WorldWideScience

Sample records for minimal promoter region

  1. Promoting regional mobility

    DEFF Research Database (Denmark)

    Jensen, Anne

    Pricing of transport has been part of EU's common transport policy since this gained momentum in the early 1990s. Since then, it has been closely connected to the trans-European transport network (TEN-T) and to rising demands of efficient mobility systems at a local, regional and Community scale....... Development of pricing policies is contested at Community level and has taken place in a clash between different policy rationalities. Significantly though, the effects of the pricing policies are closely related to regional mobility systems, e.g. through financing large trans-border infrastructure projects...... and establishing common technical charging systems thus changing the conditions for regional mobility. This paper explores how policies of infrastructure pricing shape new ways of governing mobility which influences trans-border, regional policy-making. The key findings are that there is a tendency to include...

  2. Minimalism

    CERN Document Server

    Obendorf, Hartmut

    2009-01-01

    The notion of Minimalism is proposed as a theoretical tool supporting a more differentiated understanding of reduction and thus forms a standpoint that allows definition of aspects of simplicity. This book traces the development of minimalism, defines the four types of minimalism in interaction design, and looks at how to apply it.

  3. Use of Linear Programming to Develop Cost-Minimized Nutritionally Adequate Health Promoting Food Baskets

    DEFF Research Database (Denmark)

    Parlesak, A.; Tetens, Inge; Dejgård Jensen, Jørgen

    2016-01-01

    Food-Based Dietary Guidelines (FBDGs) are developed to promote healthier eating patterns, but increasing food prices may make healthy eating less affordable. The aim of this study was to design a range of cost-minimized nutritionally adequate health-promoting food baskets (FBs) that help prevent ...

  4. Function of the EGR-1/TIS8 radiation inducible promoter in a minimal HSV-1 amplicon system

    International Nuclear Information System (INIS)

    Spear, M.A.; Sakamoto, K.M.; Herrlinger, U.; Pechan, P.; Breakefield, X.O.

    1997-01-01

    Purpose: To evaluate function of the EGR-1/TIS8 promoter region in minimal HSV-1 amplicon system in order to determine the feasibility of using the system to regulate vector replication with radiation. Materials and Methods: A 600-base pair 5' upstream region of the EGR-1 promoter linked to chloramphenicol acetyltransferase (CAT) was recombined into a minimal HSV-1 amplicon vector system (pONEC). pONEC or a control plasmid was transfected into U87 glioma cells using the Lipofectamine method. Thirty-six hours later one aliquot of cells from each transfection was irradiated to a dose of 20 Gy and another identical aliquot served as a control. CAT activity was assayed 8 hours after irradiation. Results: pONEC transfected cells irradiated with 20 Gy demonstrated 2.0 fold increase in CAT activity compared to non-irradiated cells. Cells transfected with control plasmid showed no change in CAT activity. Unirradiated pONEC cells had CAT activity 1.3 times those transfected with control plasmid. Conclusion: We have previously created HSV-1 gene therapy amplicon vector systems which allow virus-amplicon interdependent replication, with the intent of regulating replication. The above data demonstrates that a minimal amplicon system will allow radiation dependent regulation by the EGR-1 promoter, thus indicating the possibility of using this system to regulate onsite, spatially and temporally regulated vector production. Baseline CAT activity was higher and relative induction lower than other reported expression constructs, which raises concern for the ability of the system to produce a differential in transcription levels sufficient for this purpose. This is possibly the result of residual promoter/enhancer elements remaining in the HSV-1 sequences. We are attempting to create constructs lacking these elements. Addition of secondary promoter sequences may also be of use. We are also currently evaluating the efficacy of the putative IEX-1 radiation inducible promoter region in

  5. Use of Linear Programming to Develop Cost-Minimized Nutritionally Adequate Health Promoting Food Baskets

    DEFF Research Database (Denmark)

    Parlesak, A.; Tetens, Inge; Dejgård Jensen, Jørgen

    2016-01-01

    Food-Based Dietary Guidelines (FBDGs) are developed to promote healthier eating patterns, but increasing food prices may make healthy eating less affordable. The aim of this study was to design a range of cost-minimized nutritionally adequate health-promoting food baskets (FBs) that help prevent...... both micronutrient inadequacy and diet-related non-communicable diseases at lowest cost. Average prices for 312 foods were collected within the Greater Copenhagen area. The cost and nutrient content of five different cost-minimized FBs for a family of four were calculated per day using linear...... in each of the resulting five baskets was increased through limiting the relative share of individual foods. The one-day version of N contained only 12 foods at the minimum cost of DKK 27 (€ 3.6). The CA, DG, and DGN were about twice of this and the CAN cost ~DKK 81 (€ 10.8). The baskets with the greater...

  6. A 310-bp minimal promoter mediates smooth muscle cell-specific expression of telokin.

    Science.gov (United States)

    Smith, A F; Bigsby, R M; Word, R A; Herring, B P

    1998-05-01

    A cell-specific promoter located in an intron of the smooth muscle myosin light chain kinase gene directs transcription of telokin exclusively in smooth muscle cells. Transgenic mice were generated in which a 310-bp rabbit telokin promoter fragment, extending from -163 to +147, was used to drive expression of simian virus 40 large T antigen. Smooth muscle-specific expression of the T-antigen transgene paralleled that of the endogenous telokin gene in all smooth muscle tissues except uterus. The 310-bp promoter fragment resulted in very low levels of transgene expression in uterus; in contrast, a transgene driven by a 2.4-kb fragment (-2250 to +147) resulted in high levels of transgene expression in uterine smooth muscle. Telokin expression levels correlate with the estrogen status of human myometrial tissues, suggesting that deletion of an estrogen response element (ERE) may account for the low levels of transgene expression driven by the 310-bp rabbit telokin promoter in uterine smooth muscle. Experiments in A10 smooth muscle cells directly showed that reporter gene expression driven by the 2.4-kb, but not 310-bp, promoter fragment could be stimulated two- to threefold by estrogen. This stimulation was mediated through an ERE located between -1447 and -1474. Addition of the ERE to the 310-bp fragment restored estrogen responsiveness in A10 cells. These data demonstrate that in addition to a minimal 310-bp proximal promoter at least one distal cis-acting regulatory element is required for telokin expression in uterine smooth muscle. The distal element may include an ERE between -1447 and -1474.

  7. Use of Linear Programming to Develop Cost-Minimized Nutritionally Adequate Health Promoting Food Baskets.

    Science.gov (United States)

    Parlesak, Alexandr; Tetens, Inge; Dejgård Jensen, Jørgen; Smed, Sinne; Gabrijelčič Blenkuš, Mojca; Rayner, Mike; Darmon, Nicole; Robertson, Aileen

    2016-01-01

    Food-Based Dietary Guidelines (FBDGs) are developed to promote healthier eating patterns, but increasing food prices may make healthy eating less affordable. The aim of this study was to design a range of cost-minimized nutritionally adequate health-promoting food baskets (FBs) that help prevent both micronutrient inadequacy and diet-related non-communicable diseases at lowest cost. Average prices for 312 foods were collected within the Greater Copenhagen area. The cost and nutrient content of five different cost-minimized FBs for a family of four were calculated per day using linear programming. The FBs were defined using five different constraints: cultural acceptability (CA), or dietary guidelines (DG), or nutrient recommendations (N), or cultural acceptability and nutrient recommendations (CAN), or dietary guidelines and nutrient recommendations (DGN). The variety and number of foods in each of the resulting five baskets was increased through limiting the relative share of individual foods. The one-day version of N contained only 12 foods at the minimum cost of DKK 27 (€ 3.6). The CA, DG, and DGN were about twice of this and the CAN cost ~DKK 81 (€ 10.8). The baskets with the greater variety of foods contained from 70 (CAN) to 134 (DGN) foods and cost between DKK 60 (€ 8.1, N) and DKK 125 (€ 16.8, DGN). Ensuring that the food baskets cover both dietary guidelines and nutrient recommendations doubled the cost while cultural acceptability (CAN) tripled it. Use of linear programming facilitates the generation of low-cost food baskets that are nutritionally adequate, health promoting, and culturally acceptable.

  8. Beyond the Washington Consensus: Promoting Economic Growth and Minimizing the Threat of Violence in Latin America through Social Development

    Science.gov (United States)

    2012-03-01

    pp. 247–274. Mankiw , N. Gregory, David Romer, and David N. Weil. “A Contribution to the Empirics of Economic Growth.” The Quarterly Journal...WASHINGTON CONSENSUS: PROMOTING ECONOMIC GROWTH AND MINIMIZING THE THREAT OF VIOLENCE IN LATIN AMERICA THROUGH SOCIAL DEVELOPMENT by Eric J. Blomberg...Washington Consensus: Promoting Economic Growth and Minimizing the Threat of Violence in Latin America through Social Development 5. FUNDING NUMBERS

  9. Unveiling DNA structural properties of promoter regions of ...

    Indian Academy of Sciences (India)

    Aditya Kumar

    Unveiling DNA structural properties of promoter regions of prokaryotic transcriptome and their role in gene expression. Aditya Kumar. Assistant Professor. Molecular Biology & Biotechnology. Tezpur University. Tezpur – 784028, Assam ...

  10. Identification and annotation of promoter regions in microbial ...

    Indian Academy of Sciences (India)

    PRAKASH KUMAR

    2007-06-15

    Jun 15, 2007 ... It remains important, not only to detect rarely expressed genes but also for ... well as in identifying genes associated with rRNA, tRNA and ... DNA stability; free energy calculation; promoter; upstream and downstream region.

  11. [Health-Promoting Schools Regional Initiative of the Americas].

    Science.gov (United States)

    Ippolito-Shepherd, Josefa; Cerqueira, Maria Teresa; Ortega, Diana Patricia

    2005-01-01

    In Latin America, comprehensive health promotion programmes and activities are being implemented in the school setting, which take into account the conceptual framework of the Health-Promoting Schools Regional Initiative of the Pan American Health Organization, Regional office of the World Health Organization (PAHO/WHO). These programmes help to strengthen the working relationships between the health and education sectors. The Health-Promoting Schools Regional Initiative, officially launched by PAHO/WHO in 1995, aims to form future generations to have the knowledge, abilities, and skills necessary for promoting and caring for their health and that of their family and community, as well as to create and maintain healthy environments and communities. The Initiative focuses on three main components: comprehensive health education, the creation and maintenance of healthy physical and psychosocial environments, and the access to health and nutrition services, mental health, and active life. In 2001, PAHO conducted a survey in 19 Latin American countries to assess the status and trends of Health-Promoting Schools in the Region, for the appropriate regional, subregional, and national planning of pertinent health promotion and health education programmes and activities. The results of this survey provided information about policies and national plans, multisectoral coordination mechanisms for the support of health promotion in the school settings, the formation and participation in national and international networks of Health-Promoting Schools and about the level of dissemination of the strategy. For the successful development of Health-Promoting Schools is essential to involve the society as a whole, in order to mobilise human resources and materials necessary for implementing health promotion in the school settings. Thus, the constitution and consolidation of networks has been a facilitating mechanism for the exchange of ideas, resources and experiences to strengthen

  12. Selective apoptosis induction in MCF-7 cell line by truncated minimal functional region of Apoptin

    International Nuclear Information System (INIS)

    Shen Ni, Lim; Allaudin, Zeenathul Nazariah bt; Mohd Lila, Mohd Azmi b; Othman, Abas Mazni b; Othman, Fauziah bt

    2013-01-01

    Chicken Anemia Virus (CAV) VP3 protein (also known as Apoptin), a basic and proline-rich protein has a unique capability in inducing apoptosis in cancer cells but not in normal cells. Five truncated Apoptin proteins were analyzed to determine their selective ability to migrate into the nucleus of human breast adenocarcinoma MCF-7 cells for inducing apoptosis. For identification of the minimal selective domain for apoptosis, the wild-type Apoptin gene had been reconstructed by PCR to generate segmental deletions at the N’ terminal and linked with nuclear localization sites (NLS1 and NLS2). All the constructs were fused with maltose-binding protein gene and individually expressed by in vitro Rapid Translation System. Standardized dose of proteins were delivered into human breast adenocarcinoma MCF-7 cells and control human liver Chang cells by cytoplasmic microinjection, and subsequently observed for selective apoptosis effect. Three of the truncated Apoptin proteins with N-terminal deletions spanning amino acid 32–83 retained the cancer selective nature of wild-type Apoptin. The proteins were successfully translocated to the nucleus of MCF-7 cells initiating apoptosis, whereas non-toxic cytoplasmic retention was observed in normal Chang cells. Whilst these truncated proteins retained the tumour-specific death effector ability, the specificity for MCF-7 cells was lost in two other truncated proteins that harbor deletions at amino acid 1–31. The detection of apoptosing normal Chang cells and MCF-7 cells upon cytoplasmic microinjection of these proteins implicated a loss in Apoptin’s signature targeting activity. Therefore, the critical stretch spanning amino acid 1–31 at the upstream of a known hydrophobic leucine-rich stretch (LRS) was strongly suggested as one of the prerequisite region in Apoptin for cancer targeting. Identification of this selective domain provides a platform for developing small targets to facilitating carrier-mediated-transport across

  13. 9 CFR 93.436 - Ruminants from regions of minimal risk for BSE.

    Science.gov (United States)

    2010-01-01

    ... each animal's right hip, high on the tail-head (over the junction of the sacral and first cocygeal... 9 Animals and Animal Products 1 2010-01-01 2010-01-01 false Ruminants from regions of minimal risk for BSE. 93.436 Section 93.436 Animals and Animal Products ANIMAL AND PLANT HEALTH INSPECTION SERVICE...

  14. A minimal murine Msx-1 gene promoter. Organization of its cis-regulatory motifs and their role in transcriptional activation in cells in culture and in transgenic mice.

    Science.gov (United States)

    Takahashi, T; Guron, C; Shetty, S; Matsui, H; Raghow, R

    1997-09-05

    To dissect the cis-regulatory elements of the murine Msx-1 promoter, which lacks a conventional TATA element, a putative Msx-1 promoter DNA fragment (from -1282 to +106 base pairs (bp)) or its congeners containing site-specific alterations were fused to luciferase reporter and introduced into NIH3T3 and C2C12 cells, and the expression of luciferase was assessed in transient expression assays. The functional consequences of the sequential 5' deletions of the promotor revealed that multiple positive and negative regulatory elements participate in regulating transcription of the Msx-1 gene. Surprisingly, however, the optimal expression of Msx-1 promoter in either NIH3T3 or C2C12 cells required only 165 bp of the upstream sequence to warrant detailed examination of its structure. Therefore, the functional consequences of site-specific deletions and point mutations of the cis-acting elements of the minimal Msx-1 promoter were systematically examined. Concomitantly, potential transcriptional factor(s) interacting with the cis-acting elements of the minimal promoter were also studied by gel electrophoretic mobility shift assays and DNase I footprinting. Combined analyses of the minimal promoter by DNase I footprinting, electrophoretic mobility shift assays, and super shift assays with specific antibodies revealed that 5'-flanking regions from -161 to -154 and from -26 to -13 of the Msx-1 promoter contains an authentic E box (proximal E box), capable of binding a protein immunologically related to the upstream stimulating factor 1 (USF-1) and a GC-rich sequence motif which can bind to Sp1 (proximal Sp1), respectively. Additionally, we observed that the promoter activation was seriously hampered if the proximal E box was removed or mutated, and the promoter activity was eliminated completely if the proximal Sp1 site was similarly altered. Absolute dependence of the Msx-1 minimal promoter on Sp1 could be demonstrated by transient expression assays in the Sp1-deficient

  15. Minimizing the cancer-promotional activity of cox-2 as a central strategy in cancer prevention.

    Science.gov (United States)

    McCarty, Mark F

    2012-01-01

    A recent meta-analysis examining long-term mortality in subjects who participated in controlled studies evaluating the impact of daily aspirin on vascular risk, has concluded that aspirin confers substantial protection from cancer mortality. Remarkably, low-dose aspirin was as effective as higher-dose regimens; hence this protection may be achievable with minimal risk. There is reason to believe that this protection stems primarily from inhibition of cox-2 in pre-neoplastic lesions. Since safe aspirin regimens can only achieve a partial and transitory inhibition of cox-2, it may be feasible to complement the cancer-protective benefit of aspirin with other measures which decrease cox-2 expression or which limit the bioactivity of cox-2-derived PGE2. Oxidative stress boosts cox-2 expression by up-regulating activation of NF-kappaB and MAP kinases; NADPH oxidase activation may thus promote carcinogenesis by increasing cox-2 expression while also amplifying oxidant-mediated mutagenesis. A prospective cohort study has observed that relatively elevated serum bilirubin levels are associated with a marked reduction in subsequent cancer mortality; this may reflect bilirubin's physiological role as a potent inhibitor of NADPH oxidase. It may be feasible to mimic this protective effect by supplementing with spirulina, a rich source of a phycobilin which shares bilirubin's ability to inhibit NADPH oxidase. Ancillary antioxidant measures - phase 2 inducing phytochemicals, melatonin, N-acetylcysteine, and astaxanthin - may also aid cox-2 down-regulation. The cancer protection often associated with high-normal vitamin D status may be attributable, in part, to the ability of the activated vitamin D receptor to decrease cox-2 expression while promoting PGE2 catabolism and suppressing the expression of PGE2 receptors. Diets with a relatively low ratio of omega-6 to long-chain omega-3 fats may achieve cancer protection by antagonizing the production and bioactivity of PGE2. Growth

  16. Identification and annotation of promoter regions in microbial

    Indian Academy of Sciences (India)

    2007-06-15

    Jun 15, 2007 ... Analysis of various predicted structural properties of promoter regions in prokaryotic as well as eukaryotic genomes had earlier indicated that they have several common features, such as lower stability, higher curvature and less bendability, when compared with their neighboring regions. Based on the ...

  17. The Use of Trust Regions in Kohn-Sham Total Energy Minimization

    International Nuclear Information System (INIS)

    Yang, Chao; Meza, Juan C.; Wang, Lin-wang

    2006-01-01

    The Self Consistent Field (SCF) iteration, widely used for computing the ground state energy and the corresponding single particle wave functions associated with a many-electron atomistic system, is viewed in this paper as an optimization procedure that minimizes the Kohn-Sham total energy indirectly by minimizing a sequence of quadratic surrogate functions. We point out the similarity and difference between the total energy and the surrogate, and show how the SCF iteration can fail when the minimizer of the surrogate produces an increase in the KS total energy. A trust region technique is introduced as a way to restrict the update of the wave functions within a small neighborhood of an approximate solution at which the gradient of the total energy agrees with that of the surrogate. The use of trust region in SCF is not new. However, it has been observed that directly applying a trust region based SCF(TRSCF) to the Kohn-Sham total energy often leads to slow convergence. We propose to use TRSCF within a direct constrained minimization(DCM) algorithm we developed in dcm. The key ingredients of the DCM algorithm involve projecting the total energy function into a sequence of subspaces of small dimensions and seeking the minimizer of the total energy function within each subspace. The minimizer of a subspace energy function, which is computed by TRSCF, not only provides a search direction along which the KS total energy function decreases but also gives an optimal 'step-length' that yields a sufficient decrease in total energy. A numerical example is provided to demonstrate that the combination of TRSCF and DCM is more efficient than SCF

  18. Minimizing the magnetohydrodynamic potential energy for the current hole region in tokamaks

    International Nuclear Information System (INIS)

    Chu, M.S.; Parks, P.B.

    2004-01-01

    The current hole region in the tokamak has been observed to arise naturally during the development of internal transport barriers. The magnetohydrodynamic (MHD) potential energy in the current hole region is shown to be determined completely in terms of the displacements at the edge of the current hole. For modes with finite toroidal mode number n≠0, the minimized potential energy is the same as if the current hole region were a vacuum region. For modes with toroidal mode number n=0, the displacement is a superposition of three types of independent displacements: a vertical displacement or displacements that compress only the plasma, or the toroidal field uniformly. Thus for ideal MHD perturbations of plasma with a current hole, the plasma behaves as if it were bordered by an extra ''internal vacuum region.'' The relevance of the present work to computer simulations of plasma with a current hole region is also discussed

  19. MINIMIZING THE MHD POTENTIAL ENERGY FOR THE CURRENT HOLE REGION IN TOKAMAKS

    International Nuclear Information System (INIS)

    CHU, M.S; PARKS, P.B

    2004-01-01

    The current hole region in the tokamak has been observed to arise naturally during the development of internal transport barriers. The magnetohydrodynamic (MHD) potential energy in the current hole region is shown to be determined completely in terms of the displacements at the edge of the current hole. For modes with finite toroidal mode number n ≠ 0, the minimized potential energy is the same as if the current hole region were a vacuum region. For modes with toroidal mode number n = 0, the displacement is a superposition of three types of independent displacements: a vertical displacement or displacements that compress only the plasma or the toroidal field uniformly. Thus for ideal MHD perturbations of plasma with a current hole, the plasma behaves as if it were bordered by an extra ''internal vacuum region''. The relevance of the present work to computer simulations of plasma with a current hole region is also discussed

  20. Production of infectious chimeric hepatitis C virus genotype 2b harboring minimal regions of JFH-1.

    Science.gov (United States)

    Murayama, Asako; Kato, Takanobu; Akazawa, Daisuke; Sugiyama, Nao; Date, Tomoko; Masaki, Takahiro; Nakamoto, Shingo; Tanaka, Yasuhito; Mizokami, Masashi; Yokosuka, Osamu; Nomoto, Akio; Wakita, Takaji

    2012-02-01

    To establish a cell culture system for chimeric hepatitis C virus (HCV) genotype 2b, we prepared a chimeric construct harboring the 5' untranslated region (UTR) to the E2 region of the MA strain (genotype 2b) and the region of p7 to the 3' UTR of the JFH-1 strain (genotype 2a). This chimeric RNA (MA/JFH-1.1) replicated and produced infectious virus in Huh7.5.1 cells. Replacement of the 5' UTR of this chimera with that from JFH-1 (MA/JFH-1.2) enhanced virus production, but infectivity remained low. In a long-term follow-up study, we identified a cell culture-adaptive mutation in the core region (R167G) and found that it enhanced virus assembly. We previously reported that the NS3 helicase (N3H) and the region of NS5B to 3' X (N5BX) of JFH-1 enabled replication of the J6CF strain (genotype 2a), which could not replicate in cells. To reduce JFH-1 content in MA/JFH-1.2, we produced a chimeric viral genome for MA harboring the N3H and N5BX regions of JFH-1, combined with a JFH-1 5' UTR replacement and the R167G mutation (MA/N3H+N5BX-JFH1/R167G). This chimeric RNA replicated efficiently, but virus production was low. After the introduction of four additional cell culture-adaptive mutations, MA/N3H+N5BX-JFH1/5am produced infectious virus efficiently. Using this chimeric virus harboring minimal regions of JFH-1, we analyzed interferon sensitivity and found that this chimeric virus was more sensitive to interferon than JFH-1 and another chimeric virus containing more regions from JFH-1 (MA/JFH-1.2/R167G). In conclusion, we established an HCV genotype 2b cell culture system using a chimeric genome harboring minimal regions of JFH-1. This cell culture system may be useful for characterizing genotype 2b viruses and developing antiviral strategies.

  1. Perspectives on Promoting Regional Renewable Energy Research and Development

    International Nuclear Information System (INIS)

    Dresselhaus, M.

    2008-01-01

    Recent discussions at the Washington International Renewable Energy Conference (WIREC), hosted in March 2008 by the United States Government, with nearly 9000 participants including 103 ministers from 126 countries, concluded that a major acceleration in the adoption of renewable energy technologies was needed by mid-century. Because of different climatic conditions and societal preferences, regional cooperation is expected to play a major role in the efficient adoption of appropriate renewable energy technologies, and countries with special expertise in specific technologies seem eager to collaborate internationally to promote global goals in renewable energy. A review will be given of what we learned from this conference about renewable energy research and development strategies with a special focus given to using this basic knowledge base to promote the development of renewable energy technologies appropriate to specific regions of the world.(author)

  2. Mechanosensitive promoter region in the human HB-GAM gene

    DEFF Research Database (Denmark)

    Liedert, Astrid; Kassem, Moustapha; Claes, Lutz

    2009-01-01

    Mechanical loading is essential for maintaining bone mass in the adult skeleton. However, the underlying process of the transfer of the physical stimulus into a biochemical response, which is termed mechanotransduction is poorly understood. Mechanotransduction results in the modulation of gene...... cells. Analysis of the human HB-GAM gene upstream regulatory region with luciferase reporter gene assays revealed that the upregulation of HB-GAM expression occurred at the transcriptional level and was mainly dependent on the HB-GAM promoter region most upstream containing three potential AP-1 binding...

  3. Identification and characterization of a liver stage-specific promoter region of the malaria parasite Plasmodium.

    Directory of Open Access Journals (Sweden)

    Susanne Helm

    Full Text Available During the blood meal of a Plasmodium-infected mosquito, 10 to 100 parasites are inoculated into the skin and a proportion of these migrate via the bloodstream to the liver where they infect hepatocytes. The Plasmodium liver stage, despite its clinical silence, represents a highly promising target for antimalarial drug and vaccine approaches. Successfully invaded parasites undergo a massive proliferation in hepatocytes, producing thousands of merozoites that are transported into a blood vessel to infect red blood cells. To successfully develop from the liver stage into infective merozoites, a tight regulation of gene expression is needed. Although this is a very interesting aspect in the biology of Plasmodium, little is known about gene regulation in Plasmodium parasites in general and in the liver stage in particular. We have functionally analyzed a novel promoter region of the rodent parasite Plasmodium berghei that is exclusively active during the liver stage of the parasite. To prove stage-specific activity of the promoter, GFP and luciferase reporter assays have been successfully established, allowing both qualitative and accurate quantitative analysis. To further characterize the promoter region, the transcription start site was mapped by rapid amplification of cDNA ends (5'-RACE. Using promoter truncation experiments and site-directed mutagenesis within potential transcription factor binding sites, we suggest that the minimal promoter contains more than one binding site for the recently identified parasite-specific ApiAP2 transcription factors. The identification of a liver stage-specific promoter in P. berghei confirms that the parasite is able to tightly regulate gene expression during its life cycle. The identified promoter region might now be used to study the biology of the Plasmodium liver stage, which has thus far proven problematic on a molecular level. Stage-specific expression of dominant-negative mutant proteins and

  4. Nucleopolis for promoting the nuclear excellence of the Normandy region

    International Nuclear Information System (INIS)

    2016-01-01

    Nucleopolis is the Norman economic pole dedicated to nuclear energy, nuclear medicine and nuclear safety, it gathers about 70 enterprises whatever their sizes, research laboratories and teaching or training units. Nucleopolis was founded in 2009 with the economic development of the region as a unique purpose. Nucleopolis will ease the access of its members to local, national and international markets through actions of networking and by promoting innovations and skill development. Nucleopolis proposes to its members a series of services around 4 departments: Nucleo'Network to promote networking between the members themselves and between the members and major contractors; Nucleo'Business to propose assistance in national and international business; Nucleo'Competence to propose adequate training to its members to upgrade their skills and Nucleo'Innovation to foster collaborative work between its members on innovative projects. (A.C.)

  5. Fine-tuning of protein domain boundary by minimizing potential coiled coil regions

    International Nuclear Information System (INIS)

    Iwaya, Naoko; Goda, Natsuko; Unzai, Satoru; Fujiwara, Kenichiro; Tanaka, Toshiki; Tomii, Kentaro; Tochio, Hidehito; Shirakawa, Masahiro; Hiroaki, Hidekazu

    2007-01-01

    Structural determination of individual protein domains isolated from multidomain proteins is a common approach in the post-genomic era. Novel and thus uncharacterized domains liberated from intact proteins often self-associate due to incorrectly defined domain boundaries. Self-association results in missing signals, poor signal dispersion and a low signal-to-noise ratio in 1 H- 15 N HSQC spectra. We have found that a putative, non-canonical coiled coil region close to a domain boundary can cause transient hydrophobic self-association and monomer-dimer equilibrium in solution. Here we propose a rational method to predict putative coiled coil regions adjacent to the globular core domain using the program COILS. Except for the amino acid sequence, no preexisting knowledge concerning the domain is required. A small number of mutant proteins with a minimized coiled coil region have been rationally designed and tested. The engineered domains exhibit decreased self-association as assessed by 1 H- 15 N HSQC spectra with improved peak dispersion and sharper cross peaks. Two successful examples of isolating novel N-terminal domains from AAA-ATPases are demonstrated. Our method is useful for the experimental determination of domain boundaries suited for structural genomics studies

  6. Fine-tuning of protein domain boundary by minimizing potential coiled coil regions.

    Science.gov (United States)

    Iwaya, Naoko; Goda, Natsuko; Unzai, Satoru; Fujiwara, Kenichiro; Tanaka, Toshiki; Tomii, Kentaro; Tochio, Hidehito; Shirakawa, Masahiro; Hiroaki, Hidekazu

    2007-01-01

    Structural determination of individual protein domains isolated from multidomain proteins is a common approach in the post-genomic era. Novel and thus uncharacterized domains liberated from intact proteins often self-associate due to incorrectly defined domain boundaries. Self-association results in missing signals, poor signal dispersion and a low signal-to-noise ratio in (1)H-(15)N HSQC spectra. We have found that a putative, non-canonical coiled coil region close to a domain boundary can cause transient hydrophobic self-association and monomer-dimer equilibrium in solution. Here we propose a rational method to predict putative coiled coil regions adjacent to the globular core domain using the program COILS. Except for the amino acid sequence, no preexisting knowledge concerning the domain is required. A small number of mutant proteins with a minimized coiled coil region have been rationally designed and tested. The engineered domains exhibit decreased self-association as assessed by (1)H-(15)N HSQC spectra with improved peak dispersion and sharper cross peaks. Two successful examples of isolating novel N-terminal domains from AAA-ATPases are demonstrated. Our method is useful for the experimental determination of domain boundaries suited for structural genomics studies.

