WorldWideScience

Sample records for mitochondrial trna genes

  1. Characterization of 67 mitochondrial tRNA gene rearrangements in the Hymenoptera suggests that mitochondrial tRNA gene position is selectively neutral.

    Science.gov (United States)

    Dowton, Mark; Cameron, Stephen L; Dowavic, Jessica I; Austin, Andy D; Whiting, Michael F

    2009-07-01

    We present entire sequences of two hymenopteran mitochondrial genomes and the major portion of three others. We combined these data with nine previously sequenced hymenopteran mitochondrial genomes. This allowed us to infer and analyze the evolution of the 67 mitochondrial gene rearrangements so far found in this order. All of these involve tRNA genes, whereas four also involve larger (protein-coding or ribosomal RNA) genes. We find that the vast majority of mitochondrial gene rearrangements are independently derived. A maximum of four of these rearrangements represent shared, derived organizations, whereas three are convergently derived. The remaining mitochondrial gene rearrangements represent new mitochondrial genome organizations. These data are consistent with the proposal that there are an enormous number of alternative mitochondrial genome organizations possible and that mitochondrial genome organization is, for the most part, selectively neutral. Nevertheless, some mitochondrial genes appear less mobile than others. Genes close to the noncoding region are generally more mobile but only marginally so. Some mitochondrial genes rearrange in a pattern consistent with the duplication/random loss model, but more mitochondrial genes move in a pattern inconsistent with this model. An increased rate of mitochondrial gene rearrangement is not tightly associated with the evolution of parasitism. Although parasitic lineages tend to have more mitochondrial gene rearrangements than nonparasitic lineages, there are exceptions (e.g., Orussus and Schlettererius). It is likely that only a small proportion of the total number of mitochondrial gene rearrangements that have occurred during the evolution of the Hymenoptera have been sampled in the present study.

  2. The Mitochondrial Aminoacyl tRNA Synthetases: Genes and Syndromes

    OpenAIRE

    2014-01-01

    Mitochondrial respiratory chain (RC) disorders are a group of genetically and clinically heterogeneous diseases. This is because protein components of the RC are encoded by both mitochondrial and nuclear genomes and are essential in all cells. In addition, the biogenesis and maintenance of mitochondria, including mitochondrial DNA (mtDNA) replication, transcription, and translation, require nuclear-encoded genes. In the past decade, a growing number of syndromes associated with dysfunction of...

  3. The Mitochondrial Aminoacyl tRNA Synthetases: Genes and Syndromes.

    Science.gov (United States)

    Diodato, Daria; Ghezzi, Daniele; Tiranti, Valeria

    2014-01-01

    Mitochondrial respiratory chain (RC) disorders are a group of genetically and clinically heterogeneous diseases. This is because protein components of the RC are encoded by both mitochondrial and nuclear genomes and are essential in all cells. In addition, the biogenesis and maintenance of mitochondria, including mitochondrial DNA (mtDNA) replication, transcription, and translation, require nuclear-encoded genes. In the past decade, a growing number of syndromes associated with dysfunction of mtDNA translation have been reported. This paper reviews the current knowledge of mutations affecting mitochondrial aminoacyl tRNAs synthetases and their role in the pathogenic mechanisms underlying the different clinical presentations.

  4. The Mitochondrial Aminoacyl tRNA Synthetases: Genes and Syndromes

    Directory of Open Access Journals (Sweden)

    Daria Diodato

    2014-01-01

    Full Text Available Mitochondrial respiratory chain (RC disorders are a group of genetically and clinically heterogeneous diseases. This is because protein components of the RC are encoded by both mitochondrial and nuclear genomes and are essential in all cells. In addition, the biogenesis and maintenance of mitochondria, including mitochondrial DNA (mtDNA replication, transcription, and translation, require nuclear-encoded genes. In the past decade, a growing number of syndromes associated with dysfunction of mtDNA translation have been reported. This paper reviews the current knowledge of mutations affecting mitochondrial aminoacyl tRNAs synthetases and their role in the pathogenic mechanisms underlying the different clinical presentations.

  5. An evaluation of mitochondrial tRNA gene evolution and its relation to the genetic code.

    Science.gov (United States)

    Cedergren, R J

    1982-04-01

    Extensive sequence data on mitochondrial (mt) tRNAs give for the first time an opportunity to evaluate tRNA gene evolution in this organelle. Deductions from these gene structures relate to the evolution of tRNA genes in other cellular systems and to the origin of the genetic code. Mt tRNAs, in contrast to the prokaryotic nature of chloroplastic tRNA structure, can not at the present time be definitely related to either prokaryotic or eukaryotic tRNAs, probably because of a higher mutation rate in mitochondria. Fungal mt tRNAs having the same anticodon and function are generally similar enough to be considered homologous. Comparisons af all mt tRNA sequences contained in the same mitochondrion indicate that some tRNAs originated by duplication of a prototypic gene which, after divergence, led to tRNAs having different amino acid specificities. The deviant mt genetic code, although admittedly permitting a simpler decoding mechanism, is not useful in determining whether the origin of mitochondria had preceded or was derived from prokaryotes or eukaryotes, since the genetic code is variable even among mitochondria. Variants of the mt genetic code lead to speculation on the nature of the primordial code and its relation to the present "universal" code.

  6. Evidence that the mitochondrial leucyl tRNA synthetase (LARS2) gene represents a novel type 2 diabetes susceptibility gene

    NARCIS (Netherlands)

    L.M. 't Hart (Leen); H.A.P. Pols (Huib); T. Hansen (Torben); I. Rietveld (Ingrid); J.M. Dekker (Jacqueline); J.A. Maassen (Johannes); M.G.A.A.M. Nijpels (Giel); G.M.C. Janssen (George); P.P. Arp (Pascal); R.J. Heine (Robert); A.G. Uitterlinden (André); T. Jorgensen (Torben); C.M. van Duijn (Cock); K. Borch-Johnsen; O. Pedersen (Oluf)

    2005-01-01

    textabstractPreviously, we have shown that a mutation in the mitochondrial DNA-encoded tRNA(Leu(UUR)) gene is associated with type 2 diabetes. One of the consequences of this mutation is a reduced aminoacylation of tRNA(Leu(UUR)). In this study, we have examined whether variants in the leucyl tRNA s

  7. Evidence that the mitochondrial leucyl tRNA synthetase (LARS2) gene represents a novel type 2 diabetes susceptibility gene

    DEFF Research Database (Denmark)

    hart, Leen M; Hansen, Torben; Rietveld, Ingrid

    2005-01-01

    Previously, we have shown that a mutation in the mitochondrial DNA-encoded tRNA(Leu(UUR)) gene is associated with type 2 diabetes. One of the consequences of this mutation is a reduced aminoacylation of tRNA(Leu(UUR)). In this study, we have examined whether variants in the leucyl tRNA synthetase...

  8. Insertion near the mitochondrial tyrosine tRNA gene in patients with mitochondrial diseases

    Energy Technology Data Exchange (ETDEWEB)

    Goto, Y.; Nonaka, I. [National Institute of Neuroscience, Tokyo (Japan); Horai, S. [National Institute of Genetics, Mishima (Japan)

    1994-09-01

    The 3243 mutation commonly found in patients with mitochondrial myopathy, encephalopathy, lactic acidosis, and stroke-like episodes (MELAS) has been occasionally detected in patients with chronic progressive external opthalmoplegia (CPEO). To elucidate the molecular mechanism underlying this phenomenon, an extensive mitochondrial (mt) DNA study was performed on such a patient (3243-CPEO). The newly discovered insertion was located in the noncoding region between cytrochrome c oxidase subunit 1 and tyrosine tRNA. The insertion was not found in 58 or 22 CPEO patients with or without mtDNA large-scale deletion but in another 3243-CPEO patient. In addition, the insertion was present in 1 of 116 normal Japanese, who had no 3243 mutation, and in 3 of 68 3243-MELAS patients. These results raise the possibility that the phenotypic expression of the 3243 mutation could be modulated or arranged by additional mtDNA mutations.

  9. Relationships among the cyclostome braconid (Hymenoptera: Braconidae) subfamilies inferred from a mitochondrial tRNA gene rearrangement.

    Science.gov (United States)

    Dowton, M

    1999-03-01

    The arrangement of mitochondrial tRNA genes for lysine (K) and aspartate (D) from the junction of the cytochrome oxidase II and ATPase 8 genes was determined in a range of hymenopteran taxa. This indicated that the ancestral arrangement for the order is 'KD', as found in the Diptera (represented by Drosophila and Anopheles) and basal Orthoptera. Most Hymenoptera that evolved after the appearance of parasitism also have the 'KD' arrangement, including noncyclostome braconids. However, most cyclostome braconids have either a 'DK' or a 'DHK' arrangement (where 'H' refers to the tRNA gene for Histidine). In both cases, the aspartate tRNA gene is encoded on the mitochondrial N-strand, rather than the J-strand as is usually the case. This rearrangement identified a monophyletic group not previously recognized, consisting of Rogadinae + Braconinae + Gnamptodontinae + Histeromerinae + Rhyssalinae + Betylobraconinae + Opiinae + Alysiinae. Only one cyclostome subfamily (Doryctinae) retained the 'KD' arrangement, suggesting this to be the most basal of the cyclostome subfamilies, consistent with ectoparasitism being plesiomorphic for the cyclostomes. However, the Aphidiinae also retained the 'KD' arrangement, leaving unresolved the issue of whether they should be included within the cyclostomes.

  10. HUMAN MITOCHONDRIAL tRNA MUTATIONS IN MATERNALLY INHERITED DEAFNESS

    Institute of Scientific and Technical Information of China (English)

    ZHENG Jing; GONG Sha-sha; TANG Xiao-wen; ZHU Yi; GUAN Min-xin

    2013-01-01

    Mutations in mitochondrial tRNA genes have been shown to be associated with maternally inherited syn-dromic and non-syndromic deafness. Among those, mutations such as tRNALeu(UUR) 3243A>G associated with syndromic deafness are often present in heteroplasmy, and the non-syndromic deafness-associated tRNA mu-tations including tRNASer(UCN) 7445A>G are often in homoplasmy or in high levels of heteroplasmy. These tRNA mutations are the primary factors underlying the development of hearing loss. However, other tRNA mutations such as tRNAThr 15927G>A and tRNASer(UCN) 7444G>A are insufficient to produce a deafness phe-notype, but always act in synergy with the primary mitochondrial DNA mutations, and can modulate their phenotypic manifestation. These tRNA mutations may alter the structure and function of the corresponding mitochondrial tRNAs and cause failures in tRNAs metabolism. Thereby, the impairment of mitochondrial protein synthesis and subsequent defects in respiration caused by these tRNA mutations, results in mitochon-drial dysfunctions and eventually leads to the development of hearing loss. Here, we summarized the deaf-ness-associated mitochondrial tRNA mutations and discussed the pathophysiology of these mitochondrial tRNA mutations, and we hope these data will provide a foundation for the early diagnosis, management, and treatment of maternally inherited deafness.

  11. Cardiac abnormalities in diabetic patients with mutation in the mitochondrial tRNA {sup Leu(UUR)}Gene

    Energy Technology Data Exchange (ETDEWEB)

    Ueno, Hiroshi [Hyogo Medical Center for Adults, Akashi (Japan); Shiotani, Hideyuki

    1999-11-01

    An A-to-G transition at position 3243 of the mitochondrial DNA is known to be a pathogenic factor for mitochondrial myopathy, encephalopathy, lactic acidosis and stroke-like episodes (MELAS), diabetes and cardiomyopathy. This mutation causes dysfunction of the central nervous system in MELAS. Because the heart, as well as the brain and nervous system, is highly dependent on the energy produced by mitochondrial oxidation, these tissues are more vulnerable to mitochondrial defects. Cardiac abnormalities were assessed in 10 diabetic patients associated with this mutation using echocardiography and {sup 123}I-metaiodobenzylguanidine (MIBG) scintigraphy, and compared with 19 diabetic patients without the mutation. Duration of diabetes, therapy, control of blood glucose and diabetic complications, such as diabetic retinopathy and nephropathy, were not different between the 2 groups. Diabetic patients with the mutation had a significantly thicker interventricular septum (16.8{+-}3.7 vs 11.0{+-}1.6 mm, p<0.001) than those without the mutation. Fractional shortening was lower in diabetic patients with the mutation than those without it (30.7{+-}7.0 vs 42.5{+-}6.6, p<0.001). MIBG uptake on the delayed MIBG image was significantly lower in diabetic patients with the mutation than in those without the mutation (mean value of the heart to mediastinum ratio: 1.6{+-}0.2 vs 2.0{+-}0.4, p>0.05). In conclusion, left ventricular hypertrophy with or without abnormal wall motion and severely reduced MIBG uptake may be characteristic in diabetic patients with a mutation in the mitochondrial tRNA {sup Leu(UUR)} gene. (author)

  12. Mutations in the mitochondrial tRNA Ser(AGY) gene are associated with deafness, retinal degeneration, myopathy and epilepsy.

    Science.gov (United States)

    Tuppen, Helen A L; Naess, Karin; Kennaway, Nancy G; Al-Dosary, Mazhor; Lesko, Nicole; Yarham, John W; Bruhn, Helene; Wibom, Rolf; Nennesmo, Inger; Weleber, Richard G; Blakely, Emma L; Taylor, Robert W; McFarland, Robert

    2012-08-01

    Although over 200 pathogenic mitochondrial DNA (mtDNA) mutations have been reported to date, determining the genetic aetiology of many cases of mitochondrial disease is still not straightforward. Here, we describe the investigations undertaken to uncover the underlying molecular defect(s) in two unrelated Caucasian patients with suspected mtDNA disease, who presented with similar symptoms of myopathy, deafness, neurodevelopmental delay, epilepsy, marked fatigue and, in one case, retinal degeneration. Histochemical and biochemical evidence of mitochondrial respiratory chain deficiency was observed in the patient muscle biopsies and both patients were discovered to harbour a novel heteroplasmic mitochondrial tRNA (mt-tRNA)(Ser(AGY)) (MTTS2) mutation (m.12264C>T and m.12261T>C, respectively). Clear segregation of the m.12261T>C mutation with the biochemical defect, as demonstrated by single-fibre radioactive RFLP, confirmed the pathogenicity of this novel variant in patient 2. However, unusually high levels of m.12264C>T mutation within both COX-positive (98.4 ± 1.5%) and COX-deficient (98.2 ± 2.1%) fibres in patient 1 necessitated further functional investigations to prove its pathogenicity. Northern blot analysis demonstrated the detrimental effect of the m.12264C>T mutation on mt-tRNA(Ser(AGY)) stability, ultimately resulting in decreased steady-state levels of fully assembled complexes I and IV, as shown by blue-native polyacrylamide gel electrophoresis. Our findings expand the spectrum of pathogenic mutations associated with the MTTS2 gene and highlight MTTS2 mutations as an important cause of retinal and syndromic auditory impairment.

  13. The mitochondrial genome of the stingless bee Melipona bicolor (Hymenoptera, Apidae, Meliponini: sequence, gene organization and a unique tRNA translocation event conserved across the tribe Meliponini

    Directory of Open Access Journals (Sweden)

    Daniela Silvestre

    2008-01-01

    Full Text Available At present a complete mtDNA sequence has been reported for only two hymenopterans, the Old World honey bee, Apis mellifera and the sawfly Perga condei. Among the bee group, the tribe Meliponini (stingless bees has some distinction due to its Pantropical distribution, great number of species and large importance as main pollinators in several ecosystems, including the Brazilian rain forest. However few molecular studies have been conducted on this group of bees and few sequence data from mitochondrial genomes have been described. In this project, we PCR amplified and sequenced 78% of the mitochondrial genome of the stingless bee Melipona bicolor (Apidae, Meliponini. The sequenced region contains all of the 13 mitochondrial protein-coding genes, 18 of 22 tRNA genes, and both rRNA genes (one of them was partially sequenced. We also report the genome organization (gene content and order, gene translation, genetic code, and other molecular features, such as base frequencies, codon usage, gene initiation and termination. We compare these characteristics of M. bicolor to those of the mitochondrial genome of A. mellifera and other insects. A highly biased A+T content is a typical characteristic of the A. mellifera mitochondrial genome and it was even more extreme in that of M. bicolor. Length and compositional differences between M. bicolor and A. mellifera genes were detected and the gene order was compared. Eleven tRNA gene translocations were observed between these two species. This latter finding was surprising, considering the taxonomic proximity of these two bee tribes. The tRNA Lys gene translocation was investigated within Meliponini and showed high conservation across the Pantropical range of the tribe.

  14. Mitochondrial tRNA cleavage by tRNA-targeting ribonuclease causes mitochondrial dysfunction observed in mitochondrial disease

    Energy Technology Data Exchange (ETDEWEB)

    Ogawa, Tetsuhiro, E-mail: atetsu@mail.ecc.u-tokyo.ac.jp; Shimizu, Ayano; Takahashi, Kazutoshi; Hidaka, Makoto; Masaki, Haruhiko, E-mail: amasaki@mail.ecc.u-tokyo.ac.jp

    2014-08-15

    Highlights: • MTS-tagged ribonuclease was translocated successfully to the mitochondrial matrix. • MTS-tagged ribonuclease cleaved mt tRNA and reduced COX activity. • Easy and reproducible method of inducing mt tRNA dysfunction. - Abstract: Mitochondrial DNA (mtDNA) is a genome possessed by mitochondria. Since reactive oxygen species (ROS) are generated during aerobic respiration in mitochondria, mtDNA is commonly exposed to the risk of DNA damage. Mitochondrial disease is caused by mitochondrial dysfunction, and mutations or deletions on mitochondrial tRNA (mt tRNA) genes are often observed in mtDNA of patients with the disease. Hence, the correlation between mt tRNA activity and mitochondrial dysfunction has been assessed. Then, cybrid cells, which are constructed by the fusion of an enucleated cell harboring altered mtDNA with a ρ{sup 0} cell, have long been used for the analysis due to difficulty in mtDNA manipulation. Here, we propose a new method that involves mt tRNA cleavage by a bacterial tRNA-specific ribonuclease. The ribonuclease tagged with a mitochondrial-targeting sequence (MTS) was successfully translocated to the mitochondrial matrix. Additionally, mt tRNA cleavage, which resulted in the decrease of cytochrome c oxidase (COX) activity, was observed.

  15. Mitochondrial DNA heteroplasmy dynamics in a kindred harboring a novel pathogenic mutation in the mitochondrial tRNA glutamate gene

    Energy Technology Data Exchange (ETDEWEB)

    Moraes, C.T.; Hao, H. [Univ. of Miami, FL (United States); Bonilla, E.; DiMauro, S.

    1994-09-01

    We have identified a novel mitochondrial DNA (mtDNA) mutation in a 32-year-old male with a myopathy (without progressive external ophthalmoplegia) and mild pyramidal involvement. This A{yields}G transition at mtDNA position 14709 alters an evolutionary conserved nucleotide in a region coding for the anticodon loop of the mitcohondrial tRNA{sup Glu}. The 14709 mtDNA mutation was heteroplasmic but present at very high levels in the patient`s muscle (95%), white blood cells (81%) and hair follicles (90%). The same mutant mtDNA population was observed in white blood cells and hair follicles of all maternal relatives, but a lesser percentage (25-80%). The patient`s muscle showed many ragged-red fibers and a severe focal defect in cytochrome c oxidase activity, accompanied by the absence of cross-reacting material for mitochondrially synthesized polypeptides (ND 1 and COX II). The percentage of mutant mtDNA was not preferentially increased over two generations. Rather, the percentage of mutant mtDNA observed in siblings seemed to follow a normal distribution around the percentage observed in their mothers. Single hair PCR/RFLP analysis showed that the intercellular fluctuation in the percentage of mutant mtDNA differs among family members. Younger generations tend to have a more homogeneous distribution of mutant mtDNA in different hair follicles. The highest degree of variability between individual hair follicles was observed in the patient`s grandmother. These results suggest that the intercellular distribution of the mutant and wild-type mtDNA populations may drift towards homogeneity in subsequent generations.

  16. Network of tRNA Gene Sequences

    Institute of Scientific and Technical Information of China (English)

    WEI Fang-ping; LI Sheng; MA Hong-ru

    2008-01-01

    A network of 3719 tRNA gene sequences was constructed using simplest alignment. Its topology, degree distribution and clustering coefficient were studied. The behaviors of the network shift from fluctuated distribution to scale-free distribution when the similarity degree of the tRNA gene sequences increases. The tRNA gene sequences with the same anticodon identity are more self-organized than those with different anticodon identities and form local clusters in the network. Some vertices of the local cluster have a high connection with other local clusters, and the probable reason was given. Moreover, a network constructed by the same number of random tRNA sequences was used to make comparisons. The relationships between the properties of the tRNA similarity network and the characters of tRNA evolutionary history were discussed.

  17. A novel mitochondrial tRNA gene mutation in a chinese family with dilated cardiomyopathy and sensorineural deafness

    Institute of Scientific and Technical Information of China (English)

    Xianghong Wu; Xiumei Xie; Guotian Ma; Guoju Sun; Xiaobin Chen

    2006-01-01

    Objective: To determine whether a mutation of mitochondrial DNA induces familial dilated cardiomyopathy in Chinese families with cardiomyopathy, and analyzed the correlation between the genotype and phenotype. Methods: Affected members in three Chinese families of the familial dilated cardiomyopathy underwent clinical evaluation and DNA analysis. Polymerase chain reaction and direct DNA sequencing were used to screen for mitochondrial DNA mutation. The type of mtDNA vairations and clinical situation were analysed on the patients with mitochondrial DNA mutation. Results: The mitochondrial A3434G mutation was identified in one of the three families,the 3434 th nucleotide A was replaced by G, which led to change of amino acid. No mutations were identified in the clinically unaffected members of the family and all members of the other two families.Conclusion: This study indicates that the mitochondrial A3434G mutation maybe related with familial dilated cardiomyopathy and deafness.

  18. Evolution meets disease: penetrance and functional epistasis of mitochondrial tRNA mutations.

    Science.gov (United States)

    Moreno-Loshuertos, Raquel; Ferrín, Gustavo; Acín-Pérez, Rebeca; Gallardo, M Esther; Viscomi, Carlo; Pérez-Martos, Acisclo; Zeviani, Massimo; Fernández-Silva, Patricio; Enríquez, José Antonio

    2011-04-01

    About half of the mitochondrial DNA (mtDNA) mutations causing diseases in humans occur in tRNA genes. Particularly intriguing are those pathogenic tRNA mutations than can reach homoplasmy and yet show very different penetrance among patients. These mutations are scarce and, in addition to their obvious interest for understanding human pathology, they can be excellent experimental examples to model evolution and fixation of mitochondrial tRNA mutations. To date, the only source of this type of mutations is human patients. We report here the generation and characterization of the first mitochondrial tRNA pathological mutation in mouse cells, an m.3739G>A transition in the mitochondrial mt-Ti gene. This mutation recapitulates the molecular hallmarks of a disease-causing mutation described in humans, an m.4290T>C transition affecting also the human mt-Ti gene. We could determine that the pathogenic molecular mechanism, induced by both the mouse and the human mutations, is a high frequency of abnormal folding of the tRNA(Ile) that cannot be charged with isoleucine. We demonstrate that the cells harboring the mouse or human mutant tRNA have exacerbated mitochondrial biogenesis triggered by an increase in mitochondrial ROS production as a compensatory response. We propose that both the nature of the pathogenic mechanism combined with the existence of a compensatory mechanism can explain the penetrance pattern of this mutation. This particular behavior can allow a scenario for the evolution of mitochondrial tRNAs in which the fixation of two alleles that are individually deleterious can proceed in two steps and not require the simultaneous mutation of both.

  19. Correction of the consequences of mitochondrial 3243A>G mutation in the MT-TL1 gene causing the MELAS syndrome by tRNA import into mitochondria.

    Science.gov (United States)

    Karicheva, Olga Z; Kolesnikova, Olga A; Schirtz, Tom; Vysokikh, Mikhail Y; Mager-Heckel, Anne-Marie; Lombès, Anne; Boucheham, Abdeldjalil; Krasheninnikov, Igor A; Martin, Robert P; Entelis, Nina; Tarassov, Ivan

    2011-10-01

    Mutations in human mitochondrial DNA are often associated with incurable human neuromuscular diseases. Among these mutations, an important number have been identified in tRNA genes, including 29 in the gene MT-TL1 coding for the tRNA(Leu(UUR)). The m.3243A>G mutation was described as the major cause of the MELAS syndrome (mitochondrial encephalomyopathy with lactic acidosis and stroke-like episodes). This mutation was reported to reduce tRNA(Leu(UUR)) aminoacylation and modification of its anti-codon wobble position, which results in a defective mitochondrial protein synthesis and reduced activities of respiratory chain complexes. In the present study, we have tested whether the mitochondrial targeting of recombinant tRNAs bearing the identity elements for human mitochondrial leucyl-tRNA synthetase can rescue the phenotype caused by MELAS mutation in human transmitochondrial cybrid cells. We demonstrate that nuclear expression and mitochondrial targeting of specifically designed transgenic tRNAs results in an improvement of mitochondrial translation, increased levels of mitochondrial DNA-encoded respiratory complexes subunits, and significant rescue of respiration. These findings prove the possibility to direct tRNAs with changed aminoacylation specificities into mitochondria, thus extending the potential therapeutic strategy of allotopic expression to address mitochondrial disorders.

  20. Extensive and evolutionarily persistent mitochondrial tRNA editing in Velvet Worms (phylum Onychophora).

    Science.gov (United States)

    Segovia, Romulo; Pett, Walker; Trewick, Steve; Lavrov, Dennis V

    2011-10-01

    Mitochondrial genomes of onychophorans (velvet worms) present an interesting problem: Some previous studies reported them lacking several transfer RNA (tRNA) genes, whereas others found that all their tRNA genes were present but severely reduced. To resolve this discrepancy, we determined complete mitochondrial DNA (mtDNA) sequences of the onychophorans Oroperipatus sp. and Peripatoides sympatrica as well as cDNA sequences from 14 and 10 of their tRNAs, respectively. We show that tRNA genes in these genomes are indeed highly reduced and encode truncated molecules, which are restored to more conventional structures by extensive tRNA editing. During this editing process, up to 34 nucleotides are added to the tRNA sequences encoded in Oroperipatus sp. mtDNA, rebuilding the aminoacyl acceptor stem, the TΨC arm, and in some extreme cases, the variable arm and even a part of the anticodon stem. The editing is less extreme in P. sympatrica in which at least a part of the TΨC arm is always encoded in mtDNA. When the entire TΨC arm is added de novo in Oroperipatus sp., the sequence of this arm is either identical or similar among different tRNA species, yet the sequences show substantial variation for each tRNA. These observations suggest that the arm is rebuilt, at least in part, by a template-independent mechanism and argue against the alternative possibility that tRNA genes or their parts are imported from the nucleus. By contrast, the 3' end of the aminoacyl acceptor stem is likely restored by a template-dependent mechanism. The extreme tRNA editing reported here has been preserved for >140 My as it was found in both extant families of onychophorans. Furthermore, a similar type of tRNA editing may be present in several other groups of arthropods, which show a high degree of tRNA gene reduction in their mtDNA.

  1. Secondary structure and feature of mitochondrial tRNA genes of the Ussurian tube-nosed bat Murina ussuriensis (Chiroptera: Vespertilionidae

    Directory of Open Access Journals (Sweden)

    Kwang Bae Yoon

    2015-09-01

    Full Text Available The complete mitogenome (NC_021119 of the Ussurian tube-nosed bat Murina ussuriensis (Chiroptera: Vespertilionidae was annotated and characterized in our recent publication (http://www.ncbi.nlm.nih.gov/nuccore/NC_021119. Here we provide additional information on methods in detail for obtaining the complete sequence of M. ussuriensis mitogenome. In addition, we describe characteristics of 22 tRNA genes and secondary structure and feature of 22 tRNAs of M. ussuriensis mitogenome.

  2. tRNA gene diversity in the three domains of life

    Directory of Open Access Journals (Sweden)

    Kosuke eFujishima

    2014-05-01

    Full Text Available Transfer RNA (tRNA is widely known for its key role in decoding mRNA into protein. Despite their necessity and relatively short nucleotide sequences, a large diversity of gene structures and RNA secondary structures of pre-tRNAs and mature tRNAs have recently been discovered in the three domains of life. Growing evidences of disrupted tRNA genes in the genomes of Archaea reveals unique gene structures such as, intron-containing tRNA, split tRNA, and permuted tRNA. Coding sequence for these tRNAs are either separated with introns, fragmented, or permuted at the genome level. Although evolutionary scenario behind the tRNA gene disruption is still unclear, diversity of tRNA structure seems to be co-evolved with their processing enzyme, so-called RNA splicing endonuclease. Metazoan mitochondrial tRNAs (mtRNAs are known for their unique lack of either one or two arms from the typical tRNA cloverleaf structure, while still maintaining functionality. Recently identified nematode-specific V-arm containing tRNAs (nev-tRNAs possess long variable arms that are specific to eukaryotic class II tRNASer and tRNALeu but also decode class I tRNA codons. Moreover, many tRNA-like sequences have been found in the genomes of different organisms and viruses. Thus this review is aimed to cover the latest knowledge on tRNA gene diversity and further recapitulate the evolutionary and biological aspects that caused such uniqueness.

  3. Immunohistochemical analysis of the oxidative phosphorylation complexes in skeletal muscle from patients with mitochondrial DNA encoded tRNA gene defects.

    NARCIS (Netherlands)

    Paepe, B. De; Smet, J.; Lammens, M.M.Y.; Seneca, S.; Martin, J.J.; Bleecker, J. De; Meirleir, L. de; Lissens, W.; Coster, R. van

    2009-01-01

    BACKGROUND: Mitochondrial diseases display a heterogeneous spectrum of clinical phenotypes and therefore the identification of the underlying gene defect is often a difficult task. AIMS: To develop an immunohistochemical approach to stain skeletal muscle for the five multi-protein complexes that

  4. Mutation Analysis of Mitochondrial tRNA Gene in Patients with Primary Dilated Cardiomyopathy%原发性扩张型心肌病的线粒体tRNA基因突变分析

    Institute of Scientific and Technical Information of China (English)

    李红超; 舒红英; 李晓杰; 倪斌; 谢海龙; 周海燕; 倪崖

    2015-01-01

    To identify the potential pathogenic mutations of mitochondrial tRNA in patients with primary dilated cardio-myopathy(DCM) and the possible association of the mutations with DCM.Paraffin-embedded myocardial tissues from two patients with DCM and 10 healthy controls,which were discarded after forensic examination,were used for the study.PCR amplification wasperformed for the mitochondrial tRNA genes and direct sequencing was conducted.Sequencing re-sults showed no variation for mitochondrial tRNA genes in the normal myocardial tissues.The tRNAVal G1664A variation and tRNAMet T4454C variation were identified in patients with DCM.These two variations were previously reported as polymorphism in MitoMap.There was no pathogenic mutation detected in mitochondrial tRNA genes of the two patients with DCM.A patient pool of large sample size is expected for analysis of the pathogenic mutations,polymorphism loci and haplogroup that might be associated with DCM.%为寻找原发性扩张型心肌病病例是否存在已知以及未知的线粒体tRNA致病性突变,以探讨扩张型心肌病可能的发病原因.收集2例原发性扩张型心肌病患者和10例正常对照尸检心肌组织石蜡标本,针对22种线粒体tRNA基因分别设计一对引物,PCR扩增后并测序分析线粒体tRNA基因突变情况.结果在对照样本中未检测到线粒体tRNA变异位点,在1例患者中检测到了tRNAVal基因G1664A变异,Mitomap已有报道为多态性位点;于另1例患者中检测到tRNAMetT4454C变异,有文章报道该位点与线粒体功能障碍有关,Mitomap报道为多态性位点.本研究中2例病例中未检测到线粒体tRNA致病性突变位点,可能与病例个体的心衰程度有关,有必要扩大样本量深入研究线粒体tRNA以及mtDNA其他基因突变与原发性扩张型心肌病之间的关系,以寻找可能的致病突变位点、易感的多态性位点或者单倍体群,为认识原发性扩张型心肌病的发病机制进一步提供理论基础和依据.

  5. Mutations in the Caenorhabditis elegans orthologs of human genes required for mitochondrial tRNA modification cause similar electron transport chain defects but different nuclear responses.

    Science.gov (United States)

    Navarro-González, Carmen; Moukadiri, Ismaïl; Villarroya, Magda; López-Pascual, Ernesto; Tuck, Simon; Armengod, M-Eugenia

    2017-07-01

    Several oxidative phosphorylation (OXPHOS) diseases are caused by defects in the post-transcriptional modification of mitochondrial tRNAs (mt-tRNAs). Mutations in MTO1 or GTPBP3 impair the modification of the wobble uridine at position 5 of the pyrimidine ring and cause heart failure. Mutations in TRMU affect modification at position 2 and cause liver disease. Presently, the molecular basis of the diseases and why mutations in the different genes lead to such different clinical symptoms is poorly understood. Here we use Caenorhabditis elegans as a model organism to investigate how defects in the TRMU, GTPBP3 and MTO1 orthologues (designated as mttu-1, mtcu-1, and mtcu-2, respectively) exert their effects. We found that whereas the inactivation of each C. elegans gene is associated with a mild OXPHOS dysfunction, mutations in mtcu-1 or mtcu-2 cause changes in the expression of metabolic and mitochondrial stress response genes that are quite different from those caused by mttu-1 mutations. Our data suggest that retrograde signaling promotes defect-specific metabolic reprogramming, which is able to rescue the OXPHOS dysfunction in the single mutants by stimulating the oxidative tricarboxylic acid cycle flux through complex II. This adaptive response, however, appears to be associated with a biological cost since the single mutant worms exhibit thermosensitivity and decreased fertility and, in the case of mttu-1, longer reproductive cycle. Notably, mttu-1 worms also exhibit increased lifespan. We further show that mtcu-1; mttu-1 and mtcu-2; mttu-1 double mutants display severe growth defects and sterility. The animal models presented here support the idea that the pathological states in humans may initially develop not as a direct consequence of a bioenergetic defect, but from the cell's maladaptive response to the hypomodification status of mt-tRNAs. Our work highlights the important association of the defect-specific metabolic rewiring with the pathological phenotype

  6. Mutations in the Caenorhabditis elegans orthologs of human genes required for mitochondrial tRNA modification cause similar electron transport chain defects but different nuclear responses.

    Directory of Open Access Journals (Sweden)

    Carmen Navarro-González

    2017-07-01

    Full Text Available Several oxidative phosphorylation (OXPHOS diseases are caused by defects in the post-transcriptional modification of mitochondrial tRNAs (mt-tRNAs. Mutations in MTO1 or GTPBP3 impair the modification of the wobble uridine at position 5 of the pyrimidine ring and cause heart failure. Mutations in TRMU affect modification at position 2 and cause liver disease. Presently, the molecular basis of the diseases and why mutations in the different genes lead to such different clinical symptoms is poorly understood. Here we use Caenorhabditis elegans as a model organism to investigate how defects in the TRMU, GTPBP3 and MTO1 orthologues (designated as mttu-1, mtcu-1, and mtcu-2, respectively exert their effects. We found that whereas the inactivation of each C. elegans gene is associated with a mild OXPHOS dysfunction, mutations in mtcu-1 or mtcu-2 cause changes in the expression of metabolic and mitochondrial stress response genes that are quite different from those caused by mttu-1 mutations. Our data suggest that retrograde signaling promotes defect-specific metabolic reprogramming, which is able to rescue the OXPHOS dysfunction in the single mutants by stimulating the oxidative tricarboxylic acid cycle flux through complex II. This adaptive response, however, appears to be associated with a biological cost since the single mutant worms exhibit thermosensitivity and decreased fertility and, in the case of mttu-1, longer reproductive cycle. Notably, mttu-1 worms also exhibit increased lifespan. We further show that mtcu-1; mttu-1 and mtcu-2; mttu-1 double mutants display severe growth defects and sterility. The animal models presented here support the idea that the pathological states in humans may initially develop not as a direct consequence of a bioenergetic defect, but from the cell's maladaptive response to the hypomodification status of mt-tRNAs. Our work highlights the important association of the defect-specific metabolic rewiring with the

  7. MATERNALLY INHERITED HEARING-LOSS, ATAXIA AND MYOCLONUS ASSOCIATED WITH A NOVEL POINT MUTATION IN MITOCHONDRIAL TRNA(SER(UCN)) GENE

    NARCIS (Netherlands)

    TIRANTI, [No Value; CHARIOT, P; CARELLA, F; TOSCANO, A; SOLIVERI, P; GIRLANDA, P; CARRARA, F; FRATTA, GM; REID, FM; MARIOTTI, C; ZEVIANI, M

    1995-01-01

    We report on a new maternally-inherited syndrome characterized by a combination of sensorineural hearing loss, ataxia and myoclonus in a large kindred from Sicily, Hearing loss was the most widespread and sometimes the only symptom found in family members. Sequence analysis of the mitochondrial DNA

  8. Segregation patterns of a novel mutation in the mitochondrial tRNA glutamic acid gene associated with myopathy and diabetes mellitus

    Energy Technology Data Exchange (ETDEWEB)

    Hao, H.; Moraes, C.T. [Univ. of Miami, FL (United States); Bonilla, E.; Manfredi, G.; DiMauro, S. [Columbia Univ., NY (United States)

    1995-05-01

    We have identified a novel mtDNA mutation in a 29-year-old man with myopathy and diabetes mellitus. This T{r_arrow}C transition at mtDNA position 14709 alters an evolutionarily conserved nucleotide in the region specifying for the anticodon loop of the mitochondrial tRNA{sup Glu}. The nt-14709 mutation was heteroplasmic but present at very high levels in the patient`s muscle, white blood cells (WBCs), and hair follicles; lower proportions of mutated mtDNA were observed in WBCs and hair follicles of all examined maternal relatives. In the patient`s muscle, abnormal fibers showed mitochondrial proliferation, severe focal defects in cytochrome c oxidase activity, and absence of cross-reacting material for mitochondrially synthesized polypeptides. These fibers had higher levels of mutated mtDNA than did surrounding {open_quotes}normal{close_quotes} fibers. Although the percentage of mutated mtDNA in WBCs from family members were distributed around the percentage observed in the mothers, the pattern was different in hair follicles, where the mutated population tended to increase in subsequent generations. PCR/RFLP analysis of single hair showed that the intercellular variations in the percentage of mutated mtDNA differed among family members, with younger generations having a more homogeneous distribution of mutated mtDNA in different hair follicles. These results suggests that the intercellular distribution of the mutated and wild-type mtDNA populations may drift toward homogeneity in subsequent generations. 43 refs., 4 figs., 1 tab.

  9. Defective i6A37 modification of mitochondrial and cytosolic tRNAs results from pathogenic mutations in TRIT1 and its substrate tRNA.

    Directory of Open Access Journals (Sweden)

    John W Yarham

    2014-06-01

    Full Text Available Identifying the genetic basis for mitochondrial diseases is technically challenging given the size of the mitochondrial proteome and the heterogeneity of disease presentations. Using next-generation exome sequencing, we identified in a patient with severe combined mitochondrial respiratory chain defects and corresponding perturbation in mitochondrial protein synthesis, a homozygous p.Arg323Gln mutation in TRIT1. This gene encodes human tRNA isopentenyltransferase, which is responsible for i6A37 modification of the anticodon loops of a small subset of cytosolic and mitochondrial tRNAs. Deficiency of i6A37 was previously shown in yeast to decrease translational efficiency and fidelity in a codon-specific manner. Modelling of the p.Arg323Gln mutation on the co-crystal structure of the homologous yeast isopentenyltransferase bound to a substrate tRNA, indicates that it is one of a series of adjacent basic side chains that interact with the tRNA backbone of the anticodon stem, somewhat removed from the catalytic center. We show that patient cells bearing the p.Arg323Gln TRIT1 mutation are severely deficient in i6A37 in both cytosolic and mitochondrial tRNAs. Complete complementation of the i6A37 deficiency of both cytosolic and mitochondrial tRNAs was achieved by transduction of patient fibroblasts with wild-type TRIT1. Moreover, we show that a previously-reported pathogenic m.7480A>G mt-tRNASer(UCN mutation in the anticodon loop sequence A36A37A38 recognised by TRIT1 causes a loss of i6A37 modification. These data demonstrate that deficiencies of i6A37 tRNA modification should be considered a potential mechanism of human disease caused by both nuclear gene and mitochondrial DNA mutations while providing insight into the structure and function of TRIT1 in the modification of cytosolic and mitochondrial tRNAs.

  10. Defective i6A37 modification of mitochondrial and cytosolic tRNAs results from pathogenic mutations in TRIT1 and its substrate tRNA.

    Science.gov (United States)

    Yarham, John W; Lamichhane, Tek N; Pyle, Angela; Mattijssen, Sandy; Baruffini, Enrico; Bruni, Francesco; Donnini, Claudia; Vassilev, Alex; He, Langping; Blakely, Emma L; Griffin, Helen; Santibanez-Koref, Mauro; Bindoff, Laurence A; Ferrero, Ileana; Chinnery, Patrick F; McFarland, Robert; Maraia, Richard J; Taylor, Robert W

    2014-06-01

    Identifying the genetic basis for mitochondrial diseases is technically challenging given the size of the mitochondrial proteome and the heterogeneity of disease presentations. Using next-generation exome sequencing, we identified in a patient with severe combined mitochondrial respiratory chain defects and corresponding perturbation in mitochondrial protein synthesis, a homozygous p.Arg323Gln mutation in TRIT1. This gene encodes human tRNA isopentenyltransferase, which is responsible for i6A37 modification of the anticodon loops of a small subset of cytosolic and mitochondrial tRNAs. Deficiency of i6A37 was previously shown in yeast to decrease translational efficiency and fidelity in a codon-specific manner. Modelling of the p.Arg323Gln mutation on the co-crystal structure of the homologous yeast isopentenyltransferase bound to a substrate tRNA, indicates that it is one of a series of adjacent basic side chains that interact with the tRNA backbone of the anticodon stem, somewhat removed from the catalytic center. We show that patient cells bearing the p.Arg323Gln TRIT1 mutation are severely deficient in i6A37 in both cytosolic and mitochondrial tRNAs. Complete complementation of the i6A37 deficiency of both cytosolic and mitochondrial tRNAs was achieved by transduction of patient fibroblasts with wild-type TRIT1. Moreover, we show that a previously-reported pathogenic m.7480A>G mt-tRNASer(UCN) mutation in the anticodon loop sequence A36A37A38 recognised by TRIT1 causes a loss of i6A37 modification. These data demonstrate that deficiencies of i6A37 tRNA modification should be considered a potential mechanism of human disease caused by both nuclear gene and mitochondrial DNA mutations while providing insight into the structure and function of TRIT1 in the modification of cytosolic and mitochondrial tRNAs.

  11. An alanine tRNA gene cluster from Nephila clavipes.

    Science.gov (United States)

    Luciano, E; Candelas, G C

    1996-06-01

    We report the sequence of a 2.3-kb genomic DNA fragment from the orb-web spider, Nephila clavipes (Nc). The fragment contains four regions of high homology to tRNA(Ala). The members of this irregularly spaced cluster of genes are oriented in the same direction and have the same anticodon (GCA), but their sequence differs at several positions. Initiation and termination signals, as well as consensus intragenic promoter sequences characteristic of tRNA genes, have been identified in all genes. tRNA(Ala) are involved in the regulation of the fibroin synthesis in the large ampullate Nc glands.

  12. Analysis of the complement and molecular evolution of tRNA genes in cow

    Directory of Open Access Journals (Sweden)

    Barris Wesley C

    2009-04-01

    Full Text Available Abstract Background Detailed information regarding the number and organization of transfer RNA (tRNA genes at the genome level is becoming readily available with the increase of DNA sequencing of whole genomes. However the identification of functional tRNA genes is challenging for species that have large numbers of repetitive elements containing tRNA derived sequences, such as Bos taurus. Reliable identification and annotation of entire sets of tRNA genes allows the evolution of tRNA genes to be understood on a genomic scale. Results In this study, we explored the B. taurus genome using bioinformatics and comparative genomics approaches to catalogue and analyze cow tRNA genes. The initial analysis of the cow genome using tRNAscan-SE identified 31,868 putative tRNA genes and 189,183 pseudogenes, where 28,830 of the 31,868 predicted tRNA genes were classified as repetitive elements by the RepeatMasker program. We then used comparative genomics to further discriminate between functional tRNA genes and tRNA-derived sequences for the remaining set of 3,038 putative tRNA genes. For our analysis, we used the human, chimpanzee, mouse, rat, horse, dog, chicken and fugu genomes to predict that the number of active tRNA genes in cow lies in the vicinity of 439. Of this set, 150 tRNA genes were 100% identical in their sequences across all nine vertebrate genomes studied. Using clustering analyses, we identified a new tRNA-GlyCCC subfamily present in all analyzed mammalian genomes. We suggest that this subfamily originated from an ancestral tRNA-GlyGCC gene via a point mutation prior to the radiation of the mammalian lineages. Lastly, in a separate analysis we created phylogenetic profiles for each putative cow tRNA gene using a representative set of genomes to gain an overview of common evolutionary histories of tRNA genes. Conclusion The use of a combination of bioinformatics and comparative genomics approaches has allowed the confident identification of a

  13. Evolution of mitochondrial gene orders in echinoderms.

    Science.gov (United States)

    Perseke, Marleen; Fritzsch, Guido; Ramsch, Kai; Bernt, Matthias; Merkle, Daniel; Middendorf, Martin; Bernhard, Detlef; Stadler, Peter F; Schlegel, Martin

    2008-05-01

    A comprehensive analysis of the mitochondrial gene orders of all previously published and two novel Antedon mediterranea (Crinoidea) and Ophiura albida (Ophiuroidea) complete echinoderm mitochondrial genomes shows that all major types of rearrangement operations are necessary to explain the evolution of mitochondrial genomes. In addition to protein coding genes we include all tRNA genes as well as the control region in our analysis. Surprisingly, 7 of the 16 genomes published in the GenBank database contain misannotations, mostly unannotated tRNAs and/or mistakes in the orientation of tRNAs, which we have corrected here. Although the gene orders of mt genomes appear very different, only 8 events are necessary to explain the evolutionary history of echinoderms with the exception of the ophiuroids. Only two of these rearrangements are inversions, while we identify three tandem-duplication-random-loss events and three transpositions.

  14. Co-evolution of mitochondrial tRNA import and codon usage determines translational efficiency in the green alga Chlamydomonas.

    Science.gov (United States)

    Salinas, Thalia; Duby, Francéline; Larosa, Véronique; Coosemans, Nadine; Bonnefoy, Nathalie; Motte, Patrick; Maréchal-Drouard, Laurence; Remacle, Claire

    2012-09-01

    Mitochondria from diverse phyla, including protozoa, fungi, higher plants, and humans, import tRNAs from the cytosol in order to ensure proper mitochondrial translation. Despite the broad occurrence of this process, our understanding of tRNA import mechanisms is fragmentary, and crucial questions about their regulation remain unanswered. In the unicellular green alga Chlamydomonas, a precise correlation was found between the mitochondrial codon usage and the nature and amount of imported tRNAs. This led to the hypothesis that tRNA import might be a dynamic process able to adapt to the mitochondrial genome content. By manipulating the Chlamydomonas mitochondrial genome, we introduced point mutations in order to modify its codon usage. We find that the codon usage modification results in reduced levels of mitochondrial translation as well as in subsequent decreased levels and activities of respiratory complexes. These effects are linked to the consequential limitations of the pool of tRNAs in mitochondria. This indicates that tRNA mitochondrial import cannot be rapidly regulated in response to a novel genetic context and thus does not appear to be a dynamic process. It rather suggests that the steady-state levels of imported tRNAs in mitochondria result from a co-evolutive adaptation between the tRNA import mechanism and the requirements of the mitochondrial translation machinery.

  15. The Mitochondrial Genome of Raphanus sativus and Gene Evolution of Cruciferous Mitochondrial Types

    Institute of Scientific and Technical Information of China (English)

    Shengxin Chang; Jianmei Chen; Yankun Wang; Bingchao Gu; Jianbo He; Pu Chu; Rongzhan Guan

    2013-01-01

    To explore the mitochondrial genes of the Cruciferae family,the mitochondrial genome of Raphanus sativus (sat) was sequenced and annotated.The circular mitochondrial genome of sat is 239,723 bp and includes 33 protein-coding genes,three rRNA genes and 17 tRNA genes.The mitochondrial genome also contains a pair of large repeat sequences 5.9 kb in length,which may mediate genome reorganization into two sub-genomic circles,with predicted sizes of 124.8 kb and 115.0 kb,respectively.Furthermore,gene evolution of mitochondrial genomes within the Cruciferae family was analyzed using sat mitochondrial type (mitotype),together with six other reported mitotypes.The cruciferous mitochondrial genomes have maintained almost the same set of functional genes.Compared with Cycas taitungensis (a representative gymnosperm),the mitochondrial genomes of the Cruciferae have lost nine protein-coding genes and seven mitochondrial-like tRNA genes,but acquired six chloroplast-like tRNAs.Among the Cruciferae,to maintain the same set of genes that are necessary for mitochondrial function,the exons of the genes have changed at the lowest rates,as indicated by the numbers of single nucleotide polymorphisms.The open reading frames (ORFs) of unknown function in the cruciferous genomes are not conserved.Evolutionary events,such as mutations,genome reorganizations and sequence insertions or deletions (indels),have resulted in the nonconserved ORFs in the cruciferous mitochondrial genomes,which is becoming significantly different among mitotypes.This work represents the first phylogenic explanation of the evolution of genes of known function in the Cruciferae family.It revealed significant variation in ORFs and the causes of such variation.

  16. The mitochondrial genome of Raphanus sativus and gene evolution of cruciferous mitochondrial types.

    Science.gov (United States)

    Chang, Shengxin; Chen, Jianmei; Wang, Yankun; Gu, Bingchao; He, Jianbo; Chu, Pu; Guan, Rongzhan

    2013-03-20

    To explore the mitochondrial genes of the Cruciferae family, the mitochondrial genome of Raphanus sativus (sat) was sequenced and annotated. The circular mitochondrial genome of sat is 239,723 bp and includes 33 protein-coding genes, three rRNA genes and 17 tRNA genes. The mitochondrial genome also contains a pair of large repeat sequences 5.9 kb in length, which may mediate genome reorganization into two sub-genomic circles, with predicted sizes of 124.8 kb and 115.0 kb, respectively. Furthermore, gene evolution of mitochondrial genomes within the Cruciferae family was analyzed using sat mitochondrial type (mitotype), together with six other reported mitotypes. The cruciferous mitochondrial genomes have maintained almost the same set of functional genes. Compared with Cycas taitungensis (a representative gymnosperm), the mitochondrial genomes of the Cruciferae have lost nine protein-coding genes and seven mitochondrial-like tRNA genes, but acquired six chloroplast-like tRNAs. Among the Cruciferae, to maintain the same set of genes that are necessary for mitochondrial function, the exons of the genes have changed at the lowest rates, as indicated by the numbers of single nucleotide polymorphisms. The open reading frames (ORFs) of unknown function in the cruciferous genomes are not conserved. Evolutionary events, such as mutations, genome reorganizations and sequence insertions or deletions (indels), have resulted in the non-conserved ORFs in the cruciferous mitochondrial genomes, which is becoming significantly different among mitotypes. This work represents the first phylogenic explanation of the evolution of genes of known function in the Cruciferae family. It revealed significant variation in ORFs and the causes of such variation.

  17. Structural Dynamics of a Mitochondrial tRNA Possessing Weak Thermodynamic Stability

    Science.gov (United States)

    2015-01-01

    Folding dynamics are ubiquitously involved in controlling the multivariate functions of RNAs. While the high thermodynamic stabilities of some RNAs favor purely native states at equilibrium, it is unclear whether weakly stable RNAs exist in random, partially folded states or sample well-defined, globally folded conformations. Using a folding assay that precisely tracks the formation of native aminoacylable tRNA, we show that the folding of a weakly stable human mitochondrial (hmt) leucine tRNA is hierarchical with a distinct kinetic folding intermediate. The stabilities of the native and intermediate conformers are separated by only about 1.2 kcal/mol, and the species are readily interconvertible. Comparison of folding dynamics between unmodified and fully modified tRNAs reveals that post-transcriptional modifications produce a more constrained native structure that does not sample intermediate conformations. These structural dynamics may thus be crucial for recognition by some modifying enzymes in vivo, especially those targeting the globular core region, by allowing access to pretransition state conformers. Reduced conformational sampling of the native, modified tRNAs could then permit improved performance in downstream processes of translation. More generally, weak stabilities of small RNAs that fold in the absence of chaperone proteins may facilitate conformational switching that is central to biological function. PMID:24520994

  18. The enigmatic mitochondrial genome of Rhabdopleura compacta (Pterobranchia reveals insights into selection of an efficient tRNA system and supports monophyly of Ambulacraria

    Directory of Open Access Journals (Sweden)

    Stadler Peter F

    2011-05-01

    Full Text Available Abstract Background The Hemichordata comprises solitary-living Enteropneusta and colonial-living Pterobranchia, sharing morphological features with both Chordata and Echinodermata. Despite their key role for understanding deuterostome evolution, hemichordate phylogeny is controversial and only few molecular data are available for phylogenetic analysis. Furthermore, mitochondrial sequences are completely lacking for pterobranchs. Therefore, we determined and analyzed the complete mitochondrial genome of the pterobranch Rhabdopleura compacta to elucidate deuterostome evolution. Thereby, we also gained important insights in mitochondrial tRNA evolution. Results The mitochondrial DNA of Rhabdopleura compacta corresponds in size and gene content to typical mitochondrial genomes of metazoans, but shows the strongest known strand-specific mutational bias in the nucleotide composition among deuterostomes with a very GT-rich main-coding strand. The order of the protein-coding genes in R. compacta is similar to that of the deuterostome ground pattern. However, the protein-coding genes have been highly affected by a strand-specific mutational pressure showing unusual codon frequency and amino acid composition. This composition caused extremely long branches in phylogenetic analyses. The unusual codon frequency points to a selection pressure on the tRNA translation system to codon-anticodon sequences of highest versatility instead of showing adaptations in anticodon sequences to the most frequent codons. Furthermore, an assignment of the codon AGG to Lysine has been detected in the mitochondrial genome of R. compacta, which is otherwise observed only in the mitogenomes of some arthropods. The genomes of these arthropods do not have such a strong strand-specific bias as found in R. compacta but possess an identical mutation in the anticodon sequence of the tRNALys. Conclusion A strong reversed asymmetrical mutational constraint in the mitochondrial genome of

  19. Limited diagnostic value of enzyme analysis in patients with mitochondrial tRNA mutations

    DEFF Research Database (Denmark)

    Wibrand, Flemming; Jeppesen, Tina Dysgaard; Frederiksen, Anja L

    2010-01-01

    We evaluated the diagnostic value of respiratory chain (RC) enzyme analysis of muscle in adult patients with mitochondrial myopathy (MM). RC enzyme activity was measured in muscle biopsies from 39 patients who carry either the 3243A>G mutation, other tRNA point mutations, or single, large....... Only 10% of patients with the 3243A>G point mutation had decreased enzyme activity of one or more RC complexes, whereas this was the case for 83% of patients with other point mutations and 62% of patients with deletions. Abnormal muscle histochemistry was found in 65%, 100%, and 85% of patients......-scale deletions of mtDNA. Findings were compared with those obtained from asymptomatic relatives with the 3243A>G mutation, myotonic dystrophy patients, and healthy subjects. Plasma lactate concentration, maximal oxygen uptake, and ragged-red fibers/cytochrome c-negative fibers in muscle were also determined...

  20. tRNA - RMG | LSDB Archive [Life Science Database Archive metadata

    Lifescience Database Archive (English)

    Full Text Available switchLanguage; BLAST Search Image Search Home About Archive Update History Data List Contact us RMG tRNA... Data detail Data name tRNA DOI 10.18908/lsdba.nbdc00193-006 Description of data con...tents Data contents are as follows: Amino acid sequences of 23 tRNA from 17 species identified in the rice m...n Amino acids Amino acid binding to tRNA tRNA tRNA gene indicated by the cognate amino acid in one-letter code rice Rice +: tRNA... present -: tRNA absent y: pseudogene a: mitochondrial tRNA b: plastid-like tRNA Miyata

  1. Prevalence of the A1555G (12S rRNA and tRNA Ser(UCN mitochondrial mutations in hearing-impaired Brazilian patients

    Directory of Open Access Journals (Sweden)

    Abreu-Silva R.S.

    2006-01-01

    Full Text Available Mitochondrial mutations are responsible for at least 1% of the cases of hereditary deafness, but the contribution of each mutation has not yet been defined in African-derived or native American genetic backgrounds. A total of 203 unselected hearing-impaired patients were screened for the presence of the mitochondrial mutation A1555G in the 12S rRNA gene and mutations in the tRNA Ser(UCN gene in order to assess their frequency in the ethnically admixed Brazilian population. We found four individuals with A1555G mutation (2%, which is a frequency similar to those reported for European-derived populations in unselected samples. On the other hand, complete sequencing of the tRNA Ser(UCN did not reveal reported pathogenic substitutions, namely A7445G, 7472insC, T7510C, or T7511C. Instead, other rare substitutions were found such as T1291C, A7569G, and G7444A. To evaluate the significance of these findings, 110 "European-Brazilians" and 190 "African-Brazilians" unrelated hearing controls were screened. The T1291C, A7569G and G7444A substitutions were each found in about 1% (2/190 of individuals of African ancestry, suggesting that they are probably polymorphic. Our results indicate that screening for the A1555G mutation is recommended among all Brazilian deaf patients, while testing for mutations in the tRNA Ser(UCN gene should be considered only when other frequent deafness-causing mutations have been excluded or in the presence of a maternal transmission pattern.

  2. Prevalence of the A1555G (12S rRNA and tRNA Ser(UCN mitochondrial mutations in hearing-impaired Brazilian patients

    Directory of Open Access Journals (Sweden)

    R.S. Abreu-Silva

    2006-02-01

    Full Text Available Mitochondrial mutations are responsible for at least 1% of the cases of hereditary deafness, but the contribution of each mutation has not yet been defined in African-derived or native American genetic backgrounds. A total of 203 unselected hearing-impaired patients were screened for the presence of the mitochondrial mutation A1555G in the 12S rRNA gene and mutations in the tRNA Ser(UCN gene in order to assess their frequency in the ethnically admixed Brazilian population. We found four individuals with A1555G mutation (2%, which is a frequency similar to those reported for European-derived populations in unselected samples. On the other hand, complete sequencing of the tRNA Ser(UCN did not reveal reported pathogenic substitutions, namely A7445G, 7472insC, T7510C, or T7511C. Instead, other rare substitutions were found such as T1291C, A7569G, and G7444A. To evaluate the significance of these findings, 110 "European-Brazilians" and 190 "African-Brazilians" unrelated hearing controls were screened. The T1291C, A7569G and G7444A substitutions were each found in about 1% (2/190 of individuals of African ancestry, suggesting that they are probably polymorphic. Our results indicate that screening for the A1555G mutation is recommended among all Brazilian deaf patients, while testing for mutations in the tRNA Ser(UCN gene should be considered only when other frequent deafness-causing mutations have been excluded or in the presence of a maternal transmission pattern.

  3. A newly discovered tRNA(1Asp) gene (aspV) of Escherichia coli K12.

    Science.gov (United States)

    Horiuchi, T; Nagasawa, T; Takano, K; Sekiguchi, M

    1987-02-01

    We report a new tRNA(1Asp) gene near the dnaQ gene, which is located at 5 min on the Escherichia coli linkage map. We named it aspV. The sequence corresponding to the mature tRNA is identical with that of the two previously identified tRNA(1Asp) genes (aspT and aspU), but there is no homology in the sequences of their 3'- and 5'-flanking regions.

  4. Calcium regulates the expression of a Dictyostelium discoideum asparaginyl tRNA synthetase gene

    Indian Academy of Sciences (India)

    Jyoti K Jaiswal; Vidyanand Nanjundiah

    2003-12-01

    In a screen for calcium-regulated gene expression during growth and development of Dictyostelium discoideum we have identified an asparaginyl tRNA synthetase (ddAsnRS) gene, the second tRNA synthetase gene identified in this organism. The ddAsnRS gene shows many unique features. One, it is repressed by lowering cellular calcium, making it the first known calcium-regulated tRNA synthetase. Two, despite the calcium-dependence, its expression is unaltered during the cell cycle, making this the first D. discoideum gene to show a calcium-dependent but cell cycle phase-independent expression. Finally, the N-terminal domain of the predicted ddAsnRS protein shows higher sequence similarity to Glutaminyl tRNA synthetases than to other Asn tRNA synthetases. These unique features of the AsnRS from this primitive eukaryote not only point to a novel mechanism regulating the components of translation machinery and gene expression by calcium, but also hint at a link between the evolution of GlnRS and AsnRS in eukaryotes.

  5. Circularly permuted tRNA genes: their expression and implications for their physiological relevance and development.

    Directory of Open Access Journals (Sweden)

    Akiko eSoma

    2014-04-01

    Full Text Available A number of genome analyses and searches using programs that focus on the RNA-specific bulge-helix-bulge (BHB motif have uncovered a wide variety of disrupted tRNA genes. The results of these analyses have shown that genetic information encoding functional RNAs is described in the genome cryptically and is retrieved using various strategies. One such strategy is represented by circularly permuted tRNA genes, in which the sequences encoding the 5′-half and 3′-half of the specific tRNA are separated and inverted on the genome. Biochemical analyses have defined a processing pathway in which the termini of tRNA precursors (pre-tRNAs are ligated to form a characteristic circular RNA intermediate, which is then cleaved at the acceptor-stem to generate the typical cloverleaf structure with functional termini. The sequences adjacent to the processing site located between the 3′-half and the 5′-half of pre-tRNAs potentially form a BHB motif, which is the dominant recognition site for the tRNA-intron splicing endonuclease, suggesting that circularization of pre-tRNAs depends on the splicing machinery. Some permuted tRNAs contain a BHB-mediated intron in their 5′- or 3′-half, meaning that removal of an intron, as well as swapping of the 5′- and 3′-halves, are required during maturation of their pre-tRNAs. To date, 34 permuted tRNA genes have been identified from six species of unicellular algae and one archaeon. Although their physiological significance and mechanism of development remain unclear, the splicing system of BHB motifs seems to have played a key role in the formation of permuted tRNA genes. In this review, current knowledge of circularly permuted tRNA genes is presented and some unanswered questions regarding these species are discussed.

  6. Informational redundancy of tRNA(4Ser) and tRNA(7Ser) genes in Drosophila melanogaster and evidence for intergenic recombination.

    Science.gov (United States)

    Leung, J; Sinclair, D A; Hayashi, S; Tener, G M; Grigliatti, T A

    1991-05-20

    Variant tRNA genes have been widely observed in multicellular eukaryotes. Recent biochemical studies have shown that some of them are expressed in a tissue- or a stage-specific manner. These findings would thus imply that certain modified tRNAs may be crucial for the development of the organism. Using Drosophila melanogaster as a model, we have taken a combined genetic and molecular approach to examine critically the possible biological functions of tRNA(4, 7Ser) genes. We showed that at least 50% of the total templates can be deleted from the genome without inducing abnormal phenotypes such as Minute, or a decrease in viability. In addition, two of the tRNASer variant genes that are unique in sequence are also completely dispensable. This strongly implies that even though they may be expressed in vivo, they play no essential role in the development of the fruitfly. By comparison with some of the corresponding tRNA genes in another sibling species, Drosophila erecta, our results suggest strongly that the variants are products non-reciprocal exchanges among the tRNA(4, 7Ser), genes. Such intergenic recombination events may have a major influence in the concerted evolution of the two gene families.

  7. Mitochondrial 16S rRNA Is Methylated by tRNA Methyltransferase TRMT61B in All Vertebrates

    Science.gov (United States)

    Bar-Yaacov, Dan; Frumkin, Idan; Yashiro, Yuka; Schlesinger, Orr; Bieri, Philipp; Greber, Basil; Ban, Nenad; Zarivach, Raz; Alfonta, Lital; Pilpel, Yitzhak; Suzuki, Tsutomu; Mishmar, Dan

    2016-01-01

    The mitochondrial ribosome, which translates all mitochondrial DNA (mtDNA)-encoded proteins, should be tightly regulated pre- and post-transcriptionally. Recently, we found RNA-DNA differences (RDDs) at human mitochondrial 16S (large) rRNA position 947 that were indicative of post-transcriptional modification. Here, we show that these 16S rRNA RDDs result from a 1-methyladenosine (m1A) modification introduced by TRMT61B, thus being the first vertebrate methyltransferase that modifies both tRNA and rRNAs. m1A947 is conserved in humans and all vertebrates having adenine at the corresponding mtDNA position (90% of vertebrates). However, this mtDNA base is a thymine in 10% of the vertebrates and a guanine in the 23S rRNA of 95% of bacteria, suggesting alternative evolutionary solutions. m1A, uridine, or guanine may stabilize the local structure of mitochondrial and bacterial ribosomes. Experimental assessment of genome-edited Escherichia coli showed that unmodified adenine caused impaired protein synthesis and growth. Our findings revealed a conserved mechanism of rRNA modification that has been selected instead of DNA mutations to enable proper mitochondrial ribosome function. PMID:27631568

  8. Cytonuclear Interactions in the Evolution of Animal Mitochondrial tRNA Metabolism.

    Science.gov (United States)

    Pett, Walker; Lavrov, Dennis V

    2015-06-27

    The evolution of mitochondrial information processing pathways, including replication, transcription and translation, is characterized by the gradual replacement of mitochondrial-encoded proteins with nuclear-encoded counterparts of diverse evolutionary origins. Although the ancestral enzymes involved in mitochondrial transcription and replication have been replaced early in eukaryotic evolution, mitochondrial translation is still carried out by an apparatus largely inherited from the α-proteobacterial ancestor. However, variation in the complement of mitochondrial-encoded molecules involved in translation, including transfer RNAs (tRNAs), provides evidence for the ongoing evolution of mitochondrial protein synthesis. Here, we investigate the evolution of the mitochondrial translational machinery using recent genomic and transcriptomic data from animals that have experienced the loss of mt-tRNAs, including phyla Cnidaria and Ctenophora, as well as some representatives of all four classes of Porifera. We focus on four sets of mitochondrial enzymes that directly interact with tRNAs: Aminoacyl-tRNA synthetases, glutamyl-tRNA amidotransferase, tRNA(Ile) lysidine synthetase, and RNase P. Our results support the observation that the fate of nuclear-encoded mitochondrial proteins is influenced by the evolution of molecules encoded in mitochondrial DNA, but in a more complex manner than appreciated previously. The data also suggest that relaxed selection on mitochondrial translation rather than coevolution between mitochondrial and nuclear subunits is responsible for elevated rates of evolution in mitochondrial translational proteins.

  9. Mitochondrial genome evolution and tRNA truncation in Acariformes mites: new evidence from eriophyoid mites.

    Science.gov (United States)

    Xue, Xiao-Feng; Guo, Jing-Feng; Dong, Yan; Hong, Xiao-Yue; Shao, Renfu

    2016-01-06

    The subclass Acari (mites and ticks) comprises two super-orders: Acariformes and Parasitiformes. Most species of the Parasitiformes known retained the ancestral pattern of mitochondrial (mt) gene arrangement of arthropods, and their mt tRNAs have the typical cloverleaf structure. All of the species of the Acariformes known, however, have rearranged mt genomes and truncated mt tRNAs. We sequenced the mt genomes of two species of Eriophyoidea: Phyllocoptes taishanensis and Epitrimerus sabinae. The mt genomes of P. taishanensis and E. sabinae are 13,475 bp and 13,531 bp, respectively, are circular and contain the 37 genes typical of animals; most mt tRNAs are highly truncated in both mites. On the other hand, these two eriophyoid mites have the least rearranged mt genomes seen in the Acariformes. Comparison between eriophyoid mites and other Aacariformes mites showed that: 1) the most recent common ancestor of Acariformes mites retained the ancestral pattern of mt gene arrangement of arthropods with slight modifications; 2) truncation of tRNAs for cysteine, phenylalanine and histidine occurred once in the most recent common ancestor of Acariformes mites whereas truncation of other tRNAs occurred multiple times; and 3) the placement of eriophyoid mites in the order Trombidiformes needs to be reviewed.

  10. Complete mitochondrial genome of Camponotus atrox (Hymenoptera: Formicidae): a new tRNA arrangement in Hymenoptera.

    Science.gov (United States)

    Kim, Min Jee; Hong, Eui Jeong; Kim, Iksoo

    2016-01-01

    We sequenced the complete mitochondrial (mt) genome of Camponotus atrox (Hymenoptera: Formicidae), which is only distributed in Korea. The genome was 16 540 bp in size and contained typical sets of genes (13 protein-coding genes, 22 tRNAs, and 2 rRNAs). The C. atrox A+T-rich region, at 1402 bp, was the longest of all sequenced ant genomes and was composed of an identical tandem repeat consisting of six 100-bp copies and one 96-bp copy. A total of 315 bp of intergenic spacer sequence was spread over 23 regions. An alignment of the spacer sequences in ants was largely feasible among congeneric species, and there was substantial sequence divergence, indicating their potential use as molecular markers for congeneric species. The A/T contents at the first and second codon positions of protein-coding genes (PCGs) were similar for ant species, including C. atrox (73.9% vs. 72.3%, on average). With increased taxon sampling among hymenopteran superfamilies, differences in the divergence rates (i.e., the non-synonymous substitution rates) between the suborders Symphyta and Apocrita were detected, consistent with previous results. The C. atrox mt genome had a unique gene arrangement, trnI-trnM-trnQ, at the A+T-rich region and ND2 junction (underline indicates inverted gene). This may have originated from a tandem duplication of trnM-trnI, resulting in trnM-trnI-trnM-trnI-trnQ, and the subsequent loss of the first trnM and second trnI, resulting in trnI-trnM-trnQ.

  11. Different sequence signatures in the upstream regions of plant and animal tRNA genes shape distinct modes of regulation.

    Science.gov (United States)

    Zhang, Gong; Lukoszek, Radoslaw; Mueller-Roeber, Bernd; Ignatova, Zoya

    2011-04-01

    In eukaryotes, the transcription of tRNA genes is initiated by the concerted action of transcription factors IIIC (TFIIIC) and IIIB (TFIIIB) which direct the recruitment of polymerase III. While TFIIIC recognizes highly conserved, intragenic promoter elements, TFIIIB binds to the non-coding 5'-upstream regions of the tRNA genes. Using a systematic bioinformatic analysis of 11 multicellular eukaryotic genomes we identified a highly conserved TATA motif followed by a CAA-motif in the tRNA upstream regions of all plant genomes. Strikingly, the 5'-flanking tRNA regions of the animal genomes are highly heterogeneous and lack a common conserved sequence signature. Interestingly, in the animal genomes the tRNA species that read the same codon share conserved motifs in their upstream regions. Deep-sequencing analysis of 16 human tissues revealed multiple splicing variants of two of the TFIIIB subunits, Bdp1 and Brf1, with tissue-specific expression patterns. These multiple forms most likely modulate the TFIIIB-DNA interactions and explain the lack of a uniform signature motif in the tRNA upstream regions of animal genomes. The anticodon-dependent 5'-flanking motifs provide a possible mechanism for independent regulation of the tRNA transcription in various human tissues.

  12. tRNADB-CE: tRNA gene database well-timed in the era of big sequence data.

    Science.gov (United States)

    Abe, Takashi; Inokuchi, Hachiro; Yamada, Yuko; Muto, Akira; Iwasaki, Yuki; Ikemura, Toshimichi

    2014-01-01

    The tRNA gene data base curated by experts "tRNADB-CE" (http://trna.ie.niigata-u.ac.jp) was constructed by analyzing 1,966 complete and 5,272 draft genomes of prokaryotes, 171 viruses', 121 chloroplasts', and 12 eukaryotes' genomes plus fragment sequences obtained by metagenome studies of environmental samples. 595,115 tRNA genes in total, and thus two times of genes compiled previously, have been registered, for which sequence, clover-leaf structure, and results of sequence-similarity and oligonucleotide-pattern searches can be browsed. To provide collective knowledge with help from experts in tRNA researches, we added a column for enregistering comments to each tRNA. By grouping bacterial tRNAs with an identical sequence, we have found high phylogenetic preservation of tRNA sequences, especially at the phylum level. Since many species-unknown tRNAs from metagenomic sequences have sequences identical to those found in species-known prokaryotes, the identical sequence group (ISG) can provide phylogenetic markers to investigate the microbial community in an environmental ecosystem. This strategy can be applied to a huge amount of short sequences obtained from next-generation sequencers, as showing that tRNADB-CE is a well-timed database in the era of big sequence data. It is also discussed that batch-learning self-organizing-map with oligonucleotide composition is useful for efficient knowledge discovery from big sequence data.

  13. tRNADB-CE: tRNA gene database well-timed in the era of big sequence data

    Directory of Open Access Journals (Sweden)

    Takashi eAbe

    2014-05-01

    Full Text Available The tRNA Gene Data Base Curated by Experts tRNADB-CE (http://trna.ie.niigata-u.ac.jp was constructed by analyzing 1,966 complete and 5,272 draft genomes of prokaryotes, 171 viruses’, 121 chloroplasts’, and 12 eukaryotes’ genomes plus fragment sequences obtained by metagenome studies of environmental samples. 595,115 tRNA genes in total, and thus two times of genes compiled previously, have been registered, for which sequence, clover-leaf structure, and results of sequence-similarity and oligonucleotide-pattern searches can be browsed. To provide collective knowledge with help from experts in tRNA researches, we added a column for enregistering comments to each tRNA. By grouping bacterial tRNAs with an identical sequence, we have found high phylogenetic preservation of tRNA sequences, especially at the phylum level. Since many species-unknown tRNAs from metagenomic sequences have sequences identical to those found in species-known prokaryotes, the identical sequence group can provide phylogenetic markers to investigate the microbial community in an environmental ecosystem. This strategy can be applied to a huge amount of short sequences obtained from next-generation sequencers, as showing that tRNADB-CE is a well-timed database in the era of big sequence data. It is also discussed that BLSOM with oligonucleotide composition is useful for efficient knowledge discovery from big sequence data.

  14. APOBEC3B cytidine deaminase targets the non-transcribed strand of tRNA genes in yeast.

    Science.gov (United States)

    Saini, Natalie; Roberts, Steven A; Sterling, Joan F; Malc, Ewa P; Mieczkowski, Piotr A; Gordenin, Dmitry A

    2017-05-01

    Variations in mutation rates across the genome have been demonstrated both in model organisms and in cancers. This phenomenon is largely driven by the damage specificity of diverse mutagens and the differences in DNA repair efficiency in given genomic contexts. Here, we demonstrate that the single-strand DNA-specific cytidine deaminase APOBEC3B (A3B) damages tRNA genes at a 1000-fold higher efficiency than other non-tRNA genomic regions in budding yeast. We found that A3B-induced lesions in tRNA genes were predominantly located on the non-transcribed strand, while no transcriptional strand bias was observed in protein coding genes. Furthermore, tRNA gene mutations were exacerbated in cells where RNaseH expression was completely abolished (Δrnh1Δrnh35). These data suggest a transcription-dependent mechanism for A3B-induced tRNA gene hypermutation. Interestingly, in strains proficient in DNA repair, only 1% of the abasic sites formed upon excision of A3B-deaminated cytosines were not repaired leading to mutations in tRNA genes, while 18% of these lesions failed to be repaired in the remainder of the genome. A3B-induced mutagenesis in tRNA genes was found to be efficiently suppressed by the redundant activities of both base excision repair (BER) and the error-free DNA damage bypass pathway. On the other hand, deficiencies in BER did not have a profound effect on A3B-induced mutations in CAN1, the reporter for protein coding genes. We hypothesize that differences in the mechanisms underlying ssDNA formation at tRNA genes and other genomic loci are the key determinants of the choice of the repair pathways and consequently the efficiency of DNA damage repair in these regions. Overall, our results indicate that tRNA genes are highly susceptible to ssDNA-specific DNA damaging agents. However, increased DNA repair efficacy in tRNA genes can prevent their hypermutation and maintain both genome and proteome homeostasis. Published by Elsevier B.V.

