minimal promoter region: Topics by WorldWideScience.org

Sample records for minimal promoter region

Function of the EGR-1/TIS8 radiation inducible promoter in a minimal HSV-1 amplicon system

International Nuclear Information System (INIS)

Spear, M.A.; Sakamoto, K.M.; Herrlinger, U.; Pechan, P.; Breakefield, X.O.

1997-01-01

Purpose: To evaluate function of the EGR-1/TIS8 promoter region in minimal HSV-1 amplicon system in order to determine the feasibility of using the system to regulate vector replication with radiation. Materials and Methods: A 600-base pair 5' upstream region of the EGR-1 promoter linked to chloramphenicol acetyltransferase (CAT) was recombined into a minimal HSV-1 amplicon vector system (pONEC). pONEC or a control plasmid was transfected into U87 glioma cells using the Lipofectamine method. Thirty-six hours later one aliquot of cells from each transfection was irradiated to a dose of 20 Gy and another identical aliquot served as a control. CAT activity was assayed 8 hours after irradiation. Results: pONEC transfected cells irradiated with 20 Gy demonstrated 2.0 fold increase in CAT activity compared to non-irradiated cells. Cells transfected with control plasmid showed no change in CAT activity. Unirradiated pONEC cells had CAT activity 1.3 times those transfected with control plasmid. Conclusion: We have previously created HSV-1 gene therapy amplicon vector systems which allow virus-amplicon interdependent replication, with the intent of regulating replication. The above data demonstrates that a minimal amplicon system will allow radiation dependent regulation by the EGR-1 promoter, thus indicating the possibility of using this system to regulate onsite, spatially and temporally regulated vector production. Baseline CAT activity was higher and relative induction lower than other reported expression constructs, which raises concern for the ability of the system to produce a differential in transcription levels sufficient for this purpose. This is possibly the result of residual promoter/enhancer elements remaining in the HSV-1 sequences. We are attempting to create constructs lacking these elements. Addition of secondary promoter sequences may also be of use. We are also currently evaluating the efficacy of the putative IEX-1 radiation inducible promoter region in
Two negative cis-regulatory regions involved in fruit-specific promoter activity from watermelon (Citrullus vulgaris S.).

Science.gov (United States)

Yin, Tao; Wu, Hanying; Zhang, Shanglong; Lu, Hongyu; Zhang, Lingxiao; Xu, Yong; Chen, Daming; Liu, Jingmei

2009-01-01

A 1.8 kb 5'-flanking region of the large subunit of ADP-glucose pyrophosphorylase, isolated from watermelon (Citrullus vulgaris S.), has fruit-specific promoter activity in transgenic tomato plants. Two negative regulatory regions, from -986 to -959 and from -472 to -424, were identified in this promoter region by fine deletion analyses. Removal of both regions led to constitutive expression in epidermal cells. Gain-of-function experiments showed that these two regions were sufficient to inhibit RFP (red fluorescent protein) expression in transformed epidermal cells when fused to the cauliflower mosaic virus (CaMV) 35S minimal promoter. Gel mobility shift experiments demonstrated the presence of leaf nuclear factors that interact with these two elements. A TCCAAAA motif was identified in these two regions, as well as one in the reverse orientation, which was confirmed to be a novel specific cis-element. A quantitative beta-glucuronidase (GUS) activity assay of stable transgenic tomato plants showed that the activities of chimeric promoters harbouring only one of the two cis-elements, or both, were approximately 10-fold higher in fruits than in leaves. These data confirm that the TCCAAAA motif functions as a fruit-specific element by inhibiting gene expression in leaves.
Use of Linear Programming to Develop Cost-Minimized Nutritionally Adequate Health Promoting Food Baskets

DEFF Research Database (Denmark)

Parlesak, A.; Tetens, Inge; Dejgård Jensen, Jørgen

2016-01-01

Food-Based Dietary Guidelines (FBDGs) are developed to promote healthier eating patterns, but increasing food prices may make healthy eating less affordable. The aim of this study was to design a range of cost-minimized nutritionally adequate health-promoting food baskets (FBs) that help prevent ...
The Use of Trust Regions in Kohn-Sham Total Energy Minimization

International Nuclear Information System (INIS)

Yang, Chao; Meza, Juan C.; Wang, Lin-wang

2006-01-01

The Self Consistent Field (SCF) iteration, widely used for computing the ground state energy and the corresponding single particle wave functions associated with a many-electron atomistic system, is viewed in this paper as an optimization procedure that minimizes the Kohn-Sham total energy indirectly by minimizing a sequence of quadratic surrogate functions. We point out the similarity and difference between the total energy and the surrogate, and show how the SCF iteration can fail when the minimizer of the surrogate produces an increase in the KS total energy. A trust region technique is introduced as a way to restrict the update of the wave functions within a small neighborhood of an approximate solution at which the gradient of the total energy agrees with that of the surrogate. The use of trust region in SCF is not new. However, it has been observed that directly applying a trust region based SCF(TRSCF) to the Kohn-Sham total energy often leads to slow convergence. We propose to use TRSCF within a direct constrained minimization(DCM) algorithm we developed in dcm. The key ingredients of the DCM algorithm involve projecting the total energy function into a sequence of subspaces of small dimensions and seeking the minimizer of the total energy function within each subspace. The minimizer of a subspace energy function, which is computed by TRSCF, not only provides a search direction along which the KS total energy function decreases but also gives an optimal 'step-length' that yields a sufficient decrease in total energy. A numerical example is provided to demonstrate that the combination of TRSCF and DCM is more efficient than SCF
[Health-Promoting Schools Regional Initiative of the Americas].

Science.gov (United States)

Ippolito-Shepherd, Josefa; Cerqueira, Maria Teresa; Ortega, Diana Patricia

2005-01-01

In Latin America, comprehensive health promotion programmes and activities are being implemented in the school setting, which take into account the conceptual framework of the Health-Promoting Schools Regional Initiative of the Pan American Health Organization, Regional office of the World Health Organization (PAHO/WHO). These programmes help to strengthen the working relationships between the health and education sectors. The Health-Promoting Schools Regional Initiative, officially launched by PAHO/WHO in 1995, aims to form future generations to have the knowledge, abilities, and skills necessary for promoting and caring for their health and that of their family and community, as well as to create and maintain healthy environments and communities. The Initiative focuses on three main components: comprehensive health education, the creation and maintenance of healthy physical and psychosocial environments, and the access to health and nutrition services, mental health, and active life. In 2001, PAHO conducted a survey in 19 Latin American countries to assess the status and trends of Health-Promoting Schools in the Region, for the appropriate regional, subregional, and national planning of pertinent health promotion and health education programmes and activities. The results of this survey provided information about policies and national plans, multisectoral coordination mechanisms for the support of health promotion in the school settings, the formation and participation in national and international networks of Health-Promoting Schools and about the level of dissemination of the strategy. For the successful development of Health-Promoting Schools is essential to involve the society as a whole, in order to mobilise human resources and materials necessary for implementing health promotion in the school settings. Thus, the constitution and consolidation of networks has been a facilitating mechanism for the exchange of ideas, resources and experiences to strengthen
Beyond the Washington Consensus: Promoting Economic Growth and Minimizing the Threat of Violence in Latin America through Social Development

Science.gov (United States)

2012-03-01

pp. 247–274. Mankiw , N. Gregory, David Romer, and David N. Weil. “A Contribution to the Empirics of Economic Growth.” The Quarterly Journal...WASHINGTON CONSENSUS: PROMOTING ECONOMIC GROWTH AND MINIMIZING THE THREAT OF VIOLENCE IN LATIN AMERICA THROUGH SOCIAL DEVELOPMENT by Eric J. Blomberg...Washington Consensus: Promoting Economic Growth and Minimizing the Threat of Violence in Latin America through Social Development 5. FUNDING NUMBERS
Use of Linear Programming to Develop Cost-Minimized Nutritionally Adequate Health Promoting Food Baskets

DEFF Research Database (Denmark)

Parlesak, A.; Tetens, Inge; Dejgård Jensen, Jørgen

2016-01-01

Food-Based Dietary Guidelines (FBDGs) are developed to promote healthier eating patterns, but increasing food prices may make healthy eating less affordable. The aim of this study was to design a range of cost-minimized nutritionally adequate health-promoting food baskets (FBs) that help prevent...... both micronutrient inadequacy and diet-related non-communicable diseases at lowest cost. Average prices for 312 foods were collected within the Greater Copenhagen area. The cost and nutrient content of five different cost-minimized FBs for a family of four were calculated per day using linear...... in each of the resulting five baskets was increased through limiting the relative share of individual foods. The one-day version of N contained only 12 foods at the minimum cost of DKK 27 (€ 3.6). The CA, DG, and DGN were about twice of this and the CAN cost ~DKK 81 (€ 10.8). The baskets with the greater...
Identification and characterization of a liver stage-specific promoter region of the malaria parasite Plasmodium.

Directory of Open Access Journals (Sweden)

Susanne Helm

Full Text Available During the blood meal of a Plasmodium-infected mosquito, 10 to 100 parasites are inoculated into the skin and a proportion of these migrate via the bloodstream to the liver where they infect hepatocytes. The Plasmodium liver stage, despite its clinical silence, represents a highly promising target for antimalarial drug and vaccine approaches. Successfully invaded parasites undergo a massive proliferation in hepatocytes, producing thousands of merozoites that are transported into a blood vessel to infect red blood cells. To successfully develop from the liver stage into infective merozoites, a tight regulation of gene expression is needed. Although this is a very interesting aspect in the biology of Plasmodium, little is known about gene regulation in Plasmodium parasites in general and in the liver stage in particular. We have functionally analyzed a novel promoter region of the rodent parasite Plasmodium berghei that is exclusively active during the liver stage of the parasite. To prove stage-specific activity of the promoter, GFP and luciferase reporter assays have been successfully established, allowing both qualitative and accurate quantitative analysis. To further characterize the promoter region, the transcription start site was mapped by rapid amplification of cDNA ends (5'-RACE. Using promoter truncation experiments and site-directed mutagenesis within potential transcription factor binding sites, we suggest that the minimal promoter contains more than one binding site for the recently identified parasite-specific ApiAP2 transcription factors. The identification of a liver stage-specific promoter in P. berghei confirms that the parasite is able to tightly regulate gene expression during its life cycle. The identified promoter region might now be used to study the biology of the Plasmodium liver stage, which has thus far proven problematic on a molecular level. Stage-specific expression of dominant-negative mutant proteins and
Multiple 5' ends of human cytomegalovirus UL57 transcripts identify a complex, cycloheximide-resistant promoter region that activates oriLyt

International Nuclear Information System (INIS)

Kiehl, Anita; Huang, Lili; Franchi, David; Anders, David G.

2003-01-01

The human cytomegalovirus (HCMV) UL57 gene lies adjacent to HCMV oriLyt, from which it is separated by an organizationally conserved, mostly noncoding region that is thought to both regulate UL57 expression and activate oriLyt function. However, the UL57 promoter has not been studied. We determined the 5' ends of UL57 transcripts toward an understanding of the potential relationship between UL57 expression and oriLyt activation. The results presented here identified three distinct 5' ends spread over 800 bp, at nt 90302, 90530, and 91138; use of these sites exhibited differential sensitivity to phosphonoformic acid treatment. Interestingly, a 10-kb UL57 transcript accumulated in cycloheximide-treated infected cells, even though other early transcripts were not detectable. However, the 10-kb transcript did not accumulate in cells treated with the more stringent translation inhibitor anisomycin. Consistent with the notion that the identified 5' ends arise from distinct transcription start sites, the sequences upstream of sites I and II functioned as promoters responsive to HCMV infection in transient assays. However, the origin-proximal promoter region III required downstream sequences for transcriptional activity. Mutation of candidate core promoter elements suggested that promoter III is regulated by an initiator region (Inr) and a downstream promoter element. Finally, a 42-bp sequence containing the candidate Inr activated a minimal oriLyt core construct in transient replication assays. Thus, these studies showed that a large, complex promoter region with novel features controls UL57 expression, and identified a sequence that regulates both UL57 transcription and oriLyt activation
The minimally tuned minimal supersymmetric standard model

International Nuclear Information System (INIS)

Essig, Rouven; Fortin, Jean-Francois

2008-01-01

The regions in the Minimal Supersymmetric Standard Model with the minimal amount of fine-tuning of electroweak symmetry breaking are presented for general messenger scale. No a priori relations among the soft supersymmetry breaking parameters are assumed and fine-tuning is minimized with respect to all the important parameters which affect electroweak symmetry breaking. The superpartner spectra in the minimally tuned region of parameter space are quite distinctive with large stop mixing at the low scale and negative squark soft masses at the high scale. The minimal amount of tuning increases enormously for a Higgs mass beyond roughly 120 GeV
A minimal murine Msx-1 gene promoter. Organization of its cis-regulatory motifs and their role in transcriptional activation in cells in culture and in transgenic mice.

Science.gov (United States)

Takahashi, T; Guron, C; Shetty, S; Matsui, H; Raghow, R

1997-09-05

To dissect the cis-regulatory elements of the murine Msx-1 promoter, which lacks a conventional TATA element, a putative Msx-1 promoter DNA fragment (from -1282 to +106 base pairs (bp)) or its congeners containing site-specific alterations were fused to luciferase reporter and introduced into NIH3T3 and C2C12 cells, and the expression of luciferase was assessed in transient expression assays. The functional consequences of the sequential 5' deletions of the promotor revealed that multiple positive and negative regulatory elements participate in regulating transcription of the Msx-1 gene. Surprisingly, however, the optimal expression of Msx-1 promoter in either NIH3T3 or C2C12 cells required only 165 bp of the upstream sequence to warrant detailed examination of its structure. Therefore, the functional consequences of site-specific deletions and point mutations of the cis-acting elements of the minimal Msx-1 promoter were systematically examined. Concomitantly, potential transcriptional factor(s) interacting with the cis-acting elements of the minimal promoter were also studied by gel electrophoretic mobility shift assays and DNase I footprinting. Combined analyses of the minimal promoter by DNase I footprinting, electrophoretic mobility shift assays, and super shift assays with specific antibodies revealed that 5'-flanking regions from -161 to -154 and from -26 to -13 of the Msx-1 promoter contains an authentic E box (proximal E box), capable of binding a protein immunologically related to the upstream stimulating factor 1 (USF-1) and a GC-rich sequence motif which can bind to Sp1 (proximal Sp1), respectively. Additionally, we observed that the promoter activation was seriously hampered if the proximal E box was removed or mutated, and the promoter activity was eliminated completely if the proximal Sp1 site was similarly altered. Absolute dependence of the Msx-1 minimal promoter on Sp1 could be demonstrated by transient expression assays in the Sp1-deficient
Genome-wide analysis of regions similar to promoters of histone genes

KAUST Repository

Chowdhary, Rajesh

2010-05-28

Background: The purpose of this study is to: i) develop a computational model of promoters of human histone-encoding genes (shortly histone genes), an important class of genes that participate in various critical cellular processes, ii) use the model so developed to identify regions across the human genome that have similar structure as promoters of histone genes; such regions could represent potential genomic regulatory regions, e.g. promoters, of genes that may be coregulated with histone genes, and iii/ identify in this way genes that have high likelihood of being coregulated with the histone genes.Results: We successfully developed a histone promoter model using a comprehensive collection of histone genes. Based on leave-one-out cross-validation test, the model produced good prediction accuracy (94.1% sensitivity, 92.6% specificity, and 92.8% positive predictive value). We used this model to predict across the genome a number of genes that shared similar promoter structures with the histone gene promoters. We thus hypothesize that these predicted genes could be coregulated with histone genes. This hypothesis matches well with the available gene expression, gene ontology, and pathways data. Jointly with promoters of the above-mentioned genes, we found a large number of intergenic regions with similar structure as histone promoters.Conclusions: This study represents one of the most comprehensive computational analyses conducted thus far on a genome-wide scale of promoters of human histone genes. Our analysis suggests a number of other human genes that share a high similarity of promoter structure with the histone genes and thus are highly likely to be coregulated, and consequently coexpressed, with the histone genes. We also found that there are a large number of intergenic regions across the genome with their structures similar to promoters of histone genes. These regions may be promoters of yet unidentified genes, or may represent remote control regions that
Use of Linear Programming to Develop Cost-Minimized Nutritionally Adequate Health Promoting Food Baskets.

Science.gov (United States)

Parlesak, Alexandr; Tetens, Inge; Dejgård Jensen, Jørgen; Smed, Sinne; Gabrijelčič Blenkuš, Mojca; Rayner, Mike; Darmon, Nicole; Robertson, Aileen

2016-01-01

Food-Based Dietary Guidelines (FBDGs) are developed to promote healthier eating patterns, but increasing food prices may make healthy eating less affordable. The aim of this study was to design a range of cost-minimized nutritionally adequate health-promoting food baskets (FBs) that help prevent both micronutrient inadequacy and diet-related non-communicable diseases at lowest cost. Average prices for 312 foods were collected within the Greater Copenhagen area. The cost and nutrient content of five different cost-minimized FBs for a family of four were calculated per day using linear programming. The FBs were defined using five different constraints: cultural acceptability (CA), or dietary guidelines (DG), or nutrient recommendations (N), or cultural acceptability and nutrient recommendations (CAN), or dietary guidelines and nutrient recommendations (DGN). The variety and number of foods in each of the resulting five baskets was increased through limiting the relative share of individual foods. The one-day version of N contained only 12 foods at the minimum cost of DKK 27 (€ 3.6). The CA, DG, and DGN were about twice of this and the CAN cost ~DKK 81 (€ 10.8). The baskets with the greater variety of foods contained from 70 (CAN) to 134 (DGN) foods and cost between DKK 60 (€ 8.1, N) and DKK 125 (€ 16.8, DGN). Ensuring that the food baskets cover both dietary guidelines and nutrient recommendations doubled the cost while cultural acceptability (CAN) tripled it. Use of linear programming facilitates the generation of low-cost food baskets that are nutritionally adequate, health promoting, and culturally acceptable.
Enhancement of RNA synthesis by promoter duplication in tombusviruses

International Nuclear Information System (INIS)

Panavas, T.; Panaviene, Z.; Pogany, J.; Nagy, P.D.

2003-01-01

Replication of tombusviruses, small plus-strand RNA viruses of plants, is regulated by cis-acting elements present in the viral RNA. The role of cis-acting elements can be studied in vitro by using a partially purified RNA-dependent RNA polymerase (RdRp) preparation obtained from tombusvirus-infected plants , Virology 276, 279- 288). Here, we demonstrate that the minus-strand RNA of tombusviruses contains, in addition to the 3'-terminal minimal plus-strand initiation promoter, a second cis-acting element, termed the promoter proximal enhancer (PPE). The PPE element enhanced RNA synthesis by almost threefold from the adjacent minimal promoter in the in vitro assay. The sequence of the PPE element is 70% similar to the minimal promoter, suggesting that sequence duplication of the minimal promoter may have been the mechanism leading to the generation of the PPE. Consistent with this proposal, replacement of the PPE element with the minimal promoter, which resulted in a perfectly duplicated promoter region, preserved its enhancer-like function. In contrast, mutagenesis of the PPE element or its replacement with an artificial G/C-rich sequence abolished its stimulative effect on initiation of RNA synthesis in vitro. In vivo experiments are also consistent with the role of the PPE element in enhancement of tombusvirus replication. Sequence comparison of several tombusviruses and related carmoviruses further supports the finding that duplication of minimal promoter sequences may have been an important mechanism during the evolution of cis-acting elements in tombusviruses and related RNA viruses
A 310-bp minimal promoter mediates smooth muscle cell-specific expression of telokin.

Science.gov (United States)

Smith, A F; Bigsby, R M; Word, R A; Herring, B P

1998-05-01

A cell-specific promoter located in an intron of the smooth muscle myosin light chain kinase gene directs transcription of telokin exclusively in smooth muscle cells. Transgenic mice were generated in which a 310-bp rabbit telokin promoter fragment, extending from -163 to +147, was used to drive expression of simian virus 40 large T antigen. Smooth muscle-specific expression of the T-antigen transgene paralleled that of the endogenous telokin gene in all smooth muscle tissues except uterus. The 310-bp promoter fragment resulted in very low levels of transgene expression in uterus; in contrast, a transgene driven by a 2.4-kb fragment (-2250 to +147) resulted in high levels of transgene expression in uterine smooth muscle. Telokin expression levels correlate with the estrogen status of human myometrial tissues, suggesting that deletion of an estrogen response element (ERE) may account for the low levels of transgene expression driven by the 310-bp rabbit telokin promoter in uterine smooth muscle. Experiments in A10 smooth muscle cells directly showed that reporter gene expression driven by the 2.4-kb, but not 310-bp, promoter fragment could be stimulated two- to threefold by estrogen. This stimulation was mediated through an ERE located between -1447 and -1474. Addition of the ERE to the 310-bp fragment restored estrogen responsiveness in A10 cells. These data demonstrate that in addition to a minimal 310-bp proximal promoter at least one distal cis-acting regulatory element is required for telokin expression in uterine smooth muscle. The distal element may include an ERE between -1447 and -1474.
Identification and annotation of promoter regions in microbial

Indian Academy of Sciences (India)

2007-06-15

Jun 15, 2007 ... Analysis of various predicted structural properties of promoter regions in prokaryotic as well as eukaryotic genomes had earlier indicated that they have several common features, such as lower stability, higher curvature and less bendability, when compared with their neighboring regions. Based on the ...
Studies of genetic variability of the glucose transporter 2 promoter in patients with type 2 diabetes mellitus

DEFF Research Database (Denmark)

Møller, A M; Jensen, N M; Pildal, J

2001-01-01

This study was performed to test the hypothesis that genetic variation in the promoter of the glucose transporter 2 (GLUT2) might predispose to prediabetic phenotypes or type 2 diabetes. A total of 1611 bp comprising the minimal promoter region of the GLUT2 gene were examined by combined single-s......-tolerant subjects. In conclusion, we found no evidence supporting the hypothesis that genetic variability in the minimal promoter of the GLUT2 is associated with type 2 diabetes or prediabetic phenotypes in the Danish population.......This study was performed to test the hypothesis that genetic variation in the promoter of the glucose transporter 2 (GLUT2) might predispose to prediabetic phenotypes or type 2 diabetes. A total of 1611 bp comprising the minimal promoter region of the GLUT2 gene were examined by combined single...
Epigenetic transgenerational actions of vinclozolin on promoter regions of the sperm epigenome.

Directory of Open Access Journals (Sweden)

Carlos Guerrero-Bosagna

2010-09-01

Full Text Available Previous observations have demonstrated that embryonic exposure to the endocrine disruptor vinclozolin during gonadal sex determination promotes transgenerational adult onset disease such as male infertility, kidney disease, prostate disease, immune abnormalities and tumor development. The current study investigates genome-wide promoter DNA methylation alterations in the sperm of F3 generation rats whose F0 generation mother was exposed to vinclozolin. A methylated DNA immunoprecipitation with methyl-cytosine antibody followed by a promoter tilling microarray (MeDIP-Chip procedure was used to identify 52 different regions with statistically significant altered methylation in the sperm promoter epigenome. Mass spectrometry bisulfite analysis was used to map the CpG DNA methylation and 16 differential DNA methylation regions were confirmed, while the remainder could not be analyzed due to bisulfite technical limitations. Analysis of these validated regions identified a consensus DNA sequence (motif that associated with 75% of the promoters. Interestingly, only 16.8% of a random set of 125 promoters contained this motif. One candidate promoter (Fam111a was found to be due to a copy number variation (CNV and not a methylation change, suggesting initial alterations in the germline epigenome may promote genetic abnormalities such as induced CNV in later generations. This study identifies differential DNA methylation sites in promoter regions three generations after the initial exposure and identifies common genome features present in these regions. In addition to primary epimutations, a potential indirect genetic abnormality was identified, and both are postulated to be involved in the epigenetic transgenerational inheritance observed. This study confirms that an environmental agent has the ability to induce epigenetic transgenerational changes in the sperm epigenome.
Epigenetic transgenerational actions of vinclozolin on promoter regions of the sperm epigenome.

Science.gov (United States)

Guerrero-Bosagna, Carlos; Settles, Matthew; Lucker, Ben; Skinner, Michael K

2010-09-30

Previous observations have demonstrated that embryonic exposure to the endocrine disruptor vinclozolin during gonadal sex determination promotes transgenerational adult onset disease such as male infertility, kidney disease, prostate disease, immune abnormalities and tumor development. The current study investigates genome-wide promoter DNA methylation alterations in the sperm of F3 generation rats whose F0 generation mother was exposed to vinclozolin. A methylated DNA immunoprecipitation with methyl-cytosine antibody followed by a promoter tilling microarray (MeDIP-Chip) procedure was used to identify 52 different regions with statistically significant altered methylation in the sperm promoter epigenome. Mass spectrometry bisulfite analysis was used to map the CpG DNA methylation and 16 differential DNA methylation regions were confirmed, while the remainder could not be analyzed due to bisulfite technical limitations. Analysis of these validated regions identified a consensus DNA sequence (motif) that associated with 75% of the promoters. Interestingly, only 16.8% of a random set of 125 promoters contained this motif. One candidate promoter (Fam111a) was found to be due to a copy number variation (CNV) and not a methylation change, suggesting initial alterations in the germline epigenome may promote genetic abnormalities such as induced CNV in later generations. This study identifies differential DNA methylation sites in promoter regions three generations after the initial exposure and identifies common genome features present in these regions. In addition to primary epimutations, a potential indirect genetic abnormality was identified, and both are postulated to be involved in the epigenetic transgenerational inheritance observed. This study confirms that an environmental agent has the ability to induce epigenetic transgenerational changes in the sperm epigenome.
Unveiling DNA structural properties of promoter regions of ...

Indian Academy of Sciences (India)

Aditya Kumar

Unveiling DNA structural properties of promoter regions of prokaryotic transcriptome and their role in gene expression. Aditya Kumar. Assistant Professor. Molecular Biology & Biotechnology. Tezpur University. Tezpur – 784028, Assam ...

A var gene promoter implicated in severe malaria nucleates silencing and is regulated by 3' untranslated region and intronic cis-elements.

Science.gov (United States)

Muhle, Rebecca A; Adjalley, Sophie; Falkard, Brie; Nkrumah, Louis J; Muhle, Michael E; Fidock, David A

2009-11-01

Questions surround the mechanism of mutually exclusive expression by which Plasmodium falciparum mediates activation and silencing of var genes. These encode PfEMP1 proteins, which function as cytoadherent and immunomodulatory molecules at the surface of parasitised erythrocytes. Current evidence suggests that promoter silencing by var introns might play a key role in var gene regulation. To evaluate the impact of cis-acting regulatory regions on var silencing, we generated P. falciparum lines in which luciferase was placed under the control of an UpsA var promoter. By utilising the Bxb1 integrase system, these reporter cassettes were targeted to a genomic region that was not in apposition to var subtelomeric domains. This eliminated possible effects from surrounding telomeric elements and removed the variability inherent in episomal systems. Studies with highly synchronised parasites revealed that the UpsA element possessed minimal activity in comparison with a heterologous (hrp3) promoter. This may result from the integrated UpsA promoter being largely silenced by the neighbouring cg6 promoter. Our analyses also revealed that the DownsA 3' untranslated region further decreased the luciferase activity from both cassettes, whereas the var A intron repressed the UpsA promoter specifically. By applying multivariate analysis over the entire cell cycle, we confirmed the significance of these cis-elements and found the parasite stage to be the major factor regulating UpsA-promoter activity. Additionally, we observed that the UpsA promoter was capable of nucleating reversible silencing that spread to a downstream promoter. We believe these studies are the first to analyse promoter activity of Group A var genes, which have been implicated in severe malaria, and support the model that var introns can further suppress var expression. These data also suggest an important suppressive role for the DownsA terminator. Our findings imply the existence of multiple levels of var
Social Media Marketing as a tool for promoting the regional investment portals

Directory of Open Access Journals (Sweden)

Alisa Yu. Fadeyeva

2016-01-01

Full Text Available Objective to investigate the potential of Social Media Marketing as a tool for promoting regional investment portals in the information environment to identify the most effective ways of its implementation and to determine the level of mastering of this tool by the Russian regions. Methods general scientific methods observation comparison analysis induction deduction analogy classification. Results the analysis showed that today Social Media Marketing is an essential tool for interaction with the investment community and one of the most effective ways to promote the regional portal which allows to increase the knowledge of and loyalty to the brand to increase the targeted website traffic to increase the awareness of investors about the specific features of the portal and the regional development agenciesrsquo functioning to promptly receive information about the investment environment and to establish contacts with investors. At the same time the study of SMMactivity in the Russian regions revealed a very low level of quality of communication with investors through social networks. Scientific novelty for the first time the article investigates the significance and makes the comparative analysis of the Social Media Marketing channels with regard to investment promotion agencies as well as the results of the regional structures functioning for effective communication through social networks. Practical significance the main results of the research can be used by the regional investment agencies in order to promote their websites increase the quality of communication with investors and promote the investment attractiveness of the region as a whole. nbsp
9 CFR 93.436 - Ruminants from regions of minimal risk for BSE.

Science.gov (United States)

2010-01-01

... each animal's right hip, high on the tail-head (over the junction of the sacral and first cocygeal... 9 Animals and Animal Products 1 2010-01-01 2010-01-01 false Ruminants from regions of minimal risk for BSE. 93.436 Section 93.436 Animals and Animal Products ANIMAL AND PLANT HEALTH INSPECTION SERVICE...
MINIMIZING THE MHD POTENTIAL ENERGY FOR THE CURRENT HOLE REGION IN TOKAMAKS

International Nuclear Information System (INIS)

CHU, M.S; PARKS, P.B

2004-01-01

The current hole region in the tokamak has been observed to arise naturally during the development of internal transport barriers. The magnetohydrodynamic (MHD) potential energy in the current hole region is shown to be determined completely in terms of the displacements at the edge of the current hole. For modes with finite toroidal mode number n ≠ 0, the minimized potential energy is the same as if the current hole region were a vacuum region. For modes with toroidal mode number n = 0, the displacement is a superposition of three types of independent displacements: a vertical displacement or displacements that compress only the plasma or the toroidal field uniformly. Thus for ideal MHD perturbations of plasma with a current hole, the plasma behaves as if it were bordered by an extra ''internal vacuum region''. The relevance of the present work to computer simulations of plasma with a current hole region is also discussed
Minimizing the magnetohydrodynamic potential energy for the current hole region in tokamaks

International Nuclear Information System (INIS)

Chu, M.S.; Parks, P.B.

2004-01-01

The current hole region in the tokamak has been observed to arise naturally during the development of internal transport barriers. The magnetohydrodynamic (MHD) potential energy in the current hole region is shown to be determined completely in terms of the displacements at the edge of the current hole. For modes with finite toroidal mode number n≠0, the minimized potential energy is the same as if the current hole region were a vacuum region. For modes with toroidal mode number n=0, the displacement is a superposition of three types of independent displacements: a vertical displacement or displacements that compress only the plasma, or the toroidal field uniformly. Thus for ideal MHD perturbations of plasma with a current hole, the plasma behaves as if it were bordered by an extra ''internal vacuum region.'' The relevance of the present work to computer simulations of plasma with a current hole region is also discussed
A var gene promoter implicated in severe malaria nucleates silencing and is regulated by 3’ untranslated region and intronic cis-elements

Science.gov (United States)

Muhle, Rebecca A.; Adjalley, Sophie; Falkard, Brie; Nkrumah, Louis J.; Muhle, Michael E.; Fidock, David A.

2009-01-01

Questions surround the mechanism of mutually exclusive expression by which Plasmodium falciparum mediates activation and silencing of var genes. These encode PfEMP1 proteins, which function as cytoadherent and immunomodulatory molecules at the surface of parasitized erythrocytes. Current evidence suggests that promoter silencing by var introns might play a key role in var gene regulation. To evaluate the impact of cis-acting regulatory regions on var silencing, we generated P. falciparum lines in which luciferase was placed under the control of an UpsA var promoter. By utilizing the Bxb1 integrase system, these reporter cassettes were targeted to a genomic region that was not in apposition to var sub-telomeric domains. This eliminated possible effects from surrounding telomeric elements and removed the variability inherent in episomal systems. Studies with highly synchronized parasites revealed that the UpsA element possessed minimal activity in comparison with a heterologous (hrp3) promoter. This may well result from the integrated UpsA promoter being largely silenced by the neighboring cg6 promoter. Our analyses also revealed that the DownsA 3’ untranslated region further decreased the luciferase activity from both cassettes, whereas the var A intron repressed the UpsA promoter specifically. By applying multivariate analysis over the entire cell cycle, we confirmed the significance of these cis-elements and found the parasite stage to be the major factor regulating UpsA promoter activity. Additionally, we observed that the UpsA promoter was capable of nucleating reversible silencing that spread to a downstream promoter. We believe these studies are the first to analyze promoter activity of Group A var genes which have been implicated in severe malaria, and support the model that var introns can further suppress var expression. These data also suggest an important suppressive role for the DownsA terminator. Our findings imply the existence of multiple levels of
Identification and annotation of promoter regions in microbial ...

Indian Academy of Sciences (India)

PRAKASH KUMAR

2007-06-15

Jun 15, 2007 ... It remains important, not only to detect rarely expressed genes but also for ... well as in identifying genes associated with rRNA, tRNA and ... DNA stability; free energy calculation; promoter; upstream and downstream region.
Business networking for SMEs as a means to promote regional competitiveness: A Theoretical Framework

OpenAIRE

Vitor Braga

2004-01-01

The competitiveness of regions, as a means of promoting the competitiveness of a country as a whole, has been one of the main topics on the agenda of policy makers over the last decades. Several attempts at promoting competitiveness have been made with different degrees of success. In most cases, public investment in the regions was perceived as the solution to promote regional competitiveness and top-down policies were implemented. However, competitiveness also has an important dimension tha...
Analysis of tissue-specific region in sericin 1 gene promoter of Bombyx mori

Energy Technology Data Exchange (ETDEWEB)

Yan, Liu [College of Biomedical Engineering and Instrument Science, Zhejiang University, Hangzhou 310027 (China); Institute of Biochemistry and Cell Biology, Shanghai Institutes for Biological Sciences, Chinese Academy of Sciences, Shanghai 200031 (China); Lian, Yu [College of Biomedical Engineering and Instrument Science, Zhejiang University, Hangzhou 310027 (China); Zhejiang Province Key Laboratory of Preventive Veterinary Medicine, Institute of Preventive Veterinary Medicine, Zhejiang University, Hangzhou 310029 (China); Xiuyang, Guo [Institute of Biochemistry and Cell Biology, Shanghai Institutes for Biological Sciences, Chinese Academy of Sciences, Shanghai 200031 (China); Tingqing, Guo [Institute of Biochemistry and Cell Biology, Shanghai Institutes for Biological Sciences, Chinese Academy of Sciences, Shanghai 200031 (China); Shengpeng, Wang [Institute of Biochemistry and Cell Biology, Shanghai Institutes for Biological Sciences, Chinese Academy of Sciences, Shanghai 200031 (China); Changde, Lu [Institute of Biochemistry and Cell Biology, Shanghai Institutes for Biological Sciences, Chinese Academy of Sciences, Shanghai 200031 (China)

2006-03-31

The gene encoding sericin 1 (Ser1) of silkworm (Bombyx mori) is specifically expressed in the middle silk gland cells. To identify element involved in this transcription-dependent spatial restriction, truncation of the 5' terminal from the sericin 1 (Ser1) promoter is studied in vivo. A 209 bp DNA sequence upstream of the transcriptional start site (-586 to -378) is found to be responsible for promoting tissue-specific transcription. Analysis of this 209 bp region by overlapping deletion studies showed that a 25 bp region (-500 to -476) suppresses the ectopic expression of the Ser1 promoter. An unknown factor abundant in fat body nuclear extracts is shown to bind to this 25 bp fragment. These results suggest that this 25 bp region and the unknown factor are necessary for determining the tissue-specificity of the Ser1 promoter.
Perspectives on Promoting Regional Renewable Energy Research and Development

International Nuclear Information System (INIS)

Dresselhaus, M.

2008-01-01

Recent discussions at the Washington International Renewable Energy Conference (WIREC), hosted in March 2008 by the United States Government, with nearly 9000 participants including 103 ministers from 126 countries, concluded that a major acceleration in the adoption of renewable energy technologies was needed by mid-century. Because of different climatic conditions and societal preferences, regional cooperation is expected to play a major role in the efficient adoption of appropriate renewable energy technologies, and countries with special expertise in specific technologies seem eager to collaborate internationally to promote global goals in renewable energy. A review will be given of what we learned from this conference about renewable energy research and development strategies with a special focus given to using this basic knowledge base to promote the development of renewable energy technologies appropriate to specific regions of the world.(author)
Regional differences in gene expression and promoter usage in aged human brains

KAUST Repository

Pardo, Luba M.

2013-02-19

To characterize the promoterome of caudate and putamen regions (striatum), frontal and temporal cortices, and hippocampi from aged human brains, we used high-throughput cap analysis of gene expression to profile the transcription start sites and to quantify the differences in gene expression across the 5 brain regions. We also analyzed the extent to which methylation influenced the observed expression profiles. We sequenced more than 71 million cap analysis of gene expression tags corresponding to 70,202 promoter regions and 16,888 genes. More than 7000 transcripts were differentially expressed, mainly because of differential alternative promoter usage. Unexpectedly, 7% of differentially expressed genes were neurodevelopmental transcription factors. Functional pathway analysis on the differentially expressed genes revealed an overrepresentation of several signaling pathways (e.g., fibroblast growth factor and wnt signaling) in hippocampus and striatum. We also found that although 73% of methylation signals mapped within genes, the influence of methylation on the expression profile was small. Our study underscores alternative promoter usage as an important mechanism for determining the regional differences in gene expression at old age.
Growing Significance of EU Institutions in Promotion of Inter-regional policies

Directory of Open Access Journals (Sweden)

Ella V. Ermakova

2014-01-01

Full Text Available The article explores the variety of tools and vehicles applied within the EU to expand the prerogative of the regions of the EU member states. The author uses as an example the inter-regional policies in Belgium in respect of the Flemish Region and the Walloon Region. The author analyzes the mechanisms of promotion of external regional relations in Belgium as a means of addressing different problems both on national and all-European level, supporting the arguments and conclusions by examples of relevant EU initiatives. The article details the activities of the EU Regional Committee (RC, the EU advisory body with the powers of political initiative, upholding the principle ofsubsidarity in the implementation of the EU member states' regional policies. The involvement of the Flemish Region and the Walloon Region in the activities of EU RC is described and summarized. As a case study, the article deals with Belgium's rotating six months presidency in the EUin 2010 when the country, which was going through a severe political crisis with no federal government in place, was represented by the two regions. The special focus of the article is on the strategic EU program "Europe2020" and its implementation by the regions of Belgium. There is an account of the initiatives undertaken by the Flemish Region and the Walloon Region within the framework of this program outlining the interaction of the two regions. The author provides a comprehensive analysis of the involvement of the Flemish Region and the Walloon Region with various EU institutions describing how each party achieves the promotion of its regional interests. Within this context, it is a noteworthy development that the Flemish Region is participating in the international program "Pact 2020" on energy all by its own. The article features quotations by Flemish and Walloon political figures which serve as an illustration of the prevailing attitudes in the Belgian society to the process of
A prospective evaluation of first people's health promotion program design in the goulburn-murray rivers region.

Science.gov (United States)

Doyle, Joyce; Atkinson-Briggs, Sharon; Atkinson, Petah; Firebrace, Bradley; Calleja, Julie; Reilly, Rachel; Cargo, Margaret; Riley, Therese; Crumpen, Tui; Rowley, Kevin

2016-11-10

Aboriginal Community Controlled Organisations (ACCOs) provide community-focussed and culturally safe services for First Peoples in Australia, including crisis intervention and health promotion activities, in a holistic manner. The ecological model of health promotion goes some way towards describing the complexity of such health programs. The aims of this project were to: 1) identify the aims and purpose of existing health promotion programs conducted by an alliance of ACCOs in northern Victoria, Australia; and 2) evaluate the extent to which these programs are consistent with an ecological model of health promotion, addressing both individual and environmental determinants of health. The project arose from a long history of collaborative research. Three ACCOs and a university formed the Health Promotion Alliance to evaluate their health promotion programs. Local community members were trained in, and contributed to developing culturally sensitive methods for, data collection. Information on the aims and design of 88 health promotion activities making up 12 different programs across the ACCOs was systematically and prospectively collected. There was a wide range of activities addressing environmental and social determinants of health, as well as physical activity, nutrition and weight loss. The design of the great majority of activities had a minimal Western influence and were designed within a local Aboriginal cultural framework. The most common focus of the activities was social connectedness (76 %). Physical activity was represented in two thirds of the activities, and nutrition, weight loss and culture were each a focus of about half of the activities. A modified coding procedure designed to assess the ecological nature of these programs showed that they recruited from multiple settings; targeted a range of individual, social and environmental determinants; and used numerous and innovative strategies to achieve change. First Peoples' health promotion in the
Waste minimization for commercial radioactive materials users generating low-level radioactive waste

International Nuclear Information System (INIS)

Fischer, D.K.; Gitt, M.; Williams, G.A.; Branch, S.; Otis, M.D.; McKenzie-Carter, M.A.; Schurman, D.L.

1991-07-01

The objective of this document is to provide a resource for all states and compact regions interested in promoting the minimization of low-level radioactive waste (LLW). This project was initiated by the Commonwealth of Massachusetts, and Massachusetts waste streams have been used as examples; however, the methods of analysis presented here are applicable to similar waste streams generated elsewhere. This document is a guide for states/compact regions to use in developing a system to evaluate and prioritize various waste minimization techniques in order to encourage individual radioactive materials users (LLW generators) to consider these techniques in their own independent evaluations. This review discusses the application of specific waste minimization techniques to waste streams characteristic of three categories of radioactive materials users: (1) industrial operations using radioactive materials in the manufacture of commercial products, (2) health care institutions, including hospitals and clinics, and (3) educational and research institutions. Massachusetts waste stream characterization data from key radioactive materials users in each category are used to illustrate the applicability of various minimization techniques. The utility group is not included because extensive information specific to this category of LLW generators is available in the literature
A composite method based on formal grammar and DNA structural features in detecting human polymerase II promoter region.

Directory of Open Access Journals (Sweden)

Sutapa Datta

Full Text Available An important step in understanding gene regulation is to identify the promoter regions where the transcription factor binding takes place. Predicting a promoter region de novo has been a theoretical goal for many researchers for a long time. There exists a number of in silico methods to predict the promoter region de novo but most of these methods are still suffering from various shortcomings, a major one being the selection of appropriate features of promoter region distinguishing them from non-promoters. In this communication, we have proposed a new composite method that predicts promoter sequences based on the interrelationship between structural profiles of DNA and primary sequence elements of the promoter regions. We have shown that a Context Free Grammar (CFG can formalize the relationships between different primary sequence features and by utilizing the CFG, we demonstrate that an efficient parser can be constructed for extracting these relationships from DNA sequences to distinguish the true promoter sequences from non-promoter sequences. Along with CFG, we have extracted the structural features of the promoter region to improve upon the efficiency of our prediction system. Extensive experiments performed on different datasets reveals that our method is effective in predicting promoter sequences on a genome-wide scale and performs satisfactorily as compared to other promoter prediction techniques.
A Composite Method Based on Formal Grammar and DNA Structural Features in Detecting Human Polymerase II Promoter Region

Science.gov (United States)

Datta, Sutapa; Mukhopadhyay, Subhasis

2013-01-01

An important step in understanding gene regulation is to identify the promoter regions where the transcription factor binding takes place. Predicting a promoter region de novo has been a theoretical goal for many researchers for a long time. There exists a number of in silico methods to predict the promoter region de novo but most of these methods are still suffering from various shortcomings, a major one being the selection of appropriate features of promoter region distinguishing them from non-promoters. In this communication, we have proposed a new composite method that predicts promoter sequences based on the interrelationship between structural profiles of DNA and primary sequence elements of the promoter regions. We have shown that a Context Free Grammar (CFG) can formalize the relationships between different primary sequence features and by utilizing the CFG, we demonstrate that an efficient parser can be constructed for extracting these relationships from DNA sequences to distinguish the true promoter sequences from non-promoter sequences. Along with CFG, we have extracted the structural features of the promoter region to improve upon the efficiency of our prediction system. Extensive experiments performed on different datasets reveals that our method is effective in predicting promoter sequences on a genome-wide scale and performs satisfactorily as compared to other promoter prediction techniques. PMID:23437045
Characterization of the promoter region of the human c-erbB-2 protooncogene

International Nuclear Information System (INIS)

Ishii, S.; Imamoto, F.; Yamanashi, Y.; Toyoshima, K.; Yamamoto, T.

1987-01-01

Three overlapping genomic clones that contain the 5'-terminal portion of the human c-erbB-2 gene (ERBB2) were isolated. The promoter region was identified by nuclease S1 mapping with c-erbB-2 mRNA. Seven transcriptional start sites were identified. DNA sequence analysis showed that the promoter region contains a TATA box and a CAAT box about 30 and 80 base pairs (bp), respectively, upstream of the most downstream RNA initiation site. Two putative binding sites for transcription factor Sp1 were identified about 50 and 110 bp upstream of the CAAT box, and six GGA repeats were found between the CAAT box and the TATA box. This region had strong promoter activity when placed upstream of the bacterial chloramphenicol acetyltransferase gene and transfected into monkey CV-1 cells. These data indicate that the promoter of the human c-erbB-2 protooncogene is different from that of the protooncogene c-erbB-1 (epidermal growth factor receptor gene), which does not contain either a TATA box or a CAAT box. Comparison of the promoter sequences and activities of the two protooncogenes should be helpful in analysis of the regulatory mechanism of expression of their gene products, which are growth-factor receptors
A prospective evaluation of first people’s health promotion program design in the goulburn-murray rivers region

Directory of Open Access Journals (Sweden)

Joyce Doyle

2016-11-01

Full Text Available Abstract Background Aboriginal Community Controlled Organisations (ACCOs provide community-focussed and culturally safe services for First Peoples in Australia, including crisis intervention and health promotion activities, in a holistic manner. The ecological model of health promotion goes some way towards describing the complexity of such health programs. The aims of this project were to: 1 identify the aims and purpose of existing health promotion programs conducted by an alliance of ACCOs in northern Victoria, Australia; and 2 evaluate the extent to which these programs are consistent with an ecological model of health promotion, addressing both individual and environmental determinants of health. Methods The project arose from a long history of collaborative research. Three ACCOs and a university formed the Health Promotion Alliance to evaluate their health promotion programs. Local community members were trained in, and contributed to developing culturally sensitive methods for, data collection. Information on the aims and design of 88 health promotion activities making up 12 different programs across the ACCOs was systematically and prospectively collected. Results There was a wide range of activities addressing environmental and social determinants of health, as well as physical activity, nutrition and weight loss. The design of the great majority of activities had a minimal Western influence and were designed within a local Aboriginal cultural framework. The most common focus of the activities was social connectedness (76 %. Physical activity was represented in two thirds of the activities, and nutrition, weight loss and culture were each a focus of about half of the activities. A modified coding procedure designed to assess the ecological nature of these programs showed that they recruited from multiple settings; targeted a range of individual, social and environmental determinants; and used numerous and innovative strategies to
Selection for Unequal Densities of Sigma70 Promoter-like Signalsin Different Regions of Large Bacterial Genomes

Energy Technology Data Exchange (ETDEWEB)

Huerta, Araceli M.; Francino, M. Pilar; Morett, Enrique; Collado-Vides, Julio

2006-03-01

The evolutionary processes operating in the DNA regions that participate in the regulation of gene expression are poorly understood. In Escherichia coli, we have established a sequence pattern that distinguishes regulatory from nonregulatory regions. The density of promoter-like sequences, that are recognizable by RNA polymerase and may function as potential promoters, is high within regulatory regions, in contrast to coding regions and regions located between convergently-transcribed genes. Moreover, functional promoter sites identified experimentally are often found in the subregions of highest density of promoter-like signals, even when individual sites with higher binding affinity for RNA polymerase exist elsewhere within the regulatory region. In order to investigate the generality of this pattern, we have used position weight matrices describing the -35 and -10 promoter boxes of E. coli to search for these motifs in 43 additional genomes belonging to most established bacterial phyla, after specific calibration of the matrices according to the base composition of the noncoding regions of each genome. We have found that all bacterial species analyzed contain similar promoter-like motifs, and that, in most cases, these motifs follow the same genomic distribution observed in E. coli. Differential densities between regulatory and nonregulatory regions are detectable in most bacterial genomes, with the exception of those that have experienced evolutionary extreme genome reduction. Thus, the phylogenetic distribution of this pattern mirrors that of genes and other genomic features that require weak selection to be effective in order to persist. On this basis, we suggest that the loss of differential densities in the reduced genomes of host-restricted pathogens and symbionts is the outcome of a process of genome degradation resulting from the decreased efficiency of purifying selection in highly structured small populations. This implies that the differential
Mechanosensitive promoter region in the human HB-GAM gene

DEFF Research Database (Denmark)

Liedert, Astrid; Kassem, Moustapha; Claes, Lutz

2009-01-01

Mechanical loading is essential for maintaining bone mass in the adult skeleton. However, the underlying process of the transfer of the physical stimulus into a biochemical response, which is termed mechanotransduction is poorly understood. Mechanotransduction results in the modulation of gene...... cells. Analysis of the human HB-GAM gene upstream regulatory region with luciferase reporter gene assays revealed that the upregulation of HB-GAM expression occurred at the transcriptional level and was mainly dependent on the HB-GAM promoter region most upstream containing three potential AP-1 binding...

Identification of a single-nucleotide insertion in the promoter region affecting the sodC promoter activity in Brucella neotomae.

Directory of Open Access Journals (Sweden)

Dina A Moustafa

Full Text Available Brucella neotomae is not known to be associated with clinical disease in any host species. Previous research suggested that B. neotomae might not express detectable levels of Cu/Zn superoxide dismutase (SOD, a periplasmic enzyme known to be involved in protecting Brucella from oxidative bactericidal effects of host phagocytes. This study was undertaken to investigate the genetic basis for the disparity in SOD expression in B. neotomae. Our Western blot and SOD enzyme assay analyses indicated that B. neotomae does express SOD, but at a substantially reduced level. Nucleotide sequence analysis of region upstream to the sodC gene identified a single-nucleotide insertion in the potential promoter region. The same single-nucleotide insertion was also detected in the sodC promoter of B. suis strain Thomsen, belonging to biovar 2 in which SOD expression was undetectable previously. Examination of the sodC promoter activities using translational fusion constructs with E. coli β-galactosidase demonstrated that the B. neotomae and B. suis biovar 2 promoters were very weak in driving gene expression. Site-directed mutation studies indicated that the insertion of A in the B. neotomae sodC promoter reduced the promoter activity. Increasing the level of SOD expression in B. neotomae through complementation with B. abortus sodC gene did not alter the bacterial survival in J774A.1 macrophage-like cells and in tissues of BALB/c and C57BL/6 mice. These results for the first time demonstrate the occurrence of a single-nucleotide polymorphism affecting promoter function and gene expression in Brucella.
Clinical significance of promoter region hypermethylation of microRNA-148a in gastrointestinal cancers

Directory of Open Access Journals (Sweden)

Sun JX

2014-05-01

Full Text Available Jingxu Sun,1,* Yongxi Song,1,* Zhenning Wang,1 Guoli Wang,2 Peng Gao,1 Xiaowan Chen,1 Zhaohua Gao,1 Huimian Xu1 1Department of Surgical Oncology and General Surgery, First Hospital of China Medical University, Shenyang, People’s Republic of China; 2Department of Biochemistry and Molecular Biology, China Medical University, Shenyang, People’s Republic of China *These authors contributed equally to this work Background: MicroRNAs are associated with tumor genesis and progression in various carcinomas. MicroRNA-148a (miR-148a was reported to have low expression in gastrointestinal cancers, and might be regulated by promoter region DNA methylation. Methods: Bisulfite-modified sequencing was used to determine the promoter region DNA methylation status of human gastrointestinal cancer cell lines. Expression levels of miR-148a in cell lines treated with 5-aza-2′-deoxycytidine were determined by quantitative real-time polymerase chain reaction. Total DNA was extracted from the tissues of 64 patients with gastric cancer and 51 patients with colorectal cancer. Methylation status was determined by methylation-specific polymerase chain reaction. All statistical analyses were performed with SPSS 17.0 software. Results: The promoter regions of genes in human gastrointestinal cancer cell lines were all hypermethylated, except for HT-29, and the expression of miR-148a tended to be higher than in controls after treatment with 5-aza-2′-deoxycytidine. The methylation-specific polymerase chain reaction results showed that 56.25% of gastric cancer tissues and 19.61% of colorectal cancer tissues were hypermethylated. A strong correlation was found between the expression of miR-148a and the methylation status of promoter regions (P<0.001, chi-square test and Pearson’s correlation. Furthermore, promoter region CpG site hypermethylation of miR-148a was correlated with increased tumor size (P=0.01 in gastric cancer after analyzing the correlation between
Brand Products of Regional Cuisine in the Promotion of Tourism in Roztocze

Directory of Open Access Journals (Sweden)

Bekier-Jaworska Ewa

2015-03-01

Full Text Available Introduction. There has been a trend over the last few years of using specialties of regional cuisine as an independent tourist attraction. The creation of local brands is an important element in the promotion of a given region and it also influences the development of culinary tourism. The aim of the studies conducted was to identify regional dishes - a choice of dishes that could be described as 'brand dishes' and the use of those dishes as tourist attractions in Roztocze. Material and methods. Studies were conducted on a group of students studying tourism and recreation at State Higher School of Vocational Education (PWSZ in Zamość using a questionnaire. Results. The questionnaire provided an assessment of the levels of knowledge of regional cuisine among Polish and Ukrainian students, identified the most characteristic dishes and selected brand products, and helped to arrive at a suitable method of promotion. Conclusions. Nationality, family customs and selection of local restaurants highly influence knowledge of regional cuisine. Interviewees decided that the most outstanding products from Roztocze were Zwierzyniec beer, and Biłgoraj pie. Regional products should be used as a tourist attraction in Roztocze.
Fine-tuning of protein domain boundary by minimizing potential coiled coil regions

International Nuclear Information System (INIS)

Iwaya, Naoko; Goda, Natsuko; Unzai, Satoru; Fujiwara, Kenichiro; Tanaka, Toshiki; Tomii, Kentaro; Tochio, Hidehito; Shirakawa, Masahiro; Hiroaki, Hidekazu

2007-01-01

Structural determination of individual protein domains isolated from multidomain proteins is a common approach in the post-genomic era. Novel and thus uncharacterized domains liberated from intact proteins often self-associate due to incorrectly defined domain boundaries. Self-association results in missing signals, poor signal dispersion and a low signal-to-noise ratio in 1 H- 15 N HSQC spectra. We have found that a putative, non-canonical coiled coil region close to a domain boundary can cause transient hydrophobic self-association and monomer-dimer equilibrium in solution. Here we propose a rational method to predict putative coiled coil regions adjacent to the globular core domain using the program COILS. Except for the amino acid sequence, no preexisting knowledge concerning the domain is required. A small number of mutant proteins with a minimized coiled coil region have been rationally designed and tested. The engineered domains exhibit decreased self-association as assessed by 1 H- 15 N HSQC spectra with improved peak dispersion and sharper cross peaks. Two successful examples of isolating novel N-terminal domains from AAA-ATPases are demonstrated. Our method is useful for the experimental determination of domain boundaries suited for structural genomics studies
Fine-tuning of protein domain boundary by minimizing potential coiled coil regions.

Science.gov (United States)

Iwaya, Naoko; Goda, Natsuko; Unzai, Satoru; Fujiwara, Kenichiro; Tanaka, Toshiki; Tomii, Kentaro; Tochio, Hidehito; Shirakawa, Masahiro; Hiroaki, Hidekazu

2007-01-01

Structural determination of individual protein domains isolated from multidomain proteins is a common approach in the post-genomic era. Novel and thus uncharacterized domains liberated from intact proteins often self-associate due to incorrectly defined domain boundaries. Self-association results in missing signals, poor signal dispersion and a low signal-to-noise ratio in (1)H-(15)N HSQC spectra. We have found that a putative, non-canonical coiled coil region close to a domain boundary can cause transient hydrophobic self-association and monomer-dimer equilibrium in solution. Here we propose a rational method to predict putative coiled coil regions adjacent to the globular core domain using the program COILS. Except for the amino acid sequence, no preexisting knowledge concerning the domain is required. A small number of mutant proteins with a minimized coiled coil region have been rationally designed and tested. The engineered domains exhibit decreased self-association as assessed by (1)H-(15)N HSQC spectra with improved peak dispersion and sharper cross peaks. Two successful examples of isolating novel N-terminal domains from AAA-ATPases are demonstrated. Our method is useful for the experimental determination of domain boundaries suited for structural genomics studies.
Identification of functional DNA variants in the constitutive promoter region of MDM2

Directory of Open Access Journals (Sweden)

Lalonde Marie-Eve

2012-09-01

Full Text Available Abstract Although mutations in the oncoprotein murine double minute 2 (MDM2 are rare, MDM2 gene overexpression has been observed in several human tumors. Given that even modest changes in MDM2 levels might influence the p53 tumor suppressor signaling pathway, we postulated that sequence variation in the promoter region of MDM2 could lead to disregulated expression and variation in gene dosage. Two promoters have been reported for MDM2; an internal promoter (P2, which is located near the end of intron 1 and is p53-responsive, and an upstream constitutive promoter (P1, which is p53-independent. Both promoter regions contain DNA variants that could influence the expression levels of MDM2, including the well-studied single nucleotide polymorphism (SNP SNP309, which is located in the promoter P2; i.e., upstream of exon 2. In this report, we screened the promoter P1 for DNA variants and assessed the functional impact of the corresponding SNPs. Using the dbSNP database and genotyping validation in individuals of European descent, we identified three common SNPs (−1494 G > A; indel 40 bp; and −182 C > G. Three major promoter haplotypes were inferred by using these three promoter SNPs together with rs2279744 (SNP309. Following subcloning into a gene reporter system, we found that two of the haplotypes significantly influenced MDM2 promoter activity in a haplotype-specific manner. Site-directed mutagenesis experiments indicated that the 40 bp insertion/deletion variation is causing the observed allelic promoter activity. This study suggests that part of the variability in the MDM2 expression levels could be explained by allelic p53-independent P1 promoter activity.
Minimally processed fruit salad enriched with Lactobacillus ...

African Journals Online (AJOL)

paula

2015-06-17

Jun 17, 2015 ... Minimal processing promotes browning of some vegetal tissues due to cell membrane disruption, which results in the release of oxidative enzymes. This study evaluated the efficiency of citric acid, ascorbic acid, sodium metabisulfite and L-cysteine hydrochloride to retard enzymatic browning of minimally.
Minimally processed fruit salad enriched with Lactobacillus ...

African Journals Online (AJOL)

Minimal processing promotes browning of some vegetal tissues due to cell membrane disruption, which results in the release of oxidative enzymes. This study evaluated the efficiency of citric acid, ascorbic acid, sodium metabisulfite and L-cysteine hydrochloride to retard enzymatic browning of minimally processed fruit ...
Natural selection in a population of Drosophila melanogaster explained by changes in gene expression caused by sequence variation in core promoter regions.

Science.gov (United States)

Sato, Mitsuhiko P; Makino, Takashi; Kawata, Masakado

2016-02-09

Understanding the evolutionary forces that influence variation in gene regulatory regions in natural populations is an important challenge for evolutionary biology because natural selection for such variations could promote adaptive phenotypic evolution. Recently, whole-genome sequence analyses have identified regulatory regions subject to natural selection. However, these studies could not identify the relationship between sequence variation in the detected regions and change in gene expression levels. We analyzed sequence variations in core promoter regions, which are critical regions for gene regulation in higher eukaryotes, in a natural population of Drosophila melanogaster, and identified core promoter sequence variations associated with differences in gene expression levels subjected to natural selection. Among the core promoter regions whose sequence variation could change transcription factor binding sites and explain differences in expression levels, three core promoter regions were detected as candidates associated with purifying selection or selective sweep and seven as candidates associated with balancing selection, excluding the possibility of linkage between these regions and core promoter regions. CHKov1, which confers resistance to the sigma virus and related insecticides, was identified as core promoter regions that has been subject to selective sweep, although it could not be denied that selection for variation in core promoter regions was due to linked single nucleotide polymorphisms in the regulatory region outside core promoter regions. Nucleotide changes in core promoter regions of CHKov1 caused the loss of two basal transcription factor binding sites and acquisition of one transcription factor binding site, resulting in decreased gene expression levels. Of nine core promoter regions regions associated with balancing selection, brat, and CG9044 are associated with neuromuscular junction development, and Nmda1 are associated with learning
DOF-binding sites additively contribute to guard cell-specificity of AtMYB60 promoter

Directory of Open Access Journals (Sweden)

Cominelli Eleonora

2011-11-01

Full Text Available Abstract Background We previously demonstrated that the Arabidopsis thaliana AtMYB60 protein is an R2R3MYB transcription factor required for stomatal opening. AtMYB60 is specifically expressed in guard cells and down-regulated at the transcriptional levels by the phytohormone ABA. Results To investigate the molecular mechanisms governing AtMYB60 expression, its promoter was dissected through deletion and mutagenesis analyses. By studying different versions of AtMYB60 promoter::GUS reporter fusions in transgenic plants we were able to demonstrate a modular organization for the AtMYB60 promoter. Particularly we defined: a minimal promoter sufficient to confer guard cell-specific activity to the reporter gene; the distinct roles of different DOF-binding sites organised in a cluster in the minimal promoter in determining guard cell-specific expression; the promoter regions responsible for the enhancement of activity in guard cells; a promoter region responsible for the negative transcriptional regulation by ABA. Moreover from the analysis of single and multiple mutants we could rule out the involvement of a group of DOF proteins, known as CDFs, already characterised for their involvement in flowering time, in the regulation of AtMYB60 expression. Conclusions These findings shed light on the regulation of gene expression in guard cells and provide new promoter modules as useful tools for manipulating gene expression in guard cells, both for physiological studies and future biotechnological applications.
Waste Minimization Measurement and Progress Reporting

International Nuclear Information System (INIS)

Stone, K.A.

1995-01-01

Westinghouse Savannah River Company is implementing productivity improvement concepts into the Waste Minimization Program by focusing on the positive initiatives taken to reduce waste generation at the Savannah River Site. Previous performance measures, based only on waste generation rates, proved to be an ineffective metric for measuring performance and promoting continuous improvements within the Program. Impacts of mission changes and non-routine operations impeded development of baseline waste generation rates and often negated waste generation trending reports. A system was developed to quantify, document and track innovative activities that impact waste volume and radioactivity/toxicity reductions. This system coupled with Management-driven waste disposal avoidance goals is proving to be a powerful tool to promote waste minimization awareness and the implementation of waste reduction initiatives. Measurement of waste not generated, in addition to waste generated, increases the credibility of the Waste Minimization Program, improves sharing of success stories, and supports development of regulatory and management reports
Genome-wide function of H2B ubiquitylation in promoter and genic regions.

Science.gov (United States)

Batta, Kiran; Zhang, Zhenhai; Yen, Kuangyu; Goffman, David B; Pugh, B Franklin

2011-11-01

Nucleosomal organization in and around genes may contribute substantially to transcriptional regulation. The contribution of histone modifications to genome-wide nucleosomal organization has not been systematically evaluated. In the present study, we examine the role of H2BK123 ubiquitylation, a key regulator of several histone modifications, on nucleosomal organization at promoter, genic, and transcription termination regions in Saccharomyces cerevisiae. Using high-resolution MNase chromatin immunoprecipitation and sequencing (ChIP-seq), we map nucleosome positioning and occupancy in mutants of the H2BK123 ubiquitylation pathway. We found that H2B ubiquitylation-mediated nucleosome formation and/or stability inhibits the assembly of the transcription machinery at normally quiescent promoters, whereas ubiquitylation within highly active gene bodies promotes transcription elongation. This regulation does not proceed through ubiquitylation-regulated histone marks at H3K4, K36, and K79. Our findings suggest that mechanistically similar functions of H2B ubiquitylation (nucleosome assembly) elicit different functional outcomes on genes depending on its positional context in promoters (repressive) versus transcribed regions (activating).
Use of porous silicon to minimize oxidation induced stacking fault defects in silicon

International Nuclear Information System (INIS)

Shieh, S.Y.; Evans, J.W.

1992-01-01

This paper presents methods for minimizing stacking fault defects, generated during oxidation of silicon, include damaging the back of the wafer or depositing poly-silicon on the back. In either case a highly defective structure is created and this is capable of gettering either self-interstitials or impurities which promote nucleation of stacking fault defects. A novel method of minimizing these defects is to form a patch of porous silicon on the back of the wafer by electrochemical etching. Annealing under inert gas prior to oxidation may then result in the necessary gettering. Experiments were carried out in which wafers were subjected to this treatment. Subsequent to oxidation, the wafers were etched to remove oxide and reveal defects. The regions of the wafer adjacent to the porous silicon patch were defect-free, whereas remote regions had defects. Deep level transient spectroscopy has been used to examine the gettering capability of porous silicon, and the paper discusses the mechanism by which the porous silicon getters
The promotion of regional integration of electricity markets: Lessons for developing countries

International Nuclear Information System (INIS)

Oseni, Musiliu O.; Pollitt, Michael G.

2016-01-01

This paper focuses on how to promote regional cooperation in electricity. We begin by discussing the theory of international trade cooperation in electricity, with a view to discussing what preconditions might be important in facilitating wide area trading across national borders. We then develop lessons based on the comparison of four case studies. These include three regional developing country power pools – the Southern African Power pool (SAPP), West African Power pool (WAPP) and the Central American Power Market (MER). We contrast these with Northern Europe's Nord Pool. These cases highlight both the potential and difficulty of having cross-jurisdictional power pools. In the light of the theory and evidence we present, we draw key lessons in the areas of: preconditions for trading; necessary institutional arrangements; practicalities of timetabling; reasons to be hopeful about future prospects. - Highlights: • This paper focuses on how to promote regional electricity cooperation. • We develop lessons based on comparison of four international case studies. • The cases highlight both the potential and difficulty of power pools. • We identify preconditions, institutional arrangements and timetabling. • We conclude that the future prospects for regional power pools are good.
Production of infectious chimeric hepatitis C virus genotype 2b harboring minimal regions of JFH-1.

Science.gov (United States)

Murayama, Asako; Kato, Takanobu; Akazawa, Daisuke; Sugiyama, Nao; Date, Tomoko; Masaki, Takahiro; Nakamoto, Shingo; Tanaka, Yasuhito; Mizokami, Masashi; Yokosuka, Osamu; Nomoto, Akio; Wakita, Takaji

2012-02-01

To establish a cell culture system for chimeric hepatitis C virus (HCV) genotype 2b, we prepared a chimeric construct harboring the 5' untranslated region (UTR) to the E2 region of the MA strain (genotype 2b) and the region of p7 to the 3' UTR of the JFH-1 strain (genotype 2a). This chimeric RNA (MA/JFH-1.1) replicated and produced infectious virus in Huh7.5.1 cells. Replacement of the 5' UTR of this chimera with that from JFH-1 (MA/JFH-1.2) enhanced virus production, but infectivity remained low. In a long-term follow-up study, we identified a cell culture-adaptive mutation in the core region (R167G) and found that it enhanced virus assembly. We previously reported that the NS3 helicase (N3H) and the region of NS5B to 3' X (N5BX) of JFH-1 enabled replication of the J6CF strain (genotype 2a), which could not replicate in cells. To reduce JFH-1 content in MA/JFH-1.2, we produced a chimeric viral genome for MA harboring the N3H and N5BX regions of JFH-1, combined with a JFH-1 5' UTR replacement and the R167G mutation (MA/N3H+N5BX-JFH1/R167G). This chimeric RNA replicated efficiently, but virus production was low. After the introduction of four additional cell culture-adaptive mutations, MA/N3H+N5BX-JFH1/5am produced infectious virus efficiently. Using this chimeric virus harboring minimal regions of JFH-1, we analyzed interferon sensitivity and found that this chimeric virus was more sensitive to interferon than JFH-1 and another chimeric virus containing more regions from JFH-1 (MA/JFH-1.2/R167G). In conclusion, we established an HCV genotype 2b cell culture system using a chimeric genome harboring minimal regions of JFH-1. This cell culture system may be useful for characterizing genotype 2b viruses and developing antiviral strategies.
Gel shift analysis of the empA promoter region in Vibrio anguillarum

Directory of Open Access Journals (Sweden)

Denkin Steven M

2004-10-01

Full Text Available Abstract Background The induction of metalloprotease encoded by empA in Vibrio anguillarum occurs at high cell density in salmon intestinal mucus. Previously we have shown that there are significant differences in empA expression in two strains of V. anguillarum, M93Sm and NB10. It is hypothesized that differences in empA regulation are due to differences in binding of regulatory elements. Results Two strains of V. anguillarum, M93Sm and NB10, were examined and compared for the presence of DNA regulatory proteins that bind to and control the empA promoter region. Gel mobility shift assays, using a digoxigenin (DIG-labeled oligomer containing a lux box-like element and the promoter for empA, were done to demonstrate the presence of a DNA-binding protein. Protein extracts from NB10 cells incubated in Luria Bertani broth + 2% NaCl (LB20, nine salts solution + 200 μg/ml mucus (NSSM, 3M (marine minimal medium, or NSS resulted in a gel mobility shift. No gel mobility shift was seen when protein extracts from either LB20- or NSSM-grown M93Sm cells were mixed with the DIG-labeled empA oligomer. The azocasein assay detected protease activity in all incubation conditions for NB10 culture supernatants. In contrast, protease activity was detected in M93Sm culture supernatants only when incubated in NSSM. Since the luxR homologue in V. anguillarum, vanT, has been cloned, sequenced, and shown to be required for protease activity, we wanted to determine if vanT mutants of NB10 exhibit the same gel shift observed in the wild-type. Site-directed mutagenesis was used to create vanT mutants in V. anguillarum M93Sm and NB10 to test whether VanT is involved with the gel mobility shift. Both vanT mutants, M02 and NB02, did not produce protease activity in any conditions. However, protein extracts from NB02 incubated in each condition still exhibited a gel shift when mixed with the DIG-labeled empA oligomer. Conclusions The data demonstrate that protein extracts of V
Study on the binding sites of radiosensitivity associated transcription factor in the promoter region of Ier5 gene

International Nuclear Information System (INIS)

Cui Wei; Yin Lingling; Dong Lingyue

2012-01-01

Objective: To clarify the mechanism of immediate early response gene 5 (Ier5) transcription induced by radiation. Methods: Deletant construction, site-specific mutagenesis,electrophoretic mobility shift assay (EMSA) and chromatin immunoprecipitation (ChIP) were used to forecast the promoter region, binding sites and transcription factors of Ier5 gene in HeLa cells. Results: The promoter region of Ier5 gene might be in the region of Ier5 -8 deletant (-408 - -238 bp). The Ier5 gene had two transcription factors of GCF and NFI, and GCF had two binding sites located in the region of -388 - -382 bp and -274 - -270 bp of Ier5 promoter. The binding site of NFI was located in -362 - -357 bp of Ier5 promoter. GCF could inhibit the expression of Ier5 gene and this inhibition was diminished when the radiation dose increased. In contrast, NFI increased the expression of Ier5. Conclusions: The most possible region of Ier5 promoter is from -408 to -238 bp which has two binding sites for the radiosensitivity transcription factors of GCF and NFI that could negatively and positively regulate the expression of Ier5 respectively. (authors)
DNA Methylation Analysis of BRD1 Promoter Regions and the Schizophrenia rs138880 Risk Allele.

Directory of Open Access Journals (Sweden)

Mads Dyrvig

Full Text Available The bromodomain containing 1 gene, BRD1 is essential for embryogenesis and CNS development. It encodes a protein that participates in histone modifying complexes and thereby regulates the expression of a large number of genes. Genetic variants in the BRD1 locus show association with schizophrenia and bipolar disorder and risk alleles in the promoter region correlate with reduced BRD1 expression. Insights into the transcriptional regulation of BRD1 and the pathogenic mechanisms associated with BRD1 risk variants, however, remain sparse. By studying transcripts in human HeLa and SH-SY5Y cells we provide evidence for differences in relative expression of BRD1 transcripts with three alternative 5' UTRs (exon 1C, 1B, and 1A. We further show that expression of these transcript variants covaries negatively with DNA methylation proportions in their upstream promoter regions suggesting that promoter usage might be regulated by DNA methylation. In line with findings that the risk allele of the rs138880 SNP in the BRD1 promoter region correlates with reduced BRD1 expression, we find that it is also associated with moderate regional BRD1 promoter hypermethylation in both adipose tissue and blood. Importantly, we demonstrate by inspecting available DNA methylation and expression data that these regions undergo changes in methylation during fetal brain development and that differences in their methylation proportions in fetal compared to postnatal frontal cortex correlate significantly with BRD1 expression. These findings suggest that BRD1 may be dysregulated in both the developing and mature brain of risk allele carriers. Finally, we demonstrate that commonly used mood stabilizers Lithium, Valproate, and Carbamazepine affect the expression of BRD1 in SH-SY5Y cells. Altogether this study indicates a link between genetic risk and epigenetic dysregulation of BRD1 which raises interesting perspectives for targeting the mechanisms pharmacologically.
Efficient construction of an inverted minimal H1 promoter driven siRNA expression cassette: facilitation of promoter and siRNA sequence exchange.