  7. "I Can't Lie to Your Face": Minimal Face-to-Face Interaction Promotes Honestry

    OpenAIRE

    Van Zant, Alex B.; Kray, Laura J.

    2013-01-01

    In the current research, we consider how gender composition may impact the likelihood of deception in contexts with asymmetric information where one party has the opportunity to strategically deceive another party for the opportunity to gain economically. We predict that the combined processes of social categorization and social projection should make people more likely to presume trust from same-gender others than different-gender others. Because anonymous interactions promote the tendency t...

  8. Strategies to promote a climate of academic integrity and minimize student cheating and plagiarism.

    Science.gov (United States)

    Scanlan, Craig L

    2006-01-01

    Student academic misconduct is a growing problem for colleges and universities, including those responsible for preparing health professionals. Although the implementation of honor codes has had a positive impact on this problem, further reduction in student cheating and plagiarism can be achieved only via a comprehensive strategy that promotes an institutional culture of academic integrity. Such a strategy must combine efforts both to deter and detect academic misconduct, along with fair but rigorous application of sanctions against such behaviors. Methods useful in preventing or deterring dishonest behaviors among students include early integrity training complemented with course-level reinforcement, faculty role-modeling, and the application of selected testing/assignment preventive strategies, including honor pledges and honesty declarations. Giving students more responsibility for oversight of academic integrity also may help address this problem and better promote the culture needed to uphold its principles. Successful enforcement requires that academic administration provide strong and visible support for upholding academic integrity standards, including the provision of a clear and fair process and the consistent application of appropriate sanctions against those whose conduct is found to violate these standards.

  9. A Sparsity-Promoted Method Based on Majorization-Minimization for Weak Fault Feature Enhancement.

    Science.gov (United States)

    Ren, Bangyue; Hao, Yansong; Wang, Huaqing; Song, Liuyang; Tang, Gang; Yuan, Hongfang

    2018-03-28

    Fault transient impulses induced by faulty components in rotating machinery usually contain substantial interference. Fault features are comparatively weak in the initial fault stage, which renders fault diagnosis more difficult. In this case, a sparse representation method based on the Majorzation-Minimization (MM) algorithm is proposed to enhance weak fault features and extract the features from strong background noise. However, the traditional MM algorithm suffers from two issues, which are the choice of sparse basis and complicated calculations. To address these challenges, a modified MM algorithm is proposed in which a sparse optimization objective function is designed firstly. Inspired by the Basis Pursuit (BP) model, the optimization function integrates an impulsive feature-preserving factor and a penalty function factor. Second, a modified Majorization iterative method is applied to address the convex optimization problem of the designed function. A series of sparse coefficients can be achieved through iterating, which only contain transient components. It is noteworthy that there is no need to select the sparse basis in the proposed iterative method because it is fixed as a unit matrix. Then the reconstruction step is omitted, which can significantly increase detection efficiency. Eventually, envelope analysis of the sparse coefficients is performed to extract weak fault features. Simulated and experimental signals including bearings and gearboxes are employed to validate the effectiveness of the proposed method. In addition, comparisons are made to prove that the proposed method outperforms the traditional MM algorithm in terms of detection results and efficiency.

  10. Promotion and regional development. Implementation of regional productive development agencies. The case of Maule region, Chile

    Directory of Open Access Journals (Sweden)

    Enrique Yamil Alul González

    2010-12-01

    Full Text Available The Regional Productive Development Agencies implemented in Chile in 2006, were developed as a way to answer the longing desire to territorially decentralize, and that the own Regions be whom define their future. The Agencies have the responsibility to develop innovation and productive development Agendas in participative processes, which means with public, academic and private actors. Also, the Agencies have the mission to implement Competitive Improvement Plans-PMC (clusters in prioritized economic sectors by the own region. These PMC are leaded by private actors in each sector.

  11. Genetic recombination is targeted towards gene promoter regions in dogs.

    Science.gov (United States)

    Auton, Adam; Rui Li, Ying; Kidd, Jeffrey; Oliveira, Kyle; Nadel, Julie; Holloway, J Kim; Hayward, Jessica J; Cohen, Paula E; Greally, John M; Wang, Jun; Bustamante, Carlos D; Boyko, Adam R

    2013-01-01

    The identification of the H3K4 trimethylase, PRDM9, as the gene responsible for recombination hotspot localization has provided considerable insight into the mechanisms by which recombination is initiated in mammals. However, uniquely amongst mammals, canids appear to lack a functional version of PRDM9 and may therefore provide a model for understanding recombination that occurs in the absence of PRDM9, and thus how PRDM9 functions to shape the recombination landscape. We have constructed a fine-scale genetic map from patterns of linkage disequilibrium assessed using high-throughput sequence data from 51 free-ranging dogs, Canis lupus familiaris. While broad-scale properties of recombination appear similar to other mammalian species, our fine-scale estimates indicate that canine highly elevated recombination rates are observed in the vicinity of CpG rich regions including gene promoter regions, but show little association with H3K4 trimethylation marks identified in spermatocytes. By comparison to genomic data from the Andean fox, Lycalopex culpaeus, we show that biased gene conversion is a plausible mechanism by which the high CpG content of the dog genome could have occurred.

  12. Two negative cis-regulatory regions involved in fruit-specific promoter activity from watermelon (Citrullus vulgaris S.).

    Science.gov (United States)

    Yin, Tao; Wu, Hanying; Zhang, Shanglong; Lu, Hongyu; Zhang, Lingxiao; Xu, Yong; Chen, Daming; Liu, Jingmei

    2009-01-01

    A 1.8 kb 5'-flanking region of the large subunit of ADP-glucose pyrophosphorylase, isolated from watermelon (Citrullus vulgaris S.), has fruit-specific promoter activity in transgenic tomato plants. Two negative regulatory regions, from -986 to -959 and from -472 to -424, were identified in this promoter region by fine deletion analyses. Removal of both regions led to constitutive expression in epidermal cells. Gain-of-function experiments showed that these two regions were sufficient to inhibit RFP (red fluorescent protein) expression in transformed epidermal cells when fused to the cauliflower mosaic virus (CaMV) 35S minimal promoter. Gel mobility shift experiments demonstrated the presence of leaf nuclear factors that interact with these two elements. A TCCAAAA motif was identified in these two regions, as well as one in the reverse orientation, which was confirmed to be a novel specific cis-element. A quantitative beta-glucuronidase (GUS) activity assay of stable transgenic tomato plants showed that the activities of chimeric promoters harbouring only one of the two cis-elements, or both, were approximately 10-fold higher in fruits than in leaves. These data confirm that the TCCAAAA motif functions as a fruit-specific element by inhibiting gene expression in leaves.

  13. New method for minimizing regular functions with constraints on parameter region

    International Nuclear Information System (INIS)

    Kurbatov, V.S.; Silin, I.N.

    1993-01-01

    The new method of function minimization is developed. Its main features are considered. It is possible minimization of regular function with the arbitrary structure. For χ 2 -like function the usage of simplified second derivatives is possible with the control of correctness. The constraints of arbitrary structure can be used. The means for fast movement along multidimensional valleys are used. The method is tested on real data of K π2 decay of the experiment on rare K - -decays. 6 refs

  14. US-India Technical Collaboration to Promote Regional Stability

    International Nuclear Information System (INIS)

    Killinger, Mark H.; Griggs, James R.; Apt, Kenneth E.; Doyle, James E.

    2001-01-01

    Two US-India documents were signed in 2000 that provided new impetus for scientific and technical cooperation between the two countries. The first document is the US-India Science and Technology Agreement, which is aimed at 'promoting scientific and technological cooperation between the people of their two countries.' The second is the US-India Joint Statement on Energy and Environment, which states 'the United States and India believe that energy and environment could be one of the most important areas of cooperation between the two countries.' In addition to the work already underway as part of these two agreements, DOE has established a US-India Science and Technology Initiative to utilize the expertise of DOE national laboratories to conduct activities that support US policy objectives in South Asia. PNNL and LANL are working with US agencies and the Indian government and scientific communities to identify appropriate non-sensitive areas for US-Indian technical collaboration. The objectives of such collaboration are to address visible national/international problems, build trust between the United States and India, and contribute to regional stability in South Asia. This paper describes research done on the Indian scientific organization and infrastructure, potential areas for collaboration, the approach for this engagement, and current status of the initiative.

  15. US-INDIA TECHNICAL COLLABORATION TO PROMOTE REGIONAL STABILITY

    International Nuclear Information System (INIS)

    Killinger, M.H.; Griggs, J.R.; Apt, Kenneth E.; Doyle, J.E.

    2001-01-01

    Two US-India documents were signed in 2000 that provided new impetus for scientific and technical cooperation between the two countries. The first document is the US-India Science and Technology Agreement, which is aimed at 'promoting scientific and technological cooperation between the people of their two countries.' The second is the US-India Joint Statement on Energy and Environment, which states 'the United States and India believe that energy and environment could be one of the most important areas of cooperation between the two countries.' In addition to the work already underway as part of these two agreements, the US Department of Energy (DOE) has established a US-India Science and Technology Initiative to utilize the expertise of DOE national laboratories to conduct activities that support US policy objectives in South Asia. PNNL and LANL are working with US government agencies to identify appropriate non-sensitive, non-nuclear areas for US-Indian technical collaboration. The objectives of such collaboration are to address visible national and international problems, build trust between the United States and India, and contribute to regional stability in South Asia. This paper describes the approach for this engagement, the Indian scientific organization and infrastructure, potential areas for collaboration, and current status of the initiative.

  16. Efficient construction of an inverted minimal H1 promoter driven siRNA expression cassette: facilitation of promoter and siRNA sequence exchange.

    Directory of Open Access Journals (Sweden)

    Hoorig Nassanian

    2007-08-01

    Full Text Available RNA interference (RNAi, mediated by small interfering RNA (siRNA, is an effective method used to silence gene expression at the post-transcriptional level. Upon introduction into target cells, siRNAs incorporate into the RNA-induced silencing complex (RISC. The antisense strand of the siRNA duplex then "guides" the RISC to the homologous mRNA, leading to target degradation and gene silencing. In recent years, various vector-based siRNA expression systems have been developed which utilize opposing polymerase III promoters to independently drive expression of the sense and antisense strands of the siRNA duplex from the same template.We show here the use of a ligase chain reaction (LCR to develop a new vector system called pInv-H1 in which a DNA sequence encoding a specific siRNA is placed between two inverted minimal human H1 promoters (approximately 100 bp each. Expression of functional siRNAs from this construct has led to efficient silencing of both reporter and endogenous genes. Furthermore, the inverted H1 promoter-siRNA expression cassette was used to generate a retrovirus vector capable of transducing and silencing expression of the targeted protein by>80% in target cells.The unique design of this construct allows for the efficient exchange of siRNA sequences by the directional cloning of short oligonucleotides via asymmetric restriction sites. This provides a convenient way to test the functionality of different siRNA sequences. Delivery of the siRNA cassette by retroviral transduction suggests that a single copy of the siRNA expression cassette efficiently knocks down gene expression at the protein level. We note that this vector system can potentially be used to generate a random siRNA library. The flexibility of the ligase chain reaction suggests that additional control elements can easily be introduced into this siRNA expression cassette.

  17. Business networking for SMEs as a means to promote regional competitiveness: A Theoretical Framework

    OpenAIRE

    Vitor Braga

    2004-01-01

    The competitiveness of regions, as a means of promoting the competitiveness of a country as a whole, has been one of the main topics on the agenda of policy makers over the last decades. Several attempts at promoting competitiveness have been made with different degrees of success. In most cases, public investment in the regions was perceived as the solution to promote regional competitiveness and top-down policies were implemented. However, competitiveness also has an important dimension tha...

  18. The Quality of the Embedding Potential Is Decisive for Minimal Quantum Region Size in Embedding Calculations

    DEFF Research Database (Denmark)

    Nåbo, Lina J; Olsen, Jógvan Magnus Haugaard; Martínez, Todd J

    2017-01-01

    correct description of the MM region, and that this enables the use of much smaller QM regions compared to fixed charge electrostatic embedding. Furthermore, absorption intensities converge very slowly with system size and inclusion of effective external field effects in the MM region through...

  19. Constructing a State Policy To Promote Regionalism in School Government.

    Science.gov (United States)

    Zukowsky, Jerome; And Others.

    This paper defines regionalism, sets some tentative directions for the concept, and raises difficult questions related to its application in New York State. Regionalism, which offers an alternative to a State-local school governing system, is used to decentralize the planning and management of public services. A regional unit permits district…

  20. DNA methylation of PTEN gene promoter region is not correlated ...

    African Journals Online (AJOL)

    Tumor suppressor gene PTEN plays an important role in cell cycle. Disorder of PTEN protein can cause cell growth and division in an uncontrolled way, which can lead to the formation of tumors. It has been proven that epigenetic mechanisms, such as promoter hypermethylation, may account for inactivation of PTEN in a ...

  1. Promoting regional energy co-operation in South Asia

    International Nuclear Information System (INIS)

    Srivastava, Leena; Misra, Neha

    2007-01-01

    Energy is a key ingredient of the socio-economic development of any region. South Asia is not only one of the fastest growing regions in the world; it is also one of the poorest, which thus puts energy at the very heart of the development process in the region. This paper looks at the challenges faced by the South Asia sub-region for economic co-operation (SASEC) comprised of Bangladesh, Bhutan, India and Nepal, and also at the role of greater regional energy co-operation therein. The region is characterized by pressures of growing economies and increasing population. While the per capita energy consumption is one of the lowest in the world, energy intensity continues to be very high. A large portion of the population lacks access to modern sources of energy and depends on traditional sources that are not only inefficient but also have severe health and environmental problems associated with them. Increasing oil import dependency and huge investment needs for energy market development pose a further challenge. The region has a good resource potential and tremendous scope for energy co-operation, which can play a key role in addressing many of these energy security concerns and in putting it on the path of sustainable development. It is ironic that the record in the area has been so limited and that too in the most basic form of co-operation, i.e. bilateral arrangements between countries. This paper puts forth a multi-pronged strategy for sub-regional energy co-operation encompassing softer options aimed at confidence building to more substantial and larger scale co-operation efforts. Delays in decision making to ensure stronger and mutually beneficial co-operation efforts are associated with high costs not only to the energy sector but also for the entire development agenda. With the precarious energy situation in the region and unprecedented increases in international oil prices seen in recent times, it is high time for policy makers, financing institutions, NGOs

  2. The Digital North Denmark Programme -Promoting Regional Change?

    DEFF Research Database (Denmark)

    Østergaard, Christian Richter

    2007-01-01

    The Digital North Denmark (DDN) was an IT programme running from 2000 to 2003 in the North Jutland County in Denmark with national government support of € 23 million. The Danish government initiated the programme with the aim of further strengthening regions with an already proven ICT capability...... (Dybkjær and Lindegaard, 1999, p.96-100). The declared approach was to build on the existing competencies in industry as well as at universities. The national government chose two regions – Ørestaden, a new concentration of knowledge-based institutions near Copenhagen Airport, and North Jutland......-offers within four themes. The participants - meant to be project consortia of ideally private firms, public or private organisations as well as regional and municipal government bodies - could get a maximum national government support of one third of the total project sum.This chapter investigates how...

  3. Development of a YAC contig covering the minimal region of a CSNB1 locus in Xp11

    Energy Technology Data Exchange (ETDEWEB)

    Boycott, K.M.; Gratton, K.J.; Moore, B.J. [Univ. of Calgary (Canada)] [and others

    1994-09-01

    X-linked congenital stationary night blindness (CSNB1) is an eye disorder that includes impairment of night vision, reduced visual acuity and, in some cases, myopia and congenital nystagmus. Electroretinography reveals a marked reduction of the b-wave in affected individuals suggesting that X-linked CSNB is due to a molecular defect in the bipolar layer of the retina. Based on our studies of a large four generation family with X-linked CSNB, a CSNB1 locus was mapped to a 4-5 cM region at Xp11.23-Xp11.22 bounded telomerically by DXS426 and centromerically by DXS988. Using a panel of radiation and conventional somatic cell hybrids, a detailed map of new and published STSs has been generated for the minimal region of CSNB1. PCR primer pairs for STSs has been generated for the minimal region of CSNB1. PCR primer pairs for twenty-five STSs, including eleven end-clones, were used to isolate YAC clones from CEPH, mega-CEPH, and X chromosome-specific YAC libraries. In total, fifty-two YACs were characterized for STS overlaps and assembled to provide a minimum of 3 Mb of physical coverage in the region between DXS426 and DXS988. Five gaps proximal to SYP are still to be closed. Our physical map suggests the following gene order: Xpter-OTAL1-GF1-DXS1011E-MG81-HUMCRAS2P-SYP-Xcen. STS analysis of the YACs revealed three subregions of the physical map which appear to be particularly susceptible to internal deletions and end-clone analysis demonstrated chimerism in six of seventeen YACs. A physical map of Xp11.23-Xp11.22 will provide a resource for the isolation of candidate genes for the X-linked CSNB gene which maps to this region.

  4. A prospective evaluation of first people's health promotion program design in the goulburn-murray rivers region.

    Science.gov (United States)

    Doyle, Joyce; Atkinson-Briggs, Sharon; Atkinson, Petah; Firebrace, Bradley; Calleja, Julie; Reilly, Rachel; Cargo, Margaret; Riley, Therese; Crumpen, Tui; Rowley, Kevin

    2016-11-10

    Aboriginal Community Controlled Organisations (ACCOs) provide community-focussed and culturally safe services for First Peoples in Australia, including crisis intervention and health promotion activities, in a holistic manner. The ecological model of health promotion goes some way towards describing the complexity of such health programs. The aims of this project were to: 1) identify the aims and purpose of existing health promotion programs conducted by an alliance of ACCOs in northern Victoria, Australia; and 2) evaluate the extent to which these programs are consistent with an ecological model of health promotion, addressing both individual and environmental determinants of health. The project arose from a long history of collaborative research. Three ACCOs and a university formed the Health Promotion Alliance to evaluate their health promotion programs. Local community members were trained in, and contributed to developing culturally sensitive methods for, data collection. Information on the aims and design of 88 health promotion activities making up 12 different programs across the ACCOs was systematically and prospectively collected. There was a wide range of activities addressing environmental and social determinants of health, as well as physical activity, nutrition and weight loss. The design of the great majority of activities had a minimal Western influence and were designed within a local Aboriginal cultural framework. The most common focus of the activities was social connectedness (76 %). Physical activity was represented in two thirds of the activities, and nutrition, weight loss and culture were each a focus of about half of the activities. A modified coding procedure designed to assess the ecological nature of these programs showed that they recruited from multiple settings; targeted a range of individual, social and environmental determinants; and used numerous and innovative strategies to achieve change. First Peoples' health promotion in the

  5. A prospective evaluation of first people’s health promotion program design in the goulburn-murray rivers region

    Directory of Open Access Journals (Sweden)

    Joyce Doyle

    2016-11-01

    Full Text Available Abstract Background Aboriginal Community Controlled Organisations (ACCOs provide community-focussed and culturally safe services for First Peoples in Australia, including crisis intervention and health promotion activities, in a holistic manner. The ecological model of health promotion goes some way towards describing the complexity of such health programs. The aims of this project were to: 1 identify the aims and purpose of existing health promotion programs conducted by an alliance of ACCOs in northern Victoria, Australia; and 2 evaluate the extent to which these programs are consistent with an ecological model of health promotion, addressing both individual and environmental determinants of health. Methods The project arose from a long history of collaborative research. Three ACCOs and a university formed the Health Promotion Alliance to evaluate their health promotion programs. Local community members were trained in, and contributed to developing culturally sensitive methods for, data collection. Information on the aims and design of 88 health promotion activities making up 12 different programs across the ACCOs was systematically and prospectively collected. Results There was a wide range of activities addressing environmental and social determinants of health, as well as physical activity, nutrition and weight loss. The design of the great majority of activities had a minimal Western influence and were designed within a local Aboriginal cultural framework. The most common focus of the activities was social connectedness (76 %. Physical activity was represented in two thirds of the activities, and nutrition, weight loss and culture were each a focus of about half of the activities. A modified coding procedure designed to assess the ecological nature of these programs showed that they recruited from multiple settings; targeted a range of individual, social and environmental determinants; and used numerous and innovative strategies to

  6. A new polymorphism in goat β-lactoglobulin promoter region

    Directory of Open Access Journals (Sweden)

    Mirella Graziano

    2003-01-01

    Full Text Available An individual variability in β-lactoglobulin content has been previously observed in Girgentana goat milk by HPLC analysis. To identify eventual mutations affecting the transcription level of the gene, the prooter region was characterized in goats showing an anomalous phenotype, consisting in a reduced content of β-lactoglobulin respect to α-lactoalbumine. A single nucleotide substitution not previously reported has been detected. A PCR-RFLP procedure was developed for fast detection of the mutation in different goat breeds: Girgentana, Garganica, Sarda, Alpine, Montefalcone and Saanen. The Montefalcone goat showed the highest frequency of the mutation, confirming one more the peculiarity of this breed.

  7. Research Update: A minimal region of squid reflectin for vapor-induced light scattering

    Directory of Open Access Journals (Sweden)

    Patrick B. Dennis

    2017-12-01

    Full Text Available Reflectins are a family of proteins found in the light manipulating cells of cephalopods. These proteins are made up of a series of conserved repeats that contain highly represented amino acids thought to be important for function. Previous studies demonstrated that recombinant reflectins cast into thin films produced structural colors that could be dynamically modulated via changing environmental conditions. In this study, we demonstrate light scattering from reflectin films following exposure to a series of water vapor pulses. Analysis of film surface topography shows that the induction of light scatter is accompanied by self-assembly of reflectins into micro- and nanoscale features. Using a reductionist strategy, we determine which reflectin repeats and sub-repeats are necessary for these events following water vapor pulsing. With this approach, we identify a singly represented, 23-amino acid region in reflectins as being sufficient to recapitulate the light scattering properties observed in thin films of the full-length protein. Finally, the aqueous stability of reflectin films is leveraged to show that pre-exposure to buffers of varying pH can modulate the ability of water vapor pulses to induce light scatter and protein self-assembly.

  8. Research Update: A minimal region of squid reflectin for vapor-induced light scattering

    Science.gov (United States)

    Dennis, Patrick B.; Singh, Kristi M.; Vasudev, Milana C.; Naik, Rajesh R.; Crookes-Goodson, Wendy J.

    2017-12-01

    Reflectins are a family of proteins found in the light manipulating cells of cephalopods. These proteins are made up of a series of conserved repeats that contain highly represented amino acids thought to be important for function. Previous studies demonstrated that recombinant reflectins cast into thin films produced structural colors that could be dynamically modulated via changing environmental conditions. In this study, we demonstrate light scattering from reflectin films following exposure to a series of water vapor pulses. Analysis of film surface topography shows that the induction of light scatter is accompanied by self-assembly of reflectins into micro- and nanoscale features. Using a reductionist strategy, we determine which reflectin repeats and sub-repeats are necessary for these events following water vapor pulsing. With this approach, we identify a singly represented, 23-amino acid region in reflectins as being sufficient to recapitulate the light scattering properties observed in thin films of the full-length protein. Finally, the aqueous stability of reflectin films is leveraged to show that pre-exposure to buffers of varying pH can modulate the ability of water vapor pulses to induce light scatter and protein self-assembly.

  9. Graduate Management Project (GMP) Retrospective Analysis of Promotional Mediums for Tricare Prime in Tricare Region 11

    National Research Council Canada - National Science Library

    Carpenter, Steven

    1997-01-01

    This study provides retrospective market research information about the population who enrolled in TRICARE Prime in TRICARE Region 11 and the advertising mediums used to promote enrollment in the TRICARE Prime program...

  10. Active sales promotion in urban regions; Aktive Verkaufsfoerderung in Verdichtungsgebieten

    Energy Technology Data Exchange (ETDEWEB)

    Becker, H.D. [Oeffentlichkeitsarbeit, Maingas AG, Frankfurt am Main (Germany)

    1995-03-01

    The first step in any worthwhile marketing strategy for urban regions is to make a survey of all real estates without a gas supply. The data stock thus obtained serves as a short, medium, and long-term basis for all further activity. It cal be used to set up yearly personnel and activity plans. The activities are rounded off by incentives in the form of conversion aids or financing offers and additional measures presented within a Full Service Package Defining clear aims makes it easier to evaluate the success of the activities. (orig.) [Deutsch] Der erste Schritt zu einer erfolgreichen Marktbearbeitung in Verdichtungsgebieten ist die Erhebung aller Liegenschaften ohne Gasversorgung. Der gewonnene Datenbestand dient kurz-, mittel- und langfristig als Grundlage aller Aktivitaeten. Eine Personal- und Aktivitaetenplanung kann jaehrlich daraus abgeleitet werden. Kaufanreize in Form von Umstellhilfen, Finanzierungsangeboten und zusaetzlichen Dienstleistungen im Rahmen eines Full-Service-Angebotes runden die Aktivitaeten ab. Die klare Vorgabe von Zielen erleichert die Erfolgskontrolle. (orig.)

  11. Social Media Marketing as a tool for promoting the regional investment portals

    Directory of Open Access Journals (Sweden)

    Alisa Yu. Fadeyeva

    2016-01-01

    Full Text Available Objective to investigate the potential of Social Media Marketing as a tool for promoting regional investment portals in the information environment to identify the most effective ways of its implementation and to determine the level of mastering of this tool by the Russian regions. Methods general scientific methods observation comparison analysis induction deduction analogy classification. Results the analysis showed that today Social Media Marketing is an essential tool for interaction with the investment community and one of the most effective ways to promote the regional portal which allows to increase the knowledge of and loyalty to the brand to increase the targeted website traffic to increase the awareness of investors about the specific features of the portal and the regional development agenciesrsquo functioning to promptly receive information about the investment environment and to establish contacts with investors. At the same time the study of SMMactivity in the Russian regions revealed a very low level of quality of communication with investors through social networks. Scientific novelty for the first time the article investigates the significance and makes the comparative analysis of the Social Media Marketing channels with regard to investment promotion agencies as well as the results of the regional structures functioning for effective communication through social networks. Practical significance the main results of the research can be used by the regional investment agencies in order to promote their websites increase the quality of communication with investors and promote the investment attractiveness of the region as a whole. nbsp

  12. The Effect of the Retroperitoneal Transpsoas Minimally Invasive Lateral Interbody Fusion on Segmental and Regional Lumbar Lordosis

    Directory of Open Access Journals (Sweden)

    Tien V. Le

    2012-01-01

    Full Text Available Background. The minimally invasive lateral interbody fusion (MIS LIF in the lumbar spine can correct coronal Cobb angles, but the effect on sagittal plane correction is unclear. Methods. A retrospective review of thirty-five patients with lumbar degenerative disease who underwent MIS LIF without supplemental posterior instrumentation was undertaken to study the radiographic effect on the restoration of segmental and regional lumbar lordosis using the Cobb angles on pre- and postoperative radiographs. Mean disc height changes were also measured. Results. The mean follow-up period was 13.3 months. Fifty total levels were fused with a mean of 1.42 levels fused per patient. Mean segmental Cobb angle increased from 11.10° to 13.61° (<0.001 or 22.6%. L2-3 had the greatest proportional increase in segmental lordosis. Mean regional Cobb angle increased from 52.47° to 53.45° (=0.392. Mean disc height increased from 6.50 mm to 10.04 mm (<0.001 or 54.5%. Conclusions. The MIS LIF improves segmental lordosis and disc height in the lumbar spine but not regional lumbar lordosis. Anterior longitudinal ligament sectioning and/or the addition of a more lordotic implant may be necessary in cases where significant increases in regional lumbar lordosis are desired.

