 3M ESPE) cylinder with an adhesive system (Adper Scotchbond Multi-Purpose Plus Adhesive, 3M ESPE) and then stored in 100% humidity at 37°C for 24 h before SBS testing in a universal testing machine. Mean SBS (MPa) were analyzed with one-way analysis of variance (ANOVA) and the Tukey's Honestly Significant Difference (HSD) test (α = 0.05). Group AP yielded the highest mean and standard deviation (SD) value of SBS (16.8 ± 2.5 MPa) and Group C presented the lowest mean and SD value (15.4 ± 1.6 MPa). The SBS did not differ significantly among the groups (P = 0.079). Within the limitations of this study, the SBS values between zirconia ceramic to resin composite using various primers and untreated surface were not significantly different.

  15. Cytochrome c oxidase I primers for corbiculate bees: DNA barcode and mini-barcode.

    Science.gov (United States)

    Françoso, E; Arias, M C

    2013-09-01

    Bees (Apidae), of which there are more than 19 900 species, are extremely important for ecosystem services and economic purposes, so taxon identity is a major concern. The goal of this study was to optimize the DNA barcode technique based on the Cytochrome c oxidase (COI) mitochondrial gene region. This approach has previously been shown to be useful in resolving taxonomic inconsistencies and for species identification when morphological data are poor. Specifically, we designed and tested new primers and standardized PCR conditions to amplify the barcode region for bees, focusing on the corbiculate Apids. In addition, primers were designed to amplify small COI amplicons and tested with pinned specimens. Short barcode sequences were easily obtained for some Bombus century-old museum specimens and shown to be useful as mini-barcodes. The new primers and PCR conditions established in this study proved to be successful for the amplification of the barcode region for all species tested, regardless of the conditions of tissue preservation. We saw no evidence of Wolbachia or numts amplification by these primers, and so we suggest that these new primers are of broad value for corbiculate bee identification through DNA barcode. © 2013 John Wiley & Sons Ltd.

  16. Multicolor-based discrimination of 21 short tandem repeats and amelogenin using four fluorescent universal primers.

    Science.gov (United States)

    Asari, Masaru; Okuda, Katsuhiro; Hoshina, Chisato; Omura, Tomohiro; Tasaki, Yoshikazu; Shiono, Hiroshi; Matsubara, Kazuo; Shimizu, Keiko

    2016-02-01

    The aim of this study was to develop a cost-effective genotyping method using high-quality DNA for human identification. A total of 21 short tandem repeats (STRs) and amelogenin were selected, and fluorescent fragments at 22 loci were simultaneously amplified in a single-tube reaction using locus-specific primers with 24-base universal tails and four fluorescent universal primers. Several nucleotide substitutions in universal tails and fluorescent universal primers enabled the detection of specific fluorescent fragments from the 22 loci. Multiplex polymerase chain reaction (PCR) produced intense FAM-, VIC-, NED-, and PET-labeled fragments ranging from 90 to 400 bp, and these fragments were discriminated using standard capillary electrophoretic analysis. The selected 22 loci were also analyzed using two commercial kits (the AmpFLSTR Identifiler Kit and the PowerPlex ESX 17 System), and results for two loci (D19S433 and D16S539) were discordant between these kits due to mutations at the primer binding sites. All genotypes from the 100 samples were determined using 2.5 ng of DNA by our method, and the expected alleles were completely recovered. Multiplex 22-locus genotyping using four fluorescent universal primers effectively reduces the costs to less than 20% of genotyping using commercial kits, and our method would be useful to detect silent alleles from commercial kit analysis. Copyright © 2015 Elsevier Inc. All rights reserved.

  17. Summary of the primer on tumor immunology and the biological therapy of cancer

    Directory of Open Access Journals (Sweden)

    Margolin Kim

    2009-01-01

    Full Text Available Abstract The International Society for Biological Therapy of Cancer (iSBTc is one of the "premier destinations for interaction and innovation in the cancer biologics community". It provides a primer course each year during the annual meeting to address the most important areas of tumor immunology and immunotherapy. The course has been given by prominent investigators in the area of interest, covering the core principles of cancer immunology and immunotherapy. The target audience for this program includes investigators from academic, regulatory, and biopharmaceutical venues. The program goal is to enable the attendees to learn the current status and the most recent advances in biologic therapies, and to leverage this knowledge towards the improvement of cancer therapy. The 2008 immunologic primer course was held on October 30 at the 23rd Annual meeting of iSBTc in San Diego, CA. Nine internationally renowned investigators gave excellent presentations on different topics. The topics covered in this primer included: (1 cytokines in cancer immunology; (2 anti-angiogenic therapy; (3 end stage: immune killing of tumors; (4 blocking T cell checkpoints; (5 approach to identification and therapeutic exploitation of tumor antigens; (6 T regulatory cells; (7 adoptive T cell therapy; (8 immune monitoring of cancer immunotherapy; and (9 immune adjuvants. We summarized the topics in this primer for public education. The related topic slides and schedule can be accessed online http://www.isbtc.org/meetings/am08/primer08.

  18. Genus-Specific Primers for Study of Fusarium Communities in Field Samples

    Science.gov (United States)

    Edel-Hermann, Véronique; Gautheron, Nadine; Durling, Mikael Brandström; Kolseth, Anna-Karin; Steinberg, Christian; Persson, Paula; Friberg, Hanna

    2015-01-01

    Fusarium is a large and diverse genus of fungi of great agricultural and economic importance, containing many plant pathogens and mycotoxin producers. To date, high-throughput sequencing of Fusarium communities has been limited by the lack of genus-specific primers targeting regions with high discriminatory power at the species level. In the present study, we evaluated two Fusarium-specific primer pairs targeting translation elongation factor 1 (TEF1). We also present the new primer pair Fa+7/Ra+6. Mock Fusarium communities reflecting phylogenetic diversity were used to evaluate the accuracy of the primers in reflecting the relative abundance of the species. TEF1 amplicons were subjected to 454 high-throughput sequencing to characterize Fusarium communities. Field samples from soil and wheat kernels were included to test the method on more-complex material. For kernel samples, a single PCR was sufficient, while for soil samples, nested PCR was necessary. The newly developed primer pairs Fa+7/Ra+6 and Fa/Ra accurately reflected Fusarium species composition in mock DNA communities. In field samples, 47 Fusarium operational taxonomic units were identified, with the highest Fusarium diversity in soil. The Fusarium community in soil was dominated by members of the Fusarium incarnatum-Fusarium equiseti species complex, contradicting findings in previous studies. The method was successfully applied to analyze Fusarium communities in soil and plant material and can facilitate further studies of Fusarium ecology. PMID:26519387

  19. Polyadenylated Sequencing Primers Enable Complete Readability of PCR Amplicons Analyzed by Dideoxynucleotide Sequencing

    Directory of Open Access Journals (Sweden)

    Martin Beránek

    2012-01-01

    Full Text Available Dideoxynucleotide DNA sequencing is one of the principal procedures in molecular biology. Loss of an initial part of nucleotides behind the 3' end of the sequencing primer limits the readability of sequenced amplicons. We present a method which extends the readability by using sequencing primers modified by polyadenylated tails attached to their 5' ends. Performing a polymerase chain reaction, we amplified eight amplicons of six human genes (AMELX, APOE, HFE, MBL2, SERPINA1 and TGFB1 ranging from 106 bp to 680 bp. Polyadenylation of the sequencing primers minimized the loss of bases in all amplicons. Complete sequences of shorter products (AMELX 106 bp, SERPINA1 121 bp, HFE 208 bp, APOE 244 bp, MBL2 317 bp were obtained. In addition, in the case of TGFB1 products (366 bp, 432 bp, and 680 bp, respectively, the lengths of sequencing readings were significantly longer if adenylated primers were used. Thus, single strand dideoxynucleotide sequencing with adenylated primers enables complete or near complete readability of short PCR amplicons.

  20. Real-time PCR (qPCR) primer design using free online software.

    Science.gov (United States)

    Thornton, Brenda; Basu, Chhandak

    2011-01-01

    Real-time PCR (quantitative PCR or qPCR) has become the preferred method for validating results obtained from assays which measure gene expression profiles. The process uses reverse transcription polymerase chain reaction (RT-PCR), coupled with fluorescent chemistry, to measure variations in transcriptome levels between samples. The four most commonly used fluorescent chemistries are SYBR® Green dyes and TaqMan®, Molecular Beacon or Scorpion probes. SYBR® Green is very simple to use and cost efficient. As SYBR® Green dye binds to any double-stranded DNA product, its success depends greatly on proper primer design. Many types of online primer design software are available, which can be used free of charge to design desirable SYBR® Green-based qPCR primers. This laboratory exercise is intended for those who have a fundamental background in PCR. It addresses the basic fluorescent chemistries of real-time PCR, the basic rules and pitfalls of primer design, and provides a step-by-step protocol for designing SYBR® Green-based primers with free, online software. Copyright © 2010 Wiley Periodicals, Inc.