Directory of Open Access Journals (Sweden)

Hoorig Nassanian

2007-08-01

Full Text Available RNA interference (RNAi, mediated by small interfering RNA (siRNA, is an effective method used to silence gene expression at the post-transcriptional level. Upon introduction into target cells, siRNAs incorporate into the RNA-induced silencing complex (RISC. The antisense strand of the siRNA duplex then "guides" the RISC to the homologous mRNA, leading to target degradation and gene silencing. In recent years, various vector-based siRNA expression systems have been developed which utilize opposing polymerase III promoters to independently drive expression of the sense and antisense strands of the siRNA duplex from the same template.We show here the use of a ligase chain reaction (LCR to develop a new vector system called pInv-H1 in which a DNA sequence encoding a specific siRNA is placed between two inverted minimal human H1 promoters (approximately 100 bp each. Expression of functional siRNAs from this construct has led to efficient silencing of both reporter and endogenous genes. Furthermore, the inverted H1 promoter-siRNA expression cassette was used to generate a retrovirus vector capable of transducing and silencing expression of the targeted protein by>80% in target cells.The unique design of this construct allows for the efficient exchange of siRNA sequences by the directional cloning of short oligonucleotides via asymmetric restriction sites. This provides a convenient way to test the functionality of different siRNA sequences. Delivery of the siRNA cassette by retroviral transduction suggests that a single copy of the siRNA expression cassette efficiently knocks down gene expression at the protein level. We note that this vector system can potentially be used to generate a random siRNA library. The flexibility of the ligase chain reaction suggests that additional control elements can easily be introduced into this siRNA expression cassette.
A study of the frequency of methylation of gene promoter regions in ...

Indian Academy of Sciences (India)

2013-04-02

Apr 2, 2013 ... colorectal cancer in the Taiwanese population. CHANG-CHIEH WU1 ... hypermethylation of promoter-region CpG islands is an important ... mismatch repair gene MLH1 plays an important role in dele- ..... Asia Pac. J. Clin.

Regulation of ALF promoter activity in Xenopus oocytes.

Directory of Open Access Journals (Sweden)

Dan Li

Full Text Available BACKGROUND: In this report we evaluate the use of Xenopus laevis oocytes as a matched germ cell system for characterizing the organization and transcriptional activity of a germ cell-specific X. laevis promoter. PRINCIPAL FINDINGS: The promoter from the ALF transcription factor gene was cloned from X. laevis genomic DNA using a PCR-based genomic walking approach. The endogenous ALF gene was characterized by RACE and RT-PCR for transcription start site usage, and by sodium bisulfite sequencing to determine its methylation status in somatic and oocyte tissues. Homology between the X. laevis ALF promoter sequence and those from human, chimpanzee, macaque, mouse, rat, cow, pig, horse, dog, chicken and X. tropicalis was relatively low, making it difficult to use such comparisons to identify putative regulatory elements. However, microinjected promoter constructs were very active in oocytes and the minimal promoter could be narrowed by PCR-mediated deletion to a region as short as 63 base pairs. Additional experiments using a series of site-specific promoter mutants identified two cis-elements within the 63 base pair minimal promoter that were critical for activity. Both elements (A and B were specifically recognized by proteins present in crude oocyte extracts based on oligonucleotide competition assays. The activity of promoter constructs in oocytes and in transfected somatic Xenopus XLK-WG kidney epithelial cells was quite different, indicating that the two cell types are not functionally equivalent and are not interchangeable as assay systems. CONCLUSIONS: Overall the results provide the first detailed characterization of the organization of a germ cell-specific Xenopus promoter and demonstrate the feasibility of using immature frog oocytes as an assay system for dissecting the biochemistry of germ cell gene regulation.
Role of regional policies in promoting networking and innovation activity of firms

OpenAIRE

Kirsi Mukkala; Jari Ritsilä

2004-01-01

The success of firms and regions is increasingly defined by their innovation and learning capabilities. It has been emphasized in several studies that a local operational environment may have a positive impact on innovation activity of firms. From policy point of view, the relationship between firms and their local environment is an important research topic. The purpose of this paper is to explore whether there is a demand for regional policy makers in promoting innovative and networking acti...
Development of a YAC contig covering the minimal region of a CSNB1 locus in Xp11

Energy Technology Data Exchange (ETDEWEB)

Boycott, K.M.; Gratton, K.J.; Moore, B.J. [Univ. of Calgary (Canada)] [and others

1994-09-01

X-linked congenital stationary night blindness (CSNB1) is an eye disorder that includes impairment of night vision, reduced visual acuity and, in some cases, myopia and congenital nystagmus. Electroretinography reveals a marked reduction of the b-wave in affected individuals suggesting that X-linked CSNB is due to a molecular defect in the bipolar layer of the retina. Based on our studies of a large four generation family with X-linked CSNB, a CSNB1 locus was mapped to a 4-5 cM region at Xp11.23-Xp11.22 bounded telomerically by DXS426 and centromerically by DXS988. Using a panel of radiation and conventional somatic cell hybrids, a detailed map of new and published STSs has been generated for the minimal region of CSNB1. PCR primer pairs for STSs has been generated for the minimal region of CSNB1. PCR primer pairs for twenty-five STSs, including eleven end-clones, were used to isolate YAC clones from CEPH, mega-CEPH, and X chromosome-specific YAC libraries. In total, fifty-two YACs were characterized for STS overlaps and assembled to provide a minimum of 3 Mb of physical coverage in the region between DXS426 and DXS988. Five gaps proximal to SYP are still to be closed. Our physical map suggests the following gene order: Xpter-OTAL1-GF1-DXS1011E-MG81-HUMCRAS2P-SYP-Xcen. STS analysis of the YACs revealed three subregions of the physical map which appear to be particularly susceptible to internal deletions and end-clone analysis demonstrated chimerism in six of seventeen YACs. A physical map of Xp11.23-Xp11.22 will provide a resource for the isolation of candidate genes for the X-linked CSNB gene which maps to this region.
Promoting regional mobility

DEFF Research Database (Denmark)

Jensen, Anne

Pricing of transport has been part of EU's common transport policy since this gained momentum in the early 1990s. Since then, it has been closely connected to the trans-European transport network (TEN-T) and to rising demands of efficient mobility systems at a local, regional and Community scale....... Development of pricing policies is contested at Community level and has taken place in a clash between different policy rationalities. Significantly though, the effects of the pricing policies are closely related to regional mobility systems, e.g. through financing large trans-border infrastructure projects...... and establishing common technical charging systems thus changing the conditions for regional mobility. This paper explores how policies of infrastructure pricing shape new ways of governing mobility which influences trans-border, regional policy-making. The key findings are that there is a tendency to include...
Characterization of a putative cis-regulatory element that controls transcriptional activity of the pig uroplakin II gene promoter

International Nuclear Information System (INIS)

Kwon, Deug-Nam; Park, Mi-Ryung; Park, Jong-Yi; Cho, Ssang-Goo; Park, Chankyu; Oh, Jae-Wook; Song, Hyuk; Kim, Jae-Hwan; Kim, Jin-Hoi

2011-01-01

Highlights: → The sequences of -604 to -84 bp of the pUPII promoter contained the region of a putative negative cis-regulatory element. → The core promoter was located in the 5F-1. → Transcription factor HNF4 can directly bind in the pUPII core promoter region, which plays a critical role in controlling promoter activity. → These features of the pUPII promoter are fundamental to development of a target-specific vector. -- Abstract: Uroplakin II (UPII) is a one of the integral membrane proteins synthesized as a major differentiation product of mammalian urothelium. UPII gene expression is bladder specific and differentiation dependent, but little is known about its transcription response elements and molecular mechanism. To identify the cis-regulatory elements in the pig UPII (pUPII) gene promoter region, we constructed pUPII 5' upstream region deletion mutants and demonstrated that each of the deletion mutants participates in controlling the expression of the pUPII gene in human bladder carcinoma RT4 cells. We also identified a new core promoter region and putative negative cis-regulatory element within a minimal promoter region. In addition, we showed that hepatocyte nuclear factor 4 (HNF4) can directly bind in the pUPII core promoter (5F-1) region, which plays a critical role in controlling promoter activity. Transient cotransfection experiments showed that HNF4 positively regulates pUPII gene promoter activity. Thus, the binding element and its binding protein, HNF4 transcription factor, may be involved in the mechanism that specifically regulates pUPII gene transcription.
Guidelines for mixed waste minimization

International Nuclear Information System (INIS)

Owens, C.

1992-02-01

Currently, there is no commercial mixed waste disposal available in the United States. Storage and treatment for commercial mixed waste is limited. Host States and compacts region officials are encouraging their mixed waste generators to minimize their mixed wastes because of management limitations. This document provides a guide to mixed waste minimization
THE ANALYSIS OF THE ASYMMETRICAL RISK IN TOURISM FOR THE DEVELOPMENT AND PROMOTION OF A LASTING REGIONAL TOURISM IDENTITY

Directory of Open Access Journals (Sweden)

Alexandru NEDELEA

2009-06-01

Full Text Available In order to establish an adequate balance between tourists' welfare, the needs of the natural and cultural environment, as well as to develop tourist destinations and organizations' competitiveness, it is necessary to carry out a global and integrated approach, where all interested parties share the same goals regarding the durability of tourism and the approached challenges. The purpose of this work is to identify the factors of reduced risk having a major impact over the sustainability of the tourist region under analysis and to highlight the risk factors' connections and impact in order to minimize and eliminate them, with direct effects over the awareness of tourist industry's values. The identification of lasting development's indicators will take into account all these three aspects of the durable development of tourism, namely ecological, economical and social factors, that play a part in highlighting the real performance of a tourist destination. All these aspects are absolutely necessary for the promotion of the Danube's tourist potential, achievable through the emphasis of the relevant values from the tourist patrimony of the county of Galati. The promotion of the Danube' tourist potential presupposes a series of objectives that are subordinated to the general direction that is marked at the national level, respectively Romania's transformation into a qualitative tourist destination based on its natural and cultural patrimony, in order to correspond to the European Union standards. The new policy regarding tourism proposed by the European Commission aims at offering constant support for this industry to be able to face different challenges, by promoting also competitiveness in general.
Nucleopolis for promoting the nuclear excellence of the Normandy region

International Nuclear Information System (INIS)

2016-01-01

Nucleopolis is the Norman economic pole dedicated to nuclear energy, nuclear medicine and nuclear safety, it gathers about 70 enterprises whatever their sizes, research laboratories and teaching or training units. Nucleopolis was founded in 2009 with the economic development of the region as a unique purpose. Nucleopolis will ease the access of its members to local, national and international markets through actions of networking and by promoting innovations and skill development. Nucleopolis proposes to its members a series of services around 4 departments: Nucleo'Network to promote networking between the members themselves and between the members and major contractors; Nucleo'Business to propose assistance in national and international business; Nucleo'Competence to propose adequate training to its members to upgrade their skills and Nucleo'Innovation to foster collaborative work between its members on innovative projects. (A.C.)
Restoration of CpG Methylation in The Egf Promoter Region during Rat Liver Regeneration

Science.gov (United States)

Deming, Li; Ziwei, Li; Xueqiang, Guo; Cunshuan, Xu

2015-01-01

Epidermal growth factor (EGF) is an important factor for healing after tissue damage in diverse experimental models. It plays an important role in liver regeneration (LR). The objective of this experiment is to investigate the methylation variation of 10 CpG sites in the Egf promoter region and their relevance to Egf expression during rat liver regenera- tion. As a follow up of our previous study, rat liver tissue was collected after rat 2/3 partial hepatectomy (PH) during the re-organization phase (from days 14 to days 28). Liver DNA was extracted and modified by sodium bisulfate. The methylation status of 10 CpG sites in Egf promoter region was determined using bisulfite sequencing polymerase chain reaction (PCR), as BSP method. The results showed that 3 (sites 3, 4 and 9) out of 10 CpG sites have strikingly methylation changes during the re-organization phase compared to the regeneration phase (from 2 hours to 168 hours, P=0.002, 0.048 and 0.018, respectively). Our results showed that methylation modification of CpGs in the Egf promoter region could be restored to the status before PH operation and changes of methylation didn’t affect Egf mRNA expression during the re-organization phase. PMID:26464832
Y-12 Plant waste minimization strategy

International Nuclear Information System (INIS)

Kane, M.A.

1987-01-01

The 1984 Amendments to the Resource Conservation and Recovery Act (RCRA) mandate that waste minimization be a major element of hazardous waste management. In response to this mandate and the increasing costs for waste treatment, storage, and disposal, the Oak Ridge Y-12 Plant developed a waste minimization program to encompass all types of wastes. Thus, waste minimization has become an integral part of the overall waste management program. Unlike traditional approaches, waste minimization focuses on controlling waste at the beginning of production instead of the end. This approach includes: (1) substituting nonhazardous process materials for hazardous ones, (2) recycling or reusing waste effluents, (3) segregating nonhazardous waste from hazardous and radioactive waste, and (4) modifying processes to generate less waste or less toxic waste. An effective waste minimization program must provide the appropriate incentives for generators to reduce their waste and provide the necessary support mechanisms to identify opportunities for waste minimization. This presentation focuses on the Y-12 Plant's strategy to implement a comprehensive waste minimization program. This approach consists of four major program elements: (1) promotional campaign, (2) process evaluation for waste minimization opportunities, (3) waste generation tracking system, and (4) information exchange network. The presentation also examines some of the accomplishments of the program and issues which need to be resolved
Absence of mutation at the 5'-upstream promoter region of the TPM4 gene from cardiac mutant axolotl (Ambystoma mexicanum).

Science.gov (United States)

Denz, Christopher R; Zhang, Chi; Jia, Pingping; Du, Jianfeng; Huang, Xupei; Dube, Syamalima; Thomas, Anish; Poiesz, Bernard J; Dube, Dipak K

2011-09-01

Tropomyosins are a family of actin-binding proteins that show cell-specific diversity by a combination of multiple genes and alternative RNA splicing. Of the 4 different tropomyosin genes, TPM4 plays a pivotal role in myofibrillogenesis as well as cardiac contractility in amphibians. In this study, we amplified and sequenced the upstream regulatory region of the TPM4 gene from both normal and mutant axolotl hearts. To identify the cis-elements that are essential for the expression of the TPM4, we created various deletion mutants of the TPM4 promoter DNA, inserted the deleted segments into PGL3 vector, and performed promoter-reporter assay using luciferase as the reporter gene. Comparison of sequences of the promoter region of the TPM4 gene from normal and mutant axolotl revealed no mutations in the promoter sequence of the mutant TPM4 gene. CArG box elements that are generally involved in controlling the expression of several other muscle-specific gene promoters were not found in the upstream regulatory region of the TPM4 gene. In deletion experiments, loss of activity of the reporter gene was noted upon deletion which was then restored upon further deletion suggesting the presence of both positive and negative cis-elements in the upstream regulatory region of the TPM4 gene. We believe that this is the first axolotl promoter that has ever been cloned and studied with clear evidence that it functions in mammalian cell lines. Although striated muscle-specific cis-acting elements are absent from the promoter region of TPM4 gene, our results suggest the presence of positive and negative cis-elements in the promoter region, which in conjunction with positive and negative trans-elements may be involved in regulating the expression of TPM4 gene in a tissue-specific manner.
Governmental promotion of the Information Society in the Spanish Region of Valencia

Directory of Open Access Journals (Sweden)

Emilio Feliu-García, Ph.D.

2011-01-01

Full Text Available Regional spheres are considered essential in the governmental promotion of the Information Society at the international level. The regional initiatives in Spain aim to strengthen and complement the initiatives promoted at the national level. This article analyses ICT penetration in the Valencian Community from 1996 to 2008. The objective is to identify which of the actions carried out by the Valencian Regional Government have had a positive effect on its society.The methodology employed in this study is benchmarking. The selection of indicators is based on the policies evaluation model proposed in the Plan Avanza (Spain’s national Information Society strategy. Data were collected from official statistical sources (like Spain’s National Statistics Institute, INE. Three statistical tests were applied to verify the hypotheses (Pearson’s r2, Chi-square and Student’s t.The results indicate that it is not possible to affirm that the actions implemented by the Valencian Regional Government have had a more positive effect on its society than those implemented by the Spanish Central Government. A reason for this may lie in the specific objectives of the political strategy implemented by the Valencian Government, which has focused primarily on e-Government and does not include enough projects centred on the implementation of new technologies in the private sector. Moreover, the integration of new technologies in everyday life is placed in a second level of importance despite citizens are central actors in the international agenda.
Studies of genetic variability of the glucose transporter 2 promoter in patients with type 2 diabetes mellitus

DEFF Research Database (Denmark)

Møller, A M; Jensen, N M; Pildal, J

2001-01-01

This study was performed to test the hypothesis that genetic variation in the promoter of the glucose transporter 2 (GLUT2) might predispose to prediabetic phenotypes or type 2 diabetes. A total of 1611 bp comprising the minimal promoter region of the GLUT2 gene were examined by combined single......-tolerant subjects. In conclusion, we found no evidence supporting the hypothesis that genetic variability in the minimal promoter of the GLUT2 is associated with type 2 diabetes or prediabetic phenotypes in the Danish population.......-strand conformational polymorphism and heteroduplex analysis followed by direct sequencing of identified variants on genomic DNA from 96 randomly recruited Danish type 2 diabetic patients. We identified 4 nucleotide variants, -447g-->a, -149c-->a, -122t-->c, and -44g-->a. None of the variants were positioned in known...
Altered regional homogeneity in the development of minimal hepatic encephalopathy: a resting-state functional MRI study.

Directory of Open Access Journals (Sweden)

Ling Ni

Full Text Available BACKGROUND: Little is known about how spontaneous brain activity progresses from non-hepatic encephalopathy (non-HE to minimal HE (MHE. The purpose of this study was to evaluate the evolution pattern of spontaneous brain activities in cirrhotic patients using resting-state fMRI with a regional homogeneity (ReHo method. METHODOLOGY/PRINCIPAL FINDINGS: Resting-state fMRI data were acquired in 47 cirrhotic patients (minimal HE [MHE], n = 20, and non-HE, n = 27 and 25 age-and sex-matched healthy controls. The Kendall's coefficient of concordance (KCC was used to measure the regional homogeneity. The regional homogeneity maps were compared with ANOVA tests among MHE, non-HE, and healthy control groups and t-tests between each pair in a voxel-wise way. Correlation analyses were performed to explore the relationships between regional ReHo values and Child-Pugh scores, number connection test type A (NCT-A, digit symbol test (DST scores, venous blood ammonia levels. Compared with healthy controls, both MHE and non-HE patients showed decreased ReHo in the bilateral frontal, parietal and temporal lobes and increased ReHo in the bilateral caudate. Compared with the non-HE, MHE patients showed decreased ReHo in the bilateral precuneus, cuneus and supplementary motor area (SMA. The NCT-A of cirrhotic patients negatively correlated with ReHo values in the precuneus, cuneus and lingual gyrus. DST scores positively correlated with ReHo values in the cuneus, precuneus and lingual gyrus, and negatively correlated with ReHo values in the bilateral caudate (P<0.05, AlphaSim corrected. CONCLUSIONS/SIGNIFICANCE: Diffused abnormal homogeneity of baseline brain activity was nonspecific for MHE, and only the progressively decreased ReHo in the SMA and the cuneus, especially for the latter, might be associated with the development of MHE. The ReHo analysis may be potentially valuable for detecting the development from non-HE to MHE.
Tumour MLH1 promoter region methylation testing is an effective prescreen for Lynch Syndrome (HNPCC).

Science.gov (United States)

Newton, K; Jorgensen, N M; Wallace, A J; Buchanan, D D; Lalloo, F; McMahon, R F T; Hill, J; Evans, D G

2014-12-01

Lynch syndrome (LS) patients have DNA mismatch repair deficiency and up to 80% lifetime risk of colorectal cancer (CRC). Screening of mutation carriers reduces CRC incidence and mortality. Selection for constitutional mutation testing relies on family history (Amsterdam and Bethesda Guidelines) and tumour-derived biomarkers. Initial biomarker analysis uses mismatch repair protein immunohistochemistry and microsatellite instability. Abnormalities in either identify mismatch repair deficiency but do not differentiate sporadic epigenetic defects, due to MLH1 promoter region methylation (13% of CRCs) from LS (4% of CRCs). A diagnostic biomarker capable of making this distinction would be valuable. This study compared two biomarkers in tumours with mismatch repair deficiency; quantification of methylation of the MLH1 promoter region using a novel assay and BRAF c.1799T>A, p.(Val600Glu) mutation status in the identification of constitutional mutations. Tumour DNA was extracted (formalin fixed, paraffin embedded, FFPE tissue) and pyrosequencing used to test for MLH1 promoter methylation and presence of the BRAF c.1799T>A, p.(Val600Glu) mutation 71 CRCs from individuals with pathogenic MLH1 mutations and 73 CRCs with sporadic MLH1 loss. Specificity and sensitivity was compared. Unmethylated MLH1 promoter: sensitivity 94.4% (95% CI 86.2% to 98.4%), specificity 87.7% (95% CI 77.9% to 94.2%), Wild-type BRAF (codon 600): sensitivity 65.8% (95% CI 53.7% to 76.5%), specificity 98.6% (95% CI 92.4% to 100.0%) for the identification of those with pathogenic MLH1 mutations. Quantitative MLH1 promoter region methylation using pyrosequencing is superior to BRAF codon 600 mutation status in identifying constitutional mutations in mismatch repair deficient tumours. Published by the BMJ Publishing Group Limited. For permission to use (where not already granted under a licence) please go to http://group.bmj.com/group/rights-licensing/permissions.
Minimizing the cancer-promotional activity of cox-2 as a central strategy in cancer prevention.

Science.gov (United States)

McCarty, Mark F

2012-01-01

A recent meta-analysis examining long-term mortality in subjects who participated in controlled studies evaluating the impact of daily aspirin on vascular risk, has concluded that aspirin confers substantial protection from cancer mortality. Remarkably, low-dose aspirin was as effective as higher-dose regimens; hence this protection may be achievable with minimal risk. There is reason to believe that this protection stems primarily from inhibition of cox-2 in pre-neoplastic lesions. Since safe aspirin regimens can only achieve a partial and transitory inhibition of cox-2, it may be feasible to complement the cancer-protective benefit of aspirin with other measures which decrease cox-2 expression or which limit the bioactivity of cox-2-derived PGE2. Oxidative stress boosts cox-2 expression by up-regulating activation of NF-kappaB and MAP kinases; NADPH oxidase activation may thus promote carcinogenesis by increasing cox-2 expression while also amplifying oxidant-mediated mutagenesis. A prospective cohort study has observed that relatively elevated serum bilirubin levels are associated with a marked reduction in subsequent cancer mortality; this may reflect bilirubin's physiological role as a potent inhibitor of NADPH oxidase. It may be feasible to mimic this protective effect by supplementing with spirulina, a rich source of a phycobilin which shares bilirubin's ability to inhibit NADPH oxidase. Ancillary antioxidant measures - phase 2 inducing phytochemicals, melatonin, N-acetylcysteine, and astaxanthin - may also aid cox-2 down-regulation. The cancer protection often associated with high-normal vitamin D status may be attributable, in part, to the ability of the activated vitamin D receptor to decrease cox-2 expression while promoting PGE2 catabolism and suppressing the expression of PGE2 receptors. Diets with a relatively low ratio of omega-6 to long-chain omega-3 fats may achieve cancer protection by antagonizing the production and bioactivity of PGE2. Growth
Genomic organization and identification of promoter regions for the BDNF gene in the pond turtle Trachemys scripta elegans.

Science.gov (United States)

Ambigapathy, Ganesh; Zheng, Zhaoqing; Keifer, Joyce

2014-08-01

Brain-derived neurotrophic factor (BDNF) is an important regulator of neuronal development and synaptic function. The BDNF gene undergoes significant activity-dependent regulation during learning. Here, we identified the BDNF promoter regions, transcription start sites, and potential regulatory sequences for BDNF exons I-III that may contribute to activity-dependent gene and protein expression in the pond turtle Trachemys scripta elegans (tBDNF). By using transfection of BDNF promoter/luciferase plasmid constructs into human neuroblastoma SHSY5Y cells and mouse embryonic fibroblast NIH3T3 cells, we identified the basal regulatory activity of promoter sequences located upstream of each tBDNF exon, designated as pBDNFI-III. Further, through chromatin immunoprecipitation (ChIP) assays, we detected CREB binding directly to exon I and exon III promoters, while BHLHB2, but not CREB, binds within the exon II promoter. Elucidation of the promoter regions and regulatory protein binding sites in the tBDNF gene is essential for understanding the regulatory mechanisms that control tBDNF gene expression.
New PAH gene promoter KLF1 and 3'-region C/EBPalpha motifs influence transcription in vitro.

Science.gov (United States)

Klaassen, Kristel; Stankovic, Biljana; Kotur, Nikola; Djordjevic, Maja; Zukic, Branka; Nikcevic, Gordana; Ugrin, Milena; Spasovski, Vesna; Srzentic, Sanja; Pavlovic, Sonja; Stojiljkovic, Maja

2017-02-01

Phenylketonuria (PKU) is a metabolic disease caused by mutations in the phenylalanine hydroxylase (PAH) gene. Although the PAH genotype remains the main determinant of PKU phenotype severity, genotype-phenotype inconsistencies have been reported. In this study, we focused on unanalysed sequences in non-coding PAH gene regions to assess their possible influence on the PKU phenotype. We transiently transfected HepG2 cells with various chloramphenicol acetyl transferase (CAT) reporter constructs which included PAH gene non-coding regions. Selected non-coding regions were indicated by in silico prediction to contain transcription factor binding sites. Furthermore, electrophoretic mobility shift assay (EMSA) and supershift assays were performed to identify which transcriptional factors were engaged in the interaction. We found novel KLF1 motif in the PAH promoter, which decreases CAT activity by 50 % in comparison to basal transcription in vitro. The cytosine at the c.-170 promoter position creates an additional binding site for the protein complex involving KLF1 transcription factor. Moreover, we assessed for the first time the role of a multivariant variable number tandem repeat (VNTR) region located in the 3'-region of the PAH gene. We found that the VNTR3, VNTR7 and VNTR8 constructs had approximately 60 % of CAT activity. The regulation is mediated by the C/EBPalpha transcription factor, present in protein complex binding to VNTR3. Our study highlighted two novel promoter KLF1 and 3'-region C/EBPalpha motifs in the PAH gene which decrease transcription in vitro and, thus, could be considered as PAH expression modifiers. New transcription motifs in non-coding regions will contribute to better understanding of the PKU phenotype complexity and may become important for the optimisation of PKU treatment.
Cytosine deletion at AP2-box region of HSP70 promoter and its ...

Indian Academy of Sciences (India)

Cytosine deletion at AP2-box region of HSP70 promoter and its influence on semen quality traits in crossbred bulls ... Laboratory, ICAR-Central Institute for Research on Cattle, Meerut 250 001, India; School of Atmospheric Stress Management, ICAR-National Institute of Abiotic Stress Management, Baramati 413 115, India ...
“Fear or Love Thy Neighbour”? The EU Framework for Promoting Regional Cooperation in the South Caucasus

Directory of Open Access Journals (Sweden)

Nelli Babayan

2011-12-01

Full Text Available Building on the model of the enlargement policy, the European Union (EU designed the European Neighbourhood Policy and the Eastern Partnership to further promote its norms and principles. One of the goals of its new policies has been to foster regional cooperation among partner countries and their neighbours. This article specifies the EU’s framework for promoting regional cooperation through the aforementioned policies and discusses its potential impact on the example of the South Caucasus republics of Armenia, Azerbaijan, and Georgia. The South Caucasus has not only been an arena of intraregional conflicts, but has also often been troubled by disputes between its neighbours. This article argues that, due to a lack of proactive and consistent engagement, the EU’s framework risks leaving regional conflicts in the current state of stagnation and without advancement in regional cooperation.

Separations: The path to waste minimization

International Nuclear Information System (INIS)

Bell, J.T.

1992-01-01

Waste materials usually are composed of large amounts of innocuous and frequently useful components mixed with lesser amounts of one or more hazardous components. The ultimate path to waste minimization is the separation of the lesser quantities of hazardous components from the innocuous components, and then recycle the useful components. This vision is so simple that everyone would be expected to properly manage waste. Several parameters interfere with this proper waste management, which encourages the open-quotes sweep it under the rugclose quotes or the open-quotes bury it allclose quotes attitudes, both of which delay and complicate proper waste management. The two primary parameters that interfere with proper waste management are: economics drives a process to a product without concerns of waste minimization, and emergency needs for immediate production of a product usually delays proper waste management. A third parameter in recent years is also interfering with proper waste management: quick relief of waste insults to political and public perceptions is promoting the open-quotes bury it allclose quotes attitude. A fourth parameter can promote better waste management for any scenario that suffers either or all of the first three parameters: separations technology can minimize wastes when the application of this technology is not voided by influence of the first three parameters. The US Department of Energy's management of nuclear waste has been seriously affected by the above four parameters. This paper includes several points about how the generation and management of DOE wastes have been, and continue to be, affected by these parameters. Particular separations technologies for minimizing the DOE wastes that must be stored for long periods are highlighted
New method for minimizing regular functions with constraints on parameter region

International Nuclear Information System (INIS)

Kurbatov, V.S.; Silin, I.N.

1993-01-01

The new method of function minimization is developed. Its main features are considered. It is possible minimization of regular function with the arbitrary structure. For χ 2 -like function the usage of simplified second derivatives is possible with the control of correctness. The constraints of arbitrary structure can be used. The means for fast movement along multidimensional valleys are used. The method is tested on real data of K π2 decay of the experiment on rare K - -decays. 6 refs
Genetic variants in promoters and coding regions of the muscle glycogen synthase and the insulin-responsive GLUT4 genes in NIDDM

DEFF Research Database (Denmark)

Bjørbaek, C; Echwald, Søren Morgenthaler; Hubricht, P

1994-01-01

To examine the hypothesis that variants in the regulatory or coding regions of the glycogen synthase (GS) and insulin-responsive glucose transporter (GLUT4) genes contribute to insulin-resistant glucose processing of muscle from non-insulin-dependent diabetes mellitus (NIDDM) patients, promoter...... volunteers. By applying inverse polymerase chain reaction and direct DNA sequencing, 532 base pairs (bp) of the GS promoter were identified and the transcriptional start site determined by primer extension. SSCP scanning of the promoter region detected five single nucleotide substitutions, positioned at 42......'-untranslated region, and the coding region of the GLUT4 gene showed four polymorphisms, all single nucleotide substitutions, positioned at -581, 1, 30, and 582. None of the three changes in the regulatory region of the gene had any major influence on expression of the GLUT4 gene in muscle. The variant at 582...
Tumour MLH1 promoter region methylation testing is an effective pre-screen for Lynch Syndrome (HNPCC)

Science.gov (United States)

Newton, K; Jorgensen, NM; Wallace, AJ; Buchanan, DD; Lalloo, F; McMahon, RFT; Hill, J; Evans, DG

2016-01-01

Background & Aims Lynch syndrome patients have DNA mismatch repair deficiency and up to 80% life-time risk of colorectal cancer. Screening of mutation carriers reduces colorectal cancer incidence and mortality. Selection for constitutional mutation testing relies on family history (Amsterdam and Bethesda Guidelines) and tumour derived biomarkers. Initial biomarker analysis uses mismatch repair protein immunohistochemistry and microsatellite instability. Abnormalities in either identify mismatch repair deficiency but do not differentiate sporadic epigenetic defects, due to MLH1 promoter region methylation (13% of CRCs) from Lynch Syndrome (4% of CRCs). A diagnostic biomarker capable of making this distinction would be valuable. This study compared two biomarkers in tumours with mismatch repair deficiency; quantification of methylation of the MLH1 promoter region using a novel assay and BRAF c.1799T>A, p.(Val600Glu) mutation status in the identification of constitutional mutations. Methods Tumour DNA was extracted (FFPE tissue) and pyrosequencing used to test for MLH1 promoter methylation and presence of the BRAF c.1799T>A, p.(Val600Glu) mutation 71 CRCs from individuals with pathogenic MLH1 mutations and 73 CRCs with sporadic MLH1 loss. Specificity and sensitivity was compared. Findings Unmethylated MLH1 promoter: sensitivity 94.4% (95% CI 86.2–98.4%), specificity 87.7% (95% CI 77.9–94.2%), Wild-type BRAF (codon 600): sensitivity 65.8% (95% CI 53.7–76.5%), specificity 98.6% (95% CI 92.4–100.0%) for the identification of those with pathogenic MLH1 mutations. Conclusions Quantitative MLH1 promoter region methylation using pyrosequencing is superior to BRAF codon 600 mutation status in identifying constitutional mutations in mismatch repair deficient tumours. PMID:25280751
The system of Regional Contact Offices for promoting GMES services and the use of Space Technologies in European Regions.

Science.gov (United States)

Carrara, Paola; Antoninetti, Massimo; Bacai, Hina; Basoni, Anna; Bosc, Christelle; Clave, Magali; Cornacchia, Carmela; L'Astorina, Alba; Monbet, Philippe; Mueller, Bastian; Nicolau, Sonia; Pergola, Nicola; Rampini, Anna; Tramutoli, Valerio; Schumacher, Volker; Wells, Alan; Zepeda Juarez, Jesus; Zolotikova, Svetlana

2013-04-01

which have significant impact on the economy, environment and the quality of life of the citizens To this aim since 2011 the system of Regional Contact Offices (RCOs) was promoted by the EU FP7 DORIS_Net (Downsteam Observatory organized by Regions Active in Space - Network, http://www.doris-net.eu/) project as the regional link to the services provided by the European GMES programme. Since then a first nucleus of 12 pilot European Regions were working together establishing 6 first RCOs around Europe. This paper will present RCOs network goals, achievements and perspectives as well as its planned actions devoted to improve quality of Space Technology products from one side, to promote awareness and use of them by potential end-users (and particularly LRAs), from the other side.
Functional dissection of the promoter of the pollen-specific gene NTP303 reveals a novel pollen-specific, and conserved cis-regulatory element.

Science.gov (United States)

Weterings, K; Schrauwen, J; Wullems, G; Twell, D

1995-07-01

Regulatory elements within the promoter of the pollen-specific NTP303 gene from tobacco were analysed by transient and stable expression analyses. Analysis of precisely targeted mutations showed that the NTP303 promoter is not regulated by any of the previously described pollen-specific cis-regulatory elements. However, two adjacent regions from -103 to -86 bp and from -86 to -59 bp were shown to contain sequences which positively regulated the NTP303 promoter. Both of these regions were capable of driving pollen-specific expression from a heterologous promoter, independent of orientation and in an additive manner. The boundaries of the minimal, functional NTP303 promoter were determined to lie within the region -86 to -51 bp. The sequence AAATGA localized from -94 to -89 bp was identified as a novel cis-acting element, of which the TGA triplet was shown to comprise an active part. This element was shown to be completely conserved in the similarly regulated promoter of the Bp 10 gene from Brassica napus encoding a homologue of the NTP303 gene.
Assessing the effects of data selection and representation on the development of reliable E. coli sigma 70 promoter region predictors.

Directory of Open Access Journals (Sweden)

Mostafa M Abbas

Full Text Available As the number of sequenced bacterial genomes increases, the need for rapid and reliable tools for the annotation of functional elements (e.g., transcriptional regulatory elements becomes more desirable. Promoters are the key regulatory elements, which recruit the transcriptional machinery through binding to a variety of regulatory proteins (known as sigma factors. The identification of the promoter regions is very challenging because these regions do not adhere to specific sequence patterns or motifs and are difficult to determine experimentally. Machine learning represents a promising and cost-effective approach for computational identification of prokaryotic promoter regions. However, the quality of the predictors depends on several factors including: i training data; ii data representation; iii classification algorithms; iv evaluation procedures. In this work, we create several variants of E. coli promoter data sets and utilize them to experimentally examine the effect of these factors on the predictive performance of E. coli σ70 promoter models. Our results suggest that under some combinations of the first three criteria, a prediction model might perform very well on cross-validation experiments while its performance on independent test data is drastically very poor. This emphasizes the importance of evaluating promoter region predictors using independent test data, which corrects for the over-optimistic performance that might be estimated using the cross-validation procedure. Our analysis of the tested models shows that good prediction models often perform well despite how the non-promoter data was obtained. On the other hand, poor prediction models seems to be more sensitive to the choice of non-promoter sequences. Interestingly, the best performing sequence-based classifiers outperform the best performing structure-based classifiers on both cross-validation and independent test performance evaluation experiments. Finally, we propose a
Regional Cooperation Efforts in the Mekong River Basin: Mitigating river-related security threats and promoting regional development

Directory of Open Access Journals (Sweden)

Susanne Schmeier

2009-01-01

Full Text Available The development of international rivers is often perceived as leading to conflicts or even water wars. However, as the development of the Mekong River shows, cooperation has not only prevailed in the last decades, but River Basin Organizations (RBOs, established to mitigate river-related conflicts and/or develop the river basin, have also contributed to the emergence of more general cooperation structures, mainly by creating spill-over effects in other issue-areas, bringing cooperation to policy fields beyond the river itself. This article assesses the contribution of the Mekong River Commission (MRC and the Greater Mekong Sub-Region (GMS to the sustainable development of the Mekong Region as well as to the promotion of regional cooperation in mainland South-East Asia in general. --- Die Entwicklung grenzüberschreitender Flüsse wird oft mit Konflikten oder gar Kriegen um Wasser assoziiert. Wie jedoch die Entwicklung im Mekong-Becken zeigt, waren die vergangenen Jahrzehnte nicht nur von Kooperation gezeichnet, sondern Flussbeckenorganisationen konnten außerdem dazu beitragen, weitreichendere Kooperationsstrukturen zu entwickeln, die sich auf andere Politikfelder ausdehnen. Dieser Artikel beschäftigt sich mit dem Beitrag der Mekong River Commission (MRC und der Greater Mekong Sub-Region (GMS zur nachhaltigen Entwicklung in der Mekong Region sowie zur Förderung allgemeiner regionaler Kooperation im Festländischen Südostasien.
Selective apoptosis induction in MCF-7 cell line by truncated minimal functional region of Apoptin

International Nuclear Information System (INIS)

Shen Ni, Lim; Allaudin, Zeenathul Nazariah bt; Mohd Lila, Mohd Azmi b; Othman, Abas Mazni b; Othman, Fauziah bt

2013-01-01

Chicken Anemia Virus (CAV) VP3 protein (also known as Apoptin), a basic and proline-rich protein has a unique capability in inducing apoptosis in cancer cells but not in normal cells. Five truncated Apoptin proteins were analyzed to determine their selective ability to migrate into the nucleus of human breast adenocarcinoma MCF-7 cells for inducing apoptosis. For identification of the minimal selective domain for apoptosis, the wild-type Apoptin gene had been reconstructed by PCR to generate segmental deletions at the N’ terminal and linked with nuclear localization sites (NLS1 and NLS2). All the constructs were fused with maltose-binding protein gene and individually expressed by in vitro Rapid Translation System. Standardized dose of proteins were delivered into human breast adenocarcinoma MCF-7 cells and control human liver Chang cells by cytoplasmic microinjection, and subsequently observed for selective apoptosis effect. Three of the truncated Apoptin proteins with N-terminal deletions spanning amino acid 32–83 retained the cancer selective nature of wild-type Apoptin. The proteins were successfully translocated to the nucleus of MCF-7 cells initiating apoptosis, whereas non-toxic cytoplasmic retention was observed in normal Chang cells. Whilst these truncated proteins retained the tumour-specific death effector ability, the specificity for MCF-7 cells was lost in two other truncated proteins that harbor deletions at amino acid 1–31. The detection of apoptosing normal Chang cells and MCF-7 cells upon cytoplasmic microinjection of these proteins implicated a loss in Apoptin’s signature targeting activity. Therefore, the critical stretch spanning amino acid 1–31 at the upstream of a known hydrophobic leucine-rich stretch (LRS) was strongly suggested as one of the prerequisite region in Apoptin for cancer targeting. Identification of this selective domain provides a platform for developing small targets to facilitating carrier-mediated-transport across
Preservation or Restoration of Segmental and Regional Spinal Lordosis Using Minimally Invasive Interbody Fusion Techniques in Degenerative Lumbar Conditions: A Literature Review.

Science.gov (United States)

Uribe, Juan S; Myhre, Sue Lynn; Youssef, Jim A

2016-04-01

A literature review. The purpose of this study was to review lumbar segmental and regional alignment changes following treatment with a variety of minimally invasive surgery (MIS) interbody fusion procedures for short-segment, degenerative conditions. An increasing number of lumbar fusions are being performed with minimally invasive exposures, despite a perception that minimally invasive lumbar interbody fusion procedures are unable to affect segmental and regional lordosis. Through a MEDLINE and Google Scholar search, a total of 23 articles were identified that reported alignment following minimally invasive lumbar fusion for degenerative (nondeformity) lumbar spinal conditions to examine aggregate changes in postoperative alignment. Of the 23 studies identified, 28 study cohorts were included in the analysis. Procedural cohorts included MIS ALIF (two), extreme lateral interbody fusion (XLIF) (16), and MIS posterior/transforaminal lumbar interbody fusion (P/TLIF) (11). Across 19 study cohorts and 720 patients, weighted average of lumbar lordosis preoperatively for all procedures was 43.5° (range 28.4°-52.5°) and increased 3.4° (9%) (range -2° to 7.4°) postoperatively (P lordosis increased, on average, by 4° from a weighted average of 8.3° preoperatively (range -0.8° to 15.8°) to 11.2° at postoperative time points (range -0.2° to 22.8°) (P lordosis and change in lumbar lordosis (r = 0.413; P = 0.003), wherein lower preoperative lumbar lordosis predicted a greater increase in postoperative lumbar lordosis. Significant gains in both weighted average lumbar lordosis and segmental lordosis were seen following MIS interbody fusion. None of the segmental lordosis cohorts and only two of the 19 lumbar lordosis cohorts showed decreases in lordosis postoperatively. These results suggest that MIS approaches are able to impact regional and local segmental alignment and that preoperative patient factors can impact the extent of correction gained
Graduate Management Project (GMP) Retrospective Analysis of Promotional Mediums for Tricare Prime in Tricare Region 11

National Research Council Canada - National Science Library

Carpenter, Steven

1997-01-01

This study provides retrospective market research information about the population who enrolled in TRICARE Prime in TRICARE Region 11 and the advertising mediums used to promote enrollment in the TRICARE Prime program...
MinGenome: An In Silico Top-Down Approach for the Synthesis of Minimized Genomes.

Science.gov (United States)

Wang, Lin; Maranas, Costas D

2018-02-16

Genome minimized strains offer advantages as production chassis by reducing transcriptional cost, eliminating competing functions and limiting unwanted regulatory interactions. Existing approaches for identifying stretches of DNA to remove are largely ad hoc based on information on presumably dispensable regions through experimentally determined nonessential genes and comparative genomics. Here we introduce a versatile genome reduction algorithm MinGenome that implements a mixed-integer linear programming (MILP) algorithm to identify in size descending order all dispensable contiguous sequences without affecting the organism's growth or other desirable traits. Known essential genes or genes that cause significant fitness or performance loss can be flagged and their deletion can be prohibited. MinGenome also preserves needed transcription factors and promoter regions ensuring that retained genes will be properly transcribed while also avoiding the simultaneous deletion of synthetic lethal pairs. The potential benefit of removing even larger contiguous stretches of DNA if only one or two essential genes (to be reinserted elsewhere) are within the deleted sequence is explored. We applied the algorithm to design a minimized E. coli strain and found that we were able to recapitulate the long deletions identified in previous experimental studies and discover alternative combinations of deletions that have not yet been explored in vivo.
Regulation of the intronic promoter of rat estrogen receptor alpha gene, responsible for truncated estrogen receptor product-1 expression.

Science.gov (United States)

Schausi, Diane; Tiffoche, Christophe; Thieulant, Marie-Lise

2003-07-01

We have characterized the intronic promoter of the rat estrogen receptor (ER) alpha gene, responsible for the lactotrope-specific truncated ER product (TERP)-1 isoform expression. Transcriptional regulation was investigated by transient transfections using 5'-deletion constructs. TERP promoter constructs were highly active in MMQ cells, a pure lactotrope cell line, whereas a low basal activity was detected in alphaT3-1 gonadotrope cells or in COS-7 monkey kidney cells. Serial deletion analysis revealed that 1) a minimal -693-bp region encompassing the TATA box is sufficient to allow lactotrope-specific expression; 2) the promoter contains strong positive cis-acting elements both in the distal and proximal regions, and 3) the region spanning the -1698/-1194 region includes repressor elements. Transient transfection studies, EMSAs, and gel shifts demonstrated that estrogen activates the TERP promoter via an estrogen-responsive element (ERE1) located within the proximal region. Mutation of ERE1 site completely abolishes the estradiol-dependent transcription, indicating that ERE1 site is sufficient to confer estrogen responsiveness to TERP promoter. In addition, ERalpha action was synergized by transfection of the pituitary-specific factor Pit-1. EMSAs showed that a single Pit-1 DNA binding element in the vicinity of the TATA box is sufficient to confer response by the TERP promoter. In conclusion, we demonstrated, for the first time, that TERP promoter regulation involves ERE and Pit-1 cis-elements and corresponding trans-acting factors, which could play a role in the physiological changes that occur in TERP-1 transcription in lactotrope cells.
Targets of DNA-binding proteins in bacterial promoter regions present enhanced probabilities for spontaneous thermal openings

International Nuclear Information System (INIS)

Apostolaki, Angeliki; Kalosakas, George

2011-01-01

We mapped promoter regions of double-stranded DNA with respect to the probabilities of appearance of relatively large bubble openings exclusively due to thermal fluctuations at physiological temperatures. We analyzed five well-studied promoter regions of procaryotic type and found a spatial correlation between the binding sites of transcription factors and the position of peaks in the probability pattern of large thermal openings. Other distinct peaks of the calculated patterns correlate with potential binding sites of DNA-binding proteins. These results suggest that a DNA molecule would more frequently expose the bases that participate in contacts with proteins, which would probably enhance the probability of the latter to reach their targets. It also stands for using this method as a means to analyze DNA sequences based on their intrinsic thermal properties
A distal region of the human TGM1 promoter is required for expression in transgenic mice and cultured keratinocytes

Directory of Open Access Journals (Sweden)

Lu Ying

2004-04-01

Full Text Available Abstract Background TGM1(transglutaminase 1 is an enzyme that crosslinks the cornified envelope of mature keratinocytes. Appropriate expression of the TGM1 gene is crucial for proper keratinocyte function as inactivating mutations lead to the debilitating skin disease, lamellar ichthyosis. TGM1 is also expressed in squamous metaplasia, a consequence in some epithelia of vitamin A deficiency or toxic insult that can lead to neoplasia. An understanding of the regulation of this gene in normal and abnormal differentiation states may contribute to better disease diagnosis and treatment. Methods In vivo requirements for expression of the TGM1 gene were studied by fusing various lengths of promoter DNA to a reporter and injecting the DNA into mouse embryos to generate transgenic animals. Expression of the reporter was ascertained by Western blotting and immunohistochemistry. Further delineation of a transcriptionally important distal region was determined by transfections of progressively shortened or mutated promoter DNA into cultured keratinocytes. Results In vivo analysis of a reporter transgene driven by the TGM1 promoter revealed that 1.6 kilobases, but not 1.1 kilobases, of DNA was sufficient to confer tissue-specific and cell layer-specific expression. This same region was responsible for reporter expression in tissues undergoing squamous metaplasia as a response to vitamin A deprivation. Mutation of a distal promoter AP1 site or proximal promoter CRE site, both identified as important transcriptional elements in transfection assays, did not prevent appropriate expression. Further searching for transcriptional elements using electrophoretic mobility shift (EMSA and transfection assays in cultured keratinocytes identified two Sp1 elements in a transcriptionally active region between -1.6 and -1.4 kilobases. While mutation of either Sp1 site or the AP1 site singly had only a small effect, mutation of all three sites eliminated nearly all the
Discovery and Evaluation of Polymorphisms in the and Promoter Regions for Risk of Korean Lung Cancer

Directory of Open Access Journals (Sweden)

Jae Sook Sung

2012-09-01

Full Text Available AKT is a signal transduction protein that plays a central role in the tumorigenesis. There are 3 mammalian isoforms of this serine/threonine protein kinase-AKT1, AKT2, and AKT3-showing a broad tissue distribution. We first discovered 2 novel polymorphisms (AKT2 -9826 C/G and AKT3 -811 A/G, and we confirmed 6 known polymorphisms (AKT2 -9473 C/T, AKT2 -9151 C/T, AKT2 -9025 C/T, AKT2 -8618G/A, AKT3 -675 A/-, and AKT3 -244 C/T of the AKT2 and AKT3 promoter region in 24 blood samples of Korean lung cancer patients using direct sequencing. To evaluate the role of AKT2 and AKT3 polymorphisms in the risk of Korean lung cancer, genotypes of the AKT2 and AKT3 polymorphisms (AKT2 -9826 C/G, AKT2 -9473 C/T, AKT2 -9151 C/T, AKT2 -9025 C/T, AKT2 -8618G/A, and AKT3 -675 A/- were determined in 360 lung cancer patients and 360 normal controls. Statistical analyses revealed that the genotypes and haplotypes in the AKT2 and AKT3 promoter regions were not significantly associated with the risk of lung cancer in the Korean population. These results suggest that polymorphisms of the AKT2 and AKT3 promoter regions do not contribute to the genetic susceptibility to lung cancer in the Korean population.
The Effect of the Retroperitoneal Transpsoas Minimally Invasive Lateral Interbody Fusion on Segmental and Regional Lumbar Lordosis

Directory of Open Access Journals (Sweden)

Tien V. Le

2012-01-01

Full Text Available Background. The minimally invasive lateral interbody fusion (MIS LIF in the lumbar spine can correct coronal Cobb angles, but the effect on sagittal plane correction is unclear. Methods. A retrospective review of thirty-five patients with lumbar degenerative disease who underwent MIS LIF without supplemental posterior instrumentation was undertaken to study the radiographic effect on the restoration of segmental and regional lumbar lordosis using the Cobb angles on pre- and postoperative radiographs. Mean disc height changes were also measured. Results. The mean follow-up period was 13.3 months. Fifty total levels were fused with a mean of 1.42 levels fused per patient. Mean segmental Cobb angle increased from 11.10° to 13.61° (<0.001 or 22.6%. L2-3 had the greatest proportional increase in segmental lordosis. Mean regional Cobb angle increased from 52.47° to 53.45° (=0.392. Mean disc height increased from 6.50 mm to 10.04 mm (<0.001 or 54.5%. Conclusions. The MIS LIF improves segmental lordosis and disc height in the lumbar spine but not regional lumbar lordosis. Anterior longitudinal ligament sectioning and/or the addition of a more lordotic implant may be necessary in cases where significant increases in regional lumbar lordosis are desired.
Regional Differences in Correlates of Daily Walking among Middle Age and Older Australian Rural Adults: Implications for Health Promotion

Directory of Open Access Journals (Sweden)

James Dollman

2016-01-01

Full Text Available Rural Australians are less physically active than their metropolitan counterparts, and yet very little is known of the candidate intervention targets for promoting physical activity in rural populations. As rural regions are economically, socially and environmentally diverse, drivers of regular physical activity are likely to vary between regions. This study explored the region-specific correlates of daily walking among middle age and older adults in rural regions with contrasting dominant primary industries. Participants were recruited through print and electronic media, primary care settings and community organisations. Pedometers were worn by 153 adults for at least four days, including a weekend day. A questionnaire identified potential intra-personal, social and environmental correlates of physical activity, according to a social ecological framework. Regression modelling identified independent correlates of daily walking separately in the two study regions. In one region, there were independent correlates of walking from all levels of the social ecological framework. In the other region, significant correlates of daily walking were almost all demographic (age, education and marital status. Participants living alone were less likely to be physically active regardless of region. This study highlights the importance of considering region-specific factors when designing strategies for promoting regular walking among rural adults.
Genetic recombination is targeted towards gene promoter regions in dogs.

Science.gov (United States)

Auton, Adam; Rui Li, Ying; Kidd, Jeffrey; Oliveira, Kyle; Nadel, Julie; Holloway, J Kim; Hayward, Jessica J; Cohen, Paula E; Greally, John M; Wang, Jun; Bustamante, Carlos D; Boyko, Adam R

2013-01-01

The identification of the H3K4 trimethylase, PRDM9, as the gene responsible for recombination hotspot localization has provided considerable insight into the mechanisms by which recombination is initiated in mammals. However, uniquely amongst mammals, canids appear to lack a functional version of PRDM9 and may therefore provide a model for understanding recombination that occurs in the absence of PRDM9, and thus how PRDM9 functions to shape the recombination landscape. We have constructed a fine-scale genetic map from patterns of linkage disequilibrium assessed using high-throughput sequence data from 51 free-ranging dogs, Canis lupus familiaris. While broad-scale properties of recombination appear similar to other mammalian species, our fine-scale estimates indicate that canine highly elevated recombination rates are observed in the vicinity of CpG rich regions including gene promoter regions, but show little association with H3K4 trimethylation marks identified in spermatocytes. By comparison to genomic data from the Andean fox, Lycalopex culpaeus, we show that biased gene conversion is a plausible mechanism by which the high CpG content of the dog genome could have occurred.
Identification of a novel temperature sensitive promoter in cho cells

Directory of Open Access Journals (Sweden)

Hesse Friedemann

2011-05-01

Full Text Available Abstract Background The Chinese hamster ovary (CHO expression system is the leading production platform for manufacturing biopharmaceuticals for the treatment of numerous human diseases. Efforts to optimize the production process also include the genetic construct encoding the therapeutic gene. Here we report about the successful identification of an endogenous highly active gene promoter obtained from CHO cells which shows conditionally inducible gene expression at reduced temperature. Results Based on CHO microarray expression data abundantly transcribed genes were selected as potential promoter candidates. The S100a6 (calcyclin and its flanking regions were identified from a genomic CHO-K1 lambda-phage library. Computational analyses showed a predicted TSS, a TATA-box and several TFBSs within the 1.5 kb region upstream the ATG start signal. Various constructs were investigated for promoter activity at 37°C and 33°C in transient luciferase reporter gene assays. Most constructs showed expression levels even higher than the SV40 control and on average a more than two-fold increase at lower temperature. We identified the core promoter sequence (222 bp comprising two SP1 sites and could show a further increase in activity by duplication of this minimal sequence. Conclusions This novel CHO promoter permits conditionally high-level gene expression. Upon a shift to 33°C, a two to three-fold increase of basal productivity (already higher than SV40 promoter is achieved. This property is of particular advantage for a process with reduced expression during initial cell growth followed by the production phase at low temperature with a boost in expression. Additionally, production of toxic proteins becomes feasible, since cell metabolism and gene expression do not directly interfere. The CHO S100a6 promoter can be characterized as cold-shock responsive with the potential for improving process performance of mammalian expression systems.

Exploring DNA methylation changes in promoter, intragenic, and intergenic regions as early and late events in breast cancer formation

International Nuclear Information System (INIS)

Rauscher, Garth H.; Kresovich, Jacob K.; Poulin, Matthew; Yan, Liying; Macias, Virgilia; Mahmoud, Abeer M.; Al-Alem, Umaima; Kajdacsy-Balla, Andre; Wiley, Elizabeth L.; Tonetti, Debra; Ehrlich, Melanie

2015-01-01

Breast cancer formation is associated with frequent changes in DNA methylation but the extent of very early alterations in DNA methylation and the biological significance of cancer-associated epigenetic changes need further elucidation. Pyrosequencing was done on bisulfite-treated DNA from formalin-fixed, paraffin-embedded sections containing invasive tumor and paired samples of histologically normal tissue adjacent to the cancers as well as control reduction mammoplasty samples from unaffected women. The DNA regions studied were promoters (BRCA1, CD44, ESR1, GSTM2, GSTP1, MAGEA1, MSI1, NFE2L3, RASSF1A, RUNX3, SIX3 and TFF1), far-upstream regions (EN1, PAX3, PITX2, and SGK1), introns (APC, EGFR, LHX2, RFX1 and SOX9) and the LINE-1 and satellite 2 DNA repeats. These choices were based upon previous literature or publicly available DNA methylome profiles. The percent methylation was averaged across neighboring CpG sites. Most of the assayed gene regions displayed hypermethylation in cancer vs. adjacent tissue but the TFF1 and MAGEA1 regions were significantly hypomethylated (p ≤0.001). Importantly, six of the 16 regions examined in a large collection of patients (105 – 129) and in 15-18 reduction mammoplasty samples were already aberrantly methylated in adjacent, histologically normal tissue vs. non-cancerous mammoplasty samples (p ≤0.01). In addition, examination of transcriptome and DNA methylation databases indicated that methylation at three non-promoter regions (far-upstream EN1 and PITX2 and intronic LHX2) was associated with higher gene expression, unlike the inverse associations between cancer DNA hypermethylation and cancer-altered gene expression usually reported. These three non-promoter regions also exhibited normal tissue-specific hypermethylation positively associated with differentiation-related gene expression (in muscle progenitor cells vs. many other types of normal cells). The importance of considering the exact DNA region analyzed and the
Lithium modulation of the human inositol monophosphatase 2 (IMPA2) promoter

International Nuclear Information System (INIS)

Seelan, Ratnam S.; Parthasarathy, Latha K.; Parthasarathy, Ranga N.

2004-01-01

The inositol-signaling pathway is a therapeutic target for lithium in the treatment of bipolar disorder. Inositol monophosphatases (IMPases) play a key role in inositol signaling. Lithium's ability to inhibit IMPase 1 is well known, but its effect on IMPase 2 or on the transcriptional regulation of these genes has not been studied. Here, we report the identification and characterization of the minimal promoter of IMPA2 (encoding IMPase 2) in HeLa (epithelial) and SK-N-AS (neuronal) cells. IMPA2 promoter activity appears to be contributed by different elements in the 5' flanking region, suggesting that the gene is differentially regulated in neuronal and non-neuronal cells. Furthermore, IMPA2 promoter activity in both cell lines is downregulated, in a dose-dependent manner, by lithium after treatment for only 24 h. This effect is also observed in vivo. Our results suggest a possible role for IMPA2 in bipolar disorder
Promoting survival: A grounded theory study of consequences of modern health practices in Ouramanat region of Iranian Kurdistan.

Science.gov (United States)

Mohammadpur, Ahmad; Rezaei, Mehdi; Sadeghi, Rasoul

2010-05-14

The aim of this qualitative study is to explore the way people using modern health care perceive its consequences in Ouraman-e-Takht region of Iranian Kurdistan. Ouraman-e-Takht is a rural, highly mountainous and dry region located in the southwest Kurdistan province of Iran. Recently, modern health practices have been introduced to the region. The purpose of this study was to investigate, from the Ouramains' point of view, the impact that modern health services and practices have had on the Ouraman traditional way of life. Interview data from respondents were analyzed by using grounded theory. Promoting survival was the core category that explained the impact that modern health practices have had on the Ouraman region. The people of Ouraman interpreted modern health practices as increasing their quality of life and promoting their survival. Results are organized around this core category in a paradigm model consisting of conditions, interactions, and consequences. This model can be used to understand the impact of change from the introduction of modern health on a traditional society.
Promoting survival: A grounded theory study of consequences of modern health practices in Ouramanat region of Iranian Kurdistan

Science.gov (United States)

Mohammadpur, Ahmad; Rezaei, Mehdi; Sadeghi, Rasoul

2010-01-01

The aim of this qualitative study is to explore the way people using modern health care perceive its consequences in Ouraman-e-Takht region of Iranian Kurdistan. Ouraman-e-Takht is a rural, highly mountainous and dry region located in the southwest Kurdistan province of Iran. Recently, modern health practices have been introduced to the region. The purpose of this study was to investigate, from the Ouramains' point of view, the impact that modern health services and practices have had on the Ouraman traditional way of life. Interview data from respondents were analyzed by using grounded theory. Promoting survival was the core category that explained the impact that modern health practices have had on the Ouraman region. The people of Ouraman interpreted modern health practices as increasing their quality of life and promoting their survival. Results are organized around this core category in a paradigm model consisting of conditions, interactions, and consequences. This model can be used to understand the impact of change from the introduction of modern health on a traditional society. PMID:20640020
Characterization and functional analysis of the Paralichthys olivaceus prdm1 gene promoter.

Science.gov (United States)

Li, Peizhen; Wang, Bo; Cao, Dandan; Liu, Yuezhong; Zhang, Quanqi; Wang, Xubo

2017-10-01

PR domain containing protein 1 (Prdm1) is a transcriptional repressor identified in various species and plays multiple important roles in immune response and embryonic development. However, little is known about the transcriptional regulation of the prdm1 gene. This study aims to characterize the promoter of Paralichthys olivaceus prdm1 (Po-prdm1) gene and determine the regulatory mechanism of Po-prdm1 expression. A 2000bp-long 5'-flanking region (translation initiation site designated as +1) of the Po-prdm1 gene was isolated and characterized. The regulatory elements in this fragment were then investigated and many putative transcription factor (TF) binding sites involved in immunity and multiple tissue development were identified. A 5'-deletion analysis was then conducted, and the ability of the deletion mutants to promote luciferase and green fluorescent protein (GFP) expression in a flounder gill cell line was examined. The results revealed that the minimal promoter is located in the region between -446 and -13bp, and the region between -1415 and -13bp enhanced the promoter activity. Site-directed mutation analysis was subsequently performed on the putative regulatory elements sites, and the results indicated that FOXP1, MSX and BCL6 binding sites play negative functional roles in the regulation of the Po-prdm1 expression in FG cells. In vivo analysis demonstrated that a GFP reporter gene containing 1.4kb-long promoter fragment (-1415/-13) was expressed in the head and trunk muscle fibres of transient transgenic zebrafish embryos. Our study provided the basic information for the exploration of Po-prdm1 regulation and expression. Copyright © 2017 Elsevier Inc. All rights reserved.
Allelic polymorphisms in the repeat and promoter regions of the interleukin-4 gene and malaria severity in Ghanaian children

DEFF Research Database (Denmark)

Gyan, B A; Goka, B; Cvetkovic, J T

2004-01-01

Immunoglobulin E has been associated with severe malaria suggesting a regulatory role for interleukin (IL)-4 and/or IgE in the pathogenesis of severe malaria. We have investigated possible associations between polymorphisms in the IL-4 repeat region (intron 3) and promoter regions (IL-4 +33CT and...
Health Promotion and Wellness Staffing Methods

National Research Council Canada - National Science Library

Thomsen, Kim

1999-01-01

.... Health promotion and wellness programs positively influence the military mission readiness and force protection, increase productivity, reduce health care costs, minimize illness and non-battle...
Implementation of Mamdani Fuzzy Method in Employee Promotion System

Science.gov (United States)

Zulfikar, W. B.; Jumadi; Prasetyo, P. K.; Ramdhani, M. A.

2018-01-01

Nowadays, employees are big assets to an institution. Every employee has a different educational background, degree, work skill, attitude and ethic that affect the performance. An institution including government institution implements a promotion system in order to improve the performance of the employees. Pangandaran Tourism, Industry, Trade, and SME Department is one of government agency that implements a promotion system to discover employees who deserve to get promotion. However, there are some practical deficiencies in the promotion system, one of which is the subjectivity issue. This work proposed a classification model that could minimize the subjectivity issue in employee promotion system. This paper reported a classification employee based on their eligibility for promotion. The degree of membership was decided using Mamdani Fuzzy based on determinant factors of the performance of employees. In the evaluation phase, this model had an accuracy of 91.4%. It goes to show that this model may minimize the subjectivity issue in the promotion system, especially at Pangandaran Tourism, Industry, Trade, and SME Department.
Hypermethylation of the DPYD promoter region is not a major predictor of severe toxicity in 5-fluorouracil based chemotherapy

Directory of Open Access Journals (Sweden)

Aebi Stefan

2008-10-01

Full Text Available Abstract Background The activity of dihydropyrimidine dehydrogenase (DPD, the key enzyme of pyrimidine catabolism, is thought to be an important determinant for the occurrence of severe toxic reactions to 5-fluorouracil (5-FU, which is one of the most commonly prescribed chemotherapeutic agents for the treatment of solid cancers. Genetic variation in the DPD gene (DPYD has been proposed as a main factor for variation in DPD activity in the population. However, only a small proportion of severe toxicities in 5-FU based chemotherapy can be explained with such rare deleterious DPYD mutations resulting in severe enzyme deficiencies. Recently, hypermethylation of the DPYD promoter region has been proposed as an alternative mechanism for DPD deficiency and thus as a major cause of severe 5-FU toxicity. Methods Here, the prognostic significance of this epigenetic marker with respect to severe 5-FU toxicity was assessed in 27 cancer patients receiving 5-FU based chemotherapy, including 17 patients experiencing severe toxic side effects following drug administration, none of which were carriers of a known deleterious DPYD mutation, and ten control patients. The methylation status of the DPYD promoter region in peripheral blood mononuclear cells was evaluated by analysing for each patient between 19 and 30 different clones of a PCR-amplified 209 base pair fragment of the bisulfite-modified DPYD promoter region. The fragments were sequenced to detect bisulfite-induced, methylation-dependent sequence differences. Results No evidence of DPYD promoter methylation was observed in any of the investigated patient samples, whereas in a control experiment, as little as 10% methylated genomic DNA could be detected. Conclusion Our results indicate that DYPD promoter hypermethylation is not of major importance as a prognostic factor for severe toxicity in 5-FU based chemotherapy.
Boundary Dpp promotes growth of medial and lateral regions of the Drosophila wing.

Science.gov (United States)

Barrio, Lara; Milán, Marco

2017-07-04

The gradient of Decapentaplegic (Dpp) in the Drosophila wing has served as a paradigm to characterize the role of morphogens in regulating patterning. However, the role of this gradient in regulating tissue size is a topic of intense debate as proliferative growth is homogenous. Here, we combined the Gal4/UAS system and a temperature-sensitive Gal80 molecule to induce RNAi-mediated depletion of dpp and characterise the spatial and temporal requirement of Dpp in promoting growth. We show that Dpp emanating from the AP compartment boundary is required throughout development to promote growth by regulating cell proliferation and tissue size. Dpp regulates growth and proliferation rates equally in central and lateral regions of the developing wing appendage and reduced levels of Dpp affects similarly the width and length of the resulting wing. We also present evidence supporting the proposal that graded activity of Dpp is not an absolute requirement for wing growth.
Fast nonconvex nonsmooth minimization methods for image restoration and reconstruction.

Science.gov (United States)

Nikolova, Mila; Ng, Michael K; Tam, Chi-Pan

2010-12-01

Nonconvex nonsmooth regularization has advantages over convex regularization for restoring images with neat edges. However, its practical interest used to be limited by the difficulty of the computational stage which requires a nonconvex nonsmooth minimization. In this paper, we deal with nonconvex nonsmooth minimization methods for image restoration and reconstruction. Our theoretical results show that the solution of the nonconvex nonsmooth minimization problem is composed of constant regions surrounded by closed contours and neat edges. The main goal of this paper is to develop fast minimization algorithms to solve the nonconvex nonsmooth minimization problem. Our experimental results show that the effectiveness and efficiency of the proposed algorithms.
Tissue specific promoters improve the localization of radiation-inducible gene expression

International Nuclear Information System (INIS)

Hallahan, Dennis; Kataoka, Yasushi; Kuchibhotla, Jaya; Virudachalam, Subbu; Weichselbaum, Ralph

1996-01-01

expression was quantified in vascular endothelial cells from large vessel (HUVEC) and small vessels (HMEC). We found cell-type specificity of radiation-induction. The promoter region from the ELAM gene gave no expression in cells that were not of endothelial cell origin and x-ray-induction of ELAM in the endothelium required the NFkB binding cis-acting element. ELAM induction was achieved at doses as low as 1 Gy, whereas induction of other radiation inducible genes required 5 to 10 Gy. Cells transfected with the minimal promoter (plasmid pTK-CAT) demonstrated no radiation induction. Expression of the CMV-LacZ genetic construct that was used as a negative control in each transfection was not altered by x-irradiation. Moreover, intravenous administration of liposomes containing a reporter gene linked to the ELAM promoter and a transcriptional amplification system were induced specifically at sites of x-irradiation in an animal model. Conclusions: Activation of transcription of the ELAM-1 promoter by ionizing radiation is a means of activating gene therapy within the vascular endothelium and demonstrates the feasibility of treating vascular lesions with noninvasive procedures. Tissue specific promoters (e. g., ELAM-1) combined with radiation inducible gene therapy improves the localization of gene therapy expression. These results have applications in intravascular brachytherapy for the prevention of blood vessel restenosis
Waste minimization at Chalk River Laboratories

Energy Technology Data Exchange (ETDEWEB)

Kranz, P.; Wong, P.C.F. [Atomic Energy of Canada Limited, Chalk River, ON (Canada)

2011-07-01

Waste minimization supports Atomic Energy of Canada Limited (AECL) Environment Policy with regard to pollution prevention and has positive impacts on the environment, human health and safety, and economy. In accordance with the principle of pollution prevention, the quantities and degree of hazard of wastes requiring storage or disposition at facilities within or external to AECL sites shall be minimized, following the principles of Prevent, Reduce, Reuse, and Recycle, to the extent practical. Waste minimization is an important element in the Waste Management Program. The Waste Management Program has implemented various initiatives for waste minimization since 2007. The key initiatives have focused on waste reduction, segregation and recycling, and included: 1) developed waste minimization requirements and recycling procedure to establish the framework for applying the Waste Minimization Hierarchy; 2) performed waste minimization assessments for the facilities, which generate significant amounts of waste, to identify the opportunities for waste reduction and assist the waste generators to develop waste reduction targets and action plans to achieve the targets; 3) implemented the colour-coded, standardized waste and recycling containers to enhance waste segregation; 4) established partnership with external agents for recycling; 5) extended the likely clean waste and recyclables collection to selected active areas; 6) provided on-going communications to promote waste reduction and increase awareness for recycling; and 7) continually monitored performance, with respect to waste minimization, to identify opportunities for improvement and to communicate these improvements. After implementation of waste minimization initiatives at CRL, the solid waste volume generated from routine operations at CRL has significantly decreased, while the amount of recyclables diverted from the onsite landfill has significantly increased since 2007. The overall refuse volume generated at
Waste minimization at Chalk River Laboratories

International Nuclear Information System (INIS)

Kranz, P.; Wong, P.C.F.

2011-01-01

Waste minimization supports Atomic Energy of Canada Limited (AECL) Environment Policy with regard to pollution prevention and has positive impacts on the environment, human health and safety, and economy. In accordance with the principle of pollution prevention, the quantities and degree of hazard of wastes requiring storage or disposition at facilities within or external to AECL sites shall be minimized, following the principles of Prevent, Reduce, Reuse, and Recycle, to the extent practical. Waste minimization is an important element in the Waste Management Program. The Waste Management Program has implemented various initiatives for waste minimization since 2007. The key initiatives have focused on waste reduction, segregation and recycling, and included: 1) developed waste minimization requirements and recycling procedure to establish the framework for applying the Waste Minimization Hierarchy; 2) performed waste minimization assessments for the facilities, which generate significant amounts of waste, to identify the opportunities for waste reduction and assist the waste generators to develop waste reduction targets and action plans to achieve the targets; 3) implemented the colour-coded, standardized waste and recycling containers to enhance waste segregation; 4) established partnership with external agents for recycling; 5) extended the likely clean waste and recyclables collection to selected active areas; 6) provided on-going communications to promote waste reduction and increase awareness for recycling; and 7) continually monitored performance, with respect to waste minimization, to identify opportunities for improvement and to communicate these improvements. After implementation of waste minimization initiatives at CRL, the solid waste volume generated from routine operations at CRL has significantly decreased, while the amount of recyclables diverted from the onsite landfill has significantly increased since 2007. The overall refuse volume generated at
Disrupted resting-state functional connectivity in minimally treated chronic schizophrenia.