  15. The complete mitochondrial genome of Pseudocellus pearsei (Chelicerata: Ricinulei and a comparison of mitochondrial gene rearrangements in Arachnida

    Directory of Open Access Journals (Sweden)

    Braband Anke

    2007-10-01

    Full Text Available Abstract Background Mitochondrial genomes are widely utilized for phylogenetic and population genetic analyses among animals. In addition to sequence data the mitochondrial gene order and RNA secondary structure data are used in phylogenetic analyses. Arachnid phylogeny is still highly debated and there is a lack of sufficient sequence data for many taxa. Ricinulei (hooded tickspiders are a morphologically distinct clade of arachnids with uncertain phylogenetic affinities. Results The first complete mitochondrial DNA genome of a member of the Ricinulei, Pseudocellus pearsei (Arachnida: Ricinulei was sequenced using a PCR-based approach. The mitochondrial genome is a typical circular duplex DNA molecule with a size of 15,099 bp, showing the complete set of genes usually present in bilaterian mitochondrial genomes. Five tRNA genes (trnW, trnY, trnN, trnL(CUN, trnV show different relative positions compared to other Chelicerata (e.g. Limulus polyphemus, Ixodes spp.. We propose that two events led to this derived gene order: (1 a tandem duplication followed by random deletion and (2 an independent translocation of trnN. Most of the inferred tRNA secondary structures show the common cloverleaf pattern except tRNA-Glu where the TψC-arm is missing. In phylogenetic analyses (maximum likelihood, maximum parsimony, Bayesian inference using concatenated amino acid and nucleotide sequences of protein-coding genes the basal relationships of arachnid orders remain unresolved. Conclusion Phylogenetic analyses (ML, MP, BI of arachnid mitochondrial genomes fail to resolve interordinal relationships of Arachnida and remain in a preliminary stage because there is still a lack of mitogenomic data from important taxa such as Opiliones and Pseudoscorpiones. Gene order varies considerably within Arachnida – only eight out of 23 species have retained the putative arthropod ground pattern. Some gene order changes are valuable characters in phylogenetic analysis of

  16. RNA polymerase II induced transcription of tRNA genes and processing of the mRNAs in yeast

    Institute of Scientific and Technical Information of China (English)

    2000-01-01

    Only 5'-halves were produced when the terminator sequence for RNA polymerase (pol) 1II transcrip-tion was inserted into the intron of yeast tRNATyr gene. If a promoter and a terminator for pol II transcription flanked it,the tRNA gene could be transcribed by pol II, but the transcripts could not be processed into mature tRNAs. In con-trast, tRNA gene could also be transcribed by pol III and the transcripts could be processed into mature tRNAs even if a promoter and a terminator for pol II transcription flanked it. Pol II transcripts, modified with a self-cleaved hannner-head structure at 3'-end, were processed into mature tRNAs in the medium containing 100 mmol/L Mg2+ , indicating that the 3'-long trailer sequence blocks the maturation of tRNA gene transcripts by pol II.

  17. tRNA Biology in Mitochondria

    Directory of Open Access Journals (Sweden)

    Thalia Salinas-Giegé

    2015-02-01

    Full Text Available Mitochondria are the powerhouses of eukaryotic cells. They are considered as semi-autonomous because they have retained genomes inherited from their prokaryotic ancestor and host fully functional gene expression machineries. These organelles have attracted considerable attention because they combine bacterial-like traits with novel features that evolved in the host cell. Among them, mitochondria use many specific pathways to obtain complete and functional sets of tRNAs as required for translation. In some instances, tRNA genes have been partially or entirely transferred to the nucleus and mitochondria require precise import systems to attain their pool of tRNAs. Still, tRNA genes have also often been maintained in mitochondria. Their genetic arrangement is more diverse than previously envisaged. The expression and maturation of mitochondrial tRNAs often use specific enzymes that evolved during eukaryote history. For instance many mitochondria use a eukaryote-specific RNase P enzyme devoid of RNA. The structure itself of mitochondrial encoded tRNAs is also very diverse, as e.g., in Metazoan, where tRNAs often show non canonical or truncated structures. As a result, the translational machinery in mitochondria evolved adapted strategies to accommodate the peculiarities of these tRNAs, in particular simplified identity rules for their aminoacylation. Here, we review the specific features of tRNA biology in mitochondria from model species representing the major eukaryotic groups, with an emphasis on recent research on tRNA import, maturation and aminoacylation.

  18. tRNA Biology in Mitochondria

    Science.gov (United States)

    Salinas-Giegé, Thalia; Giegé, Richard; Giegé, Philippe

    2015-01-01

    Mitochondria are the powerhouses of eukaryotic cells. They are considered as semi-autonomous because they have retained genomes inherited from their prokaryotic ancestor and host fully functional gene expression machineries. These organelles have attracted considerable attention because they combine bacterial-like traits with novel features that evolved in the host cell. Among them, mitochondria use many specific pathways to obtain complete and functional sets of tRNAs as required for translation. In some instances, tRNA genes have been partially or entirely transferred to the nucleus and mitochondria require precise import systems to attain their pool of tRNAs. Still, tRNA genes have also often been maintained in mitochondria. Their genetic arrangement is more diverse than previously envisaged. The expression and maturation of mitochondrial tRNAs often use specific enzymes that evolved during eukaryote history. For instance many mitochondria use a eukaryote-specific RNase P enzyme devoid of RNA. The structure itself of mitochondrial encoded tRNAs is also very diverse, as e.g., in Metazoan, where tRNAs often show non canonical or truncated structures. As a result, the translational machinery in mitochondria evolved adapted strategies to accommodate the peculiarities of these tRNAs, in particular simplified identity rules for their aminoacylation. Here, we review the specific features of tRNA biology in mitochondria from model species representing the major eukaryotic groups, with an emphasis on recent research on tRNA import, maturation and aminoacylation. PMID:25734984

  19. 人类线粒体tRNA生物合成与线粒体疾病%Human Mitochondrial tRNA Synthesis and Mitochondrial Diseases

    Institute of Scientific and Technical Information of China (English)

    阳娅玲; 肖红利; 管敏鑫

    2013-01-01

    线粒体是普遍存在于真核细胞中的一类细胞器.每个线粒体含有多个拷贝的闭合环状双链DNA.人类线粒体DNA (mitochondrial DNA,mtDNA)共编码22种线粒体tRNA(mitochondrial tRNA,mt tRNA),2种rRNA及13种多肽.mt tRNA独特的结构特点决定了它们与具有典型三叶草结构的细胞质tRNA不同.编码mt tRNA的基因突变频率较高,这可能是引起线粒体功能障碍的主要原因之一.同时,这与很多病理现象相关.目前发现,大量与mt tRNA生物代谢和功能相关的核因子包括加工内切酶、tRNA修饰酶和氨酰-tRNA合成酶.这些核因子的异常导致了疾病相关的tRNA致病突变.由此可见mt tRNA功能对于线粒体活性的重要性.

  20. Optimization protein productivity of human interleukin-2 through codon usage, gene copy number and intracellular tRNA concentration in CHO cells.

    Science.gov (United States)

    Ou, Kua-Chun; Wang, Chih-Yang; Liu, Kuan-Ting; Chen, Yi-Ling; Chen, Yi-Chen; Lai, Ming-Derg; Yen, Meng-Chi

    2014-11-14

    Transfer RNA (tRNA) abundance is one of the critical factors for the enhancement of protein productivity in prokaryotic and eukaryotic hosts. Gene copy number of tRNA and tRNA codon usage bias are generally used to match tRNA abundance of protein-expressing hosts and to optimize the codons of recombinant proteins. Because sufficient concentration of intracellular tRNA and optimized codons of recombinant proteins enhanced translation efficiency, we hypothesized that sufficient supplement of host's tRNA improved protein productivity in mammalian cells. First, the small tRNA sequencing results of CHO-K1 cells showed moderate positive correlation with gene copy number and codon usage bias. Modification of human interleukin-2 (IL-2) through codons with high gene copy number and high codon usage bias (IL-2 HH, modified on Leu, Thr, Glu) significantly increased protein productivity in CHO-K1 cells. In contrast, modification through codons with relatively high gene copy number and low codon usage bias (IL-2 HL, modified on Ala, Thr, Val), or relatively low gene copy number and low codon usage bias (IL-2 LH, modified on Ala, Thr, Val) did not increase IL-2 productivity significantly. Furthermore, supplement of the alanine tRNA or threonine tRNA increased IL-2 productivity of IL-2 HL. In summary, we revealed a potential strategy to enhance productivity of recombinant proteins, which may be applied in production of protein drug or design of DNA vaccine.

  1. Mutations induced by monofunctional and bifunctional phosphoramide mustards in supF tRNA gene.

    Science.gov (United States)

    Mudipalli, A; Maccubbin, A E; Nadadur, S S; Struck, R F; Gurtoo, H L

    1997-11-19

    The relative mutagenicity, nature of the mutations and the sequence specificity of mutations induced by the bifunctional alkylating agent, phosphoramide mustard (PM) and a monofunctional derivative, dechloroethyl phosphoramide mustard (dePM), were analyzed by the Ames test and by an in vitro shuttle vector mutagenesis assay. Both PM and dePM increased the mutation frequency above background in either assay. However, on an equimolar basis, dePM was less mutagenic than PM. In the in vitro shuttle vector mutagenesis assay, sequencing demonstrated that about 40% of the mutant plasmids contained more than one mutation in the supF tRNA gene segment of the plasmid. About 70% of the mutations observed in dePM-treated plasmids were single base substitutions with A:T and G:C base pairs being mutated at equivalent rates. In contrast, only about 50% of the mutations observed in PM-treated plasmids were single base substitutions, 80% of which involved G:C base pairs. Single base deletions and insertions were found in approximately equal proportions with both compounds; however, these lesions were in greater abundance in PM-treated plasmids. Putative hot-spots for mutation in the supF tRNA gene included base pairs at position 102 and 110 for PM and positions 170 and 171 for dePM.

  2. Complete mitochondrial genome of the endangered roughskin sculpin Trachidermus fasciatus (Scorpaeniformes, Cottidae).

    Science.gov (United States)

    Zeng, Zhen; Liu, Zhi Zhi; Pan, Lian De; Tang, Shou Jie; Wang, Cong Tao; Tang, Wen Qiao; Yang, Jin Quan

    2012-12-01

    In this study, the complete mitochondrial genome of the endangered roughskin sculpin, Trachidermus fasciatus, was first determined. The mitogenome (16,536 bp) consisted of 13 protein-coding genes, 22 tRNA genes, 2 rRNA genes, and 1 control region. Except for the eight tRNA and ND6 genes, all other mitochondrial genes were encoded on the heavy strand. Mitochondrial DNA information can assist in species identification and conservation of the species' natural resources.

  3. Direct Regulation of tRNA and 5S rRNA Gene Transcription by Polo-like Kinase 1

    NARCIS (Netherlands)

    Fairley, Jennifer A.; Mitchell, Louise E.; Berg, Tracy; Kenneth, Niall S.; von Schubert, Conrad; Sillje, Herman H. W.; Medema, Rene H.; Nigg, Erich A.; White, Robert J.

    2012-01-01

    Polo-like kinase Plk1 controls numerous aspects of cell-cycle progression. We show that it associates with tRNA and 5S rRNA genes and regulates their transcription by RNA polymerase Ill (pol Ill) through direct binding and phosphorylation of transcription factor Brit During interphase, Plk1 promotes

  4. Direct Regulation of tRNA and 5S rRNA Gene Transcription by Polo-like Kinase 1

    NARCIS (Netherlands)

    Fairley, Jennifer A.; Mitchell, Louise E.; Berg, Tracy; Kenneth, Niall S.; von Schubert, Conrad; Sillje, Herman H. W.; Medema, Rene H.; Nigg, Erich A.; White, Robert J.

    2012-01-01

    Polo-like kinase Plk1 controls numerous aspects of cell-cycle progression. We show that it associates with tRNA and 5S rRNA genes and regulates their transcription by RNA polymerase Ill (pol Ill) through direct binding and phosphorylation of transcription factor Brit During interphase, Plk1 promotes

  5. The complete mitochondrial genome sequence and gene organization of Tridentiger trigonocephalus (Gobiidae: Gobionellinae) with phylogenetic consideration.

    Science.gov (United States)

    Wei, Hongqing; Ma, Hongyu; Ma, Chunyan; Zhang, Fengying; Wang, Wei; Chen, Wei; Ma, Lingbo

    2016-09-01

    The complete mitochondrial genome plays an important role in studies of genome-level characteristics and phylogenetic relationships. Here we determined the complete mitogenome sequence of Tridentiger trigonocephalus (Perciformes, Gobiidae), and discovered its phylogenetic relationship. This circular genome was 16 662 bp in length, and consisted of 37 typical genes, including 13 protein-coding genes, 22 tRNA genes, and two rRNA genes. The gene order of T. trigonocephalus mitochondrial genome was identical to those observed in most other vertebrates. Of 37 genes, 28 were encoded by heavy strand, while the others were encoded by light strand. The phylogenetic tree constructed by 13 concatenated protein-coding genes showed that T. trigonocephalus was closest to T. bifasciatus, and then to T. barbatus among the 20 species within suborder Gobioidei. This work should facilitate the studies on population genetic diversity, and molecular evolution in Gobioidei fishes.

  6. Next-Generation Sequencing of Two Mitochondrial Genomes from Family Pompilidae (Hymenoptera: Vespoidea Reveal Novel Patterns of Gene Arrangement

    Directory of Open Access Journals (Sweden)

    Peng-Yan Chen

    2016-10-01

    Full Text Available Animal mitochondrial genomes have provided large and diverse datasets for evolutionary studies. Here, the first two representative mitochondrial genomes from the family Pompilidae (Hymenoptera: Vespoidea were determined using next-generation sequencing. The sequenced region of these two mitochondrial genomes from the species Auplopus sp. and Agenioideus sp. was 16,746 bp long with an A + T content of 83.12% and 16,596 bp long with an A + T content of 78.64%, respectively. In both species, all of the 37 typical mitochondrial genes were determined. The secondary structure of tRNA genes and rRNA genes were predicted and compared with those of other insects. Atypical trnS1 using abnormal anticodons TCT and lacking D-stem pairings was identified. There were 49 helices belonging to six domains in rrnL and 30 helices belonging to three domains in rrns present. Compared with the ancestral organization, four and two tRNA genes were rearranged in mitochondrial genomes of Auplopus and Agenioideus, respectively. In both species, trnM was shuffled upstream of the trnI-trnQ-trnM cluster, and trnA was translocated from the cluster trnA-trnR-trnN-trnS1-trnE-trnF to the region between nad1 and trnL1, which is novel to the Vespoidea. In Auplopus, the tRNA cluster trnW-trnC-trnY was shuffled to trnW-trnY-trnC. Phylogenetic analysis within Vespoidea revealed that Pompilidae and Mutillidae formed a sister lineage, and then sistered Formicidae. The genomes presented in this study have enriched the knowledge base of molecular markers, which is valuable in respect to studies about the gene rearrangement mechanism, genomic evolutionary processes and phylogeny of Hymenoptera.

  7. Molecular mechanisms of extensive mitochondrial gene rearrangementin plethodontid salamanders

    Energy Technology Data Exchange (ETDEWEB)

    Mueller, Rachel Lockridge; Boore, Jeffrey L.

    2005-06-01

    Extensive gene rearrangement is reported in the mitochondrial genomes of lungless salamanders (Plethodontidae). In each genome with a novel gene order, there is evidence that the rearrangement was mediated by duplication of part of the mitochondrial genome, including the presence of both pseudogenes and additional, presumably functional, copies of duplicated genes. All rearrangement-mediating duplications include either the origin of light strand replication and the nearby tRNA genes or the regions flanking the origin of heavy strand replication. The latter regions comprise nad6, trnE, cob, trnT, an intergenic spacer between trnT and trnP and, in some genomes, trnP, the control region, trnF, rrnS, trnV, rrnL, trnL1, and nad1. In some cases, two copies of duplicated genes, presumptive regulatory regions, and/or sequences with no assignable function have been retained in the genome following the initial duplication; in other genomes, only one of the duplicated copies has been retained. Both tandem and non-tandem duplications are present in these genomes, suggesting different duplication mechanisms. In some of these mtDNAs, up to 25 percent of the total length is composed of tandem duplications of non-coding sequence that includes putative regulatory regions and/or pseudogenes of tRNAs and protein-coding genes along with otherwise unassignable sequences. These data indicate that imprecise initiation and termination of replication, slipped-strand mispairing, and intra-molecular recombination may all have played a role in generating repeats during the evolutionary history of plethodontid mitochondrial genomes.

  8. Clinical characteristics of diabetes with mitochondrial tRNA Leu(UUR) gene 3243 A to G mutation%线粒体tRNALeu(UUR)基因A3243G突变糖尿病患者的临床特征

    Institute of Scientific and Technical Information of China (English)

    杨篷; 张曼娜; 盛春君; 李妍; 周娇娇; 崔文洁; 曲伸

    2015-01-01

    目的:探讨线粒体tRNALeu(UUR)基因A3243G突变糖尿病患者的临床特征。方法选取临床症状疑似线粒体基因突变糖尿病患者12例,采外周血提取DNA ,检测mtDNA 3243A→G点突变情况。结果共4例携带mtDNA 3243A→G点突变,均存在线粒体基因突变糖尿病的典型临床表现,即起病年龄早、体型消瘦、伴严重双耳听力损害、胰岛β细胞分泌功能降低及无明显母系遗传史。在测定骨密度的3例患者中,2例骨质疏松,1例骨密度降低。结论线粒体基因突变糖尿病患者存在一定的隐匿性,对消瘦、耳聋的年轻患者进行线粒体基因突变筛查及骨代谢评估,有利于及时诊治线粒体基因突变糖尿病患者,防止并发症发生。%Objective To investigate the clinical characteristics of diabetic patients with mitochondrial DNA (mtDNA ) mt3243A → G mutation. Methods Twelve suspected mitochondrial diabetic patients were recruited. The gene fragment was produced by PCR ,and mutation was detected by direct sequencing. Results Four of twelve suspected mtDNA diabetic patients carried mt 3243A → G mutation. All four patients had classic clinical features of mitochondrial DNA diabetes ,including diabetes in early age ,low BMI ,deafness ,and impairedβcell function ,but without significant maternal inheritance. Furthermore ,two of three patients were diagnosed as severe osteoporosis ,and one was diagnosed as reduced bone mineral density. Conclusion Screening the mitochondrial gene mutation in the diabetes patients with lean and deafness can improve the diagnostic rate. Clinicians should pay attention to abnormal bone metabolism in the patients with mitochondrial diabetes.

  9. Two complete mitochondrial genomes from Praticolella mexicana Perez, 2011 (Polygyridae) and gene order evolution in Helicoidea (Mollusca, Gastropoda)

    Science.gov (United States)

    Minton, Russell L.; Cruz, Marco A. Martinez; Farman, Mark L.; Perez, Kathryn E.

    2016-01-01

    Abstract Helicoidea is a diverse group of land snails with a global distribution. While much is known regarding the relationships of helicoid taxa, comparatively little is known about the evolution of the mitochondrial genome in the superfamily. We sequenced two complete mitochondrial genomes from Praticolella mexicana Perez, 2011 representing the first such data from the helicoid family Polygyridae, and used them in an evolutionary analysis of mitogenomic gene order. We found the mitochondrial genome of Praticolella mexicana to be 14,008 bp in size, possessing the typical 37 metazoan genes. Multiple alternate stop codons are used, as are incomplete stop codons. Mitogenome size and nucleotide content is consistent with other helicoid species. Our analysis of gene order suggested that Helicoidea has undergone four mitochondrial rearrangements in the past. Two rearrangements were limited to tRNA genes only, and two involved protein coding genes. PMID:27833437

  10. A complete mitochondrial genome of wheat (Triticum aestivum cv. Chinese Yumai), and fast evolving mitochondrial genes in higher plants

    Indian Academy of Sciences (India)

    Peng Cui; Huitao Liu; Qiang Lin; Feng Ding; Guoyin Zhuo; Songnian Hu; Dongcheng Liu; Wenlong Yang; Kehui Zhan; Aimin Zhang; Jun Yu

    2009-12-01

    Plant mitochondrial genomes, encoding necessary proteins involved in the system of energy production, play an important role in the development and reproduction of the plant. They occupy a specific evolutionary pattern relative to their nuclear counterparts. Here, we determined the winter wheat (Triticum aestivum cv. Chinese Yumai) mitochondrial genome in a length of 452 and 526 bp by shotgun sequencing its BAC library. It contains 202 genes, including 35 known protein-coding genes, three rRNA and 17 tRNA genes, as well as 149 open reading frames (ORFs; greater than 300 bp in length). The sequence is almost identical to the previously reported sequence of the spring wheat (T. aestivum cv. Chinese Spring); we only identified seven SNPs (three transitions and four transversions) and 10 indels (insertions and deletions) between the two independently acquired sequences, and all variations were found in non-coding regions. This result confirmed the accuracy of the previously reported mitochondrial sequence of the Chinese Spring wheat. The nucleotide frequency and codon usage of wheat are common among the lineage of higher plant with a high AT-content of 58%. Molecular evolutionary analysis demonstrated that plant mitochondrial genomes evolved at different rates, which may correlate with substantial variations in metabolic rate and generation time among plant lineages. In addition, through the estimation of the ratio of non-synonymous to synonymous substitution rates between orthologous mitochondrion-encoded genes of higher plants, we found an accelerated evolutionary rate that seems to be the result of relaxed selection.

  11. Evolution of the mitochondrial genome in snakes: Gene rearrangements and phylogenetic relationships

    Directory of Open Access Journals (Sweden)

    Zhou Kaiya

    2008-11-01

    Full Text Available Abstract Background Snakes as a major reptile group display a variety of morphological characteristics pertaining to their diverse behaviours. Despite abundant analyses of morphological characters, molecular studies using mitochondrial and nuclear genes are limited. As a result, the phylogeny of snakes remains controversial. Previous studies on mitochondrial genomes of snakes have demonstrated duplication of the control region and translocation of trnL to be two notable features of the alethinophidian (all serpents except blindsnakes and threadsnakes mtDNAs. Our purpose is to further investigate the gene organizations, evolution of the snake mitochondrial genome, and phylogenetic relationships among several major snake families. Results The mitochondrial genomes were sequenced for four taxa representing four different families, and each had a different gene arrangement. Comparative analyses with other snake mitochondrial genomes allowed us to summarize six types of mitochondrial gene arrangement in snakes. Phylogenetic reconstruction with commonly used methods of phylogenetic inference (BI, ML, MP, NJ arrived at a similar topology, which was used to reconstruct the evolution of mitochondrial gene arrangements in snakes. Conclusion The phylogenetic relationships among the major families of snakes are in accordance with the mitochondrial genomes in terms of gene arrangements. The gene arrangement in Ramphotyphlops braminus mtDNA is inferred to be ancestral for snakes. After the divergence of the early Ramphotyphlops lineage, three types of rearrangements occurred. These changes involve translocations within the IQM tRNA gene cluster and the duplication of the CR. All phylogenetic methods support the placement of Enhydris plumbea outside of the (Colubridae + Elapidae cluster, providing mitochondrial genomic evidence for the familial rank of Homalopsidae.

  12. Parkinson's disease and mitochondrial gene variations

    DEFF Research Database (Denmark)

    Andalib, Sasan; Vafaee, Manouchehr Seyedi; Gjedde, Albert

    2014-01-01

    Parkinson's disease (PD) is a common disorder of the central nervous system in the elderly. The pathogenesis of PD is a complex process, with genetics as an important contributing factor. This factor may stem from mitochondrial gene variations and mutations as well as from nuclear gene variations...... and mutations. More recently, a particular role of mitochondrial dysfunction has been suggested, arising from mitochondrial DNA variations or acquired mutations in PD pathogenesis. The present review summarizes and weighs the evidence in support of mitochondrial DNA (mtDNA) variations as important contributors...

  13. NFU1 gene mutation and mitochondrial disorders

    Directory of Open Access Journals (Sweden)

    Yasemin G Kurt

    2016-01-01

    Full Text Available Mitochondrial respiratory chains consist of approximately 100 structural proteins. Thirteen of these structural proteins are encoded by mitochondrial DNA (mtDNA, and the others by nuclear DNA (nDNA. Mutation in any of the mitochondrial structural-protein related genes, regardless of whether they are in the nDNA or mtDNA, might cause mitochondrial disorders. In the recent past, new nuclear genes required for assembly, maintenance, and translation of respiratory chain proteins have been found. Mutation in these genes might also cause mitochondrial disorders (MD. NFU1 gene is one of such genes and has a role in the assembly of iron–sulfur cluster (ISC. ISCs are included in a variety of metalloproteins, such as the ferredoxins, as well as in enzymatic reactions and have been first identified in the oxidation-reduction reactions of mitochondrial electron transport. It is important to be aware of NFU1 gene mutations that may cause severe mitochondrial respiratory chain defects, mitochondrial encephalomyopathies and death, early in life.

  14. Dicistronic tRNA-5S rRNA genes in Yarrowia lipolytica: an alternative TFIIIA-independent way for expression of 5S rRNA genes.

    Science.gov (United States)

    Acker, Joël; Ozanne, Christophe; Kachouri-Lafond, Rym; Gaillardin, Claude; Neuvéglise, Cécile; Marck, Christian

    2008-10-01

    In eukaryotes, genes transcribed by RNA polymerase III (Pol III) carry their own internal promoters and as such, are transcribed as individual units. Indeed, a very few cases of dicistronic Pol III genes are yet known. In contrast to other hemiascomycetes, 5S rRNA genes of Yarrowia lipolytica are not embedded into the tandemly repeated rDNA units, but appear scattered throughout the genome. We report here an unprecedented genomic organization: 48 over the 108 copies of the 5S rRNA genes are located 3' of tRNA genes. We show that these peculiar tRNA-5S rRNA dicistronic genes are expressed in vitro and in vivo as Pol III transcriptional fusions without the need of the 5S rRNA gene-specific factor TFIIIA, the deletion of which displays a viable phenotype. We also report the existence of a novel putative non-coding Pol III RNA of unknown function about 70 nucleotide-long (RUF70), the 13 genes of which are devoid of internal Pol III promoters and located 3' of the 13 copies of the tDNA-Trp (CCA). All genes embedded in the various dicistronic genes, fused 5S rRNA genes, RUF70 genes and their leader tRNA genes appear to be efficiently transcribed and their products correctly processed in vivo.

  15. Direct regulation of tRNA and 5S rRNA gene transcription by Polo-like kinase 1.

    Science.gov (United States)

    Fairley, Jennifer A; Mitchell, Louise E; Berg, Tracy; Kenneth, Niall S; von Schubert, Conrad; Silljé, Herman H W; Medema, René H; Nigg, Erich A; White, Robert J

    2012-02-24

    Polo-like kinase Plk1 controls numerous aspects of cell-cycle progression. We show that it associates with tRNA and 5S rRNA genes and regulates their transcription by RNA polymerase III (pol III) through direct binding and phosphorylation of transcription factor Brf1. During interphase, Plk1 promotes tRNA and 5S rRNA expression by phosphorylating Brf1 directly on serine 450. However, this stimulatory modification is overridden at mitosis, when elevated Plk1 activity causes Brf1 phosphorylation on threonine 270 (T270), which prevents pol III recruitment. Thus, although Plk1 enhances net tRNA and 5S rRNA production, consistent with its proliferation-stimulating function, it also suppresses untimely transcription when cells divide. Genomic instability is apparent in cells with Brf1 T270 mutated to alanine to resist Plk1-directed inactivation, suggesting that chromosome segregation is vulnerable to inappropriate pol III activity. Copyright © 2012 Elsevier Inc. All rights reserved.

  16. Engineering and Validation of a Vector for Concomitant Expression of Rare Transfer RNA (tRNA) and HIV-1 nef Genes in Escherichia coli.

    Science.gov (United States)

    Mualif, Siti Aisyah; Teow, Sin-Yeang; Omar, Tasyriq Che; Chew, Yik Wei; Yusoff, Narazah Mohd; Ali, Syed A

    2015-01-01

    Relative ease in handling and manipulation of Escherichia coli strains make them primary candidate to express proteins heterologously. Overexpression of heterologous genes that contain codons infrequently used by E. coli is related with difficulties such as mRNA instability, early termination of transcription and/or translation, deletions and/or misincorporation, and cell growth inhibition. These codon bias -associated problems are addressed by co-expressing ColE1-compatible, rare tRNA expressing helper plasmids. However, this approach has inadequacies, which we have addressed by engineering an expression vector that concomitantly expresses the heterologous protein of interest, and rare tRNA genes in E. coli. The expression vector contains three (argU, ileY, leuW) rare tRNA genes and a useful multiple cloning site for easy in-frame cloning. To maintain the overall size of the parental plasmid vector, the rare tRNA genes replaced the non-essential DNA segments in the vector. The cloned gene is expressed under the control of T7 promoter and resulting recombinant protein has a C-terminal 6His tag for IMAC-mediated purification. We have evaluated the usefulness of this expression vector by expressing three HIV-1 genes namely HIV-1 p27 (nef), HIV-1 p24 (ca), and HIV-1 vif in NiCo21(DE3) E.coli and demonstrated the advantages of using expression vector that concomitantly expresses rare tRNA and heterologous genes.

  17. TRMT5 Mutations Cause a Defect in Post-transcriptional Modification of Mitochondrial tRNA Associated with Multiple Respiratory-Chain Deficiencies

    NARCIS (Netherlands)

    Powell, C.A.; Kopajtich, R.; D'Souza, A.R.; Rorbach, J.; Kremer, L.S.; Husain, R.A.; Dallabona, C.; Donnini, C.; Alston, C.L.; Griffin, H.; Pyle, A.; Chinnery, P.F.; Strom, T.M.; Meitinger, T.; Rodenburg, R.J.; Schottmann, G.; Schuelke, M.; Romain, N.; Haller, R.G.; Ferrero, I.; Haack, T.B.; Taylor, R.W.; Prokisch, H.; Minczuk, M.

    2015-01-01

    Deficiencies in respiratory-chain complexes lead to a variety of clinical phenotypes resulting from inadequate energy production by the mitochondrial oxidative phosphorylation system. Defective expression of mtDNA-encoded genes, caused by mutations in either the mitochondrial or nuclear genome, repr

  18. The Complete Mitochondrial Genome of Aleurocanthus camelliae: Insights into Gene Arrangement and Genome Organization within the Family Aleyrodidae.

    Science.gov (United States)

    Chen, Shi-Chun; Wang, Xiao-Qing; Li, Pin-Wu; Hu, Xiang; Wang, Jin-Jun; Peng, Ping

    2016-11-07

    There are numerous gene rearrangements and transfer RNA gene absences existing in mitochondrial (mt) genomes of Aleyrodidae species. To understand how mt genomes evolved in the family Aleyrodidae, we have sequenced the complete mt genome of Aleurocanthus camelliae and comparatively analyzed all reported whitefly mt genomes. The mt genome of A. camelliae is 15,188 bp long, and consists of 13 protein-coding genes, two rRNA genes, 21 tRNA genes and a putative control region (GenBank: KU761949). The tRNA gene, trnI, has not been observed in this genome. The mt genome has a unique gene order and shares most gene boundaries with Tetraleurodes acaciae. Nineteen of 21 tRNA genes have the conventional cloverleaf shaped secondary structure and two (trnS₁ and trnS₂) lack the dihydrouridine (DHU) arm. Using ARWEN and homologous sequence alignment, we have identified five tRNA genes and revised the annotation for three whitefly mt genomes. This result suggests that most absent genes exist in the genomes and have not been identified, due to be lack of technology and inference sequence. The phylogenetic relationships among 11 whiteflies and Drosophila melanogaster were inferred by maximum likelihood and Bayesian inference methods. Aleurocanthus camelliae and T. acaciae form a sister group, and all three Bemisia tabaci and two Bemisia afer strains gather together. These results are identical to the relationships inferred from gene order. We inferred that gene rearrangement plays an important role in the mt genome evolved from whiteflies.

  19. The complete sequence and gene organization of the mitochondrial genome of the gadilid scaphopod Siphonondentalium lobatum (Mollusca).

    Science.gov (United States)

    Dreyer, Hermann; Steiner, Gerhard

    2004-05-01

    Comparisons of mitochondrial gene sequences and gene arrangements can be informative for reconstructing high-level phylogenetic relationships. We determined the complete sequence of the mitochondrial genome of Siphonodentalium lobatum, (Mollusca, Scaphopoda). With only 13,932 bases, it is the shortest molluscan mitochondrial genome reported so far. The genome contains the usual 13 protein-coding genes, two rRNA and 22 tRNA genes. The ATPase subunit 8 gene is exceptionally short. Several transfer RNAs show truncated TpsiC arms or DHU arms. The gene arrangement of S. lobatum is markedly different from all other known molluscan mitochondrial genomes and shows low similarity even to an unpublished gene order of a dentaliid scaphopod. Phylogenetic analyses of all available complete molluscan mitochondrial genomes based on amino acid sequences of 11 protein-coding genes yield trees with low support for the basal branches. None of the traditionally accepted molluscan taxa and phylogenies are recovered in all analyses, except for the euthyneuran Gastropoda. S. lobatum appears as the sister taxon to two of the three bivalve species. We conclude that the deep molluscan phylogeny is probably beyond the resolution of mitochondrial protein sequences. Moreover, assessing the phylogenetic signal in gene order data requires a much larger taxon sample than is currently available, given the exceptional diversity of this character set in the Mollusca.

  20. Pathogenic mutations of nuclear genes associated with mitochondrial disorders

    Institute of Scientific and Technical Information of China (English)

    Xiaoyu Zhu; Xuerui Peng; Min-Xin Guan; Qingfeng Yan

    2009-01-01

    Mitochondrial disorders are clinical phenotypes associated with mitochondrial dysfunction, which can be caused by mutations in mitochondrial DNA (mtDNA) or nuclear genes. In this review, we summarized the pathogenic mutations of nuclear genes associated with mitochondrial disorders. These nuclear genes encode, components of mitochondrial translational machinery and structural subunits and assembly factors of the oxidative phosphorylation, that complex. The molecular mechanisms, that nuclear modifier genes modulate the phenotypic expression of mtDNA mutations, are discussed in detail.

  1. Shaping tRNA

    Science.gov (United States)

    Priano, Christine

    2013-01-01

    This model-building activity provides a quick, visual, hands-on tool that allows students to examine more carefully the cloverleaf structure of a typical tRNA molecule. When used as a supplement to lessons that involve gene expression, this exercise reinforces several concepts in molecular genetics, including nucleotide base-pairing rules, the…

  2. The complete mitochondrial genome of the house dust mite Dermatophagoides pteronyssinus (Trouessart: a novel gene arrangement among arthropods

    Directory of Open Access Journals (Sweden)

    Vanholme Bartel

    2009-03-01

    Full Text Available Abstract Background The apparent scarcity of available sequence data has greatly impeded evolutionary studies in Acari (mites and ticks. This subclass encompasses over 48,000 species and forms the largest group within the Arachnida. Although mitochondrial genomes are widely utilised for phylogenetic and population genetic studies, only 20 mitochondrial genomes of Acari have been determined, of which only one belongs to the diverse order of the Sarcoptiformes. In this study, we describe the mitochondrial genome of the European house dust mite Dermatophagoides pteronyssinus, the most important member of this largely neglected group. Results The mitochondrial genome of D. pteronyssinus is a circular DNA molecule of 14,203 bp. It contains the complete set of 37 genes (13 protein coding genes, 2 rRNA genes and 22 tRNA genes, usually present in metazoan mitochondrial genomes. The mitochondrial gene order differs considerably from that of other Acari mitochondrial genomes. Compared to the mitochondrial genome of Limulus polyphemus, considered as the ancestral arthropod pattern, only 11 of the 38 gene boundaries are conserved. The majority strand has a 72.6% AT-content but a GC-skew of 0.194. This skew is the reverse of that normally observed for typical animal mitochondrial genomes. A microsatellite was detected in a large non-coding region (286 bp, which probably functions as the control region. Almost all tRNA genes lack a T-arm, provoking the formation of canonical cloverleaf tRNA-structures, and both rRNA genes are considerably reduced in size. Finally, the genomic sequence was used to perform a phylogenetic study. Both maximum likelihood and Bayesian inference analysis clustered D. pteronyssinus with Steganacarus magnus, forming a sistergroup of the Trombidiformes. Conclusion Although the mitochondrial genome of D. pteronyssinus shares different features with previously characterised Acari mitochondrial genomes, it is unique in many ways. Gene

  3. Co segregation of the m.1555A>G mutation in the MT-RNR1 gene and mutations in MT-ATP6 gene in a family with dilated mitochondrial cardiomyopathy and hearing loss: A whole mitochondrial genome screening.

    Science.gov (United States)

    Alila-Fersi, Olfa; Chamkha, Imen; Majdoub, Imen; Gargouri, Lamia; Mkaouar-Rebai, Emna; Tabebi, Mouna; Tlili, Abdelaziz; Keskes, Leila; Mahfoudh, Abdelmajid; Fakhfakh, Faiza

    2017-02-26

    Mitochondrial disease refers to a heterogeneous group of disorders resulting in defective cellular energy production due to dysfunction of the mitochondrial respiratory chain, which is responsible for the generation of most cellular energy. Because cardiac muscles are one of the high energy demanding tissues, mitochondrial cardiomyopathies is one of the most frequent mitochondria disorders. Mitochondrial cardiomyopathy has been associated with several point mutations of mtDNA in both genes encoded mitochondrial proteins and mitochondrial tRNA and rRNA. We reported here the first description of mutations in MT-ATP6 gene in two patients with clinical features of dilated mitochondrial cardiomyopathy. The mutational analysis of the whole mitochondrial DNA revealed the presence of m.1555A>G mutation in MT-RNR1 gene associated to the m.8527A>G (p.M>V) and the m.8392C>T (p.136P>S) variations in the mitochondrial MT-ATP6 gene in patient1 and his family members with variable phenotype including hearing impairment. The second patient with isolated mitochondrial cardiomyopathy presented the m.8605C>T (p.27P>S) mutation in the MT-ATP6 gene. The three mutations p.M1V, p.P27S and p.P136S detected in MT-ATP6 affected well conserved residues of the mitochondrial protein ATPase 6. In addition, the substitution of proline residue at position 27 and 136 effect hydrophobicity and structure flexibility conformation of the protein.

  4. Extensive loss of translational genes in the structurally dynamic mitochondrial genome of the angiosperm Silene latifolia

    Directory of Open Access Journals (Sweden)

    Sloan Daniel B

    2010-09-01

    Full Text Available Abstract Background Mitochondrial gene loss and functional transfer to the nucleus is an ongoing process in many lineages of plants, resulting in substantial variation across species in mitochondrial gene content. The Caryophyllaceae represents one lineage that has experienced a particularly high rate of mitochondrial gene loss relative to other angiosperms. Results In this study, we report the first complete mitochondrial genome sequence from a member of this family, Silene latifolia. The genome can be mapped as a 253,413 bp circle, but its structure is complicated by a large repeated region that is present in 6 copies. Active recombination among these copies produces a suite of alternative genome configurations that appear to be at or near "recombinational equilibrium". The genome contains the fewest genes of any angiosperm mitochondrial genome sequenced to date, with intact copies of only 25 of the 41 protein genes inferred to be present in the common ancestor of angiosperms. As observed more broadly in angiosperms, ribosomal proteins have been especially prone to gene loss in the S. latifolia lineage. The genome has also experienced a major reduction in tRNA gene content, including loss of functional tRNAs of both native and chloroplast origin. Even assuming expanded wobble-pairing rules, the mitochondrial genome can support translation of only 17 of the 61 sense codons, which code for only 9 of the 20 amino acids. In addition, genes encoding 18S and, especially, 5S rRNA exhibit exceptional sequence divergence relative to other plants. Divergence in one region of 18S rRNA appears to be the result of a gene conversion event, in which recombination with a homologous gene of chloroplast origin led to the complete replacement of a helix in this ribosomal RNA. Conclusions These findings suggest a markedly expanded role for nuclear gene products in the translation of mitochondrial genes in S. latifolia and raise the possibility of altered

  5. The complete mitochondrial genome and novel gene arrangement of the unique-headed bug Stenopirates sp. (Hemiptera: Enicocephalidae.

    Directory of Open Access Journals (Sweden)

    Hu Li

    Full Text Available Many of true bugs are important insect pests to cultivated crops and some are important vectors of human diseases, but few cladistic analyses have addressed relationships among the seven infraorders of Heteroptera. The Enicocephalomorpha and Nepomorpha are consider the basal groups of Heteroptera, but the basal-most lineage remains unresolved. Here we report the mitochondrial genome of the unique-headed bug Stenopirates sp., the first mitochondrial genome sequenced from Enicocephalomorpha. The Stenopirates sp. mitochondrial genome is a typical circular DNA molecule of 15, 384 bp in length, and contains 37 genes and a large non-coding fragment. The gene order differs substantially from other known insect mitochondrial genomes, with rearrangements of both tRNA genes and protein-coding genes. The overall AT content (82.5% of Stenopirates sp. is the highest among all the known heteropteran mitochondrial genomes. The strand bias is consistent with other true bugs with negative GC-skew and positive AT-skew for the J-strand. The heteropteran mitochondrial atp8 exhibits the highest evolutionary rate, whereas cox1 appears to have the lowest rate. Furthermore, a negative correlation was observed between the variation of nucleotide substitutions and the GC content of each protein-coding gene. A microsatellite was identified in the putative control region. Finally, phylogenetic reconstruction suggests that Enicocephalomorpha is the sister group to all the remaining Heteroptera.

  6. Engineering and Validation of a Vector for Concomitant Expression of Rare Transfer RNA (tRNA and HIV-1 nef Genes in Escherichia coli.

    Directory of Open Access Journals (Sweden)

    Siti Aisyah Mualif

    Full Text Available Relative ease in handling and manipulation of Escherichia coli strains make them primary candidate to express proteins heterologously. Overexpression of heterologous genes that contain codons infrequently used by E. coli is related with difficulties such as mRNA instability, early termination of transcription and/or translation, deletions and/or misincorporation, and cell growth inhibition. These codon bias -associated problems are addressed by co-expressing ColE1-compatible, rare tRNA expressing helper plasmids. However, this approach has inadequacies, which we have addressed by engineering an expression vector that concomitantly expresses the heterologous protein of interest, and rare tRNA genes in E. coli. The expression vector contains three (argU, ileY, leuW rare tRNA genes and a useful multiple cloning site for easy in-frame cloning. To maintain the overall size of the parental plasmid vector, the rare tRNA genes replaced the non-essential DNA segments in the vector. The cloned gene is expressed under the control of T7 promoter and resulting recombinant protein has a C-terminal 6His tag for IMAC-mediated purification. We have evaluated the usefulness of this expression vector by expressing three HIV-1 genes namely HIV-1 p27 (nef, HIV-1 p24 (ca, and HIV-1 vif in NiCo21(DE3 E.coli and demonstrated the advantages of using expression vector that concomitantly expresses rare tRNA and heterologous genes.

  7. The first complete mitochondrial genome sequences of Amblypygi (Chelicerata: Arachnida) reveal conservation of the ancestral arthropod gene order.

    Science.gov (United States)

    Fahrein, Kathrin; Masta, Susan E; Podsiadlowski, Lars

    2009-05-01

    Amblypygi (whip spiders) are terrestrial chelicerates inhabiting the subtropics and tropics. In morphological and rRNA-based phylogenetic analyses, Amblypygi cluster with Uropygi (whip scorpions) and Araneae (spiders) to form the taxon Tetrapulmonata, but there is controversy regarding the interrelationship of these three taxa. Mitochondrial genomes provide an additional large data set of phylogenetic information (sequences, gene order, RNA secondary structure), but in arachnids, mitochondrial genome data are missing for some of the major orders. In the course of an ongoing project concerning arachnid mitochondrial genomics, we present the first two complete mitochondrial genomes from Amblypygi. Both genomes were found to be typical circular duplex DNA molecules with all 37 genes usually present in bilaterian mitochondrial genomes. In both species, gene order is identical to that of Limulus polyphemus (Xiphosura), which is assumed to reflect the putative arthropod ground pattern. All tRNA gene sequences have the potential to fold into structures that are typical of metazoan mitochondrial tRNAs, except for tRNA-Ala, which lacks the D arm in both amblypygids, suggesting the loss of this feature early in amblypygid evolution. Phylogenetic analysis resulted in weak support for Uropygi being the sister group of Amblypygi.

  8. Sugarcane genes related to mitochondrial function

    Directory of Open Access Journals (Sweden)

    Fonseca Ghislaine V.

    2001-01-01

    Full Text Available Mitochondria function as metabolic powerhouses by generating energy through oxidative phosphorylation and have become the focus of renewed interest due to progress in understanding the subtleties of their biogenesis and the discovery of the important roles which these organelles play in senescence, cell death and the assembly of iron-sulfur (Fe/S centers. Using proteins from the yeast Saccharomyces cerevisiae, Homo sapiens and Arabidopsis thaliana we searched the sugarcane expressed sequence tag (SUCEST database for the presence of expressed sequence tags (ESTs with similarity to nuclear genes related to mitochondrial functions. Starting with 869 protein sequences, we searched for sugarcane EST counterparts to these proteins using the basic local alignment search tool TBLASTN similarity searching program run against 260,781 sugarcane ESTs contained in 81,223 clusters. We were able to recover 367 clusters likely to represent sugarcane orthologues of the corresponding genes from S. cerevisiae, H. sapiens and A. thaliana with E-value <= 10-10. Gene products belonging to all functional categories related to mitochondrial functions were found and this allowed us to produce an overview of the nuclear genes required for sugarcane mitochondrial biogenesis and function as well as providing a starting point for detailed analysis of sugarcane gene structure and physiology.

  9. Yeast mitochondrial threonyl-tRNA synthetase recognizes tRNA isoacceptors by distinct mechanisms and promotes CUN codon reassignment

    Energy Technology Data Exchange (ETDEWEB)

    Ling, Jiqiang; Peterson, Kaitlyn M.; Simonovic, Ivana; Cho, Chris; Soll, Dieter; Simonovic, Miljan (Yale); (UIC)

    2014-03-12

    Aminoacyl-tRNA synthetases (aaRSs) ensure faithful translation of mRNA into protein by coupling an amino acid to a set of tRNAs with conserved anticodon sequences. Here, we show that in mitochondria of Saccharomyces cerevisiae, a single aaRS (MST1) recognizes and aminoacylates two natural tRNAs that contain anticodon loops of different size and sequence. Besides a regular ?? with a threonine (Thr) anticodon, MST1 also recognizes an unusual ??, which contains an enlarged anticodon loop and an anticodon triplet that reassigns the CUN codons from leucine to threonine. Our data show that MST1 recognizes the anticodon loop in both tRNAs, but employs distinct recognition mechanisms. The size but not the sequence of the anticodon loop is critical for ?? recognition, whereas the anticodon sequence is essential for aminoacylation of ??. The crystal structure of MST1 reveals that, while lacking the N-terminal editing domain, the enzyme closely resembles the bacterial threonyl-tRNA synthetase (ThrRS). A detailed structural comparison with Escherichia coli ThrRS, which is unable to aminoacylate ??, reveals differences in the anticodon-binding domain that probably allow recognition of the distinct anticodon loops. Finally, our mutational and modeling analyses identify the structural elements in MST1 (e.g., helix {alpha}11) that define tRNA selectivity. Thus, MTS1 exemplifies that a single aaRS can recognize completely divergent anticodon loops of natural isoacceptor tRNAs and that in doing so it facilitates the reassignment of the genetic code in yeast mitochondria.

  10. Mitochondrial DNA of Clathrina clathrus (Calcarea, Calcinea): six linear chromosomes, fragmented rRNAs, tRNA editing, and a novel genetic code.

    Science.gov (United States)

    Lavrov, Dennis V; Pett, Walker; Voigt, Oliver; Wörheide, Gert; Forget, Lise; Lang, B Franz; Kayal, Ehsan

    2013-04-01

    Sponges (phylum Porifera) are a large and ancient group of morphologically simple but ecologically important aquatic animals. Although their body plan and lifestyle are relatively uniform, sponges show extensive molecular and genetic diversity. In particular, mitochondrial genomes from three of the four previously studied classes of Porifera (Demospongiae, Hexactinellida, and Homoscleromorpha) have distinct gene contents, genome organizations, and evolutionary rates. Here, we report the mitochondrial genome of Clathrina clathrus (Calcinea, Clathrinidae), a representative of the fourth poriferan class, the Calcarea, which proves to be the most unusual. Clathrina clathrus mitochondrial DNA (mtDNA) consists of six linear chromosomes 7.6-9.4 kb in size and encodes at least 37 genes: 13 protein codings, 2 ribosomal RNAs (rRNAs), and 24 transfer RNAs (tRNAs). Protein genes include atp9, which has now been found in all major sponge lineages, but no atp8. Our analyses further reveal the presence of a novel genetic code that involves unique reassignments of the UAG codons from termination to tyrosine and of the CGN codons from arginine to glycine. Clathrina clathrus mitochondrial rRNAs are encoded in three (srRNA) and ≥6 (lrRNA) fragments distributed out of order and on several chromosomes. The encoded tRNAs contain multiple mismatches in the aminoacyl acceptor stems that are repaired posttranscriptionally by 3'-end RNA editing. Although our analysis does not resolve the phylogenetic position of calcareous sponges, likely due to their high rates of mitochondrial sequence evolution, it confirms mtDNA as a promising marker for population studies in this group. The combination of unusual mitochondrial features in C. clathrus redefines the extremes of mtDNA evolution in animals and further argues against the idea of a "typical animal mtDNA."

  11. Poly(T) variation within mitochondrial protein-coding genes in Globodera (Nematoda: Heteroderidae).

    Science.gov (United States)

    Riepsamen, Angelique H; Blok, Vivian C; Phillips, Mark; Gibson, Tracey; Dowton, Mark

    2008-03-01

    We sequenced a mitochondrial subgenome from the nematode Globodera rostochiensis, in two overlapping pieces. The subgenome was 9210 bp and contained four protein-coding genes (ND4, COIII, ND3, Cytb) and two tRNA genes (tRNA(Thr), tRNA(Gln)). Genome organization was similar to that of Globodera pallida, which is multipartite. Together with the small number of genes on this subgenome, this suggests that the mitochondrial genome of G. rostochiensis is also multipartite. In the initial clones sequenced, COIII and ND3 were full-length, while ND4 and Cytb were interrupted by premature stop codons and contained point indels that disrupted the reading frame. However, sequencing of multiple clones, from DNA extracted both from multiple individuals and from single cysts, revealed a predominant source of variation-in the length of polythymidine tracts. Comparison of our genomic sequences with ESTs similarly revealed variation in the length of polythymidine tracts. We subsequently sequenced both genomic DNA and mRNA from populations of G. pallida. In each case, variation in the length of polythymidine tracts was observed. The levels of expression of mitochondrial genes in G. pallida were representative of the subgenomes present: little evidence of differential expression was observed. These observations are consistent with the operation of posttranscriptional editing in Globodera mitochondria, although this is difficult to show conclusively in the presence of intraindividual gene sequence variation. Further, alternative explanations cannot be discounted; these include the operation of slippage during translation or that genomic copies of most genes are pseudogenes with a small proportion of full-length sequences able to maintain mitochondrial function.

  12. Extensive mitochondrial genome rearrangements between Cerithioidea and Hypsogastropoda (Mollusca; Caenogastropoda) as determined from the partial nucleotide sequences of the mitochondrial DNA of Cerithidea djadjariensis and Batillaria cumingi.

    Science.gov (United States)

    Kojima, Shigeaki

    2010-06-01

    Partial nucleotide sequences ( approximately 8000 bp) of the mitochondrial DNA of two cerithioidean gastropod species-Cerithidea djadjariensis and Batillaria cumingi-were determined. The order of mitochondrial genes (eight protein genes, two ribosomal RNA genes, and nine transfer RNA genes) was identical between these two species. and remarkably different from the previously reported order in other gastropods. The results indicate that the genome structure of the common ancestor of Cerithioidea and its sister group, Hypsogastropoda, is almost identical to that of the common ancestor of Gastropoda; moreover, independent mitochondrial genome rearrangements were identified between the lineages of Cerithioidea and Hypsogastropoda. The rearrangements within Cerithioidea can be explained by the inversion of a single tRNA gene, two translocations of a single tRNA gene, and three translocations of a genome fragment containing a tRNA gene and protein-coding gene(s).

  13. A correlation between N2-dimethylguanosine presence and alternate tRNA conformers.

    Science.gov (United States)

    Steinberg, S; Cedergren, R

    1995-11-01

    Even though the evolutionary conservation of the cloverleaf model is strongly suggestive of powerful constraints on the secondary structure of functional tRNAs, some mitochondrial tRNAs cannot be folded into this form. From the optimal base pairing pattern of these recalcitrant tRNAs, structural correlations between the length of the anticodon stem and the lengths of connector regions between the two helical domains, formed by the coaxial stacking of the anticodon and D-stems and the acceptor and T-stems, have been derived and used to scan the tRNA and tRNA gene database. We show here that some cytosolic tRNA gene sequences that are compatible with the cloverleaf model can also be folded into patterns proposed for the unusual mitochondrial tRNAs. Furthermore, the ability to be folded into these atypical structures correlates in the mature RNA sequences with the presence of dimethylguanosine, whose role may be to prevent the unusual mitochondrial tRNA pattern folding.

  14. Mdp1, a Saccharomyces Cerevisiae Gene Involved in Mitochondrial/Cytoplasmic Protein Distribution, Is Identical to the Ubiquitin-Protein Ligase Gene Rsp5

    OpenAIRE

    Zoladek, T; Tobiasz, A.; Vaduva, G.; Boguta, M.; Martin, N C; Hopper, A K

    1997-01-01

    Alteration of the subcellular distribution of Mod5p-I, a tRNA modification enzyme, member of the sorting isozyme family, affects tRNA-mediated nonsense suppression. Altered suppression efficiency was used to identify MDP genes, which, when mutant, change the mitochondrial/cytosolic distribution of Mod5p-I,KR6. MDP2 is the previously identified VRP1, which encodes verprolin, required for proper organization of the actin cytoskeleton. MDP3 is identical to PAN1, which encodes a protein involved ...

  15. The rRNA and tRNA transcripts of maternally and paternally inherited mitochondrial DNAs of Mytilus galloprovincialis suggest presence of a "degradosome" in mussel mitochondria and necessitate the re-annotation of the l-rRNA/CR boundary.

    Science.gov (United States)

    Kyriakou, Eleni; Chatzoglou, Evanthia; Zouros, Eleftherios; Rodakis, George C

    2014-04-25

    Species of the genus Mytilus carry two mitochondrial genomes in obligatory coexistence; one transmitted though the eggs (the F type) and one through the sperm (the M type). We have studied the 3' and 5' ends of rRNA and tRNA transcripts using RT-PCR and RNA circularization techniques in both the F and M genomes of Mytilus galloprovincialis. We have found polyadenylated and non-adenylated transcripts for both ribosomal and transfer RNAs. In all these genes the 5' ends of the transcripts coincided with the first nucleotide of the annotated genes, but the 3' ends were heterogeneous. The l-rRNA 3' end is 47 or 48 nucleotides upstream from the one assigned by a previous annotation, which makes the adjacent first domain (variable domain one, VD1) of the main control region (CR) correspondingly longer. We have observed s-rRNA and l-rRNA transcripts with truncated 3' end and polyadenylated tRNA transcripts carrying the CCA trinucleotide. We have also detected polyadenylated RNA remnants carrying the sequences of the control region, which strongly suggests RNA degradation activity and thus presence of degradosomes in Mytilus mitochondria.

  16. Nuclear gene defects in mitochondrial disorders.

    Science.gov (United States)

    Zeviani, M; Corona, P; Nijtmans, L; Tiranti, V

    1999-12-01

    An increasing number of nuclear genes have been associated with abnormalities of oxidative phosphorylation and mitochondrial disorders. The protein products of these genes can be grouped into three categories: structural components of the respiratory chain, factors influencing the structural integrity or the copy number of mitochondrial DNA, and proteins which control the formation, assembly and turnover of the respiratory complexes. Loss-of-function mutations in SURF-1, a gene belonging to the third category, have been associated with Leigh syndrome with cytochrome c oxidase deficiency. Mature Surf-1 protein (Surf-1p) is a 30 kDa hydrophobic polypeptide whose function is still unknown. Using antibodies against human Surf-1p, we demonstrated that this protein is imported into mitochondria as a larger precursor. The same analysis revealed that no protein is present in cell lines harboring loss-of-function mutations of SURF-1, regardless of their type and position. We also generated several constructs with truncated or partially deleted SURF-1 cDNAs. None of these constructs, expressed into SURF-1 null mutant cells, were able to rescue the COX phenotype, suggesting that different regions of the protein are all essential for function. Finally, experiments based on 2D gel electrophoresis indicated that assembly of COX in SURF-1 null mutants is blocked at an early step, most likely before the incorporation of subunit II in the nascent intermediates composed of subunit I alone or subunit I plus subunit IV.

  17. Intramitochondrial recombination - is it why some mitochondrial genes sleep around?

    Science.gov (United States)

    Dowton, M; Campbell, N J.H.

    2001-06-01

    A new paper by Kajander et al. undermines the general view that mitochondria do not recombine. The authors discovered the existence of 'sublimons', rearranged mitochondrial genomes present at very low levels in healthy human patients. Crucially, the different rearranged mitochondrial genomes can theoretically be interconverted through intramitochondrial recombination. The putative operation of intramitochondrial recombination should impact on our ideas of how mitochondrial genes evolve, particularly with respect to how mitochondrial genomes rearrange.

  18. Extensive microheterogeneity of serine tRNA genes from Drosophila melanogaster.

    Science.gov (United States)

    Cribbs, D L; Leung, J; Newton, C H; Hayashi, S; Miller, R C; Tener, G M

    1987-10-05

    The nucleotide sequences of nine genes corresponding to tRNA(Ser)4 or tRNA(Ser)7 of Drosophila melanogaster were determined. Eight of the genes compose the major tRNA(Ser)4,7 cluster at 12DE on the X chromosome, while the other is from 23E on the left arm of chromosome 2. Among the eight X-linked genes, five different, interrelated, classes of sequence were found. Four of the eight genes correspond to tRNA(Ser)4 and tRNA(Ser)7 (which are 96% homologous), two appear to result from single crossovers between tRNA(Ser)4 and tRNA(Ser)7 genes, one is an apparent double crossover product, and the last differs from a tRNA(Ser)4 gene by a single C to T transition at position 50. The single autosomal gene corresponds to tRNA(Ser)7. Comparison of a pair of genes corresponding to tRNA(Ser)4 from D. melanogaster and Drosophila simulans showed that, while gene flanking sequences may diverge considerably by accumulation of point changes, gene sequences are maintained intact. Our data indicate that recombination occurs between non-allelic tRNA(Ser) genes, and suggest that at least some recombinational events may be intergenic conversions.

  19. Association of Genes, Pathways, and Haplogroups of the Mitochondrial Genome with the Risk of Colorectal Cancer: The Multiethnic Cohort.

    Directory of Open Access Journals (Sweden)

    Yuqing Li

    Full Text Available The mitochondrial genome encodes for the synthesis of 13 proteins that are essential for the oxidative phosphorylation (OXPHOS system. Inherited variation in mitochondrial genes may influence cancer development through changes in mitochondrial proteins, altering the OXPHOS process, and promoting the production of reactive oxidative species. To investigate the role of the OXPHOS pathway and mitochondrial genes in colorectal cancer (CRC risk, we tested 185 mitochondrial SNPs (mtSNPs, located in 13 genes that comprise four complexes of the OXPHOS pathway and mtSNP groupings for rRNA and tRNA, in 2,453 colorectal cancer cases and 11,930 controls from the Multiethnic Cohort Study. Using the sequence kernel association test, we examined the collective set of 185 mtSNPs, as well as subsets of mtSNPs grouped by mitochondrial pathways, complexes, and genes, adjusting for age, sex, principal components of global ancestry, and self-reported maternal race/ethnicity. We also tested for haplogroup associations using unconditional logistic regression, adjusting for the same covariates. Stratified analyses were conducted by self-reported maternal race/ethnicity. In European Americans, a global test of all genetic variants of the mitochondrial genome identified an association with CRC risk (P = 0.04. In mtSNP-subset analysis, the NADH dehydrogenase 2 (MT-ND2 gene in Complex I was associated with CRC risk at a P-value of 0.001 (q = 0.015. In addition, haplogroup T was associated with CRC risk (OR = 1.66, 95% CI: 1.19-2.33, P = 0.003. No significant mitochondrial pathway and gene associations were observed in the remaining four racial/ethnic groups--African Americans, Asian Americans, Latinos, and Native Hawaiians. In summary, our findings suggest that variations in the mitochondrial genome and particularly in the MT-ND2 gene may play a role in CRC risk among European Americans, but not in other maternal racial/ethnic groups. Further replication is warranted and

  20. Complete mitochondrial genome of a wild Siberian tiger.

    Science.gov (United States)

    Sun, Yujiao; Lu, Taofeng; Sun, Zhaohui; Guan, Weijun; Liu, Zhensheng; Teng, Liwei; Wang, Shuo; Ma, Yuehui

    2015-01-01

    In this study, the complete mitochondrial genome of Siberian tiger (Panthera tigris altaica) was sequenced, using muscle tissue obtained from a male wild tiger. The total length of the mitochondrial genome is 16,996 bp. The genome structure of this tiger is in accordance with other Siberian tigers and it contains 12S rRNA gene, 16S rRNA gene, 22 tRNA genes, 13 protein-coding genes, and 1 control region.

  1. Yeast H2A.Z, FACT complex and RSC regulate transcription of tRNA gene through differential dynamics of flanking nucleosomes.

    Science.gov (United States)

    Mahapatra, Sahasransu; Dewari, Pooran S; Bhardwaj, Anubhav; Bhargava, Purnima

    2011-05-01

    FACT complex is involved in elongation and ensures fidelity in the initiation step of transcription by RNA polymerase (pol) II. Histone variant H2A.Z is found in nucleosomes at the 5'-end of many genes. We report here H2A.Z-chaperone activity of the yeast FACT complex on the short, nucleosome-free, non-coding, pol III-transcribed yeast tRNA genes. On a prototype gene, yeast SUP4, chromatin remodeler RSC and FACT regulate its transcription through novel mechanisms, wherein the two gene-flanking nucleosomes containing H2A.Z, play different roles. Nhp6, which ensures transcription fidelity and helps load yFACT onto the gene flanking nucleosomes, has inhibitory role. RSC maintains a nucleosome abutting the gene terminator downstream, which results in reduced transcription rate in active state while H2A.Z probably helps RSC in keeping the gene nucleosome-free and serves as stress-sensor. All these factors maintain an epigenetic state which allows the gene to return quickly from repressed to active state and tones down the expression from the active SUP4 gene, required probably to maintain the balance in cellular tRNA pool.

  2. Mitochondrial transcription termination factor 2 binds to entire mitochondrial DNA and negatively regulates mitochondrial gene expression

    Institute of Scientific and Technical Information of China (English)

    Weiwei Huang; Min Yu; Yang Jiao; Jie Ma; Mingxing Ma; Zehua Wang; Hong Wu; Deyong Tan

    2011-01-01

    Mitochondrial transcription termination factor 2 (mTERF2) is a mitochondriai matrix protein that binds to the mitochondriai DNA.Previous studies have shown that overexpression of mTERF2 can inhibit cell proliferation, but the mechanism has not been well defined so far.This study aimed to present the binding pattern of mTERF2 to the mitochondrial DNA (mtDNA) in vivo, and investigated the biological function of mTERF2 on the replication of mtDNA, mRNA transcription, and protein translation.The mTERF2 binding to entire mtDNA was identified via the chromatin immunoprecipitation analysis.The mtDNA replication efficiency and expression levels of mitochondria genes were significantly inhibited when the mTERF2 was overexpressed in HeLa cells.The inhibition level of mtDNA content was the same with the decreased levels of mRNA and mitochondrial protein expression.Overall, the mTERF2 might be a cell growth inhibitor based on its negative effect on mtDNA replication, which eventually own-regulated all of the oxidative phosphorylation components in the mitochondria that were essential for the cell's energy metabolism.

  3. The mitochondrial genome sequence of a deep-sea, hydrothermal vent limpet, Lepetodrilus nux, presents a novel vetigastropod gene arrangement.

    Science.gov (United States)

    Nakajima, Yuichi; Shinzato, Chuya; Khalturina, Mariia; Nakamura, Masako; Watanabe, Hiromi; Satoh, Noriyuki; Mitarai, Satoshi

    2016-08-01

    While mitochondrial (mt) genomes are used extensively for comparative and evolutionary genomics, few mt genomes of deep-sea species, including hydrothermal vent species, have been determined. The Genus Lepetodrilus is a major deep-sea gastropod taxon that occurs in various deep-sea ecosystems. Using next-generation sequencing, we determined nearly the complete mitochondrial genome sequence of Lepetodrilus nux, which inhabits hydrothermal vents in the Okinawa Trough. The total length of the mitochondrial genome is 16,353bp, excluding the repeat region. It contains 13 protein-coding genes, 22 tRNA genes, two rRNA genes, and a control region, typical of most metazoan genomes. Compared with other vetigastropod mt genome sequences, L. nux employs a novel mt gene arrangement. Other novel arrangements have been identified in the vetigastropod, Fissurella volcano, and in Chrysomallon squamiferum, a neomphaline gastropod; however, all three gene arrangements are different, and Bayesian inference suggests that each lineage diverged independently. Our findings suggest that vetigastropod mt gene arrangements are more diverse than previously realized.

  4. Horizontal acquisition of multiple mitochondrial genes from a parasitic plant followed by gene conversion with host mitochondrial genes

    Directory of Open Access Journals (Sweden)

    Hao Weilong

    2010-12-01

    Full Text Available Abstract Background Horizontal gene transfer (HGT is relatively common in plant mitochondrial genomes but the mechanisms, extent and consequences of transfer remain largely unknown. Previous results indicate that parasitic plants are often involved as either transfer donors or recipients, suggesting that direct contact between parasite and host facilitates genetic transfer among plants. Results In order to uncover the mechanistic details of plant-to-plant HGT, the extent and evolutionary fate of transfer was investigated between two groups: the parasitic genus Cuscuta and a small clade of Plantago species. A broad polymerase chain reaction (PCR survey of mitochondrial genes revealed that at least three genes (atp1, atp6 and matR were recently transferred from Cuscuta to Plantago. Quantitative PCR assays show that these three genes have a mitochondrial location in the one species line of Plantago examined. Patterns of sequence evolution suggest that these foreign genes degraded into pseudogenes shortly after transfer and reverse transcription (RT-PCR analyses demonstrate that none are detectably transcribed. Three cases of gene conversion were detected between native and foreign copies of the atp1 gene. The identical phylogenetic distribution of the three foreign genes within Plantago and the retention of cytidines at ancestral positions of RNA editing indicate that these genes were probably acquired via a single, DNA-mediated transfer event. However, samplings of multiple individuals from two of the three species in the recipient Plantago clade revealed complex and perplexing phylogenetic discrepancies and patterns of sequence divergence for all three of the foreign genes. Conclusions This study reports the best evidence to date that multiple mitochondrial genes can be transferred via a single HGT event and that transfer occurred via a strictly DNA-level intermediate. The discovery of gene conversion between co-resident foreign and native

  5. The complete mitochondrial genome of the silvertip tetra, Hasemania nana (Characiformes: Characidae).

    Science.gov (United States)

    Xu, Ru; Zhao, Zi-Xia; Xu, Peng; Sun, Xiao-Wen

    2015-01-01

    We first sequenced the complete mitochondrial genome of silvertip tetra (Hasemania nana). The mitogenome was determined to be 16,581 bp long circular molecule with a typical gene arrangement of vertebrate mitochondrial DNA. All genes were encoded on the heavy strand with the exception of ND6 and eight tRNA genes. Mitochondrial DNA information provided the basis for the studies in species identification and conservation of the species' natural resources.

  6. The complete mitochondrial genome of the Piaractus brachypomus (Characiformes: Characidae).

    Science.gov (United States)

    Chen, Huanpu; Li, Shuisheng; Xie, Zhenzhen; Zhang, Yong; Zhu, Chunhua; Deng, Siping; Li, Guangli; Huang, Hai

    2016-01-01

    The complete mitochondrial genome of the Piaractus brachypomus is described in the present study. The mitochondrial genome is 16,561 bp long and consists of 13 protein-coding genes, 2 rRNA genes, 22 tRNA genes and a control region. The P. brachypomus mitochondrial genome shows the similar gene order and composition with those of most other vertebrates. The nucleotide compositions of the light strand in descending order is 31.57% of A, 26.19% of C, 26.18% of T and 16.06% of G. With the exception of the NADH dehydrogenase subunit 6 (ND6) and eight tRNA genes, all other mitochondrial genes are encoded on the heavy strand.

  7. The complete mitochondrial genome of the tapeworm Cladotaenia vulturi (Cestoda: Paruterinidae): gene arrangement and phylogenetic relationships with other cestodes.

    Science.gov (United States)

    Guo, Aijiang

    2016-08-31

    Tapeworms Cladotaenia spp. are among the most important wildlife pathogens in birds of prey. The genus Cladotaenia is placed in the family Paruterinidae based on morphological characteristics and hosts. However, limited molecular information is available for studying the phylogenetic position of this genus in relation to other cestodes. In this study, the complete mitochondrial (mt) genome of Cladotaenia vulturi was amplified using "Long-PCR" and then sequenced by primer walking. Sequence annotation and gene identification were performed by comparison with published flatworm mt genomes. The phylogenetic relationships of C. vulturi with other cestode species were established using the concatenated amino acid sequences of 12 protein-coding genes with Bayesian Inference and Maximum Likelihood methods. The complete mitochondrial genome of the Cladotaenia vulturi is 13,411 kb in size and contains 36 genes. The gene arrangement of C. vulturi is identical to those in Anoplocephala spp. (Anoplocephalidae), Hymenolepis spp. (Hymenolepididae) and Dipylidium caninum (Dipylidiidae), but different from that in taeniids owing to the order shift between the tRNA (L1) and tRNA (S2) genes. Phylogenetic analyses based on the amino acid sequences of the concatenated 12 protein-coding genes showed that the species in the Taeniidae form a group and C. vulturi is a sister taxon to the species of the family Taeniidae. To our knowledge, the present study provides the first molecular data to support the early proposal from morphological evidence that the Taeniidae is a sister group to the family Paruterinidae. This novel mt genome sequence will be useful for further investigations into the population genetics, phylogenetics and systematics of the family Paruterinidae and inferring phylogenetic relationships among several lineages within the order Cyclophyllidea.

  8. Complete mitochondrial DNA sequence of the Qianshao spotted pig.

    Science.gov (United States)

    Xu, Dong; Chai, Yu-Lan; Jiang, Juan; He, Chang-Qing; Ma, Hai-Ming

    2015-01-01

    The complete mitochondrial genome sequence of Qianshao spotted pig was first determined in this study. The mitogenome (16,700 bp) consists of 22 tRNA genes, 2 ribosomal RNA genes, 13 protein-coding genes and 1 control region (D-loop region). The complete mitochondrial genome sequence of the Qianshao spotted pig enriches data resource for further study in genetic mechanism.

  9. The complete mitochondrial genome of the Yorkshire pig (Sus scrofa).

    Science.gov (United States)

    Xu, Dong; Yang, Hu; Ma, Haiming

    2016-01-01

    This study aims to identify the complete nucleotide sequence of mitochondrial genome in the Yorkshire pig. Sequence analysis indicates that the genome structure is in accordance with other pig breeds, and it contains 22 tRNA genes, 2 ribosomal RNA genes, 13 protein-coding genes and 1 control region (D-loop region). The complete mitochondrial genome sequence of the Yorkshire pig provides an important record set for further study on genetic mechanism.

  10. Evidence for mitochondrial genetic control of autosomal gene expression.

    Science.gov (United States)

    Kassam, Irfahan; Qi, Tuan; Lloyd-Jones, Luke; Holloway, Alexander; Jan Bonder, Marc; Henders, Anjali K; Martin, Nicholas G; Powell, Joseph E; Franke, Lude; Montgomery, Grant W; Visscher, Peter M; McRae, Allan F

    2016-10-18

    The mitochondrial and nuclear genomes coordinate and co-evolve in eukaryotes in order to adapt to environmental changes. Variation in the mitochondrial genome is capable of affecting expression of genes on the nuclear genome. Sex-specific mitochondrial genetic control of gene expression has been demonstrated in Drosophila melanogaster, where males were found to drive most of the total variation in gene expression. This has potential implications for male-related health and disease resulting from variation in mtDNA solely inherited from the mother. We used a family-based study comprised of 47,323 gene expression probes and 78 mitochondrial SNPs (mtSNPs) from n = 846 individuals to examine the extent of mitochondrial genetic control of gene expression in humans. This identified 15 significant probe-mtSNP associations (P[Formula: see text]) corresponding to 5 unique genes on the mitochondrial and nuclear genomes, with three of these genes corresponding to mitochondrial genetic control of gene expression in the nuclear genome. The associated mtSNPs for three genes (one cis and two trans associations) were replicated (P expression in any of these five probes. Sex-specific effects were examined by applying our analysis to males and females separately and testing for differences in effect size. The MEST gene was identified as having the most significantly different effect sizes across the sexes (P [Formula: see text]). MEST was similarly expressed in males and females with the G allele; however, males with the C allele are highly expressed for MEST, while females show no expression of the gene. This study provides evidence for the mitochondrial genetic control of expression of several genes in humans, with little evidence found for sex-specific effects.

  11. The complete mitochondrial genome sequence of Diaphorina citri (Hemiptera: Psyllidae)

    Science.gov (United States)

    The first complete mitochondrial genome (mitogenome) sequence of Asian citrus psyllid, Diaphorina citri (Hemiptera: Psyllidae), from Guangzhou, China is presented. The circular mitogenome is 14,996 bp in length with an A+T content of 74.5%, and contains 13 protein-coding genes (PCGs), 22 tRNA genes ...

  12. The complete mitochondrial genome of the common sea slater, Ligia oceanica (Crustacea, Isopoda bears a novel gene order and unusual control region features

    Directory of Open Access Journals (Sweden)

    Podsiadlowski Lars

    2006-09-01

    Full Text Available Abstract Background Sequence data and other characters from mitochondrial genomes (gene translocations, secondary structure of RNA molecules are useful in phylogenetic studies among metazoan animals from population to phylum level. Moreover, the comparison of complete mitochondrial sequences gives valuable information about the evolution of small genomes, e.g. about different mechanisms of gene translocation, gene duplication and gene loss, or concerning nucleotide frequency biases. The Peracarida (gammarids, isopods, etc. comprise about 21,000 species of crustaceans, living in many environments from deep sea floor to arid terrestrial habitats. Ligia oceanica is a terrestrial isopod living at rocky seashores of the european North Sea and Atlantic coastlines. Results The study reveals the first complete mitochondrial DNA sequence from a peracarid crustacean. The mitochondrial genome of Ligia oceanica is a circular double-stranded DNA molecule, with a size of 15,289 bp. It shows several changes in mitochondrial gene order compared to other crustacean species. An overview about mitochondrial gene order of all crustacean taxa yet sequenced is also presented. The largest non-coding part (the putative mitochondrial control region of the mitochondrial genome of Ligia oceanica is unexpectedly not AT-rich compared to the remainder of the genome. It bears two repeat regions (4× 10 bp and 3× 64 bp, and a GC-rich hairpin-like secondary structure. Some of the transfer RNAs show secondary structures which derive from the usual cloverleaf pattern. While some tRNA genes are putative targets for RNA editing, trnR could not be localized at all. Conclusion Gene order is not conserved among Peracarida, not even among isopods. The two isopod species Ligia oceanica and Idotea baltica show a similarly derived gene order, compared to the arthropod ground pattern and to the amphipod Parhyale hawaiiensis, suggesting that most of the translocation events were already

  13. Determination of the number of copies of genes coding for 5s-rRNA and tRNA in the genomes of 43 species of wheat and Aegilops

    Energy Technology Data Exchange (ETDEWEB)

    Vakhitov, V.A.; Gimalov, F.R.; Nikonorov, Yu.M.

    1986-10-01

    The number of 5s-rRNA and tRNA genes has been studied in 43 species of wheat and Aegilops differing in ploidy level, genomic composition and origin. It has been demonstrated that the repeatability of the 5s-rRNA and tRNA genes increases in wheat with increasing ploidy level, but not in proportion to the genome size. In Aegilops, in distinction from wheat, the relative as well as absolute number of 5s-RNA genes increases with increasing ploidy level. The proportion of the sequences coding for tRNA in the dipoloid and polyploid Aegilops species is practically similar, while the number of tRNA genes increases almost 2-3 times with increasing ploidy level. Large variability has been recorded between the species with similar genomic composition and ploidy level in respect of the number of the 5s-rRNA and tRNA genes. It has been demonstrated that integration of the initial genomes of the amphidiploids is accompanied by elimination of a particular part of these genomes. It has been concluded that the mechanisms of establishment and evolution of genomes in the intra- and intergeneric allopolyploids are not identical.

  14. The mitochondrial genome of Xiphinema americanum sensu stricto (Nematoda: Enoplea): considerable economization in the length and structural features of encoded genes.

    Science.gov (United States)

    He, Y; Jones, J; Armstrong, M; Lamberti, F; Moens, M

    2005-12-01

    The complete sequence of the mitochondrial genome of the plant parasitic nematode Xiphinema americanum sensu stricto has been determined. At 12626bp it is the smallest metazoan mitochondrial genome reported to date. Genes are transcribed from both strands. Genes coding for 12 proteins, 2 rRNAs and 17 putative tRNAs (with the tRNA-C, I, N, S1, S2 missing) are predicted from the sequence. The arrangement of genes within the X. americanum mitochondrial genome is unique and includes gene overlaps. Comparisons with the mtDNA of other nematodes show that the small size of the X. americanum mtDNA is due to a combination of factors. The two mitochondrial rRNA genes are considerably smaller than those of other nematodes, with most of the protein encoding and tRNA genes also slightly smaller. In addition, five tRNAs genes are absent, lengthy noncoding regions are not present in the mtDNA, and several gene overlaps are present.

  15. The yfiC gene of E. coli encodes an adenine-N6 methyltransferase that specifically modifies A37 of tRNA1Val(cmo5UAC).