  1. Primer sets for cloning the human repertoire of T cell Receptor Variable regions

    Directory of Open Access Journals (Sweden)

    Santoro Claudio

    2008-08-01

    Full Text Available Abstract Background Amplification and cloning of naïve T cell Receptor (TR repertoires or antigen-specific TR is crucial to shape immune response and to develop immuno-based therapies. TR variable (V regions are encoded by several genes that recombine during T cell development. The cloning of expressed genes as large diverse libraries from natural sources relies upon the availability of primers able to amplify as many V genes as possible. Results Here, we present a list of primers computationally designed on all functional TR V and J genes listed in the IMGT®, the ImMunoGeneTics information system®. The list consists of unambiguous or degenerate primers suitable to theoretically amplify and clone the entire TR repertoire. We show that it is possible to selectively amplify and clone expressed TR V genes in one single RT-PCR step and from as little as 1000 cells. Conclusion This new primer set will facilitate the creation of more diverse TR libraries than has been possible using currently available primer sets.

  2. Primer sets for cloning the human repertoire of T cell Receptor Variable regions.

    Science.gov (United States)

    Boria, Ilenia; Cotella, Diego; Dianzani, Irma; Santoro, Claudio; Sblattero, Daniele

    2008-08-29

    Amplification and cloning of naïve T cell Receptor (TR) repertoires or antigen-specific TR is crucial to shape immune response and to develop immuno-based therapies. TR variable (V) regions are encoded by several genes that recombine during T cell development. The cloning of expressed genes as large diverse libraries from natural sources relies upon the availability of primers able to amplify as many V genes as possible. Here, we present a list of primers computationally designed on all functional TR V and J genes listed in the IMGT, the ImMunoGeneTics information system. The list consists of unambiguous or degenerate primers suitable to theoretically amplify and clone the entire TR repertoire. We show that it is possible to selectively amplify and clone expressed TR V genes in one single RT-PCR step and from as little as 1000 cells. This new primer set will facilitate the creation of more diverse TR libraries than has been possible using currently available primer sets.

  3. Temas de Física para Ingeniería: Primer principio de la termodinámica

    OpenAIRE

    Beléndez Vázquez, Augusto

    1992-01-01

    Acústica, fluidos y termodinámica: "Primer principio de la termodinámica". Objetivos y caracteres generales de la termodinámica. Conceptos fundamentales de la termodinámica. Capacidad calorífica, calor específico y calor latente. Trabajo. Primer principio de la termodinámica: energía interna. Algunas aplicaciones del primer principio.

  4. Developing the Medication Reminder Mobile Application "Seeb".

    Science.gov (United States)

    Saghaeiannejad-Isfahani, Sakineh; Ehteshami, Asghar; Savari, Ebtesam; Samimi, Ali

    2017-06-01

    Today, the structure of comprehensive health care emphasizes self-care more than therapy. Medication therapy is a strong instrument for therapy received through the health setting, especially in medication area. Error in medication administration has produced different problems and they cost billions of dollars every year. Regarding mobile phone extensions, we developed a local medication reminder mobile application called "Seeb" as a suitable solution for decreasing medication errors for Iranians. We conducted a mixed methods study in three Phases: 1) Comparative study of existing mobile applications; 2) developed its object-oriented model; 3) Developed the initial version of "Seeb" that was approved for production. This application was designed for the appropriate medication administration including time and dosages through: recording patient and medication data; scheduling patients' medication; and reporting medication administration on progress. "Seeb" has been designed in compliance with Iranian health information technologists and pharmacists requirements. It is expected to reduce medication error and improve patient adherence to medical prescriptions.

  5. Generation and confinement of mobile charges in buried oxide of SOI substrates; Generation et confinement de charges mobiles dans les oxydes enterres de substrats SOI

    Energy Technology Data Exchange (ETDEWEB)

    Gruber, O.; Krawiec, S.; Musseau, O.; Paillet, Ph.; Courtot-Descharles, A. [CEA Bruyeres-le-Chatel, DIF, 91 (France)

    1999-07-01

    We analyze the mechanisms of generation and confinement of mobile protons resulting from hydrogen annealing of SOI buried oxides. This study of the mechanisms of generation and confinement of mobile protons in the buried oxide of SOI wafers emphasizes the importance of H+ diffusion in the oxide in the formation of a mobile charge. Under specific electric field conditions the irradiation of these devices results in a pinning of this mobile charge at the bottom Si-SiO{sub 2} interface. Ab initio calculations are in progress to investigate the possible precursor defects in the oxide and detail the mechanism for mobile proton generation and confinement. (authors)

  6. A primer on sulfur for the planetary geologist

    Science.gov (United States)

    Theilig, E.

    1982-01-01

    Sulfur has been proposed as the dominant composition for the volcanic material on Io. Sulfur is a complex element which forms many intramolecular and intermolecular allotropes exhibiting a variety of physical properties. Cyclo-S8 sulfur is the most abundant and stable molecular form. The important molecular species within liquid sulfur change in concentration with temperature. Concentrations of the allotropes control the physical properties of the melt. Discontinuities in density, viscosity, and thermal properties reflect the polymerization process within liquid sulfur. Variations in the melting point are related to autodissociation of the liquid. Many solids forms of sulfur have been identified but only orthorhombic alpha and monoclinic beta sulfur, both composed of cyclo-S8 sulfur, are stable under terrestrial conditions. Physical properties of solid sulfur are dependent on the allotrope and, in some cases, the thermal history. Three natural terrestrial sulfur flows are described: (1) Siretoko-Iosan, Japan; (2) Volcan Azufre, Galapagos Islands; and (3) Mauna Loa, Hawaii. All of the flows are associated with fumarolic areas and are considered to have formed by the melting and mobilization of sulfur deposits. Surface textures of the flows indicate a behavior of molten sulfur similar to that of silicate lava. Channels, rivulets, and lobate edges were described for the flows. The solidification of man-made sulfur flows formed as part of the Frasch mining process by which sulfur is removed from the subsurface in a liquid state is described.

  7. Making Everyday Mobility

    DEFF Research Database (Denmark)

    Wind, Simon

    2013; Urry 2007) and family theory (Holdsworth 2013; Morgan 2011), it is argued that family mobility is far from only an instrumental phenomenon, displacing family members back and forth between activities and doings, but also a type of family practice (Morgan, 2011) carrying social and emotional...... coping process in the family, it is argued that making and performing mobility practices is to be understood as creating elasticity. Following this, it is elasticity that enables family members to stretch to accommodate the family’s practical, social and emotional conditions as well as adapt......Based upon a qualitative PhD study of 11 families everyday mobility, this paper inquiries into the everyday mobility of families with children in the Greater Copenhagen Area and the role mobility plays in contributing to coping in the families’ everyday life. Drawing on Mobilities theory (Jensen...

  8. Mobilities, Futures & the City

    DEFF Research Database (Denmark)

    Freudendal-Pedersen, Malene; Kesselring, Sven

    2016-01-01

    significant attention to these shifts in societies’ discursive patterns and structures. For making up powerful and strong visions and policies for sustainable cities, ‘collaborative storytelling’ plays a key role. The theoretical outset for the research project ‘Mobilities, Futures & the City’, which grounds......The future of cities and regions will be strongly shaped by the mobilities of people, goods, modes of transport, waste and information. In many ways, the ‘why and ‘for what’ often get lost in discourses on planning and designing mobilities. The predominant planning paradigm still conceptualizes...... the future of cities and mobilities as a matter of rather more efficient technologies than of social cohesion, integration and connectivity. Sustainable mobility needs the mobilities of ideas and concepts and the reflexivity of policies. Communicative planning theory and the ‘argumentative turn’ have given...

  9. CERN Mobility Survey

    CERN Multimedia

    GS Department

    2011-01-01

    The Institute of Shipping and Transport of the University of the Aegean and the National Technical University of Athens are partners with CERN in a study of mobility patterns between and within the CERN sites and to that effect have realized a mobility survey dedicated to the CERN community.         The study aims to understand: How you presently get around the CERN sites; What problems you encounter regarding mobility; What your needs are; What improvements you’d like to see; What measures you would like to see implemented most. The replies we receive will enable us to define a general policy promoting the diversity of mobility at CERN and to establish and quantify the strategic actions to be implemented for both the short and medium term. The objectives of the transport mobility plans are to: Facilitate mobility within and between the CERN sites by identifying adequate solutions in response to individual ...

  10. Social Perspectives on Mobility

    DEFF Research Database (Denmark)

    Uth Thomsen, Thyra; Gudmundsson, Henrik; Drewes Nielsen, Lise

    Globalisation is heavily dependent on physical transport, as people and goods travel over longer distances and with higher frequency. Movement and mobility have become integrated parts of late modern identity and practice, and a state of flux can be sensed everywhere. Bringing together the latest...... interdisciplinary theoretical approaches with empirical case studies analysing and appraising innovative policies from Scandinavia, this volume demonstrates that mobility research is a key issue within social enquiry. It addresses three broad themes. Firstly, mobility as a constructed social reality, examining how...... individuals construct notions of mobility in their everyday life and practice. Secondly, mobility as spatial co-ordination and transgression, and finally, mobility as a policy theme, where the contributors explore recent developments in transport policy at national and European levels, suggesting ways forward...