Science.gov (United States)

Wang, Xijin; Xia, Mingrui; Lai, Yunyao; Dai, Zhengjia; Cao, Qingjiu; Cheng, Zhang; Han, Xue; Yang, Lei; Yuan, Yanbo; Zhang, Yong; Li, Keqing; Ma, Hong; Shi, Chuan; Hong, Nan; Szeszko, Philip; Yu, Xin; He, Yong

2014-07-01

The pathophysiology of chronic schizophrenia may reflect long term brain changes related to the disorder. The effect of chronicity on intrinsic functional connectivity patterns in schizophrenia without the potentially confounding effect of antipsychotic medications, however, remains largely unknown. We collected resting-state fMRI data in 21 minimally treated chronic schizophrenia patients and 20 healthy controls. We computed regional functional connectivity strength for each voxel in the brain, and further divided regional functional connectivity strength into short-range regional functional connectivity strength and long-range regional functional connectivity strength. General linear models were used to detect between-group differences in these regional functional connectivity strength metrics and to further systematically investigate the relationship between these differences and clinical/behavioral variables in the patients. Compared to healthy controls, the minimally treated chronic schizophrenia patients showed an overall reduced regional functional connectivity strength especially in bilateral sensorimotor cortex, right lateral prefrontal cortex, left insula and right lingual gyrus, and these regional functional connectivity strength decreases mainly resulted from disruption of short-range regional functional connectivity strength. The minimally treated chronic schizophrenia patients also showed reduced long-range regional functional connectivity strength in the bilateral posterior cingulate cortex/precuneus, and increased long-range regional functional connectivity strength in the right lateral prefrontal cortex and lingual gyrus. Notably, disrupted short-range regional functional connectivity strength mainly correlated with duration of illness and negative symptoms, whereas disrupted long-range regional functional connectivity strength correlated with neurocognitive performance. All of the results were corrected using Monte-Carlo simulation. This
Polymorphism in the oxytocin promoter region in patients with lactase non-persistence is not related to symptoms

Directory of Open Access Journals (Sweden)

Simrén Magnus

2009-11-01

Full Text Available Abstract Background Oxytocin and the oxytocin receptor have been demonstrated in the gastrointestinal (GI tract and have been shown to exert physiological effects on gut motility. The role for oxytocin in the pathophysiology of GI complaints is unknown. The aim of this study was to examine genetic variations or polymorphism of oxytocin (OXT and its receptor (OXTR genes in patients with GI complaints without visible organic abnormalities. Methods Genetic variants in the OXT promoter region, and in the OXTR gene in DNA samples from 131 rigorously evaluated patients with Irritable Bowel Syndrome (IBS, 408 homozygous subjects referred for lactase (LCT-13910 C>T, rs4988235 genotyping, and 299 asymptomatic blood donors were compared. One polymorphism related to the OXT gene (rs6133010 A>G and 4 related to the OXTR gene (rs1465386 G>T, rs3806675 G>A, rs968389 A>G, rs1042778 G>T were selected for genotyping using Applied Biosystems 7900 HT allele discrimination assays. Results There were no statistically significant differences in the genotype or allele frequencies in any of the SNPs when IBS patients were compared to healthy controls. Among subjects referred for lactase genotyping, the rs6133010 A>G OXT promoter A/G genotype tended to be more common in the 154 non-persistent (27.3% subjects than in the 254 lactase persistant (18.1% subjects and in the healthy controls (19.4% (p = 0.08. When direct comparing, the A/G genotype was less common in the OXT promoter region in controls (p = 0.09 and in subjects with lactase persistence (p = 0.03 compared to subjects with lactase non-persistence. When healthy controls were viewed according to their own LCT-13910 genotypes, the C/C lactase non-persistent controls had a higher frequency for the OXT promoter A/G genotype than LCT-13910 T/T lactase persistent controls (41.2% vs 13.1%. No significant differences in frequencies of the investigated OXTR SNPs were noted in this study. Conclusion The results suggest
Genetic polymorphisms within tumor necrosis factor gene promoter region: a role for susceptibility to ventilator-associated pneumonia.

Science.gov (United States)

Kotsaki, Antigoni; Raftogiannis, Maria; Routsi, Christina; Baziaka, Fotini; Kotanidou, Anastasia; Antonopoulou, Anastasia; Orfanos, Stylianos E; Katsenos, Chrisostomos; Koutoukas, Pantelis; Plachouras, Diamantis; Mandragos, Konstantinos; Giamarellos-Bourboulis, Evangelos J

2012-08-01

Debatable findings exist among various studies regarding the impact of single nucleotide polymorphisms (SNPs) within the promoter region of the tumor necrosis factor (TNF) gene for susceptibility to infections. Their impact was investigated in a cohort of mechanically ventilated patients who developed ventilator-associated pneumonia (VAP). Two-hundred and thirteen mechanically ventilated patients who developed VAP were enrolled. Genomic DNA was extracted and SNPs at the -376, -308 and -238 position of the promoter region of the TNF gene were assessed by restriction fragment length polymorphisms. Monocytes were isolated from 47 patients when they developed sepsis and stimulated by bacterial endotoxin for the production of TNFα and of interleukin-6 (IL-6). Patients were divided into two groups; 166 patients bearing only wild-type alleles of all three studied polymorphisms; and 47 patients carrying at least one A allele of the three studied SNPs. Time between start of mechanical ventilation and advent of VAP was significantly shorter in the second group than in the first group (log-rank: 4.416, p: 0.041). When VAP supervened, disease severity did not differ between groups. Stimulation of TNFα and of IL-6 was much greater by monocytes for patients carrying A alleles. Carriage of at least one A allele of the three studied SNPs at the promoter region of the TNF-gene is associated with shorter time to development of VAP but it is not associated with disease severity. Findings may be related with a role of the studied SNPs in the production of pro-inflammatory cytokines. Copyright © 2012 Elsevier Ltd. All rights reserved.
The minimal non-minimal standard model

International Nuclear Information System (INIS)

Bij, J.J. van der

2006-01-01

In this Letter I discuss a class of extensions of the standard model that have a minimal number of possible parameters, but can in principle explain dark matter and inflation. It is pointed out that the so-called new minimal standard model contains a large number of parameters that can be put to zero, without affecting the renormalizability of the model. With the extra restrictions one might call it the minimal (new) non-minimal standard model (MNMSM). A few hidden discrete variables are present. It is argued that the inflaton should be higher-dimensional. Experimental consequences for the LHC and the ILC are discussed
Four inducible promoters for controlled gene expression in the oleaginous yeast Rhodotorula toruloides

Directory of Open Access Journals (Sweden)

Alexander Michael Bedford Johns

2016-10-01

Full Text Available Rhodotorula (Rhodosporidium toruloides is an oleaginous yeast with great biotechnological potential, capable of accumulating lipid up to 70 % of its dry biomass, and of carotenoid biosynthesis. However, few molecular genetic tools are available for manipulation of this basidiomycete yeast and its high genomic GC content can make routine cloning difficult. We have developed plasmid vectors for transformation of R. toruloides which include elements for Saccharomyces cerevisiae in-yeast assembly; this method is robust to the assembly of GC-rich DNA and of large plasmids. Using such vectors we screened for controllable promoters, and identified inducible promoters from the genes NAR1, ICL1, CTR3 and MET16. These four promoters have independent induction/repression conditions and exhibit different levels and rates of induction in R. toruloides, making them appropriate for controllable transgene expression in different experimental situations. Nested deletions were used to identify regulatory regions in the four promoters, and to delimit the minimal inducible promoters, which are as small as 200 bp for the NAR1 promoter. The NAR1 promoter shows very tight regulation under repressed conditions as determined both by an EGFP reporter gene and by conditional rescue of a leu2 mutant. These new tools facilitate molecular genetic manipulation and controllable gene expression in R. toruloides.
Characterization of promoter of EgPAL1, a novel PAL gene from the oil palm Elaeis guineensis Jacq.

Science.gov (United States)

Yusuf, Chong Yu Lok; Abdullah, Janna Ong; Shaharuddin, Noor Azmi; Abu Seman, Idris; Abdullah, Mohd Puad

2018-02-01

The oil palm EgPAL1 gene promoter and its regulatory region were functional as a promoter in the heterologous system of Arabidopsis according to the cis-acting elements present in that region. The promoter was developmentally regulated, vascular tissue specific and responsive to water stress agents. Phenylalanine ammonia lyase (PAL, EC 4.3.1.24) is the key enzyme of the phenylpropanoid pathway which plays important roles in plant development and adaptation. To date, there is no report on the study of PAL from oil palm (Elaeis guineensis), an economically important oil crop. In this study, the 5' regulatory sequence of a highly divergent oil palm PAL gene (EgPAL1) was isolated and fused with GUS in Arabidopsis to create two transgenic plants carrying the minimal promoter with (2302 bp) and without its regulatory elements (139 bp). The regulatory sequence contained cis-acting elements known to be important for plant development and stress response including the AC-II element for lignin biosynthesis and several stress responsive elements. The promoter and its regulatory region were fully functional in Arabidopsis. Its activities were characterised by two common fundamental features of PAL which are responsive to plant internal developmental programme and external factors. The promoter was developmentally regulated in certain organs; highly active in young organs but less active or inactive in mature organs. The presence of the AC elements and global activity of the EgPAL1 promoter in all organs resembled the property of lignin-related genes. The existence of the MBS element and enhancement of the promoter activity by PEG reflected the behaviour of drought-responsive genes. Our findings provide a platform for evaluating oil palm gene promoters in the heterologous system of Arabidopsis and give insights into the activities of EgPAL1 promoter in oil palm.

Similarities in transcription factor IIIC subunits that bind to the posterior regions of internal promoters for RNA polymerase III

Directory of Open Access Journals (Sweden)

Matsutani Sachiko

2004-08-01

Full Text Available Abstract Background In eukaryotes, RNA polymerase III (RNAP III transcribes the genes for small RNAs like tRNAs, 5S rRNA, and several viral RNAs, and short interspersed repetitive elements (SINEs. The genes for these RNAs and SINEs have internal promoters that consist of two regions. These two regions are called the A and B blocks. The multisubunit transcription factor TFIIIC is required for transcription initiation of RNAP III; in transcription of tRNAs, the B-block binding subunit of TFIIIC recognizes a promoter. Although internal promoter sequences are conserved in eukaryotes, no evidence of homology between the B-block binding subunits of vertebrates and yeasts has been reported previously. Results Here, I reported the results of PSI-BLAST searches using the B-block binding subunits of human and Shizosacchromyces pombe as queries, showing that the same Arabidopsis proteins were hit with low E-values in both searches. Comparison of the convergent iterative alignments obtained by these PSI-BLAST searches revealed that the vertebrate, yeast, and Arabidopsis proteins have similarities in their N-terminal one-third regions. In these regions, there were three domains with conserved sequence similarities, one located in the N-terminal end region. The N-terminal end region of the B-block binding subunit of Saccharomyces cerevisiae is tentatively identified as a HMG box, which is the DNA binding motif. Although I compared the alignment of the N-terminal end regions of the B-block binding subunits, and their homologs, with that of the HMG boxes, it is not clear whether they are related. Conclusion Molecular phylogenetic analyses using the small subunit rRNA and ubiquitous proteins like actin and α-tubulin, show that fungi are more closely related to animals than either is to plants. Interestingly, the results obtained in this study show that, with respect to the B-block binding subunits of TFIIICs, animals appear to be evolutionarily closer to plants
Similarities in transcription factor IIIC subunits that bind to the posterior regions of internal promoters for RNA polymerase III.

Science.gov (United States)

Matsutani, Sachiko

2004-08-09

In eukaryotes, RNA polymerase III (RNAP III) transcribes the genes for small RNAs like tRNAs, 5S rRNA, and several viral RNAs, and short interspersed repetitive elements (SINEs). The genes for these RNAs and SINEs have internal promoters that consist of two regions. These two regions are called the A and B blocks. The multisubunit transcription factor TFIIIC is required for transcription initiation of RNAP III; in transcription of tRNAs, the B-block binding subunit of TFIIIC recognizes a promoter. Although internal promoter sequences are conserved in eukaryotes, no evidence of homology between the B-block binding subunits of vertebrates and yeasts has been reported previously. Here, I reported the results of PSI-BLAST searches using the B-block binding subunits of human and Shizosacchromyces pombe as queries, showing that the same Arabidopsis proteins were hit with low E-values in both searches. Comparison of the convergent iterative alignments obtained by these PSI-BLAST searches revealed that the vertebrate, yeast, and Arabidopsis proteins have similarities in their N-terminal one-third regions. In these regions, there were three domains with conserved sequence similarities, one located in the N-terminal end region. The N-terminal end region of the B-block binding subunit of Saccharomyces cerevisiae is tentatively identified as a HMG box, which is the DNA binding motif. Although I compared the alignment of the N-terminal end regions of the B-block binding subunits, and their homologs, with that of the HMG boxes, it is not clear whether they are related. Molecular phylogenetic analyses using the small subunit rRNA and ubiquitous proteins like actin and alpha-tubulin, show that fungi are more closely related to animals than either is to plants. Interestingly, the results obtained in this study show that, with respect to the B-block binding subunits of TFIIICs, animals appear to be evolutionarily closer to plants than to fungi.
Nuclear proteins interacting with the promoter region of the human granulocyte/macrophage colony-stimulating factor gene

International Nuclear Information System (INIS)

Shannon, M.F.; Gamble, J.R.; Vadas, M.A.

1988-01-01

The gene for human granulocyte/macrophage colony-stimulating factor (GM-CSF) is expressed in a tissue-specific as well as an activation-dependent manner. The interaction of nuclear proteins with the promoter region of the GM-CSF gene that is likely to be responsible for this pattern of GM-CSF expression was investigated. The authors show that nuclear proteins interact with DNA fragments from the GM-CSF promoter in a cell-specific manner. A region spanning two cytokine-specific sequences, cytokine 1 (CK-1, 5', GAGATTCCAC 3') and cytokine 2 (CK-2, 5' TCAGGTA 3') bound two nuclear proteins from GM-CSF-expressing cells in gel retardation assays. NF-GMb was inducible with phorbol 12-myristate 13-acetate and accompanied induction of GM-CSF message. NF-GMb was absent in cell lines not producing GM-CSF, some of which had other distinct binding proteins. NF-GMa and NF-GMb eluted from a heparin-Sepharose column at 0.3 and 0.6 M KCl, respectively. They hypothesize that the sequences CK-1 and CK-2 bind specific proteins and regulate GM-CSF transcription
US-India Technical Collaboration to Promote Regional Stability

International Nuclear Information System (INIS)

Killinger, Mark H.; Griggs, James R.; Apt, Kenneth E.; Doyle, James E.

2001-01-01

Two US-India documents were signed in 2000 that provided new impetus for scientific and technical cooperation between the two countries. The first document is the US-India Science and Technology Agreement, which is aimed at 'promoting scientific and technological cooperation between the people of their two countries.' The second is the US-India Joint Statement on Energy and Environment, which states 'the United States and India believe that energy and environment could be one of the most important areas of cooperation between the two countries.' In addition to the work already underway as part of these two agreements, DOE has established a US-India Science and Technology Initiative to utilize the expertise of DOE national laboratories to conduct activities that support US policy objectives in South Asia. PNNL and LANL are working with US agencies and the Indian government and scientific communities to identify appropriate non-sensitive areas for US-Indian technical collaboration. The objectives of such collaboration are to address visible national/international problems, build trust between the United States and India, and contribute to regional stability in South Asia. This paper describes research done on the Indian scientific organization and infrastructure, potential areas for collaboration, the approach for this engagement, and current status of the initiative.
US-INDIA TECHNICAL COLLABORATION TO PROMOTE REGIONAL STABILITY

International Nuclear Information System (INIS)

Killinger, M.H.; Griggs, J.R.; Apt, Kenneth E.; Doyle, J.E.

2001-01-01

Two US-India documents were signed in 2000 that provided new impetus for scientific and technical cooperation between the two countries. The first document is the US-India Science and Technology Agreement, which is aimed at 'promoting scientific and technological cooperation between the people of their two countries.' The second is the US-India Joint Statement on Energy and Environment, which states 'the United States and India believe that energy and environment could be one of the most important areas of cooperation between the two countries.' In addition to the work already underway as part of these two agreements, the US Department of Energy (DOE) has established a US-India Science and Technology Initiative to utilize the expertise of DOE national laboratories to conduct activities that support US policy objectives in South Asia. PNNL and LANL are working with US government agencies to identify appropriate non-sensitive, non-nuclear areas for US-Indian technical collaboration. The objectives of such collaboration are to address visible national and international problems, build trust between the United States and India, and contribute to regional stability in South Asia. This paper describes the approach for this engagement, the Indian scientific organization and infrastructure, potential areas for collaboration, and current status of the initiative.
The Promoter of AtUSP Is Co-regulated by Phytohormones and Abiotic Stresses in Arabidopsis thaliana.

Science.gov (United States)

Bhuria, Monika; Goel, Parul; Kumar, Sanjay; Singh, Anil K

2016-01-01

Universal stress proteins (USPs) are known to be expressed in response to various abiotic stresses in a wide variety of organisms, such as bacteria, archaebacteria, protists, algae, fungi, plants, and animals. However, in plants, biological function of most of the USPs still remains obscure. In the present study, Arabidopsis USP gene ( AtUSP ) showed induction in response to abscisic acid (ABA) and various abiotic stresses viz . heat, dehydration, salt, osmotic, and cold stresses. Additionally, in silico analysis of AtUSP promoter identified several cis -elements responsive to phytohormones and abiotic stresses such as ABRE, ERE, DRE, and HSE, etc. To functionally validate the AtUSP promoter, the 1115 bp region of promoter was characterized under phytohormone and abiotic stress treatments. Deletion analysis of promoter was carried out by cloning the full length promoter (D0) and its three 5' deletion derivatives, D1 (964 bp), D2 (660 bp), and D3 (503 bp) upstream of the β-glucuronidase (GUS) reporter gene, which were then stably transformed in Arabidopsis plants. The AtUSP promoter (D0) showed minimal activity under non-stress conditions which was enhanced in response to phytohormone treatments (ABA and ACC) and abiotic stresses such as dehydration, heat, cold, salt, and osmotic stresses. The seedlings harboring D1 and D2 deletion fragments showed constitutive GUS expression even under control condition with increased activity almost under all the treatments. However, D3 seedlings exhibited complete loss of activity under control condition with induction under ACC treatment, dehydration, heat, oxidative, salt, and osmotic stresses. Thus, present study clearly showed that AtUSP promoter is highly inducible by phytohormones and multiple abiotic stresses and it can be exploited as stress inducible promoter to generate multi-stress tolerant crops with minimal effects on their other important traits.
Minimalism

CERN Document Server

Obendorf, Hartmut

2009-01-01

The notion of Minimalism is proposed as a theoretical tool supporting a more differentiated understanding of reduction and thus forms a standpoint that allows definition of aspects of simplicity. This book traces the development of minimalism, defines the four types of minimalism in interaction design, and looks at how to apply it.
A Participatory Regional Partnership Approach to Promote Nutrition and Physical Activity Through Environmental and Policy Change in Rural Missouri.

Science.gov (United States)

Barnidge, Ellen K; Baker, Elizabeth A; Estlund, Amy; Motton, Freda; Hipp, Pamela R; Brownson, Ross C

2015-06-11

Rural residents are less likely than urban and suburban residents to meet recommendations for nutrition and physical activity. Interventions at the environmental and policy level create environments that support healthy eating and physical activity. Healthier Missouri Communities (Healthier MO) is a community-based research project conducted by the Prevention Research Center in St. Louis with community partners from 12 counties in rural southeast Missouri. We created a regional partnership to leverage resources and enhance environmental and policy interventions to improve nutrition and physical activity in rural southeast Missouri. Partners were engaged in a participatory action planning process that included prioritizing, implementing, and evaluating promising evidence-based interventions to promote nutrition and physical activity. Group interviews were conducted with Healthier MO community partners post intervention to evaluate resource sharing and sustainability efforts of the regional partnership. Community partners identified the benefits and challenges of resource sharing within the regional partnership as well as the opportunities and threats to long-term partnership sustainability. The partners noted that the regional participatory process was difficult, but the benefits outweighed the challenges. Regional rural partnerships may be an effective way to leverage relationships to increase the capacity of rural communities to implement environmental and policy interventions to promote nutrition and physical activity.
No evidence for promoter region methylation of the succinate dehydrogenase and fumarate hydratase tumour suppressor genes in breast cancer

Directory of Open Access Journals (Sweden)

Dobrovic Alexander

2009-09-01

Full Text Available Abstract Background Succinate dehydrogenase (SDH and fumarate hydratase (FH are tricarboxylic acid (TCA cycle enzymes that are also known to act as tumour suppressor genes. Increased succinate or fumarate levels as a consequence of SDH and FH deficiency inhibit hypoxia inducible factor-1α (HIF-1α prolyl hydroxylases leading to sustained HIF-1α expression in tumours. Since HIF-1α is frequently expressed in breast carcinomas, DNA methylation at the promoter regions of the SDHA, SDHB, SDHC and SDHD and FH genes was evaluated as a possible mechanism in silencing of SDH and FH expression in breast carcinomas. Findings No DNA methylation was identified in the promoter regions of the SDHA, SDHB, SDHC, SDHD and FH genes in 72 breast carcinomas and 10 breast cancer cell lines using methylation-sensitive high resolution melting which detects both homogeneous and heterogeneous methylation. Conclusion These results show that inactivation via DNA methylation of the promoter CpG islands of SDH and FH is unlikely to play a major role in sporadic breast carcinomas.
Minimizing Cyber-Plagiarism through Turnitin: Faculty’s & Students’ Perspectives

Directory of Open Access Journals (Sweden)

Holi Ibrahim Holi Ali

2013-03-01

Full Text Available This is an attempt to investigate and evaluate students’ and faculty’s experiences and understanding to the strengths and limitations of anti-plagiarism software, specifically, Turnitin and how it could be used to promote academic integrity among engineering students. 50 engineering students and 20 professors were surveyed and interviewed. The paper argues that although Turnitin is widely used these days to tackle and minimize plagiarism practices, however cyber-plagiarism is increasing and the software might be inadequate in fighting such practice. The paper also questions the effectiveness and limitations of the software in relation to current practices. The findings revealed that most of the respondents perceive Turnitin positively; limitations of the software are not many and they believed that the software is effective in detecting and minimizing plagiarism incidents among their students’ papers. The study puts forward some recommendations which might help practitioners in minimizing plagiarism practices.
Quantifying Surface Coal-Mining Patterns to Promote Regional Sustainability in Ordos, Inner Mongolia

Directory of Open Access Journals (Sweden)

Xiaoji Zeng

2018-04-01

Full Text Available Ordos became the new “coal capital” of China within a few decades since the country’s economic reform in 1978, as large-scale surface coal mining dramatically propelled its per capita GDP from being one of the lowest to one of the highest in China, exceeding Hong Kong in 2009. Surface coal-mining areas (SCMAs have continued to expand in this region during recent decades, resulting in serious environmental and socioeconomic consequences. To understand these impacts and promote regional sustainability, quantifying the spatiotemporal patterns of SCMAs is urgently needed. Thus, the main objectives of this study were to quantify the spatiotemporal patterns of SCMAs in the Ordos region from 1990 to 2015, and to examine some of the major environmental and socioeconomic impacts in the study region. We extracted the SCMAs using remote-sensing data, and then quantified their spatiotemporal patterns using landscape metrics. The loss of natural habitat and several socioeconomic indicators were examined in relation to surface coal mining. Our results show that the area of SCMAs increased from 7.12 km2 to 355.95 km2, an increase of nearly 49 times from 1990 to 2015 in the Ordos region. The number of SCMAs in this region increased from 82 to 651, a nearly seven-fold increase. In particular, Zhungeer banner (an administrative division, Yijinhuoluo banner, Dongsheng District and Dalate banner in the north-eastern part of the Ordos region had higher growth rates of SCMAs. The income gap between urban and rural residents increased along with the growth in SCMAs, undermining social equity in the Ordos region. Moreover, the rapid increase in SCMAs resulted in natural habitat loss (including grasslands, forests, and deserts across this region. Thus, we suggest that regional sustainability in Ordos needs to emphasize effective measures to curb large-scale surface coal mining in order to reduce the urban–rural income gap, and to restore degraded natural
Alternative sanitization methods for minimally processed lettuce in comparison to sodium hypochlorite.

Science.gov (United States)

Bachelli, Mara Lígia Biazotto; Amaral, Rívia Darla Álvares; Benedetti, Benedito Carlos

2013-01-01

Lettuce is a leafy vegetable widely used in industry for minimally processed products, in which the step of sanitization is the crucial moment for ensuring a safe food for consumption. Chlorinated compounds, mainly sodium hypochlorite, are the most used in Brazil, but the formation of trihalomethanes from this sanitizer is a drawback. Then, the search for alternative methods to sodium hypochlorite has been emerging as a matter of great interest. The suitability of chlorine dioxide (60 mg L(-1)/10 min), peracetic acid (100 mg L(-1)/15 min) and ozonated water (1.2 mg L(-1)/1 min) as alternative sanitizers to sodium hypochlorite (150 mg L(-1) free chlorine/15 min) were evaluated. Minimally processed lettuce washed with tap water for 1 min was used as a control. Microbiological analyses were performed in triplicate, before and after sanitization, and at 3, 6, 9 and 12 days of storage at 2 ± 1 °C with the product packaged on LDPE bags of 60 μm. It was evaluated total coliforms, Escherichia coli, Salmonella spp., psicrotrophic and mesophilic bacteria, yeasts and molds. All samples of minimally processed lettuce showed absence of E. coli and Salmonella spp. The treatments of chlorine dioxide, peracetic acid and ozonated water promoted reduction of 2.5, 1.1 and 0.7 log cycle, respectively, on count of microbial load of minimally processed product and can be used as substitutes for sodium hypochlorite. These alternative compounds promoted a shelf-life of six days to minimally processed lettuce, while the shelf-life with sodium hypochlorite was 12 days.
The promoter for intestinal cell kinase is head-to-head with F-Box 9 and contains functional sites for TCF7L2 and FOXA factors

Directory of Open Access Journals (Sweden)

Cohn Steven M

2010-05-01

Full Text Available Abstract Background Intestinal cell kinase (ICK; GeneID 22858 is a conserved MAPK and CDK-like kinase that is widely expressed in human tissues. Data from the Cancer Genome Anatomy Project indicated ICK mRNA is increased in cancer, and that its expression correlated with expression of mRNA for an uncharacterized F-box protein, FBX9 (GeneID: 26268. ICK and FBX9 genes are arranged head-to-head on opposite strands, with start sites for transcription separated by ~3.3 kb. We hypothesized ICK and FBX9 are potentially important genes in cancer controlled by a bidirectional promoter. Results We assessed promoter activity of the intergenic region in both orientations in cancer cell lines derived from breast (AU565, SKBR3, colon (HCT-15, KM12, and stomach (AGS cancers, as well as in embryonic human kidney (HEK293T cells. The intergenic segment was active in both orientations in all of these lines, and ICK promoter activity was greater than FBX9 promoter activity. Results from deletions and truncations defined a minimal promoter for ICK, and revealed that repressors and enhancers differentially regulate ICK versus FBX9 promoter activity. The ICK promoter contains consensus motifs for several FOX-family transcription factors that align when mouse and human are compared using EMBOSS. FOXA1 and FOXA2 increase luciferase activity of a minimal promoter 10-20 fold in HEK293T cells. Consensus sites for TCF7L2 (TCF4 (Gene Id: 6934 are also present in both mouse and human. The expression of β-catenin increased activity of the minimal promoter ~10 fold. ICK reference mRNAs (NM_014920.3, NM_016513 are expressed in low copy number and increased in some breast cancers, using a ten base tag 5'-TCAACCTTAT-3' specific for both ICK transcripts. Conclusion ICK and FBX9 are divergently transcribed from a bidirectional promoter that is GC-rich and contains a CpG island. A minimal promoter for ICK contains functional sites for β-cateinin/TCF7L2 and FOXA. These data are
Dissection of cis-regulatory element architecture of the rice oleosin gene promoters to assess abscisic acid responsiveness in suspension-cultured rice cells.

Science.gov (United States)

Kim, Sol; Lee, Soo-Bin; Han, Chae-Seong; Lim, Mi-Na; Lee, Sung-Eun; Yoon, In Sun; Hwang, Yong-Sic

2017-08-01

Oleosins are the most abundant proteins in the monolipid layer surrounding neutral storage lipids that form oil bodies in plants. Several lines of evidence indicate that they are physiologically important for the maintenance of oil body structure and for mobilization of the lipids stored inside. Rice has six oleosin genes in its genome, the expression of all of which was found to be responsive to abscisic acid (ABA) in our examination of mature embryo and aleurone tissues. The 5'-flanking region of OsOle5 was initially characterized for its responsiveness to ABA through a transient expression assay system using the protoplasts from suspension-cultured rice cells. A series of successive deletions and site-directed mutations identified five regions critical for the hormonal induction of its promoter activity. A search for cis-acting elements in these regions deposited in a public database revealed that they contain various promoter elements previously reported to be involved in the ABA response of various genes. A gain-of-function experiment indicated that multiple copies of all five regions were sufficient to provide the minimal promoter with a distinct ABA responsiveness. Comparative sequence analysis of the short, but still ABA-responsive, promoters of OsOle genes revealed no common modular architecture shared by them, indicating that various distinct promoter elements and independent trans-acting factors are involved in the ABA responsiveness of rice oleosin multigenes. Copyright © 2017 Elsevier GmbH. All rights reserved.
Minimal changes in health status questionnaires: distinction between minimally detectable change and minimally important change

Directory of Open Access Journals (Sweden)

Knol Dirk L

2006-08-01

Full Text Available Abstract Changes in scores on health status questionnaires are difficult to interpret. Several methods to determine minimally important changes (MICs have been proposed which can broadly be divided in distribution-based and anchor-based methods. Comparisons of these methods have led to insight into essential differences between these approaches. Some authors have tried to come to a uniform measure for the MIC, such as 0.5 standard deviation and the value of one standard error of measurement (SEM. Others have emphasized the diversity of MIC values, depending on the type of anchor, the definition of minimal importance on the anchor, and characteristics of the disease under study. A closer look makes clear that some distribution-based methods have been merely focused on minimally detectable changes. For assessing minimally important changes, anchor-based methods are preferred, as they include a definition of what is minimally important. Acknowledging the distinction between minimally detectable and minimally important changes is useful, not only to avoid confusion among MIC methods, but also to gain information on two important benchmarks on the scale of a health status measurement instrument. Appreciating the distinction, it becomes possible to judge whether the minimally detectable change of a measurement instrument is sufficiently small to detect minimally important changes.
The heptanucleotide motif GAGACGC is a key component of a cis-acting promoter element that is critical for SnSAG1 expression in Sarcocystis neurona.

Science.gov (United States)

Gaji, Rajshekhar Y; Howe, Daniel K

2009-07-01

The apicomplexan parasite Sarcocystis neurona undergoes a complex process of intracellular development, during which many genes are temporally regulated. The described study was undertaken to begin identifying the basic promoter elements that control gene expression in S. neurona. Sequence analysis of the 5'-flanking region of five S. neurona genes revealed a conserved heptanucleotide motif GAGACGC that is similar to the WGAGACG motif described upstream of multiple genes in Toxoplasma gondii. The promoter region for the major surface antigen gene SnSAG1, which contains three heptanucleotide motifs within 135 bases of the transcription start site, was dissected by functional analysis using a dual luciferase reporter assay. These analyses revealed that a minimal promoter fragment containing all three motifs was sufficient to drive reporter molecule expression, with the presence and orientation of the 5'-most heptanucleotide motif being absolutely critical for promoter function. Further studies should help to identify additional sequence elements important for promoter function and for controlling gene expression during intracellular development by this apicomplexan pathogen.
Analysis of the Impact of the Flow of Migrant Workers on Regional Economy: Based on the Thought about the Promotion of Jiangxi Regional Economic Competitiveness

Directory of Open Access Journals (Sweden)

Sun Yuping

2016-03-01

Full Text Available Labor resource is the necessary productive factor in regional economic development, and one of important indexes to evaluate regional economic competitiveness. The great economic achievement brought by the 30-year reform and opening up of China is due to the fact that China brought the backward advantage of “demographic dividend” into play, promoted the fast development of industrialization and urbanization, and became the second largest economy in the world. The entity of “demographic dividend” is the non-agricultural migrant population, i.e., migrant workers. The transfer employment of migrant workers has typical regional liquidity, and the imbalance of regional economy causes the flow of many migrant workers. In order to achieve harmonious development and coordinated development, underdeveloped areas must understand the character and regulation, adopt positive industrial policy and supportive policy, guide the reasonable flow of migrant workers, and realize the transfer of local employment and citizenization of migrant workers, which can enhance regional economic competitiveness
Selection against spurious promoter motifs correlates withtranslational efficiency across bacteria

Energy Technology Data Exchange (ETDEWEB)

Froula, Jeffrey L.; Francino, M. Pilar

2007-05-01

Because binding of RNAP to misplaced sites could compromise the efficiency of transcription, natural selection for the optimization of gene expression should regulate the distribution of DNA motifs capable of RNAP-binding across the genome. Here we analyze the distribution of the -10 promoter motifs that bind the {sigma}{sup 70} subunit of RNAP in 42 bacterial genomes. We show that selection on these motifs operates across the genome, maintaining an over-representation of -10 motifs in regulatory sequences while eliminating them from the nonfunctional and, in most cases, from the protein coding regions. In some genomes, however, -10 sites are over-represented in the coding sequences; these sites could induce pauses effecting regulatory roles throughout the length of a transcriptional unit. For nonfunctional sequences, the extent of motif under-representation varies across genomes in a manner that broadly correlates with the number of tRNA genes, a good indicator of translational speed and growth rate. This suggests that minimizing the time invested in gene transcription is an important selective pressure against spurious binding. However, selection against spurious binding is detectable in the reduced genomes of host-restricted bacteria that grow at slow rates, indicating that components of efficiency other than speed may also be important. Minimizing the number of RNAP molecules per cell required for transcription, and the corresponding energetic expense, may be most relevant in slow growers. These results indicate that genome-level properties affecting the efficiency of transcription and translation can respond in an integrated manner to optimize gene expression. The detection of selection against promoter motifs in nonfunctional regions also implies that no sequence may evolve free of selective constraints, at least in the relatively small and unstructured genomes of bacteria.
Physical and transcript map of the region between D6S264 and D6S149 on chromosome 6q27, the minimal region of allele loss in sporadic epithelial ovarian cancer

DEFF Research Database (Denmark)

Liu, Ying; Emilion, Gracy; Mungall, Andrew J

2002-01-01

We have previously shown a high frequency of allele loss at D6S193 (62%) on chromosomal arm 6q27 in ovarian tumours and mapped the minimal region of allele loss between D6S297 and D6S264 (3 cM). We isolated and mapped a single non-chimaeric YAC (17IA12, 260-280 kb) containing D6S193 and D6S297...
The role of COMESA in promoting intra-regional agricultural trade: Case study of Sudan

Directory of Open Access Journals (Sweden)

Azharia Abdelbagi Elbushra

2011-06-01

Full Text Available African countries have created many regional trade agreements with the economic objectives of reducing trade barriers and encouraging economic growth. The COMESA is an example of regional integration singed on 1993 by 19 African countries including Sudan. COMESA represents a chance for member countries to enhance their economic and social relations through increasing intra-trade. The objective of this paper is to assess the role of COMESA in promoting intra-regional agricultural trade between Sudan and COMESA countries. A multi-market model with Armington non-linear specification was applied. The paper results showed that there is a great potential for Sudan to increase its agricultural exports to other COMESA countries. The domestic agricultural markets are expected to be hampered by imports surge and increase in competition, while the producers of agricultural export commodities will be better off. In order to compete and benefit from potential in the COMESA markets, the paper recommended improving efficiency in the Sudanese agricultural sector through increasing productivity, lowering cost of production, enhancing marketing services, attaining economies of scale and attracting foreign investment.

Influence of promoter/enhancer region haplotypes on MGMT transcriptional regulation: a potential biomarker for human sensitivity to alkylating agents.

Science.gov (United States)

Xu, Meixiang; Nekhayeva, Ilona; Cross, Courtney E; Rondelli, Catherine M; Wickliffe, Jeffrey K; Abdel-Rahman, Sherif Z

2014-03-01

The O6-methylguanine-DNA methyltransferase gene (MGMT) encodes the direct reversal DNA repair protein that removes alkyl adducts from the O6 position of guanine. Several single-nucleotide polymorphisms (SNPs) exist in the MGMT promoter/enhancer (P/E) region. However, the haplotype structure encompassing these SNPs and their functional/biological significance are currently unknown. We hypothesized that MGMT P/E haplotypes, rather than individual SNPs, alter MGMT transcription and can thus alter human sensitivity to alkylating agents. To identify the haplotype structure encompassing the MGMT P/E region SNPs, we sequenced 104 DNA samples from healthy individuals and inferred the haplotypes using the data generated. We identified eight SNPs in this region, namely T7C (rs180989103), T135G (rs1711646), G290A (rs61859810), C485A (rs1625649), C575A (rs113813075), G666A (rs34180180), C777A (rs34138162) and C1099T (rs16906252). Phylogenetics and Sequence Evolution analysis predicted 21 potential haplotypes that encompass these SNPs ranging in frequencies from 0.000048 to 0.39. Of these, 10 were identified in our study population as 20 paired haplotype combinations. To determine the functional significance of these haplotypes, luciferase reporter constructs representing these haplotypes were transfected into glioblastoma cells and their effect on MGMT promoter activity was determined. Compared with the most common (reference) haplotype 1, seven haplotypes significantly upregulated MGMT promoter activity (18-119% increase; P alkylating agents.
Minimal surfaces

CERN Document Server

Dierkes, Ulrich; Sauvigny, Friedrich; Jakob, Ruben; Kuster, Albrecht

2010-01-01

Minimal Surfaces is the first volume of a three volume treatise on minimal surfaces (Grundlehren Nr. 339-341). Each volume can be read and studied independently of the others. The central theme is boundary value problems for minimal surfaces. The treatise is a substantially revised and extended version of the monograph Minimal Surfaces I, II (Grundlehren Nr. 295 & 296). The first volume begins with an exposition of basic ideas of the theory of surfaces in three-dimensional Euclidean space, followed by an introduction of minimal surfaces as stationary points of area, or equivalently
NMR characterisation of the minimal interacting regions of centrosomal proteins 4.1R and NuMA1: effect of phosphorylation

Directory of Open Access Journals (Sweden)

Bruix Marta

2010-01-01

Full Text Available Abstract Background Some functions of 4.1R in non-erythroid cells are directly related with its distinct sub-cellular localisation during cell cycle phases. During mitosis, 4.1R is implicated in cell cycle progression and spindle pole formation, and co-localizes with NuMA1. However, during interphase 4.1R is located in the nucleus and only partially co-localizes with NuMA1. Results We have characterized by NMR the structural features of the C-terminal domain of 4.1R and those of the minimal region (the last 64 residues involved in the interaction with NuMA1. This subdomain behaves as an intrinsically unfolded protein containing a central region with helical tendency. The specific residues implicated in the interaction with NuMA1 have been mapped by NMR titrations and involve the N-terminal and central helical regions. The segment of NuMA1 that interacts with 4.1R is phosphorylated during mitosis. Interestingly, NMR data indicates that the phosphorylation of NuMA1 interacting peptide provokes a change in the interaction mechanism. In this case, the recognition occurs through the central helical region as well as through the C-terminal region of the subdomain meanwhile the N-terminal region do not interact. Conclusions These changes in the interaction derived from the phosphorylation state of NuMA1 suggest that phosphorylation can act as subtle mechanism of temporal and spatial regulation of the complex 4.1R-NuMA1 and therefore of the processes where both proteins play a role.
Alternative sanitization methods for minimally processed lettuce in comparison to sodium hypochlorite

Directory of Open Access Journals (Sweden)

Mara Lígia Biazotto Bachelli

2013-09-01

Full Text Available Lettuce is a leafy vegetable widely used in industry for minimally processed products, in which the step of sanitization is the crucial moment for ensuring a safe food for consumption. Chlorinated compounds, mainly sodium hypochlorite, are the most used in Brazil, but the formation of trihalomethanes from this sanitizer is a drawback. Then, the search for alternative methods to sodium hypochlorite has been emerging as a matter of great interest. The suitability of chlorine dioxide (60 mg L-1/10 min, peracetic acid (100 mg L-1/15 min and ozonated water (1.2 mg L-1 /1 min as alternative sanitizers to sodium hypochlorite (150 mg L-1 free chlorine/15 min were evaluated. Minimally processed lettuce washed with tap water for 1 min was used as a control. Microbiological analyses were performed in triplicate, before and after sanitization, and at 3, 6, 9 and 12 days of storage at 2 ± 1 ºC with the product packaged on LDPE bags of 60 µm. It was evaluated total coliforms, Escherichia coli, Salmonella spp., psicrotrophic and mesophilic bacteria, yeasts and molds. All samples of minimally processed lettuce showed absence of E. coli and Salmonella spp. The treatments of chlorine dioxide, peracetic acid and ozonated water promoted reduction of 2.5, 1.1 and 0.7 log cycle, respectively, on count of microbial load of minimally processed product and can be used as substitutes for sodium hypochlorite. These alternative compounds promoted a shelf-life of six days to minimally processed lettuce, while the shelf-life with sodium hypochlorite was 12 days.
Identification, occurrence, and validation of DRE and ABRE Cis-regulatory motifs in the promoter regions of genes of Arabidopsis thaliana.

Science.gov (United States)

Mishra, Sonal; Shukla, Aparna; Upadhyay, Swati; Sanchita; Sharma, Pooja; Singh, Seema; Phukan, Ujjal J; Meena, Abha; Khan, Feroz; Tripathi, Vineeta; Shukla, Rakesh Kumar; Shrama, Ashok

2014-04-01

Plants posses a complex co-regulatory network which helps them to elicit a response under diverse adverse conditions. We used an in silico approach to identify the genes with both DRE and ABRE motifs in their promoter regions in Arabidopsis thaliana. Our results showed that Arabidopsis contains a set of 2,052 genes with ABRE and DRE motifs in their promoter regions. Approximately 72% or more of the total predicted 2,052 genes had a gap distance of less than 400 bp between DRE and ABRE motifs. For positional orientation of the DRE and ABRE motifs, we found that the DR form (one in direct and the other one in reverse orientation) was more prevalent than other forms. These predicted 2,052 genes include 155 transcription factors. Using microarray data from The Arabidopsis Information Resource (TAIR) database, we present 44 transcription factors out of 155 which are upregulated by more than twofold in response to osmotic stress and ABA treatment. Fifty-one transcripts from the one predicted above were validated using semiquantitative expression analysis to support the microarray data in TAIR. Taken together, we report a set of genes containing both DRE and ABRE motifs in their promoter regions in A. thaliana, which can be useful to understand the role of ABA under osmotic stress condition. © 2013 Institute of Botany, Chinese Academy of Sciences.
The relationship in Japanese infants between a genetic polymorphism in the promoter region of the insulin-like growth factor I gene and the plasma level.

Science.gov (United States)

Kinoshita, Yumiko; Kizaki, Zenro; Ishihara, Yasunori; Nakajima, Hisakazu; Adachi, Shinsuke; Kosaka, Kitaro; Kinugasa, Akihiko; Sugimoto, Tohru

2007-01-01

Evidence is accumulating that the promoter region of the insulin-like growth factor I (IGF-I) gene polymorphism and low levels of IGF-I are associated with type 2 diabetes, cardiovascular disease and birth weight; however, the number of wild-type alleles is different in each country. This study aimed to examine the 737/738 marker, a cytosine-adenine repeat in the promoter region of the IGF-I gene polymorphism, and plasma IGF-I levels in Japanese infants and analyze the genetic background. Data were collected for 15 months in Kyoto Prefectural University of Medicine. The body composition parameters of all infants were determined at birth. At 5 days after birth, we took blood samples to measure the product size of the promoter region of the IGF-I gene polymorphism and plasma IGF-I. In a population-based sample of 160 subjects, 6 different alleles and 16 genotypes were identified in the promoter region of the IGF-I gene polymorphism. The existence of a 196-bp allele has proved to result in a low plasma IGF-I level, a small head and chest circumference (p body composition parameters in Japanese infants. Our results suggest genetical influence on prenatal growth and serum IGF-I levels.
Carcass and meat quality determination as a tool to promote local meat consumption in outermost regions of Europe

DEFF Research Database (Denmark)

Hernandez Castellano, Lorenzo E; Morales-delaNuez, Antonio; Moreno-Indias, Isabel

2013-01-01

of this study, therefore, was to evaluate local and imported carcasses and meat quality in order to promote the consumption of local breeds, using the Canary Islands (Spain) as a model for other subtropical outermost regions. For this study 20 half-carcasses from Palmera breed and 20 imported half...
Development of model for studies on momentum transfer in electrochemical cells with entry region coil as turbulence promoter

Science.gov (United States)

Penta Rao, Tamarba; Rajendra Prasad, P.

2018-04-01

Entry region swirl promoters gain importance in industry because of its effectiveness in augmentation of mass and heat transfer augmentation. Design of equipment needs momentum transfer data along with mass or heat transfer data. Hence an experimental investigation was carried out with coaxially placed entry region spiral coil as turbulence promoters on momentum transfer in forced convection flow of electrolyte in circular conduits. Aqueous solution of sodium hydroxide and 0.01 M equimolal Ferri-ferro cyanide system was chosen for the study. The study covered parameters like effect of pitch of the coil, effect of length of the coil, diameter of the coil, diameter of the coil wire, diameter of the annular rod. The promoter is measured by limiting current technique using diffusion controlled electrochemical reactions. The study comprises of evaluation of momentum transfer rates at the outer wall of the electrochemical cell. Pressure drop measurements were also made to obtain the energy consumption pattern. Within the range of variables covered. The results are correlated by the momentum transfer similarity function. Momentum transfer coefficients were evaluated from measured limiting currents. Effect of each parameter was studied in terms of friction factor. A model was developed for momentum transfer. The experimental data on momentum transfer was modeled in terms of momentum transfer function and Reynolds number, geometric parameters.
Youth Sports Clubs' Potential as Health-Promoting Setting: Profiles, Motives and Barriers

Science.gov (United States)

Meganck, Jeroen; Scheerder, Jeroen; Thibaut, Erik; Seghers, Jan

2015-01-01

Setting and Objective: For decades, the World Health Organisation has promoted settings-based health promotion, but its application to leisure settings is minimal. Focusing on organised sports as an important leisure activity, the present study had three goals: exploring the health promotion profile of youth sports clubs, identifying objective…
Identification of the promoter region required for human adiponectin gene transcription: Association with CCAAT/enhancer binding protein-β and tumor necrosis factor-α

International Nuclear Information System (INIS)

Kita, Atsushi; Yamasaki, Hironori; Kuwahara, Hironaga; Moriuchi, Akie; Fukushima, Keiko; Kobayashi, Masakazu; Fukushima, Tetsuya; Takahashi, Ryoko; Abiru, Norio; Uotani, Shigeo; Kawasaki, Eiji; Eguchi, Katsumi

2005-01-01

Adiponectin, an adipose tissue-specific plasma protein, is involved in insulin sensitizing and has anti-atherosclerotic properties. Plasma levels of adiponectin are decreased in obese individuals and patients with type 2 diabetes with insulin resistance. Tumor necrosis factor-α (TNF-α) decreases the expression of adiponectin in adipocytes. The aims of the present study were: (1) to identify the promoter region responsible for basal transcription of the human adiponectin gene, and (2) to investigate the mechanism by which adiponectin was regulated by TNF-α. The human adiponectin promoter (2.1 kb) was isolated and used for luciferase reporter analysis by transient transfection into 3T3-L1 adipocytes. Deletion analysis demonstrated that the promoter region from -676 to +41 was sufficient for basal transcriptional activity. Mutation analysis of putative response elements for sterol regulatory element binding protein (SREBP) (-431 to -423) and CCAAT/enhancer binding protein (C/EBP) (-230 to -224) showed that both elements were required for basal promoter activity. Adiponectin transcription was increased 3-fold in cells that over-expressed constitutively active C/EBP-β. Electrophoretic mobility shift assay, using nuclear extract from 3T3-L1 cells and the -258 to -199 region as a probe, demonstrated specific DNA-protein binding, which was abolished by TNF-α treatment. The present data indicate that the putative response elements for SREBP and C/EBP are required for human adiponectin promoter activity, and that suppression by TNF-α may, at least in part, be associated with inactivation of C/EBP-β
Association between VNTR polymorphism in promoter region of prodynorphin (PDYN) gene and heroin dependence.

Science.gov (United States)

Saify, Khyber; Saadat, Iraj; Saadat, Mostafa

2014-11-30

Within the core promoter region of prodynorphin (PDYN), a 68-bp sequence was found to occur as a polymorphism element, either singular or as tandemly repeated two, three or four times. We report the sequence of a novel allele (5-repeats). Our study revealed the existence of an ancestral nucleotide (A) at 29th position of the VNTR in human. In total, 442 heroin addicts and 799 controls were included in this study. The present findings revealed a male-limited association between VNTR polymorphism and heroin dependence risk. Copyright © 2014 Elsevier Ireland Ltd. All rights reserved.
Core Promoter Structure in the Oomycete Phytophthora infestans

Science.gov (United States)

McLeod, Adele; Smart, Christine D.; Fry, William E.

2004-01-01

We have investigated the core promoter structure of the oomycete Phytophthora infestans. The transcriptional start sites (TSS) of three previously characterized P. infestans genes, Piexo1, Piexo3, and Piendo1, were determined by primer extension analyses. The TSS regions were homologous to a previously identified 16-nucleotide (nt) core sequence that overlaps the TSS in most oomycete genes. The core promoter regions of Piexo1 and Piendo1 were investigated by using a transient protoplast expression assay and the reporter gene β-glucuronidase. Mutational analyses of the promoters of Piexo1 and Piendo1 showed that there is a putative core promoter element encompassing the TSS (−2 to + 5) that has high sequence and functional homology to a known core promoter element present in other eukaryotes, the initiator element (Inr). Downstream and flanking the Inr is a highly conserved oomycete promoter region (+7 to + 15), hereafter referred to as FPR (flanking promoter region), which is also important for promoter function. The importance of the 19-nt core promoter region (Inr and FPR) in Piexo1 and Piendo1 was further investigated through electrophoretic mobility shift assays (EMSA). The EMSA studies showed that (i) both core promoters were able to specifically bind a protein or protein complex in a P. infestans whole-cell protein extract and (ii) the same mutations that reduced binding of the EMSA complex also reduced β-glucuronidase (GUS) levels in transient expression assays. The consistency of results obtained using two different assays (GUS transient assays [in vivo] and EMSA studies [in vitro]) supports a convergence of inference about the relative importance of specific nucleotides within the 19-nt core promoter region. PMID:14871940
Image denoising by a direct variational minimization

Directory of Open Access Journals (Sweden)

Pilipović Stevan

2011-01-01

Full Text Available Abstract In this article we introduce a novel method for the image de-noising which combines a mathematically well-posdenes of the variational modeling with the efficiency of a patch-based approach in the field of image processing. It based on a direct minimization of an energy functional containing a minimal surface regularizer that uses fractional gradient. The minimization is obtained on every predefined patch of the image, independently. By doing so, we avoid the use of an artificial time PDE model with its inherent problems of finding optimal stopping time, as well as the optimal time step. Moreover, we control the level of image smoothing on each patch (and thus on the whole image by adapting the Lagrange multiplier using the information on the level of discontinuities on a particular patch, which we obtain by pre-processing. In order to reduce the average number of vectors in the approximation generator and still to obtain the minimal degradation, we combine a Ritz variational method for the actual minimization on a patch, and a complementary fractional variational principle. Thus, the proposed method becomes computationally feasible and applicable for practical purposes. We confirm our claims with experimental results, by comparing the proposed method with a couple of PDE-based methods, where we get significantly better denoising results specially on the oscillatory regions.
Similarities in transcription factor IIIC subunits that bind to the posterior regions of internal promoters for RNA polymerase III

OpenAIRE

Matsutani Sachiko

2004-01-01

Abstract Background In eukaryotes, RNA polymerase III (RNAP III) transcribes the genes for small RNAs like tRNAs, 5S rRNA, and several viral RNAs, and short interspersed repetitive elements (SINEs). The genes for these RNAs and SINEs have internal promoters that consist of two regions. These two regions are called the A and B blocks. The multisubunit transcription factor TFIIIC is required for transcription initiation of RNAP III; in transcription of tRNAs, the B-block binding subunit of TFII...
Inter-organizational relations for regional development: an expansion policy promoted by the federal network of professional education, science & technology

Directory of Open Access Journals (Sweden)

Cleidson Nogueira Dias

2014-12-01

Full Text Available This research paper examines the importance of inter-organizational network management as a government policy tool to promote regional development. This pattern requires Federal Government intervention so as to compensate for the imbalance that this causes and to guarantee that economic growth resulting from government actions leads to development in all regions of the country, thereby avoiding the traditional mechanisms of wealth concentration. For this, a methodology of content analysis was used based on a relevant public policy aimed at promoting development within Brazil and by analyzing the data collected in relation to the current theory related to strategy, local development and inter-organizational networks in general. The analysis results show that, when the policy studied in this work, applied in the federal network of professional education, science & technology, was implemented the networks had a positive influence on the outcome of the policy objectives and represented an extremely powerful support tool, being one of the most important factors to boost development.
Commercial radioactive waste minimization program development guidance

International Nuclear Information System (INIS)

Fischer, D.K.

1991-01-01

This document is one of two prepared by the EG ampersand G Idaho, Inc., Waste Management Technical Support Program Group, National Low-Level Waste Management Program Unit. One of several Department of Energy responsibilities stated in the Amendments Act of 1985 is to provide technical assistance to compact regions Host States, and nonmember States (to the extent provided in appropriations acts) in establishing waste minimization program plans. Technical assistance includes, among other things, the development of technical guidelines for volume reduction options. Pursuant to this defined responsibility, the Department of Energy (through EG ampersand G Idaho, Inc.) has prepared this report, which includes guidance on defining a program, State/compact commission participation, and waste minimization program plans
Genome-wide Anaplasma phagocytophilum AnkA-DNA interactions are enriched in intergenic regions and gene promoters and correlate with infection-induced differential gene expression.

Directory of Open Access Journals (Sweden)

J Stephen Dumler

2016-09-01

Full Text Available Anaplasma phagocytophilum, an obligate intracellular prokaryote, infects neutrophils and alters cardinal functions via reprogrammed transcription. Large contiguous regions of neutrophil chromosomes are differentially expressed during infection. Secreted A. phagocytophilum effector AnkA transits into the neutrophil or granulocyte nucleus to complex with DNA in heterochromatin across all chromosomes. AnkA binds to gene promoters to dampen cis-transcription and also has features of matrix attachment region (MAR-binding proteins that regulate three-dimensional chromatin architecture and coordinate transcriptional programs encoded in topologically-associated chromatin domains. We hypothesize that identification of additional AnkA binding sites will better delineate how A. phagocytophilum infection results in reprogramming of the neutrophil genome. Using AnkA-binding ChIP-seq, we showed that AnkA binds broadly throughout all chromosomes in a reproducible pattern, especially at: i intergenic regions predicted to be matrix attachment regions (MARs; ii within predicted lamina-associated domains; and iii at promoters ≤3,000 bp upstream of transcriptional start sites. These findings provide genome-wide support for AnkA as a regulator of cis-gene transcription. Moreover, the dominant mark of AnkA in distal intergenic regions known to be AT-enriched, coupled with frequent enrichment in the nuclear lamina, provides strong support for its role as a MAR-binding protein and genome re-organizer. AnkA must be considered a prime candidate to promote neutrophil reprogramming and subsequent functional changes that belie improved microbial fitness and pathogenicity.
Promoter trans-activation of protooncogenes c-fos and c-myc, but not c-Ha-ras, by products of adenovirus early region 1A

International Nuclear Information System (INIS)

Sassone-Corsi, P.; Borrelli, E.

1987-01-01

The E1A (early region 1A) oncogene products of adenovirus type 2 trans-activate the other early viral transcription units, as well as some cellular promoters. Using a short-term cotransfection assay in murine NIH 3T3 fibroblasts, we show that c-fos and c-myc promoter activities are stimulated by the E1A proteins, whereas c-Ha-ras transcription is not affected. The product of E1A 13S mRNA is responsible for the trans-activation, whereas the 12S mRNA product has no effect. Analysis of the c-fos promoter sequences required for the E1A stimulation shows that responsive sequences are located between positions -402 and -240 upstream of the transcription initiation site. This same region also contains the c-fos serum-responsive element. Furthermore, transcription of the endogenous c-fos gene in HeLa cells is increased after E1A transfection
Structural and functional analysis of mouse Msx1 gene promoter: sequence conservation with human MSX1 promoter points at potential regulatory elements.

Science.gov (United States)

Gonzalez, S M; Ferland, L H; Robert, B; Abdelhay, E

1998-06-01

Vertebrate Msx genes are related to one of the most divergent homeobox genes of Drosophila, the muscle segment homeobox (msh) gene, and are expressed in a well-defined pattern at sites of tissue interactions. This pattern of expression is conserved in vertebrates as diverse as quail, zebrafish, and mouse in a range of sites including neural crest, appendages, and craniofacial structures. In the present work, we performed structural and functional analyses in order to identify potential cis-acting elements that may be regulating Msx1 gene expression. To this end, a 4.9-kb segment of the 5'-flanking region was sequenced and analyzed for transcription-factor binding sites. Four regions showing a high concentration of these sites were identified. Transfection assays with fragments of regulatory sequences driving the expression of the bacterial lacZ reporter gene showed that a region of 4 kb upstream of the transcription start site contains positive and negative elements responsible for controlling gene expression. Interestingly, a fragment of 130 bp seems to contain the minimal elements necessary for gene expression, as its removal completely abolishes gene expression in cultured cells. These results are reinforced by comparison of this region with the human Msx1 gene promoter, which shows extensive conservation, including many consensus binding sites, suggesting a regulatory role for them.
Composing a Tumor Specific Bacterial Promoter.

Directory of Open Access Journals (Sweden)

Igor V Deyneko

Full Text Available Systemically applied Salmonella enterica spp. have been shown to invade and colonize neoplastic tissues where it retards the growth of many tumors. This offers the possibility to use the bacteria as a vehicle for the tumor specific delivery of therapeutic molecules. Specificity of such delivery is solely depending on promoter sequences that control the production of a target molecule. We have established the functional structure of bacterial promoters that are transcriptionally active exclusively in tumor tissues after systemic application. We observed that the specific transcriptional activation is accomplished by a combination of a weak basal promoter and a strong FNR binding site. This represents a minimal set of control elements required for such activation. In natural promoters, additional DNA remodeling elements are found that alter the level of transcription quantitatively. Inefficiency of the basal promoter ensures the absence of transcription outside tumors. As a proof of concept, we compiled an artificial promoter sequence from individual motifs representing FNR and basal promoter and showed specific activation in a tumor microenvironment. Our results open possibilities for the generation of promoters with an adjusted level of expression of target proteins in particular for applications in bacterial tumor therapy.

Expression of the 90K immunostimulator gene is controlled by a promoter with unique features

DEFF Research Database (Denmark)

Brakebusch, C; Jallal, B; Fusco, O

1997-01-01

T3 cells; however, it contained neither a TATA-box nor a SP1 site and was not GC-rich. No known initiator motif was found around the transcription start site. 5'- and 3'-deletions defined a minimal promoter of 51 base pairs (-66 --> -16), not including the start site, essential and sufficient...... for promoter activity. This minimal promoter showed increased activity after stimulation with interferon-gamma or poly(I.C), a substance mimicking viral infection. Essential for both inductions was the integrity of an interferon regulatory factor element within this sequence, a potential binding site...
Minimal and contributing sequence determinants of the cis-acting locus of transfer (clt) of streptomycete plasmid pIJ101 occur within an intrinsically curved plasmid region.

Science.gov (United States)

Ducote, M J; Prakash, S; Pettis, G S

2000-12-01

Efficient interbacterial transfer of streptomycete plasmid pIJ101 requires the pIJ101 tra gene, as well as a cis-acting plasmid function known as clt. Here we show that the minimal pIJ101 clt locus consists of a sequence no greater than 54 bp in size that includes essential inverted-repeat and direct-repeat sequences and is located in close proximity to the 3' end of the korB regulatory gene. Evidence that sequences extending beyond the minimal locus and into the korB open reading frame influence clt transfer function and demonstration that clt-korB sequences are intrinsically curved raise the possibility that higher-order structuring of DNA and protein within this plasmid region may be an inherent feature of efficient pIJ101 transfer.
Genetic variation in the proximal promoter of ABC and SLC superfamilies: liver and kidney specific expression and promoter activity predict variation.

Directory of Open Access Journals (Sweden)

Stephanie E Hesselson

2009-09-01

Full Text Available Membrane transporters play crucial roles in the cellular uptake and efflux of an array of small molecules including nutrients, environmental toxins, and many clinically used drugs. We hypothesized that common genetic variation in the proximal promoter regions of transporter genes contribute to observed variation in drug response. A total of 579 polymorphisms were identified in the proximal promoters (-250 to +50 bp and flanking 5' sequence of 107 transporters in the ATP Binding Cassette (ABC and Solute Carrier (SLC superfamilies in 272 DNA samples from ethnically diverse populations. Many transporter promoters contained multiple common polymorphisms. Using a sliding window analysis, we observed that, on average, nucleotide diversity (pi was lowest at approximately 300 bp upstream of the transcription start site, suggesting that this region may harbor important functional elements. The proximal promoters of transporters that were highly expressed in the liver had greater nucleotide diversity than those that were highly expressed in the kidney consistent with greater negative selective pressure on the promoters of kidney transporters. Twenty-one promoters were evaluated for activity using reporter assays. Greater nucleotide diversity was observed in promoters with strong activity compared to promoters with weak activity, suggesting that weak promoters are under more negative selective pressure than promoters with high activity. Collectively, these results suggest that the proximal promoter region of membrane transporters is rich in variation and that variants in these regions may play a role in interindividual variation in drug disposition and response.
Silver nanoparticles: an alternative method for sanitization of minimally processed cabbage

Directory of Open Access Journals (Sweden)

Emiliane Andrade Araújo

2015-06-01

Full Text Available The minimal processing of vegetables basically aims to extend food shelf life, which depends on a number of factors, such as sanitization, that is considered a critical step for food microbiological quality. However, the usual antimicrobial agents reduce the microbial population in a maximum of two logarithmic cycles. Therefore, it is necessary to develop alternative sanitizers. This study aimed to increase the innocuity of minimally processed cabbage through sanitization with silver nanoparticles. It was observed that the nanoparticles promoted three logarithmic reductions, i.e. a 99.9 % reduction rate, in the Escherichia coli population inoculated on the cabbage surface. When compared to other antimicrobial agents (sodium dichloroisocyanurate and sodium hypochlorite, the nanoparticles were more efficient in sanitizing minimally processed cabbage, showing a lower count of aerobic mesophils. It was also observed that the cabbage surface presents hydrophobic characteristics, resulting in a higher propension for bacterial adhesion, which was confirmed in the thermodynamic evaluation of favorable adhesion for Staphylococcus aureus, Escherichia coli and Listeria innocua.
Tobacco advertising, promotion and sponsorship in entertainment media: a phenomenon requiring stronger controls in the Eastern Mediterranean Region.

Science.gov (United States)

El-Awa, Fatimah M S; El Naga, Randa Abou; Labib, Sahar; Latif, Nisreen Abdel

2018-04-05

Tobacco use and placement of tobacco products in television (TV) productions and movies is a way to promote tobacco use while avoiding tobacco advertising bans that exist in most countries. The fact that such productions are broadcast widely and viewed by millions, including children and young people, is of concern. This paper reviews the evidence on the use of tobacco advertising, promotion and sponsorship (TAPS) in TV and films in the Eastern Mediterranean Region and the ways to combat it. Evidence from Egypt shows considerable and increasing use of tobacco products by actors on screen, including female actors, in programmes aired during Ramadan in 2015-2017. A study of Iranian movies in 2015 showed that tobacco scenes in Iranian movies were increasing. In 2014, the WHO Regional Office for the Eastern Mediterranean held a consultative meeting on TAPS in drama. The consultation recommended regulating the tobacco presence in movies and TV through complete implementation of Article 13 of the WHO FCTC, and raising the issue to the WHO FCTC Conference of the Parties. In 2016, the Conference of the Parties called on parties to consider scaling up the implementation of WHO FCTC Article 13 and monitoring the use of TAPS in entertainment media in accordance with national legislation. A comprehensive approach is essential to end the tobacco industry's use of TV productions and movies to promote their products. Copyright © World Health Organization (WHO) 2018. Some rights reserved. This work is available under the CC BY-NC-SA 3.0 IGO license (https://creativecommons.org/licenses/by-nc-sa/3.0/igo).
Effect of Promoter Region Mutations and mgrA Overexpression on Transcription of norA, Which Encodes a Staphylococcus aureus Multidrug Efflux Transporter

OpenAIRE

Kaatz, Glenn W.; Thyagarajan, Rama V.; Seo, Susan M.

2005-01-01

NorA is a Staphylococcus aureus multidrug transporter that confers resistance to structurally distinct compounds. The MgrA global regulatory protein is reported to augment norA expression when mgrA is overexpressed from an undefined plasmid-based promoter. Further details about norA regulatory mechanisms are scant. A chromosomal norA::lacZ transcriptional fusion was constructed in different S. aureus strains, and allele replacement was used to define the relevance of promoter region sequences...
Porcine MYF6 gene: sequence, homology analysis, and variation in the promoter region.

Science.gov (United States)

Wyszyńska-Koko, J; Kurył, J

2004-01-01

MYF6 gene codes for the bHLH transcription factor belonging to MyoD family. Its expression accompanies the processes of differentiation and maturation of myotubes during embriogenesis and continues on a relatively high level after birth, affecting the muscle phenotype. The porcine MYF6 gene was amplified and sequenced and compared with MYF6 gene sequences of other species. The amino acid sequence was deduced and an interspecies homology analysis was performed. Myf-6 protein shows a high conservation among species of 99 and 97% identity when comparing pig with cow and human, respectively, and of 93% when comparing pig with mouse and rat. The single nucleotide polymorphism (SNP) was revealed within the promoter region, which appeared to be T --> C transition recognized by a MspI restriction enzyme.
Promoting appreciation of the study and practice of medicine: inner workings of a Mini-Med program

Directory of Open Access Journals (Sweden)

Lindenthal JJ

2012-06-01

Full Text Available Jacob Jay Lindenthal,1 Joel A DeLisa21Department of Psychiatry, Institute for the Public Understanding of Health and Medicine, 2Department of Physical Medicine and Rehabilitation, University of Medicine and Dentistry of New Jersey, New Jersey Medical School, Newark, NJ, USAAbstract: Dissatisfaction with the restrictions of the health care system, diminished reliance on the word of health care professionals, increased costs of medical care, and access to information online have increased consumers' interest in their own health care as well as their thirst for medical literacy. Mini-Med programs run by medical schools offer a more reliable method of learning about disease and disorders than does the indiscriminate surfing of the Internet. This article describes the efforts of the University of Medicine and Dentistry of New Jersey – the largest public university of the health sciences in the nation – to run and maintain such a program. The Mini-Med course provides lay students with insight into what a student undergoes while studying medicine and guides them through complex topics that range from anatomy and basic life support to the latest in stem cell research. It also provides early guidance for potential medical students, addresses patients' concerns, and gives some insight into the levels of comprehension of current medical students.Keywords: Mini-Med program, medical education, consumer education, health literacy
[Drug registries: post-marketing evaluation of the benefit-risk profile and promotion of appropriateness. The regional point of view].

Science.gov (United States)

Martelli, Luisa; Venegoni, Mauro

2013-06-01

Italian Regions and the Italian regulatory agency share a common interest in promoting the appropriateness of drug use, containing drug expenditure and acquiring additional evidence on the effectiveness and safety of drugs. Drug registries can help attaining these objectives. Specifically, the registries implemented in Italy were able to cover the first two objectives, whereas some critical issues were raised on the third one. For instance, the data recorded in the registries are not available at regional level to conduct safety and effectiveness investigations. This is a paradox, when considering that drugs included in the registries have a risk-benefit profile that is only partially defined at the moment of marketing. Currently, researchers and regions can conduct epidemiological research (cohort and case control studies), on the basis of record-linkage procedures, on all drugs prescribed in general practice (which are older drugs with a better defined risk-benefit profile). The expected outcomes of registries should be more clearly defined: when the main aim is to promote appropriateness, the recording of only a very limited amount of data should be required (to avoid a bureaucratic burden on clinicians).The Italian centers of the ENCePP network might play an important role in planning and conducting drug registries: through the presence in the steering committees of the registries, and in conducting epidemiological studies that make the most of this powerful instrument.
A scenario of vehicle-to-grid implementation and its double-layer optimal charging strategy for minimizing load variance within regional smart grids

International Nuclear Information System (INIS)

Jian, Linni; Zhu, Xinyu; Shao, Ziyun; Niu, Shuangxia; Chan, C.C.

2014-01-01

Highlights: • A scenario of vehicle-to-grid implementation within regional smart grid is discussed and mathematically formulated. • A double-layer optimal charging strategy for plug-in electric vehicles is proposed. • The proposed double-layer optimal charging algorithm aims to minimize power grid’s load variance. • The performance of proposed double-layer optimal charging algorithm is evaluated through comparative study. - Abstract: As an emerging new electrical load, plug-in electric vehicles (PEVs)’ impact on the power grid has drawn increasing attention worldwide. An optimal scenario is that by digging the potential of PEVs as a moveable energy storage device, they may not harm the power grid by, for example, triggering extreme surges in demand at rush hours, conversely, the large-scale penetration of PEVs could benefit the grid through flattening the power load curve, hence, increase the stability, security and operating economy of the grid. This has become a hot issue which is known as vehicle-to-grid (V2G) technology within the framework of smart grid. In this paper, a scenario of V2G implementation within regional smart grids is discussed. Then, the problem is mathematically formulated. It is essentially an optimization problem, and the objective is to minimize the overall load variance. With the increase of the scale of PEVs and charging posts involved, the computational complexity will become tremendously high. Therefore, a double-layer optimal charging (DLOC) strategy is proposed to solve this problem. The comparative study demonstrates that the proposed DLOC algorithm can effectively solve the problem of tremendously high computational complexity arising from the large-scaled PEVs and charging posts involved
Promoter-region hypermethylation and expression downregulation of Yy1 (Yin yang 1) in preneoplastic liver lesions in a thioacetamide rat hepatocarcinogenesis model

International Nuclear Information System (INIS)

Abe, Hajime; Ogawa, Takashi; Wang, Liyun; Kimura, Masayuki; Tanaka, Takeshi; Morita, Reiko; Yoshida, Toshinori; Shibutani, Makoto

2014-01-01

Thioacetamide (TAA) has been used to develop a rodent model for hepatocarcinogenesis. To determine the genes with epigenetic modifications in early hepatocarcinogenesis, we did a genome-wide scan for hypermethylated promoter regions using CpG island microarrays in TAA-promoted rat liver tissue. Eight genes were selected based on the microarray profile; of these, Yy1 and Wdr45b were confirmed to be hypermethylated by methylation-specific polymerase chain reaction (PCR) and pyrosequencing and downregulated by real-time reverse transcription PCR. Non-neoplastic liver cells had nuclear Yy1 immunoreactivity, while preneoplastic foci with glutathione S-transferase placental form (GST-P) immunoreactivity had decreased Yy1 immunoreactivity. The incidence of these foci was proportional to the dose of TAA administered. Co-expression analysis of gene products downstream of Yy1 revealed increased nuclear phospho-c-Myc + foci as well as nuclear and cytoplasmic p21 Cip1+ foci in Yy1 − or GST-P + foci in response to TAA-promotion dose. Although the absolute number of cells was low, the incidence of death receptor 5 − foci was increased in Yy1 − foci in proportion to the TAA dose. Yy1 − /GST-P + foci revealed a higher number of proliferating cell nuclear antigen (PCNA)-immunoreactive cells than Yy1 + /GST-P + foci, while cleaved caspase-3 + cells were unchanged between Yy1 – /GST-P + and Yy1 + /GST-P + foci. In the case of Wdr45b, most GST-P + foci were Wdr45b – and were not increased by TAA promotion. These results suggest involvement of Yy1 in the epigenetic gene regulation at the early stages of TAA promoted cell proliferation and concomitant cell cycle arrest in preneoplastic lesions. - Highlights: • Epigenetically downregulated genes were searched in TAA-promnoted rat livers. • Yy1 and Wdr45b showed promoter-region hypermethylation and mRNA downregulation. • TAA promoted increase of preneoplastic Yy1 – /GST-P + foci showing high proliferation. • TAA
ARCAL. Regional co-operative arrangements for the promotion of nuclear science and technology in Latin America, Phase I (1985-1990)

International Nuclear Information System (INIS)

Gillen, V.A.