  13. Genome-wide analysis of regions similar to promoters of histone genes

    KAUST Repository

    Chowdhary, Rajesh

    2010-05-28

    Background: The purpose of this study is to: i) develop a computational model of promoters of human histone-encoding genes (shortly histone genes), an important class of genes that participate in various critical cellular processes, ii) use the model so developed to identify regions across the human genome that have similar structure as promoters of histone genes; such regions could represent potential genomic regulatory regions, e.g. promoters, of genes that may be coregulated with histone genes, and iii/ identify in this way genes that have high likelihood of being coregulated with the histone genes.Results: We successfully developed a histone promoter model using a comprehensive collection of histone genes. Based on leave-one-out cross-validation test, the model produced good prediction accuracy (94.1% sensitivity, 92.6% specificity, and 92.8% positive predictive value). We used this model to predict across the genome a number of genes that shared similar promoter structures with the histone gene promoters. We thus hypothesize that these predicted genes could be coregulated with histone genes. This hypothesis matches well with the available gene expression, gene ontology, and pathways data. Jointly with promoters of the above-mentioned genes, we found a large number of intergenic regions with similar structure as histone promoters.Conclusions: This study represents one of the most comprehensive computational analyses conducted thus far on a genome-wide scale of promoters of human histone genes. Our analysis suggests a number of other human genes that share a high similarity of promoter structure with the histone genes and thus are highly likely to be coregulated, and consequently coexpressed, with the histone genes. We also found that there are a large number of intergenic regions across the genome with their structures similar to promoters of histone genes. These regions may be promoters of yet unidentified genes, or may represent remote control regions that

  14. How to promote the regional cooperation in Asia

    Energy Technology Data Exchange (ETDEWEB)

    Nakano, Masayuki [International Affairs and Safeguards Division, Atomic Energy Bureau, Science and Technology Agency, Tokyo (Japan)

    2000-12-01

    The Tenth International Conference for Nuclear Cooperation in Asia was held in Tokyo on March 10, 1999. Representatives participated from Australia, China, Indonesia, Japan, Korea, Malaysia, the Philippines, Thailand, and Vietnam as well as IAEA as an observer. The countries reflected on the positive achievements of the past ten years and affirmed the major goals for the future, the major theme of the meeting being the evolution of the framework. Some typical cooperative activities have result in: (a) new varieties of plants with greater productivity under a range of environmental conditions (b) development and adoptions of improved analytical procedures to track air pollution in major cities where the identification of the major sources will facilitate remediation measures (c) coordinated trials for radiation therapy of cervical cancer and the development of rigorous protocols (d) training of staff in research reactor operation and in the use of research reactors for the study of new materials. The participating countries have committed to reviewing the six existing sub-categories, namely (1) utilization of research reactors, (2,3) application of radiation and radioisotope in the agriculture and the medical fields, (4) public acceptance of nuclear energy, (5) radioactive waste management, and (6) nuclear safety culture. To share knowledge on human resources development within the region and to consider measures for the further development of human resources in relevant fields, a seminar for human resources development, sponsored by Japan, will be held in Japan. The conference will be renamed as (Forum for Nuclear Cooperation in Asia) beginning with the next conference. The Forum for Nuclear Cooperation in Asia will be held in Japan and in a participating country other than Japan in alternating years. To enhance the regional nuclear cooperation activities under this framework, each participating country will register a Coordinator and Project Leaders to facilitate

  15. How to promote the regional cooperation in Asia

    International Nuclear Information System (INIS)

    Nakano, Masayuki

    2000-01-01

    The Tenth International Conference for Nuclear Cooperation in Asia was held in Tokyo on March 10, 1999. Representatives participated from Australia, China, Indonesia, Japan, Korea, Malaysia, the Philippines, Thailand, and Vietnam as well as IAEA as an observer. The countries reflected on the positive achievements of the past ten years and affirmed the major goals for the future, the major theme of the meeting being the evolution of the framework. Some typical cooperative activities have result in: (a) new varieties of plants with greater productivity under a range of environmental conditions (b) development and adoptions of improved analytical procedures to track air pollution in major cities where the identification of the major sources will facilitate remediation measures (c) coordinated trials for radiation therapy of cervical cancer and the development of rigorous protocols (d) training of staff in research reactor operation and in the use of research reactors for the study of new materials. The participating countries have committed to reviewing the six existing sub-categories, namely (1) utilization of research reactors, (2,3) application of radiation and radioisotope in the agriculture and the medical fields, (4) public acceptance of nuclear energy, (5) radioactive waste management, and (6) nuclear safety culture. To share knowledge on human resources development within the region and to consider measures for the further development of human resources in relevant fields, a seminar for human resources development, sponsored by Japan, will be held in Japan. The conference will be renamed as (Forum for Nuclear Cooperation in Asia) beginning with the next conference. The Forum for Nuclear Cooperation in Asia will be held in Japan and in a participating country other than Japan in alternating years. To enhance the regional nuclear cooperation activities under this framework, each participating country will register a Coordinator and Project Leaders to facilitate

  16. Regional differences in gender promotion and scholarly productivity in otolaryngology.

    Science.gov (United States)

    Eloy, Jean Anderson; Mady, Leila J; Svider, Peter F; Mauro, Kevin M; Kalyoussef, Evelyne; Setzen, Michael; Baredes, Soly; Chandrasekhar, Sujana S

    2014-03-01

    To identify whether regional differences exist in gender disparities in scholarly productivity and faculty rank among academic otolaryngologists. Academic otolaryngologists' bibliometric data analyses. Online faculty listings from 98 otolaryngology departments were organized by gender, academic rank, fellowship training status, and institutional location. The Scopus database was used to assess bibliometrics of these otolaryngologists, including the h-index, number of publications, and publication experience. Analysis included 1127 otolaryngologists, 916 men (81.3%) and 211 women (18.7%). Female faculty comprised 15.4% in the Midwest, 18.8% in the Northeast, 21.3% in the South, and 19.0% in the West (P = .44). Overall, men obtained significantly higher senior academic ranks (associate professor or professor) compared to women (59.8% vs. 40.2%, P .05). Gender disparities in academic rank and scholarly productivity exist most notably in the Northeast, where women in otolaryngology are most underrepresented relative to men at senior academic ranks and in scholarly productivity.

  17. Analysis of tissue-specific region in sericin 1 gene promoter of Bombyx mori

    Energy Technology Data Exchange (ETDEWEB)

    Yan, Liu [College of Biomedical Engineering and Instrument Science, Zhejiang University, Hangzhou 310027 (China); Institute of Biochemistry and Cell Biology, Shanghai Institutes for Biological Sciences, Chinese Academy of Sciences, Shanghai 200031 (China); Lian, Yu [College of Biomedical Engineering and Instrument Science, Zhejiang University, Hangzhou 310027 (China); Zhejiang Province Key Laboratory of Preventive Veterinary Medicine, Institute of Preventive Veterinary Medicine, Zhejiang University, Hangzhou 310029 (China); Xiuyang, Guo [Institute of Biochemistry and Cell Biology, Shanghai Institutes for Biological Sciences, Chinese Academy of Sciences, Shanghai 200031 (China); Tingqing, Guo [Institute of Biochemistry and Cell Biology, Shanghai Institutes for Biological Sciences, Chinese Academy of Sciences, Shanghai 200031 (China); Shengpeng, Wang [Institute of Biochemistry and Cell Biology, Shanghai Institutes for Biological Sciences, Chinese Academy of Sciences, Shanghai 200031 (China); Changde, Lu [Institute of Biochemistry and Cell Biology, Shanghai Institutes for Biological Sciences, Chinese Academy of Sciences, Shanghai 200031 (China)

    2006-03-31

    The gene encoding sericin 1 (Ser1) of silkworm (Bombyx mori) is specifically expressed in the middle silk gland cells. To identify element involved in this transcription-dependent spatial restriction, truncation of the 5' terminal from the sericin 1 (Ser1) promoter is studied in vivo. A 209 bp DNA sequence upstream of the transcriptional start site (-586 to -378) is found to be responsible for promoting tissue-specific transcription. Analysis of this 209 bp region by overlapping deletion studies showed that a 25 bp region (-500 to -476) suppresses the ectopic expression of the Ser1 promoter. An unknown factor abundant in fat body nuclear extracts is shown to bind to this 25 bp fragment. These results suggest that this 25 bp region and the unknown factor are necessary for determining the tissue-specificity of the Ser1 promoter.

  18. Epigenetic transgenerational actions of vinclozolin on promoter regions of the sperm epigenome.

    Directory of Open Access Journals (Sweden)

    Carlos Guerrero-Bosagna

    2010-09-01

    Full Text Available Previous observations have demonstrated that embryonic exposure to the endocrine disruptor vinclozolin during gonadal sex determination promotes transgenerational adult onset disease such as male infertility, kidney disease, prostate disease, immune abnormalities and tumor development. The current study investigates genome-wide promoter DNA methylation alterations in the sperm of F3 generation rats whose F0 generation mother was exposed to vinclozolin. A methylated DNA immunoprecipitation with methyl-cytosine antibody followed by a promoter tilling microarray (MeDIP-Chip procedure was used to identify 52 different regions with statistically significant altered methylation in the sperm promoter epigenome. Mass spectrometry bisulfite analysis was used to map the CpG DNA methylation and 16 differential DNA methylation regions were confirmed, while the remainder could not be analyzed due to bisulfite technical limitations. Analysis of these validated regions identified a consensus DNA sequence (motif that associated with 75% of the promoters. Interestingly, only 16.8% of a random set of 125 promoters contained this motif. One candidate promoter (Fam111a was found to be due to a copy number variation (CNV and not a methylation change, suggesting initial alterations in the germline epigenome may promote genetic abnormalities such as induced CNV in later generations. This study identifies differential DNA methylation sites in promoter regions three generations after the initial exposure and identifies common genome features present in these regions. In addition to primary epimutations, a potential indirect genetic abnormality was identified, and both are postulated to be involved in the epigenetic transgenerational inheritance observed. This study confirms that an environmental agent has the ability to induce epigenetic transgenerational changes in the sperm epigenome.

  19. Epigenetic transgenerational actions of vinclozolin on promoter regions of the sperm epigenome.

    Science.gov (United States)

    Guerrero-Bosagna, Carlos; Settles, Matthew; Lucker, Ben; Skinner, Michael K

    2010-09-30

    Previous observations have demonstrated that embryonic exposure to the endocrine disruptor vinclozolin during gonadal sex determination promotes transgenerational adult onset disease such as male infertility, kidney disease, prostate disease, immune abnormalities and tumor development. The current study investigates genome-wide promoter DNA methylation alterations in the sperm of F3 generation rats whose F0 generation mother was exposed to vinclozolin. A methylated DNA immunoprecipitation with methyl-cytosine antibody followed by a promoter tilling microarray (MeDIP-Chip) procedure was used to identify 52 different regions with statistically significant altered methylation in the sperm promoter epigenome. Mass spectrometry bisulfite analysis was used to map the CpG DNA methylation and 16 differential DNA methylation regions were confirmed, while the remainder could not be analyzed due to bisulfite technical limitations. Analysis of these validated regions identified a consensus DNA sequence (motif) that associated with 75% of the promoters. Interestingly, only 16.8% of a random set of 125 promoters contained this motif. One candidate promoter (Fam111a) was found to be due to a copy number variation (CNV) and not a methylation change, suggesting initial alterations in the germline epigenome may promote genetic abnormalities such as induced CNV in later generations. This study identifies differential DNA methylation sites in promoter regions three generations after the initial exposure and identifies common genome features present in these regions. In addition to primary epimutations, a potential indirect genetic abnormality was identified, and both are postulated to be involved in the epigenetic transgenerational inheritance observed. This study confirms that an environmental agent has the ability to induce epigenetic transgenerational changes in the sperm epigenome.

  20. Identification of functional DNA variants in the constitutive promoter region of MDM2

    Directory of Open Access Journals (Sweden)

    Lalonde Marie-Eve

    2012-09-01

    Full Text Available Abstract Although mutations in the oncoprotein murine double minute 2 (MDM2 are rare, MDM2 gene overexpression has been observed in several human tumors. Given that even modest changes in MDM2 levels might influence the p53 tumor suppressor signaling pathway, we postulated that sequence variation in the promoter region of MDM2 could lead to disregulated expression and variation in gene dosage. Two promoters have been reported for MDM2; an internal promoter (P2, which is located near the end of intron 1 and is p53-responsive, and an upstream constitutive promoter (P1, which is p53-independent. Both promoter regions contain DNA variants that could influence the expression levels of MDM2, including the well-studied single nucleotide polymorphism (SNP SNP309, which is located in the promoter P2; i.e., upstream of exon 2. In this report, we screened the promoter P1 for DNA variants and assessed the functional impact of the corresponding SNPs. Using the dbSNP database and genotyping validation in individuals of European descent, we identified three common SNPs (−1494 G > A; indel 40 bp; and −182 C > G. Three major promoter haplotypes were inferred by using these three promoter SNPs together with rs2279744 (SNP309. Following subcloning into a gene reporter system, we found that two of the haplotypes significantly influenced MDM2 promoter activity in a haplotype-specific manner. Site-directed mutagenesis experiments indicated that the 40 bp insertion/deletion variation is causing the observed allelic promoter activity. This study suggests that part of the variability in the MDM2 expression levels could be explained by allelic p53-independent P1 promoter activity.

  1. Altered regional homogeneity in the development of minimal hepatic encephalopathy: a resting-state functional MRI study.

    Directory of Open Access Journals (Sweden)

    Ling Ni

    Full Text Available BACKGROUND: Little is known about how spontaneous brain activity progresses from non-hepatic encephalopathy (non-HE to minimal HE (MHE. The purpose of this study was to evaluate the evolution pattern of spontaneous brain activities in cirrhotic patients using resting-state fMRI with a regional homogeneity (ReHo method. METHODOLOGY/PRINCIPAL FINDINGS: Resting-state fMRI data were acquired in 47 cirrhotic patients (minimal HE [MHE], n = 20, and non-HE, n = 27 and 25 age-and sex-matched healthy controls. The Kendall's coefficient of concordance (KCC was used to measure the regional homogeneity. The regional homogeneity maps were compared with ANOVA tests among MHE, non-HE, and healthy control groups and t-tests between each pair in a voxel-wise way. Correlation analyses were performed to explore the relationships between regional ReHo values and Child-Pugh scores, number connection test type A (NCT-A, digit symbol test (DST scores, venous blood ammonia levels. Compared with healthy controls, both MHE and non-HE patients showed decreased ReHo in the bilateral frontal, parietal and temporal lobes and increased ReHo in the bilateral caudate. Compared with the non-HE, MHE patients showed decreased ReHo in the bilateral precuneus, cuneus and supplementary motor area (SMA. The NCT-A of cirrhotic patients negatively correlated with ReHo values in the precuneus, cuneus and lingual gyrus. DST scores positively correlated with ReHo values in the cuneus, precuneus and lingual gyrus, and negatively correlated with ReHo values in the bilateral caudate (P<0.05, AlphaSim corrected. CONCLUSIONS/SIGNIFICANCE: Diffused abnormal homogeneity of baseline brain activity was nonspecific for MHE, and only the progressively decreased ReHo in the SMA and the cuneus, especially for the latter, might be associated with the development of MHE. The ReHo analysis may be potentially valuable for detecting the development from non-HE to MHE.

  2. Reduced Zeta potential through use of cationic adhesion promoter for improved resist process performance and minimizing material consumption

    Science.gov (United States)

    Hodgson, Lorna; Thompson, Andrew

    2012-03-01

    This paper presents the results of a non-HMDS (non-silane) adhesion promoter that was used to reduce the zeta potential for very thin (proprietary) polymer on silicon. By reducing the zeta potential, as measured by the minimum sample required to fully coat a wafer, the amount of polymer required to coat silicon substrates was significantly reduced in the manufacture of X-ray windows used for high transmission of low-energy X-rays. Moreover, this approach used aqueous based adhesion promoter described as a cationic surface active agent that has been shown to improve adhesion of photoresists (positive, negative, epoxy [SU8], e-beam and dry film). As well as reducing the amount of polymer required to coat substrates, this aqueous adhesion promoter is nonhazardous, and contains non-volatile solvents.

  3. Promoting appreciation of the study and practice of medicine: inner workings of a Mini-Med program

    Directory of Open Access Journals (Sweden)

    Lindenthal JJ

    2012-06-01

    Full Text Available Jacob Jay Lindenthal,1 Joel A DeLisa21Department of Psychiatry, Institute for the Public Understanding of Health and Medicine, 2Department of Physical Medicine and Rehabilitation, University of Medicine and Dentistry of New Jersey, New Jersey Medical School, Newark, NJ, USAAbstract: Dissatisfaction with the restrictions of the health care system, diminished reliance on the word of health care professionals, increased costs of medical care, and access to information online have increased consumers' interest in their own health care as well as their thirst for medical literacy. Mini-Med programs run by medical schools offer a more reliable method of learning about disease and disorders than does the indiscriminate surfing of the Internet. This article describes the efforts of the University of Medicine and Dentistry of New Jersey – the largest public university of the health sciences in the nation – to run and maintain such a program. The Mini-Med course provides lay students with insight into what a student undergoes while studying medicine and guides them through complex topics that range from anatomy and basic life support to the latest in stem cell research. It also provides early guidance for potential medical students, addresses patients' concerns, and gives some insight into the levels of comprehension of current medical students.Keywords: Mini-Med program, medical education, consumer education, health literacy

  4. A var gene promoter implicated in severe malaria nucleates silencing and is regulated by 3' untranslated region and intronic cis-elements.

    Science.gov (United States)

    Muhle, Rebecca A; Adjalley, Sophie; Falkard, Brie; Nkrumah, Louis J; Muhle, Michael E; Fidock, David A

    2009-11-01

    Questions surround the mechanism of mutually exclusive expression by which Plasmodium falciparum mediates activation and silencing of var genes. These encode PfEMP1 proteins, which function as cytoadherent and immunomodulatory molecules at the surface of parasitised erythrocytes. Current evidence suggests that promoter silencing by var introns might play a key role in var gene regulation. To evaluate the impact of cis-acting regulatory regions on var silencing, we generated P. falciparum lines in which luciferase was placed under the control of an UpsA var promoter. By utilising the Bxb1 integrase system, these reporter cassettes were targeted to a genomic region that was not in apposition to var subtelomeric domains. This eliminated possible effects from surrounding telomeric elements and removed the variability inherent in episomal systems. Studies with highly synchronised parasites revealed that the UpsA element possessed minimal activity in comparison with a heterologous (hrp3) promoter. This may result from the integrated UpsA promoter being largely silenced by the neighbouring cg6 promoter. Our analyses also revealed that the DownsA 3' untranslated region further decreased the luciferase activity from both cassettes, whereas the var A intron repressed the UpsA promoter specifically. By applying multivariate analysis over the entire cell cycle, we confirmed the significance of these cis-elements and found the parasite stage to be the major factor regulating UpsA-promoter activity. Additionally, we observed that the UpsA promoter was capable of nucleating reversible silencing that spread to a downstream promoter. We believe these studies are the first to analyse promoter activity of Group A var genes, which have been implicated in severe malaria, and support the model that var introns can further suppress var expression. These data also suggest an important suppressive role for the DownsA terminator. Our findings imply the existence of multiple levels of var

  5. Machine Learning Classification of Cirrhotic Patients with and without Minimal Hepatic Encephalopathy Based on Regional Homogeneity of Intrinsic Brain Activity.

    Science.gov (United States)

    Chen, Qiu-Feng; Chen, Hua-Jun; Liu, Jun; Sun, Tao; Shen, Qun-Tai

    2016-01-01

    Machine learning-based approaches play an important role in examining functional magnetic resonance imaging (fMRI) data in a multivariate manner and extracting features predictive of group membership. This study was performed to assess the potential for measuring brain intrinsic activity to identify minimal hepatic encephalopathy (MHE) in cirrhotic patients, using the support vector machine (SVM) method. Resting-state fMRI data were acquired in 16 cirrhotic patients with MHE and 19 cirrhotic patients without MHE. The regional homogeneity (ReHo) method was used to investigate the local synchrony of intrinsic brain activity. Psychometric Hepatic Encephalopathy Score (PHES) was used to define MHE condition. SVM-classifier was then applied using leave-one-out cross-validation, to determine the discriminative ReHo-map for MHE. The discrimination map highlights a set of regions, including the prefrontal cortex, anterior cingulate cortex, anterior insular cortex, inferior parietal lobule, precentral and postcentral gyri, superior and medial temporal cortices, and middle and inferior occipital gyri. The optimized discriminative model showed total accuracy of 82.9% and sensitivity of 81.3%. Our results suggested that a combination of the SVM approach and brain intrinsic activity measurement could be helpful for detection of MHE in cirrhotic patients.

  6. Gel shift analysis of the empA promoter region in Vibrio anguillarum

    Directory of Open Access Journals (Sweden)

    Denkin Steven M

    2004-10-01

    Full Text Available Abstract Background The induction of metalloprotease encoded by empA in Vibrio anguillarum occurs at high cell density in salmon intestinal mucus. Previously we have shown that there are significant differences in empA expression in two strains of V. anguillarum, M93Sm and NB10. It is hypothesized that differences in empA regulation are due to differences in binding of regulatory elements. Results Two strains of V. anguillarum, M93Sm and NB10, were examined and compared for the presence of DNA regulatory proteins that bind to and control the empA promoter region. Gel mobility shift assays, using a digoxigenin (DIG-labeled oligomer containing a lux box-like element and the promoter for empA, were done to demonstrate the presence of a DNA-binding protein. Protein extracts from NB10 cells incubated in Luria Bertani broth + 2% NaCl (LB20, nine salts solution + 200 μg/ml mucus (NSSM, 3M (marine minimal medium, or NSS resulted in a gel mobility shift. No gel mobility shift was seen when protein extracts from either LB20- or NSSM-grown M93Sm cells were mixed with the DIG-labeled empA oligomer. The azocasein assay detected protease activity in all incubation conditions for NB10 culture supernatants. In contrast, protease activity was detected in M93Sm culture supernatants only when incubated in NSSM. Since the luxR homologue in V. anguillarum, vanT, has been cloned, sequenced, and shown to be required for protease activity, we wanted to determine if vanT mutants of NB10 exhibit the same gel shift observed in the wild-type. Site-directed mutagenesis was used to create vanT mutants in V. anguillarum M93Sm and NB10 to test whether VanT is involved with the gel mobility shift. Both vanT mutants, M02 and NB02, did not produce protease activity in any conditions. However, protein extracts from NB02 incubated in each condition still exhibited a gel shift when mixed with the DIG-labeled empA oligomer. Conclusions The data demonstrate that protein extracts of V

  7. Promoting appreciation of the study and practice of medicine: inner workings of a Mini-Med program

    Science.gov (United States)

    Lindenthal, Jacob Jay; DeLisa, Joel A

    2012-01-01

    Dissatisfaction with the restrictions of the health care system, diminished reliance on the word of health care professionals, increased costs of medical care, and access to information online have increased consumers’ interest in their own health care as well as their thirst for medical literacy. Mini-Med programs run by medical schools offer a more reliable method of learning about disease and disorders than does the indiscriminate surfing of the Internet. This article describes the efforts of the University of Medicine and Dentistry of New Jersey – the largest public university of the health sciences in the nation – to run and maintain such a program. The Mini-Med course provides lay students with insight into what a student undergoes while studying medicine and guides them through complex topics that range from anatomy and basic life support to the latest in stem cell research. It also provides early guidance for potential medical students, addresses patients’ concerns, and gives some insight into the levels of comprehension of current medical students. PMID:23762004

  8. Promoting appreciation of the study and practice of medicine: inner workings of a Mini-Med program.

    Science.gov (United States)

    Lindenthal, Jacob Jay; Delisa, Joel A

    2012-01-01

    Dissatisfaction with the restrictions of the health care system, diminished reliance on the word of health care professionals, increased costs of medical care, and access to information online have increased consumers' interest in their own health care as well as their thirst for medical literacy. Mini-Med programs run by medical schools offer a more reliable method of learning about disease and disorders than does the indiscriminate surfing of the Internet. This article describes the efforts of the University of Medicine and Dentistry of New Jersey - the largest public university of the health sciences in the nation - to run and maintain such a program. The Mini-Med course provides lay students with insight into what a student undergoes while studying medicine and guides them through complex topics that range from anatomy and basic life support to the latest in stem cell research. It also provides early guidance for potential medical students, addresses patients' concerns, and gives some insight into the levels of comprehension of current medical students.

  9. 'It's interesting how few people die from smoking': tobacco industry efforts to minimize risk and discredit health promotion.

    Science.gov (United States)

    Smith, Elizabeth A

    2007-04-01

    It is well known that the tobacco industry has placed articles in scientific literature to maintain controversy over the dangers of tobacco use, while claiming that smokers are well-informed about risk. This study illuminates an industry attempt to directly undermine popular understanding of the hazards of smoking using an industry-created organization called Associates for Research in the Science of Enjoyment (ARISE). Searches of tobacco industry documents contained in the Legacy Tobacco Documents Library, British American Tobacco Documents Library, and British Columbia's Tobacco Industry documents were performed as well as searches of the LexisNexis database for news articles on ARISE published between 1989 and 2005. Qualitative analysis focused on industry motives, media strategies, and rhetorical tactics; quantitative content analysis focused on media coverage. Between 1989 and 2005, at least 846 articles appeared in the European, Australian, and US press mentioning ARISE, its members, or its activities. Many of these articles presented two themes: smoking was a healthful 'pleasure', and health promotion practices, including cessation, were stressful and unhealthy. Few articles included responses from health advocates, questioned ARISE's claims, or mentioned its funding. ARISE successfully planted stories in the press, designed to allay the health concerns of smokers and to discredit health promotion information and practices. ARISE's later interest in food suggests that counterfactual 'health' messages on almost any topic could be promoted similarly, regardless of their implausibility.

  10. Growing Significance of EU Institutions in Promotion of Inter-regional policies

    Directory of Open Access Journals (Sweden)

    Ella V. Ermakova

    2014-01-01

    Full Text Available The article explores the variety of tools and vehicles applied within the EU to expand the prerogative of the regions of the EU member states. The author uses as an example the inter-regional policies in Belgium in respect of the Flemish Region and the Walloon Region. The author analyzes the mechanisms of promotion of external regional relations in Belgium as a means of addressing different problems both on national and all-European level, supporting the arguments and conclusions by examples of relevant EU initiatives. The article details the activities of the EU Regional Committee (RC, the EU advisory body with the powers of political initiative, upholding the principle ofsubsidarity in the implementation of the EU member states' regional policies. The involvement of the Flemish Region and the Walloon Region in the activities of EU RC is described and summarized. As a case study, the article deals with Belgium's rotating six months presidency in the EUin 2010 when the country, which was going through a severe political crisis with no federal government in place, was represented by the two regions. The special focus of the article is on the strategic EU program "Europe2020" and its implementation by the regions of Belgium. There is an account of the initiatives undertaken by the Flemish Region and the Walloon Region within the framework of this program outlining the interaction of the two regions. The author provides a comprehensive analysis of the involvement of the Flemish Region and the Walloon Region with various EU institutions describing how each party achieves the promotion of its regional interests. Within this context, it is a noteworthy development that the Flemish Region is participating in the international program "Pact 2020" on energy all by its own. The article features quotations by Flemish and Walloon political figures which serve as an illustration of the prevailing attitudes in the Belgian society to the process of

  11. Does FDI promote regional development? Evidence from local and regional productivity spillovers in Greece

    Directory of Open Access Journals (Sweden)

    Vassilis MONASTIRIOTIS

    2010-12-01

    Full Text Available Studies on the productivity spillovers of FDI have concentrated on the nationalsectoral level. As a result, little is known about the impact of FDI on absolute and relative regional economic performance. In this paper we examine this issue by relying on a unique dataset of over 20,000 Greek firms for the period 2002-2006 covering all sectors of economic activity. We examine the spatial distribution of foreign-owned firms in the country and analyse the effect that their presence – at the local, regional and national levels – has on the productivity of domestic firms. We find strong evidence suggesting that foreignowned firms self-select into regions and sectors of high productivity. Net of this selection effect, the impact of foreign presence on domestic productivity is negative – although at the very local level some positive spillover effects are identifiable. The bulk of the effects concentrate in non-manufacturing activities, high-tech sectors, and medium-sized high-productivity firms. Importantly, this effect is not constant across space however. Productivity spillovers tend to be negative in the regions hosting the main urban areas in the country but positive in smaller and more peripheral regions. In this way, despite the tendency of FDI to concentrate in a limited number of areas within the country – those of the highest level of development – the externalities that FDI activity generates to the local economies appear to be of a rather equilibrating character.

  12. Global morphological analysis of marine viruses shows minimal regional variation and dominance of non-tailed viruses.

    Science.gov (United States)

    Brum, Jennifer R; Schenck, Ryan O; Sullivan, Matthew B

    2013-09-01

    Viruses influence oceanic ecosystems by causing mortality of microorganisms, altering nutrient and organic matter flux via lysis and auxiliary metabolic gene expression and changing the trajectory of microbial evolution through horizontal gene transfer. Limited host range and differing genetic potential of individual virus types mean that investigations into the types of viruses that exist in the ocean and their spatial distribution throughout the world's oceans are critical to understanding the global impacts of marine viruses. Here we evaluate viral morphological characteristics (morphotype, capsid diameter and tail length) using a quantitative transmission electron microscopy (qTEM) method across six of the world's oceans and seas sampled through the Tara Oceans Expedition. Extensive experimental validation of the qTEM method shows that neither sample preservation nor preparation significantly alters natural viral morphological characteristics. The global sampling analysis demonstrated that morphological characteristics did not vary consistently with depth (surface versus deep chlorophyll maximum waters) or oceanic region. Instead, temperature, salinity and oxygen concentration, but not chlorophyll a concentration, were more explanatory in evaluating differences in viral assemblage morphological characteristics. Surprisingly, given that the majority of cultivated bacterial viruses are tailed, non-tailed viruses appear to numerically dominate the upper oceans as they comprised 51-92% of the viral particles observed. Together, these results document global marine viral morphological characteristics, show that their minimal variability is more explained by environmental conditions than geography and suggest that non-tailed viruses might represent the most ecologically important targets for future research.