    Science.gov (United States)

    Golovina, Anna Y; Sergiev, Petr V; Golovin, Andrey V; Serebryakova, Marina V; Demina, Irina; Govorun, Vadim M; Dontsova, Olga A

    2009-06-01

    Transfer RNA is highly modified. Nucleotide 37 of the anticodon loop is represented by various modified nucleotides. In Escherichia coli, the valine-specific tRNA (cmo(5)UAC) contains a unique modification, N(6)-methyladenosine, at position 37; however, the enzyme responsible for this modification is unknown. Here we demonstrate that the yfiC gene of E. coli encodes an enzyme responsible for the methylation of A37 in tRNA(1)(Val). Inactivation of yfiC gene abolishes m(6)A formation in tRNA(1)(Val), while expression of the yfiC gene from a plasmid restores the modification. Additionally, unmodified tRNA(1)(Val) can be methylated by recombinant YfiC protein in vitro. Although the methylation of m(6)A in tRNA(1)(Val) by YfiC has little influence on the cell growth under standard conditions, the yfiC gene confers a growth advantage under conditions of osmotic and oxidative stress.

  16. Nuclear and mitochondrial genes for inferring Trichuris phylogeny.

    Science.gov (United States)

    Callejón, Rocío; Cutillas, Cristina; Nadler, Steven A

    2015-12-01

    Nucleotide sequences of the triose phosphate isomerase (TPI) gene (624 bp) and mitochondrial cytochrome b (cob) gene (520 bp) were obtained by PCR and evaluated for utility in inferring the phylogenetic relationships among Trichuris species. Published sequences of one other nuclear gene (18S or SSU rRNA, 1816-1846 bp) and one additional mitochondrial (mtDNA) gene (cytochrome oxidase 1, cox1, 342 bp) were also analyzed. Maximum likelihood and Bayesian inference methods were used to infer phylogenies for each gene separately but also for the combined mitochondrial data (two genes), the combined nuclear data (two genes), and the total evidence (four gene) dataset. Few Trichuris clades were uniformly resolved across separate analyses of individual genes. For the mtDNA, the cob gene trees had greater phylogenetic resolution and tended to have higher support values than the cox1 analyses. For nuclear genes, the SSU gene trees had slightly greater resolution and support values than the TPI analyses, but TPI was the only gene with reliable support for the deepest nodes in the tree. Combined analyses of genes yielded strongly supported clades in most cases, with the exception of the relationship among Trichuris clades 1, 2, and 3, which showed conflicting results between nuclear and mitochondrial genes. Both the TPI and cob genes proved valuable for inferring Trichuris relationships, with greatest resolution and support values achieved through combined analysis of multiple genes. Based on the phylogeny of the combined analysis of nuclear and mitochondrial genes, parsimony mapping of definitive host utilization depicts artiodactyls as the ancestral hosts for these Trichuris, with host-shifts into primates, rodents, and Carnivora.

  17. A horizontally transferred tRNA(Cys) gene in the sugar beet mitochondrial genome: evidence that the gene is present in diverse angiosperms and its transcript is aminoacylated.

    Science.gov (United States)

    Kitazaki, Kazuyoshi; Kubo, Tomohiko; Kagami, Hiroyo; Matsumoto, Takuma; Fujita, Asami; Matsuhira, Hiroaki; Matsunaga, Muneyuki; Mikami, Tetsuo

    2011-10-01

    Of the two tRNA(Cys) (GCA) genes, trnC1-GCA and trnC2-GCA, previously identified in mitochondrial genome of sugar beet, the former is a native gene and probably a pseudo-copy, whereas the latter, of unknown origin, is transcribed into a tRNA [tRNA(Cys2) (GCA)]. In this study, the trnC2-GCA sequence was mined from various public databases. To evaluate whether or not the trnC2-GCA sequence is located in the mitochondrial genome, the relative copy number of its sequence to nuclear gene was assessed in a number of angiosperm species, using a quantitative real-time PCR assay. The trnC2-GCA sequence was found to exist sporadically in the mitochondrial genomes of a wide range of angiosperms. The mitochondrial tRNA(Cys2) (GCA) species from sugar beet (Beta vulgaris), spinach (Spinacea oleracea) and cucumber (Cucumis sativus) were found to be aminoacylated, indicating that they may participate in translation. We also identified a sugar beet nuclear gene that encodes cysteinyl-tRNA synthetase, which is dual-targeted to mitochondria and plastids, and may aminoacylate tRNA(Cys2) (GCA). What is of particular interest is that trnC1-GCA and trnC2-GCA co-exist in the mitochondrial genomes of eight diverse angiosperms, including spinach, and that the spinach tRNA(Cys1) (GCA) is also aminoacylated. Taken together, our observations lead us to surmise that trnC2-GCA may have been horizontally transferred to a common ancestor of eudicots, followed by co-existence and dual expression of trnC1-GCA and trnC2-GCA in mitochondria with occasional loss or inactivation of either trnC-GCA gene during evolution. © 2011 The Authors. The Plant Journal © 2011 Blackwell Publishing Ltd.

  18. mTOR associates with TFIIIC, is found at tRNA and 5S rRNA genes, and targets their repressor Maf1.

    Science.gov (United States)

    Kantidakis, Theodoros; Ramsbottom, Ben A; Birch, Joanna L; Dowding, Sarah N; White, Robert J

    2010-06-29

    Synthesis of tRNA and 5S rRNA by RNA polymerase (pol) III is regulated by the mTOR pathway in mammalian cells. The mTOR kinase localizes to tRNA and 5S rRNA genes, providing an opportunity for direct control. Its presence at these sites can be explained by interaction with TFIIIC, a DNA-binding factor that recognizes the promoters of these genes. TFIIIC contains a TOR signaling motif that facilitates its association with mTOR. Maf1, a repressor that binds and inhibits pol III, is phosphorylated in a mTOR-dependent manner both in vitro and in vivo at serine 75, a site that contributes to its function as a transcriptional inhibitor. Proximity ligation assays confirm the interaction of mTOR with Maf1 and TFIIIC in nuclei. In contrast to Maf1 regulation in yeast, no evidence is found for nuclear export of Maf1 in response to mTOR signaling in HeLa cells. We conclude that mTOR associates with TFIIIC, is recruited to pol III-transcribed genes, and relieves their repression by Maf1.

  19. A novel mitochondrial gene order in shorebirds (Scolopacidae, Charadriiformes)

    NARCIS (Netherlands)

    Verkuil, Yvonne I.; Piersma, Theunis; Baker, Allan J.

    2010-01-01

    Although the mitochondrial genome in birds has highly conserved features, with protein genes similar to mammals and amphibians, several variations in gene order around the hypervariable control region have been found. Here we report a novel gene arrangement around the control region in shorebirds (C

  20. Complete mitochondrial genome of a Wild Amur Moose (Alces alces cameloides).

    Science.gov (United States)

    Yu, Yanze; Feng, Yuan; Wang, Hongcheng; Yang, Yong; Duan, Yubao; Zhou, Zhengyan; Zhang, Minghai

    2016-11-01

    In this study, the complete mitochondrial genome (mt DNA) of Amur Moose (Alces alces cameloides) was sequenced, using muscle tissue obtained from a male Amur moose. The total length of the mitochondrial genome is 16,305 bp. The genome structure of Amur moose is similar to other moose and it contains 12S rRNA gene, 16S rRNA gene, 22 tRNA genes, 13 protein-coding genes, and 1 control region.

  1. Mitochondrial gene mutations and type 2 diabetes in Chinese families

    Institute of Scientific and Technical Information of China (English)

    LI Ming-zhen; YU De-min; YU Pei; LIU De-min; WANG Kun; TANG Xin-zhi

    2008-01-01

    Background Numerous mitochondrial DNA mutations are significantly correlated with development of diabetes. This study investigated mitochondrial gene, point mutations in patients with type 2 diabetes and their families. Methods Unrelated patients with type 2 diabetes(n=826)were randomly recruited; unrelated and nondiabetic subjects (n=637)served as controls. The clinical and biochemical data of the participants were collected. Total genome was extracted from peripheral leucocytes. Polymerase chain reaction, restriction fragment length polymorphism (PCR-RFLP)and clonig techniques were used to screen mitochondrial genes including np3316,np3394 and np3426 in the ND1 region and np3243 in the tRNALeu (UUR). Results In 39 diabetics with one or more mitochondrial gene point mutations, the prevalence(4.7%,39/826)of mtDNA mutations was higher than that(0.7%,5/637)in the controls. The identical mutation was found in 23 of 43 tested members from three pedigrees. Affected family members presented with variable clinical features ranging from normal glucose tolerance to impaired glucose tolerance (IGT)(n=2),impaired fasting glucose(IFG)(n=1)to type 2 diabetes (n=13)with 3 family members suffering from hearing loss. Conclusions Type 2 diabetes in China is associated with several mitochondrial gene mutations. Aged patients with diabetic family history had a higher prevalence of mutation and various clinical pictures. Mitochondrial gene mutation might be one of the genetic factors contributing to diabetic familial clustering.

  2. Association between allelic variation due to short tandem repeats in tRNA gene of Entamoeba histolytica and clinical phenotypes of amoebiasis.

    Science.gov (United States)

    Jaiswal, Virendra; Ghoshal, Ujjala; Mittal, Balraj; Dhole, Tapan N; Ghoshal, Uday C

    2014-05-01

    Genotypes of Entamoeba histolytica (E. histolytica) may contribute clinical phenotypes of amoebiasis such as amoebic liver abscess (ALA), dysentery and asymptomatic cyst passers state. Hence, we evaluated allelic variation due to short tandem repeats (STRs) in tRNA gene of E. histolytica and clinical phenotypes of amoebiasis. Asymptomatic cyst passers (n=24), patients with dysentery (n=56) and ALA (n=107) were included. Extracted DNA from stool (dysentery, asymptomatic cyst passers) and liver aspirate was amplified using 6 E. histolytica specific tRNA-linked STRs (D-A, A-L, N-K2, R-R, S-Q, and S(TGA)-D) primers. PCR products were subjected to sequencing. Association between allelic variation and clinical phenotypes was analyzed. A total of 9 allelic variations were found in D-A, 8 in A-L, 4 in N-K2, 5 in R-R, 10 in S(TAG)-D and 7 in S-Q loci. A significant association was found between allelic variants and clinical phenotypes of amoebiasis. This study reveals that allelic variation due to short tandem repeats (STRs) in tRNA gene of E. histolytica is associated different clinical outcome of amoebiasis.

  3. Genomic characteristics comparisons of 12 food-related filamentous fungi in tRNA gene set, codon usage and amino acid composition.

    Science.gov (United States)

    Chen, Wanping; Xie, Ting; Shao, Yanchun; Chen, Fusheng

    2012-04-10

    Filamentous fungi are widely exploited in food industry due to their abilities to secrete large amounts of enzymes and metabolites. The recent availability of fungal genome sequences has provided an opportunity to explore the genomic characteristics of these food-related filamentous fungi. In this paper, we selected 12 representative filamentous fungi in the areas of food processing and safety, which were Aspergillus clavatus, A. flavus, A. fumigatus, A. nidulans, A. niger, A. oryzae, A. terreus, Monascus ruber, Neurospora crassa, Penicillium chrysogenum, Rhizopus oryzae and Trichoderma reesei, and did the comparative studies of their genomic characteristics of tRNA gene distribution, codon usage pattern and amino acid composition. The results showed that the copy numbers greatly differed among isoaccepting tRNA genes and the distribution seemed to be related with translation process. The results also revealed that genome compositional variation probably constrained the base choice at the third codon, and affected the overall amino acid composition but seemed to have little effect on the integrated physicochemical characteristics of overall amino acids. The further analysis suggested that the wobble pairing and base modification were the important mechanisms in codon-anticodon interaction. In the scope of authors' knowledge, it is the first report about the genomic characteristics analysis of food-related filamentous fungi, which would be informative for the analysis of filamentous fungal genome evolution and their practical application in food industry. Copyright © 2012 Elsevier B.V. All rights reserved.

  4. Expression of a transferred nuclear gene in a mitochondrial genome

    Directory of Open Access Journals (Sweden)

    Yichun Qiu

    2014-08-01

    Full Text Available Transfer of mitochondrial genes to the nucleus, and subsequent gain of regulatory elements for expression, is an ongoing evolutionary process in plants. Many examples have been characterized, which in some cases have revealed sources of mitochondrial targeting sequences and cis-regulatory elements. In contrast, there have been no reports of a nuclear gene that has undergone intracellular transfer to the mitochondrial genome and become expressed. Here we show that the orf164 gene in the mitochondrial genome of several Brassicaceae species, including Arabidopsis, is derived from the nuclear ARF17 gene that codes for an auxin responsive protein and is present across flowering plants. Orf164 corresponds to a portion of ARF17, and the nucleotide and amino acid sequences are 79% and 81% identical, respectively. Orf164 is transcribed in several organ types of Arabidopsis thaliana, as detected by RT-PCR. In addition, orf164 is transcribed in five other Brassicaceae within the tribes Camelineae, Erysimeae and Cardamineae, but the gene is not present in Brassica or Raphanus. This study shows that nuclear genes can be transferred to the mitochondrial genome and become expressed, providing a new perspective on the movement of genes between the genomes of subcellular compartments.

  5. The complete mitochondrial genome of the common cutworm, Spodoptera litura (Lepidoptera: Noctuidade).

    Science.gov (United States)

    Liu, Qiu-Ning; Zhu, Bao-Jian; Dai, Li-Shang; Wang, Lei; Qian, Cen; Wei, Guo-Qing; Liu, Chao-Liang

    2016-01-01

    The complete mitochondrial genome (mitogenome) of Spodoptera litura (Lepidoptera: Noctuidae) was determined to be 15,374 bp (GenBank accession No. KF543065), including 13 protein-coding genes (PCGs), two rRNA genes, 22 tRNA genes and an A + T-rich region. It has the typical gene organization and order of mitogenomes from lepidopteran insects. The AT skew of this mitogenome was slightly positive and the nucleotide composition was also biased toward A + T nucleotides (81.03%). All PCGs were initiated by ATN codons, except for cytochrome c oxidase subunit 1 (cox1) gene which was initiated by CGA. Four of the 13 PCGs harbor the incomplete termination codon by T. All the tRNA genes displayed a typical clover-leaf structure of mitochondrial tRNA, with the exception of trnS1 (AGN). The A + T-rich region of the mitogenome was 326 bp in length.

  6. Mitochondrial gene therapy augments mitochondrial physiology in a Parkinson's disease cell model.

    Science.gov (United States)

    Keeney, Paula M; Quigley, Caitlin K; Dunham, Lisa D; Papageorge, Christina M; Iyer, Shilpa; Thomas, Ravindar R; Schwarz, Kathleen M; Trimmer, Patricia A; Khan, Shaharyar M; Portell, Francisco R; Bergquist, Kristen E; Bennett, James P

    2009-08-01

    Neurodegeneration in Parkinson's disease (PD) affects mainly dopaminergic neurons in the substantia nigra, where age-related, increasing percentages of cells lose detectable respiratory activity associated with depletion of intact mitochondrial DNA (mtDNA). Replenishment of mtDNA might improve neuronal bioenergetic function and prevent further cell death. We developed a technology ("ProtoFection") that uses recombinant human mitochondrial transcription factor A (TFAM) engineered with an N-terminal protein transduction domain (PTD) followed by the SOD2 mitochondrial localization signal (MLS) to deliver mtDNA cargo to the mitochondria of living cells. MTD-TFAM (MTD = PTD + MLS = "mitochondrial transduction domain") binds mtDNA and rapidly transports it across plasma membranes to mitochondria. For therapeutic proof-of-principle we tested ProtoFection technology in Parkinson's disease cybrid cells, using mtDNA generated from commercially available human genomic DNA (gDNA; Roche). Nine to 11 weeks after single exposures to MTD-TFAM + mtDNA complex, PD cybrid cells with impaired respiration and reduced mtDNA genes increased their mtDNA gene copy numbers up to 24-fold, mtDNA-derived RNAs up to 35-fold, TFAM and ETC proteins, cell respiration, and mitochondrial movement velocities. Cybrid cells with no or minimal basal mitochondrial impairments showed reduced or no responses to treatment, suggesting the possibility of therapeutic selectivity. Exposure of PD but not control cybrid cells to MTD-TFAM protein alone or MTD-TFAM + mtDNA complex increased expression of PGC-1alpha, suggesting activation of mitochondrial biogenesis. ProtoFection technology for mitochondrial gene therapy holds promise for improving bioenergetic function in impaired PD neurons and needs additional development to define its pharmacodynamics and delineate its molecular mechanisms. It also is unclear whether single-donor gDNA for generating mtDNA would be a preferred therapeutic compared with the pooled

  7. Mitochondrial genes are altered in blood early in Alzheimer's disease.

    Science.gov (United States)

    Lunnon, Katie; Keohane, Aoife; Pidsley, Ruth; Newhouse, Stephen; Riddoch-Contreras, Joanna; Thubron, Elisabeth B; Devall, Matthew; Soininen, Hikka; Kłoszewska, Iwona; Mecocci, Patrizia; Tsolaki, Magda; Vellas, Bruno; Schalkwyk, Leonard; Dobson, Richard; Malik, Afshan N; Powell, John; Lovestone, Simon; Hodges, Angela

    2017-01-07

    Although mitochondrial dysfunction is a consistent feature of Alzheimer's disease in the brain and blood, the molecular mechanisms behind these phenomena are unknown. Here we have replicated our previous findings demonstrating reduced expression of nuclear-encoded oxidative phosphorylation (OXPHOS) subunits and subunits required for the translation of mitochondrial-encoded OXPHOS genes in blood from people with Alzheimer's disease and mild cognitive impairment. Interestingly this was accompanied by increased expression of some mitochondrial-encoded OXPHOS genes, namely those residing closest to the transcription start site of the polycistronic heavy chain mitochondrial transcript (MT-ND1, MT-ND2, MT-ATP6, MT-CO1, MT-CO2, MT-C03) and MT-ND6 transcribed from the light chain. Further we show that mitochondrial DNA copy number was unchanged suggesting no change in steady-state numbers of mitochondria. We suggest that an imbalance in nuclear and mitochondrial genome-encoded OXPHOS transcripts may drive a negative feedback loop reducing mitochondrial translation and compromising OXPHOS efficiency, which is likely to generate damaging reactive oxygen species.

  8. The complete mitochondrial genome sequence of Emperor Penguins (Aptenodytes forsteri).

    Science.gov (United States)

    Xu, Qiwu; Xia, Yan; Dang, Xiao; Chen, Xiaoli

    2016-09-01

    The emperor penguin (Aptenodytes forsteri) is the largest living species of penguin. Herein, we first reported the complete mitochondrial genome of emperor penguin. The mitochondrial genome is a circular molecule of 17 301 bp in length, consisting of 13 protein-coding genes, 22 tRNA genes, two rRNA, and one control region. To verify the accuracy and the utility of new determined mitogenome sequences, we constructed the species phylogenetic tree of emperor penguin together with 10 other closely species. This is the second complete mitochondrial genome of penguin, and this is going to be an important data to study mitochondrial evolution of birds.

  9. Mitochondrial genome organization and phylogeny of two vespid wasps.

    Science.gov (United States)

    Cameron, Stephen L; Dowton, Mark; Castro, Lyda R; Ruberu, Kalani; Whiting, Michael F; Austin, Andy D; Diement, Kieren; Stevens, Julia

    2008-10-01

    We sequenced the entire mitochondrial genome of Abispa ephippium (Hymenoptera: Vespoidea: Vespidae: Eumeninae) and most of the mitochondrial genome of Polistes humilis synoecus (Hymenoptera: Vespoidea: Vespidae: Polistinae). The arrangement of genes differed between the two genomes and also differed slightly from that inferred to be ancestral for the Hymenoptera. The genome organization for both vespids is different from that of all other mitochondrial genomes previously reported. A number of tRNA gene rearrangements were identified that represent potential synapomorphies for a subset of the Vespidae. Analysis of all available hymenopteran mitochondrial genome sequences recovered an uncontroversial phylogeny, one consistent with analyses of other types of data.

  10. Romanian cyprinids phylogeny based on 16S ARN mitochondrial genes

    OpenAIRE

    Luca C.; Kevorkian S.; Elvira M.; Dinischiotu A.; Costache M.

    2007-01-01

    The vertebrate mitochondrial genome has been an important model system for studying molecular evolution, organism phylogeny, and genome structure. Phylogenetic relatioships were inferred from analysis of 570 base pairs (bp) of mithocondrial DNA (mtDNA), representing a conserved region of 16S rRNA. We sequenced 13 cyprinids species and one putative outgroup (Misgurnus fossilis) from Romania. Based upon nucleotide sequence comparisons of cyprinid mitochondrial 16SRNA genes, we established the p...

  11. Mitochondrial genome organization and vertebrate phylogenetics

    Directory of Open Access Journals (Sweden)

    Pereira Sérgio Luiz

    2000-01-01

    Full Text Available With the advent of DNA sequencing techniques the organization of the vertebrate mitochondrial genome shows variation between higher taxonomic levels. The most conserved gene order is found in placental mammals, turtles, fishes, some lizards and Xenopus. Birds, other species of lizards, crocodilians, marsupial mammals, snakes, tuatara, lamprey, and some other amphibians and one species of fish have gene orders that are less conserved. The most probable mechanism for new gene rearrangements seems to be tandem duplication and multiple deletion events, always associated with tRNA sequences. Some new rearrangements seem to be typical of monophyletic groups and the use of data from these groups may be useful for answering phylogenetic questions involving vertebrate higher taxonomic levels. Other features such as the secondary structure of tRNA, and the start and stop codons of protein-coding genes may also be useful in comparisons of vertebrate mitochondrial genomes.

  12. MITOCHONDRIAL AND METABOLIC GENE EXPRESSION IN THE AGED RAT HEART

    Directory of Open Access Journals (Sweden)

    Gregory P Barton

    2016-08-01

    Full Text Available Aging is associated with a decline in cardiac function. Exercise intervention has been suggested as a way to improve this decrement. Age-related decline in cardiac function is associated with decreases in fatty acid oxidation, mitochondrial function and AMP-activated protein kinase (AMPK activity. The molecular mechanisms involved with age-related changes in mitochondrial function and substrate metabolism are poorly understood. We determined gene expression differences in hearts of Young (6 mo, Old (33 mo, and old exercise trained (Old + EXE (34 mo FBN rats, using Qiagen PCR arrays for Glucose, Fatty acid, and Mitochondrial metabolism. Old rats demonstrated decreased (p < 0.05 expression for key genes in fatty acid oxidation, mitochondrial function, and AMPK signaling. There were no differences in the expression of genes involved in glucose metabolism with age. These gene expression changes occurred prior to altered protein translation as we found no differences in the protein content of peroxisome proliferator activated receptor gamma, coactivators 1 alpha (PGC-1α, peroxisome proliferator activated receptor alpha (PPARα, and AMPKα2 between young and old hearts. Four months of exercise training did not attenuate the decline in the gene expression in aged hearts. Despite this lack of change in gene expression, exercise-trained rats demonstrated increased exercise capacity compared to their sedentary counterparts. Taken together, our results show that differential expression of genes associated with fatty acid metabolism, AMPK signaling and mitochondrial function are superfluous and decrease in the aging heart which may play a role in age-related declines in fatty acid oxidation, AMPK activity and mitochondrial function in the heart.

  13. Computationally driven, quantitative experiments discover genes required for mitochondrial biogenesis.

    Directory of Open Access Journals (Sweden)

    David C Hess

    2009-03-01

    Full Text Available Mitochondria are central to many cellular processes including respiration, ion homeostasis, and apoptosis. Using computational predictions combined with traditional quantitative experiments, we have identified 100 proteins whose deficiency alters mitochondrial biogenesis and inheritance in Saccharomyces cerevisiae. In addition, we used computational predictions to perform targeted double-mutant analysis detecting another nine genes with synthetic defects in mitochondrial biogenesis. This represents an increase of about 25% over previously known participants. Nearly half of these newly characterized proteins are conserved in mammals, including several orthologs known to be involved in human disease. Mutations in many of these genes demonstrate statistically significant mitochondrial transmission phenotypes more subtle than could be detected by traditional genetic screens or high-throughput techniques, and 47 have not been previously localized to mitochondria. We further characterized a subset of these genes using growth profiling and dual immunofluorescence, which identified genes specifically required for aerobic respiration and an uncharacterized cytoplasmic protein required for normal mitochondrial motility. Our results demonstrate that by leveraging computational analysis to direct quantitative experimental assays, we have characterized mutants with subtle mitochondrial defects whose phenotypes were undetected by high-throughput methods.

  14. Systematically fragmented genes in a multipartite mitochondrial genome

    Science.gov (United States)

    Vlcek, Cestmir; Marande, William; Teijeiro, Shona; Lukeš, Julius; Burger, Gertraud

    2011-01-01

    Arguably, the most bizarre mitochondrial DNA (mtDNA) is that of the euglenozoan eukaryote Diplonema papillatum. The genome consists of numerous small circular chromosomes none of which appears to encode a complete gene. For instance, the cox1 coding sequence is spread out over nine different chromosomes in non-overlapping pieces (modules), which are transcribed separately and joined to a contiguous mRNA by trans-splicing. Here, we examine how many genes are encoded by Diplonema mtDNA and whether all are fragmented and their transcripts trans-spliced. Module identification is challenging due to the sequence divergence of Diplonema mitochondrial genes. By employing most sensitive protein profile search algorithms and comparing genomic with cDNA sequence, we recognize a total of 11 typical mitochondrial genes. The 10 protein-coding genes are systematically chopped up into three to 12 modules of 60–350 bp length. The corresponding mRNAs are all trans-spliced. Identification of ribosomal RNAs is most difficult. So far, we only detect the 3′-module of the large subunit ribosomal RNA (rRNA); it does not trans-splice with other pieces. The small subunit rRNA gene remains elusive. Our results open new intriguing questions about the biochemistry and evolution of mitochondrial trans-splicing in Diplonema. PMID:20935050

  15. The complete mitochondrial genome of the mountainous duskywing, Erynnis montanus (Lepidoptera: Hesperiidae): a new gene arrangement in Lepidoptera.

    Science.gov (United States)

    Wang, Ah Rha; Jeong, Heon Cheon; Han, Yeon Soo; Kim, Iksoo

    2014-04-01

    The mountainous duskywing, Erynnis montanus, belongs to a lepidopteran family Hesperiidae. The 15,530-bp long complete mitochondrial genome (mitogenome) of the species has the typical gene content of animals (13 protein-coding genes, two rRNA genes, 22 tRNA genes and one major non-coding A+T-rich region). As typical in lepidopteran mitogenome E. montanus mitogenome also contained a high A/T content in the whole genome (81.7%) and the CGA (arginine) as the start codon for the COI gene. Unlike other lepidopteran species, including two sequenced skippers, the E. montanus mitogenome has a unique arrangement tRNA(Ser)-tRNA(Asn), instead of the tRNA(Asn)-tRNA(Ser) found unanimously in other lepidopteran species, providing a new gene arrangement in Lepidoptera. Such rearrangement probably was likely caused by duplication of gene block tRNA(Ser)-tRNA(Asn) and subsequent random loss of tRNA(Asn) in the first copy and tRNA(Ser) in the second copy, resulting in the arrangement tRNA(Ser)-tRNA(Asn).

  16. Complete mitochondrial genomes of Ceratobaeus sp. and Idris sp. (Hymenoptera: Scelionidae): shared gene rearrangements as potential phylogenetic markers at the tribal level.

    Science.gov (United States)

    Mao, Meng; Dowton, Mark

    2014-10-01

    We sequenced the complete mitochondrial genomes of two sceliond taxa (Ceratobaeus sp. and Idris sp.). An atypical tRNA-Arg which lacks a D-stem was identified in both taxa, and represents a potentially derived character of sceliond wasps. A number of tRNA genes have rearranged in the two mitochondrial genomes compared with the ancestral organization. Some of these derived genome organizations are shared, and thus have much potential as phylogenetic markers at the tribal level in the subfamily Scelioninae. We test the influence of third codon inclusion/exclusion, alignment methods and partition schemes on the reconstruction of phylogenetic relationships. The results show that inclusion of third codon positions does not appear to be problematic when investigating the phylogeny of closely related taxa. Muscle and PartitionFinder schemes significantly improve the likelihood scores.

  17. Virulence characteristics of Salmonella following deletion of genes encoding the tRNA modification enzymes GidA and MnmE.

    Science.gov (United States)

    Shippy, Daniel C; Eakley, Nicholas M; Lauhon, Charles T; Bochsler, Philip N; Fadl, Amin A

    2013-04-01

    Salmonella is an important foodborne pathogen causing major public health problems throughout the world due to the consumption of contaminated food. Our previous studies have shown that deletion of glucose-inhibited division (gidA) gene significantly altered Salmonella virulence in both in vitro and in vivo models of infection. In Escherichia coli, GidA and MnmE have been shown to modify several bacterial factors by a post-transcriptional mechanism to modify tRNA. Therefore, we hypothesize that GidA and MnmE complex together to modulate virulence genes in Salmonella using a similar mechanism. To test our hypothesis, and to examine the relative contribution of GidA and MnmE in modulation of Salmonella virulence, we constructed gidA and mnmE single mutants as well as a gidA mnmE double mutant strain of Salmonella. Results from the in vitro data displayed a reduction in growth, motility, intracellular replication, and invasion of T84 intestinal epithelial cells in the mutant strains compared to the wild-type Salmonella strain. The in vivo data showed a significant attenuation of the mutant strains as indicated by the induction of inflammatory cytokines and chemokines, as well as in the severity of histopathological lesions in the liver and spleen, compared to mice infected with the wild-type strain. Also, a significant increase in the LD50 was observed in mice infected with the mutant strains, and mice immunized with the mutants were protected against a lethal dose of wild-type Salmonella. A pull-down assay indicated that Salmonella GidA and MnmE bind together, and HPLC analysis revealed that deletion of gidA and/or mnmE altered Salmonella tRNA modification. Overall, the data suggest MnmE and GidA bind together and use a post-transcriptional mechanism to modify tRNA to regulate Salmonella pathogenesis.

  18. The Amerindian mtDNA haplogroup B2 enhances the risk of HPV for cervical cancer: de-regulation of mitochondrial genes may be involved.

    Science.gov (United States)

    Guardado-Estrada, Mariano; Medina-Martínez, Ingrid; Juárez-Torres, Eligia; Roman-Bassaure, Edgar; Macías, Luis; Alfaro, Ana; Alcántara-Vázquez, Avissai; Alonso, Patricia; Gomez, Guillermo; Cruz-Talonia, Fernando; Serna, Luis; Muñoz-Cortez, Sergio; Borges-Ibañez, Manuel; Espinosa, Ana; Kofman, Susana; Berumen, Jaime

    2012-04-01

    Although human papillomavirus (HPV) infection is the main causal factor for cervical cancer (CC), there are data suggesting that genetic factors could modulate the risk for CC. Sibling studies suggest that maternally inherited factors could be involved in CC. To assess whether mitochondrial DNA (mtDNA) polymorphisms are associated to CC, HPV infection and HPV types, a case-control study was performed in the Mexican population. Polymorphism of mtDNA D-loop was investigated in 187 CC patients and 270 healthy controls. HPV was detected and typed in cervical scrapes. The expression of 29 mitochondrial genes was analyzed in a subset of 45 tumor biopsies using the expression microarray ST1.0. The Amerindian haplogroup B2 increased the risk for CC (odds ratio (OR)=1.6; 95% confidence interval (CI): 1.05-2.58) and enhanced 36% (OR=208; 95% CI: 25.2-1735.5) the risk conferred by the HPV alone (OR=152.9; 95% CI: 65.4-357.5). In cases, the distribution of HPV types was similar in all haplogroups but one (D1), in which is remarkable the absence of HPV18, a very low frequency of HPV16 and high frequencies of HPV45, HPV31 and other HPV types. Two mtDNA genes (mitochondrial aspartic acid tRNA (MT-TD), mitochondrial lysine tRNA (MT-TK)) could be involved in the increased risk conferred by the haplogroup B2, as they were upregulated exclusively in B2 tumors (P<0.01, t-test). Although the association of mtDNA with CC and HPV infection is clear, other studies with higher sample size will be needed to elucidate the role of mtDNA in cervical carcinogenesis.

  19. Active Center Control of Termination by RNA Polymerase III and tRNA Gene Transcription Levels In Vivo.

    Directory of Open Access Journals (Sweden)

    Keshab Rijal

    2016-08-01

    Full Text Available The ability of RNA polymerase (RNAP III to efficiently recycle from termination to reinitiation is critical for abundant tRNA production during cellular proliferation, development and cancer. Yet understanding of the unique termination mechanisms used by RNAP III is incomplete, as is its link to high transcription output. We used two tRNA-mediated suppression systems to screen for Rpc1 mutants with gain- and loss- of termination phenotypes in S. pombe. 122 point mutation mutants were mapped to a recently solved 3.9 Å structure of yeast RNAP III elongation complex (EC; they cluster in the active center bridge helix and trigger loop, as well as the pore and funnel, the latter of which indicate involvement of the RNA cleavage domain of the C11 subunit in termination. Purified RNAP III from a readthrough (RT mutant exhibits increased elongation rate. The data strongly support a kinetic coupling model in which elongation rate is inversely related to termination efficiency. The mutants exhibit good correlations of terminator RT in vitro and in vivo, and surprisingly, amounts of transcription in vivo. Because assessing in vivo transcription can be confounded by various parameters, we used a tRNA reporter with a processing defect and a strong terminator. By ruling out differences in RNA decay rates, the data indicate that mutants with the RT phenotype synthesize more RNA than wild type cells, and than can be accounted for by their increased elongation rate. Finally, increased activity by the mutants appears unrelated to the RNAP III repressor, Maf1. The results show that the mobile elements of the RNAP III active center, including C11, are key determinants of termination, and that some of the mutations activate RNAP III for overall transcription. Similar mutations in spontaneous cancer suggest this as an unforeseen mechanism of RNAP III activation in disease.

  20. Pseudoscorpion mitochondria show rearranged genes and genome-wide reductions of RNA gene sizes and inferred structures, yet typical nucleotide composition bias

    Directory of Open Access Journals (Sweden)

    Ovchinnikov Sergey

    2012-03-01

    Full Text Available Abstract Background Pseudoscorpions are chelicerates and have historically been viewed as being most closely related to solifuges, harvestmen, and scorpions. No mitochondrial genomes of pseudoscorpions have been published, but the mitochondrial genomes of some lineages of Chelicerata possess unusual features, including short rRNA genes and tRNA genes that lack sequence to encode arms of the canonical cloverleaf-shaped tRNA. Additionally, some chelicerates possess an atypical guanine-thymine nucleotide bias on the major coding strand of their mitochondrial genomes. Results We sequenced the mitochondrial genomes of two divergent taxa from the chelicerate order Pseudoscorpiones. We find that these genomes possess unusually short tRNA genes that do not encode cloverleaf-shaped tRNA structures. Indeed, in one genome, all 22 tRNA genes lack sequence to encode canonical cloverleaf structures. We also find that the large ribosomal RNA genes are substantially shorter than those of most arthropods. We inferred secondary structures of the LSU rRNAs from both pseudoscorpions, and find that they have lost multiple helices. Based on comparisons with the crystal structure of the bacterial ribosome, two of these helices were likely contact points with tRNA T-arms or D-arms as they pass through the ribosome during protein synthesis. The mitochondrial gene arrangements of both pseudoscorpions differ from the ancestral chelicerate gene arrangement. One genome is rearranged with respect to the location of protein-coding genes, the small rRNA gene, and at least 8 tRNA genes. The other genome contains 6 tRNA genes in novel locations. Most chelicerates with rearranged mitochondrial genes show a genome-wide reversal of the CA nucleotide bias typical for arthropods on their major coding strand, and instead possess a GT bias. Yet despite their extensive rearrangement, these pseudoscorpion mitochondrial genomes possess a CA bias on the major coding strand. Phylogenetic

  1. The complete mitochondrial genome of the cyclopoid copepod Paracyclopina nana: a highly divergent genome with novel gene order and atypical gene numbers.

    Science.gov (United States)

    Ki, Jang-Seu; Park, Heum Gi; Lee, Jae-Seong

    2009-04-15

    In this paper, we describe the complete mitogenome of the cyclopoid copepod Paracyclopina nana with emphasis on the highly rearranged gene order and high divergence against published copepod mitogenomes. The P. nana mtDNA is 15,981 bp in length (70.9% AT) and consists of 37 genes (12 protein-coding genes, 2 rRNAs, 23 tRNAs) that are atypical for metazoan mitogenomes. Unusually, it contains an extra tRNA (tRNA-Ala) but it does not contain the ATPase 8 gene. The P. nana mitogenome has a long putative control region with high AT content (1351 bp, 77.0% AT). The Cyt b was considerably short in length, compared to other crustaceans. Compared to typical mitogenomes of arthropods and copepods, the gene order of the P. nana mitogenome is highly rearranged with a novel gene structure. In addition, P. nana has highly divergent mt genes (mostly less than 50%), judged by amino acid substitution. We present the first complete mitogenome sequence from a cyclopoid copepod, thereby increasing our understanding of copepod and crustacean evolution from the mitochondrial point of view.

  2. The Agaricus bisporus cox1 gene: the longest mitochondrial gene and the largest reservoir of mitochondrial group i introns.

    Directory of Open Access Journals (Sweden)

    Cyril Férandon

    Full Text Available In eukaryotes, introns are located in nuclear and organelle genes from several kingdoms. Large introns (up to 5 kbp are frequent in mitochondrial genomes of plant and fungi but scarce in Metazoa, even if these organisms are grouped with fungi among the Opisthokonts. Mitochondrial introns are classified in two groups (I and II according to their RNA secondary structure involved in the intron self-splicing mechanism. Most of these mitochondrial group I introns carry a "Homing Endonuclease Gene" (heg encoding a DNA endonuclease acting in transfer and site-specific integration ("homing" and allowing intron spreading and gain after lateral transfer even between species from different kingdoms. Opposed to this gain mechanism, is another which implies that introns, which would have been abundant in the ancestral genes, would mainly evolve by loss. The importance of both mechanisms (loss and gain is matter of debate. Here we report the sequence of the cox1 gene of the button mushroom Agaricus bisporus, the most widely cultivated mushroom in the world. This gene is both the longest mitochondrial gene (29,902 nt and the largest group I intron reservoir reported to date with 18 group I and 1 group II. An exhaustive analysis of the group I introns available in cox1 genes shows that they are mobile genetic elements whose numerous events of loss and gain by lateral transfer combine to explain their wide and patchy distribution extending over several kingdoms. An overview of intron distribution, together with the high frequency of eroded heg, suggests that they are evolving towards loss. In this landscape of eroded and lost intron sequences, the A. bisporus cox1 gene exhibits a peculiar dynamics of intron keeping and catching, leading to the largest collection of mitochondrial group I introns reported to date in a Eukaryote.

  3. Gene cloning, expression and purification of human mito-chondrial tRNALeu(UUR) and its mutant

    Institute of Scientific and Technical Information of China (English)

    HAN; Weiguo

    2001-01-01

    [1]Anderson, S., Bankier, A. T., Barrell, B. G. et al., Sequence and organization of the human mitochondrial gene, Nature, 1981, 290(9): 457.[2]Wang, X. M., Yang, Y. S., The mutation of human mitochondrial tRNA and diseases, Chemistry of Life, 1999, 19(4): 171.[3]Goto, Y., Nonaka, I., Horai, S., A mutation in the tRNAleu(UUR) gene associated with the MELAS subgroup of mitochondrial encephalomyopathies, Nature, 1990, 348(13): 651.[4]Schapira, A. H. V., Mitochondrial disorders, Current Opinion in Genetics and Development, 1993, 3: 457.[5]Moraes, C. T., Ricci, E., Bonilla, W. et al., The mitochondrial tRNAleu(UUR) mutation in mitochondrial encephalomyopathy, lactic acidosis, and stroke-like episode (MELAS): genetic, biochemical and morphological correlations in skeletal muscle, Am. J. Hum. Genet., 1992, 50: 934.[6]Chen, L., Jin, Y. X., Wang, D. B. et al., Species-specific identity elements of tRNATrp, Prog. Natl. Sci., 2000, 10(3): 192.[7]Sambrook, J., Fritsch, E. F., Maniatis, T., Molecular Cloning: A Laboratory Manual, 2nd ed., New York: Cold Spring Harbor Laboratory Press, 1989, 556-558.[8]Merri, C. R., Goldman, D., Keuren, M. L. V., Gel protein stains: silver stain, Methods Enzymol, 1984, 104: 441.[9]Li, Y., Wang, E., Wang, Y., Overproduction and purification of Escherichia coli tRNAleu, Science in China, Ser. C, 1998, 41(3): 225.[10]Hess, J. F., Parisi, M. A., Bennett Clayton, D. A., Impairment of mitochondrial transcription termination by a point mutation associated with the MELAS subgroup of mitochondrial encephalomyopathies, Nature, 1991, 352: 236.[11]Yousufzai, A. Y. K., Bradford, M. W., Shrago, E. et al., Characterization of the adenine nucleotide translocase of pancreatic islet mitochondria, FEBS Lett., 1982, 137: 201.[12]Welsh, N., Paabo, S., Welsh, M., Decreased mitochondrial gene expression in isolated islet of rats injected neonatally with streptozotocin, Diabetologia, 1991, 34: 626.[13] Chen, L., Jin

  4. Transcription profiles of mitochondrial genes correlate with mitochondrial DNA haplotypes in a natural population of Silene vulgaris

    Directory of Open Access Journals (Sweden)

    Olson Matthew S

    2010-01-01

    Full Text Available Abstract Background Although rapid changes in copy number and gene order are common within plant mitochondrial genomes, associated patterns of gene transcription are underinvestigated. Previous studies have shown that the gynodioecious plant species Silene vulgaris exhibits high mitochondrial diversity and occasional paternal inheritance of mitochondrial markers. Here we address whether variation in DNA molecular markers is correlated with variation in transcription of mitochondrial genes in S. vulgaris collected from natural populations. Results We analyzed RFLP variation in two mitochondrial genes, cox1 and atp1, in offspring of ten plants from a natural population of S. vulgaris in Central Europe. We also investigated transcription profiles of the atp1 and cox1 genes. Most DNA haplotypes and transcription profiles were maternally inherited; for these, transcription profiles were associated with specific mitochondrial DNA haplotypes. One individual exhibited a pattern consistent with paternal inheritance of mitochondrial DNA; this individual exhibited a transcription profile suggestive of paternal but inconsistent with maternal inheritance. We found no associations between gender and transcript profiles. Conclusions Specific transcription profiles of mitochondrial genes were associated with specific mitochondrial DNA haplotypes in a natural population of a gynodioecious species S. vulgaris. Our findings suggest the potential for a causal association between rearrangements in the plant mt genome and transcription product variation.

  5. The Agaricus bisporus cox1 Gene: The Longest Mitochondrial Gene and the Largest Reservoir of Mitochondrial Group I Introns

    Science.gov (United States)

    Férandon, Cyril; Moukha, Serge; Callac, Philippe; Benedetto, Jean-Pierre; Castroviejo, Michel; Barroso, Gérard

    2010-01-01

    In eukaryotes, introns are located in nuclear and organelle genes from several kingdoms. Large introns (up to 5 kbp) are frequent in mitochondrial genomes of plant and fungi but scarce in Metazoa, even if these organisms are grouped with fungi among the Opisthokonts. Mitochondrial introns are classified in two groups (I and II) according to their RNA secondary structure involved in the intron self-splicing mechanism. Most of these mitochondrial group I introns carry a “Homing Endonuclease Gene” (heg) encoding a DNA endonuclease acting in transfer and site-specific integration (“homing”) and allowing intron spreading and gain after lateral transfer even between species from different kingdoms. Opposed to this gain mechanism, is another which implies that introns, which would have been abundant in the ancestral genes, would mainly evolve by loss. The importance of both mechanisms (loss and gain) is matter of debate. Here we report the sequence of the cox1 gene of the button mushroom Agaricus bisporus, the most widely cultivated mushroom in the world. This gene is both the longest mitochondrial gene (29,902 nt) and the largest group I intron reservoir reported to date with 18 group I and 1 group II. An exhaustive analysis of the group I introns available in cox1 genes shows that they are mobile genetic elements whose numerous events of loss and gain by lateral transfer combine to explain their wide and patchy distribution extending over several kingdoms. An overview of intron distribution, together with the high frequency of eroded heg, suggests that they are evolving towards loss. In this landscape of eroded and lost intron sequences, the A. bisporus cox1 gene exhibits a peculiar dynamics of intron keeping and catching, leading to the largest collection of mitochondrial group I introns reported to date in a Eukaryote. PMID:21124976

  6. Chloroplast protein and centrosomal genes, a tRNA intron, and odd telomeres in an unusually compact eukaryotic genome, the cryptomonad nucleomorph.

    Science.gov (United States)

    Zauner, S; Fraunholz, M; Wastl, J; Penny, S; Beaton, M; Cavalier-Smith, T; Maier, U G; Douglas, S

    2000-01-04

    Cells of several major algal groups are evolutionary chimeras of two radically different eukaryotic cells. Most of these "cells within cells" lost the nucleus of the former algal endosymbiont. But after hundreds of millions of years cryptomonads still retain the nucleus of their former red algal endosymbiont as a tiny relict organelle, the nucleomorph, which has three minute linear chromosomes, but their function and the nature of their ends have been unclear. We report extensive cryptomonad nucleomorph sequences (68.5 kb), from one end of each of the three chromosomes of Guillardia theta. Telomeres of the nucleomorph chromosomes differ dramatically from those of other eukaryotes, being repeats of the 23-mer sequence (AG)(7)AAG(6)A, not a typical hexamer (commonly TTAGGG). The subterminal regions comprising the rRNA cistrons and one protein-coding gene are exactly repeated at all three chromosome ends. Gene density (one per 0.8 kb) is the highest for any cellular genome. None of the 38 protein-coding genes has spliceosomal introns, in marked contrast to the chlorarachniophyte nucleomorph. Most identified nucleomorph genes are for gene expression or protein degradation; histone, tubulin, and putatively centrosomal ranbpm genes are probably important for chromosome segregation. No genes for primary or secondary metabolism have been found. Two of the three tRNA genes have introns, one in a hitherto undescribed location. Intergenic regions are exceptionally short; three genes transcribed by two different RNA polymerases overlap their neighbors. The reported sequences encode two essential chloroplast proteins, FtsZ and rubredoxin, thus explaining why cryptomonad nucleomorphs persist.

  7. The complete mitochondrial genome of Liobagrus kingi (Teleostei, Siluriformes: Amblycipitidae).

    Science.gov (United States)

    Jia, Xiang-Yang; Li, Ying-Wen; Wang, Deng-Qiang; Tian, Hui-Wu; Xiong, Xing; Li, Shu-Hua; Chen, Da-Qing

    2013-08-01

    Liobagrus kingi is endemic to southwest China and listed as endangered species (IUCN 2012). Genetic diversity is necessary for conservation issue. In studying this, the complete mitochondrial genome sequence of L. kingi has been obtained with PCR, which contains 13 protein-coding genes, 22 tRNA genes, 2 rRNA genes, and a non-coding control region with the total length of 16,483 bp. The gene arrangement and composition are similar to that of other vertebrates. Most of the genes are encoded on heavy strand, except for eight tRNA and ND6 genes. Just like most other vertebrates, the against bias of G has a universality in different statistical results. The complete mitochondrial genome sequence of L. kingi would contribute to better understand population genetics and protect its genetic diversity.

  8. Angiosperm phylogeny inferred from sequences of four mitochondrial genes

    Institute of Scientific and Technical Information of China (English)

    Yin-Long QIU; Zhi-Duan CHEN; Libo LI; Bin WANG; Jia-Yu XUE; Tory A. HENDRY; Rui-Qi LI; Joseph W. BROWN; Yang LIU; Geordan T. HUDSON

    2010-01-01

    An angiosperm phylogeny was reconstructed in a maximum likelihood analysis of sequences of four mitochondrial genes, atpl, matR, had5, and rps3, from 380 species that represent 376 genera and 296 families of seed plants. It is largely congruent with the phylogeny of angiosperms reconstructed from chloroplast genes atpB, matK, and rbcL, and nuclear 18S rDNA. The basalmost lineage consists of Amborella and Nymphaeales (including Hydatellaceae). Austrobaileyales follow this clade and are sister to the mesangiosperms, which include Chloranthaceae, Ceratophyllum, magnoliids, monocots, and eudicots. With the exception of Chloranthaceae being sister to Ceratophyllum, relationships among these five lineages are not well supported. In eudicots, Ranunculales, Sabiales, Proteales, Trochodendrales, Buxales, Gunnerales, Saxifragales, Vitales, Berberidopsidales, and Dilleniales form a basal grade of lines that diverged before the diversification of rosids and asterids. Within rosids, the COM (Celastrales-Oxalidales-Malpighiales) clade is sister to malvids (or rosid Ⅱ), instead of to the nitrogen-fixing clade as found in all previous large-scale molecular analyses of angiosperms. Santalales and Caryophyllales are members of an expanded asterid clade. This study shows that the mitochondrial genes are informative markers for resolving relationships among genera, families, or higher rank taxa across angiosperms. The low substitution rates and low homoplasy levels of the mitochondrial genes relative to the chloroplast genes, as found in this study, make them particularly useful for reconstructing ancient phylogenetic relationships. A mitochondrial gene-based angiosperm phylogeny provides an independent and essential reference for comparison with hypotheses of angiosperm phylogeny based on chloroplast genes, nuclear genes, and non-molecular data to reconstruct the underlying organismal phylogeny.

  9. Rates of gene rearrangement and nucleotide substitution are correlated in the mitochondrial genomes of insects.

    Science.gov (United States)

    Shao, Renfu; Dowton, Mark; Murrell, Anna; Barker, Stephen C

    2003-10-01

    A number of studies indicated that lineages of animals with high rates of mitochondrial (mt) gene rearrangement might have high rates of mt nucleotide substitution. We chose the hemipteroid assemblage and the Insecta to test the idea that rates of mt gene rearrangement and mt nucleotide substitution are correlated. For this purpose, we sequenced the mt genome of a lepidopsocid from the Psocoptera, the only order of hemipteroid insects for which an entire mtDNA sequence is not available. The mt genome of this lepidopsocid is circular, 16,924 bp long, and contains 37 genes and a putative control region; seven tRNA genes and a protein-coding gene in this genome have changed positions relative to the ancestral arrangement of mt genes of insects. We then compared the relative rates of nucleotide substitution among species from each of the four orders of hemipteroid insects and among the 20 insects whose mt genomes have been sequenced entirely. All comparisons among the hemipteroid insects showed that species with higher rates of gene rearrangement also had significantly higher rates of nucleotide substitution statistically than did species with lower rates of gene rearrangement. In comparisons among the 20 insects, where the mt genomes of the two species differed by more than five breakpoints, the more rearranged species always had a significantly higher rate of nucleotide substitution than the less rearranged species. However, in comparisons where the mt genomes of two species differed by five or less breakpoints, the more rearranged species did not always have a significantly higher rate of nucleotide substitution than the less rearranged species. We tested the statistical significance of the correlation between the rates of mt gene rearrangement and mt nucleotide substitution with nine pairs of insects that were phylogenetically independent from one another. We found that the correlation was positive and statistically significant (R2 = 0.73, P = 0.01; Rs = 0.67, P

  10. Mutation of the mitochondrial tyrosyl-tRNA synthetase gene, YARS2, causes myopathy, lactic acidosis, and sideroblastic anemia--MLASA syndrome.

    Science.gov (United States)

    Riley, Lisa G; Cooper, Sandra; Hickey, Peter; Rudinger-Thirion, Joëlle; McKenzie, Matthew; Compton, Alison; Lim, Sze Chern; Thorburn, David; Ryan, Michael T; Giegé, Richard; Bahlo, Melanie; Christodoulou, John

    2010-07-09

    Mitochondrial respiratory chain disorders are a heterogeneous group of disorders in which the underlying genetic defect is often unknown. We have identified a pathogenic mutation (c.156C>G [p.F52L]) in YARS2, located at chromosome 12p11.21, by using genome-wide SNP-based homozygosity analysis of a family with affected members displaying myopathy, lactic acidosis, and sideroblastic anemia (MLASA). We subsequently identified the same mutation in another unrelated MLASA patient. The YARS2 gene product, mitochondrial tyrosyl-tRNA synthetase (YARS2), was present at lower levels in skeletal muscle whereas fibroblasts were relatively normal. Complex I, III, and IV were dysfunctional as indicated by enzyme analysis, immunoblotting, and immunohistochemistry. A mitochondrial protein-synthesis assay showed reduced levels of respiratory chain subunits in myotubes generated from patient cell lines. A tRNA aminoacylation assay revealed that mutant YARS2 was still active; however, enzyme kinetics were abnormal compared to the wild-type protein. We propose that the reduced aminoacylation activity of mutant YARS2 enzyme leads to decreased mitochondrial protein synthesis, resulting in mitochondrial respiratory chain dysfunction. MLASA has previously been associated with PUS1 mutations; hence, the YARS2 mutation reported here is an alternative cause of MLASA.

  11. The complete mitochondrial DNA of white shark (Carcharodon carcharias) from Isla Guadalupe, Mexico.

    Science.gov (United States)

    Diaz-Jaimes, Pindaro; Hinojosa-Alvarez, Silvia; Sánchez-Hernández, Xóchitl; Hoyos-Padilla, Mauricio; García-De-León, Francisco J

    2016-01-01

    The Isla Guadalupe white shark mitochondrial structure is similar to the one previously reported for a white shark individual from Taiwan with a total length of 16,745 and 16,742 bp respectively; the base composition of the genomes was as follow A (30.60%), T (28.67%), C (26.86%) and G (13.87%), contains 13 protein-coding genes and 24 tRNA genes and the non-coding control region. The tRNA genes range from 70-72 bp. Gene order is the same as in other vertebrates and teleosts.

  12. Complete mitochondrial genome of Rhinogobius giurinus (Perciformes: Gobiidae: Gobionellinae).

    Science.gov (United States)

    Xie, Lingpeng; Yang, Xuefen; Ma, Zhihong; Yang, Ruibin

    2015-04-01

    In this study, we present the complete mitochondrial gene for the freshwater goby Rhinogobius giurinus. The genome is a circular molecule of 16,520 bp in length and consists of 13 protein-coding genes, 22 tRNA genes, 2 ribosomal RNA genes and 2 main non-coding regions (the control region and the origin of the light strand replication). The overall base composition of R. giurinus is 26.08% for T, 29.56% for C, 27.73% for A and 16.63% for G, with a slight A + T bias of 53.81%. It has the typical vertebrate mitochondrial gene arrangement.

  13. Gene recruitment--a common mechanism in the evolution of transfer RNA gene families.

    Science.gov (United States)

    Wang, Xiujuan; Lavrov, Dennis V

    2011-04-01

    The evolution of alloacceptor transfer RNAs (tRNAs) has been traditionally thought to occur vertically and reflect the evolution of the genetic code. Yet there have been several indications that a tRNA gene could evolve horizontally, from a copy of an alloacceptor tRNA gene in the same genome. Earlier, we provided the first unambiguous evidence for the occurrence of such "tRNA gene recruitment" in nature--in the mitochondrial (mt) genome of the demosponge Axinella corrugata. Yet the extent and the pattern of this process in the evolution of tRNA gene families remained unclear. Here we analyzed tRNA genes from 21 mt genomes of demosponges as well as nuclear genomes of rhesus macaque, chimpanzee and human. We found four new cases of alloacceptor tRNA gene recruitment in mt genomes and eleven cases in the nuclear genomes. In most of these cases we observed a single nucleotide substitution at the middle position of the anticodon, which resulted in the change of not only the tRNA's amino-acid identity but also the class of the amino-acyl tRNA synthetases (aaRSs) involved in amino-acylation. We hypothesize that the switch to a different class of aaRSs may have prevented the conflict between anticodon and amino-acid identities of recruited tRNAs. Overall our results suggest that gene recruitment is a common phenomenon in tRNA multigene family evolution and should be taken into consideration when tRNA evolutionary history is reconstructed.

  14. Complete mitochondrial DNA sequence of the endangered frog Odorrana ishikawae (family Ranidae) and unexpected diversity of mt gene arrangements in ranids.

    Science.gov (United States)

    Kurabayashi, Atsushi; Yoshikawa, Natsuhiko; Sato, Naoki; Hayashi, Yoko; Oumi, Shohei; Fujii, Tamotsu; Sumida, Masayuki

    2010-08-01

    We determined the complete nucleotide sequence of the mitochondrial (mt) genome of an endangered Japanese frog, Odorrana ishikawae (family Ranidae). We also sequenced partial mt genomes of three other Odorrana and six ranid species to survey the diversity of genomic organizations and elucidate the phylogenetic problems remaining in this frog family. The O. ishikawae mt genome contained the 37 mt genes and single control region (CR) typically found in vertebrate mtDNAs, but the region of Light-strand replication origin (OL) was triplicated in this species. Four protein-encoding genes (atp6, nd2, nd3, and nd5) were found to have high sequence divergence and to be usable for population genetics studies on this endangered species. Among the surveyed ranids, only two species (Rana and Lithobates) manifested the typical neobatrachian-type mt gene arrangement. In contrast, relatively large gene rearrangements were found in Amolops, Babina, and Staurois species; and translocations of single tRNA genes (trns) were observed in Glandirana and Odorrana species. Though the inter-generic and interspecific relationships of ranid taxa remain to be elucidated based on 12S and 16S rrn sequence data, some of the derived mt gene orders were found to have synapomorphic features useful for solving problematic ranid phylogenies. The tandem duplication and random loss (TDRL) model, the traditional model for mt gene rearrangement, failed to easily explain several of the mt gene rearrangements observed here. Indeed, the recent recombination-based gene rearrangement models seemed to be more suitable for this purpose. The high frequency of gene translocations involving a specific trn block (trnH-trnS1) and several single tRNA genes suggest that there may be a retrotranslocation in ranid mt genomes.

  15. Evidence of a bigenomic regulation of mitochondrial gene expression by thyroid hormone during rat brain development

    Energy Technology Data Exchange (ETDEWEB)

    Sinha, Rohit Anthony; Pathak, Amrita; Mohan, Vishwa; Babu, Satish; Pal, Amit; Khare, Drirh [Department of Endocrinology, Sanjay Gandhi Postgraduate Institute of Medical Sciences, Lucknow 226014 (India); Godbole, Madan M., E-mail: madangodbole@yahoo.co.in [Department of Endocrinology, Sanjay Gandhi Postgraduate Institute of Medical Sciences, Lucknow 226014 (India)

    2010-07-02

    Hypothyroidism during early mammalian brain development is associated with decreased expression of various mitochondrial encoded genes along with evidence for mitochondrial dysfunction. However, in-spite of the similarities between neurological disorders caused by perinatal hypothyroidism and those caused by various genetic mitochondrial defects we still do not know as to how thyroid hormone (TH) regulates mitochondrial transcription during development and whether this regulation by TH is nuclear mediated or through mitochondrial TH receptors? We here in rat cerebellum show that hypothyroidism causes reduction in expression of nuclear encoded genes controlling mitochondrial biogenesis like PGC-1{alpha}, NRF-1{alpha} and Tfam. Also, we for the first time demonstrate a mitochondrial localization of thyroid hormone receptor (mTR) isoform in developing brain capable of binding a TH response element (DR2) present in D-loop region of mitochondrial DNA. These results thus indicate an integrated nuclear-mitochondrial cross talk in regulation of mitochondrial transcription by TH during brain development.

  16. Massive mitochondrial gene transfer in a parasitic flowering plant clade.

    Directory of Open Access Journals (Sweden)

    Zhenxiang Xi

    Full Text Available Recent studies have suggested that plant genomes have undergone potentially rampant horizontal gene transfer (HGT, especially in the mitochondrial genome. Parasitic plants have provided the strongest evidence of HGT, which appears to be facilitated by the intimate physical association between the parasites and their hosts. A recent phylogenomic study demonstrated that in the holoparasite Rafflesia cantleyi (Rafflesiaceae, whose close relatives possess the world's largest flowers, about 2.1% of nuclear gene transcripts were likely acquired from its obligate host. Here, we used next-generation sequencing to obtain the 38 protein-coding and ribosomal RNA genes common to the mitochondrial genomes of angiosperms from R. cantleyi and five additional species, including two of its closest relatives and two host species. Strikingly, our phylogenetic analyses conservatively indicate that 24%-41% of these gene sequences show evidence of HGT in Rafflesiaceae, depending on the species. Most of these transgenic sequences possess intact reading frames and are actively transcribed, indicating that they are potentially functional. Additionally, some of these transgenes maintain synteny with their donor and recipient lineages, suggesting that native genes have likely been displaced via homologous recombination. Our study is the first to comprehensively assess the magnitude of HGT in plants involving a genome (i.e., mitochondria and a species interaction (i.e., parasitism where it has been hypothesized to be potentially rampant. Our results establish for the first time that, although the magnitude of HGT involving nuclear genes is appreciable in these parasitic plants, HGT involving mitochondrial genes is substantially higher. This may represent a more general pattern for other parasitic plant clades and perhaps more broadly for angiosperms.

  17. Massive mitochondrial gene transfer in a parasitic flowering plant clade.

    Science.gov (United States)

    Xi, Zhenxiang; Wang, Yuguo; Bradley, Robert K; Sugumaran, M; Marx, Christopher J; Rest, Joshua S; Davis, Charles C

    2013-01-01

    Recent studies have suggested that plant genomes have undergone potentially rampant horizontal gene transfer (HGT), especially in the mitochondrial genome. Parasitic plants have provided the strongest evidence of HGT, which appears to be facilitated by the intimate physical association between the parasites and their hosts. A recent phylogenomic study demonstrated that in the holoparasite Rafflesia cantleyi (Rafflesiaceae), whose close relatives possess the world's largest flowers, about 2.1% of nuclear gene transcripts were likely acquired from its obligate host. Here, we used next-generation sequencing to obtain the 38 protein-coding and ribosomal RNA genes common to the mitochondrial genomes of angiosperms from R. cantleyi and five additional species, including two of its closest relatives and two host species. Strikingly, our phylogenetic analyses conservatively indicate that 24%-41% of these gene sequences show evidence of HGT in Rafflesiaceae, depending on the species. Most of these transgenic sequences possess intact reading frames and are actively transcribed, indicating that they are potentially functional. Additionally, some of these transgenes maintain synteny with their donor and recipient lineages, suggesting that native genes have likely been displaced via homologous recombination. Our study is the first to comprehensively assess the magnitude of HGT in plants involving a genome (i.e., mitochondria) and a species interaction (i.e., parasitism) where it has been hypothesized to be potentially rampant. Our results establish for the first time that, although the magnitude of HGT involving nuclear genes is appreciable in these parasitic plants, HGT involving mitochondrial genes is substantially higher. This may represent a more general pattern for other parasitic plant clades and perhaps more broadly for angiosperms.

  18. Complete mitochondrial genome of the Scorpaenopsis cirrhosa (Scorpaeniformes: Scorpaenidae).

    Science.gov (United States)

    Wu, Zhongjie; Wang, Daoru; Hu, Jing; Wang, Qian

    2016-09-01

    The complete mitochondrial genome of the Scorpaenopsis cirrhosa has been sequenced. The mitochondrial genome is 16 966 bp in length, containing 13 protein-coding genes, 2 ribosomal RNA genes, 22 transfer RNA genes, and 1 control region. The gene order and composition of S. cirrhosa mitochondrial genome was similar to that of most other vertebrates. The overall nucleotides base composition of the heavy strand is A (27.91%), G (17.71%), C (28.02%), and T (26.35%). With the exception of the NADH dehydrogenase subunit 6 (ND6) and eight tRNA genes, all other mitochondrial genes are encoded on the heavy strand. The tRNA-Ser2 gene lacked DHC arm and could not fold into a typical clover-leaf secondary structure. Seen from the phylogenetic tree, S. cirrhosa, a stonefish and four rockfishes from the same order (Scorpaeniformes) clustered into one branch.

  19. The complete mitochondrial genome of the Synanceia verrucosa (Scorpaeniformes: Synanceiidae).

    Science.gov (United States)

    Wang, Qian; Wang, Jun; Luo, Jian; Chen, Guohua

    2016-11-01

    The complete mitochondrial genome of the Synanceia verrucosa has been sequenced. The mitochondrial genome is 16,506 bp in length, containing 13 protein-coding genes, two ribosomal RNA genes, 22 transfer RNA genes, and one control region. The gene order and the composition of S. verrucosa mitochondrial genome were similar to that of most other vertebrates. The overall nucleotides base composition of the heavy strand is A (31.01%), G (15.06%), C (25.60%), and T (28.34%). With the exception of the NADH dehydrogenase subunit 6 (ND6) and eight tRNA genes, all other mitochondrial genes are encoded on the heavy strand. The tRNA-Ser2 gene lacked DHC arm and could not fold into a typical clover-leaf secondary structure. Seen from the phylogenetic tree, a stonefish (S. verrucosa), two lionfishes, and eight rockfishes from the same order (Scorpaeniformes) clustered into one branch.

  20. Clinical and ethical implications of mitochondrial gene transfer.

    Science.gov (United States)

    Mitalipov, Shoukhrat; Wolf, Don P

    2014-01-01

    Inherited diseases caused by mitochondrial gene (mtDNA) mutations affect at least 1 in 5000-10,000 children and are associated with severe clinical symptoms. Novel reproductive techniques designed to replace mutated mtDNA in oocytes or early embryos have been proposed to prevent transmission of disease from parents to their children. Here we review the efficacy and safety of these approaches and their associated ethical and regulatory issues.

  1. RARS2 Mutations: Is Pontocerebellar Hypoplasia Type 6 a Mitochondrial Encephalopathy?

    NARCIS (Netherlands)

    Dijk, T. van; Ruissen, F. van; Jaeger, B.; Rodenburg, R.J.T.; Tamminga, S.; Maarle, M. van; Baas, F.; Wolf, N.I.; Poll-The, B.T.

    2017-01-01

    Mutations in the mitochondrial arginyl tRNA synthetase (RARS2) gene are associated with Pontocerebellar Hypoplasia type 6 (PCH6). Here we report two patients, compound heterozygous for RARS2 mutations, presenting with early onset epileptic encephalopathy and (progressive) atrophy of both supra- and

  2. A fragment of chloroplast DNA was transferred horizontally, probably from non-eudicots, to mitochondrial genome of Phaseolus.

    Science.gov (United States)

    Woloszynska, Magdalena; Bocer, Tomasz; Mackiewicz, Pawel; Janska, Hanna

    2004-11-01

    The mitochondrial genomes of some Phaseolus species contain a fragment of chloroplast trnA gene intron, named pvs-trnA for its location within the Phaseolus vulgaris sterility sequence (pvs). The purpose of this study was to determine the type of transfer (intracellular or horizontal) that gave rise to pvs-trnA. Using a PCR approach we could not find the respective portion of the trnA gene as a part of pvs outside the Phaseolus genus. However, a BLAST search revealed longer fragments of trnA present in the mitochondrial genomes of some Citrus species, Helianthus annuus and Zea mays. Basing on the identity or near-identity between these mitochondrial sequences and their chloroplast counterparts we concluded that they had relocated from chloroplasts to mitochondria via recent, independent, intracellular DNA transfers. In contrast, pvs-trnA displayed a relatively higher sequence divergence when compared with its chloroplast counterpart from Phaseolus vulgaris. Alignment of pvs-trnA with corresponding trnA fragments from 35 plant species as well as phylogenetic analysis revealed that pvs-trnA grouped with non-eudicot sequences and was well separated from all Fabales sequences. In conclusion, we propose that pvs-trnA arose via horizontal transfer of a trnA intron fragment from chloroplast of a non-eudicot plant to Phaseolus mitochondria. This is the first example of horizontal transfer of a chloroplast sequence to the mitochondrial genome in higher plants.

  3. Mitochondrial genome of the African lion Panthera leo leo.

    Science.gov (United States)

    Ma, Yue-ping; Wang, Shuo

    2015-01-01

    In this study, the complete mitochondrial genome sequence of the African lion P. leo leo was reported. The total length of the mitogenome was 17,054 bp. It contained the typical mitochondrial structure, including 13 protein-coding genes, 22 transfer RNA genes, 2 ribosomal RNA genes and 1 control region; 21 of the tRNA genes folded into typical cloverleaf secondary structure except for tRNASe. The overall composition of the mitogenome was A (32.0%), G (14.5%), C (26.5%) and T (27.0%). The new sequence will provide molecular genetic information for conservation genetics study of this important large carnivore.

  4. Sequences and gene organization of the mitochondrial genomes of the liver flukes Opisthorchis viverrini and Clonorchis sinensis (Trematoda).

    Science.gov (United States)

    Cai, X Q; Liu, G H; Song, H Q; Wu, C Y; Zou, F C; Yan, H K; Yuan, Z G; Lin, R Q; Zhu, X Q

    2012-01-01

    Opisthorchis viverrini and Clonorchis sinensis are important trematodes infecting humans and animals, belonging to the family Opisthorchiidae. In the present study, we sequenced the nearly complete mitochondrial (mt) DNA (mtDNA) sequences of O. viverrini from Laos, obtained the complete mtDNA sequences of C. sinensis from China and Korea, and revealed their gene annotations and genome organizations. The mtDNA sequences of O. viverrini, C. sinensis (China isolate), C. sinensis (Korea isolate) were 13,510, 13,879, and 13,877 bp in size, respectively. Each of the three mt genomes comprises 36 genes, consisting of 12 genes coding for proteins, two genes for rRNA, and 20 genes (O. viverrini) or 22 genes (C. sinensis) for tRNA. The gene content and arrangement are identical to that of Fasciola hepatica, and Paragonimus westermani, but distinct from Schistosoma spp. All genes are transcribed in the same direction and have a nucleotide composition high in T. The contents of A + T of the mt genomes were 59.39% for O. viverrini, 60.03% for C. sinensis (China isolate), and 59.99% for C. sinensis (Korea isolate). Phylogenetic analyses using concatenated amino acid sequences of the 12 protein-coding genes, with three different computational algorithms [maximum parsimony, maximum likelihood, and Bayesian analysis], all revealed distinct groups with high statistical support, indicating that O. viverrini and C. sinensis represent sister taxa. These data provide additional novel mtDNA markers for studying the molecular epidemiology and population genetics of the two liver flukes and should have implications for the molecular diagnosis, prevention, and control of opisthorchiasis and clonorchiasis in humans and animals.

  5. Mitochondrial genome sequence and expression profiling for the legume pod borer Maruca vitrata (Lepidoptera: Crambidae.

    Directory of Open Access Journals (Sweden)

    Venu M Margam

    Full Text Available We report the assembly of the 14,054 bp near complete sequencing of the mitochondrial genome of the legume pod borer (LPB, Maruca vitrata (Lepidoptera: Crambidae, which we subsequently used to estimate divergence and relationships within the lepidopteran lineage. The arrangement and orientation of the 13 protein-coding, 2 rRNA, and 19 tRNA genes sequenced was typical of insect mitochondrial DNA sequences described to date. The sequence contained a high A+T content of 80.1% and a bias for the use of codons with A or T nucleotides in the 3rd position. Transcript mapping with midgut and salivary gland ESTs for mitochondrial genome annotation showed that translation from protein-coding genes initiates and terminates at standard mitochondrial codons, except for the coxI gene, which may start from an arginine CGA codon. The genomic copy of coxII terminates at a T nucleotide, and a proposed polyadenylation mechanism for completion of the TAA stop codon was confirmed by comparisons to EST data. EST contig data further showed that mature M. vitrata mitochondrial transcripts are monocistronic, except for bicistronic transcripts for overlapping genes nd4/nd4L and nd6/cytb, and a tricistronic transcript for atp8/atp6/coxIII. This processing of polycistronic mitochondrial transcripts adheres to the tRNA punctuated cleavage mechanism, whereby mature transcripts are cleaved only at intervening tRNA gene sequences. In contrast, the tricistronic atp8/atp6/coxIII in Drosophila is present as separate atp8/atp6 and coxIII transcripts despite the lack of an intervening tRNA. Our results indicate that mitochondrial processing mechanisms vary between arthropod species, and that it is crucial to use transcriptional information to obtain full annotation of mitochondrial genomes.

  6. LHON/MELAS overlap syndrome associated with a mitochondrial MTND1 gene mutation.

    Science.gov (United States)

    Blakely, Emma L; de Silva, Rajith; King, Andrew; Schwarzer, Verena; Harrower, Tim; Dawidek, Gervase; Turnbull, Douglass M; Taylor, Robert W

    2005-05-01

    Pathogenic point mutations in the mitochondrial MTND1 gene have previously been described in association with two distinct clinical phenotypes -- Leber hereditary optic neuropathy (LHON) and mitochondrial myopathy, encephalopathy, lactic acidosis and stroke-like episodes (MELAS). Here we report the first heteroplasmic mitochondrial DNA (mtDNA) point mutation (3376G>A) in the MTND1 gene associated with an overlap syndrome comprising the clinical features of both LHON and MELAS. Muscle histochemistry revealed subtle mitochondrial abnormalities, while biochemical analysis showed an isolated complex I deficiency. Our findings serve to highlight the growing importance of mutations in mitochondrial complex I structural genes in MELAS and its associated overlap syndromes.

  7. The Armc10/SVH gene: genome context, regulation of mitochondrial dynamics and protection against Aβ-induced mitochondrial fragmentation

    Science.gov (United States)

    Serrat, R; Mirra, S; Figueiro-Silva, J; Navas-Pérez, E; Quevedo, M; López-Doménech, G; Podlesniy, P; Ulloa, F; Garcia-Fernàndez, J; Trullas, R; Soriano, E

    2014-01-01

    Mitochondrial function and dynamics are essential for neurotransmission, neural function and neuronal viability. Recently, we showed that the eutherian-specific Armcx gene cluster (Armcx1–6 genes), located in the X chromosome, encodes for a new family of proteins that localise to mitochondria, regulating mitochondrial trafficking. The Armcx gene cluster evolved by retrotransposition of the Armc10 gene mRNA, which is present in all vertebrates and is considered to be the ancestor gene. Here we investigate the genomic organisation, mitochondrial functions and putative neuroprotective role of the Armc10 ancestor gene. The genomic context of the Armc10 locus shows considerable syntenic conservation among vertebrates, and sequence comparisons and CHIP-data suggest the presence of at least three conserved enhancers. We also show that the Armc10 protein localises to mitochondria and that it is highly expressed in the brain. Furthermore, we show that Armc10 levels regulate mitochondrial trafficking in neurons, but not mitochondrial aggregation, by controlling the number of moving mitochondria. We further demonstrate that the Armc10 protein interacts with the KIF5/Miro1-2/Trak2 trafficking complex. Finally, we show that overexpression of Armc10 in neurons prevents Aβ-induced mitochondrial fission and neuronal death. Our data suggest both conserved and differential roles of the Armc10/Armcx gene family in regulating mitochondrial dynamics in neurons, and underscore a protective effect of the Armc10 gene against Aβ-induced toxicity. Overall, our findings support a further degree of regulation of mitochondrial dynamics in the brain of more evolved mammals. PMID:24722288

  8. RNase MRP cleaves pre-tRNASer-Met in the tRNA maturation pathway.

    Science.gov (United States)

    Saito, Yuichiro; Takeda, Jun; Adachi, Kousuke; Nobe, Yuko; Kobayashi, Junya; Hirota, Kouji; Oliveira, Douglas V; Taoka, Masato; Isobe, Toshiaki

    2014-01-01

    Ribonuclease mitochondrial RNA processing (RNase MRP) is a multifunctional ribonucleoprotein (RNP) complex that is involved in the maturation of various types of RNA including ribosomal RNA. RNase MRP consists of a potential catalytic RNA and several protein components, all of which are required for cell viability. We show here that the temperature-sensitive mutant of rmp1, the gene for a unique protein component of RNase MRP, accumulates the dimeric tRNA precursor, pre-tRNA(Ser-Met). To examine whether RNase MRP mediates tRNA maturation, we purified the RNase MRP holoenzyme from the fission yeast Schizosaccharomyces pombe and found that the enzyme directly and selectively cleaves pre-tRNA(Ser-Met), suggesting that RNase MRP participates in the maturation of specific tRNA in vivo. In addition, mass spectrometry-based ribonucleoproteomic analysis demonstrated that this RNase MRP consists of one RNA molecule and 11 protein components, including a previously unknown component Rpl701. Notably, limited nucleolysis of RNase MRP generated an active catalytic core consisting of partial mrp1 RNA fragments, which constitute "Domain 1" in the secondary structure of RNase MRP, and 8 proteins. Thus, the present study provides new insight into the structure and function of RNase MRP.

  9. The complete mitochondrial genome of the clam Mactra veneriformis (Bivalvia: Mactridae): has a unique non-coding region, missing atp8 and typical tRNA Ser.

    Science.gov (United States)

    Meng, Xueping; Shen, Xin; Zhao, Nana; Tian, Mei; Liang, Meng; Hao, Jue; Cheng, Hanliang; Yan, Binlun; Dong, Zhiguo; Zhu, Xiaoling

    2013-12-01

    Mactra veneriformis (Bivalvia: Mactridae) is one commonly cultured bivalve species in the western Pacific Ocean. In the current study, the complete mitrochondrial DNA (mtDNA) of the clam M. veneriformis was determined. The M. veneriformis mt genome is 16,854 bp in length and encodes 34 genes on the same strand, including 12 protein-coding genes (PCGs), 2 ribosomal RNA genes and 20 transfer RNA genes. The length of 12 PCGs is 11,358 bp, which accounts for 67.4% in whole mt genome. The proportion is similar to other clams' mt genomes and within those of bivalves mt genomes. Gene order (which is the same as that of RZ C. antiquata) of M. veneriformis mt genome is compared with that of other veneroids. Compared with the typical gene content of animal mt genomes, atp8 and two tRNA(Ser) genes are missing in the mt genome. All non-coding regions are 1978 bp in length, among them the longest one is speculated as the control region, which is located between the tRNA(His) and tRNA(Arg). The secondary largest non-coding region (NCR(664)) between the tRNA(Gln) and tRNA(Thr) in the M. veneriformis mt genome contains one section of tandem repeats (125 nt × 5.2 or 249 nt × 2.6). The tandem repeats account for 97.89% (650/664) of the NCR(664), which is a unique characteristic of the M. veneriformis mt non-coding regions compared with those of other veneroids.