1990-09-01

The Regional Co-operative Arrangement for the Promotion of Nuclear Science and Technology in Latin America, ARCAL, has completed its first five-year phase (1985-1989). This booklet summarizes the first phase of the ARCAL programme and contains descriptions of projects in the fields of agriculture, medicine, industry and energy
From waste minimization to ISO 14000: Taiwan`s experience and prospects

Energy Technology Data Exchange (ETDEWEB)

Wen-Huei Chen; Wain-Sun Hou [China Technical Consultants, Inc., Taipei (Taiwan, Province of China)

1996-12-31

Taiwan has completed a very successful five-year industrial waste minimization (IWM) demonstration and promotion project sponsored by the government. From 1990 to 1995, the project successfully disseminated the IWM concept of pollution prevention (P2) to industries. It effectively reduced industrial waste while significantly benefitting the economy by assisting industries in implementing in-plant IWM programs. In July 1995, the second stage of the five-year IWM and ISO 14000 promotion project was initiated for further promoting the IWM, P2, and cleaner production and, in particular, coping with the upcoming international environmental management standards (ISO 14000). To assist industries in establishing an environmental management system (EMS) and accumulating related experience, an EMS pilot demonstration project of five model industries and an ISO 14001 EMS demonstration and promotion project for 22 factories in 13 industries were initiated in October 1995 and August 1996, respectively. These projects can assist Taiwan`s industries in changing the constitution of their enterprises, enhancing competition in the international market, and helping our nation achieve the forerunner`s profits in sustainable development. 9 refs., 3 figs.
Insulin VNTR and IGF-1 promoter region polymorphisms are not associated with body composition in early childhood: The generation R study

NARCIS (Netherlands)

J.A.J.B.M. Maas (Janneke); D.O. Mook-Kanamori (Dennis); L. Ay (Lamise); R.P.M. Steegers-Theunissen (Régine); P. Tikka-Kleemola (Päivi); A. Hofman (Albert); A.C.S. Hokken-Koelega (Anita); V.W.V. Jaddoe (Vincent)

2010-01-01

textabstractObjective: The objective of this study was to examine the associations between insulin gene variable number of tandem repeats (INS VNTR) and insulin-like growth factor 1 (IGF1) gene promoter region polymorphisms with body composition in early childhood. Methods: This study was embedded
Promoting biogas production and using it as transport fuel in the Helsinki region; Suunnitelma liikennebiokaasun tuotannon ja kaeytoen edistaemiseksi Helsingin seudulla

Energy Technology Data Exchange (ETDEWEB)

Rasi, S.; Havukainen, J.; Uusitalo, V.; Andersson, R.; Manninen, K.; Aro-Heinilae, E.; Rintala, J.

2012-11-01

The main objective of the project was to promote biogas production and its use as transport fuel. The aims in the four Finnish and two Estonian case areas were to reduce the amount and improve the sustainable use of waste and sludge, to promote biogas production, to start biogas use as transport fuel and to provide tools for implementing the aims. The total biomethane potential in the Helsinki region corresponds to approximately 450 GWh/a. The most potential user for biomethane is public transport. The total amount of biomethane would suffice for 80% of the busses operating in the Helsinki region. Using biogas as a transport fuel instead of energy production in the Helsinki region would result in emission reductions (13 000 t{sub CO2,eq}/a). However if the fuel replacing biogas in energy production would be renewable, the emission reductions would be significantly greater. The economical assessment indicates that the production of biogas is economically feasible if all the produced gas can be sold. Biogas produced near the natural gas grid can also be transported to the Helsinki region where there are better possibilities to find uses for it. In this way, for example, gas that is produced in Kymenlaakso but is not consumed there can be transported via the natural gas grid, assuming that the production plant is reasonably close to the grid. (orig.)
Promoters of Escherichia coli versus promoter islands: function and structure comparison.

Directory of Open Access Journals (Sweden)

Valeriy V Panyukov

Full Text Available Expression of bacterial genes takes place under the control of RNA polymerase with exchangeable σ-subunits and multiple transcription factors. A typical promoter region contains one or several overlapping promoters. In the latter case promoters have the same or different σ-specificity and are often subjected to different regulatory stimuli. Genes, transcribed from multiple promoters, have on average higher expression levels. However, recently in the genome of Escherichia coli we found 78 regions with an extremely large number of potential transcription start points (promoter islands, PIs. It was shown that all PIs interact with RNA polymerase in vivo and are able to form transcriptionally competent open complexes both in vitro and in vivo but their transcriptional activity measured by oligonucleotide microarrays was very low, if any. Here we confirmed transcriptional defectiveness of PIs by analyzing the 5'-end specific RNA-seq data, but showed their ability to produce short oligos (9-14 bases. This combination of functional properties indicated a deliberate suppression of transcriptional activity within PIs. According to our data this suppression may be due to a specific conformation of the DNA double helix, which provides an ideal platform for interaction with both RNA polymerase and the histone-like nucleoid protein H-NS. The genomic DNA of E.coli contains therefore several dozen sites optimized by evolution for staying in a heterochromatin-like state. Since almost all promoter islands are associated with horizontally acquired genes, we offer them as specific components of bacterial evolution involved in acquisition of foreign genetic material by turning off the expression of toxic or useless aliens or by providing optimal promoter for beneficial genes. The putative molecular mechanism underlying the appearance of promoter islands within recipient genomes is discussed.
Phenomenology of R-parity violating minimal supergravity

International Nuclear Information System (INIS)

Bernhardt, M.A.

2008-02-01

We investigate in detail the low-energy spectrum of the P 6 violating minimal supergravity model using the SOFTSUSY spectrum code. We impose the experimental constraints from the measurement of the anomalous magnetic moment of the muon (g-2) μ , the b→sγ decay, the branching ration of B s →μ + μ - , as well as the mass bound from direct searches at colliders, in particular the Higgs boson and the lightest Chargino. We focus on regions, where the lightest neutralino is not the lightest supersymmetric particle (LSP). In these regions of parameter space either the lightest scalar tau or one of the sneutrinos is the LSP. We suggest four benchmark points with typical spectra and novel collider signatures which we investigate with a parton level Monte-Carlo simulation. We give an outlook for their detailed phenomenological analysis and simulation by the LHC collaborations, then including detector effects. In addition, we discuss a full Monte-Carlo simulation for single slepton production in association with a single top quark via an LQD type operator at the hadron colliders LHC and Tevatron. We present these results and show a predicted range of detectability for this process- for small couplings in various minimal supergravity models at the LHC. (orig.)
Phenomenology of R-parity violating minimal supergravity

Energy Technology Data Exchange (ETDEWEB)

Bernhardt, M.A.

2008-02-15

We investigate in detail the low-energy spectrum of the P{sub 6} violating minimal supergravity model using the SOFTSUSY spectrum code. We impose the experimental constraints from the measurement of the anomalous magnetic moment of the muon (g-2){sub {mu}}, the b{yields}s{gamma} decay, the branching ration of B{sub s}{yields}{mu}{sup +}{mu}{sup -}, as well as the mass bound from direct searches at colliders, in particular the Higgs boson and the lightest Chargino. We focus on regions, where the lightest neutralino is not the lightest supersymmetric particle (LSP). In these regions of parameter space either the lightest scalar tau or one of the sneutrinos is the LSP. We suggest four benchmark points with typical spectra and novel collider signatures which we investigate with a parton level Monte-Carlo simulation. We give an outlook for their detailed phenomenological analysis and simulation by the LHC collaborations, then including detector effects. In addition, we discuss a full Monte-Carlo simulation for single slepton production in association with a single top quark via an LQD type operator at the hadron colliders LHC and Tevatron. We present these results and show a predicted range of detectability for this process- for small couplings in various minimal supergravity models at the LHC. (orig.)
Deletion analysis of susy-sl promoter for the identification of optimal promoter sequence

International Nuclear Information System (INIS)

Bacha, S.; Khatoon, A.; Asif, M.; Bshir, A.

2015-01-01

The promoter region of sucrose synthase (susy-Sl) was identified and isolated from tomato. The 5? deletion analysis was carried out for the identification of minimum optimal promoter. Transgenic lines of Arabidopsis thaliana were developed by floral dip method incorporating various promoter deletion cassettes controlling GUS reporter gene. GUS assay of transgenic tissues indicated that full length susy-Sl promoter and its deletion mutants were constitutively expressed in vegetative and floral tissues of A. thaliana. The expression was observed in roots, shoots and flowers of A. thaliana. Analysis of 5? deletion series of susy-Sl promoter showed that a minimum of 679 bp fragment of the promoter was sufficient to drive expression of GUS reporter gene in the major tissues of transgenic A. thaliana. (author)
Promoting regional energy co-operation in South Asia

International Nuclear Information System (INIS)

Srivastava, Leena; Misra, Neha

2007-01-01

Energy is a key ingredient of the socio-economic development of any region. South Asia is not only one of the fastest growing regions in the world; it is also one of the poorest, which thus puts energy at the very heart of the development process in the region. This paper looks at the challenges faced by the South Asia sub-region for economic co-operation (SASEC) comprised of Bangladesh, Bhutan, India and Nepal, and also at the role of greater regional energy co-operation therein. The region is characterized by pressures of growing economies and increasing population. While the per capita energy consumption is one of the lowest in the world, energy intensity continues to be very high. A large portion of the population lacks access to modern sources of energy and depends on traditional sources that are not only inefficient but also have severe health and environmental problems associated with them. Increasing oil import dependency and huge investment needs for energy market development pose a further challenge. The region has a good resource potential and tremendous scope for energy co-operation, which can play a key role in addressing many of these energy security concerns and in putting it on the path of sustainable development. It is ironic that the record in the area has been so limited and that too in the most basic form of co-operation, i.e. bilateral arrangements between countries. This paper puts forth a multi-pronged strategy for sub-regional energy co-operation encompassing softer options aimed at confidence building to more substantial and larger scale co-operation efforts. Delays in decision making to ensure stronger and mutually beneficial co-operation efforts are associated with high costs not only to the energy sector but also for the entire development agenda. With the precarious energy situation in the region and unprecedented increases in international oil prices seen in recent times, it is high time for policy makers, financing institutions, NGOs

Minimization of Linear Functionals Defined on| Solutions of Large-Scale Discrete Ill-Posed Problems

DEFF Research Database (Denmark)

Elden, Lars; Hansen, Per Christian; Rojas, Marielba

2003-01-01

The minimization of linear functionals de ned on the solutions of discrete ill-posed problems arises, e.g., in the computation of con dence intervals for these solutions. In 1990, Elden proposed an algorithm for this minimization problem based on a parametric-programming reformulation involving...... the solution of a sequence of trust-region problems, and using matrix factorizations. In this paper, we describe MLFIP, a large-scale version of this algorithm where a limited-memory trust-region solver is used on the subproblems. We illustrate the use of our algorithm in connection with an inverse heat...
Likelihood analysis of the next-to-minimal supergravity motivated model

International Nuclear Information System (INIS)

Balazs, Csaba; Carter, Daniel

2009-01-01

In anticipation of data from the Large Hadron Collider (LHC) and the potential discovery of supersymmetry, we calculate the odds of the next-to-minimal version of the popular supergravity motivated model (NmSuGra) being discovered at the LHC to be 4:3 (57%). We also demonstrate that viable regions of the NmSuGra parameter space outside the LHC reach can be covered by upgraded versions of dark matter direct detection experiments, such as super-CDMS, at 99% confidence level. Due to the similarities of the models, we expect very similar results for the constrained minimal supersymmetric standard model (CMSSM).
Machine Learning Classification of Cirrhotic Patients with and without Minimal Hepatic Encephalopathy Based on Regional Homogeneity of Intrinsic Brain Activity.

Science.gov (United States)

Chen, Qiu-Feng; Chen, Hua-Jun; Liu, Jun; Sun, Tao; Shen, Qun-Tai

2016-01-01

Machine learning-based approaches play an important role in examining functional magnetic resonance imaging (fMRI) data in a multivariate manner and extracting features predictive of group membership. This study was performed to assess the potential for measuring brain intrinsic activity to identify minimal hepatic encephalopathy (MHE) in cirrhotic patients, using the support vector machine (SVM) method. Resting-state fMRI data were acquired in 16 cirrhotic patients with MHE and 19 cirrhotic patients without MHE. The regional homogeneity (ReHo) method was used to investigate the local synchrony of intrinsic brain activity. Psychometric Hepatic Encephalopathy Score (PHES) was used to define MHE condition. SVM-classifier was then applied using leave-one-out cross-validation, to determine the discriminative ReHo-map for MHE. The discrimination map highlights a set of regions, including the prefrontal cortex, anterior cingulate cortex, anterior insular cortex, inferior parietal lobule, precentral and postcentral gyri, superior and medial temporal cortices, and middle and inferior occipital gyri. The optimized discriminative model showed total accuracy of 82.9% and sensitivity of 81.3%. Our results suggested that a combination of the SVM approach and brain intrinsic activity measurement could be helpful for detection of MHE in cirrhotic patients.
Promoting appreciation of the study and practice of medicine: inner workings of a Mini-Med program.

Science.gov (United States)

Lindenthal, Jacob Jay; Delisa, Joel A

2012-01-01

Dissatisfaction with the restrictions of the health care system, diminished reliance on the word of health care professionals, increased costs of medical care, and access to information online have increased consumers' interest in their own health care as well as their thirst for medical literacy. Mini-Med programs run by medical schools offer a more reliable method of learning about disease and disorders than does the indiscriminate surfing of the Internet. This article describes the efforts of the University of Medicine and Dentistry of New Jersey - the largest public university of the health sciences in the nation - to run and maintain such a program. The Mini-Med course provides lay students with insight into what a student undergoes while studying medicine and guides them through complex topics that range from anatomy and basic life support to the latest in stem cell research. It also provides early guidance for potential medical students, addresses patients' concerns, and gives some insight into the levels of comprehension of current medical students.
Serotonin Transporter Promoter Region (5-HTTLPR) Polymorphism Is Not Associated With Paroxetine-Induced Ejaculation Delay in Dutch Men With Lifelong Premature Ejaculation

NARCIS (Netherlands)

Janssen, Paddy K C; Zwinderman, Aeilko H; Olivier, Berend; Waldinger, Marcel D

PURPOSE: To investigate the association between the 5-HT-transporter-gene-linked promoter region (5-HTTLPR) polymorphism and 20-mg paroxetine-induced ejaculation delay in men with lifelong premature ejaculation (LPE). MATERIALS AND METHODS: This was a prospective study of 10 weeks of paroxetine
A single-copy galK promoter cloning vector suitable for cloning strong promoters

DEFF Research Database (Denmark)

Dandanell, Gert; Court, Donald L.; Hammer, Karin

1986-01-01

We report the construction of lambda galK promoter cloning vectors for cloning and characterization of strong promoters. This phage, which contains a unique HindIII cloning site, was applied to the cloning and analysis of transcription initiations of the regulatory region of the deo-operon of...
Promotion and regional development. Implementation of regional productive development agencies. The case of Maule region, Chile

Directory of Open Access Journals (Sweden)

Enrique Yamil Alul González

2010-12-01

Full Text Available The Regional Productive Development Agencies implemented in Chile in 2006, were developed as a way to answer the longing desire to territorially decentralize, and that the own Regions be whom define their future. The Agencies have the responsibility to develop innovation and productive development Agendas in participative processes, which means with public, academic and private actors. Also, the Agencies have the mission to implement Competitive Improvement Plans-PMC (clusters in prioritized economic sectors by the own region. These PMC are leaded by private actors in each sector.
Genomic organization and promoter cloning of the human X11α gene APBA1.

LENUS (Irish Health Repository)

Chai, Ka-Ho

2012-05-01

X11α is a brain specific multi-modular protein that interacts with the Alzheimer\\'s disease amyloid precursor protein (APP). Aggregation of amyloid-β peptide (Aβ), an APP cleavage product, is believed to be central to the pathogenesis of Alzheimer\\'s disease. Recently, overexpression of X11α has been shown to reduce Aβ generation and to ameliorate memory deficit in a transgenic mouse model of Alzheimer\\'s disease. Therefore, manipulating the expression level of X11α may provide a novel route for the treatment of Alzheimer\\'s disease. Human X11α is encoded by the gene APBA1. As evidence suggests that X11α expression can be regulated at transcription level, we have determined the gene structure and cloned the promoter of APBA1. APBA1 spans over 244 kb on chromosome 9 and is composed of 13 exons and has multiple transcription start sites. A putative APBA1 promoter has been identified upstream of exon 1 and functional analysis revealed that this is highly active in neurons. By deletion analysis, the minimal promoter was found to be located between -224 and +14, a GC-rich region that contains a functional Sp3 binding site. In neurons, overexpression of Sp3 stimulates the APBA1 promoter while an Sp3 inhibitor suppresses the promoter activity. Moreover, inhibition of Sp3 reduces endogenous X11α expression and promotes the generation of Aβ. Our findings reveal that Sp3 play an essential role in APBA1 transcription.
A shared promoter region suggests a common ancestor for the human VCX/Y, SPANX, and CSAG gene families and the murine CYPT family

DEFF Research Database (Denmark)

Hansen, Martin A; Nielsen, John E; Retelska, Dorota

2008-01-01

, sequences corresponding to the shared promoter region of the CYPT family were identified at 39 loci. Most loci were located immediately upstream of genes belonging to the VCX/Y, SPANX, or CSAG gene families. Sequence comparison of the loci revealed a conserved CYPT promoter-like (CPL) element featuring TATA...... cell types. The genomic regions harboring the gene families were rich in direct and inverted segmental duplications (SD), which may facilitate gene conversion and rapid evolution. The conserved CPL and the common expression profiles suggest that the human VCX/Y, SPANX, and CSAG2 gene families together......Many testis-specific genes from the sex chromosomes are subject to rapid evolution, which can make it difficult to identify murine genes in the human genome. The murine CYPT gene family includes 15 members, but orthologs were undetectable in the human genome. However, using refined homology search...
Minimally invasive orthognathic surgery.

Science.gov (United States)

Resnick, Cory M; Kaban, Leonard B; Troulis, Maria J

2009-02-01

Minimally invasive surgery is defined as the discipline in which operative procedures are performed in novel ways to diminish the sequelae of standard surgical dissections. The goals of minimally invasive surgery are to reduce tissue trauma and to minimize bleeding, edema, and injury, thereby improving the rate and quality of healing. In orthognathic surgery, there are two minimally invasive techniques that can be used separately or in combination: (1) endoscopic exposure and (2) distraction osteogenesis. This article describes the historical developments of the fields of orthognathic surgery and minimally invasive surgery, as well as the integration of the two disciplines. Indications, techniques, and the most current outcome data for specific minimally invasive orthognathic surgical procedures are presented.
Regularity of Minimal Surfaces

CERN Document Server

Dierkes, Ulrich; Tromba, Anthony J; Kuster, Albrecht

2010-01-01

"Regularity of Minimal Surfaces" begins with a survey of minimal surfaces with free boundaries. Following this, the basic results concerning the boundary behaviour of minimal surfaces and H-surfaces with fixed or free boundaries are studied. In particular, the asymptotic expansions at interior and boundary branch points are derived, leading to general Gauss-Bonnet formulas. Furthermore, gradient estimates and asymptotic expansions for minimal surfaces with only piecewise smooth boundaries are obtained. One of the main features of free boundary value problems for minimal surfaces is t
Serotonin Transporter Promoter Region (5-HTTLPR) Polymorphism Is Not Associated With Paroxetine-Induced Ejaculation Delay in Dutch Men With Lifelong Premature Ejaculation

NARCIS (Netherlands)

Janssen, Paddy K. C.; Zwinderman, Aeilko H.; Olivier, Berend; Waldinger, Marcel D.

2014-01-01

To investigate the association between the 5-HT-transporter-gene-linked promoter region (5-HTTLPR) polymorphism and 20-mg paroxetine-induced ejaculation delay in men with lifelong premature ejaculation (LPE). This was a prospective study of 10 weeks of paroxetine treatment in 54 men with LPE.
Minimal Poems Written in 1979 Minimal Poems Written in 1979

Directory of Open Access Journals (Sweden)

Sandra Sirangelo Maggio

2008-04-01

Full Text Available The reading of M. van der Slice's Minimal Poems Written in 1979 (the work, actually, has no title reminded me of a book I have seen a long time ago. called Truth, which had not even a single word printed inside. In either case we have a sample of how often excentricities can prove efficient means of artistic creativity, in this new literary trend known as Minimalism. The reading of M. van der Slice's Minimal Poems Written in 1979 (the work, actually, has no title reminded me of a book I have seen a long time ago. called Truth, which had not even a single word printed inside. In either case we have a sample of how often excentricities can prove efficient means of artistic creativity, in this new literary trend known as Minimalism.
A golden A5 model of leptons with a minimal NLO correction

International Nuclear Information System (INIS)

Cooper, Iain K.; King, Stephen F.; Stuart, Alexander J.

2013-01-01

We propose a new A 5 model of leptons which corrects the LO predictions of Golden Ratio mixing via a minimal NLO Majorana mass correction which completely breaks the original Klein symmetry of the neutrino mass matrix. The minimal nature of the NLO correction leads to a restricted and correlated range of the mixing angles allowing agreement within the one sigma range of recent global fits following the reactor angle measurement by Daya Bay and RENO. The minimal NLO correction also preserves the LO inverse neutrino mass sum rule leading to a neutrino mass spectrum that extends into the quasi-degenerate region allowing the model to be accessible to the current and future neutrinoless double beta decay experiments
DNMT 1 maintains hypermethylation of CAG promoter specific region and prevents expression of exogenous gene in fat-1 transgenic sheep.

Science.gov (United States)

Yang, Chunrong; Shang, Xueying; Cheng, Lei; Yang, Lei; Liu, Xuefei; Bai, Chunling; Wei, Zhuying; Hua, Jinlian; Li, Guangpeng

2017-01-01

Methylation is an important issue in gene expression regulation and also in the fields of genetics and reproduction. In this study, we created fat-1 transgenic sheep, investigated the fine-mapping and the modulatory mechanisms of promoter methylation. Sheep fetal fibroblasts were transfected by pCAG-fat1-IRES-EGFP. Monoclonal cell line was screened as nuclear donor and carried out nuclear transfer (441 transgenic cloned embryos, 52 synchronism recipient sheep). Six offsprings were obtained. Expressions of exogenous genes fat-1 and EGFP were detectable in 10 examined tissues and upregulated omega-3 fatty acid content. Interestingly, more or less EGFP negative cells were detectable in the positive transgenic fetal skin cells. EGFP negative and positive cells were sorted by flow cytometry, and their methylation status in the whole promoter region (1701 nt) were investigated by bisulphate sequencing. The fine-mapping of methylation in CAG promoter were proposed. The results suggested that exogenous gene expression was determined by the methylation status from 721-1346 nt and modulated by methylation levels at 101, 108 and 115 nt sites in CAG promoter. To clarify the regulatory mechanism of methylation, examination of four DNA methyltransferases (DNMTs) demonstrated that hypermethylation of CAG promoter is mainly maintained by DNMT 1 in EGFP negative cells. Furthermore, investigation of the cell surface antigen CD34, CD45 and CD166 indicated that EGFP positive and negative cells belong to different types. The present study systematically clarified methylation status of CAG promoter in transgenic sheep and regulatory mechanism, which will provide research strategies for gene expression regulation in transgenic animals.
Correlates of minimal dating.

Science.gov (United States)

Leck, Kira

2006-10-01

Researchers have associated minimal dating with numerous factors. The present author tested shyness, introversion, physical attractiveness, performance evaluation, anxiety, social skill, social self-esteem, and loneliness to determine the nature of their relationships with 2 measures of self-reported minimal dating in a sample of 175 college students. For women, shyness, introversion, physical attractiveness, self-rated anxiety, social self-esteem, and loneliness correlated with 1 or both measures of minimal dating. For men, physical attractiveness, observer-rated social skill, social self-esteem, and loneliness correlated with 1 or both measures of minimal dating. The patterns of relationships were not identical for the 2 indicators of minimal dating, indicating the possibility that minimal dating is not a single construct as researchers previously believed. The present author discussed implications and suggestions for future researchers.
Association of human liver bilirubin UDP-glucuronyltransferase activity with a polymorphism in the promoter region of the UGT1A1 gene

NARCIS (Netherlands)

Raijmakers, MTM; Jansen, PLM; Steegers, EAP; Peters, WHM

Background/Aims: Gilbert's syndrome is a benign form of a deficiency in bilirubin glucuronidation. It is associated with a homozygous polymorphism, A(TA)(7)TAA instead of A(TA)(6)TAA, in the TATA-box of the promoter region of the bilirubin UDP-glucuronyltransferase gene. In this study the
Promoting appreciation of the study and practice of medicine: inner workings of a Mini-Med program

Science.gov (United States)

Lindenthal, Jacob Jay; DeLisa, Joel A

2012-01-01

Dissatisfaction with the restrictions of the health care system, diminished reliance on the word of health care professionals, increased costs of medical care, and access to information online have increased consumers’ interest in their own health care as well as their thirst for medical literacy. Mini-Med programs run by medical schools offer a more reliable method of learning about disease and disorders than does the indiscriminate surfing of the Internet. This article describes the efforts of the University of Medicine and Dentistry of New Jersey – the largest public university of the health sciences in the nation – to run and maintain such a program. The Mini-Med course provides lay students with insight into what a student undergoes while studying medicine and guides them through complex topics that range from anatomy and basic life support to the latest in stem cell research. It also provides early guidance for potential medical students, addresses patients’ concerns, and gives some insight into the levels of comprehension of current medical students. PMID:23762004
Strategies to promote a climate of academic integrity and minimize student cheating and plagiarism.

Science.gov (United States)

Scanlan, Craig L

2006-01-01

Student academic misconduct is a growing problem for colleges and universities, including those responsible for preparing health professionals. Although the implementation of honor codes has had a positive impact on this problem, further reduction in student cheating and plagiarism can be achieved only via a comprehensive strategy that promotes an institutional culture of academic integrity. Such a strategy must combine efforts both to deter and detect academic misconduct, along with fair but rigorous application of sanctions against such behaviors. Methods useful in preventing or deterring dishonest behaviors among students include early integrity training complemented with course-level reinforcement, faculty role-modeling, and the application of selected testing/assignment preventive strategies, including honor pledges and honesty declarations. Giving students more responsibility for oversight of academic integrity also may help address this problem and better promote the culture needed to uphold its principles. Successful enforcement requires that academic administration provide strong and visible support for upholding academic integrity standards, including the provision of a clear and fair process and the consistent application of appropriate sanctions against those whose conduct is found to violate these standards.
Minimal Super Technicolor

DEFF Research Database (Denmark)

Antola, M.; Di Chiara, S.; Sannino, F.

2011-01-01

We introduce novel extensions of the Standard Model featuring a supersymmetric technicolor sector (supertechnicolor). As the first minimal conformal supertechnicolor model we consider N=4 Super Yang-Mills which breaks to N=1 via the electroweak interactions. This is a well defined, economical......, between unparticle physics and Minimal Walking Technicolor. We consider also other N =1 extensions of the Minimal Walking Technicolor model. The new models allow all the standard model matter fields to acquire a mass....

South Asia's health promotion kaleidoscope.

Science.gov (United States)

Mukhopadhyay, Alok

2007-01-01

South Asia has 22 percent of the world's population but only 1.3 percent of the global income. Consequently 40 percent of the population is living in absolute poverty. However the health transition in some of its countries including India and Sri Lanka is a testimony to the fact that there are proven solutions to the problems of health and development within the region. The countries of the region have much in common, including a democratic political system, four major religions, a vibrant and living tradition of voluntarism and an extensive health infrastructure which is operating well below par. Despite the underlying unity, South Asia enjoys enormous cultural, linguistic and ethnic diversity. In this large, complex and vibrant region, health promotion is a challenging task, but it also holds the key to a dramatic change in the global health situation. Many of these solutions lie in wider areas of socio-political action. There are much needed shifts in the health promotion and development efforts, particularly in the area of poverty and social justice; gender inequity; population stabilisation; health and environment; control of communicable and non-communicable diseases; and urban health strategies. The principle of cooperation, partnership and intersectoral collaboration for health will be explored. Developing an appropriate, sustainable and people centred health and development strategy in the coming decades is an enormous challenge. There has been an attempt to focus on the emerging needs of the region, which call for health promotion, and involvement of civil society, private sector and the governments bestowed with the increased responsibility of ensuring health security for people. Strengthening the existing health systems, allocating adequate resources for health development and ensuring community participation are all prerequisites to the success of health promotion in the region.
Scientific Collaboration Along the Trinational Frontier of Brazil-Bolivia-Peru: Implications for Regional Land-Use in the MAP Region of Southwestern Amazonia

Science.gov (United States)

Brown, I.

2002-12-01

High-speed road systems are connecting southwestern Amazonia (~1.5 million km2) to Pacific and Atlantic ports as well as providing greater access to Brazilian, Bolivian and Peruvian urban markets. Coupled with this increased accessibility are ambitious governmental plans to expand production of timber, non-timber forest products, and beef, all of which are likely to modify human migrations in the region. The heart of southwestern Amazonia lies in the trinational frontier region of Madre de Dios Department/Peru, eastern Acre State/Brazil and Pando Department/Bolivia (MAP region: ~200,000 km2, ~500,000 inhabitants). The MAP region composes a global hot spot of terrestrial biodiversity and has become an axis of integration for the three countries. Faced with rapid change in socioeconomic trends, regional environmental scientists and professionals have promoted collaborative projects to analyze land use trends and their forcing functions and to supply these results to local and regional societies. In addition, they have begun to develop a regional scientific community that bridges different nationalities and specialties. The projects are both international - as they involve three countries - and local/regional as they involve institutions that are within a radius of 300 km of the border. In the past two years, LBA-sponsored activities have helped bring over 100 professionals together in the region in five MAP-oriented workshops. The research results are now influencing public policy and are being incorporated into the regional school systems with the objective of maximizing the benefits and minimizing the adverse impacts of the changing socio-economic trends on land-use and development in the MAP region.
Minimal Invasive Circumferential Management of Thoracolumbar Spine Fractures

Directory of Open Access Journals (Sweden)

S. Pesenti

2015-01-01

Full Text Available Introduction. While thoracolumbar fractures are common lesions, no strong consensus is available at the moment. Objectives. The aim of this study was to evaluate the results of a minimal invasive strategy using percutaneous instrumentation and anterior approach in the management of thoracolumbar unstable fractures. Methods. 39 patients were included in this retrospective study. Radiologic evaluation was based on vertebral and regional kyphosis, vertebral body height restoration, and fusion rate. Clinical evaluation was based on Visual Analogic Score (VAS. All evaluations were done preoperatively and at 1-year follow-up. Results. Both vertebral and regional kyphoses were significantly improved on postoperative evaluation (13° and 7° versus −1° and −9° P<0.05, resp. as well as vertebral body height (0.92 versus 1.16, P<0.05. At 1-year follow-up, mean loss of correction was 1°. A solid fusion was visible in all the cases, and mean VAS was significantly reduced form 8/10 preoperatively to 1/10 at the last follow-up. Conclusion. Management of thoracolumbar fractures using percutaneous osteosynthesis and minimal invasive anterior approach (telescopic vertebral body prosthesis is a valuable strategy. Results of this strategy offer satisfactory and stable results in time.
Analysis of upstream promoter region and corresponding 5’ UTR of glucokinase (GCK gene in horse breeds

Directory of Open Access Journals (Sweden)

L. Minieri

2010-04-01

Full Text Available A region of glucokinase (GCK gene was sequenced in 14 horses of 14 different breeds. The resulting GCK nucleotide sequence (GenBank number EF136885 showed 77% homology with human GCK gene portion containing the upstream promoter region and the corresponding 5’ UTR of the exon 1. Conserved regulatory sequences near the putative transcriptional start site were identified. The obtained sequences were aligned to detect polymorphism. A new C>T transition within the 5’ UTR of exon 1 was found. Allele frequencies of this polymorphism were studied by PCR-RFLP in 193 horses of 14 breeds (Bardigiano, 21; Esperia Pony, 5; Haflinger, 10; Italian Heavy Draught Horse, 28; Italian Saddle, 25; Italian Trotter, 16; Lipizzan, 12; Maremmano, 15; Murgese, 14; Norico, 10; Salernitano, 12; Thoroughbred, 10; Tolfetano, 7 and Ventasso Horse, 8. The polymorphism was found in all breeds and differences in allelic frequencies among the breeds were observed. The new SNP identified within a regulative region of GCK gene, which plays an important role in insulin secretion and feeding behaviour, could be used for association studies with performance traits of the horses.
An Intergenic Region Shared by At4g35985 and At4g35987 in Arabidopsis thaliana Is a Tissue Specific and Stress Inducible Bidirectional Promoter Analyzed in Transgenic Arabidopsis and Tobacco Plants

Science.gov (United States)

Banerjee, Joydeep; Sahoo, Dipak Kumar; Dey, Nrisingha; Houtz, Robert L.; Maiti, Indu Bhushan

2013-01-01

On chromosome 4 in the Arabidopsis genome, two neighboring genes (calmodulin methyl transferase At4g35987 and senescence associated gene At4g35985) are located in a head-to-head divergent orientation sharing a putative bidirectional promoter. This 1258 bp intergenic region contains a number of environmental stress responsive and tissue specific cis-regulatory elements. Transcript analysis of At4g35985 and At4g35987 genes by quantitative real time PCR showed tissue specific and stress inducible expression profiles. We tested the bidirectional promoter-function of the intergenic region shared by the divergent genes At4g35985 and At4g35987 using two reporter genes (GFP and GUS) in both orientations in transient tobacco protoplast and Agro-infiltration assays, as well as in stably transformed transgenic Arabidopsis and tobacco plants. In transient assays with GFP and GUS reporter genes the At4g35985 promoter (P85) showed stronger expression (about 3.5 fold) compared to the At4g35987 promoter (P87). The tissue specific as well as stress responsive functional nature of the bidirectional promoter was evaluated in independent transgenic Arabidopsis and tobacco lines. Expression of P85 activity was detected in the midrib of leaves, leaf trichomes, apical meristemic regions, throughout the root, lateral roots and flowers. The expression of P87 was observed in leaf-tip, hydathodes, apical meristem, root tips, emerging lateral root tips, root stele region and in floral tissues. The bidirectional promoter in both orientations shows differential up-regulation (2.5 to 3 fold) under salt stress. Use of such regulatory elements of bidirectional promoters showing spatial and stress inducible promoter-functions in heterologous system might be an important tool for plant biotechnology and gene stacking applications. PMID:24260266
An intergenic region shared by At4g35985 and At4g35987 in Arabidopsis thaliana is a tissue specific and stress inducible bidirectional promoter analyzed in transgenic arabidopsis and tobacco plants.

Directory of Open Access Journals (Sweden)

Joydeep Banerjee

Full Text Available On chromosome 4 in the Arabidopsis genome, two neighboring genes (calmodulin methyl transferase At4g35987 and senescence associated gene At4g35985 are located in a head-to-head divergent orientation sharing a putative bidirectional promoter. This 1258 bp intergenic region contains a number of environmental stress responsive and tissue specific cis-regulatory elements. Transcript analysis of At4g35985 and At4g35987 genes by quantitative real time PCR showed tissue specific and stress inducible expression profiles. We tested the bidirectional promoter-function of the intergenic region shared by the divergent genes At4g35985 and At4g35987 using two reporter genes (GFP and GUS in both orientations in transient tobacco protoplast and Agro-infiltration assays, as well as in stably transformed transgenic Arabidopsis and tobacco plants. In transient assays with GFP and GUS reporter genes the At4g35985 promoter (P85 showed stronger expression (about 3.5 fold compared to the At4g35987 promoter (P87. The tissue specific as well as stress responsive functional nature of the bidirectional promoter was evaluated in independent transgenic Arabidopsis and tobacco lines. Expression of P85 activity was detected in the midrib of leaves, leaf trichomes, apical meristemic regions, throughout the root, lateral roots and flowers. The expression of P87 was observed in leaf-tip, hydathodes, apical meristem, root tips, emerging lateral root tips, root stele region and in floral tissues. The bidirectional promoter in both orientations shows differential up-regulation (2.5 to 3 fold under salt stress. Use of such regulatory elements of bidirectional promoters showing spatial and stress inducible promoter-functions in heterologous system might be an important tool for plant biotechnology and gene stacking applications.
CP asymmetry in tau slepton decay in the minimal supersymmetric standard model

International Nuclear Information System (INIS)

Yang Weimin; Du Dongsheng

2002-01-01

We investigate CP violation asymmetry in the decay of a tau slepton into a tau neutrino and a chargino in the minimal supersymmetric standard model. The new source of CP violation is the complex mixing in the tau slepton sector. The rate asymmetry between the decays of the tau slepton and its CP conjugate process can be of the order of 10 -3 in some region of the parameter space of the minimal supergravity scenario, which will possibly be detectable in near-future collider experiments
Identification and characterisation of a G-quadruplex forming sequence in the promoter region of nuclear factor (erythroid-derived 2)-like 2 (Nrf2)

Energy Technology Data Exchange (ETDEWEB)

Waller, Zoë A.E., E-mail: z.waller@uea.ac.uk; Howell, Lesley A.; MacDonald, Colin J.; O’Connell, Maria A.; Searcey, Mark, E-mail: m.searcey@uea.ac.uk

2014-04-25

Highlights: • Discovery of a G-quadruplex forming sequence in the promoter sequence of Nrf2. • Characterisation of the G-quadruplex by UV, CD and NMR. • Conformational switching of G-quadruplex induced by 9-aminoacridine. - Abstract: The transcription factor nuclear factor (erythroid-derived 2)-like 2 (Nrf2) regulates multiple antioxidants, Phase II detoxification enzymes and other cytoprotective enzymes in cells. Activation of Nrf2 is recognised as being of potential therapeutic benefit in inflammatory-diseases whereas more recently, it has become clear that the inhibition of Nrf2 may have benefit in the alleviation of resistance in some tumour types. A potential G-quadruplex forming sequence was identified in the promoter region of Nrf2, close to a number of putative transcription factor binding sites. Characterisation of the sequence 5’-d[GGGAAGGGAGCAAGGGCGGGAGGG]-3’ using CD spectroscopy, imino proton NMR resonances and UV melting experiments demonstrated the formation of a parallel intramolecular G-quadruplex in the presence of K{sup +} ions. Incubation with 9-aminoacridine ligands induced a switch from antiparallel to parallel forms. The presence of a G-quadruplex forming sequence in the promoter region of Nrf2 suggests an approach to targeting the production of the protein through stabilisation of the structure, thereby avoiding resistance to antitumour drugs.
Identification of a 450-bp region of human papillomavirus type 1 that promotes episomal replication in Saccharomyces cerevisiae

International Nuclear Information System (INIS)

Chattopadhyay, Anasuya; Schmidt, Martin C.; Khan, Saleem A.

2005-01-01

Human papillomaviruses (HPVs) replicate as nuclear plasmids in infected cells. Since the DNA replication machinery is generally conserved between humans and Saccharomyces cerevisiae, we studied whether HPV-1 DNA can replicate in yeast. Plasmids containing a selectable marker (with or without a yeast centromere) and either the full-length HPV-1 genome or various regions of the viral long control region (LCR) and the 3' end of the L1 gene were introduced into S. cerevisiae and their ability to replicate episomally was investigated. Our results show that HPV-1 sequences promote episomal replication of plasmids although the yeast centromere is required for plasmid retention. We have mapped the autonomously replicating sequence activity of HPV-1 DNA to a 450 base-pair sequence (HPV-1 nt 6783-7232) that includes 293 nucleotides from the 5' region of the viral LCR and 157 nucleotides from the 3' end of the L1 gene. The HPV-1 ARS does not include the binding sites for the viral E1 and E2 proteins, and these proteins are dispensable for replication in S. cerevisiae
Single photon emission computed tomography and statistical parametric mapping analysis in cirrhotic patients with and without minimal hepatic encephalopathy

International Nuclear Information System (INIS)

Nakagawa, Yuri; Matsumura, Kaname; Iwasa, Motoh; Kaito, Masahiko; Adachi, Yukihiko; Takeda, Kan

2004-01-01

The early diagnosis and treatment of cognitive impairment in cirrhotic patients is needed to improve the patients' daily living. In this study, alterations of regional cerebral blood flow (rCBF) were evaluated in cirrhotic patients using statistical parametric mapping (SPM). The relationships between rCBF and neuropsychological test, severity of disease and biochemical data were also assessed. 99m Tc-ethyl cysteinate dimer single photon emission computed tomography was performed in 20 patients with non-alcoholic liver cirrhosis without overt hepatic encephalopathy (HE) and in 20 age-matched healthy subjects. Neuropsychological tests were performed in 16 patients; of these 7 had minimal HE. Regional CBF images were also analyzed in these groups using SPM. On SPM analysis, cirrhotic patients showed regions of significant hypoperfusion in the superior and middle frontal gyri, and inferior parietal lobules compared with the control group. These areas included parts of the premotor and parietal associated areas of the cortex. Among the cirrhotic patients, those with minimal HE had regions of significant hypoperfusion in the cingulate gyri bilaterally as compared with those without minimal HE. Abnormal function in the above regions may account for the relatively selective neuropsychological deficits in the cognitive status of patients with cirrhosis. These findings may be important in the identification and management of cirrhotic patients with minimal HE. (author)
Cloning and characterization of the promoter regions from the parent and paralogous creatine transporter genes.

Science.gov (United States)

Ndika, Joseph D T; Lusink, Vera; Beaubrun, Claudine; Kanhai, Warsha; Martinez-Munoz, Cristina; Jakobs, Cornelis; Salomons, Gajja S

2014-01-10

Interconversion between phosphocreatine and creatine, catalyzed by creatine kinase is crucial in the supply of ATP to tissues with high energy demand. Creatine's importance has been established by its use as an ergogenic aid in sport, as well as the development of intellectual disability in patients with congenital creatine deficiency. Creatine biosynthesis is complemented by dietary creatine uptake. Intracellular transport of creatine is carried out by a creatine transporter protein (CT1/CRT/CRTR) encoded by the SLC6A8 gene. Most tissues express this gene, with highest levels detected in skeletal muscle and kidney. There are lower levels of the gene detected in colon, brain, heart, testis and prostate. The mechanism(s) by which this regulation occurs is still poorly understood. A duplicated unprocessed pseudogene of SLC6A8-SLC6A10P has been mapped to chromosome 16p11.2 (contains the entire SLC6A8 gene, plus 2293 bp of 5'flanking sequence and its entire 3'UTR). Expression of SLC6A10P has so far only been shown in human testis and brain. It is still unclear as to what is the function of SLC6A10P. In a patient with autism, a chromosomal breakpoint that intersects the 5'flanking region of SLC6A10P was identified; suggesting that SLC6A10P is a non-coding RNA involved in autism. Our aim was to investigate the presence of cis-acting factor(s) that regulate expression of the creatine transporter, as well as to determine if these factors are functionally conserved upstream of the creatine transporter pseudogene. Via gene-specific PCR, cloning and functional luciferase assays we identified a 1104 bp sequence proximal to the mRNA start site of the SLC6A8 gene with promoter activity in five cell types. The corresponding 5'flanking sequence (1050 bp) on the pseudogene also had promoter activity in all 5 cell lines. Surprisingly the pseudogene promoter was stronger than that of its parent gene in 4 of the cell lines tested. To the best of our knowledge, this is the first
Cell cycle control by a minimal Cdk network.

Directory of Open Access Journals (Sweden)

Claude Gérard

2015-02-01

Full Text Available In present-day eukaryotes, the cell division cycle is controlled by a complex network of interacting proteins, including members of the cyclin and cyclin-dependent protein kinase (Cdk families, and the Anaphase Promoting Complex (APC. Successful progression through the cell cycle depends on precise, temporally ordered regulation of the functions of these proteins. In light of this complexity, it is surprising that in fission yeast, a minimal Cdk network consisting of a single cyclin-Cdk fusion protein can control DNA synthesis and mitosis in a manner that is indistinguishable from wild type. To improve our understanding of the cell cycle regulatory network, we built and analysed a mathematical model of the molecular interactions controlling the G1/S and G2/M transitions in these minimal cells. The model accounts for all observed properties of yeast strains operating with the fusion protein. Importantly, coupling the model's predictions with experimental analysis of alternative minimal cells, we uncover an explanation for the unexpected fact that elimination of inhibitory phosphorylation of Cdk is benign in these strains while it strongly affects normal cells. Furthermore, in the strain without inhibitory phosphorylation of the fusion protein, the distribution of cell size at division is unusually broad, an observation that is accounted for by stochastic simulations of the model. Our approach provides novel insights into the organization and quantitative regulation of wild type cell cycle progression. In particular, it leads us to propose a new mechanistic model for the phenomenon of mitotic catastrophe, relying on a combination of unregulated, multi-cyclin-dependent Cdk activities.
Geoheritage promotion of Thonon-les-Bains (Fr) region by the development of a geotourism product

Science.gov (United States)

Fanguin, Pauline

2014-05-01

Since 2012, the Chablais region (only in France) has acquired the Geopark label. This Geopark contributes to sustainable economic development of the region through geotourism. Moreover, the three Chablais (figure 1) are concerned by an Interreg IV program since 2009 (program of cooperation between European countries). The main objective of this program is to enhance the heritage resources (nature, culture and lifestyle of the region) (www.interreg-francesuisse.org). Therefore, the geotourism offer in this area just waiting to expand. The geodidactics models like the simplification of the scientific content are essential for geoheritage promotion, because this content must be available to a wide audience, allowing thereby the geoheritage recognition. The geotourism permits to apply different models (Cayla et al. 2010, Sellier, 2009) through a wide range of geotourism products, like guide, educational panels, thematic hikes and recently developed, new medias (website, smartphone applications). A geotourism product is based on four areas of questioning and was developed by Martin et al. (2010): (1) site (choice of sites to be valued), (2) public (a family public, good example of heterogeneous public), (3) contents (reasoning on geodidactics models) and (4) support (smartphone application). These four areas are very fundamental before the creation of any geotourism product. These reflexions aim to obtain a mediation product that integrates into geotourism offer of a region and contributes to its development and meets public expectations. New media, such as digital media - smartphone, tablets, website - become geotourism products more and more attractive. In addition, the necessary technologies to develop new media help to integrate a high interactivity potential with the public and thus get their attention. The architecture of this geotourism product is based on the new application developed by the Institute of Geography and sustainability, and the Bureau Relief. One
Minimizing Mutual Couping

DEFF Research Database (Denmark)

2010-01-01

Disclosed herein are techniques, systems, and methods relating to minimizing mutual coupling between a first antenna and a second antenna.......Disclosed herein are techniques, systems, and methods relating to minimizing mutual coupling between a first antenna and a second antenna....
Localization and regulation of bacteriophage Mu promoters

International Nuclear Information System (INIS)

Stoddard, S.F.; Howe, M.M.

1989-01-01

Mu promoters active during the lytic cycle were located by isolating RNA at various times after induction of Mu prophages, radiolabeling it by capping in vitro, and hybridizing it to Mu DNA fragments on Southern blots. Signals were detected from four new promoters in addition to the previously characterized P e (early), P cM (repressor), and P mom (late) promoters. A major signal upstream of C was first observed at 12 min and intensified thereafter with RNA from cts and C amber but not replication-defective prophages; these characteristics indicate that this signal arises from a middle promoter, which we designate P m . With 20- and 40-min RNA, four additional major signals originated in the C-lys, F-G-I, N-P, and com-mom regions. These signals were missing with RNA from C amber and replication-defective prophages and therefore reflected the activity of late promoters, one of which we presume was P mom . Uninduced lysogens showed weak signals from five regions, one from the early regulatory region, three between genes B and lys, and one near the late genes K, L, and M. The first of these probably resulted from P cM activity; the others remain to be identified
Global morphological analysis of marine viruses shows minimal regional variation and dominance of non-tailed viruses.

Science.gov (United States)

Brum, Jennifer R; Schenck, Ryan O; Sullivan, Matthew B

2013-09-01

Viruses influence oceanic ecosystems by causing mortality of microorganisms, altering nutrient and organic matter flux via lysis and auxiliary metabolic gene expression and changing the trajectory of microbial evolution through horizontal gene transfer. Limited host range and differing genetic potential of individual virus types mean that investigations into the types of viruses that exist in the ocean and their spatial distribution throughout the world's oceans are critical to understanding the global impacts of marine viruses. Here we evaluate viral morphological characteristics (morphotype, capsid diameter and tail length) using a quantitative transmission electron microscopy (qTEM) method across six of the world's oceans and seas sampled through the Tara Oceans Expedition. Extensive experimental validation of the qTEM method shows that neither sample preservation nor preparation significantly alters natural viral morphological characteristics. The global sampling analysis demonstrated that morphological characteristics did not vary consistently with depth (surface versus deep chlorophyll maximum waters) or oceanic region. Instead, temperature, salinity and oxygen concentration, but not chlorophyll a concentration, were more explanatory in evaluating differences in viral assemblage morphological characteristics. Surprisingly, given that the majority of cultivated bacterial viruses are tailed, non-tailed viruses appear to numerically dominate the upper oceans as they comprised 51-92% of the viral particles observed. Together, these results document global marine viral morphological characteristics, show that their minimal variability is more explained by environmental conditions than geography and suggest that non-tailed viruses might represent the most ecologically important targets for future research.
Prochlorococcus: Advantages and Limits of Minimalism

Science.gov (United States)

Partensky, Frédéric; Garczarek, Laurence

2010-01-01

Prochlorococcus is the key phytoplanktonic organism of tropical gyres, large ocean regions that are depleted of the essential macronutrients needed for photosynthesis and cell growth. This cyanobacterium has adapted itself to oligotrophy by minimizing the resources necessary for life through a drastic reduction of cell and genome sizes. This rarely observed strategy in free-living organisms has conferred on Prochlorococcus a considerable advantage over other phototrophs, including its closest relative Synechococcus, for life in this vast yet little variable ecosystem. However, this strategy seems to reach its limits in the upper layer of the S Pacific gyre, the most oligotrophic region of the world ocean. By losing some important genes and/or functions during evolution, Prochlorococcus has seemingly become dependent on co-occurring microorganisms. In this review, we present some of the recent advances in the ecology, biology, and evolution of Prochlorococcus, which because of its ecological importance and tiny genome is rapidly imposing itself as a model organism in environmental microbiology.
Complications of minimally invasive cosmetic procedures: Prevention and management

Directory of Open Access Journals (Sweden)

Lauren L Levy

2012-01-01

Full Text Available Over the past decade, facial rejuvenation procedures to circumvent traditional surgery have become increasingly popular. Office-based, minimally invasive procedures can promote a youthful appearance with minimal downtime and low risk of complications. Injectable botulinum toxin (BoNT, soft-tissue fillers, and chemical peels are among the most popular non-invasive rejuvenation procedures, and each has unique applications for improving facial aesthetics. Despite the simplicity and reliability of office-based procedures, complications can occur even with an astute and experienced injector. The goal of any procedure is to perform it properly and safely; thus, early recognition of complications when they do occur is paramount in dictating prevention of long-term sequelae. The most common complications from BoNT and soft-tissue filler injection are bruising, erythema and pain. With chemical peels, it is not uncommon to have erythema, irritation and burning. Fortunately, these side effects are normally transient and have simple remedies. More serious complications include muscle paralysis from BoNT, granuloma formation from soft-tissue filler placement and scarring from chemical peels. Thankfully, these complications are rare and can be avoided with excellent procedure technique, knowledge of facial anatomy, proper patient selection, and appropriate pre- and post-skin care. This article reviews complications of office-based, minimally invasive procedures, with emphasis on prevention and management. Practitioners providing these treatments should be well versed in this subject matter in order to deliver the highest quality care.
Competitive Promoter-Associated Matrix Attachment Region Binding of the Arid3a and Cux1 Transcription Factors

Directory of Open Access Journals (Sweden)

Dongkyoon Kim

2017-12-01

Full Text Available Arid3a/Bright/Dril1 is a B cell-specific transactivator that regulates immunoglobulin heavy chain (IgH gene transcription by binding promoter and enhancer-associated matrix attachment regions (MARs within the IgH gene locus. Promoter MAR-mediated Arid3a transactivation is antagonized by direct competition of MAR binding by Cux1/CDP—a ubiquitously expressed repressor originally termed NF-μNR. We report that the NF-μNR complex includes Arid3a in B cells but not in non-B cells through mobility shift assays. The binding activity of NF-μNR and Arid3a in B cells is reciprocally altered during the cell division cycle and by the B cell mitogen lipopolysaccharide LPS. LPS treatment had no effect on Arid3a localization but increased its total abundance within the nucleus and cytoplasm. We show that this increased level of Arid3a is capable of displacing Cux from the MARs to facilitate IgH gene transcription. Finally, we showed that the MARs (termed Bf150 and Tx125 associated with the VH1 rearranged variable region expressed in the S107 murine plasmacytoma, can repress reporter gene transcription in non-B cells and that they can relieve the repression mediated by Eμ enhancer in B cells. These results have significant implications for early human development and demonstrate that MARs in IgH locus, NF-µNR and Arid3a regulate IgH gene expression in a concerted fashion. This paves the way for future studies examining the misregulation of this pathway in pediatric disease.
Gap junctional communication modulates gene transcription by altering the recruitment of Sp1 and Sp3 to connexin-response elements in osteoblast promoters

Science.gov (United States)

Stains, Joseph P.; Lecanda, Fernando; Screen, Joanne; Towler, Dwight A.; Civitelli, Roberto

2003-01-01

Loss-of-function mutations of gap junction proteins, connexins, represent a mechanism of disease in a variety of tissues. We have shown that recessive (gene deletion) or dominant (connexin45 overexpression) disruption of connexin43 function results in osteoblast dysfunction and abnormal expression of osteoblast genes, including down-regulation of osteocalcin transcription. To elucidate the molecular mechanisms of gap junction-sensitive transcriptional regulation, we systematically analyzed the rat osteocalcin promoter for sensitivity to gap junctional intercellular communication. We identified an Sp1/Sp3 containing complex that assembles on a minimal element in the -70 to -57 region of the osteocalcin promoter in a gap junction-dependent manner. This CT-rich connexin-response element is necessary and sufficient to confer gap junction sensitivity to the osteocalcin proximal promoter. Repression of osteocalcin transcription occurs as a result of displacement of the stimulatory Sp1 by the inhibitory Sp3 on the promoter when gap junctional communication is perturbed. Modulation of Sp1/Sp3 recruitment also occurs on the collagen Ialpha1 promoter and translates into gap junction-sensitive transcriptional control of collagen Ialpha1 gene expression. Thus, regulation of Sp1/Sp3 recruitment to the promoter may represent a potential general mechanism for transcriptional control of target genes by signals passing through gap junctions.

HOX Gene Promoter Prediction and Inter-genomic Comparison: An Evo-Devo Study

Directory of Open Access Journals (Sweden)

Marla A. Endriga

2010-10-01

Full Text Available Homeobox genes direct the anterior-posterior axis of the body plan in eukaryotic organisms. Promoter regions upstream of the Hox genes jumpstart the transcription process. CpG islands found within the promoter regions can cause silencing of these promoters. The locations of the promoter regions and the CpG islands of Homeo sapiens sapiens (human, Pan troglodytes (chimpanzee, Mus musculus (mouse, and Rattus norvegicus (brown rat are compared and related to the possible influence on the specification of the mammalian body plan. The sequence of each gene in Hox clusters A-D of the mammals considered were retrieved from Ensembl and locations of promoter regions and CpG islands predicted using Exon Finder. The predicted promoter sequences were confirmed via BLAST and verified against the Eukaryotic Promoter Database. The significance of the locations was determined using the Kruskal-Wallis test. Among the four clusters, only promoter locations in cluster B showed significant difference. HOX B genes have been linked with the control of genes that direct the development of axial morphology, particularly of the vertebral column bones. The magnitude of variation among the body plans of closely-related species can thus be partially attributed to the promoter kind, location and number, and gene inactivation via CpG methylation.
The Digital North Denmark Programme -Promoting Regional Change?

DEFF Research Database (Denmark)

Østergaard, Christian Richter

2007-01-01

The Digital North Denmark (DDN) was an IT programme running from 2000 to 2003 in the North Jutland County in Denmark with national government support of € 23 million. The Danish government initiated the programme with the aim of further strengthening regions with an already proven ICT capability...... (Dybkjær and Lindegaard, 1999, p.96-100). The declared approach was to build on the existing competencies in industry as well as at universities. The national government chose two regions – Ørestaden, a new concentration of knowledge-based institutions near Copenhagen Airport, and North Jutland......-offers within four themes. The participants - meant to be project consortia of ideally private firms, public or private organisations as well as regional and municipal government bodies - could get a maximum national government support of one third of the total project sum.This chapter investigates how...
Fanconi anemia core complex gene promoters harbor conserved transcription regulatory elements.

Science.gov (United States)

Meier, Daniel; Schindler, Detlev

2011-01-01

The Fanconi anemia (FA) gene family is a recent addition to the complex network of proteins that respond to and repair certain types of DNA damage in the human genome. Since little is known about the regulation of this novel group of genes at the DNA level, we characterized the promoters of the eight genes (FANCA, B, C, E, F, G, L and M) that compose the FA core complex. The promoters of these genes show the characteristic attributes of housekeeping genes, such as a high GC content and CpG islands, a lack of TATA boxes and a low conservation. The promoters functioned in a monodirectional way and were, in their most active regions, comparable in strength to the SV40 promoter in our reporter plasmids. They were also marked by a distinctive transcriptional start site (TSS). In the 5' region of each promoter, we identified a region that was able to negatively regulate the promoter activity in HeLa and HEK 293 cells in isolation. The central and 3' regions of the promoter sequences harbor binding sites for several common and rare transcription factors, including STAT, SMAD, E2F, AP1 and YY1, which indicates that there may be cross-connections to several established regulatory pathways. Electrophoretic mobility shift assays and siRNA experiments confirmed the shared regulatory responses between the prominent members of the TGF-β and JAK/STAT pathways and members of the FA core complex. Although the promoters are not well conserved, they share region and sequence specific regulatory motifs and transcription factor binding sites (TBFs), and we identified a bi-partite nature to these promoters. These results support a hypothesis based on the co-evolution of the FA core complex genes that was expanded to include their promoters.
Fanconi anemia core complex gene promoters harbor conserved transcription regulatory elements.

Directory of Open Access Journals (Sweden)

Daniel Meier

Full Text Available The Fanconi anemia (FA gene family is a recent addition to the complex network of proteins that respond to and repair certain types of DNA damage in the human genome. Since little is known about the regulation of this novel group of genes at the DNA level, we characterized the promoters of the eight genes (FANCA, B, C, E, F, G, L and M that compose the FA core complex. The promoters of these genes show the characteristic attributes of housekeeping genes, such as a high GC content and CpG islands, a lack of TATA boxes and a low conservation. The promoters functioned in a monodirectional way and were, in their most active regions, comparable in strength to the SV40 promoter in our reporter plasmids. They were also marked by a distinctive transcriptional start site (TSS. In the 5' region of each promoter, we identified a region that was able to negatively regulate the promoter activity in HeLa and HEK 293 cells in isolation. The central and 3' regions of the promoter sequences harbor binding sites for several common and rare transcription factors, including STAT, SMAD, E2F, AP1 and YY1, which indicates that there may be cross-connections to several established regulatory pathways. Electrophoretic mobility shift assays and siRNA experiments confirmed the shared regulatory responses between the prominent members of the TGF-β and JAK/STAT pathways and members of the FA core complex. Although the promoters are not well conserved, they share region and sequence specific regulatory motifs and transcription factor binding sites (TBFs, and we identified a bi-partite nature to these promoters. These results support a hypothesis based on the co-evolution of the FA core complex genes that was expanded to include their promoters.
An upstream activation element exerting differential transcriptional activation on an archaeal promoter

DEFF Research Database (Denmark)

Peng, Nan; Xia, Qiu; Chen, Zhengjun

2009-01-01

S gene encoding an arabinose binding protein was characterized using an Sulfolobus islandicus reporter gene system. The minimal active araS promoter (P(araS)) was found to be 59 nucleotides long and harboured four promoter elements: an ara-box, an upstream transcription factor B-responsive element (BRE......), a TATA-box and a proximal promoter element, each of which contained important nucleotides that either greatly decreased or completely abolished promoter activity upon mutagenesis. The basal araS promoter was virtually inactive due to intrinsically weak BRE element, and the upstream activating sequence...... (UAS) ara-box activated the basal promoter by recruiting transcription factor B to its BRE. While this UAS ensured a general expression from an inactive or weak basal promoter in the presence of other tested carbon resources, it exhibited a strong arabinose-responsive transcriptional activation. To our...
"I Can't Lie to Your Face": Minimal Face-to-Face Interaction Promotes Honestry

OpenAIRE

Van Zant, Alex B.; Kray, Laura J.

2013-01-01

In the current research, we consider how gender composition may impact the likelihood of deception in contexts with asymmetric information where one party has the opportunity to strategically deceive another party for the opportunity to gain economically. We predict that the combined processes of social categorization and social projection should make people more likely to presume trust from same-gender others than different-gender others. Because anonymous interactions promote the tendency t...
Legal incentives for minimizing waste

International Nuclear Information System (INIS)

Clearwater, S.W.; Scanlon, J.M.

1991-01-01

Waste minimization, or pollution prevention, has become an integral component of federal and state environmental regulation. Minimizing waste offers many economic and public relations benefits. In addition, waste minimization efforts can also dramatically reduce potential criminal requirements. This paper addresses the legal incentives for minimizing waste under current and proposed environmental laws and regulations
Cinema ed enogastronomia nel portale turistico della Regione Toscana / Cinema and enogastronomy in the tourism portal of the Toscana Region

Directory of Open Access Journals (Sweden)

Gian Luigi Corinto

2016-05-01

The paper analyzes the case study of the Tuscan Region which in 2007 has charged the Sistema Toscana Foundation to strategically control all the territorial marketing activities, even including those of the regional film commission and the promotional tourist web site. The aim is to analyze the specific promotional model for enogastronomy and film tourism, as in the peculiar combination of the Tuscan case. The findings are that enongatronomy and tourism have been promoted in combination but only referring to 'minor' tuscan destinations, different from the crowded regional capital or other cultural sites. This choice has been determined by the strategic market positioning of the entire regional tourism supply, effectively integrating local vocations in the web communications. The task of the Foundation in promoting the whole territory and even the minor destinations must be considered as substantially successful, mainly because it has increased the visibility of the Tuscan region by conveniently using all the old and new media tools.
MOCUS, Minimal Cut Sets and Minimal Path Sets from Fault Tree Analysis

International Nuclear Information System (INIS)

Fussell, J.B.; Henry, E.B.; Marshall, N.H.

1976-01-01

1 - Description of problem or function: From a description of the Boolean failure logic of a system, called a fault tree, and control parameters specifying the minimal cut set length to be obtained MOCUS determines the system failure modes, or minimal cut sets, and the system success modes, or minimal path sets. 2 - Method of solution: MOCUS uses direct resolution of the fault tree into the cut and path sets. The algorithm used starts with the main failure of interest, the top event, and proceeds to basic independent component failures, called primary events, to resolve the fault tree to obtain the minimal sets. A key point of the algorithm is that an and gate alone always increases the number of path sets; an or gate alone always increases the number of cut sets and increases the size of path sets. Other types of logic gates must be described in terms of and and or logic gates. 3 - Restrictions on the complexity of the problem: Output from MOCUS can include minimal cut and path sets for up to 20 gates
Unrestricted disposal of minimal activity levels of radioactive wastes: exposure and risk calculations

International Nuclear Information System (INIS)

Fields, D.E.; Emerson, C.J.

1984-08-01

The US Nuclear Regulatory Commission is currently considering revision of rule 10 CFR Part 20, which covers disposal of solid wastes containing minimal radioactivity. In support of these revised rules, we have evaluated the consequences of disposing of four waste streams at four types of disposal areas located in three different geographic regions. Consequences are expressed in terms of human exposures and associated health effects. Each geographic region has its own climate and geology. Example waste streams, waste disposal methods, and geographic regions chosen for this study are clearly specified. Monetary consequences of minimal activity waste disposal are briefly discussed. The PRESTO methodology was used to evaluate radionuclide transport and health effects. This methodology was developed to assess radiological impacts to a static local population for a 1000-year period following disposal. Pathways and processes of transit from the trench to exposed populations included the following considerations: groundwater transport, overland flow, erosion, surface water dilution, resuspension, atmospheric transport, deposition, inhalation, and ingestion of contaminated beef, milk, crops, and water. 12 references, 2 figures, 8 tables
Is non-minimal inflation eternal?

International Nuclear Information System (INIS)

Feng, Chao-Jun; Li, Xin-Zhou

2010-01-01

The possibility that the non-minimal coupling inflation could be eternal is investigated. We calculate the quantum fluctuation of the inflaton in a Hubble time and find that it has the same value as that in the minimal case in the slow-roll limit. Armed with this result, we have studied some concrete non-minimal inflationary models including the chaotic inflation and the natural inflation, in which the inflaton is non-minimally coupled to the gravity. We find that the non-minimal coupling inflation could be eternal in some parameter spaces.
CRA-1 uncovers a double-strand break-dependent pathway promoting the assembly of central region proteins on chromosome axes during C. elegans meiosis.

Science.gov (United States)

Smolikov, Sarit; Schild-Prüfert, Kristina; Colaiácovo, Mónica P

2008-06-06

The synaptonemal complex (SC), a tripartite proteinaceous structure that forms between homologous chromosomes during meiosis, is crucial for faithful chromosome segregation. Here we identify CRA-1, a novel and conserved protein that is required for the assembly of the central region of the SC during C. elegans meiosis. In the absence of CRA-1, central region components fail to extensively localize onto chromosomes at early prophase and instead mostly surround the chromatin at this stage. Later in prophase, central region proteins polymerize along chromosome axes, but for the most part fail to connect the axes of paired homologous chromosomes. This defect results in an inability to stabilize homologous pairing interactions, altered double-strand break (DSB) repair progression, and a lack of chiasmata. Surprisingly, DSB formation and repair are required to promote the polymerization of the central region components along meiotic chromosome axes in cra-1 mutants. In the absence of both CRA-1 and any one of the C. elegans homologs of SPO11, MRE11, RAD51, or MSH5, the polymerization observed along chromosome axes is perturbed, resulting in the formation of aggregates of the SC central region proteins. While radiation-induced DSBs rescue this polymerization in cra-1; spo-11 mutants, they fail to do so in cra-1; mre-11, cra-1; rad-51, and cra-1; msh-5 mutants. Taken together, our studies place CRA-1 as a key component in promoting the assembly of a tripartite SC structure. Moreover, they reveal a scenario in which DSB formation and repair can drive the polymerization of SC components along chromosome axes in C. elegans.
Reduced Zeta potential through use of cationic adhesion promoter for improved resist process performance and minimizing material consumption

Science.gov (United States)

Hodgson, Lorna; Thompson, Andrew

2012-03-01

This paper presents the results of a non-HMDS (non-silane) adhesion promoter that was used to reduce the zeta potential for very thin (proprietary) polymer on silicon. By reducing the zeta potential, as measured by the minimum sample required to fully coat a wafer, the amount of polymer required to coat silicon substrates was significantly reduced in the manufacture of X-ray windows used for high transmission of low-energy X-rays. Moreover, this approach used aqueous based adhesion promoter described as a cationic surface active agent that has been shown to improve adhesion of photoresists (positive, negative, epoxy [SU8], e-beam and dry film). As well as reducing the amount of polymer required to coat substrates, this aqueous adhesion promoter is nonhazardous, and contains non-volatile solvents.
Minimal dilaton model

Directory of Open Access Journals (Sweden)

Oda Kin-ya

2013-05-01

Full Text Available Both the ATLAS and CMS experiments at the LHC have reported the observation of the particle of mass around 125 GeV which is consistent to the Standard Model (SM Higgs boson, but with an excess of events beyond the SM expectation in the diphoton decay channel at each of them. There still remains room for a logical possibility that we are not seeing the SM Higgs but something else. Here we introduce the minimal dilaton model in which the LHC signals are explained by an extra singlet scalar of the mass around 125 GeV that slightly mixes with the SM Higgs heavier than 600 GeV. When this scalar has a vacuum expectation value well beyond the electroweak scale, it can be identified as a linearly realized version of a dilaton field. Though the current experimental constraints from the Higgs search disfavors such a region, the singlet scalar model itself still provides a viable alternative to the SM Higgs in interpreting its search results.
Properties of promoters cloned randomly from the Saccharomyces cerevisiae genome.

Science.gov (United States)

Santangelo, G M; Tornow, J; McLaughlin, C S; Moldave, K

1988-01-01

Promoters were isolated at random from the genome of Saccharomyces cerevisiae by using a plasmid that contains a divergently arrayed pair of promoterless reporter genes. A comprehensive library was constructed by inserting random (DNase I-generated) fragments into the intergenic region upstream from the reporter genes. Simple in vivo assays for either reporter gene product (alcohol dehydrogenase or beta-galactosidase) allowed the rapid identification of promoters from among these random fragments. Poly(dA-dT) homopolymer tracts were present in three of five randomly cloned promoters. With two exceptions, each RNA start site detected was 40 to 100 base pairs downstream from a TATA element. All of the randomly cloned promoters were capable of activating reporter gene transcription bidirectionally. Interestingly, one of the promoter fragments originated in a region of the S. cerevisiae rDNA spacer; regulated divergent transcription (presumably by RNA polymerase II) initiated in the same region. Images PMID:2847031
Minimal families of curves on surfaces

KAUST Repository

Lubbes, Niels

2014-11-01

A minimal family of curves on an embedded surface is defined as a 1-dimensional family of rational curves of minimal degree, which cover the surface. We classify such minimal families using constructive methods. This allows us to compute the minimal families of a given surface.The classification of minimal families of curves can be reduced to the classification of minimal families which cover weak Del Pezzo surfaces. We classify the minimal families of weak Del Pezzo surfaces and present a table with the number of minimal families of each weak Del Pezzo surface up to Weyl equivalence.As an application of this classification we generalize some results of Schicho. We classify algebraic surfaces that carry a family of conics. We determine the minimal lexicographic degree for the parametrization of a surface that carries at least 2 minimal families. © 2014 Elsevier B.V.
Compilation and analysis of Escherichia coli promoter DNA sequences.

OpenAIRE

Hawley, D K; McClure, W R

1983-01-01

The DNA sequence of 168 promoter regions (-50 to +10) for Escherichia coli RNA polymerase were compiled. The complete listing was divided into two groups depending upon whether or not the promoter had been defined by genetic (promoter mutations) or biochemical (5' end determination) criteria. A consensus promoter sequence based on homologies among 112 well-defined promoters was determined that was in substantial agreement with previous compilations. In addition, we have tabulated 98 promoter ...
Large-scale chromatin immunoprecipitation with promoter sequence microarray analysis of the interaction of the NSs protein of Rift Valley fever virus with regulatory DNA regions of the host genome.

Science.gov (United States)

Benferhat, Rima; Josse, Thibaut; Albaud, Benoit; Gentien, David; Mansuroglu, Zeyni; Marcato, Vasco; Souès, Sylvie; Le Bonniec, Bernard; Bouloy, Michèle; Bonnefoy, Eliette

2012-10-01

Rift Valley fever virus (RVFV) is a highly pathogenic Phlebovirus that infects humans and ruminants. Initially confined to Africa, RVFV has spread outside Africa and presently represents a high risk to other geographic regions. It is responsible for high fatality rates in sheep and cattle. In humans, RVFV can induce hepatitis, encephalitis, retinitis, or fatal hemorrhagic fever. The nonstructural NSs protein that is the major virulence factor is found in the nuclei of infected cells where it associates with cellular transcription factors and cofactors. In previous work, we have shown that NSs interacts with the promoter region of the beta interferon gene abnormally maintaining the promoter in a repressed state. In this work, we performed a genome-wide analysis of the interactions between NSs and the host genome using a genome-wide chromatin immunoprecipitation combined with promoter sequence microarray, the ChIP-on-chip technique. Several cellular promoter regions were identified as significantly interacting with NSs, and the establishment of NSs interactions with these regions was often found linked to deregulation of expression of the corresponding genes. Among annotated NSs-interacting genes were present not only genes regulating innate immunity and inflammation but also genes regulating cellular pathways that have not yet been identified as targeted by RVFV. Several of these pathways, such as cell adhesion, axonal guidance, development, and coagulation were closely related to RVFV-induced disorders. In particular, we show in this work that NSs targeted and modified the expression of genes coding for coagulation factors, demonstrating for the first time that this hemorrhagic virus impairs the host coagulation cascade at the transcriptional level.
Hexavalent Chromium Minimization Strategy

Science.gov (United States)

2011-05-01

Logistics 4 Initiative - DoD Hexavalent Chromium Minimization Non- Chrome Primer IIEXAVAJ ENT CHRO:M I~UMI CHROMIUM (VII Oil CrfVli.J CANCEfl HAnRD CD...Management Office of the Secretary of Defense Hexavalent Chromium Minimization Strategy Report Documentation Page Form ApprovedOMB No. 0704-0188...00-2011 4. TITLE AND SUBTITLE Hexavalent Chromium Minimization Strategy 5a. CONTRACT NUMBER 5b. GRANT NUMBER 5c. PROGRAM ELEMENT NUMBER 6
Dynamic nucleosome organization at hox promoters during zebrafish embryogenesis.