  13. Role of regional policies in promoting networking and innovation activity of firms

    OpenAIRE

    Kirsi Mukkala; Jari Ritsilä

    2004-01-01

    The success of firms and regions is increasingly defined by their innovation and learning capabilities. It has been emphasized in several studies that a local operational environment may have a positive impact on innovation activity of firms. From policy point of view, the relationship between firms and their local environment is an important research topic. The purpose of this paper is to explore whether there is a demand for regional policy makers in promoting innovative and networking acti...

  14. The minimally tuned minimal supersymmetric standard model

    International Nuclear Information System (INIS)

    Essig, Rouven; Fortin, Jean-Francois

    2008-01-01

    The regions in the Minimal Supersymmetric Standard Model with the minimal amount of fine-tuning of electroweak symmetry breaking are presented for general messenger scale. No a priori relations among the soft supersymmetry breaking parameters are assumed and fine-tuning is minimized with respect to all the important parameters which affect electroweak symmetry breaking. The superpartner spectra in the minimally tuned region of parameter space are quite distinctive with large stop mixing at the low scale and negative squark soft masses at the high scale. The minimal amount of tuning increases enormously for a Higgs mass beyond roughly 120 GeV

  15. Characterization of the promoter region of the human c-erbB-2 protooncogene

    International Nuclear Information System (INIS)

    Ishii, S.; Imamoto, F.; Yamanashi, Y.; Toyoshima, K.; Yamamoto, T.

    1987-01-01

    Three overlapping genomic clones that contain the 5'-terminal portion of the human c-erbB-2 gene (ERBB2) were isolated. The promoter region was identified by nuclease S1 mapping with c-erbB-2 mRNA. Seven transcriptional start sites were identified. DNA sequence analysis showed that the promoter region contains a TATA box and a CAAT box about 30 and 80 base pairs (bp), respectively, upstream of the most downstream RNA initiation site. Two putative binding sites for transcription factor Sp1 were identified about 50 and 110 bp upstream of the CAAT box, and six GGA repeats were found between the CAAT box and the TATA box. This region had strong promoter activity when placed upstream of the bacterial chloramphenicol acetyltransferase gene and transfected into monkey CV-1 cells. These data indicate that the promoter of the human c-erbB-2 protooncogene is different from that of the protooncogene c-erbB-1 (epidermal growth factor receptor gene), which does not contain either a TATA box or a CAAT box. Comparison of the promoter sequences and activities of the two protooncogenes should be helpful in analysis of the regulatory mechanism of expression of their gene products, which are growth-factor receptors

  16. A study of the frequency of methylation of gene promoter regions in ...

    Indian Academy of Sciences (India)

    2013-04-02

    Apr 2, 2013 ... colorectal cancer in the Taiwanese population. CHANG-CHIEH WU1 ... hypermethylation of promoter-region CpG islands is an important ... mismatch repair gene MLH1 plays an important role in dele- ..... Asia Pac. J. Clin.

  17. Cytosine deletion at AP2-box region of HSP70 promoter and its ...

    Indian Academy of Sciences (India)

    Cytosine deletion at AP2-box region of HSP70 promoter and its influence on semen quality traits in crossbred bulls ... Laboratory, ICAR-Central Institute for Research on Cattle, Meerut 250 001, India; School of Atmospheric Stress Management, ICAR-National Institute of Abiotic Stress Management, Baramati 413 115, India ...

  18. Clinical significance of promoter region hypermethylation of microRNA-148a in gastrointestinal cancers

    Directory of Open Access Journals (Sweden)

    Sun JX

    2014-05-01

    Full Text Available Jingxu Sun,1,* Yongxi Song,1,* Zhenning Wang,1 Guoli Wang,2 Peng Gao,1 Xiaowan Chen,1 Zhaohua Gao,1 Huimian Xu1 1Department of Surgical Oncology and General Surgery, First Hospital of China Medical University, Shenyang, People’s Republic of China; 2Department of Biochemistry and Molecular Biology, China Medical University, Shenyang, People’s Republic of China *These authors contributed equally to this work Background: MicroRNAs are associated with tumor genesis and progression in various carcinomas. MicroRNA-148a (miR-148a was reported to have low expression in gastrointestinal cancers, and might be regulated by promoter region DNA methylation. Methods: Bisulfite-modified sequencing was used to determine the promoter region DNA methylation status of human gastrointestinal cancer cell lines. Expression levels of miR-148a in cell lines treated with 5-aza-2′-deoxycytidine were determined by quantitative real-time polymerase chain reaction. Total DNA was extracted from the tissues of 64 patients with gastric cancer and 51 patients with colorectal cancer. Methylation status was determined by methylation-specific polymerase chain reaction. All statistical analyses were performed with SPSS 17.0 software. Results: The promoter regions of genes in human gastrointestinal cancer cell lines were all hypermethylated, except for HT-29, and the expression of miR-148a tended to be higher than in controls after treatment with 5-aza-2′-deoxycytidine. The methylation-specific polymerase chain reaction results showed that 56.25% of gastric cancer tissues and 19.61% of colorectal cancer tissues were hypermethylated. A strong correlation was found between the expression of miR-148a and the methylation status of promoter regions (P<0.001, chi-square test and Pearson’s correlation. Furthermore, promoter region CpG site hypermethylation of miR-148a was correlated with increased tumor size (P=0.01 in gastric cancer after analyzing the correlation between

  19. The system of Regional Contact Offices for promoting GMES services and the use of Space Technologies in European Regions.

    Science.gov (United States)

    Carrara, Paola; Antoninetti, Massimo; Bacai, Hina; Basoni, Anna; Bosc, Christelle; Clave, Magali; Cornacchia, Carmela; L'Astorina, Alba; Monbet, Philippe; Mueller, Bastian; Nicolau, Sonia; Pergola, Nicola; Rampini, Anna; Tramutoli, Valerio; Schumacher, Volker; Wells, Alan; Zepeda Juarez, Jesus; Zolotikova, Svetlana

    2013-04-01

    which have significant impact on the economy, environment and the quality of life of the citizens To this aim since 2011 the system of Regional Contact Offices (RCOs) was promoted by the EU FP7 DORIS_Net (Downsteam Observatory organized by Regions Active in Space - Network, http://www.doris-net.eu/) project as the regional link to the services provided by the European GMES programme. Since then a first nucleus of 12 pilot European Regions were working together establishing 6 first RCOs around Europe. This paper will present RCOs network goals, achievements and perspectives as well as its planned actions devoted to improve quality of Space Technology products from one side, to promote awareness and use of them by potential end-users (and particularly LRAs), from the other side.

  20. Central thalamic deep brain stimulation to promote recovery from chronic posttraumatic minimally conscious state: challenges and opportunities.

    Science.gov (United States)

    Giacino, Joseph; Fins, Joseph J; Machado, Andre; Schiff, Nicholas D

    2012-07-01

    Central thalamic deep brain stimulation (CT-DBS) may have therapeutic potential to improve behavioral functioning in patients with severe traumatic brain injury (TBI), but its use remains experimental. Current research suggests that the central thalamus plays a critical role in modulating arousal during tasks requiring sustained attention, working memory, and motor function. The aim of the current article is to review the methodology used in the CT-DBS protocol developed by our group, outline the challenges we encountered and offer suggestions for future DBS trials in this population. RATIONAL FOR CT-DBS IN TBI:  CT-DBS may therefore be able to stimulate these functions by eliciting action potentials that excite thalamocortical and thalamostriatal pathways. Because patients in chronic minimally conscious state (MCS) have a very low probability of regaining functional independence, yet often have significant sparing of cortical connectivity, they may represent a particularly appropriate target group for CT-DBS. PIlOT STUDY RESULTS:  We have conducted a series of single-subject studies of CT-DBS in patients with chronic posttraumatic MCS, with 24-month follow-up. Outcomes were measured using the Coma Recovery Scale-Revised as well as a battery of secondary outcome measures to capture more granular changes. Findings from our index case suggest that CT-DBS can significantly increase functional communication, motor performance, feeding, and object naming in the DBS on state, with performance in some domains remaining above baseline even after DBS was turned off. The use of CT-DBS in patients in MCS, however, presents challenges at almost every step, including during surgical planning, outcome measurement, and postoperative care. Additionally, given the difficulties of obtaining informed consent from patients in MCS and the experimental nature of the treatment, a robust, scientifically rooted ethical framework is resented for pursuing this line of work. © 2012

  1. DNA Methylation Analysis of BRD1 Promoter Regions and the Schizophrenia rs138880 Risk Allele.

    Directory of Open Access Journals (Sweden)

    Mads Dyrvig

    Full Text Available The bromodomain containing 1 gene, BRD1 is essential for embryogenesis and CNS development. It encodes a protein that participates in histone modifying complexes and thereby regulates the expression of a large number of genes. Genetic variants in the BRD1 locus show association with schizophrenia and bipolar disorder and risk alleles in the promoter region correlate with reduced BRD1 expression. Insights into the transcriptional regulation of BRD1 and the pathogenic mechanisms associated with BRD1 risk variants, however, remain sparse. By studying transcripts in human HeLa and SH-SY5Y cells we provide evidence for differences in relative expression of BRD1 transcripts with three alternative 5' UTRs (exon 1C, 1B, and 1A. We further show that expression of these transcript variants covaries negatively with DNA methylation proportions in their upstream promoter regions suggesting that promoter usage might be regulated by DNA methylation. In line with findings that the risk allele of the rs138880 SNP in the BRD1 promoter region correlates with reduced BRD1 expression, we find that it is also associated with moderate regional BRD1 promoter hypermethylation in both adipose tissue and blood. Importantly, we demonstrate by inspecting available DNA methylation and expression data that these regions undergo changes in methylation during fetal brain development and that differences in their methylation proportions in fetal compared to postnatal frontal cortex correlate significantly with BRD1 expression. These findings suggest that BRD1 may be dysregulated in both the developing and mature brain of risk allele carriers. Finally, we demonstrate that commonly used mood stabilizers Lithium, Valproate, and Carbamazepine affect the expression of BRD1 in SH-SY5Y cells. Altogether this study indicates a link between genetic risk and epigenetic dysregulation of BRD1 which raises interesting perspectives for targeting the mechanisms pharmacologically.

  2. A composite method based on formal grammar and DNA structural features in detecting human polymerase II promoter region.

    Directory of Open Access Journals (Sweden)

    Sutapa Datta

    Full Text Available An important step in understanding gene regulation is to identify the promoter regions where the transcription factor binding takes place. Predicting a promoter region de novo has been a theoretical goal for many researchers for a long time. There exists a number of in silico methods to predict the promoter region de novo but most of these methods are still suffering from various shortcomings, a major one being the selection of appropriate features of promoter region distinguishing them from non-promoters. In this communication, we have proposed a new composite method that predicts promoter sequences based on the interrelationship between structural profiles of DNA and primary sequence elements of the promoter regions. We have shown that a Context Free Grammar (CFG can formalize the relationships between different primary sequence features and by utilizing the CFG, we demonstrate that an efficient parser can be constructed for extracting these relationships from DNA sequences to distinguish the true promoter sequences from non-promoter sequences. Along with CFG, we have extracted the structural features of the promoter region to improve upon the efficiency of our prediction system. Extensive experiments performed on different datasets reveals that our method is effective in predicting promoter sequences on a genome-wide scale and performs satisfactorily as compared to other promoter prediction techniques.

  3. A Composite Method Based on Formal Grammar and DNA Structural Features in Detecting Human Polymerase II Promoter Region

    Science.gov (United States)

    Datta, Sutapa; Mukhopadhyay, Subhasis

    2013-01-01

    An important step in understanding gene regulation is to identify the promoter regions where the transcription factor binding takes place. Predicting a promoter region de novo has been a theoretical goal for many researchers for a long time. There exists a number of in silico methods to predict the promoter region de novo but most of these methods are still suffering from various shortcomings, a major one being the selection of appropriate features of promoter region distinguishing them from non-promoters. In this communication, we have proposed a new composite method that predicts promoter sequences based on the interrelationship between structural profiles of DNA and primary sequence elements of the promoter regions. We have shown that a Context Free Grammar (CFG) can formalize the relationships between different primary sequence features and by utilizing the CFG, we demonstrate that an efficient parser can be constructed for extracting these relationships from DNA sequences to distinguish the true promoter sequences from non-promoter sequences. Along with CFG, we have extracted the structural features of the promoter region to improve upon the efficiency of our prediction system. Extensive experiments performed on different datasets reveals that our method is effective in predicting promoter sequences on a genome-wide scale and performs satisfactorily as compared to other promoter prediction techniques. PMID:23437045

  4. Multiple 5' ends of human cytomegalovirus UL57 transcripts identify a complex, cycloheximide-resistant promoter region that activates oriLyt

    International Nuclear Information System (INIS)

    Kiehl, Anita; Huang, Lili; Franchi, David; Anders, David G.

    2003-01-01

    The human cytomegalovirus (HCMV) UL57 gene lies adjacent to HCMV oriLyt, from which it is separated by an organizationally conserved, mostly noncoding region that is thought to both regulate UL57 expression and activate oriLyt function. However, the UL57 promoter has not been studied. We determined the 5' ends of UL57 transcripts toward an understanding of the potential relationship between UL57 expression and oriLyt activation. The results presented here identified three distinct 5' ends spread over 800 bp, at nt 90302, 90530, and 91138; use of these sites exhibited differential sensitivity to phosphonoformic acid treatment. Interestingly, a 10-kb UL57 transcript accumulated in cycloheximide-treated infected cells, even though other early transcripts were not detectable. However, the 10-kb transcript did not accumulate in cells treated with the more stringent translation inhibitor anisomycin. Consistent with the notion that the identified 5' ends arise from distinct transcription start sites, the sequences upstream of sites I and II functioned as promoters responsive to HCMV infection in transient assays. However, the origin-proximal promoter region III required downstream sequences for transcriptional activity. Mutation of candidate core promoter elements suggested that promoter III is regulated by an initiator region (Inr) and a downstream promoter element. Finally, a 42-bp sequence containing the candidate Inr activated a minimal oriLyt core construct in transient replication assays. Thus, these studies showed that a large, complex promoter region with novel features controls UL57 expression, and identified a sequence that regulates both UL57 transcription and oriLyt activation

  5. Regional Cooperation Efforts in the Mekong River Basin: Mitigating river-related security threats and promoting regional development

    Directory of Open Access Journals (Sweden)

    Susanne Schmeier

    2009-01-01

    Full Text Available The development of international rivers is often perceived as leading to conflicts or even water wars. However, as the development of the Mekong River shows, cooperation has not only prevailed in the last decades, but River Basin Organizations (RBOs, established to mitigate river-related conflicts and/or develop the river basin, have also contributed to the emergence of more general cooperation structures, mainly by creating spill-over effects in other issue-areas, bringing cooperation to policy fields beyond the river itself. This article assesses the contribution of the Mekong River Commission (MRC and the Greater Mekong Sub-Region (GMS to the sustainable development of the Mekong Region as well as to the promotion of regional cooperation in mainland South-East Asia in general. --- Die Entwicklung grenzüberschreitender Flüsse wird oft mit Konflikten oder gar Kriegen um Wasser assoziiert. Wie jedoch die Entwicklung im Mekong-Becken zeigt, waren die vergangenen Jahrzehnte nicht nur von Kooperation gezeichnet, sondern Flussbeckenorganisationen konnten außerdem dazu beitragen, weitreichendere Kooperationsstrukturen zu entwickeln, die sich auf andere Politikfelder ausdehnen. Dieser Artikel beschäftigt sich mit dem Beitrag der Mekong River Commission (MRC und der Greater Mekong Sub-Region (GMS zur nachhaltigen Entwicklung in der Mekong Region sowie zur Förderung allgemeiner regionaler Kooperation im Festländischen Südostasien.

  6. Regional differences in gene expression and promoter usage in aged human brains

    KAUST Repository

    Pardo, Luba M.

    2013-02-19

    To characterize the promoterome of caudate and putamen regions (striatum), frontal and temporal cortices, and hippocampi from aged human brains, we used high-throughput cap analysis of gene expression to profile the transcription start sites and to quantify the differences in gene expression across the 5 brain regions. We also analyzed the extent to which methylation influenced the observed expression profiles. We sequenced more than 71 million cap analysis of gene expression tags corresponding to 70,202 promoter regions and 16,888 genes. More than 7000 transcripts were differentially expressed, mainly because of differential alternative promoter usage. Unexpectedly, 7% of differentially expressed genes were neurodevelopmental transcription factors. Functional pathway analysis on the differentially expressed genes revealed an overrepresentation of several signaling pathways (e.g., fibroblast growth factor and wnt signaling) in hippocampus and striatum. We also found that although 73% of methylation signals mapped within genes, the influence of methylation on the expression profile was small. Our study underscores alternative promoter usage as an important mechanism for determining the regional differences in gene expression at old age.

  7. Brand Products of Regional Cuisine in the Promotion of Tourism in Roztocze

    Directory of Open Access Journals (Sweden)

    Bekier-Jaworska Ewa

    2015-03-01

    Full Text Available Introduction. There has been a trend over the last few years of using specialties of regional cuisine as an independent tourist attraction. The creation of local brands is an important element in the promotion of a given region and it also influences the development of culinary tourism. The aim of the studies conducted was to identify regional dishes - a choice of dishes that could be described as 'brand dishes' and the use of those dishes as tourist attractions in Roztocze. Material and methods. Studies were conducted on a group of students studying tourism and recreation at State Higher School of Vocational Education (PWSZ in Zamość using a questionnaire. Results. The questionnaire provided an assessment of the levels of knowledge of regional cuisine among Polish and Ukrainian students, identified the most characteristic dishes and selected brand products, and helped to arrive at a suitable method of promotion. Conclusions. Nationality, family customs and selection of local restaurants highly influence knowledge of regional cuisine. Interviewees decided that the most outstanding products from Roztocze were Zwierzyniec beer, and Biłgoraj pie. Regional products should be used as a tourist attraction in Roztocze.

  8. Tumour MLH1 promoter region methylation testing is an effective prescreen for Lynch Syndrome (HNPCC).

    Science.gov (United States)

    Newton, K; Jorgensen, N M; Wallace, A J; Buchanan, D D; Lalloo, F; McMahon, R F T; Hill, J; Evans, D G

    2014-12-01

    Lynch syndrome (LS) patients have DNA mismatch repair deficiency and up to 80% lifetime risk of colorectal cancer (CRC). Screening of mutation carriers reduces CRC incidence and mortality. Selection for constitutional mutation testing relies on family history (Amsterdam and Bethesda Guidelines) and tumour-derived biomarkers. Initial biomarker analysis uses mismatch repair protein immunohistochemistry and microsatellite instability. Abnormalities in either identify mismatch repair deficiency but do not differentiate sporadic epigenetic defects, due to MLH1 promoter region methylation (13% of CRCs) from LS (4% of CRCs). A diagnostic biomarker capable of making this distinction would be valuable. This study compared two biomarkers in tumours with mismatch repair deficiency; quantification of methylation of the MLH1 promoter region using a novel assay and BRAF c.1799T>A, p.(Val600Glu) mutation status in the identification of constitutional mutations. Tumour DNA was extracted (formalin fixed, paraffin embedded, FFPE tissue) and pyrosequencing used to test for MLH1 promoter methylation and presence of the BRAF c.1799T>A, p.(Val600Glu) mutation 71 CRCs from individuals with pathogenic MLH1 mutations and 73 CRCs with sporadic MLH1 loss. Specificity and sensitivity was compared. Unmethylated MLH1 promoter: sensitivity 94.4% (95% CI 86.2% to 98.4%), specificity 87.7% (95% CI 77.9% to 94.2%), Wild-type BRAF (codon 600): sensitivity 65.8% (95% CI 53.7% to 76.5%), specificity 98.6% (95% CI 92.4% to 100.0%) for the identification of those with pathogenic MLH1 mutations. Quantitative MLH1 promoter region methylation using pyrosequencing is superior to BRAF codon 600 mutation status in identifying constitutional mutations in mismatch repair deficient tumours. Published by the BMJ Publishing Group Limited. For permission to use (where not already granted under a licence) please go to http://group.bmj.com/group/rights-licensing/permissions.

  9. Genome-wide function of H2B ubiquitylation in promoter and genic regions.

    Science.gov (United States)

    Batta, Kiran; Zhang, Zhenhai; Yen, Kuangyu; Goffman, David B; Pugh, B Franklin

    2011-11-01

    Nucleosomal organization in and around genes may contribute substantially to transcriptional regulation. The contribution of histone modifications to genome-wide nucleosomal organization has not been systematically evaluated. In the present study, we examine the role of H2BK123 ubiquitylation, a key regulator of several histone modifications, on nucleosomal organization at promoter, genic, and transcription termination regions in Saccharomyces cerevisiae. Using high-resolution MNase chromatin immunoprecipitation and sequencing (ChIP-seq), we map nucleosome positioning and occupancy in mutants of the H2BK123 ubiquitylation pathway. We found that H2B ubiquitylation-mediated nucleosome formation and/or stability inhibits the assembly of the transcription machinery at normally quiescent promoters, whereas ubiquitylation within highly active gene bodies promotes transcription elongation. This regulation does not proceed through ubiquitylation-regulated histone marks at H3K4, K36, and K79. Our findings suggest that mechanistically similar functions of H2B ubiquitylation (nucleosome assembly) elicit different functional outcomes on genes depending on its positional context in promoters (repressive) versus transcribed regions (activating).

  10. THE ANALYSIS OF THE ASYMMETRICAL RISK IN TOURISM FOR THE DEVELOPMENT AND PROMOTION OF A LASTING REGIONAL TOURISM IDENTITY

    Directory of Open Access Journals (Sweden)

    Alexandru NEDELEA

    2009-06-01

    Full Text Available In order to establish an adequate balance between tourists' welfare, the needs of the natural and cultural environment, as well as to develop tourist destinations and organizations' competitiveness, it is necessary to carry out a global and integrated approach, where all interested parties share the same goals regarding the durability of tourism and the approached challenges. The purpose of this work is to identify the factors of reduced risk having a major impact over the sustainability of the tourist region under analysis and to highlight the risk factors' connections and impact in order to minimize and eliminate them, with direct effects over the awareness of tourist industry's values. The identification of lasting development's indicators will take into account all these three aspects of the durable development of tourism, namely ecological, economical and social factors, that play a part in highlighting the real performance of a tourist destination. All these aspects are absolutely necessary for the promotion of the Danube's tourist potential, achievable through the emphasis of the relevant values from the tourist patrimony of the county of Galati. The promotion of the Danube' tourist potential presupposes a series of objectives that are subordinated to the general direction that is marked at the national level, respectively Romania's transformation into a qualitative tourist destination based on its natural and cultural patrimony, in order to correspond to the European Union standards. The new policy regarding tourism proposed by the European Commission aims at offering constant support for this industry to be able to face different challenges, by promoting also competitiveness in general.

  11. Discovery and Evaluation of Polymorphisms in the and Promoter Regions for Risk of Korean Lung Cancer

    Directory of Open Access Journals (Sweden)

    Jae Sook Sung

    2012-09-01

    Full Text Available AKT is a signal transduction protein that plays a central role in the tumorigenesis. There are 3 mammalian isoforms of this serine/threonine protein kinase-AKT1, AKT2, and AKT3-showing a broad tissue distribution. We first discovered 2 novel polymorphisms (AKT2 -9826 C/G and AKT3 -811 A/G, and we confirmed 6 known polymorphisms (AKT2 -9473 C/T, AKT2 -9151 C/T, AKT2 -9025 C/T, AKT2 -8618G/A, AKT3 -675 A/-, and AKT3 -244 C/T of the AKT2 and AKT3 promoter region in 24 blood samples of Korean lung cancer patients using direct sequencing. To evaluate the role of AKT2 and AKT3 polymorphisms in the risk of Korean lung cancer, genotypes of the AKT2 and AKT3 polymorphisms (AKT2 -9826 C/G, AKT2 -9473 C/T, AKT2 -9151 C/T, AKT2 -9025 C/T, AKT2 -8618G/A, and AKT3 -675 A/- were determined in 360 lung cancer patients and 360 normal controls. Statistical analyses revealed that the genotypes and haplotypes in the AKT2 and AKT3 promoter regions were not significantly associated with the risk of lung cancer in the Korean population. These results suggest that polymorphisms of the AKT2 and AKT3 promoter regions do not contribute to the genetic susceptibility to lung cancer in the Korean population.

  12. Restoration of CpG Methylation in The Egf Promoter Region during Rat Liver Regeneration

    Science.gov (United States)

    Deming, Li; Ziwei, Li; Xueqiang, Guo; Cunshuan, Xu

    2015-01-01

    Epidermal growth factor (EGF) is an important factor for healing after tissue damage in diverse experimental models. It plays an important role in liver regeneration (LR). The objective of this experiment is to investigate the methylation variation of 10 CpG sites in the Egf promoter region and their relevance to Egf expression during rat liver regenera- tion. As a follow up of our previous study, rat liver tissue was collected after rat 2/3 partial hepatectomy (PH) during the re-organization phase (from days 14 to days 28). Liver DNA was extracted and modified by sodium bisulfate. The methylation status of 10 CpG sites in Egf promoter region was determined using bisulfite sequencing polymerase chain reaction (PCR), as BSP method. The results showed that 3 (sites 3, 4 and 9) out of 10 CpG sites have strikingly methylation changes during the re-organization phase compared to the regeneration phase (from 2 hours to 168 hours, P=0.002, 0.048 and 0.018, respectively). Our results showed that methylation modification of CpGs in the Egf promoter region could be restored to the status before PH operation and changes of methylation didn’t affect Egf mRNA expression during the re-organization phase. PMID:26464832

  13. Governmental promotion of the Information Society in the Spanish Region of Valencia

    Directory of Open Access Journals (Sweden)

    Emilio Feliu-García, Ph.D.

    2011-01-01

    Full Text Available Regional spheres are considered essential in the governmental promotion of the Information Society at the international level. The regional initiatives in Spain aim to strengthen and complement the initiatives promoted at the national level. This article analyses ICT penetration in the Valencian Community from 1996 to 2008. The objective is to identify which of the actions carried out by the Valencian Regional Government have had a positive effect on its society.The methodology employed in this study is benchmarking. The selection of indicators is based on the policies evaluation model proposed in the Plan Avanza (Spain’s national Information Society strategy. Data were collected from official statistical sources (like Spain’s National Statistics Institute, INE. Three statistical tests were applied to verify the hypotheses (Pearson’s r2, Chi-square and Student’s t.The results indicate that it is not possible to affirm that the actions implemented by the Valencian Regional Government have had a more positive effect on its society than those implemented by the Spanish Central Government. A reason for this may lie in the specific objectives of the political strategy implemented by the Valencian Government, which has focused primarily on e-Government and does not include enough projects centred on the implementation of new technologies in the private sector. Moreover, the integration of new technologies in everyday life is placed in a second level of importance despite citizens are central actors in the international agenda.

  14. The promotion of regional integration of electricity markets: Lessons for developing countries

    International Nuclear Information System (INIS)

    Oseni, Musiliu O.; Pollitt, Michael G.

    2016-01-01

    This paper focuses on how to promote regional cooperation in electricity. We begin by discussing the theory of international trade cooperation in electricity, with a view to discussing what preconditions might be important in facilitating wide area trading across national borders. We then develop lessons based on the comparison of four case studies. These include three regional developing country power pools – the Southern African Power pool (SAPP), West African Power pool (WAPP) and the Central American Power Market (MER). We contrast these with Northern Europe's Nord Pool. These cases highlight both the potential and difficulty of having cross-jurisdictional power pools. In the light of the theory and evidence we present, we draw key lessons in the areas of: preconditions for trading; necessary institutional arrangements; practicalities of timetabling; reasons to be hopeful about future prospects. - Highlights: • This paper focuses on how to promote regional electricity cooperation. • We develop lessons based on comparison of four international case studies. • The cases highlight both the potential and difficulty of power pools. • We identify preconditions, institutional arrangements and timetabling. • We conclude that the future prospects for regional power pools are good.

  15. Quantifying Surface Coal-Mining Patterns to Promote Regional Sustainability in Ordos, Inner Mongolia

    Directory of Open Access Journals (Sweden)

    Xiaoji Zeng

    2018-04-01

    Full Text Available Ordos became the new “coal capital” of China within a few decades since the country’s economic reform in 1978, as large-scale surface coal mining dramatically propelled its per capita GDP from being one of the lowest to one of the highest in China, exceeding Hong Kong in 2009. Surface coal-mining areas (SCMAs have continued to expand in this region during recent decades, resulting in serious environmental and socioeconomic consequences. To understand these impacts and promote regional sustainability, quantifying the spatiotemporal patterns of SCMAs is urgently needed. Thus, the main objectives of this study were to quantify the spatiotemporal patterns of SCMAs in the Ordos region from 1990 to 2015, and to examine some of the major environmental and socioeconomic impacts in the study region. We extracted the SCMAs using remote-sensing data, and then quantified their spatiotemporal patterns using landscape metrics. The loss of natural habitat and several socioeconomic indicators were examined in relation to surface coal mining. Our results show that the area of SCMAs increased from 7.12 km2 to 355.95 km2, an increase of nearly 49 times from 1990 to 2015 in the Ordos region. The number of SCMAs in this region increased from 82 to 651, a nearly seven-fold increase. In particular, Zhungeer banner (an administrative division, Yijinhuoluo banner, Dongsheng District and Dalate banner in the north-eastern part of the Ordos region had higher growth rates of SCMAs. The income gap between urban and rural residents increased along with the growth in SCMAs, undermining social equity in the Ordos region. Moreover, the rapid increase in SCMAs resulted in natural habitat loss (including grasslands, forests, and deserts across this region. Thus, we suggest that regional sustainability in Ordos needs to emphasize effective measures to curb large-scale surface coal mining in order to reduce the urban–rural income gap, and to restore degraded natural

  16. A var gene promoter implicated in severe malaria nucleates silencing and is regulated by 3’ untranslated region and intronic cis-elements

    Science.gov (United States)

    Muhle, Rebecca A.; Adjalley, Sophie; Falkard, Brie; Nkrumah, Louis J.; Muhle, Michael E.; Fidock, David A.