  10. Decrypting the mitochondrial gene pool of modern Panamanians.

    Science.gov (United States)

    Perego, Ugo A; Lancioni, Hovirag; Tribaldos, Maribel; Angerhofer, Norman; Ekins, Jayne E; Olivieri, Anna; Woodward, Scott R; Pascale, Juan Miguel; Cooke, Richard; Motta, Jorge; Achilli, Alessandro

    2012-01-01

    The Isthmus of Panama--the narrow neck of land connecting the northern and southern American landmasses--was an obligatory corridor for the Paleo-Indians as they moved into South America. Archaeological evidence suggests an unbroken link between modern natives and their Paleo-Indian ancestors in some areas of Panama, even if the surviving indigenous groups account for only 12.3% of the total population. To evaluate if modern Panamanians have retained a larger fraction of the native pre-Columbian gene pool in their maternally-inherited mitochondrial genome, DNA samples and historical records were collected from more than 1500 volunteer participants living in the nine provinces and four indigenous territories of the Republic. Due to recent gene-flow, we detected ~14% African mitochondrial lineages, confirming the demographic impact of the Atlantic slave trade and subsequent African immigration into Panama from Caribbean islands, and a small European (~2%) component, indicating only a minor influence of colonialism on the maternal side. The majority (~83%) of Panamanian mtDNAs clustered into native pan-American lineages, mostly represented by haplogroup A2 (51%). These findings reveal an overwhelming native maternal legacy in today's Panama, which is in contrast with the overall concept of personal identity shared by many Panamanians. Moreover, the A2 sub-clades A2ad and A2af (with the previously named 6 bp Huetar deletion), when analyzed at the maximum level of resolution (26 entire mitochondrial genomes), confirm the major role of the Pacific coastal path in the peopling of North, Central and South America, and testify to the antiquity of native mitochondrial genomes in Panama.

  11. Decrypting the mitochondrial gene pool of modern Panamanians.

    Directory of Open Access Journals (Sweden)

    Ugo A Perego

    Full Text Available The Isthmus of Panama--the narrow neck of land connecting the northern and southern American landmasses--was an obligatory corridor for the Paleo-Indians as they moved into South America. Archaeological evidence suggests an unbroken link between modern natives and their Paleo-Indian ancestors in some areas of Panama, even if the surviving indigenous groups account for only 12.3% of the total population. To evaluate if modern Panamanians have retained a larger fraction of the native pre-Columbian gene pool in their maternally-inherited mitochondrial genome, DNA samples and historical records were collected from more than 1500 volunteer participants living in the nine provinces and four indigenous territories of the Republic. Due to recent gene-flow, we detected ~14% African mitochondrial lineages, confirming the demographic impact of the Atlantic slave trade and subsequent African immigration into Panama from Caribbean islands, and a small European (~2% component, indicating only a minor influence of colonialism on the maternal side. The majority (~83% of Panamanian mtDNAs clustered into native pan-American lineages, mostly represented by haplogroup A2 (51%. These findings reveal an overwhelming native maternal legacy in today's Panama, which is in contrast with the overall concept of personal identity shared by many Panamanians. Moreover, the A2 sub-clades A2ad and A2af (with the previously named 6 bp Huetar deletion, when analyzed at the maximum level of resolution (26 entire mitochondrial genomes, confirm the major role of the Pacific coastal path in the peopling of North, Central and South America, and testify to the antiquity of native mitochondrial genomes in Panama.

  12. Complete Mitochondrial Genome of Eruca sativa Mill. (Garden Rocket)

    OpenAIRE

    Yankun Wang; Pu Chu; Qing Yang; Shengxin Chang; Jianmei Chen; Maolong Hu; Rongzhan Guan

    2014-01-01

    Eruca sativa (Cruciferae family) is an ancient crop of great economic and agronomic importance. Here, the complete mitochondrial genome of Eruca sativa was sequenced and annotated. The circular molecule is 247,696 bp long, with a G+C content of 45.07%, containing 33 protein-coding genes, three rRNA genes, and 18 tRNA genes. The Eruca sativa mitochondrial genome may be divided into six master circles and four subgenomic molecules via three pairwise large repeats, resulting in a more dynamic st...

  13. An 18.3 kb DNA fragment from yeast chromosome VII carries four unknown open reading frames, the gene for an Asn synthase, remnants of Ty and three tRNA genes.

    Science.gov (United States)

    Van Dyck, L; Tettelin, H; Purnelle, B; Goffeau, A

    1997-02-01

    An 18.3 kb DNA segment from yeast Saccharomyces cerevisiae VII encompasses the previously characterized MEP1, NUP57 and PPT1 genes as well as seven new open reading frames (ORFs) of at least 100 residues. G6358 is an ubiquitous glutamine-dependent asparagine synthase. G6362 is membrane protein highly homologous to a protein of unknown function in the yeast Schizosaccharomyces pombe. Three ORFs (G6324, G6335 and G6365) have no significant homology with previously reported proteins of characteristic motifs. G6321 and G6359, enclosed in longer ORFs, are not likely to be coding. The segment also contains tRNA genes for Asn, Arg and Ile as well as sigma element and two solo deltas. ORFs and genetic elements are named according to a preliminary working nomenclature.

  14. Recombinant Mitochondrial Transcription Factor A with N-terminal Mitochondrial Transduction Domain Increases Respiration and Mitochondrial Gene Expression

    OpenAIRE

    Iyer, Shilpa; Thomas, Ravindar R.; Portell, Francisco R.; Dunham, Lisa D.; Quigley, Caitlin K.; Bennett, James P

    2009-01-01

    We developed a scalable procedure to produce human mitochondrial transcription factor A (TFAM) modified with an N-terminal protein transduction domain (PTD) and mitochondrial localization signal (MLS) that allow it to cross membranes and enter mitochondria through its “mitochondrial transduction domain” (MTD=PTD+MLS). Alexa488-labeled MTD-TFAM rapidly entered the mitochondrial compartment of cybrid cells carrying the G11778A LHON mutation. MTD-TFAM reversibly increased respiration and levels ...

  15. Disorders of phospholipid metabolism: an emerging class of mitochondrial disease due to defects in nuclear genes

    Directory of Open Access Journals (Sweden)

    Ya-Wen eLu

    2015-02-01

    Full Text Available The human nuclear and mitochondrial genomes co-exist within each cell. While the mitochondrial genome encodes for a limited number of proteins, transfer RNAs, and ribosomal RNAs, the vast majority of mitochondrial proteins are encoded in the nuclear genome. Of the multitude of mitochondrial disorders known to date, only a fifth are maternally inherited. The recent characterization of the mitochondrial proteome therefore serves as an important step towards delineating the nosology of a large spectrum of phenotypically heterogeneous diseases. Following the identification of the first nuclear gene defect to underlie a mitochondrial disorder, a plenitude of genetic variants that provoke mitochondrial pathophysiology have been molecularly elucidated and classified into six categories that impact: 1 oxidative phosphorylation (subunits and assembly factors; 2 mitochondrial DNA maintenance and expression; 3 mitochondrial protein import and assembly; 4 mitochondrial quality control (chaperones and proteases; 5 iron-sulfur cluster homeostasis; and 6 mitochondrial dynamics (fission and fusion. Here, we propose that an additional class of genetic variant be included in the classification schema to acknowledge the role of genetic defects in phospholipid biosynthesis, remodeling, and metabolism in mitochondrial pathophysiology. This seventh class includes a small but notable group of nuclear-encoded proteins whose dysfunction impacts normal mitochondrial phospholipid metabolism. The resulting human disorders present with a diverse array of pathologic consequences that reflect the variety of functions that phospholipids have in mitochondria and highlight the important role of proper membrane homeostasis in mitochondrial biology.

  16. Mitochondrial transcription factor A (Tfam) gene sequencing and mitochondrial evaluation in inherited retinal dysplasia in miniature schnauzer dogs

    OpenAIRE

    Bauer, Bianca S.; Forsyth, George W.; Sandmeyer, Lynne S.; Grahn, Bruce H.

    2011-01-01

    Mitochondrial transcription factor A (Tfam) has been implicated in the pathogenesis of retinal dysplasia in miniature schnauzer dogs and it has been proposed that affected dogs have altered mitochondrial numbers, size, and morphology. To test these hypotheses the Tfam gene of affected and normal miniature schnauzer dogs with retinal dysplasia was sequenced and lymphocyte mitochondria were quantified, measured, and the morphology was compared in normal and affected dogs using transmission elec...

  17. Complete mitochondrial DNA sequence of the endangered Tarim schizothoracin (Schizothorax biddulphi Günther).

    Science.gov (United States)

    Gong, Xiao Ling; Cui, Zhong Kai; Zhang, Xiao Yi; Wang, Cheng Hui

    2012-10-01

    Tarim schizothoracin (Schizothorax biddulphi Günther) is an extremely endangered freshwater fish that thrives only in the Tarim River drainage in China. In this paper, we initially determined the complete mitochondrial genome of schizothoracin fishes. The mitochondrial genome of S. biddulphi was 16,585 bp long, which is similar to most vertebrates. It contains the same gene order and a similar number of gene or region including 13 protein-coding genes, 2 rRNA genes, 22 tRNA genes, and 1 putative control region.

  18. Effects of hydrogen peroxide on mitochondrial gene expression of intestinal epithelial cells

    Institute of Scientific and Technical Information of China (English)

    Jian-Ming Li; Qian Cai; Hong Zhou; Guang-Xia Xiao

    2002-01-01

    AIM: To study the effects of hydrogen peroxide on mitochondrial gene expression of intestinal epithelial cells in in vitro model of hydrogen peroxide-stimulated SW-480 cells.METHODS: RNA of hydrogen peroxide-induced SW-480 cells was isolated, and reverse-transcriptional polymerase chain reaction was performed to study gene expression of ATPase subunit 6, ATPase subunit 8, cytochrome c oxidase subunit Ⅰ (COⅠ), cytochrome coxidase subuit Ⅱ (COⅡ) and cytochrome c oxidase subunit Ⅲ (COⅢ). Mitochondria were isolated and activities of mitochondrial cytochrome c oxidase and ATPase were also measured simultaneously.RESULTS: Hydrogen peroxide led to differential expression of mitochondrial genes with some genes up-regulated or down-regulated in a dose dependent manner. Differences were very obvious in expressions of mitochondrial genes of cells treated with hydrogen peroxide in a concentration of 400 μmol/L or 4 mmol/L. In general, differential expression of mitochondrial genes was characterized by up-regulation of mitochondrial genes in the concentration of 400 μmol/L and down-regulation in the concentration of 4 mmol/L. In consistence with changes in mitochondrial gene expressions, hydrogen peroxide resulted in decreased activities of cytochrome c oxidase and ATPase.CONCLUSIONS: The differential expression of mitochondrial genes encoding cytochrome c oxidase and ATPase is involved in apoptosis of intestinal epithelial cells by affecting activities of cytochorme c oxidase and ATPase.

  19. Mitochondrial gene order change in Schistosoma (Platyhelminthes: Digenea: Schistosomatidae).

    Science.gov (United States)

    Webster, Bonnie L; Littlewood, D Timothy J

    2012-01-01

    In the flatworm genus Schistosoma, species of which include parasites of biomedical and veterinary importance, mitochondrial gene order is radically different in some species. A PCR-based survey of 19 schistosomatid spp. established which of 14 Schistosoma spp. have the ancestral (plesiomorphic) or derived gene order condition. A phylogeny for Schistosoma was estimated and used to infer the origin of the gene order change which is present in all members of a clade containing Schistosoma incognitum and members of the traditionally recognised Schistosoma indicum, Schistosoma mansoni and Schistosomahaematobium spp. groups. Schistosoma turkestanicum, with the plesiomorphic gene order state, is sister to this clade. Common interval analysis suggests change in gene order, from ancestral to derived, consisted of two sequential transposition events: (a) nad1_nad3 to nad3_nad1 and (b) [atp6,nad2]_[nad3,-nad1,cox1,rrnL,rrnS,cox2,nad6] to [nad3,nad1,cox1,rrnL,rrnS,cox2,nad6]_[atp6,nad2], where gene order offragments within square brackets remain unchanged. Gene order change is rare in parasitic flatworms and is a robust synapomorphy for schistosome spp. that exhibit it. The schistosomatid phylogeny casts some doubt on the origin of Schistosoma (Asian or African), highlights the propensity for species to hosts witch amongst mammalian (definitive) hosts, and indicates the likely importance of snail (intermediate)hosts in determining and defining patterns of schistosome radiation and continental invasion. Mitogenomic sampling of Schistosoma dattai and Schistosoma harinasutai to determine gene order, and within key species, especially S. turkestanicum and S. incognitum, to determine ancestral ranges, may help discover the geographic origins of gene order change in the genus. Samples of S. incognitum from India and Thailand suggest this taxon may include cryptic species. Crown Copyright 2012 Published by Elsevier Ltd. on behalf of Australian Society for Parasitology Inc. Allrights

  20. Unusual features of control region and a novel NADH 6 genes in mitochondrial genome of the finespot goby, Chaeturichthys stigmatias (Perciformes, Gobiidae).

    Science.gov (United States)

    Sun, Yuena; Wei, Tao; Jin, Xiaoxiao

    2015-01-01

    In this article, we determined the complete mitogenome of finespot goby Chaeturichthys stigmatias with emphasis on the arranged gene order and gene feature with published Gobiidae species. The C. stigmatias mtDNA was 18,562 bp in length (56.94% AT), and comprised 37 genes (13 protein genes, 2 rRNAs and 22 tRNAs) that was typical for mitochondrial genome of Gobiidae species. Unusually, the NADH 6 gene was very large in length compared with other Gobiidae species. Mitogenome of C. stigmatias had a long putative control region with high AT content (71.28%). Within this sequence, we determined repeat regions, the termination-associated sequence and the conserved sequence block for this region. The origin of L-strand replication in C. stigmatias was located in a cluster of five tRNA genes (WANCY). The conserved motif (5'-GCCGG-3') was also determined at the base of the stem in the tRNA-Cys gene. This study will provide a better understanding of Gobiidae mitogenomes and offer useful information for future studies concerning Gobiidae mitogenome evolution.

  1. Sequence Diversity in tRNA Gene Locus A-L among Iranian Isolates of Entamoeba Dispar

    Directory of Open Access Journals (Sweden)

    M Rostami-Nejad

    2012-02-01

    Full Text Available Background: A number of methods for detecting diversity in Entamoeba have been described over the years. In the present study the genetic polymorphism of noncoding locus A-L was ana­lyzed using PCR and sequencing in order to clarify the genotypic differences among E. dispar isolates.Methods: A total of 28 E. dispar from patients with gastrointestinal symptoms were determined and the genomic DNA was extracted directly from stool. For genotype analysis; Locus A-L was amplified by PCR and PCR products were sequenced .The sequences obtained were edited ma­nually and aligned using Gene Runner software.Results: With sequencing of PCR products a reliable genetic diversity in size, number and posi­tion of the repeat units were observed among the Iranian E. dispar isolates in locus A-L gene. Se­quences showed variation in length from 448bp to 507bp and seven distinct types were identified.Conclusion: The genetic diversity of loci like A-L shows them to be suitable for epidemiological studies such as the characterization of the routes of transmission of these parasites in Iran.

  2. Characteristics of the mitochondrial genome of four native goats in China (Capra hircus).

    Science.gov (United States)

    E, Guang-Xin; Huang, Yong-Fu; Liu, Nan; Zhao, Yong-Ju; He, Jian-Ning; Na, Ri-Su; Zhao, Zhong-Quan; Jiang, Cao-De; Zhang, Jia-Hua; Ma, Yue-Hui; Chen, Li-Peng; Qiu, Xiao-Yu; Sun, Ya-Wang; Zeng, Yan; Sun, Yuan-Zhi; Yu, Chang-Hui; Wei, Shu-Ya

    2016-09-01

    Here, we describe the complete mitochondrial genome sequences of Jining Gray goat, Fushun black goat, Youzhou black-skin goat, and Hechuan white goat. The mitogenome of those four goats consisted of 16,640 nt, consisting of 13 protein-coding genes, 22 transfer RNA (tRNA) genes, 2 ribosomal RNA (rRNA) genes and a control region. As in other mammals, most mitochondrial genes are encoded on the heavy strand, except for ND6 and eight tRNA genes, which are encoded on the light strand. The complete mitogenome of these four local breeds of Chinese native goats could provide an important data to further breed improvement and animal genetics resource conservation in China.

  3. Fragmentary 5S rRNA gene in the human mitochondrial genome

    Energy Technology Data Exchange (ETDEWEB)

    Nierlich, D.P.

    1982-02-01

    The human mitochondrial genoma contains a 23-nucleodtide sequence that is homologous to a part of the 5S rRNA's of bacteria. This homology, the structure of the likely transcript, and the location of the sequence relative to the mitochondrial rRNA genes suggest that the sequence represents a fragmentary 5S rRNA gene.

  4. Base-pairing versatility determines wobble sites in tRNA anticodons of vertebrate mitogenomes.

    Directory of Open Access Journals (Sweden)

    Miguel M Fonseca

    Full Text Available BACKGROUND: Vertebrate mitochondrial genomes typically have one transfer RNA (tRNA for each synonymous codon family. This limited anticodon repertoire implies that each tRNA anticodon needs to wobble (establish a non-Watson-Crick base pairing between two nucleotides in RNA molecules to recognize one or more synonymous codons. Different hypotheses have been proposed to explain the factors that determine the nucleotide composition of wobble sites in vertebrate mitochondrial tRNA anticodons. Until now, the two major postulates--the "codon-anticodon adaptation hypothesis" and the "wobble versatility hypothesis"--have not been formally tested in vertebrate mitochondria because both make the same predictions regarding the composition of anticodon wobble sites. The same is true for the more recent "wobble cost hypothesis". PRINCIPAL FINDINGS: In this study we have analyzed the occurrence of synonymous codons and tRNA anticodon wobble sites in 1553 complete vertebrate mitochondrial genomes, focusing on three fish species with mtDNA codon usage bias reversal (L-strand is GT-rich. These mitogenomes constitute an excellent opportunity to study the evolution of the wobble nucleotide composition of tRNA anticodons because due to the reversal the predictions for the anticodon wobble sites differ between the existing hypotheses. We observed that none of the wobble sites of tRNA anticodons in these unusual mitochondrial genomes coevolved to match the new overall codon usage bias, suggesting that nucleotides at the wobble sites of tRNA anticodons in vertebrate mitochondrial genomes are determined by wobble versatility. CONCLUSIONS/SIGNIFICANCE: Our results suggest that, at wobble sites of tRNA anticodons in vertebrate mitogenomes, selection favors the most versatile nucleotide in terms of wobble base-pairing stability and that wobble site composition is not influenced by codon usage. These results are in agreement with the "wobble versatility hypothesis".

  5. Organization of Mitochondrial Gene Expression in Two Distinct Ribosome-Containing Assemblies

    Directory of Open Access Journals (Sweden)

    Kirsten Kehrein

    2015-02-01

    Full Text Available Mitochondria contain their own genetic system that provides subunits of the complexes driving oxidative phosphorylation. A quarter of the mitochondrial proteome participates in gene expression, but how all these factors are orchestrated and spatially organized is currently unknown. Here, we established a method to purify and analyze native and intact complexes of mitochondrial ribosomes. Quantitative mass spectrometry revealed extensive interactions of ribosomes with factors involved in all the steps of posttranscriptional gene expression. These interactions result in large expressosome-like assemblies that we termed mitochondrial organization of gene expression (MIOREX complexes. Superresolution microscopy revealed that most MIOREX complexes are evenly distributed throughout the mitochondrial network, whereas a subset is present as nucleoid-MIOREX complexes that unite the whole spectrum of organellar gene expression. Our work therefore provides a conceptual framework for the spatial organization of mitochondrial protein synthesis that likely developed to facilitate gene expression in the organelle.

  6. Mitochondrial bioenergetics and redox state are unaltered in Trypanosoma cruzi isolates with compromised mitochondrial complex I subunit genes.

    Science.gov (United States)

    Carranza, Julio César; Kowaltowski, Alicia J; Mendonça, Marco Aurélio G; de Oliveira, Thays C; Gadelha, Fernanda R; Zingales, Bianca

    2009-06-01

    In trypanosomatids the involvement of mitochondrial complex I in NADH oxidation has long been debated. Here, we took advantage of natural Trypanosoma cruzi mutants which present conspicuous deletions in ND4, ND5 and ND7 genes coding for complex I subunits to further investigate its functionality. Mitochondrial bioenergetics of wild type and complex I mutants showed no significant differences in oxygen consumption or respiratory control ratios in the presence of NADH-linked substrates or FADH(2)-generating succinate. No correlation could be established between mitochondrial membrane potentials and ND deletions. Since release of reactive oxygen species occurs at complex I, we measured mitochondrial H(2)O(2) formation induced by different substrates. Significant differences not associated to ND deletions were observed among the parasite isolates, demonstrating that these mutations are not important for the control of oxidant production. Our data support the notion that complex I has a limited function in T. cruzi.

  7. Mitochondrial encephalopathy with lactic acidosis and stroke-like ...

    African Journals Online (AJOL)

    Laila Selim

    2013-04-12

    Apr 12, 2013 ... This disease has mainly been associated to the mitochondrial .... are the tRNA Leucine (Leu), tRNA –Lysine (Lys) and tRNA-. Isoleucine (Ile) . .... malities of infarct-like lesions that are not confined to the ma- jor vascular ...

  8. The complete sequence of mitochondrial genome of Laiwu Black pig (Sus Scrofa).

    Science.gov (United States)

    Yang, Hu; Xu, Xing-Li; Ma, Hai-Ming

    2016-01-01

    In the present study, the ear tissue of an adult Laiwu Black pig is from the Shandong province of China. The complete mitochondrial genome of Laiwu Black pig was determined by polymerase chain reaction (PCR). The complete mitochondrial genome is 16,710 bp, and it contains 13 protein-coding genes, 2 rRNA genes, 22 tRNA genes, a control region (D-loop), with the genome organization and gene order being identical to that of the typical vertebrates.

  9. The complete mitochondrial genome of cultivated radish WK10039 (Raphanus sativus L.).

    Science.gov (United States)

    Jeong, Young-Min; Chung, Won-Hyung; Choi, Ah Young; Mun, Jeong-Hwan; Kim, Namshin; Yu, Hee-Ju

    2016-01-01

    We determined the complete nucleotide sequence of the mitochondrial genome of radish cultivar WK10039 (Raphanus sativus L.). The total length of the mtDNA sequence is 244,054 bp, with GC content of 45.3%. The radish mtDNA contains 82 protein-coding genes, 17 tRNA genes, and 3 rRNA genes. Among the protein-coding genes, 34 encode proteins with known functions. There are two 5529 bp repeats in the radish mitochondrial genome that may contribute to DNA recombination resulting in at least three different forms of mtDNA in radish.

  10. Complete mitochondrial genome of the Walking goby Scartelaos histophorus (Perceformes, Gobiidae).

    Science.gov (United States)

    Quan, Xianqing; Jin, Xiaoxiao; Wang, Rixin; Xu, Tianjun; Shi, Ge

    2012-08-01

    The Walking goby Scartelaos histophorus (Perciformes, Gobiidae) is an amphibious gobioid fish. In this paper, the complete mitochondrial genome of S. histophorus was first determined. The genome is 16,496 bp in length and consists of 13 protein-coding genes, 22 tRNA genes, 2 ribosomal RNA genes, and 1 control region. The overall base composition of S. histophorus is 27.5% for T, 28.0% for C, 28.3% for A, and 16.1% for G, with a slight A+T bias of 55.8%. It has the typical vertebrate mitochondrial gene arrangement.

  11. The complete mitochondrial genome of the Asian particolored bat Vespertilio sinensis (Chiroptera: Vespertilionidae) in Korea.

    Science.gov (United States)

    Yoon, Kwang Bae; Lee, Jin Hong; Cho, Jae Youl; Park, Yung Chul

    2016-01-01

    The complete nucleotide sequence of the mitochondrial genome of the Asian particolored bat, Vespertilio sinensis, was determined. The genome organization, gene contents, and codon usage conformed to those of other bat mitochondrial genomes. The total length of the mitogenome of Vespertilio sinensis is 16,971 bp with a total base composition of 32.6% A, 29.6% T, 23.7% C and 14.0% G. The mitogenome consists of 13 protein-coding genes, 2 rRNA (12S and 16S RNA) genes, 22 tRNA genes and 1 control region.

  12. Limited clinical relevance of mitochondrial DNA mutation and gene expression analyses in ovarian cancer

    Directory of Open Access Journals (Sweden)

    Rachinger Andrea

    2008-10-01

    Full Text Available Abstract Background In recent years, numerous studies have investigated somatic mutations in mitochondrial DNA in various tumours. The observed high mutation rates might reflect mitochondrial deregulation; consequently, mutation analyses could be clinically relevant. The purpose of this study was to determine if mutations in the mitochondrial D-loop region and/or the level of mitochondrial gene expression could influence the clinical course of human ovarian carcinomas. Methods We sequenced a 1320-base-pair DNA fragment of the mitochondrial genome (position 16,000-750 in 54 cancer samples and in 44 corresponding germline control samples. In addition, six transcripts (MT-ATP6, MT-CO1, MT-CYB, MT-ND1, MT-ND6, and MT-RNR1 were quantified in 62 cancer tissues by real-time RT-PCR. Results Somatic mutations in the D-loop sequence were found in 57% of ovarian cancers. Univariate analysis showed no association between mitochondrial DNA mutation status or mitochondrial gene expression and any of the examined clinicopathologic parameters. A multivariate logistic regression model revealed that the expression of the mitochondrial gene RNR1 might be used as a predictor of tumour sensitivity to chemotherapy. Conclusion In contrast to many previously published papers, our study indicates rather limited clinical relevance of mitochondrial molecular analyses in ovarian carcinomas. These discrepancies in the clinical utility of mitochondrial molecular tests in ovarian cancer require additional large, well-designed validation studies.

  13. Sequencing and alignment of mitochondrial genomes of Tibetan chicken and two lowland chicken breeds

    Institute of Scientific and Technical Information of China (English)

    2008-01-01

    Tibetan chicken lives in high-altitude area and has adapted well to hypoxia genetically. Shouguang chicken and Silky chicken are both lowland chicken breeds. In the present study, the complete mito-chondrial genome sequences of the three chicken breeds were all sequenced. The results showed that the mitochondrial DNAs (mtDNAs) of Shouguang chicken and Silky chicken consist of 16784 bp and 16785 bp respectively, and Tibetan chicken mitochondrial genome varies from 16784 bp to 16786 bp. After sequence analysis, 120 mutations, including 4 single nucleotide polymorphisms (SNPs) in tRNA genes, 9 SNPs and 1 insertion in rRNA genes, 38 SNPs and 1 deletion in D-LOOP, 66 SNPs in pro-tein-coding genes, were found. This work will provide clues for the future study on the association between mitochondrial genes and the adaptation to hypoxia.Tibetan chicken, lowland chicken, mitochondrial genome, hypoxia.

  14. The complete mitochondrial genome of the acid-tolerant fungus Penicillium ShG4C

    Directory of Open Access Journals (Sweden)

    Andrey V. Mardanov

    2016-12-01

    Full Text Available Complete mitochondrial genome of the acid-tolerant fungus Penicillium ShG4C, isolated from oxidized sediments of an abandoned polymetallic mine site, has been sequenced using high-throughput sequencing approach. The mitochondrial genome represents a circular DNA molecule with size of 26,725 bp. It encodes a usual set of mitochondrial genes, including 15 protein coding genes, large and small ribosomal RNAs and 27 tRNA genes. All genes are located on H-strand DNA and transcribed in one direction. Taxonomic analysis based on concatenated sequences of mitochondrial proteins confirmed taxonomic position of this fungus within the genus Penicillium. The sequence of the complete mitochondrial genome of Penicillium ShG4C was deposited in DBBJ/EMBL/GenBank under accession number KX931017.

  15. Genes of the mitochondrial apoptotic pathway in Mytilus galloprovincialis.

    Directory of Open Access Journals (Sweden)

    Noelia Estévez-Calvar

    Full Text Available Bivalves play vital roles in marine, brackish, freshwater and terrestrial habitats. In recent years, these ecosystems have become affected through anthropogenic activities. The ecological success of marine bivalves is based on the ability to modify their physiological functions in response to environmental changes. One of the most important mechanisms involved in adaptive responses to environmental and biological stresses is apoptosis, which has been scarcely studied in mollusks, although the final consequence of this process, DNA fragmentation, has been frequently used for pollution monitoring. Environmental stressors induce apoptosis in molluscan cells via an intrinsic pathway. Many of the proteins involved in vertebrate apoptosis have been recognized in model invertebrates; however, this process might not be universally conserved. Mytilus galloprovincialis is presented here as a new model to study the linkage between molecular mechanisms that mediate apoptosis and marine bivalve ecological adaptations. Therefore, it is strictly necessary to identify the key elements involved in bivalve apoptosis. In the present study, six mitochondrial apoptotic-related genes were characterized, and their gene expression profiles following UV irradiation were evaluated. This is the first step for the development of potential biomarkers to assess the biological responses of marine organisms to stress. The results confirmed that apoptosis and, more specifically, the expression of the genes involved in this process can be used to assess the biological responses of marine organisms to stress.

  16. A novel mitochondrial ATP8 gene mutation in a patient with apical hypertrophic cardiomyopathy and neuropathy

    Science.gov (United States)

    Jonckheere, An I; Hogeveen, Marije; Nijtmans, Leo; van den Brand, Mariel; Janssen, Antoon; Diepstra, Heleen; van den Brandt, Frans; van den Heuvel, Bert; Hol, Frans; Hofste, Tom; Kapusta, Livia; Dillmann, U; Shamdeen, M; Smeitink, J; Smeitink, J; Rodenburg, Richard

    2009-01-01

    To identify the biochemical and molecular genetic defect in a 16-year-old patient presenting with apical hypertrophic cardiomyopathy and neuropathy suspected for a mitochondrial disorder. Measurement of the mitochondrial energy-generating system (MEGS) capacity in muscle and enzyme analysis in muscle and fibroblasts were performed. Relevant parts of the mitochondrial DNA were analysed by sequencing. A homoplasmic nonsense mutation m.8529G→A (p.Trp55X) was found in the mitochondrial ATP8 gene in the patient’s fibroblasts and muscle tissue. Reduced complex V activity was measured in the patient’s fibroblasts and muscle tissue, and was confirmed in cybrid clones containing patient-derived mitochondrial DNA We describe the first pathogenic mutation in the mitochondrial ATP8 gene, resulting in an improper assembly and reduced activity of the complex V holoenzyme. PMID:21686774

  17. Altered expression of mitochondrial related genes in the native Tibetan placents by mitochondrial cDNA array analysis

    Institute of Scientific and Technical Information of China (English)

    Luo Yongjun; Gao Wenxiang; Zhao Xiuxin; Suo Lang; Chen Li; Liu Fuyu; Song Tonglin; Chen Jian; Gao Yuqi

    2009-01-01

    Objective: To explore the mechanism of native Tibetan fetuses adaptation to hypoxia, we tried to find the different expression genes about mitochondrial function in the native Tibetan placents. Methods: In this study, the placents of native Tibetan and the high-altitude Han (ha-Han) were collected. After the total RNA extraction, the finally synthesized cDNAs were hybridized to mitochondrial array to find the altered expression genes between them. Then, the cytochrome c oxidase 17 (Coxl7), dynactin 2 (DCTN2, also known as p50), and vascular endothelial growth factor receptor (VEGFR, also known as KDR) were chosen from the altered expression genes to further verify the array results using the SYBR Green real-time PCR. Because the altered expression genes (such as Cybb and Coxl 7) in the array results related to the activities of COXI and COXIV, the placental mitochondria activities of COXI and COXIV were measured to find their changes in the hypoxia. Results: By a standard of >1.5 or <0.67, there were 24 different expressed genes between the native Tibetan and the ha-Han placents, including 3 up-regulated genes and 21 down-regulated genes. These genes were related to energy metabolism, signal transduction, cell proliferation, electron transport, cell adhesion, nucleotide-excision repair. The array results of Coxl7, DCTN2 and KDR were further verified by the real-time RT-PCR. Through the mitochondria respiration measurements, the activity of COXI in the native Tibetan placents were higher than that of ha-Han, there was no difference in COXIV activity between them. Conclusion: The altered mitochondrial related genes in the native Tibetan placents may have a role in the high altitude adaptation for fetuses through changing the activity of mitochondrial COX.

  18. tRNA nucleotide 47: an evolutionary enigma.

    Science.gov (United States)

    Cermakian, N; McClain, W H; Cedergren, R

    1998-08-01

    A previous analysis of tRNA sequences suggested a correlation between the absence of a nucleotide at position 47 (nt 47) in the extra loop and the presence of a U13:G22 base pair in the D-stem. We have evaluated the significance of this correlation by determining the in vivo activity of tRNAs containing either a C13:G22 or a U13:G22 pair in tRNA molecules with or without nt 47. Although this correlation might reflect some malfunction of tRNAs lacking nt 47, but containing the C13:G22, assays of the in vivo suppressor activity showed that this tRNA is actually more active than the tRNA with the features found in the database, i.e., a U13:G22 base pair and no nt 47. Moreover, analogous constructs with a GGC anticodon permitted the growth of an Escherichia coli strain deleted for tRNA(Ala)GGC genes equally well. On the other hand, long-term growth experiments with competing E. coli strains harboring the tRNA lacking nt 47, either with the C13:G22 or the U13:G22 base pair demonstrated that the U13:G22 tRNA overtook the C13:G22 strain even when the starting proportion of strains favored the C13:G22 strain. Thus, the preference for the U13:G22 tRNA lacking nt 47 in the sequence database is most likely due to factors that come into play during extended growth or latency rather than to the ability of the tRNA to engage in protein synthesis.

  19. Mitochondrial DNA sequence of Onychostoma rara.

    Science.gov (United States)

    Zeng, Chun-Fang; Li, Xiao-Ling; Li, Chuan-Wu; Huang, Xiang-Rong; Wan, Yi-Wen

    2015-01-01

    The complete mitochondrial genome sequence of Onychostoma rara was determined to be 16,590 bp in length and contains 13 protein-coding genes (PCGs), 22 tRNA genes, large (rrnL) and small (rrnS) rRNA and the non-coding control region. Its total A + T content is 55.65%. We also analyzed the structure of control region, 6 CSBs (CSB-1, CSB-2, CSB-3, CSB-D, CSB-E and CSB-F) and 2 bp tandem repeat were detected.

  20. Rapidly Evolving Mitochondrial Genome and Directional Selection in Mitochondrial Genes in the Parasitic Wasp Nasonia (Hymenoptera: Pteromalidae)

    Science.gov (United States)

    Raychoudhury, Rhitoban; Lavrov, Dennis V.; Werren, John H.

    2008-01-01

    We sequenced the nearly complete mtDNA of 3 species of parasitic wasps, Nasonia vitripennis (2 strains), Nasonia giraulti, and Nasonia longicornis, including all 13 protein-coding genes and the 2 rRNAs, and found unusual patterns of mitochondrial evolution. The Nasonia mtDNA has a unique gene order compared with other insect mtDNAs due to multiple rearrangements. The mtDNAs of these wasps also show nucleotide substitution rates over 30 times faster than nuclear protein-coding genes, indicating among the highest substitution rates found in animal mitochondria (normally <10 times faster). A McDonald and Kreitman test shows that the between-species frequency of fixed replacement sites relative to silent sites is significantly higher compared with within-species polymorphisms in 2 mitochondrial genes of Nasonia, atp6 and atp8, indicating directional selection. Consistent with this interpretation, the Ka/Ks (nonsynonymous/synonymous substitution rates) ratios are higher between species than within species. In contrast, cox1 shows a signature of purifying selection for amino acid sequence conservation, although rates of amino acid substitutions are still higher than for comparable insects. The mitochondrial-encoded polypeptides atp6 and atp8 both occur in F0F1ATP synthase of the electron transport chain. Because malfunction in this fundamental protein severely affects fitness, we suggest that the accelerated accumulation of replacements is due to beneficial mutations necessary to compensate mild-deleterious mutations fixed by random genetic drift or Wolbachia sweeps in the fast evolving mitochondria of Nasonia. We further propose that relatively high rates of amino acid substitution in some mitochondrial genes can be driven by a “Compensation-Draft Feedback”; increased fixation of mildly deleterious mutations results in selection for compensatory mutations, which lead to fixation of additional deleterious mutations in nonrecombining mitochondrial genomes, thus

  1. Rapidly evolving mitochondrial genome and directional selection in mitochondrial genes in the parasitic wasp nasonia (hymenoptera: pteromalidae).

    Science.gov (United States)

    Oliveira, Deodoro C S G; Raychoudhury, Rhitoban; Lavrov, Dennis V; Werren, John H

    2008-10-01

    We sequenced the nearly complete mtDNA of 3 species of parasitic wasps, Nasonia vitripennis (2 strains), Nasonia giraulti, and Nasonia longicornis, including all 13 protein-coding genes and the 2 rRNAs, and found unusual patterns of mitochondrial evolution. The Nasonia mtDNA has a unique gene order compared with other insect mtDNAs due to multiple rearrangements. The mtDNAs of these wasps also show nucleotide substitution rates over 30 times faster than nuclear protein-coding genes, indicating among the highest substitution rates found in animal mitochondria (normally mitochondrial genes of Nasonia, atp6 and atp8, indicating directional selection. Consistent with this interpretation, the Ka/Ks (nonsynonymous/synonymous substitution rates) ratios are higher between species than within species. In contrast, cox1 shows a signature of purifying selection for amino acid sequence conservation, although rates of amino acid substitutions are still higher than for comparable insects. The mitochondrial-encoded polypeptides atp6 and atp8 both occur in F0F1ATP synthase of the electron transport chain. Because malfunction in this fundamental protein severely affects fitness, we suggest that the accelerated accumulation of replacements is due to beneficial mutations necessary to compensate mild-deleterious mutations fixed by random genetic drift or Wolbachia sweeps in the fast evolving mitochondria of Nasonia. We further propose that relatively high rates of amino acid substitution in some mitochondrial genes can be driven by a "Compensation-Draft Feedback"; increased fixation of mildly deleterious mutations results in selection for compensatory mutations, which lead to fixation of additional deleterious mutations in nonrecombining mitochondrial genomes, thus accelerating the process of amino acid substitutions.

  2. Complete mitochondrial genome of the ocellate river stingray (Potamotrygon motoro).

    Science.gov (United States)

    Song, Hong-Mei; Mu, Xi-Dong; Wei, Min-Xia; Wang, Xue-Jie; Luo, Jian-Ren; Hu, Yin-Chang

    2015-01-01

    We determined the first complete mitochondrial genome sequence of Potamotrygon motoro from South American freshwater stingrays. The total length of P. motoro mitogenome is 17,448 bp, which consists of 13 protein-coding genes, 22 tRNA genes, 2 rRNA genes and a control region, with the genome organization and gene order being identical to that of the typical vertebrate. The overall nucleotide composition is 32.3% A, 24.4% T, 30.5% C and 12.8% G. These data will provide useful molecular information for phylogenetic relationships within the family Potamotrygonidae species.

  3. Complete mitochondrial genome of the Antarctic amphipod Gondogeneia antarctica (Crustacea, amphipod).

    Science.gov (United States)

    Shin, Seung Chul; Cho, Jin; Lee, Jong Kyu; Ahn, Do Hwan; Lee, Hyoungseok; Park, Hyun

    2012-02-01

    The complete sequence of the mitochondrial genome of the Antarctic amphipod Gondogeneia antarctica was determined to be 18,424 bp in length, and to contain 13 protein-coding genes (PCGs), 22 tRNA genes, and large (rrnL) and small (rrnS) rRNA genes. Its total A+T content is 70.1%. The G. antarctica mitogenome is the largest known among those of crustaceans, due to the existence of two relatively large intergenic non-coding sequences. The PCG arrangement of G. antarctica is identical to that of the ancestral pancrustacean ground pattern, although the tRNA arrangement differs somewhat. The complete mitogenome sequences of 68 species of pancrustacea have been added to the NCBI database, only 4 of which represent complete mitogenome sequences from amphipods. This is the first report of a mitogenome sequence of an Antarctic amphipod, and provides insights into the evolution of crustacean mitochondrial genomes, particularly in amphipods.

  4. Mitochondrial DNA sequence of the hybrid of Duroc (♂) × [Landrace (♂) × Yorshire (♀)] pig.

    Science.gov (United States)

    Xu, Dong; He, Chang-Qing; He, Jun; Yang, Hu; Ma, Hai-Ming

    2015-01-01

    Duroc (♂) × [Landrace (♂) × Yorshire (♀)] (D × LY) pig is the popular hybrid pigs in order to make the most use of the heterosis in the world. In this study, the complete nucleotide sequence of D × LY pig mitochondrial genome was determined for the first time. Sequence analysis showed that the genome structure was in accordance with other pig breeds. It contained 22 tRNA genes, 2 ribosomal RNA genes, 13 protein-coding genes and 1 control region (D-loop region). The complete mitochondrial genome sequence of the D × LY pig provides an important data set for further study in genetic mechanism.

  5. Complete mitochondrial DNA genome of Pseudobagrus brevicaudatus (Siluriformes: Bagridae).

    Science.gov (United States)

    Liang, Hong-Wei; Meng, Yan; Li, Zhong; Zhang, Yan; Zou, Gui-wei

    2014-06-01

    The complete mitochondrial genome of Pseudobagrus brevicaudatus (Siluriformes: Bagridae) was sequenced in this study. The total length of the mitogenome is 16,533 bp, with the base composition of 31.6% A, 26.8% T, 15.0%G, 26.6% C. The gene order and genes were the same as that found in other previously reported catfishes, including 13 protein-coding genes, 22 transfer RNA genes, 2 ribosomal RNA genes, and 1 non-coding control region. Except for ND6 gene and 8 tRNA genes, all other mitochondrial genes were encoded on the heavy strand. This complete mitogenome data provides the basis for taxonomic and conservation research of this and closely related species.

  6. Extensive mitochondrial gene arrangements in coleoid Cephalopoda and their phylogenetic implications.

    Science.gov (United States)

    Akasaki, Tetsuya; Nikaido, Masato; Tsuchiya, Kotaro; Segawa, Susumu; Hasegawa, Masami; Okada, Norihiro

    2006-03-01

    We determined the complete mitochondrial genomes of five cephalopods of the Subclass Coleoidea (Suborder Oegopsida: Watasenia scintillans, Todarodes pacificus, Suborder Myopsida: Sepioteuthis lessoniana, Order Sepiida: Sepia officinalis, and Order Octopoda: Octopus ocellatus) and used them to infer phylogenetic relationships. In our Maximum Likelihood (ML) tree, sepiids (cuttlefish) are at the most basal position of all decapodiformes, and oegopsids and myopsids form a monophyletic clade, thus supporting the traditional classification of the Order Teuthida. We detected extensive gene rearrangements in the mitochondrial genomes of broad cephalopod groups. It is likely that the arrangements of mitochondrial genes in Oegopsida and Sepiida were derived from those of Octopoda, which is thought to be the ancestral order, by entire gene duplication and random gene loss. Oegopsida in particular has undergone long-range gene duplications. We also found that the mitochondrial gene arrangement of Sepioteuthis lessoniana differs from that of Loligo bleekeri, although they belong to the same family. Analysis of both the phylogenetic tree and mitochondrial gene rearrangements of coleoid Cephalopoda suggests that each mitochondrial gene arrangement was acquired after the divergence of each lineage.

  7. The complete mitochondrial genome of the armored catfish, Hypostomus plecostomus (Siluriformes: Loricariidae).

    Science.gov (United States)

    Liu, Shikai; Zhang, Jiaren; Yao, Jun; Liu, Zhanjiang

    2016-05-01

    The complete mitochondrial genome of the armored catfish, Hypostomus plecostomus, was determined by next generation sequencing of genomic DNA without prior sample processing or primer design. Bioinformatics analysis resulted in the entire mitochondrial genome sequence with length of 16,523 bp. The H. plecostomus mitochondrial genome is consisted of 13 protein-coding genes, 22 tRNA genes, 2 rRNA genes, and 1 control region, showing typical circular molecule structure of mitochondrial genome as in other vertebrates. The whole genome base composition was estimated to be 31.8% A, 27.0% T, 14.6% G, and 26.6% C, with A/T bias of 58.8%. This work provided the H. plecostomus mitochondrial genome sequence which should be valuable for species identification, phylogenetic analysis and conservation genetics studies in catfishes.

  8. Mitochondrial genomes of Vanhornia eucnemidarum (Apocrita: Vanhorniidae) and Primeuchroeus spp. (Aculeata: Chrysididae): Evidence of rearranged mitochondrial genomes within the Apocrita (Insecta: Hymenoptera).

    Science.gov (United States)

    Castro, Lyda Raquel; Ruberu, Kalani; Dowton, Mark

    2006-07-01

    We sequenced most of the mitochondrial (mt) genomes of 2 apocritan taxa: Vanhornia eucnemidarum and Primeuchroeus spp. These mt genomes have similar nucleotide composition and codon usage to those of mt genomes reported for other Hymenoptera, with a total A + T content of 80.1% and 78.2%, respectively. Gene content corresponds to that of other metazoan mt genomes, but gene organization is not conserved. There are a total of 6 tRNA genes rearranged in V. eucnemidarum and 9 in Primeuchroeus spp. Additionally, several noncoding regions were found in the mt genome of V. eucnemidarum, as well as evidence of a sustained gene duplication involving 3 tRNA genes. We also report an inversion of the large and small ribosomal RNA genes in Primeuchroeus spp. mt genome. However, none of the rearrangements reported are phylogenetically informative with respect to the current taxon sample.

  9. Comparative study of human mitochondrial proteome reveals extensive protein subcellular relocalization after gene duplications

    Directory of Open Access Journals (Sweden)

    Huang Yong

    2009-11-01

    Full Text Available Abstract Background Gene and genome duplication is the principle creative force in evolution. Recently, protein subcellular relocalization, or neolocalization was proposed as one of the mechanisms responsible for the retention of duplicated genes. This hypothesis received support from the analysis of yeast genomes, but has not been tested thoroughly on animal genomes. In order to evaluate the importance of subcellular relocalizations for retention of duplicated genes in animal genomes, we systematically analyzed nuclear encoded mitochondrial proteins in the human genome by reconstructing phylogenies of mitochondrial multigene families. Results The 456 human mitochondrial proteins selected for this study were clustered into 305 gene families including 92 multigene families. Among the multigene families, 59 (64% consisted of both mitochondrial and cytosolic (non-mitochondrial proteins (mt-cy families while the remaining 33 (36% were composed of mitochondrial proteins (mt-mt families. Phylogenetic analyses of mt-cy families revealed three different scenarios of their neolocalization following gene duplication: 1 relocalization from mitochondria to cytosol, 2 from cytosol to mitochondria and 3 multiple subcellular relocalizations. The neolocalizations were most commonly enabled by the gain or loss of N-terminal mitochondrial targeting signals. The majority of detected subcellular relocalization events occurred early in animal evolution, preceding the evolution of tetrapods. Mt-mt protein families showed a somewhat different pattern, where gene duplication occurred more evenly in time. However, for both types of protein families, most duplication events appear to roughly coincide with two rounds of genome duplications early in vertebrate evolution. Finally, we evaluated the effects of inaccurate and incomplete annotation of mitochondrial proteins and found that our conclusion of the importance of subcellular relocalization after gene duplication on

  10. Characterization of the complete mitochondrial genome of the hybrid Epinephelus moara♀ × Epinephelus lanceolatus♂, and phylogenetic analysis in subfamily epinephelinae

    Science.gov (United States)

    Gao, Fengtao; Wei, Min; Zhu, Ying; Guo, Hua; Chen, Songlin; Yang, Guanpin

    2017-06-01

    This study presents the complete mitochondrial genome of the hybrid Epinephelus moara♀× Epinephelus lanceolatus♂. The genome is 16886 bp in length, and contains 13 protein-coding genes, 2 rRNA genes, 22 tRNA genes, a light-strand replication origin and a control region. Additionally, phylogenetic analysis based on the nucleotide sequences of 13 conserved protein-coding genes using the maximum likelihood method indicated that the mitochondrial genome is maternally inherited. This study presents genomic data for studying phylogenetic relationships and breeding of hybrid Epinephelinae.

  11. Allotopic Expression of a Gene Encoding FLAG Tagged-subunit 8 of Yeast Mitochondrial ATP Synthase

    Directory of Open Access Journals (Sweden)

    I MADE ARTIKA

    2006-03-01

    Full Text Available Subunit 8 of yeast mitochondrial ATP synthase is a polypeptide of 48 amino acids encoded by the mitochondrial ATP8 gene. A nuclear version of subunit 8 gene has been designed to encode FLAG tagged-subunit 8 fused with a mitochondrial signal peptide. The gene has been cloned into a yeast expression vector and then expressed in a yeast strain lacking endogenous subunit 8. Results showed that the gene was successfully expressed and the synthesized FLAG tagged-subunit 8 protein was imported into mitochondria. Following import, the FLAG tagged-subunit 8 protein assembled into functional mitochondrial ATP synthase complex. Furthermore, the subunit 8 protein could be detected using anti-FLAG tag monoclonal antibody.

  12. The rearranged mitochondrial genome of Leptopilina boulardi (Hymenoptera: Figitidae, a parasitoid wasp of Drosophila

    Directory of Open Access Journals (Sweden)

    Daniel S. Oliveira

    Full Text Available Abstract The partial mitochondrial genome sequence of Leptopilina boulardi (Hymenoptera: Figitidae was characterized. Illumina sequencing was used yielding 35,999,679 reads, from which 102,482 were utilized in the assembly. The length of the sequenced region of this partial mitochondrial genome is 15,417 bp, consisting of 13 protein-coding, two rRNA, and 21tRNA genes (the trnaM failed to be sequenced and a partial A+T-rich region. All protein-coding genes start with ATN codons. Eleven protein-coding genes presented TAA stop codons, whereas ND6 and COII that presented TA, and T nucleotides, respectively. The gene pattern revealed extensive rearrangements compared to the typical pattern generally observed in insects. These rearrangements involve two protein-coding and two ribosomal genes, along with the 16 tRNA genes. This gene order is different from the pattern described for Ibalia leucospoides (Ibaliidae, Cynipoidea, suggesting that this particular gene order can be variable among Cynipoidea superfamily members. A maximum likelihood phylogenetic analysis of the main groups of Apocrita was performed using amino acid sequence of 13 protein-coding genes, showing monophyly for the Cynipoidea superfamily within the Hymenoptera phylogeny.

  13. Gene set of nuclear-encoded mitochondrial regulators is enriched for common inherited variation in obesity.

    Directory of Open Access Journals (Sweden)

    Nadja Knoll

    Full Text Available There are hints of an altered mitochondrial function in obesity. Nuclear-encoded genes are relevant for mitochondrial function (3 gene sets of known relevant pathways: (1 16 nuclear regulators of mitochondrial genes, (2 91 genes for oxidative phosphorylation and (3 966 nuclear-encoded mitochondrial genes. Gene set enrichment analysis (GSEA showed no association with type 2 diabetes mellitus in these gene sets. Here we performed a GSEA for the same gene sets for obesity. Genome wide association study (GWAS data from a case-control approach on 453 extremely obese children and adolescents and 435 lean adult controls were used for GSEA. For independent confirmation, we analyzed 705 obesity GWAS trios (extremely obese child and both biological parents and a population-based GWAS sample (KORA F4, n = 1,743. A meta-analysis was performed on all three samples. In each sample, the distribution of significance levels between the respective gene set and those of all genes was compared using the leading-edge-fraction-comparison test (cut-offs between the 50(th and 95(th percentile of the set of all gene-wise corrected p-values as implemented in the MAGENTA software. In the case-control sample, significant enrichment of associations with obesity was observed above the 50(th percentile for the set of the 16 nuclear regulators of mitochondrial genes (p(GSEA,50 = 0.0103. This finding was not confirmed in the trios (p(GSEA,50 = 0.5991, but in KORA (p(GSEA,50 = 0.0398. The meta-analysis again indicated a trend for enrichment (p(MAGENTA,50 = 0.1052, p(MAGENTA,75 = 0.0251. The GSEA revealed that weak association signals for obesity might be enriched in the gene set of 16 nuclear regulators of mitochondrial genes.

  14. Gene set of nuclear-encoded mitochondrial regulators is enriched for common inherited variation in obesity.

    Science.gov (United States)

    Knoll, Nadja; Jarick, Ivonne; Volckmar, Anna-Lena; Klingenspor, Martin; Illig, Thomas; Grallert, Harald; Gieger, Christian; Wichmann, Heinz-Erich; Peters, Annette; Hebebrand, Johannes; Scherag, André; Hinney, Anke

    2013-01-01

    There are hints of an altered mitochondrial function in obesity. Nuclear-encoded genes are relevant for mitochondrial function (3 gene sets of known relevant pathways: (1) 16 nuclear regulators of mitochondrial genes, (2) 91 genes for oxidative phosphorylation and (3) 966 nuclear-encoded mitochondrial genes). Gene set enrichment analysis (GSEA) showed no association with type 2 diabetes mellitus in these gene sets. Here we performed a GSEA for the same gene sets for obesity. Genome wide association study (GWAS) data from a case-control approach on 453 extremely obese children and adolescents and 435 lean adult controls were used for GSEA. For independent confirmation, we analyzed 705 obesity GWAS trios (extremely obese child and both biological parents) and a population-based GWAS sample (KORA F4, n = 1,743). A meta-analysis was performed on all three samples. In each sample, the distribution of significance levels between the respective gene set and those of all genes was compared using the leading-edge-fraction-comparison test (cut-offs between the 50(th) and 95(th) percentile of the set of all gene-wise corrected p-values) as implemented in the MAGENTA software. In the case-control sample, significant enrichment of associations with obesity was observed above the 50(th) percentile for the set of the 16 nuclear regulators of mitochondrial genes (p(GSEA,50) = 0.0103). This finding was not confirmed in the trios (p(GSEA,50) = 0.5991), but in KORA (p(GSEA,50) = 0.0398). The meta-analysis again indicated a trend for enrichment (p(MAGENTA,50) = 0.1052, p(MAGENTA,75) = 0.0251). The GSEA revealed that weak association signals for obesity might be enriched in the gene set of 16 nuclear regulators of mitochondrial genes.

  15. CLP1 as a novel player in linking tRNA splicing to neurodegenerative disorders.

    Science.gov (United States)

    Weitzer, Stefan; Hanada, Toshikatsu; Penninger, Josef M; Martinez, Javier

    2015-01-01

    Defects in RNA metabolic pathways are well-established causes for neurodegenerative disorders. Several mutations in genes involved in pre-messenger RNA (pre-mRNA) and tRNA metabolism, RNA stability and protein translation have been linked to motor neuron diseases. Our study on a mouse carrying a catalytically inactive version of the RNA kinase CLP1, a component of the tRNA splicing endonuclease complex, revealed a neurological disorder characterized by progressive loss of lower spinal motor neurons. Surprisingly, mutant mice accumulate a novel class of tRNA-derived fragments. In addition, patients with homozygous missense mutations in CLP1 (R140H) were recently identified who suffer from severe motor-sensory defects, cortical dysgenesis and microcephaly, and exhibit alterations in transfer RNA (tRNA) splicing. Here, we review functions of CLP1 in different RNA pathways and provide hypotheses on the role of the tRNA splicing machinery in the generation of tRNA fragments and the molecular links to neurodegenerative disorders. We further immerse the biology of tRNA splicing into topics of (t)RNA metabolism and oxidative stress, putting forward the idea that defects in tRNA processing leading to tRNA fragment accumulation might trigger the development of neurodegenerative diseases.

  16. PCR-based bioprospecting for homing endonucleases in fungal mitochondrial rRNA genes.

    Science.gov (United States)

    Hafez, Mohamed; Guha, Tuhin Kumar; Shen, Chen; Sethuraman, Jyothi; Hausner, Georg

    2014-01-01

    Fungal mitochondrial genomes act as "reservoirs" for homing endonucleases. These enzymes with their DNA site-specific cleavage activities are attractive tools for genome editing and gene therapy applications. Bioprospecting and characterization of naturally occurring homing endonucleases offers an alternative to synthesizing artificial endonucleases. Here, we describe methods for PCR-based screening of fungal mitochondrial rRNA genes for homing endonuclease encoding sequences, and we also provide protocols for the purification and biochemical characterization of putative native homing endonucleases.

  17. Origin, evolution, and mechanism of 5′ tRNA editing in chytridiomycete fungi

    Science.gov (United States)

    LAFOREST, MARIE-JOSÉE; BULLERWELL, CHARLES E.; FORGET, LISE; LANG, B. FRANZ

    2004-01-01

    5′ tRNA editing has been demonstrated to occur in the mitochondria of the distantly related rhizopod amoeba Acanthamoeba castellanii and the chytridiomycete fungus Spizellomyces punctatus. In these organisms, canonical tRNA structures are restored by removing mismatched nucleotides at the first three 5′ positions and replacing them with nucleotides capable of forming Watson–Crick base pairs with their 3′ counterparts. This form of editing seems likely to occur in members of Amoebozoa other than A. castellanii, as well as in members of Heterolobosea. Evidence for 5′ tRNA editing has not been found to date, however, in any other fungus including the deeply branching chytridiomycete Allomyces macrogynus. We predicted that a similar form of tRNA editing would occur in members of the chytridiomycete order Monoblepharidales based on the analysis of complete mitochondrial tRNA complements. This prediction was confirmed by analysis of tRNA sequences using a tRNA circularization/ RT-PCR-based approach. The presence of partially and completely unedited tRNAs in members of the Monoblepharidales suggests the involvement of a 5′-to-3′ exonuclease rather than an endonuclease in removing the three 5′ nucleotides from a tRNA substrate. Surprisingly, analysis of the mtDNA of the chytridiomycete Rhizophydium brooksianum, which branches as a sister group to S. punctatus in molecular phylogenies, did not suggest the presence of editing. This prediction was also confirmed experimentally. The absence of tRNA editing in R. brooksianum raises the possibility that 5′ tRNA editing may have evolved twice independently within Chytridiomycota, once in the lineage leading to S. punctatus and once in the lineage leading to the Monoblepharidales. PMID:15247432

  18. Mitochondrial DNA triplication and punctual mutations in patients with mitochondrial neuromuscular disorders

    Energy Technology Data Exchange (ETDEWEB)

    Mkaouar-Rebai, Emna, E-mail: emna.mkaouar@gmail.com [Département des Sciences de la Vie, Faculté des Sciences de Sfax, Université de Sfax (Tunisia); Felhi, Rahma; Tabebi, Mouna [Laboratoire de Génétique Moléculaire Humaine, Faculté de Médecine de Sfax, Université de Sfax (Tunisia); Alila-Fersi, Olfa; Chamkha, Imen [Département des Sciences de la Vie, Faculté des Sciences de Sfax, Université de Sfax (Tunisia); Maalej, Marwa; Ammar, Marwa [Laboratoire de Génétique Moléculaire Humaine, Faculté de Médecine de Sfax, Université de Sfax (Tunisia); Kammoun, Fatma [Service de pédiatrie, C.H.U. Hedi Chaker de Sfax (Tunisia); Keskes, Leila [Laboratoire de Génétique Moléculaire Humaine, Faculté de Médecine de Sfax, Université de Sfax (Tunisia); Hachicha, Mongia [Service de pédiatrie, C.H.U. Hedi Chaker de Sfax (Tunisia); Fakhfakh, Faiza, E-mail: faiza.fakhfakh02@gmail.com [Département des Sciences de la Vie, Faculté des Sciences de Sfax, Université de Sfax (Tunisia)

    2016-04-29

    Mitochondrial diseases are a heterogeneous group of disorders caused by the impairment of the mitochondrial oxidative phosphorylation system which have been associated with various mutations of the mitochondrial DNA (mtDNA) and nuclear gene mutations. The clinical phenotypes are very diverse and the spectrum is still expanding. As brain and muscle are highly dependent on OXPHOS, consequently, neurological disorders and myopathy are common features of mtDNA mutations. Mutations in mtDNA can be classified into three categories: large-scale rearrangements, point mutations in tRNA or rRNA genes and point mutations in protein coding genes. In the present report, we screened mitochondrial genes of complex I, III, IV and V in 2 patients with mitochondrial neuromuscular disorders. The results showed the presence the pathogenic heteroplasmic m.9157G>A variation (A211T) in the MT-ATP6 gene in the first patient. We also reported the first case of triplication of 9 bp in the mitochondrial NC7 region in Africa and Tunisia, in association with the novel m.14924T>C in the MT-CYB gene in the second patient with mitochondrial neuromuscular disorder. - Highlights: • We reported 2 patients with mitochondrial neuromuscular disorders. • The heteroplasmic MT-ATP6 9157G>A variation was reported. • A triplication of 9 bp in the mitochondrial NC7 region was detected. • The m.14924T>C transition (S60P) in the MT-CYB gene was found.

  19. The mitochondrial genome of the deep-sea glass sponge Lophophysema eversa (Porifera, Hexacinellida, Hyalonematidae).

    Science.gov (United States)

    Zhang, Yanjie; Sun, Jin; Li, Xinzheng; Qiu, Jian-Wen

    2016-01-01

    We reported a nearly complete mitochondrial genome (mitogenome) from the glass sponge Lophophysema eversa, the second mitogenome in the order Amphidiscosida and the ninth in the class Hexactinellida. It is 20,651 base pairs in length and contains 39 genes including 13 protein-coding genes, 2 ribosomal RNA subunit genes and 24 tRNA genes. The gene content and order of L. eversa are identical to those of Tabachnickia sp., the other species with a sequenced mitogenome in Amphidiscosida, except with two additional tRNAs and three tRNA translocations. The cob gene has a +1 translational frameshift. These results will contribute to a better understanding of the phylogeny of glass sponges.

  20. Similar Efficacies of Selection Shape Mitochondrial and Nuclear Genes in Both Drosophila melanogaster and Homo sapiens.

    Science.gov (United States)

    Cooper, Brandon S; Burrus, Chad R; Ji, Chao; Hahn, Matthew W; Montooth, Kristi L

    2015-08-21

    Deleterious mutations contribute to polymorphism even when selection effectively prevents their fixation. The efficacy of selection in removing deleterious mitochondrial mutations from populations depends on the effective population size (Ne) of the mitochondrial DNA and the degree to which a lack of recombination magnifies the effects of linked selection. Using complete mitochondrial genomes from Drosophila melanogaster and nuclear data available from the same samples, we reexamine the hypothesis that nonrecombining animal mitochondrial DNA harbor an excess of deleterious polymorphisms relative to the nuclear genome. We find no evidence of recombination in the mitochondrial genome, and the much-reduced level of mitochondrial synonymous polymorphism relative to nuclear genes is consistent with a reduction in Ne. Nevertheless, we find that the neutrality index, a measure of the excess of nonsynonymous polymorphism relative to the neutral expectation, is only weakly significantly different between mitochondrial and nuclear loci. This difference is likely the result of the larger proportion of beneficial mutations in X-linked relative to autosomal loci, and we find little to no difference between mitochondrial and autosomal neutrality indices. Reanalysis of published data from Homo sapiens reveals a similar lack of a difference between the two genomes, although previous studies have suggested a strong difference in both species. Thus, despite a smaller Ne, mitochondrial loci of both flies and humans appear to experience similar efficacies of purifying selection as do loci in the recombining nuclear genome.

  1. Sequencing and alignment of mitochondrial genomes of Tibetan chicken and two lowland chicken breeds

    Institute of Scientific and Technical Information of China (English)

    2008-01-01

    Tibetan chicken lives in high-altitude area and has adapted well to hypoxia genetically. Shouguang chicken and Silky chicken are both lowland chicken breeds. In the present study, the complete mitochondrial genome sequences of the three chicken breeds were all sequenced. The results showed that the mitochondrial DNAs (mtDNAs) of Shouguang chicken and Silky chicken consist of 16784 bp and 16785 bp respectively, and Tibetan chicken mitochondrial genome varies from 16784 bp to 16786 bp. After sequence analysis, 120 mutations, including 4 single nucleotide polymorphisms (SNPs) in tRNA genes, 9 SNPs and 1 insertion in rRNA genes, 38 SNPs and 1 deletion in D-LOOP, 66 SNPs in protein-coding genes, were found. This work will provide clues for the future study on the association between mitochondrial genes and the adaptation to hypoxia.

  2. The mitochondrial genome of the wood-degrading basidiomycete Trametes cingulata.

    Science.gov (United States)

    Haridas, Sajeet; Gantt, J Stephen

    2010-07-01

    We present the 91,500 bp mitochondrial genome of the wood-degrading basidiomycete Trametes cingulata and compare it with the mitochondrial genomes of five additional Basidiomycota species. The Trametes mitochondrial genome encodes 15 proteins, 25 tRNAs and the small and large rRNAs. All of the genes, except one tRNA, are found on the same DNA strand. Several additional ORFs have also been identified; however, their sequences have not been conserved across the species we compared and they show no similarity to any known gene, suggesting that they may not correspond to authentic genes. The presence of endonuclease-like sequences in introns suggests a mechanism that explains the diversity of mitochondrial genome sizes that are unrelated to the gene content.

  3. Mutations in the SPG7 gene cause chronic progressive external ophthalmoplegia through disordered mitochondrial DNA maintenance.

    Science.gov (United States)

    Pfeffer, Gerald; Gorman, Gráinne S; Griffin, Helen; Kurzawa-Akanbi, Marzena; Blakely, Emma L; Wilson, Ian; Sitarz, Kamil; Moore, David; Murphy, Julie L; Alston, Charlotte L; Pyle, Angela; Coxhead, Jon; Payne, Brendan; Gorrie, George H; Longman, Cheryl; Hadjivassiliou, Marios; McConville, John; Dick, David; Imam, Ibrahim; Hilton, David; Norwood, Fiona; Baker, Mark R; Jaiser, Stephan R; Yu-Wai-Man, Patrick; Farrell, Michael; McCarthy, Allan; Lynch, Timothy; McFarland, Robert; Schaefer, Andrew M; Turnbull, Douglass M; Horvath, Rita; Taylor, Robert W; Chinnery, Patrick F

    2014-05-01

    Despite being a canonical presenting feature of mitochondrial disease, the genetic basis of progressive external ophthalmoplegia remains unknown in a large proportion of patients. Here we show that mutations in SPG7 are a novel cause of progressive external ophthalmoplegia associated with multiple mitochondrial DNA deletions. After excluding known causes, whole exome sequencing, targeted Sanger sequencing and multiplex ligation-dependent probe amplification analysis were used to study 68 adult patients with progressive external ophthalmoplegia either with or without multiple mitochondrial DNA deletions in skeletal muscle. Nine patients (eight probands) were found to carry compound heterozygous SPG7 mutations, including three novel mutations: two missense mutations c.2221G>A; p.(Glu741Lys), c.2224G>A; p.(Asp742Asn), a truncating mutation c.861dupT; p.Asn288*, and seven previously reported mutations. We identified a further six patients with single heterozygous mutations in SPG7, including two further novel mutations: c.184-3C>T (predicted to remove a splice site before exon 2) and c.1067C>T; p.(Thr356Met). The clinical phenotype typically developed in mid-adult life with either progressive external ophthalmoplegia/ptosis and spastic ataxia, or a progressive ataxic disorder. Dysphagia and proximal myopathy were common, but urinary symptoms were rare, despite the spasticity. Functional studies included transcript analysis, proteomics, mitochondrial network analysis, single fibre mitochondrial DNA analysis and deep re-sequencing of mitochondrial DNA. SPG7 mutations caused increased mitochondrial biogenesis in patient muscle, and mitochondrial fusion in patient fibroblasts associated with the clonal expansion of mitochondrial DNA mutations. In conclusion, the SPG7 gene should be screened in patients in whom a disorder of mitochondrial DNA maintenance is suspected when spastic ataxia is prominent. The complex neurological phenotype is likely a result of the clonal

  4. The complete mitochondrial genome of Coilia nasus (Clupeiformes: Engraulidae) from Ariake Sea.

    Science.gov (United States)

    Zhang, Nan; Song, Na; Gao, Tianxiang

    2016-01-01

    In this study, the complete mitochondrial genome (mitogenome) sequence of Coilia nasus has been determined by long polymerase chain reaction and primer walking methods. The mitogenome is a circular molecule of 16,900 bp in length and contains 37 mitochondrial genes including 13 protein-coding genes, 2 ribosomal RNA (rRNA), 22 transfer RNA (tRNA) and a control region as other bony fishes. Within the control region, we identified the termination-associated sequence domain (TAS), the central conserved sequence block domains (CSB-F, CSB-E and CSB-D), and the conserved sequence block domains (CSB-1, CSB-2 and CSB-3).

  5. Discovery of mitochondrial chimeric-gene associated with cytoplasmic male sterility of HL-rice

    Institute of Scientific and Technical Information of China (English)

    2002-01-01

    The mitochondrial genome libraries of HL-type sterile line(A) and maintainer line(B) have been constructed.Mitochondrial gene, atp6, was used to screen libraries, due to the different Southern and Northern blot results between sterile and maintainer line. Sequencing analysis of positive clones proved that there were two copies of atp6 gene in sterile line and only one in maintainer line. One copy of atpt6 in sterile line was same to that in maintainer line; the other showed different flanking sequence from the 49th nucleotide downstream of the termination codon of atp6 gene. A new chimeric gene, orfH79, was found in the region. OrfH79 had homology to mitochondrial gene coxⅡ and orfl07, and was special to HL-sterile cytoplasm.``

  6. Dual localized mitochondrial and nuclear proteins as gene expression regulators in plants?

    Directory of Open Access Journals (Sweden)

    Philippe eGiegé

    2012-09-01

    Full Text Available Mitochondria heavily depend on the coordinated expression of both mitochondrial and nuclear genomes because some of their most significant activities are held by multi-subunit complexes composed of both mitochondrial and nuclear encoded proteins. Thus, precise communication and signaling pathways are believed to exist between the two compartments. Proteins dual localized to both mitochondria and the nucleus make excellent candidates for a potential involvement in the envisaged communication. Here, we review the identified instances of dual localized nucleo-mitochondrial proteins with an emphasis on plant proteins and discuss their functions, which are seemingly mostly related to gene expression regulation. We discuss whether dual localization could be achieved by dual targeting and / or by re-localization and try to apprehend the signals required for the respective processes. Finally, we propose that in some instances, dual localized mitochondrial and nuclear proteins might act as retrograde signaling molecules for mitochondrial biogenesis.

  7. Mutations of mitochondrial genome in patients with carotid atherosclerosis

    Directory of Open Access Journals (Sweden)

    Margarita A Sazonova

    2015-03-01

    Full Text Available With aim of detection the spectrum of mitochondrial DNA mutations in patients with carotid atherosclerosis from Moscow Region, we used a Roche 454 high-throughput sequencing of the whole mitochondrial genome. We have found that the presence of a number of homoplasmic mitochondrial DNA mutations in genes of 16S ribosomal RNA, subunits 2, 4 and 5 NADH dehydrogenase, subunits 1 and 2 cytochrome C oxidase, subunit 6 ATP-synthase, tRNA- Leu 2 and cytochrome B differed between conventionally healthy participants of the study and patients with carotid atherosclerosis. We also found heteroplasmic mutations, including insertions one or several nucleotides, that occurred more frequently in mitochondrial DNA of conventionally healthy participants of the study or patients with atherosclerotic lesions.

  8. Mosaic origins of a complex chimeric mitochondrial gene in Silene vulgaris.

    Directory of Open Access Journals (Sweden)

    Helena Storchova

    Full Text Available Chimeric genes are significant sources of evolutionary innovation that are normally created when portions of two or more protein coding regions fuse to form a new open reading frame. In plant mitochondria astonishingly high numbers of different novel chimeric genes have been reported, where they are generated through processes of rearrangement and recombination. Nonetheless, because most studies do not find or report nucleotide variation within the same chimeric gene, evolution after the origination of these chimeric genes remains unstudied. Here we identify two alleles of a complex chimera in Silene vulgaris that are divergent in nucleotide sequence, genomic position relative to other mitochondrial genes, and expression patterns. Structural patterns suggest a history partially influenced by gene conversion between the chimeric gene and functional copies of subunit 1 of the mitochondrial ATP synthase gene (atp1. We identified small repeat structures within the chimeras that are likely recombination sites allowing generation of the chimera. These results establish the potential for chimeric gene divergence in different plant mitochondrial lineages within the same species. This result contrasts with the absence of diversity within mitochondrial chimeras found in crop species.

  9. The mitochondrial genome of Phallusia mammillata and Phallusia fumigata (Tunicata, Ascidiacea: high genome plasticity at intra-genus level

    Directory of Open Access Journals (Sweden)

    Pesole Graziano

    2007-08-01

    Full Text Available Abstract Background Within Chordata, the subphyla Vertebrata and Cephalochordata (lancelets are characterized by a remarkable stability of the mitochondrial (mt genome, with constancy of gene content and almost invariant gene order, whereas the limited mitochondrial data on the subphylum Tunicata suggest frequent and extensive gene rearrangements, observed also within ascidians of the same genus. Results To confirm this evolutionary trend and to better understand the evolutionary dynamics of the mitochondrial genome in Tunicata Ascidiacea, we have sequenced and characterized the complete mt genome of two congeneric ascidian species, Phallusia mammillata and Phallusia fumigata (Phlebobranchiata, Ascidiidae. The two mtDNAs are surprisingly rearranged, both with respect to one another and relative to those of other tunicates and chordates, with gene rearrangements affecting both protein-coding and tRNA genes. The new data highlight the extraordinary variability of ascidian mt genome in base composition, tRNA secondary structure, tRNA gene content, and non-coding regions (number, size, sequence and location. Indeed, both Phallusia genomes lack the trnD gene, show loss/acquisition of DHU-arm in two tRNAs, and have a G+C content two-fold higher than other ascidians. Moreover, the mt genome of P. fumigata presents two identical copies of trnI, an extra tRNA gene with uncertain amino acid specificity, and four almost identical sequence regions. In addition, a truncated cytochrome b, lacking a C-terminal tail that commonly protrudes into the mt matrix, has been identified as a new mt feature probably shared by all tunicates. Conclusion The frequent occurrence of major gene order rearrangements in ascidians both at high taxonomic level and within the same genus makes this taxon an excellent model to study the mechanisms of gene rearrangement, and renders the mt genome an invaluable phylogenetic marker to investigate molecular biodiversity and speciation

  10. Three-Parent IVF: Gene Replacement for the Prevention of Inherited Mitochondrial Diseases

    Science.gov (United States)

    Amato, Paula; Tachibana, Masahito; Sparman, Michelle; Mitalipov, Shoukhrat

    2014-01-01

    Mitochondrial dysfunction has been recognized as a significant cause of a number of serious multi-organ diseases. Tissues with a high metabolic demand such as brain, heart, muscle, CNS are often affected. Mitochondrial disease can be due to mutations in mitochondrial DNA (mtDNA) or in nuclear genes involved in mitochondrial function. There is no curative treatment for patients with mitochondrial disease. Given the lack of treatments and the limitations of prenatal and preimplantation diagnosis, attention has focused on prevention of transmission of mitochondrial disease through germline gene replacement therapy. Since mtDNA is strictly maternally inherited, two approaches have been proposed. In the first, the nuclear genome from the pronuclear stage zygote of an affected woman is transferred to an enucleated donor zygote. A second technique involves transfer of the metaphase II spindle from the unfertilized oocyte of an affected woman to an enucleated donor oocyte. Our group recently reported successful spindle transfer between human oocytes resulting in blastocyst development and embryonic stem cell derivation, with very low levels of heteroplasmy. In this review, we summarize these novel assisted reproductive techniques and their use to prevent transmission of mitochondrial disorders. The promises and challenges are discussed, focusing on their potential clinical application. PMID:24382342

  11. Complete mitochondrial genomes of two brown frogs, Rana dybowskii and Rana cf. chensinensis (Anura: Ranidae).

    Science.gov (United States)

    Li, Jiao; Lei, Guangchun; Fu, Cuizhang

    2016-01-01

    We first determined complete mitochondrial genomes of Rana dybowskii and Rana cf. chensinensis (Anura: Ranidae). The mitogenomic lengths of R. dybowskii and R. cf. chensinensis were 18,864 and 18,808 bp, respectively. The two mitogenomes have similar gene compositions including 13 protein-coding genes, 22 tRNA genes, 2 rRNA genes and a control region. Rana dybowskii and R. cf. chensinensis mitogenomes displayed same gene order arrangements and similar base compositions with an A + T bias. Mitogenomic data of the two species contributed to provide molecular marker for their conservative genetics and clarified their phylogenetic position under mitogenome-based phylogeny of the genus Rana.

  12. Molecular phylogeny of the Oriental butterfly genus Arhopala (Lycaenidae, Theclinae) inferred from mitochondrial and nuclear genes

    NARCIS (Netherlands)

    Megens, H.J.W.C.; Nes, Van W.J.; Moorsel, van C.H.M.; Pierce, N.E.; Jong, de R.