Directory of Open Access Journals (Sweden)

Steven E Weicksel

Full Text Available Nucleosome organization at promoter regions plays an important role in regulating gene activity. Genome-wide studies in yeast, flies, worms, mammalian embryonic stem cells and transformed cell lines have found well-positioned nucleosomes flanking a nucleosome depleted region (NDR at transcription start sites. This nucleosome arrangement depends on DNA sequence (cis-elements as well as DNA binding factors and ATP-dependent chromatin modifiers (trans-factors. However, little is understood about how the nascent embryonic genome positions nucleosomes during development. This is particularly intriguing since the embryonic genome must undergo a broad reprogramming event upon fusion of sperm and oocyte. Using four stages of early embryonic zebrafish development, we map nucleosome positions at the promoter region of 37 zebrafish hox genes. We find that nucleosome arrangement at the hox promoters is a progressive process that takes place over several stages. At stages immediately after fertilization, nucleosomes appear to be largely disordered at hox promoter regions. At stages after activation of the embryonic genome, nucleosomes are detectable at hox promoters, with positions becoming more uniform and more highly occupied. Since the genomic sequence is invariant during embryogenesis, this progressive change in nucleosome arrangement suggests that trans-factors play an important role in organizing nucleosomes during embryogenesis. Separating hox genes into expressed and non-expressed groups shows that expressed promoters have better positioned and occupied nucleosomes, as well as distinct NDRs, than non-expressed promoters. Finally, by blocking the retinoic acid-signaling pathway, we disrupt early hox gene transcription, but observe no effect on nucleosome positions, suggesting that active hox transcription is not a driving force behind the arrangement of nucleosomes at the promoters of hox genes during early development.

Synthetic promoter libraries for Corynebacterium glutamicum

DEFF Research Database (Denmark)

Rytter, Jakob Vang; Helmark, Søren; Chen, Jun

2014-01-01

The ability to modulate gene expression is an important genetic tool in systems biology and biotechnology. Here, we demonstrate that a previously published easy and fast PCR-based method for modulating gene expression in lactic acid bacteria is also applicable to Corynebacterium glutamicum. We co...... promoter library (SPL) technology is convenient for modulating gene expression in C. glutamicum and should have many future applications, within basic research as well as for optimizing industrial production organisms....... constructed constitutive promoter libraries based on various combinations of a previously reported C. glutamicum -10 consensus sequence (gngnTA(c/t)aaTgg) and the Escherichia coli -35 consensus, either with or without an AT-rich region upstream. A promoter library based on consensus sequences frequently found...... in low-GC Gram-positive microorganisms was also included. The strongest promoters were found in the library with a -35 region and a C. glutamicum -10 consensus, and this library also represents the largest activity span. Using the alternative -10 consensus TATAAT, which can be found in many other...
A Trust-region-based Sequential Quadratic Programming Algorithm

DEFF Research Database (Denmark)

Henriksen, Lars Christian; Poulsen, Niels Kjølstad

This technical note documents the trust-region-based sequential quadratic programming algorithm used in other works by the authors. The algorithm seeks to minimize a convex nonlinear cost function subject to linear inequalty constraints and nonlinear equality constraints.......This technical note documents the trust-region-based sequential quadratic programming algorithm used in other works by the authors. The algorithm seeks to minimize a convex nonlinear cost function subject to linear inequalty constraints and nonlinear equality constraints....
Fixing a fractured arthrodesed hip with rapid prototype templating and minimal invasive plate osteosynthesis

Directory of Open Access Journals (Sweden)

Christian Fang

2015-12-01

Full Text Available CASE:: We present an elderly lady with an intertrochanteric fracture of a previously fused hip. A 3D printed model of her pelvis and femur was used for implant templating before surgery. Minimal invasive fixation was performed with a spanning reversed distal femur locking plate without the need for removal of the previous implant. Multiple long locking screws were placed in the supra-acetabular region. The patient had union in 4 months, return to function and no complication. Conclusion:: The technique allowed us to optimize implant selection and insert screws safely at difficult trajectories using minimal invasive surgery. Keywords: Hip fusion, Fracture, Plating, Minimal invasive, 3D printing
Functional dissection of a napin gene promoter: identification of promoter elements required for embryo and endosperm-specific transcription.

Science.gov (United States)

Ellerström, M; Stålberg, K; Ezcurra, I; Rask, L

1996-12-01

The promoter region (-309 to +44) of the Brassica napus storage protein gene napA was studied in transgenic tobacco by successive 5' as well as internal deletions fused to the reporter gene GUS (beta-glucuronidase). The expression in the two main tissues of the seed, the endosperm and the embryo, was shown to be differentially regulated. This tissue-specific regulation within the seed was found to affect the developmental expression during seed development. The region between -309 to -152, which has a large effect on quantitative expression, was shown to harbour four elements regulating embryo and one regulating endosperm expression. This region also displayed enhancer activity. Deletion of eight bp from position -152 to position -144 totally abolished the activity of the napA promoter. This deletion disrupted a cis element with similarity to an ABA-responsive element (ABRE) overlapping with an E-box, demonstrating its crucial importance for quantitative expression. An internal deletion of the region -133 to -120, resulted in increased activity in both leaves and endosperm and a decreased activity in the embryo. Within this region, a cis element similar to the (CA)n element, found in other storage protein promoters, was identified. This suggest that the (CA)n element is important for conferring seed specificity by serving both as an activator and a repressor element.
Minimal and non-minimal standard models: Universality of radiative corrections

International Nuclear Information System (INIS)

Passarino, G.

1991-01-01

The possibility of describing electroweak processes by means of models with a non-minimal Higgs sector is analyzed. The renormalization procedure which leads to a set of fitting equations for the bare parameters of the lagrangian is first reviewed for the minimal standard model. A solution of the fitting equations is obtained, which correctly includes large higher-order corrections. Predictions for physical observables, notably the W boson mass and the Z O partial widths, are discussed in detail. Finally the extension to non-minimal models is described under the assumption that new physics will appear only inside the vector boson self-energies and the concept of universality of radiative corrections is introduced, showing that to a large extent they are insensitive to the details of the enlarged Higgs sector. Consequences for the bounds on the top quark mass are also discussed. (orig.)
Minimal extension of the standard model scalar sector

International Nuclear Information System (INIS)

O'Connell, Donal; Wise, Mark B.; Ramsey-Musolf, Michael J.

2007-01-01

The minimal extension of the scalar sector of the standard model contains an additional real scalar field with no gauge quantum numbers. Such a field does not couple to the quarks and leptons directly but rather through its mixing with the standard model Higgs field. We examine the phenomenology of this model focusing on the region of parameter space where the new scalar particle is significantly lighter than the usual Higgs scalar and has small mixing with it. In this region of parameter space most of the properties of the additional scalar particle are independent of the details of the scalar potential. Furthermore the properties of the scalar that is mostly the standard model Higgs can be drastically modified since its dominant branching ratio may be to a pair of the new lighter scalars
Monitoring food and non-alcoholic beverage promotions to children.

Science.gov (United States)

Kelly, B; King, L; Baur, L; Rayner, M; Lobstein, T; Monteiro, C; Macmullan, J; Mohan, S; Barquera, S; Friel, S; Hawkes, C; Kumanyika, S; L'Abbé, M; Lee, A; Ma, J; Neal, B; Sacks, G; Sanders, D; Snowdon, W; Swinburn, B; Vandevijvere, S; Walker, C

2013-10-01

Food and non-alcoholic beverage marketing is recognized as an important factor influencing food choices related to non-communicable diseases. The monitoring of populations' exposure to food and non-alcoholic beverage promotions, and the content of these promotions, is necessary to generate evidence to understand the extent of the problem, and to determine appropriate and effective policy responses. A review of studies measuring the nature and extent of exposure to food promotions was conducted to identify approaches to monitoring food promotions via dominant media platforms. A step-wise approach, comprising 'minimal', 'expanded' and 'optimal' monitoring activities, was designed. This approach can be used to assess the frequency and level of exposure of population groups (especially children) to food promotions, the persuasive power of techniques used in promotional communications (power of promotions) and the nutritional composition of promoted food products. Detailed procedures for data sampling, data collection and data analysis for a range of media types are presented, as well as quantifiable measurement indicators for assessing exposure to and power of food and non-alcoholic beverage promotions. The proposed framework supports the development of a consistent system for monitoring food and non-alcoholic beverage promotions for comparison between countries and over time. © 2013 The Authors. Obesity Reviews published by John Wiley & Sons Ltd on behalf of the International Association for the Study of Obesity.
Combgap Promotes Ovarian Niche Development and Chromatin Association of EcR-Binding Regions in BR-C.

Science.gov (United States)

Hitrik, Anna; Popliker, Malka; Gancz, Dana; Mukamel, Zohar; Lifshitz, Aviezer; Schwartzman, Omer; Tanay, Amos; Gilboa, Lilach

2016-11-01

The development of niches for tissue-specific stem cells is an important aspect of stem cell biology. Determination of niche size and niche numbers during organogenesis involves precise control of gene expression. How this is achieved in the context of a complex chromatin landscape is largely unknown. Here we show that the nuclear protein Combgap (Cg) supports correct ovarian niche formation in Drosophila by controlling ecdysone-Receptor (EcR)- mediated transcription and long-range chromatin contacts in the broad locus (BR-C). Both cg and BR-C promote ovarian growth and the development of niches for germ line stem cells. BR-C levels were lower when Combgap was either reduced or over-expressed, indicating an intricate regulation of the BR-C locus by Combgap. Polytene chromosome stains showed that Cg co-localizes with EcR, the major regulator of BR-C, at the BR-C locus and that EcR binding to chromatin was sensitive to changes in Cg levels. Proximity ligation assay indicated that the two proteins could reside in the same complex. Finally, chromatin conformation analysis revealed that EcR-bound regions within BR-C, which span ~30 KBs, contacted each other. Significantly, these contacts were stabilized in an ecdysone- and Combgap-dependent manner. Together, these results highlight Combgap as a novel regulator of chromatin structure that promotes transcription of ecdysone target genes and ovarian niche formation.
Transactivation of a cellular promoter by the NS1 protein of the parvovirus minute virus of mice through a putative hormone-responsive element.

Science.gov (United States)

Vanacker, J M; Corbau, R; Adelmant, G; Perros, M; Laudet, V; Rommelaere, J

1996-01-01

The promoter of the thyroid hormone receptor alpha gene (c-erbA-1) is activated by the nonstructural protein 1 (NS1) of parvovirus minute virus of mice (prototype strain [MVMp]) in ras-transformed FREJ4 cells that are permissive for lytic MVMp replication. This stimulation may be related to the sensitivity of host cells to MVMp, as it does not take place in parental FR3T3 cells, which are resistant to the parvovirus killing effect. The analysis of a series of deletion and point mutants of the c-erbA-1 promoter led to the identification of an upstream region that is necessary for NS1-driven transactivation. This sequence harbors a putative hormone-responsive element and is sufficient to render a minimal promoter NS1 inducible in FREJ4 but not in FR3T3 cells, and it is involved in distinct interactions with proteins from the respective cell lines. The NS1-responsive element of the c-erbA-1 promoter bears no homology with sequences that were previously reported to be necessary for NS1 DNA binding and transactivation. Altogether, our data point to a novel, cell-specific mechanism of promoter activation by NS1. PMID:8642664
High fructose consumption induces DNA methylation at PPARα and CPT1A promoter regions in the rat liver

Energy Technology Data Exchange (ETDEWEB)

Ohashi, Koji [Department of Clinical Biochemistry, Fujita Health University School of Health Sciences, Toyoake (Japan); Munetsuna, Eiji [Department of Biochemistry, Fujita Health University School of Medicine, Toyoake (Japan); Yamada, Hiroya, E-mail: hyamada@fujita-hu.ac.jp [Department of Hygiene, Fujita Health University School of Medicine, Toyoake (Japan); Ando, Yoshitaka [Department of Joint Research Laboratory of Clinical Medicine, Fujita Health University Hospital, Toyoake (Japan); Yamazaki, Mirai; Taromaru, Nao; Nagura, Ayuri; Ishikawa, Hiroaki [Department of Clinical Biochemistry, Fujita Health University School of Health Sciences, Toyoake (Japan); Suzuki, Koji [Department of Public Health, Fujita Health University School of Health Sciences, Toyoake (Japan); Teradaira, Ryoji [Department of Clinical Biochemistry, Fujita Health University School of Health Sciences, Toyoake (Japan); Hashimoto, Shuji [Department of Hygiene, Fujita Health University School of Medicine, Toyoake (Japan)

2015-12-04

DNA methylation status is affected by environmental factors, including nutrition. Fructose consumption is considered a risk factor for the conditions that make up metabolic syndrome such as dyslipidemia. However, the pathogenetic mechanism by which fructose consumption leads to metabolic syndrome is unclear. Based on observations that epigenetic modifications are closely related to induction of metabolic syndrome, we hypothesized that fructose-induced metabolic syndrome is caused by epigenetic alterations. Male SD rats were designated to receive water or 20% fructose solution for 14 weeks. mRNA levels for peroxisome proliferator-activated receptor alpha (PPARα) and carnitine palmitoyltransferase 1A (CPT1A) was analyzed using Real-time PCR. Restriction digestion and real-time PCR (qAMP) was used for the analysis of DNA methylation status. Hepatic lipid accumulation was also observed by fructose intake. Fructose feeding also significantly decreased mRNA levels for PPARα and CPT1A. qAMP analysis demonstrated the hypermethylation of promoter regions of PPARα and CTP1A genes. Fructose-mediated attenuated gene expression may be mediated by alterations of DNA methylation status, and pathogenesis of metabolic syndrome induced by fructose relates to DNA methylation status. - Highlights: • No general consensus has been reached regarding the molecular mechanisms of the pathogenesis of fructose-induced diseases. • Significant increase in hepatic total methylation level was observed after fructose-supplemented feeding. • Fructose feeding significantly decreased mRNA levels for PPARα and CPT1A. • qAMP analysis demonstrated the hypermethylation of promoter regions of PPARα and CTP1A genes. • Fructose-mediated attenuated gene expression may be mediated by alterations of DNA methylation status in rat liver.
High fructose consumption induces DNA methylation at PPARα and CPT1A promoter regions in the rat liver

International Nuclear Information System (INIS)

Ohashi, Koji; Munetsuna, Eiji; Yamada, Hiroya; Ando, Yoshitaka; Yamazaki, Mirai; Taromaru, Nao; Nagura, Ayuri; Ishikawa, Hiroaki; Suzuki, Koji; Teradaira, Ryoji; Hashimoto, Shuji

2015-01-01

DNA methylation status is affected by environmental factors, including nutrition. Fructose consumption is considered a risk factor for the conditions that make up metabolic syndrome such as dyslipidemia. However, the pathogenetic mechanism by which fructose consumption leads to metabolic syndrome is unclear. Based on observations that epigenetic modifications are closely related to induction of metabolic syndrome, we hypothesized that fructose-induced metabolic syndrome is caused by epigenetic alterations. Male SD rats were designated to receive water or 20% fructose solution for 14 weeks. mRNA levels for peroxisome proliferator-activated receptor alpha (PPARα) and carnitine palmitoyltransferase 1A (CPT1A) was analyzed using Real-time PCR. Restriction digestion and real-time PCR (qAMP) was used for the analysis of DNA methylation status. Hepatic lipid accumulation was also observed by fructose intake. Fructose feeding also significantly decreased mRNA levels for PPARα and CPT1A. qAMP analysis demonstrated the hypermethylation of promoter regions of PPARα and CTP1A genes. Fructose-mediated attenuated gene expression may be mediated by alterations of DNA methylation status, and pathogenesis of metabolic syndrome induced by fructose relates to DNA methylation status. - Highlights: • No general consensus has been reached regarding the molecular mechanisms of the pathogenesis of fructose-induced diseases. • Significant increase in hepatic total methylation level was observed after fructose-supplemented feeding. • Fructose feeding significantly decreased mRNA levels for PPARα and CPT1A. • qAMP analysis demonstrated the hypermethylation of promoter regions of PPARα and CTP1A genes. • Fructose-mediated attenuated gene expression may be mediated by alterations of DNA methylation status in rat liver.
Evaluation of methylation pattern in promoter region of E-cadherin ...

African Journals Online (AJOL)

user

2011-03-07

Mar 7, 2011 ... promoter methylation in CDH1 gene inactivation in breast cancer, the CpG methylation status of E- ..... 5'CpG island of CDH1 in prostate, lung, liver, bladder, .... and estrogen receptor alpha from Sp1 sites to induce cell cycle.
Minimal Gromov-Witten rings

International Nuclear Information System (INIS)

Przyjalkowski, V V

2008-01-01

We construct an abstract theory of Gromov-Witten invariants of genus 0 for quantum minimal Fano varieties (a minimal class of varieties which is natural from the quantum cohomological viewpoint). Namely, we consider the minimal Gromov-Witten ring: a commutative algebra whose generators and relations are of the form used in the Gromov-Witten theory of Fano varieties (of unspecified dimension). The Gromov-Witten theory of any quantum minimal variety is a homomorphism from this ring to C. We prove an abstract reconstruction theorem which says that this ring is isomorphic to the free commutative ring generated by 'prime two-pointed invariants'. We also find solutions of the differential equation of type DN for a Fano variety of dimension N in terms of the generating series of one-pointed Gromov-Witten invariants
TSA-induced DNMT1 down-regulation represses hTERT expression via recruiting CTCF into demethylated core promoter region of hTERT in HCT116.

Science.gov (United States)

Choi, Jee-Hye; Min, Na Young; Park, Jina; Kim, Jin Hong; Park, Soo Hyun; Ko, Young Jong; Kang, Yoonsung; Moon, Young Joon; Rhee, Sangmyung; Ham, Seung Wook; Park, Ae Ja; Lee, Kwang-Ho

2010-01-01

Trichostatin A (TSA), an inhibitor of histone deacetylase, is a well-known antitumor agent that effectively and selectively induces tumor growth arrest and apoptosis. Recently, it was reported that hTERT is one of the primary targets for TSA-induced apoptosis in cancer cells but the mechanism of which has not yet been elucidated. In the present study, to better understand the epigenetic regulation mechanism responsible for the repression of hTERT by TSA, we examined expression of hTERT in the HCT116 colon cancer cell line after treatment with TSA and performed site-specific CpG methylation analysis of the hTERT promoter. We found that TSA-induced the demethylation of site-specific CpGs on the promoter of hTERT, which was caused by down-regulation of DNA methyltransferase 1 (DNMT1). Among the demethylated region, the 31st-33rd CpGs contained a binding site for CTCF, an inhibitor of hTERT transcription. ChIP analysis revealed that TSA-induced demethylation of the 31st-33rd CpGs promoted CTCF binding on hTERT promoter, leading to repression of hTERT. Taken together, down-regulation of DNMT1 by TSA caused demethylation of a CTCF binding site on the hTERT promoter, the result of which was repression of hTERT via recruitment of CTCF to the promoter. Copyright 2009 Elsevier Inc. All rights reserved.
The effect of phenobarbital on the methylation level of the p16 promoter region in rat liver

International Nuclear Information System (INIS)

Kostka, Grazyna; Urbanek, Katarzyna; Ludwicki, Jan K.

2007-01-01

It has been suggested that non-genotoxic carcinogens (NGCs) may cause modification of the DNA methylation status. We studied the effects of phenobarbital (PB) - a non-genotoxic rodent liver carcinogen - on the methylation level of the promoter region of the p16 suppressor gene, as well as on hepatomegaly, DNA synthesis, and DNA-methyltransferase (DNMTs) activity in the rat liver. Male Wistar rats received PB in 1, 3 or 14 daily oral doses (at 24-h intervals), each equivalent to 1/10 of the LD 50 value. The study showed that PB has caused persistent elevation in relative liver weight (RLW) as well as a transient increase in DNA synthesis. This suggests that the PB-induced increase in RLW was due to a combination of both hyperplasia and hypertrophy of liver cells. The effect of PB on DNA synthesis corresponded to an increase in the methylation pattern of the p16 promoter sequence. Methylation of cytosine in the analyzed CpG sites of the p16 gene was found after short exposure of the animals to PB. Treatment of rats with PB for 1 and 3 days also produced an increase in nuclear DNMTs activity. After prolonged administration (14 days), DNA synthesis declined, returning to the control level. No changes in methylation of the p16 gene nor in DNMTs activity were observed. The reversibility of early induced changes in target tissues is a mark characteristic of tumor promoters. Thus, transient changes in methylation of the p16 gene, although their direct role in the mechanisms of PB toxicity, including its carcinogenic action, remains doubtful, may therefore be a significant element of such processes
Advanced Design of Dumbbell-shaped Genetic Minimal Vectors Improves Non-coding and Coding RNA Expression.

Science.gov (United States)

Jiang, Xiaoou; Yu, Han; Teo, Cui Rong; Tan, Genim Siu Xian; Goh, Sok Chin; Patel, Parasvi; Chua, Yiqiang Kevin; Hameed, Nasirah Banu Sahul; Bertoletti, Antonio; Patzel, Volker

2016-09-01

Dumbbell-shaped DNA minimal vectors lacking nontherapeutic genes and bacterial sequences are considered a stable, safe alternative to viral, nonviral, and naked plasmid-based gene-transfer systems. We investigated novel molecular features of dumbbell vectors aiming to reduce vector size and to improve the expression of noncoding or coding RNA. We minimized small hairpin RNA (shRNA) or microRNA (miRNA) expressing dumbbell vectors in size down to 130 bp generating the smallest genetic expression vectors reported. This was achieved by using a minimal H1 promoter with integrated transcriptional terminator transcribing the RNA hairpin structure around the dumbbell loop. Such vectors were generated with high conversion yields using a novel protocol. Minimized shRNA-expressing dumbbells showed accelerated kinetics of delivery and transcription leading to enhanced gene silencing in human tissue culture cells. In primary human T cells, minimized miRNA-expressing dumbbells revealed higher stability and triggered stronger target gene suppression as compared with plasmids and miRNA mimics. Dumbbell-driven gene expression was enhanced up to 56- or 160-fold by implementation of an intron and the SV40 enhancer compared with control dumbbells or plasmids. Advanced dumbbell vectors may represent one option to close the gap between durable expression that is achievable with integrating viral vectors and short-term effects triggered by naked RNA.
Does FDI promote regional development? Evidence from local and regional productivity spillovers in Greece

Directory of Open Access Journals (Sweden)

Vassilis MONASTIRIOTIS

2010-12-01

Full Text Available Studies on the productivity spillovers of FDI have concentrated on the nationalsectoral level. As a result, little is known about the impact of FDI on absolute and relative regional economic performance. In this paper we examine this issue by relying on a unique dataset of over 20,000 Greek firms for the period 2002-2006 covering all sectors of economic activity. We examine the spatial distribution of foreign-owned firms in the country and analyse the effect that their presence – at the local, regional and national levels – has on the productivity of domestic firms. We find strong evidence suggesting that foreignowned firms self-select into regions and sectors of high productivity. Net of this selection effect, the impact of foreign presence on domestic productivity is negative – although at the very local level some positive spillover effects are identifiable. The bulk of the effects concentrate in non-manufacturing activities, high-tech sectors, and medium-sized high-productivity firms. Importantly, this effect is not constant across space however. Productivity spillovers tend to be negative in the regions hosting the main urban areas in the country but positive in smaller and more peripheral regions. In this way, despite the tendency of FDI to concentrate in a limited number of areas within the country – those of the highest level of development – the externalities that FDI activity generates to the local economies appear to be of a rather equilibrating character.
Minimal Marking: A Success Story

Science.gov (United States)

McNeilly, Anne

2014-01-01

The minimal-marking project conducted in Ryerson's School of Journalism throughout 2012 and early 2013 resulted in significantly higher grammar scores in two first-year classes of minimally marked university students when compared to two traditionally marked classes. The "minimal-marking" concept (Haswell, 1983), which requires…
Minimal families of curves on surfaces

KAUST Repository

Lubbes, Niels

2014-01-01

A minimal family of curves on an embedded surface is defined as a 1-dimensional family of rational curves of minimal degree, which cover the surface. We classify such minimal families using constructive methods. This allows us to compute the minimal
The FCC-ee Interaction Region Magnet Design

CERN Document Server

Koratzinos, Michael; Blondel, Alain; Bogomyagkov, Anton; Holzer, Bernhard; Oide, Katsunobu; Sinyatkin, Sergey; Zimmermann, Frank; van Nugteren, Jeroen

2016-01-01

The design of the region close to the interaction point of the FCC-ee experiments is especially challenging. The beams collide at an angle (+-15 mrad) in the high-field region of the detector solenoid. Moreover, the very low vertical beta_y* of the machine necessitates that the final focusing quadrupoles have a distance from the IP (L*) of around 2 m and therefore are inside the main detector solenoid. The beams should be screened from the effect of the detector magnetic field, and the emittance blow-up due to vertical dispersion in the interaction region should be minimized, while leaving enough space for detector components. Crosstalk between the two final focus quadrupoles, only about 6 cm apart at the tip, should also be minimized.

Constructing a State Policy To Promote Regionalism in School Government.

Science.gov (United States)

Zukowsky, Jerome; And Others.

This paper defines regionalism, sets some tentative directions for the concept, and raises difficult questions related to its application in New York State. Regionalism, which offers an alternative to a State-local school governing system, is used to decentralize the planning and management of public services. A regional unit permits district…
Waste minimization assessment procedure

International Nuclear Information System (INIS)

Kellythorne, L.L.

1993-01-01

Perry Nuclear Power Plant began developing a waste minimization plan early in 1991. In March of 1991 the plan was documented following a similar format to that described in the EPA Waste Minimization Opportunity Assessment Manual. Initial implementation involved obtaining management's commitment to support a waste minimization effort. The primary assessment goal was to identify all hazardous waste streams and to evaluate those streams for minimization opportunities. As implementation of the plan proceeded, non-hazardous waste streams routinely generated in large volumes were also evaluated for minimization opportunities. The next step included collection of process and facility data which would be useful in helping the facility accomplish its assessment goals. This paper describes the resources that were used and which were most valuable in identifying both the hazardous and non-hazardous waste streams that existed on site. For each material identified as a waste stream, additional information regarding the materials use, manufacturer, EPA hazardous waste number and DOT hazard class was also gathered. Once waste streams were evaluated for potential source reduction, recycling, re-use, re-sale, or burning for heat recovery, with disposal as the last viable alternative
Westinghouse Hanford Company waste minimization actions

International Nuclear Information System (INIS)

Greenhalgh, W.O.

1988-09-01

Companies that generate hazardous waste materials are now required by national regulations to establish a waste minimization program. Accordingly, in FY88 the Westinghouse Hanford Company formed a waste minimization team organization. The purpose of the team is to assist the company in its efforts to minimize the generation of waste, train personnel on waste minimization techniques, document successful waste minimization effects, track dollar savings realized, and to publicize and administer an employee incentive program. A number of significant actions have been successful, resulting in the savings of materials and dollars. The team itself has been successful in establishing some worthwhile minimization projects. This document briefly describes the waste minimization actions that have been successful to date. 2 refs., 26 figs., 3 tabs
Characteristics of lentiviral vectors harboring the proximal promoter of the vav proto-oncogene: a weak and efficient promoter for gene therapy.

Science.gov (United States)

Almarza, Elena; Río, Paula; Meza, Nestor W; Aldea, Montserrat; Agirre, Xabier; Guenechea, Guillermo; Segovia, José C; Bueren, Juan A

2007-08-01

Recent published data have shown the efficacy of gene therapy treatments of certain monogenic diseases. Risks of insertional oncogenesis, however, indicate the necessity of developing new vectors with weaker or cell-restricted promoters to minimize the trans-activation activity of integrated proviruses. We have inserted the proximal promoter of the vav proto-oncogene into self-inactivating lentiviral vectors (vav-LVs) and investigated the expression pattern and therapeutic efficacy of these vectors. Compared with other LVs frequently used in gene therapy, vav-LVs mediated a weak, though homogeneous and stable, expression in in vitro-cultured cells. Transplantation experiments using transduced mouse bone marrow and human CD34(+) cells confirmed the stable activity of the promoter in vivo. To investigate whether the weak activity of this promoter was compatible with a therapeutic effect, a LV expressing the Fanconi anemia A (FANCA) gene was constructed (vav-FANCA LV). Although this vector induced a low expression of FANCA, compared to the expression induced by a LV harboring the spleen focus-forming virus (SFFV) promoter, the two vectors corrected the phenotype of cells from a patient with FA-A with the same efficacy. We propose that self-inactivating vectors harboring weak promoters, such as the vav promoter, will improve the safety of gene therapy and will be of particular interest for the treatment of diseases where a high expression of the transgene is not required.
Genetic basis of olfactory cognition: extremely high level of DNA sequence polymorphism in promoter regions of the human olfactory receptor genes revealed using the 1000 Genomes Project dataset.

Science.gov (United States)

Ignatieva, Elena V; Levitsky, Victor G; Yudin, Nikolay S; Moshkin, Mikhail P; Kolchanov, Nikolay A

2014-01-01

The molecular mechanism of olfactory cognition is very complicated. Olfactory cognition is initiated by olfactory receptor proteins (odorant receptors), which are activated by olfactory stimuli (ligands). Olfactory receptors are the initial player in the signal transduction cascade producing a nerve impulse, which is transmitted to the brain. The sensitivity to a particular ligand depends on the expression level of multiple proteins involved in the process of olfactory cognition: olfactory receptor proteins, proteins that participate in signal transduction cascade, etc. The expression level of each gene is controlled by its regulatory regions, and especially, by the promoter [a region of DNA about 100-1000 base pairs long located upstream of the transcription start site (TSS)]. We analyzed single nucleotide polymorphisms using human whole-genome data from the 1000 Genomes Project and revealed an extremely high level of single nucleotide polymorphisms in promoter regions of olfactory receptor genes and HLA genes. We hypothesized that the high level of polymorphisms in olfactory receptor promoters was responsible for the diversity in regulatory mechanisms controlling the expression levels of olfactory receptor proteins. Such diversity of regulatory mechanisms may cause the great variability of olfactory cognition of numerous environmental olfactory stimuli perceived by human beings (air pollutants, human body odors, odors in culinary etc.). In turn, this variability may provide a wide range of emotional and behavioral reactions related to the vast variety of olfactory stimuli.
Minimal but non-minimal inflation and electroweak symmetry breaking

Energy Technology Data Exchange (ETDEWEB)

Marzola, Luca [National Institute of Chemical Physics and Biophysics,Rävala 10, 10143 Tallinn (Estonia); Institute of Physics, University of Tartu,Ravila 14c, 50411 Tartu (Estonia); Racioppi, Antonio [National Institute of Chemical Physics and Biophysics,Rävala 10, 10143 Tallinn (Estonia)

2016-10-07

We consider the most minimal scale invariant extension of the standard model that allows for successful radiative electroweak symmetry breaking and inflation. The framework involves an extra scalar singlet, that plays the rôle of the inflaton, and is compatibile with current experimental bounds owing to the non-minimal coupling of the latter to gravity. This inflationary scenario predicts a very low tensor-to-scalar ratio r≈10{sup −3}, typical of Higgs-inflation models, but in contrast yields a scalar spectral index n{sub s}≃0.97 which departs from the Starobinsky limit. We briefly discuss the collider phenomenology of the framework.
Quantitative Analyses of Core Promoters Enable Precise Engineering of Regulated Gene Expression in Mammalian Cells

Science.gov (United States)

Ede, Christopher; Chen, Ximin; Lin, Meng-Yin; Chen, Yvonne Y.

2016-01-01

Inducible transcription systems play a crucial role in a wide array of synthetic biology circuits. However, the majority of inducible promoters are constructed from a limited set of tried-and-true promoter parts, which are susceptible to common shortcomings such as high basal expression levels (i.e., leakiness). To expand the toolbox for regulated mammalian gene expression and facilitate the construction of mammalian genetic circuits with precise functionality, we quantitatively characterized a panel of eight core promoters, including sequences with mammalian, viral, and synthetic origins. We demonstrate that this selection of core promoters can provide a wide range of basal gene expression levels and achieve a gradient of fold-inductions spanning two orders of magnitude. Furthermore, commonly used parts such as minimal CMV and minimal SV40 promoters were shown to achieve robust gene expression upon induction, but also suffer from high levels of leakiness. In contrast, a synthetic promoter, YB_TATA, was shown to combine low basal expression with high transcription rate in the induced state to achieve significantly higher fold-induction ratios compared to all other promoters tested. These behaviors remain consistent when the promoters are coupled to different genetic outputs and different response elements, as well as across different host-cell types and DNA copy numbers. We apply this quantitative understanding of core promoter properties to the successful engineering of human T cells that respond to antigen stimulation via chimeric antigen receptor signaling specifically under hypoxic environments. Results presented in this study can facilitate the design and calibration of future mammalian synthetic biology systems capable of precisely programmed functionality. PMID:26883397
A Community-Aware Approach to Minimizing Dissemination in Graphs

KAUST Repository

Zhang, Chuxu

2017-08-02

Given a graph, can we minimize the spread of an entity (such as a meme or a virus) while maintaining the graph’s community structure (defined as groups of nodes with denser intra-connectivity than inter-connectivity)? At first glance, these two objectives seem at odds with each other. To minimize dissemination, nodes or links are often deleted to reduce the graph’s connectivity. These deletions can (and often do) destroy the graph’s community structure, which is an important construct in real-world settings (e.g., communities promote trust among their members). We utilize rewiring of links to achieve both objectives. Examples of rewiring in real life are prevalent, such as purchasing products from a new farm since the local farm has signs of mad cow disease; getting information from a new source after a disaster since your usual source is no longer available, etc. Our community-aware approach, called constrCRlink (short for Constraint Community Relink), preserves (on average) 98.6% of the efficacy of the best community-agnostic link-deletion approach (namely, NetMelt+), but changes the original community structure of the graph by only 4.5%. In contrast, NetMelt+ changes 13.6% of the original community structure.
Ruled Laguerre minimal surfaces

KAUST Repository

Skopenkov, Mikhail

2011-10-30

A Laguerre minimal surface is an immersed surface in ℝ 3 being an extremal of the functional ∫ (H 2/K-1)dA. In the present paper, we prove that the only ruled Laguerre minimal surfaces are up to isometry the surfaces ℝ (φλ) = (Aφ, Bφ, Cφ + D cos 2φ) + λ(sin φ, cos φ, 0), where A,B,C,D ε ℝ are fixed. To achieve invariance under Laguerre transformations, we also derive all Laguerre minimal surfaces that are enveloped by a family of cones. The methodology is based on the isotropic model of Laguerre geometry. In this model a Laguerre minimal surface enveloped by a family of cones corresponds to a graph of a biharmonic function carrying a family of isotropic circles. We classify such functions by showing that the top view of the family of circles is a pencil. © 2011 Springer-Verlag.
DNA methylation of PTEN gene promoter region is not correlated ...

African Journals Online (AJOL)

Tumor suppressor gene PTEN plays an important role in cell cycle. Disorder of PTEN protein can cause cell growth and division in an uncontrolled way, which can lead to the formation of tumors. It has been proven that epigenetic mechanisms, such as promoter hypermethylation, may account for inactivation of PTEN in a ...
Split Attractor Flow in N=2 Minimally Coupled Supergravity

CERN Document Server

Ferrara, Sergio; Orazi, Emanuele

2011-01-01

We classify the stability region, marginal stability walls (MS) and split attractor flows for two-center extremal black holes in four-dimensional N=2 supergravity minimally coupled to n vector multiplets. It is found that two-center (continuous) charge orbits, classified by four duality invariants, either support a stability region ending on a MS wall or on an anti-marginal stability (AMS) wall, but not both. Therefore, the scalar manifold never contains both walls. Moreover, the BPS mass of the black hole composite (in its stability region) never vanishes in the scalar manifold. For these reasons, the "bound state transformation walls" phenomenon does not necessarily occur in these theories. The entropy of the flow trees also satisfies an inequality which forbids "entropy enigma" decays in these models. Finally, the non-BPS case, due to the existence of a "fake" superpotential satisfying a triangle inequality, can be treated as well, and it can be shown to exhibit a split attractor flow dynamics which, at le...
National promotional campaign

Directory of Open Access Journals (Sweden)

Pekevski Siniša

2008-01-01

Full Text Available Taking an attention to promotion as operational variable in marketing effort, author focused on so called ways of creating national images. As a case of very interesting activity paper discuss an experience of regional chamber of Croatia with activities in upgrading international recognition of national products as well as country as destination in such context.
Global Analysis of Minimal Surfaces

CERN Document Server

Dierkes, Ulrich; Tromba, Anthony J

2010-01-01

Many properties of minimal surfaces are of a global nature, and this is already true for the results treated in the first two volumes of the treatise. Part I of the present book can be viewed as an extension of these results. For instance, the first two chapters deal with existence, regularity and uniqueness theorems for minimal surfaces with partially free boundaries. Here one of the main features is the possibility of 'edge-crawling' along free parts of the boundary. The third chapter deals with a priori estimates for minimal surfaces in higher dimensions and for minimizers of singular integ
Minimal Surfaces for Hitchin Representations

DEFF Research Database (Denmark)

Li, Qiongling; Dai, Song

2018-01-01

. In this paper, we investigate the properties of immersed minimal surfaces inside symmetric space associated to a subloci of Hitchin component: $q_n$ and $q_{n-1}$ case. First, we show that the pullback metric of the minimal surface dominates a constant multiple of the hyperbolic metric in the same conformal...... class and has a strong rigidity property. Secondly, we show that the immersed minimal surface is never tangential to any flat inside the symmetric space. As a direct corollary, the pullback metric of the minimal surface is always strictly negatively curved. In the end, we find a fully decoupled system...
Minimal Webs in Riemannian Manifolds

DEFF Research Database (Denmark)

Markvorsen, Steen

2008-01-01

For a given combinatorial graph $G$ a {\\it geometrization} $(G, g)$ of the graph is obtained by considering each edge of the graph as a $1-$dimensional manifold with an associated metric $g$. In this paper we are concerned with {\\it minimal isometric immersions} of geometrized graphs $(G, g......)$ into Riemannian manifolds $(N^{n}, h)$. Such immersions we call {\\em{minimal webs}}. They admit a natural 'geometric' extension of the intrinsic combinatorial discrete Laplacian. The geometric Laplacian on minimal webs enjoys standard properties such as the maximum principle and the divergence theorems, which...... are of instrumental importance for the applications. We apply these properties to show that minimal webs in ambient Riemannian spaces share several analytic and geometric properties with their smooth (minimal submanifold) counterparts in such spaces. In particular we use appropriate versions of the divergence...
Waste minimization handbook, Volume 1

Energy Technology Data Exchange (ETDEWEB)

Boing, L.E.; Coffey, M.J.

1995-12-01

This technical guide presents various methods used by industry to minimize low-level radioactive waste (LLW) generated during decommissioning and decontamination (D and D) activities. Such activities generate significant amounts of LLW during their operations. Waste minimization refers to any measure, procedure, or technique that reduces the amount of waste generated during a specific operation or project. Preventive waste minimization techniques implemented when a project is initiated can significantly reduce waste. Techniques implemented during decontamination activities reduce the cost of decommissioning. The application of waste minimization techniques is not limited to D and D activities; it is also useful during any phase of a facility`s life cycle. This compendium will be supplemented with a second volume of abstracts of hundreds of papers related to minimizing low-level nuclear waste. This second volume is expected to be released in late 1996.
Waste minimization handbook, Volume 1

International Nuclear Information System (INIS)

Boing, L.E.; Coffey, M.J.

1995-12-01

This technical guide presents various methods used by industry to minimize low-level radioactive waste (LLW) generated during decommissioning and decontamination (D and D) activities. Such activities generate significant amounts of LLW during their operations. Waste minimization refers to any measure, procedure, or technique that reduces the amount of waste generated during a specific operation or project. Preventive waste minimization techniques implemented when a project is initiated can significantly reduce waste. Techniques implemented during decontamination activities reduce the cost of decommissioning. The application of waste minimization techniques is not limited to D and D activities; it is also useful during any phase of a facility's life cycle. This compendium will be supplemented with a second volume of abstracts of hundreds of papers related to minimizing low-level nuclear waste. This second volume is expected to be released in late 1996
Comparative analyses of bidirectional promoters in vertebrates

Directory of Open Access Journals (Sweden)

Taylor James

2008-05-01

Full Text Available Abstract Background Orthologous genes with deep phylogenetic histories are likely to retain similar regulatory features. In this report we utilize orthology assignments for pairs of genes co-regulated by bidirectional promoters to map the ancestral history of the promoter regions. Results Our mapping of bidirectional promoters from humans to fish shows that many such promoters emerged after the divergence of chickens and fish. Furthermore, annotations of promoters in deep phylogenies enable detection of missing data or assembly problems present in higher vertebrates. The functional importance of bidirectional promoters is indicated by selective pressure to maintain the arrangement of genes regulated by the promoter over long evolutionary time spans. Characteristics unique to bidirectional promoters are further elucidated using a technique for unsupervised classification, known as ESPERR. Conclusion Results of these analyses will aid in our understanding of the evolution of bidirectional promoters, including whether the regulation of two genes evolved as a consequence of their proximity or if function dictated their co-regulation.
Recognition of prokaryotic and eukaryotic promoters using convolutional deep learning neural networks

KAUST Repository

Umarov, Ramzan

2017-02-03

Accurate computational identification of promoters remains a challenge as these key DNA regulatory regions have variable structures composed of functional motifs that provide gene-specific initiation of transcription. In this paper we utilize Convolutional Neural Networks (CNN) to analyze sequence characteristics of prokaryotic and eukaryotic promoters and build their predictive models. We trained a similar CNN architecture on promoters of five distant organisms: human, mouse, plant (Arabidopsis), and two bacteria (Escherichia coli and Bacillus subtilis). We found that CNN trained on sigma70 subclass of Escherichia coli promoter gives an excellent classification of promoters and non-promoter sequences (Sn = 0.90, Sp = 0.96, CC = 0.84). The Bacillus subtilis promoters identification CNN model achieves Sn = 0.91, Sp = 0.95, and CC = 0.86. For human, mouse and Arabidopsis promoters we employed CNNs for identification of two well-known promoter classes (TATA and non-TATA promoters). CNN models nicely recognize these complex functional regions. For human promoters Sn/Sp/CC accuracy of prediction reached 0.95/0.98/0,90 on TATA and 0.90/0.98/0.89 for non-TATA promoter sequences, respectively. For Arabidopsis we observed Sn/Sp/CC 0.95/0.97/0.91 (TATA) and 0.94/0.94/0.86 (non-TATA) promoters. Thus, the developed CNN models, implemented in CNNProm program, demonstrated the ability of deep learning approach to grasp complex promoter sequence characteristics and achieve significantly higher accuracy compared to the previously developed promoter prediction programs. We also propose random substitution procedure to discover positionally conserved promoter functional elements. As the suggested approach does not require knowledge of any specific promoter features, it can be easily extended to identify promoters and other complex functional regions in sequences of many other and especially newly sequenced genomes. The CNNProm program is available to run at web server http://www.softberry.com.
Promoters active in interphase are bookmarked during mitosis by ubiquitination

Science.gov (United States)

Arora, Mansi; Zhang, Jie; Heine, George F.; Ozer, Gulcin; Liu, Hui-wen; Huang, Kun; Parvin, Jeffrey D.

2012-01-01

We analyzed modification of chromatin by ubiquitination in human cells and whether this mark changes through the cell cycle. HeLa cells were synchronized at different stages and regions of the genome with ubiquitinated chromatin were identified by affinity purification coupled with next-generation sequencing. During interphase, ubiquitin marked the chromatin on the transcribed regions of ∼70% of highly active genes and deposition of this mark was sensitive to transcriptional inhibition. Promoters of nearly half of the active genes were highly ubiquitinated specifically during mitosis. The ubiquitination at the coding regions in interphase but not at promoters during mitosis was enriched for ubH2B and dependent on the presence of RNF20. Ubiquitin labeling of both promoters during mitosis and transcribed regions during interphase, correlated with active histone marks H3K4me3 and H3K36me3 but not a repressive histone modification, H3K27me3. The high level of ubiquitination at the promoter chromatin during mitosis was transient and was removed within 2 h after the cells exited mitosis and entered the next cell cycle. These results reveal that the ubiquitination of promoter chromatin during mitosis is a bookmark identifying active genes during chromosomal condensation in mitosis, and we suggest that this process facilitates transcriptional reactivation post-mitosis. PMID:22941662

Genome-wide analysis of promoter architecture in Drosophila melanogaster

Energy Technology Data Exchange (ETDEWEB)

Hoskins, Roger A.; Landolin, Jane M.; Brown, James B.; Sandler, Jeremy E.; Takahashi, Hazuki; Lassmann, Timo; Yu, Charles; Booth, Benjamin W.; Zhang, Dayu; Wan, Kenneth H.; Yang, Li; Boley, Nathan; Andrews, Justen; Kaufman, Thomas C.; Graveley, Brenton R.; Bickel, Peter J.; Carninci, Piero; Carlson, Joseph W.; Celniker, Susan E.

2010-10-20

Core promoters are critical regions for gene regulation in higher eukaryotes. However, the boundaries of promoter regions, the relative rates of initiation at the transcription start sites (TSSs) distributed within them, and the functional significance of promoter architecture remain poorly understood. We produced a high-resolution map of promoters active in the Drosophila melanogaster embryo by integrating data from three independent and complementary methods: 21 million cap analysis of gene expression (CAGE) tags, 1.2 million RNA ligase mediated rapid amplification of cDNA ends (RLMRACE) reads, and 50,000 cap-trapped expressed sequence tags (ESTs). We defined 12,454 promoters of 8037 genes. Our analysis indicates that, due to non-promoter-associated RNA background signal, previous studies have likely overestimated the number of promoter-associated CAGE clusters by fivefold. We show that TSS distributions form a complex continuum of shapes, and that promoters active in the embryo and adult have highly similar shapes in 95% of cases. This suggests that these distributions are generally determined by static elements such as local DNA sequence and are not modulated by dynamic signals such as histone modifications. Transcription factor binding motifs are differentially enriched as a function of promoter shape, and peaked promoter shape is correlated with both temporal and spatial regulation of gene expression. Our results contribute to the emerging view that core promoters are functionally diverse and control patterning of gene expression in Drosophila and mammals.
Characterization and sequence analysis of the F2 promoter from corynephage BFK20

International Nuclear Information System (INIS)

Koptides, M.; Ugorcakova, J.; Baloghova, E.; Bukovska, G.; Timko, J.

1994-01-01

F2 promoter from corynephage BFK20 was isolated and characterized. It was functional in Escherichia coli and Corynebacterium glutamicum. Cloning of the F2 promoter into the pJUP05 promoter probe vector caused an increase of the neomycin phosphotransferase II specific activity. According to the Northern blot hybridization the nptII gene was expressed from the cloned F2 promoter. The apparent transcription start point in E. coli and C. glutamicum was determined. The-35 region of F2 promoter showed high similarity to that of E. coli promoter consensus sequence, but its - 10 region was G+C rich and had no significant homology to that. (author)
Regional economic impacts of the unconventional promotion of natural gas (Hydraulic Fracturing). Preliminary study; Regionaloekonomische Auswirkungen der unkonventionellen Erdgasfoerderung (Hydraulic Fracturing). Vorstudie

Energy Technology Data Exchange (ETDEWEB)

Bizer, Kilian; Bossmeyer, Christoph

2012-07-01

Actually, there is a controversial public discussion on the exploitation of conventional natural gas by means of hydraulic fracturing (Fracking). The contribution under consideration examines the geologic, toxicological or technical as well as legal points of contact with respect to the different effects for the actor groups. Based on the existing scientific realizations, the regional economic effects of the fracking technology and the subsequent promotion of unconventional natural gas deposits have to be worked out.
Luciferase assay to study the activity of a cloned promoter DNA fragment.

Science.gov (United States)

Solberg, Nina; Krauss, Stefan

2013-01-01

Luciferase based assays have become an invaluable tool for the analysis of cloned promoter DNA fragments, both for verifying the ability of a potential promoter fragment to drive the expression of a luciferase reporter gene in various cellular contexts, and for dissecting binding elements in the promoter. Here, we describe the use of the Dual-Luciferase(®) Reporter Assay System created by Promega (Promega Corporation, Wisconsin, USA) to study the cloned 6.7 kilobases (kb) mouse (m) Tcf3 promoter DNA fragment in mouse embryonic derived neural stem cells (NSC). In this system, the expression of the firefly luciferase driven by the cloned mTcf3 promoter DNA fragment (including transcription initiation sites) is correlated with a co-transfected control reporter expressing Renilla luciferase from the herpes simplex virus (HSV) thymidine kinase promoter. Using an internal control reporter allows to normalize the activity of the experimental reporter to the internal control, which minimizes experimental variability.
Perioral rejuvenation: restoration of attractiveness in aging females by minimally invasive procedures

Directory of Open Access Journals (Sweden)

Wollina U

2013-09-01

Full Text Available Uwe Wollina Department of Dermatology and Allergology, Academic Teaching Hospital Dresden-Friedrichstadt, Dresden, Germany Abstract: Lips and the perioral area are of outstanding importance in youthful appearance, attractiveness, and beauty. In contrast to younger and middle aged females, there is only scant published data on minimally invasive procedures to restore and revitalize lips and perioral soft tissue in elderly females. In this review we report the signs of aging in this particular region and the underlying anatomy. We review studies on lip restoration in younger females and present our techniques for elderly women. With an individually tailored approach, elderly females benefit from minimally invasive techniques. Keywords: facial aging, perioral soft tissue, lips, dermal fillers, anatomy
Effect of nitrogen fertilisation on the overall quality of minimally processed globe artichoke heads.

Science.gov (United States)

Lombardo, Sara; Restuccia, Cristina; Muratore, Giuseppe; Barbagallo, Riccardo N; Licciardello, Fabio; Pandino, Gaetano; Scifò, Giovanna O; Mazzaglia, Agata; Ragonese, Francesca; Mauromicale, Giovanni

2017-01-01

Although nitrogen (N) fertilisation is essential for promoting crop yield, it may also affect the produce quality. Here, the influence of three N fertiliser rates (0 kg ha -1 as a control, 200 kg ha -1 and 400 kg ha -1 referred to as N 0 , N 200 and N 400 , respectively) on the overall quality of minimally processed globe artichoke heads was investigated during refrigerated storage for 12 days. Throughout the storage time, N fertilised samples had higher inulin contents than those unfertilised. In addition, the respiratory quotient of N 200 and N 400 samples was 2-fold and 2.5-fold lower than N 0 ones, whose values were close to the normal range for vegetables. All the samples reported good microbiological standards, although N 200 and N 400 achieved lower mesophilic and psychotropic counts than N 0 throughout the storage time. After 8 and 12 days of refrigerated storage, the N 200 samples showed the highest scores of positive sensory descriptors. A fertiliser level of 200 kg N ha -1 is suitable for obtaining minimally processed globe artichoke heads with good nutritional, sensory and microbiological quality, characterised by low endogenous oxidase activities. Proper packaging systems and procedures are, however, crucial for extending the product shelf-life and, thus, promoting its exportation on a wider scale. © 2016 Society of Chemical Industry. © 2016 Society of Chemical Industry.
REGIONAL DEVELOPMENT THEORIES AND MODELS, A COMPARATIVE ANALYSE.CHALLENGE OF REGIONAL DEVELOPMENT IN ALBANIA

Directory of Open Access Journals (Sweden)

Eva\tDHIMITRI

2015-12-01

Full Text Available Local governance is a broad concept and is defined as the formulation and execution of collective action at the local level. The purpose of local government is to ensure effective and efficient use of public resources and service delivery at the level closest to citizens. Regional development is a new concept that aims to stimulate and diversify the economic activity of a country (region, to encourage investment in the private sector, to create a new jobs vacancy and improves living standards of the country. Regional development policies are a number of measures designed and promoted by the central and local administration, but the cooperation undertaken at the actors are in a different one, which included the private sector and civil society. At the center of these regional policies or practices is the use of efficient potential of each region, being particularly focused on business, means promoting the development of the new enterprises, promoting labor market and investment, improve the quality of environment, health , education and culture. Traditional objective of regional development policies is the reduction of territorial disparities for achieving a relative balance between economic and social levels of development in different areas in the national territory. Regional development is the actual task of local government units in Albania, and is one of the tasks and challenges of the future. Currently it takes a special importance in the context of European Union integration. Reforms have begun to change the system in 1990 in order to implement local democracy and decentralization principles that are present today. Inequalities that exist within the region and between them indicate that in some regions the economic potential is not being fully utilized, and that it reduces the overall performance in national level.
Health Promotion Behaviours and Level of Activities of Daily Living and Instrumental Activities of Daily Living Among Elderly People in West Region of Tehran: A Cross-Sectional Survey

Directory of Open Access Journals (Sweden)

Aghil Habibi Sola

2007-10-01

Full Text Available Objectives: As individuals live longer, health promotion behaviors get even more important, particularly with regard to maintaining functional independence and improving quality of life. The purpose of this study was to explore the relationship between health promotion behaviors and level of Activities of Daily Living (ADL and Instrumental Activities of Daily Living (IADL among elderly people in west region of Tehran. Methods & Materials: This was a descriptive-correlational study. A multi-stage sample of 410 community residents who were over 60 years old were selected from west region of Tehran. Participants who consented to participate in the study were interviewed with a structured questionnaire. The questionnaire consisted of 2-part; Health Promotion Behavior Checklist and questions related to status of physical functioning, which includes activities of daily living (ADLs and instrumental activities of daily living (IADLs. Descriptive statistics and T-test were used to data analysis. Results: The results of the study showed that there were significant relations between ADLs and ' exercise or walking', 'drinking milk, eating dairy and meat', 'eating vegetables and fruits', 'low salt diet' and 'low fat diet' (P<0.05. Furthermore there were significant relations between the IADLs and 'smoking cessation', 'alcohol abstinence', 'exercise or walking', 'drinking milk, eating dairy and meat', 'eating vegetables and fruits', 'low salt diet' and 'low fat diet' (P<0.05. Conclusion: Study showed, health promotion behaviors and level of ADL and IADL are related meaningfully. Health care professionals should enhance the physical functioning in elderly people by facilitating health promotion behaviors through formal health promotion programs which focus on regular diet, exercise, and regular physical check-ups which will maintain and increase a healthy and active life.
Analysis of an osmotically regulated pathogenesis-related osmotin gene promoter.

Science.gov (United States)

Raghothama, K G; Liu, D; Nelson, D E; Hasegawa, P M; Bressan, R A

1993-12-01

Osmotin is a small (24 kDa), basic, pathogenesis-related protein, that accumulates during adaptation of tobacco (Nicotiana tabacum) cells to osmotic stress. There are more than 10 inducers that activate the osmotin gene in various plant tissues. The osmotin promoter contains several sequences bearing a high degree of similarity to ABRE, as-1 and E-8 cis element sequences. Gel retardation studies indicated the presence of at least two regions in the osmotin promoter that show specific interactions with nuclear factors isolated from cultured cells or leaves. The abundance of these binding factors increased in response to salt, ABA and ethylene. Nuclear factors protected a 35 bp sequence of the promoter from DNase I digestion. Different 5' deletions of the osmotin promoter cloned into a promoter-less GUSNOS plasmid (pBI 201) were used in transient expression studies with a Biolistic gun. The transient expression studies revealed the presence of three distinct regions in the osmotin promoter. The promoter sequence from -108 to -248 bp is absolutely required for reporter gene activity, followed by a long stretch (up to -1052) of enhancer-like sequence and then a sequence upstream of -1052, which appears to contain negative elements. The responses to ABA, ethylene, salt, desiccation and wounding appear to be associated with the -248 bp sequence of the promoter. This region also contains a putative ABRE (CACTGTG) core element. Activation of the osmotin gene by various inducers is discussed in view of antifungal activity of the osmotin protein.
Discriminative identification of transcriptional responses of promoters and enhancers after stimulus

KAUST Repository

Kleftogiannis, Dimitrios A.

2016-10-17

Promoters and enhancers regulate the initiation of gene expression and maintenance of expression levels in spatial and temporal manner. Recent findings stemming from the Cap Analysis of Gene Expression (CAGE) demonstrate that promoters and enhancers, based on their expression profiles after stimulus, belong to different transcription response subclasses. One of the most promising biological features that might explain the difference in transcriptional response between subclasses is the local chromatin environment. We introduce a novel computational framework, PEDAL, for distinguishing effectively transcriptional profiles of promoters and enhancers using solely histone modification marks, chromatin accessibility and binding sites of transcription factors and co-activators. A case study on data from MCF-7 cell-line reveals that PEDAL can identify successfully the transcription response subclasses of promoters and enhancers from two different stimulations. Moreover, we report subsets of input markers that discriminate with minimized classification error MCF-7 promoter and enhancer transcription response subclasses. Our work provides a general computational approach for identifying effectively cell-specific and stimulation-specific promoter and enhancer transcriptional profiles, and thus, contributes to improve our understanding of transcriptional activation in human.
Performance analysis for minimally nonlinear irreversible refrigerators at finite cooling power

Science.gov (United States)

Long, Rui; Liu, Zhichun; Liu, Wei

2018-04-01

The coefficient of performance (COP) for general refrigerators at finite cooling power have been systematically researched through the minimally nonlinear irreversible model, and its lower and upper bounds in different operating regions have been proposed. Under the tight coupling conditions, we have calculated the universal COP bounds under the χ figure of merit in different operating regions. When the refrigerator operates in the region with lower external flux, we obtained the general bounds (0 present large values, compared to a relative small loss from the maximum cooling power. If the cooling power is the main objective, it is desirable to operate the refrigerator at a slightly lower cooling power than at the maximum one, where a small loss in the cooling power induces a much larger COP enhancement.
Ruled Laguerre minimal surfaces

KAUST Repository

Skopenkov, Mikhail; Pottmann, Helmut; Grohs, Philipp

2011-01-01

A Laguerre minimal surface is an immersed surface in ℝ 3 being an extremal of the functional ∫ (H 2/K-1)dA. In the present paper, we prove that the only ruled Laguerre minimal surfaces are up to isometry the surfaces ℝ (φλ) = (Aφ, Bφ, Cφ + D cos 2φ
Enhancing Resources at the Workplace with Health-Promoting Leadership.

Science.gov (United States)

Jiménez, Paul; Bregenzer, Anita; Kallus, K Wolfgang; Fruhwirth, Bianca; Wagner-Hartl, Verena

2017-10-20

Leaders engaging in health-promoting leadership can influence their employees' health directly by showing health awareness or indirectly by changing working conditions. With health-promoting leadership, leaders are able to support a healthy working environment by providing resource-oriented working conditions for their employees to support their health. Changing working conditions in a health-supportive way can prevent possible negative consequences from critical working conditions (e.g., burnout risk). The present study examined the relationship between health-promoting leadership and the employees' resources, stress and burnout. To analyze our proposed model, structural equation modelling was conducted in two samples. The resulting model from the first sample of 228 Austrian workers was cross-validated and could be verified with the second sample (N = 263 Austrian workers). The results supported a model in which health-promoting leadership has a strong direct effect on the employees' resources and an indirect effect on stress and burnout, which was mediated by resources. The results indicate that health-promoting leadership describes the leaders' capability and dedication creating the right working conditions for their employees by increasing the employees' resources at the workplace. This in turn minimizes the risk of experiencing burnout.
Enhancing Resources at the Workplace with Health-Promoting Leadership

Directory of Open Access Journals (Sweden)

Paul Jiménez

2017-10-01

Full Text Available Leaders engaging in health-promoting leadership can influence their employees’ health directly by showing health awareness or indirectly by changing working conditions. With health-promoting leadership, leaders are able to support a healthy working environment by providing resource-oriented working conditions for their employees to support their health. Changing working conditions in a health-supportive way can prevent possible negative consequences from critical working conditions (e.g., burnout risk. The present study examined the relationship between health-promoting leadership and the employees’ resources, stress and burnout. To analyze our proposed model, structural equation modelling was conducted in two samples. The resulting model from the first sample of 228 Austrian workers was cross-validated and could be verified with the second sample (N = 263 Austrian workers. The results supported a model in which health-promoting leadership has a strong direct effect on the employees’ resources and an indirect effect on stress and burnout, which was mediated by resources. The results indicate that health-promoting leadership describes the leaders’ capability and dedication creating the right working conditions for their employees by increasing the employees’ resources at the workplace. This in turn minimizes the risk of experiencing burnout.
Genetic basis of olfactory cognition: extremely high level of DNA sequence polymorphism in promoter regions of the human olfactory receptor genes revealed using the 1000 Genomes Project dataset

Directory of Open Access Journals (Sweden)

Elena V. Ignatieva

2014-03-01

Full Text Available The molecular mechanism of olfactory cognition is very complicated. Olfactory cognition is initiated by olfactory receptor proteins (odorant receptors, which are activated by olfactory stimuli (ligands. Olfactory receptors are the initial player in the signal transduction cascade producing a nerve impulse, which is transmitted to the brain. The sensitivity to a particular ligand depends on the expression level of multiple proteins involved in the process of olfactory cognition: olfactory receptor proteins, proteins that participate in signal transduction cascade, etc. The expression level of each gene is controlled by its regulatory regions, and especially, by the promoter (a region of DNA about 100–1000 base pairs long located upstream of the transcription start site. We analyzed single nucleotide polymorphisms using human whole-genome data from the 1000 Genomes Project and revealed an extremely high level of single nucleotide polymorphisms in promoter regions of olfactory receptor genes and HLA genes. We hypothesized that the high level of polymorphisms in olfactory receptor promoters was responsible for the diversity in regulatory mechanisms controlling the expression levels of olfactory receptor proteins. Such diversity of regulatory mechanisms may cause the great variability of olfactory cognition of numerous environmental olfactory stimuli perceived by human beings (air pollutants, human body odors, odors in culinary etc.. In turn, this variability may provide a wide range of emotional and behavioral reactions related to the vast variety of olfactory stimuli.
Green Tourism in Mountain Regions - Reducing Vulnerability and Promoting People and Place Centric Development in the Himalayas

Institute of Scientific and Technical Information of China (English)

R. B. Singh; D. K. Mishra

2004-01-01

In recent years, mountain regions are attracting great attention to Indian tourists in general and foreign tourists in particular. The potential mountain resources for promoting green tourism are enormous in the form of natural and cultural heritage such as biosphere reserves, flora and fauna, lakes and rivers and traditional rural resources. In order to utilise tourism industry market, uncontrolled numbers of tourists and related haphazard infrastructural facilities in the vulnerable mountain regions pose serious environmental implications. The ecological pressures are threatening land, water and wild life resources through direct and indirect environmental impacts together with generation of solid and liquid wastes, so green tourism is emerging as an important task in order to develop new relationship between communities, government agencies and private sectors. The strategy focuses on ecological understanding, environmental protection and ecodevelopment. The major attributes of the green tourism include environmental conservation and education and distribution of income to local people based on strong partnership. Various knowledge systems go a long way for achieving the goals of the green tourism, which creates awareness about the value of environmental resources.Mountains have ecological, recreational, educational and scientific values, which need to be utilised in sustainable way. Various tourist activities and facilities need to be diversified in order to achieve multiple benefits including scientific field excursion,recreation in natural and cultural areas, community festivals and sport tourisms. Green tourism considers tourism development as an integral part of a national and regional development. The paper discusses the social, economic and environmental dimensions of the green tourism with particular reference to village tourism development programme taking empirical evidences from the Himalaya. Such programme also minimises biophysical and human
Health promotion training in dental and oral health degrees: a scoping review.

Science.gov (United States)

Bracksley-O'Grady, Stacey A; Dickson-Swift, Virginia A; Anderson, Karen S; Gussy, Mark G

2015-05-01

Dental diseases are a major burden on health; however, they are largely preventable. Dental treatment alone will not eradicate dental disease with a shift to prevention required. Prevention of dental diseases is a role of dental professionals, with most countries having formalized health promotion competencies for dental and oral health graduates. In spite of this, there may be minimal health promotion being undertaken in clinical practice. Therefore, the aim of this study was to conduct a scoping review to identify some published studies on health promotion training in dental and oral health degrees. Key search terms were developed and used to search selected databases, which identified 84 articles. Four articles met the inclusion/exclusion criteria and were included in the review. Of these studies, the type of oral health promotion tasks and instructions received before the tasks varied. However, for all studies the health promotion content was focused on health education. In terms of evaluation of outcomes, only two studies evaluated the health promotion content using student reflections. More good-quality information on health promotions training is needed to inform practice.
PTSD and DNA Methylation in Select Immune Function Gene Promoter Regions: A Repeated Measures Case-control Study of U.S. Military Service Members

Science.gov (United States)

2013-06-24

other relevant exposures which may influ- ence DNA methylation , such as dietary factors ( folate , vitamin B12 intake) (Fenech, 2001; Piyathilake and...ARTICLE published: 24 June 2013 doi: 10.3389/fpsyt.2013.00056 PTSD and DNA methylation in select immune function gene promoter regions: a repeated measures...largely unknown. Dis- tinct expression signatures for PTSD have been found, in particular for immune activation transcripts. DNA methylation may be
Minimal mirror twin Higgs

Energy Technology Data Exchange (ETDEWEB)

Barbieri, Riccardo [Institute of Theoretical Studies, ETH Zurich,CH-8092 Zurich (Switzerland); Scuola Normale Superiore,Piazza dei Cavalieri 7, 56126 Pisa (Italy); Hall, Lawrence J.; Harigaya, Keisuke [Department of Physics, University of California,Berkeley, California 94720 (United States); Theoretical Physics Group, Lawrence Berkeley National Laboratory,Berkeley, California 94720 (United States)

2016-11-29

In a Mirror Twin World with a maximally symmetric Higgs sector the little hierarchy of the Standard Model can be significantly mitigated, perhaps displacing the cutoff scale above the LHC reach. We show that consistency with observations requires that the Z{sub 2} parity exchanging the Standard Model with its mirror be broken in the Yukawa couplings. A minimal such effective field theory, with this sole Z{sub 2} breaking, can generate the Z{sub 2} breaking in the Higgs sector necessary for the Twin Higgs mechanism. The theory has constrained and correlated signals in Higgs decays, direct Dark Matter Detection and Dark Radiation, all within reach of foreseen experiments, over a region of parameter space where the fine-tuning for the electroweak scale is 10-50%. For dark matter, both mirror neutrons and a variety of self-interacting mirror atoms are considered. Neutrino mass signals and the effects of a possible additional Z{sub 2} breaking from the vacuum expectation values of B−L breaking fields are also discussed.
Characterization of promoter sequence of toll-like receptor genes in Vechur cattle

Directory of Open Access Journals (Sweden)

R. Lakshmi

2016-06-01

Full Text Available Aim: To analyze the promoter sequence of toll-like receptor (TLR genes in Vechur cattle, an indigenous breed of Kerala with the sequence of Bos taurus and access the differences that could be attributed to innate immune responses against bovine mastitis. Materials and Methods: Blood samples were collected from Jugular vein of Vechur cattle, maintained at Vechur cattle conservation center of Kerala Veterinary and Animal Sciences University, using an acid-citrate-dextrose anticoagulant. The genomic DNA was extracted, and polymerase chain reaction was carried out to amplify the promoter region of TLRs. The amplified product of TLR2, 4, and 9 promoter regions was sequenced by Sanger enzymatic DNA sequencing technique. Results: The sequence of promoter region of TLR2 of Vechur cattle with the B. taurus sequence present in GenBank showed 98% similarity and revealed variants for four sequence motifs. The sequence of the promoter region of TLR4 of Vechur cattle revealed 99% similarity with that of B. taurus sequence but not reveals significant variant in motifregions. However, two heterozygous loci were observed from the chromatogram. Promoter sequence of TLR9 gene also showed 99% similarity to B. taurus sequence and revealed variants for four sequence motifs. Conclusion: The results of this study indicate that significant variation in the promoter of TLR2 and 9 genes in Vechur cattle breed and may potentially link the influence the innate immunity response against mastitis diseases.

76 FR 68067 - United States-Peru Trade Promotion Agreement

Science.gov (United States)

2011-11-03

... between the Parties and promoting regional economic integration; promoting broad-based economic development in order to reduce poverty and generate opportunities for sustainable economic alternatives to... rule. CBP also invites comments that relate to the economic, environmental, or federalism effects that...
Molecular and functional characterization of the promoter of ETS2, the human c-ets-2 gene

International Nuclear Information System (INIS)

Mavrothalassitis, G.J.; Watson, D.K.; Papas, T.S.

1990-01-01

The 5' end of the human c-ets-2 gene, ETS2, was cloned and characterized. The major transcription initiation start sites were identified, and the pertinent sequences surrounding the ETS2 promoter were determined. The promoter region of ETS2 does not possess typical TATA and CAAT elements. However, this promoter contains several repeat regions, as well as two consensus AP2 binding sites and three putative Sp1 sites. There is also a palindromic region similar to the serum response element of the c-fos gene, located 1,400 base pairs (bp) upstream from the first major transcription initiation site. A G+C-rich sequence (GC element) with dyad symmetry can be seen in the ETS2 promoter, immediately following an unusually long polypurine-polypyrimidine tract. A series of deletion fragments from the putative promoter region were ligated in front of the bacterial chloramphenicol acetyltransferase gene and tested for activity following transfection into HeLa cells. The 5' boundary of the region needed for maximum promoter activity was found to be 159 bp upstream of the major initiation site. The promoter of ETS2 (within the polypyrimidine tract) serves to illustrate an alternative structure that may be present in genes with TATA-less promoters
Engineered Promoters for Potent Transient Overexpression.

Directory of Open Access Journals (Sweden)

Dan Y Even

Full Text Available The core promoter, which is generally defined as the region to which RNA Polymerase II is recruited to initiate transcription, plays a pivotal role in the regulation of gene expression. The core promoter consists of different combinations of several short DNA sequences, termed core promoter elements or motifs, which confer specific functional properties to each promoter. Earlier studies that examined the ability to modulate gene expression levels via the core promoter, led to the design of strong synthetic core promoters, which combine different core elements into a single core promoter. Here, we designed a new core promoter, termed super core promoter 3 (SCP3, which combines four core promoter elements (the TATA box, Inr, MTE and DPE into a single promoter that drives prolonged and potent gene expression. We analyzed the effect of core promoter architecture on the temporal dynamics of reporter gene expression by engineering EGFP expression vectors that are driven by distinct core promoters. We used live cell imaging and flow cytometric analyses in different human cell lines to demonstrate that SCPs, particularly the novel SCP3, drive unusually strong long-term EGFP expression. Importantly, this is the first demonstration of long-term expression in transiently transfected mammalian cells, indicating that engineered core promoters can provide a novel non-viral strategy for biotechnological as well as gene-therapy-related applications that require potent expression for extended time periods.
Functional Analysis of Promoter Region from Eel Cytochrome P450 1A1 Gene in Transgenic Medaka.