  11. Embodied Cultures of Mobilities

    DEFF Research Database (Denmark)

    Jensen, Ole B.

    2010-01-01

    and material artifacts. The paper target the complex relationship between the moving, sensing body and the material and built environment of infrastructures and mobility modes in order to explore what norms, and meanings, and everyday life mobility cultures are being produced and re-produced in this process....... A particular emphasis is put on how mobilities produce and re-produce norms, meanings and cultures in relation to the Everyday life perspective. By looking into walking, running, cycling, driving and mass transit mobilities different modes of embodied mobility is identified. The theoretical framework is based...... and interaction (Lynch). The argument is thus that understanding embodied cultures of mobilities from the vantage point of this paper lend is self to new interpretations, explorations and understandings of what it means to move within and between other social agents in particular material and physical...

  12. Quality attributes for mobile applications

    OpenAIRE

    Fernandes, João M.; Ferreira, André Leite

    2016-01-01

    A mobile application is a type of software application developed to run on a mobile device. The chapter discusses the main characteristics of mobile devices, since they have a great impact on mobile applications. It also presents the classification of mobile applications according to two main types: native and web-based applications. Finally, this chapter identifies the most relevant types of quality attributes for mobile applications. It shows that the relevant quality attributes for mobile ...

  13. Viscosupplementation for Osteoarthritis: a Primer for Primary Care Physicians

    Science.gov (United States)

    2015-01-01

    Introduction Osteoarthritis (OA) constitutes a growing public health burden and the most common cause of disability in the United States. Non-pharmacologic modalities and conservative pharmacologic therapies are recommended for the initial treatment of OA, including acetaminophen, and topical and oral non-steroidal anti-inflammatory drugs. However, safety concerns continue to mount regarding the use of these treatments and none have been shown to impact disease progression. Viscosupplementation with injections of hyaluronans (HAs) are indicated when non-pharmacologic and simple analgesics have failed to relieve symptoms (e.g., pain, stiffness) associated with knee OA. This review evaluates literature focusing on the efficacy and/or safety of HA injections in treating OA of the knee and in other joints, including the hip, shoulder, and ankle. Methods Relevant literature on intra-articular (IA) HA injections as a treatment for OA pain in the knee and other joints was identified through PubMed database searches from inception until January 2013. Search terms included “hyaluronic acid” or “hylan”, and “osteoarthritis”. Discussion Current evidence indicates that HA injections are beneficial and safe for patients with OA of the knee. IA injections of HAs treat the symptoms of knee OA and may also have disease-modifying properties, potentially delaying progression of OA. Although traditionally reserved for second-line treatment, evidence suggests that HAs may have value as a first-line therapy in the treatment of knee OA as they have been shown to be more effective in earlier stages and grades of disease, more recently diagnosed OA, and in less severe radiographic OA. Conclusion For primary care physicians who treat and care for patients with OA of the knee, IA injection with HAs constitutes a safe and effective treatment that can be routinely administered in the office setting. PMID:24203348

  14. Mobile wallets' business models

    OpenAIRE

    Buchinger, Uschi; Ranaivoson, Heritiana; Ballon, Pieter

    2017-01-01

    Background and Purpose: Though Mobile Wallets have the potential to entirely substitute their physical predecessor, many Mobile Wallets narrow their operations to one particular feature. This might be because of strategic business- model design choices to position themselves strategically as intermediates between users and business partners (third parties) in more delimited markets. Thus, Mobile Wallet Applications (MWAs) often represent platforms in narrow two-sided market structures. De...

  15. Mobile learning in medicine

    Science.gov (United States)

    Serkan Güllüoüǧlu, Sabri

    2013-03-01

    This paper outlines the main infrastructure for implicating mobile learning in medicine and present a sample mobile learning application for medical learning within the framework of mobile learning systems. Mobile technology is developing nowadays. In this case it will be useful to develop different learning environments using these innovations in internet based distance education. M-learning makes the most of being on location, providing immediate access, being connected, and acknowledges learning that occurs beyond formal learning settings, in places such as the workplace, home, and outdoors. Central to m-learning is the principle that it is the learner who is mobile rather than the device used to deliver m learning. The integration of mobile technologies into training has made learning more accessible and portable. Mobile technologies make it possible for a learner to have access to a computer and subsequently learning material and activities; at any time and in any place. Mobile devices can include: mobile phone, personal digital assistants (PDAs), personal digital media players (eg iPods, MP3 players), portable digital media players, portable digital multimedia players. Mobile learning (m-learning) is particularly important in medical education, and the major users of mobile devices are in the field of medicine. The contexts and environment in which learning occurs necessitates m-learning. Medical students are placed in hospital/clinical settings very early in training and require access to course information and to record and reflect on their experiences while on the move. As a result of this paper, this paper strives to compare and contrast mobile learning with normal learning in medicine from various perspectives and give insights and advises into the essential characteristics of both for sustaining medical education.

  16. Mobil Viral Pazarlama

    OpenAIRE

    Barutçu, Süleyman

    2011-01-01

    OBJECTIVE: Mobile Viral Marketing, with using mobile phones, is one of the most importantinnovations after Word of Mouth Marketing performed by face to face amongpeople and Viral Marketing performed in the İnternet. The main objective of thisstudy is to call marketing communicators’ and academicians’ attentions whowant to increase the recognition of companies’ products, services and brands tobecome a current issue in the marketplace using Mobile Viral Marketingapplications by reason of techno...

  17. Specific and sensitive quantitative RT-PCR of miRNAs with DNA primers

    DEFF Research Database (Denmark)

    Balcells, Ingrid; Cirera Salicio, Susanna; Busk, Peter K.

    2011-01-01

    BACKGROUND: MicroRNAs are important regulators of gene expression at the post-transcriptional level and play an important role in many biological processes. Due to the important biological role it is of great interest to quantitatively determine their expression level in different biological...... be designed with a success rate of 94%. The method was able to quantify synthetic templates over eight orders of magnitude and readily discriminated between microRNAs with single nucleotide differences. Importantly, PCR with DNA primers yielded significantly higher amplification efficiencies of biological...... samples than a similar method based on locked nucleic acids-spiked primers, which is in agreement with the observation that locked nucleic acid interferes with efficient amplification of short templates. The higher amplification efficiency of DNA primers translates into higher sensitivity and precision...

  18. Designing universal primers for the isolation of DNA sequences encoding Proanthocyanidins biosynthetic enzymes in Crataegus aronia

    Directory of Open Access Journals (Sweden)

    Zuiter Afnan

    2012-08-01

    Full Text Available Abstract Background Hawthorn is the common name of all plant species in the genus Crataegus, which belongs to the Rosaceae family. Crataegus are considered useful medicinal plants because of their high content of proanthocyanidins (PAs and other related compounds. To improve PAs production in Crataegus tissues, the sequences of genes encoding PAs biosynthetic enzymes are required. Findings Different bioinformatics tools, including BLAST, multiple sequence alignment and alignment PCR analysis were used to design primers suitable for the amplification of DNA fragments from 10 candidate genes encoding enzymes involved in PAs biosynthesis in C. aronia. DNA sequencing results proved the utility of the designed primers. The primers were used successfully to amplify DNA fragments of different PAs biosynthesis genes in different Rosaceae plants. Conclusion To the best of our knowledge, this is the first use of the alignment PCR approach to isolate DNA sequences encoding PAs biosynthetic enzymes in Rosaceae plants.

  19. Detection of gunshot primer residue on bone in an experimental setting-an unexpected finding.

    Science.gov (United States)

    Berryman, Hugh E; Kutyla, Alicja K; Russell Davis, J

    2010-03-01

    Pork ribs with intact muscle tissue were used in an experimental attempt to identify bullet wipe on bone at distances from 1 to 6 feet with 0.45 caliber, full metal jacket ammunition. This resulted in the unexpected finding of primer-derived gunshot residue (GSR) deep within the wound tract. Of significance is the fact that the GSR was deposited on the bone, under the periosteum, after the bullet passed through a Ziploc bag and c. 1 inch of muscle tissue. It is also important to note that the GSR persisted on the bone after the periosteum was forcibly removed. The presence of primer-derived GSR on bone provides the potential to differentiate gunshot trauma from blunt trauma when the bone presents an atypical gunshot wound. In this study, the presence of gunshot primer residue at a distance of 6 feet demonstrates the potential for establishing maximum gun-to-target distance for remote shootings.

  20. Microsatellite primers for a species of South African everlasting daisy (Helichrysum odoratissimum; Gnaphalieae, Asteraceae).