    2004-01-01

    We present a phylogeny for a selection of species of the butterfly genus Arhopala Boisduval, 1832 based on molecular characters. We sequenced 1778 bases of the mitochondrial genes Cytochrome Oxidase 1 and 2 including tRNALeu, and a 393-bp fragment of the nuclear wingless gene for a total of 42 speci

  13. The mitochondrial genome of the egg-laying flatworm Aglaiogyrodactylus forficulatus (Platyhelminthes: Monogenoidea).

    Science.gov (United States)

    Bachmann, Lutz; Fromm, Bastian; Patella de Azambuja, Luciana; Boeger, Walter A

    2016-05-17

    The rather species-poor oviparous gyrodactylids are restricted to South America. It was suggested that they have a basal position within the otherwise viviparous Gyrodactylidae. Accordingly, it was proposed that the species-rich viviparous gyrodactylids diversified and dispersed from there. The mitochondrial genome of Aglaiogyrodactylus forficulatus was bioinformatically assembled from next-generation illumina MiSeq sequencing reads, annotated, and compared to previously published mitochondrial genomes of other monogenoidean flatworm species. The mitochondrial genome of A. forficulatus consists of 14,371 bp with an average A + T content of 75.12 %. All expected 12 protein coding, 22 tRNA, and 2 rRNA genes were identified. Furthermore, there were two repetitive non-coding regions essentially consisting of 88 bp and 233 bp repeats, respectively. Maximum Likelihood analyses placed the mitochondrial genome of A. forficulatus in a well-supported clade together with the viviparous Gyrodactylidae species. The gene order differs in comparison to that of other monogenoidean species, with rearrangements mainly affecting tRNA genes. In comparison to Paragyrodactylus variegatus, four gene order rearrangements, i.e. three transpositions and one complex tandem-duplication-random-loss event, were detected. Mitochondrial genome sequence analyses support a basal position of the oviparous A. forficulatus within Gyrodactylidae, and a sister group relationship of the oviparous and viviparous forms.

  14. Seventeen new complete mtDNA sequences reveal extensive mitochondrial genome evolution within the Demospongiae.

    Directory of Open Access Journals (Sweden)

    Xiujuan Wang

    Full Text Available Two major transitions in animal evolution--the origins of multicellularity and bilaterality--correlate with major changes in mitochondrial DNA (mtDNA organization. Demosponges, the largest class in the phylum Porifera, underwent only the first of these transitions and their mitochondrial genomes display a peculiar combination of ancestral and animal-specific features. To get an insight into the evolution of mitochondrial genomes within the Demospongiae, we determined 17 new mtDNA sequences from this group and analyzing them with five previously published sequences. Our analysis revealed that all demosponge mtDNAs are 16- to 25-kbp circular molecules, containing 13-15 protein genes, 2 rRNA genes, and 2-27 tRNA genes. All but four pairs of sampled genomes had unique gene orders, with the number of shared gene boundaries ranging from 1 to 41. Although most demosponge species displayed low rates of mitochondrial sequence evolution, a significant acceleration in evolutionary rates occurred in the G1 group (orders Dendroceratida, Dictyoceratida, and Verticillitida. Large variation in mtDNA organization was also observed within the G0 group (order Homosclerophorida including gene rearrangements, loss of tRNA genes, and the presence of two introns in Plakortis angulospiculatus. While introns are rare in modern-day demosponge mtDNA, we inferred that at least one intron was present in cox1 of the common ancestor of all demosponges. Our study uncovered an extensive mitochondrial genomic diversity within the Demospongiae. Although all sampled mitochondrial genomes retained some ancestral features, including a minimally modified genetic code, conserved structures of tRNA genes, and presence of multiple non-coding regions, they vary considerably in their size, gene content, gene order, and the rates of sequence evolution. Some of the changes in demosponge mtDNA, such as the loss of tRNA genes and the appearance of hairpin-containing repetitive elements

  15. Seventeen New Complete mtDNA Sequences Reveal Extensive Mitochondrial Genome Evolution within the Demospongiae

    Science.gov (United States)

    Wang, Xiujuan; Lavrov, Dennis V.

    2008-01-01

    Two major transitions in animal evolution–the origins of multicellularity and bilaterality–correlate with major changes in mitochondrial DNA (mtDNA) organization. Demosponges, the largest class in the phylum Porifera, underwent only the first of these transitions and their mitochondrial genomes display a peculiar combination of ancestral and animal-specific features. To get an insight into the evolution of mitochondrial genomes within the Demospongiae, we determined 17 new mtDNA sequences from this group and analyzing them with five previously published sequences. Our analysis revealed that all demosponge mtDNAs are 16- to 25-kbp circular molecules, containing 13–15 protein genes, 2 rRNA genes, and 2–27 tRNA genes. All but four pairs of sampled genomes had unique gene orders, with the number of shared gene boundaries ranging from 1 to 41. Although most demosponge species displayed low rates of mitochondrial sequence evolution, a significant acceleration in evolutionary rates occurred in the G1 group (orders Dendroceratida, Dictyoceratida, and Verticillitida). Large variation in mtDNA organization was also observed within the G0 group (order Homosclerophorida) including gene rearrangements, loss of tRNA genes, and the presence of two introns in Plakortis angulospiculatus. While introns are rare in modern-day demosponge mtDNA, we inferred that at least one intron was present in cox1 of the common ancestor of all demosponges. Our study uncovered an extensive mitochondrial genomic diversity within the Demospongiae. Although all sampled mitochondrial genomes retained some ancestral features, including a minimally modified genetic code, conserved structures of tRNA genes, and presence of multiple non-coding regions, they vary considerably in their size, gene content, gene order, and the rates of sequence evolution. Some of the changes in demosponge mtDNA, such as the loss of tRNA genes and the appearance of hairpin-containing repetitive elements, occurred in

  16. Interspecific Comparison and annotation of two complete mitochondrial genome sequences from the plant pathogenic fungus Mycosphaerella graminicola

    Energy Technology Data Exchange (ETDEWEB)

    Millenbaugh, Bonnie A; Pangilinan, Jasmyn L.; Torriani, Stefano F.F.; Goodwin, Stephen B.; Kema, Gert H.J.; McDonald, Bruce A.

    2007-12-07

    The mitochondrial genomes of two isolates of the wheat pathogen Mycosphaerella graminicola were sequenced completely and compared to identify polymorphic regions. This organism is of interest because it is phylogenetically distant from other fungi with sequenced mitochondrial genomes and it has shown discordant patterns of nuclear and mitochondrial diversity. The mitochondrial genome of M. graminicola is a circular molecule of approximately 43,960 bp containing the typical genes coding for 14 proteins related to oxidative phosphorylation, one RNA polymerase, two rRNA genes and a set of 27 tRNAs. The mitochondrial DNA of M. graminicola lacks the gene encoding the putative ribosomal protein (rps5-like), commonly found in fungal mitochondrial genomes. Most of the tRNA genes were clustered with a gene order conserved with many other ascomycetes. A sample of thirty-five additional strains representing the known global mt diversity was partially sequenced to measure overall mitochondrial variability within the species. Little variation was found, confirming previous RFLP-based findings of low mitochondrial diversity. The mitochondrial sequence of M. graminicola is the first reported from the family Mycosphaerellaceae or the order Capnodiales. The sequence also provides a tool to better understand the development of fungicide resistance and the conflicting pattern of high nuclear and low mitochondrial diversity in global populations of this fungus.

  17. Mitochondrial gene replacement in primate offspring and embryonic stem cells.

    Science.gov (United States)

    Tachibana, Masahito; Sparman, Michelle; Sritanaudomchai, Hathaitip; Ma, Hong; Clepper, Lisa; Woodward, Joy; Li, Ying; Ramsey, Cathy; Kolotushkina, Olena; Mitalipov, Shoukhrat

    2009-09-17

    Mitochondria are found in all eukaryotic cells and contain their own genome (mitochondrial DNA or mtDNA). Unlike the nuclear genome, which is derived from both the egg and sperm at fertilization, the mtDNA in the embryo is derived almost exclusively from the egg; that is, it is of maternal origin. Mutations in mtDNA contribute to a diverse range of currently incurable human diseases and disorders. To establish preclinical models for new therapeutic approaches, we demonstrate here that the mitochondrial genome can be efficiently replaced in mature non-human primate oocytes (Macaca mulatta) by spindle-chromosomal complex transfer from one egg to an enucleated, mitochondrial-replete egg. The reconstructed oocytes with the mitochondrial replacement were capable of supporting normal fertilization, embryo development and produced healthy offspring. Genetic analysis confirmed that nuclear DNA in the three infants born so far originated from the spindle donors whereas mtDNA came from the cytoplast donors. No contribution of spindle donor mtDNA was detected in offspring. Spindle replacement is shown here as an efficient protocol replacing the full complement of mitochondria in newly generated embryonic stem cell lines. This approach may offer a reproductive option to prevent mtDNA disease transmission in affected families.

  18. Mitochondrial metagenomics: letting the genes out of the bottle.

    Science.gov (United States)

    Crampton-Platt, Alex; Yu, Douglas W; Zhou, Xin; Vogler, Alfried P

    2016-01-01

    'Mitochondrial metagenomics' (MMG) is a methodology for shotgun sequencing of total DNA from specimen mixtures and subsequent bioinformatic extraction of mitochondrial sequences. The approach can be applied to phylogenetic analysis of taxonomically selected taxa, as an economical alternative to mitogenome sequencing from individual species, or to environmental samples of mixed specimens, such as from mass trapping of invertebrates. The routine generation of mitochondrial genome sequences has great potential both for systematics and community phylogenetics. Mapping of reads from low-coverage shotgun sequencing of environmental samples also makes it possible to obtain data on spatial and temporal turnover in whole-community phylogenetic and species composition, even in complex ecosystems where species-level taxonomy and biodiversity patterns are poorly known. In addition, read mapping can produce information on species biomass, and potentially allows quantification of within-species genetic variation. The success of MMG relies on the formation of numerous mitochondrial genome contigs, achievable with standard genome assemblers, but various challenges for the efficiency of assembly remain, particularly in the face of variable relative species abundance and intra-specific genetic variation. Nevertheless, several studies have demonstrated the power of mitogenomes from MMG for accurate phylogenetic placement, evolutionary analysis of species traits, biodiversity discovery and the establishment of species distribution patterns; it offers a promising avenue for unifying the ecological and evolutionary understanding of species diversity.

  19. The complete sequence of mitochondrial genome of Wuzhishan pig (Sus Scrofa).

    Science.gov (United States)

    Chai, Yu-Lan; Xu, Dong; Ma, Hai-Ming

    2016-01-01

    In the present study, we sequenced the complete mitochondrial genome of Wuzhishan pig, which was 16,741 bp in size and had a nucleotide composition in A and T (60.46%). The genome consisted of a major non-coding control region (D-loop region) and 37 genes, including 2 ribosomal RNA (rRNA) genes, 13 protein-coding genes (PCGs), and 22 transfer RNA (tRNA) genes. The genes in the mitochondrial genomes of Wuzhishan pig used three kinds of initiation codons (ATA, ATG, and GTG) and four kinds of termination codons (TAA, AGA, TAG, and an incomplete termination codons T-). The complete mitochondrial genome sequence of Wuzhishan pig provides an important data set for further study on genetic mechanism.

  20. Mitogenomic analyses propose positive selection in mitochondrial genes for high-altitude adaptation in galliform birds.

    Science.gov (United States)

    Zhou, Taicheng; Shen, Xuejuan; Irwin, David M; Shen, Yongyi; Zhang, Yaping

    2014-09-01

    Galliform birds inhabit very diverse habitats, including plateaus that are above 3000 m in altitude. At high altitude, lower temperature and hypoxia are two important factors influencing survival. Mitochondria, as the ultimate oxygen transductor, play an important role in aerobic respiration through oxidative phosphorylation (OXPHOS). We analyzed the mitochondrial genomes of six high-altitude phasianidae birds and sixteen low-altitude relatives in an attempt to determine the role of mitochondrial genes in high-altitude adaptation. We reconstructed the phylogenetic relationships of these phasianidae birds and relatives and found at least four lineages that independently occupied this high-altitude habitat. Selective analyses revealed significant evidence for positive selection in the genes ND2, ND4, and ATP6 in three of the high-altitude lineages. This result strongly suggests that adaptive evolution of mitochondrial genes played a critical role during the independent acclimatization to high altitude by galliform birds.

  1. Frequent mitochondrial gene rearrangements at the hymenopteran nad3-nad5 junction.

    Science.gov (United States)

    Dowton, Mark; Castro, Lyda R; Campbell, Sarah L; Bargon, Sharmilla D; Austin, Andrew D

    2003-05-01

    We characterized the organization of mitochondrial genes from a diverse range of hymenopterans. Of the 21 taxa characterized, 12 had distinct, derived organizations. Some rearrangements were consistent with the duplication-random loss mechanism, while others were not. Local inversions were relatively common, i.e., rearrangements characterized by the movement of genes from one mitochondrial strand to the other, opposite or close to their ancestral position. This type of rearrangement is inconsistent with the duplication/random loss model of mitochondrial gene rearrangement. Instead, they are best explained by the operation of recombination. Taxa with derived organizations were restricted to a single, monophyletic group of wasps, the Apocrita, which comprise about 90% of all hymenopterans.

  2. Screening of PEO1 and mitochondrial genes in sporadic cases of ophthalmoplegia

    Directory of Open Access Journals (Sweden)

    Ashok Singh

    2013-01-01

    Full Text Available Aim: To screen the gene PEO1 and mitochondrial genes in sporadic cases of rare progressive external ophthalmoplegia (PEO patients from North India. Materials and Methods: The nuclear and mitochondrial DNA was isolated from the sporadic PEO patients, and bi-directional sequencing was done in gene PEO1 and mitochondrial genes to capture the mutations relevant to the PEO disease. Results: In the present study, none of the mutations were reported in the coding region of PEO1 gene, while four mutations were observed in mtDNA genes, namely NADH dehydrogenase subunit 2 (ND2, tRNA-Trp, non-coding nucleotides (MT-NC3, and NADH dehydrogenase subunit 5 (MT-ND5. Our study revealed two novel mutations, one in tRNA-Trp and the other in ND2 gene, which may have role in sporadic cases of PEO patients. The absence of novel conserved mutation in tRNA-Trp gene was also confirmed in 110 ethnically matched controls. Conclusion: The sporadic case of PEO disease is not associated with mutations in nuclear gene PEO1. The novel mutation in tRNA-Trp gene and ND2 mutations may have role in the disease.

  3. The complete mitochondrial genome of Plodia interpunctella (Lepidoptera: Pyralidae) and comparison with other Pyraloidea insects.

    Science.gov (United States)

    Liu, Qiu-Ning; Chai, Xin-Yue; Bian, Dan-Dan; Zhou, Chun-Lin; Tang, Bo-Ping

    2016-01-01

    The mitochondrial (mt) genome can provide important information for the understanding of phylogenetic relationships. The complete mt genome of Plodia interpunctella (Lepidoptera: Pyralidae) has been sequenced. The circular genome is 15 287 bp in size, encoding 13 protein-coding genes (PCGs), 2 rRNA genes, 22 tRNA genes, and a control region. The AT skew of this mt genome is slightly negative, and the nucleotide composition is biased toward A+T nucleotides (80.15%). All PCGs start with the typical ATN (ATA, ATC, ATG, and ATT) codons, except for the cox1 gene which may start with the CGA codon. Four of the 13 PCGs harbor the incomplete termination codon T or TA. All the tRNA genes are folded into the typical clover-leaf structure of mitochondrial tRNA, except for trnS1 (AGN) in which the DHU arm fails to form a stable stem-loop structure. The overlapping sequences are 35 bp in total and are found in seven different locations. A total of 240 bp of intergenic spacers are scattered in 16 regions. The control region of the mt genome is 327 bp in length and consisted of several features common to the sequenced lepidopteran insects. Phylogenetic analysis based on 13 PCGs using the Maximum Likelihood method shows that the placement of P. interpunctella was within the Pyralidae.

  4. Inhibition of mitochondrial gene transcription suppresses neurotensin secretion in the human carcinoid cell line BON.

    Science.gov (United States)

    Li, Nan; Wang, Qingding; Li, Jing; Wang, Xiaofu; Hellmich, Mark R; Rajaraman, Srinivasan; Greeley, George H; Townsend, Courtney M; Evers, B Mark

    2005-02-01

    Mitochondria, organelles essential for ATP production, play a central role in a number of cellular functions, including the regulation of insulin secretion. Neurotensin (NT), an important regulatory intestinal hormone, has been implicated in fatty acid translocation, gut motility and secretion, and intestinal cell growth; however, mechanisms regulating NT secretion have not been entirely defined. The purpose of this study was to determine the effect of inhibition of mitochondrial gene transcription on NT secretion. BON cells, a novel human carcinoid cell line that produces and secretes NT peptide and expresses the gene encoding NT (designated NT/N), were treated with ethidium bromide (EB; 0.05, 0.1, and 0.4 microg/ml), an inhibitor of DNA and RNA synthesis, or vehicle over a time course (1-4 days). Cells were then stimulated with either ACh (100 microM) or phorbol 12 myristate,13-acetate (PMA, 10 nM) for 30 min. Media and cells were extracted, and NT peptide measured by RIA. Treatment with EB had no effect on BON cell viability or cell cycle distribution over the 4-day course. In contrast, EB treatment produced a dose-dependent reduction of mitochondrial gene expression; however, NT/N gene expression was not altered. Mitochondrial inhibition by EB treatment suppressed NT secretion induced by ACh and PMA, both in a dose-dependent manner. EB-mediated inhibition of NT secretion and mitochondrial gene expression was reversed with removal of EB. Our results demonstrate that inhibition of mitochondrial gene transcription suppresses both ACh- and PMA-stimulated NT release. These findings are the first to demonstrate that mitochondrial function is important for agonist-mediated NT secretion.

  5. The complete mitochondrial genome of Thamnaconus hypargyreus (Tetraodontiformes: Monacanthidae).

    Science.gov (United States)

    Li, Yufang; Chen, Guobao; Li, Min; Yu, Jie; Wu, Shuiqing; Xiong, Dan; Li, Yongzhen

    2016-01-01

    Lesser-spotted leatherjacket Thamnaconus hypargyreus (Tetraodontiformes: Monacanthidae) is an economically important fish species in the South China Sea. In this study, we designed 15 pairs of primers for amplification of the mitochondrial fragments of T. hypargyreus by PCR. The complete mitogenome sequence has 16,438 bp, containing the usual 2 rRNA genes, 13 protein-coding genes, 22 tRNA genes, and 1 control region, the gene composition and order of which are similar to most of other vertebrates. Most mitochondrial genes except ND6 and eight tRNA genes are encoded on the heavy strand. The overall base composition of the heavy strand is 27.5% A, 26.0% T, 17.4% G, 29.1% C with a slight AT bias of 53.5%. There are 12 regions of gene overlaps totaling 32 bp and 11 intergenic spacer regions totaling 68 bp. This mitogenome sequence data of T. hypargyreus would provide the fundamental genetic data for further conservation genetic studies for this important fish species.

  6. Conservation of the structure and organization of lupin mitochondrial nad3 and rps12 genes.

    Science.gov (United States)

    Rurek, M; Oczkowski, M; Augustyniak, H

    1998-01-01

    A high level of the nucleotide sequence conservation of mitochondrial nad3 and rps12 genes was found in four lupin species. The only differences concern three nucleotides in the Lupinus albus rps12 gene and three nucleotides insertion in the L. mutabilis spacer. Northern blot analysis as well as RT-PCR confirmed cotranscription of the L. luteus genes because the transcripts detected were long enough.

  7. Mitochondrial neurogastrointestinal encephalomyopathy: novel pathogenic mutations in thymidine phosphorylase gene in two Italian brothers.

    Science.gov (United States)

    Libernini, Laura; Lupis, Chiara; Mastrangelo, Mario; Carrozzo, Rosalba; Santorelli, Filippo Maria; Inghilleri, Maurizio; Leuzzi, Vincenzo

    2012-08-01

    Mitochondrial neurogastrointestinal encephalomyopathy (MNGIE, MIM 603041) is an autosomal recessive multisystem disorder occurring due to mutations in a nuclear gene coding for the enzyme thymidine phosphorylase (TYMP). Clinical features of MNGIE include gastrointestinal dysmotility, cachexia, ptosis or ophthalmoparesis, peripheral neuropathy, diffuse leukoencephalopathy, and signs of mitochondrial dysfunction in tissues. We report the clinical and molecular findings in two brothers in whom novel TYMP gene mutations (c.215-13_215delinsGCGTGA; c.1159 + 2T > A) were associated with different clinical presentations and outcomes.

  8. Isolated respiratory chain enzyme deficiency in patients with a mitochondrial (encephalo-) myopathy: Sequence analysis of the mitochondrial complex and IV genes

    Energy Technology Data Exchange (ETDEWEB)

    Vries, D. de; Coo, I. de; Buddiger, P. [University Hospital Nijmegen (Netherlands)] [and others

    1994-09-01

    The mitochondrial respiratory chain consists of four enzyme complexes. Deficiencies of complex I (NADH dehydrogenase) and complex IV (cytochrome c oxidase) are frequently found in muscle biopsies from patients with a mitochondrial (encephalo-)myopathy. Mutations in the mitochondrial-encoded subunits have been observed in a number of different mitochondrial (encephalo-)myophathies. We screened eight mitochondrial (encephalo-)myopathy patients with an isolated complex I deficiency for mutations in the ND genes by direct sequencing. No abnormality was detected. We also studied 9 mitochondrial (encephalo-)myopathy patients and an isolated complex IV deficiency. In the muscle biopsy of one patient a novel heteroplasmic mutation (T {r_arrow} C) at nucleotide position 6681 was found in the mitochondrial COX I gene. This mutation led to the substitution of a conserved Tyr for His. As this mutation changed the secondary structure of the protein and was not found in the healthy mother, we consider it likely that this mutation is pathological. In the other patients no abnormality was detected. Therefore, mutations in the mitochondrially-encoded subunits are not a frequent cause of isolated respiratory chain enzyme deficiency.

  9. Complete mitochondrial genome of the mudskipper Boleophthalmus boddarti (Perciformes, Gobiidae).

    Science.gov (United States)

    Zhang, Yu Ting; Ghaffar, Mazlan Abd; Li, Zhe; Chen, Wei; Chen, Shi Xi; Hong, Wan Shu

    2016-01-01

    The Boddart's goggle-eyed mudskipper, Boleophthalmus boddarti (Perciformes, Gobiidae) is an amphibious fish, inhabiting brackish waters of estuaries and builds burrows in soft mud along the intertidal zone. In this paper, the complete mitochondrial genome sequence of B. boddarti was firstly determined. The circle genome (16,727 bp) comprises 13 protein-coding genes, 22 tRNA genes, 2 rRNA genes and 1 control region. The overall base composition of B. boddarti is 29.1% for C, 28.9% for A, 25.9% for T, and 16.0% for G, with a slight A + T bias of 54.8%. The termination-associated sequence, conserved sequence block domains, and a 131-bp tandem repeat were found in the control region. It has the typical vertebrate mitochondrial gene arrangement.

  10. Accelerated evolution of mitochondrial but not nuclear genomes of Hymenoptera: new evidence from crabronid wasps.

    Directory of Open Access Journals (Sweden)

    Martin Kaltenpoth

    Full Text Available Mitochondrial genes in animals are especially useful as molecular markers for the reconstruction of phylogenies among closely related taxa, due to the generally high substitution rates. Several insect orders, notably Hymenoptera and Phthiraptera, show exceptionally high rates of mitochondrial molecular evolution, which has been attributed to the parasitic lifestyle of current or ancestral members of these taxa. Parasitism has been hypothesized to entail frequent population bottlenecks that increase rates of molecular evolution by reducing the efficiency of purifying selection. This effect should result in elevated substitution rates of both nuclear and mitochondrial genes, but to date no extensive comparative study has tested this hypothesis in insects. Here we report the mitochondrial genome of a crabronid wasp, the European beewolf (Philanthus triangulum, Hymenoptera, Crabronidae, and we use it to compare evolutionary rates among the four largest holometabolous insect orders (Coleoptera, Diptera, Hymenoptera, Lepidoptera based on phylogenies reconstructed with whole mitochondrial genomes as well as four single-copy nuclear genes (18S rRNA, arginine kinase, wingless, phosphoenolpyruvate carboxykinase. The mt-genome of P. triangulum is 16,029 bp in size with a mean A+T content of 83.6%, and it encodes the 37 genes typically found in arthropod mt genomes (13 protein-coding, 22 tRNA, and two rRNA genes. Five translocations of tRNA genes were discovered relative to the putative ancestral genome arrangement in insects, and the unusual start codon TTG was predicted for cox2. Phylogenetic analyses revealed significantly longer branches leading to the apocritan Hymenoptera as well as the Orussoidea, to a lesser extent the Cephoidea, and, possibly, the Tenthredinoidea than any of the other holometabolous insect orders for all mitochondrial but none of the four nuclear genes tested. Thus, our results suggest that the ancestral parasitic lifestyle of

  11. Extreme mitochondrial evolution in the ctenophore Mnemiopsis leidyi: Insight from mtDNA and the nuclear genome.

    Science.gov (United States)

    Pett, Walker; Ryan, Joseph F; Pang, Kevin; Mullikin, James C; Martindale, Mark Q; Baxevanis, Andreas D; Lavrov, Dennis V

    2011-08-01

    Recent advances in sequencing technology have led to a rapid accumulation of mitochondrial DNA (mtDNA) sequences, which now represent the wide spectrum of animal diversity. However, one animal phylum--Ctenophora--has, to date, remained completely unsampled. Ctenophores, a small group of marine animals, are of interest due to their unusual biology, controversial phylogenetic position, and devastating impact as invasive species. Using data from the Mnemiopsis leidyi genome sequencing project, we Polymerase Chain Reaction (PCR) amplified and analyzed its complete mitochondrial (mt-) genome. At just over 10 kb, the mt-genome of M. leidyi is the smallest animal mtDNA ever reported and is among the most derived. It has lost at least 25 genes, including atp6 and all tRNA genes. We show that atp6 has been relocated to the nuclear genome and has acquired introns and a mitochondrial targeting presequence, while tRNA genes have been genuinely lost, along with nuclear-encoded mt-aminoacyl tRNA synthetases. The mt-genome of M. leidyi also displays extremely high rates of sequence evolution, which likely led to the degeneration of both protein and rRNA genes. In particular, encoded rRNA molecules possess little similarity with their homologs in other organisms and have highly reduced secondary structures. At the same time, nuclear encoded mt-ribosomal proteins have undergone expansions, likely to compensate for the reductions in mt-rRNA. The unusual features identified in M. leidyi mtDNA make this organism an interesting system for the study of various aspects of mitochondrial biology, particularly protein and tRNA import and mt-ribosome structures, and add to its value as an emerging model species. Furthermore, the fast-evolving M. leidyi mtDNA should be a convenient molecular marker for species- and population-level studies.

  12. Extreme Mitochondrial Evolution in the Ctenophore Mnemiopsis leidyi: Insights from mtDNA and the Nuclear Genome

    Science.gov (United States)

    Pett, Walker; Ryan, Joseph F.; Pang, Kevin; Mullikin, James C.; Martindale, Mark Q.; Baxevanis, Andreas D.; Lavrov, Dennis V.

    2012-01-01

    Recent advances in sequencing technology have led to a rapid accumulation of mitochondrial DNA (mtDNA) sequences, which now represent the wide spectrum of animal diversity. However, one animal phylum – Ctenophora – has, to date, remained completely unsampled. Ctenophores, a small group of marine animals, are of interest due to their unusual biology, controversial phylogenetic position, and devastating impact as an invasive species. Using data from the Mnemiopsis leidyi genome sequencing project, we PCR amplified and analyzed its complete mitochondrial (mt-) genome. At just over 10kb, the mt-genome of M. leidyi is the smallest animal mtDNA ever reported and is among the most derived. It has lost at least 25 genes, including atp6 and all tRNA genes. We show that atp6 has been relocated to the nuclear genome and has acquired introns and a mitochondrial targeting presequence, while tRNA genes have been genuinely lost, along with nuclear-encoded mt-aminoacyl tRNA synthetases. The mt-genome of M. leidyi also displays extremely high rates of sequence evolution, which likely led to the degeneration of both protein and rRNA genes. In particular, encoded rRNA molecules possess little similarity with their homologues in other organisms and have highly reduced secondary structures. At the same time, nuclear encoded mt-ribosomal proteins have undergone expansions, probably to compensate for the reductions in mt-rRNA. The unusual features identified in M. leidyi mtDNA make this organism an interesting system for the study of various aspects of mitochondrial biology, particularly protein and tRNA import and mt-ribosome structures, and add to its value as an emerging model species. Furthermore, the fast-evolving M. leidyi mtDNA should be a convenient molecular marker for species- and population-level studies. PMID:21985407

  13. The plant mitochondrial mat-r gene/nad1 gene complex

    Energy Technology Data Exchange (ETDEWEB)

    Wolstenhome, D.R.

    1996-12-31

    We have completed sequencing segments of the maize mitochondrial (mt) DNA that contains all five of the exons (A-E) of the gene (nad1) for subunit I of the respiratory chain NADH dehydrogenase. Analysis of these sequences indicates that exons B and C are joined by a continuous group II intron, but the remaining exons are associated with partial group II introns and are encoded at widely separated locations in the maize mtDNA molecule. We have shown that mature transcripts of the maize nad1 gene contain 23 edited nucleotides, and that transcripts of maize and soybean mat-r genes contain 15 and 14 edits, respectively. The majority of edits in nad1 transcripts result in amino acid replacements that increase similarity between the maize NAD1 protein and NAD1 proteins of other plant species and of animal species. We found that the intron between exons b and c is not edited. From data obtained using PCR and sequencing we have shown that transcripts containing all possible exon combinations exist in maize mitochondria.

  14. DNA adenine methyltransferase (Dam) controls the expression of the cytotoxic enterotoxin (act) gene of Aeromonas hydrophila via tRNA modifying enzyme-glucose-inhibited division protein (GidA).

    Science.gov (United States)

    Erova, Tatiana E; Kosykh, Valeri G; Sha, Jian; Chopra, Ashok K

    2012-05-01

    Aeromonas hydrophila is both a human and animal pathogen, and the cytotoxic enterotoxin (Act) is a crucial virulence factor of this bacterium because of its associated hemolytic, cytotoxic, and enterotoxic activities. Previously, to define the role of some regulatory genes in modulating Act production, we showed that deletion of a glucose-inhibited division gene (gidA) encoding tRNA methylase reduced Act levels, while overproduction of DNA adenine methyltransferase (Dam) led to a concomitant increase in Act-associated biological activities of a diarrheal isolate SSU of A. hydrophila. Importantly, there are multiple GATC binding sites for Dam within an upstream sequence of the gidA gene and one such target site in the act gene upstream region. We showed the dam gene to be essential for the viability of A. hydrophila SSU, and, therefore, to better understand the interaction of the encoding genes, Dam and GidA, in act gene regulation, we constructed a gidA in-frame deletion mutant of Escherichia coli GM28 (dam(+)) and GM33 (∆dam) strains. We then tested the expressional activity of the act and gidA genes by using a promoterless pGlow-TOPO vector containing a reporter green fluorescent protein (GFP). Our data indicated that in GidA(+) strains of E. coli, constitutive methylation of the GATC site(s) by Dam negatively regulated act and gidA gene expression as measured by GFP production. However, in the ∆gidA strains, irrespective of the presence or absence of constitutively active Dam, we did not observe any alteration in the expression of the act gene signifying the role of GidA in positively regulating Act production. To determine the exact mechanism of how Dam and GidA influence Act, a real-time quantitative PCR (RT-qPCR) assay was performed. The analysis indicated an increase in gidA and act gene expression in the A. hydrophila Dam-overproducing strain, and these data matched with Act production in the E. coli GM28 strain. Thus, the extent of DNA methylation

  15. Gene arrangement convergence, diverse intron content, and genetic code modifications in mitochondrial genomes of sphaeropleales (chlorophyta).

    Science.gov (United States)

    Fučíková, Karolina; Lewis, Paul O; González-Halphen, Diego; Lewis, Louise A

    2014-08-08

    The majority of our knowledge about mitochondrial genomes of Viridiplantae comes from land plants, but much less is known about their green algal relatives. In the green algal order Sphaeropleales (Chlorophyta), only one representative mitochondrial genome is currently available-that of Acutodesmus obliquus. Our study adds nine completely sequenced and three partially sequenced mitochondrial genomes spanning the phylogenetic diversity of Sphaeropleales. We show not only a size range of 25-53 kb and variation in intron content (0-11) and gene order but also conservation of 13 core respiratory genes and fragmented ribosomal RNA genes. We also report an unusual case of gene arrangement convergence in Neochloris aquatica, where the two rns fragments were secondarily placed in close proximity. Finally, we report the unprecedented usage of UCG as stop codon in Pseudomuriella schumacherensis. In addition, phylogenetic analyses of the mitochondrial protein-coding genes yield a fully resolved, well-supported phylogeny, showing promise for addressing systematic challenges in green algae. © The Author(s) 2014. Published by Oxford University Press on behalf of the Society for Molecular Biology and Evolution.

  16. Peripheral neuropathy predicts nuclear gene defect in patients with mitochondrial ophthalmoplegia.

    Science.gov (United States)

    Horga, Alejandro; Pitceathly, Robert D S; Blake, Julian C; Woodward, Catherine E; Zapater, Pedro; Fratter, Carl; Mudanohwo, Ese E; Plant, Gordon T; Houlden, Henry; Sweeney, Mary G; Hanna, Michael G; Reilly, Mary M

    2014-12-01

    Progressive external ophthalmoplegia is a common clinical feature in mitochondrial disease caused by nuclear DNA defects and single, large-scale mitochondrial DNA deletions and is less frequently associated with point mutations of mitochondrial DNA. Peripheral neuropathy is also a frequent manifestation of mitochondrial disease, although its prevalence and characteristics varies considerably among the different syndromes and genetic aetiologies. Based on clinical observations, we systematically investigated whether the presence of peripheral neuropathy could predict the underlying genetic defect in patients with progressive external ophthalmoplegia. We analysed detailed demographic, clinical and neurophysiological data from 116 patients with genetically-defined mitochondrial disease and progressive external ophthalmoplegia. Seventy-eight patients (67%) had a single mitochondrial DNA deletion, 12 (10%) had a point mutation of mitochondrial DNA and 26 (22%) had mutations in either POLG, C10orf2 or RRM2B, or had multiple mitochondrial DNA deletions in muscle without an identified nuclear gene defect. Seventy-seven patients had neurophysiological studies; of these, 16 patients (21%) had a large-fibre peripheral neuropathy. The prevalence of peripheral neuropathy was significantly lower in patients with a single mitochondrial DNA deletion (2%) as compared to those with a point mutation of mitochondrial DNA or with a nuclear DNA defect (44% and 52%, respectively; Pneuropathy as the only independent predictor associated with a nuclear DNA defect (P=0.002; odds ratio 8.43, 95% confidence interval 2.24-31.76). Multinomial logistic regression analysis identified peripheral neuropathy, family history and hearing loss as significant predictors of the genotype, and the same three variables showed the highest performance in genotype classification in a decision tree analysis. Of these variables, peripheral neuropathy had the highest specificity (91%), negative predictive value

  17. Octocoral mitochondrial genomes provide insights into the phylogenetic history of gene order rearrangements, order reversals, and cnidarian phylogenetics.

    Science.gov (United States)

    Figueroa, Diego F; Baco, Amy R

    2014-12-24

    We use full mitochondrial genomes to test the robustness of the phylogeny of the Octocorallia, to determine the evolutionary pathway for the five known mitochondrial gene rearrangements in octocorals, and to test the suitability of using mitochondrial genomes for higher taxonomic-level phylogenetic reconstructions. Our phylogeny supports three major divisions within the Octocorallia and show that Paragorgiidae is paraphyletic, with Sibogagorgia forming a sister branch to the Coralliidae. Furthermore, Sibogagorgia cauliflora has what is presumed to be the ancestral gene order in octocorals, but the presence of a pair of inverted repeat sequences suggest that this gene order was not conserved but rather evolved back to this apparent ancestral state. Based on this we recommend the resurrection of the family Sibogagorgiidae to fix the paraphyly of the Paragorgiidae. This is the first study to show that in the Octocorallia, mitochondrial gene orders have evolved back to an ancestral state after going through a gene rearrangement, with at least one of the gene orders evolving independently in different lineages. A number of studies have used gene boundaries to determine the type of mitochondrial gene arrangement present. However, our findings suggest that this method known as gene junction screening may miss evolutionary reversals. Additionally, substitution saturation analysis demonstrates that while whole mitochondrial genomes can be used effectively for phylogenetic analyses within Octocorallia, their utility at higher taxonomic levels within Cnidaria is inadequate. Therefore for phylogenetic reconstruction at taxonomic levels higher than subclass within the Cnidaria, nuclear genes will be required, even when whole mitochondrial genomes are available.

  18. Characterization of the complete mitochondrial genome of the giant silkworm moth, Eriogyna pyretorum (Lepidoptera: Saturniidae).

    Science.gov (United States)

    Jiang, Shao-Tong; Hong, Gui-Yun; Yu, Miao; Li, Na; Yang, Ying; Liu, Yan-Qun; Wei, Zhao-Jun

    2009-05-22

    The complete mitochondrial genome (mitogenome) of Eriogyna pyretorum (Lepidoptera: Saturniidae) was determined as being composed of 15,327 base pairs (bp), including 13 protein-coding genes (PCGs), 2 rRNA genes, 22 tRNA genes, and a control region. The arrangement of the PCGs is the same as that found in the other sequenced lepidopteran. The AT skewness for the E. pyretorum mitogenome is slightly negative (-0.031), indicating the occurrence of more Ts than As. The nucleotide composition of the E. pyretorum mitogenome is also biased toward A + T nucleotides (80.82%). All PCGs are initiated by ATN codons, except for cytochrome c oxidase subunit 1 and 2 (cox1 and cox2). Two of the 13 PCGs harbor the incomplete termination codon by T. All tRNA genes have a typical clover-leaf structure of mitochondrial tRNA, with the exception of trnS1(AGN) and trnS2(UCN). Phylogenetic analysis among the available lepidopteran species supports the current morphology-based hypothesis that Bombycoidea, Geometroidea, Notodontidea, Papilionoidea and Pyraloidea are monophyletic. As has been previously suggested, Bombycidae (Bombyx mori and Bombyx mandarina), Sphingoidae (Manduca sexta) and Saturniidae (Antheraea pernyi, Antheraea yamamai, E. pyretorum and Caligula boisduvalii) formed a group.

  19. RNA editing of 10 Didymium iridis mitochondrial genes and comparison with the homologous genes in Physarum polycephalum.

    Science.gov (United States)

    Traphagen, Stephen J; Dimarco, Michael J; Silliker, Margaret E

    2010-04-01

    Regions of the Didymium iridis mitochondrial genome were identified with similarity to typical mitochondrial genes; however, these regions contained numerous stop codons. We used RT-PCR and DNA sequencing to determine whether, through RNA editing, these regions were transcribed into mRNAs that could encode functional proteins. Ten putative gene regions were examined: atp1, atp6, atp8, atp9, cox1, cox2, cytb, nad4L, nad6, and nad7. The cDNA sequences of each gene could encode a functional mitochondrial protein that was highly conserved compared with homologous genes. The type of editing events and editing sequence features were very similar to those observed in the homologous genes of Physarum polycephalum, though the actual editing locations showed a variable degree of conservation. Edited sites were compared with encoded sites in D. iridis and P. polycephalum for all 10 genes. Edited sequence for a portion of the cox1 gene was available for six myxomycetes, which, when compared, showed a high degree of conservation at the protein level. Different types of editing events showed varying degrees of site conservation with C-to-U base changes being the least conserved. Several aspects of single C insertion editing events led to the preferential creation of hydrophobic amino acid codons that may help to minimize adverse effects on the resulting protein structure.

  20. RNA editing of 10 Didymium iridis mitochondrial genes and comparison with the homologous genes in Physarum polycephalum

    Science.gov (United States)

    Traphagen, Stephen J.; Dimarco, Michael J.; Silliker, Margaret E.

    2010-01-01

    Regions of the Didymium iridis mitochondrial genome were identified with similarity to typical mitochondrial genes; however, these regions contained numerous stop codons. We used RT-PCR and DNA sequencing to determine whether, through RNA editing, these regions were transcribed into mRNAs that could encode functional proteins. Ten putative gene regions were examined: atp1, atp6, atp8, atp9, cox1, cox2, cytb, nad4L, nad6, and nad7. The cDNA sequences of each gene could encode a functional mitochondrial protein that was highly conserved compared with homologous genes. The type of editing events and editing sequence features were very similar to those observed in the homologous genes of Physarum polycephalum, though the actual editing locations showed a variable degree of conservation. Edited sites were compared with encoded sites in D. iridis and P. polycephalum for all 10 genes. Edited sequence for a portion of the cox1 gene was available for six myxomycetes, which, when compared, showed a high degree of conservation at the protein level. Different types of editing events showed varying degrees of site conservation with C-to-U base changes being the least conserved. Several aspects of single C insertion editing events led to the preferential creation of hydrophobic amino acid codons that may help to minimize adverse effects on the resulting protein structure. PMID:20159952

  1. Deleterious mutation in FDX1L gene is associated with a novel mitochondrial muscle myopathy.

    Science.gov (United States)

    Spiegel, Ronen; Saada, Ann; Halvardson, Jonatan; Soiferman, Devorah; Shaag, Avraham; Edvardson, Simon; Horovitz, Yoseph; Khayat, Morad; Shalev, Stavit A; Feuk, Lars; Elpeleg, Orly

    2014-07-01

    Isolated metabolic myopathies encompass a heterogeneous group of disorders, with mitochondrial myopathies being a subgroup, with depleted skeletal muscle energy production manifesting either by recurrent episodes of myoglobinuria or progressive muscle weakness. In this study, we investigated the genetic cause of a patient from a consanguineous family who presented with adolescent onset autosomal recessive mitochondrial myopathy. Analysis of enzyme activities of the five respiratory chain complexes in our patients' skeletal muscle showed severely impaired activities of iron sulfur (Fe-S)-dependent complexes I, II and III and mitochondrial aconitase. We employed exome sequencing combined with homozygosity mapping to identify a homozygous mutation, c.1A>T, in the FDX1L gene, which encodes the mitochondrial ferredoxin 2 (Fdx2) protein. The mutation disrupts the ATG initiation translation site resulting in severe reduction of Fdx2 content in the patient muscle and fibroblasts mitochondria. Fdx2 is the second component of the Fe-S cluster biogenesis machinery, the first being IscU that is associated with isolated mitochondrial myopathy. We suggest adding genetic analysis of FDX1L in cases of mitochondrial myopathy especially when associated with reduced activity of the respiratory chain complexes I, II and III.

  2. New genes and pathomechanisms in mitochondrial disorders unraveled by NGS technologies.

    Science.gov (United States)

    Legati, Andrea; Reyes, Aurelio; Nasca, Alessia; Invernizzi, Federica; Lamantea, Eleonora; Tiranti, Valeria; Garavaglia, Barbara; Lamperti, Costanza; Ardissone, Anna; Moroni, Isabella; Robinson, Alan; Ghezzi, Daniele; Zeviani, Massimo

    2016-08-01

    Next Generation Sequencing (NGS) technologies are revolutionizing the diagnostic screening for rare disease entities, including primary mitochondrial disorders, particularly those caused by nuclear gene defects. NGS approaches are able to identify the causative gene defects in small families and even single individuals, unsuitable for investigation by traditional linkage analysis. These technologies are contributing to fill the gap between mitochondrial disease cases defined on the basis of clinical, neuroimaging and biochemical readouts, which still outnumber by approximately 50% the cases for which a molecular-genetic diagnosis is attained. We have been using a combined, two-step strategy, based on targeted genes panel as a first NGS screening, followed by whole exome sequencing (WES) in still unsolved cases, to analyze a large cohort of subjects, that failed to show mutations in mtDNA and in ad hoc sets of specific nuclear genes, sequenced by the Sanger's method. Not only this approach has allowed us to reach molecular diagnosis in a significant fraction (20%) of these difficult cases, but it has also revealed unexpected and conceptually new findings. These include the possibility of marked variable penetrance of recessive mutations, the identification of large-scale DNA rearrangements, which explain spuriously heterozygous cases, and the association of mutations in known genes with unusual, previously unreported clinical phenotypes. Importantly, WES on selected cases has unraveled the presence of pathogenic mutations in genes encoding non-mitochondrial proteins (e.g. the transcription factor E4F1), an observation that further expands the intricate genetics of mitochondrial disease and suggests a new area of investigation in mitochondrial medicine. This article is part of a Special Issue entitled 'EBEC 2016: 19th European Bioenergetics Conference, Riva del Garda, Italy, July 2-6, 2016', edited by Prof. Paolo Bernardi.

  3. Rice Mitochondrial Genes Are Transcribed by Multiple Promoters That Are Highly Diverged

    Institute of Scientific and Technical Information of China (English)

    Qun-Yu Zhang; Yao-Guang Liu

    2006-01-01

    Plant mitochondrial genes are often transcribed into complex sets of mRNA. To characterize the transcription initiation and promoter structure, the transcript termini of four mitochondrial genes, atp1, atp6, cob,rps7, in rice (Oryza sativa L.), were determined by using a modified circularized RNA reverse transcriptionpolymerase chain reaction method. The results revealed that three genes (atp1, atp6, rps7) were transcribed from multiple initiation sites, indicating the presence of multiple promoters. Two transcription termination sites were detected in three genes (atp6, cob, rps7), respectively. Analysis on the promoter architecture showed that the YRTA (Y=T or C, R=A or G) motifs that are widely present in the mitochondrial promoters of other monocot and dicot plant species were detected only in two of the 12 analyzed promoters.Our data suggest that the promoter sequences in the rice mitochondrial genome are highly diverged in comparison to those in other plants, and the YRTA motif is not an essential element for the promoter activity.

  4. Phylogenetic analyses of basal angiosperms based on nine plastid, mitochondrial, and nuclear genes

    NARCIS (Netherlands)

    Qiu, Y.L.; Dombrovska, O.; Lee, J.; Li, L.; Whitlock, B.A.; Bernasconi-Quadroni, F.; Rest, J.S.; Davis, C.C.; Borsch, T.; Hilu, K.W.; Renner, S.S.; Soltis, D.E.; Soltis, P.E.; Zanis, M.J.; Cannone, J.J.; Powell, M.; Savolainen, V.; Chatrou, L.W.; Chase, M.W.

    2005-01-01

    DNA sequences of nine genes (plastid: atpB, matK, and rbcL; mitochondrial: atp1, matR, mtSSU, and mtLSU; nuclear: 18S and 26S rDNAs) from 100 species of basal angiosperms and gymnosperms were analyzed using parsimony, Bayesian, and maximum likelihood methods. All of these analyses support the follow

  5. Host mitochondrial association evolved in the human parasite Toxoplasma gondii via neofunctionalization of a gene duplicate

    Science.gov (United States)

    In Toxoplasma gondii, an intracellular parasite of humans and other warm-blooded animals, the ability to associate with host mitochondria (HMA) is driven by a locally expanded gene family that encodes multiple mitochondrial association factor 1 (MAF1) proteins. The importance of copy number in the e...

  6. Phylogenetic analyses of basal angiosperms based on nine plastid, mitochondrial, and nuclear genes

    NARCIS (Netherlands)

    Qiu, Y.L.; Dombrovska, O.; Lee, J.; Li, L.; Whitlock, B.A.; Bernasconi-Quadroni, F.; Rest, J.S.; Davis, C.C.; Borsch, T.; Hilu, K.W.; Renner, S.S.; Soltis, D.E.; Soltis, P.E.; Zanis, M.J.; Cannone, J.J.; Powell, M.; Savolainen, V.; Chatrou, L.W.; Chase, M.W.

    2005-01-01

    DNA sequences of nine genes (plastid: atpB, matK, and rbcL; mitochondrial: atp1, matR, mtSSU, and mtLSU; nuclear: 18S and 26S rDNAs) from 100 species of basal angiosperms and gymnosperms were analyzed using parsimony, Bayesian, and maximum likelihood methods. All of these analyses support the

  7. Complete sequence of the mitochondrial genome of Odontamblyopus rubicundus (Perciformes: Gobiidae): genome characterization and phylogenetic analysis

    Indian Academy of Sciences (India)

    Tianxing Liu; Xiaoxiao Jin; Rixin Wang; Tianjun Xu

    2013-12-01

    Odontamblyopus rubicundus is a species of gobiid fishes, inhabits muddy-bottomed coastal waters. In this paper, the first complete mitochondrial genome sequence of O. rubicundus is reported. The complete mitochondrial genome sequence is 17119 bp in length and contains 13 protein-coding genes, two rRNA genes, 22 tRNA genes, a control region and an L-strand origin as in other teleosts. Most mitochondrial genes are encoded on H-strand except for ND6 and seven tRNA genes. Some overlaps occur in protein-coding genes and tRNAs ranging from 1 to 7 bp. The possibly nonfunctional L-strand origin folded into a typical stem-loop secondary structure and a conserved motif (5′-GCCGG-3′) was found at the base of the stem within the $tRNA^{Cys}$ gene. The TAS, CSB-2 and CSB-3 could be detected in the control region. However, in contrast to most of other fishes, the central conserved sequence block domain and the CSB-1 could not be recognized in O. rubicundus, which is consistent with Acanthogobius hasta (Gobiidae). In addition, phylogenetic analyses based on different sequences of species of Gobiidae and different methods showed that the classification of O. rubicundus into Odontamblyopus due to morphology is debatable.

  8. Characterization of the complete mitochondrial genome of the black cutworm Agrotis ipsilon (Lepidoptera: Noctuidae).

    Science.gov (United States)

    Wu, Qiu-Ling; Cui, Wen-Xia; Wei, Shu-Jun

    2015-02-01

    The complete mitochondrial genome of the black cutworm Agrotis ipsilon (Lepidoptera: Noctuidae) was determined (GenBank accession No. KF163965). The length of this mitochondrial genome is 15,377 bp with an A + T content of 82.5%. There are 37 typical animal mitochondrial genes, that is, 13 protein-coding, 2 rRNA and 22 tRNA gene and an A + T-rich region. The tRNA gene trnM was rearranged to the upstream of the trnI-trnQ-trnM cluster compared with the pupative ancestral arrangement of insects. All protein-coding genes start with ATN start codon except for the gene cox1, which uses CGA as in other lepidopteran species. Ten protein-coding genes stop with termination codon TAA, whereas three protein-coding gene use incomplete stop codon T. The A + T-region is located between rrnS and trnM with a length of 332 bp and A + T content of 94.88%.

  9. Complete sequence of the mitochondrial genome of Odontamblyopus rubicundus (Perciformes: Gobiidae): genome characterization and phylogenetic analysis.

    Science.gov (United States)

    Liu, Tianxing; Jin, Xiaoxiao; Wang, Rixin; Xu, Tianjun

    2013-12-01

    Odontamblyopus rubicundus is a species of gobiid fishes, inhabits muddy-bottomed coastal waters. In this paper, the first complete mitochondrial genome sequence of O. rubicundus is reported. The complete mitochondrial genome sequence is 17119 bp in length and contains 13 protein-coding genes, two rRNA genes, 22 tRNA genes, a control region and an L-strand origin as in other teleosts. Most mitochondrial genes are encoded on H-strand except for ND6 and seven tRNA genes. Some overlaps occur in protein-coding genes and tRNAs ranging from 1 to 7 bp. The possibly nonfunctional L-strand origin folded into a typical stem-loop secondary structure and a conserved motif (5'-GCCGG-3') was found at the base of the stem within the tRNACys gene. The TAS, CSB-2 and CSB-3 could be detected in the control region. However, in contrast to most of other fishes, the central conserved sequence block domain and the CSB-1 could not be recognized in O. rubicundus, which is consistent with Acanthogobius hasta (Gobiidae). In addition, phylogenetic analyses based on different sequences of species of Gobiidae and different methods showed that the classification of O. rubicundus into Odontamblyopus due to morphology is debatable.

  10. Increased Incidence of Mitochondrial Cytochrome C Oxidase 1 Gene Mutations in Patients with Primary Ovarian Insufficiency.

    Directory of Open Access Journals (Sweden)

    Xiumei Zhen

    Full Text Available Primary ovarian insufficiency (POI, also known as premature ovarian failure (POF, is defined as more than six months of cessation of menses before the age of 40 years, with two serum follicle stimulating hormone (FSH levels (at least 1 month apart falling in the menopause range. The cause of POI remains undetermined in the majority of cases, although some studies have reported increased levels of reactive oxygen species (ROS in idiopathic POF. The role of mitochondrial DNA in the pathogenesis of POI has not been studied extensively. This aim of this study was to uncover underlying mitochondrial genetic defects in patients with POI. The entire region of the mitochondrial genome was amplified in subjects with idiopathic POI (n=63 and age-matched healthy female controls (n=63 using nine pair sets of primers, followed by screening of the mitochondrial genome using an Illumina MiSeq. We identified a total of 96 non-synonymous mitochondrial variations in POI patients and 93 non-synonymous variations in control subjects. Of these, 21 (9 in POI and 12 in control non-synonymous variations had not been reported previously. Eight mitochondrial cytochrome coxidase 1 (MT-CO1 missense variants were identified in POI patients, whereas only four missense mutations were observed in controls. A high incidence of MT-CO1 missense variants were identified in POI patients compared with controls, and the difference between the groups was statistically significant (13/63 vs. 5/63, p=0.042. Our results show that patients with primary ovarian insufficiency exhibit an increased incidence of mitochondrial cytochrome c oxidase 1 gene mutations, suggesting that MT-CO1 gene mutation may be causal in POI.

  11. The yeast VAS1 gene encodes both mitochondrial and cytoplasmic valyl-tRNA synthetases.

    Science.gov (United States)

    Chatton, B; Walter, P; Ebel, J P; Lacroute, F; Fasiolo, F

    1988-01-05

    S1 mapping on the VAS1 structural gene indicates the existence of two classes of transcripts initiating at distinct in-frame translation start codons. The longer class of VAS1 transcripts initiates upstream of both ATG codons located 138 base pairs away and the shorter class downstream of the first ATG. A mutation that destroys the first AUG on the long message results in respiratory deficiency but does not affect viability. Mutation of the ATG at position 139 leads to lethality because the initiating methionine codon of the essential cytoplasmic valyl-tRNA synthetase has been destroyed. N-terminal protein sequence data further confirm translation initiation at ATG-139 for the cytoplasmic valyl-tRNA synthetase. From these results, we conclude that the VAS1 single gene encodes both mitochondrial and cytoplasmic valyl-tRNA synthetases. The presequence of the mitochondrial valyl-tRNA synthetase shows amino acid composition but not the amphiphilic character of imported mitochondrial proteins. From mutagenesis of the ATG-139 we conclude that the presequence specifically targets the cytoplasmically synthesized mitochondrial valyl-tRNA synthetase to the mitochondrial outer membrane and prevents binding of the enzyme core to cytoplasmic tRNAVal.

  12. Cloning, expression, and chromosomal assignment of the human mitochondrial intermediate peptidase gene (MIPEP).

    Science.gov (United States)

    Chew, A; Buck, E A; Peretz, S; Sirugo, G; Rinaldo, P; Isaya, G

    1997-03-15

    The mitochondrial intermediate peptidase of Saccharomyces cerevisiae (YMIP) is a component of the yeast mitochondrial protein import machinery critically involved in the biogenesis of the oxidative phosphorylation (OXPHOS) system. This leader peptidase removes specific octapeptides from the amino terminus of nuclear-encoded OXPHOS subunits and components of the mitochondrial genetic apparatus. To address the biologic role of the human peptidase [MIPEP gene, HMIP polypeptide], we have initiated its molecular and functional characterization. A full-length cDNA was isolated by screening a human liver library using a rat MIP (RMIP) cDNA as a probe. The encoded protein contained a typical mitochondrial leader peptide and showed 92 and 54% homology to RMIP and YMIP, respectively. A survey of human mitochondrial protein precursors revealed that, similar to YMIP, HMIP is primarily involved in the maturation of OXPHOS-related proteins. Northern analysis showed that the MIPEP gene is differentially expressed in human tissues, with the highest levels of expression in the heart, skeletal muscle, and pancreas, three organ systems that are frequently affected in OXPHOS disorders. Using fluorescence in situ hybridization, the MIPEP locus was assigned to 13q12. This information offers the possibility of testing the potential involvement of HMIP in the pathophysiology of nuclear-driven OXPHOS disorders.

  13. Lipophilic proteins encoded by mitochondrial and nuclear genes in Neurospora crassa.

    Science.gov (United States)

    Küntzel, H; Pieniaźek, N J; Pieniaźek, D; Leister, D E

    1975-06-01

    Mitochondrial proteins soluble in neutral chloroform-methanol (2:1) were separated from lipids by ether precipitation and resolved by Sephadex G-200 filtration in the presence of dodecylsulfate into two major fractions eluting in the excluded region (peak I) and in a region of an apparent molecular weight 8000 (peak II). Residual phospholipids are found only in peak II. Peak I consists of several aggregated small polypeptides of molecular weights around 8000, which can be disaggregated by mild oxidation with performic acid. Cycloheximide stimulates almost two-fold incorporation of radioactive phenylalanine into peak I proteins but inhibits labelling of peak II proteins by 95%. Chloramphenicol and ethidium bromide inhibit the synthesis of peak I proteins by 70% and 95% respectively, but do not affect labelling of peak II proteins. At least 30% of the translation products of mitochondrial DNA in vitro behave like peak I proteins: they are soluble in organic solvents, they aggregate in dodecylsulfate buffer after removal of phospholipids and they contain species of molecular weights around 8000 that disaggregate upon oxidation. The data strongly suggest that the proteins of peak I are encoded by mitochondrial genes and synthesized on mitochondrial ribosomes, whereas the proteins of peak II are encoded by nuclear genes and synthesized on cytoplasmic ribosomes. Both groups of lipophilic proteins are very similar in their molecular weights, but the mitochondrially coded peak I proteins have the unique property of forming large heat-stable aggregates in the presence of dodecylsulfate.

  14. Complete mitochondrial genome of the Algerian honeybee, Apis mellifera intermissa (Hymenoptera: Apidae).

    Science.gov (United States)

    Hu, Peng; Lu, Zhi-Xiang; Haddad, Nizar; Noureddine, Adjlane; Loucif-Ayad, Wahida; Wang, Yong-Zhi; Zhao, Ren-Bin; Zhang, Ai-Ling; Guan, Xin; Zhang, Hai-Xi; Niu, Hua

    2016-05-01

    In this study, the complete mitochondrial genome sequence of Algerian honeybee, Apis mellifera intermissa, is analyzed for the first time. The results show that this genome is 16,336 bp in length, and contains 13 protein-coding genes, 22 transfer RNA genes, 2 ribosomal RNA genes, and 1 control region (D-loop). The overall base composition is A (43.2%), C (9.8%), G (5.6%), and T (41.4%), so the percentage of A and T (84.6%) is considerably higher than that of G and C. All the genes are encoded on H-strand, except for four subunit genes (ND1, ND4, ND4L, and ND5), two rRNA genes (12S and 16S rRNA), and eight tRNA genes. The complete mitochondrial genome sequence reported here would be useful for further phylogenetic analysis and conservation genetic studies in A. m. intermissa.

  15. The mitochondrial genome of Iberobaenia (Coleoptera: Iberobaeniidae): first rearrangement of protein-coding genes in the beetles.

    Science.gov (United States)

    Andujar, Carmelo; Arribas, Paula; Linard, Benjamin; Kundrata, Robin; Bocak, Ladislav; Vogler, Alfried P

    2017-03-01

    The complete mitochondrial genome of the recently discovered beetle family Iberobaeniidae is described and compared with known coleopteran mitogenomes. The mitochondrial sequence was obtained by shotgun metagenomic sequencing using the Illumina Miseq technology and resulted in an average coverage of 130 × and a minimum coverage of 35×. The mitochondrial genome of Iberobaeniidae includes 13 protein-coding genes, 2 rRNAs, 22 tRNAs genes, and 1 putative control region, and showed a unique rearrangement of protein-coding genes. This is the first rearrangement affecting the relative position of protein-coding and ribosomal genes reported for the order Coleoptera.

  16. Complete mitochondrial DNA genome of tetraploid Carassius auratus gibelio.

    Science.gov (United States)

    Li, Zhong; Liang, Hong-Wei; Zou, Gui-Wei

    2016-01-01

    The complete mitochondrial genome was sequenced from the tetraploid Carassius auratus gibelio in this study. The genome sequence was 16,576 bp in length. The mitochondrial genome contains 13 protein-coding genes, 2 ribosomal RNAs, 22 transfer RNAs, and 2 non-coding regions (control region and origin of light-strand replication). All genes were encoded on the heavy strain except for ND6 and eight tRNA genes. The overall base composition is 31.61% A, 25.81% T, 26.62% G, 15.96% C, with an A+T bias of 57.42%. The complete mitogenome data provides useful genetic markers for the studies on the molecular identification, population genetics, phylogenetic analysis and conservation genetics.

  17. The complete mitochondrial genome of Paracymoriza distinctalis (Lepidoptera: Crambidae).

    Science.gov (United States)

    Ye, Fei; You, Ping

    2016-01-01

    The complete mitochondrial genome of Paracymoriza distinctalis (Leech, 1889) has been determined in this article. The mitochondrial genome of P. distinctalis was 15,354 bp in length, containing 13 protein-coding genes (PCGs), 22 transfer RNA (tRNA) genes, 2 ribosomal RNA (rRNA) genes and an A + T-rich region. All PCGs start with ATN codon, except for COI, which begins with CGA. Eleven PCGs stop with typical stop codon TAA. But ND5 and COII use incomplete stop codon T. All the 22 tRNAs have the typical clover-leaf structure except for tRNA(Ser)(AGN) lacking the dihydrouridine (DHU) stem. There were several conserved motifs in the intergenic region between tRNA(Ser)(UCN) and ND1 and the A + T-rich region of P. distinctalis.

  18. The complete mitochondrial genome of Lophiogobius ocellicauda (Perciformes, Gobiidae).

    Science.gov (United States)

    Quan, Xianqing; Jin, Xiaoxiao; Sun, Yuena

    2014-04-01

    Lophiogobius ocellicauda, which is a small demersal fish and inhabited brackish and freshwater environment of estuary, is a kind of forage fish of some predaceous economic fish. In this paper, the complete mitochondrial genome of L. ocellicauda was firstly determined. The genome is 16,663 bp in length and consists of 13 protein-coding genes, 22 tRNA genes, 2 rRNA genes and 2 main non-coding regions (the control region and the origin of the light strand replication). The complete mitochondrial genome base composition is 26.4% for T, 28.4% for C, 29.2% for A and 16.0% for G, with a slight A + T bias of 55.6%. Within the control region, the termination associated sequence, central and conserved sequence block domains were found.

  19. Trichinella spiralis mtDNA: a nematode mitochondrial genome that encodes a putative ATP8 and normally structured tRNAS and has a gene arrangement relatable to those of coelomate metazoans.

    Science.gov (United States)

    Lavrov, D V; Brown, W M

    2001-01-01

    The complete mitochondrial DNA (mtDNA) of the nematode Trichinella spiralis has been amplified in four overlapping fragments and 16,656 bp of its sequence has been determined. This sequence contains the 37 genes typical of metazoan mtDNAs, including a putative atp8, which is absent from all other nematode mtDNAs examined. The genes are transcribed from both mtDNA strands and have an arrangement relatable to those of coelomate metazoans, but not to those of secernentean nematodes. All protein genes appear to initiate with ATN codons, typical for metazoans. Neither TTG nor GTT start codons, inferred for several genes of other nematodes, were found. The 22 T. spiralis tRNA genes fall into three categories: (i) those with the potential to form conventional "cloverleaf" secondary structures, (ii) those with TPsiC arm + variable arm replacement loops, and (iii) those with DHU-arm replacement loops. Mt-tRNA(R) has a 5'-UCG-3' anticodon, as in most other metazoans, instead of the very unusual 5'-ACG-3' present in the secernentean nematodes. The sequence also contains a large repeat region that is polymorphic in size at the population and/or individual level. PMID:11156984

  20. Gene therapy of mitochondrial DNA mutations: a brief, biased history of allotopic expression in mammalian cells.

    Science.gov (United States)

    Zullo, S J

    2001-09-01

    Successful treatment of mitochondrial DNA (mtDNA) mutations might be possible by construction of mtDNA-encoded protein genes so that they can be inserted into the nuclear genome and the protein expressed in the mitochondria (allotopic expression). This technique would require individual assembly of all 13 mtDNA-encoded protein genes with an aminoterminal leader peptide that directs the cytoplasmic translated protein to the mitochondrial membrane. The 13 allotopic genes could be inserted into the nuclear genome of a patient's stem cell that had been "cured" of its nascent mtDNA via ethidium bromide treatment (rho-zero cell). The rho-zero cell would be a uridine auxotroph, and recovery from uridine auxotrophy would indicate successful transformation. The patient's own cells could then be returned to the patient's body. With a selective advantage of recovered oxidative phosphorylation, the transformed cells could replace cells with mtDNA mutations. Results of experiments by us on allotopically expressed CHO ATPase6 and of experiments by other workers suggest that there might be competition with endogenous mtDNA-encoded proteins if the particular protein gene is not removed from the endogenous mitochondrial genomes. Thus, it is likely that all 13 mtDNA-encoded protein genes will need to be allotopically expressed, with concomitant removal of all mtDNA genomes, in order for this form of mtDNA gene therapy to be successful.

  1. Involvement of plastid, mitochondrial and nuclear genomes in plant-to-plant horizontal gene transfer

    Directory of Open Access Journals (Sweden)

    Maria Virginia Sanchez-Puerta

    2014-12-01

    Full Text Available This review focuses on plant-to-plant horizontal gene transfer (HGT involving the three DNA-containing cellular compartments. It highlights the great incidence of HGT in the mitochondrial genome (mtDNA of angiosperms, the increasing number of examples in plant nuclear genomes, and the lack of any convincing evidence for HGT in the well-studied plastid genome of land plants. Most of the foreign mitochondrial genes are non-functional, generally found as pseudogenes in the recipient plant mtDNA that maintains its functional native genes. The few exceptions involve chimeric HGT, in which foreign and native copies recombine leading to a functional and single copy of the gene. Maintenance of foreign genes in plant mitochondria is probably the result of genetic drift, but a possible evolutionary advantage may be conferred through the generation of genetic diversity by gene conversion between native and foreign copies. Conversely, a few cases of nuclear HGT in plants involve functional transfers of novel genes that resulted in adaptive evolution. Direct cell-to-cell contact between plants (e.g. host-parasite relationships or natural grafting facilitate the exchange of genetic material, in which HGT has been reported for both nuclear and mitochondrial genomes, and in the form of genomic DNA, instead of RNA. A thorough review of the literature indicates that HGT in mitochondrial and nuclear genomes of angiosperms is much more frequent than previously expected and that the evolutionary impact and mechanisms underlying plant-to-plant HGT remain to be uncovered.

  2. The complete mitochondrial genome sequence of Xingkai topmouth culter (Culter alburnus).

    Science.gov (United States)

    Liu, Yu; Yang, Jun

    2014-12-01

    The complete sequence of the mitochondrial genome of Culter alburnus was determined to be 16,622 bp in length by Sanger sequencing technology, and to contain 13 protein-coding genes (PCGs), 22 tRNA genes and 2 ribosomal genes. Its total A + T content is 55.99%. 6 CSBs (CSB-1, CSB-2, CSB-3, CSB-D, CSB-E and CSB-F) and 1TAS were identified in the control region; the control region also included a 2 bp tandem repeat with 8 repeat times.

  3. The complete mitochondrial genome of the North Chinese Leopard (Panthera pardus japonensis).

    Science.gov (United States)

    Dou, Hailong; Feng, Limin; Xiao, Wenhong; Wang, Tianming

    2016-01-01

    The North Chinese Leopard (Panthera pardus japonensis) is an endemic subspecies of Panthera pardus to China, living in small and isolated populations with a severely fragmented distribution. Here we first sequenced and annotated its complete mitochondrial genome. The total length of the North Chinese Leopard is of 16,966 base pairs that consist of 2 rRNA gene, 22 tRNA genes, 13 protein-coding genes, 1 OLR and 1 control region (CR). The structures of the genomes were highly similar to other Felidae.

  4. Complete mitochondrial genome of the mudskipper Boleophthalmus pectinirostris (Perciformes, Gobiidae): repetitive sequences in the control region.

    Science.gov (United States)

    Liu, Zhi Zhi; Wang, Cong Tao; Ma, Ling Bo; He, An Yuan; Yang, Jin Quan; Tang, Wen Qiao

    2012-02-01

    The mudskipper, Boleophthalmus pectinirostris (Perciformes, Gobiidae), is an amphibious gobioid fish. In this paper, the complete mitochondrial genome of B. pectinirostris was firstly determined. The mitogenome (17,111 bp) comprises 13 protein-coding genes, 22 tRNA genes, 2 rRNA genes and 1 putative control region. 130-bp tandem repeat was identified in the control region, which was almost identical among the 10 individuals examined, and three different frequencies of the repeat unit (five, six or seven) were found among these individuals.

  5. Evolutionary dynamics of a mitochondrial rearrangement "hot spot" in the Hymenoptera.

    Science.gov (United States)

    Dowton, M; Austin, A D

    1999-02-01

    The arrangement of tRNA genes at the junction of the cytochrome oxidase II and ATPase 8 genes was examined across a broad range of Hymenoptera. Seven distinct arrangements of tRNA genes were identified among a group of wasps that have diverged over the last 180 Myr (suborder Apocrita); many of the rearrangements represent evolutionarily independent events. Approximately equal proportions of local rearrangements, inversions, and translocations were observed, in contrast to vertebrate mitochondria, in which local rearrangements predominate. Surprisingly, homoplasy was evident among certain types of rearrangement; a reversal of the plesiomorphic gene order has arisen on three separate occasions in the Insecta, while the tRNA(H) gene has been translocated to this locus on two separate occasions. Phylogenetic analysis indicates that this gene translocation is real and is not an artifactual translocation resulting from the duplication of a resident tRNA gene followed by mutation of the anticodon. The nature of the intergenic sequences surrounding this region does not indicate that it should be especially prone to rearrangement; it does not generally have the tandem or inverted repeats that might facilitate this plasticity. Intriguingly, these findings are consistent with the view that during the evolution of the Hymenoptera, rearrangements increased at the same time that the rate of point mutations and compositional bias also increased. This association may direct investigations into mitochondrial genome plasticity in other invertebrate lineages.

  6. Pentamidine binds to tRNA through non-specific hydrophobic interactions and inhibits aminoacylation and translation.

    Science.gov (United States)

    Sun, Tao; Zhang, Yi

    2008-03-01

    The selective and potent inhibition of mitochondrial translation in Saccharomyces cerevisiae by pentamidine suggests a novel antimicrobial action for this drug. Electrophoresis mobility shift assay, T1 ribonuclease footprinting, hydroxyl radical footprinting and isothermal titration calorimetry collectively demonstrated that pentamidine non-specifically binds to two distinct classes of sites on tRNA. The binding was driven by favorable entropy changes indicative of a large hydrophobic interaction, suggesting that the aromatic rings of pentamidine are inserted into the stacked base pairs of tRNA helices. Pentamidine binding disrupts the tRNA secondary structure and masks the anticodon loop in the tertiary structure. Consistently, we showed that pentamidine specifically inhibits tRNA aminoacylation but not the cognate amino acid adenylation. Pentamidine inhibited protein translation in vitro with an EC(50) equivalent to that binds to tRNA and inhibits tRNA aminoacylation in vitro, but drastically higher than that inhibits translation in vivo, supporting the established notion that the antimicrobial activity of pentamidine is largely due to its selective accumulation by the pathogen rather than by the host cell. Therefore, interrupting tRNA aminoacylation by the entropy-driven non-specific binding is an important mechanism of pentamidine in inhibiting protein translation, providing new insights into the development of antimicrobial drugs.

  7. The complete mitochondrial genome of the geophilomorph centipede Strigamia maritima.

    Directory of Open Access Journals (Sweden)

    Helen E Robertson

    Full Text Available Strigamia maritima (Myriapoda; Chilopoda is a species from the soil-living order of geophilomorph centipedes. The Geophilomorpha is the most speciose order of centipedes with over a 1000 species described. They are notable for their large number of appendage bearing segments and are being used as a laboratory model to study the embryological process of segmentation within the myriapods. Using a scaffold derived from the recently published genome of Strigamia maritima that contained multiple mitochondrial protein-coding genes, here we report the complete mitochondrial genome of Strigamia, the first from any geophilomorph centipede. The mitochondrial genome of S. maritima is a circular molecule of 14,938 base pairs, within which we could identify the typical mitochondrial genome complement of 13 protein-coding genes and 2 ribosomal RNA genes. Sequences resembling 16 of the 22 transfer RNA genes typical of metazoan mitochondrial genomes could be identified, many of which have clear deviations from the standard 'cloverleaf' secondary structures of tRNA. Phylogenetic trees derived from the concatenated alignment of protein-coding genes of S. maritima and >50 other metazoans were unable to resolve the Myriapoda as monophyletic, but did support a monophyletic group of chilopods: Strigamia was resolved as the sister group of the scolopendromorph Scolopocryptos sp. and these two (Geophilomorpha and Scolopendromorpha, along with the Lithobiomorpha, formed a monophyletic group the Pleurostigmomorpha. Gene order within the S. maritima mitochondrial genome is unique compared to any other arthropod or metazoan mitochondrial genome to which it has been compared. The highly unusual organisation of the mitochondrial genome of Strigamia maritima is in striking contrast with the conservatively evolving nuclear genome: sampling of more members of this order of centipedes will be required to see whether this unusual organization is typical of the Geophilomorpha or

  8. Increased Prevalence 12308 A > G mutation in Mitochondrial tRNALeu (CUN Gene Associated with earlier Age of Onset in Friedreich Ataxia

    Directory of Open Access Journals (Sweden)

    Mohammad Medhi HEIDARI

    2011-12-01

    ;96(20:11492-5.Babcock M, de Silva D, Oaks R, Davis-Kaplan S, Jiralerspong S, Montermini L, et al. Regulation of mitochondrial iron accumulation by Yfh1p, a putative homolog of frataxin. Science 1997;276(5319:1709-12.Wilson RB, Roof DM. Respiratory deficiency due to loss of mitochondrial DNA in yeast lacking the frataxin homologue. Nat Genet 1997;16(4:352-7.Ramazzotti A, Vanmansart V, Foury F. Mitochondrial functional interactions between frataxin and Isu1p, the iron-sulfur cluster scaffold protein, in Saccharomycescerevisiae. FEBS Lett 2004;557(1-3:215-20.Foury F, Cazzalini O. Deletion of the yeast homologue of the human gene associated with Friedreich ataxiaelicits iron accumulation in mitochondria. FEBS Lett1997;411(2-3:373-7.Foury F, Talibi D. Mitochondrial control of iron homeostasis. A genome wide analysis of gene expression in a yeast frataxin-deficient strain. J Biol Chem 2001;276(11:7762-8.Koeppen AH. Friedreich ataxia: pathology, pathogenesis, and molecular genetics. J Neurol Sci 2011;303(1-2:1-12.Kish SJ, Bergeron C, Rajput A, Dozic S, Mastrogiacomo F, Chang LJ, et al. Brain cytochrome oxidase in Alzheimer’s disease. J Neurochem 1992;59(2:776-9.Schapira AH. Mitochondrial complex I deficiency in Parkinson’s disease. Adv Neurol 1993;60(1:288-91.Lu F, Selak M, O’Connor J, Croul S, Lorenzana C, Butunoi C, et al. Oxidative damage to mitochondrial DNA and activity of mitochondrial enzymes in chronicactive lesions of multiple sclerosis. J Neurol Sci2000;177(2:95-103.Bradley JL, Blake JC, Chamberlain S, Thomas PK, Cooper JM, Schapira AH. Clinical, biochemical and molecular genetic correlations in Friedreich ataxia. Hum Mol Genet 2000;9(2:275-82.Rotig A, de Lonlay P, Chretien D, Foury F, Koenig M, Sidi D, et al. Aconitase and mitochondrial iron-sulphur protein deficiency in Friedreich ataxia. Nat Genet1997;17(2:215-7.van den Ouweland JM, Bruining GJ, Lindhout D, Wit JM, Veldhuyzen BF, Maassen JA. Mutations in mitochondrial tRNA genes: non-link age with syndromes of Wolfram and

  9. Expression of genes related to mitochondrial function in Nellore cattle divergently ranked on residual feed intake.

    Science.gov (United States)

    Fonseca, Larissa Fernanda Simielli; Gimenez, Daniele Fernanda Jovino; Mercadante, Maria Eugênia Zerlotti; Bonilha, Sarah Figueiredo Martins; Ferro, Jesus Aparecido; Baldi, Fernando; de Souza, Fábio Ricardo Pablos; de Albuquerque, Lucia Galvão

    2015-02-01

    Several measures have been proposed to investigate and improve feed efficiency in cattle. One of the most commonly used measure of feed efficiency is residual feed intake (RFI), which is estimated as the difference between actual feed intake and expected feed intake based on the animal's average live weight. This measure permits to identify and select the most efficient animals without selecting for higher mature weight. Mitochondrial function has been indicated as a major factor that influences RFI. The analysis of genes involved in mitochondrial function is therefore an alternative to identify molecular markers associated with higher feed efficiency. This study analyzed the expression of PGC1α, TFAM, UCP2 and UCP3 genes by quantitative real-time PCR in liver and muscle tissues of two groups of Nellore cattle divergently ranked on RFI values in order to evaluate the relationship of these genes with RFI. In liver tissue, higher expression of TFAM and UCP2 genes was observed in the negative RFI group. Expression of PGC1α gene did not differ significantly between the two groups, whereas UCP3 gene was not expressed in liver tissue. In muscle tissue, higher expression of TFAM gene was observed in the positive RFI group. Expression of PGC1α, UCP2 and UCP3 genes did not differ significantly between the two groups. These results suggest the use of TFAM and UCP2 as possible candidate gene markers in breeding programs designed to increase the feed efficiency of Nellore cattle.