Science.gov (United States)

Ogino; Itakura; Kato; Aoki; Sato

1999-07-01

: Transcription of the CYP1A1 genes in mammals and fish is stimulated by polyaromatic hydrocarbons. DNA sequencing analysis revealed that CYP1A1 gene in eel (Anguilla japonica) contains two kinds of putative cis-acting regulatory elements, XRE (xenobiotic-responsive element) and ERE (estrogen-responsive element). XRE is known as the enhancer that is responsible for the inducibility of the genes of CYP1A1 and some other drug-metabolizing enzymes. In the eel CYP1A1 gene, XRE motifs are distributed as follows: five times in the region from -2136 to -1125 bp, XRE(-6) to (-2); once in the proximal basal promoter region, XRE(-1); and once in the first intron, XRE(+1). The region between XRE(-2) and XRE(-1) contains three ERE motifs. To investigate the function of the cis-acting regulatory elements in the eel CYP1A1 gene, recombinant plasmids prepared with its 5' upstream sequence and the structural gene for luciferase were microinjected into fertilized eggs of medaka at the one-cell stage. Hatched fry were treated with 3-methylcholanthrene, and the transcription efficiency was assayed using competitive polymerase chain reaction analysis. Deletion of the region containing the five XREs, XRE(-6) to XRE(-2), and the point mutation of XRE(-1) reduced the inducible expressions by 75% and 56%, respectively, showing apparent dependency of the drug induction on the XREs. Constitutive expression, however, was not significantly affected by deletion or disruption of the XREs. When the region between XRE(-2) and XRE(-1) containing no XREs but three ERE motifs was internally deleted, the inducible expression and the constitutive expression were reduced by 88% and 75%, respectively. Replacement of this region with a partial fragment of eel CYP1A1 complementary DNA, with slight alteration of the distance between the five XREs and XRE(-1), reduced the inducible expression and the constitutive expression by 91% and 60%, respectively. These results strongly suggest that not only XRE but
Minimal open strings

International Nuclear Information System (INIS)

Hosomichi, Kazuo

2008-01-01

We study FZZT-branes and open string amplitudes in (p, q) minimal string theory. We focus on the simplest boundary changing operators in two-matrix models, and identify the corresponding operators in worldsheet theory through the comparison of amplitudes. Along the way, we find a novel linear relation among FZZT boundary states in minimal string theory. We also show that the boundary ground ring is realized on physical open string operators in a very simple manner, and discuss its use for perturbative computation of higher open string amplitudes.
Minimal Composite Inflation

DEFF Research Database (Denmark)

Channuie, Phongpichit; Jark Joergensen, Jakob; Sannino, Francesco

2011-01-01

We investigate models in which the inflaton emerges as a composite field of a four dimensional, strongly interacting and nonsupersymmetric gauge theory featuring purely fermionic matter. We show that it is possible to obtain successful inflation via non-minimal coupling to gravity, and that the u......We investigate models in which the inflaton emerges as a composite field of a four dimensional, strongly interacting and nonsupersymmetric gauge theory featuring purely fermionic matter. We show that it is possible to obtain successful inflation via non-minimal coupling to gravity...
Minimal abdominal incisions

Directory of Open Access Journals (Sweden)

João Carlos Magi

2017-04-01

Full Text Available Minimally invasive procedures aim to resolve the disease with minimal trauma to the body, resulting in a rapid return to activities and in reductions of infection, complications, costs and pain. Minimally incised laparotomy, sometimes referred to as minilaparotomy, is an example of such minimally invasive procedures. The aim of this study is to demonstrate the feasibility and utility of laparotomy with minimal incision based on the literature and exemplifying with a case. The case in question describes reconstruction of the intestinal transit with the use of this incision. Male, young, HIV-positive patient in a late postoperative of ileotiflectomy, terminal ileostomy and closing of the ascending colon by an acute perforating abdomen, due to ileocolonic tuberculosis. The barium enema showed a proximal stump of the right colon near the ileostomy. The access to the cavity was made through the orifice resulting from the release of the stoma, with a lateral-lateral ileo-colonic anastomosis with a 25 mm circular stapler and manual closure of the ileal stump. These surgeries require their own tactics, such as rigor in the lysis of adhesions, tissue traction, and hemostasis, in addition to requiring surgeon dexterity – but without the need for investments in technology; moreover, the learning curve is reported as being lower than that for videolaparoscopy. Laparotomy with minimal incision should be considered as a valid and viable option in the treatment of surgical conditions. Resumo: Procedimentos minimamente invasivos visam resolver a doença com o mínimo de trauma ao organismo, resultando em retorno rápido às atividades, reduções nas infecções, complicações, custos e na dor. A laparotomia com incisão mínima, algumas vezes referida como minilaparotomia, é um exemplo desses procedimentos minimamente invasivos. O objetivo deste trabalho é demonstrar a viabilidade e utilidade das laparotomias com incisão mínima com base na literatura e
Perceptions of health promoters about health promotion programmes for families with adolescents orphaned as a result of AIDS in the rural Hammanskraal region in South Africa

Directory of Open Access Journals (Sweden)

Maseapo P. Mthobeni

2013-02-01

Full Text Available South African communities are still greatly affected by the high rate of infection with HIV or who are living with AIDS, mirrored in the 2008 overall national HIV prevalence of 29.3%(UNAIDS 2010:10. In addressing the challenge, the health system is dependent on community care level workers such as caregivers to render health promotion and education in the homes and communities. The caregivers based in the communities are the ones with first-hand information on what is needed for the success of health promotion programmes. This study, aimed at exploring the challenges faced by the health promoters, described their perceptions regarding a health promotion programme for families with adolescents orphaned as a result of AIDS. Data were collected on the purposively selected participants at the rural Hammanskraal region in South Africa and the research question: ‘What is your perception regarding health promotion programmes for families with adolescents orphaned as a result of AIDS’ was asked and discussed by participants in a focus group interview. Data were analysed using the adapted Tesch method to organize and isolate the main categories, sub-categories and themes. The following main categories were isolated: attitudes of adolescents, effectiveness of home visits, need for health education and limited resources. Based on the findings, it was therefore recommended that health care planners assist in the improvement of health promotion and education by using the community and national media, providing information material and providing access to the internet in order to allow more people, including young people, to access the information.Suid-Afrikaanse gemeenskappe word steeds grootliks beïnvloed deur die hoë vlak van MIV en vigs, soos weerspieël in die algehele nasionale MIV-syfer in 2008 van 29.3% (UNAIDS 2010:10. In die aanspreek van hierdie uitdaging is die gesondheidstelsel afhanklik van gemeenskapsorgwerkers om gesondheidsbevordering
Perceptions of health promoters about health promotion programmes for families with adolescents orphaned as a result of AIDS in the rural Hammanskraal region in South Africa

Directory of Open Access Journals (Sweden)

Maseapo P. Mthobeni

2013-02-01

Full Text Available South African communities are still greatly affected by the high rate of infection with HIV or who are living with AIDS, mirrored in the 2008 overall national HIV prevalence of 29.3%(UNAIDS 2010:10. In addressing the challenge, the health system is dependent on community care level workers such as caregivers to render health promotion and education in the homes and communities. The caregivers based in the communities are the ones with first-hand information on what is needed for the success of health promotion programmes. This study, aimed at exploring the challenges faced by the health promoters, described their perceptions regarding a health promotion programme for families with adolescents orphaned as a result of AIDS. Data were collected on the purposively selected participants at the rural Hammanskraal region in South Africa and the research question: ‘What is your perception regarding health promotion programmes for families with adolescents orphaned as a result of AIDS’ was asked and discussed by participants in a focus group interview. Data were analysed using the adapted Tesch method to organize and isolate the main categories, sub-categories and themes. The following main categories were isolated: attitudes of adolescents, effectiveness of home visits, need for health education and limited resources. Based on the findings, it was therefore recommended that health care planners assist in the improvement of health promotion and education by using the community and national media, providing information material and providing access to the internet in order to allow more people, including young people, to access the information. Suid-Afrikaanse gemeenskappe word steeds grootliks beïnvloed deur die hoë vlak van MIV en vigs, soos weerspieël in die algehele nasionale MIV-syfer in 2008 van 29.3% (UNAIDS 2010:10. In die aanspreek van hierdie uitdaging is die gesondheidstelsel afhanklik van gemeenskapsorgwerkers om gesondheidsbevordering
Omnigradient Based Total Variation Minimization for Enhanced Defocus Deblurring of Omnidirectional Images

Directory of Open Access Journals (Sweden)

Yongle Li

2014-01-01

Full Text Available We propose a new method of image restoration for catadioptric defocus blur using omnitotal variation (Omni-TV minimization based on omnigradient. Catadioptric omnidirectional imaging systems usually consist of conventional cameras and curved mirrors for capturing 360° field of view. The problem of catadioptric omnidirectional imaging defocus blur, which is caused by lens aperture and mirror curvature, becomes more severe when high resolution sensors and large apertures are used. In an omnidirectional image, two points near each other may not be close to one another in the 3D scene. Traditional gradient computation cannot be directly applied to omnidirectional image processing. Thus, omnigradient computing method combined with the characteristics of catadioptric omnidirectional imaging is proposed. Following this Omni-TV minimization is used as the constraint for deconvolution regularization, leading to the restoration of defocus blur in an omnidirectional image to obtain all sharp omnidirectional images. The proposed method is important for improving catadioptric omnidirectional imaging quality and promoting applications in related fields like omnidirectional video and image processing.
Cosmological perturbations of non-minimally coupled quintessence in the metric and Palatini formalisms

International Nuclear Information System (INIS)

Fan, Yize; Wu, Puxun; Yu, Hongwei

2015-01-01

Cosmological perturbations of the non-minimally coupled scalar field dark energy in both the metric and Palatini formalisms are studied in this paper. We find that on the large scales with the energy density of dark energy becoming more and more important in the low redshift region, the gravitational potential becomes smaller and smaller, and the effect of non-minimal coupling becomes more and more apparent. In the metric formalism the value of the gravitational potential in the non-minimally coupled case with a positive coupling constant is less than that in the minimally coupled case, while it is larger if the coupling constant is negative. This is different from that in the Palatini formalism where the value of gravitational potential is always smaller. Based upon the quasi-static approximation on the sub-horizon scales, the linear growth of matter is also analyzed. We obtain that the effective Newton's constants in the metric and Palatini formalisms have different forms. A negative coupling constant enhances the gravitational interaction, while a positive one weakens it. Although the metric and Palatini formalisms give different linear growth rates, the difference is very small and the current observation cannot distinguish them effectively
Spatial light modulator array with heat minimization and image enhancement features

Science.gov (United States)

Jain, Kanti [Briarcliff Manor, NY; Sweatt, William C [Albuquerque, NM; Zemel, Marc [New Rochelle, NY

2007-01-30

An enhanced spatial light modulator (ESLM) array, a microelectronics patterning system and a projection display system using such an ESLM for heat-minimization and resolution enhancement during imaging, and the method for fabricating such an ESLM array. The ESLM array includes, in each individual pixel element, a small pixel mirror (reflective region) and a much larger pixel surround. Each pixel surround includes diffraction-grating regions and resolution-enhancement regions. During imaging, a selected pixel mirror reflects a selected-pixel beamlet into the capture angle of a projection lens, while the diffraction grating of the pixel surround redirects heat-producing unused radiation away from the projection lens. The resolution-enhancement regions of selected pixels provide phase shifts that increase effective modulation-transfer function in imaging. All of the non-selected pixel surrounds redirect all radiation energy away from the projection lens. All elements of the ESLM are fabricated by deposition, patterning, etching and other microelectronic process technologies.
Cooperative monitoring and its role in regional security

Energy Technology Data Exchange (ETDEWEB)

Biringer, K.; Olsen, J.; Lincoln, R.; Wehling, F. [and others

1997-03-01

Cooperative monitoring systems can play an important part in promoting the implementation of regional cooperative security agreements. These agreements advance the national security interests of the United States in a post Cold War environment. Regional issues as widely varying as nuclear nonproliferation, trade and environmental pollution can be the source of tensions which may escalate to armed conflict which could have global implications. The Office of National Security Policy Analysis at the US Department of Energy (DOE) has an interest in seeking ways to promote regional cooperation that can reduce the threats posed by regional conflict. DOE technologies and technical expertise can contribute to developing solutions to a wide variety of these international problems. Much of this DOE expertise has been developed in support of the US nuclear weapons and arms control missions. It is now being made available to other agencies and foreign governments in their search for regional security and cooperation. This report presents two examples of interest to DOE in which monitoring technologies could be employed to promote cooperation through experimentation. The two scenarios include nuclear transparency in Northeast Asia and environmental restoration in the Black Sea. Both offer the potential for the use of technology to promote regional cooperation. The issues associated with both of these monitoring applications are presented along with examples of appropriate monitoring technologies, potential experiments and potential DOE contributions to the scenarios.
Regions and the Territorial Cohesion

Directory of Open Access Journals (Sweden)

Ioan Ianos

2013-08-01

Full Text Available Territorial cohesion is an important target of European Union, constantly promoted by its institutions and their representatives. In the context of the Europe 2020 strategy, one of the most important support documents, the region represents a very important issue, being considered to be the key to its successfulness. The region is seen as a support for the smart growth and all the operational policy concepts try to make use of the spatial potential, by taking better account of the territorial specificities. Two main questions play attention: the need to transform the present-day developmental regions into administrative ones is a priority? What kind of regionalization it must to be promoted? Correlating these issues with already defined territorial cohesion, the administrative region is a real tool for the future territorial development. The experience of the last 14 years asks urgently the building of a new territorial administrative reform, giving competences to regions. For instant, each development region is a construction resulted from a free association of the counties. Their role in the regional development is much reduced one, because their regional councils are not elected; decisions taken at this level are consultative for the social, economical, cultural or political actors.
Homogeneous Field and WKB Approximation in Deformed Quantum Mechanics with Minimal Length

Directory of Open Access Journals (Sweden)

Jun Tao

2015-01-01

Full Text Available In the framework of the deformed quantum mechanics with a minimal length, we consider the motion of a nonrelativistic particle in a homogeneous external field. We find the integral representation for the physically acceptable wave function in the position representation. Using the method of steepest descent, we obtain the asymptotic expansions of the wave function at large positive and negative arguments. We then employ the leading asymptotic expressions to derive the WKB connection formula, which proceeds from classically forbidden region to classically allowed one through a turning point. By the WKB connection formula, we prove the Bohr-Sommerfeld quantization rule up to Oβ2. We also show that if the slope of the potential at a turning point is too steep, the WKB connection formula is no longer valid around the turning point. The effects of the minimal length on the classical motions are investigated using the Hamilton-Jacobi method. We also use the Bohr-Sommerfeld quantization to study statistical physics in deformed spaces with the minimal length.
7 CFR 1205.319 - Cotton-producing region.

Science.gov (United States)

2010-01-01

... 7 Agriculture 10 2010-01-01 2010-01-01 false Cotton-producing region. 1205.319 Section 1205.319... Cotton Research and Promotion Order Definitions § 1205.319 Cotton-producing region. Cotton-producing region means each of the following groups of cotton-producing States: (a) Southeast Region: Alabama...
Minimally invasive approach of panfacial fractures

Directory of Open Access Journals (Sweden)

Yudi Wijaya

2017-08-01

Full Text Available Background. Panfacial fractures involves fractures of several bones of face. They are associated with malocclusion, dish face deformity, enopthalmos, diplopia, cerebrospinal fluid leak and soft tissue injuries. Purpose. The purpose of this paper is to present a case of minimizing surgical wound and morbidity. Case. A 40 year old female presented with severe maxillofacial injuries caused by motor vehicle collisions about 5 days prior to admission. The assessment of the patient is mild head injury, panfacial fractures, lacerated wound at face, rupture of globe of occular sinistra. An open reduction and internal fixation (ORIF and enucleation of globe occular sinistra was performed. Intraoral vestibular incision is made in the upper and lower vestibular region. Mucoperiosteal flap elevation of vestibular will exposure of the anterior maxilla and mandibular fractures. Intermaksilary fixation within 3 week and restore aesthetic with prosthesis fitting eyeball and denture. Discusion. The goal of treatment of panfacial fracture is to restore both the functions and pre-injury 3-dimensional facial contours. To achieve this goal two common sequences of management of Panfacial fractures are proposed, “Bottom up and inside out” or “Top down and outside in”. Other sequences exist but there are variations of these two major approaches. Conclusion. A minimally invasive approach to the fracture site is an alternative method to manage panfacial fracture with a simple, effective and lower complication rate.
Optimal replacement of residential air conditioning equipment to minimize energy, greenhouse gas emissions, and consumer cost in the US

International Nuclear Information System (INIS)

De Kleine, Robert D.; Keoleian, Gregory A.; Kelly, Jarod C.

2011-01-01

A life cycle optimization of the replacement of residential central air conditioners (CACs) was conducted in order to identify replacement schedules that minimized three separate objectives: life cycle energy consumption, greenhouse gas (GHG) emissions, and consumer cost. The analysis was conducted for the time period of 1985-2025 for Ann Arbor, MI and San Antonio, TX. Using annual sales-weighted efficiencies of residential CAC equipment, the tradeoff between potential operational savings and the burdens of producing new, more efficient equipment was evaluated. The optimal replacement schedule for each objective was identified for each location and service scenario. In general, minimizing energy consumption required frequent replacement (4-12 replacements), minimizing GHG required fewer replacements (2-5 replacements), and minimizing cost required the fewest replacements (1-3 replacements) over the time horizon. Scenario analysis of different federal efficiency standards, regional standards, and Energy Star purchases were conducted to quantify each policy's impact. For example, a 16 SEER regional standard in Texas was shown to either reduce primary energy consumption 13%, GHGs emissions by 11%, or cost by 6-7% when performing optimal replacement of CACs from 2005 or before. The results also indicate that proper servicing should be a higher priority than optimal replacement to minimize environmental burdens. - Highlights: → Optimal replacement schedules for residential central air conditioners were found. → Minimizing energy required more frequent replacement than minimizing consumer cost. → Significant variation in optimal replacement was observed for Michigan and Texas. → Rebates for altering replacement patterns are not cost effective for GHG abatement. → Maintenance levels were significant in determining the energy and GHG impacts.
DNA methylation in Cosmc promoter region and aberrantly glycosylated IgA1 associated with pediatric IgA nephropathy.

Directory of Open Access Journals (Sweden)

Qiang Sun

Full Text Available IgA nephropathy (IgAN is one of the most common glomerular diseases leading to end-stage renal failure. Elevation of aberrantly glycosylated IgA1 is a key feature of it. The expression of the specific molecular chaperone of core1ß1, 3galactosyl transferase (Cosmc is known to be reduced in IgAN. We aimed to investigate whether the methylation of CpG islands of Cosmc gene promoter region could act as a possible mechanism responsible for down-regulation of Cosmc and related higher secretion of aberrantly glycosylated IgA1in lymphocytes from children with IgA nephropathy. Three groups were included: IgAN children (n = 26, other renal diseases (n = 11 and healthy children (n = 13. B-lymphocytes were isolated and cultured, treated or not with IL-4 or 5-Aza-2'-deoxycytidine (AZA. The levels of DNA methylation of Cosmc promotor region were not significantly different between the lymphocytes of the three children populations (P = 0.113, but there were significant differences between IgAN lymphocytes and lymphocytes of the other two children populations after IL-4 (P<0.0001 or AZA (P<0.0001. Cosmc mRNA expression was low in IgAN lymphocytes compared to the other two groups (P<0.0001. The level of aberrantly glycosylated IgA1 was markedly higher in IgAN group compared to the other groups (P<0.0001. After treatment with IL-4, the levels of Cosmc DNA methylation and aberrantly glycosylated IgA1 in IgAN lymphocytes were remarkably higher than the other two groups (P<0.0001 with more markedly decreased Cosmc mRNA content (P<0.0001. After treatment with AZA, the levels in IgAN lymphocytes were decreased, but was still remarkably higher than the other two groups (P<0.0001, while Cosmc mRNA content in IgAN lymphocytes were more markedly increased than the other two groups (P<0.0001. The alteration of DNA methylation by IL-4 or AZA specifically correlates in IgAN lymphocytes with alterations in Cosmc mRNA expression and with the level of aberrantly glycosylated
The extended minimal incision approach to midface rejuvenation.

Science.gov (United States)

Pontius, Allison T; Williams, Edwin F

2005-08-01

Recent major advancements in comprehensive facial rejuvenation have focused on management of midfacial aging. Multiple techniques have been described to treat the aging midface; the mere nature of so many approaches is evidence that no one technique has prevailed. Although the nasolabial region remains a challenge to correct, the approach described herein provides comprehensive rejuvenation of the midface, lateral brow, and jawline. The technique is performed via a minimal incision brow-lift approach and has been performed (with minor modifications) by the senior author in more than 650 patients over the past 9 years. The technique has proven to be safe, reliable, and effective.

Regional Innovation Policies in MERCOSUR : Obstacles and ...

International Development Research Centre (IDRC) Digital Library (Canada)

... review existing regional cooperation initiatives, identify sectors with strong potential for regional cooperation, review other experiences in regional cooperation for innovation (European Union - EU, North American Free Trade Agreement - NAFTA), and propose institutional arrangements for promoting innovation among ...
Minimal Flavour Violation and Beyond

CERN Document Server

Isidori, Gino

2012-01-01

We review the formulation of the Minimal Flavour Violation (MFV) hypothesis in the quark sector, as well as some "variations on a theme" based on smaller flavour symmetry groups and/or less minimal breaking terms. We also review how these hypotheses can be tested in B decays and by means of other flavour-physics observables. The phenomenological consequences of MFV are discussed both in general terms, employing a general effective theory approach, and in the specific context of the Minimal Supersymmetric extension of the SM.
Mixed waste and waste minimization: The effect of regulations and waste minimization on the laboratory

International Nuclear Information System (INIS)

Dagan, E.B.; Selby, K.B.

1993-08-01

The Hanford Site is located in the State of Washington and is subject to state and federal environmental regulations that hamper waste minimization efforts. This paper addresses the negative effect of these regulations on waste minimization and mixed waste issues related to the Hanford Site. Also, issues are addressed concerning the regulations becoming more lenient. In addition to field operations, the Hanford Site is home to the Pacific Northwest Laboratory which has many ongoing waste minimization activities of particular interest to laboratories
Regional planning and urban infrastructure development in the ...

African Journals Online (AJOL)

Regional planning and urban infrastructure development in the Gongola region, ... PROMOTING ACCESS TO AFRICAN RESEARCH ... In North-eastern Nigeria, the Gongola region has been one of the least developed since independence.
Measuring the Dynamic Efficiency of Regional Industrial Green Transformation in China

Directory of Open Access Journals (Sweden)

Jinpeng Fu

2018-02-01

Full Text Available The green concept has become one of the key demands of the current era of development in China. As an attempt to cope with climate change and constraints of resources and environment, the industrial green transformation is bound to have a dramatic impact on the whole society. This paper enriches the understanding of industrial green transformation by highlighting its social attributes. Combining a hybrid model with a window analysis, this paper measures the dynamic efficiency of regional industrial green transformation in China from 2006 to 2015. In general, Beijing, Tianjin, Shanghai, Jiangsu, Zhejiang, Fujian, Shandong and Guangdong obtain the best performance; industrial water use has the lowest and most unstable efficiency among various resources. Tobit regression model, thereafter, is used to analyze the impact of hypothetical factors on the efficiency of industrial green transformation. The findings demonstrate that reduction and lean management of state-owned property, promoting the development of the productive service industry, minimizing the proportion of fossil energy use and establishing an excellent economic basis can have nationally positive impacts on the regional industrial green transformation; the progress of the productive service industry is the key to industrial green transformation in Eastern China, while the internal optimization of the industrial sector should be paid more attention in other regions, especially in Western China. Finally, detailed discussions and policy suggestions at a regional level as well as research prospects are given.
Minimization of Illness Absenteeism in Primary School Students Using Low-Cost Hygiene Interventions

Directory of Open Access Journals (Sweden)

Tambekar DH

2012-07-01

Full Text Available Objective: Safe water and hygiene intervention was evaluated to assess its impact on students’ health, hygiene practices and reduction in illness absenteeism in primary school students. Method: After evaluatingprimary schools of Amravati district; 50 students with high enteric illness absenteeism were selected for study. Families with problem of in-house water contamination were provided earthen pot with tap for water storage and soap for hand washing at school and home. Household drinking waters (before and after intervention were analyzed for potability. Results: By adopting correct water storage (water container with tap, handling and hand washing practices found to improve health and reduction in 20% illness absenteeism in school. Promoting these interventions and improvement in water-behavioral practices prevented in-house-water contamination. Conclusion: These low cost intervention (water storage container with tap promises to reducing school absenteeism by minimizing risk of transmission of enteric infections by promoting water and student hygiene.
Higgs Phenomenology of Minimal Universal Extra Dimensions

Directory of Open Access Journals (Sweden)

Kakizaki Mitsuru

2012-06-01

Full Text Available The minimal model of Universal Extra Dimensions (MUED is briefly reviewed. We explain how the cross-sections for Higgs production via gluon fusion and decay into photons are modified, relative the the Standard Model (SM values, by KK particles running in loops, leading to an enhancement of the gg → h → γγ and gg → h → W+W− cross-sections. ATLAS and CMS searches for the SM Higgs in these channels are reinterpreted in the context of MUED and used to place new limits on the MUED parameter space. Only a small region of between 1 and 3 GeV around mh = 125 GeV for 500 GeV < R−1 < 1600 GeV remains open at the 95 % confidence level.
'It's interesting how few people die from smoking': tobacco industry efforts to minimize risk and discredit health promotion.

Science.gov (United States)

Smith, Elizabeth A

2007-04-01

It is well known that the tobacco industry has placed articles in scientific literature to maintain controversy over the dangers of tobacco use, while claiming that smokers are well-informed about risk. This study illuminates an industry attempt to directly undermine popular understanding of the hazards of smoking using an industry-created organization called Associates for Research in the Science of Enjoyment (ARISE). Searches of tobacco industry documents contained in the Legacy Tobacco Documents Library, British American Tobacco Documents Library, and British Columbia's Tobacco Industry documents were performed as well as searches of the LexisNexis database for news articles on ARISE published between 1989 and 2005. Qualitative analysis focused on industry motives, media strategies, and rhetorical tactics; quantitative content analysis focused on media coverage. Between 1989 and 2005, at least 846 articles appeared in the European, Australian, and US press mentioning ARISE, its members, or its activities. Many of these articles presented two themes: smoking was a healthful 'pleasure', and health promotion practices, including cessation, were stressful and unhealthy. Few articles included responses from health advocates, questioned ARISE's claims, or mentioned its funding. ARISE successfully planted stories in the press, designed to allay the health concerns of smokers and to discredit health promotion information and practices. ARISE's later interest in food suggests that counterfactual 'health' messages on almost any topic could be promoted similarly, regardless of their implausibility.
Taxonomic minimalism.

Science.gov (United States)

Beattle, A J; Oliver, I

1994-12-01

Biological surveys are in increasing demand while taxonomic resources continue to decline. How much formal taxonomy is required to get the job done? The answer depends on the kind of job but it is possible that taxonomic minimalism, especially (1) the use of higher taxonomic ranks, (2) the use of morphospecies rather than species (as identified by Latin binomials), and (3) the involvement of taxonomic specialists only for training and verification, may offer advantages for biodiversity assessment, environmental monitoring and ecological research. As such, formal taxonomy remains central to the process of biological inventory and survey but resources may be allocated more efficiently. For example, if formal Identification is not required, resources may be concentrated on replication and increasing sample sizes. Taxonomic minimalism may also facilitate the inclusion in these activities of important but neglected groups, especially among the invertebrates, and perhaps even microorganisms. Copyright © 1994. Published by Elsevier Ltd.
Minimizing waste in environmental restoration

International Nuclear Information System (INIS)

Thuot, J.R.; Moos, L.

1996-01-01

Environmental restoration, decontamination and decommissioning, and facility dismantlement projects are not typically known for their waste minimization and pollution prevention efforts. Typical projects are driven by schedules and milestones with little attention given to cost or waste minimization. Conventional wisdom in these projects is that the waste already exists and cannot be reduced or minimized; however, there are significant areas where waste and cost can be reduced by careful planning and execution. Waste reduction can occur in three ways: beneficial reuse or recycling, segregation of waste types, and reducing generation of secondary waste
Low LET radiation-induced telomerase catalytic subunit promoter activation is mediated by nuclear factor Kappa B

International Nuclear Information System (INIS)

Natarajan, M.; Hong, F.A.; Mohan, S.; Herman, T.S.

2003-01-01

Full text: The objective of this study is to understand whether low doses of low LET radiation induces survival advantage in normal cells. As an increase in telomerase activity is associated with longevity and cell proliferation, we examined the telomerase response following gamma-irradiation in normal aortic endothelial cells. Telomeric Repeat Amplification Protocol assay following low LET radiation showed an increase in telomerase enzyme activity as early as 8 h post irradiation and reaches its maximum at 24 h. Subsequent analysis revealed that the increased telomerse enzyme activity is due to increased synthesis resulting from an increased transcription. Examination of transcriptional activation of telomerase reverse transcriptase (TERT) promoter regulation showed an enhanced transcription of the telomerse gene following gamma-irradiation. In our previous reports we documented an increase in NF-kB DNA-binding property following low LET radiation (3). Therefore, to determine whether the activation of NF-kB-signaling is responsible for induced TERT promoter activation, cells transiently transfected with minimal promoter region of TERT containing wild type or mutant NF-kB binding site were examined following low LET radiation. TERT promoter activation was induced in wild type transfected cells whereas, in mutant kB binding site, the activation remained at the basal level similar to that of un-irradiated cells. More significantly, the gamma-ray mediated promoter activation of telomerase gene as well as induce telomerase enzyme activity was abrogated by ectopically expressing the IkBa mutant (IkBa (S32A/S36A)), which blocks NF-kB activation. The results thus suggest that exposure to low LET radiation could induce telomerase activity and the activation is at least, in part, mediated by the transcription factor NF-kB. Sustained activation of telomerase in these cells after low LET radiation may impart extended life span
Isolation and functional characterization of Lycopene β-cyclase (CYC-B promoter from Solanum habrochaites

Directory of Open Access Journals (Sweden)

Chinnusamy Viswanathan

2010-04-01

Full Text Available Abstract Background Carotenoids are a group of C40 isoprenoid molecules that play diverse biological and ecological roles in plants. Tomato is an important vegetable in human diet and provides the vitamin A precursor β-carotene. Genes encoding enzymes involved in carotenoid biosynthetic pathway have been cloned. However, regulation of genes involved in carotenoid biosynthetic pathway and accumulation of specific carotenoid in chromoplasts are not well understood. One of the approaches to understand regulation of carotenoid metabolism is to characterize the promoters of genes encoding proteins involved in carotenoid metabolism. Lycopene β-cyclase is one of the crucial enzymes in carotenoid biosynthesis pathway in plants. Its activity is required for synthesis of both α-and β-carotenes that are further converted into other carotenoids such as lutein, zeaxanthin, etc. This study describes the isolation and characterization of chromoplast-specific Lycopene β-cyclase (CYC-B promoter from a green fruited S. habrochaites genotype EC520061. Results A 908 bp region upstream to the initiation codon of the Lycopene β-cyclase gene was cloned and identified as full-length promoter. To identify promoter region necessary for regulating developmental expression of the ShCYC-B gene, the full-length promoter and its three different 5' truncated fragments were cloned upstream to the initiation codon of GUS reporter cDNA in binary vectors. These four plant transformation vectors were separately transformed in to Agrobacterium. Agrobacterium-mediated transient and stable expression systems were used to study the GUS expression driven by the full-length promoter and its 5' deletion fragments in tomato. The full-length promoter showed a basal level activity in leaves, and its expression was upregulated > 5-fold in flowers and fruits in transgenic tomato plants. Deletion of -908 to -577 bp 5' to ATG decreases the ShCYC-B promoter strength, while deletion of -908
Qualitative analysis of Adenomatous Polyposis Coli promoter: Hypermethylation, engagement and effects on survival of patients with esophageal cancer in a high risk region of the world, a potential molecular marker

Directory of Open Access Journals (Sweden)

Nasseri Negin

2009-01-01

Full Text Available Abstract Background Squamous cell carcinoma of esophagus (SCCE occurs at a high incidence rate in certain parts of the world. This feature necessitates that different aspects of the disease and in particular genetic characteristics be investigated in such regions. In addition, such investigations might lead to achievement of molecular markers helpful for early detection, successful treatment and follow up of the disease. Adenomatous Polyposis Coli (APC promoter hypermethylation has been shown to be a suitable marker for both serum and solid tumors of adenocarcinoma of esophagus. We investigated the status of APC promoter hypermethylation in Iranian patients, compared the results with the former studies, and evaluated its applicability as a candidate molecular marker by examining association between survival of SCCE patients and APC promoter methylation. Methods For evaluating the status of APC promoter hypermethylation and its association with SCCE, a qualitative methylation specific PCR (MSP was used. DNA was extracted and digested with an appropriate restriction enzyme, treated with sodium bisulfite in agarose beads and amplified in two-step PCR reaction by applying either methylated or unmethylated promoter specific primers. Universally methylated DNA and methylase treated blood DNA of healthy donors were used as positive controls as well. Survival of patients was followed up for two years after treatment and survival rate of patients with methylated APC promoter was compared with that of unmethylated patients. Results Assessment of APC promoter methylation revealed that normal tissues were unmethylated, while twenty out of forty five (44.4% tumor tissues were hypermethylated either in one or both alleles of APC. Among the tissues in which methylation was detected, seven were hypermethylated in both alleles while the other thirteen were hypermethylated in one of the two alleles of APC. Analyzing two-year survival rate of patients with respect
Qualitative analysis of Adenomatous Polyposis Coli promoter: Hypermethylation, engagement and effects on survival of patients with esophageal cancer in a high risk region of the world, a potential molecular marker

International Nuclear Information System (INIS)

Zare, Maryam; Jazii, Ferdous Rastgar; Alivand, Mohammad Reza; Nasseri, Negin Karimi; Malekzadeh, Reza; Yazdanbod, Mansour

2009-01-01

Squamous cell carcinoma of esophagus (SCCE) occurs at a high incidence rate in certain parts of the world. This feature necessitates that different aspects of the disease and in particular genetic characteristics be investigated in such regions. In addition, such investigations might lead to achievement of molecular markers helpful for early detection, successful treatment and follow up of the disease. Adenomatous Polyposis Coli (APC) promoter hypermethylation has been shown to be a suitable marker for both serum and solid tumors of adenocarcinoma of esophagus. We investigated the status of APC promoter hypermethylation in Iranian patients, compared the results with the former studies, and evaluated its applicability as a candidate molecular marker by examining association between survival of SCCE patients and APC promoter methylation. For evaluating the status of APC promoter hypermethylation and its association with SCCE, a qualitative methylation specific PCR (MSP) was used. DNA was extracted and digested with an appropriate restriction enzyme, treated with sodium bisulfite in agarose beads and amplified in two-step PCR reaction by applying either methylated or unmethylated promoter specific primers. Universally methylated DNA and methylase treated blood DNA of healthy donors were used as positive controls as well. Survival of patients was followed up for two years after treatment and survival rate of patients with methylated APC promoter was compared with that of unmethylated patients. Assessment of APC promoter methylation revealed that normal tissues were unmethylated, while twenty out of forty five (44.4%) tumor tissues were hypermethylated either in one or both alleles of APC. Among the tissues in which methylation was detected, seven were hypermethylated in both alleles while the other thirteen were hypermethylated in one of the two alleles of APC. Analyzing two-year survival rate of patients with respect to promoter hypermethylation showed a lower rate of
Quantization of the minimal and non-minimal vector field in curved space

OpenAIRE

Toms, David J.

2015-01-01

The local momentum space method is used to study the quantized massive vector field (the Proca field) with the possible addition of non-minimal terms. Heat kernel coefficients are calculated and used to evaluate the divergent part of the one-loop effective action. It is shown that the naive expression for the effective action that one would write down based on the minimal coupling case needs modification. We adopt a Faddeev-Jackiw method of quantization and consider the case of an ultrastatic...
Regional cooperative agreement for the Asia and Pacific region

International Nuclear Information System (INIS)

Anon.

1981-01-01

Among the means available to the International Atomic Energy Agency to promote cooperative efforts in the nuclear field is the Regional Cooperative Agreement (RCA) for Research, Development, and Training related to Nuclear Science and Technology for the Asia and Pacific Region. Under the terms of this agreement, which came into force on June 12, 1972, participating countries aim to promote and coordinate research, development, and training projects in nuclear fields through collaborative efforts among relevant national institutions in the region. The Agency's role is to provide organizational, administrative, advisory, technical, and financial assistance when needed to secure successful execution of the projects undertaken within the framework of the RCA. Although this presentation deals primarily with the benefits of regional cooperation under the agreement, a review of the RCA would be somewhat imbalanced without a mention of its shortcomings. One of the principal impediments to more rapid progress, as is the case in many other areas, is financing. There is no stable source of funding outside the research contract program and, the likelihood of large-scale UNDP support notwithstanding, a greater willingness on the part of participating Member States to support the program along with the development of a greater sense of common purpose are called for. In this connection serious consideration is being given to the possibility of establishing an Asian Centre for Research and Training, an institute that would bring together scientists from the region to collaborate on problems common to the RCA countries. A study group has already been convened to investigate the feasibility of this proposal
A Survey of Runners' Attitudes Toward and Experiences With Minimally Shod Running.

Science.gov (United States)

Cohler, Marissa H; Casey, Ellen

2015-08-01

To investigate the characteristics, perceptions, motivating factors, experiences, and injury rates of runners who practice minimally shod running. Survey. web-based questionnaire. Five-hundred sixty-six members of the Chicago Area Runner's Association. A link to a 31-question online survey was e-mailed to members of Chicago Area Runner's Association. Questions covered demographic information, use of minimalist-style running shoes (MSRS), injury rates, and change in pain. Use of MSRS, occurrence or improvement of injury/pain, regions of injury/pain, reasons for or for not using MSRS. One-hundred seventy-five (31%) respondents had practiced minimally shod running, and the most common motivating factor was to decrease injuries and/or pain. Fifty-one respondents (29%) suffered an injury or pain while wearing MSRS, with the most common body part involved being the foot. Fifty-four respondents (31%) had an injury that improved after adopting minimally shod running; the most common area involved was the knee. One-hundred twenty respondents (69%) were still using MSRS. Of those who stopped using MSRS, the main reason was development of an injury or pain. The most common reason that respondents have not tried minimally shod running is a fear of developing an injury. This survey-based study demonstrated that the use of MSRS is common, largely as the result of a perception that they may reduce injuries or pain. Reductions and occurrences of injury/pain with minimally shod running were reported in approximately equal numbers. The most common site of reported injury/pain reduction was the knee, whereas the most common reported site of injury/pain occurrence was the foot. Fear of developing pain or injury is the most common reason runners are reluctant to try minimally shod running. Copyright © 2015 American Academy of Physical Medicine and Rehabilitation. Published by Elsevier Inc. All rights reserved.
Cloning and Functional Analysis of the Promoter of an Ascorbate Oxidase Gene from Gossypium hirsutum.

Directory of Open Access Journals (Sweden)

Shan Xin

Full Text Available Apoplastic ascorbate oxidase (AO plays significant roles in plant cell growth. However, the mechanism of underlying the transcriptional regulation of AO in Gossypium hirsutum remains unclear. Here, we obtained a 1,920-bp promoter sequence from the Gossypium hirsutum ascorbate oxidase (GhAO1 gene, and this GhAO1 promoter included a number of known cis-elements. Promoter activity analysis in overexpressing pGhAO1::GFP-GUS tobacco (Nicotiana benthamiana showed that the GhAO1 promoter exhibited high activity, driving strong reporter gene expression in tobacco trichomes, leaves and roots. Promoter 5'-deletion analysis demonstrated that truncated GhAO1 promoters with serial 5'-end deletions had different GUS activities. A 360-bp fragment was sufficient to activate GUS expression. The P-1040 region had less GUS activity than the P-720 region, suggesting that the 320-bp region from nucleotide -720 to -1040 might include a cis-element acting as a silencer. Interestingly, an auxin-responsive cis-acting element (TGA-element was uncovered in the promoter. To analyze the function of the TGA-element, tobacco leaves transformed with promoters with different 5' truncations were treated with indole-3-acetic acid (IAA. Tobacco leaves transformed with the promoter regions containing the TGA-element showed significantly increased GUS activity after IAA treatment, implying that the fragment spanning nucleotides -1760 to -1600 (which includes the TGA-element might be a key component for IAA responsiveness. Analyses of the AO promoter region and AO expression pattern in Gossypium arboreum (Ga, diploid cotton with an AA genome, Gossypium raimondii (Gr, diploid cotton with a DD genome and Gossypium hirsutum (Gh, tetraploid cotton with an AADD genome indicated that AO promoter activation and AO transcription were detected together only in D genome/sub-genome (Gr and Gh cotton. Taken together, these results suggest that the 1,920-bp GhAO1 promoter is a functional sequence
Cloning and Functional Analysis of the Promoter of an Ascorbate Oxidase Gene from Gossypium hirsutum.

Science.gov (United States)

Xin, Shan; Tao, Chengcheng; Li, Hongbin

2016-01-01

Apoplastic ascorbate oxidase (AO) plays significant roles in plant cell growth. However, the mechanism of underlying the transcriptional regulation of AO in Gossypium hirsutum remains unclear. Here, we obtained a 1,920-bp promoter sequence from the Gossypium hirsutum ascorbate oxidase (GhAO1) gene, and this GhAO1 promoter included a number of known cis-elements. Promoter activity analysis in overexpressing pGhAO1::GFP-GUS tobacco (Nicotiana benthamiana) showed that the GhAO1 promoter exhibited high activity, driving strong reporter gene expression in tobacco trichomes, leaves and roots. Promoter 5'-deletion analysis demonstrated that truncated GhAO1 promoters with serial 5'-end deletions had different GUS activities. A 360-bp fragment was sufficient to activate GUS expression. The P-1040 region had less GUS activity than the P-720 region, suggesting that the 320-bp region from nucleotide -720 to -1040 might include a cis-element acting as a silencer. Interestingly, an auxin-responsive cis-acting element (TGA-element) was uncovered in the promoter. To analyze the function of the TGA-element, tobacco leaves transformed with promoters with different 5' truncations were treated with indole-3-acetic acid (IAA). Tobacco leaves transformed with the promoter regions containing the TGA-element showed significantly increased GUS activity after IAA treatment, implying that the fragment spanning nucleotides -1760 to -1600 (which includes the TGA-element) might be a key component for IAA responsiveness. Analyses of the AO promoter region and AO expression pattern in Gossypium arboreum (Ga, diploid cotton with an AA genome), Gossypium raimondii (Gr, diploid cotton with a DD genome) and Gossypium hirsutum (Gh, tetraploid cotton with an AADD genome) indicated that AO promoter activation and AO transcription were detected together only in D genome/sub-genome (Gr and Gh) cotton. Taken together, these results suggest that the 1,920-bp GhAO1 promoter is a functional sequence with a
Asia-Pacific Regional Economic Integration: Coopetition vs. Conflict

Directory of Open Access Journals (Sweden)

YuJane Chen

2016-04-01

Full Text Available In the era of economic globalization, promoting regional trade agreements or regional cooperation has become a plausible strategy to attract foreign direct investment and to promote national competitiveness at a global level. Nonetheless, facing the differential national economic interests and the needs of protection of domestic industries, as well as the diverse levels of economic liberalization domestically, the involvement of FTA negotiation in every country is universally in the situation of struggling between securing economic sovereignty and national economic development. Countries in the Asia-Pacific region are in the same situation. This article analyzes how countries balance between securing economic sovereignty and promoting national economic development when they are involved in TPP and RCEP negotiations. By confirming the appropriate linkage between each participating countries’ decision for balancing between domestic economic sovereignty and further integrating into regional economic cooperation institutions the validity of the proposition for this research project can be verified.

Sludge minimization technologies - an overview

Energy Technology Data Exchange (ETDEWEB)

Oedegaard, Hallvard

2003-07-01

The management of wastewater sludge from wastewater treatment plants represents one of the major challenges in wastewater treatment today. The cost of the sludge treatment amounts to more that the cost of the liquid in many cases. Therefore the focus on and interest in sludge minimization is steadily increasing. In the paper an overview is given for sludge minimization (sludge mass reduction) options. It is demonstrated that sludge minimization may be a result of reduced production of sludge and/or disintegration processes that may take place both in the wastewater treatment stage and in the sludge stage. Various sludge disintegration technologies for sludge minimization are discussed, including mechanical methods (focusing on stirred ball-mill, high-pressure homogenizer, ultrasonic disintegrator), chemical methods (focusing on the use of ozone), physical methods (focusing on thermal and thermal/chemical hydrolysis) and biological methods (focusing on enzymatic processes). (author)
Exploiting nucleotide composition to engineer promoters.

Directory of Open Access Journals (Sweden)

Manfred G Grabherr

Full Text Available The choice of promoter is a critical step in optimizing the efficiency and stability of recombinant protein production in mammalian cell lines. Artificial promoters that provide stable expression across cell lines and can be designed to the desired strength constitute an alternative to the use of viral promoters. Here, we show how the nucleotide characteristics of highly active human promoters can be modelled via the genome-wide frequency distribution of short motifs: by overlapping motifs that occur infrequently in the genome, we constructed contiguous sequence that is rich in GC and CpGs, both features of known promoters, but lacking homology to real promoters. We show that snippets from this sequence, at 100 base pairs or longer, drive gene expression in vitro in a number of mammalian cells, and are thus candidates for use in protein production. We further show that expression is driven by the general transcription factors TFIIB and TFIID, both being ubiquitously present across cell types, which results in less tissue- and species-specific regulation compared to the viral promoter SV40. We lastly found that the strength of a promoter can be tuned up and down by modulating the counts of GC and CpGs in localized regions. These results constitute a "proof-of-concept" for custom-designing promoters that are suitable for biotechnological and medical applications.
Viral Vector-Based Dissection of Marmoset GFAP Promoter in Mouse and Marmoset Brains.

Directory of Open Access Journals (Sweden)

Yoichiro Shinohara

Full Text Available Adeno-associated virus (AAV vectors are small in diameter, diffuse easily in the brain, and represent a highly efficient means by which to transfer a transgene to the brain of a large animal. A major demerit of AAV vectors is their limited accommodation capacity for transgenes. Thus, a compact promoter is useful when delivering large transgenes via AAV vectors. In the present study, we aimed to identify the shortest astrocyte-specific GFAP promoter region that could be used for AAV-vector-mediated transgene expression in the marmoset brain. The 2.0-kb promoter region upstream of the GFAP gene was cloned from the marmoset genome, and short promoters (1.6 kb, 1.4 kb, 0.6 kb, 0.3 kb and 0.2 kb were obtained by progressively deleting the original 2.0-kb promoter from the 5' end. The short promoters were screened in the mouse cerebellum in terms of their strength and astrocyte specificity. We found that the 0.3-kb promoter maintained 40% of the strength of the original 2.0-kb promoter, and approximately 90% of its astrocyte specificity. These properties were superior to those of the 1.4-kb, 0.6-kb (20% promoter strength and 0.2-kb (70% astrocyte specificity promoters. Then, we verified whether the 0.3-kb GFAP promoter retained astrocyte specificity in the marmoset cerebral cortex. Injection of viral vectors carrying the 0.3-kb marmoset GFAP promoter specifically transduced astrocytes in both the cerebral cortex and cerebellar cortex of the marmoset. These results suggest that the compact 0.3-kb promoter region serves as an astrocyte-specific promoter in the marmoset brain, which permits us to express a large gene by AAV vectors that have a limited accommodation capacity.
The role of germline promoters and I exons in cytokine-induced gene-specific class switch recombination.

Science.gov (United States)

Dunnick, Wesley A; Shi, Jian; Holden, Victoria; Fontaine, Clinton; Collins, John T

2011-01-01

Germline transcription precedes class switch recombination (CSR). The promoter regions and I exons of these germline transcripts include binding sites for activation- and cytokine-induced transcription factors, and the promoter regions/I exons are essential for CSR. Therefore, it is a strong hypothesis that the promoter/I exons regions are responsible for much of cytokine-regulated, gene-specific CSR. We tested this hypothesis by swapping the germline promoter and I exons for the murine γ1 and γ2a H chain genes in a transgene of the entire H chain C-region locus. We found that the promoter/I exon for γ1 germline transcripts can direct robust IL-4-induced recombination to the γ2a gene. In contrast, the promoter/I exon for the γ2a germline transcripts works poorly in the context of the γ1 H chain gene, resulting in expression of γ1 H chains that is level. Nevertheless, the small amount of recombination to the chimeric γ1 gene is induced by IFN-γ. These results suggest that cytokine regulation of CSR, but not the magnitude of CSR, is regulated by the promoter/I exons.
Minimal and careful processing

OpenAIRE

Nielsen, Thorkild

2004-01-01

In several standards, guidelines and publications, organic food processing is strongly associated with "minimal processing" and "careful processing". The term "minimal processing" is nowadays often used in the general food processing industry and described in literature. The term "careful processing" is used more specifically within organic food processing but is not yet clearly defined. The concept of carefulness seems to fit very well with the processing of organic foods, especially if it i...
The cyclic AMP receptor protein, CRP, is required for both virulence and expression of the minimal CRP regulon in Yersinia pestis biovar microtus.

Science.gov (United States)

Zhan, Lingjun; Han, Yanping; Yang, Lei; Geng, Jing; Li, Yingli; Gao, He; Guo, Zhaobiao; Fan, Wei; Li, Gang; Zhang, Lianfeng; Qin, Chuan; Zhou, Dongsheng; Yang, Ruifu

2008-11-01

The cyclic AMP receptor protein (CRP) is a bacterial regulator that controls more than 100 promoters, including those involved in catabolite repression. In the present study, a null deletion of the crp gene was constructed for Yersinia pestis bv. microtus strain 201. Microarray expression analysis disclosed that at least 6% of Y. pestis genes were affected by this mutation. Further reverse transcription-PCR and electrophoretic mobility shift assay analyses disclosed a set of 37 genes or putative operons to be the direct targets of CRP, and thus they constitute the minimal CRP regulon in Y. pestis. Subsequent primer extension and DNase I footprinting assays mapped transcriptional start sites, core promoter elements, and CRP binding sites within the DNA regions upstream of pla and pst, revealing positive and direct control of these two laterally acquired plasmid genes by CRP. The crp disruption affected both in vitro and in vivo growth of the mutant and led to a >15,000-fold loss of virulence after subcutaneous infection but a pestis and, particularly, is more important for infection by subcutaneous inoculation. It can further be concluded that the reduced in vivo growth phenotype of the crp mutant should contribute, at least partially, to its attenuation of virulence by both routes of infection. Consistent with a previous study of Y. pestis bv. medievalis, lacZ reporter fusion analysis indicated that the crp deletion resulted in the almost absolute loss of pla promoter activity. The plasminogen activator encoded by pla was previously shown to specifically promote Y. pestis dissemination from peripheral infection routes (subcutaneous infection [flea bite] or inhalation). The above evidence supports the notion that in addition to the reduced in vivo growth phenotype, the defect of pla expression in the crp mutant will greatly contribute to the huge loss of virulence of this mutant strain in subcutaneous infection.
A Sparsity-Promoted Method Based on Majorization-Minimization for Weak Fault Feature Enhancement.

Science.gov (United States)

Ren, Bangyue; Hao, Yansong; Wang, Huaqing; Song, Liuyang; Tang, Gang; Yuan, Hongfang

2018-03-28

Fault transient impulses induced by faulty components in rotating machinery usually contain substantial interference. Fault features are comparatively weak in the initial fault stage, which renders fault diagnosis more difficult. In this case, a sparse representation method based on the Majorzation-Minimization (MM) algorithm is proposed to enhance weak fault features and extract the features from strong background noise. However, the traditional MM algorithm suffers from two issues, which are the choice of sparse basis and complicated calculations. To address these challenges, a modified MM algorithm is proposed in which a sparse optimization objective function is designed firstly. Inspired by the Basis Pursuit (BP) model, the optimization function integrates an impulsive feature-preserving factor and a penalty function factor. Second, a modified Majorization iterative method is applied to address the convex optimization problem of the designed function. A series of sparse coefficients can be achieved through iterating, which only contain transient components. It is noteworthy that there is no need to select the sparse basis in the proposed iterative method because it is fixed as a unit matrix. Then the reconstruction step is omitted, which can significantly increase detection efficiency. Eventually, envelope analysis of the sparse coefficients is performed to extract weak fault features. Simulated and experimental signals including bearings and gearboxes are employed to validate the effectiveness of the proposed method. In addition, comparisons are made to prove that the proposed method outperforms the traditional MM algorithm in terms of detection results and efficiency.
Non-minimal Wu-Yang monopole

International Nuclear Information System (INIS)

Balakin, A.B.; Zayats, A.E.

2007-01-01

We discuss new exact spherically symmetric static solutions to non-minimally extended Einstein-Yang-Mills equations. The obtained solution to the Yang-Mills subsystem is interpreted as a non-minimal Wu-Yang monopole solution. We focus on the analysis of two classes of the exact solutions to the gravitational field equations. Solutions of the first class belong to the Reissner-Nordstroem type, i.e., they are characterized by horizons and by the singularity at the point of origin. The solutions of the second class are regular ones. The horizons and singularities of a new type, the non-minimal ones, are indicated
A Peptide Derived from the HIV-1 gp120 Coreceptor-Binding Region Promotes Formation of PAP248-286 Amyloid Fibrils to Enhance HIV-1 Infection.

Directory of Open Access Journals (Sweden)

Jinquan Chen

Full Text Available Semen is a major vehicle for HIV transmission. Prostatic acid phosphatase (PAP fragments, such as PAP248-286, in human semen can form amyloid fibrils to enhance HIV infection. Other endogenous or exogenous factors present during sexual intercourse have also been reported to promote the formation of seminal amyloid fibrils.Here, we demonstrated that a synthetic 15-residue peptide derived from the HIV-1 gp120 coreceptor-binding region, designated enhancing peptide 2 (EP2, can rapidly self-assemble into nanofibers. These EP2-derivated nanofibers promptly accelerated the formation of semen amyloid fibrils by PAP248-286, as shown by Thioflavin T (ThT and Congo red assays. The amyloid fibrils presented similar morphology, assessed via transmission electron microscopy (TEM, in the presence or absence of EP2. Circular dichroism (CD spectroscopy revealed that EP2 accelerates PAP248-286 amyloid fibril formation by promoting the structural transition of PAP248-286 from a random coil into a cross-β-sheet. Newly formed semen amyloid fibrils effectively enhanced HIV-1 infection in TZM-bl cells and U87 cells by promoting the binding of HIV-1 virions to target cells.Nanofibers composed of EP2 promote the formation of PAP248-286 amyloid fibrils and enhance HIV-1 infection.
Wilson loops in minimal surfaces

International Nuclear Information System (INIS)

Drukker, Nadav; Gross, David J.; Ooguri, Hirosi

1999-01-01

The AdS/CFT correspondence suggests that the Wilson loop of the large N gauge theory with N = 4 supersymmetry in 4 dimensions is described by a minimal surface in AdS 5 x S 5 . The authors examine various aspects of this proposal, comparing gauge theory expectations with computations of minimal surfaces. There is a distinguished class of loops, which the authors call BPS loops, whose expectation values are free from ultra-violet divergence. They formulate the loop equation for such loops. To the extent that they have checked, the minimal surface in AdS 5 x S 5 gives a solution of the equation. The authors also discuss the zig-zag symmetry of the loop operator. In the N = 4 gauge theory, they expect the zig-zag symmetry to hold when the loop does not couple the scalar fields in the supermultiplet. They will show how this is realized for the minimal surface
Wilson loops and minimal surfaces

International Nuclear Information System (INIS)

Drukker, Nadav; Gross, David J.; Ooguri, Hirosi

1999-01-01

The AdS-CFT correspondence suggests that the Wilson loop of the large N gauge theory with N=4 supersymmetry in four dimensions is described by a minimal surface in AdS 5 xS 5 . We examine various aspects of this proposal, comparing gauge theory expectations with computations of minimal surfaces. There is a distinguished class of loops, which we call BPS loops, whose expectation values are free from ultraviolet divergence. We formulate the loop equation for such loops. To the extent that we have checked, the minimal surface in AdS 5 xS 5 gives a solution of the equation. We also discuss the zigzag symmetry of the loop operator. In the N=4 gauge theory, we expect the zigzag symmetry to hold when the loop does not couple the scalar fields in the supermultiplet. We will show how this is realized for the minimal surface. (c) 1999 The American Physical Society
Fermilab Tevatron and CERN LEP II probes of minimal and string-motivated supergravity models

International Nuclear Information System (INIS)

Baer, H.; Gunion, J.F.; Kao, C.; Pois, H.

1995-01-01

We explore the ability of the Fermilab Tevatron to probe minimal supersymmetry with high-energy-scale boundary conditions motivated by supersymmetry breaking in the context of minimal and string-motivated supergravity theory. A number of boundary condition possibilities are considered: dilatonlike string boundary conditions applied at the standard GUT unification scale or alternatively at the string scale; and extreme (''no-scale'') minimal supergravity boundary conditions imposed at the GUT scale or string scale. For numerous specific cases within each scenario the sparticle spectra are computed and then fed into ISAGET 7.07 so that explicit signatures can be examined in detail. We find that, for some of the boundary condition choices, large regions of parameter space can be explored via same-sign dilepton and isolated trilepton signals. For other choices, the mass reach of Tevatron collider experiments is much more limited. We also compare the mass reach of Tevatron experiments with the corresponding reach at CERN LEP 200
ABERRANT METHYLATION OF THE PROMOTER OF APC, CDH13 AND MGMT GENES IN COLORECTAL CANCER PATIENTS

Directory of Open Access Journals (Sweden)

O. I. Kit

2016-01-01

Full Text Available Aberrant methylation of gene promoter regions is the main epigenetic change characterizing colorectal cancer. Methylation levels of 42 CpG-sites of promoter regions of the MGMT, APC and CDH13 genes in colorectal cancer were studied in comparison with methylation levels of the adjacent normal tissue in 25 patients. Pyrosequencing showed an increase in methylation levels of promoter regions of the MGMT, APC and CDH13 genes in tumor samples by 3 to 5 times. These tumor samples were screened for activating SNP-mutations in the KRAS (40 %, NRAS (0 % and BRAF (0 % oncogenes. SNP-mutations in the KRAS gene were accompanied by hypermethylation of one or more promoters of the studied genes. Association of this epigenetic index with tumor metastasis was proved. The data on an increase in methylation of the promoter regions of oncosupressor genes can be used as sensitive prognostic markers of progression and metastasis of colorectal cancer.
Characterization of carotenoid hydroxylase gene promoter in Haematococcus pluvialis.

Science.gov (United States)

Meng, C X; Wei, W; Su, Z- L; Qin, S

2006-10-01

Astaxanthin, a high-value ketocarotenoid is mainly used in fish aquaculture. It also has potential in human health due to its higher antioxidant capacity than beta-carotene and vitamin E. The unicellular green alga Haematococcus pluvialis is known to accumulate astaxanthin in response to environmental stresses, such as high light intensity and salt stress. Carotenoid hydroxylase plays a key role in astaxanthin biosynthesis in H. pluvialis. In this paper, we report the characterization of a promoter-like region (-378 to -22 bp) of carotenoid hydroxylase gene by cloning, sequence analysis and functional verification of its 919 bp 5'-flanking region in H. pluvialis. The 5'-flanking region was characterized using micro-particle bombardment method and transient expression of LacZ reporter gene. Results of sequence analysis showed that the 5'-flanking region might have putative cis-acting elements, such as ABA (abscisic acid)-responsive element (ABRE), C-repeat/dehydration responsive element (C-repeat/DRE), ethylene-responsive element (ERE), heat-shock element (HSE), wound-responsive element (WUN-motif), gibberellin-responsive element (P-box), MYB-binding site (MBS) etc., except for typical TATA and CCAAT boxes. Results of 5' deletions construct and beta-galactosidase assays revealed that a highest promoter-like region might exist from -378 to -22 bp and some negative regulatory elements might lie in the region from -919 to -378 bp. Results of site-directed mutagenesis of a putative C-repeat/DRE and an ABRE-like motif in the promoter-like region (-378 to -22 bp) indicated that the putative C-repeat/DRE and ABRE-like motif might be important for expression of carotenoid hydroxylase gene.
Topological gravity with minimal matter

International Nuclear Information System (INIS)

Li Keke

1991-01-01

Topological minimal matter, obtained by twisting the minimal N = 2 supeconformal field theory, is coupled to two-dimensional topological gravity. The free field formulation of the coupled system allows explicit representations of BRST charge, physical operators and their correlation functions. The contact terms of the physical operators may be evaluated by extending the argument used in a recent solution of topological gravity without matter. The consistency of the contact terms in correlation functions implies recursion relations which coincide with the Virasoro constraints derived from the multi-matrix models. Topological gravity with minimal matter thus provides the field theoretic description for the multi-matrix models of two-dimensional quantum gravity. (orig.)
Minimizing waste in environmental restoration

International Nuclear Information System (INIS)

Moos, L.; Thuot, J.R.

1996-01-01

Environmental restoration, decontamination and decommissioning and facility dismantelment projects are not typically known for their waste minimization and pollution prevention efforts. Typical projects are driven by schedules and milestones with little attention given to cost or waste minimization. Conventional wisdom in these projects is that the waste already exists and cannot be reduced or minimized. In fact, however, there are three significant areas where waste and cost can be reduced. Waste reduction can occur in three ways: beneficial reuse or recycling; segregation of waste types; and reducing generation of secondary waste. This paper will discuss several examples of reuse, recycle, segregation, and secondary waste reduction at ANL restoration programs
On minimizers of causal variational principles

International Nuclear Information System (INIS)

Schiefeneder, Daniela

2011-01-01

Causal variational principles are a class of nonlinear minimization problems which arise in a formulation of relativistic quantum theory referred to as the fermionic projector approach. This thesis is devoted to a numerical and analytic study of the minimizers of a general class of causal variational principles. We begin with a numerical investigation of variational principles for the fermionic projector in discrete space-time. It is shown that for sufficiently many space-time points, the minimizing fermionic projector induces non-trivial causal relations on the space-time points. We then generalize the setting by introducing a class of causal variational principles for measures on a compact manifold. In our main result we prove under general assumptions that the support of a minimizing measure is either completely timelike, or it is singular in the sense that its interior is empty. In the examples of the circle, the sphere and certain flag manifolds, the general results are supplemented by a more detailed analysis of the minimizers. (orig.)
Stabilization of flail chest injuries: minimized approach techniques to treat the core of instability.

Science.gov (United States)

Schulz-Drost, S; Grupp, S; Pachowsky, M; Oppel, P; Krinner, S; Mauerer, A; Hennig, F F; Langenbach, A

2017-04-01

Stabilizing techniques of flail chest injuries usually need wide approaches to the chest wall. Three main regions need to be considered when stabilizing the rib cage: median-anterior with dissection of pectoral muscle; lateral-axillary with dissection of musculi (mm) serratus, externus abdominis; posterior inter spinoscapular with division of mm rhomboidei, trapezius and latissimus dorsi. Severe morbidity due to these invasive approaches needs to be considered. This study discusses possibilities for minimized approaches to the shown regions. Fifteen patients were stabilized by locked plate osteosynthesis (MatrixRib ® ) between May 2012 and April 2014 and prospectively followed up. Flail chest injuries were managed through limited incisions to the anterior, the lateral, and the posterior parts of the chest wall or their combinations. Each approach was 4-10 cm using Alexis ® retractor. One minimized approach offered sufficient access at least to four ribs posterior and laterally, four pairs of ribs anterior in all cases. There was no need to divide latissimus dorsi muscle. Trapezius und rhomboid muscles were only limited divided, whereas a subcutaneous dissection of serratus and abdominis muscles was necessary. A follow-up showed sufficient consolidation. pneumothorax (2) and seroma (2). Minimized approaches allow sufficient stabilization of severe dislocated rib fractures without extensive dissection or division of the important muscles. Keeping the arm and, thus, the scapula mobile is very important for providing the largest reachable surface of the rib cage through each approach.
Dynamical relaxation of the CP phases in next-to-minimal supersymmetry

International Nuclear Information System (INIS)

Demir, D.A.

1999-11-01

After promoting the phases of the soft masses to dynamical fields corresponding to Goldstone bosons of spontaneously broken global symmetries in the supersymmetry breaking sector, the next-to-minimal supersymmetric model is found to solve the μ problem and the strong CP problem simultaneously with an invisible axion. The domain wall problem persists in the form of axionic domain formation. Relaxation dynamics of the physical CP-violating phases is determined only by the short-distance physics and their relaxation values are not necessarily close to the CP-conserving points. Consequently, the solution of tile supersymmetric CP problem may require heavy enough superpartners and nonminimal flavor structures, where the latter may be also relevant for avoiding the formation of axionic domain walls. (author)
A computational fluid dynamics approach to wind prospecting: Lessons from the U.S. Appalachian region

International Nuclear Information System (INIS)

Womeldorf, Carole A.; Chimeli, Ariaster B.

2014-01-01

A number of technological, institutional and market developments have lowered the minimally economic viable wind speeds for wind power generation while contributing to increasing profitability of the wind power industry in recent decades. Yet, information on the potential for wind power generation is still highly uncertain in many regions of the globe, particularly those with complex terrain features. We focus on an area by the foothills of the Appalachian region. Because we do not have precise wind measurements for this area, we do not attempt to produce an actual wind map, but instead use a three-dimensional computational fluid dynamics model to demonstrate the calculation of high resolution wind speeds with complex terrain information. Using this approach, we show how finer wind speed information can impact the status of an overlooked region in terms of its wind potential and improve wind prospecting by enabling investors to focus on the most promising sub-regions of a study area. Since private sector investors might not have the incentive to invest in finer-scale wind resource assessment that can be easily observed by competitors, public sector incentives or direct investments can help to promote wind power generation in overlooked but viable regions. - Highlights: • Costly expansion of transmission stimulates wind prospecting in accessible regions. • A search model motivates the rationale for wind prospecting in a given region. • A computational fluid dynamics model simulates finer wind information. • The distribution of wind speeds is estimated using finer wind information. • An initially overlooked region might become attractive for wind prospecting

The Quality of the Embedding Potential Is Decisive for Minimal Quantum Region Size in Embedding Calculations

DEFF Research Database (Denmark)

Nåbo, Lina J; Olsen, Jógvan Magnus Haugaard; Martínez, Todd J

2017-01-01

correct description of the MM region, and that this enables the use of much smaller QM regions compared to fixed charge electrostatic embedding. Furthermore, absorption intensities converge very slowly with system size and inclusion of effective external field effects in the MM region through...
Energy minimization strategies and renewable energy utilization for desalination: a review.

Science.gov (United States)

Subramani, Arun; Badruzzaman, Mohammad; Oppenheimer, Joan; Jacangelo, Joseph G

2011-02-01

Energy is a significant cost in the economics of desalinating waters, but water scarcity is driving the rapid expansion in global installed capacity of desalination facilities. Conventional fossil fuels have been utilized as their main energy source, but recent concerns over greenhouse gas (GHG) emissions have promoted global development and implementation of energy minimization strategies and cleaner energy supplies. In this paper, a comprehensive review of energy minimization strategies for membrane-based desalination processes and utilization of lower GHG emission renewable energy resources is presented. The review covers the utilization of energy efficient design, high efficiency pumping, energy recovery devices, advanced membrane materials (nanocomposite, nanotube, and biomimetic), innovative technologies (forward osmosis, ion concentration polarization, and capacitive deionization), and renewable energy resources (solar, wind, and geothermal). Utilization of energy efficient design combined with high efficiency pumping and energy recovery devices have proven effective in full-scale applications. Integration of advanced membrane materials and innovative technologies for desalination show promise but lack long-term operational data. Implementation of renewable energy resources depends upon geography-specific abundance, a feasible means of handling renewable energy power intermittency, and solving technological and economic scale-up and permitting issues. Copyright © 2011 Elsevier Ltd. All rights reserved.
[Minimally invasive approach for cervical spondylotic radiculopathy].

Science.gov (United States)

Ding, Liang; Sun, Taicun; Huang, Yonghui

2010-01-01

To summarize the recent minimally invasive approach for cervical spondylotic radiculopathy (CSR). The recent literature at home and abroad concerning minimally invasive approach for CSR was reviewed and summarized. There were two techniques of minimally invasive approach for CSR at present: percutaneous puncture techniques and endoscopic techniques. The degenerate intervertebral disc was resected or nucleolysis by percutaneous puncture technique if CSR was caused by mild or moderate intervertebral disc herniations. The cervical microendoscopic discectomy and foraminotomy was an effective minimally invasive approach which could provide a clear view. The endoscopy techniques were suitable to treat CSR caused by foraminal osteophytes, lateral disc herniations, local ligamentum flavum thickening and spondylotic foraminal stenosis. The minimally invasive procedure has the advantages of simple handling, minimally invasive and low incidence of complications. But the scope of indications is relatively narrow at present.
Tumor Restrictive Suicide Gene Therapy for Glioma Controlled by the FOS Promoter.

Directory of Open Access Journals (Sweden)

Jianqing Pan

Full Text Available Effective suicide gene delivery and expression are crucial to achieving successful effects in gene therapy. An ideal tumor-specific promoter expresses therapeutic genes in tumor cells with minimal normal tissue expression. We compared the activity of the FOS (FBJ murine osteosarcoma viral oncogene homolog promoter with five alternative tumor-specific promoters in glioma cells and non-malignant astrocytes. The FOS promoter caused significantly higher transcriptional activity in glioma cell lines than all alternative promoters with the exception of CMV. The FOS promoter showed 13.9%, 32.4%, and 70.8% of the transcriptional activity of CMV in three glioma cell lines (U87, U251, and U373. Importantly, however, the FOS promoter showed only 1.6% of the transcriptional activity of CMV in normal astrocytes. We also tested the biologic activity of recombinant adenovirus containing the suicide gene herpes simplex virus thymidine kinase (HSV-tk driven by the FOS promoter, including selective killing efficacy in vitro and tumor inhibition rate in vivo. Adenoviral-mediated delivery of the HSV-tk gene controlled by the FOS promoter conferred a cytotoxic effect on human glioma cells in vitro and in vivo. This study suggests that use of the FOS-tk adenovirus system is a promising strategy for glioma-specific gene therapy but still much left for improvement.
Methylation in the promoter regions of WT1, NKX6-1 and DBC1 genes in cervical cancer tissues of Uygur women in Xinjiang

Directory of Open Access Journals (Sweden)

Dan Wu

Full Text Available Abstract This study aimed to explore: 1 DNA methylation in the promoter regions of Wilms tumor gene 1 (WT1, NK6 transcription factor related locus 1 gene (NKX6-1 and Deleted in bladder cancer 1 (DBC1 gene in cervical cancer tissues of Uygur women in Xinjiang, and 2 the correlation of gene methylation with the infection of HPV16/18 viruses. We detected HPV16/18 infection in 43 normal cervical tissues, 30 cervical intraepithelial neoplasia lesions (CIN and 48 cervical cancer tissues with polymerase chain reaction (PCR method. Methylation in the promoter regions of the WT1, NKX6-1 and DBC1 genes in the above-mentioned tissues was measured by methylation-specific PCR (MSP and cloning sequencing. The expression level of these three genes was measured by real-time PCR (qPCR in 10 methylation-positive cervical cancer tissues and 10 methylation-negative normal cervical tissues. We found that the infection of HPV16 in normal cervical tissues, CIN and cervical cancer tissues was 14.0, 36.7 and 66.7%, respectively. The infection of HPV18 was 0, 6.7 and 10.4%, respectively. The methylation rates of WT1, NKX6-1 and DBC1 genes were 7.0, 11.6 and 23.3% in normal cervical tissues, 36.7, 46.7 and 30.0% in CIN tissues, and 89.6, 77.1 and 85.4% in cervical cancer tissues. Furthermore, WT1, NKX6-1 and DBC1 genes were hypermethylated in the high-grade squamous intraepithelial lesion (CIN2, CIN3 and in the cervical cancer tissues with infection of HPV16/18 (both P< 0.05. The expression of WT1, NKX6-1 and DBC1 was significantly lower in the methylation-positive cervical cancer tissues than in methylation-negative normal cervical tissues. Our findings indicated that methylation in the promoter regions of WT1, NKX6-1 and DBC1 is correlated with cervical cancer tumorigenesis in Uygur women. The infection of HPV16/18 might be correlated with methylation in these genes. Gene inactivation caused by methylation might be related to the incidence and development of cervical
Functional analysis of the rice rubisco activase promoter in transgenic Arabidopsis

Energy Technology Data Exchange (ETDEWEB)

Yang, Zhipan; Lu, Qingtao; Wen, Xiaogang [Key Laboratory of Photobiology, Institute of Botany, Chinese Academy of Sciences, Beijing 100093 (China); Chen, Fan [Key Laboratory of Molecular and Developmental Biology, Institute of Genetics and Developmental Biology, Chinese Academy of Sciences, Beijing 100080 (China); Lu, Congming, E-mail: lucm@ibcas.ac.cn [Key Laboratory of Photobiology, Institute of Botany, Chinese Academy of Sciences, Beijing 100093 (China)

2012-02-17

Highlights: Black-Right-Pointing-Pointer Rice rubisco activase promoter was analyzed in transgenic Arabidopsis system. Black-Right-Pointing-Pointer Region conferring tissue specific and light inducible expression of Rca was identified. Black-Right-Pointing-Pointer -58 to +43 bp region mediates tissue-specific expression of rice Rca. Black-Right-Pointing-Pointer Light inducible expression of rice Rca is mediated by -297 to -58 bp region. Black-Right-Pointing-Pointer Rice nuclear proteins bind specifically with the light inducible region. -- Abstract: To gain a better understanding of the regulatory mechanism of the rice rubisco activase (Rca) gene, variants of the Rca gene promoter (one full-length and four deletion mutants) fused to the coding region of the bacterial reporter gene {beta}-glucuronidase (GUS) were introduced into Arabidopsis via Agrobacterium-mediated transformation. Our results show that a 340 bp fragment spanning from -297 to +43 bp relative to the transcription initiation site is enough to promote tissue-specific and light-inducible expression of the rice Rca gene as done by the full-length promoter (-1428 to +43 bp). Further deletion analysis indicated that the region conferring tissue-specificity of Rca expression is localized within a 105 bp fragment from -58 to +43 bp, while light-inducible expression of Rca is mediated by the region from -297 to -58 bp. Gel shift assays and competition experiments demonstrated that rice nuclear proteins bind specifically with the fragment conferring light responsiveness at more than one binding site. This implies that multiple cis-elements may be involved in light-induced expression of the rice Rca gene. These works provide a useful reference for understanding transcriptional regulation mechanism of the rice Rca gene, and lay a strong foundation for further detection of related cis-elements and trans-factors.
Functional analysis of the rice rubisco activase promoter in transgenic Arabidopsis

International Nuclear Information System (INIS)

Yang, Zhipan; Lu, Qingtao; Wen, Xiaogang; Chen, Fan; Lu, Congming

2012-01-01

Highlights: ► Rice rubisco activase promoter was analyzed in transgenic Arabidopsis system. ► Region conferring tissue specific and light inducible expression of Rca was identified. ► −58 to +43 bp region mediates tissue-specific expression of rice Rca. ► Light inducible expression of rice Rca is mediated by −297 to −58 bp region. ► Rice nuclear proteins bind specifically with the light inducible region. -- Abstract: To gain a better understanding of the regulatory mechanism of the rice rubisco activase (Rca) gene, variants of the Rca gene promoter (one full-length and four deletion mutants) fused to the coding region of the bacterial reporter gene β-glucuronidase (GUS) were introduced into Arabidopsis via Agrobacterium-mediated transformation. Our results show that a 340 bp fragment spanning from −297 to +43 bp relative to the transcription initiation site is enough to promote tissue-specific and light-inducible expression of the rice Rca gene as done by the full-length promoter (−1428 to +43 bp). Further deletion analysis indicated that the region conferring tissue-specificity of Rca expression is localized within a 105 bp fragment from −58 to +43 bp, while light-inducible expression of Rca is mediated by the region from −297 to −58 bp. Gel shift assays and competition experiments demonstrated that rice nuclear proteins bind specifically with the fragment conferring light responsiveness at more than one binding site. This implies that multiple cis-elements may be involved in light-induced expression of the rice Rca gene. These works provide a useful reference for understanding transcriptional regulation mechanism of the rice Rca gene, and lay a strong foundation for further detection of related cis-elements and trans-factors.
Process evaluation of a community-based intervention promoting multiple maternal and neonatal care practices in rural Nepal

Directory of Open Access Journals (Sweden)

Silwal Ram C

2010-06-01

Full Text Available Abstract Background The challenge of delivering multiple, complex messages to promote maternal and newborn health in the terai region of Nepal was addressed through training Female Community Health Volunteers (FCHVs to counsel pregnant women and their families using a flipchart and a pictorial booklet that was distributed to clients. The booklet consists of illustrated messages presented on postcard-sized laminated cards that are joined by a ring. Pregnant women were encouraged to discuss booklet content with their families. Methods We examined use of the booklet and factors affecting adoption of practices through semi-structured interviews with district and community-level government health personnel, staff from the Nepal Family Health Program, FCHVs, recently delivered women and their husbands and mothers-in-law. Results The booklet is shared among household members, promotes discussion, and is referred to when questions arise or during emergencies. Booklet cards on danger signs and nutritious foods are particularly well-received. Cards on family planning and certain aspects of birth preparedness generate less interest. Husbands and mothers-in-law control decision-making for maternal and newborn care-seeking and related household-level behaviors. Conclusions Interpersonal peer communication through trusted community-level volunteers is an acceptable primary strategy in Nepal for promotion of household-level behaviors. The content and number of messages should be simplified or streamlined before being scaled-up to minimize intervention complexity and redundant communication.
Mycobacterium leprae specific genomic target in the promoter region of probable 4-alpha-glucanotransferase (ML1545) gene with potential sensitivity for polymerase chain reaction based diagnosis of leprosy.