    Science.gov (United States)

    Glennon, Kelsey L; Cron, Glynis V

    2016-05-01

    Microsatellites were developed for the widespread Helichrysum odoratissimum (Asteraceae) to estimate gene flow across diploid populations and to test if gene flow occurs among other closely related lineages within this genus. Ten primer pairs were developed and tested using populations across South Africa; however, only seven primer pairs were polymorphic for the target species. The seven polymorphic primers amplified di- and trinucleotide repeats with up to 16 alleles per locus among 125 diploid individuals used for analyses. These markers can be used to estimate gene flow among populations of known ploidy level of H. odoratissimum to test evolutionary hypotheses. Furthermore, these markers amplify successfully in other Helichrysum species, including the other three taxonomic Group 4 species, and therefore can be used to inform taxonomic work on these species.

  1. Microsatellite primers for a species of South African everlasting daisy (Helichrysum odoratissimum; Gnaphalieae, Asteraceae)1

    Science.gov (United States)

    Glennon, Kelsey L.; Cron, Glynis V.

    2016-01-01

    Premise of the study: Microsatellites were developed for the widespread Helichrysum odoratissimum (Asteraceae) to estimate gene flow across diploid populations and to test if gene flow occurs among other closely related lineages within this genus. Methods and Results: Ten primer pairs were developed and tested using populations across South Africa; however, only seven primer pairs were polymorphic for the target species. The seven polymorphic primers amplified di- and trinucleotide repeats with up to 16 alleles per locus among 125 diploid individuals used for analyses. Conclusions: These markers can be used to estimate gene flow among populations of known ploidy level of H. odoratissimum to test evolutionary hypotheses. Furthermore, these markers amplify successfully in other Helichrysum species, including the other three taxonomic Group 4 species, and therefore can be used to inform taxonomic work on these species. PMID:27213125

  2. GST-PRIME: an algorithm for genome-wide primer design.

    Science.gov (United States)

    Leister, Dario; Varotto, Claudio

    2007-01-01

    The profiling of mRNA expression based on DNA arrays has become a powerful tool to study genome-wide transcription of genes in a number of organisms. GST-PRIME is a software package created to facilitate large-scale primer design for the amplification of probes to be immobilized on arrays for transcriptome analyses, even though it can be also applied in low-throughput approaches. GST-PRIME allows highly efficient, direct amplification of gene-sequence tags (GSTs) from genomic DNA (gDNA), starting from annotated genome or transcript sequences. GST-PRIME provides a customer-friendly platform for automatic primer design, and despite the relative simplicity of the algorithm, experimental tests in the model plant species Arabidopsis thaliana confirmed the reliability of the software. This chapter describes the algorithm used for primer design, its input and output files, and the installation of the standalone package and its use.

  3. Keeping communication mobile

    International Nuclear Information System (INIS)

    Latimer, Cole

    2010-01-01

    While mobile phones are ubiquitous in nearly all walks of Australia industry, there is still one sector were the technology has been unsurprisingly absent. Aside from the obvious operational hazards that a mobile phone would encounter when being used underground, such as harsh working conditions, dust and heavy knocks, the technology required to actually use a mobile at depths has been in the early stages for some time. However and Australian company, Mine Site Technologies, has taken a leap into this space by designing the world's first mobile phone for underground mining

  4. Mobile Solar Tracker Facility

    Data.gov (United States)

    Federal Laboratory Consortium — NIST's mobile solar tracking facility is used to characterize the electrical performance of photovoltaic panels. It incorporates meteorological instruments, a solar...

  5. Programming the Mobile Web

    CERN Document Server

    Firtman, Maximiliano

    2010-01-01

    Today's market for mobile apps goes beyond the iPhone to include BlackBerry, Nokia, Windows Phone, and smartphones powered by Android, webOS, and other platforms. If you're an experienced web developer, this book shows you how to build a standard app core that you can extend to work with specific devices. You'll learn the particulars and pitfalls of building mobile apps with HTML, CSS, and other standard web tools. You'll also explore platform variations, finicky mobile browsers, Ajax design patterns for mobile, and much more. Before you know it, you'll be able to create mashups using Web 2.

  6. Mobile Test Capabilities

    Data.gov (United States)

    Federal Laboratory Consortium — The Electrical Power Mobile Test capabilities are utilized to conduct electrical power quality testing on aircraft and helicopters. This capability allows that the...

  7. Best Sale Mobile Application

    OpenAIRE

    Chittugnanamoorthy, Balakumar

    2014-01-01

    The aim of this thesis was to find a best way to advertise short-term sales and reduce paper waste. Another aim was to help the seller to identify a potential customer for a specific product, by means of providing a number of people accessing an advertisement. A mobile phone is one of the widely used electronic devices by many people. Modern mobile phones support a good internet connection. Also, people carry their mobile devices with them even outside their homes. So a mobile application ...

  8. Proxemic Mobile Collocated Interactions

    DEFF Research Database (Denmark)

    Porcheron, Martin; Lucero, Andrés; Quigley, Aaron

    2016-01-01

    and their digital devices (i.e. the proxemic relationships). Building on the ideas of proxemic interactions, this workshop is motivated by the concept of ‘proxemic mobile collocated interactions’, to harness new or existing technologies to create engaging and interactionally relevant experiences. Such approaches......Recent research on mobile collocated interactions has been looking at situations in which collocated users engage in collaborative activities using their mobile devices. However, existing practices fail to fully account for the culturally-dependent spatial relationships between people...... in exploring proxemics and mobile collocated interactions....

  9. Practical mobile forensics

    CERN Document Server

    Bommisetty, Satish; Mahalik, Heather

    2014-01-01

    The book is an easy-to-follow guide with clear instructions on various mobile forensic techniques. The chapters and the topics within are structured for a smooth learning curve, which will swiftly empower you to master mobile forensics. If you are a budding forensic analyst, consultant, engineer, or a forensic professional wanting to expand your skillset, this is the book for you. The book will also be beneficial to those with an interest in mobile forensics or wanting to find data lost on mobile devices. It will be helpful to be familiar with forensics in general but no prior experience is re

  10. Cooperative Mobile Web Browsing

    DEFF Research Database (Denmark)

    Perrucci, GP; Fitzek, FHP; Zhang, Qi

    2009-01-01

    This paper advocates a novel approach for mobile web browsing based on cooperation among wireless devices within close proximity operating in a cellular environment. In the actual state of the art, mobile phones can access the web using different cellular technologies. However, the supported data......-range links can then be used for cooperative mobile web browsing. By implementing the cooperative web browsing on commercial mobile phones, it will be shown that better performance is achieved in terms of increased data rate and therefore reduced access times, resulting in a significantly enhanced web...

  11. Mobile Project Management

    Directory of Open Access Journals (Sweden)

    Catalin BOJA

    2006-01-01

    Full Text Available Based on the development of new communication and data transfer technologies, the mobile solutions for the management process have been able to provide new ways to conduct management actions. This environment describes methods and tools available only here, which will bring information, speed and efficiency to any stage and component of the management process. The paper takes into discussion the impact of the technological development on the management process paradigm. The paper presents the main aspects regarding the business and management models used in mobile management. The role of mobile multimedia informatics applications in mobile management is highlighted.

  12. Mobility Charters and Manifestos

    DEFF Research Database (Denmark)

    Jensen, Ole B.

    2010-01-01

    This paper explore a number of different cases of articulating notions of ‘correct’ mobility behavior and practice by looking into charters, manifestos and codes of mobility regulation. Within such discourses of ‘correct mobility’ more or less subtle expressions of power as well as normative and ...... ‘Highway Code Booklets’ from the 1930’s, 40’s and 50’s, the ‘City Slow Charter’, the ‘New Urbanism Charter’ as attempts to codify and order mobility and mobile practices.......This paper explore a number of different cases of articulating notions of ‘correct’ mobility behavior and practice by looking into charters, manifestos and codes of mobility regulation. Within such discourses of ‘correct mobility’ more or less subtle expressions of power as well as normative...... and ethical positions on mobility prevail. Such ‘imagined correct mobility behavior’ are drawing on larger issues of societal change that need to be brought out in a critical analysis and discussion reflecting the attempts to control, design and orchestrate mobility patterns. The paper therefore argues within...

  13. The setup of a mobile mobility panel for the Netherlands

    NARCIS (Netherlands)

    Geurs, Karst Teunis; Veenstra, Sander; Thomas, Tom

    2013-01-01

    This paper describes the setup of the Dutch Mobile Mobility Panel project, in which GPS-enabled mobile phones (smartphones) are used as a passive multiple-week and multiple-year travel behaviour data collection tool. The data collection methodology used in the Dutch Mobile Mobility Panel comprised

  14. Mobile lifestyles : Conceptualizing heterogeneity in mobile youth culture

    NARCIS (Netherlands)

    Vanden Abeele, M.M.P.