  10. Cytoplasmic male sterility of tuber mustard is associated with the alternative spliced mitochondrial T gene transcripts

    Institute of Scientific and Technical Information of China (English)

    PEI Yanxi; CHEN Zhujun; CAO Jiashu; CHEN Xuejun; LIU Xiaohui

    2004-01-01

    Two transcripts of T gene, T1170 and T1243, were obtained from the mitochondrial cDNA of tuber mustard CMS line. T1243 was a transcript with an intron unspliced, which has the basic characteristics of type Ⅱ intron. The expressions of the two transcripts were analyzed by reverse transcription PCR (RT-PCR). The results showed that, at seedling stage, the expression of T gene was mainly in the form of T1170 but decreased with the development gradually, while the expression abundance of another transcript, T1243, increased gradually. The T1243 was prevalent at the profuse flowering stage. The expression pattern was confirmed by Northern blot analysis. These results suggested that the alternative spliced mitochondrial T gene transcripts were related to CMS of tuber mustard.

  11. Methylated nucleosides in tRNA and tRNA methyltransferases

    Directory of Open Access Journals (Sweden)

    Hiroyuki eHori

    2014-05-01

    Full Text Available To date, more than 90 modified nucleosides have been found in tRNA and the biosynthetic pathways of the majority of tRNA modifications include a methylation step(s. Recent studies of the biosynthetic pathways have demonstrated that the availability of methyl group donors for the methylation in tRNA is important for correct and efficient protein synthesis. In this review, I focus on the methylated nucleosides and tRNA methyltransferases. The primary functions of tRNA methylations are linked to the different steps of protein synthesis, such as the stabilization of tRNA structure, reinforcement of the codon–anticodon interaction, regulation of wobble base pairing, and prevention of frameshift errors. However, beyond these basic functions, recent studies have demonstrated that tRNA methylations are also involved in the RNA quality control system and regulation of tRNA localization in the cell. In a thermophilic eubacterium, tRNA modifications and the modification enzymes form a network that responses to temperature changes. Furthermore, several modifications are involved in genetic diseases, infections, and the immune response. Moreover, structural, biochemical, and bioinformatics studies of tRNA methyltransferases have been clarifying the details of tRNA methyltransferases and have enabled these enzymes to be classified. In the final section, the evolution of modification enzymes is discussed.

  12. Effect of Mitochondrial Dysfunction on Carbon Metabolism and Gene Expression in Flower Tissues of Arabidopsis thaliana

    Institute of Scientific and Technical Information of China (English)

    Maria V.Busi; Maria E.Gomez-Lobato; Sebastian P.Rius; Valeria R.Turowski; Paula Casati; Eduardo J.Zabaleta; Diego F.Gomez-Casati; Alejandro Araya

    2011-01-01

    We characterized the transcriptomic response of transgenic plants carrying a mitochondrial dysfunction induced by the expression of the unedited form of the ATP synthase subunit 9.The u-ATP9 transgene driven by A9 and APETALA3 promoters induce mitochondrial dysfunction revealed by a decrease jn both oxygen uptake and adenine nucleotides(ATP,ADP)levels without changes in the ATP/ADP ratio.Furthermore,we measured an increase in ROS accumulation and a decrease in glutathione and ascorbate levels with a concomitant oxidative stress response.The transcriptome analysis of young Arabidopsis flowers,validated by Qrt-PCR and enzymatic or functional tests,showed dramatic changes in u-ATP9 plants.Both lines display a modification in the expression of various genes involved in carbon,lipid,and cell wall metabolism,suggesting that an important metabolic readjustment occurs in plants with a mitochondrial dysfunction.Interestingly,transcript levels involved in mitochondrial respiration,protein synthesis,and degradation are affected.Moreover,the Ievels of several mRNAs encoding for transcription factors and DNA binding proteins were also changed.Some of them are involved in stress and hormone responses,suggesting that several signaling pathways overlap.Indeed,the transcriptome data revealed that the mitochondrial dysfunction dramatically alters the expression of genes involved in signaling pathways,including those related to ethylene,absicic acid,and auxin signal transduction.Our data suggest that the mitochondrial dysfunction model used in this report may be usefuI to uncover the retrograde signaling mechanism between the nucleus and mitochondria in plant cells.

  13. Complete mitochondrial genome of Chocolate Pansy, Junonia iphita (Lepidoptera: Nymphalidae: Nymphalinae).

    Science.gov (United States)

    Vanlalruati, Catherine; Mandal, Surajit De; Gurusubramanian, Guruswami; Senthil Kumar, Nachimuthu

    2016-07-01

    The complete mitochondrial genome of Junonia iphita was determined to be 15,433 bp in length, including 37 typical mitochondrial genes and an AT-rich region. All the protein coding genes (PCGs) are initiated by typical ATN codons, except cox1 gene that is by CGA codon. Eight genes use complete termination codon (TAA), whereas the cox1, cox2 and nad5 genes end with single T; nad4 and nad1 ends with stop codon TA. All the tRNA show secondary cloverleaf structures except trnS1 (AGN). The A + T rich region is 546 bp in length containing ATAGA motif followed by a 18 bp poly-T stretch, two microsatellite-like (TA)9 elements and 8 bp poly-A stretch immediately upstream of trnM gene.

  14. The complete mitochondrial genome of European wild boar, Sus scrofa scrofa.

    Science.gov (United States)

    Hu, Xiao-Di; Yang, Xiao-Tian; Yang, En

    2016-09-01

    In this study, we report the complete mitochondrial genome sequence of the European wild boar, Sus scrofa scrofa for the first time. The genome is found to be 16,770 bp in length and has a base composition of A (34.63%), G (13.38%), C (26.21%), and T (25.78%), indicating that the percentage of A + T (60.41%) was higher than G + C (39.59%). Similar to other pigs, it contains a typically conserved structure including 13 protein-coding genes, 22 transfer RNA genes, 2 ribosomal RNA genes, and 1 control region (D-loop). Most of the genes were located on the H-strand except for the ND6 gene and eight tRNA genes. The complete mitochondrial genome sequence provided here would add a new genetic resource and new study on the evolution of the genus Sus.

  15. Mitochondrial genome of the black flying fox, Pteropus alecto (Chiroptera: Megachiroptera: Pteropodidae).

    Science.gov (United States)

    Gao, Cheng-Wen; Wang, Shuo; Gao, Li-Zhi

    2016-01-01

    In this article we report the complete mitochondrial genome of black flying fox, Pteropus alecto, with the sequence length of 16,739 bp for the first time. The mitogenome contained a total of 13 protein-coding genes, 22 transfer RNA genes, 2 ribosomal RNA genes and 1 control region. The base composition was A (33.1%), G (14.5%), C (27.2%) and T (25.2%), indicating that the percentage of A and T (58.3%) was higher than that of G and C. Most of these genes were distributed on the H-strand, except for the ND6 subunit gene and eight tRNA genes. The mitochondrial genome analyzed here will provide new genetic information to study the evolution of bats.

  16. Comparative sequence analysis of the non-protein-coding mitochondrial DNA of inbred rat strains.

    Directory of Open Access Journals (Sweden)

    Avinash Abhyankar

    Full Text Available The proper function of mammalian mitochondria necessitates a coordinated expression of both nuclear and mitochondrial genes, most likely due to the co-evolution of nuclear and mitochondrial genomes. The non-protein coding regions of mitochondrial DNA (mtDNA including the D-loop, tRNA and rRNA genes form a major component of this regulated expression unit. Here we present comparative analyses of the non-protein-coding regions from 27 Rattus norvegicus mtDNA sequences. There were two variable positions in 12S rRNA, 20 in 16S rRNA, eight within the tRNA genes and 13 in the D-loop. Only one of the three neutrality tests used demonstrated statistically significant evidence for selection in 16S rRNA and tRNA-Cys. Based on our analyses of conserved sequences, we propose that some of the variable nucleotide positions identified in 16S rRNA and tRNA-Cys, and the D-loop might be important for mitochondrial function and its regulation.

  17. The complete mitochondrial genome of Neobenedenia melleni (Platyhelminthes: Monogenea): mitochondrial gene content, arrangement and composition compared with two Benedenia species.

    Science.gov (United States)

    Zhang, Juan; Wu, Xiangyun; Li, Yanwei; Zhao, Mengwei; Xie, Mingquan; Li, Anxing

    2014-10-01

    The complete mitochondrial (mt) genome sequences of Neobenedenia melleni were determined and compared with those of Benedenia seriolae and B. hoshinai. This circular genome comprises 13,270 bp and includes all 36 typical mt genes found in flatworms. Total AT content of N. melleni is 75.9 %. ATG is the most common start codon, while nad4L is initiated by GTG. All protein-coding genes are predicted to terminate with TAG and TAA. N. melleni has the trnR with a TCG anticodon, which is the same to B. seriolae but different from B. hoshinai (ACG). The mt gene arrangement of N. melleni is similar to that of B. seriolae and B. hoshinai with the exception of three translocations (trnF, trnT and trnG). The overlapped region between nad4L and nad4 was found in the N. melleni mt genome, which was also reported for the published Gyrodactylus species, but it was not found in those of B. seriolae and B. hoshinai, which are non-coding regions instead. The present study provides useful molecular characters for species or strain identification and systematic studies of this parasite.

  18. Strikingly Bacteria-Like and Gene-Rich Mitochondrial Genomes throughout Jakobid Protists

    Science.gov (United States)

    Burger, Gertraud; Gray, Michael W.; Forget, Lise; Lang, B. Franz

    2013-01-01

    The most bacteria-like mitochondrial genome known is that of the jakobid flagellate Reclinomonas americana NZ. This genome also encodes the largest known gene set among mitochondrial DNAs (mtDNAs), including the RNA subunit of RNase P (transfer RNA processing), a reduced form of transfer–messenger RNA (translational control), and a four-subunit bacteria-like RNA polymerase, which in other eukaryotes is substituted by a nucleus-encoded, single-subunit, phage-like enzyme. Further, protein-coding genes are preceded by potential Shine–Dalgarno translation initiation motifs. Whether similarly ancestral mitochondrial characters also exist in relatives of R. americana NZ is unknown. Here, we report a comparative analysis of nine mtDNAs from five distant jakobid genera: Andalucia, Histiona, Jakoba, Reclinomonas, and Seculamonas. We find that Andalucia godoyi has an even larger mtDNA gene complement than R. americana NZ. The extra genes are rpl35 (a large subunit mitoribosomal protein) and cox15 (involved in cytochrome oxidase assembly), which are nucleus encoded throughout other eukaryotes. Andalucia cox15 is strikingly similar to its homolog in the free-living α-proteobacterium Tistrella mobilis. Similarly, a long, highly conserved gene cluster in jakobid mtDNAs, which is a clear vestige of prokaryotic operons, displays a gene order more closely resembling that in free-living α-proteobacteria than in Rickettsiales species. Although jakobid mtDNAs, overall, are characterized by bacteria-like features, they also display a few remarkably divergent characters, such as 3′-tRNA editing in Seculamonas ecuadoriensis and genome linearization in Jakoba libera. Phylogenetic analysis with mtDNA-encoded proteins strongly supports monophyly of jakobids with Andalucia as the deepest divergence. However, it remains unclear which α-proteobacterial group is the closest mitochondrial relative. PMID:23335123

  19. Multiple independent origins of mitochondrial control region duplications in the order Psittaciformes

    Science.gov (United States)

    Schirtzinger, Erin E.; Tavares, Erika S.; Gonzales, Lauren A.; Eberhard, Jessica R.; Miyaki, Cristina Y.; Sanchez, Juan J.; Hernandez, Alexis; Müeller, Heinrich; Graves, Gary R.; Fleischer, Robert C.; Wright, Timothy F.

    2012-01-01

    Mitochondrial genomes are generally thought to be under selection for compactness, due to their small size, consistent gene content, and a lack of introns or intergenic spacers. As more animal mitochondrial genomes are fully sequenced, rearrangements and partial duplications are being identified with increasing frequency, particularly in birds (Class Aves). In this study, we investigate the evolutionary history of mitochondrial control region states within the avian order Psittaciformes (parrots and cockatoos). To this aim, we reconstructed a comprehensive multi-locus phylogeny of parrots, used PCR of three diagnostic fragments to classify the mitochondrial control region state as single or duplicated, and mapped these states onto the phylogeny. We further sequenced 44 selected species to validate these inferences of control region state. Ancestral state reconstruction using a range of weighting schemes identified six independent origins of mitochondrial control region duplications within Psittaciformes. Analysis of sequence data showed that varying levels of mitochondrial gene and tRNA homology and degradation were present within a given clade exhibiting duplications. Levels of divergence between control regions within an individual varied from 0–10.9% with the differences occurring mainly between 51 and 225 nucleotides 3′ of the goose hairpin in domain I. Further investigations into the fates of duplicated mitochondrial genes, the potential costs and benefits of having a second control region, and the complex relationship between evolutionary rates, selection, and time since duplication are needed to fully explain these patterns in the mitochondrial genome. PMID:22543055

  20. 鸿雁线粒体DNA全基因组序列测定及分析%Completely Sequencing and Gene Organization of the Anser cygnoides Mitochondrial Genome

    Institute of Scientific and Technical Information of China (English)

    穆春宇; 陈国宏; 黄正洋; 陈阳; 王彬; 苏燕辉; 李洋; 孙志明; 徐琪; 赵文明

    2014-01-01

    species of Swan goose (Anser cygnoides). Swan goose mitochondrial genome sequence was analysed by direct sequencing techniques. The results showed that whole mitochondrial genome sequence was 16 739 bp (GenBank accession No. KJ124555) in Swan goose, including 22 tRNA genes, 2 rRNA genes, 13 protein-coding genes and a D-loop region. Base composition of T, C, A and G were 22.49%, 32.24%, 30.21%and 15.06%, respectively. Besides, the base preference of AT was not determined. 22 kinds of tRNA were all typically cloverleaf structures. Compared to 12SrRNA of Red Junglefowl (Gallus gallus) and Mongolian Ground Jay (Podoces hendersoni), we found the secondary structure of 12SrRNA included 4 domains, 37 stem-loops and 13 salients in the Swan goose, and LSP/HSP, ETAS1-2, goose hairpin, E-box, F-box, D-box, C-box, Bird similarity-box, CSB1-box, CSB-like and OH in the D-loop control region. Finally, taken Red Junglefowl as an outgroup, the phylogenetic tree was constructed based on mitochondrial genome sequences using Neighbor-joining (N-J) algorithm, Maxium-likelihood (ML) algorithm and Bayesian model. The results showed that Swan goose, Greylag goose, Bean goose, white-fronted goose and Canada goose had close genetic relationship. The findings enrich the ducks mitochondrial genome sequences and provide a theoretical basis for the study of geese phylogeny.

  1. The complete mitochondrial genome of the striped-tailed rat-snake, Orthriophis taeniurus (Reptilia, Serpentes, Colubridae).

    Science.gov (United States)

    Li, En; Sun, Fuxiao; Zhang, Ruidong; Chen, Jing; Wu, Xiaobing

    2016-01-01

    The complete mitochondrial genome (mitogenome) of the striped-tailed rat-snake Orthriophis taeniurus was determined in the present study. The genome is 17,183 bp in size, containing 2 ribosomal RNA (rRNA) genes, 13 protein-coding genes (PCGs), 22 transfer RNA (tRNA) genes, and 2 control regions (CRI and CRII). The gene order and orientation in O. taeniurus mitogenome are basically identical to that of other alethinophidian snakes. Nucleotide composition is very similar with other vertebrates, showing an AT bias.

  2. Towards germline gene therapy of inherited mitochondrial diseases.

    Science.gov (United States)

    Tachibana, Masahito; Amato, Paula; Sparman, Michelle; Woodward, Joy; Sanchis, Dario Melguizo; Ma, Hong; Gutierrez, Nuria Marti; Tippner-Hedges, Rebecca; Kang, Eunju; Lee, Hyo-Sang; Ramsey, Cathy; Masterson, Keith; Battaglia, David; Lee, David; Wu, Diana; Jensen, Jeffrey; Patton, Phillip; Gokhale, Sumita; Stouffer, Richard; Mitalipov, Shoukhrat

    2013-01-31

    Mutations in mitochondrial DNA (mtDNA) are associated with severe human diseases and are maternally inherited through the egg's cytoplasm. Here we investigated the feasibility of mtDNA replacement in human oocytes by spindle transfer (ST; also called spindle-chromosomal complex transfer). Of 106 human oocytes donated for research, 65 were subjected to reciprocal ST and 33 served as controls. Fertilization rate in ST oocytes (73%) was similar to controls (75%); however, a significant portion of ST zygotes (52%) showed abnormal fertilization as determined by an irregular number of pronuclei. Among normally fertilized ST zygotes, blastocyst development (62%) and embryonic stem cell isolation (38%) rates were comparable to controls. All embryonic stem cell lines derived from ST zygotes had normal euploid karyotypes and contained exclusively donor mtDNA. The mtDNA can be efficiently replaced in human oocytes. Although some ST oocytes displayed abnormal fertilization, remaining embryos were capable of developing to blastocysts and producing embryonic stem cells similar to controls.

  3. Mitochondrial genome evolution in Alismatales: Size reduction and extensive loss of ribosomal protein genes

    DEFF Research Database (Denmark)

    Petersen, Gitte; Cuenca, Argelia; Zervas, Athanasios

    2017-01-01

    The order Alismatales is a hotspot for evolution of plant mitochondrial genomes characterized by remarkable differences in genome size, substitution rates, RNA editing, retrotranscription, gene loss and intron loss. Here we have sequenced the complete mitogenomes of Zostera marina and Stratiotes ...... mitogenome from a non-parasitic plant. Using a broad sample of the Alismatales, the evolutionary history of ribosomal protein gene loss is analyzed. In Zostera almost all ribosomal protein genes are lost from the mitogenome, but only some can be found in the nucleus....

  4. Enhanced osteoclastogenesis by mitochondrial retrograde signaling through transcriptional activation of the cathepsin K gene.

    Science.gov (United States)

    Guha, Manti; Srinivasan, Satish; Koenigstein, Alexander; Zaidi, Mone; Avadhani, Narayan G

    2016-01-01

    Mitochondrial dysfunction has emerged as an important factor in wide ranging human pathologies. We have previously defined a retrograde signaling pathway that originates from dysfunctional mitochondria (Mt-RS) and causes a global nuclear transcriptional reprograming as its end point. Mitochondrial dysfunction causing disruption of mitochondrial membrane potential and consequent increase in cytosolic calcium [Ca(2) ](c) activates calcineurin and the transcription factors NF-κB, NFAT, CREB, and C/EBPδ. In macrophages, this signaling complements receptor activator of nuclear factor kappa-B ligand (RANKL)-induced osteoclastic differentiation. Here, we show that the Mt-RS activated transcriptional coactivator heterogeneous ribonucleoprotein A2 (hnRNP A2) is induced by hypoxia in murine macrophages. We demonstrate that the cathepsin K gene (Ctsk), one of the key genes upregulated during osteoclast differentiation, is transcriptionally activated by Mt-RS factors. HnRNP A2 acts as a coactivator with nuclear transcription factors, cRel, and C/EBPδ for Ctsk promoter activation under hypoxic conditions. Notably, our study shows that hypoxia-induced activation of the stress target factors mediates effects similar to that of RANKL with regard to Ctsk activation. We therefore suggest that mitochondrial dysfunction and activation of Mt-RS, induced by various pathophysiologic conditions, is a potential risk factor for osteoclastogenesis and bone loss.

  5. Enhanced osteoclastogenesis by mitochondrial retrograde signaling through transcriptional activation of the cathepsin K gene

    Science.gov (United States)

    Guha, Manti; Srinivasan, Satish; Koenigstein, Alexander; Zaidi, Mone; Avadhani, Narayan G.

    2015-01-01

    Mitochondrial dysfunction has emerged as an important factor in wide ranging human pathologies. We have previously defined a retrograde signaling pathway that originates from dysfunctional mitochondria (Mt-RS) and causes a global nuclear transcriptional reprograming as its endpoint. Mitochondrial dysfunction causing disruption of mitochondrial membrane potential and consequent increase in cytosolic calcium [Ca2](c) activates calcineurin and the transcription factors NF-κB, NFAT, CREB, and C/EBPδ. In macrophages this signaling complements receptor activator of nuclear factor kappa-B ligand (RANKL)–induced osteoclastic differentiation. Here, we show that the Mt-RS activated transcriptional coactivator heterogeneous ribonucleoprotein A2 (hnRNP A2) is induced by hypoxia in murine macrophages. We demonstrate that the cathepsin K gene (Cstk), one of the key genes upregulated during osteoclast differentiation, is transcriptionally activated by Mt-RS factors. HnRNP A2 acts as a coactivator with nuclear transcription factors, cRel, and C/EBPδ for Cstk promoter activation under hypoxic conditions. Notably, our study shows that hypoxia-induced activation of the stress target factors mediates effects similar to that of RANKL with regard to Cstk activation. We therefore suggest that mitochondrial dysfunction and activation of Mt-RS, induced by various pathophysiologic conditions, is a potential risk factor for osteoclastogenesis and bone loss. PMID:25800988

  6. Mitochondrial genome sequence and gene order of Sipunculus nudus give additional support for an inclusion of Sipuncula into Annelida

    Directory of Open Access Journals (Sweden)

    Bartolomaeus Thomas

    2009-01-01

    Full Text Available Abstract Background Mitochondrial genomes are a valuable source of data for analysing phylogenetic relationships. Besides sequence information, mitochondrial gene order may add phylogenetically useful information, too. Sipuncula are unsegmented marine worms, traditionally placed in their own phylum. Recent molecular and morphological findings suggest a close affinity to the segmented Annelida. Results The first complete mitochondrial genome of a member of Sipuncula, Sipunculus nudus, is presented. All 37 genes characteristic for metazoan mtDNA were detected and are encoded on the same strand. The mitochondrial gene order (protein-coding and ribosomal RNA genes resembles that of annelids, but shows several derivations so far found only in Sipuncula. Sequence based phylogenetic analysis of mitochondrial protein-coding genes results in significant bootstrap support for Annelida sensu lato, combining Annelida together with Sipuncula, Echiura, Pogonophora and Myzostomida. Conclusion The mitochondrial sequence data support a close relationship of Annelida and Sipuncula. Also the most parsimonious explanation of changes in gene order favours a derivation from the annelid gene order. These results complement findings from recent phylogenetic analyses of nuclear encoded genes as well as a report of a segmental neural patterning in Sipuncula.

  7. Complete mitochondrial genome sequence from an endangered Indian snake, Python molurus molurus (Serpentes, Pythonidae).

    Science.gov (United States)

    Dubey, Bhawna; Meganathan, P R; Haque, Ikramul

    2012-07-01

    This paper reports the complete mitochondrial genome sequence of an endangered Indian snake, Python molurus molurus (Indian Rock Python). A typical snake mitochondrial (mt) genome of 17258 bp length comprising of 37 genes including the 13 protein coding genes, 22 tRNA genes, and 2 ribosomal RNA genes along with duplicate control regions is described herein. The P. molurus molurus mt. genome is relatively similar to other snake mt. genomes with respect to gene arrangement, composition, tRNA structures and skews of AT/GC bases. The nucleotide composition of the genome shows that there are more A-C % than T-G% on the positive strand as revealed by positive AT and CG skews. Comparison of individual protein coding genes, with other snake genomes suggests that ATP8 and NADH3 genes have high divergence rates. Codon usage analysis reveals a preference of NNC codons over NNG codons in the mt. genome of P. molurus. Also, the synonymous and non-synonymous substitution rates (ka/ks) suggest that most of the protein coding genes are under purifying selection pressure. The phylogenetic analyses involving the concatenated 13 protein coding genes of P. molurus molurus conformed to the previously established snake phylogeny.

  8. Mitochondrial Genome Analysis of Wild Rice (Oryza minuta) and Its Comparison with Other Related Species

    Science.gov (United States)

    Asaf, Sajjad; Khan, Abdul Latif; Khan, Abdur Rahim; Waqas, Muhammad; Kang, Sang-Mo; Khan, Muhammad Aaqil; Shahzad, Raheem; Seo, Chang-Woo; Shin, Jae-Ho; Lee, In-Jung

    2016-01-01

    Oryza minuta (Poaceae family) is a tetraploid wild relative of cultivated rice with a BBCC genome. O. minuta has the potential to resist against various pathogenic diseases such as bacterial blight (BB), white backed planthopper (WBPH) and brown plant hopper (BPH). Here, we sequenced and annotated the complete mitochondrial genome of O. minuta. The mtDNA genome is 515,022 bp, containing 60 protein coding genes, 31 tRNA genes and two rRNA genes. The mitochondrial genome organization and the gene content at the nucleotide level are highly similar (89%) to that of O. rufipogon. Comparison with other related species revealed that most of the genes with known function are conserved among the Poaceae members. Similarly, O. minuta mt genome shared 24 protein-coding genes, 15 tRNA genes and 1 ribosomal RNA gene with other rice species (indica and japonica). The evolutionary relationship and phylogenetic analysis revealed that O. minuta is more closely related to O. rufipogon than to any other related species. Such studies are essential to understand the evolutionary divergence among species and analyze common gene pools to combat risks in the current scenario of a changing environment. PMID:27045847

  9. Cadmium exposure affects mitochondrial bioenergetics and gene expression of key mitochondrial proteins in the eastern oyster Crassostrea virginica Gmelin (Bivalvia: Ostreidae)

    Energy Technology Data Exchange (ETDEWEB)

    Sokolova, Inna M. [Biology Department, University of North Carolina at Charlotte, 9201 University City Blvd., Charlotte, NC 28223 (United States)]. E-mail: insokolo@uncc.edu; Sokolov, Eugene P. [Biology Department, University of North Carolina at Charlotte, 9201 University City Blvd., Charlotte, NC 28223 (United States); Ponnappa, Kavita M. [Biology Department, University of North Carolina at Charlotte, 9201 University City Blvd., Charlotte, NC 28223 (United States)

    2005-07-01

    Cadmium is a ubiquitous and extremely toxic metal, which strongly affects mitochondrial function of aquatic organisms in vitro; however, nothing is known about the in vivo effects of sublethal concentrations of this metal on mitochondrial bioenergetics. We have studied the effects of exposure to 0 (control) or 25 {mu}g L{sup -1} (Cd-exposed) Cd{sup 2+} on mitochondrial function and gene expression of key mitochondrial proteins in the eastern oyster Crassostrea virginica. Cadmium exposure in vivo resulted in considerable accumulation of cadmium in oyster mitochondria and in a significant decrease of ADP-stimulated respiration (state 3) by 30% indicating impaired capacity for ATP production. The decrease in state 3 respiration was similar to the level of inhibition expected from the direct effects of cadmium accumulated in oyster mitochondria. On the other hand, while no effect on proton leak was expected based on the mitochondrial accumulation of cadmium, Cd-exposed oysters in fact showed a significant decline of the proton leak rate (state 4 + respiration) by 40%. This suggested a downregulation of proton leak, which correlated with a decrease in mRNA expression of a mitochondrial uncoupling protein UCP6 and two other potential uncouplers, mitochondrial substrate carriers MSC-1 and MSC-2. Expression of other key mitochondrial proteins including cytochrome c oxidase, adenine nucleotide transporter and voltage dependent anion channel was not affected by cadmium exposure. Adenylate energy charge (AEC) was significantly lower in Cd-exposed oysters; however, this was due to higher steady state ADP levels and not to the decrease in tissue ATP levels. Our data show that adjustment of the proton leak in cadmium-exposed oysters may be a compensatory mechanism, which allows them to maintain normal mitochondrial coupling and ATP levels despite the cadmium-induced inhibition of capacity for ATP production.

  10. Mitochondrial retrograde regulation tuning fork in nuclear genes expressions of higher plants

    Institute of Scientific and Technical Information of China (English)

    Jinghua Yang; Mingfang Zhang; Jingquan Yu

    2008-01-01

    In plant cells, there are three organelles: the nucleus, chloroplast, and mitochondria that store genetic information. The nucleus possesses the majority of genetic information and controls most aspects of organelles gene expression, growth, and development. In return,organdies also send signals back to regulate nuclear gene expression, a process defined as retrograde regulation. The best studies of organelles to nucleus retrograde regulation exist in plant chloroplast-to-nuclear regulation and yeast mitochondria-to-nuclear regulation. In this review, we summarize the recent understanding of mitochondrial retrograde regulation in higher plant, which involves multiple potential signaling pathway in relation to cytoplasmic male-sterility, biotic stress, and abiotie stress. With respect to mitochondrial retrograde regulation signal pathways involved in cytoplasmic male-sterility, we consider that nuclear transcriptional factor genes are the targeted genes regulated by mitoehondria to determine the abnormal reproductive development, and the MAPK signaling pathway may be involved in this regulation in Brassica juncea. When plants suffer biotic and abiotie stress, plant cells will initiate cell death or other events directed toward recovering from stress. During this process, we propose that mitochondria may determine how plant cell responds to a given stress through retrograde regulation. Meanwhile, several transducer molecules have also been discussed here. In particular, thePaepe research group reported that leaf mitochondrial modulated whole cell redox homeostasis, set antioxidant capacity, and determinedstress resistance through altered signaling and diurnal regulation, which is an indication of plant mitochondria with more active function than ever.

  11. A mutation in the mitochondrial fission gene Dnm1l leads to cardiomyopathy.

    Directory of Open Access Journals (Sweden)

    Houman Ashrafian

    2010-06-01

    Full Text Available Mutations in a number of genes have been linked to inherited dilated cardiomyopathy (DCM. However, such mutations account for only a small proportion of the clinical cases emphasising the need for alternative discovery approaches to uncovering novel pathogenic mutations in hitherto unidentified pathways. Accordingly, as part of a large-scale N-ethyl-N-nitrosourea mutagenesis screen, we identified a mouse mutant, Python, which develops DCM. We demonstrate that the Python phenotype is attributable to a dominant fully penetrant mutation in the dynamin-1-like (Dnm1l gene, which has been shown to be critical for mitochondrial fission. The C452F mutation is in a highly conserved region of the M domain of Dnm1l that alters protein interactions in a yeast two-hybrid system, suggesting that the mutation might alter intramolecular interactions within the Dnm1l monomer. Heterozygous Python fibroblasts exhibit abnormal mitochondria and peroxisomes. Homozygosity for the mutation results in the death of embryos midway though gestation. Heterozygous Python hearts show reduced levels of mitochondria enzyme complexes and suffer from cardiac ATP depletion. The resulting energy deficiency may contribute to cardiomyopathy. This is the first demonstration that a defect in a gene involved in mitochondrial remodelling can result in cardiomyopathy, showing that the function of this gene is needed for the maintenance of normal cellular function in a relatively tissue-specific manner. This disease model attests to the importance of mitochondrial remodelling in the heart; similar defects might underlie human heart muscle disease.

  12. Complete mitochondrial genome of the medicinal mushroom Ganoderma lucidum.

    Directory of Open Access Journals (Sweden)

    Jianqin Li

    Full Text Available Ganoderma lucidum is one of the well-known medicinal basidiomycetes worldwide. The mitochondrion, referred to as the second genome, is an organelle found in most eukaryotic cells and participates in critical cellular functions. Elucidating the structure and function of this genome is important to understand completely the genetic contents of G. lucidum. In this study, we assembled the mitochondrial genome of G. lucidum and analyzed the differential expressions of its encoded genes across three developmental stages. The mitochondrial genome is a typical circular DNA molecule of 60,630 bp with a GC content of 26.67%. Genome annotation identified genes that encode 15 conserved proteins, 27 tRNAs, small and large rRNAs, four homing endonucleases, and two hypothetical proteins. Except for genes encoding trnW and two hypothetical proteins, all genes were located on the positive strand. For the repeat structure analysis, eight forward, two inverted, and three tandem repeats were detected. A pair of fragments with a total length around 5.5 kb was found in both the nuclear and mitochondrial genomes, which suggests the possible transfer of DNA sequences between two genomes. RNA-Seq data for samples derived from three stages, namely, mycelia, primordia, and fruiting bodies, were mapped to the mitochondrial genome and qualified. The protein-coding genes were expressed higher in mycelia or primordial stages compared with those in the fruiting bodies. The rRNA abundances were significantly higher in all three stages. Two regions were transcribed but did not contain any identified protein or tRNA genes. Furthermore, three RNA-editing sites were detected. Genome synteny analysis showed that significant genome rearrangements occurred in the mitochondrial genomes. This study provides valuable information on the gene contents of the mitochondrial genome and their differential expressions at various developmental stages of G. lucidum. The results contribute to the

  13. Pathogenic mechanism of a human mitochondrial tRNAPhe mutation associated with myoclonic epilepsy with ragged red fibers syndrome.

    Science.gov (United States)

    Ling, Jiqiang; Roy, Hervé; Qin, Daoming; Rubio, Mary Anne T; Alfonzo, Juan D; Fredrick, Kurt; Ibba, Michael

    2007-09-25

    Human mitochondrial tRNA (hmt-tRNA) mutations are associated with a variety of diseases including mitochondrial myopathies, diabetes, encephalopathies, and deafness. Because the current understanding of the precise molecular mechanisms of these mutations is limited, there is no efficient method to treat their associated mitochondrial diseases. Here, we use a variety of known mutations in hmt-tRNA(Phe) to investigate the mechanisms that lead to malfunctions. We tested the impact of hmt-tRNA(Phe) mutations on aminoacylation, structure, and translation elongation-factor binding. The majority of the mutants were pleiotropic, exhibiting defects in aminoacylation, global structure, and elongation-factor binding. One notable exception was the G34A anticodon mutation of hmt-tRNA(Phe) (mitochondrial DNA mutation G611A), which is associated with MERRF (myoclonic epilepsy with ragged red fibers). In vitro, the G34A mutation decreases aminoacylation activity by 100-fold, but does not affect global folding or recognition by elongation factor. Furthermore, G34A hmt-tRNA(Phe) does not undergo adenosine-to-inosine (A-to-I) editing, ruling out miscoding as a possible mechanism for mitochondrial malfunction. To improve the aminoacylation state of the mutant tRNA, we modified the tRNA binding domain of the nucleus-encoded human mitochondrial phenylalanyl-tRNA synthetase, which aminoacylates hmt-tRNA(Phe) with cognate phenylalanine. This variant enzyme displayed significantly improved aminoacylation efficiency for the G34A mutant, suggesting a general strategy to treat certain classes of mitochondrial diseases by modification of the corresponding nuclear gene.

  14. Three-parent in vitro fertilization: gene replacement for the prevention of inherited mitochondrial diseases.

    Science.gov (United States)

    Amato, Paula; Tachibana, Masahito; Sparman, Michelle; Mitalipov, Shoukhrat

    2014-01-01

    The exchange of nuclear genetic material between oocytes and embryos offers a novel reproductive option for the prevention of inherited mitochondrial diseases. Mitochondrial dysfunction has been recognized as a significant cause of a number of serious multiorgan diseases. Tissues with a high metabolic demand, such as brain, heart, muscle, and central nervous system, are often affected. Mitochondrial disease can be due to mutations in mitochondrial DNA or in nuclear genes involved in mitochondrial function. There is no curative treatment for patients with mitochondrial disease. Given the lack of treatments and the limitations of prenatal and preimplantation diagnosis, attention has focused on prevention of transmission of mitochondrial disease through germline gene replacement therapy. Because mitochondrial DNA is strictly maternally inherited, two approaches have been proposed. In the first, the nuclear genome from the pronuclear stage zygote of an affected woman is transferred to an enucleated donor zygote. A second technique involves transfer of the metaphase II spindle from the unfertilized oocyte of an affected woman to an enucleated donor oocyte. Our group recently reported successful spindle transfer between human oocytes, resulting in blastocyst development and embryonic stem cell derivation, with very low levels of heteroplasmy. In this review we summarize these novel assisted reproductive techniques and their use to prevent transmission of mitochondrial disorders. The promises and challenges are discussed, focusing on their potential clinical application.

  15. Drosophila Erect wing (Ewg) controls mitochondrial fusion during muscle growth and maintenance by regulation of the Opa1-like gene.

    Science.gov (United States)

    Rai, Mamta; Katti, Prasanna; Nongthomba, Upendra

    2014-01-01

    Mitochondrial biogenesis and morphological changes are associated with tissue-specific functional demand, but the factors and pathways that regulate these processes have not been completely identified. A lack of mitochondrial fusion has been implicated in various developmental and pathological defects. The spatiotemporal regulation of mitochondrial fusion in a tissue such as muscle is not well understood. Here, we show in Drosophila indirect flight muscles (IFMs) that the nuclear-encoded mitochondrial inner membrane fusion gene, Opa1-like, is regulated in a spatiotemporal fashion by the transcription factor/co-activator Erect wing (Ewg). In IFMs null for Ewg, mitochondria undergo mitophagy and/or autophagy accompanied by reduced mitochondrial functioning and muscle degeneration. By following the dynamics of mitochondrial growth and shape in IFMs, we found that mitochondria grow extensively and fuse during late pupal development to form the large tubular mitochondria. Our evidence shows that Ewg expression during early IFM development is sufficient to upregulate Opa1-like, which itself is a requisite for both late pupal mitochondrial fusion and muscle maintenance. Concomitantly, by knocking down Opa1-like during early muscle development, we show that it is important for mitochondrial fusion, muscle differentiation and muscle organization. However, knocking down Opa1-like, after the expression window of Ewg did not cause mitochondrial or muscle defects. This study identifies a mechanism by which mitochondrial fusion is regulated spatiotemporally by Ewg through Opa1-like during IFM differentiation and growth.

  16. The complete mitochondrial genome of Lista haraldusalis (Lepidoptera: Pyralidae).

    Science.gov (United States)

    Ye, Fei; Yu, Hai-Li; Li, Peng-Fei; You, Ping

    2015-01-01

    We have determined the complete mitochondrial genome of Lista haraldusalis Walker, 1859. The mitochondrial genome of L. haraldusalis is 15,213 bp in size with 81.5% A+T content. It consists of 13 protein-coding genes (PCGs), 22 transfer RNA (tRNA), 2 ribosomal RNA (rRNA) genes and an A+T-rich region. All PCGs start with ATN codon, except for COI, which begins with TTAG. Eleven PCGs stop with typical stop codon TAA and TAG. But ND6 and COII use incomplete stop codon T. All of the 22 tRNAs have the typical cloverleaf structure except for tRNASer(AGN) lacking of the dihydrouridine (DHU) stem. The conserved motif ATACTA, poly-T stretch, ATAGA, ATTTA and microsatellite-like (AT)11 were found in the intergenic region between tRNASer(UCN) and ND1 and the A+T-rich region of L. haraldusalis, respectively.

  17. Study on Mitochondrial DNA Cytochrome b Gene of Chinese sea bass,%Study on Mitochondrial DNA Cytochrome b Gene of Chinese sea bass, Lateolabrax sp.

    Institute of Scientific and Technical Information of China (English)

    高天翔; 张秀梅; 陈大刚; 张美昭; 任一平; 张亚平

    2001-01-01

    参考鳗鲡等鱼类线粒体DNA序列进行了中国花鲈线粒体DNA细胞色素b基因片断的引物设计、PCR扩增及其序列测定。得到中国花鲈的碱基序列为410bp,其A、T、G、C含量分别为101bp(24.63%)、112bp(27.32%)、72bp(17.56%)、125bp(30.49%),与鳗鲡等其他鱼类相同基因片断序列碱基含量相似。%The primers of mitochondrial DNA cytochrome b gene of C hinesesea bass were designed by referencing the sequences of Anguilla speci es. We successfully amplified and sequenced the 410 base pairs that encode the c ytochrome b gene of mitochondrial DNA. The A, T, G and C contents of the sequenc e were 101bp (24.63%), 112bp (27.32%), 72bp (17.56%) and 125bp (30 .49%) respectively, similar to the sequences of other species.

  18. Complete female mitochondrial genome of Anodonta anatina (Mollusca: Unionidae): confirmation of a novel protein-coding gene (F ORF).

    Science.gov (United States)

    Soroka, Marianna; Burzyński, Artur

    2015-04-01

    Freshwater mussels are among animals having two different, gender-specific mitochondrial genomes. We sequenced complete female mitochondrial genomes from five individuals of Anodonta anatina, a bivalve species common in palearctic ecozone. The length of the genome was variable: 15,637-15,653 bp. This variation was almost entirely confined to the non-coding parts, which constituted approximately 5% of the genome. Nucleotide diversity was moderate, at 0.3%. Nucleotide composition was typically biased towards AT (66.0%). All genes normally seen in animal mtDNA were identified, as well as the ORF characteristic for unionid mitochondrial genomes, bringing the total number of genes present to 38. If this additional ORF does encode a protein, it must evolve under a very relaxed selection since all substitutions within this gene were non-synonymous. The gene order and structure of the genome were identical to those of all female mitochondrial genomes described in unionid bivalves except the Gonideini.

  19. Fragmentation of the large subunit ribosomal RNA gene in oyster mitochondrial genomes

    Directory of Open Access Journals (Sweden)

    Milbury Coren A

    2010-09-01

    Full Text Available Abstract Background Discontinuous genes have been observed in bacteria, archaea, and eukaryotic nuclei, mitochondria and chloroplasts. Gene discontinuity occurs in multiple forms: the two most frequent forms result from introns that are spliced out of the RNA and the resulting exons are spliced together to form a single transcript, and fragmented gene transcripts that are not covalently attached post-transcriptionally. Within the past few years, fragmented ribosomal RNA (rRNA genes have been discovered in bilateral metazoan mitochondria, all within a group of related oysters. Results In this study, we have characterized this fragmentation with comparative analysis and experimentation. We present secondary structures, modeled using comparative sequence analysis of the discontinuous mitochondrial large subunit rRNA genes of the cupped oysters C. virginica, C. gigas, and C. hongkongensis. Comparative structure models for the large subunit rRNA in each of the three oyster species are generally similar to those for other bilateral metazoans. We also used RT-PCR and analyzed ESTs to determine if the two fragmented LSU rRNAs are spliced together. The two segments are transcribed separately, and not spliced together although they still form functional rRNAs and ribosomes. Conclusions Although many examples of discontinuous ribosomal genes have been documented in bacteria and archaea, as well as the nuclei, chloroplasts, and mitochondria of eukaryotes, oysters are some of the first characterized examples of fragmented bilateral animal mitochondrial rRNA genes. The secondary structures of the oyster LSU rRNA fragments have been predicted on the basis of previous comparative metazoan mitochondrial LSU rRNA structure models.

  20. A novel additional group II intron distinguishes the mitochondrial rps3 gene in gymnosperms.

    Science.gov (United States)

    Regina, Teresa M R; Picardi, Ernesto; Lopez, Loredana; Pesole, Graziano; Quagliariello, Carla

    2005-02-01

    Comparative analysis of the ribosomal protein S3 gene (rps3) in the mitochondrial genome of Cycas with newly sequenced counterparts from Magnolia and Helianthus and available sequences from higher plants revealed that the positional clustering with the genes for ribosomal protein S19 (rps19) and L16 (rpl16) is preserved in gymnosperms. However, in contrast to the other land plant species, the rps3 gene in Cycas mitochondria is unique in possessing a second intron: rps3i2. Reverse transcription-polymerase chain reaction (RT-PCR) analysis of the transcripts generated from the rps19-rps3-rpl16 cluster in Cycas mitochondria demonstrated that the genes are cotranscribed and extensively modified by RNA editing and that both introns are efficiently spliced. Despite remarkable size heterogeneity, the Cycas rps3i1 can be shown to be homologous to the group IIA introns present within the rps3 gene of algae and land plants, including Magnolia and Helianthus. Conversely, sequences similar to the rps3i2 have not been reported previously. On the basis of conserved primary and secondary structure the second intervening sequence interrupting the Cycas rps3 gene has been classified as a group II intron. The close relationship of the rps3i2 to a group of different plant mitochondrial introns is intriguing and suggestive of a mitochondrial derivation for this novel intervening sequence. Interestingly, the rps3i2 appears to be conserved at the same gene location in other gymnosperms. Furthermore, the pattern of the rps3i2 distribution among algae and land plants provides evidence for the evolutionary acquisition of this novel intron in gymnosperms via intragenomic transposition or retrotransposition.

  1. Massively convergent evolution for ribosomal protein gene content in plastid and mitochondrial genomes.

    Science.gov (United States)

    Maier, Uwe-G; Zauner, Stefan; Woehle, Christian; Bolte, Kathrin; Hempel, Franziska; Allen, John F; Martin, William F

    2013-01-01

    Plastid and mitochondrial genomes have undergone parallel evolution to encode the same functional set of genes. These encode conserved protein components of the electron transport chain in their respective bioenergetic membranes and genes for the ribosomes that express them. This highly convergent aspect of organelle genome evolution is partly explained by the redox regulation hypothesis, which predicts a separate plastid or mitochondrial location for genes encoding bioenergetic membrane proteins of either photosynthesis or respiration. Here we show that convergence in organelle genome evolution is far stronger than previously recognized, because the same set of genes for ribosomal proteins is independently retained by both plastid and mitochondrial genomes. A hitherto unrecognized selective pressure retains genes for the same ribosomal proteins in both organelles. On the Escherichia coli ribosome assembly map, the retained proteins are implicated in 30S and 50S ribosomal subunit assembly and initial rRNA binding. We suggest that ribosomal assembly imposes functional constraints that govern the retention of ribosomal protein coding genes in organelles. These constraints are subordinate to redox regulation for electron transport chain components, which anchor the ribosome to the organelle genome in the first place. As organelle genomes undergo reduction, the rRNAs also become smaller. Below size thresholds of approximately 1,300 nucleotides (16S rRNA) and 2,100 nucleotides (26S rRNA), all ribosomal protein coding genes are lost from organelles, while electron transport chain components remain organelle encoded as long as the organelles use redox chemistry to generate a proton motive force.

  2. Investigation of the Mitochondrial ATPase 6/8 and tRNALys Genes Mutations in Autism

    OpenAIRE

    Sepideh Dadgar; Zahra-Soheila Soheili; Omid Aryani; Massoud Houshmand; Fahimeh Piryaei

    2012-01-01

    Objective: Autism results from developmental factors that affect many or all functional brain systems. Brain is one of tissues which are crucially in need of adenosine triphosphate (ATP). Autism is noticeably affected by mitochondrial dysfunction which impairs energy metabolism. Considering mutations within ATPase 6, ATPase 8 and tRNALys genes, associated with different neural diseases, and the main role of ATPase 6/8 in energy generation, we decided to investigate mutations on these mtDNA-en...

  3. Phylogenetic relationship between Dermanyssus gallinae populations in European countries based on mitochondrial COI gene sequences.

    Science.gov (United States)

    Marangi, M; de Luna, C J; Cafiero, M A; Camarda, A; le Bouquin, S; Huonnic, D; Giangaspero, A; Sparagano, O A E

    2009-06-01

    Phylogenetic analysis of Dermanyssus gallinae mites originating from UK, France and Italy was performed using partial amplification of the mitochondrial COI gene. Results showed that UK samples reveal the greatest variation and diversity and are linked to one of the French populations highlighting North-South genetic transitions in European red mite populations. Intra-farm variations between mite samples highlighted the diversity between national populations and possibly its origin from the different chemical strategies used in each country.

  4. Timing major conflict between mitochondrial and nuclear genes in species relationships of Polygonia butterflies (Nymphalidae: Nymphalini

    Directory of Open Access Journals (Sweden)

    Warren Andrew D

    2009-05-01

    Full Text Available Abstract Background Major conflict between mitochondrial and nuclear genes in estimating species relationships is an increasingly common finding in animals. Usually this is attributed to incomplete lineage sorting, but recently the possibility has been raised that hybridization is important in generating such phylogenetic patterns. Just how widespread ancient and/or recent hybridization is in animals and how it affects estimates of species relationships is still not well-known. Results We investigate the species relationships and their evolutionary history over time in the genus Polygonia using DNA sequences from two mitochondrial gene regions (COI and ND1, total 1931 bp and four nuclear gene regions (EF-1α, wingless, GAPDH and RpS5, total 2948 bp. We found clear, strongly supported conflict between mitochondrial and nuclear DNA sequences in estimating species relationships in the genus Polygonia. Nodes at which there was no conflict tended to have diverged at the same time when analyzed separately, while nodes at which conflict was present diverged at different times. We find that two species create most of the conflict, and attribute the conflict found in Polygonia satyrus to ancient hybridization and conflict found in Polygonia oreas to recent or ongoing hybridization. In both examples, the nuclear gene regions tended to give the phylogenetic relationships of the species supported by morphology and biology. Conclusion Studies inferring species-level relationships using molecular data should never be based on a single locus. Here we show that the phylogenetic hypothesis generated using mitochondrial DNA gives a very different interpretation of the evolutionary history of Polygonia species compared to that generated from nuclear DNA. We show that possible cases of hybridization in Polygonia are not limited to sister species, but may be inferred further back in time. Furthermore, we provide more evidence that Haldane's effect might not be as

  5. Phylogenetic analysis of the complete mitochondrial genome of Madurella mycetomatis confirms its taxonomic position within the order Sordariales.

    Directory of Open Access Journals (Sweden)

    Wendy W J van de Sande

    Full Text Available BACKGROUND: Madurella mycetomatis is the most common cause of human eumycetoma. The genus Madurella has been characterized by overall sterility on mycological media. Due to this sterility and the absence of other reliable morphological and ultrastructural characters, the taxonomic classification of Madurella has long been a challenge. Mitochondria are of monophyletic origin and mitochondrial genomes have been proven to be useful in phylogenetic analyses. RESULTS: The first complete mitochondrial DNA genome of a mycetoma-causative agent was sequenced using 454 sequencing. The mitochondrial genome of M. mycetomatis is a circular DNA molecule with a size of 45,590 bp, encoding for the small and the large subunit rRNAs, 27 tRNAs, 11 genes encoding subunits of respiratory chain complexes, 2 ATP synthase subunits, 5 hypothetical proteins, 6 intronic proteins including the ribosomal protein rps3. In phylogenetic analyses using amino acid sequences of the proteins involved in respiratory chain complexes and the 2 ATP synthases it appeared that M. mycetomatis clustered together with members of the order Sordariales and that it was most closely related to Chaetomium thermophilum. Analyses of the gene order showed that within the order Sordariales a similar gene order is found. Furthermore also the tRNA order seemed mostly conserved. CONCLUSION: Phylogenetic analyses of fungal mitochondrial genomes confirmed that M. mycetomatis belongs to the order of Sordariales and that it was most closely related to Chaetomium thermophilum, with which it also shared a comparable gene and tRNA order.

  6. Assessing the Association of Mitochondrial Genetic Variation With Primary Open-Angle Glaucoma Using Gene-Set Analyses.

    Science.gov (United States)

    Khawaja, Anthony P; Cooke Bailey, Jessica N; Kang, Jae Hee; Allingham, R Rand; Hauser, Michael A; Brilliant, Murray; Budenz, Donald L; Christen, William G; Fingert, John; Gaasterland, Douglas; Gaasterland, Terry; Kraft, Peter; Lee, Richard K; Lichter, Paul R; Liu, Yutao; Medeiros, Felipe; Moroi, Syoko E; Richards, Julia E; Realini, Tony; Ritch, Robert; Schuman, Joel S; Scott, William K; Singh, Kuldev; Sit, Arthur J; Vollrath, Douglas; Wollstein, Gadi; Zack, Donald J; Zhang, Kang; Pericak-Vance, Margaret; Weinreb, Robert N; Haines, Jonathan L; Pasquale, Louis R; Wiggs, Janey L

    2016-09-01

    Recent studies indicate that mitochondrial proteins may contribute to the pathogenesis of primary open-angle glaucoma (POAG). In this study, we examined the association between POAG and common variations in gene-encoding mitochondrial proteins. We examined genetic data from 3430 POAG cases and 3108 controls derived from the combination of the GLAUGEN and NEIGHBOR studies. We constructed biological-system coherent mitochondrial nuclear-encoded protein gene-sets by intersecting the MitoCarta database with the Kyoto Encyclopedia of Genes and Genomes (KEGG) database. We examined the mitochondrial gene-sets for association with POAG and with normal-tension glaucoma (NTG) and high-tension glaucoma (HTG) subsets using Pathway Analysis by Randomization Incorporating Structure. We identified 22 KEGG pathways with significant mitochondrial protein-encoding gene enrichment, belonging to six general biological classes. Among the pathway classes, mitochondrial lipid metabolism was associated with POAG overall (P = 0.013) and with NTG (P = 0.0006), and mitochondrial carbohydrate metabolism was associated with NTG (P = 0.030). Examining the individual KEGG pathway mitochondrial gene-sets, fatty acid elongation and synthesis and degradation of ketone bodies, both lipid metabolism pathways, were significantly associated with POAG (P = 0.005 and P = 0.002, respectively) and NTG (P = 0.0004 and P < 0.0001, respectively). Butanoate metabolism, a carbohydrate metabolism pathway, was significantly associated with POAG (P = 0.004), NTG (P = 0.001), and HTG (P = 0.010). We present an effective approach for assessing the contributions of mitochondrial genetic variation to open-angle glaucoma. Our findings support a role for mitochondria in POAG pathogenesis and specifically point to lipid and carbohydrate metabolism pathways as being important.

  7. Unexpected expansion of tRNA substrate recognition by the yeast m1G9 methyltransferase Trm10

    Science.gov (United States)

    Swinehart, William E.; Henderson, Jeremy C.; Jackman, Jane E.

    2013-01-01

    N-1 Methylation of the nearly invariant purine residue found at position 9 of tRNA is a nucleotide modification found in multiple tRNA species throughout Eukarya and Archaea. First discovered in Saccharomyces cerevisiae, the tRNA methyltransferase Trm10 is a highly conserved protein both necessary and sufficient to catalyze all known instances of m1G9 modification in yeast. Although there are 19 unique tRNA species that contain a G at position 9 in yeast, and whose fully modified sequence is known, only 9 of these tRNA species are modified with m1G9 in wild-type cells. The elements that allow Trm10 to distinguish between structurally similar tRNA species are not known, and sequences that are shared between all substrate or all nonsubstrate tRNAs have not been identified. Here, we demonstrate that the in vitro methylation activity of yeast Trm10 is not sufficient to explain the observed pattern of modification in vivo, as additional tRNA species are substrates for Trm10 m1G9 methyltransferase activity. Similarly, overexpression of Trm10 in yeast yields m1G9 containing tRNA species that are ordinarily unmodified in vivo. Thus, yeast Trm10 has a significantly broader tRNA substrate specificity than is suggested by the observed pattern of modification in wild-type yeast. These results may shed light onto the suggested involvement of Trm10 in other pathways in other organisms, particularly in higher eukaryotes that contain up to three different genes with sequence similarity to the single TRM10 gene in yeast, and where these other enzymes have been implicated in pathways beyond tRNA processing. PMID:23793893

  8. An association study of 45 folate-related genes in spina bifida: Involvement of cubilin (CUBN) and tRNA aspartic acid methyltransferase 1 (TRDMT1).

    NARCIS (Netherlands)

    Franke, B.; Vermeulen, S.; Steegers-Theunissen, R.P.M.; Coenen, M.J.H.; Schijvenaars, M.M.V.A.P.; Scheffer, H.; Heijer, M. den; Blom, H.J.

    2009-01-01

    BACKGROUND: Spina bifida is a class of neural tube defects, which are congenital malformations of the central nervous system with a prevalence of 0.5 to 12 per 1000 births globally. In this article we attempt to identify genes related to folate and its metabolic pathways that are involved in the eti

  9. NUCLEAR GENE MUTATIONS AS THE CAUSE OF MITOCHONDRIAL COMPLEX III DEFICIENCY

    Directory of Open Access Journals (Sweden)

    Erika eFernandez-Vizarra

    2015-04-01

    Full Text Available Complex III (CIII deficiency is one of the least common oxidative phosphorylation defects associated to mitochondrial disease. CIII constitutes the center of the mitochondrial respiratory chain, as well as a crossroad for several other metabolic pathways. For more than ten years, of all the potential candidate genes encoding structural subunits and assembly factors, only three were known to be associated to CIII defects in human pathology. Thus, leaving many of these cases unresolved. These first identified genes were MT-CYB, the only CIII subunit encoded in the mitochondrial DNA; BCS1L, encoding an assembly factor, and UQCRB, a nuclear-encoded structural subunit. Nowadays, thanks to the fast progress that has taken place in the last three-four years, pathological changes in seven more genes are known to be associated to these conditions. This review will focus on the strategies that have permitted the latest discovery of mutations in factors that are necessary for a correct CIII assembly and activity, in relation with their function. In addition, new data further establishing the molecular role of LYRM7/MZM1L as a chaperone involved in CIII biogenesis are provided.

  10. Complete mitochondrial genome of the rabbitfish Siganus fuscescens (Perciformes, Siganidae).

    Science.gov (United States)

    Oh, Dae-Ju; Kim, Ji-Young; Lee, Jung-A; Yoon, Weon-Jong; Park, Soo-Yeong; Jung, Yong-Hwan

    2007-08-01

    We determined the complete nucleotide sequence of the mitochondrial genome for the rabbitfish Siganus fuscescens (Perciformes, Siganidae). This mitochondrial genome, consisting of 16,491 base pairs (bp), included 13 protein-coding genes, 2 ribosomal RNAs, 22 transfer RNAs, and a noncoding control region similar those found in other vertebrates; the gene order was identical to that of typical vertebrates. Most of the genes of S. fuscescens were encoded on the H-strand, while the ND6 and eight tRNA (Gln, Ala, Asn, Cys, Tyr, Ser [UCN], Glu, and Pro) genes were encoded on the L-strand. The reading frames of ATPase 8 and 6 and those of ND4L and ND4 overlapped by ten and seven nucleotides, respectively. All mitochondrial protein-coding genes began with an ATG start codon, except for CO1, which started with GTG. Open reading frames of S. fuscescens ended with TAA (ND1, CO1, ATPase 8, ND4L, ND5 and ND6), and the remainder had incomplete stop codons, either TA (ATPase 6 and CO3) or T (ND2, CO2, ND3, ND4, and Cytb). The origin of L-strand replication in S. fuscescens was located in a cluster of five tRNA genes (WANCY) and was 34 nucleotides in length. A major noncoding region between the tRNA-Pro and tRNA-Phe genes (828 bp) was considered to be the control region (D-loop). Within this sequence, we identified a conserved sequence block characteristic of this region. The rabbitfish was grouped with Siganus canaliculatus in most parsimony analyses, which showed 100% bootstrap support for their divergence. These findings are useful for inferring phylogenetic relationships and identification within the suborder Acanthuroidei.

  11. Genetic Fingerprinting of Wheat and Its Progenitors by Mitochondrial Gene orf256

    Directory of Open Access Journals (Sweden)

    Mona M. Elseehy

    2012-04-01

    Full Text Available orf256 is a wheat mitochondrial gene associated with cytoplasmic male sterility (CMS that has different organization in various species. This study exploited the orf256 gene as a mitochondrial DNA marker to study the genetic fingerprint of Triticum and Aegilops species. PCR followed by sequencing of common parts of the orf256 gene were employed to determine the fingerprint and molecular evolution of Triticum and Aegilops species. Although many primer pairs were used, two pairs of orf256 specific primers (5:-94/C: 482, 5:253/C: 482, amplified DNA fragments of 576 bp and 230 bp respectively in all species were tested. A common 500 bp of nine species of Triticum and Aegilops were aligned and showed consistent results with that obtained from other similar chloroplast or nuclear genes. Base alignment showed that there were various numbers of base substitutions in all species compared to S. cereal (Sc (the outgroup species. Phylogenetic relationship revealed similar locations and proximity on phylogenetic trees established using plastid and nuclear genes. The results of this study open a good route to use unknown function genes of mitochondria in studying the molecular relationships and evolution of wheat and complex plant genomes.

  12. Unequal and genotype-dependent expression of mitochondrial genes in larvae of the pacific oyster Crassostrea gigas.

    Science.gov (United States)

    Curole, Jason P; Meyer, Eli; Manahan, Donal T; Hedgecock, Dennis

    2010-04-01

    Mitochondria are essential for regulation of energy metabolism, but little is known about patterns of mitochondrial genome expression in invertebrates. To explore the association of mitochondrial expression with differential growth of Crassostrea gigas, the Pacific oyster, we crossed two inbred lines to produce inbred and hybrid larvae, which grew at different rates under the same environmental conditions. Using high-throughput cloning and sequencing methods, we identified 1.1 million expressed sequence tags from the mitochondrial genome, 96.7% of which were perfect matches to genes targeted by the method. Expression varied significantly among genes, ranging over nearly four orders of magnitude, from mt:lRNA, which constituted 21% of all transcripts, to mt:CoII, which constituted less than 0.02% of all transcripts. Variable expression of genes coding for subunits of macromolecular complexes (e.g., mt:CoI and mt:CoII) implies that stoichiometry in these complexes must be regulated post-transcriptionally. Surprisingly, the mitochondrial transcriptome contained non-coding transcripts, which may play a role in the regulation of mitochondrial function. Finally, mitochondrial expression depended strongly on maternal factors and nuclear-cytoplasmic interactions, which may explain previously observed growth differences between reciprocal hybrids. Differences in mitochondrial gene expression could provide a biochemical index for the metabolic basis of genetically determined differences in larval growth.

  13. Gene expression changes of single skeletal muscle fibers in response to modulation of the mitochondrial calcium uniporter (MCU

    Directory of Open Access Journals (Sweden)

    Francesco Chemello

    2015-09-01

    Full Text Available The mitochondrial calcium uniporter (MCU gene codifies for the inner mitochondrial membrane (IMM channel responsible for mitochondrial Ca2+ uptake. Cytosolic Ca2+ transients are involved in sarcomere contraction through cycles of release and storage in the sarcoplasmic reticulum. In addition cytosolic Ca2+ regulates various signaling cascades that eventually lead to gene expression reprogramming. Mitochondria are strategically placed in close contact with the ER/SR, thus cytosolic Ca2+ transients elicit large increases in the [Ca2+] of the mitochondrial matrix ([Ca2+]mt. Mitochondrial Ca2+ uptake regulates energy production and cell survival. In addition, we recently showed that MCU-dependent mitochondrial Ca2+ uptake controls skeletal muscle trophism. In the same report, we dissected the effects of MCU-dependent mitochondrial Ca2+ uptake on gene expression through microarray gene expression analysis upon modulation of MCU expression by in vivo AAV infection. Analyses were performed on single skeletal muscle fibers at two time points (7 and 14 days post-AAV injection. Raw and normalized data are available on the GEO database (http://www.ncbi.nlm.nih.gov/geo/ (GSE60931.

  14. Gene expression changes of single skeletal muscle fibers in response to modulation of the mitochondrial calcium uniporter (MCU).

    Science.gov (United States)

    Chemello, Francesco; Mammucari, Cristina; Gherardi, Gaia; Rizzuto, Rosario; Lanfranchi, Gerolamo; Cagnin, Stefano

    2015-09-01

    The mitochondrial calcium uniporter (MCU) gene codifies for the inner mitochondrial membrane (IMM) channel responsible for mitochondrial Ca(2 +) uptake. Cytosolic Ca(2 +) transients are involved in sarcomere contraction through cycles of release and storage in the sarcoplasmic reticulum. In addition cytosolic Ca(2 +) regulates various signaling cascades that eventually lead to gene expression reprogramming. Mitochondria are strategically placed in close contact with the ER/SR, thus cytosolic Ca(2 +) transients elicit large increases in the [Ca(2 +)] of the mitochondrial matrix ([Ca(2 +)]mt). Mitochondrial Ca(2 +) uptake regulates energy production and cell survival. In addition, we recently showed that MCU-dependent mitochondrial Ca(2 +) uptake controls skeletal muscle trophism. In the same report, we dissected the effects of MCU-dependent mitochondrial Ca(2 +) uptake on gene expression through microarray gene expression analysis upon modulation of MCU expression by in vivo AAV infection. Analyses were performed on single skeletal muscle fibers at two time points (7 and 14 days post-AAV injection). Raw and normalized data are available on the GEO database (http://www.ncbi.nlm.nih.gov/geo/) (GSE60931).

  15. The complete sequence of the mitochondrial genome of Lantang pig (Sus scrofa).

    Science.gov (United States)

    Ran, Mao-Liang; Liu, Zhen; Yang, An-Qi; Li, Zhi; Chen, Bin

    2016-01-01

    Lantang pig is a native breed of Guangzhou Province in China. It is the first time that the complete mitochondrial genome sequence of Lantang pig is reported in this work, which is determined through the PCR-based method. The total length of the mitognome is 16,709 bp, which contains 2 ribosomal RNA genes, 22 tRNA genes, 13 PCGs and 1 conntrol region (D-loop region, Table 1). The total base composition of Lantang pig mitochondrial genome is 34.69% for A, 26.18% for C, 25.82% for T and 13.31% for G, in the order A>C>T>G. The complete mitochondrial genome of Lantang pig provides an important data in genetic mechanism and the evolution genomes.

  16. Mitochondrial myopathy, lactic acidosis, and sideroblastic anemia (MLASA) plus associated with a novel de novo mutation (m.8969G>A) in the mitochondrial encoded ATP6 gene.

    Science.gov (United States)

    Burrage, Lindsay C; Tang, Sha; Wang, Jing; Donti, Taraka R; Walkiewicz, Magdalena; Luchak, J Michael; Chen, Li-Chieh; Schmitt, Eric S; Niu, Zhiyv; Erana, Rodrigo; Hunter, Jill V; Graham, Brett H; Wong, Lee-Jun; Scaglia, Fernando

    2014-11-01

    Mitochondrial myopathy, lactic acidosis and sideroblastic anemia (MLASA) is a rare mitochondrial disorder that has previously been associated with mutations in PUS1 and YARS2. In the present report, we describe a 6-year old male with an MLASA plus phenotype. This patient had features of MLASA in the setting of developmental delay, sensorineural hearing loss, epilepsy, agenesis of the corpus callosum, failure to thrive, and stroke-like episodes. Sequencing of the mitochondrial genome identified a novel de novo, heteroplasmic mutation in the mitochondrial DNA (mtDNA) encoded ATP6 gene (m.8969G>A, p.S148N). Whole exome sequencing did not identify mutations or variants in PUS1 or YARS2 or any known nuclear genes that could affect mitochondrial function and explain this phenotype. Studies of fibroblasts derived from the patient revealed a decrease in oligomycin-sensitive respiration, a finding which is consistent with a complex V defect. Thus, this mutation in MT-ATP6 may represent the first mtDNA point mutation associated with the MLASA phenotype.

  17. The role of SIGMAR1 gene mutation and mitochondrial dysfunction in amyotrophic lateral sclerosis.

    Science.gov (United States)

    Fukunaga, Kohji; Shinoda, Yasuharu; Tagashira, Hideaki

    2015-01-01

    Amyotrophic lateral sclerosis (ALS) patients exhibit diverse pathologies such as endoplasmic reticulum (ER) stress and mitochondrial dysfunction in motor neurons. Five to ten percent of patients have familial ALS, a form of the disease caused by mutations in ALS-related genes, while sporadic forms of the disease occur in 90-95% of patients. Recently, it was reported that familial ALS patients exhibit a missense mutation in SIGMAR1 (c.304G > C), which encodes sigma-1 receptor (Sig-1R), substituting glutamine for glutamic acid at amino acid residue 102 (p.E102Q). Expression of that mutant Sig-1R(E102Q) protein reduces mitochondrial ATP production, inhibits proteasome activity and causes mitochondrial injury, aggravating ER stress-induced neuronal death in neuro2A cells. In this issue, we discuss mechanisms underlying mitochondrial impairment seen in ALS motor neurons and propose that therapies that protect mitochondria might improve the quality of life (QOL) of ALS patients and should be considered for clinical trials.

  18. Effect of PEG and mPEG-anthracene on tRNA aggregation and particle formation.

    Science.gov (United States)

    Froehlich, E; Mandeville, J S; Arnold, D; Kreplak, L; Tajmir-Riahi, H A

    2012-01-09

    Poly(ethylene glycol) (PEG) and its derivatives are synthetic polymers with major applications in gene and drug delivery systems. Synthetic polymers are also used to transport miRNA and siRNA in vitro. We studied the interaction of tRNA with several PEGs of different compositions, such as PEG 3350, PEG 6000, and mPEG-anthracene under physiological conditions. FTIR, UV-visible, CD, and fluorescence spectroscopic methods as well as atomic force microscopy (AFM) were used to analyze the PEG binding mode, the binding constant, and the effects of polymer complexation on tRNA stability, aggregation, and particle formation. Structural analysis showed that PEG-tRNA interaction occurs via RNA bases and the backbone phosphate group with both hydrophilic and hydrophobic contacts. The overall binding constants of K(PEG 3350-tRNA)= 1.9 (±0.5) × 10(4) M(-1), K(PEG 6000-tRNA) = 8.9 (±1) × 10(4) M(-1), and K(mPEG-anthracene)= 1.2 (±0.40) × 10(3) M(-1) show stronger polymer-RNA complexation by PEG 6000 and by PEG 3350 than the mPEG-anthracene. AFM imaging showed that PEG complexes contain on average one tRNA with PEG 3350, five tRNA with PEG 6000, and ten tRNA molecules with mPEG-anthracene. tRNA aggregation and particle formation occurred at high polymer concentrations, whereas it remains in A-family structure.

  19. Sequence, structure, and stacking: specifics of tRNA anchoring to the T box riboswitch.

    Science.gov (United States)

    Grigg, Jason C; Ke, Ailong

    2013-12-01

    The term riboswitch usually refers to small molecule sensing regulatory modules in the 5' untranslated regions of a mRNA. They are typically comprised of separate ligand binding and regulatory domains. The T box riboswitch is unique from other identified riboswitches because its effector is an essential macromolecule, tRNA. It senses the aminoacylation state of tRNA to regulate genes involved in a variety of functions relating to amino acid metabolism and tRNA aminoacylation. T box riboswitches performs an intuitively simple process using a complex structured RNA element and, until recently, the underlying mechanisms were poorly understood. Only two sequence-specific contacts had been previously identified: (1) between the specifier sequence (codon) and the tRNA anticodon and (2) between an anti-terminator stem loop and the tRNA acceptor arm CCA tail. tRNA aminoacylation blocks the latter interaction and therefore serves as the switch between termination and anti-termination. Outside of these two contacts, the structure and functions of T box riboswitches have come to light in some recent studies. We recently described the X-ray crystal structure of the highly conserved T box riboswitch distal Stem I region and demonstrated that this region interacts with the tRNA elbow to anchor it to the riboswitch. Independently, Lehmann et al. used sequence homology search to arrive at a similar model for Stem I-tRNA interactions. The model was further supported by two recent structures of the Stem I-tRNA complex, determined independently by our group and by Zhang and Ferré-D'Amaré. This article highlights some of these contributions to synthesize an updated model for tRNA recognition by the T box riboswitch.

  20. The complete chloroplast and mitochondrial genomes of the green macroalga Ulva sp. UNA00071828 (Ulvophyceae, Chlorophyta.

    Directory of Open Access Journals (Sweden)

    James T Melton

    Full Text Available Sequencing mitochondrial and chloroplast genomes has become an integral part in understanding the genomic machinery and the phylogenetic histories of green algae. Previously, only three chloroplast genomes (Oltmannsiellopsis viridis, Pseudendoclonium akinetum, and Bryopsis hypnoides and two mitochondrial genomes (O. viridis and P. akinetum from the class Ulvophyceae have been published. Here, we present the first chloroplast and mitochondrial genomes from the ecologically and economically important marine, green algal genus Ulva. The chloroplast genome of Ulva sp. was 99,983 bp in a circular-mapping molecule that lacked inverted repeats, and thus far, was the smallest ulvophycean plastid genome. This cpDNA was a highly compact, AT-rich genome that contained a total of 102 identified genes (71 protein-coding genes, 28 tRNA genes, and three ribosomal RNA genes. Additionally, five introns were annotated in four genes: atpA (1, petB (1, psbB (2, and rrl (1. The circular-mapping mitochondrial genome of Ulva sp. was 73,493 bp and follows the expanded pattern also seen in other ulvophyceans and trebouxiophyceans. The Ulva sp. mtDNA contained 29 protein-coding genes, 25 tRNA genes, and two rRNA genes for a total of 56 identifiable genes. Ten introns were annotated in this mtDNA: cox1 (4, atp1 (1, nad3 (1, nad5 (1, and rrs (3. Double-cut-and-join (DCJ values showed that organellar genomes across Chlorophyta are highly rearranged, in contrast to the highly conserved organellar genomes of the red algae (Rhodophyta. A phylogenomic investigation of 51 plastid protein-coding genes showed that Ulvophyceae is not monophyletic, and also placed Oltmannsiellopsis (Oltmannsiellopsidales and Tetraselmis (Chlorodendrophyceae closely to Ulva (Ulvales and Pseudendoclonium (Ulothrichales.

  1. Complete mitochondrial genome of the giant African snail, Achatina fulica (Mollusca: Achatinidae): a novel location of putative control regions (CR) in the mitogenome within Pulmonate species.

    Science.gov (United States)

    He, Zhang-Ping; Dai, Xia-Bin; Zhang, Shuai; Zhi, Ting-Ting; Lun, Zhao-Rong; Wu, Zhong-Dao; Yang, Ting-Bao

    2016-01-01

    The whole sequence (15,057 bp) of the mitochondrial DNA (mtDNA) of the terrestrial snail Achatina fulica (order Stylommatophora) was determined. The mitogenome, as the typical metazoan mtDNA, contains 13 protein-coding genes (PCG), 2 ribosomal RNA genes (rRNA) and 22 transfer RNA genes (tRNA). The tRNA genes include two trnS without standard secondary structure. Interestingly, among the known mitogenomes of Pulmonata species, we firstly characterized an unassigned lengthy sequence (551 bp) between the cox1 and the trnV which may be the CR for the sake of its AT bases usage bias (65.70%) and potential hairpin structure.

  2. Complete mitochondrial genome sequence of the polychaete annelidPlatynereis dumerilii

    Energy Technology Data Exchange (ETDEWEB)

    Boore, Jeffrey L.

    2004-08-15

    Complete mitochondrial genome sequences are now available for 126 metazoans (see Boore 1999; Mitochondrial Genomics link at http://www.jgi.doe.gov), but the taxonomic representation is highly biased. For example, 80 are from a single phylum, Chordata, and show little variation for many molecular features. Arthropoda is represented by 16 taxa, Mollusca by eight, and Echinodermata by five, with only 17 others from the remaining {approx}30 metazoan phyla. With few exceptions (see Wolstenholme 1992 and Boore 1999) these are circular DNA molecules, about 16 kb in size, and encode the same set of 37 genes. A variety of non-standard names are sometimes used for animal mitochondrial genes; see Boore (1999) for gene nomenclature and a table of synonyms. Mitochondrial genome comparisons serve as a model of genome evolution. In this system, much smaller and simpler than that of the nucleus, are all of the same factors of genome evolution, where one may find tractable the changes in tRNA structure, base composition, genetic code, gene arrangement, etc. Further, patterns of mitochondrial gene rearrangements are an exceptionally reliable indicator of phylogenetic relationships (Smith et al.1993; Boore et al. 1995; Boore, Lavrov, and Brown 1998; Boore and Brown 1998, 2000; Dowton 1999; Stechmann and Schlegel 1999; Kurabayashi and Ueshima 2000). To these ends, we are sampling further the variation among major animal groups in features of their mitochondrial genomes.

  3. Intrageneric phylogeny of Acomys (rodentia, muridae) using mitochondrial gene cytochrome b.

    Science.gov (United States)

    Barome, P O; Monnerot, M; Gautun, J C

    1998-06-01

    This paper investigates interspecies relationships within the genus Acomys (spiny mice) by analyzing entire mitochondrial cytochrome b gene (1141 bp). This gene provides strong phylogenetic signal, as shown by high support of the topology obtained (bootstrap value and RNA support number). The phylogeny is congruent with inferences from allozymes for the species considered. Controversial taxonomy of Acomys cahirinus, dimidiatus, airensis, and ignitus is clarified, with their specific ranks confirmed on the basis of tree topology and nucleotide distances. Phylogenetic relationship between the undescribed species Acomys sp. from west Africa and A. airensis argue in favor of two distinct colonization events in this zone.

  4. The complete mitochondrial genome sequence of the spider habronattus oregonensis reveals rearranged and extremely truncated tRNAs

    Energy Technology Data Exchange (ETDEWEB)

    Masta, Susan E.; Boore, Jeffrey L.