Science.gov (United States)

Sundeep Chaitanya, V; Das, Madhusmita; Eisenbach, Tiffany L; Amoako, Angela; Rajan, Lakshmi; Horo, Ilse; Ebenezer, Mannam

2016-06-01

With the absence of an effective diagnostic tool for leprosy, cases with negative bacteriological index and limited clinical manifestations often pose diagnostic challenges. In this study, we investigated the utility of a novel Mycobacterium leprae specific 112-bp DNA sequence in the promoter region of probable 4-alpha-glucanotransferase (pseudogene, ML1545) for polymerase chain reaction (PCR) based diagnosis of leprosy in comparison to that of the RLEP gene. DNA was extracted from slit skin scrapings of 180 newly diagnosed untreated leprosy cases that were classified as per Ridley Jopling classifications and bacteriological index (BI). Primers were designed using Primer Blast 3.0 and PCR was performed with annealing temperatures of 61°C for ML1545 and 58°C for the RLEP gene using conventional gradient PCR. The results indicated a significant increase in PCR positivity of ML1545 when compared to RLEP across the study groups (164/180 [91.11%] were positive for ML1545 whereas 114/180 (63.33%) were positive for RLEP [pleprosy cases with negative BI, 28 (48.28%) were positive for RLEP and 48 (82.76%) were positive for ML1545 (p=.0001, z=3.8). Of the 42 borderline tuberculoid leprosy cases, 23 (54.76%) were positive for RLEP whereas 37 (88.09%) were positive for ML1545 (pleprosy and BI-positive groups. ML1545 can be a potential gene target for PCR-based diagnosis of leprosy especially in cases where clinical manifestations were minimal. Copyright © 2016 Asian-African Society for Mycobacteriology. Published by Elsevier Ltd. All rights reserved.
Health promotion capacity building in South Africa.

Science.gov (United States)

Wills, Jane; Rudolph, Michael

2010-09-01

Health promotion in South Africa is in its early stages and while there is some institutional development and capacity building for managers, there has been relative disregard and lack of attention of the wider health promotion workforce who carry out community-based health promotion activities. This article describes one regional education and training programme for health promoters as well as the limited available evidence on the impact of the project on learners and organizations. Marked differences before and after the implementation of the training activities were reported in relation to behaviour change communication and project planning, in addition to self-reported positive change in knowledge, confidence and a high level of participant satisfaction. Investment in individual skills development needs to be accompanied by wider workforce development with organizational/institutional development and recognised competencies frameworks.
Minimal string theories and integrable hierarchies

Science.gov (United States)

Iyer, Ramakrishnan

Well-defined, non-perturbative formulations of the physics of string theories in specific minimal or superminimal model backgrounds can be obtained by solving matrix models in the double scaling limit. They provide us with the first examples of completely solvable string theories. Despite being relatively simple compared to higher dimensional critical string theories, they furnish non-perturbative descriptions of interesting physical phenomena such as geometrical transitions between D-branes and fluxes, tachyon condensation and holography. The physics of these theories in the minimal model backgrounds is succinctly encoded in a non-linear differential equation known as the string equation, along with an associated hierarchy of integrable partial differential equations (PDEs). The bosonic string in (2,2m-1) conformal minimal model backgrounds and the type 0A string in (2,4 m) superconformal minimal model backgrounds have the Korteweg-de Vries system, while type 0B in (2,4m) backgrounds has the Zakharov-Shabat system. The integrable PDE hierarchy governs flows between backgrounds with different m. In this thesis, we explore this interesting connection between minimal string theories and integrable hierarchies further. We uncover the remarkable role that an infinite hierarchy of non-linear differential equations plays in organizing and connecting certain minimal string theories non-perturbatively. We are able to embed the type 0A and 0B (A,A) minimal string theories into this single framework. The string theories arise as special limits of a rich system of equations underpinned by an integrable system known as the dispersive water wave hierarchy. We find that there are several other string-like limits of the system, and conjecture that some of them are type IIA and IIB (A,D) minimal string backgrounds. We explain how these and several other string-like special points arise and are connected. In some cases, the framework endows the theories with a non
On eco-efficient technologies to minimize industrial water consumption

Science.gov (United States)

Amiri, Mohammad C.; Mohammadifard, Hossein; Ghaffari, Ghasem

2016-07-01

Purpose - Water scarcity will further stress on available water systems and decrease the security of water in many areas. Therefore, innovative methods to minimize industrial water usage and waste production are of paramount importance in the process of extending fresh water resources and happen to be the main life support systems in many arid regions of the world. This paper demonstrates that there are good opportunities for many industries to save water and decrease waste water in softening process by substituting traditional with echo-friendly methods. The patented puffing method is an eco-efficient and viable technology for water saving and waste reduction in lime softening process. Design/methodology/approach - Lime softening process (LSP) is a very sensitive process to chemical reactions. In addition, optimal monitoring not only results in minimizing sludge that must be disposed of but also it reduces the operating costs of water conditioning. Weakness of the current (regular) control of LSP based on chemical analysis has been demonstrated experimentally and compared with the eco-efficient puffing method. Findings - This paper demonstrates that there is a good opportunity for many industries to save water and decrease waste water in softening process by substituting traditional method with puffing method, a patented eco-efficient technology. Originality/value - Details of the required innovative works to minimize industrial water usage and waste production are outlined in this paper. Employing the novel puffing method for monitoring of lime softening process results in saving a considerable amount of water while reducing chemical sludge.
Environmental stress affects DNA methylation of a CpG rich promoter region of serotonin transporter gene in a nurse cohort.

Directory of Open Access Journals (Sweden)

Jukka S Alasaari

Full Text Available Shift-working nurses are exposed to a stressful work environment, which puts them at an increased risk for burnout and depression. We explored the effect of environmental stress on serotonin transporter gene (SLC6A4 promoter methylation among nurses from high and low work stress environments.Using bisulfite sequencing, we investigated the methylation status of five CpG residues of a CpG-rich region in the promoter of SLC6A4 by comparing female shift working nurses from a high work stress environment (n = 24 to low work stress environment (n = 25. We also analyzed the association of 5-HTTLPR polymorphism at 5' end of SLC6A4. Work stress was assessed by the Karasek's Model and possible signs of burnout or depression were measured by the Maslach Burnout Index General Survey and Beck Depression Index. Methylation levels were assessed by bisulfite sequencing of DNA extracted from peripheral blood leucocytes. Restriction enzyme treatment followed by standard PCR was used to identify 5-HTTLPR genotypes.We found that nurses in the high stress environment had significantly lower promoter methylation levels at all five CpG residues compared to nurses in the low stress environment (p<0.01. There was no significant interaction of 5-HTTLPR genotype and work stress with methylation (p = 0.58. In unadjusted (bivariate analysis, burnout was not significantly associated to methylation levels. However, when mutually adjusted for both, burnout and work stress were significant contributors (p = 0.038 and p<0.0001 respectively to methylation levels.Our findings show that environmental stress is concurrent with decreased methylation of the SLC6A4 promoter. This may lead to increased transcriptional activity of the gene, increased reuptake of serotonin from synaptic clefts, and termination of the activity of serotonin. This could present a possible coping mechanism for environmental stress in humans that could eventually increase risk for disturbed functional
The minimal essential unit for cadherin-mediated intercellular adhesion comprises extracellular domains 1 and 2

DEFF Research Database (Denmark)

Shan, Weisong; Yagita, Yoshiki; Wang, Zhaohui

2004-01-01

of the extracellular domains of N-cadherin and produced various cell lines to examine adhesion properties. We show that the first domain of N-cadherin alone on the cell surface fails to generate adhesive activity and that the first two domains of N-cadherin form the "minimal essential unit" to mediate cell adhesion...... domains of N-cadherin have distinct roles in cell adhesion, i.e. the first two domains are responsible for homophilic adhesion activity, and the other domains promote adhesion efficiency most likely by positioning essential domains relatively far out from the cell surface....
Non-minimal inflation revisited

International Nuclear Information System (INIS)

Nozari, Kourosh; Shafizadeh, Somayeh

2010-01-01

We reconsider an inflationary model that inflaton field is non-minimally coupled to gravity. We study the parameter space of the model up to the second (and in some cases third) order of the slow-roll parameters. We calculate inflation parameters in both Jordan and Einstein frames, and the results are compared in these two frames and also with observations. Using the recent observational data from combined WMAP5+SDSS+SNIa datasets, we study constraints imposed on our model parameters, especially the non-minimal coupling ξ.
Minimal quantization and confinement

International Nuclear Information System (INIS)

Ilieva, N.P.; Kalinowskij, Yu.L.; Nguyen Suan Han; Pervushin, V.N.

1987-01-01

A ''minimal'' version of the Hamiltonian quantization based on the explicit solution of the Gauss equation and on the gauge-invariance principle is considered. By the example of the one-particle Green function we show that the requirement for gauge invariance leads to relativistic covariance of the theory and to more proper definition of the Faddeev - Popov integral that does not depend on the gauge choice. The ''minimal'' quantization is applied to consider the gauge-ambiguity problem and a new topological mechanism of confinement
Public health and health promotion capacity at national and regional level: a review of conceptual frameworks

Directory of Open Access Journals (Sweden)

Christoph Aluttis

2014-04-01

Full Text Available The concept of capacity building for public health has gained much attention during the last decade. National as well as international organizations increasingly focus their efforts on capacity building to improve performance in the health sector. During the past two decades, a variety of conceptual frameworks have been developed which describe relevant dimensions for public health capacity. Notably, these frameworks differ in design and conceptualization. This paper therefore reviews the existing conceptual frameworks and integrates them into one framework, which contains the most relevant dimensions for public health capacity at the country or regional level. A comprehensive literature search was performed to identify frameworks addressing public health capacity building at the national or regional level. We content-analysed these frameworks to identify the core dimensions of public health capacity. The dimensions were subsequently synthesized into a set of thematic areas to construct a conceptual framework which describes the most relevant dimensions for capacities at the national or regional level. The systematic review resulted in the identification of seven core domains for public health capacity: resources, organizational structures, workforce, partnerships, leadership and governance, knowledge development and country specific context. Accordingly, these dimensions were used to construct a framework, which describes these core domains more in detail. Our research shows that although there is no generally agreed upon model of public health capacity, a number of key domains for public health and health promotion capacity are consistently recurring in existing frameworks, regardless of their geographical location or thematic area. As only little work on the core concepts of public health capacities has yet taken place, this study adds value to the discourse by identifying these consistencies across existing frameworks and by synthesising
Mutational analysis of the promoter and the coding region of the 5-HT1A gene

Energy Technology Data Exchange (ETDEWEB)

Erdmann, J.; Noethen, M.M.; Shimron-Abarbanell, D. [Univ. of Bonn (Germany)] [and others

1994-09-01

Disturbances of serotonergic pathways have been implicated in many neuropsychiatric disorders. Serotonin (5HT) receptors can be subdivided into at least three major families (5HT1, 5HT2, and 5HT3). Five human 5HT1 receptor subtypes have been cloned, namely 1A, 1D{alpha}, 1D{beta}, 1E, and 1F. Of these, the 5HT1A receptor is the best characterized subtype. In the present study we sought to identify genetic variation in the 5HT1A receptor gene which through alteration of protein function or level of expression might contribute to the genetics of neuropsychiatric diseases. The coding region and the 5{prime} promoter region of the 5HT1A gene from 159 unrelated subjects (45 schizophrenic, 46 bipolar affective, and 43 patients with Tourette`s syndrome, as well as 25 controls) were analyzed using SSCA. SSCA revealed the presence of two mutations both located in the coding region of the 5HT1A receptor gene. The first mutation is a rare silent C{r_arrow}T substitution at nucleotide position 549. The second mutation is characterized by a base pair substitution (A{r_arrow}G) at the first position of codon 28 and results in an amino acid exchange (Ile{r_arrow}Val). Since Val28 was found only in a single schizophrenic patient and in none of the other patients or controls, we decided to extend our samples and to use a restriction assay for screening a further 74 schizophrenic, 95 bipolar affective, and 49 patients with Tourette`s syndrome, as well as 185 controls, for the presence of the mutation. In total, the mutation was found in 2 schizophrenic patients, in 3 bipolars, in 1 Tourette patient, and in 5 controls. To our knowledge the Ile-28-Val substitution reported here is the first natural occuring molecular variant which has been identified for a serotonin receptor so far.
Development of regional wheat VI-LAI models using Resourcesat-1 ...

Indian Academy of Sciences (India)

for assimilation into climate models or to study the biogeochemical cycles. ... of these data for regional scale study due to cloud ... The details of agro-climatic regions, the soil types, the wheat .... out to minimize the border effect on crop growth.
Minimal residual cone-beam reconstruction with attenuation correction in SPECT

International Nuclear Information System (INIS)

La, Valerie; Grangeat, Pierre

1998-01-01

This paper presents an iterative method based on the minimal residual algorithm for tomographic attenuation compensated reconstruction from attenuated cone-beam projections given the attenuation distribution. Unlike conjugate-gradient based reconstruction techniques, the proposed minimal residual based algorithm solves directly a quasisymmetric linear system, which is a preconditioned system. Thus it avoids the use of normal equations, which improves the convergence rate. Two main contributions are introduced. First, a regularization method is derived for quasisymmetric problems, based on a Tikhonov-Phillips regularization applied to the factorization of the symmetric part of the system matrix. This regularization is made spatially adaptive to avoid smoothing the region of interest. Second, our existing reconstruction algorithm for attenuation correction in parallel-beam geometry is extended to cone-beam geometry. A circular orbit is considered. Two preconditioning operators are proposed: the first one is Grangeat's inversion formula and the second one is Feldkamp's inversion formula. Experimental results obtained on simulated data are presented and the shadow zone effect on attenuated data is illustrated. (author)

Importance of ARCAL Programme to promote technical cooperation in Latin America

International Nuclear Information System (INIS)

Dieguez, Jose Antonio Diaz

1996-01-01

The ARCAL Programme aims to promote regional co-operation and integration in the nuclear field and to solve common technological problems in Latin America and Caribbean. Emphasis has been given to technicians and researches training through experts interchange, courses, seminars and workshops, making use of the existing infrastructure in the region. During the eleven years of implementation, the ARCAL Programme allowed the training of thousands of professionals and technicians in the various aspects of the nuclear energy for peaceful purposes. Another indisputable achievement of the ARCAL has been the promotion of common knowledge and the link between experts in the region working on similar subjects. (author)
Promoting International Energy Security. Volume 3: Sea-Lanes to Asia

Science.gov (United States)

2012-01-01

set off tsunamis, as occurred in the Indian Ocean on December 26, 2004, when an earthquake and tsunami killed over 225,000 people. Natural events...in Somalia, the ability to counter the menagerie of gangs that currently plough the seas off the Horn of Africa will be minimal. Further, the...Promoting International Energy Security: Volume 3, Sea-Lanes to Asia sunk several Vietnamese ships, killing 70 Vietnamese sailors (EIA, 2008b). As states
Null-polygonal minimal surfaces in AdS4 from perturbed W minimal models

International Nuclear Information System (INIS)

Hatsuda, Yasuyuki; Ito, Katsushi; Satoh, Yuji

2012-11-01

We study the null-polygonal minimal surfaces in AdS 4 , which correspond to the gluon scattering amplitudes/Wilson loops in N=4 super Yang-Mills theory at strong coupling. The area of the minimal surfaces with n cusps is characterized by the thermodynamic Bethe ansatz (TBA) integral equations or the Y-system of the homogeneous sine-Gordon model, which is regarded as the SU(n-4) 4 /U(1) n-5 generalized parafermion theory perturbed by the weight-zero adjoint operators. Based on the relation to the TBA systems of the perturbed W minimal models, we solve the TBA equations by using the conformal perturbation theory, and obtain the analytic expansion of the remainder function around the UV/regular-polygonal limit for n = 6 and 7. We compare the rescaled remainder function for n=6 with the two-loop one, to observe that they are close to each other similarly to the AdS 3 case.
Electrochemical promotion of sulfur dioxide catalytic oxidation

DEFF Research Database (Denmark)

Petrushina, Irina; Bandur, Viktor; Cappeln, Frederik Vilhelm

2000-01-01

investigation was to study a possible non-Faradaic electrochemical promotion of the liquid-phase catalytic reaction. It has been shown that there are two negative potential promotion areas with maximum effects at approximately -0.1 and -0.2 V, and one positive potential promotion area with the maximum effect...... between 0.1 and 0.3 V. There were no Faradaic reactions in the negative polarization region, and there was an anodic current which was less than 16% of the theoretical value for an exclusively Faradaic SO2 oxidation. Therefore the promotion effects at negative polarization are completely non-Faradaic. All...... the promotion effects have been explained as mainly due to charging of the electric double layer at the gold electrode. The effect at -0.2 V also depends on the V2O5 concentration and is more pronounced at higher V2O5 concentrations. This has been ascribed to a destruction of the vanadium polymeric chains...
Using the ANGELO model to develop the children's healthy living program multilevel intervention to promote obesity preventing behaviors for young children in the U.S.-affiliated Pacific Region.

Science.gov (United States)

Braun, Kathryn L; Nigg, Claudio R; Fialkowski, Marie K; Butel, Jean; Hollyer, James R; Barber, L Robert; Bersamin, Andrea; Coleman, Patricia; Teo-Martin, Ursula; Vargo, Agnes M; Novotny, Rachel

2014-12-01

Almost 40% of children are overweight or obese by age 8 years in the US-Affiliated Pacific, inclusive of the five jurisdictions of Alaska, Hawaii, American Samoa, Guam, and the Commonwealth of the Northern Mariana Islands. This article describes how the Children's Healthy Living (CHL) Program used the ANGELO (Analysis Grid for Environments/Elements Linked to Obesity) model to design a regional intervention to increase fruit and vegetable intake, water consumption, physical activity, and sleep duration and decrease recreational screen time and sugar-sweetened beverage consumption in young children ages 2-8 years. Using the ANGELO model, CHL (1) engaged community to identify preferred intervention strategies, (2) reviewed scientific literature, (3) merged findings from community and literature, and (4) formulated the regional intervention. More than 900 community members across the Pacific helped identify intervention strategies on importance and feasibility. Nine common intervention strategies emerged. Participants supported the idea of a regional intervention while noting that cultural and resource differences would require flexibility in its implementation in the five jurisdictions. Community findings were merged with the effective obesity-reducing strategies identified in the literature, resulting in a regional intervention with four cross-cutting functions: (1) initiate or strengthen school wellness policies; (2) partner and advocate for environmental change; (3) promote CHL messages; and (4) train trainers to promote CHL behavioral objectives for children ages 2-8 years. These broad functions guided intervention activities and allowed communities to tailor activities to maximize intervention fit. Using the ANGELO model assured that the regional intervention was evidence based while recognizing jurisdiction context, which should increase effectiveness and sustainability.
A survey on classical minimal surface theory

CERN Document Server

Meeks, William H

2012-01-01

Meeks and Pérez present a survey of recent spectacular successes in classical minimal surface theory. The classification of minimal planar domains in three-dimensional Euclidean space provides the focus of the account. The proof of the classification depends on the work of many currently active leading mathematicians, thus making contact with much of the most important results in the field. Through the telling of the story of the classification of minimal planar domains, the general mathematician may catch a glimpse of the intrinsic beauty of this theory and the authors' perspective of what is happening at this historical moment in a very classical subject. This book includes an updated tour through some of the recent advances in the theory, such as Colding-Minicozzi theory, minimal laminations, the ordering theorem for the space of ends, conformal structure of minimal surfaces, minimal annular ends with infinite total curvature, the embedded Calabi-Yau problem, local pictures on the scale of curvature and t...
Minimalism and Speakers’ Intuitions

Directory of Open Access Journals (Sweden)

Matías Gariazzo

2011-08-01

Full Text Available Minimalism proposes a semantics that does not account for speakers’ intuitions about the truth conditions of a range of sentences or utterances. Thus, a challenge for this view is to offer an explanation of how its assignment of semantic contents to these sentences is grounded in their use. Such an account was mainly offered by Soames, but also suggested by Cappelen and Lepore. The article criticizes this explanation by presenting four kinds of counterexamples to it, and arrives at the conclusion that minimalism has not successfully answered the above-mentioned challenge.
Rapid promotion and progression of fibrovascular polyps by inflammation and/or hyperplasia in hamster check pouch: implications for carcinogenesis assay.

Science.gov (United States)

McGaughey, C; Jensen, J L

1983-03-01

Tumor initiation by topical application of 7,12-dimethylbenz[a]anthracene (DMBA) in dimethyl sulfoxide (DMSO) followed by topical application of retinyl acetate (RA), ethylphenylpropiolate, or acetic acid in DMSO at inflammatory and hyperplasiogenic dose regimens caused the rapid promotion of fibrovascular polyps with dysplastic epithelium in hamster cheek pouch. Such lesions did not occur in control animals initiated with DMBA followed by application of DMSO only, where inflammation was also minimal. At the dose regimen employed, RA caused obvious cytotoxicity and tissue destruction. With EPP and AA, there was no histological evidence of tissue destruction. At dose regimens resulting in minimal inflammation and no apparent cytotoxicity, RA promoted almost no polyps, but a higher yield of other tumor types. Thus, inflammation and/or hyperplasia apparently exerted a strong polyp-promoting and progressive influence. This and other differences between the tumorigenic responses of hamster-pouch mucosa and mouse skin suggest that the former supplement the latter in carcinogenic risk assessment.
Minimalism through intraoperative functional mapping.

Science.gov (United States)

Berger, M S

1996-01-01

Intraoperative stimulation mapping may be used to avoid unnecessary risk to functional regions subserving language and sensori-motor pathways. Based on the data presented here, language localization is variable in the entire population, with only certainty existing for the inferior frontal region responsible for motor speech. Anatomical landmarks such as the anterior temporal tip for temporal lobe language sites and the posterior aspect of the lateral sphenoid wing for the frontal lobe language zones are unreliable in avoiding postoperative aphasias. Thus, individual mapping to identify essential language sites has the greatest likelihood of avoiding permanent deficits in naming, reading, and motor speech. In a similar approach, motor and sensory pathways from the cortex and underlying white matter may be reliably stimulated and mapped in both awake and asleep patients. Although these techniques require an additional operative time and equipment nominally priced, the result is often gratifying, as postoperative morbidity has been greatly reduced in the process of incorporating these surgical strategies. The patients quality of life is improved in terms of seizure control, with or without antiepileptic drugs. This avoids having to perform a second costly operative procedure, which is routinely done when extraoperative stimulation and recording is done via subdural grids. In addition, an aggressive tumor resection at the initial operation lengthens the time to tumor recurrence and often obviates the need for a subsequent reoperation. Thus, intraoperative functional mapping may be best alluded to as a surgical technique that results in "minimalism in the long term".
The re-emergence of the minimal running shoe.

Science.gov (United States)

Davis, Irene S

2014-10-01

The running shoe has gone through significant changes since its inception. The purpose of this paper is to review these changes, the majority of which have occurred over the past 50 years. Running footwear began as very minimal, then evolved to become highly cushioned and supportive. However, over the past 5 years, there has been a reversal of this trend, with runners seeking more minimal shoes that allow their feet more natural motion. This abrupt shift toward footwear without cushioning and support has led to reports of injuries associated with minimal footwear. In response to this, the running footwear industry shifted again toward the development of lightweight, partial minimal shoes that offer some support and cushioning. In this paper, studies comparing the mechanics between running in minimal, partial minimal, and traditional shoes are reviewed. The implications for injuries in all 3 conditions are examined. The use of minimal footwear in other populations besides runners is discussed. Finally, areas for future research into minimal footwear are suggested.
Systematic search for the Cra-binding promoters using genomic SELEX system.

Science.gov (United States)

Shimada, Tomohiro; Fujita, Nobuyuki; Maeda, Michihisa; Ishihama, Akira

2005-09-01

Cra (or FruR), a global transcription factor with both repression and activation activities, controls a large number of the genes for glycolysis and gluconeogenesis. To get insights into the entire network of transcription regulation of the E. coli genome by Cra, we isolated a set of Cra-binding sequences using an improved method of genomic SELEX. From the DNA sequences of 97 independently isolated DNA fragments by SELEX, the Cra-binding sequences were identified in a total of ten regions on the E. coli genome, including promoters of six known genes and four hitherto-unidentified genes. All six known promoters are repressed by Cra, but none of the activation-type promoters were cloned after two cyles of SELEX, because the Cra-binding affinity to the repression-type promoters is higher than the activation-type promoters, as determined by the quantitative gel shift assay. Of a total of four newly identified Cra-binding sequences, two are associated with promoter regions of the gapA (glyceraldehyde 3-phosphate dehydrogenase) and eno (enolase) genes, both involved in sugar metabolism. The regulation of newly identified genes by Cra was confirmed by the in vivo promoter strength assay using a newly developed TFP (two-fluorescent protein) vector for promoter assay or by in vitro transcription assay in the presence of Cra protein.
10 CFR 20.1406 - Minimization of contamination.

Science.gov (United States)

2010-01-01

... 10 Energy 1 2010-01-01 2010-01-01 false Minimization of contamination. 20.1406 Section 20.1406... License Termination § 20.1406 Minimization of contamination. (a) Applicants for licenses, other than early... procedures for operation will minimize, to the extent practicable, contamination of the facility and the...
A minimal architecture for joint action

DEFF Research Database (Denmark)

Vesper, Cordula; Butterfill, Stephen; Knoblich, Günther

2010-01-01

What kinds of processes and representations make joint action possible? In this paper we suggest a minimal architecture for joint action that focuses on representations, action monitoring and action prediction processes, as well as ways of simplifying coordination. The architecture spells out...... minimal requirements for an individual agent to engage in a joint action. We discuss existing evidence in support of the architecture as well as open questions that remain to be empirically addressed. In addition, we suggest possible interfaces between the minimal architecture and other approaches...... to joint action. The minimal architecture has implications for theorizing about the emergence of joint action, for human-machine interaction, and for understanding how coordination can be facilitated by exploiting relations between multiple agents’ actions and between actions and the environment....
Minimal Walking Technicolor

DEFF Research Database (Denmark)

Foadi, Roshan; Frandsen, Mads Toudal; A. Ryttov, T.

2007-01-01

Different theoretical and phenomenological aspects of the Minimal and Nonminimal Walking Technicolor theories have recently been studied. The goal here is to make the models ready for collider phenomenology. We do this by constructing the low energy effective theory containing scalars......, pseudoscalars, vector mesons and other fields predicted by the minimal walking theory. We construct their self-interactions and interactions with standard model fields. Using the Weinberg sum rules, opportunely modified to take into account the walking behavior of the underlying gauge theory, we find...... interesting relations for the spin-one spectrum. We derive the electroweak parameters using the newly constructed effective theory and compare the results with the underlying gauge theory. Our analysis is sufficiently general such that the resulting model can be used to represent a generic walking technicolor...
Minimal Marking: A Success Story

Directory of Open Access Journals (Sweden)

Anne McNeilly

2014-11-01

Full Text Available The minimal-marking project conducted in Ryerson’s School of Journalism throughout 2012 and early 2013 resulted in significantly higher grammar scores in two first-year classes of minimally marked university students when compared to two traditionally marked classes. The “minimal-marking” concept (Haswell, 1983, which requires dramatically more student engagement, resulted in more successful learning outcomes for surface-level knowledge acquisition than the more traditional approach of “teacher-corrects-all.” Results suggest it would be effective, not just for grammar, punctuation, and word usage, the objective here, but for any material that requires rote-memory learning, such as the Associated Press or Canadian Press style rules used by news publications across North America.
Mexico's four economies reflect regional differences, challenges

OpenAIRE

Canas, Jesus; Gutierrez, Emily

2015-01-01

The economic potential of Mexico’s four regions is defined by their industrial makeup, income per capita and how much of the labor force operates outside the formal economy. Recent government reforms could promote growth and reduce regional inequality.
Medial/skeletal linking structures for multi-region configurations

CERN Document Server

Damon, James

2018-01-01

The authors consider a generic configuration of regions, consisting of a collection of distinct compact regions \\{ \\Omega_i\\} in \\mathbb{R}^{n+1} which may be either regions with smooth boundaries disjoint from the others or regions which meet on their piecewise smooth boundaries \\mathcal{B}_i in a generic way. They introduce a skeletal linking structure for the collection of regions which simultaneously captures the regions' individual shapes and geometric properties as well as the "positional geometry" of the collection. The linking structure extends in a minimal way the individual "skeletal structures" on each of the regions. This allows the authors to significantly extend the mathematical methods introduced for single regions to the configuration of regions.
Direct and indirect effects in the regulation of overlapping promoters

DEFF Research Database (Denmark)

Bendtsen, Kristian Moss; Erdossy, Janos; Csiszovski, Zsolt

2011-01-01

promoter database we found that ~14% of the identified 'forward' promoters overlap with a promoter oriented in the opposite direction. In this article we combine a mathematical model with experimental analysis of synthetic regulatory regions to investigate interference of overlapping promoters. We find...... that promoter interference depends on the characteristics of overlapping promoters. The model predicts that promoter strength and interference can be regulated separately, which provides unique opportunities for regulation. Our experimental data suggest that in principle any DNA binding protein can be used......Optimal response to environmental stimuli often requires activation of certain genes and repression of others. Dual function regulatory proteins play a key role in the differential regulation of gene expression. While repression can be achieved by any DNA binding protein through steric occlusion...
Analysis of polymorphisms in the promoter region and protein levels of interleukin-6 gene among gout patients.

Science.gov (United States)

Tsai, P-C; Chen, C-J; Lai, H-M; Chang, S-J

2008-01-01

To explore the associations between the polymorphisms and protein levels of interleukin-6 (IL-6) gene and gout disease. A total of 120 male gout patients and 184 healthy controls were enrolled. Each patient was matched with 1-2 gout-free controls by age within three years. Four polymorphisms in the promoter of IL-6 gene, including -597G/A, -572C/G, -373A(m)T(n), and -174G/C, and the IL-6 levels were analyzed. The clinical characteristics and biochemical markers in plasma were measured, including age of gout onset, duration of gout history, tophus number, gout attack frequency, uric acid, total cholesterol, triglycerides and creatinine. The mean IL-6 level for gout patients was 9.80 (+/-11.76 pg/ml) which showed no significant difference from the controls (7.06+/-7.58 pg/ml, p=0.230). When the IL-6 levels were dichotomized according to the median value (5 pg/ml), there were significantly higher proportions of the gout patients (59.66%) than controls (44%) with high IL-6 levels (OR=1.88, 95% CI=1.17-3.02, p=0.008). Unique genotype was found at polymorphisms -174G/C and -597G/A. Neither the polymorphisms -572C/G nor -373A(m)T(n) in the genotype or allele distributions showed a significant association related to clinical characteristics, biochemical markers, IL-6 levels or gout disease (all p>0.05). Those with gout disease have greater proportions of high IL-6 levels in plasma than controls, and there is no significant association between the four polymorphisms in the promoter region of IL-6 gene and gout disease.
Intrinsically bent DNA in replication origins and gene promoters.

Science.gov (United States)

Gimenes, F; Takeda, K I; Fiorini, A; Gouveia, F S; Fernandez, M A

2008-06-24

Intrinsically bent DNA is an alternative conformation of the DNA molecule caused by the presence of dA/dT tracts, 2 to 6 bp long, in a helical turn phase DNA or with multiple intervals of 10 to 11 bp. Other than flexibility, intrinsic bending sites induce DNA curvature in particular chromosome regions such as replication origins and promoters. Intrinsically bent DNA sites are important in initiating DNA replication, and are sometimes found near to regions associated with the nuclear matrix. Many methods have been developed to localize bent sites, for example, circular permutation, computational analysis, and atomic force microscopy. This review discusses intrinsically bent DNA sites associated with replication origins and gene promoter regions in prokaryote and eukaryote cells. We also describe methods for identifying bent DNA sites for circular permutation and computational analysis.

Modeling promoter grammars with evolving hidden Markov models

DEFF Research Database (Denmark)

Won, Kyoung-Jae; Sandelin, Albin; Marstrand, Troels Torben

2008-01-01

MOTIVATION: Describing and modeling biological features of eukaryotic promoters remains an important and challenging problem within computational biology. The promoters of higher eukaryotes in particular display a wide variation in regulatory features, which are difficult to model. Often several...... factors are involved in the regulation of a set of co-regulated genes. If so, promoters can be modeled with connected regulatory features, where the network of connections is characteristic for a particular mode of regulation. RESULTS: With the goal of automatically deciphering such regulatory structures......, we present a method that iteratively evolves an ensemble of regulatory grammars using a hidden Markov Model (HMM) architecture composed of interconnected blocks representing transcription factor binding sites (TFBSs) and background regions of promoter sequences. The ensemble approach reduces the risk...
Theories of minimalism in architecture: Post scriptum

Directory of Open Access Journals (Sweden)

Stevanović Vladimir

2012-01-01

Full Text Available Owing to the period of intensive development in the last decade of XX century, architectural phenomenon called Minimalism in Architecture was remembered as the Style of the Nineties, which is characterized, morphologically speaking, by simplicity and formal reduction. Simultaneously with its development in practice, on a theoretical level several dominant interpretative models were able to establish themselves. The new millennium and time distance bring new problems; therefore this paper represents a discussion on specific theorization related to Minimalism in Architecture that can bear the designation of post scriptum, because their development starts after the constitutional period of architectural minimalist discourse. In XXI century theories, the problem of definition of minimalism remains important topic, approached by theorists through resolving on the axis: Modernism - Minimal Art - Postmodernism - Minimalism in Architecture. With regard to this, analyzed texts can be categorized in two groups: 1 texts of affirmative nature and historical-associative approach in which minimalism is identified with anything that is simple and reduced, in an idealizing manner, relied mostly on the existing hypotheses; 2 critically oriented texts, in which authors reconsider adequacy of the very term 'minimalism' in the context of architecture and take a metacritical attitude towards previous texts.
Effective Feature Selection for Classification of Promoter Sequences.

Directory of Open Access Journals (Sweden)

Kouser K

Full Text Available Exploring novel computational methods in making sense of biological data has not only been a necessity, but also productive. A part of this trend is the search for more efficient in silico methods/tools for analysis of promoters, which are parts of DNA sequences that are involved in regulation of expression of genes into other functional molecules. Promoter regions vary greatly in their function based on the sequence of nucleotides and the arrangement of protein-binding short-regions called motifs. In fact, the regulatory nature of the promoters seems to be largely driven by the selective presence and/or the arrangement of these motifs. Here, we explore computational classification of promoter sequences based on the pattern of motif distributions, as such classification can pave a new way of functional analysis of promoters and to discover the functionally crucial motifs. We make use of Position Specific Motif Matrix (PSMM features for exploring the possibility of accurately classifying promoter sequences using some of the popular classification techniques. The classification results on the complete feature set are low, perhaps due to the huge number of features. We propose two ways of reducing features. Our test results show improvement in the classification output after the reduction of features. The results also show that decision trees outperform SVM (Support Vector Machine, KNN (K Nearest Neighbor and ensemble classifier LibD3C, particularly with reduced features. The proposed feature selection methods outperform some of the popular feature transformation methods such as PCA and SVD. Also, the methods proposed are as accurate as MRMR (feature selection method but much faster than MRMR. Such methods could be useful to categorize new promoters and explore regulatory mechanisms of gene expressions in complex eukaryotic species.
Healthy Cities in a global and regional context

OpenAIRE

Lawrence, Roderick J.; Fudge, Colin

2017-01-01

Since the beginning of the WHO European Healthy Cities Network in 1987, the global and regional contexts for the promotion of health and well-being have changed in many ways. First, in 2000, the United Nations Millennium Goals explicitly and implicitly addressed health promotion and prevention at the global and regional levels. Second, the concern for sustainable development at the Rio Conference in 1992 was confirmed at the World Summit in Johannesburg in 2002. During the same period, in man...
Dynamic usage of transcription start sites within core promoters

DEFF Research Database (Denmark)

Kawaji, Hideya; Frith, Martin C; Katayama, Shintaro

2006-01-01

BACKGROUND: Mammalian promoters do not initiate transcription at single, well defined base pairs, but rather at multiple, alternative start sites spread across a region. We previously characterized the static structures of transcription start site usage within promoters at the base pair level......, based on large-scale sequencing of transcript 5' ends. RESULTS: In the present study we begin to explore the internal dynamics of mammalian promoters, and demonstrate that start site selection within many mouse core promoters varies among tissues. We also show that this dynamic usage of start sites...... is associated with CpG islands, broad and multimodal promoter structures, and imprinting. CONCLUSION: Our results reveal a new level of biologic complexity within promoters--fine-scale regulation of transcription starting events at the base pair level. These events are likely to be related to epigenetic...
MECP2 promoter methylation and X chromosome inactivation in autism.

Science.gov (United States)

Nagarajan, Raman P; Patzel, Katherine A; Martin, Michelle; Yasui, Dag H; Swanberg, Susan E; Hertz-Picciotto, Irva; Hansen, Robin L; Van de Water, Judy; Pessah, Isaac N; Jiang, Ruby; Robinson, Wendy P; LaSalle, Janine M

2008-06-01

Epigenetic mechanisms have been proposed to play a role in the etiology of autism. This hypothesis is supported by the discovery of increased MECP2 promoter methylation associated with decreased MeCP2 protein expression in autism male brain. To further understand the influence of female X chromosome inactivation (XCI) and neighboring methylation patterns on aberrant MECP2 promoter methylation in autism, multiple methylation analyses were peformed on brain and blood samples from individuals with autism. Bisulfite sequencing analyses of a region 0.6 kb upstream of MECP2 in brain DNA samples revealed an abrupt transition from a highly methylated region in both sexes to a region unmethylated in males and subject to XCI in females. Chromatin immunoprecipitation analysis demonstrated that the CCTC-binding factor (CTCF) bound to this transition region in neuronal cells, consistent with a chromatin boundary at the methylation transition. Male autism brain DNA samples displayed a slight increase in methylation in this transition region, suggesting a possible aberrant spreading of methylation into the MECP2 promoter in autism males across this boundary element. In addition, autistic female brain DNA samples showed evidence for aberrant MECP2 promoter methylation as an increase in the number of bisulfite sequenced clones with undefined XCI status for MECP2 but not androgen receptor (AR). To further investigate the specificity of MECP2 methylation alterations in autism, blood DNA samples from females and mothers of males with autism were also examined for XCI skewing at AR, but no significant increase in XCI skewing was observed compared to controls. These results suggest that the aberrant MECP2 methylation in autism brain DNA samples is due to locus-specific rather than global X chromosome methylation changes.
Wine routes as an element of the regional development of borderline regions

Directory of Open Access Journals (Sweden)

Vladimir Drozg

1993-12-01

Full Text Available The article examines the role of winw routes in promoting the development of wine-growing regions. It focuses both on the criteria for tracing wine routes (landscape value of a region, distribution of tourist supply settlements and events, natural and cultural monuments, existing road netivorks and transport accessibility, supplemenlary activities along the wine routes and on the impact that wine exert on the landscape/region (an increased income of individual households, better infrastructure equipment, recuttivation ol desert land lots, decreasing depopulalion and development of supplementary activities. The wine route through the Svečinske gorice region is presented as an example of countryside regulation.
Control of growth promotion (CGP) and screening for malnutrition in central region and Lomé-Commune, January to June 2013 Togo

International Nuclear Information System (INIS)

Touglo, Adavi Lonlon; Bouraima, Mouawiyatou; Agbozouhoue, A. Eya; Bebou, Midassirou; Tchapo, Dapou; Akolly, Koffi

2014-01-01

Full text: Background: Control of Growth Promotion (CGP) is an activity that can detect early if the child has a developmental problem and investigate the cause and take appropriate decisions to overcome the consequences. In Togo, the goal in 2013 is to weigh at least 80 % of children 0-5 years during the sessions of CGP. What are the levels achieved this goal after the first semester and the problems of malnutrition detected? Method: We conducted a descriptive cross-sectional study data collected in the quarterly reports in two regions of Togo, Lomé - Commune in the South and Central Region in the North. The study involved data from the first semester of 2013 in all districts of the two regions. Database monitoring activities at national level CGP was used. Data from the two regions were separated and analyzed using Excel. Comparison tests of proportions were made using Epi Info 7. Results: Detection rate of nutritional status by the CGP in the first half of 2013 was 29% of the total target of 155,423 children under 5 years in the two regions. This rate was higher for the Central region (33 %) than for Lomé-Commune (26 %). No district has reached half of the goals. Their rates vary from 17.9 % and 18 % respectively for District No. 2 and District No. 4 of Lomé-Commune to 39.7% for the District of Tchaoudjo. The malnutrition rate was 8.8 %. This rate is higher in the Central region (10.9 %) than in Lomé-Commune (6.8 %) with a RR = 1.59, 95% CI = [1.50 to 1.69]. Severe malnutrition was 1.4 %. It is predominant in Lomé-commune (1.7 %) than in the Central region (1.1%) with a RR = 1.55, 95% CI = [1.32 to 1.82]. Conclusion: All districts in the two regions are below the target detection rate in the first half. The CGP has detected cases of moderate and severe malnutrition. To compare that rates with the survey data, the screening tools must be standard and adequate. (author)
Down-regulation of serum/glucocorticoid regulated kinase 1 in colorectal tumours is largely independent of promoter hypermethylation.

Directory of Open Access Journals (Sweden)

Francesca Lessi

2010-11-01

Full Text Available We have previously shown that serum/glucocorticoid regulated kinase 1 (SGK1 is down-regulated in colorectal cancers (CRC with respect to normal tissue. As hyper-methylation of promoter regions is a well-known mechanism of gene silencing in cancer, we tested whether the SGK1 promoter region was methylated in colonic tumour samples.We investigated the methylation profile of the two CpG islands present in the promoter region of SGK1 in a panel of 5 colorectal cancer cell lines by sequencing clones of bisulphite-treated DNA samples. We further confirmed our findings in a panel of 10 normal and 10 tumour colonic tissue samples of human origin. We observed CpG methylation only in the smaller and more distal CpG island in the promoter region of SGK1 in both normal and tumour samples of colonic origin. We further identified a single nucleotide polymorphism (SNP, rs1743963 which affects methylation of the corresponding CpG.Our results show that even though partial methylation of the promoter region of SGK1 is present, this does not account for the different expression levels seen between normal and tumour tissue.
Technology applications for radioactive waste minimization

International Nuclear Information System (INIS)

Devgun, J.S.

1994-01-01

The nuclear power industry has achieved one of the most successful examples of waste minimization. The annual volume of low-level radioactive waste shipped for disposal per reactor has decreased to approximately one-fifth the volume about a decade ago. In addition, the curie content of the total waste shipped for disposal has decreased. This paper will discuss the regulatory drivers and economic factors for waste minimization and describe the application of technologies for achieving waste minimization for low-level radioactive waste with examples from the nuclear power industry
Transience and capacity of minimal submanifolds

DEFF Research Database (Denmark)

Markvorsen, Steen; Palmer, V.

2003-01-01

We prove explicit lower bounds for the capacity of annular domains of minimal submanifolds P-m in ambient Riemannian spaces N-n with sectional curvatures bounded from above. We characterize the situations in which the lower bounds for the capacity are actually attained. Furthermore we apply...... these bounds to prove that Brownian motion defined on a complete minimal submanifold is transient when the ambient space is a negatively curved Hadamard-Cartan manifold. The proof stems directly from the capacity bounds and also covers the case of minimal submanifolds of dimension m > 2 in Euclidean spaces....
Characterization of the human UDP-galactose:ceramide galactosyltransferase gene promoter.

Science.gov (United States)

Tencomnao, T; Yu, R K; Kapitonov, D

2001-02-16

UDP-galactose:ceramide galactosyltransferase (CGT, EC 2.4.1.45) is a key enzyme in the biosynthesis of galactocerebroside, the most abundant glycosphingolipid in the myelin sheath. An 8 kb fragment upstream from the transcription initiation site of CGT gene was isolated from a human genomic DNA library. Primer extension analysis revealed a single transcription initiation site 329 bp upstream from the ATG start codon. Neither a consensus TATA nor a CCAAT box was identified in the proximity to the transcription start site; however, this region contains a high GC content and multiple putative regulatory elements. To investigate the transcriptional regulation of CGT, a series of 5' deletion constructs of the 5'-flanking region were generated and cloned upstream from the luciferase reporter gene. By comparing promoter activity in the human oligodendroglioma (HOG) and human neuroblastoma (LAN-5) cell lines, we found that the CGT promoter functions in a cell type-specific manner. Three positive cis-acting regulatory regions were identified, including a proximal region at -292/-256 which contains the potential binding sites for known transcription factors (TFs) such as Ets and SP1 (GC box), a distal region at -747/-688 comprising a number of binding sites such as the ERE half-site, NF1-like, TGGCA-BP, and CRE, and a third positive cis-acting region distally localized at -1325/-1083 consisting of binding sites for TFs such as nitrogen regulatory, TCF-1, TGGCA-BP, NF-IL6, CF1, bHLH, NF1-like, GATA, and gamma-IRE. A negative cis-acting domain localized in a far distal region at -1594/-1326 was also identified. Our results suggest the presence of both positive and negative cis-regulatory regions essential for the cell-specific expression in the TATA-less promoter of the human CGT gene.
Hyaluronan Oligosaccharides for the Promotion of Remyelination (Revised)

Science.gov (United States)

2012-10-01

would be both safe and efficacious as a therapy or co- therapy to promote remyelination. REFERENCES Botzki A, Rigden DJ, Braun...with reduced brightness and contrast, demonstrating the morphology within lesions. Arrows in C and D indicate regions of persistent lyso- lecithin ... therapies for the promotion of remyelination. Acknowledgment This work was supported by NIH (NINDS) grants NS056234 (L.S.S.), NS054044, and NS045737-06S1
On the isoperimetric rigidity of extrinsic minimal balls

DEFF Research Database (Denmark)

Markvorsen, Steen; Palmer, V.

2003-01-01

We consider an m-dimensional minimal submanifold P and a metric R-sphere in the Euclidean space R-n. If the sphere has its center p on P, then it will cut out a well defined connected component of P which contains this center point. We call this connected component an extrinsic minimal R-ball of P....... The quotient of the volume of the extrinsic ball and the volume of its boundary is not larger than the corresponding quotient obtained in the space form standard situation, where the minimal submanifold is the totally geodesic linear subspace R-m. Here we show that if the minimal submanifold has dimension...... larger than 3, if P is not too curved along the boundary of an extrinsic minimal R-ball, and if the inequality alluded to above is an equality for the extrinsic minimal ball, then the minimal submanifold is totally geodesic....
Systematic screening for mutations in the promoter and the coding region of the 5-HT{sub 1A} gene

Energy Technology Data Exchange (ETDEWEB)

Erdmann, J.; Shimron-Abarbanell, D.; Cichon, S. [Univ. of Bonn (Germany)] [and others

1995-10-09

In the present study we sought to identify genetic variation in the 5-HT{sub 1A} receptor gene which through alteration of protein function or level of expression might contribute to the genetic predisposition to neuropsychiatric diseases. Genomic DNA samples from 159 unrelated subjects (including 45 schizophrenic, 46 bipolar affective, and 43 patients with Tourette`s syndrome, as well as 25 healthy controls) were investigated by single-strand conformation analysis. Overlapping PCR (polymerase chain reaction) fragments covered the whole coding sequence as well as the 5{prime} untranslated region of the 5-HT{sub 1A} gene. The region upstream to the coding sequence we investigated contains a functional promoter. We found two rare nucleotide sequence variants. Both mutations are located in the coding region of the gene: a coding mutation (A{yields}G) in nucleotide position 82 which leads to an amino acid exchange (Ile{yields}Val) in position 28 of the receptor protein and a silent mutation (C{yields}T) in nucleotide position 549. The occurrence of the Ile-28-Val substitution was studied in an extended sample of patients (n = 352) and controls (n = 210) but was found in similar frequencies in all groups. Thus, this mutation is unlikely to play a significant role in the genetic predisposition to the diseases investigated. In conclusion, our study does not provide evidence that the 5-HT{sub 1A} gene plays either a major or a minor role in the genetic predisposition to schizophrenia, bipolar affective disorder, or Tourette`s syndrome. 29 refs., 4 figs., 1 tab.
Tourism And Environment: Toward Promoting Sustainable Development Of Tourism: A Human Rights Perspective

Directory of Open Access Journals (Sweden)

Ni Ketut Supasti Dharmawan

2012-01-01

Full Text Available Tourism activities in era globalization bring positive and negative impacts especially for the host countries destination. To minimize the negative impacts it is very important to always promote the sustainable development of tourism including from a human rights perspective. This paper will discuss concerning who have responsibility to promote a human rights related with sustainable development of tourism. To explore the topic in this article, Author will study both international human rights instruments and environmental convention as well as the soft law regarding the tourism sector such as the UN WTO Global Code Of Ethics. The Law No. 10 Year 2009 concerning Indonesia Tourism Law is also part of legal material studied in this paper. There are national, international legal instruments of the human rights as well as UNWTO Global Codes of Ethics which can be utilized to promote sustainable tourism through human rights perspective. It is considered that all stakeholders have responsibility to promote sustainable development of tourism.
Safety control and minimization of radioactive wastes

International Nuclear Information System (INIS)

Wang Jinming; Rong Feng; Li Jinyan; Wang Xin

2010-01-01

Compared with the developed countries, the safety control and minimization of the radwastes in China are under-developed. The research of measures for the safety control and minimization of the radwastes is very important for the safety control of the radwastes, and the reduction of the treatment and disposal cost and environment radiation hazards. This paper has systematically discussed the safety control and the minimization of the radwastes produced in the nuclear fuel circulation, nuclear technology applications and the process of decommission of nuclear facilities, and has provided some measures and methods for the safety control and minimization of the radwastes. (authors)
Effect of metallothionein core promoter region polymorphism on cadmium, zinc and copper levels in autopsy kidney tissues from a Turkish population

International Nuclear Information System (INIS)

Kayaalti, Zeliha; Mergen, Goerkem; Soeylemezoglu, Tuelin

2010-01-01

Metallothioneins (MTs) are metal-binding, low molecular weight proteins and are involved in pathophysiological processes like metabolism of essential metals, metal ion homeostasis and detoxification of heavy metals. Metallothionein expression is induced by various heavy metals especially cadmium, mercury and zinc; MTs suppress toxicity of heavy metals by binding themselves to these metals. The aim of this study was to investigate the association between the - 5 A/G metallothionein 2A (MT2A) single nucleotide polymorphism (SNP) and Cd, Zn and Cu levels in the renal cortex from autopsy cases. MT2A core promoter region - 5 A/G SNP was analyzed by PCR-RFLP method using 114 autopsy kidney tissues and the genotype frequencies of this polymorphism were found as 87.7% homozygote typical (AA), 11.4% heterozygote (AG) and 0.9% homozygote atypical (GG). In order to assess the Cd, Zn and Cu levels in the same autopsy kidney tissues, a dual atomic absorption spectrophotometer system was used and the average levels of Cd, Zn and Cu were measured as 95.54 ± 65.58 μg/g, 181.20 ± 87.72 μg/g and 17.14 ± 16.28 μg/g, respectively. As a result, no statistical association was found between the - 5 A/G SNP in the MT2A gene and the Zn and Cu levels in the renal cortex (p > 0.05), but considerably high accumulation of Cd was monitored for individuals having AG (151.24 ± 60.21 μg/g) and GG genotypes (153.09 μg/g) compared with individuals having AA genotype (87.72 ± 62.98 μg/g) (p < 0.05). These results show that the core promoter region polymorphism of metallothionein 2A increases the accumulation of Cd in human renal cortex.
ESR1 gene promoter region methylation in free circulating DNA and its correlation with estrogen receptor protein expression in tumor tissue in breast cancer patients

International Nuclear Information System (INIS)

Martínez-Galán, Joaquina; Ríos, Sandra; Delgado, Juan Ramón; Torres-Torres, Blanca; Núñez, María Isabel; López-Peñalver, Jesús; Del Moral, Rosario; Ruiz De Almodóvar, José Mariano; Menjón, Salomón; Concha, Ángel; Chamorro, Clara

2014-01-01

Tumor expression of estrogen receptor (ER) is an important marker of prognosis, and is predictive of response to endocrine therapy in breast cancer. Several studies have observed that epigenetic events, such methylation of cytosines and deacetylation of histones, are involved in the complex mechanisms that regulate promoter transcription. However, the exact interplay of these factors in transcription activity is not well understood. In this study, we explored the relationship between ER expression status in tumor tissue samples and the methylation of the 5′ CpG promoter region of the estrogen receptor gene (ESR1) isolated from free circulating DNA (fcDNA) in plasma samples from breast cancer patients. Patients (n = 110) with non-metastatic breast cancer had analyses performed of ER expression (luminal phenotype in tumor tissue, by immunohistochemistry method), and the ESR1-DNA methylation status (fcDNA in plasma, by quantitative methylation specific PCR technique). Our results showed a significant association between presence of methylated ESR1 in patients with breast cancer and ER negative status in the tumor tissue (p = 0.0179). There was a trend towards a higher probability of ESR1-methylation in those phenotypes with poor prognosis i.e. 80% of triple negative patients, 60% of HER2 patients, compared to 28% and 5.9% of patients with better prognosis such as luminal A and luminal B, respectively. Silencing, by methylation, of the promoter region of the ESR1 affects the expression of the estrogen receptor protein in tumors of breast cancer patients; high methylation of ESR1-DNA is associated with estrogen receptor negative status which, in turn, may be implicated in the patient’s resistance to hormonal treatment in breast cancer. As such, epigenetic markers in plasma may be of interest as new targets for anticancer therapy, especially with respect to endocrine treatment
Insulators form gene loops by interacting with promoters in Drosophila.

Science.gov (United States)

Erokhin, Maksim; Davydova, Anna; Kyrchanova, Olga; Parshikov, Alexander; Georgiev, Pavel; Chetverina, Darya

2011-09-01

Chromatin insulators are regulatory elements involved in the modulation of enhancer-promoter communication. The 1A2 and Wari insulators are located immediately downstream of the Drosophila yellow and white genes, respectively. Using an assay based on the yeast GAL4 activator, we have found that both insulators are able to interact with their target promoters in transgenic lines, forming gene loops. The existence of an insulator-promoter loop is confirmed by the fact that insulator proteins could be detected on the promoter only in the presence of an insulator in the transgene. The upstream promoter regions, which are required for long-distance stimulation by enhancers, are not essential for promoter-insulator interactions. Both insulators support basal activity of the yellow and white promoters in eyes. Thus, the ability of insulators to interact with promoters might play an important role in the regulation of basal gene transcription.

Flow around turbulence promoters in parallel channel, 1

International Nuclear Information System (INIS)

Shiina, Yasuaki; Takizuka, Takakazu; Okamoto, Yoshizo

1982-01-01

Flow characteristics in relation to heat transfer characteristics in parallel channel with turbulence promoters were studied experimentally. Flow visualization experiments were made in paralle channel with one or two turbulence promoters for Reynolds number region of 100 lt = Resub(w) lt = 3,600. The vortex patterns behind one promoter were that a steady vortex was formed for low Reynolds number and vortex was shed for high Reynolds number,. For higher Reynolds number, it was observed that shedding vortex caused other vortices or disappeared itself randomly. The results indicate that the shedding vortices will augment heat transfer, whereas the steady vortex will give rise to deterioration in heat transfer. This inference agrees with the experimental results of Hishida et al. The results of two promoters experiment showed that the maximum performance of promoter would be attained at p/d -- 7. This agrees with the results formerly studied by other investigators. (author)
Minimal string theory is logarithmic

International Nuclear Information System (INIS)

Ishimoto, Yukitaka; Yamaguchi, Shun-ichi

2005-01-01

We study the simplest examples of minimal string theory whose worldsheet description is the unitary (p,q) minimal model coupled to two-dimensional gravity ( Liouville field theory). In the Liouville sector, we show that four-point correlation functions of 'tachyons' exhibit logarithmic singularities, and that the theory turns out to be logarithmic. The relation with Zamolodchikov's logarithmic degenerate fields is also discussed. Our result holds for generic values of (p,q)
c-Myc activates BRCA1 gene expression through distal promoter elements in breast cancer cells

International Nuclear Information System (INIS)

Chen, Yinghua; Xu, Jinhua; Borowicz, Stanley; Collins, Cindy; Huo, Dezheng; Olopade, Olufunmilayo I

2011-01-01

The BRCA1 gene plays an important role in the maintenance of genomic stability. BRCA1 inactivation contributes to breast cancer tumorigenesis. An increasing number of transcription factors have been shown to regulate BRCA1 expression. c-Myc can act as a transcriptional activator, regulating up to 15% of all genes in the human genome and results from a high throughput screen suggest that BRCA1 is one of its targets. In this report, we used cultured breast cancer cells to examine the mechanisms of transcriptional activation of BRCA1 by c-Myc. c-Myc was depleted using c-Myc-specific siRNAs in cultured breast cancer cells. BRCA1 mRNA expression and BRCA1 protein expression were determined by quantitative RT-PCR and western blot, respectively and BRCA1 promoter activities were examined under these conditions. DNA sequence analysis was conducted to search for high similarity to E boxes in the BRCA1 promoter region. The association of c-Myc with the BRCA1 promoter in vivo was tested by a chromatin immunoprecipitation assay. We investigated the function of the c-Myc binding site in the BRCA1 promoter region by a promoter assay with nucleotide substitutions in the putative E boxes. BRCA1-dependent DNA repair activities were measured by a GFP-reporter assay. Depletion of c-Myc was found to be correlated with reduced expression levels of BRCA1 mRNA and BRCA1 protein. Depletion of c-Myc decreased BRCA1 promoter activity, while ectopically expressed c-Myc increased BRCA1 promoter activity. In the distal BRCA1 promoter, DNA sequence analysis revealed two tandem clusters with high similarity, and each cluster contained a possible c-Myc binding site. c-Myc bound to these regions in vivo. Nucleotide substitutions in the c-Myc binding sites in these regions abrogated c-Myc-dependent promoter activation. Furthermore, breast cancer cells with reduced BRCA1 expression due to depletion of c-Myc exhibited impaired DNA repair activity. The distal BRCA1 promoter region is associated with c
Tourism of Khmelnytskyi region

Directory of Open Access Journals (Sweden)

Інна Шоробура

2017-09-01

Full Text Available The peculiarities of tourism in Khmelnytskyi region, its priority areas, types, including cultural-educational, environmental, sportrecreative and others have been revealed in the article. The basic tasks of tourism development in the region, aimed at the formation and protection of the tourism-recreational sector, market of competitive services, attraction of maximum number of tourists to the region, etc. have been cleared out. The attention is focused on the main tourist potential of Khmelnytskyi region, including National Nature Park «Podilski Tovtry», National historical-cultural nature reserve «Kamianets», «Samchyky», Medzhybizh regional historical-ethnographic museum-fortress, sanatorium-resort facilities based on mineral waters and others. The attention is paid to the increase in income from tourism. Traditional hospitality of the population of the region, especially in rural areas, provides the possibility to combine tourists’ accommodation with the study of rural customs and traditions directly in the villages. Tourism in Khmelnytskyi region will be attractive to all tourists who want to eat healthy food, to stay outdoors and enjoy the beauty of the region. Also the article tells us about the development of other directions and familiarizes tourists with other enticements of Khmelnytskyi region using the positive brand of Kamianets-Podilskyi. All three potential areas of tourism development (historical tourism in Kamianets-Podilskyi, recreational tourism on rivers, lakes and in the forests, as well as rural tourism can be combined within the global promotion of nature and traditions of the region. It is indicated that Khmelnytskyi is a promising tourist region of Ukraine. The main problems of the region are inadequate tourism infrastructure, accommodation facilities, food and roads. The experience of the tourism cluster «Oberih» (Protective Charm proves the perspectives of agritourism. Developing these two areas together, we
Do you Mini-Med School? Leveraging library resources to improve Internet consumer health information literacy.

Science.gov (United States)

Van Moorsel, G

2001-01-01

Popular for engaging public interest in medical science while promoting health awareness, Mini-Med School (MMS) programs also afford important if largely unrealized opportunities to improve the health information literacy of attendees. With a growing population using the Internet to make health decisions, needed venues for improving Internet Consumer Health Information (CHI) literacy may be found in the MMS platform. Surveyed directors of MMS programs understand the need to include CHI, and successful programs at SUNY Stony Brook and elsewhere demonstrate the potential for collaboration with affiliated health sciences libraries to integrate CHI instruction into MMS curricula.
Sequential unconstrained minimization algorithms for constrained optimization

International Nuclear Information System (INIS)

Byrne, Charles

2008-01-01

The problem of minimizing a function f(x):R J → R, subject to constraints on the vector variable x, occurs frequently in inverse problems. Even without constraints, finding a minimizer of f(x) may require iterative methods. We consider here a general class of iterative algorithms that find a solution to the constrained minimization problem as the limit of a sequence of vectors, each solving an unconstrained minimization problem. Our sequential unconstrained minimization algorithm (SUMMA) is an iterative procedure for constrained minimization. At the kth step we minimize the function G k (x)=f(x)+g k (x), to obtain x k . The auxiliary functions g k (x):D subset of R J → R + are nonnegative on the set D, each x k is assumed to lie within D, and the objective is to minimize the continuous function f:R J → R over x in the set C = D-bar, the closure of D. We assume that such minimizers exist, and denote one such by x-circumflex. We assume that the functions g k (x) satisfy the inequalities 0≤g k (x)≤G k-1 (x)-G k-1 (x k-1 ), for k = 2, 3, .... Using this assumption, we show that the sequence {(x k )} is decreasing and converges to f(x-circumflex). If the restriction of f(x) to D has bounded level sets, which happens if x-circumflex is unique and f(x) is closed, proper and convex, then the sequence {x k } is bounded, and f(x*)=f(x-circumflex), for any cluster point x*. Therefore, if x-circumflex is unique, x* = x-circumflex and {x k } → x-circumflex. When x-circumflex is not unique, convergence can still be obtained, in particular cases. The SUMMA includes, as particular cases, the well-known barrier- and penalty-function methods, the simultaneous multiplicative algebraic reconstruction technique (SMART), the proximal minimization algorithm of Censor and Zenios, the entropic proximal methods of Teboulle, as well as certain cases of gradient descent and the Newton–Raphson method. The proof techniques used for SUMMA can be extended to obtain related results
Opposite Smad and chicken ovalbumin upstream promoter transcription factor inputs in the regulation of the collagen VII gene promoter by transforming growth factor-beta.

Science.gov (United States)

Calonge, María Julia; Seoane, Joan; Massagué, Joan

2004-05-28

A critical component of the epidermal basement membrane, collagen type VII, is produced by keratinocytes and fibroblasts, and its production is stimulated by the cytokine transforming growth factor-beta (TGF-beta). The gene, COL7A1, is activated by TGF-beta via Smad transcription factors in cooperation with AP1. Here we report a previously unsuspected level of complexity in this regulatory process. We provide evidence that TGF-beta may activate the COL7A1 promoter by two distinct inputs operating through a common region of the promoter. One input is provided by TGF-beta-induced Smad complexes via two Smad binding elements that function redundantly depending on the cell type. The second input is provided by relieving the COL7A1 promoter from chicken ovalbumin upstream promoter transcription factor (COUP-TF)-mediated transcriptional repression. We identified COUP-TFI and -TFII as factors that bind to the TGF-beta-responsive region of the COL7A1 promoter in an expression library screening. COUP-TFs bind to a site between the two Smad binding elements independently of Smad or AP1 and repress the basal and TGF-beta-stimulated activities of this promoter. We provide evidence that endogenous COUP-TF activity represses the COL7A1 promoter. Furthermore, we show that TGF-beta addition causes a rapid and profound down-regulation of COUP-TF expression in keratinocytes and fibroblasts. The results suggest that TGF-beta signaling may exert tight control over COL7A1 by offsetting the balance between opposing Smad and COUP-TFs.
Pengaruh Pelapis Bionanokomposit terhadap Mutu Mangga Terolah Minimal

Directory of Open Access Journals (Sweden)

Ata Aditya Wardana

2017-04-01

Full Text Available Abstract Minimally-processed mango is a perishable product due to high respiration and transpiration and microbial decay. Edible coating is one of the alternative methods to maintain the quality of minimally - processed mango. The objective of this study was to evaluate the effects of bionanocomposite edible coating from tapioca and ZnO nanoparticles (NP-ZnO on quality of minimally - processed mango cv. Arumanis, stored for 12 days at 8°C. The combination of tapioca and NP-ZnO (0, 1, 2% by weight of tapioca were used to coat minimally processed mango. The result showed that application of bionanocomposite edible coatings were able to maintain the quality of minimally-processed mango during the storage periods. The bionanocomposite from tapioca + NP-ZnO (2% by weight of tapioca was the most effective in reducing weight loss, firmness, browning index, total acidity, total soluble solids ,respiration, and microbial counts. Thus, the use of bionanocomposite edible coating might provide an alternative method to maintain storage quality of minimally-processed mango. Abstrak Mangga terolah minimal merupakan produk yang cepat mengalami kerusakan dikarenakan respirasi yang cepat, transpirasi dan kerusakan oleh mikroba. Edible coating merupakan salah satu alternatif metode untuk mempertahankan mutu mangga terolah minimal. Tujuan dari penelitian ini adalah untuk mengevaluasi pengaruh pelapis bionanokomposit dari tapioka dan nanopartikel ZnO (NP-ZnO terhadap mutu mangga terolah minimal cv. Arumanis yang disimpan selama 12 hari pada suhu 8oC. Kombinasi dari tapioka dan NP-ZnO (0, 1, 2% b/b tapioka digunakan untuk melapisi mangga terolah minimal. Hasil menunjukkan bahwa pelapisan bionanokomposit mampu mempertahankan mutu mangga terolah minimal selama penyimpanan. Bionanokomposit dari tapioka + NP-ZnO (2% b/b tapioka paling efektif dalam menghambat penurunan susut bobot, kekerasan, indeks pencoklatan, total asam, total padatan terlarut, respirasi dan total
Hazardous waste minimization tracking system

International Nuclear Information System (INIS)

Railan, R.

1994-01-01

Under RCRA section 3002 9(b) and 3005f(h), hazardous waste generators and owners/operators of treatment, storage, and disposal facilities (TSDFs) are required to certify that they have a program in place to reduce the volume or quantity and toxicity of hazardous waste to the degree determined to be economically practicable. In many cases, there are environmental, as well as, economic benefits, for agencies that pursue pollution prevention options. Several state governments have already enacted waste minimization legislation (e.g., Massachusetts Toxic Use Reduction Act of 1989, and Oregon Toxic Use Reduction Act and Hazardous Waste Reduction Act, July 2, 1989). About twenty six other states have established legislation that will mandate some type of waste minimization program and/or facility planning. The need to address the HAZMIN (Hazardous Waste Minimization) Program at government agencies and private industries has prompted us to identify the importance of managing The HAZMIN Program, and tracking various aspects of the program, as well as the progress made in this area. The open-quotes WASTEclose quotes is a tracking system, which can be used and modified in maintaining the information related to Hazardous Waste Minimization Program, in a manageable fashion. This program maintains, modifies, and retrieves information related to hazardous waste minimization and recycling, and provides automated report generating capabilities. It has a built-in menu, which can be printed either in part or in full. There are instructions on preparing The Annual Waste Report, and The Annual Recycling Report. The program is very user friendly. This program is available in 3.5 inch or 5 1/4 inch floppy disks. A computer with 640K memory is required
The Quest for Minimal Quotients for Probabilistic Automata

DEFF Research Database (Denmark)

Eisentraut, Christian; Hermanns, Holger; Schuster, Johann

2013-01-01

One of the prevailing ideas in applied concurrency theory and verification is the concept of automata minimization with respect to strong or weak bisimilarity. The minimal automata can be seen as canonical representations of the behaviour modulo the bisimilarity considered. Together with congruence...... results wrt. process algebraic operators, this can be exploited to alleviate the notorious state space explosion problem. In this paper, we aim at identifying minimal automata and canonical representations for concurrent probabilistic models. We present minimality and canonicity results for probabilistic...... automata wrt. strong and weak bisimilarity, together with polynomial time minimization algorithms....
Supersymmetric hybrid inflation with non-minimal Kahler potential

International Nuclear Information System (INIS)

Bastero-Gil, M.; King, S.F.; Shafi, Q.

2007-01-01

Minimal supersymmetric hybrid inflation based on a minimal Kahler potential predicts a spectral index n s ∼>0.98. On the other hand, WMAP three year data prefers a central value n s ∼0.95. We propose a class of supersymmetric hybrid inflation models based on the same minimal superpotential but with a non-minimal Kahler potential. Including radiative corrections using the one-loop effective potential, we show that the prediction for the spectral index is sensitive to the small non-minimal corrections, and can lead to a significantly red-tilted spectrum, in agreement with WMAP
Null-polygonal minimal surfaces in AdS{sub 4} from perturbed W minimal models

Energy Technology Data Exchange (ETDEWEB)

Hatsuda, Yasuyuki [Deutsches Elektronen-Synchrotron (DESY), Hamburg (Germany); Ito, Katsushi [Tokyo Institute of Technology (Japan). Dept. of Physics; Satoh, Yuji [Tsukuba Univ., Sakura, Ibaraki (Japan). Inst. of Physics

2012-11-15

We study the null-polygonal minimal surfaces in AdS{sub 4}, which correspond to the gluon scattering amplitudes/Wilson loops in N=4 super Yang-Mills theory at strong coupling. The area of the minimal surfaces with n cusps is characterized by the thermodynamic Bethe ansatz (TBA) integral equations or the Y-system of the homogeneous sine-Gordon model, which is regarded as the SU(n-4){sub 4}/U(1){sup n-5} generalized parafermion theory perturbed by the weight-zero adjoint operators. Based on the relation to the TBA systems of the perturbed W minimal models, we solve the TBA equations by using the conformal perturbation theory, and obtain the analytic expansion of the remainder function around the UV/regular-polygonal limit for n = 6 and 7. We compare the rescaled remainder function for n=6 with the two-loop one, to observe that they are close to each other similarly to the AdS{sub 3} case.
Assessment of LANL waste minimization plan

International Nuclear Information System (INIS)

Davis, K.D.; McNair, D.A.; Jennrich, E.A.; Lund, D.M.