    2014-01-01

    Adolescents’ characteristic understanding and use of mobile phones have led observers to speak of a “mobile youth culture.” This article explores whether we can differentiate lifestyles within mobile youth culture. We construct a user typology of Flemish adolescent mobile phone users based on mobile

  15. Clorhidrorrea congénita:: primer reporte en Cuba Congenital chlorhydria:: first report in Cuba

    Directory of Open Access Journals (Sweden)

    Carlos Ramírez Pérez

    2009-12-01

    Full Text Available En el presente trabajo se exponen los antecedentes prenatales, perinatales y posnatales de un lactante de 6 meses de edad, del sexo masculino, con clorhidrorrea congénita, así como el cuadro clínico, diagnóstico y tratamiento utilizado. Un elemento significativo lo constituyó la expulsión anal de abundante líquido no meconial desde las primeras horas de nacido, así como alcalosis metabólica grave y la presencia de desnutrición rápidamente progresiva. En los exámenes complementarios se constató hipocloremia de un 50 % con respecto a las cifras de referencia y un pH sanguíneo mayor de 7,50. El diagnóstico confirmatorio se obtuvo al comprobar concentraciones de cloro en heces fecales superiores a las de la suma de sodio y potasio. Se proponen indicadores diagnósticos prenatales entre los que tienen gran valor la consanguinidad, el polihidramnios y los resultados del ultrasonido en el tercer trimestre del embarazo. El diagnóstico precoz permitió establecer el tratamiento y evitó el frecuente desenlace fatal. Es el primer caso de esta enfermedad que se informa en el país.In present paper are showed the prenatal, perinatal and postnatal backgrounds from a male breast-fed baby aged 6 months presenting with congenital chlorhydria, as well as the clinical picture, diagnosis and treatment applied. A significant element was the anal expulsion of non-meconium abundant fluid from the first hours of born, as well as a severe metabolic alkalosis and the presence of a quickly progressive malnutrition. In complementary examinations was confirmed a 50% hypochloremia regarding the reference figures and a blood pH over 7,50. Confirmatory diagnosis was achieved verifying the chlorine concentrations in feces higher to that of the sum of sodium and potassium. Prenatal diagnostic indicators are proposed those with higher value including the consanguinity, polyhydramnios and the US results during the third trimester of pregnancy. Early diagnosis

  16. Mobile communications – on standards, classifications and generations

    DEFF Research Database (Denmark)

    Tadayoni, Reza; Henten, Anders; Sørensen, Jannick Kirk

    The research question addressed in this paper is concerned with the manners in which the general technological progress in mobile communications is presented and the reasons for the differences in these manners of presentation. The relevance of this research question is that the different....... In common parlance, progress in mobile technologies is mostly referred to as generations. In the International Telecommunication Union (ITU), the classification terminology is that of International Mobile Telecommunication (IMT) standards. In the specialized standards body with a central position...... in the standardization of core mobile technologies, namely 3GPP (3rd Generation Partnership Project), the terminology of ‘releases’ is used. In order to address the research question, the paper uses an analytical framework based on the differences and relationships between the concepts of standards, classifications...

  17. Transfer of primer binding site-mutated simian immunodeficiency virus vectors by genetically engineered artificial and hybrid tRNA-like primers

    DEFF Research Database (Denmark)

    Hansen, A C; Grunwald, T; Lund, Anders Henrik

    2001-01-01

    could be obtained by cotransfection of a gene for an engineered tRNA(Pro)-tRNA hybrid with a match to PBS-Pro. The importance of tRNA backbone identity was further analyzed by complementing the PBS-X2 vector with a gene for a matching x2 primer with a tRNA backbone, which led to three- to fourfold...

  18. Detection of enteroviruses and hepatitis a virus in water by consensus primer multiplex RT-PCR

    Science.gov (United States)

    Li, Jun-Wen; Wang, Xin-Wei; Yuan, Chang-Qing; Zheng, Jin-Lai; Jin, Min; Song, Nong; Shi, Xiu-Quan; Chao, Fu-Huan

    2002-01-01

    AIM: To develop a rapid detection method of enteroviruses and Hepatitis A virus (HAV). METHODS: A one-step, single-tube consensus primers multiplex RT-PCR was developed to simultaneously detect Poliovirus, Coxsackie virus, Echovirus and HAV. A general upstream primer and a HAV primer and four different sets of primers (5 primers) specific for Poliovirus, Coxsacki evirus, Echovirus and HAV cDNA were mixed in the PCR mixture to reverse transcript and amplify the target DNA. Four distinct amplified DNA segments representing Poliovirus, Coxsackie virus, Echovirus and HAV were identified by gel electrophoresis as 589-, 671-, 1084-, and 1128 bp sequences, respectively. Semi-nested PCR was used to confirm the amplified products for each enterovirus and HAV. RESULTS: All four kinds of viral genome RNA were detected, and producing four bands which could be differentiated by the band size on the gel. To confirm the specificity of the multiplex PCR products, semi-nested PCR was performed. For all the four strains tested gave positive results. The detection sensitivity of multiplex PCR was similar to that of monoplex RT-PCR which was 24 PFU for Poliovrus, 21 PFU for Coxsackie virus, 60 PFU for Echovirus and 105 TCID50 for HAV. The minimum amount of enteric viral RNA detected by semi-nested PCR was equivalent to 2.4 PFU for Poliovrus, 2.1 PFU for Coxsackie virus, 6.0 PFU for Echovirus and 10.5 TCID50 for HAV. CONCLUSION: The consensus primers multiplex RT-PCR has more advantages over monoplex RT-PCR for enteric viruses detection, namely, the rapid turnaround time and cost effectiveness. PMID:12174381

  19. Nonspecific amplification of human DNA by Streptococcus pneumoniae LytA primer

    Directory of Open Access Journals (Sweden)

    Helen Hencida Thangamony

    2018-01-01

    Full Text Available Background: Determination of various analytical parameters is essential for the validation of primers used for in-house nucleic acid amplification tests. While standardising a high-resolution melt analysis (HRMA for detection of Streptococcus pneumoniae in acute pyogenic meningitis, we encountered non-specific amplification of certain base pair sequences of human DNA by Centers for Disease Control & Prevention, USA recommended S. pneumoniae LytA primer. Materials and Methods: HRMA was standardised using DNA extracted from an ATCC strain of S. pneumoniae using SP LytA F373 primer and Type-it HRMTM polymerase chain reaction kit in Rotor-Gene Q Thermal Cycler according to the manufacturer's instructions. Specificity of the primers was determined in dry and wet laboratory experiments against diverse related and unrelated microbial pathogens by HRMA and on DNA extracted from unspiked clinical samples negative for SP DNA. Sensitivity was determined by calculating lower limit of detection threshold in experiments with spiked samples. The amplicon from spiked experiments was sequenced and analysed through Gene Bank. Results: Our dry/wet laboratory experiments showed two separate curves and different Tm values indicating certain non-specific amplification by the primer. Basic Local Alignment Search Tool (BLAST analysis of the amplicon obtained in the spiked experiment showed sequences of human chromosome 20 associated with Homo sapiens protein tyrosine phosphatase, receptor type T gene. The problem was resolved by stopping the reaction at 30th Ct cycle and observing the Tm values. Conclusion: Since HRMA is done without a specific probe, one should be aware of non-specific amplifications while using primers for HRMA of human clinical samples.

  20. Hubungan Stres dengan Kejadian Dismenore Primer pada Mahasiswi Pendidikan Dokter Fakultas Kedokteran Universitas Andalas

    Directory of Open Access Journals (Sweden)

    Diana Sari

    2015-05-01

    Full Text Available AbstrakDismenore primer merupakan nyeri menstruasi yang dijumpai tanpa kelainan yang nyata pada alat-alat genital. Lebih dari 50% wanita mengalami dismenore primer dan 15% diantaranya mengalami nyeri yang hebat.Tujuan penelitian ini adalah untuk menentukan hubungan tingkat stres dengan derajat dismenore primer. Penelitian dilakukan pada mahasiswi pendidikan dokter Fakultas Kedokteran Universitas Andalas angkatan 2009 dan 2010. Desain penelitian ini menggunakan cross sectional study dengan jumlah subjek 165 orang. Pengumpulan data dari responden dilakukan dengan wawancara terpimpin (pengisian kuesioner. Analisa statistik yang digunakan adalah uji chi-square dan uji koefisien korelasi sederhana. Uji chi-square menunjukan ada hubungan yang bermakna antara stres dengan kejadian dismenore primer dan uji statistik koefisien korelasi sederhana menunjukkan ada hubungan yang bermakna dengan korelasi agak lemah antara tingkat stres dengan derajat dismenore primer.Kata kunci: stres, dismenore primer, mahasiswi fakultas kedokteran AbstractPrimary dysmenorrhoea is menstrual pain founded without real abnormalities in genital organs. More than 50% woman experiance it and 15% had severe pain. The objective of this study was to determine relationship between stress and primary dysmenorrhoea. Research was executed to education medical female students medical faculty of Andalas University class of 2009 and 2010. This research use cross sectional study design with 165 subjects. Data was collected by guided interview. Statistic analysis use chi-square test and simple correlation test. Chi-square test show there is significant relationship between stress and primary dysmenorrhoea and simple coefficient test show there is weak correlation between stress levels and degree of primary dysmenorrhoea.Keywords: stress, primary dysmenorrhoea, female student of medical faculty