    2009-01-01

    Questions surround the mechanism of mutually exclusive expression by which Plasmodium falciparum mediates activation and silencing of var genes. These encode PfEMP1 proteins, which function as cytoadherent and immunomodulatory molecules at the surface of parasitized erythrocytes. Current evidence suggests that promoter silencing by var introns might play a key role in var gene regulation. To evaluate the impact of cis-acting regulatory regions on var silencing, we generated P. falciparum lines in which luciferase was placed under the control of an UpsA var promoter. By utilizing the Bxb1 integrase system, these reporter cassettes were targeted to a genomic region that was not in apposition to var sub-telomeric domains. This eliminated possible effects from surrounding telomeric elements and removed the variability inherent in episomal systems. Studies with highly synchronized parasites revealed that the UpsA element possessed minimal activity in comparison with a heterologous (hrp3) promoter. This may well result from the integrated UpsA promoter being largely silenced by the neighboring cg6 promoter. Our analyses also revealed that the DownsA 3’ untranslated region further decreased the luciferase activity from both cassettes, whereas the var A intron repressed the UpsA promoter specifically. By applying multivariate analysis over the entire cell cycle, we confirmed the significance of these cis-elements and found the parasite stage to be the major factor regulating UpsA promoter activity. Additionally, we observed that the UpsA promoter was capable of nucleating reversible silencing that spread to a downstream promoter. We believe these studies are the first to analyze promoter activity of Group A var genes which have been implicated in severe malaria, and support the model that var introns can further suppress var expression. These data also suggest an important suppressive role for the DownsA terminator. Our findings imply the existence of multiple levels of

  17. Boundary Dpp promotes growth of medial and lateral regions of the Drosophila wing.

    Science.gov (United States)

    Barrio, Lara; Milán, Marco

    2017-07-04

    The gradient of Decapentaplegic (Dpp) in the Drosophila wing has served as a paradigm to characterize the role of morphogens in regulating patterning. However, the role of this gradient in regulating tissue size is a topic of intense debate as proliferative growth is homogenous. Here, we combined the Gal4/UAS system and a temperature-sensitive Gal80 molecule to induce RNAi-mediated depletion of dpp and characterise the spatial and temporal requirement of Dpp in promoting growth. We show that Dpp emanating from the AP compartment boundary is required throughout development to promote growth by regulating cell proliferation and tissue size. Dpp regulates growth and proliferation rates equally in central and lateral regions of the developing wing appendage and reduced levels of Dpp affects similarly the width and length of the resulting wing. We also present evidence supporting the proposal that graded activity of Dpp is not an absolute requirement for wing growth.

  18. Association between VNTR polymorphism in promoter region of prodynorphin (PDYN) gene and heroin dependence.

    Science.gov (United States)

    Saify, Khyber; Saadat, Iraj; Saadat, Mostafa

    2014-11-30

    Within the core promoter region of prodynorphin (PDYN), a 68-bp sequence was found to occur as a polymorphism element, either singular or as tandemly repeated two, three or four times. We report the sequence of a novel allele (5-repeats). Our study revealed the existence of an ancestral nucleotide (A) at 29th position of the VNTR in human. In total, 442 heroin addicts and 799 controls were included in this study. The present findings revealed a male-limited association between VNTR polymorphism and heroin dependence risk. Copyright © 2014 Elsevier Ireland Ltd. All rights reserved.

  19. Minimal surfaces

    CERN Document Server

    Dierkes, Ulrich; Sauvigny, Friedrich; Jakob, Ruben; Kuster, Albrecht

    2010-01-01

    Minimal Surfaces is the first volume of a three volume treatise on minimal surfaces (Grundlehren Nr. 339-341). Each volume can be read and studied independently of the others. The central theme is boundary value problems for minimal surfaces. The treatise is a substantially revised and extended version of the monograph Minimal Surfaces I, II (Grundlehren Nr. 295 & 296). The first volume begins with an exposition of basic ideas of the theory of surfaces in three-dimensional Euclidean space, followed by an introduction of minimal surfaces as stationary points of area, or equivalently

  20. Minimal and contributing sequence determinants of the cis-acting locus of transfer (clt) of streptomycete plasmid pIJ101 occur within an intrinsically curved plasmid region.

    Science.gov (United States)

    Ducote, M J; Prakash, S; Pettis, G S

    2000-12-01

    Efficient interbacterial transfer of streptomycete plasmid pIJ101 requires the pIJ101 tra gene, as well as a cis-acting plasmid function known as clt. Here we show that the minimal pIJ101 clt locus consists of a sequence no greater than 54 bp in size that includes essential inverted-repeat and direct-repeat sequences and is located in close proximity to the 3' end of the korB regulatory gene. Evidence that sequences extending beyond the minimal locus and into the korB open reading frame influence clt transfer function and demonstration that clt-korB sequences are intrinsically curved raise the possibility that higher-order structuring of DNA and protein within this plasmid region may be an inherent feature of efficient pIJ101 transfer.

  1. Minimal traumatic brain injury causes persistent changes in DNA methylation at BDNF gene promoters in rat amygdala: A possible role in anxiety-like behaviors.

    Science.gov (United States)

    Sagarkar, Sneha; Bhamburkar, Tanmayi; Shelkar, Gajanan; Choudhary, Amit; Kokare, Dadasaheb M; Sakharkar, Amul J

    2017-10-01

    Minimal traumatic brain injury (MTBI) often transforms into chronic neuropsychiatric conditions including anxiety, the underlying mechanisms of which are largely unknown. In the present study, we employed the closed-head injury paradigm to induce MTBI in rats and examined whether DNA methylation can explain long-term changes in the expression of the brain-derived neurotrophic factor (BDNF) in the amygdala as well as trauma-induced anxiety-like behaviors. The MTBI caused anxiety-like behaviors and altered the expression of DNA methyltransferase (DNMT) isoforms (DNMT1, DNMT3a, and DNMT3b) and factors involved in DNA demethylation such as the growth arrest and DNA damage 45 (GADD45a and GADD45b). After 30days of MTBI, the over-expression of DNMT3a and DNMT3b corresponded to heightened DNMT activity, whereas the mRNA levels of GADD45a and GADD45b were declined. The methylated cytosine levels at the BDNF promoters (Ip, IVp and IXp) were increased in the amygdala of the trauma-induced animals; these coincided negatively with the mRNA levels of exon IV and IXa, but not of exon I. Interestingly, treatment with 5-azacytidine, a pan DNMT inhibitor, normalized the MTBI-induced DNMT activity and DNA hypermethylation at exon IVp and IXp. Furthermore, 5-azacytidine also corrected the deficits in the expression of exons IV and IXa and reduced the anxiety-like behaviors. These results suggest that the DNMT-mediated DNA methylation at the BDNF IVp and IXp might be involved in the regulation of BDNF gene expression in the amygdala. Further, it could also be related to MTBI-induced anxiety-like behaviors via the regulation of synaptic plasticity. Copyright © 2017 Elsevier Inc. All rights reserved.

  2. The role of COMESA in promoting intra-regional agricultural trade: Case study of Sudan

    Directory of Open Access Journals (Sweden)

    Azharia Abdelbagi Elbushra

    2011-06-01

    Full Text Available African countries have created many regional trade agreements with the economic objectives of reducing trade barriers and encouraging economic growth. The COMESA is an example of regional integration singed on 1993 by 19 African countries including Sudan. COMESA represents a chance for member countries to enhance their economic and social relations through increasing intra-trade. The objective of this paper is to assess the role of COMESA in promoting intra-regional agricultural trade between Sudan and COMESA countries. A multi-market model with Armington non-linear specification was applied. The paper results showed that there is a great potential for Sudan to increase its agricultural exports to other COMESA countries. The domestic agricultural markets are expected to be hampered by imports surge and increase in competition, while the producers of agricultural export commodities will be better off. In order to compete and benefit from potential in the COMESA markets, the paper recommended improving efficiency in the Sudanese agricultural sector through increasing productivity, lowering cost of production, enhancing marketing services, attaining economies of scale and attracting foreign investment.

  3. Role of sanitary and epidemiologic service of Gomel region aimed to minimization of consequences of the Chernobyl accident

    International Nuclear Information System (INIS)

    Klyuchenovich, V. I.; Zinovich, V. N.

    2001-01-01

    Chernobyl accident leads to the organization and realization large-scale actions for liquidation of its consequences. In the structure of state public health service was created complete system of radiation protection. In the first days after Chernobyl accident sanitary and epidemiologic service of the Gomel region developed recommendations on working conditions in agriculture, mode of operation of all kinds of food enterprises, rest of children and adults, behavior of the population, the organization of the radiometric control of food stuffs and water. The division of a radiation control ware organized at the regional centers of hygiene and epidemiologic under the control external irradiation dozes as the basic part of the population lived in territories with high density of the radioactive contamination

  4. Porcine MYF6 gene: sequence, homology analysis, and variation in the promoter region.

    Science.gov (United States)

    Wyszyńska-Koko, J; Kurył, J

    2004-01-01

    MYF6 gene codes for the bHLH transcription factor belonging to MyoD family. Its expression accompanies the processes of differentiation and maturation of myotubes during embriogenesis and continues on a relatively high level after birth, affecting the muscle phenotype. The porcine MYF6 gene was amplified and sequenced and compared with MYF6 gene sequences of other species. The amino acid sequence was deduced and an interspecies homology analysis was performed. Myf-6 protein shows a high conservation among species of 99 and 97% identity when comparing pig with cow and human, respectively, and of 93% when comparing pig with mouse and rat. The single nucleotide polymorphism (SNP) was revealed within the promoter region, which appeared to be T --> C transition recognized by a MspI restriction enzyme.

  5. Absence of mutation at the 5'-upstream promoter region of the TPM4 gene from cardiac mutant axolotl (Ambystoma mexicanum).

    Science.gov (United States)

    Denz, Christopher R; Zhang, Chi; Jia, Pingping; Du, Jianfeng; Huang, Xupei; Dube, Syamalima; Thomas, Anish; Poiesz, Bernard J; Dube, Dipak K

    2011-09-01

    Tropomyosins are a family of actin-binding proteins that show cell-specific diversity by a combination of multiple genes and alternative RNA splicing. Of the 4 different tropomyosin genes, TPM4 plays a pivotal role in myofibrillogenesis as well as cardiac contractility in amphibians. In this study, we amplified and sequenced the upstream regulatory region of the TPM4 gene from both normal and mutant axolotl hearts. To identify the cis-elements that are essential for the expression of the TPM4, we created various deletion mutants of the TPM4 promoter DNA, inserted the deleted segments into PGL3 vector, and performed promoter-reporter assay using luciferase as the reporter gene. Comparison of sequences of the promoter region of the TPM4 gene from normal and mutant axolotl revealed no mutations in the promoter sequence of the mutant TPM4 gene. CArG box elements that are generally involved in controlling the expression of several other muscle-specific gene promoters were not found in the upstream regulatory region of the TPM4 gene. In deletion experiments, loss of activity of the reporter gene was noted upon deletion which was then restored upon further deletion suggesting the presence of both positive and negative cis-elements in the upstream regulatory region of the TPM4 gene. We believe that this is the first axolotl promoter that has ever been cloned and studied with clear evidence that it functions in mammalian cell lines. Although striated muscle-specific cis-acting elements are absent from the promoter region of TPM4 gene, our results suggest the presence of positive and negative cis-elements in the promoter region, which in conjunction with positive and negative trans-elements may be involved in regulating the expression of TPM4 gene in a tissue-specific manner.

  6. Allelic polymorphisms in the repeat and promoter regions of the interleukin-4 gene and malaria severity in Ghanaian children

    DEFF Research Database (Denmark)

    Gyan, B A; Goka, B; Cvetkovic, J T

    2004-01-01

    Immunoglobulin E has been associated with severe malaria suggesting a regulatory role for interleukin (IL)-4 and/or IgE in the pathogenesis of severe malaria. We have investigated possible associations between polymorphisms in the IL-4 repeat region (intron 3) and promoter regions (IL-4 +33CT and...

  7. Biomaterial-based regional chemotherapy: Local anticancer drug delivery to enhance chemotherapy and minimize its side-effects.

    Science.gov (United States)

    Krukiewicz, Katarzyna; Zak, Jerzy K

    2016-05-01

    Since the majority of anticancer pharmacological agents affect not only cancer tissue but also normal cells, chemotherapy is usually accompanied with severe side effects. Regional chemotherapy, as the alternative version of conventional treatment, leads to the enhancement of the therapeutic efficiency of anticancer drugs and, simultaneously, reduction of toxic effects to healthy tissues. This paper provides an insight into different approaches of local delivery of chemotherapeutics, such as the injection of anticancer agents directly into tumor tissue, the use of injectable in situ forming drug carriers or injectable platforms in a form of implants. The wide range of biomaterials used as reservoirs of anticancer drugs is described, i.e. poly(ethylene glycol) and its copolymers, polyurethanes, poly(lactic acid) and its copolymers, poly(ɛ-caprolactone), polyanhydrides, chitosan, cellulose, cyclodextrins, silk, conducting polymers, modified titanium surfaces, calcium phosphate based biomaterials, silicone and silica implants, as well as carbon nanotubes and graphene. To emphasize the applicability of regional chemotherapy in cancer treatment, the commercially available products approved by the relevant health agencies are presented. Copyright © 2016 Elsevier B.V. All rights reserved.

  8. Cloning and characterization of the promoter regions from the parent and paralogous creatine transporter genes.

    Science.gov (United States)

    Ndika, Joseph D T; Lusink, Vera; Beaubrun, Claudine; Kanhai, Warsha; Martinez-Munoz, Cristina; Jakobs, Cornelis; Salomons, Gajja S

    2014-01-10

    Interconversion between phosphocreatine and creatine, catalyzed by creatine kinase is crucial in the supply of ATP to tissues with high energy demand. Creatine's importance has been established by its use as an ergogenic aid in sport, as well as the development of intellectual disability in patients with congenital creatine deficiency. Creatine biosynthesis is complemented by dietary creatine uptake. Intracellular transport of creatine is carried out by a creatine transporter protein (CT1/CRT/CRTR) encoded by the SLC6A8 gene. Most tissues express this gene, with highest levels detected in skeletal muscle and kidney. There are lower levels of the gene detected in colon, brain, heart, testis and prostate. The mechanism(s) by which this regulation occurs is still poorly understood. A duplicated unprocessed pseudogene of SLC6A8-SLC6A10P has been mapped to chromosome 16p11.2 (contains the entire SLC6A8 gene, plus 2293 bp of 5'flanking sequence and its entire 3'UTR). Expression of SLC6A10P has so far only been shown in human testis and brain. It is still unclear as to what is the function of SLC6A10P. In a patient with autism, a chromosomal breakpoint that intersects the 5'flanking region of SLC6A10P was identified; suggesting that SLC6A10P is a non-coding RNA involved in autism. Our aim was to investigate the presence of cis-acting factor(s) that regulate expression of the creatine transporter, as well as to determine if these factors are functionally conserved upstream of the creatine transporter pseudogene. Via gene-specific PCR, cloning and functional luciferase assays we identified a 1104 bp sequence proximal to the mRNA start site of the SLC6A8 gene with promoter activity in five cell types. The corresponding 5'flanking sequence (1050 bp) on the pseudogene also had promoter activity in all 5 cell lines. Surprisingly the pseudogene promoter was stronger than that of its parent gene in 4 of the cell lines tested. To the best of our knowledge, this is the first

  9. Identification of a single-nucleotide insertion in the promoter region affecting the sodC promoter activity in Brucella neotomae.

    Directory of Open Access Journals (Sweden)

    Dina A Moustafa

    Full Text Available Brucella neotomae is not known to be associated with clinical disease in any host species. Previous research suggested that B. neotomae might not express detectable levels of Cu/Zn superoxide dismutase (SOD, a periplasmic enzyme known to be involved in protecting Brucella from oxidative bactericidal effects of host phagocytes. This study was undertaken to investigate the genetic basis for the disparity in SOD expression in B. neotomae. Our Western blot and SOD enzyme assay analyses indicated that B. neotomae does express SOD, but at a substantially reduced level. Nucleotide sequence analysis of region upstream to the sodC gene identified a single-nucleotide insertion in the potential promoter region. The same single-nucleotide insertion was also detected in the sodC promoter of B. suis strain Thomsen, belonging to biovar 2 in which SOD expression was undetectable previously. Examination of the sodC promoter activities using translational fusion constructs with E. coli β-galactosidase demonstrated that the B. neotomae and B. suis biovar 2 promoters were very weak in driving gene expression. Site-directed mutation studies indicated that the insertion of A in the B. neotomae sodC promoter reduced the promoter activity. Increasing the level of SOD expression in B. neotomae through complementation with B. abortus sodC gene did not alter the bacterial survival in J774A.1 macrophage-like cells and in tissues of BALB/c and C57BL/6 mice. These results for the first time demonstrate the occurrence of a single-nucleotide polymorphism affecting promoter function and gene expression in Brucella.

  10. Assessing the effects of data selection and representation on the development of reliable E. coli sigma 70 promoter region predictors.

    Directory of Open Access Journals (Sweden)

    Mostafa M Abbas

    Full Text Available As the number of sequenced bacterial genomes increases, the need for rapid and reliable tools for the annotation of functional elements (e.g., transcriptional regulatory elements becomes more desirable. Promoters are the key regulatory elements, which recruit the transcriptional machinery through binding to a variety of regulatory proteins (known as sigma factors. The identification of the promoter regions is very challenging because these regions do not adhere to specific sequence patterns or motifs and are difficult to determine experimentally. Machine learning represents a promising and cost-effective approach for computational identification of prokaryotic promoter regions. However, the quality of the predictors depends on several factors including: i training data; ii data representation; iii classification algorithms; iv evaluation procedures. In this work, we create several variants of E. coli promoter data sets and utilize them to experimentally examine the effect of these factors on the predictive performance of E. coli σ70 promoter models. Our results suggest that under some combinations of the first three criteria, a prediction model might perform very well on cross-validation experiments while its performance on independent test data is drastically very poor. This emphasizes the importance of evaluating promoter region predictors using independent test data, which corrects for the over-optimistic performance that might be estimated using the cross-validation procedure. Our analysis of the tested models shows that good prediction models often perform well despite how the non-promoter data was obtained. On the other hand, poor prediction models seems to be more sensitive to the choice of non-promoter sequences. Interestingly, the best performing sequence-based classifiers outperform the best performing structure-based classifiers on both cross-validation and independent test performance evaluation experiments. Finally, we propose a

  11. Physical and transcript map of the region between D6S264 and D6S149 on chromosome 6q27, the minimal region of allele loss in sporadic epithelial ovarian cancer

    DEFF Research Database (Denmark)

    Liu, Ying; Emilion, Gracy; Mungall, Andrew J

    2002-01-01

    We have previously shown a high frequency of allele loss at D6S193 (62%) on chromosomal arm 6q27 in ovarian tumours and mapped the minimal region of allele loss between D6S297 and D6S264 (3 cM). We isolated and mapped a single non-chimaeric YAC (17IA12, 260-280 kb) containing D6S193 and D6S297...

  12. Preservation or Restoration of Segmental and Regional Spinal Lordosis Using Minimally Invasive Interbody Fusion Techniques in Degenerative Lumbar Conditions: A Literature Review.

    Science.gov (United States)

    Uribe, Juan S; Myhre, Sue Lynn; Youssef, Jim A

    2016-04-01

    A literature review. The purpose of this study was to review lumbar segmental and regional alignment changes following treatment with a variety of minimally invasive surgery (MIS) interbody fusion procedures for short-segment, degenerative conditions. An increasing number of lumbar fusions are being performed with minimally invasive exposures, despite a perception that minimally invasive lumbar interbody fusion procedures are unable to affect segmental and regional lordosis. Through a MEDLINE and Google Scholar search, a total of 23 articles were identified that reported alignment following minimally invasive lumbar fusion for degenerative (nondeformity) lumbar spinal conditions to examine aggregate changes in postoperative alignment. Of the 23 studies identified, 28 study cohorts were included in the analysis. Procedural cohorts included MIS ALIF (two), extreme lateral interbody fusion (XLIF) (16), and MIS posterior/transforaminal lumbar interbody fusion (P/TLIF) (11). Across 19 study cohorts and 720 patients, weighted average of lumbar lordosis preoperatively for all procedures was 43.5° (range 28.4°-52.5°) and increased 3.4° (9%) (range -2° to 7.4°) postoperatively (P lordosis increased, on average, by 4° from a weighted average of 8.3° preoperatively (range -0.8° to 15.8°) to 11.2° at postoperative time points (range -0.2° to 22.8°) (P lordosis and change in lumbar lordosis (r = 0.413; P = 0.003), wherein lower preoperative lumbar lordosis predicted a greater increase in postoperative lumbar lordosis. Significant gains in both weighted average lumbar lordosis and segmental lordosis were seen following MIS interbody fusion. None of the segmental lordosis cohorts and only two of the 19 lumbar lordosis cohorts showed decreases in lordosis postoperatively. These results suggest that MIS approaches are able to impact regional and local segmental alignment and that preoperative patient factors can impact the extent of correction gained

  13. Public health and health promotion capacity at national and regional level: a review of conceptual frameworks

    Directory of Open Access Journals (Sweden)

    Christoph Aluttis

    2014-04-01

    Full Text Available The concept of capacity building for public health has gained much attention during the last decade. National as well as international organizations increasingly focus their efforts on capacity building to improve performance in the health sector. During the past two decades, a variety of conceptual frameworks have been developed which describe relevant dimensions for public health capacity. Notably, these frameworks differ in design and conceptualization. This paper therefore reviews the existing conceptual frameworks and integrates them into one framework, which contains the most relevant dimensions for public health capacity at the country or regional level. A comprehensive literature search was performed to identify frameworks addressing public health capacity building at the national or regional level. We content-analysed these frameworks to identify the core dimensions of public health capacity. The dimensions were subsequently synthesized into a set of thematic areas to construct a conceptual framework which describes the most relevant dimensions for capacities at the national or regional level. The systematic review resulted in the identification of seven core domains for public health capacity: resources, organizational structures, workforce, partnerships, leadership and governance, knowledge development and country specific context. Accordingly, these dimensions were used to construct a framework, which describes these core domains more in detail. Our research shows that although there is no generally agreed upon model of public health capacity, a number of key domains for public health and health promotion capacity are consistently recurring in existing frameworks, regardless of their geographical location or thematic area. As only little work on the core concepts of public health capacities has yet taken place, this study adds value to the discourse by identifying these consistencies across existing frameworks and by synthesising

  14. Mutational analysis of the promoter and the coding region of the 5-HT1A gene

    Energy Technology Data Exchange (ETDEWEB)

    Erdmann, J.; Noethen, M.M.; Shimron-Abarbanell, D. [Univ. of Bonn (Germany)] [and others

    1994-09-01

    Disturbances of serotonergic pathways have been implicated in many neuropsychiatric disorders. Serotonin (5HT) receptors can be subdivided into at least three major families (5HT1, 5HT2, and 5HT3). Five human 5HT1 receptor subtypes have been cloned, namely 1A, 1D{alpha}, 1D{beta}, 1E, and 1F. Of these, the 5HT1A receptor is the best characterized subtype. In the present study we sought to identify genetic variation in the 5HT1A receptor gene which through alteration of protein function or level of expression might contribute to the genetics of neuropsychiatric diseases. The coding region and the 5{prime} promoter region of the 5HT1A gene from 159 unrelated subjects (45 schizophrenic, 46 bipolar affective, and 43 patients with Tourette`s syndrome, as well as 25 controls) were analyzed using SSCA. SSCA revealed the presence of two mutations both located in the coding region of the 5HT1A receptor gene. The first mutation is a rare silent C{r_arrow}T substitution at nucleotide position 549. The second mutation is characterized by a base pair substitution (A{r_arrow}G) at the first position of codon 28 and results in an amino acid exchange (Ile{r_arrow}Val). Since Val28 was found only in a single schizophrenic patient and in none of the other patients or controls, we decided to extend our samples and to use a restriction assay for screening a further 74 schizophrenic, 95 bipolar affective, and 49 patients with Tourette`s syndrome, as well as 185 controls, for the presence of the mutation. In total, the mutation was found in 2 schizophrenic patients, in 3 bipolars, in 1 Tourette patient, and in 5 controls. To our knowledge the Ile-28-Val substitution reported here is the first natural occuring molecular variant which has been identified for a serotonin receptor so far.

  15. Study on the binding sites of radiosensitivity associated transcription factor in the promoter region of Ier5 gene

    International Nuclear Information System (INIS)

    Cui Wei; Yin Lingling; Dong Lingyue

    2012-01-01

    Objective: To clarify the mechanism of immediate early response gene 5 (Ier5) transcription induced by radiation. Methods: Deletant construction, site-specific mutagenesis,electrophoretic mobility shift assay (EMSA) and chromatin immunoprecipitation (ChIP) were used to forecast the promoter region, binding sites and transcription factors of Ier5 gene in HeLa cells. Results: The promoter region of Ier5 gene might be in the region of Ier5 -8 deletant (-408 - -238 bp). The Ier5 gene had two transcription factors of GCF and NFI, and GCF had two binding sites located in the region of -388 - -382 bp and -274 - -270 bp of Ier5 promoter. The binding site of NFI was located in -362 - -357 bp of Ier5 promoter. GCF could inhibit the expression of Ier5 gene and this inhibition was diminished when the radiation dose increased. In contrast, NFI increased the expression of Ier5. Conclusions: The most possible region of Ier5 promoter is from -408 to -238 bp which has two binding sites for the radiosensitivity transcription factors of GCF and NFI that could negatively and positively regulate the expression of Ier5 respectively. (authors)

  16. Selection for Unequal Densities of Sigma70 Promoter-like Signalsin Different Regions of Large Bacterial Genomes

    Energy Technology Data Exchange (ETDEWEB)

    Huerta, Araceli M.; Francino, M. Pilar; Morett, Enrique; Collado-Vides, Julio

    2006-03-01

    The evolutionary processes operating in the DNA regions that participate in the regulation of gene expression are poorly understood. In Escherichia coli, we have established a sequence pattern that distinguishes regulatory from nonregulatory regions. The density of promoter-like sequences, that are recognizable by RNA polymerase and may function as potential promoters, is high within regulatory regions, in contrast to coding regions and regions located between convergently-transcribed genes. Moreover, functional promoter sites identified experimentally are often found in the subregions of highest density of promoter-like signals, even when individual sites with higher binding affinity for RNA polymerase exist elsewhere within the regulatory region. In order to investigate the generality of this pattern, we have used position weight matrices describing the -35 and -10 promoter boxes of E. coli to search for these motifs in 43 additional genomes belonging to most established bacterial phyla, after specific calibration of the matrices according to the base composition of the noncoding regions of each genome. We have found that all bacterial species analyzed contain similar promoter-like motifs, and that, in most cases, these motifs follow the same genomic distribution observed in E. coli. Differential densities between regulatory and nonregulatory regions are detectable in most bacterial genomes, with the exception of those that have experienced evolutionary extreme genome reduction. Thus, the phylogenetic distribution of this pattern mirrors that of genes and other genomic features that require weak selection to be effective in order to persist. On this basis, we suggest that the loss of differential densities in the reduced genomes of host-restricted pathogens and symbionts is the outcome of a process of genome degradation resulting from the decreased efficiency of purifying selection in highly structured small populations. This implies that the differential

  17. Geoheritage promotion of Thonon-les-Bains (Fr) region by the development of a geotourism product

    Science.gov (United States)

    Fanguin, Pauline

    2014-05-01

    Since 2012, the Chablais region (only in France) has acquired the Geopark label. This Geopark contributes to sustainable economic development of the region through geotourism. Moreover, the three Chablais (figure 1) are concerned by an Interreg IV program since 2009 (program of cooperation between European countries). The main objective of this program is to enhance the heritage resources (nature, culture and lifestyle of the region) (www.interreg-francesuisse.org). Therefore, the geotourism offer in this area just waiting to expand. The geodidactics models like the simplification of the scientific content are essential for geoheritage promotion, because this content must be available to a wide audience, allowing thereby the geoheritage recognition. The geotourism permits to apply different models (Cayla et al. 2010, Sellier, 2009) through a wide range of geotourism products, like guide, educational panels, thematic hikes and recently developed, new medias (website, smartphone applications). A geotourism product is based on four areas of questioning and was developed by Martin et al. (2010): (1) site (choice of sites to be valued), (2) public (a family public, good example of heterogeneous public), (3) contents (reasoning on geodidactics models) and (4) support (smartphone application). These four areas are very fundamental before the creation of any geotourism product. These reflexions aim to obtain a mediation product that integrates into geotourism offer of a region and contributes to its development and meets public expectations. New media, such as digital media - smartphone, tablets, website - become geotourism products more and more attractive. In addition, the necessary technologies to develop new media help to integrate a high interactivity potential with the public and thus get their attention. The architecture of this geotourism product is based on the new application developed by the Institute of Geography and sustainability, and the Bureau Relief. One

  18. NMR characterisation of the minimal interacting regions of centrosomal proteins 4.1R and NuMA1: effect of phosphorylation

    Directory of Open Access Journals (Sweden)

    Bruix Marta

    2010-01-01

    Full Text Available Abstract Background Some functions of 4.1R in non-erythroid cells are directly related with its distinct sub-cellular localisation during cell cycle phases. During mitosis, 4.1R is implicated in cell cycle progression and spindle pole formation, and co-localizes with NuMA1. However, during interphase 4.1R is located in the nucleus and only partially co-localizes with NuMA1. Results We have characterized by NMR the structural features of the C-terminal domain of 4.1R and those of the minimal region (the last 64 residues involved in the interaction with NuMA1. This subdomain behaves as an intrinsically unfolded protein containing a central region with helical tendency. The specific residues implicated in the interaction with NuMA1 have been mapped by NMR titrations and involve the N-terminal and central helical regions. The segment of NuMA1 that interacts with 4.1R is phosphorylated during mitosis. Interestingly, NMR data indicates that the phosphorylation of NuMA1 interacting peptide provokes a change in the interaction mechanism. In this case, the recognition occurs through the central helical region as well as through the C-terminal region of the subdomain meanwhile the N-terminal region do not interact. Conclusions These changes in the interaction derived from the phosphorylation state of NuMA1 suggest that phosphorylation can act as subtle mechanism of temporal and spatial regulation of the complex 4.1R-NuMA1 and therefore of the processes where both proteins play a role.