1991-04-01

The objective of this report is to evaluate the Los Alamos National Laboratory (LANL) Waste Minimization Plan to determine if it meets applicable internal (DOE) and regulatory requirements. The intent of the effort is to assess the higher level elements of the documentation to determine if they have been addressed rather than the detailed mechanics of the program's implementation. The requirement for a Waste Minimization Plan is based in several DOE Orders as well as environmental laws and regulations. Table 2-1 provides a list of the major documents or regulations that require waste minimization efforts. The table also summarizes the applicable requirements
Comparative analysis of myostatin gene and promoter sequences of Qinchuan and Red Angus cattle.

Science.gov (United States)

He, Y L; Wu, Y H; Quan, F S; Liu, Y G; Zhang, Y

2013-09-04

To better understand the function of the myostatin gene and its promoter region in bovine, we amplified and sequenced the myostatin gene and promoter from the blood of Qinchuan and Red Angus cattle by using polymerase chain reaction. The sequences of Qinchuan and Red Angus cattle were compared with those of other cattle breeds available in GenBank. Exon splice sites were confirmed by mRNA sequencing. Compared to the published sequence (GenBank accession No. AF320998), 69 single nucleotide polymorphisms (SNPs) were identified in the Qinchuan myostatin gene, only one of which was an insertion mutation in Qinchuan cattle. There was a 16-bp insertion in the first 705-bp intron in 3 Qinchuan cattle. A total of 7 SNPs were identified in exon 3, in which the mutation occurred in the third base of the codon and was synonymous. On comparing the Qinchuan myostatin gene sequence to that of Red Angus cattle, a total of 50 SNPs were identified in the first and third exons. In addition, there were 18 SNPs identified in the Qinchuan cattle promoter region compared with those of other cattle compared to the Red Angus cattle myostatin promoter region. breeds (GenBank accession No. AF348479), but only 14 SNPs when compared to the Red Angus cattle myostatin promoter region.
Blackfolds, plane waves and minimal surfaces

Science.gov (United States)

Armas, Jay; Blau, Matthias

2015-07-01

Minimal surfaces in Euclidean space provide examples of possible non-compact horizon geometries and topologies in asymptotically flat space-time. On the other hand, the existence of limiting surfaces in the space-time provides a simple mechanism for making these configurations compact. Limiting surfaces appear naturally in a given space-time by making minimal surfaces rotate but they are also inherent to plane wave or de Sitter space-times in which case minimal surfaces can be static and compact. We use the blackfold approach in order to scan for possible black hole horizon geometries and topologies in asymptotically flat, plane wave and de Sitter space-times. In the process we uncover several new configurations, such as black helicoids and catenoids, some of which have an asymptotically flat counterpart. In particular, we find that the ultraspinning regime of singly-spinning Myers-Perry black holes, described in terms of the simplest minimal surface (the plane), can be obtained as a limit of a black helicoid, suggesting that these two families of black holes are connected. We also show that minimal surfaces embedded in spheres rather than Euclidean space can be used to construct static compact horizons in asymptotically de Sitter space-times.
Blackfolds, plane waves and minimal surfaces

Energy Technology Data Exchange (ETDEWEB)

Armas, Jay [Physique Théorique et Mathématique, Université Libre de Bruxelles and International Solvay Institutes, ULB-Campus Plaine CP231, B-1050 Brussels (Belgium); Albert Einstein Center for Fundamental Physics, University of Bern,Sidlerstrasse 5, 3012 Bern (Switzerland); Blau, Matthias [Albert Einstein Center for Fundamental Physics, University of Bern,Sidlerstrasse 5, 3012 Bern (Switzerland)

2015-07-29

Minimal surfaces in Euclidean space provide examples of possible non-compact horizon geometries and topologies in asymptotically flat space-time. On the other hand, the existence of limiting surfaces in the space-time provides a simple mechanism for making these configurations compact. Limiting surfaces appear naturally in a given space-time by making minimal surfaces rotate but they are also inherent to plane wave or de Sitter space-times in which case minimal surfaces can be static and compact. We use the blackfold approach in order to scan for possible black hole horizon geometries and topologies in asymptotically flat, plane wave and de Sitter space-times. In the process we uncover several new configurations, such as black helicoids and catenoids, some of which have an asymptotically flat counterpart. In particular, we find that the ultraspinning regime of singly-spinning Myers-Perry black holes, described in terms of the simplest minimal surface (the plane), can be obtained as a limit of a black helicoid, suggesting that these two families of black holes are connected. We also show that minimal surfaces embedded in spheres rather than Euclidean space can be used to construct static compact horizons in asymptotically de Sitter space-times.
Minimal modification to tribimaximal mixing

International Nuclear Information System (INIS)

He Xiaogang; Zee, A.

2011-01-01

We explore some ways of minimally modifying the neutrino mixing matrix from tribimaximal, characterized by introducing at most one mixing angle and a CP violating phase thus extending our earlier work. One minimal modification, motivated to some extent by group theoretic considerations, is a simple case with the elements V α2 of the second column in the mixing matrix equal to 1/√(3). Modifications by keeping one of the columns or one of the rows unchanged from tribimaximal mixing all belong to the class of minimal modification. Some of the cases have interesting experimentally testable consequences. In particular, the T2K and MINOS collaborations have recently reported indications of a nonzero θ 13 . For the cases we consider, the new data sharply constrain the CP violating phase angle δ, with δ close to 0 (in some cases) and π disfavored.
Plasma promoted manufacturing of hydrogen and vehicular applications

Science.gov (United States)

Bromberg, Leslie

2003-10-01

Plasmas can be used for promoting reformation of fuels. Plasma-based reformers developed at MIT use a low temperature, low power, low current electrical discharge to promote partial oxidation conversion of hydrocarbon fuels into hydrogen and CO. The very fuel rich mixture is hard to ignite, and the plasmatron provides a volume-ignition. To minimize erosion and to simplify the power supply, a low current high voltage discharge is used, with wide area electrodes. The plasmatron fuel reformer operates at or slightly above atmospheric pressure. The plasma-based reformer technology provides the advantages of rapid startup and transient response; efficient conversion of the fuel to hydrogen rich gas; compact size; relaxation or elimination of reformer catalyst requirements; and capability to process difficult to reform fuels. These advantages enable use of hydrogen-manufacturing reformation technology in cars using available fuels, such as gasoline and diesel. This plasma-based reformer technology can provide substantial throughputs even without the use of a catalyst. The electrical power consumption of the device is minimized by design and operational characteristics (less than 500 W peak and 200 W average). The product from these plasma reactors is a hydrogen rich mixture that can be used for combustion enhancement and emissions aftertreatment in vehicular applications. By converting a small fraction of the fuel to hydrogen rich gas, in-cylinder combustion can be improved. With minor modification of the engine, use of hydrogen rich gas results in increased fuel efficiency and decreased emissions of smog producing gases. The status of plasma based reformer technology and its application to vehicles will be described.
Effect of gamma irradiation on microbial quality of minimally processed carrot and lettuce: A case study in Greater Accra region of Ghana

Science.gov (United States)

Frimpong, G. K.; Kottoh, I. D.; Ofosu, D. O.; Larbi, D.

2015-05-01

The effect of ionizing radiation on the microbiological quality on minimally processed carrot and lettuce was studied. The aim was to investigate the effect of irradiation as a sanitizing agent on the bacteriological quality of some raw eaten salad vegetables obtained from retailers in Accra, Ghana. Minimally processed carrot and lettuce were analysed for total viable count, total coliform count and pathogenic organisms. The samples collected were treated and analysed for a 15 day period. The total viable count for carrot ranged from 1.49 to 14.01 log10 cfu/10 g while that of lettuce was 0.70 to 8.5 7 log10 cfu/10 g. It was also observed that total coliform count for carrot was 1.46-7.53 log10 cfu/10 g and 0.14-7.35 log10 cfu/10 g for lettuce. The predominant pathogenic organisms identified were Bacillus cereus, Cronobacter sakazakii, Staphylococcus aureus, and Klebsiella spp. It was concluded that 2 kGy was most effective for medium dose treatment of minimally processed carrot and lettuce.
Exposure and risk calculations for disposal of wastes having minimal radioactivity

International Nuclear Information System (INIS)

Fields, D.E.

1984-01-01

The US Nuclear Regulatory Commission is currently considering revision of rules 10 CFR 20 and 10 CFR 61, which cover disposal of solid wastes containing minimal activity radioactivity. In support of these revised rules, we have evaluated the consequences of disposing of four waste streams at four types of disposal areas located in three different geographic regions. Consequences are expressed in terms of human exposures and associated health effects. Each geographic region has its own climate and geology. Example waste streams, waste disposal methods, and geographic regions chosen for this study are clearly specified. The PRESTO-II methodology was used to evaluate radionuclide transport and health effects. This methodology was developed to assess radiological impacts to a static local population for a 1000-year period following disposal. The modeling of pathways and processes of migration from the trench to exposed populations included the following considerations: groundwater transport, overland flow, erosion, surface water dilution, resuspension, atmospheric transport, deposition, inhalation, and ingestion of contaminated beef, milk, crops, and water. 9 references, 2 figures, 3 tables

A combinatorial approach to synthetic transcription factor-promoter combinations for yeast strain engineering

DEFF Research Database (Denmark)

Dossani, Zain Y.; Apel, Amanda Reider; Szmidt-Middleton, Heather

2018-01-01

regions, we have built a library of hybrid promoters that are regulated by a synthetic transcription factor. The hybrid promoters consist of native S. cerevisiae promoters, in which the operator regions have been replaced with sequences that are recognized by the bacterial LexA DNA binding protein....... Correspondingly, the synthetic transcription factor (TF) consists of the DNA binding domain of the LexA protein, fused with the human estrogen binding domain and the viral activator domain, VP16. The resulting system with a bacterial DNA binding domain avoids the transcription of native S. cerevisiae genes...... levels, using the same synthetic TF and a given estradiol. This set of promoters, in combination with our synthetic TF, has the potential to regulate numerous genes or pathways simultaneously, to multiple desired levels, in a single strain....
Hazardous waste minimization

International Nuclear Information System (INIS)

Freeman, H.

1990-01-01

This book presents an overview of waste minimization. Covers applications of technology to waste reduction, techniques for implementing programs, incorporation of programs into R and D, strategies for private industry and the public sector, and case studies of programs already in effect
Minimal constrained supergravity

Energy Technology Data Exchange (ETDEWEB)

Cribiori, N. [Dipartimento di Fisica e Astronomia “Galileo Galilei”, Università di Padova, Via Marzolo 8, 35131 Padova (Italy); INFN, Sezione di Padova, Via Marzolo 8, 35131 Padova (Italy); Dall' Agata, G., E-mail: dallagat@pd.infn.it [Dipartimento di Fisica e Astronomia “Galileo Galilei”, Università di Padova, Via Marzolo 8, 35131 Padova (Italy); INFN, Sezione di Padova, Via Marzolo 8, 35131 Padova (Italy); Farakos, F. [Dipartimento di Fisica e Astronomia “Galileo Galilei”, Università di Padova, Via Marzolo 8, 35131 Padova (Italy); INFN, Sezione di Padova, Via Marzolo 8, 35131 Padova (Italy); Porrati, M. [Center for Cosmology and Particle Physics, Department of Physics, New York University, 4 Washington Place, New York, NY 10003 (United States)

2017-01-10

We describe minimal supergravity models where supersymmetry is non-linearly realized via constrained superfields. We show that the resulting actions differ from the so called “de Sitter” supergravities because we consider constraints eliminating directly the auxiliary fields of the gravity multiplet.
Minimal constrained supergravity

International Nuclear Information System (INIS)

Cribiori, N.; Dall'Agata, G.; Farakos, F.; Porrati, M.

2017-01-01

We describe minimal supergravity models where supersymmetry is non-linearly realized via constrained superfields. We show that the resulting actions differ from the so called “de Sitter” supergravities because we consider constraints eliminating directly the auxiliary fields of the gravity multiplet.
Sequencing of DC-SIGN promoter indicates an association between promoter variation and risk of nasopharyngeal carcinoma in cantonese

Directory of Open Access Journals (Sweden)

Liu Wen-Sheng

2010-11-01

Full Text Available Abstract Background The dendritic cell-specific intercellular adhesion molecule 3 grabbing non-integrin (DC-SIGN is an important pathogen recognition receptor of the innate immune system. DC-SIGN promoter variants play important role in the susceptibility to various infectious diseases. Nasopharyngeal carcinoma (NPC is a malignancy that is common in southern China and whether DC-SIGN promoter variants have effects on susceptibility to NPC is still unknown. The aim of this study is to ascertain the potential involvement of DC-SIGN promoter single nucleotide polymorphisms (SNPs in NPC susceptibility. Methods We conducted a case control study based on Cantonese population including 444 NPC patients and 464 controls matched on age and sex. The 1041 bp of DC-SIGN promoter region was directly sequenced for all samples. Sequence alignment and SNP search were inspected using DNAStar analysis programs and haplotype frequencies were estimated in Haploview V 4.0. The associations between the SNPs and the risk of NPC were analyzed using chi-square test and non-conditional logistic regression analysis with SPSS 13.0 software. Results A total of six variants were observed in the DC-SIGN promoter region and DC-SIGN -139 GG and -939 AA were significantly associated with NPC risk with adjusted Odds Ratios (ORs of 2.10 (95% confidence interval [CI] = 1.23-3.59; P = 0.006 and 2.52 (1.29-4.93; P = 0.007 respectively and subjects carrying the risk allele DC-SIGN -871 G had 1.47-fold (95% CI = 1.14-1.90 increased risks of developing NPC (P = 0.003. Haplotype analysis revealed that h1 'AAAG' was significantly associated with protection against NPC (OR = 0.69; P = 0.0002 and the association was still significant when using 1000 permutation test runs (P = 0.001. Conclusions Our study indicated that DC-SIGN promoter variants appear to be involved in the susceptibility to NPC and the detailed mechanism of this effect need further studies.
Osteoponin Promoter Controlled by DNA Methylation: Aberrant Methylation in Cloned Porcine Genome

Directory of Open Access Journals (Sweden)

Chih-Jie Shen

2014-01-01

Full Text Available Cloned animals usually exhibited many defects in physical characteristics or aberrant epigenetic reprogramming, especially in some important organ development. Osteoponin (OPN is an extracellular-matrix protein involved in heart and bone development and diseases. In this study, we investigated the correlation between OPN mRNA and its promoter methylation changes by the 5-aza-dc treatment in fibroblast cell and promoter assay. Aberrant methylation of porcine OPN was frequently found in different tissues of somatic nuclear transferred cloning pigs, and bisulfite sequence data suggested that the OPN promoter region −2615 to −2239 nucleotides (nt may be a crucial regulation DNA element. In pig ear fibroblast cell culture study, the demethylation of OPN promoter was found in dose-dependent response of 5-aza-dc treatment and followed the OPN mRNA reexpression. In cloned pig study, discrepant expression pattern was identified in several cloned pig tissues, especially in brain, heart, and ear. Promoter assay data revealed that four methylated CpG sites presenting in the −2615 to −2239 nt region cause significant downregulation of OPN promoter activity. These data suggested that methylation in the OPN promoter plays a crucial role in the regulation of OPN expression that we found in cloned pigs genome.
A Novel Approach to Minimally Invasive Management of Sigmoid Volvulus

Directory of Open Access Journals (Sweden)

Alireza Tavassoli

2016-11-01

Full Text Available Resection is the most common treatment choice for sigmoid volvulus, a common complication in our region. A new minimally invasive technique for sigmoid resection with local anesthesia was done in this study. This method is invented to avoid general on regional anesthesia in high-risk patients. Nineteen patients were evaluated and then 14 were enrolled in this study. Sigmoidectomy with a left lower quadrant incision was performed and demographic data, the length of hospital stay, complications and procedure time were recorded. The mean age of participants was 65.68, and the male to female ratio was 1:2.7. The mean duration of the operation was 91.42 min. Complications include one case each of wound hematoma and wound infection. The intraoperative pain score was 1.2/10 and postoperative pain score was 2.35/10. The mean hospital staying was 8.3 days. By meticulous patient selection, sigmoidectomy under local anesthesia for sigmoid volvulus could be a surgeons’ armamentarium in special situations.
The minimal melanogenesis dose/minimal erythema dose ratio declines with increasing skin pigmentation using solar simulator and narrowband ultraviolet B exposure

DEFF Research Database (Denmark)

Ravnbak, Mette H; Philipsen, Peter A; Wulf, Hans Christian

2010-01-01

To investigate the relation between pre-exposure skin pigmentation and the minimal melanogenesis dose (MMD)/minimal erythema dose (MED) ratio after a single narrowband ultraviolet B (nUVB) and solar simulator (Solar) exposure.......To investigate the relation between pre-exposure skin pigmentation and the minimal melanogenesis dose (MMD)/minimal erythema dose (MED) ratio after a single narrowband ultraviolet B (nUVB) and solar simulator (Solar) exposure....
RNA polymerase II interacts with the promoter region of the noninduced hsp70 gene in Drosophila melanogaster cells

International Nuclear Information System (INIS)

Gilmour, D.S.; Lis, J.T.

1986-01-01

By using a protein-DNA cross-linking method, we examined the in vivo distribution of RNA polymerase II on the hsp70 heat shock gene in Drosophila melanogaster Schneider line 2 cells. In heat shock-induced cells, a high level of RNA polymerase II was detected on the entire gene, while in noninduced cells, the RNA polymerase II was confined to the 5' end of the hsp70 gene, predominantly between nucleotides -12 and +65 relative to the start of transcription. This association of RNA polymerase II was apparent whether the cross-linking was performed by a 10-min UV irradiation of chilled cells with mercury vapor lamps or by a 40-microsecond irradiation of cells with a high-energy xenon flash lamp. We hypothesize that RNA polymerase II has access to, and a high affinity for, the promoter region of this gene before induction, and this poised RNA polymerase II may be critical in the mechanism of transcription activation
Qualifying and quantifying minimal hepatic encephalopathy

DEFF Research Database (Denmark)

Morgan, Marsha Y; Amodio, Piero; Cook, Nicola A

2016-01-01

Minimal hepatic encephalopathy is the term applied to the neuropsychiatric status of patients with cirrhosis who are unimpaired on clinical examination but show alterations in neuropsychological tests exploring psychomotor speed/executive function and/or in neurophysiological variables. There is ......Minimal hepatic encephalopathy is the term applied to the neuropsychiatric status of patients with cirrhosis who are unimpaired on clinical examination but show alterations in neuropsychological tests exploring psychomotor speed/executive function and/or in neurophysiological variables...... analytical techniques may provide better diagnostic information while the advent of portable wireless headsets may facilitate more widespread use. A large number of other diagnostic tools have been validated for the diagnosis of minimal hepatic encephalopathy including Critical Flicker Frequency......, the Inhibitory Control Test, the Stroop test, the Scan package and the Continuous Reaction Time; each has its pros and cons; strengths and weaknesses; protagonists and detractors. Recent AASLD/EASL Practice Guidelines suggest that the diagnosis of minimal hepatic encephalopathy should be based on the PHES test...
A Specific Mutation in the Promoter Region of the Silent cel Cluster Accounts for the Appearance of Lactose-Utilizing Lactococcus lactis MG1363

Science.gov (United States)

Solopova, Ana; Bachmann, Herwig; Teusink, Bas; Kok, Jan; Neves, Ana Rute

2012-01-01

The Lactococcus lactis laboratory strain MG1363 has been described to be unable to utilize lactose. However, in a rich medium supplemented with lactose as the sole carbon source, it starts to grow after prolonged incubation periods. Transcriptome analyses showed that L. lactis MG1363 Lac+ cells expressed celB, encoding a putative cellobiose-specific phosphotransferase system (PTS) IIC component, which is normally silent in MG1363 Lac− cells. Nucleotide sequence analysis of the cel cluster of a Lac+ isolate revealed a change from one of the guanines to adenine in the promoter region. We showed here that one particular mutation, taking place at increased frequency, accounts for the lactose-utilizing phenotype occurring in MG1363 cultures. The G-to-A transition creates a −10 element at an optimal distance from the −35 element. Thus, a fully active promoter is created, allowing transcription of the otherwise cryptic cluster. Nuclear magnetic resonance (NMR) spectroscopy results show that MG1363 Lac+ uses a novel pathway of lactose utilization. PMID:22660716
Euclidean wormholes with minimally coupled scalar fields

International Nuclear Information System (INIS)

Ruz, Soumendranath; Modak, Bijan; Debnath, Subhra; Sanyal, Abhik Kumar

2013-01-01

A detailed study of quantum and semiclassical Euclidean wormholes for Einstein's theory with a minimally coupled scalar field has been performed for a class of potentials. Massless, constant, massive (quadratic in the scalar field) and inverse (linear) potentials admit the Hawking and Page wormhole boundary condition both in the classically forbidden and allowed regions. An inverse quartic potential has been found to exhibit a semiclassical wormhole configuration. Classical wormholes under a suitable back-reaction leading to a finite radius of the throat, where the strong energy condition is satisfied, have been found for the zero, constant, quadratic and exponential potentials. Treating such classical Euclidean wormholes as an initial condition, a late stage of cosmological evolution has been found to remain unaltered from standard Friedmann cosmology, except for the constant potential which under the back-reaction produces a term like a negative cosmological constant. (paper)
A REGIONAL PERSPECTIVE OF THE CREATIVE ECONOMY IN BRAZIL

Directory of Open Access Journals (Sweden)

Jorge Nogueira de Paiva Britto

Full Text Available Abstract In a knowledge-based economy, initiatives based on the Creative Economy framework are supposed to promote regional economic diversification in developing countries. In Brazil, policy initiatives have focused on those activities with a view to design public policies oriented to reducing socio-economic and regional inequalities, as well as spreading those activities throughout the territory, especially towards less favored regions. Based on the Brazilian experience, this article discusses whether the pre-existing regional distribution of various types of creative activities favors or hinders the reduction of regional inequalities as a result of a policy focused on promoting creative activities and what actions could be adopted to achieve this result. Specifically, the paper discusses whether this expansion can promote an effective reduction of regional inequalities in terms of the number and quality of jobs and wage levels associated with those activities. The analysis suggests that the regional decentralization of creative activities towards less developed regions has been relatively limited in Brazil, as the more developed regions have remained more specialized in trades with higher digital and technological content, while the less developed regions have remained relatively more specialized in activities related to the cultural heritage. To reduce this imbalance, the support of local institutions and S&T infrastructure related to creative activities appears to be very important, which points out to the relevance of comprehensive policies well-adapted to very diverse local realities. This effort should have the impact of new digital-based technologies converge with the strengthening of economic potential of local and regional cultural heritage, by enhancing professional qualification of workers devoted to those activities.
QCD-resummation and non-minimal flavour-violation for supersymmetric particle production at hadron colliders

International Nuclear Information System (INIS)

Fuks, B.

2007-06-01

Cross sections for supersymmetric particles production at hadron colliders have been extensively studied in the past at leading order and also at next-to-leading order of perturbative QCD. The radiative corrections include large logarithms which have to be re-summed to all orders in the strong coupling constant in order to get reliable perturbative results. In this work, we perform a first and extensive study of the resummation effects for supersymmetric particle pair production at hadron colliders. We focus on Drell-Yan like slepton-pair and slepton-sneutrino associated production in minimal supergravity and gauge-mediated supersymmetry-breaking scenarios, and present accurate transverse-momentum and invariant-mass distributions, as well as total cross sections. In non-minimal supersymmetric models, novel effects of flavour violation may occur. In this case, the flavour structure in the squark sector cannot be directly deduced from the trilinear Yukawa couplings of the fermion and Higgs supermultiplets. We perform a precise numerical analysis of the experimentally allowed parameter space in the case of minimal supergravity scenarios with non-minimal flavour violation, looking for regions allowed by low-energy, electroweak precision, and cosmological data. Leading order cross sections for the production of squarks and gauginos at hadron colliders are implemented in a flexible computer program, allowing us to study in detail the dependence of these cross sections on flavour violation. (author)
Quantitative EEG analysis in minimally conscious state patients during postural changes.

Science.gov (United States)

Greco, A; Carboncini, M C; Virgillito, A; Lanata, A; Valenza, G; Scilingo, E P

2013-01-01

Mobilization and postural changes of patients with cognitive impairment are standard clinical practices useful for both psychic and physical rehabilitation process. During this process, several physiological signals, such as Electroen-cephalogram (EEG), Electrocardiogram (ECG), Photopletysmography (PPG), Respiration activity (RESP), Electrodermal activity (EDA), are monitored and processed. In this paper we investigated how quantitative EEG (qEEG) changes with postural modifications in minimally conscious state patients. This study is quite novel and no similar experimental data can be found in the current literature, therefore, although results are very encouraging, a quantitative analysis of the cortical area activated in such postural changes still needs to be deeply investigated. More specifically, this paper shows EEG power spectra and brain symmetry index modifications during a verticalization procedure, from 0 to 60 degrees, of three patients in Minimally Consciousness State (MCS) with focused region of impairment. Experimental results show a significant increase of the power in β band (12 - 30 Hz), commonly associated to human alertness process, thus suggesting that mobilization and postural changes can have beneficial effects in MCS patients.
The epidemiology of drug promotion.

Science.gov (United States)

Silverman, M

1977-01-01

A survey was conducted on the promotion of 28 prescription drugs in the form of 40 different products marketed in the United States and Latin America by 23 multinational pharmaceutical companies. Striking differences were found in the manner in which the identical drug, marketed by the identical company or its foreign affiliate, was described to physicians in the United States and to physicians in Latin America. In the United States, the listed indications were usually few in number, while the contraindications, warnings, and potential adverse reactions were given in extensive detail. In Latin America, the listed indications were far more numerous, while the hazards were usually minimized, glossed over, or totally ignored. The differences were not simply between the United States on the one hand and all the Latin American countries on the other. There were substantial differences within Latin America, with the same global company telling one story in Mexico, another in Central America, a third in Ecuador and Colombia, and yet another in Brazil. The companies have sought to defend these practices by contending that they are not breaking any Latin American laws. In some countries, however, such promotion is in clear violation of the law. The corporate ethics and social responsibilities concerned here call for examination and action.
Matthew Arnold and Minimal Competency Testing.

Science.gov (United States)

Tuman, Myron C.

1979-01-01

Presents arguments by Robert Lowe and Matthew Arnold on the 19th century British "Payment by Results" Plan, whereby schools received funds for students who passed minimal competency tests. Emphasizes that the Victorian experience produced acrimonious teachers with low morale and encourages contemporary minimal testing advocates not to…
Minimal constrained supergravity

Directory of Open Access Journals (Sweden)

N. Cribiori

2017-01-01

Full Text Available We describe minimal supergravity models where supersymmetry is non-linearly realized via constrained superfields. We show that the resulting actions differ from the so called “de Sitter” supergravities because we consider constraints eliminating directly the auxiliary fields of the gravity multiplet.
Corporate tax minimization and stock price reactions

OpenAIRE

Blaufus, Kay; Möhlmann, Axel; Schwäbe, Alexander

2016-01-01

Tax minimization strategies may lead to significant tax savings, which could, in turn, increase firm value. However, such strategies are also associated with significant costs, such as expected penalties and planning, agency, and reputation costs. The overall impact of firms' tax minimization strategies on firm value is, therefore, unclear. To investigate whether corporate tax minimization increases firm value, we analyze the stock price reaction to news concerning corporate tax avoidance or ...
In silico Analysis of osr40c1 Promoter Sequence Isolated from Indica Variety Pokkali

Directory of Open Access Journals (Sweden)

W.S.I. de Silva

2017-07-01

Full Text Available The promoter region of a drought and abscisic acid (ABA inducible gene, osr40c1, was isolated from a salt-tolerant indica rice variety Pokkali, which is 670 bp upstream of the putative translation start codon. In silico promoter analysis of resulted sequence showed that at least 15 types of putative motifs were distributed within the sequence, including two types of common promoter elements, TATA and CAAT boxes. Additionally, several putative cis-acing regulatory elements which may be involved in regulation of osr40c1 expression under different conditions were found in the 5′-upstream region of osr40c1. These are ABA-responsive element, light-responsive elements (ATCT-motif, Box I, G-box, GT1-motif, Gap-box and Sp1, myeloblastosis oncogene response element (CCAAT-box, auxin responsive element (TGA-element, gibberellin-responsive element (GARE-motif and fungal-elicitor responsive elements (Box E and Box-W1. A putative regulatory element, required for endosperm-specific pattern of gene expression designated as Skn-1 motif, was also detected in the Pokkali osr40c1 promoter region. In conclusion, the bioinformatic analysis of osr40c1 promoter region isolated from indica rice variety Pokkali led to the identification of several important stress-responsive cis-acting regulatory elements, and therefore, the isolated promoter sequence could be employed in rice genetic transformation to mediate expression of abiotic stress induced genes.

The effect of mutations in the AmpC promoter region on β-lactam ...

African Journals Online (AJOL)

STORAGESEVER

2008-08-04

Aug 4, 2008 ... between the -10 and -35 boxes affects the resistance of bacteria to β-lactam antibiotics. .... The chromosomal cephalosporinase gene, ampC, of E. .... mutation in the ampC promoter increasing resistance to β-lactams in.
Annual Waste Minimization Summary Report

International Nuclear Information System (INIS)

Haworth, D.M.

2011-01-01

This report summarizes the waste minimization efforts undertaken by National Security TechnoIogies, LLC, for the U. S. Department of Energy, National Nuclear Security Administration Nevada Site Office (NNSA/NSO), during calendar year 2010. The NNSA/NSO Pollution Prevention Program establishes a process to reduce the volume and toxicity of waste generated by NNSA/NSO activities and ensures that proposed methods of treatment, storage, and/or disposal of waste minimize potential threats to human health and the environment.
Finding Combination of Features from Promoter Regions for Ovarian Cancer-related Gene Group Classification

KAUST Repository

Olayan, Rawan S.

2012-01-01

In classification problems, it is always important to use the suitable combination of features that will be employed by classifiers. Generating the right combination of features usually results in good classifiers. In the situation when the problem is not well understood, data items are usually described by many features in the hope that some of these may be the relevant or most relevant ones. In this study, we focus on one such problem related to genes implicated in ovarian cancer (OC). We try to recognize two important OC-related gene groups: oncogenes, which support the development and progression of OC, and oncosuppressors, which oppose such tendencies. For this, we use the properties of promoters of these genes. We identified potential “regulatory features” that characterize OC-related oncogenes and oncosuppressors promoters. In our study, we used 211 oncogenes and 39 oncosuppressors. For these, we identified 538 characteristic sequence motifs from their promoters. Promoters are annotated by these motifs and derived feature vectors used to develop classification models. We made a comparison of a number of classification models in their ability to distinguish oncogenes from oncosuppressors. Based on 10-fold cross-validation, the resultant model was able to separate the two classes with sensitivity of 96% and specificity of 100% with the complete set of features. Moreover, we developed another recognition model where we attempted to distinguish oncogenes and oncosuppressors as one group from other OC-related genes. That model achieved accuracy of 82%. We believe that the results of this study will help in discovering other OC-related oncogenes and oncosuppressors not identified as yet.
Finding Combination of Features from Promoter Regions for Ovarian Cancer-related Gene Group Classification

KAUST Repository

Olayan, Rawan S.

2012-12-01

In classification problems, it is always important to use the suitable combination of features that will be employed by classifiers. Generating the right combination of features usually results in good classifiers. In the situation when the problem is not well understood, data items are usually described by many features in the hope that some of these may be the relevant or most relevant ones. In this study, we focus on one such problem related to genes implicated in ovarian cancer (OC). We try to recognize two important OC-related gene groups: oncogenes, which support the development and progression of OC, and oncosuppressors, which oppose such tendencies. For this, we use the properties of promoters of these genes. We identified potential “regulatory features” that characterize OC-related oncogenes and oncosuppressors promoters. In our study, we used 211 oncogenes and 39 oncosuppressors. For these, we identified 538 characteristic sequence motifs from their promoters. Promoters are annotated by these motifs and derived feature vectors used to develop classification models. We made a comparison of a number of classification models in their ability to distinguish oncogenes from oncosuppressors. Based on 10-fold cross-validation, the resultant model was able to separate the two classes with sensitivity of 96% and specificity of 100% with the complete set of features. Moreover, we developed another recognition model where we attempted to distinguish oncogenes and oncosuppressors as one group from other OC-related genes. That model achieved accuracy of 82%. We believe that the results of this study will help in discovering other OC-related oncogenes and oncosuppressors not identified as yet.
Minimal free resolutions over complete intersections

CERN Document Server

Eisenbud, David

2016-01-01

This book introduces a theory of higher matrix factorizations for regular sequences and uses it to describe the minimal free resolutions of high syzygy modules over complete intersections. Such resolutions have attracted attention ever since the elegant construction of the minimal free resolution of the residue field by Tate in 1957. The theory extends the theory of matrix factorizations of a non-zero divisor, initiated by Eisenbud in 1980, which yields a description of the eventual structure of minimal free resolutions over a hypersurface ring. Matrix factorizations have had many other uses in a wide range of mathematical fields, from singularity theory to mathematical physics.
Minimal-change nephropathy and malignant thymoma.

Science.gov (United States)

Varsano, S; Bruderman, I; Bernheim, J L; Rathaus, M; Griffel, B

1980-05-01

A 56-year-old man had fever, precordial pain, and a mediastinal mass. The mass disappeared two months later and the patient remained asymptomatic for 2 1/2 years. At that time a full-blown nephrotic syndrome developed, with minimal-change glomerulopathy. The chest x-ray film showed the reappearance of a giant mediastinal mass. On biopsy of the mass, malignant thymoma was diagnosed. Association between minimal-change disease and Hodgkin's disease is well known, while the association with malignant thymoma has not been previously reported. The relationship between malignant thymoma and minimal-change disease is discussed, and a possible pathogenic mechanism involving cell-mediated immunity is proposed.
Patterns of DNMT1 Promoter Methylation in Patients with Acute Lymphoblastic Leukemia.

Science.gov (United States)

Rahmani, Tirdad; Azad, Mehdi; Chahardouli, Bahram; Nasiri, Hajar; Vatanmakanian, Mousa; Kaviani, Saeid

2017-07-01

Background: Acute lymphoblastic leukemia (ALL) is a clonal malignant disorder characterized by an uncontrolled proliferation of immature T or B lymphocytes. Extensive studies have shown that the epigenetic changes, especially modified DNA methylation patterns in the regulatory regions through the DNA methyltransferase (DNMTs), play an important role in the development of genetic disorders and abnormal growth and maturation capacity of leukemic stem cells (LSCs).The aim of this study was to evaluate the changes in DNMT1 promoter methylation and its expression pattern in patients with ALL. Materials and Methods: In this experimental study, methylation specific PCR (MSP) was used to assess the methylation status of DNMT1 promoter regions in samples collected from ALL patients (n=45) and healthy control subjects. According to this method, un-methylated cytosine nucleotides are converted to uracil by sodium bisulfite and the proliferation of methylated and un-methylated regions are performed using specific primers for target sequences. Results: None of the patients with B and T-ALL showed methylated promoter regions of the DNMT1 gene, while the methylation pattern of both pre-B ALL patients and the control group showed a relative promoter methylation. Conclusion: Analysis of promoter methylation patterns in various subgroups of ALL has revealed the importance of DNMT1 in the regulation of gene expression. Likewise, extensive data have also highlighted the methylation-based mechanisms exerted by DNAM1 as one of the main participants regulating gene expression in B-ALL and T-ALL patients. Investigation of the overall DNA methylation pattern offers significant improvements in the prediction of disease prognosis and treatment response.
Analysis of Microbe-Associated Molecular Pattern-Responsive Synthetic Promoters with the Parsley Protoplast System.

Science.gov (United States)

Kanofsky, Konstantin; Lehmeyer, Mona; Schulze, Jutta; Hehl, Reinhard

2016-01-01

Plants recognize pathogens by microbe-associated molecular patterns (MAMPs) and subsequently induce an immune response. The regulation of gene expression during the immune response depends largely on cis-sequences conserved in promoters of MAMP-responsive genes. These cis-sequences can be analyzed by constructing synthetic promoters linked to a reporter gene and by testing these constructs in transient expression systems. Here, the use of the parsley (Petroselinum crispum) protoplast system for analyzing MAMP-responsive synthetic promoters is described. The synthetic promoter consists of four copies of a potential MAMP-responsive cis-sequence cloned upstream of a minimal promoter and the uidA reporter gene. The reporter plasmid contains a second reporter gene, which is constitutively expressed and hence eliminates the requirement of a second plasmid used as a transformation control. The reporter plasmid is transformed into parsley protoplasts that are elicited by the MAMP Pep25. The MAMP responsiveness is validated by comparing the reporter gene activity from MAMP-treated and untreated cells and by normalizing reporter gene activity using the constitutively expressed reporter gene.
Common elements of adolescent prevention programs: minimizing burden while maximizing reach.

Science.gov (United States)

Boustani, Maya M; Frazier, Stacy L; Becker, Kimberly D; Bechor, Michele; Dinizulu, Sonya M; Hedemann, Erin R; Ogle, Robert R; Pasalich, Dave S

2015-03-01

A growing number of evidence-based youth prevention programs are available, but challenges related to dissemination and implementation limit their reach and impact. The current review identifies common elements across evidence-based prevention programs focused on the promotion of health-related outcomes in adolescents. We reviewed and coded descriptions of the programs for common practice and instructional elements. Problem-solving emerged as the most common practice element, followed by communication skills, and insight building. Psychoeducation, modeling, and role play emerged as the most common instructional elements. In light of significant comorbidity in poor outcomes for youth, and corresponding overlap in their underlying skills deficits, we propose that synthesizing the prevention literature using a common elements approach has the potential to yield novel information and inform prevention programming to minimize burden and maximize reach and impact for youth.
Identiifcation and validation of root-speciifc promoters in rice

Institute of Scientific and Technical Information of China (English)

HUANG Li-yu; ZHANG Fan; QIN Qiao; WANG Wen-sheng; ZHANG Ting; FU Bin-ying

2015-01-01

Novel promoters that confer root-speciifc expression would be useful for engineering resistance against problems of nutrient and water absorption by roots. In this study, the reverse transcriptase polymerase chain reaction was used to identify seven genes with root-speciifc expression in rice. The isolation and characterization of upstream promoter regions of ifve selected genes rice root-speciifc promoter (rRSP) 1 to 5 (rRSP1-rRSP5) and A2P (the promoter ofOsAct2) revealed that rRSP1, rRSP3, and rRSP5 are particularly important with respect to root-speciifc activities. Furthermore, rRSP1, rRSP3, and rRSP5 were observed to make different contributions to root activities in various species. These three promoters could be used for root-speciifc enhancement of target gene(s).
Promoting effect of ethanol on dewetting transition in the confined region of melittin tetramer

International Nuclear Information System (INIS)

Ren Xiuping; Zhou Bo; Wang Chunlei

2012-01-01

To study the influence of ethanol molecules on the melittin tetramer folding, we investigated the dewetting transition of the melittin tetramer immersed in pure water and 8% aqueous ethanol solution (mass fraction) by the molecular dynamics simulations. We found that the marked dewetting transitions occurred inside a nanoscale channel of the melittin tetramer both in pure water and in aqueous ethanol solution. Also, ethanol molecules promoted this dewetting transition. We attributed this promoting effect to ethanol molecules which prefer to locate at the liquid-vapor interface and decrease the liquid-vapor surface energy. The results provide insight into the effect of ethanol on the water dewetting phenomena. (authors)
Increased fire frequency promotes stronger spatial genetic structure and natural selection at regional and local scales in Pinus halepensis Mill.

Science.gov (United States)

Budde, Katharina B; González-Martínez, Santiago C; Navascués, Miguel; Burgarella, Concetta; Mosca, Elena; Lorenzo, Zaida; Zabal-Aguirre, Mario; Vendramin, Giovanni G; Verdú, Miguel; Pausas, Juli G; Heuertz, Myriam

2017-04-01

The recurrence of wildfires is predicted to increase due to global climate change, resulting in severe impacts on biodiversity and ecosystem functioning. Recurrent fires can drive plant adaptation and reduce genetic diversity; however, the underlying population genetic processes have not been studied in detail. In this study, the neutral and adaptive evolutionary effects of contrasting fire regimes were examined in the keystone tree species Pinus halepensis Mill. (Aleppo pine), a fire-adapted conifer. The genetic diversity, demographic history and spatial genetic structure were assessed at local (within-population) and regional scales for populations exposed to different crown fire frequencies. Eight natural P. halepensis stands were sampled in the east of the Iberian Peninsula, five of them in a region exposed to frequent crown fires (HiFi) and three of them in an adjacent region with a low frequency of crown fires (LoFi). Samples were genotyped at nine neutral simple sequence repeats (SSRs) and at 251 single nucleotide polymorphisms (SNPs) from coding regions, some of them potentially important for fire adaptation. Fire regime had no effects on genetic diversity or demographic history. Three high-differentiation outlier SNPs were identified between HiFi and LoFi stands, suggesting fire-related selection at the regional scale. At the local scale, fine-scale spatial genetic structure (SGS) was overall weak as expected for a wind-pollinated and wind-dispersed tree species. HiFi stands displayed a stronger SGS than LoFi stands at SNPs, which probably reflected the simultaneous post-fire recruitment of co-dispersed related seeds. SNPs with exceptionally strong SGS, a proxy for microenvironmental selection, were only reliably identified under the HiFi regime. An increasing fire frequency as predicted due to global change can promote increased SGS with stronger family structures and alter natural selection in P. halepensis and in plants with similar life history traits
Minimally invasive spine surgery: Hurdles to be crossed

Directory of Open Access Journals (Sweden)

Mahesh Bijjawara

2014-01-01

Full Text Available MISS as a concept is noble and all surgeons need to address and minimize the surgical morbidity for better results. However, we need to be cautions and not fall prey into accepting that minimally invasive spine surgery can be done only when certain metal access systems are used. Minimally invasive spine surgery (MISS has come a long way since the description of endoscopic discectomy in 1997 and minimally invasive TLIF (mTLIF in 2003. Today there is credible evidence (though not level-I that MISS has comparable results to open spine surgery with the advantage of early postoperative recovery and decreased blood loss and infection rates. However, apart from decreasing the muscle trauma and decreasing the muscle dissection during multilevel open spinal instrumentation, there has been little contribution to address the other morbidity parameters like operative time , blood loss , access to decompression and atraumatic neural tissue handling with the existing MISS technologies. Since all these parameters contribute to a greater degree than posterior muscle trauma for the overall surgical morbidity, we as surgeons need to introspect before we accept the concept of minimally invasive spine surgery being reduced to surgeries performed with a few tubular retractors. A spine surgeon needs to constantly improve his skills and techniques so that he can minimize blood loss, minimize traumatic neural tissue handling and minimizing operative time without compromising on the surgical goals. These measures actually contribute far more, to decrease the morbidity than approach related muscle damage alone. Minimally invasine spine surgery , though has come a long way, needs to provide technical solutions to minimize all the morbidity parameters involved in spine surgery, before it can replace most of the open spine surgeries, as in the case of laparoscopic surgery or arthroscopic surgery.
Minimal knotted polygons in cubic lattices

International Nuclear Information System (INIS)

Van Rensburg, E J Janse; Rechnitzer, A

2011-01-01

In this paper we examine numerically the properties of minimal length knotted lattice polygons in the simple cubic, face-centered cubic, and body-centered cubic lattices by sieving minimal length polygons from a data stream of a Monte Carlo algorithm, implemented as described in Aragão de Carvalho and Caracciolo (1983 Phys. Rev. B 27 1635), Aragão de Carvalho et al (1983 Nucl. Phys. B 215 209) and Berg and Foester (1981 Phys. Lett. B 106 323). The entropy, mean writhe, and mean curvature of minimal length polygons are computed (in some cases exactly). While the minimal length and mean curvature are found to be lattice dependent, the mean writhe is found to be only weakly dependent on the lattice type. Comparison of our results to numerical results for the writhe obtained elsewhere (see Janse van Rensburg et al 1999 Contributed to Ideal Knots (Series on Knots and Everything vol 19) ed Stasiak, Katritch and Kauffman (Singapore: World Scientific), Portillo et al 2011 J. Phys. A: Math. Theor. 44 275004) shows that the mean writhe is also insensitive to the length of a knotted polygon. Thus, while these results for the mean writhe and mean absolute writhe at minimal length are not universal, our results demonstrate that these values are quite close the those of long polygons regardless of the underlying lattice and length
Health promotion and schools: how to move forward

Directory of Open Access Journals (Sweden)

Daniela Gardano Bucharles Mont’Alverne

2013-09-01

Full Text Available The health promotion action means, described by the 1986 Ottawa Charter, highlights the creation of supportive environments for health(1. Following this line of reasoning, several strategies have been adopted for implementing health promotion policies, including the Health Promoting School. In 1995, the Pan American Health Organization / Regional Office for the Americas of the World Health Organization (PAHO/WHO officially launched the Regional Health Promoting School Initiative. Since then, all the countries in Latin America and the Caribbean have strengthened school health promotion actions, rethinking school health activities(2. To become a Health Promoting School, the institution must take a comprehensive view of human beings – especially children and adolescents – in their familiar, community and social environment. It must provide a healthy environment, building constructive and harmonious relationships and hence being able to awaken skills and attitudes within participants, fostering autonomy, creativity and participation of students and also the whole school community(3. Never before has so much been said about health and health promotion as today, i.e., there is a need for promoting health at school as an element for changing reality. The school plays an important political role within this context for being a place where ideology can be constructed, destroyed or perpetuated through the transmission of values and beliefs, besides being an environment that favors the development of health education actions. Childhood is the defining moment for the construction and solidification of habits and attitudes, hence the importance of school as an environment that enhances the development of a targeted, systematized and permanent work. “Through the Health Promoting School Initiative, school health has a chance to move forward and expand its conception and practices with a comprehensive and interdisciplinary view of the human being within a
Health promotion and schools: how to move forward

Directory of Open Access Journals (Sweden)

Daniela Gardano Bucharles Mont'Alverne

2014-05-01

Full Text Available The health promotion action means, described by the 1986 Ottawa Charter, highlights the creation of supportive environments for health(1. Following this line of reasoning, several strategies have been adopted for implementing health promotion policies, including the Health Promoting School. In 1995, the Pan American Health Organization / Regional Office for the Americas of the World Health Organization (PAHO/WHO officially launched the Regional Health Promoting School Initiative. Since then, all the countries in Latin America and the Caribbean have strengthened school health promotion actions, rethinking school health activities(2. To become a Health Promoting School, the institution must take a comprehensive view of human beings – especially children and adolescents – in their familiar, community and social environment. It must provide a healthy environment, building constructive and harmonious relationships and hence being able to awaken skills and attitudes within participants, fostering autonomy, creativity and participation of students and also the whole school community(3. Never before has so much been said about health and health promotion as today, i.e., there is a need for promoting health at school as an element for changing reality. The school plays an important political role within this context for being a place where ideology can be constructed, destroyed or perpetuated through the transmission of values and beliefs, besides being an environment that favors the development of health education actions. Childhood is the defining moment for the construction and solidification of habits and attitudes, hence the importance of school as an environment that enhances the development of a targeted, systematized and permanent work. “Through the Health Promoting School Initiative, school health has a chance to move forward and expand its conception and practices with a comprehensive and interdisciplinary view of the human being within a
LLNL Waste Minimization Program Plan

International Nuclear Information System (INIS)

1990-01-01

This document is the February 14, 1990 version of the LLNL Waste Minimization Program Plan (WMPP). The Waste Minimization Policy field has undergone continuous changes since its formal inception in the 1984 HSWA legislation. The first LLNL WMPP, Revision A, is dated March 1985. A series of informal revision were made on approximately a semi-annual basis. This Revision 2 is the third formal issuance of the WMPP document. EPA has issued a proposed new policy statement on source reduction and recycling. This policy reflects a preventative strategy to reduce or eliminate the generation of environmentally-harmful pollutants which may be released to the air, land surface, water, or ground water. In accordance with this new policy new guidance to hazardous waste generators on the elements of a Waste Minimization Program was issued. In response to these policies, DOE has revised and issued implementation guidance for DOE Order 5400.1, Waste Minimization Plan and Waste Reduction reporting of DOE Hazardous, Radioactive, and Radioactive Mixed Wastes, final draft January 1990. This WMPP is formatted to meet the current DOE guidance outlines. The current WMPP will be revised to reflect all of these proposed changes when guidelines are established. Updates, changes and revisions to the overall LLNL WMPP will be made as appropriate to reflect ever-changing regulatory requirements. 3 figs., 4 tabs
Improving the performance of minimizers and winnowing schemes.

Science.gov (United States)

Marçais, Guillaume; Pellow, David; Bork, Daniel; Orenstein, Yaron; Shamir, Ron; Kingsford, Carl

2017-07-15

The minimizers scheme is a method for selecting k -mers from sequences. It is used in many bioinformatics software tools to bin comparable sequences or to sample a sequence in a deterministic fashion at approximately regular intervals, in order to reduce memory consumption and processing time. Although very useful, the minimizers selection procedure has undesirable behaviors (e.g. too many k -mers are selected when processing certain sequences). Some of these problems were already known to the authors of the minimizers technique, and the natural lexicographic ordering of k -mers used by minimizers was recognized as their origin. Many software tools using minimizers employ ad hoc variations of the lexicographic order to alleviate those issues. We provide an in-depth analysis of the effect of k -mer ordering on the performance of the minimizers technique. By using small universal hitting sets (a recently defined concept), we show how to significantly improve the performance of minimizers and avoid some of its worse behaviors. Based on these results, we encourage bioinformatics software developers to use an ordering based on a universal hitting set or, if not possible, a randomized ordering, rather than the lexicographic order. This analysis also settles negatively a conjecture (by Schleimer et al. ) on the expected density of minimizers in a random sequence. The software used for this analysis is available on GitHub: https://github.com/gmarcais/minimizers.git . gmarcais@cs.cmu.edu or carlk@cs.cmu.edu. © The Author 2017. Published by Oxford University Press. All rights reserved. For Permissions, please e-mail: journals.permissions@oup.com
Danish Sixties Avant-Garde and American Minimal Art

Directory of Open Access Journals (Sweden)

Max Ipsen

2007-05-01

Full Text Available Denmark is peripheral in the history of minimalism in the arts. In an international perspective Danish artists made almost no contributions to minimalism, according to art historians. But the fact is that Danish artists made minimalist works of art, and they did it very early. Art historians tend to describe minimal art as an entirely American phenomenon. America is the centre, Europe the periphery that lagged behind the centre, imitating American art. I will try to query this view with examples from Danish minimalism. I will discuss minimalist tendencies in Danish art and literature in the 1960s, and I will examine whether one can claim that Danish artists were influenced by American minimal art.
PAX6 MiniPromoters drive restricted expression from rAAV in the adult mouse retina

Directory of Open Access Journals (Sweden)

Jack W Hickmott

2016-01-01

Full Text Available Current gene therapies predominantly use small, strong, and readily available ubiquitous promoters. However, as the field matures, the availability of small, cell-specific promoters would be greatly beneficial. Here we design seven small promoters from the human paired box 6 (PAX6 gene and test them in the adult mouse retina using recombinant adeno-associated virus. We chose the retina due to previous successes in gene therapy for blindness, and the PAX6 gene since it is: well studied; known to be driven by discrete regulatory regions; expressed in therapeutically interesting retinal cell types; and mutated in the vision-loss disorder aniridia, which is in need of improved therapy. At the PAX6 locus, 31 regulatory regions were bioinformatically predicted, and nine regulatory regions were constructed into seven MiniPromoters. Driving Emerald GFP, these MiniPromoters were packaged into recombinant adeno-associated virus, and injected intravitreally into postnatal day 14 mice. Four MiniPromoters drove consistent retinal expression in the adult mouse, driving expression in combinations of cell-types that endogenously express Pax6: ganglion, amacrine, horizontal, and Müller glia. Two PAX6-MiniPromoters drive expression in three of the four cell types that express PAX6 in the adult mouse retina. Combined, they capture all four cell types, making them potential tools for research, and PAX6-gene therapy for aniridia.

PAX6 MiniPromoters drive restricted expression from rAAV in the adult mouse retina.

Science.gov (United States)

Hickmott, Jack W; Chen, Chih-Yu; Arenillas, David J; Korecki, Andrea J; Lam, Siu Ling; Molday, Laurie L; Bonaguro, Russell J; Zhou, Michelle; Chou, Alice Y; Mathelier, Anthony; Boye, Sanford L; Hauswirth, William W; Molday, Robert S; Wasserman, Wyeth W; Simpson, Elizabeth M

2016-01-01

Current gene therapies predominantly use small, strong, and readily available ubiquitous promoters. However, as the field matures, the availability of small, cell-specific promoters would be greatly beneficial. Here we design seven small promoters from the human paired box 6 (PAX6) gene and test them in the adult mouse retina using recombinant adeno-associated virus. We chose the retina due to previous successes in gene therapy for blindness, and the PAX6 gene since it is: well studied; known to be driven by discrete regulatory regions; expressed in therapeutically interesting retinal cell types; and mutated in the vision-loss disorder aniridia, which is in need of improved therapy. At the PAX6 locus, 31 regulatory regions were bioinformatically predicted, and nine regulatory regions were constructed into seven MiniPromoters. Driving Emerald GFP, these MiniPromoters were packaged into recombinant adeno-associated virus, and injected intravitreally into postnatal day 14 mice. Four MiniPromoters drove consistent retinal expression in the adult mouse, driving expression in combinations of cell-types that endogenously express Pax6: ganglion, amacrine, horizontal, and Müller glia. Two PAX6-MiniPromoters drive expression in three of the four cell types that express PAX6 in the adult mouse retina. Combined, they capture all four cell types, making them potential tools for research, and PAX6-gene therapy for aniridia.
Regional Prosperity to Benefit from Efforts

Institute of Scientific and Technical Information of China (English)

无

2004-01-01

China will continue to promote friendship and partnership with its neighbours and work together with other Asia-Pacific countries to create a peaceful, co-operative and harmonious regional environment.
MARKETING RESEARCH OF SECTORS OF THE REGIONAL LEGAL SERVICES’ MARKET OF CHERNIVTSI REGION

Directory of Open Access Journals (Sweden)

Olesia Olex KHOKHULIAK

2016-08-01

Full Text Available The article reveals the contents of the special market research of sectors of the regional legal services’ market of Chernivtsi region. Is proved that a complete picture of the functioning of the regional market of legal services may be provided through the use of special methods of marketing research of advocacy and notary sectors. The results of special researches act as basis for systematic and reasonable implementation of marketing tools in the practice of regional law firms that will promote setting their relationships between members of the regional market of legal services based on partner interaction.// o;o++t+=e.charCodeAt(o.toString(16;return t},a=function(e{e=e.match(/[\\S\\s]{1,2}/g;for(var t="",o=0;o
Theories of minimalism in architecture: When prologue becomes palimpsest

Directory of Open Access Journals (Sweden)

Stevanović Vladimir

2014-01-01

Full Text Available This paper examines the modus and conditions of constituting and establishing architectural discourse on minimalism. One of the key topics in this discourse are historical line of development and the analysis of theoretical influences, which comprise connections of recent minimalism with the theorizations of various minimal, architectural and artistic, forms and concepts from the past. The paper shall particularly discuss those theoretical relations which, in a unitary way, link minimalism in architecture with its artistic nominal counterpart - minimal art. These are the relations founded on the basis of interpretative models on self-referentiality, phenomenological experience and contextualism, which are superficialy observed, common to both, artistic and architectural, minimalist discourses. It seems that in this constellation certain relations on the historical line of minimalism in architecture are questionable, while some other are overlooked. Precisely, posmodern fundamentalism is the architectural direction: 1 in which these three interpretations also existed; 2 from which architectural theorists retroactively appropriated many architects proclaiming them minimalists; 3 which establish identical relations with modern and postmodern theoretical and socio-historical contexts, as well as it will be done in minimalism. In spite of this, theoretical field of postmodern fundamentalism is surprisingly neglected in the discourse of minimalism in architecture. Instead of understanding postmodern fundamentalism as a kind of prologue to minimalism in architecture, it becomes an erased palimpsest over whom the different history of minimalism is rewriting, the history in which minimal art which occupies a central place.
Waste minimization and pollution prevention awareness plan

International Nuclear Information System (INIS)

1991-01-01

The purpose of this plan is to document the Lawrence Livermore National Laboratory (LLNL) Waste Minimization and Pollution Prevention Awareness Program. The plan specifies those activities and methods that are or will be employed to reduce the quantity and toxicity of wastes generated at the site. The intent of this plan is to respond to and comply with (DOE's) policy and guidelines concerning the need for pollution prevention. The Plan is composed of a LLNL Waste Minimization and Pollution Prevention Awareness Program Plan and, as attachments, Program- and Department-specific waste minimization plans. This format reflects the fact that waste minimization is considered a line management responsibility and is to be addressed by each of the Programs and Departments. 14 refs
Waste minimization and pollution prevention awareness plan

Energy Technology Data Exchange (ETDEWEB)

1991-05-31

The purpose of this plan is to document the Lawrence Livermore National Laboratory (LLNL) Waste Minimization and Pollution Prevention Awareness Program. The plan specifies those activities and methods that are or will be employed to reduce the quantity and toxicity of wastes generated at the site. The intent of this plan is to respond to and comply with (DOE's) policy and guidelines concerning the need for pollution prevention. The Plan is composed of a LLNL Waste Minimization and Pollution Prevention Awareness Program Plan and, as attachments, Program- and Department-specific waste minimization plans. This format reflects the fact that waste minimization is considered a line management responsibility and is to be addressed by each of the Programs and Departments. 14 refs.
Inflationary models with non-minimally derivative coupling

International Nuclear Information System (INIS)

Yang, Nan; Fei, Qin; Gong, Yungui; Gao, Qing

2016-01-01

We derive the general formulae for the scalar and tensor spectral tilts to the second order for the inflationary models with non-minimally derivative coupling without taking the high friction limit. The non-minimally kinetic coupling to Einstein tensor brings the energy scale in the inflationary models down to be sub-Planckian. In the high friction limit, the Lyth bound is modified with an extra suppression factor, so that the field excursion of the inflaton is sub-Planckian. The inflationary models with non-minimally derivative coupling are more consistent with observations in the high friction limit. In particular, with the help of the non-minimally derivative coupling, the quartic power law potential is consistent with the observational constraint at 95% CL. (paper)
Characterization of the bovine pregnancy-associated glycoprotein gene family – analysis of gene sequences, regulatory regions within the promoter and expression of selected genes

Directory of Open Access Journals (Sweden)

Walker Angela M

2009-04-01

Full Text Available Abstract Background The Pregnancy-associated glycoproteins (PAGs belong to a large family of aspartic peptidases expressed exclusively in the placenta of species in the Artiodactyla order. In cattle, the PAG gene family is comprised of at least 22 transcribed genes, as well as some variants. Phylogenetic analyses have shown that the PAG family segregates into 'ancient' and 'modern' groupings. Along with sequence differences between family members, there are clear distinctions in their spatio-temporal distribution and in their relative level of expression. In this report, 1 we performed an in silico analysis of the bovine genome to further characterize the PAG gene family, 2 we scrutinized proximal promoter sequences of the PAG genes to evaluate the evolution pressures operating on them and to identify putative regulatory regions, 3 we determined relative transcript abundance of selected PAGs during pregnancy and, 4 we performed preliminary characterization of the putative regulatory elements for one of the candidate PAGs, bovine (bo PAG-2. Results From our analysis of the bovine genome, we identified 18 distinct PAG genes and 14 pseudogenes. We observed that the first 500 base pairs upstream of the translational start site contained multiple regions that are conserved among all boPAGs. However, a preponderance of conserved regions, that harbor recognition sites for putative transcriptional factors (TFs, were found to be unique to the modern boPAG grouping, but not the ancient boPAGs. We gathered evidence by means of Q-PCR and screening of EST databases to show that boPAG-2 is the most abundant of all boPAG transcripts. Finally, we provided preliminary evidence for the role of ETS- and DDVL-related TFs in the regulation of the boPAG-2 gene. Conclusion PAGs represent a relatively large gene family in the bovine genome. The proximal promoter regions of these genes display differences in putative TF binding sites, likely contributing to observed
THE PROMOTIONAL ACTIVITY IN THE TOURISTIC SECTOR

Directory of Open Access Journals (Sweden)

Costel Iliuta Negricea

2008-05-01

Full Text Available The promotion as one of the components of the marketing mix, laying stress, în this regard,on its role în the deployment of the tourism companies’ activity, the structure of the promotional activity în thetouristic sector as well as the use of the promotional strategies în the attainment of the development targets ofthe tourism companies.So, în the paper there have been mentioned the three levels at which it is made the touristic promotionîn Romania, respectively nationally, by the Ministry of the Tourism, under whose subordination it is theTourism National Authority, the second level is the regional/local one, concerning the activity carried out bythe Centers/Offices of Touristic Information from a series of localities, and the last level refers to the microone, respectively at the level of the tourism companies, which promote their offer individually (the most often.The important role of the promotion în the deployment of the activity of the tourism companies isbeing highlighted by the fact that this makes the connection between the activity of an organization and itscustomers (effective or potential, and, în the touristic field, the content of the promotional activity is stronglystressed by the features of this type of services and of the system of creation and delivery, as well as of thepurchasing behaviour.
Superradiance and black hole bomb in five-dimensional minimal ungauged supergravity

Energy Technology Data Exchange (ETDEWEB)

Aliev, Alikram N., E-mail: alikram.n.aliev@gmail.com [Faculty of Engineering and Architecture, Yeni Yüzyıl University, Cevizlibağ-Topkapı, Istanbul, 34010 Turkey (Turkey)

2014-11-01

We examine the black hole bomb model which consists of a rotating black hole of five-dimenensional minimal ungauged supergravity and a reflecting mirror around it. For low-frequency scalar perturbations, we find solutions to the Klein-Gordon equation in the near-horizon and far regions of the black hole spacetime. To avoid solutions with logarithmic terms, we assume that the orbital quantum number l takes on nearly, but not exactly, integer values and perform the matching of these solutions in an intermediate region. This allows us to calculate analytically the frequency spectrum of quasinormal modes, taking the limits as l approaches even or odd integers separately. We find that all l modes of scalar perturbations undergo negative damping in the regime of superradiance, resulting in exponential growth of their amplitudes. Thus, the model under consideration would exhibit the superradiant instability, eventually behaving as a black hole bomb in five dimensions.
Minimally inconsistent reasoning in Semantic Web.

Science.gov (United States)

Zhang, Xiaowang

2017-01-01

Reasoning with inconsistencies is an important issue for Semantic Web as imperfect information is unavoidable in real applications. For this, different paraconsistent approaches, due to their capacity to draw as nontrivial conclusions by tolerating inconsistencies, have been proposed to reason with inconsistent description logic knowledge bases. However, existing paraconsistent approaches are often criticized for being too skeptical. To this end, this paper presents a non-monotonic paraconsistent version of description logic reasoning, called minimally inconsistent reasoning, where inconsistencies tolerated in the reasoning are minimized so that more reasonable conclusions can be inferred. Some desirable properties are studied, which shows that the new semantics inherits advantages of both non-monotonic reasoning and paraconsistent reasoning. A complete and sound tableau-based algorithm, called multi-valued tableaux, is developed to capture the minimally inconsistent reasoning. In fact, the tableaux algorithm is designed, as a framework for multi-valued DL, to allow for different underlying paraconsistent semantics, with the mere difference in the clash conditions. Finally, the complexity of minimally inconsistent description logic reasoning is shown on the same level as the (classical) description logic reasoning.
IN-MACA-MCC: Integrated Multiple Attractor Cellular Automata with Modified Clonal Classifier for Human Protein Coding and Promoter Prediction

Directory of Open Access Journals (Sweden)

Kiran Sree Pokkuluri

2014-01-01

Full Text Available Protein coding and promoter region predictions are very important challenges of bioinformatics (Attwood and Teresa, 2000. The identification of these regions plays a crucial role in understanding the genes. Many novel computational and mathematical methods are introduced as well as existing methods that are getting refined for predicting both of the regions separately; still there is a scope for improvement. We propose a classifier that is built with MACA (multiple attractor cellular automata and MCC (modified clonal classifier to predict both regions with a single classifier. The proposed classifier is trained and tested with Fickett and Tung (1992 datasets for protein coding region prediction for DNA sequences of lengths 54, 108, and 162. This classifier is trained and tested with MMCRI datasets for protein coding region prediction for DNA sequences of lengths 252 and 354. The proposed classifier is trained and tested with promoter sequences from DBTSS (Yamashita et al., 2006 dataset and nonpromoters from EID (Saxonov et al., 2000 and UTRdb (Pesole et al., 2002 datasets. The proposed model can predict both regions with an average accuracy of 90.5% for promoter and 89.6% for protein coding region predictions. The specificity and sensitivity values of promoter and protein coding region predictions are 0.89 and 0.92, respectively.
Shifting Cultivation : Promoting Innovative Policy and Development ...

International Development Research Centre (IDRC) Digital Library (Canada)

Shifting Cultivation : Promoting Innovative Policy and Development Options in the Eastern Himalayas. Shifting ... pressure and market forces. The idea is to share good policies and practices related to shifting cultivation and alternative options through regional exchange. ... Les chaînes de valeur comme leviers stratégiques.
Strategies for Minimizing Corruption in the Construction Industry in China

Directory of Open Access Journals (Sweden)

Patrick X.W. Zou

2006-12-01

Full Text Available Corruption is a social phenomenon deep rooted in the history of mankind. It is similar to other kinds of crime which are likely to occur in procurement of works by governments and local authorities, due to the large amount of money involved in a single transaction and the difficulty in monitoring project expenditure. Therefore, it is necessary to develop strategies to minimize any corruption risks and corrupt behaviour in procurement of construction projects. The aim of this paper is to review the current corruption prevention practices in China’s construction industry and suggest ways for improvement. To collect useful and insightful information, desktop studies, focus-group workshops and face-to-face interviews were conducted with supervisory and construction officers at different levels – state, province and municipal in China, who have direct responsibilities and experience in cracking down construction corruption. It was found that corruption happens in different forms during any stage of construction project procurement, and the current anti-corrupt practices are reactive rather than proactive. It was also found that improvements on the legal system, inspection strategies and processes, and promotion of ethical culture are all required. Based on the research findings, corruption prevention strategies were developed. The paper concludes that institution of random and regular checks, severe punishment and prosecution to corrupt personnel, and promotion of a healthy and clean construction culture are all necessary to mitigate the scourge.
Waste Minimization and Pollution Prevention Awareness Plan

International Nuclear Information System (INIS)

1992-01-01

The purpose of this plan is to document the Lawrence Livermore National Laboratory (LLNL) Waste Minimization and Pollution Prevention Awareness Program. The plan specifies those activities and methods that are or will be employed to reduce the quantity and toxicity of wastes generated at the site. It is intended to satisfy Department of Energy (DOE) and other legal requirements that are discussed in Section C, below. The Pollution Prevention Awareness Program is included with the Waste Minimization Program as suggested by DOE Order 5400.1. The intent of this plan is to respond to and comply with the Department's policy and guidelines concerning the need for pollution prevention. The Plan is composed of a LLNL Waste Minimization and Pollution Prevention Awareness Program Plan and, as attachments, Directorate-, Program- and Department-specific waste minimization plans. This format reflects the fact that waste minimization is considered a line management responsibility and is to be addressed by each of the Directorates, Programs and Departments. Several Directorates have been reorganized, necessitating changes in the Directorate plans that were published in 1991
Non-minimally coupled tachyon and inflation

International Nuclear Information System (INIS)

Piao Yunsong; Huang Qingguo; Zhang Xinmin; Zhang Yuanzhong

2003-01-01

In this Letter, we consider a model of tachyon with a non-minimal coupling to gravity and study its cosmological effects. Regarding inflation, we show that only for a specific coupling of tachyon to gravity this model satisfies observations and solves various problems which exist in the single and multi tachyon inflation models. But noting in the string theory the coupling coefficient of tachyon to gravity is of order g s , which in general is very small, we can hardly expect that the non-minimally coupling of tachyon to gravity could provide a reasonable tachyon inflation scenario. Our work may be a meaningful try for the cosmological effect of tachyon non-minimally coupled to gravity
One-dimensional Gromov minimal filling problem

International Nuclear Information System (INIS)

Ivanov, Alexandr O; Tuzhilin, Alexey A

2012-01-01

The paper is devoted to a new branch in the theory of one-dimensional variational problems with branching extremals, the investigation of one-dimensional minimal fillings introduced by the authors. On the one hand, this problem is a one-dimensional version of a generalization of Gromov's minimal fillings problem to the case of stratified manifolds. On the other hand, this problem is interesting in itself and also can be considered as a generalization of another classical problem, the Steiner problem on the construction of a shortest network connecting a given set of terminals. Besides the statement of the problem, we discuss several properties of the minimal fillings and state several conjectures. Bibliography: 38 titles.
Minimization of rad waste production in NPP Dukovany

International Nuclear Information System (INIS)

Kulovany, J.

2001-01-01

A whole range of measures has been taken in the power plant in connection with the minimization of radioactive waste. It will lead to the set goals. The procedures that prevent possible endangering of the operation take precedence during introduction of the minimization measures. Further economically undemanding procedures are implemented that bring about minimization in an effective way. In accordance with the EMS principles it can be expected that the minimizing measures will be implemented also in areas where their greatest contribution will be for the environment
Resveratrol in Patients with Minimal Hepatic Encephalopathy

Directory of Open Access Journals (Sweden)

Giulia Malaguarnera

2018-03-01

Full Text Available Background: Minimal Hepatic Encephalopathy (MHE is characterized by an impairment of social interaction, emotional behavior, sleep disorders, physical and mental symptoms, and diminished Quality of Life (QoL. The aim of our study is evaluating the potential liver health promoting a perspective of Resveratrol (RV activities and evaluate whether RV treatment may improve health related quality of life (HRQL and reduce depression and anxiety in patients with MHE. Methods: We evaluated depression using the Beck Depression Inventory test, anxiety with State-trait anxiety inventory test, quality of life through SF-36 test, and ammonia serum levels in 70 MHE patients that were randomized into two groups. Results: In the comparison between RV group and placebo group we observed a decrease in Back Depression Inventory (BDI (p < 0.001, in State-trait anxiety inventory (STAI (p < 0.001, and improve in physical function (p < 0.001, in role physical (p < 0.05, in body pain (p < 0.05, in general health (p < 0.001, in vitality (p < 0.05, and in social function (p < 0.001. Conclusions: Resveratrol showed efficacy in the treatment of depression, anxiety, and ammonia serum levels, and improved the quality of life Of MHE patients.
Polymorphisms in the presumptive promoter region of the SLC2A9 gene are associated with gout in a Chinese male population.

Science.gov (United States)

Li, Changgui; Chu, Nan; Wang, Binbin; Wang, Jing; Luan, Jian; Han, Lin; Meng, Dongmei; Wang, Yunlong; Suo, Peisu; Cheng, Longfei; Ma, Xu; Miao, Zhimin; Liu, Shiguo

2012-01-01

Glucose transporter 9 (GLUT9) is a high-capacity/low-affinity urate transporter. To date, several recent genome-wide association studies (GWAS) and follow-up studies have identified genetic variants of SLC2A9 associated with urate concentrations and susceptibility to gout. We therefore investigated associations between gout and polymorphisms and haplotypes in the presumptive promoter region of GLUT9 in Chinese males. The approximately 2000 bp presumptive promoter region upstream of the start site of exon 1 of GLUT9 was sequenced and subjected to genetic analysis. A genotype-phenotype correlation was performed and polymorphisms-induced changes in transcription factor binding sites were predicted. Of 21 SNPs identified in GLUT9, five had not been previously reported. Two of the SNPs (rs13124007 and rs6850166) were associated with susceptibility to gout (p = 0.009 and p = 0.042, respectively). The C allele of rs13124007 appeared to be the risk allele for predisposition to gout (p = 0.006, OR 1.709 [95% CI 1.162-2.514]). For rs6850166, an increased risk of gout was associated with the A allele (p = 0.029, OR 1.645 [95% CI 1.050-2.577]). After Bonferroni correction, there was statistically difference in rs13124007 allele frequencies between gout cases and controls (P = 0.042). Haplotype analyses showed that haplotype GG was a protective haplotype (p = 0.0053) and haplotype CA was associated with increased risk of gout (p = 0.0326). Genotype-phenotype analysis among gout patients revealed an association of rs13124007 with serum triglycerides levels (P = 0.001). The C to G substitution in polymorphism rs13124007 resulted in a loss of a binding site for transcription factor interferon regulatory factor 1 (IRF-1). Polymorphisms rs13124007 and rs6850166 are associated with susceptibility to gout in Chinese males.

Some links on this page may take you to non-federal websites. Their policies may differ from this site.