  1. Pengembangan Sejumlah Primer untuk Reverse Transcriptase Polymerase Chain Reaction Guna Melacak Virus Flu Burung di Indonesia (DEVELOPMENt OF PRIMERS FOR REVERSE TRANSCRIPTASE POLYMERASE CHAIN REACTION TO DETECT AVIAN INFLUENZA VIRUS IN INDONESIA

    Directory of Open Access Journals (Sweden)

    Ni Luh Putu Indi Dharmayanti

    2016-07-01

    Full Text Available Until recently, two clades of of avian influenza viruses (AIVs designated as 2.3.2 and 2.2.3 havebeen circulating in Indonesia. Mutations of AIV genes have cretaed many more variants of the virus. It istherefore important to evaluate the appropriate methods used for the detection and diagnosis of AI virusin the field. Reverse Transcriptase-Polymerase Chain Reaction (RT-PCR have been used as a standardmethod for detection of AIV in many laboratories in Indonesia. The success of RT-PCR for detection ofAIV virus is dependent on the nucleotide sequences of primer that match with the circulating of AIVs. Theaims of this study was to develop RT-PCR by designing primers for H5 subtype specific to the circulatingAIVs in the field. The primers were designed using Primer Design software, and optimization andvalidation of the primer were conducted using AIVs that have been characterized in the previous study.The primers were then used RT-PCR using AIV isolates from field samples and their sensitivity andspecificity were then determined. The results showed that the H5 primers designed in this study, H5-IDand H5-NLP, was able to detect the AIVs in field samples better than the H5-specific primers have beenused previously. In conclusion, H5 primers designed based on recent viruses in the field showed betterresults in the detection of AI virus as compared to the previous primers. As AIV-H5N1 subtype in the fieldwill continue to change and evolve, the use of primers designed in this study is recommended for diagnosisof H5 AIV.

  2. Progressive Pigmentary Purpura

    Science.gov (United States)

    ... Category: Share: Yes No, Keep Private Progressive Pigmentary Purpura Share | Progressive pigmentary purpura (we will call it PPP) is a group ... conditions ( Schamberg's disease , Lichenoid dermatitis of Gourgerot-Blum, purpura annularis telangiectodes of Majocchi and Lichen aureus). Schamberg's ...

  3. Primary Progressive Aphasia

    Science.gov (United States)

    ... which cause different symptoms. Semantic variant primary progressive aphasia Symptoms include these difficulties: Comprehending spoken or written ... word meanings Naming objects Logopenic variant primary progressive aphasia Symptoms include: Having difficulty retrieving words Frequently pausing ...

  4. The progressive tax

    OpenAIRE

    Estrada, Fernando

    2010-01-01

    This article describes the argumentative structure of Hayek on the relationship between power to tax and the progressive tax. It is observed throughout its work giving special attention to two works: The Constitution of Liberty (1959) and Law, Legislation and Liberty, vol3; The Political Order of Free People, 1979) Hayek describes one of the arguments most complete information bout SFP progressive tax systems (progressive tax). According to the author the history of the tax progressive system...

  5. Gold nanoparticle-assisted primer walking for closing the human chromosomal gap

    DEFF Research Database (Denmark)

    Li, H; Shi, B; Li, X

    2013-01-01

    The finished sequence of the human genome still contains 260 euchromatic gaps. All the PCR-based genome walking techniques used to close gaps have common limitations, such as low efficiency and low specificity. We herein describe a strategy to solve this problem by employing gold nanoparticles (Au......NPs) to improve the efficiency in primer walking amplification. We used this strategy to close a gap in human chromosome 5 containing a DNA stretch composed of the 12SAT repeat. The obtained gap sequence is highly conserved among several mammalian genomes. The demonstrated AuNP-assisted primer walking strategy...

  6. One fungus, which genes? Development and assessment of universal primers for potential secondary fungal DNA barcodes.

    Science.gov (United States)

    Stielow, J B; Lévesque, C A; Seifert, K A; Meyer, W; Iriny, L; Smits, D; Renfurm, R; Verkley, G J M; Groenewald, M; Chaduli, D; Lomascolo, A; Welti, S; Lesage-Meessen, L; Favel, A; Al-Hatmi, A M S; Damm, U; Yilmaz, N; Houbraken, J; Lombard, L; Quaedvlieg, W; Binder, M; Vaas, L A I; Vu, D; Yurkov, A; Begerow, D; Roehl, O; Guerreiro, M; Fonseca, A; Samerpitak, K; van Diepeningen, A D; Dolatabadi, S; Moreno, L F; Casaregola, S; Mallet, S; Jacques, N; Roscini, L; Egidi, E; Bizet, C; Garcia-Hermoso, D; Martín, M P; Deng, S; Groenewald, J Z; Boekhout, T; de Beer, Z W; Barnes, I; Duong, T A; Wingfield, M J; de Hoog, G S; Crous, P W; Lewis, C T; Hambleton, S; Moussa, T A A; Al-Zahrani, H S; Almaghrabi, O A; Louis-Seize, G; Assabgui, R; McCormick, W; Omer, G; Dukik, K; Cardinali, G; Eberhardt, U; de Vries, M; Robert, V

    2015-12-01

    The aim of this study was to assess potential candidate gene regions and corresponding universal primer pairs as secondary DNA barcodes for the fungal kingdom, additional to ITS rDNA as primary barcode. Amplification efficiencies of 14 (partially) universal primer pairs targeting eight genetic markers were tested across > 1 500 species (1 931 strains or specimens) and the outcomes of almost twenty thousand (19 577) polymerase chain reactions were evaluated. We tested several well-known primer pairs that amplify: i) sections of the nuclear ribosomal RNA gene large subunit (D1-D2 domains of 26/28S); ii) the complete internal transcribed spacer region (ITS1/2); iii) partial β -tubulin II (TUB2); iv) γ-actin (ACT); v) translation elongation factor 1-α (TEF1α); and vi) the second largest subunit of RNA-polymerase II (partial RPB2, section 5-6). Their PCR efficiencies were compared with novel candidate primers corresponding to: i) the fungal-specific translation elongation factor 3 (TEF3); ii) a small ribosomal protein necessary for t-RNA docking; iii) the 60S L10 (L1) RP; iv) DNA topoisomerase I (TOPI); v) phosphoglycerate kinase (PGK); vi) hypothetical protein LNS2; and vii) alternative sections of TEF1α. Results showed that several gene sections are accessible to universal primers (or primers universal for phyla) yielding a single PCR-product. Barcode gap and multi-dimensional scaling analyses revealed that some of the tested candidate markers have universal properties providing adequate infra- and inter-specific variation that make them attractive barcodes for species identification. Among these gene sections, a novel high fidelity primer pair for TEF1α, already widely used as a phylogenetic marker in mycology, has potential as a supplementary DNA barcode with superior resolution to ITS. Both TOPI and PGK show promise for the Ascomycota, while TOPI and LNS2 are attractive for the Pucciniomycotina, for which universal primers for ribosomal subunits often fail.

  7. Beneath sci-fi sound: primer, science fiction sound design, and American independent cinema

    OpenAIRE

    Johnston, Nessa

    2012-01-01

    Primer is a very low budget science-fiction film that deals with the subject of time travel; however, it looks and sounds quite distinctively different from other films associated with the genre. While Hollywood blockbuster sci-fi relies on “sound spectacle” as a key attraction, in contrast Primer sounds “lo-fi” and screen-centred, mixed to two channel stereo rather than the now industry-standard 5.1 surround sound. Although this is partly a consequence of the economics of its production, the...

  8. Within- and cross-firm mobility and earnings growth

    DEFF Research Database (Denmark)

    Frederiksen, Anders; Halliday, Timothy; Koch, Alexander Karl

    While it is well established that both promotions within firms and mobility across firms lead to substantial earnings progression, few studies offer an integrated analysis of the effects of these two types of mobility on earnings growth. To do this, we exploit a large Danish panel data set and te...... deductable pension contributions and more expensive real estate or financed consumption where interest is tax deductable....

  9. Mobilizing community energy

    International Nuclear Information System (INIS)

    Bomberg, Elizabeth; McEwen, Nicola

    2012-01-01

    What explains the galvanising of communities to participate actively in energy projects? How do groups mobilize to overcome the often formidable barriers highlighted in the existing literature? Drawing on original qualitative research of 100 community energy groups in Scotland, including six in-depth case studies, we explain how effective mobilization occurs and the political dynamics surrounding such mobilization. To capture these dynamics, we adapt theories offered by literature on social movements, with a particular focus on resource mobilization theories. Applying our adapted framework, we identify two particular sets of resources shaping community energy mobilization: (i) structural resources, which refer to the broad political context structuring and constraining opportunities for community energy mobilization; and (ii) symbolic resources—less tangible resources used to galvanise participants. We investigate to what extent our case study groups were able to draw upon and exploit these resources. We find that structural resources can either facilitate or hinder mobilization; what matters is how state resources are exploited and constraints mitigated. The use of symbolic resources was highly effective in aiding mobilization. Each of the groups examined – despite their considerable variation – effectively exploited symbolic resources such as shared identity or desire for strong, self reliant communities. - Highlights: ► Explains how/why community energy groups mobilize and the political dynamics surrounding it. ► Draws on original qualitative research of 100 community energy groups in Scotland. ► Identifies two particular sets of resources (structural and symbolic) and their importance. ► Explains how these resources shape community energy mobilization in Scotland. ► Provides an original application of resource mobilization theory to the field of energy studies.