  19. “Fear or Love Thy Neighbour”? The EU Framework for Promoting Regional Cooperation in the South Caucasus

    Directory of Open Access Journals (Sweden)

    Nelli Babayan

    2011-12-01

    Full Text Available Building on the model of the enlargement policy, the European Union (EU designed the European Neighbourhood Policy and the Eastern Partnership to further promote its norms and principles. One of the goals of its new policies has been to foster regional cooperation among partner countries and their neighbours. This article specifies the EU’s framework for promoting regional cooperation through the aforementioned policies and discusses its potential impact on the example of the South Caucasus republics of Armenia, Azerbaijan, and Georgia. The South Caucasus has not only been an arena of intraregional conflicts, but has also often been troubled by disputes between its neighbours. This article argues that, due to a lack of proactive and consistent engagement, the EU’s framework risks leaving regional conflicts in the current state of stagnation and without advancement in regional cooperation.

  20. Regional Differences in Correlates of Daily Walking among Middle Age and Older Australian Rural Adults: Implications for Health Promotion

    Directory of Open Access Journals (Sweden)

    James Dollman

    2016-01-01

    Full Text Available Rural Australians are less physically active than their metropolitan counterparts, and yet very little is known of the candidate intervention targets for promoting physical activity in rural populations. As rural regions are economically, socially and environmentally diverse, drivers of regular physical activity are likely to vary between regions. This study explored the region-specific correlates of daily walking among middle age and older adults in rural regions with contrasting dominant primary industries. Participants were recruited through print and electronic media, primary care settings and community organisations. Pedometers were worn by 153 adults for at least four days, including a weekend day. A questionnaire identified potential intra-personal, social and environmental correlates of physical activity, according to a social ecological framework. Regression modelling identified independent correlates of daily walking separately in the two study regions. In one region, there were independent correlates of walking from all levels of the social ecological framework. In the other region, significant correlates of daily walking were almost all demographic (age, education and marital status. Participants living alone were less likely to be physically active regardless of region. This study highlights the importance of considering region-specific factors when designing strategies for promoting regular walking among rural adults.

  1. A scenario of vehicle-to-grid implementation and its double-layer optimal charging strategy for minimizing load variance within regional smart grids

    International Nuclear Information System (INIS)

    Jian, Linni; Zhu, Xinyu; Shao, Ziyun; Niu, Shuangxia; Chan, C.C.

    2014-01-01

    Highlights: • A scenario of vehicle-to-grid implementation within regional smart grid is discussed and mathematically formulated. • A double-layer optimal charging strategy for plug-in electric vehicles is proposed. • The proposed double-layer optimal charging algorithm aims to minimize power grid’s load variance. • The performance of proposed double-layer optimal charging algorithm is evaluated through comparative study. - Abstract: As an emerging new electrical load, plug-in electric vehicles (PEVs)’ impact on the power grid has drawn increasing attention worldwide. An optimal scenario is that by digging the potential of PEVs as a moveable energy storage device, they may not harm the power grid by, for example, triggering extreme surges in demand at rush hours, conversely, the large-scale penetration of PEVs could benefit the grid through flattening the power load curve, hence, increase the stability, security and operating economy of the grid. This has become a hot issue which is known as vehicle-to-grid (V2G) technology within the framework of smart grid. In this paper, a scenario of V2G implementation within regional smart grids is discussed. Then, the problem is mathematically formulated. It is essentially an optimization problem, and the objective is to minimize the overall load variance. With the increase of the scale of PEVs and charging posts involved, the computational complexity will become tremendously high. Therefore, a double-layer optimal charging (DLOC) strategy is proposed to solve this problem. The comparative study demonstrates that the proposed DLOC algorithm can effectively solve the problem of tremendously high computational complexity arising from the large-scaled PEVs and charging posts involved

  2. Genomic organization and identification of promoter regions for the BDNF gene in the pond turtle Trachemys scripta elegans.

    Science.gov (United States)

    Ambigapathy, Ganesh; Zheng, Zhaoqing; Keifer, Joyce

    2014-08-01

    Brain-derived neurotrophic factor (BDNF) is an important regulator of neuronal development and synaptic function. The BDNF gene undergoes significant activity-dependent regulation during learning. Here, we identified the BDNF promoter regions, transcription start sites, and potential regulatory sequences for BDNF exons I-III that may contribute to activity-dependent gene and protein expression in the pond turtle Trachemys scripta elegans (tBDNF). By using transfection of BDNF promoter/luciferase plasmid constructs into human neuroblastoma SHSY5Y cells and mouse embryonic fibroblast NIH3T3 cells, we identified the basal regulatory activity of promoter sequences located upstream of each tBDNF exon, designated as pBDNFI-III. Further, through chromatin immunoprecipitation (ChIP) assays, we detected CREB binding directly to exon I and exon III promoters, while BHLHB2, but not CREB, binds within the exon II promoter. Elucidation of the promoter regions and regulatory protein binding sites in the tBDNF gene is essential for understanding the regulatory mechanisms that control tBDNF gene expression.

  3. Carcass and meat quality determination as a tool to promote local meat consumption in outermost regions of Europe

    DEFF Research Database (Denmark)

    Hernandez Castellano, Lorenzo E; Morales-delaNuez, Antonio; Moreno-Indias, Isabel

    2013-01-01

    of this study, therefore, was to evaluate local and imported carcasses and meat quality in order to promote the consumption of local breeds, using the Canary Islands (Spain) as a model for other subtropical outermost regions. For this study 20 half-carcasses from Palmera breed and 20 imported half...

  4. Self-Paced Segmentation of Written Words on a Touchscreen Tablet Promotes the Oral Production of Nonverbal and Minimally Verbal Children with Autism

    Science.gov (United States)

    Vernay, Frédérique; Kahina, Harma; Thierry, Marrone; Jean-Yves, Roussey

    2017-01-01

    We investigated in a pilot study the effects of various types of visual mediation (photos, written words and self-paced syllabic segmentation of written words displayed on a touchscreen tablet) that are thought to facilitate the oral production of nonverbal and minimally verbal children with autism, according to the participants' level of oral…

  5. Relationship of interleukin-1B gene promoter region polymorphism with Helicobacter pylori infection and gastritis.

    Science.gov (United States)

    Ramis, Ivy Bastos; Vianna, Júlia Silveira; Halicki, Priscila Cristina Bartolomeu; Lara, Caroline; Tadiotto, Thássia Fernanda; da Silva Maciel, João Batista; Gonçalves, Carla Vitola; von Groll, Andrea; Dellagostin, Odir Antônio; da Silva, Pedro Eduardo Almeida

    2015-09-29

    Helicobacter pylori infection is associated with gastritis, peptic ulcer disease and gastric carcinoma. The severity of damage is determined by the interplay between environmental/behavioral factors, bacterial pathogenicity genes and host genetic polymorphisms that can influence the secretion levels of inflammatory cytokines. Accordingly, this study aimed to identify polymorphisms in the IL-1B and IL-1RN genes and their associations with H. pylori infection, cagA gene of H. pylori, and gastroduodenal diseases. Gastric biopsy samples from 151 patients infected with H. pylori and 76 uninfected individuals were analyzed. H. pylori infection was diagnosed by histology and PCR. Polymorphisms at positions -511, -31 and +3954 of the IL-1B gene were detected by PCR-RFLP, and an analysis of the VNTR polymorphism of the IL-1RN gene was performed by PCR. It was observed that the presence of the T/T genotype at position -511 and the C/C genotype at position -31 were associated with H. pylori infection and with an increased risk of gastritis in H. pylori-positive patients. Additionally, strains from patients H. pylori-positive carrying the cagA gene was significantly related with the T/T genotype at position -511 of IL-1B.  No association of polymorphisms at position +3954 of IL-1B and in the IL-1RN with H. pylori infection and with risk of severe gastric diseases was found. We demonstrated that polymorphisms in the promoter region of the IL-1B gene (at positions -511 and -31) are associated with an enhanced risk of H. pylori infection as well as gastritis in H. pylori-positive patients.

  6. Taxonomic minimalism.

    Science.gov (United States)

    Beattle, A J; Oliver, I

    1994-12-01

    Biological surveys are in increasing demand while taxonomic resources continue to decline. How much formal taxonomy is required to get the job done? The answer depends on the kind of job but it is possible that taxonomic minimalism, especially (1) the use of higher taxonomic ranks, (2) the use of morphospecies rather than species (as identified by Latin binomials), and (3) the involvement of taxonomic specialists only for training and verification, may offer advantages for biodiversity assessment, environmental monitoring and ecological research. As such, formal taxonomy remains central to the process of biological inventory and survey but resources may be allocated more efficiently. For example, if formal Identification is not required, resources may be concentrated on replication and increasing sample sizes. Taxonomic minimalism may also facilitate the inclusion in these activities of important but neglected groups, especially among the invertebrates, and perhaps even microorganisms. Copyright © 1994. Published by Elsevier Ltd.

  7. New PAH gene promoter KLF1 and 3'-region C/EBPalpha motifs influence transcription in vitro.

    Science.gov (United States)

    Klaassen, Kristel; Stankovic, Biljana; Kotur, Nikola; Djordjevic, Maja; Zukic, Branka; Nikcevic, Gordana; Ugrin, Milena; Spasovski, Vesna; Srzentic, Sanja; Pavlovic, Sonja; Stojiljkovic, Maja

    2017-02-01

    Phenylketonuria (PKU) is a metabolic disease caused by mutations in the phenylalanine hydroxylase (PAH) gene. Although the PAH genotype remains the main determinant of PKU phenotype severity, genotype-phenotype inconsistencies have been reported. In this study, we focused on unanalysed sequences in non-coding PAH gene regions to assess their possible influence on the PKU phenotype. We transiently transfected HepG2 cells with various chloramphenicol acetyl transferase (CAT) reporter constructs which included PAH gene non-coding regions. Selected non-coding regions were indicated by in silico prediction to contain transcription factor binding sites. Furthermore, electrophoretic mobility shift assay (EMSA) and supershift assays were performed to identify which transcriptional factors were engaged in the interaction. We found novel KLF1 motif in the PAH promoter, which decreases CAT activity by 50 % in comparison to basal transcription in vitro. The cytosine at the c.-170 promoter position creates an additional binding site for the protein complex involving KLF1 transcription factor. Moreover, we assessed for the first time the role of a multivariant variable number tandem repeat (VNTR) region located in the 3'-region of the PAH gene. We found that the VNTR3, VNTR7 and VNTR8 constructs had approximately 60 % of CAT activity. The regulation is mediated by the C/EBPalpha transcription factor, present in protein complex binding to VNTR3. Our study highlighted two novel promoter KLF1 and 3'-region C/EBPalpha motifs in the PAH gene which decrease transcription in vitro and, thus, could be considered as PAH expression modifiers. New transcription motifs in non-coding regions will contribute to better understanding of the PKU phenotype complexity and may become important for the optimisation of PKU treatment.

  8. Exploring DNA methylation changes in promoter, intragenic, and intergenic regions as early and late events in breast cancer formation

    International Nuclear Information System (INIS)

    Rauscher, Garth H.; Kresovich, Jacob K.; Poulin, Matthew; Yan, Liying; Macias, Virgilia; Mahmoud, Abeer M.; Al-Alem, Umaima; Kajdacsy-Balla, Andre; Wiley, Elizabeth L.; Tonetti, Debra; Ehrlich, Melanie

    2015-01-01

    Breast cancer formation is associated with frequent changes in DNA methylation but the extent of very early alterations in DNA methylation and the biological significance of cancer-associated epigenetic changes need further elucidation. Pyrosequencing was done on bisulfite-treated DNA from formalin-fixed, paraffin-embedded sections containing invasive tumor and paired samples of histologically normal tissue adjacent to the cancers as well as control reduction mammoplasty samples from unaffected women. The DNA regions studied were promoters (BRCA1, CD44, ESR1, GSTM2, GSTP1, MAGEA1, MSI1, NFE2L3, RASSF1A, RUNX3, SIX3 and TFF1), far-upstream regions (EN1, PAX3, PITX2, and SGK1), introns (APC, EGFR, LHX2, RFX1 and SOX9) and the LINE-1 and satellite 2 DNA repeats. These choices were based upon previous literature or publicly available DNA methylome profiles. The percent methylation was averaged across neighboring CpG sites. Most of the assayed gene regions displayed hypermethylation in cancer vs. adjacent tissue but the TFF1 and MAGEA1 regions were significantly hypomethylated (p ≤0.001). Importantly, six of the 16 regions examined in a large collection of patients (105 – 129) and in 15-18 reduction mammoplasty samples were already aberrantly methylated in adjacent, histologically normal tissue vs. non-cancerous mammoplasty samples (p ≤0.01). In addition, examination of transcriptome and DNA methylation databases indicated that methylation at three non-promoter regions (far-upstream EN1 and PITX2 and intronic LHX2) was associated with higher gene expression, unlike the inverse associations between cancer DNA hypermethylation and cancer-altered gene expression usually reported. These three non-promoter regions also exhibited normal tissue-specific hypermethylation positively associated with differentiation-related gene expression (in muscle progenitor cells vs. many other types of normal cells). The importance of considering the exact DNA region analyzed and the

  9. Natural selection in a population of Drosophila melanogaster explained by changes in gene expression caused by sequence variation in core promoter regions.

    Science.gov (United States)

    Sato, Mitsuhiko P; Makino, Takashi; Kawata, Masakado

    2016-02-09

    Understanding the evolutionary forces that influence variation in gene regulatory regions in natural populations is an important challenge for evolutionary biology because natural selection for such variations could promote adaptive phenotypic evolution. Recently, whole-genome sequence analyses have identified regulatory regions subject to natural selection. However, these studies could not identify the relationship between sequence variation in the detected regions and change in gene expression levels. We analyzed sequence variations in core promoter regions, which are critical regions for gene regulation in higher eukaryotes, in a natural population of Drosophila melanogaster, and identified core promoter sequence variations associated with differences in gene expression levels subjected to natural selection. Among the core promoter regions whose sequence variation could change transcription factor binding sites and explain differences in expression levels, three core promoter regions were detected as candidates associated with purifying selection or selective sweep and seven as candidates associated with balancing selection, excluding the possibility of linkage between these regions and core promoter regions. CHKov1, which confers resistance to the sigma virus and related insecticides, was identified as core promoter regions that has been subject to selective sweep, although it could not be denied that selection for variation in core promoter regions was due to linked single nucleotide polymorphisms in the regulatory region outside core promoter regions. Nucleotide changes in core promoter regions of CHKov1 caused the loss of two basal transcription factor binding sites and acquisition of one transcription factor binding site, resulting in decreased gene expression levels. Of nine core promoter regions regions associated with balancing selection, brat, and CG9044 are associated with neuromuscular junction development, and Nmda1 are associated with learning

  10. Tumour MLH1 promoter region methylation testing is an effective pre-screen for Lynch Syndrome (HNPCC)

    Science.gov (United States)

    Newton, K; Jorgensen, NM; Wallace, AJ; Buchanan, DD; Lalloo, F; McMahon, RFT; Hill, J; Evans, DG

    2016-01-01

    Background & Aims Lynch syndrome patients have DNA mismatch repair deficiency and up to 80% life-time risk of colorectal cancer. Screening of mutation carriers reduces colorectal cancer incidence and mortality. Selection for constitutional mutation testing relies on family history (Amsterdam and Bethesda Guidelines) and tumour derived biomarkers. Initial biomarker analysis uses mismatch repair protein immunohistochemistry and microsatellite instability. Abnormalities in either identify mismatch repair deficiency but do not differentiate sporadic epigenetic defects, due to MLH1 promoter region methylation (13% of CRCs) from Lynch Syndrome (4% of CRCs). A diagnostic biomarker capable of making this distinction would be valuable. This study compared two biomarkers in tumours with mismatch repair deficiency; quantification of methylation of the MLH1 promoter region using a novel assay and BRAF c.1799T>A, p.(Val600Glu) mutation status in the identification of constitutional mutations. Methods Tumour DNA was extracted (FFPE tissue) and pyrosequencing used to test for MLH1 promoter methylation and presence of the BRAF c.1799T>A, p.(Val600Glu) mutation 71 CRCs from individuals with pathogenic MLH1 mutations and 73 CRCs with sporadic MLH1 loss. Specificity and sensitivity was compared. Findings Unmethylated MLH1 promoter: sensitivity 94.4% (95% CI 86.2–98.4%), specificity 87.7% (95% CI 77.9–94.2%), Wild-type BRAF (codon 600): sensitivity 65.8% (95% CI 53.7–76.5%), specificity 98.6% (95% CI 92.4–100.0%) for the identification of those with pathogenic MLH1 mutations. Conclusions Quantitative MLH1 promoter region methylation using pyrosequencing is superior to BRAF codon 600 mutation status in identifying constitutional mutations in mismatch repair deficient tumours. PMID:25280751

  11. Hypermethylation of the DPYD promoter region is not a major predictor of severe toxicity in 5-fluorouracil based chemotherapy

    Directory of Open Access Journals (Sweden)

    Aebi Stefan

    2008-10-01

    Full Text Available Abstract Background The activity of dihydropyrimidine dehydrogenase (DPD, the key enzyme of pyrimidine catabolism, is thought to be an important determinant for the occurrence of severe toxic reactions to 5-fluorouracil (5-FU, which is one of the most commonly prescribed chemotherapeutic agents for the treatment of solid cancers. Genetic variation in the DPD gene (DPYD has been proposed as a main factor for variation in DPD activity in the population. However, only a small proportion of severe toxicities in 5-FU based chemotherapy can be explained with such rare deleterious DPYD mutations resulting in severe enzyme deficiencies. Recently, hypermethylation of the DPYD promoter region has been proposed as an alternative mechanism for DPD deficiency and thus as a major cause of severe 5-FU toxicity. Methods Here, the prognostic significance of this epigenetic marker with respect to severe 5-FU toxicity was assessed in 27 cancer patients receiving 5-FU based chemotherapy, including 17 patients experiencing severe toxic side effects following drug administration, none of which were carriers of a known deleterious DPYD mutation, and ten control patients. The methylation status of the DPYD promoter region in peripheral blood mononuclear cells was evaluated by analysing for each patient between 19 and 30 different clones of a PCR-amplified 209 base pair fragment of the bisulfite-modified DPYD promoter region. The fragments were sequenced to detect bisulfite-induced, methylation-dependent sequence differences. Results No evidence of DPYD promoter methylation was observed in any of the investigated patient samples, whereas in a control experiment, as little as 10% methylated genomic DNA could be detected. Conclusion Our results indicate that DYPD promoter hypermethylation is not of major importance as a prognostic factor for severe toxicity in 5-FU based chemotherapy.

  12. Targets of DNA-binding proteins in bacterial promoter regions present enhanced probabilities for spontaneous thermal openings

    International Nuclear Information System (INIS)

    Apostolaki, Angeliki; Kalosakas, George

    2011-01-01

    We mapped promoter regions of double-stranded DNA with respect to the probabilities of appearance of relatively large bubble openings exclusively due to thermal fluctuations at physiological temperatures. We analyzed five well-studied promoter regions of procaryotic type and found a spatial correlation between the binding sites of transcription factors and the position of peaks in the probability pattern of large thermal openings. Other distinct peaks of the calculated patterns correlate with potential binding sites of DNA-binding proteins. These results suggest that a DNA molecule would more frequently expose the bases that participate in contacts with proteins, which would probably enhance the probability of the latter to reach their targets. It also stands for using this method as a means to analyze DNA sequences based on their intrinsic thermal properties

  13. Water-soluble multidentate polymers compactly coating Ag2S quantum dots with minimized hydrodynamic size and bright emission tunable from red to second near-infrared region.

    Science.gov (United States)

    Gui, Rijun; Wan, Ajun; Liu, Xifeng; Yuan, Wen; Jin, Hui

    2014-05-21

    Hydrodynamic size-minimized quantum dots (QDs) have outstanding physicochemical properties for applications in multicolor molecular and cellular imaging at the level of single molecules and nanoparticles. In this study, we have reported the aqueous synthesis of Ag2S QDs by using thiol-based multidentate polymers as capping reagents. By regulating the composition of the precursors (AgNO3 and sulfur-N2H4·H2O complex) and multidentate polymers (poly(acrylic acid)-graft-cysteamine-graft-ethylenediamine), as well as the reaction time, Ag2S QDs (2.6-3.7 nm) are prepared, displaying tunable photoluminescence (PL) emission from red to the second near-infrared region (687-1096 nm). The small hydrodynamic thickness (1.6-1.9 nm) of the multidentate polymers yields a highly compact coating for the QDs, which results in the bright fluorescent QDs with high PL quantum yields (QYs: 14.2-16.4%). Experimental results confirm that the QDs have high PL stability and ultralow cytotoxicity, as well as high PLQYs and small hydrodynamic sizes (4.5-5.6 nm) similar to fluorescent proteins (27-30 kDa), indicating the feasibility of highly effective PL imaging in cells and living animals.

  14. Similarities in transcription factor IIIC subunits that bind to the posterior regions of internal promoters for RNA polymerase III

    OpenAIRE

    Matsutani Sachiko

    2004-01-01

    Abstract Background In eukaryotes, RNA polymerase III (RNAP III) transcribes the genes for small RNAs like tRNAs, 5S rRNA, and several viral RNAs, and short interspersed repetitive elements (SINEs). The genes for these RNAs and SINEs have internal promoters that consist of two regions. These two regions are called the A and B blocks. The multisubunit transcription factor TFIIIC is required for transcription initiation of RNAP III; in transcription of tRNAs, the B-block binding subunit of TFII...

  15. Promoting effect of ethanol on dewetting transition in the confined region of melittin tetramer

    International Nuclear Information System (INIS)

    Ren Xiuping; Zhou Bo; Wang Chunlei

    2012-01-01

    To study the influence of ethanol molecules on the melittin tetramer folding, we investigated the dewetting transition of the melittin tetramer immersed in pure water and 8% aqueous ethanol solution (mass fraction) by the molecular dynamics simulations. We found that the marked dewetting transitions occurred inside a nanoscale channel of the melittin tetramer both in pure water and in aqueous ethanol solution. Also, ethanol molecules promoted this dewetting transition. We attributed this promoting effect to ethanol molecules which prefer to locate at the liquid-vapor interface and decrease the liquid-vapor surface energy. The results provide insight into the effect of ethanol on the water dewetting phenomena. (authors)

  16. A Participatory Regional Partnership Approach to Promote Nutrition and Physical Activity Through Environmental and Policy Change in Rural Missouri.

    Science.gov (United States)

    Barnidge, Ellen K; Baker, Elizabeth A; Estlund, Amy; Motton, Freda; Hipp, Pamela R; Brownson, Ross C

    2015-06-11

    Rural residents are less likely than urban and suburban residents to meet recommendations for nutrition and physical activity. Interventions at the environmental and policy level create environments that support healthy eating and physical activity. Healthier Missouri Communities (Healthier MO) is a community-based research project conducted by the Prevention Research Center in St. Louis with community partners from 12 counties in rural southeast Missouri. We created a regional partnership to leverage resources and enhance environmental and policy interventions to improve nutrition and physical activity in rural southeast Missouri. Partners were engaged in a participatory action planning process that included prioritizing, implementing, and evaluating promising evidence-based interventions to promote nutrition and physical activity. Group interviews were conducted with Healthier MO community partners post intervention to evaluate resource sharing and sustainability efforts of the regional partnership. Community partners identified the benefits and challenges of resource sharing within the regional partnership as well as the opportunities and threats to long-term partnership sustainability. The partners noted that the regional participatory process was difficult, but the benefits outweighed the challenges. Regional rural partnerships may be an effective way to leverage relationships to increase the capacity of rural communities to implement environmental and policy interventions to promote nutrition and physical activity.

  17. Influence of promoter/enhancer region haplotypes on MGMT transcriptional regulation: a potential biomarker for human sensitivity to alkylating agents.

    Science.gov (United States)

    Xu, Meixiang; Nekhayeva, Ilona; Cross, Courtney E; Rondelli, Catherine M; Wickliffe, Jeffrey K; Abdel-Rahman, Sherif Z

    2014-03-01

    The O6-methylguanine-DNA methyltransferase gene (MGMT) encodes the direct reversal DNA repair protein that removes alkyl adducts from the O6 position of guanine. Several single-nucleotide polymorphisms (SNPs) exist in the MGMT promoter/enhancer (P/E) region. However, the haplotype structure encompassing these SNPs and their functional/biological significance are currently unknown. We hypothesized that MGMT P/E haplotypes, rather than individual SNPs, alter MGMT transcription and can thus alter human sensitivity to alkylating agents. To identify the haplotype structure encompassing the MGMT P/E region SNPs, we sequenced 104 DNA samples from healthy individuals and inferred the haplotypes using the data generated. We identified eight SNPs in this region, namely T7C (rs180989103), T135G (rs1711646), G290A (rs61859810), C485A (rs1625649), C575A (rs113813075), G666A (rs34180180), C777A (rs34138162) and C1099T (rs16906252). Phylogenetics and Sequence Evolution analysis predicted 21 potential haplotypes that encompass these SNPs ranging in frequencies from 0.000048 to 0.39. Of these, 10 were identified in our study population as 20 paired haplotype combinations. To determine the functional significance of these haplotypes, luciferase reporter constructs representing these haplotypes were transfected into glioblastoma cells and their effect on MGMT promoter activity was determined. Compared with the most common (reference) haplotype 1, seven haplotypes significantly upregulated MGMT promoter activity (18-119% increase; P alkylating agents.

  18. Association of polymorphisms of interleukin-18 gene promoter region with polycystic ovary syndrome in chinese population

    Directory of Open Access Journals (Sweden)

    Li Mei-zhi

    2010-10-01

    Full Text Available Abstract Background Recent research shows that polycystic ovary syndrome (PCOS may have an association with low-grade chronic inflammation, and that PCOS may induce an increase in serum interleukin-18 (IL-18 levels. Methods To investigate the polymorphisms of the IL-18 gene promoters with PCOS, two single nucleotide polymorphisms (SNPs in the promoter of the IL-18 gene (at positions -607C/A and -137G/C in 118 Chinese women with PCOS and 79 controls were evaluated using polymerase chain reaction (PCR. Results No significant differences were found in the genotype distribution, allele frequency and haplotype frequency between the PCOS and control groups. Further analysis demonstrated a relationship between IL-18 gene promoter polymorphisms and PCOS insulin resistance (IR. Regarding the -137 allele frequency, G and C allele frequencies were 93.5% and 6.5%, respectively, in the PCOS with IR patients; G and C allele frequencies were 85.4% and 14.6%, respectively, in PCOS patients without IR (chi2 = 3.601, P = 0.048. Conclusions The presence of a polymorphism in the IL-18 gene was found to have no correlation with the occurrence of PCOS. Carriage of the C allele at position -137 in the promoter of the IL-18 gene may play a protective role from the development of PCOS IR.

  19. Evaluation of methylation pattern in promoter region of E-cadherin ...

    African Journals Online (AJOL)

    user

    2011-03-07

    Mar 7, 2011 ... promoter methylation in CDH1 gene inactivation in breast cancer, the CpG methylation status of E- ..... 5'CpG island of CDH1 in prostate, lung, liver, bladder, .... and estrogen receptor alpha from Sp1 sites to induce cell cycle.

  20. The effect of mutations in the AmpC promoter region on β-lactam ...

    African Journals Online (AJOL)

    STORAGESEVER

    2008-08-04

    Aug 4, 2008 ... between the -10 and -35 boxes affects the resistance of bacteria to β-lactam antibiotics. .... The chromosomal cephalosporinase gene, ampC, of E. .... mutation in the ampC promoter increasing resistance to β-lactams in.