    2004-01-31

    We sequenced the entire mitochondrial genome of the jumping spider Habronattus oregonensis of the arachnid order Araneae (Arthropoda: Chelicerata). A number of unusual features distinguish this genome from other chelicerate and arthropod mitochondrial genomes. Most of the transfer RNA gene sequences are greatly reduced in size and cannot be folded into typical cloverleaf-shaped secondary structures. At least nine of the tRNA sequences lack the potential to form TYC arm stem pairings, and instead are inferred to have TV-replacement loops. Furthermore, sequences that could encode the 3' aminoacyl acceptor stems in at least 10 tRNAs appear to be lacking, because fully paired acceptor stems are not possible and because the downstream sequences instead encode adjacent genes. Hence, these appear to be among the smallest known tRNA genes. We postulate that an RNA editing mechanism must exist to restore the 3' aminoacyl acceptor stems in order to allow the tRNAs to function. At least seven tRN As are rearranged with respect to the chelicerate Limulus polyphemus, although the arrangement of the protein-coding genes is identical. Most mitochondrial protein-coding genes of H. oregonensis have ATN as initiation codons, as commonly found in arthropod mtDNAs, but cytochrome oxidase subunit 2 and 3 genes apparently use UUG as an initiation codon. Finally, many of the gene sequences overlap one another and are truncated. This 14,381 bp genome, the first mitochondrial genome of a spider yet sequenced, is one of the smallest arthropod mitochondrial genomes known. We suggest that post transcriptional RNA editing can likely maintain function of the tRNAs while permitting the accumulation of mutations that would otherwise be deleterious. Such mechanisms may have allowed for the minimization of the spider mitochondrial genome.

  5. The complete mitochondrial genome of the orange-spotted grouper Epinephelus coioides (Perciformes, Serranidae).

    Science.gov (United States)

    Yang, Huirong; Xie, Zhenzhen; Li, Shuisheng; Wu, Xichao; Peng, Cheng; Zhang, Yong; Lin, Haoran

    2016-05-01

    We present the complete mitochondrial genome of Epinephelus coioides in this study. The mitochondrial genome is 16,458 bp in length, containing 13 protein-coding genes, 2 rRNA genes, 22 tRNA genes and a control region. All of them are encoded on the heavy strand except ND6 and 8 tRNA genes on the light strand. The nucleotide compositions of the light strand are 28.88% of G, 28.75% of T, 26.58% of A and 15.80% of C. All the protein-coding genes share ATG initiation codon except ATP6 with CTG and COXI with GTG, and four types of inferred termination codons are T (ND2, COXII, ND3, ND4 and Cytb), TA (COXIII), TAA (ND1, ATP8, ND4L, ND5, ATP6 and COXI) and TAG (ND6). There are 10 intergenic spacers, 5 gene overlaps and no tandem repeat sequence. Gene arrangement and distribution are consistent with the typical vertebrates.

  6. Gene expression profiling in equine polysaccharide storage myopathy revealed inflammation, glycogenesis inhibition, hypoxia and mitochondrial dysfunctions

    Directory of Open Access Journals (Sweden)

    Benech Philippe

    2009-08-01

    Full Text Available Abstract Background Several cases of myopathies have been observed in the horse Norman Cob breed. Muscle histology examinations revealed that some families suffer from a polysaccharide storage myopathy (PSSM. It is assumed that a gene expression signature related to PSSM should be observed at the transcriptional level because the glycogen storage disease could also be linked to other dysfunctions in gene regulation. Thus, the functional genomic approach could be conducted in order to provide new knowledge about the metabolic disorders related to PSSM. We propose exploring the PSSM muscle fiber metabolic disorders by measuring gene expression in relationship with the histological phenotype. Results Genotypying analysis of GYS1 mutation revealed 2 homozygous (AA and 5 heterozygous (GA PSSM horses. In the PSSM muscles, histological data revealed PAS positive amylase resistant abnormal polysaccharides, inflammation, necrosis, and lipomatosis and active regeneration of fibers. Ultrastructural evaluation revealed a decrease of mitochondrial number and structural disorders. Extensive accumulation of an abnormal polysaccharide displaced and partially replaced mitochondria and myofibrils. The severity of the disease was higher in the two homozygous PSSM horses. Gene expression analysis revealed 129 genes significantly modulated (p Conclusion The main disorders observed in PSSM muscles could be related to mitochondrial dysfunctions, glycogenesis inhibition and the chronic hypoxia of the PSSM muscles.

  7. Relationship between mutations of mitochondrial DNA ND1 gene and type 2 diabetes

    Institute of Scientific and Technical Information of China (English)

    于珮; 于德民; 刘德敏; 王琨; 汤新之

    2004-01-01

    Background Recent studies have indicated that many mutations in mitochondrial (mt)DNA NDI gene region are related to diabetes mellitus. In this study we explored the relationship between various mtDNA ND1 gene mutations and type 2 diabetes mellitus (DM) among Chinese. Methods Using PCR restriction fragment length polymorphism (PCR-RFLP) analysis and gene sequencing, 4 spots of mtDNA (nt3243, nt3316, nt3394, nt3426) were screened in 478 diabetics and 430 non-diabetic subjects.Results In diabetic group, there were 13 carriers (2.72%)of 3316 G→A mutation,12 (2.51%) of 3394 T→C mutation and 2 (0.42%) of 3426A→G mutation. In controls, only 3394 T→C mutation was observed in 2 subjects (0.47%). There was significant difference in the frequency of 3316 and 3394 mutation between two groups (P<0.05, respectively). More subjects with mitochondrial DNA ND1 gene mutations had DM family history and greater tendency of maternal inheritance when compared to those patients without mutation in diabetic group(P<0.01). A 3426 mutation diabetic pedigree was studied, and we found 12 maternal members in the family had the same mutation. Conclusion mtDNA ND1 gene mutations at nt3316 (G→A), nt3394 (T→C) and 3426 (A→G) might contribute to the pathogenesis of DM with other genetic factors and environment factors.

  8. Is tRNA binding or tRNA mimicry mandatory for translation factors?

    Science.gov (United States)

    Kristensen, Ole; Laurberg, Martin; Liljas, Anders; Selmer, Maria

    2002-02-01

    tRNA is the adaptor in the translation process. The ribosome has three sites for tRNA, the A-, P-, and E-sites. The tRNAs bridge between the ribosomal subunits with the decoding site and the mRNA on the small or 30S subunit and the peptidyl transfer site on the large or 50S subunit. The possibility that translation release factors could mimic tRNA has been discussed for a long time, since their function is very similar to that of tRNA. They identify stop codons of the mRNA presented in the decoding site and hydrolyse the nascent peptide from the peptidyl tRNA in the peptidyl transfer site. The structures of eubacterial release factors are not yet known, and the first example of tRNA mimicry was discovered when elongation factor G (EF-G) was found to have a closely similar shape to a complex of elongation factor Tu (EF-Tu) with aminoacyl-tRNA. An even closer imitation of the tRNA shape is seen in ribosome recycling factor (RRF). The number of proteins mimicking tRNA is rapidly increasing. This primarily concerns translation factors. It is now evident that in some sense they are either tRNA mimics, GTPases or possibly both.

  9. Complete sequences of the mitochondrial DNA of the wild Gracilariopsis lemaneiformis and two mutagenic cultivated breeds (Gracilariaceae, Rhodophyta.

    Directory of Open Access Journals (Sweden)

    Lei Zhang

    Full Text Available The complete mitochondrial DNA (mtDNA of Gracilariopsis lemaneiformis was sequenced (25883 bp and mapped to a circular model. The A+T composition was 72.5%. Forty six genes and two potentially functional open reading frames were identified. They include 24 protein-coding genes, 2 rRNA genes, 20 tRNA genes and 2 ORFs (orf60, orf142. There is considerable sequence synteny across the five red algal mtDNAs falling into Florideophyceae including Gr. lemaneiformis in this study and previously sequenced species. A long stem-loop and a hairpin structure were identified in intergenic regions of mt genome of Gr. lemaneiformis, which are believed to be involved with transcription and replication. In addition, the mtDNAs of two mutagenic cultivated breeds ("981" and "07-2" were also sequenced. Compared with the mtDNA of wild Gr. lemaneiformis, the genome size and gene length and order of three strains were completely identical except nine base mutations including eight in the protein-coding genes and one in the tRNA gene. None of the base mutations caused frameshift or a premature stop codon in the mtDNA genes. Phylogenetic analyses based on mitochondrial protein-coding genes and rRNA genes demonstrated Gracilariopsis andersonii had closer phylogenetic relationship with its parasite Gracilariophila oryzoides than Gracilariopsis lemaneiformis which was from the same genus of Gracilariopsis.

  10. Gene expression profiling specifies chemokine, mitochondrial and lipid metabolism signatures in leprosy.

    Directory of Open Access Journals (Sweden)

    Luana Tatiana Albuquerque Guerreiro

    Full Text Available Herein, we performed microarray experiments in Schwann cells infected with live M. leprae and identified novel differentially expressed genes (DEG in M. leprae infected cells. Also, we selected candidate genes associated or implicated with leprosy in genetic studies and biological experiments. Forty-seven genes were selected for validation in two independent types of samples by multiplex qPCR. First, an in vitro model using THP-1 cells was infected with live Mycobacterium leprae and M. bovis bacillus Calmette-Guérin (BCG. In a second situation, mRNA obtained from nerve biopsies from patients with leprosy or other peripheral neuropathies was tested. We detected DEGs that discriminate M. bovis BCG from M. leprae infection. Specific signatures of susceptible responses after M. leprae infection when compared to BCG lead to repression of genes, including CCL2, CCL3, IL8 and SOD2. The same 47-gene set was screened in nerve biopsies, which corroborated the down-regulation of CCL2 and CCL3 in leprosy, but also evidenced the down-regulation of genes involved in mitochondrial metabolism, and the up-regulation of genes involved in lipid metabolism and ubiquitination. Finally, a gene expression signature from DEG was identified in patients confirmed of having leprosy. A classification tree was able to ascertain 80% of the cases as leprosy or non-leprous peripheral neuropathy based on the expression of only LDLR and CCL4. A general immune and mitochondrial hypo-responsive state occurs in response to M. leprae infection. Also, the most important genes and pathways have been highlighted providing new tools for early diagnosis and treatment of leprosy.

  11. Biosynthesis and functions of sulfur modifications in tRNA

    Directory of Open Access Journals (Sweden)

    Naoki eShigi

    2014-04-01

    Full Text Available Sulfur is an essential element for a variety of cellular constituents in all living organisms. In tRNA molecules, there are many sulfur-containing nucleosides, such as the derivatives of 2‑thiouridine (s2U, 4-thiouridine (s4U, 2-thiocytidine (s2C, and 2-methylthioadenosine (ms2A. Earlier studies established the functions of these modifications for accurate and efficient translation, including proper recognition of the codons in mRNA or stabilization of tRNA structure. In many cases, the biosynthesis of these sulfur modifications starts with cysteine desulfurases, which catalyze the generation of persulfide (an activated form of sulfur from cysteine. Many sulfur-carrier proteins are responsible for delivering this activated sulfur to each biosynthesis pathway. Finally, specific modification enzymes activate target tRNAs and then incorporate sulfur atoms. Intriguingly, the biosynthesis of 2-thiouridine in all domains of life is functionally and evolutionarily related to the ubiquitin-like post-translational modification system of cellular proteins in eukaryotes. This review summarizes the recent characterization of the biosynthesis of sulfur modifications in tRNA and the novel roles of this modification in cellular functions in various model organisms, with a special emphasis on 2-thiouridine derivatives. Each biosynthesis pathway of sulfur-containing molecules is mutually modulated via sulfur trafficking, and 2-thiouridine and codon usage bias have been proposed to control the translation of specific genes.

  12. The partial mitochondrial genome of the Cephalothrix rufifrons (Nemertea, Palaeonemertea): characterization and implications for the phylogenetic position of Nemertea.

    Science.gov (United States)

    Turbeville, J M; Smith, D M

    2007-06-01

    A continuous 10.1kb fragment of the Cephalothrix rufifrons (Nemertea, Palaeonemertea) mitochondrial genome was sequenced and characterized to further assess organization of protostome mitochondrial genomes and evaluate the phylogenetic potential of gene arrangement and amino acid characters. The genome is A-T rich (72%), and this biased base composition is partly reflected in codon usage. Inferred tRNA secondary structures are typical of those reported for other metazoan mitochondrial DNAs. The arrangement of the 26 genes contained in the fragment exhibits marked similarity to those of many protostome taxa, most notably molluscs with highly conserved arrangements and a phoronid. Separate and simultaneous phylogenetic analyses of inferred amino acid sequences and gene adjacencies place the nemertean within the protostomes among coelomate lophotrochozoan taxa, but do not find a well-supported sister taxon link.

  13. The Maize Imprinted Gene Floury3 Encodes a PLATZ Protein Required for tRNA and 5S rRNA Transcription Through Interaction with RNA Polymerase III.

    Science.gov (United States)

    Li, Qi; Wang, Jiechen; Ye, Jianwei; Zheng, Xixi; Xiang, Xiaoli; Li, Changsheng; Fu, Miaomiao; Wang, Qiong; Zhang, Zhi-Yong; Wu, Yongrui

    2017-09-05

    Maize (Zea mays) floury3 (fl3) is a classic semi-dominant negative mutant that exhibits severe defects in the endosperm but fl3 plants otherwise appear normal. We cloned the fl3 gene and determined that it encodes a PLATZ (plant AT-rich sequence- and zinc-binding) protein. The mutation in fl3 resulted in an Asn to His replacement in the conserved PLATZ domain, creating a dominant allele. Fl3 is specifically expressed in starchy endosperm cells and regulated by genomic imprinting, which leads to the suppressed expression of fl3 when transmitted through the male, perhaps as a consequence the semi-dominant behavior. Yeast two-hybrid screening and bimolecular luciferase complementation (BiLC) experiments revealed that FL3 interacts with the RNA polymerase III subunit 53 (RPC53) and transcription factor class C 1 (TFC1), two critical factors of the RNA polymerase III (RNAPIII) transcription complex. In the fl3 endosperm, the levels of many tRNAs and 5S rRNA that are transcribed by RNAPIII are significantly reduced, suggesting that the incorrectly folded fl3 protein may impair the function of RNAPIII. The transcriptome is dramatically altered in fl3 mutants, in which the down-regulated genes are primarily enriched in pathways related to translation, ribosome, misfolded protein responses and nutrient reservoir activity. Collectively, these changes may lead to defects in endosperm development and storage reserve filling in fl3 seeds. © 2017 American Society of Plant Biologists. All rights reserved.

  14. Ca2+ signals regulate mitochondrial metabolism by stimulating CREB-mediated expression of the mitochondrial Ca2+ uniporter gene MCU.

    Science.gov (United States)

    Shanmughapriya, Santhanam; Rajan, Sudarsan; Hoffman, Nicholas E; Zhang, Xueqian; Guo, Shuchi; Kolesar, Jill E; Hines, Kevin J; Ragheb, Jonathan; Jog, Neelakshi R; Caricchio, Roberto; Baba, Yoshihiro; Zhou, Yandong; Kaufman, Brett A; Cheung, Joseph Y; Kurosaki, Tomohiro; Gill, Donald L; Madesh, Muniswamy

    2015-03-03

    Cytosolic Ca2+ signals, generated through the coordinated translocation of Ca2+ across the plasma membrane (PM) and endoplasmic reticulum (ER) membrane, mediate diverse cellular responses. Mitochondrial Ca2+ is important for mitochondrial function, and when cytosolic Ca2+ concentration becomes too high, mitochondria function as cellular Ca2+ sinks. By measuring mitochondrial Ca2+ currents, we found that mitochondrial Ca2+ uptake was reduced in chicken DT40 B lymphocytes lacking either the ER-localized inositol trisphosphate receptor (IP3R), which releases Ca2+ from the ER, or Orai1 or STIM1, components of the PM-localized Ca2+ -permeable channel complex that mediates store-operated calcium entry (SOCE) in response to depletion of ER Ca2+ stores. The abundance of MCU, the pore-forming subunit of the mitochondrial Ca2+ uniporter, was reduced in cells deficient in IP3R, STIM1, or Orai1. Chromatin immunoprecipitation and promoter reporter analyses revealed that the Ca2+ -regulated transcription factor CREB (cyclic adenosine monophosphate response element-binding protein) directly bound the MCU promoter and stimulated expression. Lymphocytes deficient in IP3R, STIM1, or Orai1 exhibited altered mitochondrial metabolism, indicating that Ca2+ released from the ER and SOCE-mediated signals modulates mitochondrial function. Thus, our results showed that a transcriptional regulatory circuit involving Ca2+ -dependent activation of CREB controls the Ca2+ uptake capability of mitochondria and hence regulates mitochondrial metabolism.

  15. Fast evolution of the retroprocessed mitochondrial rps3 gene in Conifer II and further evidence for the phylogeny of gymnosperms.

    Science.gov (United States)

    Ran, Jin-Hua; Gao, Hui; Wang, Xiao-Quan

    2010-01-01

    The popular view that plant mitochondrial genome evolves slowly in sequence has been recently challenged by the extraordinarily high substitution rates of mtDNA documented mainly from several angiosperm genera, but high substitution rate acceleration accompanied with great length variation has been very rarely reported in plant mitochondrial genes. Here, we studied evolution of the mitochondrial rps3 gene that encodes the ribosomal small subunit protein 3 and found a dramatically high variation in both length and sequence of an exon region of it in Conifer II. A sequence comparison between cDNA and genomic DNA showed that there are no RNA editing sites in the Conifer II rps3 gene. Southern blotting analyses of the total DNA and mtDNA, together with the real-time PCR analysis, showed that rps3 exists as a single mitochondrial locus in gymnosperms. It is very likely that the Conifer II rps3 gene has experienced retroprocessing, i.e., the re-integration of its cDNA into the mitochondrial genome, followed by an evolutionary acceleration due to the intron loss. In addition, the phylogenetic analysis of rps3 supports the sister relationship between conifers and Gnetales. In particular, the monophyly of conifer II is strongly supported by the shared loss of two rps3 introns. Our results also indicate that the mitochondrial gene tree would be affected in topology when the "edited" paralogs are analyzed together with their genomic sequences.

  16. MIP1, a new yeast gene homologous to the rat mitochondrial intermediate peptidase gene, is required for oxidative metabolism in Saccharomyces cerevisiae.

    OpenAIRE

    Isaya, G; Miklos, D; Rollins, R A

    1994-01-01

    Cleavage of amino-terminal octapeptides, F/L/IXXS/T/GXXXX, by mitochondrial intermediate peptidase (MIP) is typical of many mitochondrial precursor proteins imported to the matrix and the inner membrane. We previously described the molecular characterization of rat liver MIP (RMIP) and indicated a putative homolog in the sequence predicted from gene YCL57w of yeast chromosome III. A new yeast gene, MIP1, has now been isolated by screening a Saccharomyces cerevisiae genomic library with an RMI...

  17. Sequence analysis of mitochondrial 16S ribosomal RNA gene fragment from seven mosquito species

    Indian Academy of Sciences (India)

    Yogesh S Shouche; Milind S Patole

    2000-12-01

    Mosquitoes are vectors for the transmission of many human pathogens that include viruses, nematodes and protozoa. For the understanding of their vectorial capacity, identification of disease carrying and refractory strains is essential. Recently, molecular taxonomic techniques have been utilized for this purpose. Sequence analysis of the mitochondrial 16S rRNA gene has been used for molecular taxonomy in many insects. In this paper, we have analysed a 450 bp hypervariable region of the mitochondrial 16S rRNA gene in three major genera of mosquitoes, Aedes, Anopheles and Culex. The sequence was found to be unusually A + T rich and in substitutions the rate of transversions was higher than the transition rate. A phylogenetic tree was constructed with these sequences. An interesting feature of the sequences was a stretch of Ts that distinguished between Aedes and Culex on the one hand, and Anopheles on the other. This is the first report of mitochondrial rRNA sequences from these medically important genera of mosquitoes.

  18. The complete mitochondrial genome of the citrus red mite Panonychus citri (Acari: Tetranychidae): high genome rearrangement and extremely truncated tRNAs.

    Science.gov (United States)

    Yuan, Ming-Long; Wei, Dan-Dan; Wang, Bao-Jun; Dou, Wei; Wang, Jin-Jun

    2010-10-23

    The family Tetranychidae (Chelicerata: Acari) includes ~1200 species, many of which are of agronomic importance. To date, mitochondrial genomes of only two Tetranychidae species have been sequenced, and it has been found that these two mitochondrial genomes are characterized by many unusual features in genome organization and structure such as gene order and nucleotide frequency. The scarcity of available sequence data has greatly impeded evolutionary studies in Acari (mites and ticks). Information on Tetranychidae mitochondrial genomes is quite important for phylogenetic evaluation and population genetics, as well as the molecular evolution of functional genes such as acaricide-resistance genes. In this study, we sequenced the complete mitochondrial genome of Panonychus citri (Family Tetranychidae), a worldwide citrus pest, and provide a comparison to other Acari. The mitochondrial genome of P. citri is a typical circular molecule of 13,077 bp, and contains the complete set of 37 genes that are usually found in metazoans. This is the smallest mitochondrial genome within all sequenced Acari and other Chelicerata, primarily due to the significant size reduction of protein coding genes (PCGs), a large rRNA gene, and the A + T-rich region. The mitochondrial gene order for P. citri is the same as those for P. ulmi and Tetranychus urticae, but distinctly different from other Acari by a series of gene translocations and/or inversions. The majority of the P. citri mitochondrial genome has a high A + T content (85.28%), which is also reflected by AT-rich codons being used more frequently, but exhibits a positive GC-skew (0.03). The Acari mitochondrial nad1 exhibits a faster amino acid substitution rate than other genes, and the variation of nucleotide substitution patterns of PCGs is significantly correlated with the G + C content. Most tRNA genes of P. citri are extremely truncated and atypical (44-65, 54.1 ± 4.1 bp), lacking either the T- or D-arm, as found in P. ulmi

  19. The complete mitochondrial genome of the citrus red mite Panonychus citri (Acari: Tetranychidae: high genome rearrangement and extremely truncated tRNAs

    Directory of Open Access Journals (Sweden)

    Dou Wei

    2010-10-01

    Full Text Available Abstract Background The family Tetranychidae (Chelicerata: Acari includes ~1200 species, many of which are of agronomic importance. To date, mitochondrial genomes of only two Tetranychidae species have been sequenced, and it has been found that these two mitochondrial genomes are characterized by many unusual features in genome organization and structure such as gene order and nucleotide frequency. The scarcity of available sequence data has greatly impeded evolutionary studies in Acari (mites and ticks. Information on Tetranychidae mitochondrial genomes is quite important for phylogenetic evaluation and population genetics, as well as the molecular evolution of functional genes such as acaricide-resistance genes. In this study, we sequenced the complete mitochondrial genome of Panonychus citri (Family Tetranychidae, a worldwide citrus pest, and provide a comparison to other Acari. Results The mitochondrial genome of P. citri is a typical circular molecule of 13,077 bp, and contains the complete set of 37 genes that are usually found in metazoans. This is the smallest mitochondrial genome within all sequenced Acari and other Chelicerata, primarily due to the significant size reduction of protein coding genes (PCGs, a large rRNA gene, and the A + T-rich region. The mitochondrial gene order for P. citri is the same as those for P. ulmi and Tetranychus urticae, but distinctly different from other Acari by a series of gene translocations and/or inversions. The majority of the P. citri mitochondrial genome has a high A + T content (85.28%, which is also reflected by AT-rich codons being used more frequently, but exhibits a positive GC-skew (0.03. The Acari mitochondrial nad1 exhibits a faster amino acid substitution rate than other genes, and the variation of nucleotide substitution patterns of PCGs is significantly correlated with the G + C content. Most tRNA genes of P. citri are extremely truncated and atypical (44-65, 54.1 ± 4.1 bp, lacking

  20. Interactive Effects of Dietary Lipid and Phenotypic Feed Efficiency on the Expression of Nuclear and Mitochondrial Genes Involved in the Mitochondrial Electron Transport Chain in Rainbow Trout

    Directory of Open Access Journals (Sweden)

    Jonathan C. Eya

    2015-04-01

    Full Text Available A 2 × 3 factorial study was conducted to evaluate the effects of dietary lipid level on the expression of mitochondrial and nuclear genes involved in electron transport chain in all-female rainbow trout Oncorhynchus mykiss. Three practical diets with a fixed crude protein content of 40%, formulated to contain 10% (40/10, 20% (40/20 and 30% (40/30 dietary lipid, were fed to apparent satiety to triplicate groups of either low-feed efficient (F120; 217.66 ± 2.24 g initial average mass or high-feed efficient (F136; 205.47 ± 1.27 g full-sib families of fish, twice per day, for 90 days. At the end of the experiment, the results showed that there is an interactive effect of the dietary lipid levels and the phenotypic feed efficiency (growth rate and feed efficiency on the expression of the mitochondrial genes nd1 (NADH dehydrogenase subunit 1, cytb (Cytochrome b, cox1 (Cytochrome c oxidase subunits 1, cox2 (Cytochrome c oxidase subunits 2 and atp6 (ATP synthase subunit 6 and nuclear genes ucp2α (uncoupling proteins 2 alpha, ucp2β (uncoupling proteins 2 beta, pparα (peroxisome proliferator-activated receptor alpha, pparβ (peroxisome proliferatoractivated receptor beta and ppargc1α (proliferator-activated receptor gamma coactivator 1 alpha in fish liver, intestine and muscle, except on ppargc1α in the muscle which was affected by the diet and the family separately. Also, the results revealed that the expression of mitochondrial genes is associated with that of nuclear genes involved in electron transport chain in fish liver, intestine and muscle. Furthermore, this work showed that the expression of mitochondrial genes parallels with the expression of genes encoding uncoupling proteins (UCP in the liver and the intestine of rainbow trout. This study for the first time presents the molecular basis of the effects of dietary lipid level on mitochondrial and nuclear genes involved in mitochondrial electron transport chain in fish.

  1. The daily rhythms of mitochondrial gene expression and oxidative stress regulation are altered by aging in the mouse liver.

    Science.gov (United States)

    Gong, Changxia; Li, Chengwei; Qi, Xiaoqing; Song, Zhiyin; Wu, Jianguo; Hughes, Michael E; Li, Xiaodong

    2015-01-01

    The circadian clock regulates many cellular processes, notably including the cell cycle, metabolism and aging. Mitochondria play essential roles in metabolism and are the major sites of reactive oxygen species (ROS) production in the cell. The clock regulates mitochondrial functions by driving daily changes in NAD(+) levels and Sirt3 activity. In addition to this central route, in the present study, we find that the expression of some mitochondrial genes is also rhythmic in the liver, and that there rhythms are disrupted by the Clock(Δ19) mutation in young mice, suggesting that they are regulated by the core circadian oscillator. Related to this observation, we also find that the regulation of oxidative stress is rhythmic in the liver. Since mitochondria and ROS play important roles in aging, and mitochondrial functions are also disturbed by aging, these related observations prompt the compelling hypothesis that circadian oscillators influence aging by regulating ROS in mitochondria. During aging, the expression rhythms of some mitochondrial genes were altered in the liver and the temporal regulation over the dynamics of mitochondrial oxidative stress was disrupted. However, the expression of clock genes was not affected. Our results suggested that mitochondrial functions are combinatorially regulated by the clock and other age-dependent mechanism(s), and that aging disrupts mitochondrial rhythms through mechanisms downstream of the clock.

  2. Regulation of the cell cycle via mitochondrial gene expression and energy metabolism in HeLa cells

    Institute of Scientific and Technical Information of China (English)

    Wei Xiong; Yang Jiao; Weiwei Huang; Mingxing Ma; Min Yu; Qinghua Cui; Deyong Tan

    2012-01-01

    Human cervical cancer HeLa cells have functional mitochondria.Recent studies have suggested that mitochondrial metabolism plays an essential role in tumor cell proliferation.Nevertheless,how cells coordinate mitochondrial dynamics and cell cycle progression remains to be clarified.To investigate the relationship between mitochondrial function and cell cycle regulation,the mitochondrial gene expression profile and cellular ATP levels were determined by cell cycle progress analysis in the present study.HeLa cells were synchronized in the G0/G1 phase by serum starvation,and re-entered cell cycle by restoring serum culture,time course experiment was performed to analyze the expression of mitochondrial transcription regulators and mitochondrial genes,mitochondrial membrane potential (MMP),cellular ATP levels,and cell cycle progression.The results showed that when arrested G0/G1 cells were stimulated in serum-containing medium,the amount of DNA and the expression levels of both mRNA and proteins in mitochondria started to increase at 2 h time point,whereas the MMP and ATP level elevated at 4 h.Furthermore,the cyclin D1 expression began to increase at 4 h after serum triggered cell cycle.ATP synthesis inhibitor-oligomycintreatment suppressed the cyclin D1 and cyclin B1 expression levels and blocked cell cycle progression.Taken together,our results suggested that increased mitochondrial gene expression levels,oxidative phosphorylation activation,and cellular ATP content increase are important events for triggering cell cycle.Finally,we demonstrated that mitochondrial gene expression levels and cellular ATP content are tightly regulated and might play a central role in regulating cell proliferation.

  3. Genetic differentiation of the mitochondrial cytochrome oxidase C subunit I gene in genus Paramecium (Protista, Ciliophora.

    Directory of Open Access Journals (Sweden)

    Yan Zhao

    Full Text Available BACKGROUND: The mitochondrial cytochrome c oxidase subunit I (COI gene is being used increasingly for evaluating inter- and intra-specific genetic diversity of ciliated protists. However, very few studies focus on assessing genetic divergence of the COI gene within individuals and how its presence might affect species identification and population structure analyses. METHODOLOGY/PRINCIPAL FINDINGS: We evaluated the genetic variation of the COI gene in five Paramecium species for a total of 147 clones derived from 21 individuals and 7 populations. We identified a total of 90 haplotypes with several individuals carrying more than one haplotype. Parsimony network and phylogenetic tree analyses revealed that intra-individual diversity had no effect in species identification and only a minor effect on population structure. CONCLUSIONS: Our results suggest that the COI gene is a suitable marker for resolving inter- and intra-specific relationships of Paramecium spp.

  4. Genetic differentiation of the mitochondrial cytochrome oxidase C subunit I gene in genus Paramecium (Protista, Ciliophora).

    Science.gov (United States)

    Zhao, Yan; Gentekaki, Eleni; Yi, Zhenzhen; Lin, Xiaofeng

    2013-01-01

    The mitochondrial cytochrome c oxidase subunit I (COI) gene is being used increasingly for evaluating inter- and intra-specific genetic diversity of ciliated protists. However, very few studies focus on assessing genetic divergence of the COI gene within individuals and how its presence might affect species identification and population structure analyses. We evaluated the genetic variation of the COI gene in five Paramecium species for a total of 147 clones derived from 21 individuals and 7 populations. We identified a total of 90 haplotypes with several individuals carrying more than one haplotype. Parsimony network and phylogenetic tree analyses revealed that intra-individual diversity had no effect in species identification and only a minor effect on population structure. Our results suggest that the COI gene is a suitable marker for resolving inter- and intra-specific relationships of Paramecium spp.

  5. Ethylmalonic encephalopathy is caused by mutations in ETHE1, a gene encoding a mitochondrial matrix protein.

    Science.gov (United States)

    Tiranti, Valeria; D'Adamo, Pio; Briem, Egill; Ferrari, Gianfrancesco; Mineri, Rossana; Lamantea, Eleonora; Mandel, Hanna; Balestri, Paolo; Garcia-Silva, Maria-Teresa; Vollmer, Brigitte; Rinaldo, Piero; Hahn, Si Houn; Leonard, James; Rahman, Shamima; Dionisi-Vici, Carlo; Garavaglia, Barbara; Gasparini, Paolo; Zeviani, Massimo

    2004-02-01

    Ethylmalonic encephalopathy (EE) is a devastating infantile metabolic disorder affecting the brain, gastrointestinal tract, and peripheral vessels. High levels of ethylmalonic acid are detected in the body fluids, and cytochrome c oxidase activity is decreased in skeletal muscle. By use of a combination of homozygosity mapping, integration of physical and functional genomic data sets, and mutational screening, we identified GenBank D83198 as the gene responsible for EE. We also demonstrated that the D83198 protein product is targeted to mitochondria and internalized into the matrix after energy-dependent cleavage of a short leader peptide. The gene had previously been known as "HSCO" (for hepatoma subtracted clone one). However, given its role in EE, the name of the gene has been changed to "ETHE1." The severe consequences of its malfunctioning indicate an important role of the ETHE1 gene product in mitochondrial homeostasis and energy metabolism.

  6. Sequence and secondary structure of the mitochondrial 16S ribosomal RNA gene of Ixodes scapularis.

    Science.gov (United States)

    Krakowetz, Chantel N; Chilton, Neil B

    2015-02-01

    The complete DNA sequences and secondary structure of the mitochondrial (mt) 16S ribosomal (r) RNA gene were determined for six Ixodes scapularis adults. There were 44 variable nucleotide positions in the 1252 bp sequence alignment. Most (95%) nucleotide alterations did not affect the integrity of the secondary structure of the gene because they either occurred at unpaired positions or represented compensatory changes that maintained the base pairing in helices. A large proportion (75%) of the intraspecific variation in DNA sequence occurred within Domains I, II and VI of the 16S gene. Therefore, several regions within this gene may be highly informative for studies of the population genetics and phylogeography of I. scapularis, a major vector of pathogens of humans and domestic animals in North America.

  7. The complete mitochondrial genome of the bagarius yarrelli from honghe river

    Science.gov (United States)

    Du, M.; Zhou, C. J.; Niu, B. Z.; Liu, Y. H.; Li, N.; Ai, J. L.; Xu, G. L.

    2016-08-01

    The total length of mitochondrial DNA sequence of the Bagarius yarrelli from the Honghe river of China is determined in this paper. The total length of the circular molecule is 16524 base pair which denoted a similar gene order to that of the other bony fishes, which include a non-coding control region, a replicated origin, two ribosome RNA (rRNA) genes, 22 transfer RNA (tRNA) genes as well as 13 protein-coding genes. Its whole base constitution is 31.4% for A, 26.9% for C, 15.7% for G and 26.0% for T, with an A+T bias of 57.4%. Those mitochondrial data would contribute to further study molecular evolution and population genetics of this species.

  8. Genetic characterization of Meigu goat (Capra hircus) based on the mitochondrial DNA.

    Science.gov (United States)

    Duan, Xiaoyue; Zhang, Hao; Li, Haijun; Niu, Lili; Wang, Linjie; Li, Li; Zhang, Hongping; Zhong, Tao

    2016-01-01

    Meigu goat (Capra hircus) is one of the indigenous goat breeds in China. Our research findings revealed that the entire mitochondrial genome of Meigu goat was 16,643 bp in length. The contents of A, C, T and G in the mitochondrial genome were 33.59%, 26.05%, 27.31% and 13.05%, respectively. The mitogenome of meigu goat contained 13 protein-coding genes, 2 rRNA genes, 22 tRNA genes and 1 control region. Components of the Meigu goat's mitogenome were similar to those of other Capra hircus in gene arrangement and composition. These results could provide essential information for molecular phylogenetic and evolutionary analyses of domestic goats.

  9. Complete mitochondrial genome of the striped sandgoby Acentrogobius pflaumii (Perciformes, gobiidae).

    Science.gov (United States)

    Jin, Xiaoxiao; Wang, Rixin; Zhao, Shenglong; Xu, Tianjun; Shi, Ge

    2012-12-01

    The striped sandgoby, Acentrogobius pflaumii (Perciformes, Gobiidae), is a widespread goby inhabiting shallow sandy-muddy bottoms in temperate riverine estuaries and inner bays. In this study, the complete mitochondrial genome of A. pflaumii was firstly determined. The genome is 16,515 bp in length and consists of 13 protein-coding genes, 22 tRNA genes, 2 ribosomal RNA genes, and 2 main non-coding regions (the control region and the origin of the light-strand replication). The overall base composition of A. pflaumii is 25.8% for T, 29.3% for C, 26.6% for A, and 18.3% for G, with a slight A+T bias of 52.4%. It has the typical vertebrate mitochondrial gene arrangement.

  10. Common inherited variation in mitochondrial genes is not enriched for associations with type 2 diabetes or related glycemic traits.

    Directory of Open Access Journals (Sweden)

    Ayellet V Segrè

    2010-08-01

    Full Text Available Mitochondrial dysfunction has been observed in skeletal muscle of people with diabetes and insulin-resistant individuals. Furthermore, inherited mutations in mitochondrial DNA can cause a rare form of diabetes. However, it is unclear whether mitochondrial dysfunction is a primary cause of the common form of diabetes. To date, common genetic variants robustly associated with type 2 diabetes (T2D are not known to affect mitochondrial function. One possibility is that multiple mitochondrial genes contain modest genetic effects that collectively influence T2D risk. To test this hypothesis we developed a method named Meta-Analysis Gene-set Enrichment of variaNT Associations (MAGENTA; http://www.broadinstitute.org/mpg/magenta. MAGENTA, in analogy to Gene Set Enrichment Analysis, tests whether sets of functionally related genes are enriched for associations with a polygenic disease or trait. MAGENTA was specifically designed to exploit the statistical power of large genome-wide association (GWA study meta-analyses whose individual genotypes are not available. This is achieved by combining variant association p-values into gene scores and then correcting for confounders, such as gene size, variant number, and linkage disequilibrium properties. Using simulations, we determined the range of parameters for which MAGENTA can detect associations likely missed by single-marker analysis. We verified MAGENTA's performance on empirical data by identifying known relevant pathways in lipid and lipoprotein GWA meta-analyses. We then tested our mitochondrial hypothesis by applying MAGENTA to three gene sets: nuclear regulators of mitochondrial genes, oxidative phosphorylation genes, and approximately 1,000 nuclear-encoded mitochondrial genes. The analysis was performed using the most recent T2D GWA meta-analysis of 47,117 people and meta-analyses of seven diabetes-related glycemic traits (up to 46,186 non-diabetic individuals. This well-powered analysis found no

  11. Complete mitochondrial genome sequences of Atlantic sturgeon, Acipenser oxyrinchus oxyrinchus, Gulf sturgeon, A. o. desotoi and European sturgeon A. sturio (Acipenseriformes: Acipenseridae) obtained through next generation sequencing.

    Science.gov (United States)

    Popović, Danijela; Baca, Mateusz; Panagiotopoulou, Hanna

    2016-07-01

    Complete mitochondrial genome sequences of European sturgeon and two subspecies of the North American, Atlantic and Gulf sturgeons were determined using MiSeq Illumina technology. All three genomes show typical vertebrate organization. They possess 22 tRNA genes, 13 protein-coding genes, 2 rRNA (ribosomal RNA) genes and a non-coding control region. Excluding ND6, all protein-coding genes are on the heavy strand. The whole mitogenome sequences have been deposited in GenBank under accession numbers KP997216-KP997218.

  12. Partial mitochondrial gene arrangements support a close relationship between Tardigrada and Arthropoda.

    Science.gov (United States)

    Ryu, Shi Hyun; Lee, Ji Min; Jang, Kuem-Hee; Choi, Eun Hwa; Park, Shin Ju; Chang, Cheon Young; Kim, Won; Hwang, Ui Wook

    2007-12-31

    Regions (about 3.7-3.8 kb) of the mitochondrial genomes (rrnL-cox1) of two tardigrades, a heterotardigrade, Batillipes pennaki, and a eutardigrade, Pseudobiotus spinifer, were sequenced and characterized. The gene order in Batillipes was rrnL-V-rrnS-Q-I-M-nad2-W-C-Y-cox1, and in Pseudobiotus it was rrnL-V-rrnS-Q-M-nad2-W-C-Y-cox1. With the exception of the trnI gene, the two tardigrade regions have the same gene content and order. Their gene orders are strikingly similar to that of the chelicerate Limulus polyphemus (rrnL-V-rrnS-CR-I-Q-M-nad2-W-C-Y-cox1), which is considered to be ancestral for arthropods. Although the tardigrades do not have a distinct control region (CR) within this segment, the trnI gene in Pseudobiotus is located between rrnL-trnL1 and trnL2-nad1, and the trnI gene in Batillipes is located between trnQ and trnM. In addition, the 106-bp region between trnQ and trnM in Batillipes not only contains two plausible trnI genes with opposite orientations, but also exhibits some CR-like characteristics. The mitochondrial gene arrangements of 183 other protostomes were compared. 60 (52.2%) of the 115 arthropods examined have the M-nad2-W-C-Y-cox1 arrangement, and 88 (76.5%) the M-nad2-W arrangement, as found in the tardigrades. In contrast, no such arrangement was seen in the 70 non-arthropod protostomes studied. These are the first non-sequence molecular data that support the close relationship of tardigrades and arthropods.

  13. Complete nucleotide sequence and gene rearrangement of the mitochondrial genome of Occidozyga martensii

    Indian Academy of Sciences (India)

    En Li; Xiaoqiang Li; Xiaobing Wu; Ge Feng; Man Zhang; Haitao Shi; Lijun Wang; Jianping Jiang

    2014-12-01

    In this study, the complete nucleotide sequence (18,321 bp) of the mitochondrial (mt) genome of the round-tongued floating frog, Occidozyga martensii was determined. Although, the base composition and codon usage of O. martensii conformed to the typical vertebrate patterns, this mt genome contained 23 tRNAs (a tandem duplication of tRNA-Met gene). The LTPF tRNA-gene cluster, and the derived position of the ND5 gene downstream of the control region, were present in this mitogenome. Moreover, we found that in the WANCY tRNA-gene cluster, the tRNA-Asn gene was located between the tRNA-Tyr and COI genes instead of between the tRNA-Ala and tRNA-Cys genes, which is a novel mtDNA gene rearrangement in vertebrates. Based on the concatenated nucleotide sequences of the 13 protein-coding genes, phylogenetic analysis (BI, ML, MP) was performed to further clarify the phylogenetic relations of this species within anurans.

  14. A mitochondrial tRNA(Met) mutation causing developmental delay, exercise intolerance and limb girdle phenotype with onset in early childhood

    DEFF Research Database (Denmark)

    Born, Alfred Peter; Duno, Morten; Rafiq, Jabin;

    2015-01-01

    , but 90% COX negative fibres and ragged blue fibres. Respiratory chain enzyme analysis in muscle showed a combined deficiency and mitochondrial DNA sequencing revealed the presence of an m.4450G>A mutation in the MT-TM gene encoding the tRNA for methionine. The mutation was only detected in mt......DNA extracted from muscle and skin fibroblast, and could not be found in other tissues or in the mother. This is the second patient reported in the literature with a mitochondrial myopathy due to a mt-tRNA(Met) mutation. The first patient, a 30-year-old woman, presented with exercise intolerance, limb girdle...

  15. Complete mitochondrial genome of the Eurasian flying squirrel Pteromys volans (Sciuromorpha, Sciuridae) and revision of rodent phylogeny.

    Science.gov (United States)

    Ryu, Shi Hyun; Kwak, Min Jung; Hwang, Ui Wook

    2013-02-01

    In this study, the complete mitochondrial genome of the Eurasian flying squirrel Pteromys volans (Rodentia, Sciuromorpha, Sciuridae) was sequenced and characterized in detail. The entire mitochondrial genome of P. volans consisted of 16,513 bp and contained 13 protein-coding genes, 22 tRNA genes, two rRNA genes, and two non-coding regions. Its gene arrangement pattern was consistent with the mammalian ground pattern. The overall base composition and AT contents were similar to those of other rodent mitochondrial genomes. The light-strand origin generally identified between tRNA ( Asn ) and tRNA ( Cys ) consisted of a secondary structure with an 11-bp stem and an 11-bp loop. The large control region was constructed of three characteristic domains, ETAS, CD, and CSB without any repeat sequences. Each domain contained ETAS1, subsequences A, B, and C, and CSB1, respectively. In order to examine phylogenetic contentious issues of the monophyly of rodents and phylogenetic relationships among five rodent suborders, here, phylogenetic analyses based on nucleotide sequence data of the 35 rodent and 3 lagomorph mitochondrial genomes were performed using the Bayesian inference and maximum likelihood method. The result strongly supported the rodent monophyly with high node confidence values (BP 100 % in ML and BPP 1.00 in BI) and also monophylies of four rodent suborders (BP 85-100 % in ML and BPP 1.00 in BI), except for Anomalumorpha in which only one species was examined here. Also, phylogenetic relationships among the five rodent suborders were suggested and discussed in detail.

  16. Rare genomic changes and mitochondrial sequences provide independent support for congruent relationships among the sea spiders (Arthropoda, Pycnogonida).

    Science.gov (United States)

    Masta, Susan E; McCall, Andrew; Longhorn, Stuart J

    2010-10-01

    Pycnogonids, or sea spiders, are an enigmatic group of arthropods. Their unique anatomical features have made them difficult to place within the broader group Arthropoda. Most attempts to classify members of Pycnogonida have focused on utilizing these anatomical features to infer relatedness. Using data from mitochondrial genomes, we show that pycnogonids are placed as derived chelicerates, challenging the hypothesis that they diverged early in arthropod history. Our increased taxon sampling of three new mitochondrial genomes also allows us to infer phylogenetic relatedness among major pycnogonid lineages. Phylogenetic analyses based on all 13 mitochondrial protein-coding genes yield well-resolved relationships among the sea spider lineages. Gene order and tRNA secondary structure characters provide independent lines of evidence for these inferred phylogenetic relationships among pycnogonids, and show a minimal amount of homoplasy. Additionally, rare changes in three tRNA genes unite pycnogonids as a clade; these include changes in anticodon identity in tRNA(Lys) and tRNA(Ser(AGN)) and the shared loss of D-arm sequence in the tRNA(Ala) gene. Using mitochondrial genome changes and tRNA structural changes is especially useful for resolving relationships among the major lineages of sea spiders in light of the fact that there have been multiple independent evolutionary changes in nucleotide strand bias among sea spiders. Such reversed nucleotide biases can mislead phylogeny reconstruction based on sequences, although the use of appropriate methods can overcome these effects. With pycnogonids, we find that applying methods to compensate for strand bias and that using genome-level characters yield congruent phylogenetic signals.

  17. The Rhodomonas salina mitochondrial genome: bacteria-like operons, compact gene arrangement and complex repeat region.

    Science.gov (United States)

    Hauth, Amy M; Maier, Uwe G; Lang, B Franz; Burger, Gertraud

    2005-01-01

    To gain insight into the mitochondrial genome structure and gene content of a putatively ancestral group of eukaryotes, the cryptophytes, we sequenced the complete mitochondrial DNA of Rhodomonas salina. The 48 063 bp circular-mapping molecule codes for 2 rRNAs, 27 tRNAs and 40 proteins including 23 components of oxidative phosphorylation, 15 ribosomal proteins and two subunits of tat translocase. One potential protein (ORF161) is without assigned function. Only two introns occur in the genome; both are present within cox1 belong to group II and contain RT open reading frames. Primitive genome features include bacteria-like rRNAs and tRNAs, ribosomal protein genes organized in large clusters resembling bacterial operons and the presence of the otherwise rare genes such as rps1 and tatA. The highly compact gene organization contrasts with the presence of a 4.7 kb long, repeat-containing intergenic region. Repeat motifs approximately 40-700 bp long occur up to 31 times, forming a complex repeat structure. Tandem repeats are the major arrangement but the region also includes a large, approximately 3 kb, inverted repeat and several potentially stable approximately 40-80 bp long hairpin structures. We provide evidence that the large repeat region is involved in replication and transcription initiation, predict a promoter motif that occurs in three locations and discuss two likely scenarios of how this highly structured repeat region might have evolved.

  18. Profiling of genes central to human mitochondrial energy metabolism following low intensity laser irradiation

    Science.gov (United States)

    Houreld, Nicolette N.; Masha, Roland; Abrahamse, Heidi

    2012-09-01

    Background: Wound healing involves three overlapping phases: inflammation, granulation and tissue remodelling. If this process is disrupted, delayed wound healing ensues, a common complication seen in diabetic patients. Low intensity laser irradiation (LILI) has been found to promote healing in such patients. However, the exact mechanisms of action are poorly understood. Purpose: This study aimed to profile the expression of key genes involved in mitochondrial respiration. Materials and Methods: Diabetic wounded fibroblast cells were exposed to a wavelength of 660 nm and a fluence of 5 J/cm2 and incubated for 30 min. Total RNA was isolated and 1 μg reverse transcribed into cDNA which was used for real-time polymerase chain reaction (PCR) array analysis. The array contained genes important for each of the mitochondrial complexes involved in the electron transport chain (ETC). Adenosine triphosphate (ATP) levels were also determined post-irradiation by ATP luminescence. Results: Genes involved in complex IV (cytochrome c oxidase), COX6B2 and COX6C, and PPA1 which is involved in complex V (ATP synthase) were significantly up-regulated. There was a significant increase in ATP levels in diabetic wounded cells post-irradiation. Discussion and Conclusion: LILI stimulates the ETC at a transcriptional level, resulting in an increase in ATP. This study helps understand the mechanisms of LILI in diabetic wound healing, and gives information on activation of genes in response to LILI.

  19. 磷虾类线粒体基因组的特征和基因排列比较%Comparison of the characteristics and gene order in mitochondrial genomes of krills

    Institute of Scientific and Technical Information of China (English)

    申欣; 王海青; 王敏晓; 刘斌

    2012-01-01

    利用长PCR扩增获得太平洋磷虾的线粒体DNA,结合鸟枪法和引物步移法测定太平洋磷虾的线粒体基因组.结果表明,太平洋磷虾线粒体基因组全长为16 898 bp,在最大非编码区中存在一个串联重复区域(4.7×154 bp).在15个主编码基因中,变异位点数最多的是nad5基因(319~321个),其次为nad4基因(284~285个)和cox1基因(232~233个).因此,nad5基因和nad4基因可以作为候选的分子标记,用于分析磷虾类不同的物种和群体之间的生物多样性.对比泛甲壳动物的原始排列,太平洋磷虾和南极磷虾线粒体基因组共享3个转运RNA基因(tRNALeu(CUN)、tRNALeu(UUR)和tRNATrp)的易位.与太平洋磷虾线粒体基因组相比,南极磷虾线粒体基因组存在1个转运RNA基因(tRNAAAsn)的重复和1个转运RNA基因(tRNAlle)的易位.太平洋磷虾和南极磷虾之间的基因排列并不完全一致,说明在磷虾类内部线粒体基因组的基因排列顺序并不保守.%The mitochondrial genomic DNA of Euphausia pacifica was obtained by long PCR amplification,and was then sequenced using shotgun and primer-walking strategies.The mitochondrial genome of E.pacifica is 16,898 bp in length.The largest non-coding region in E.pacifica mitochondrial genome contains one section with tandem repeats (4.7×154 bp).Nad5 gene has the largest number of different loci (319-321),followed by nad4 (284 ~ 285) and coxl (232~233) gene.Therefore,nad5 and nad\\ genes can be used as alternative molecular markers to analyze genetic diversity among krills species and populations.Translocation of three tRNAs (tRNALeu(CUN),tRNALeu(UUR) and tRNATrp) is shared by E.pacifica and E.superba mitochondrial genomes when compared with the pancrustacean ground pattern.The duplication of tRNAAsn and translocation of tRNA"' were found in the mitochondrial genome of E.superba when compared with the E.pacifica mitochondrial genome.Gene orders are not identical between E.pacifica and E

  20. The transcriptional co-repressor myeloid translocation gene 16 inhibits glycolysis and stimulates mitochondrial respiration.

    Directory of Open Access Journals (Sweden)

    Parveen Kumar

    Full Text Available The myeloid translocation gene 16 product MTG16 is found in multiple transcription factor-containing complexes as a regulator of gene expression implicated in development and tumorigenesis. A stable Tet-On system for doxycycline-dependent expression of MTG16 was established in B-lymphoblastoid Raji cells to unravel its molecular functions in transformed cells. A noticeable finding was that expression of certain genes involved in tumor cell metabolism including 6-phosphofructo-2-kinase/fructose-2,6-biphosphatase 3 and 4 (PFKFB3 and PFKFB4, and pyruvate dehydrogenase kinase isoenzyme 1 (PDK1 was rapidly diminished when MTG16 was expressed. Furthermore, hypoxia-stimulated production of PFKFB3, PFKFB4 and PDK1 was inhibited by MTG16 expression. The genes in question encode key regulators of glycolysis and its coupling to mitochondrial metabolism and are commonly found to be overexpressed in transformed cells. The MTG16 Nervy Homology Region 2 (NHR2 oligomerization domain and the NHR3 protein-protein interaction domain were required intact for inhibition of PFKFB3, PFKFB4 and PDK1 expression to occur. Expression of MTG16 reduced glycolytic metabolism while mitochondrial respiration and formation of reactive oxygen species increased. The metabolic changes were paralleled by increased phosphorylation of mitogen-activated protein kinases, reduced levels of amino acids and inhibition of proliferation with a decreased fraction of cells in S-phase. Overall, our findings show that MTG16 can serve as a brake on glycolysis, a stimulator of mitochondrial respiration and an inhibitor of cell proliferation. Hence, elevation of MTG16 might have anti-tumor effect.

  1. Osteo-chondroprogenitor-specific deletion of the selenocysteine tRNA gene, Trsp, leads to chondronecrosis and abnormal skeletal development: a putative model for Kashin-Beck disease.

    Directory of Open Access Journals (Sweden)

    Charlene M Downey

    2009-08-01

    Full Text Available Kashin-Beck disease, a syndrome characterized by short stature, skeletal deformities, and arthropathy of multiple joints, is highly prevalent in specific regions of Asia. The disease has been postulated to result from a combination of different environmental factors, including contamination of barley by mold mycotoxins, iodine deficiency, presence of humic substances in drinking water, and, importantly, deficiency of selenium. This multifunctional trace element, in the form of selenocysteine, is essential for normal selenoprotein function, including attenuation of excessive oxidative stress, and for the control of redox-sensitive molecules involved in cell growth and differentiation. To investigate the effects of skeletal selenoprotein deficiency, a Cre recombinase transgenic mouse line was used to trigger Trsp gene deletions in osteo-chondroprogenitors. Trsp encodes selenocysteine tRNA([Ser]Sec, required for the incorporation of selenocysteine residues into selenoproteins. The mutant mice exhibited growth retardation, epiphyseal growth plate abnormalities, and delayed skeletal ossification, as well as marked chondronecrosis of articular, auricular, and tracheal cartilages. Phenotypically, the mice thus replicated a number of the pathological features of Kashin-Beck disease, supporting the notion that selenium deficiency is important to the development of this syndrome.

  2. A voltage-gated pore for translocation of tRNA

    Energy Technology Data Exchange (ETDEWEB)

    Koley, Sandip; Adhya, Samit, E-mail: nilugrandson@gmail.com

    2013-09-13

    Highlights: •A tRNA translocating complex was assembled from purified proteins. •The complex translocates tRNA at a membrane potential of ∼60 mV. •Translocation requires Cys and His residues in the Fe–S center of RIC6 subunit. -- Abstract: Very little is known about how nucleic acids are translocated across membranes. The multi-subunit RNA Import Complex (RIC) from mitochondria of the kinetoplastid protozoon Leishmania tropica induces translocation of tRNAs across artificial or natural membranes, but the nature of the translocation pore remains unknown. We show that subunits RIC6 and RIC9 assemble on the membrane in presence of subunit RIC4A to form complex R3. Atomic Force Microscopy of R3 revealed particles with an asymmetric surface groove of ∼20 nm rim diameter and ∼1 nm depth. R3 induced translocation of tRNA into liposomes when the pH of the medium was lowered to ∼6 in the absence of ATP. R3-mediated tRNA translocation could also be induced at neutral pH by a K{sup +} diffusion potential with an optimum of 60–70 mV. Point mutations in the Cys{sub 2}–His{sub 2} Fe-binding motif of RIC6, which is homologous to the respiratory Complex III Fe–S protein, abrogated import induced by low pH but not by K{sup +} diffusion potential. These results indicate that the R3 complex forms a pore that is gated by a proton-generated membrane potential and that the Fe–S binding region of RIC6 has a role in proton translocation. The tRNA import complex of L. tropica thus contains a novel macromolecular channel distinct from the mitochondrial protein import pore that is apparently involved in tRNA import in some species.

  3. The complete mitochondrial genome of Cleithenes herzenstein and its phylogenetic analysis.

    Science.gov (United States)

    Bo, Zhang; Wenping, Song; Kefeng, Liu; Debin, Zheng; Chao, Ma; Guangxia, Xiao

    2016-09-01

    The complete mitochondrial genome of Stewartia sinensis was obtained with long PCR approach. Amplification primers were designed according to mitogenome sequences of some other fish species. PCR reactions were according to Kong et al. ( 2009 ). The complete mitochondria sequence of Cleithenes herzenstein was deposited in GenBank under the accession number KT223828. Structural and evolutionary analyses were also performed. The length of the complete mitochondrial DNA sequence was 17 175 bp, consisting of 13 protein-coding genes, 22 tRNA genes, and two rRNA genes. Other than D-loop, another non-coding region named ''OL'' region was found ( Table 1 ). The ''OL'' region (CTTTTTCCCGCCTAGTTTAACCAGTAAAAGGCGGGAA) is 38 bp and has the potential to fold into a stem-loop secondary structure. Most of the genes were encoded on the heavy strand (H strand) except for ND6 and eight tRNA genes ( Table 1 ). The base composition and gene arrangement of C. herzenstein mitogenome was identical to typical vertebrate. For sequence alignment, the mitogenome sequence of C. herzenstein was 96% and 95% similar to that of Platichthys stellatus and Verasper moseri, respectively.

  4. The complete mitochondrial genome of rock carp Procypris rabaudi (Cypriniformes: Cyprinidae) and phylogenetic implications.

    Science.gov (United States)

    Zhang, Xiuyue; Yue, Bisong; Jiang, Wanxiang; Song, Zhaobin

    2009-05-01

    Rock carp, Procypris rabaudi (Tchang), is an endemic fish species in China. We sequenced the complete mitochondrial genome of it by high-fidelity polymerase chain reaction with conserved primers and primer walking sequencing method. The complete mitochondrial genome of rock carp is 16595 bp in length and contains 13 protein-coding genes, two ribosomal RNA (rRNA) genes, 22 transfer RNA (tRNA) genes and one control region, with an identical order to that of most other vertebrates. The origin of L-strand replication (OL) in rock carp mitochondrion is located in a cluster of five tRNA genes (WANCY region) with 35 nucleotides in length. The control region is located between the tRNA-Pro and tRNA-Phe genes and is 943 bp in length. Three conserved sequence blocks (CSB), an extended termination associated sequence (ETAS), an AT-repeat microsatellite sequence and a putative promoter sequence for H-strand transcription (HSP) were identified within this region. The microsatellite sequence has a very low variation, with only one repeat alteration in 50 checked individuals (from 12 to 13 repeats). The phylogenetic analysis for rock carp was performed with Bayesian and Maximum likelihood (ML) methods based on the concatenated nucleotide sequence of 12 protein-coding genes on the heavy strand. The result suggested that traditional taxonomic barbines possibly originated more early than cyprininaes; rock carp was placed at the position between barbines and cyprininaes, while has a closer relationship with cyprininaes than barbines.

  5. Lineage-specific fragmentation and nuclear relocation of the mitochondrial cox2 gene in chlorophycean green algae (Chlorophyta).

    Science.gov (United States)

    Rodríguez-Salinas, Elizabeth; Riveros-Rosas, Héctor; Li, Zhongkui; Fucíková, Karolina; Brand, Jerry J; Lewis, Louise A; González-Halphen, Diego

    2012-07-01

    In most eukaryotes the subunit 2 of cytochrome c oxidase (COX2) is encoded in intact mitochondrial genes. Some green algae, however, exhibit split cox2 genes (cox2a and cox2b) encoding two polypeptides (COX2A and COX2B) that form a heterodimeric COX2 subunit. Here, we analyzed the distribution of intact and split cox2 gene sequences in 39 phylogenetically diverse green algae in phylum Chlorophyta obtained from databases (28 sequences from 22 taxa) and from new cox2 data generated in this work (23 sequences from 18 taxa). Our results support previous observations based on a smaller number of taxa, indicating that algae in classes Prasinophyceae, Ulvophyceae, and Trebouxiophyceae contain orthodox, intact mitochondrial cox2 genes. In contrast, all of the algae in Chlorophyceae that we examined exhibited split cox2 genes, and could be separated into two groups: one that has a mitochondrion-localized cox2a gene and a nucleus-localized cox2b gene ("Scenedesmus-like"), and another that has both cox2a and cox2b genes in the nucleus ("Chlamydomonas-like"). The location of the split cox2a and cox2b genes was inferred using five different criteria: differences in amino acid sequences, codon usage (mitochondrial vs. nuclear), codon preference (third position frequencies), presence of nucleotide sequences encoding mitochondrial targeting sequences and presence of spliceosomal introns. Distinct green algae could be grouped according to the form of cox2 gene they contain: intact or fragmented, mitochondrion- or nucleus-localized, and intron-containing or intron-less. We present a model describing the events that led to mitochondrial cox2 gene fragmentation and the independent and sequential migration of cox2a and cox2b genes to the nucleus in chlorophycean green algae. We also suggest that the distribution of the different forms of the cox2 gene provides important insights into the phylogenetic relationships among major groups of Chlorophyceae.

  6. Structural rules and conformational compensations in the tRNA L-form.

    Science.gov (United States)

    Steinberg, S; Leclerc, F; Cedergren, R

    1997-02-21

    The mitochondrial tRNAs (mtRNA) of five distinct, secondary structure types have been identified in the tRNA sequence compilation, and the three-dimensional modeling for representative sequences of these types has been carried out using a new criterion for the lengths of the helical domains and connector regions in a full-sized tRNA conformation. This criterion has been derived from the analysis of the known structures of cytosolic tRNAs and states that in the tRNA structure nucleotide 59 of the T-loop should stack onto Domain 1. To ensure this, Domain 1 must have 12 layers of stacked nucleotides, and in the case of a deletion of a base-pair in the T-stem, an additional 13th layer is required. Although a number of mitochondrial tRNAs harbored deficiencies in this criterion and, therefore, could not be modeled directly, this disability could be corrected and modeling accomplished by invoking structural compensations derived from one of two unusual aspects of these tRNAs. One class of these tRNAs contained an unpaired nucleotide in their anticodon stem, and their three-dimensional structure was successfully modeled when the unpaired nucleotide was intercalated into the helical domain of the stem. The second class contained more than the required number of nucleotides connecting the tRNA helical domains; the conformational flexibility of these nucleotides allowed them to take the place of the absent layers. The conformational compensation that we report rationalizes disparate features of these tRNAs and suggests that the stacking of nucleotide 59 on Domain 1 is an essential feature of the three-dimensional L-form of tRNA.

  7. Chromosomal localization of mitochondrial transcription factor A (TCF6), single-stranded DNA-binding protein (SSBP), and endonuclease G (ENDOG), three human housekeeping genes involving in mitochondrial biogenesis

    Energy Technology Data Exchange (ETDEWEB)

    Tiranti, V.; Rossi, G.; DiDonato, S. [Istituto Nazionale Neurologico, Carlo Besta (Italy)] [and others

    1995-01-20

    By using a PCR-based screening of a somatic cell hybrid panel and FISH, we have assigned the loci of mitochondrial single-stranded DNA-binding protein (SSBP), mitochondrial transcription factor A (TCF6), and mitochondrial endonuclease G (ENDOG) genes to human chromosomes 7q34, 10q21, and 9q34.1, respectively. The products of these three genes are involved in fundamental aspects of mitochondrial biogenesis, such as replication and transcription of the mitochondrial genome. The chromosomal localization of these genes is important to testing whether the corresponding proteins may play a role in the etiopathogenesis of human disorders associated with qualitative or quantitative abnormalities of mitochondrial DNA. 20 refs., 1 fig., 2 tabs.

  8. Complete mitochondrial genome sequence of a Hungarian red deer (Cervus elaphus hippelaphus) from high-throughput sequencing data and its phylogenetic position within the family Cervidae.

    Science.gov (United States)

    Frank, Krisztián; Barta, Endre; Bana, Nóra Á; Nagy, János; Horn, Péter; Orosz, László; Stéger, Viktor

    2016-06-01

    Recently, there has been considerable interest in genetic differentiation in the Cervidae family. A common tool used to determine genetic variation in different species, breeds and populations is mitochondrial DNA analysis, which can be used to estimate phylogenetic relationships among animal taxa and for molecular phylogenetic evolution analysis. With the development of sequencing technology, more and more mitochondrial sequences have been made available in public databases, including whole mitochondrial DNA sequences. These data have been used for phylogenetic analysis of animal species, and for studies of evolutionary processes. We determined the complete mitochondrial genome of a Central European red deer, Cervus elaphus hippelaphus, from Hungary by a next generation sequencing technology. The mitochondrial genome is 16 354 bp in length and contains 13 protein-coding genes, two rRNA genes, 22 tRNA genes and a control region, all of which are arranged similar as in other vertebrates. We made phylogenetic analyses with the new sequence and 76 available mitochondrial sequences of Cervidae, using Bos taurus mitochondrial sequence as outgroup. We used 'neighbor joining' and 'maximum likelihood' methods on whole mitochondrial genome sequences; the consensus phylogenetic trees supported monophyly of the family Cervidae; it was divided into two subfamilies, Cervinae and Capreolinae, and five tribes, Cervini, Muntiacini, Alceini, Odocoileini, and Capreolini. The evolutionary structure of the family Cervidae can be reconstructed by phylogenetic analysis based on whole mitochondrial genomes; which method could be used broadly in phylogenetic evolutionary analysis of animal taxa.

  9. The complete mitochondrial genome of Corydoras nattereri (Callichthyidae: Corydoradinae

    Directory of Open Access Journals (Sweden)

    Daniel A. Moreira

    Full Text Available ABSTRACT The complete mitogenome of Corydoras nattereri , a species of mailed catfishes from southeastern Brazil, was reconstructed using next-generation sequencing techniques. The mitogenome was assembled using mitochondrial transcripts from the liver transcriptomes of three individuals, and produced a circular DNA sequence of 16,557 nucleotides encoding 22 tRNA genes, two rRNA genes, 13 protein-coding genes and two noncoding control regions (D-loop, OrigL. Phylogeographic analysis of closely related sequences of Cytochrome Oxydase C subunit I (COI demonstrates high diversity among morphologically similar populations of C. nattereri . Corydoras nattereri is nested within a complex of populations currently assigned to C. paleatus and C. ehrhardti . Analysis of mitogenome structure demonstrated that an insertion of 21 nucleotides between the ATPase subunit-6 and COIII genes may represent a phylogenetically informative character associated with the evolution of the Corydoradinae.

  10. The mitochondrial ND1 m.3337G>A mutation associated to multiple mitochondrial DNA deletions in a patient with Wolfram syndrome and cardiomyopathy

    Energy Technology Data Exchange (ETDEWEB)

    Mezghani, Najla [Laboratoire de Genetique Moleculaire Humaine, Faculte de Medecine de Sfax, Universite de Sfax (Tunisia); Mnif, Mouna [Service d' endocrinologie, C.H.U. Habib Bourguiba de Sfax (Tunisia); Mkaouar-Rebai, Emna, E-mail: emna_mkaouar@mail2world.com [Laboratoire de Genetique Moleculaire Humaine, Faculte de Medecine de Sfax, Universite de Sfax (Tunisia); Kallel, Nozha [Service d' endocrinologie, C.H.U. Habib Bourguiba de Sfax (Tunisia); Salem, Ikhlass Haj [Laboratoire de Genetique Moleculaire Humaine, Faculte de Medecine de Sfax, Universite de Sfax (Tunisia); Charfi, Nadia; Abid, Mohamed [Service d' endocrinologie, C.H.U. Habib Bourguiba de Sfax (Tunisia); Fakhfakh, Faiza [Laboratoire de Genetique Moleculaire Humaine, Faculte de Medecine de Sfax, Universite de Sfax (Tunisia)

    2011-07-29

    Highlights: {yields} We reported a patient with Wolfram syndrome and dilated cardiomyopathy. {yields} We detected the ND1 mitochondrial m.3337G>A mutation in 3 tested tissues (blood leukocytes, buccal mucosa and skeletal muscle). {yields} Long-range PCR amplification revealed the presence of multiple mitochondrial deletions in the skeletal muscle. {yields} The deletions remove several tRNA and protein-coding genes. -- Abstract: Wolfram syndrome (WFS) is a rare hereditary disorder also known as DIDMOAD (diabetes insipidus, diabetes mellitus, optic atrophy, and deafness). It is a heterogeneous disease and full characterization of all clinical and biological features of this disorder is difficult. The wide spectrum of clinical expression, affecting several organs and tissues, and the similarity in phenotype between patients with Wolfram syndrome and those with certain types of respiratory chain diseases suggests mitochondrial DNA (mtDNA) involvement in Wolfram syndrome patients. We report a Tunisian patient with clinical features of moderate Wolfram syndrome including diabetes, dilated cardiomyopathy and neurological complications. The results showed the presence of the mitochondrial ND1 m.3337G>A mutation in almost homoplasmic form in 3 tested tissues of the proband (blood leukocytes, buccal mucosa and skeletal muscle). In addition, the long-range PCR amplifications revealed the presence of multiple deletions of the mitochondrial DNA extracted from the patient's skeletal muscle removing several tRNA and protein-coding genes. Our study reported a Tunisian patient with clinical features of moderate Wolfram syndrome associated with cardiomyopathy, in whom we detected the ND1 m.3337G>A mutation with mitochondrial multiple deletions.

  11. Complete mitochondrial DNA sequence of the ark shell Scapharca broughtonii: an ultra-large metazoan mitochondrial genome.

    Science.gov (United States)

    Liu, Yun-Guo; Kurokawa, Tadahide; Sekino, Masashi; Tanabe, Toru; Watanabe, Kazuhito

    2013-03-01

    The complete mitochondrial (mt) genome of the ark shell Scapharca broughtonii was determined using long PCR and a genome walking sequencing strategy with genus-specific primers. The S. broughtonii mt genome (GenBank accession number AB729113) contained 12 protein-coding genes (the atp8 gene is missing, as in most bivalves), 2 ribosomal RNA genes, and 42 transfer tRNA genes, in a length of 46,985 nucleotides for the size of mtDNA with only one copy of the heteroplasmic tandem repeat (HTR) unit. Moreover the S. broughtonii mt genome shows size variation; these genomes ranged in size from about 47 kb to about 50 kb because of variation in the number of repeat sequences in the non-coding region. The mt-genome of S. broughtonii is, to date, the longest reported metazoan mtDNA sequence. Sequence duplication in non-coding region and the formation of HTR arrays were two of the factors responsible for the ultra-large size of this mt genome. All the tRNA genes were found within the S. broughtonii mt genome, unlike the other bivalves usually lacking one or more tRNA genes. Twelve additional specimens were used to analyze the patterns of tandem repeat arrays by PCR amplification and agarose electrophoresis. Each of the 12 specimens displayed extensive heteroplasmy and had 8-10 length variants. The motifs of the HTR arrays are about 353-362 bp and the number of repeats ranges from 1 to 11.

  12. Doxorubicin Differentially Induces Apoptosis, Expression of Mitochondrial Apoptosis-Related Genes, and Mitochondrial Potential in BCR-ABL1-Expressing Cells Sensitive and Resistant to Imatinib

    Directory of Open Access Journals (Sweden)

    Ewelina Synowiec

    2015-01-01

    Full Text Available Imatinib resistance is an emerging problem in the therapy of chronic myeloid leukemia (CML. Because imatinib induces apoptosis, which may be coupled with mitochondria and DNA damage is a prototype apoptosis-inducing factor, we hypothesized that imatinib-sensitive and -resistant CML cells might differentially express apoptosis-related mitochondrially encoded genes in response to genotoxic stress. We investigated the effect of doxorubicin (DOX, a DNA-damaging anticancer drug, on apoptosis and the expression of the mitochondrial NADH dehydrogenase 3 (MT-ND3 and cytochrome b (MT-CYB in model CML cells showing imatinib resistance caused by Y253H mutation in the BCR-ABL1 gene (253 or culturing imatinib-sensitive (S cells in increasing concentrations of imatinib (AR. The imatinib-resistant 253 cells displayed higher sensitivity to apoptosis induced by 1 μM DOX and this was confirmed by an increased activity of executioner caspases 3 and 7 in those cells. Native mitochondrial potential was lower in imatinib-resistant cells than in their sensitive counterparts and DOX lowered it. MT-CYB mRNA expression in 253 cells was lower than that in S cells and 0.1 μM DOX kept this relationship. In conclusion, imatinib resistance may be associated with altered mitochondrial response to genotoxic stress, which may be further exploited in CML therapy in patients with imatinib resistance.

  13. Single nucleotide polymorphisms linked to mitochondrial uncoupling protein genes UCP2 and UCP3 affect mitochondrial metabolism and healthy aging in female nonagenarians.

    Science.gov (United States)

    Kim, Sangkyu; Myers, Leann; Ravussin, Eric; Cherry, Katie E; Jazwinski, S Michal

    2016-08-01

    Energy expenditure decreases with age, but in the oldest-old, energy demand for maintenance of body functions increases with declining health. Uncoupling proteins have profound impact on mitochondrial metabolic processes; therefore, we focused attention on mitochondrial uncoupling protein genes. Alongside resting metabolic rate (RMR), two SNPs in the promoter region of UCP2 were associated with healthy aging. These SNPs mark potential binding sites for several transcription factors; thus, they may affect expression of the gene. A third SNP in the 3'-UTR of UCP3 interacted with RMR. This UCP3 SNP is known to impact UCP3 expression in tissue culture cells, and it has been associated with body weight and mitochondrial energy metabolism. The significant main effects of the UCP2 SNPs and the interaction effect of the UCP3 SNP were also observed after controlling for fat-free mass (FFM) and physical-activity related energy consumption. The association of UCP2/3 with healthy aging was not found in males. Thus, our study provides evidence that the genetic risk factors for healthy aging differ in males and females, as expected from the differences in the phenotypes associated with healthy aging between the two sexes. It also has implications for how mitochondrial function changes during aging.

  14. Complete mitochondrial genome of Nanorana pleskei (Amphibia: Anura: Dicroglossidae and evolutionary characteristics of the amphibian mitochondrial genomes

    Directory of Open Access Journals (Sweden)

    Guiying CHEN, Bin WANG, Jiongyu LIU, Feng XIE, Jianping JIANG

    2011-12-01

    Full Text Available The complete mitochondrial genome of Nanorana pleskei from the Qinghai-Tibet Plateau was sequenced. It includes 17,660 base pairs, containing 13 protein-coding genes, two rRNAs and 23 tRNAs. A tandem duplication of tRNAMet gene was found in this mitochondrial genome, and the similarity between the two tRNAMet genes is 85.8%, being the highest in amphibian mitochondrial genomes sequenced thus far. Based on gene organization, 24 types were found from 145 amphibian mitochondrial genomes. Type 1 was present in 108 species, type 11 in 11 species, types 5, 16, 17, and 20 each in two species, and the others each present in one species. Fifteen types were found in Anura, being the most diversity in three orders of the Lissamphibia. Our phylogenetic results using 11 protein-coding gene sequences of 145 amphibian mitochondrial genomes strongly support the monophyly of the Lissamphibia, as well as its three orders, the Gymnophiona, Caudata, and Anura, among which the relationships were ((Gymnophiona (Caudata, Anura. Based on the phylogenetic trees, type 1 was recognized as the ancestral type for amphibians, and type 11 was the synapomorphic type for the Neobatrachia. Gene rearrangements among lineages provide meaningful phylogenetic information. The rearrangement of the LTPF tRNA gene cluster and the translocation of the ND5 gene only found in the Neobatrachia support the monophyly of this group; similarly, the tandem duplication of the tRNAMet genes only found in the Dicroglossidae support the monophyly of this family [Current Zoology 57 (6: 785–805, 2011].

  15. The transfer RNA genes in Oryza sativa L.ssp.indica

    Institute of Scientific and Technical Information of China (English)

    WANG; Xiyin(王希胤); SHI; Xiaoli(史晓黎); HAO; Bailin(郝柏林)

    2002-01-01

    The availability of the draft genome sequence of Oryza sativa L. ssp. indica has made it possible to study the rice tRNA genes. A total of 596 tRNA genes, including 3 selenocysteine tRNA genes and one suppressor tRNA gene are identified in 127551 rice contigs. There are 45 species of tRNA genes and the revised wobble hypothesis proposed by Guthrie and Abelson is perfectly obeyed. The relationship between codon usage and the number of corresponding tRNA genes is discussed. Redundancy may exist in the present list of tRNA genes and novel ones may be found in the future. A set of 33 tRNA genes is discovered in the complete chloroplast genome of Oryza sativa L. ssp. indica. These tRNA genes are identical to those in ssp. japonica identified by us independently from the origional annotation.

  16. [Some features of mitochondrial gene pool of Maeotis in light of their relation to Cis-Asov nomads].

    Science.gov (United States)

    Morozova, I Iu; Batieva, E F; Grosheva, A N; Kovalevskaia, V B; Rychkov, S Iu

    2013-09-01

    New data on mitochondrial gene pool polymorphism of Maeotis (1st-3rd centuries CE) in the light of their relation with Sarmatian nomads are presented. Maeotis are more genetically various, compared to Sarmatians; both the age of Maeotian gene pool and their close interactions with neighboring tribes can be reasons for this. The study of relationships of Maeotis and Sarmatians suggests an intensive gene interchange between them, which influences significantly on the formation of the Maeotian gene pool.

  17. Preliminary study on mitochondrial 16S rRNA gene sequences and phylogeny of flatfishes (Pleuronectiformes)

    Institute of Scientific and Technical Information of China (English)

    2005-01-01

    A 605 bp section of mitochondrial 16S rRNA gene from Paralichthys olivaceus, Pseudorhombus cinnamomeus, Psetta maxima and Kareius bicoloratus, which represent 3 families of Order Pleuronectiformes was amplified by PCR and sequenced to show the molecular systematics of Pleuronectiformes for comparison with related gene sequences of other 6 flatfish downloaded from GenBank. Phylogenetic analysis based on genetic distance from related gene sequences of 10 flatfish showed that this method was ideal to explore the relationship between species, genera and families. Phylogenetic trees set-up is based on neighbor-joining, maximum parsimony and maximum likelihood methods that accords to the general rule of Pleuronectiformes evolution. But they also resulted in some confusion. Unlike data from morphological characters, P. olivaceus clustered with K.bicoloratus, but P. cinnamomeus did not cluster with P. olivaceus, which is worth further studying.