  10. A Mobile Augmented Reality Emulator for Android

    Directory of Open Access Journals (Sweden)

    Donald Munro

    2017-07-01

    Full Text Available Augmented Reality (AR provides a fusion of the real and virtual worlds by superimposing virtual objects on real world scenery. The implementation of AR on mobile devices is known as Mobile Augmented Reality (MAR. MAR is in its infancy and MAR development software is in the process of maturing. Dating back to the origin of Computer Science as an independent field, software development tools have been an integral part of the process of software creation. MAR, being a relatively new technology, is still lacking such related software development tools. With the rapid progression of mobile devices, the development of MAR applications fusing advanced Computer Vision techniques with mobile device sensors have become increasingly feasible. However, testing and debugging of MAR applications present a new challenge in that they require the developer be at the location that is being augmented at some point during the development process. In this research study, a MAR recorder application was developed as well as emulation class libraries for Android devices that allows the recording and off-site playback of video, location and motion sensor data. The research objective was to provide a software emulator which provides debugging, testing and prototyping capabilities for a MAR application including the ability to emulate the combination of computer vision with locational and motion sensors using previously recorded data. The emulator was evaluated using different mobile technologies. The results indicate that this research could assist developers of MAR applications to implement applications more rapidly, without being at the location.

  11. Mobile human-computer interaction perspective on mobile learning

    CSIR Research Space (South Africa)

    Botha, Adèle

    2010-10-01

    Full Text Available Applying a Mobile Human Computer Interaction (MHCI) view to the domain of education using Mobile Learning (Mlearning), the research outlines its understanding of the influences and effects of different interactions on the use of mobile technology...

  12. Security for Mobility

    DEFF Research Database (Denmark)

    Nielson, Hanne Riis; Nielson, Flemming; Buchholtz, Mikael

    2004-01-01

    We show how to use static analysis to provide information about security issues related to mobility. First the syntax and semantics of Mobile Ambients is reviewed and we show how to obtain a so-called 0CFA analysis that can be implemented in polynomial time. Next we consider discretionary access...

  13. Security for Mobility

    DEFF Research Database (Denmark)

    Nielson, Hanne Riis; Nielson, Flemming; Buchholtz, Mikael

    2002-01-01

    We show how to use static analysis to provide information about security issues related to mobility. First the syntax and semantics of Mobile Ambients is reviewed and we show how to obtain a so-called 0CFA analysis that can be implemented in polynomial time. Next we consider discretionary access...

  14. Mobile banking in Asia

    OpenAIRE

    Anne Ho

    2010-01-01

    Technology has transformed the banking industry with the introduction of mobile banking services that offer unprecedented convenience and accessibility to customers. This Asia Focus report describes the various approaches to mobile banking in Asia, and examines how particular countries have addressed regulatory issues.

  15. Mobile Christian - shuttle flight

    Science.gov (United States)

    2009-01-01

    Erin Whittle, 14, (seated) and Brianna Johnson, 14, look on as Louis Stork, 13, attempts a simulated landing of a space shuttle at StenniSphere. The young people were part of a group from Mobile Christian School in Mobile, Ala., that visited StenniSphere on April 21.

  16. Designing for mobile interaction

    DEFF Research Database (Denmark)

    Nazzi, Elena

    2009-01-01

    The theme of this PhD project is designing for mobile interaction with devices and services, for the accessing, making, and sharing of information, taking into account the dynamic physical and social settings that embrace this interaction. To narrow down this theme, the whole project focuses...... on the exploitation of social interaction --- in particular among senior citizens --- to enhance and support mobile interaction....

  17. Mobile phone; Mobiltelefon

    Energy Technology Data Exchange (ETDEWEB)

    2009-07-01

    Almost the entire Norwegian population has cell phone. The usefulness of the cell phone is great, but can use a mobile phone to health or discomfort? How can exposure be reduced? NRPA follows research and provides advice on mobile phone use. (AG)

  18. Mastering Mobile Security

    Science.gov (United States)

    Panettieri, Joseph C.

    2007-01-01

    Without proper security, mobile devices are easy targets for worms, viruses, and so-called robot ("bot") networks. Hackers increasingly use bot networks to launch massive attacks against eCommerce websites--potentially targeting one's online tuition payment or fundraising/financial development systems. How can one defend his mobile systems against…

  19. Wireless mobile Internet security

    CERN Document Server

    Rhee, Man Young

    2013-01-01

      The mobile industry for wireless cellular services has grown at a rapid pace over the past decade. Similarly, Internet service technology has also made dramatic growth through the World Wide Web with a wire line infrastructure. Realization for complete wired/wireless mobile Internet technologies will become the future objectives for convergence of these technologies thr

  20. Mobile communication security

    NARCIS (Netherlands)

    Broek, F.M.J. van den

    2016-01-01

    Security of the mobile network Fabian van den Broek We looked at the security of the wireless connection between mobile phone and cell towers and suggested possible improvements. The security was analysed on a design level, by looking at the protocols and encryption techniques, but also on an

  1. Mobile spectrometric laboratory

    International Nuclear Information System (INIS)

    Isajenko, K.A.; Lipinski, P.

    2002-01-01

    The article presents the Mobile Spectrometric Laboratory used by Central Laboratory for Radiological Protection since year 2000. The equipment installed in the Mobile Laboratory and its uses is described. The results of international exercises and intercalibrations, in which the Laboratory participated are presented. (author)

  2. Mobile Apps for Librarians

    Science.gov (United States)

    Power, June L.

    2013-01-01

    In an increasing mobile environment, library and reading-related activities often take place on a phone or tablet device. Not only does this mean that library Web sites must keep mobile navigability in mind, but also develop and utilize apps that allow patrons to interact with information and with libraries. While apps do not serve every purpose,…

  3. Mobile-first Bootstrap

    CERN Document Server

    Magno, Alexandre

    2013-01-01

    A practical, step-by-step tutorial on developing websites for mobile using Bootstrap.This book is for anyone who wants to get acquainted with the new features available in Bootstrap 3 and who wants to develop websites with the mobile-first feature of Bootstrap. The reader should have a basic knowledge of Bootstrap as a frontend framework.

  4. Understanding mobile information needs

    OpenAIRE

    Church, Karen; Smyth, Barry

    2008-01-01

    In this paper we describe the results of a four-week diary study of mobile information needs, focusing on the intent behind mobile needs and the importance on context on such needs. We identified three key intents among diary entries: informational, geographical and personal information management (PIM). Furthermore, we found many of these information needs have high temporal and location dependencies.

  5. Mobile Informal Learning

    NARCIS (Netherlands)

    Börner, Dirk; Glahn, Christian; Specht, Marcus

    2009-01-01

    Börner, D., Glahn, C., & Specht, M. (2009). Mobile Informal Learning. Presentation for the Education in the Wild: contextual and location-based mobile learning in action workshop at the STELLAR Alpine Rendez-Vous 2009. November, 30-December, 3, 2009, Garmisch-Partenkirchen, Germany.

  6. Innovazione nel mobile learning

    Directory of Open Access Journals (Sweden)

    Immaculada Arnedillo-Sànchez

    2008-01-01

    Full Text Available Descrizione, da una prospettiva europea, dell’innovazione nel settore del mobile learning e l’utilizzabilita’ del mobile learning in contesti educativi. Vengono illustrate i principali progetti europei di m-learning e si esamina le prospettive pedagogiche e teoriche relative al campo.

  7. MELCOR computer code manuals: Primer and user's guides, Version 1.8.3 September 1994. Volume 1

    International Nuclear Information System (INIS)

    Summers, R.M.; Cole, R.K. Jr.; Smith, R.C.; Stuart, D.S.; Thompson, S.L.; Hodge, S.A.; Hyman, C.R.; Sanders, R.L.