  1. A distal region of the human TGM1 promoter is required for expression in transgenic mice and cultured keratinocytes

    Directory of Open Access Journals (Sweden)

    Lu Ying

    2004-04-01

    Full Text Available Abstract Background TGM1(transglutaminase 1 is an enzyme that crosslinks the cornified envelope of mature keratinocytes. Appropriate expression of the TGM1 gene is crucial for proper keratinocyte function as inactivating mutations lead to the debilitating skin disease, lamellar ichthyosis. TGM1 is also expressed in squamous metaplasia, a consequence in some epithelia of vitamin A deficiency or toxic insult that can lead to neoplasia. An understanding of the regulation of this gene in normal and abnormal differentiation states may contribute to better disease diagnosis and treatment. Methods In vivo requirements for expression of the TGM1 gene were studied by fusing various lengths of promoter DNA to a reporter and injecting the DNA into mouse embryos to generate transgenic animals. Expression of the reporter was ascertained by Western blotting and immunohistochemistry. Further delineation of a transcriptionally important distal region was determined by transfections of progressively shortened or mutated promoter DNA into cultured keratinocytes. Results In vivo analysis of a reporter transgene driven by the TGM1 promoter revealed that 1.6 kilobases, but not 1.1 kilobases, of DNA was sufficient to confer tissue-specific and cell layer-specific expression. This same region was responsible for reporter expression in tissues undergoing squamous metaplasia as a response to vitamin A deprivation. Mutation of a distal promoter AP1 site or proximal promoter CRE site, both identified as important transcriptional elements in transfection assays, did not prevent appropriate expression. Further searching for transcriptional elements using electrophoretic mobility shift (EMSA and transfection assays in cultured keratinocytes identified two Sp1 elements in a transcriptionally active region between -1.6 and -1.4 kilobases. While mutation of either Sp1 site or the AP1 site singly had only a small effect, mutation of all three sites eliminated nearly all the

  2. Promoting University and Industry Links at the Regional Level: Comparing China's Reform and International Experience

    Science.gov (United States)

    Po, Yang; Cai, Yuzhuo; Lyytinen, Anu; Hölttä, Seppo

    2016-01-01

    This paper intends to learn from international experiences in order to facilitating China's ongoing regional university transformation with an ultimate goal to enhance the role of university in regional economic development and innovation. In so doing, this paper compares major models of universities of applied sciences (UAS) around the world from…

  3. Murine leukemia virus vector integration favors promoter regions and regional hot spots in a human T-cell line

    International Nuclear Information System (INIS)

    Tsukahara, Tomonori; Agawa, Hideyuki; Matsumoto, Sayori; Matsuda, Mizuho; Ueno, Shuichi; Yamashita, Yuki; Yamada, Koichiro; Tanaka, Nobuyuki; Kojima, Katsuhiko; Takeshita, Toshikazu

    2006-01-01

    Genomic analysis of integration will be important in evaluating the safety of human gene therapy with retroviral vectors. Here, we investigated MLV vector integration sites in human T-cells, since they are amenable to gene transfer studies, and have been used therapeutically in clinical trials. We mapped 340 MLV vector integration sites in the infected human T-cell clones we established. The data showed that MLV preferred integration near the transcription start sites (±5 kb), near CpG islands (±1 kb), and within the first intron of RefSeq genes. We also identified MLV integration hot spots that contained three or more integrations within a 100 kb region. RT-PCR revealed that mRNA-levels of T-cell clones that contained MLV integrations near transcription start sites or introns were dysregulated compared to the uninfected cells. These studies help define the profile of MLV integration in T-cells and the risks associated with MLV-based gene therapy

  4. Promoting survival: A grounded theory study of consequences of modern health practices in Ouramanat region of Iranian Kurdistan.

    Science.gov (United States)

    Mohammadpur, Ahmad; Rezaei, Mehdi; Sadeghi, Rasoul

    2010-05-14

    The aim of this qualitative study is to explore the way people using modern health care perceive its consequences in Ouraman-e-Takht region of Iranian Kurdistan. Ouraman-e-Takht is a rural, highly mountainous and dry region located in the southwest Kurdistan province of Iran. Recently, modern health practices have been introduced to the region. The purpose of this study was to investigate, from the Ouramains' point of view, the impact that modern health services and practices have had on the Ouraman traditional way of life. Interview data from respondents were analyzed by using grounded theory. Promoting survival was the core category that explained the impact that modern health practices have had on the Ouraman region. The people of Ouraman interpreted modern health practices as increasing their quality of life and promoting their survival. Results are organized around this core category in a paradigm model consisting of conditions, interactions, and consequences. This model can be used to understand the impact of change from the introduction of modern health on a traditional society.

  5. Promoting survival: A grounded theory study of consequences of modern health practices in Ouramanat region of Iranian Kurdistan

    Science.gov (United States)

    Mohammadpur, Ahmad; Rezaei, Mehdi; Sadeghi, Rasoul

    2010-01-01

    The aim of this qualitative study is to explore the way people using modern health care perceive its consequences in Ouraman-e-Takht region of Iranian Kurdistan. Ouraman-e-Takht is a rural, highly mountainous and dry region located in the southwest Kurdistan province of Iran. Recently, modern health practices have been introduced to the region. The purpose of this study was to investigate, from the Ouramains' point of view, the impact that modern health services and practices have had on the Ouraman traditional way of life. Interview data from respondents were analyzed by using grounded theory. Promoting survival was the core category that explained the impact that modern health practices have had on the Ouraman region. The people of Ouraman interpreted modern health practices as increasing their quality of life and promoting their survival. Results are organized around this core category in a paradigm model consisting of conditions, interactions, and consequences. This model can be used to understand the impact of change from the introduction of modern health on a traditional society. PMID:20640020

  6. Promotion of physical activity in the European region: content analysis of 27 national policy documents

    DEFF Research Database (Denmark)

    Daugbjerg, Signe B; Kahlmeier, Sonja; Racioppi, Francesca

    2009-01-01

    . Population groups most in need such as people with low levels of physical activity were rarely specifically targeted. Most policies emphasized the importance of an evaluation. However, only about half of them indicated a related intention or requirement. CONCLUSION: In recent years there has been......BACKGROUND: Over the past years there has been increasing interest in physical activity promotion and the development of appropriate policy. So far, there has been no comprehensive overview of the activities taking place in Europe in this area of public health policy. METHODS: Using different...... search methods, 49 national policy documents on physical activity promotion were identified. An analysis grid covering key features was developed for the analysis of the 27 documents published in English. RESULTS: Analysis showed that many general recommendations for policy developments are being...

  7. Analysis of the Impact of the Flow of Migrant Workers on Regional Economy: Based on the Thought about the Promotion of Jiangxi Regional Economic Competitiveness

    Directory of Open Access Journals (Sweden)

    Sun Yuping

    2016-03-01

    Full Text Available Labor resource is the necessary productive factor in regional economic development, and one of important indexes to evaluate regional economic competitiveness. The great economic achievement brought by the 30-year reform and opening up of China is due to the fact that China brought the backward advantage of “demographic dividend” into play, promoted the fast development of industrialization and urbanization, and became the second largest economy in the world. The entity of “demographic dividend” is the non-agricultural migrant population, i.e., migrant workers. The transfer employment of migrant workers has typical regional liquidity, and the imbalance of regional economy causes the flow of many migrant workers. In order to achieve harmonious development and coordinated development, underdeveloped areas must understand the character and regulation, adopt positive industrial policy and supportive policy, guide the reasonable flow of migrant workers, and realize the transfer of local employment and citizenization of migrant workers, which can enhance regional economic competitiveness

  8. Finding Combination of Features from Promoter Regions for Ovarian Cancer-related Gene Group Classification

    KAUST Repository

    Olayan, Rawan S.

    2012-12-01

    In classification problems, it is always important to use the suitable combination of features that will be employed by classifiers. Generating the right combination of features usually results in good classifiers. In the situation when the problem is not well understood, data items are usually described by many features in the hope that some of these may be the relevant or most relevant ones. In this study, we focus on one such problem related to genes implicated in ovarian cancer (OC). We try to recognize two important OC-related gene groups: oncogenes, which support the development and progression of OC, and oncosuppressors, which oppose such tendencies. For this, we use the properties of promoters of these genes. We identified potential “regulatory features” that characterize OC-related oncogenes and oncosuppressors promoters. In our study, we used 211 oncogenes and 39 oncosuppressors. For these, we identified 538 characteristic sequence motifs from their promoters. Promoters are annotated by these motifs and derived feature vectors used to develop classification models. We made a comparison of a number of classification models in their ability to distinguish oncogenes from oncosuppressors. Based on 10-fold cross-validation, the resultant model was able to separate the two classes with sensitivity of 96% and specificity of 100% with the complete set of features. Moreover, we developed another recognition model where we attempted to distinguish oncogenes and oncosuppressors as one group from other OC-related genes. That model achieved accuracy of 82%. We believe that the results of this study will help in discovering other OC-related oncogenes and oncosuppressors not identified as yet.

  9. Finding Combination of Features from Promoter Regions for Ovarian Cancer-related Gene Group Classification

    KAUST Repository

    Olayan, Rawan S.

    2012-01-01

    In classification problems, it is always important to use the suitable combination of features that will be employed by classifiers. Generating the right combination of features usually results in good classifiers. In the situation when the problem is not well understood, data items are usually described by many features in the hope that some of these may be the relevant or most relevant ones. In this study, we focus on one such problem related to genes implicated in ovarian cancer (OC). We try to recognize two important OC-related gene groups: oncogenes, which support the development and progression of OC, and oncosuppressors, which oppose such tendencies. For this, we use the properties of promoters of these genes. We identified potential “regulatory features” that characterize OC-related oncogenes and oncosuppressors promoters. In our study, we used 211 oncogenes and 39 oncosuppressors. For these, we identified 538 characteristic sequence motifs from their promoters. Promoters are annotated by these motifs and derived feature vectors used to develop classification models. We made a comparison of a number of classification models in their ability to distinguish oncogenes from oncosuppressors. Based on 10-fold cross-validation, the resultant model was able to separate the two classes with sensitivity of 96% and specificity of 100% with the complete set of features. Moreover, we developed another recognition model where we attempted to distinguish oncogenes and oncosuppressors as one group from other OC-related genes. That model achieved accuracy of 82%. We believe that the results of this study will help in discovering other OC-related oncogenes and oncosuppressors not identified as yet.

  10. Association of a Human FABP1 Gene Promoter Region Polymorphism with Altered Serum Triglyceride Levels.

    Directory of Open Access Journals (Sweden)

    Xian-E Peng

    Full Text Available Liver fatty acid-binding protein (L-FABP, also known as fatty acid-binding protein 1 (FABP1, is a key regulator of hepatic lipid metabolism. Elevated FABP1 levels are associated with an increased risk of cardiovascular disease (CVD and metabolic syndromes. In this study, we examine the association of FABP1 gene promoter variants with serum FABP1 and lipid levels in a Chinese population. Four promoter single-nucleotide polymorphisms (SNPs of FABP1 gene were genotyped in a cross-sectional survey of healthy volunteers (n = 1,182 from Fuzhou city of China. Results showed that only the rs2919872 G>A variant was significantly associated with serum TG concentration(P = 0.032.Compared with the rs2919872 G allele, rs2919872 A allele contributed significantly to reduced serum TG concentration, and this allele dramatically decreased the FABP1 promoter activity(P < 0.05. The rs2919872 A allele carriers had considerably lower serum FABP1 levels than G allele carriers (P < 0.01. In the multivariable linear regression analysis, the rs2919872 A allele was negatively associated with serum FABP1 levels (β = -0.320, P = 0.003, while serum TG levels were positively associated with serum FABP1 levels (β = 0.487, P = 0.014. Our data suggest that compared with the rs2919872 G allele, the rs2919872 A allele reduces the transcriptional activity of FABP1 promoter, and thereby may link FABP1 gene variation to TG level in humans.

  11. DNMT 1 maintains hypermethylation of CAG promoter specific region and prevents expression of exogenous gene in fat-1 transgenic sheep.

    Science.gov (United States)

    Yang, Chunrong; Shang, Xueying; Cheng, Lei; Yang, Lei; Liu, Xuefei; Bai, Chunling; Wei, Zhuying; Hua, Jinlian; Li, Guangpeng

    2017-01-01

    Methylation is an important issue in gene expression regulation and also in the fields of genetics and reproduction. In this study, we created fat-1 transgenic sheep, investigated the fine-mapping and the modulatory mechanisms of promoter methylation. Sheep fetal fibroblasts were transfected by pCAG-fat1-IRES-EGFP. Monoclonal cell line was screened as nuclear donor and carried out nuclear transfer (441 transgenic cloned embryos, 52 synchronism recipient sheep). Six offsprings were obtained. Expressions of exogenous genes fat-1 and EGFP were detectable in 10 examined tissues and upregulated omega-3 fatty acid content. Interestingly, more or less EGFP negative cells were detectable in the positive transgenic fetal skin cells. EGFP negative and positive cells were sorted by flow cytometry, and their methylation status in the whole promoter region (1701 nt) were investigated by bisulphate sequencing. The fine-mapping of methylation in CAG promoter were proposed. The results suggested that exogenous gene expression was determined by the methylation status from 721-1346 nt and modulated by methylation levels at 101, 108 and 115 nt sites in CAG promoter. To clarify the regulatory mechanism of methylation, examination of four DNA methyltransferases (DNMTs) demonstrated that hypermethylation of CAG promoter is mainly maintained by DNMT 1 in EGFP negative cells. Furthermore, investigation of the cell surface antigen CD34, CD45 and CD166 indicated that EGFP positive and negative cells belong to different types. The present study systematically clarified methylation status of CAG promoter in transgenic sheep and regulatory mechanism, which will provide research strategies for gene expression regulation in transgenic animals.

  12. Association of the Resistin Gene Promoter Region Polymorphism with Kawasaki Disease in Chinese Children

    Directory of Open Access Journals (Sweden)

    Ruixi Liu

    2012-01-01

    Full Text Available Objectives. The −420C>G polymorphism located in the resistin gene (RETN promoter has recently been suggested to play a potential role in proinflammatory conditions and cardiovascular disease. This study investigated the association of the RETN promoter polymorphism with Kawasaki disease (KD and its clinical parameters in Chinese children. Methods. We compared patients with complete KD to incomplete KD children. Genotyping of the RETN promoter polymorphism was performed using MassARRAY system, and serum resistin levels were estimated using the sandwich enzyme immunoassay method. Results. There was no significant difference in RETN (−420C>G genotypes between KD and control groups. However, the frequency of the G allele was higher in iKD patients than in cKD children due to a significantly increased frequency of the GG genotypes. Serum levels of resistin were significantly higher in KD patients than in controls regardless of the presence of coronary artery lesions (CALs. Conclusion. The present findings suggest that while resistin may play a role in the pathogenesis of KD, there is no apparent association between CAL and the RETN (−420C>G gene polymorphism in KD children. However, the diagnosis of iKD is challenging but can be supported by the presence of the G allele and the GG genotypes.

  13. Developing regionally specific grazing practices to promote production, profitability, and environmental quality

    Science.gov (United States)

    Rangelands are valued for their capacity to provide diverse suites of ecosystem services, from food production to carbon storage to biological diversity. Although rangelands worldwide share common characteristics, differences among biogeographic regions result in differences in the types of opportun...

  14. Cytosine deletion at AP2-box region of HSP70 promoter and its ...

    Indian Academy of Sciences (India)

    of thermotolerance in cells (Leung et al. 1996). ... region of HSP70 significantly affected cellular thermotol- erance ... The double PCR-RFLP using ScrFI confirmed the occur- ... suade of HSP70 on defense of proteins related to respiration.

  15. Regional differences in gene expression and promoter usage in aged human brains

    KAUST Repository

    Pardo, Luba M.; Rizzu, Patrizia; Francescatto, Margherita; Vitezic, Morana; Leday, Gwenaë l G.R.; Sanchez, Javier Simon; Khamis, Abdullah M.; Takahashi, Hazuki; van de Berg, Wilma D.J.; Medvedeva, Yulia A.; van de Wiel, Mark A.; Daub, Carsten O.; Carninci, Piero; Heutink, Peter

    2013-01-01

    To characterize the promoterome of caudate and putamen regions (striatum), frontal and temporal cortices, and hippocampi from aged human brains, we used high-throughput cap analysis of gene expression to profile the transcription start sites

  16. Development of model for studies on momentum transfer in electrochemical cells with entry region coil as turbulence promoter

    Science.gov (United States)

    Penta Rao, Tamarba; Rajendra Prasad, P.

    2018-04-01

    Entry region swirl promoters gain importance in industry because of its effectiveness in augmentation of mass and heat transfer augmentation. Design of equipment needs momentum transfer data along with mass or heat transfer data. Hence an experimental investigation was carried out with coaxially placed entry region spiral coil as turbulence promoters on momentum transfer in forced convection flow of electrolyte in circular conduits. Aqueous solution of sodium hydroxide and 0.01 M equimolal Ferri-ferro cyanide system was chosen for the study. The study covered parameters like effect of pitch of the coil, effect of length of the coil, diameter of the coil, diameter of the coil wire, diameter of the annular rod. The promoter is measured by limiting current technique using diffusion controlled electrochemical reactions. The study comprises of evaluation of momentum transfer rates at the outer wall of the electrochemical cell. Pressure drop measurements were also made to obtain the energy consumption pattern. Within the range of variables covered. The results are correlated by the momentum transfer similarity function. Momentum transfer coefficients were evaluated from measured limiting currents. Effect of each parameter was studied in terms of friction factor. A model was developed for momentum transfer. The experimental data on momentum transfer was modeled in terms of momentum transfer function and Reynolds number, geometric parameters.

  17. No evidence for promoter region methylation of the succinate dehydrogenase and fumarate hydratase tumour suppressor genes in breast cancer

    Directory of Open Access Journals (Sweden)

    Dobrovic Alexander

    2009-09-01

    Full Text Available Abstract Background Succinate dehydrogenase (SDH and fumarate hydratase (FH are tricarboxylic acid (TCA cycle enzymes that are also known to act as tumour suppressor genes. Increased succinate or fumarate levels as a consequence of SDH and FH deficiency inhibit hypoxia inducible factor-1α (HIF-1α prolyl hydroxylases leading to sustained HIF-1α expression in tumours. Since HIF-1α is frequently expressed in breast carcinomas, DNA methylation at the promoter regions of the SDHA, SDHB, SDHC and SDHD and FH genes was evaluated as a possible mechanism in silencing of SDH and FH expression in breast carcinomas. Findings No DNA methylation was identified in the promoter regions of the SDHA, SDHB, SDHC, SDHD and FH genes in 72 breast carcinomas and 10 breast cancer cell lines using methylation-sensitive high resolution melting which detects both homogeneous and heterogeneous methylation. Conclusion These results show that inactivation via DNA methylation of the promoter CpG islands of SDH and FH is unlikely to play a major role in sporadic breast carcinomas.

  18. Similarities in transcription factor IIIC subunits that bind to the posterior regions of internal promoters for RNA polymerase III

    Directory of Open Access Journals (Sweden)

    Matsutani Sachiko

    2004-08-01

    Full Text Available Abstract Background In eukaryotes, RNA polymerase III (RNAP III transcribes the genes for small RNAs like tRNAs, 5S rRNA, and several viral RNAs, and short interspersed repetitive elements (SINEs. The genes for these RNAs and SINEs have internal promoters that consist of two regions. These two regions are called the A and B blocks. The multisubunit transcription factor TFIIIC is required for transcription initiation of RNAP III; in transcription of tRNAs, the B-block binding subunit of TFIIIC recognizes a promoter. Although internal promoter sequences are conserved in eukaryotes, no evidence of homology between the B-block binding subunits of vertebrates and yeasts has been reported previously. Results Here, I reported the results of PSI-BLAST searches using the B-block binding subunits of human and Shizosacchromyces pombe as queries, showing that the same Arabidopsis proteins were hit with low E-values in both searches. Comparison of the convergent iterative alignments obtained by these PSI-BLAST searches revealed that the vertebrate, yeast, and Arabidopsis proteins have similarities in their N-terminal one-third regions. In these regions, there were three domains with conserved sequence similarities, one located in the N-terminal end region. The N-terminal end region of the B-block binding subunit of Saccharomyces cerevisiae is tentatively identified as a HMG box, which is the DNA binding motif. Although I compared the alignment of the N-terminal end regions of the B-block binding subunits, and their homologs, with that of the HMG boxes, it is not clear whether they are related. Conclusion Molecular phylogenetic analyses using the small subunit rRNA and ubiquitous proteins like actin and α-tubulin, show that fungi are more closely related to animals than either is to plants. Interestingly, the results obtained in this study show that, with respect to the B-block binding subunits of TFIIICs, animals appear to be evolutionarily closer to plants

  19. Similarities in transcription factor IIIC subunits that bind to the posterior regions of internal promoters for RNA polymerase III.

    Science.gov (United States)

    Matsutani, Sachiko

    2004-08-09

    In eukaryotes, RNA polymerase III (RNAP III) transcribes the genes for small RNAs like tRNAs, 5S rRNA, and several viral RNAs, and short interspersed repetitive elements (SINEs). The genes for these RNAs and SINEs have internal promoters that consist of two regions. These two regions are called the A and B blocks. The multisubunit transcription factor TFIIIC is required for transcription initiation of RNAP III; in transcription of tRNAs, the B-block binding subunit of TFIIIC recognizes a promoter. Although internal promoter sequences are conserved in eukaryotes, no evidence of homology between the B-block binding subunits of vertebrates and yeasts has been reported previously. Here, I reported the results of PSI-BLAST searches using the B-block binding subunits of human and Shizosacchromyces pombe as queries, showing that the same Arabidopsis proteins were hit with low E-values in both searches. Comparison of the convergent iterative alignments obtained by these PSI-BLAST searches revealed that the vertebrate, yeast, and Arabidopsis proteins have similarities in their N-terminal one-third regions. In these regions, there were three domains with conserved sequence similarities, one located in the N-terminal end region. The N-terminal end region of the B-block binding subunit of Saccharomyces cerevisiae is tentatively identified as a HMG box, which is the DNA binding motif. Although I compared the alignment of the N-terminal end regions of the B-block binding subunits, and their homologs, with that of the HMG boxes, it is not clear whether they are related. Molecular phylogenetic analyses using the small subunit rRNA and ubiquitous proteins like actin and alpha-tubulin, show that fungi are more closely related to animals than either is to plants. Interestingly, the results obtained in this study show that, with respect to the B-block binding subunits of TFIIICs, animals appear to be evolutionarily closer to plants than to fungi.

  20. Perceptions of health promoters about health promotion programmes for families with adolescents orphaned as a result of AIDS in the rural Hammanskraal region in South Africa

    Directory of Open Access Journals (Sweden)

    Maseapo P. Mthobeni

    2013-02-01

    Full Text Available South African communities are still greatly affected by the high rate of infection with HIV or who are living with AIDS, mirrored in the 2008 overall national HIV prevalence of 29.3%(UNAIDS 2010:10. In addressing the challenge, the health system is dependent on community care level workers such as caregivers to render health promotion and education in the homes and communities. The caregivers based in the communities are the ones with first-hand information on what is needed for the success of health promotion programmes. This study, aimed at exploring the challenges faced by the health promoters, described their perceptions regarding a health promotion programme for families with adolescents orphaned as a result of AIDS. Data were collected on the purposively selected participants at the rural Hammanskraal region in South Africa and the research question: ‘What is your perception regarding health promotion programmes for families with adolescents orphaned as a result of AIDS’ was asked and discussed by participants in a focus group interview. Data were analysed using the adapted Tesch method to organize and isolate the main categories, sub-categories and themes. The following main categories were isolated: attitudes of adolescents, effectiveness of home visits, need for health education and limited resources. Based on the findings, it was therefore recommended that health care planners assist in the improvement of health promotion and education by using the community and national media, providing information material and providing access to the internet in order to allow more people, including young people, to access the information.Suid-Afrikaanse gemeenskappe word steeds grootliks beïnvloed deur die hoë vlak van MIV en vigs, soos weerspieël in die algehele nasionale MIV-syfer in 2008 van 29.3% (UNAIDS 2010:10. In die aanspreek van hierdie uitdaging is die gesondheidstelsel afhanklik van gemeenskapsorgwerkers om gesondheidsbevordering

  1. Perceptions of health promoters about health promotion programmes for families with adolescents orphaned as a result of AIDS in the rural Hammanskraal region in South Africa

    Directory of Open Access Journals (Sweden)

    Maseapo P. Mthobeni

    2013-02-01

    Full Text Available South African communities are still greatly affected by the high rate of infection with HIV or who are living with AIDS, mirrored in the 2008 overall national HIV prevalence of 29.3%(UNAIDS 2010:10. In addressing the challenge, the health system is dependent on community care level workers such as caregivers to render health promotion and education in the homes and communities. The caregivers based in the communities are the ones with first-hand information on what is needed for the success of health promotion programmes. This study, aimed at exploring the challenges faced by the health promoters, described their perceptions regarding a health promotion programme for families with adolescents orphaned as a result of AIDS. Data were collected on the purposively selected participants at the rural Hammanskraal region in South Africa and the research question: ‘What is your perception regarding health promotion programmes for families with adolescents orphaned as a result of AIDS’ was asked and discussed by participants in a focus group interview. Data were analysed using the adapted Tesch method to organize and isolate the main categories, sub-categories and themes. The following main categories were isolated: attitudes of adolescents, effectiveness of home visits, need for health education and limited resources. Based on the findings, it was therefore recommended that health care planners assist in the improvement of health promotion and education by using the community and national media, providing information material and providing access to the internet in order to allow more people, including young people, to access the information. Suid-Afrikaanse gemeenskappe word steeds grootliks beïnvloed deur die hoë vlak van MIV en vigs, soos weerspieël in die algehele nasionale MIV-syfer in 2008 van 29.3% (UNAIDS 2010:10. In die aanspreek van hierdie uitdaging is die gesondheidstelsel afhanklik van gemeenskapsorgwerkers om gesondheidsbevordering

  2. MICB gene diversity and balancing selection on its promoter region in Yao population in southern China.

    Science.gov (United States)

    Chen, Xiang; Liu, Xuexiang; Wei, Xiaomou; Meng, Yuming; Liu, Limin; Qin, Shini; Liu, Yanyu; Dai, Shengming

    2016-12-01

    To comprehensively examine the MICB gene polymorphism and identify its differences in Chinese Yao population from other ethnic groups, we investigated the polymorphism in the 5'-upstream regulation region (5'-URR), coding region (exons 2-4), and the 3'-untranslated region (3'-UTR) of MICB gene by using PCR-SBT method in 125 healthy unrelated Yao individuals in Guangxi Zhuang Autonomous Region. Higher polymorphism was observed in the 5'-URR, nine single nucleotide polymorphisms (SNPs) and a two base pairs deletion at position -139/-138 were found in our study. Only five different variation sites, however, were detected in exons 2-4 and three were observed in the 3'-UTR. The minor allele frequencies of all variants were greater than 5%, except for rs3828916, rs3131639, rs45627734, rs113620316, rs779737471, and the variation at position +11803 in the 3'-UTR. The first nine SNPs of 5'-URR and rs1065075, rs1051788 of the coding region showed significant linkage disequilibrium with each other. Ten different MICB extended haplotypes (EH) encompassing the 5'-URR, exons 2-4, and 3'-UTR were found in this population, and the most frequent was EH1 (23.2%). We provided several evidences for balancing selection effect on the 5'-URR of MICB gene in Yao population. Copyright © 2016 American Society for Histocompatibility and Immunogenetics. Published by Elsevier Inc. All rights reserved.

  3. Hypermethylation of the FANCC and FANCL Promoter Regions in Sporadic Acute Leukaemia

    Directory of Open Access Journals (Sweden)

    C. J. Hess

    2008-01-01

    Full Text Available Objective: Inactivation of the FA-BRCA pathway results in chromosomal instability. Fanconi anaemia (FA patients have an inherited defect in this pathway and are strongly predisposed to the development of acute myeloid leukaemia (AML. Studies in sporadic cancers have shown promoter methylation of the FANCF gene in a significant proportion of various solid tumours. However, only a single leukaemic case with methylation of one of the FA-BRCA genes has been described to date, i.e. methylation of FANCF in cell line CHRF-288. We investigated the presence of aberrant methylation in 11 FA-BRCA genes in sporadic cases of leukaemia.

  4. CAGE-defined promoter regions of the genes implicated in Rett Syndrome

    DEFF Research Database (Denmark)

    Vitezic, Morana; Bertin, Nicolas; Andersson, Robin

    2014-01-01

    BACKGROUND: Mutations in three functionally diverse genes cause Rett Syndrome. Although the functions of Forkhead box G1 (FOXG1), Methyl CpG binding protein 2 (MECP2) and Cyclin-dependent kinase-like 5 (CDKL5) have been studied individually, not much is known about their relation to each other...... reveal the predominantly used transcription start sites (TSSs) for each gene including novel transcription start sites for FOXG1. We show that FOXG1 expression is poorly correlated with the expression of MECP2 and CDKL5. We identify promoter shapes for each TSS, the predicted location of enhancers...