  18. The Complete Mitochondrial Genome of Gossypium hirsutum and Evolutionary Analysis of Higher Plant Mitochondrial Genomes

    Science.gov (United States)

    Su, Aiguo; Geng, Jianing; Grover, Corrinne E.; Hu, Songnian; Hua, Jinping

    2013-01-01

    Background Mitochondria are the main manufacturers of cellular ATP in eukaryotes. The plant mitochondrial genome contains large number of foreign DNA and repeated sequences undergone frequently intramolecular recombination. Upland Cotton (Gossypium hirsutum L.) is one of the main natural fiber crops and also an important oil-producing plant in the world. Sequencing of the cotton mitochondrial (mt) genome could be helpful for the evolution research of plant mt genomes. Methodology/Principal Findings We utilized 454 technology for sequencing and combined with Fosmid library of the Gossypium hirsutum mt genome screening and positive clones sequencing and conducted a series of evolutionary analysis on Cycas taitungensis and 24 angiosperms mt genomes. After data assembling and contigs joining, the complete mitochondrial genome sequence of G. hirsutum was obtained. The completed G.hirsutum mt genome is 621,884 bp in length, and contained 68 genes, including 35 protein genes, four rRNA genes and 29 tRNA genes. Five gene clusters are found conserved in all plant mt genomes; one and four clusters are specifically conserved in monocots and dicots, respectively. Homologous sequences are distributed along the plant mt genomes and species closely related share the most homologous sequences. For species that have both mt and chloroplast genome sequences available, we checked the location of cp-like migration and found several fragments closely linked with mitochondrial genes. Conclusion The G. hirsutum mt genome possesses most of the common characters of higher plant mt genomes. The existence of syntenic gene clusters, as well as the conservation of some intergenic sequences and genic content among the plant mt genomes suggest that evolution of mt genomes is consistent with plant taxonomy but independent among different species. PMID:23940520

  19. The complete mitochondrial genome of Gossypium hirsutum and evolutionary analysis of higher plant mitochondrial genomes.

    Directory of Open Access Journals (Sweden)

    Guozheng Liu

    Full Text Available BACKGROUND: Mitochondria are the main manufacturers of cellular ATP in eukaryotes. The plant mitochondrial genome contains large number of foreign DNA and repeated sequences undergone frequently intramolecular recombination. Upland Cotton (Gossypium hirsutum L. is one of the main natural fiber crops and also an important oil-producing plant in the world. Sequencing of the cotton mitochondrial (mt genome could be helpful for the evolution research of plant mt genomes. METHODOLOGY/PRINCIPAL FINDINGS: We utilized 454 technology for sequencing and combined with Fosmid library of the Gossypium hirsutum mt genome screening and positive clones sequencing and conducted a series of evolutionary analysis on Cycas taitungensis and 24 angiosperms mt genomes. After data assembling and contigs joining, the complete mitochondrial genome sequence of G. hirsutum was obtained. The completed G.hirsutum mt genome is 621,884 bp in length, and contained 68 genes, including 35 protein genes, four rRNA genes and 29 tRNA genes. Five gene clusters are found conserved in all plant mt genomes; one and four clusters are specifically conserved in monocots and dicots, respectively. Homologous sequences are distributed along the plant mt genomes and species closely related share the most homologous sequences. For species that have both mt and chloroplast genome sequences available, we checked the location of cp-like migration and found several fragments closely linked with mitochondrial genes. CONCLUSION: The G. hirsutum mt genome possesses most of the common characters of higher plant mt genomes. The existence of syntenic gene clusters, as well as the conservation of some intergenic sequences and genic content among the plant mt genomes suggest that evolution of mt genomes is consistent with plant taxonomy but independent among different species.

  20. Dynamic regulation of genes involved in mitochondrial DNA replication and transcription during mouse brown fat cell differentiation and recruitment.

    Science.gov (United States)

    Murholm, Maria; Dixen, Karen; Qvortrup, Klaus; Hansen, Lillian H L; Amri, Ez-Zoubir; Madsen, Lise; Barbatelli, Giorgio; Quistorff, Bjørn; Hansen, Jacob B

    2009-12-24

    Brown adipocytes are specialised in dissipating energy through adaptive thermogenesis, whereas white adipocytes are specialised in energy storage. These essentially opposite functions are possible for two reasons relating to mitochondria, namely expression of uncoupling protein 1 (UCP1) and a remarkably higher mitochondrial abundance in brown adipocytes. Here we report a comprehensive characterisation of gene expression linked to mitochondrial DNA replication, transcription and function during white and brown fat cell differentiation in vitro as well as in white and brown fat, brown adipose tissue fractions and in selected adipose tissues during cold exposure. We find a massive induction of the majority of such genes during brown adipocyte differentiation and recruitment, e.g. of the mitochondrial transcription factors A (Tfam) and B2 (Tfb2m), whereas only a subset of the same genes were induced during white adipose conversion. In addition, PR domain containing 16 (PRDM16) was found to be expressed at substantially higher levels in brown compared to white pre-adipocytes and adipocytes. We demonstrate that forced expression of Tfam but not Tfb2m in brown adipocyte precursor cells promotes mitochondrial DNA replication, and that silencing of PRDM16 expression during brown fat cell differentiation blunts mitochondrial biogenesis and expression of brown fat cell markers. Using both in vitro and in vivo model systems of white and brown fat cell differentiation, we report a detailed characterisation of gene expression linked to mitochondrial biogenesis and function. We find significant differences in differentiating white and brown adipocytes, which might explain the notable increase in mitochondrial content observed during brown adipose conversion. In addition, our data support a key role of PRDM16 in triggering brown adipocyte differentiation, including mitochondrial biogenesis and expression of UCP1.

  1. Dynamic regulation of genes involved in mitochondrial DNA replication and transcription during mouse brown fat cell differentiation and recruitment.

    Directory of Open Access Journals (Sweden)

    Maria Murholm

    Full Text Available BACKGROUND: Brown adipocytes are specialised in dissipating energy through adaptive thermogenesis, whereas white adipocytes are specialised in energy storage. These essentially opposite functions are possible for two reasons relating to mitochondria, namely expression of uncoupling protein 1 (UCP1 and a remarkably higher mitochondrial abundance in brown adipocytes. METHODOLOGY/PRINCIPAL FINDINGS: Here we report a comprehensive characterisation of gene expression linked to mitochondrial DNA replication, transcription and function during white and brown fat cell differentiation in vitro as well as in white and brown fat, brown adipose tissue fractions and in selected adipose tissues during cold exposure. We find a massive induction of the majority of such genes during brown adipocyte differentiation and recruitment, e.g. of the mitochondrial transcription factors A (Tfam and B2 (Tfb2m, whereas only a subset of the same genes were induced during white adipose conversion. In addition, PR domain containing 16 (PRDM16 was found to be expressed at substantially higher levels in brown compared to white pre-adipocytes and adipocytes. We demonstrate that forced expression of Tfam but not Tfb2m in brown adipocyte precursor cells promotes mitochondrial DNA replication, and that silencing of PRDM16 expression during brown fat cell differentiation blunts mitochondrial biogenesis and expression of brown fat cell markers. CONCLUSIONS/SIGNIFICANCE: Using both in vitro and in vivo model systems of white and brown fat cell differentiation, we report a detailed characterisation of gene expression linked to mitochondrial biogenesis and function. We find significant differences in differentiating white and brown adipocytes, which might explain the notable increase in mitochondrial content observed during brown adipose conversion. In addition, our data support a key role of PRDM16 in triggering brown adipocyte differentiation, including mitochondrial biogenesis and

  2. Mitochondrial ND3 as the novel causative gene for Leber hereditary optic neuropathy and dystonia.

    Science.gov (United States)

    Wang, Kang; Takahashi, Yuji; Gao, Zong-Liang; Wang, Guo-Xiang; Chen, Xian-Wen; Goto, Jun; Lou, Jin-Ning; Tsuji, Shoji

    2009-10-01

    Leber hereditary optic neuropathy and dystonia (LDYT) is a mitochondrial disorder associated with variable combinations of vision loss and progressive generalized dystonia. LDYT is a unique oxidative phosphorylation disorder caused by mutations in mitochondrial ND6 or ND4 gene. In this paper, we describe a Chinese family with 18 LDYT patients. The comprehensive nucleotide sequence analysis of the entire mitochondrial genome using resequencing microarray revealed a mutation (mtND3*10197A (m.10197G>A)) substituting a threonine for a highly conserved alanine at codon 47 of MTND3 on the background of haplogroup D4b. Quantitative analysis of the heteroplasmy of the mutation revealed a homoplasmy in the leukocytes of all the affected individuals on the maternal side. This is the first description of the ND3 mutation causing LDYT. The mtND3*10197A (m.10197G>A) mutation has recently been described in French and Korean patients with Leigh syndrome. These findings suggest that the clinical presentations associated with the mtND3*10197A (m.10197G>A) mutation (ND3) are much wider, encompassing those of LDYT and Leigh syndrome.

  3. Discrimination of Anemonefish Species by PCR-RFLP Analysis of Mitochondrial Gene Fragments

    Directory of Open Access Journals (Sweden)

    Chuta Boonphakdee

    2008-01-01

    Full Text Available A means of discriminating among species of clown anemonefishes, based on restriction enzyme analysis of partial mitochondrial DNA sequences, was investigated. Mitochondrial 16S rRNA and cytochrome b genes from 6 species (7 strains of anemonefish (Premnas biculeatus, Amphiprion polymnus, A. sandaracinos, A. perideraion, A. ocellaris, A. ocellaris var. and A. percula were PCR-amplified. A 623-bp portion of 16S rRNA gene was obtained from different fishes using the same pair of primers. Further investigation of this 16S rRNA fragment, by restriction endonuclease digestion with BfuCI and RsaI, was not able to distinguish all fishes studied, but did yield 3 different digestion patterns. The first was specific to P. biculaetus, the sole member of the genus Premnas, while the remaining two separated the Amphiprion species into 2 groups: 1 A. polymnas, A. sandaracinos and A. perideraion, and 2 A. ocellaris, A. ocellaris var. and A. percula. In contrast to this, restriction endonuclease digestion of a 786-bp fragment of the cytochrome b gene with HinfI and RsaI, was able to differentiate different 7 anemonefishes. This utility marker is valuable for unambiguous species/strain identification of juvenile anemonefishes.

  4. Overexpression of Citrus junos mitochondrial citrate synthase gene in Nicotiana benthamiana confers aluminum tolerance.

    Science.gov (United States)

    Deng, Wei; Luo, Keming; Li, Zhengguo; Yang, Yingwu; Hu, Nan; Wu, Yu

    2009-07-01

    Aluminum (Al) toxicity is one of the major factors that limit plant growth in acid soils. Al-induced release of organic acids into rhizosphere from the root apex has been identified as a major Al-tolerance mechanism in many plant species. In this study, Al tolerance of Yuzu (Citrus Junos Sieb. ex Tanaka) was tested on the basis of root elongation and the results demonstrated that Yuzu was Al tolerant compared with other plant species. Exposure to Al triggered the exudation of citrate from the Yuzu root. Thus, the mechanism of Al tolerance in Yuzu involved an Al-inducible increase in citrate release. Aluminum also elicited an increase of citrate content and increased the expression level of mitochondrial citrate synthase (CjCS) gene and enzyme activity in Yuzu. The CjCS gene was cloned from Yuzu and overexpressed in Nicotiana benthamiana using Agrobacterium tumefaciens-mediated methods. Increased expression level of the CjCS gene and enhanced enzyme activity were observed in transgenic plants compared with the wild-type plants. Root growth experiments showed that transgenic plants have enhanced levels of Al tolerance. The transgenic Nicotiana plants showed increased levels of citrate in roots compared to wild-type plants. The exudation of citrate from roots of the transgenic plants significantly increased when exposed to Al. The results with transgenic plants suggest that overexpression of mitochondrial CS can be a useful tool to achieve Al tolerance.

  5. Expression of the Bcl-2 family genes and complexes involved in the mitochondrial transport in prostate cancer cells.

    Science.gov (United States)

    Asmarinah, Asmarinah; Paradowska-Dogan, Agnieszka; Kodariah, Ria; Tanuhardja, Budiana; Waliszewski, Przemyslaw; Mochtar, Chaidir Arif; Weidner, Wolfgang; Hinsch, Elvira

    2014-10-01

    Alteration of molecular pathways triggering apoptosis gives raise to various pathological tissue processes, such as tumorigenesis. The mitochondrial pathway is regulated by both the genes of the Bcl-2 family and the genes encoding mitochondrial transport molecules. Those proteins allow a release of cyctochrome c through the outer mitochondrial membrane. This release activates the caspase cascade resulting in death of cells. There are at least two main transport systems associated with the family of Bcl-2 proteins that are involved in transport of molecules through the outer mitochondrial membrane, i.e., the voltage dependent anion channels (VDACs) and translocases of the outer mitochondrial membrane proteins (TOMs). We investigated the expression of genes of the Bcl-2 family, i.e., pro-apoptotic Bak and Bid, and anti-apoptotic Bcl-2; VDAC gene, i.e., VDAC1, VDAC2 and VDAC3; and TOMM genes, i.e., TOMM20, TOMM22 and TOMM40. This study was performed at the mRNA and the protein level. Fourteen paraffin embedded prostate cancer tissues and five normal prostate tissues were analyzed by the quantitative PCR array and immunohistochemistry. We found a significant increase in both mRNA expression of the anti-apoptotic Bcl-2 gene and VDAC1 gene in prostate cancer tissue in comparison with their normal counterparts. Translation of the anti-apoptotic Bcl-2 and VDAC1 genes in prostate cancer tissue was slightly increased. We observed no significant differences in the mRNA expression of the pro-apoptotic Bak and Bid genes, VDAC2 or VDAC3 genes or the three TOMM genes in these tissues. The pro-apoptotic Bax protein was downtranslated significantly in secretory cells of prostate cancer as compared to normal prostate. We suggest that this protein is a good candidate as biomarker for prostate cancer.

  6. Significant prognostic values of nuclear genes encoding mitochondrial complex I subunits in tumor patients.

    Science.gov (United States)

    Li, L D; Sun, H F; Bai, Y; Gao, S P; Jiang, H L; Jin, W

    2016-01-01

    In cancer biology, it remains still open question concerning the oncogenic versus oncosuppressor behavior of metabolic genes, which includes those encoding mitochondrial complex I (CI) subunits. The prognostic value of nuclear genome mRNAs expression of CI subunits is to be evaluated in the tumor patients. We used the Kaplan Meier plotter database, the cBio Cancer Genomics Portal, and the Oncomine in which gene expression data and survival information were from thousands of tumor patients to assess the relevance of nuclear genome mRNAs level of CI subunits to patients' survival, as well as their alterations in gene and expression level in tumors. We presented that the relative expression level of overwhelming majority of the nuclear genes of CI subunits with survival significance (overall survival, relapse free survival, progression free survival, distant metastasis free survival, post progression survival, and first progression), had consistent effects for patients in each type of four tumors separately, including breast cancer, ovarian cancer, lung cancer, and gastric cancer. However, in gene level, frequent cumulative or individual alteration of these genes could not significantly affect patients' survival and the overexpression of the individual gene was not ubiquitous in tumors versus normal tissues. Given that reprogrammed energy metabolism was viewed as an emerging hallmark of tumor, thus tumor patients' survival might potentially to be evaluated by certain threshold for overall expression of CI subunits. Comprehensive understanding of the nuclear genome encoded CI subunits may have guiding significance for the diagnosis and prognosis in tumor patients.

  7. The complete mitochondrial genomes of Schistosoma haematobium and Schistosoma spindale and the evolutionary history of mitochondrial genome changes among parasitic flatworms.

    Science.gov (United States)

    Littlewood, D Timothy J; Lockyer, Anne E; Webster, Bonnie L; Johnston, David A; Le, Thanh Hoa

    2006-05-01

    Complete mitochondrial genome sequences for the schistosomes Schistosoma haematobium and Schistosoma. spindale have been characterized. S. haematobium is the causative agent of urinary schistosomiasis in humans and S. spindale uses ruminants as its definitive host; both are transmitted by freshwater snail intermediate hosts. Results confirm a major gene order rearrangement among schistosomes in all traditional Schistosoma species groups other than Schistosoma japonicum; i.e., species groups S. mansoni, S. haematobium, and S. indicum. These data lend support to the 'out of Asia' (East and Southeast Asia) hypothesis for Schistosoma. The gene order change involves translocation of atp6-nad2-trnA and a rearrangement of nad3-nad1 relative to other parasitic flatworm mt genomes so far sequenced. Gene order and tRNA secondary structure changes (loss and acquisition of the DHU and/or TPsiC arms of trnC, trnF, and trnR) between mitochondrial genomes of these and other (digenean and cestode) flatworms were inferred by character mapping onto a phylogeny estimated from nuclear small subunit rRNA gene sequences of these same species, in order to find additional rare genomic changes suitable as synapomorphies. Denser and wider taxon sampling of mt genomes across the Platyhelminthes will validate these putative characters.

  8. Genes related to mitochondrial functions are differentially expressed in phosphine-resistant and -susceptible Tribolium castaneum.

    Science.gov (United States)

    Oppert, Brenda; Guedes, Raul N C; Aikins, Michael J; Perkin, Lindsey; Chen, Zhaorigetu; Phillips, Thomas W; Zhu, Kun Yan; Opit, George P; Hoon, Kelly; Sun, Yongming; Meredith, Gavin; Bramlett, Kelli; Hernandez, Natalie Supunpong; Sanderson, Brian; Taylor, Madison W; Dhingra, Dalia; Blakey, Brandon; Lorenzen, Marcé; Adedipe, Folukemi; Arthur, Frank

    2015-11-18

    Phosphine is a valuable fumigant to control pest populations in stored grains and grain products. However, recent studies indicate a substantial increase in phosphine resistance in stored product pests worldwide. To understand the molecular bases of phosphine resistance in insects, we used RNA-Seq to compare gene expression in phosphine-resistant and susceptible laboratory populations of the red flour beetle, Tribolium castaneum. Each population was evaluated as either phosphine-exposed or no phosphine (untreated controls) in triplicate biological replicates (12 samples total). Pairwise analysis indicated there were eight genes differentially expressed between susceptible and resistant insects not exposed to phosphine (i.e., basal expression) or those exposed to phopshine (>8-fold expression and 90 % C.I.). However, 214 genes were differentially expressed among all four treatment groups at a statistically significant level (ANOVA, p < 0.05). Increased expression of 44 cytochrome P450 genes was found in resistant vs. susceptible insects, and phosphine exposure resulted in additional increases of 21 of these genes, five of which were significant among all treatment groups (p < 0.05). Expression of two genes encoding anti-diruetic peptide was 2- to 8-fold reduced in phosphine-resistant insects, and when exposed to phosphine, expression was further reduced 36- to 500-fold compared to susceptible. Phosphine-resistant insects also displayed differential expression of cuticle, carbohydrate, protease, transporter, and many mitochondrial genes, among others. Gene ontology terms associated with mitochondrial functions (oxidation biological processes, monooxygenase and catalytic molecular functions, and iron, heme, and tetrapyyrole binding) were enriched in the significantly differentially expressed dataset. Sequence polymorphism was found in transcripts encoding a known phosphine resistance gene, dihydrolipoamide dehydrogenase, in both susceptible and resistant

  9. The complete mitochondrial genome sequence of the Dark-spotted frog Pelophylax nigromaculatus (Amphibia, Anura, Ranidae).

    Science.gov (United States)

    Jiang, Lichun; Zhao, Li; Liu, Yabin; Leng, Zheng; Zhao, Liping; Ruan, Qiping

    2017-03-01

    The dark-spotted frog (Pelophylax nigromaculatus) belongs to Ranidae. This species is known from the Russian Far East, central, northern and north-eastern China, the Democratic People's Republic of Korea, the Republic of Korea, and Japan. In this study, the complete mitochondrial genome of P. nigromaculatus was sequenced. The mitogenome was 17 567 bp in length, consisting of 13 protein-coding genes, 22 transfer RNA (tRNA) genes, 2 ribosomal RNA (rRNA) genes, and a non-coding control region. As in other vertebrates, most mitochondrial genes are encoded on the heavy strand, except for ND6 and eight tRNA genes which are encoded on the light strand. The overall base composition of the P. nigromaculatus is 29.2% A, 27.4% T, 28.4% C, and 15.0% G. Phylogenetic analysis showed P. nigromaculatus was closely related to P. plancyi and P. chosenicus. The complete mitogenome of P. nigromaculatus can provide important data for the studies on phylogenetic relationship and population genetics to further explore the taxonomic status of this species.

  10. The complete sequence of the mitochondrial genome of Butomus umbellatus--a member of an early branching lineage of monocotyledons.

    Science.gov (United States)

    Cuenca, Argelia; Petersen, Gitte; Seberg, Ole

    2013-01-01

    In order to study the evolution of mitochondrial genomes in the early branching lineages of the monocotyledons, i.e., the Acorales and Alismatales, we are sequencing complete genomes from a suite of key taxa. As a starting point the present paper describes the mitochondrial genome of Butomus umbellatus (Butomaceae) based on next-generation sequencing data. The genome was assembled into a circular molecule, 450,826 bp in length. Coding sequences cover only 8.2% of the genome and include 28 protein coding genes, four rRNA genes, and 12 tRNA genes. Some of the tRNA genes and a 16S rRNA gene are transferred from the plastid genome. However, the total amount of recognized plastid sequences in the mitochondrial genome is only 1.5% and the amount of DNA transferred from the nucleus is also low. RNA editing is abundant and a total of 557 edited sites are predicted in the protein coding genes. Compared to the 40 angiosperm mitochondrial genomes sequenced to date, the GC content of the Butomus genome is uniquely high (49.1%). The overall similarity between the mitochondrial genomes of Butomus and Spirodela (Araceae), the closest relative yet sequenced, is low (less than 20%), and the two genomes differ in size by a factor 2. Gene order is also largely unconserved. However, based on its phylogenetic position within the core alismatids Butomus will serve as a good reference point for subsequent studies in the early branching lineages of the monocotyledons.

  11. Mitochondrial genome architecture of the giant red sea urchin Mesocentrotus franciscanus (Strongylocentrotidae, Echinoida).

    Science.gov (United States)

    Gaitán-Espitia, Juan Diego; Hofmann, Gretchen E

    2016-01-01

    The complete mitochondrial genome of the Californian giant red sea urchin Mesocentrotus franciscanus has been determined. It has a length of 15,650 bp and contains the same 37 genes found in other metazoans (13 protein-coding genes, 22 tRNA genes, and two rRNA genes). Only five tRNA genes and the Nad6 gene are coded on the minus strand. There were 14 identified small intergene regions (2 to 24 bp) and a large non-coding region (125 bp) located between the tRNA-T and tRNA-P. The overall base composition of this genome is 29.8% A, 27.6% T, 29.7% C, and 17.5% G, with a slight A + T bias of 59.4%. The most frequent start codon is ATG (11 genes) whereas TAA is the most frequent stop codon (10 genes). Overall, gene arrangement pattern, gene content and genome organization is similar to other echinoids.

  12. Autism in the Son of a Woman with Mitochondrial Myopathy and Dysautonomia: A Case Report.

    Science.gov (United States)

    Brown, Bradley D; Rais, Theodore

    2015-01-01

    The relationship between autism spectrum disorders and mitochondrial dysfunction, including mitochondrial myopathies and other mitochondrial diseases, is an area of ongoing research. All autism spectrum disorders are known to be heritable, via genetic and/or epigenetic mechanisms, but specific modes of inheritance are not well characterized. Nevertheless, autism spectrum disorders have been linked to many specific genes associated with mitochondrial function, especially to genes involved in mitochondrial tRNA and the electron transport chain, both particularly vulnerable to point mutations, and clinical research also supports a relationship between the two pathologies. Although only a small minority of patients with autism have a mitochondrial disease, many patients with mitochondrial myopathies have autism spectrum disorder symptoms, and these symptoms may be the presenting symptoms, which presents a diagnostic challenge for clinicians. The authors report the case of a 15-year-old boy with a history of autism spectrum disorder and neurocardiogenic syncope, admitted to the inpatient unit for self-injury, whose young mother, age 35, was discovered to suffer from mitochondrial myopathy, dysautonomia, neurocardiogenic syncope, Ehler-Danlos syndrome, and other uncommon multisystem pathologies likely related to mitochondrial dysfunction. This case illustrates the need for a high index of suspicion for mitochondrial disease in patients with autism, as they have two orders of magnitude greater risk for such diseases than the general population. The literature shows that mitochondrial disease is underdiagnosed in autism spectrum disorder patients and should not be viewed as a "zebra" (i.e., an obscure diagnosis that is made when a more common explanation is more likely).

  13. Maternal inheritance in polyploid fish inferred from mitochondrial ATPase genes analysis

    Institute of Scientific and Technical Information of China (English)

    Jinpeng Yan; Xinhong Guo; Shaojun Liu; Jun Xiao; Zhen Liu; Yubao Chen; Yun Liu

    2009-01-01

    The sequences of the ATPase8/6 genes for the triploid, tetraploid and pentaploid hybrids as well as for their male parent blunt snout bream were determined. In order to examine mitochondrial maternal inheritance, the sequences were subjected to a comparative sequence analysis with the homologous sequences of red crucian carp, their female parent, and zebrafish as the outgroup. Base compo-sition and variation as well as the divergences based on nucleotide sequences and deduced amino acid sequences were calculated. Phy-logenetic trees were also constructed with maximum parsimony (MP), minimum evolution (ME), neighbor joining (NJ) and the unweighted pair group method with arithmetic mean (UPGMA) algorithms in MEGA 3.1. The results showed that most nucleotide sub-stitutions occurred at the third codon position of the two genes and thus represented synonymous mutations. The nucleotide sequence divergences of the ATPase8/6 genes ranged from 0.0% to 21.6% among ingroup samples (three types of polyploids and their parents), and 27.0-28.2% between their ingroup and the outgroup samples. All the polyploids were considerably closer in sequence relationship to the female parent red crucian carp (0.0-3.3%) compared to their male parent blunt snout bream (21.0-21.6%). The phylogenetic trees also showed a similar result. In conclusion, the mitochondrial ATPase8/6 genes of artificial polyploid fish stringently indicated maternal inheritance. Our results also suggested that the ATPase8/6 genes are valuable genetic markers to track genealogies and variations in the progenies of the hybrids.

  14. Assembled Plastid and Mitochondrial Genomes, as well as Nuclear Genes, Place the Parasite Family Cynomoriaceae in the Saxifragales.

    Science.gov (United States)

    Bellot, Sidonie; Cusimano, Natalie; Luo, Shixiao; Sun, Guiling; Zarre, Shahin; Gröger, Andreas; Temsch, Eva; Renner, Susanne S

    2016-08-03

    Cynomoriaceae, one of the last unplaced families of flowering plants, comprise one or two species or subspecies of root parasites that occur from the Mediterranean to the Gobi Desert. Using Illumina sequencing, we assembled the mitochondrial and plastid genomes as well as some nuclear genes of a Cynomorium specimen from Italy. Selected genes were also obtained by Sanger sequencing from individuals collected in China and Iran, resulting in matrices of 33 mitochondrial, 6 nuclear, and 14 plastid genes and rDNAs enlarged to include a representative angiosperm taxon sampling based on data available in GenBank. We also compiled a new geographic map to discern possible discontinuities in the parasites' occurrence. Cynomorium has large genomes of 13.70-13.61 (Italy) to 13.95-13.76 pg (China). Its mitochondrial genome consists of up to 49 circular subgenomes and has an overall gene content similar to that of photosynthetic angiosperms, while its plastome retains only 27 of the normally 116 genes. Nuclear, plastid and mitochondrial phylogenies place Cynomoriaceae in Saxifragales, and we found evidence for several horizontal gene transfers from different hosts, as well as intracellular gene transfers. © The Author 2016. Published by Oxford University Press on behalf of the Society for Molecular Biology and Evolution.

  15. [Chronic progressive external ophthalmoplegia with mitochondrial anomalies. Clinical, histological, biochemical and genetic analysis (9 cases)].

    Science.gov (United States)

    Drouet, A

    1996-01-01

    We report the clinical signs and histological findings in nine patients with mitochondrial ocular myopathies. There were four males and five females. Of age ranging from 47 to 82 years. A more often asymetrical ptosis was in all cases of chronic progressive external ophtalmoplegia (CPEO), but muscle weakness in limbs was not usual. The prognosis in this group was good, but ubidecarenone (150 mg/d) used for two cases, did not improve ophtalmoplegia. The serum creatine kinase was normal in eight of nine cases and electromyography showed myopathic changes in three cases. Histoenzymatic analysis of the muscle biopsy and biochemical studies of mitochondria isolated from the muscle sample demonstrated mitochondrial myopathy associated with partial deficiency of complexes I and/or IV of the electron transfer chain. One of seven patients studied had single deletion by Southern blot analysis, in a heteroplasmic state and another an A-->G transition at position 3243 within the mitochondrial tRNA leu (UUR) gene. Chronic progressive external ophtalmoplegia, without large deletion, may have abnormality in other coding regions of mt DNA such as tRNA, rRNA or protein genes.

  16. Altered expression of mitochondrial and extracellular matrix genes in the heart of human fetuses with chromosome 21 trisomy

    Directory of Open Access Journals (Sweden)

    Olla Carlo

    2007-08-01

    Full Text Available Abstract Background The Down syndrome phenotype has been attributed to overexpression of chromosome 21 (Hsa21 genes. However, the expression profile of Hsa21 genes in trisomic human subjects as well as their effects on genes located on different chromosomes are largely unknown. Using oligonucleotide microarrays we compared the gene expression profiles of hearts of human fetuses with and without Hsa21 trisomy. Results Approximately half of the 15,000 genes examined (87 of the 168 genes on Hsa21 were expressed in the heart at 18–22 weeks of gestation. Hsa21 gene expression was globally upregulated 1.5 fold in trisomic samples. However, not all genes were equally dysregulated and 25 genes were not upregulated at all. Genes located on other chromosomes were also significantly dysregulated. Functional class scoring and gene set enrichment analyses of 473 genes, differentially expressed between trisomic and non-trisomic hearts, revealed downregulation of genes encoding mitochondrial enzymes and upregulation of genes encoding extracellular matrix proteins. There were no significant differences between trisomic fetuses with and without heart defects. Conclusion We conclude that dosage-dependent upregulation of Hsa21 genes causes dysregulation of the genes responsible for mitochondrial function and for the extracellular matrix organization in the fetal heart of trisomic subjects. These alterations might be harbingers of the heart defects associated with Hsa21 trisomy, which could be based on elusive mechanisms involving genetic variability, environmental factors and/or stochastic events.

  17. Phylogeny of all major groups of cetaceans based on DNA sequences from three mitochondrial genes.

    Science.gov (United States)

    Milinkovitch, M C; Meyer, A; Powell, J R

    1994-11-01

    Traditionally, living cetaceans (order Cetacea) are classified into two highly distinct suborders: the echolocating toothed whales, Odontoceti, and the filter-feeding baleen whales, Mysticeti. A molecular phylogeny based on 1,352 base pairs of two mitochondrial ribosomal gene segments and the mitochondrial cytochrome b gene for all major groups of cetaceans contradicts this long-accepted taxonomic subdivision. One group of toothed whales, the sperm whales, is more closely related to the morphologically highly divergent baleen whales than to other odontocetes. This finding suggests that the suborder Odontoceti constitutes an unnatural grouping and challenges the conventional scenario of a long, independent evolutionary history of odontocetes and mysticetes. The superfamily Delphinoidea (dolphins, porpoises, and white whales) appears to be monophyletic; the Amazon River dolphin, Inia geoffrensis, is its sister species. This river dolphin is genetically more divergent from the morphologically similar marine dolphins than the sperm whales are from the morphologically dissimilar baleen whales. The phylogenetic relationships among the three families of Delphinoidea remain uncertain, and we suggest that the two cladogenetic events that generated these three clades occurred within a very short period of time. Among the baleen whales, the bowhead is basal, and the gray whale is the sister species to the rorquals (family Balaenopteridae). The phylogenetic position of beaked whales (Ziphioidea) remains weakly supported by molecular data. Based on molecular clock assumptions, the mitochondrial-DNA data suggest a more recent origin of baleen whales (approximately 25 mya) than has been previously assumed (> 40 mya). This revised phylogeny has important implications for the rate and mode of evolution of morphological and physiological innovations in cetaceans.

  18. ADA1 and NET1 Genes of Yeast Mediate Both Chromosome Maintenance and Mitochondrial $\\rho^{-}$ Mutagenesis

    CERN Document Server

    Koltovaya, N A; Tchekhouta, I A; Devin, A B

    2002-01-01

    An increase in the mitochondrial (mt) rho^- mutagenesis is a well-known respose of yeast cells to mutations in the numerous nuclear genes as well as to various kinds of stress. Notwithstanding the extensive studies during several decades the biological significance of this response is not yet fully understood. The genetic approach to solution of this subject includes the study of genes that are required for the high incidence of spontaneous rho^- mutants. Previously we found that mutations in certain nuclear genes including CDC28, the central cell-cycle regulation gene, may decrease the spontaneous rho^- mutability and simultaneously affect maintenance of the yeast chromosomes and plasmids. The present work provides data on identification of two more genes, resembling CDC28 in this respect. These genes NET1 and ADA1 mediate important regulatory protein-protein interactions in the yeast cell. The effects of net1 and ada1 mutations on the maintenance of yeast mt genome, chromosomes and plasmids as well as on ce...

  19. HIV-1 Modulates the tRNA Pool to Improve Translation Efficiency

    Science.gov (United States)

    van Weringh, Anna; Ragonnet-Cronin, Manon; Pranckeviciene, Erinija; Pavon-Eternod, Mariana; Kleiman, Lawrence; Xia, Xuhua

    2011-01-01

    Despite its poorly adapted codon usage, HIV-1 replicates and is expressed extremely well in human host cells. HIV-1 has recently been shown to package non-lysyl transfer RNAs (tRNAs) in addition to the tRNALys needed for priming reverse transcription and integration of the HIV-1 genome. By comparing the codon usage of HIV-1 genes with that of its human host, we found that tRNAs decoding codons that are highly used by HIV-1 but avoided by its host are overrepresented in HIV-1 virions. In particular, tRNAs decoding A-ending codons, required for the expression of HIV's A-rich genome, are highly enriched. Because the affinity of Gag-Pol for all tRNAs is nonspecific, HIV packaging is most likely passive and reflects the tRNA pool at the time of viral particle formation. Codon usage of HIV-1 early genes is similar to that of highly expressed host genes, but codon usage of HIV-1 late genes was better adapted to the selectively enriched tRNA pool, suggesting that alterations in the tRNA pool are induced late in viral infection. If HIV-1 genes are adapting to an altered tRNA pool, codon adaptation of HIV-1 may be better than previously thought. PMID:21216840

  20. Silencing of mitochondrial NADP{sup +}-dependent isocitrate dehydrogenase gene enhances glioma radiosensitivity

    Energy Technology Data Exchange (ETDEWEB)

    Kim, Sung Youl [School of Life Sciences and Biotechnology, College of Natural Sciences, Kyungpook National University, Taegu (Korea, Republic of); Yoo, Young Hyun [Mitochondria Hub Regulation Center, Dong-A University College of Medicine, Busan (Korea, Republic of); Park, Jeen-Woo, E-mail: parkjw@knu.ac.kr [School of Life Sciences and Biotechnology, College of Natural Sciences, Kyungpook National University, Taegu (Korea, Republic of)

    2013-04-05

    Highlights: •Silencing of the IDPm gene enhances IR-induced autophagy in glioma cells. •Autophagy inhibition augmented apoptosis of irradiated glioma cells. •Results offer a redox-active therapeutic strategy for the treatment of cancer. -- Abstract: Reactive oxygen species (ROS) levels are elevated in organisms that have been exposed to ionizing radiation and are protagonists in the induction of cell death. Recently, we demonstrated that the control of mitochondrial redox balance and the cellular defense against oxidative damage are primary functions of mitochondrial NADP{sup +}-dependent isocitrate dehydrogenase (IDPm) via the supply of NADPH for antioxidant systems. In the present study, we report an autophagic response to ionizing radiation in A172 glioma cells transfected with small interfering RNA (siRNA) targeting the IDPm gene. Autophagy in A172 transfectant cells was associated with enhanced autophagolysosome formation and GFP–LC3 punctuation/aggregation. Furthermore, we found that the inhibition of autophagy by chloroquine augmented apoptotic cell death of irradiated A172 cells transfected with IDPm siRNA. Taken together, our data suggest that autophagy functions as a survival mechanism in A172 cells against ionizing radiation-induced apoptosis and the sensitizing effect of IDPm siRNA and autophagy inhibitor on the ionizing radiation-induced apoptotic cell death of glioma cells offers a novel redox-active therapeutic strategy for the treatment of cancer.

  1. Phylogenetics and Srf Analysis of Mitochondrial DNA COII Gene in Anopheles Species (Diptera: Culicidae

    Directory of Open Access Journals (Sweden)

    Monika Sharma

    2011-07-01

    Full Text Available Mitochondrial DNA COII gene was used to study the interspecific variation and molecular analysis among six species of genus Anopheles belonging to subgenus Cellia i.e. An. stephensi, An. culicifacies, An. maculatus, An. subpictus, An. annularis and An. splendidus. The sequence was found to be AT rich with maximum of 75.07% in An. culicifacies. The sequence analysis revealed the number of transversions to be more than transitions which is opposite of the general contention with transitions being more frequent than transversions in mitochondrial genes. However, among the Anopheles species, the maximum number of substitutions was found in An. maculatus. The phylogenetic analysis using the three methods MP, ML and NJ methods was also carried out for which Cx. quinquefasciatus was taken as outgroup. Analysis showed that An. stephensi and An. culicifacies shared a close genetic homology while An. annularis and An. splendidus made another group with identical genetic qualities. To the contrary, An. subpictus and An. maculatus had hypervariable non-homologous genomic qualities. Short tandem as well as nontandem repeats were also studied using SRF (Spectral Repeat Finder programme. The repeats were conserved in all the species except certain polymorphic repeats such as TAT and TTTAT were present in An. stephensi whereas no polymorphic repeats were present in An. subpictus. Identification of repeats is crucial to shed light on the function and structure of proteins, and explain their evolutionary past.

  2. Differential regulation of mitochondrial pyruvate carrier genes modulates respiratory capacity and stress tolerance in yeast.

    Directory of Open Access Journals (Sweden)

    Alba Timón-Gómez

    Full Text Available Mpc proteins are highly conserved from yeast to humans and are necessary for the uptake of pyruvate at the inner mitochondrial membrane, which is used for leucine and valine biosynthesis and as a fuel for respiration. Our analysis of the yeast MPC gene family suggests that amino acid biosynthesis, respiration rate and oxidative stress tolerance are regulated by changes in the Mpc protein composition of the mitochondria. Mpc2 and Mpc3 are highly similar but functionally different: Mpc2 is most abundant under fermentative non stress conditions and important for amino acid biosynthesis, while Mpc3 is the most abundant family member upon salt stress or when high respiration rates are required. Accordingly, expression of the MPC3 gene is highly activated upon NaCl stress or during the transition from fermentation to respiration, both types of regulation depend on the Hog1 MAP kinase. Overexpression experiments show that gain of Mpc2 function leads to a severe respiration defect and ROS accumulation, while Mpc3 stimulates respiration and enhances tolerance to oxidative stress. Our results identify the regulated mitochondrial pyruvate uptake as an important determinant of respiration rate and stress resistance.

  3. Mitochondrial tRNALeu/Lys and ATPase 6/8 gene variations in spinocerebellar ataxias.

    Science.gov (United States)

    Safaei, Sepideh; Houshmand, Massoud; Banoei, Mohammad Mehdi; Panahi, Mehdi Shafa Shariat; Nafisi, Shahriar; Parivar, Kazem; Rostami, Maryam; Shariati, Parvin

    2009-01-01

    The spinocerebellar ataxias (SCA) comprise a heterogeneous group of severe late-onset neurodegenerative diseases that are promoted by the expansion of a tandem-arrayed DNA sequence that modifies the primary structure of the protein. Genomic DNA of 20 patients affected with SCAs was extracted from peripheral blood and screened for deletions in mitochondrial DNA (mtDNA). Sequencing of tRNA(Leu), tRNA(Lys), cytochrome oxidase II, ATPase 6/8 and NADH dehydrogenase I (NDI) genes belonging to mtDNA from patients with SCAs was also carried out to detect the presence of variations. We identified cytosine-adenine-guanine (CAG) trinucleotide repeat expansions in 20 patients. Seven of these patients had at least one nucleotide change in mtDNA. In such cases, 5 nucleotide variations resulted in amino acid changes with two novel variations T8256G and G9010A. SCA patients showed high levels of mtDNA variations in lymphocytes. It can be proposed that the SCA gene proteins (Ataxins) are involved in the complicated intracellular mechanisms that affect cellular organelles and their components, such as the mitochondrial genome. The instability of CAG repeats in polyglutamine diseases such as SCAs and Huntington's disease might be a causative factor in mtDNA variation or possible damage. Copyright 2008 S. Karger AG, Basel.

  4. Nuclear Expression of a Mitochondrial DNA Gene: Mitochondrial Targeting of Allotopically Expressed Mutant ATP6 in Transgenic Mice

    Directory of Open Access Journals (Sweden)

    David A. Dunn

    2012-01-01

    Full Text Available Nuclear encoding of mitochondrial DNA transgenes followed by mitochondrial targeting of the expressed proteins (allotopic expression; AE represents a potentially powerful strategy for creating animal models of mtDNA disease. Mice were created that allotopically express either a mutant (A6M or wildtype (A6W mt-Atp6 transgene. Compared to non-transgenic controls, A6M mice displayed neuromuscular and motor deficiencies (wire hang, pole, and balance beam analyses; P0.05. This study illustrates a mouse model capable of circumventing in vivo mitochondrial mutations. Moreover, it provides evidence supporting AE as a tool for mtDNA disease research with implications in development of DNA-based therapeutics.

  5. Mitochondrial atpA gene is altered in a new orf220-type cytoplasmic male-sterile line of stem mustard (Brassica juncea).

    Science.gov (United States)

    Yang, Jing-Hua; Huai, Yan; Zhang, Ming-Fang

    2009-02-01

    The purpose of this research is to identify the probable mitochondrial factor associated with cytoplasmic male sterility (cms) by comparative analysis of cms and its isogenic maintainer lines in stem mustards. Dramatic variations in the morphology of floral organs were observed in cms stem mustard. Mitochondrial atpA gene was shown to be altered in cms compared with that in its maintainer line, of which mitochondrial atpA gene from its maintainer line was sequenced to encode 507 amino acids. It was indicative of high homology with mitochondrial atpA genes from other species, even as high as 94% in similarity with Oryza sativa in terms of amino acid constituents. However, only 429 amino acids were deduced in cms showing 83% similarity with atpA gene from its maintainer line. Two copies were observed in its maintainer line, but only one was found in cms. Such numerous differences of mitochondrial atpA gene between cms and its maintainer lines may not be the results of evolutionary divergence but the rearrangements of mitochondria. Expression of mitochondrial atpA gene was shown to be down-regulated in cms by using Northern blot. Consequently, mitochondrial ATP synthesis was severely decreased more than one fold in cms stem mustard indicating deficiency in mitochondrial ATP synthesis in this type of cms. Therefore, we deduced that mitochondrial atpA gene altered in cms could be associated with male-sterility in this type of cms.

  6. Coptotermes gestroi (Isoptera: Rhinotermitidae) in Brazil: possible origins inferred by mitochondrial cytochrome oxidase II gene sequences.

    Science.gov (United States)

    Martins, C; Fontes, L R; Bueno, O C; Martins, V G

    2010-09-01

    The Asian subterranean termite, Coptotermes gestroi, originally from northeast India through Burma, Thailand, Malaysia, and the Indonesian archipelago, is a major termite pest introduced in several countries around the world, including Brazil. We sequenced the mitochondrial COII gene from individuals representing 23 populations. Phylogenetic analysis of COII gene sequences from this and other studies resulted in two main groups: (1) populations of Cleveland (USA) and four populations of Malaysia and (2) populations of Brazil, four populations of Malaysia, and one population from each of Thailand, Puerto Rico, and Key West (USA). Three new localities are reported here, considerably enlarging the distribution of C. gestroi in Brazil: Campo Grande (state of Mato Grosso do Sul), Itajaí (state of Santa Catarina), and Porto Alegre (state of Rio Grande do Sul).

  7. Sensory ataxic neuropathy in golden retriever dogs is caused by a deletion in the mitochondrial tRNATyr gene.

    Directory of Open Access Journals (Sweden)

    Izabella Baranowska

    2009-05-01

    Full Text Available Sensory ataxic neuropathy (SAN is a recently identified neurological disorder in golden retrievers. Pedigree analysis revealed that all affected dogs belong to one maternal lineage, and a statistical analysis showed that the disorder has a mitochondrial origin. A one base pair deletion in the mitochondrial tRNA(Tyr gene was identified at position 5304 in affected dogs after re-sequencing the complete mitochondrial genome of seven individuals. The deletion was not found among dogs representing 18 different breeds or in six wolves, ruling out this as a common polymorphism. The mutation could be traced back to a common ancestor of all affected dogs that lived in the 1970s. We used a quantitative oligonucleotide ligation assay to establish the degree of heteroplasmy in blood and tissue samples from affected dogs and controls. Affected dogs and their first to fourth degree relatives had 0-11% wild-type (wt sequence, while more distant relatives ranged between 5% and 60% wt sequence and all unrelated golden retrievers had 100% wt sequence. Northern blot analysis showed that tRNA(Tyr had a 10-fold lower steady-state level in affected dogs compared with controls. Four out of five affected dogs showed decreases in mitochondrial ATP production rates and respiratory chain enzyme activities together with morphological alterations in muscle tissue, resembling the changes reported in human mitochondrial pathology. Altogether, these results provide conclusive evidence that the deletion in the mitochondrial tRNA(Tyr gene is the causative mutation for SAN.

  8. All 37 Mitochondrial Genes of Aphid Aphis craccivora Obtained from Transcriptome Sequencing: Implications for the Evolution of Aphids.

    Directory of Open Access Journals (Sweden)

    Nan Song

    Full Text Available The availability of mitochondrial genome data for Aphididae, one of the economically important insect pest families, in public databases is limited. The advent of next generation sequencing technology provides the potential to generate mitochondrial genome data for many species timely and cost-effectively. In this report, we used transcriptome sequencing technology to determine all the 37 mitochondrial genes of the cowpea aphid, Aphis craccivora. This method avoids the necessity of finding suitable primers for long PCRs or primer-walking amplicons, and is proved to be effective in obtaining the whole set of mitochondrial gene data for insects with difficulty in sequencing mitochondrial genome by PCR-based strategies. Phylogenetic analyses of aphid mitochondrial genome data show clustering based on tribe level, and strongly support the monophyly of the family Aphididae. Within the monophyletic Aphidini, three samples from Aphis grouped together. In another major clade of Aphididae, Pterocomma pilosum was recovered as a potential sister-group of Cavariella salicicola, as part of Macrosiphini.

  9. Identification and sequence analysis of metazoan tRNA 3'-end processing enzymes tRNase Zs.

    Directory of Open Access Journals (Sweden)

    Zhikang Wang

    Full Text Available tRNase Z is the endonuclease responsible for removing the 3'-trailer sequences from precursor tRNAs, a prerequisite for the addition of the CCA sequence. It occurs in the short (tRNase Z(S and long (tRNase Z(L forms. Here we report the identification and sequence analysis of candidate tRNase Zs from 81 metazoan species. We found that the vast majority of deuterostomes, lophotrochozoans and lower metazoans have one tRNase Z(S and one tRNase Z(L genes, whereas ecdysozoans possess only a single tRNase Z(L gene. Sequence analysis revealed that in metazoans, a single nuclear tRNase Z(L gene is likely to encode both the nuclear and mitochondrial forms of tRNA 3'-end processing enzyme through mechanisms that include alternative translation initiation from two in-frame start codons and alternative splicing. Sequence conservation analysis revealed a variant PxKxRN motif, PxPxRG, which is located in the N-terminal region of tRNase Z(Ss. We also identified a previously unappreciated motif, AxDx, present in the C-terminal region of both tRNase Z(Ss and tRNase Z(Ls. The AxDx motif consisting mainly of a very short loop is potentially close enough to form hydrogen bonds with the loop containing the PxKxRN or PxPxRG motif. Through complementation analysis, we demonstrated the likely functional importance of the AxDx motif. In conclusion, our analysis supports the notion that in metazoans a single tRNase Z(L has evolved to participate in both nuclear and mitochondrial tRNA 3'-end processing, whereas tRNase Z(S may have evolved new functions. Our analysis also unveils new evolutionarily conserved motifs in tRNase Zs, including the C-terminal AxDx motif, which may have functional significance.

  10. Absence of pathogenic mitochondrial DNA mutations in mouse brain tumors

    Directory of Open Access Journals (Sweden)

    Seyfried Thomas N

    2005-08-01

    Full Text Available Abstract Background Somatic mutations in the mitochondrial genome occur in numerous tumor types including brain tumors. These mutations are generally found in the hypervariable regions I and II of the displacement loop and unlikely alter mitochondrial function. Two hypervariable regions of mononucleotide repeats occur in the mouse mitochondrial genome, i.e., the origin of replication of the light strand (OL and the Arg tRNA. Methods In this study we examined the entire mitochondrial genome in a series of chemically induced brain tumors in the C57BL/6J strain and spontaneous brain tumors in the VM mouse strain. The tumor mtDNA was compared to that of mtDNA in brain mitochondrial populations from the corresponding syngeneic mouse host strain. Results Direct sequencing revealed a few homoplasmic base pair insertions, deletions, and substitutions in the tumor cells mainly in regions of mononucleotide repeats. A heteroplasmic mutation in the 16srRNA gene was detected in a spontaneous metastatic VM brain tumor. Conclusion None of the mutations were considered pathogenic, indicating that mtDNA somatic mutations do not likely contribute to the initiation or progression of these diverse mouse brain tumors.

  11. Phylogeny and mitochondrial gene order variation in Lophotrochozoa in the light of new mitogenomic data from Nemertea

    Directory of Open Access Journals (Sweden)

    von Döhren Jörn

    2009-08-01

    Full Text Available Abstract Background The new animal phylogeny established several taxa which were not identified by morphological analyses, most prominently the Ecdysozoa (arthropods, roundworms, priapulids and others and Lophotrochozoa (molluscs, annelids, brachiopods and others. Lophotrochozoan interrelationships are under discussion, e.g. regarding the position of Nemertea (ribbon worms, which were discussed to be sister group to e.g. Mollusca, Brachiozoa or Platyhelminthes. Mitochondrial genomes contributed well with sequence data and gene order characters to the deep metazoan phylogeny debate. Results In this study we present the first complete mitochondrial genome record for a member of the Nemertea, Lineus viridis. Except two trnP and trnT, all genes are located on the same strand. While gene order is most similar to that of the brachiopod Terebratulina retusa, sequence based analyses of mitochondrial genes place nemerteans close to molluscs, phoronids and entoprocts without clear preference for one of these taxa as sister group. Conclusion Almost all recent analyses with large datasets show good support for a taxon comprising Annelida, Mollusca, Brachiopoda, Phoronida and Nemertea. But the relationships among these taxa vary between different studies. The analysis of gene order differences gives evidence for a multiple independent occurrence of a large inversion in the mitochondrial genome of Lophotrochozoa and a re-inversion of the same part in gastropods. We hypothesize that some regions of the genome have a higher chance for intramolecular recombination than others and gene order data have to be analysed carefully to detect convergent rearrangement events.

  12. Phylogeny and mitochondrial gene order variation in Lophotrochozoa in the light of new mitogenomic data from Nemertea.

    Science.gov (United States)

    Podsiadlowski, Lars; Braband, Anke; Struck, Torsten H; von Döhren, Jörn; Bartolomaeus, Thomas

    2009-08-06

    The new animal phylogeny established several taxa which were not identified by morphological analyses, most prominently the Ecdysozoa (arthropods, roundworms, priapulids and others) and Lophotrochozoa (molluscs, annelids, brachiopods and others). Lophotrochozoan interrelationships are under discussion, e.g. regarding the position of Nemertea (ribbon worms), which were discussed to be sister group to e.g. Mollusca, Brachiozoa or Platyhelminthes. Mitochondrial genomes contributed well with sequence data and gene order characters to the deep metazoan phylogeny debate. In this study we present the first complete mitochondrial genome record for a member of the Nemertea, Lineus viridis. Except two trnP and trnT, all genes are located on the same strand. While gene order is most similar to that of the brachiopod Terebratulina retusa, sequence based analyses of mitochondrial genes place nemerteans close to molluscs, phoronids and entoprocts without clear preference for one of these taxa as sister group. Almost all recent analyses with large datasets show good support for a taxon comprising Annelida, Mollusca, Brachiopoda, Phoronida and Nemertea. But the relationships among these taxa vary between different studies. The analysis of gene order differences gives evidence for a multiple independent occurrence of a large inversion in the mitochondrial genome of Lophotrochozoa and a re-inversion of the same part in gastropods. We hypothesize that some regions of the genome have a higher chance for intramolecular recombination than others and gene order data have to be analysed carefully to detect convergent rearrangement events.

  13. Nuclear and mitochondrial gene genealogies and allozyme polymorphism across a major phylogeographic break in the copepod Tigriopus californicus.

    OpenAIRE

    Burton, R S; Lee, B. N.

    1994-01-01

    The genetic structure of natural populations is frequently inferred from geographic distributions of alleles at multiple gene loci. Surveys of allozyme polymorphisms in the tidepool copepod Tigriopus californicus have revealed sharp genetic differentiation of populations, indicating that gene flow among populations is highly restricted. Analysis of population structure in this species has now been extended to include nuclear and mitochondrial gene genealogies. DNA sequences of the mtDNA-encod...

  14. Relationships among characiform fishes inferred from analysis of nuclear and mitochondrial gene sequences.

    Science.gov (United States)

    Calcagnotto, Daniela; Schaefer, Scott A; DeSalle, Rob

    2005-07-01

    Suprafamilial relationships among characiform fishes and implications for the taxonomy and biogeographic history of the Characiformes were investigated by parsimony analysis of four nuclear and two mitochondrial genes across 124 ingroup and 11 outgroup taxa. Simultaneous analysis of 3660 aligned base pairs from the mitochondrial 16S and cytochrome b genes and the nuclear recombination activating gene (RAG2), seven in absentia (sia), forkhead (fkh), and alpha-tropomyosin (trop) gene loci confirmed the non-monophyly of the African and Neotropical assemblages and corroborated many suprafamilial groups proposed previously on the basis of morphological features. The African distichodontids plus citharinids were strongly supported as a monophyletic Citharinoidei that is the sistergroup to all other characiforms, which form a monophyletic Characoidei composed of two large clades. The first represents an assemblage of both African and Neotropical taxa, wherein a monophyletic African Alestidae is sister to a smaller clade comprised of the Neotropical families Ctenolucidae, Lebiasinidae, and the African Hepsetidae, with that assemblage sister to a strictly Neotropical clade comprised of the Crenuchidae and Erythrinidae. The second clade within the Characoidei is strictly Neotropical and includes all other Characiformes grouped into two well supported major clades. The first, corresponding to a traditional definition of the Characidae, is congruent with some groupings previously supported by morphological evidence. The second clade comprises a monophyletic Anostomoidea that is sister to a clade formed by the families Hemiodontidae, Parodontidae, and Serrasalmidae, with that assemblage, in turn, the sistergroup of the Cynodontidae. Serrasalmidae, traditionally regarded as a subfamily of Characidae, was recovered as the sistergroup of (Anostomoidea (Parodontidae+Hemiodontidae)) and the family Cynodontidae was recovered with strong support as the sistergroup to this assemblage

  15. Dynamic regulation of genes involved in mitochondrial DNA replication and transcription during mouse brown fat cell differentiation and recruitment

    DEFF Research Database (Denmark)

    Murholm, Maria; Dixen, Karen; Qvortrup, Klaus

    2009-01-01

    BACKGROUND: Brown adipocytes are specialised in dissipating energy through adaptive thermogenesis, whereas white adipocytes are specialised in energy storage. These essentially opposite functions are possible for two reasons relating to mitochondria, namely expression of uncoupling protein 1 (UCP1......) and a remarkably higher mitochondrial abundance in brown adipocytes. METHODOLOGY/PRINCIPAL FINDINGS: Here we report a comprehensive characterisation of gene expression linked to mitochondrial DNA replication, transcription and function during white and brown fat cell differentiation in vitro as well as in white...... precursor cells promotes mitochondrial DNA replication, and that silencing of PRDM16 expression during brown fat cell differentiation blunts mitochondrial biogenesis and expression of brown fat cell markers. CONCLUSIONS/SIGNIFICANCE: Using both in vitro and in vivo model systems of white and brown fat cell...

  16. The Complete Sequence of the Mitochondrial Genome of the Chamberednautilus (Mollusca: Cephalopoda)

    Energy Technology Data Exchange (ETDEWEB)

    Boore, Jeffrey L.

    2005-12-01

    Background: Mitochondria contain small genomes that arephysically separate from those of nuclei. Their comparison serves as amodel system for understanding the processes of genome evolution.Although complete mitochondrial genome sequences have been reported formore than 600 animals, the taxonomic sampling is highly biased towardvertebrates and arthropods, leaving much of the diversity yetuncharacterized. Results: The mitochondrial genome of a cephalopodmollusk, the Chambered Nautilus, is 16,258 nts in length and 59.5 percentA+T, both values that are typical of animal mitochondrial genomes. Itcontains the 37 genes that are typical for animal mtDNAs, with 15 on oneDNA strand and 22 on the other. The arrangement of these genes can bederived from that of the distantly related Katharina tunicata (Mollusca:Polyplacophora) by a switch in position of two large blocks of genes andtranspositions of four tRNA genes. There is strong skew in thedistribution of nucleotides between the two strands. There are an unusualnumber of non-coding regions and their function, if any, is not known;however, several of these demark abrupt shifts in nucleotide skew,suggesting that they may play roles in transcription and/or replication.One of the non-coding regions contains multiple repeats of a tRNA-likesequence. Some of the tRNA genes appear to overlap on the same strand,but this could be resolved if the polycistron were cleaved at thebeginning of the downstream gene, followed by polyadenylation of theproduct of the upstream gene to form a fully paired structure.Conclusions: Nautilus sp. mtDNA contains an expected gene content thathas experienced few rearrangements since the evolutionary split betweencephalopods and polyplacophorans. It contains an unusual number ofnon-coding regions, especially considering that these otherwise often aregenerated by the same processes that produce gene rearrangements. Thisappears to be yet another case where polyadenylation of mitochondrialtRNAs restores

  17. Copy number variation of mitochondrial genes in Pneumocystis jirovecii according to the fungal load in BAL specimens

    Directory of Open Access Journals (Sweden)

    clara valero

    2016-09-01

    Full Text Available AbstractPneumocystis jirovecii is an unculturable fungus and the causative agent of Pneumocystis pneumonia, a life-threatening opportunistic infection. Although molecular diagnosis is often based on the mtLSU rRNA mitochondrial gene due to its greater sensitivity, physiology and the dynamics of the mitochondria in this fungus remains largely unknown. We developed and optimized six real-time PCR assays in order to determine the copy number of four mitochondrial genes (mtSSU rRNA, mtLSU rRNA, NAD1 and CYTB in comparison to nuclear genome (DHPS and HSP70 and tested 84 bronchoalveolar fluids of patients at different stages of the infection. Unexpectedly, we found that copy number of mitochondrial genes varied from gene to gene with mtSSU rRNA gene being more represented (37 copies than NAD1 (23 copies, mtLSU rRNA (15 copies and CYTB (6 copies genes compared to nuclear genome. Hierarchical clustering analysis (HCA allowed us to define five major clusters, significantly associated with fungal load (p=0.029, in which copy number of mitochondrial genes was significantly different among them. More importantly, copy number of mtLSU rRNA, NAD1 and CYTB but not mtSSU rRNA differed according to P. jirovecii physiological state with a decreased number of copies when the fungal load is low. This suggests the existence of a mixture of various subspecies of mtDNA that can harbor different amplification rates. Overall, we revealed here an unexpected plasticity and dynamics of P. jirovecii mitochondrial DNA that vary according to P. jirovecii’s physiological state.

  18. Emerging roles of tRNA in adaptive translation, signalling dynamics and disease.

    Science.gov (United States)

    Kirchner, Sebastian; Ignatova, Zoya

    2015-02-01

    tRNAs, nexus molecules between mRNAs and proteins, have a central role in translation. Recent discoveries have revealed unprecedented complexity of tRNA biosynthesis, modification patterns, regulation and function. In this Review, we present emerging concepts regarding how tRNA abundance is dynamically regulated and how tRNAs (and their nucleolytic fragments) are centrally involved in stress signalling and adaptive translation, operating across a wide range of timescales. Mutations in tRNAs or in genes affecting tRNA biogenesis are also linked to complex human diseases with surprising heterogeneity in tissue vulnerability, and we highlight cell-specific aspects that modulate the disease penetrance of tRNA-based pathologies.

  19. Saturation of recognition elements blocks evolution of new tRNA identities.

    Science.gov (United States)

    Saint-Léger, Adélaïde; Bello, Carla; Dans, Pablo D; Torres, Adrian Gabriel; Novoa, Eva Maria; Camacho, Noelia; Orozco, Modesto; Kondrashov, Fyodor A; Ribas de Pouplana, Lluís

    2016-04-01

    Understanding the principles that led to the current complexity of the genetic code is a central question in evolution. Expansion of the genetic code required the selection of new transfer RNAs (tRNAs) with specific recognition signals that allowed them to be matured, modified, aminoacylated, and processed by the ribosome without compromising the fidelity or efficiency of protein synthesis. We show that saturation of recognition signals blocks the emergence of new tRNA identities and that the rate of nucleotide substitutions in tRNAs is higher in species with fewer tRNA genes. We propose that the growth of the genetic code stalled because a limit was reached in the number of identity elements that can be effectively used in the tRNA structure.

  20. Nuclear and mitochondrial gene genealogies and allozyme polymorphism across a major phylogeographic break in the copepod Tigriopus californicus.

    Science.gov (United States)

    Burton, R S; Lee, B N

    1994-05-24

    The genetic structure of natural populations is frequently inferred from geographic distributions of alleles at multiple gene loci. Surveys of allozyme polymorphisms in the tidepool copepod Tigriopus californicus have revealed sharp genetic differentiation of populations, indicating that gene flow among populations is highly restricted. Analysis of population structure in this species has now been extended to include nuclear and mitochondrial gene genealogies. DNA sequences of the mtDNA-encoded cytochrome-c oxidase subunit I gene from 21 isofemale lines derived from seven populations reveal a phylogeographic break between populations north and south of Point Conception, California, with sequence divergence across the break exceeding 18%, the highest level of mtDNA divergence yet reported among conspecific populations. Divergence between populations based on 22 sequences of the nuclear histone H1 gene is geographically concordant with the mitochondrial sequences. In contrast with previously studied nuclear genes in other sexually reproducing metazoans, the H1 gene genealogy from T. californicus shows no evidence of recombination. The apparent absence of intragenic recombinants probably results from the persistent lack of gene flow among geographically separated populations, a conclusion strongly supported by allozyme data and the mitochondrial gene genealogy. Despite strong population differentiation at allozyme loci, the phylogeographic break identified by the DNA sequences was not evident in the allozyme data.

  1. Cloning, characterization, and expression of Cytochrome b (Cytb)-a key mitochondrial gene from Prorocentrum donghaiense

    Institute of Scientific and Technical Information of China (English)

    ZHAO Liyuan; MI Tiezhu; ZHEN Yu; YU Zhigang

    2012-01-01

    Mitochondrial cytochrome b (Cytb),one of the few proteins encoded by the mitochondrial DNA,plays an important role in transferring electrons.As a mitochondrial gene,it has been widely used for phylogenetic analysis.Previously,a 949-bp fragment of the coding gene and mRNA editing were characterized from Prorocentrum donghaiense,which might prove useful for resolving P.donghaiense from closely related species.However,the full-length coding region has not been characterized.In this study,we used rapid amplification of cDNA ends (RACE) to obtain full-length,1124 bp cDNA.Cytb transcript contained a standard initiation codon ATG,but did not have a recognizable stop codon.Homology comparison showed that the P.donghaiense Cytb had a high sequence identity to Cytb sequences from other dinoflagellate species.Phylogenetic analysis placed Cytb from P.donghaiense in the clade of dinofiagellates and it clustered together strongly with that from P.minimum.Based on the full-length sequence,we inferred 32 editing events at different positions,accounting for 2.93% of the Cytb gent.34.4% (11) of the changes were A to G,25% (8) were T to C,and 25% (8) were C to U,with smaller proportions of G to C and G to A edits (9.4% (3) and 6.2% (2),respectively).The expression level of the Cytb transcript was quantified by real-time PCR with a TaqMan probe at different times during the whole growth phase.The average Cytb transcript was present at 39.27±7.46 copies of cDNA per cell during the whole growth cycle,and the expression of Cytb was relatively stable over the different phases.These results deepen our understanding of the structure and characteristics of Cytb in P.donghaiense,and confirmed that Cytb in P.donghaiense is a candidate reference gene for studying the expression of other genes.

  2. MitoRes: a resource of nuclear-encoded mitochondrial genes and their products in Metazoa

    Directory of Open Access Journals (Sweden)

    Grillo Giorgio

    2006-01-01

    Full Text Available Abstract Background Mitochondria are sub-cellular organelles that have a central role in energy production and in other metabolic pathways of all eukaryotic respiring cells. In the last few years, with more and more genomes being sequenced, a huge amount of data has been generated providing an unprecedented opportunity to use the comparative analysis approach in studies of evolution and functional genomics with the aim of shedding light on molecular mechanisms regulating mitochondrial biogenesis and metabolism. In this context, the problem of the optimal extraction of representative datasets of genomic and proteomic data assumes a crucial importance. Specialised resources for nuclear-encoded mitochondria-related proteins already exist; however, no mitochondrial database is currently available with the same features of MitoRes, which is an update of the MitoNuc database extensively modified in its structure, data sources and graphical interface. It contains data on nuclear-encoded mitochondria-related products for any metazoan species for which this type of data is available and also provides comprehensive sequence datasets (gene, transcript and protein as well as useful tools for their extraction and export. Description MitoRes http://www2.ba.itb.cnr.it/MitoRes/ consolidates information from publicly external sources and automatically annotates them into a relational database. Additionally, it also clusters proteins on the basis of their sequence similarity and interconnects them with genomic data. The search engine and sequence management tools allow the query/retrieval of the database content and the extraction and export of sequences (gene, transcript, protein and related sub-sequences (intron, exon, UTR, CDS, signal peptide and gene flanking regions ready to be used for in silico analysis. Conclusion The tool we describe here has been developed to support lab scientists and bioinformaticians alike in the characterization of molecular

  3. The mitochondrial import gene tomm22 is specifically required for hepatocyte survival and provides a liver regeneration model

    Science.gov (United States)

    Curado, Silvia; Ober, Elke A.; Walsh, Susan; Cortes-Hernandez, Paulina; Verkade, Heather; Koehler, Carla M.; Stainier, Didier Y. R.

    2010-01-01

    SUMMARY Understanding liver development should lead to greater insights into liver diseases and improve therapeutic strategies. In a forward genetic screen for genes regulating liver development in zebrafish, we identified a mutant – oliver – that exhibits liver-specific defects. In oliver mutants, the liver is specified, bile ducts form and hepatocytes differentiate. However, the hepatocytes die shortly after their differentiation, and thus the resulting mutant liver consists mainly of biliary tissue. We identified a mutation in the gene encoding translocase of the outer mitochondrial membrane 22 (Tomm22) as responsible for this phenotype. Mutations in tomm genes have been associated with mitochondrial dysfunction, but most studies on the effect of defective mitochondrial protein translocation have been carried out in cultured cells or unicellular organisms. Therefore, the tomm22 mutant represents an important vertebrate genetic model to study mitochondrial biology and hepatic mitochondrial diseases. We further found that the temporary knockdown of Tomm22 levels by morpholino antisense oligonucleotides causes a specific hepatocyte degeneration phenotype that is reversible: new hepatocytes repopulate the liver as Tomm22 recovers to wild-type levels. The specificity and reversibility of hepatocyte ablation after temporary knockdown of Tomm22 provides an additional model to study liver regeneration, under conditions where most hepatocytes have died. We used this regeneration model to analyze the signaling commonalities between hepatocyte development and regeneration. PMID:20483998

  4. Complete mitochondrial genome sequence of Tridentiger bifasciatus and Tridentiger barbatus (Perciformes, Gobiidae): a mitogenomic perspective on the phylogenetic relationships of Gobiidae.

    Science.gov (United States)

    Jin, Xiaoxiao; Wang, Rixin; Wei, Tao; Tang, Da; Xu, Tianjun

    2015-01-01

    The fishes of suborder Gobioidei is the largest group of those in present living Perciformes, which contains about 2,200 species belonging to 270 genera of 9 families in the world. The monophyly and phylogenetic relationships of gobies have been controversial and disputable for a long time. In the present study, the complete mitochondrial genome of the shimofuri goby Tridentiger bifasciatus (T. bifasciatus) and shokihaze goby Tridentiger barbatus (T. barbatus) were firstly determined. The two mitochondrial genomes were both consisted of 2 ribosomal RNA (rRNA) genes, 13 protein-coding genes, 22 transfer RNA (tRNA) genes, and one major control region (CR). They shared similar features with those of other gobies in terms of gene arrangement, base composition, and tRNA structures. The CR was absence of typical conserved blocks (CSB-E, and CSB-F) respectively for the T. bifasciatus and T. barbatus. Phylogenomic analyses, which based on 12 concatenated protein-coding genes and complete mitochondrial genome sequences, revealed that there were two groups within the Gobiidae. A large group consisted of the Amblyopinae, Gobionellinae, Oxudercinae and Sicydiinae, and Amblyopinae was nested in Oxudercinae and they were both paraphyletic to Sicydiinae. The other group was the Gobiinae. As a whole, our phylogenetic data was different from the traditionally classification of Gobiidae, but supported the new phylogenetic taxonomy view of Thacker (Copeia 2009:93-104, 2009).

  5. Characterization of the complete mitochondrial genome of Acanthoscelides obtectus (Coleoptera: Chrysomelidae: Bruchinae) with phylogenetic analysis.

    Science.gov (United States)

    Yao, Jie; Yang, Hong; Dai, Renhuai

    2017-07-20

    Acanthoscelides obtectus is a common species of the subfamily Bruchinae and a worldwide-distributed seed-feeding beetle. The complete mitochondrial genome of A. obtectus is 16,130 bp in length with an A + T content of 76.4%. It contains a positive AT skew and a negative GC skew. The mitogenome of A. obtectus contains 13 protein-coding genes (PCGs), 22 tRNA genes, two rRNA genes and a non-coding region (D-loop). All PCGs start with an ATN codon, and seven (ND3, ATP6, COIII, ND3, ND4L, ND6, and Cytb) of them terminate with TAA, while the remaining five (COI, COII, ND1, ND4, and ND5) terminate with a single T, ATP8 terminates with TGA. Except tRNA (Ser) , the secondary structures of 21 tRNAs that can be folded into a typical clover-leaf structure were identified. The secondary structures of lrRNA and srRNA were also predicted in this study. There are six domains with 48 helices in lrRNA and three domains with 32 helices in srRNA. The control region of A. obtectus is 1354 bp in size with the highest A + T content (83.5%) in a mitochondrial gene. Thirteen PCGs in 19 species have been used to infer their phylogenetic relationships. Our results show that A. obtectus belongs to the family Chrysomelidae (subfamily-Bruchinae). This is the first study on phylogenetic analyses involving the mitochondrial genes of A. obtectus and could provide basic data for future studies of mitochondrial genome diversities and the evolution of related insect lineages.

  6. Human mitochondrial DNA deletions associated with mutations in the gene encoding Twinkle, a phage T7 gene 4-like protein localized in mitochondria.

    Science.gov (United States)

    Spelbrink, J N; Li, F Y; Tiranti, V; Nikali, K; Yuan, Q P; Tariq, M; Wanrooij, S; Garrido, N; Comi, G; Morandi, L; Santoro, L; Toscano, A; Fabrizi, G M; Somer, H; Croxen, R; Beeson, D; Poulton, J; Suomalainen, A; Jacobs, H T; Zeviani, M; Larsson, C

    2001-07-01

    The gene products involved in mammalian mitochondrial DNA (mtDNA) maintenance and organization remain largely unknown. We report here a novel mitochondrial protein, Twinkle, with structural similarity to phage T7 gene 4 primase/helicase and other hexameric ring helicases. Twinkle colocalizes with mtDNA in mitochondrial nucleoids. Screening of the gene encoding Twinkle in individuals with autosomal dominant progressive external ophthalmoplegia (adPEO), associated with multiple mtDNA deletions, identified 11 different coding-region mutations co-segregating with the disorder in 12 adPEO pedigrees of various ethnic origins. The mutations cluster in a region of the protein proposed to be involved in subunit interactions. The function of Twinkle is inferred to be critical for lifetime maintenance of human mtDNA integrity.

  7. Polymorphisms in the mitochondrial oxidative phosphorylation chain genes as prognostic markers for colorectal cancer

    Directory of Open Access Journals (Sweden)

    Lascorz Jesus

    2012-04-01

    Full Text Available Abstract Background Currently, the TNM classification of malignant tumours based on clinicopathological staging remains the standard for colorectal cancer (CRC prognostication. Recently, we identified the mitochondrial oxidative phosphorylation chain as a consistently overrepresented category in the published gene expression profiling (GEP studies on CRC prognosis. Methods We evaluated associations of putative regulatory single nucleotide polymorphisms (SNPs in genes from the oxidative phosphorylation chain with survival and disease prognosis in 613 CRC patients from Northern Germany (PopGen cohort. Results Two SNPs in the 3′ untranslated region of UQCRB (complex III, rs7836698 and rs10504961, were associated with overall survival (HR = 0.52, 95% CI 0.32–0.85 and HR = 0.64, 95% CI 0.42–0.99, for TT carriers. These associations were restricted to the group of patients with cancer located in the colon (HR = 0.42, 95% CI 0.22–0.82 and HR = 0.46, 95% CI 0.25–0.83. Multivariate analysis indicated that both markers might act as independent prognostic markers. Additionally, the TT carriers were ~2 times more likely to develop tumours in the colon than in the rectum. Two SNPs in COX6B1 (complex IV were associated with lymph node metastasis in a dominant model (rs6510502, OR = 1.75, 95% CI 1.20–2.57; rs10420252, OR = 1.68, 95% CI 1.11–2.53; rs6510502 was associated also with distant metastasis (OR = 1.67, 95% CI 1.09–2.56 in a dominant model. Conclusions This is the first report suggesting that markers in genes from the mitochondrial oxidative chain might be prognostic factors for CRC. Additional studies replicating the presented findings are needed.

  8. Molecular analysis of polymerase gamma gene and mitochondrial polymorphism in fertile and subfertile men.

    Science.gov (United States)

    Harris, T P; Gomas, K P; Weir, F; Holyoake, A J; McHugh, P; Wu, M; Sin, Y; Sin, I L; Sin, F Y T

    2006-06-01

    CAG trinucleotide repeat length in the nuclear polymerase gamma gene (POLgamma) has been shown to be associated with men with reduced fertility. The present study investigated the frequency of CAG repeat length genotypes and three exonuclease motifs of the POLgamma in relation to the frequency of mitochondrial nucleotide substitutions. DNA from semen samples of 93 normozoospermic men and 192 non-normozoospermic men was isolated and the specific regions of the genes were amplified by polymerase chain reactions (PCR) and sequenced to identify mutations. The genotypic frequencies of pooled POLgamma CAG repeat lengths, =10/ not equal 10 heterozygotes and not equal 10/ not equal 10 homozygotes, were significantly different between normozoospermic and non-normozoospermic men (p < 0.05), with non-normozoospermic men having a slightly higher frequency of the =10/=10 genotypes. The allelic frequency for =10 is 0.79 and not equal10 is 0.21 for normozoospermic men and 0.85 and 0.15, respectively, for non-normozoospermic men (p < 0.025). There was no mutation detected in the exonuclease motifs in all the samples tested. Eighty normozoospermic and 124 non-normozoospermic semen samples were analysed for nucleotide substitutions in mitochondrial genes by PCR and sequencing. Heteroplasmic mutations were found in one azoospermic man, four asthenozoospermic men and two normozoospermic men. Only one asthenozoospermic man was heterozygous for the POLgamma genotype. Of the 17 men with non-synonymous nucleotide substitutions, 14 were homozygous for the POLgamma genotype. Non-normozoospermic men had twice as many nucleotide substitutions than normozoospermic men. However, there were no significant differences in the frequencies of nucleotide substitution and POLgamma genotypes in the two groups of men.

  9. The marine indo-west pacific break: contrasting the resolving power of mitochondrial and nuclear genes.

    Science.gov (United States)

    Williams, S T; Jara, J; Gomez, E; Knowlton, N

    2002-11-01

    Simultaneous studies of both nuclear and mitochondrial markers were undertaken in two widespread Indo-West Pacific (IWP) marine invertebrates to compare and contrast the ability of these markers to resolve genetic structure. In particular, we were interested in the resolution of a genetic break between the Indian and Pacific Oceans due to historical isolation. Sequence variation from the