    1995-03-01

    MELCOR is a fully integrated, engineering-level computer code that models the progression of severe accidents in light water reactor nuclear power plants. MELCOR is being developed at Sandia National Laboratories for the US Nuclear Regulatory Commission as a second-generation plant risk assessment tool and the successor to the Source Term Code Package. A broad spectrum of severe accident phenomena in both boiling and pressurized water reactors is treated in MELCOR in a unified framework. These include: thermal-hydraulic response in the reactor coolant system, reactor cavity, containment, and confinement buildings; core heatup, degradation, and relocation; core-concrete attack; hydrogen production, transport, and combustion; fission product release and transport; and the impact of engineered safety features on thermal-hydraulic and radionuclide behavior. Current uses of MELCOR include estimation of severe accident source terms and their sensitivities and uncertainties in a variety of applications. This publication of the MELCOR computer code manuals corresponds to MELCOR 1.8.3, released to users in August, 1994. Volume 1 contains a primer that describes MELCOR's phenomenological scope, organization (by package), and documentation. The remainder of Volume 1 contains the MELCOR Users' Guides, which provide the input instructions and guidelines for each package. Volume 2 contains the MELCOR Reference Manuals, which describe the phenomenological models that have been implemented in each package

  8. Children's velo-mobility

    DEFF Research Database (Denmark)

    Carstensen, Trine Agervig; Nielsen, Thomas Sick; Olafsson, Anton Stahl

    2014-01-01

    . How cycling is learned and constituted, and how cycling skills are consolidated, extended and turned into a stabilized practice remains unstudied. Drawing on in-depth interview data from the region of Copenhagen, Denmark, among families with children (N=20) the paper provides new insights into how......Sustainable mobilities play a dominate role in low carbon futures and cycling is an integral element. Children are heirs of transport cultures and crucial for future sustainable mobility. Moreover cycling is important for children’s independent mobility and geographical experience. Dominating...... approaches in transport research, including cycling, understand travel behaviour individualistic and lack to grasp the relational complexities, which are inevitable when considering children’s mobilities. Furthermore has children’s cycling largely been studied as independent mobility and active school travel...

  9. Mobilities and Representations

    DEFF Research Database (Denmark)

    Thelle, Mikkel

    2017-01-01

    to consider how they and their peers are currently confronting representations of mobility. This is particularly timely given the growing academic focus on practices, material mediation, and nonrepresentational theories, as well as on bodily reactions, emotions, and feelings that, according to those theories......As the centerpiece of the eighth T2M yearbook, the following interview about representations of mobility signals a new and exciting focus area for Mobility in History. In future issues we hope to include reviews that grapple more with how mobilities have been imagined and represented in the arts......, literature, and film. Moreover, we hope the authors of future reviews will reflect on the ways they approached those representations. Such commentaries would provide valuable methodological insights, and we hope to begin that effort with this interview. We have asked four prominent mobility scholars...

  10. Mobile Collocated Interactions

    DEFF Research Database (Denmark)

    Lucero, Andrés; Clawson, James; Lyons, Kent

    2015-01-01

    Mobile devices such as smartphones and tablets were originally conceived and have traditionally been utilized for individual use. Research on mobile collocated interactions has been looking at situations in which collocated users engage in collaborative activities using their mobile devices, thus...... going from personal/individual toward shared/multiuser experiences and interactions. However, computers are getting smaller, more powerful, and closer to our bodies. Therefore, mobile collocated interactions research, which originally looked at smartphones and tablets, will inevitably include ever......-smaller computers, ones that can be worn on our wrists or other parts of the body. The focus of this workshop is to bring together a community of researchers, designers and practitioners to explore the potential of extending mobile collocated interactions to the use of wearable devices....

  11. MOBILIZING KNOWLEDGE IN DENMARK

    DEFF Research Database (Denmark)

    Holm, Claus

    2011-01-01

    Knowledge mobilization is not only a new expression in a Danish context. It is also an interesting concept to introduce and discuss. For doesn’t knowledge mobilization have more – or, at least, as much – to do with politics as with education research or education in itself? Doesn’t modern knowledge...... mobilization have to do with a new political will to mobilize the population by creating a connection between education research and education? On the basis of this report on the Danish efforts with respect to ’knowledge mobilization’, these questions can be answered affirmatively; the extent of knowledge...... competition state – that is to be realized by fulfilling the ambitions for comprehensive knowledge mobilization through education.1 On the other hand, Denmark is having a hard time finding a broad consensus when what is, in principle, supposed to be a common political will is to be translated into knowledge...

  12. A secure wireless mobile-to-server link

    Science.gov (United States)

    Kumar, Abhinav; Akopian, David; Agaian, Sos; Creutzburg, Reiner

    2009-02-01

    Modern mobile devices are some of the most technologically advanced devices that people use on a daily basis and the current trends indicate continuous growth in mobile phone applications. Nowadays phones are equipped with cameras that can capture still images and video, they are equipped with software that can read, convert, manipulate, communicate and save multimedia in multiple formats. This tremendous progress increased the volumes of communicated sensitive information which should be protected against unauthorized access. This paper discusses two general approaches for data protection, steganography and cryptography, and demonstrates how to integrate such algorithms with a mobile-toserver link being used by many applications.

  13. Mobile Health Information System: A Mobile App

    African Journals Online (AJOL)

    Steve

    It is predicted that mobile technology will have a big impact in healthcare, especially in developing countries. .... Information dissemination is done with the use of posters, fliers and mass media. Below is a picture of what it looks like. Fig 3.2: ...

  14. Mobility management in the future mobile network

    NARCIS (Netherlands)

    Karimzadeh Motallebi Azar, Morteza

    2018-01-01

    The current mobile network architectures are heavily hierarchical, which implies that all traffic must be traversed through a centralized core entity. This makes the network prone to several limitations, e.g., suboptimal communication paths, low scalability, signaling overhead, and single point of

  15. Forced selection of a human immunodeficiency virus type 1 variant that uses a non-self tRNA primer for reverse transcription: Involvement of viral RNA sequences and the reverse transcriptase enzyme

    NARCIS (Netherlands)

    Abbink, Truus E. M.; Beerens, Nancy; Berkhout, Ben

    2004-01-01

    Human immunodeficiency virus type 1 uses the tRNA(3)(Lys) molecule as a selective primer for reverse transcription. This primer specificity is imposed by sequence complementarity between the tRNA primer and two motifs in the viral RNA genome: the primer-binding site (PBS) and the primer activation

  16. Microsatellite Primers for Parkia biglobosa (Fabaceae: Mimosoideae) Reveal that a Single Plant Sires All Seeds Per Pod

    DEFF Research Database (Denmark)

    Lassen, Kristin Marie; Kjær, Erik Dahl; Ouédraogo, Moussa

    2014-01-01

    Premise of the study: Microsatellite primers were developed for an indigenous fruit tree, Parkia biglobosa, as a tool to study reproductive biology and population structure. Here we use the primers to determine the number of fathers per pod.  Methods and Results: Microsatellite loci were enriched...

  17. Detection and typing of human papillomavirus in archival cervical cancer specimens by DNA amplification with consensus primers

    NARCIS (Netherlands)

    RESNICK, R. M.; Cornelissen, M. T.; WRIGHT, D. K.; EICHINGER, G. H.; FOX, H. S.; ter Schegget, J.; MANOS, M. M.

    1990-01-01

    We developed a polymerase chain reaction DNA amplification system using two distinct consensus oligonucleotide primer sets for the improved detection and typing of a broad spectrum of human genital papillomavirus (HPV) sequences, including those of novel viruses. The system incorporates one primer

  18. Effect of clearfil protect bond and transbond plus self-etch primer on shear bond strength of orthodontic brackets

    Directory of Open Access Journals (Sweden)

    S Hamid Raji

    2011-01-01

    Conclusion: The shear bond strength of clearfil protect bond and transbond plus self-etch primer was enough for bonding the orthodontic brackets. The mode of failure of bonded brackets with these two self-etch primers is safe for enamel.

  19. Hemorragias obstétricas en el primer y segundo trimestre del embarazo

    OpenAIRE

    García Rodríguez, Blanca

    2013-01-01

    Se aborda el tema de las hemorragias obstétricas en el primer y segundo trimestre del embarazo. Diagnóstico precoz de las mismas, la identificación de factores de riesgo, las causas y el tratamiento terapéutico

  20. Evaluation of genetic diversity in open pollinated guava by iPBS primers

    International Nuclear Information System (INIS)

    Mehmood, A.; Jaskani, M.J.; Ahmad, S.; Ahmad, R.

    2013-01-01

    DNA markers are important tools for assessing genetic diversity and relationships among species, cultivars and breeding materials. Many horticultural species are lacking genomic information. DNA markers that do not require prior knowledge of DNA sequences are therefore appealing for horticultural research. A retrotransposon-based DNA marker system, iPBS (inter primer binding sites) developed from conserved primer binding sites within retrotransposons, was used to study the genetic variation and relationships in ornamental guava. PCR from 6 iPBS primers (dominant markers) produced a total of 113 bands (52.38-100% polymorphic) ranging from 150 bp to 3000 bp, and the mean PIC value for each primer ranging from 0.1245 to 0.3698. Molecular information generated from both iPBS was separately scored in a matrix for phylogenetic dendrogram construction. The phylogenetic dendrogram based on iPBS markers reflected morphologic classifications of the accessions that were studied. The iPBS PCR-based genome fingerprinting technology in this study is low-cost and provides another effective alternative in differentiation of accessions in guava (Psidium guajava Linn.) and related species or genera. (author)