  5. Fish farming as an innovative strategy for promoting food security in drought risk regions of Zimbabwe

    Directory of Open Access Journals (Sweden)

    Elvin Shava

    2017-11-01

    Full Text Available This article examines the implementation of fish farming as an innovative and economic strategy for promoting food security and dietary diversities among vulnerable households in drought risk areas of Zimbabwe. The declining climatic conditions and lack of economic opportunities in Mwenezi district of Zimbabwe attracted the attention of three nongovernmental organisations (NGOs to implement fish farming as an innovative mechanism to stimulate food security and generate employment in the district. The article used a qualitative research approach that includes semi-structured interviews and secondary data. The purposive sampling technique was adopted to interview participants in Mwenezi district who were involved in fish farming to assess and explore the experiences and benefits they derive from such development projects. Results for the article revealed that fish farming was well embraced by local communities as it led to improvements in food security, household income and employment regeneration. The local government including traditional leadership (Chiefs and Headmen’s supported the NGO activities as they benefited local communities. The article concludes that although fish farming was instrumental in regenerating employment, some participants still fail to participate because of laziness and desire to maintain dependency syndrome. The article recommends the NGOs to launch awareness campaigns in rural communities and increase networking with the donor community which is fundamental in attracting sustainable funding. The government can also promote fish farming in vulnerable rural communities by providing funding and capacity building programmes.

  6. Polymorphism in the oxytocin promoter region in patients with lactase non-persistence is not related to symptoms

    Directory of Open Access Journals (Sweden)

    Simrén Magnus

    2009-11-01

    Full Text Available Abstract Background Oxytocin and the oxytocin receptor have been demonstrated in the gastrointestinal (GI tract and have been shown to exert physiological effects on gut motility. The role for oxytocin in the pathophysiology of GI complaints is unknown. The aim of this study was to examine genetic variations or polymorphism of oxytocin (OXT and its receptor (OXTR genes in patients with GI complaints without visible organic abnormalities. Methods Genetic variants in the OXT promoter region, and in the OXTR gene in DNA samples from 131 rigorously evaluated patients with Irritable Bowel Syndrome (IBS, 408 homozygous subjects referred for lactase (LCT-13910 C>T, rs4988235 genotyping, and 299 asymptomatic blood donors were compared. One polymorphism related to the OXT gene (rs6133010 A>G and 4 related to the OXTR gene (rs1465386 G>T, rs3806675 G>A, rs968389 A>G, rs1042778 G>T were selected for genotyping using Applied Biosystems 7900 HT allele discrimination assays. Results There were no statistically significant differences in the genotype or allele frequencies in any of the SNPs when IBS patients were compared to healthy controls. Among subjects referred for lactase genotyping, the rs6133010 A>G OXT promoter A/G genotype tended to be more common in the 154 non-persistent (27.3% subjects than in the 254 lactase persistant (18.1% subjects and in the healthy controls (19.4% (p = 0.08. When direct comparing, the A/G genotype was less common in the OXT promoter region in controls (p = 0.09 and in subjects with lactase persistence (p = 0.03 compared to subjects with lactase non-persistence. When healthy controls were viewed according to their own LCT-13910 genotypes, the C/C lactase non-persistent controls had a higher frequency for the OXT promoter A/G genotype than LCT-13910 T/T lactase persistent controls (41.2% vs 13.1%. No significant differences in frequencies of the investigated OXTR SNPs were noted in this study. Conclusion The results suggest

  7. Genetic polymorphisms within tumor necrosis factor gene promoter region: a role for susceptibility to ventilator-associated pneumonia.

    Science.gov (United States)

    Kotsaki, Antigoni; Raftogiannis, Maria; Routsi, Christina; Baziaka, Fotini; Kotanidou, Anastasia; Antonopoulou, Anastasia; Orfanos, Stylianos E; Katsenos, Chrisostomos; Koutoukas, Pantelis; Plachouras, Diamantis; Mandragos, Konstantinos; Giamarellos-Bourboulis, Evangelos J

    2012-08-01

    Debatable findings exist among various studies regarding the impact of single nucleotide polymorphisms (SNPs) within the promoter region of the tumor necrosis factor (TNF) gene for susceptibility to infections. Their impact was investigated in a cohort of mechanically ventilated patients who developed ventilator-associated pneumonia (VAP). Two-hundred and thirteen mechanically ventilated patients who developed VAP were enrolled. Genomic DNA was extracted and SNPs at the -376, -308 and -238 position of the promoter region of the TNF gene were assessed by restriction fragment length polymorphisms. Monocytes were isolated from 47 patients when they developed sepsis and stimulated by bacterial endotoxin for the production of TNFα and of interleukin-6 (IL-6). Patients were divided into two groups; 166 patients bearing only wild-type alleles of all three studied polymorphisms; and 47 patients carrying at least one A allele of the three studied SNPs. Time between start of mechanical ventilation and advent of VAP was significantly shorter in the second group than in the first group (log-rank: 4.416, p: 0.041). When VAP supervened, disease severity did not differ between groups. Stimulation of TNFα and of IL-6 was much greater by monocytes for patients carrying A alleles. Carriage of at least one A allele of the three studied SNPs at the promoter region of the TNF-gene is associated with shorter time to development of VAP but it is not associated with disease severity. Findings may be related with a role of the studied SNPs in the production of pro-inflammatory cytokines. Copyright © 2012 Elsevier Ltd. All rights reserved.

  8. Regional efforts to promote forestry best management practices: a southern success story

    Science.gov (United States)

    Herb Nicholson; John Colberg; Hughes Simpson; Tom Gerow; Wib Owen

    2016-01-01

    The Southern Group of State Foresters has a long history of water resource protection efforts, providing leadership in BMP development, improvement, and implementation, enhancing state BMP programs, establishing effective partnerships, and standardizing an approach to consistently monitor implementation across the region.

  9. Evaluation of methylation pattern in promoter region of E-cadherin ...

    African Journals Online (AJOL)

    The epithelial cadherin gene (CDH1) has been identified as a tumor suppressor gene located within the 16q22.1 region. The CDH1 gene encodes a transmembrane glycoprotein involved in cell to cell adhesion and loss of CDH1 expression contributes to increased proliferation, invasion and metastasis in breast carcinoma.

  10. Chromosomal minimal critical regions in therapy-related leukemia appear different from those of de novo leukemia by high-resolution aCGH.

    Directory of Open Access Journals (Sweden)

    Nathalie Itzhar

    Full Text Available Therapy-related acute leukemia (t-AML, is a severe complication of cytotoxic therapy used for primary cancer treatment. The outcome of these patients is poor, compared to people who develop de novo acute leukemia (p-AML. Cytogenetic abnormalities in t-AML are similar to those found in p-AML but present more frequent unfavorable karyotypes depending on the inducting agent. Losses of chromosome 5 or 7 are observed after alkylating agents while balanced translocations are found after topoisomerase II inhibitors. This study compared t-AML to p-AML using high resolution array CGH in order to find copy number abnormalities (CNA at a higher resolution than conventional cytogenetics. More CNAs were observed in 30 t-AML than in 36 p-AML: 104 CNAs were observed with 63 losses and 41 gains (mean number 3.46 per case in t-AML, while in p-AML, 69 CNAs were observed with 32 losses and 37 gains (mean number of 1.9 per case. In primary leukemia with a previously "normal" karyotype, 18% exhibited a previously undetected CNA, whereas in the (few t-AML with a normal karyotype, the rate was 50%. Several minimal critical regions (MCRs were found in t-AML and p-AML. No common MCRs were found in the two groups. In t-AML a 40 kb deleted MCR pointed to RUNX1 on 21q22, a gene coding for a transcription factor implicated in frequent rearrangements in leukemia and in familial thrombocytopenia. In de novo AML, a 1 Mb MCR harboring ERG and ETS2 was observed from patients with complex aCGH profiles. High resolution cytogenomics obtained by aCGH and similar techniques already published allowed us to characterize numerous non random chromosome abnormalities. This work supports the hypothesis that they can be classified into several categories: abnormalities common to all AML; those more frequently found in t-AML and those specifically found in p-AML.

  11. Epigenetic changes within the promoter region of the HLA-G gene in ovarian tumors

    Directory of Open Access Journals (Sweden)

    Matyunina Lilya V

    2008-05-01

    Full Text Available Abstract Background Previous findings have suggested that epigenetic-mediated HLA-G expression in tumor cells may be associated with resistance to host immunosurveillance. To explore the potential role of DNA methylation on HLA-G expression in ovarian cancer, we correlated differences in HLA-G expression with methylation changes within the HLA-G regulatory region in an ovarian cancer cell line treated with 5-aza-deoxycytidine (5-aza-dC and in malignant and benign ovarian tumor samples and ovarian surface epithelial cells (OSE isolated from patients with normal ovaries. Results A region containing an intact hypoxia response element (HRE remained completely methylated in the cell line after treatment with 5-aza-dC and was completely methylated in all of the ovarian tumor (malignant and benign samples examined, but only variably methylated in normal OSE samples. HLA-G expression was significantly increased in the 5-aza-dC treated cell line but no significant difference was detected between the tumor and OSE samples examined. Conclusion Since HRE is the binding site of a known repressor of HLA-G expression (HIF-1, we hypothesize that methylation of the region surrounding the HRE may help maintain the potential for expression of HLA-G in ovarian tumors. The fact that no correlation exists between methylation and HLA-G gene expression between ovarian tumor samples and OSE, suggests that changes in methylation may be necessary but not sufficient for HLA-G expression in ovarian cancer.

  12. Nuclear proteins interacting with the promoter region of the human granulocyte/macrophage colony-stimulating factor gene

    International Nuclear Information System (INIS)

    Shannon, M.F.; Gamble, J.R.; Vadas, M.A.

    1988-01-01

    The gene for human granulocyte/macrophage colony-stimulating factor (GM-CSF) is expressed in a tissue-specific as well as an activation-dependent manner. The interaction of nuclear proteins with the promoter region of the GM-CSF gene that is likely to be responsible for this pattern of GM-CSF expression was investigated. The authors show that nuclear proteins interact with DNA fragments from the GM-CSF promoter in a cell-specific manner. A region spanning two cytokine-specific sequences, cytokine 1 (CK-1, 5', GAGATTCCAC 3') and cytokine 2 (CK-2, 5' TCAGGTA 3') bound two nuclear proteins from GM-CSF-expressing cells in gel retardation assays. NF-GMb was inducible with phorbol 12-myristate 13-acetate and accompanied induction of GM-CSF message. NF-GMb was absent in cell lines not producing GM-CSF, some of which had other distinct binding proteins. NF-GMa and NF-GMb eluted from a heparin-Sepharose column at 0.3 and 0.6 M KCl, respectively. They hypothesize that the sequences CK-1 and CK-2 bind specific proteins and regulate GM-CSF transcription

  13. Inter-organizational relations for regional development: an expansion policy promoted by the federal network of professional education, science & technology

    Directory of Open Access Journals (Sweden)

    Cleidson Nogueira Dias

    2014-12-01

    Full Text Available This research paper examines the importance of inter-organizational network management as a government policy tool to promote regional development. This pattern requires Federal Government intervention so as to compensate for the imbalance that this causes and to guarantee that economic growth resulting from government actions leads to development in all regions of the country, thereby avoiding the traditional mechanisms of wealth concentration. For this, a methodology of content analysis was used based on a relevant public policy aimed at promoting development within Brazil and by analyzing the data collected in relation to the current theory related to strategy, local development and inter-organizational networks in general.  The analysis results show that, when the policy studied in this work, applied in the federal network of professional education, science & technology, was implemented the networks had a positive influence on the outcome of the policy objectives and represented an extremely powerful support tool, being one of the most important factors to boost development.

  14. Nucleotide sequence of the promoter region of the gene encoding chicken Calbindin D28K

    Energy Technology Data Exchange (ETDEWEB)

    Ferrari, S; Drusiani, E; Battini, R; Fregni, M

    1988-01-11

    Calbindin D28K (formerly Vitamin D-Dependent Calcium Binding Protein) is a protein induced by 1,25-dihydroxycholecalciferol in several chicken tissues. A chicken genomic DNA library was screened with a synthetic oligonucleotide representing the sequence of Calbindin D18K cDNA from nt 146 to nt 176. The positive clone CBAl extends the 5'-end of the first exon by 451 bp. The sequence of a BamHI-SacII restriction fragment with coordinates -451 + 50 is shown. The BamHI-SacII fragment was subcloned 5' to the CAT gene of pUCCAT. The result is shown of a CAT assay on mouse fibroblasts 3T6 transiently transfected with pUCCAT, pUCCAT containing the BamHI-SacII fragment in the correct or opposite orientation or the SV40 promoter. /sup 14/C-chloramphenicol and its acetyl derivatives generated by purified CAT are also shown. The expression of CAT appears to be constitutive since the enzyme activity is not influenced by the presence (+) or absence (-) of 1,25-dihydroxycholecalciferol in the culture medium.

  15. Export Promotion Aims and Reality: A Comparison of the Iberian, Baltic and Central European Region

    Directory of Open Access Journals (Sweden)

    Éltető Andrea

    2017-06-01

    Full Text Available As a consequence of the international crisis in 2008-2009, the role of exports in economic growth came into focus in most countries. Exports of EU Member States gained momentum from 2010 onward but with certain changes in their structure and direction. In several countries, the turn towards non-EU areas, such as China or Latin America was part of the state export strategy. On the one hand, our article describes these foreign trade strategies and their institutional framework of the Iberian, Baltic and Central European governments, detecting possible similarities. On the other hand, we analyse recent export data. This way we can get a picture on the structure and direction of exports of periphery economies and this can be compared to the aims of the given states. Our hypothesis is that there is a gap between the reality and the intentions of the governments. The size of this gap varies and is influenced by certain factors such as the different involvement of multinational companies in foreign trade or the different economic structure of these countries. In our paper we list which countries adopted a government strategy and with what aim. We provide a short literature review on state trade promotion policies and discuss these policies and their institutions in the Baltic, Visegrád and Iberian countries.

  16. Methylation of Promoter Regions of Genes of the Human Intrauterine Renin Angiotensin System and Their Expression

    Directory of Open Access Journals (Sweden)

    Shane D. Sykes

    2015-01-01

    Full Text Available The intrauterine renin angiotensin system (RAS is implicated in placentation and labour onset. Here we investigate whether promoter methylation of RAS genes changes with gestation or labour and if it affects gene expression. Early gestation amnion and placenta were studied, as were term amnion, decidua, and placenta collected before labour (at elective caesarean section or after spontaneous labour and delivery. The expression and degree of methylation of the prorenin receptor (ATP6AP2, angiotensin converting enzyme (ACE, angiotensin II type 1 receptor (AGTR1, and two proteases that can activate prorenin (kallikrein, KLK1, and cathepsin D, CTSD were measured by qPCR and a DNA methylation array. There was no effect of gestation or labour on the methylation of RAS genes and CTSD. Amnion and decidua displayed strong correlations between the percent hypermethylation of RAS genes and CTSD, suggestive of global methylation. There were no correlations between the degree of methylation and mRNA abundance of any genes studied. KLK1 was the most methylated gene and the proportion of hypermethylated KLK1 alleles was lower in placenta than decidua. The presence of intermediate methylated alleles of KLK1 in early gestation placenta and in amnion after labour suggests that KLK1 methylation is uniquely dynamic in these tissues.

  17. Trithorax dependent changes in chromatin landscape at enhancer and promoter regions drive female puberty.

    Science.gov (United States)

    Toro, Carlos A; Wright, Hollis; Aylwin, Carlos F; Ojeda, Sergio R; Lomniczi, Alejandro

    2018-01-04

    Polycomb group (PcG) proteins control the timing of puberty by repressing the Kiss1 gene in hypothalamic arcuate nucleus (ARC) neurons. Here we identify two members of the Trithorax group (TrxG) of modifiers, mixed-lineage leukemia 1 (MLL1), and 3 (MLL3), as central components of an activating epigenetic machinery that dynamically counteracts PcG repression. Preceding puberty, MLL1 changes the chromatin configuration at the promoters of Kiss1 and Tac3, two genes required for puberty to occur, from repressive to permissive. Concomitantly, MLL3 institutes a chromatin structure that changes the functional status of a Kiss1 enhancer from poised to active. RNAi-mediated, ARC-specific Mll1 knockdown reduced Kiss1 and Tac3 expression, whereas CRISPR-Cas9-directed epigenome silencing of the Kiss1 enhancer selectively reduced Kiss1 activity. Both interventions delay puberty and disrupt reproductive cyclicity. Our results demonstrate that an epigenetic switch from transcriptional repression to activation is crucial to the regulatory mechanism controlling the timing of mammalian puberty.

  18. Tobacco advertising, promotion and sponsorship in entertainment media: a phenomenon requiring stronger controls in the Eastern Mediterranean Region.

    Science.gov (United States)

    El-Awa, Fatimah M S; El Naga, Randa Abou; Labib, Sahar; Latif, Nisreen Abdel

    2018-04-05

    Tobacco use and placement of tobacco products in television (TV) productions and movies is a way to promote tobacco use while avoiding tobacco advertising bans that exist in most countries. The fact that such productions are broadcast widely and viewed by millions, including children and young people, is of concern. This paper reviews the evidence on the use of tobacco advertising, promotion and sponsorship (TAPS) in TV and films in the Eastern Mediterranean Region and the ways to combat it. Evidence from Egypt shows considerable and increasing use of tobacco products by actors on screen, including female actors, in programmes aired during Ramadan in 2015-2017. A study of Iranian movies in 2015 showed that tobacco scenes in Iranian movies were increasing. In 2014, the WHO Regional Office for the Eastern Mediterranean held a consultative meeting on TAPS in drama. The consultation recommended regulating the tobacco presence in movies and TV through complete implementation of Article 13 of the WHO FCTC, and raising the issue to the WHO FCTC Conference of the Parties. In 2016, the Conference of the Parties called on parties to consider scaling up the implementation of WHO FCTC Article 13 and monitoring the use of TAPS in entertainment media in accordance with national legislation. A comprehensive approach is essential to end the tobacco industry's use of TV productions and movies to promote their products. Copyright © World Health Organization (WHO) 2018. Some rights reserved. This work is available under the CC BY-NC-SA 3.0 IGO license (https://creativecommons.org/licenses/by-nc-sa/3.0/igo).

  19. Cloning and analysis of the promoter region of the human fibronectin gene

    International Nuclear Information System (INIS)

    Dean, D.C.; Bowlus, C.L.; Bourgeois, S.

    1987-01-01

    Human fibronectin (FN) genomic clones were isolated by screening a human genomic library with a 75-base oligonucleotide. The sequence of the oligonucleotide corresponds to a region near the 5' end of the human FN cDNA clone pFH6 that contains the amino-terminal coding sequences but does not extend to the 5' end of the mRNA. The 5' end of the FN gene is found on a 3.7-kilobase-pair EcoRI fragment that contains about 2.7 kilobase pairs of flanking sequence. The first exon is 414 base pairs long, with a 5' untranslated region of 267 base pairs. As deduced on the basis of the position of the initiation codon, FN is synthesized with a 31-residue amino acid extension on the amion terminus that is not present in the mature polypeptide. This amino-terminal extension appears to contain both a signal peptide and a propeptide. The first 200 base pairs of 5'-flanking sequence is very G+C rich. Upstream of this the sequence becomes relatively A+T rich. The sequence ATATAA is found at -25 and the sequence CAAT is present at -150. The sequence GGGGCGGGGC at -102 exhibits homology to the binding site for the transcription factor SP1, and the sequence TGACGTCA at -173 exhibits homology to 5'-flanking sequences important for induction by cAMP

  20. Guidelines for mixed waste minimization

    International Nuclear Information System (INIS)

    Owens, C.

    1992-02-01

    Currently, there is no commercial mixed waste disposal available in the United States. Storage and treatment for commercial mixed waste is limited. Host States and compacts region officials are encouraging their mixed waste generators to minimize their mixed wastes because of management limitations. This document provides a guide to mixed waste minimization

  1. Efforts to promote regional security dialogue and cooperation in the North Pacific

    International Nuclear Information System (INIS)

    Mason, P.

    1994-01-01

    Indifference to the new realities of the post-cold war era does nothing to preserve the traditional priorities laid down in the Final Document of the first special session on disarmament. On the contrary, such attitudes directly contribute to the trend towards marginalization which began when publics no longer feared the threat of a nuclear holocaust. It is believed that the expertise of forty years of multilateral arms control and disarmament efforts is directly relevant to the broader efforts of the international community to restore, maintain and promote international peace and security. Who can deny that confidence-building is central to preventive diplomacy? Or that the arms control component-from disarming to demobilization-is not equally central to peace operations whether they be traditional peace-keeping or post-conflict peace-building? Indeed the success or failure of the disarmament aspect of a peace operation is often critical to its overall success-Somalia surely being one recent sad example. The multilateral disarmament community must apply itself more directly and systematically to these broader problems - just as the United Nations Secretariat has increasingly begun to do - or risk indifference from Governments forced to make tough choices against a range of competing priorities. It is undeniably true that the post-cold war has significantly increased the potential for the international community to negotiate historic new multilateral disarmament treaties. And this window of opportunity must be utilized to the fullest. At the same time, due account must be taken of the hard fact that, for an increasing number of countries, expensive obligations in relation to advanced unconventional weapons which neither they nor their neighbours seek to possess may count for less than practical assistance in finding solutions to more parochial, but no less urgent, problems

  2. Clinicopathologic Risk Factor Distributions for MLH1 Promoter Region Methylation in CIMP-Positive Tumors.

    Science.gov (United States)

    Levine, A Joan; Phipps, Amanda I; Baron, John A; Buchanan, Daniel D; Ahnen, Dennis J; Cohen, Stacey A; Lindor, Noralane M; Newcomb, Polly A; Rosty, Christophe; Haile, Robert W; Laird, Peter W; Weisenberger, Daniel J

    2016-01-01

    The CpG island methylator phenotype (CIMP) is a major molecular pathway in colorectal cancer. Approximately 25% to 60% of CIMP tumors are microsatellite unstable (MSI-H) due to DNA hypermethylation of the MLH1 gene promoter. Our aim was to determine if the distributions of clinicopathologic factors in CIMP-positive tumors with MLH1 DNA methylation differed from those in CIMP-positive tumors without DNA methylation of MLH1. We assessed the associations between age, sex, tumor-site, MSI status BRAF and KRAS mutations, and family colorectal cancer history with MLH1 methylation status in a large population-based sample of CIMP-positive colorectal cancers defined by a 5-marker panel using unconditional logistic regression to assess the odds of MLH1 methylation by study variables. Subjects with CIMP-positive tumors without MLH1 methylation were significantly younger, more likely to be male, and more likely to have distal colon or rectal primaries and the MSI-L phenotype. CIMP-positive MLH1-unmethylated tumors were significantly less likely than CIMP-positive MLH1-methylated tumors to harbor a BRAF V600E mutation and significantly more likely to harbor a KRAS mutation. MLH1 methylation was associated with significantly better overall survival (HR, 0.50; 95% confidence interval, 0.31-0.82). These data suggest that MLH1 methylation in CIMP-positive tumors is not a completely random event and implies that there are environmental or genetic determinants that modify the probability that MLH1 will become methylated during CIMP pathogenesis. MLH1 DNA methylation status should be taken into account in etiologic studies. ©2015 American Association for Cancer Research.

  3. Clinicopathological risk factor distributions for MLH1 promoter region methylation in CIMP positive tumors

    Science.gov (United States)

    Levine, A. Joan; Phipps, Amanda I.; Baron, John A.; Buchanan, Daniel D.; Ahnen, Dennis J.; Cohen, Stacey A.; Lindor, Noralane M.; Newcomb, Polly A.; Rosty, Christophe; Haile, Robert W.; Laird, Peter W.; Weisenberger, Daniel J.

    2015-01-01

    Background The CpG Island Methylator Phenotype (CIMP) is a major molecular pathway in colorectal cancer (CRC). Approximately 25% to 60% of CIMP tumors are microsatellite unstable (MSI-H) due to DNA hypermethylation of the MLH1 gene promoter. Our aim was to determine if the distributions of clinicopathologic factors in CIMP-positive tumors with MLH1 DNA methylation differed from those in CIMP-positive tumors without DNA methylation of MLH1. Methods We assessed the associations between age, sex, tumor-site, MSI status BRAF and KRAS mutations and family CRC history with MLH1 methylation status in a large population-based sample of CIMP-positive CRCs defined by a 5-marker panel using unconditional logistic regression to assess the odds of MLH1 methylation by study variables. Results Subjects with CIMP-positive tumors without MLH1 methylation were significantly younger, more likely to be male, more likely to have distal colon or rectal primaries and the MSI-L phenotype. CIMP-positive MLH1-unmethylated tumors were significantly less likely than CIMP-positive MLH1-methylated tumors to harbor a BRAF V600E mutation and significantly more likely to harbor a KRAS mutation. MLH1 methylation was associated with significantly better overall survival (HR=0.50; 95% Confidence Interval (0.31, 0.82)). Conclusions These data suggest that MLH1 methylation in CIMP-positive tumors is not a completely random event and implies that there are environmental or genetic determinants that modify the probability that MLH1 will become methylated during CIMP pathogenesis. Impact MLH1 DNA methylation status should be taken into account in etiologic studies. PMID:26512054

  4. Promoting Vehicle to Grid (V2G) in the Nordic Region

    DEFF Research Database (Denmark)

    Kester, Johannes; Noel, Lance; Zarazua de Rubens, Gerardo

    2018-01-01

    Vehicle to Grid (V2G) holds the promise of cheap, flexible, and fast-responding storage through the use of electric vehicle batteries. Unfortunately, infrastructure, battery degradation and consumer awareness are only some of the challenges to a faster development of this technology. This paper...... offers a qualitative comparative analysis that draws on a subsample of 227 semistructured interviews on electric vehicles with both transportation and electricity experts from 201 institutions and 17 cities within the Nordic region to discuss the reasoning and arguments behind V2G incentives and policy...... mechanisms. A frequency analysis of the most coded V2G responses favoured an update of the electricity market regulation – in particular in relation to electricity taxation and aggregator markets – and support for pilot projects. However, the analysis overall implies that V2G, in contrast to EVs...

  5. Cis-acting elements in the promoter region of the human aldolase C gene.

    Science.gov (United States)

    Buono, P; de Conciliis, L; Olivetta, E; Izzo, P; Salvatore, F

    1993-08-16

    We investigated the cis-acting sequences involved in the expression of the human aldolase C gene by transient transfections into human neuroblastoma cells (SKNBE). We demonstrate that 420 bp of the 5'-flanking DNA direct at high efficiency the transcription of the CAT reporter gene. A deletion between -420 bp and -164 bp causes a 60% decrease of CAT activity. Gel shift and DNase I footprinting analyses revealed four protected elements: A, B, C and D. Competition analyses indicate that Sp1 or factors sharing a similar sequence specificity bind to elements A and B, but not to elements C and D. Sequence analysis shows a half palindromic ERE motif (GGTCA), in elements B and D. Region D binds a transactivating factor which appears also essential to stabilize the initiation complex.

  6. Revolutionising engineering education in the Middle East region to promote earthquake-disaster mitigation

    Science.gov (United States)

    Baytiyeh, Hoda; Naja, Mohamad K.

    2014-09-01

    Due to the high market demands for professional engineers in the Arab oil-producing countries, the appetite of Middle Eastern students for high-paying jobs and challenging careers in engineering has sharply increased. As a result, engineering programmes are providing opportunities for more students to enrol on engineering courses through lenient admission policies that do not compromise academic standards. This strategy has generated an influx of students who must be carefully educated to enhance their professional knowledge and social capital to assist in future earthquake-disaster risk-reduction efforts. However, the majority of Middle Eastern engineering students are unaware of the valuable acquired engineering skills and knowledge in building the resilience of their communities to earthquake disasters. As the majority of the countries in the Middle East are exposed to seismic hazards and are vulnerable to destructive earthquakes, engineers have become indispensable assets and the first line of defence against earthquake threats. This article highlights the contributions of some of the engineering innovations in advancing technologies and techniques for effective disaster mitigation and it calls for the incorporation of earthquake-disaster-mitigation education into academic engineering programmes in the Eastern Mediterranean region.

  7. Possible association between serotonin transporter promoter region polymorphism and extremely violent crime in Chinese males.

    Science.gov (United States)

    Liao, Ding-Lieh; Hong, Chen-Jee; Shih, Hao-Ling; Tsai, Shih-Jen

    2004-01-01

    The neurotransmitter, serotonin, has been implicated in aggressive behavior. The serotonin transporter (5-HTT), which reuptakes serotonin into the nerve terminal, plays a critical role in the regulation of serotonergic function. Previous western reports have demonstrated that the low-activity short (S) allele of the 5-HTT gene-linked polymorphic-region (5-HTTLPR) polymorphism is associated with aggressive behavior and associated personality traits. In the present study, we investigated this 5-HTTLPR genetic polymorphism in a group of Chinese males who had been convicted for extremely violent crime (n = 135) and a normal control group (n = 111). The proportion of S-allele carriers was significantly higher in the criminal group than in the controls (p = 0.006). A significant association was not demonstrated for the relationship between the 5-HTTLPR polymorphism and antisocial personality disorder, substance abuse or alcohol abuse in the criminal group. Our findings demonstrate that carriage of the low-activity S allele is associated with extremely violent criminal behavior in Chinese males, and suggests that the 5-HTT may be implicated in the mechanisms underlying violent behaviors.

  8. E-Cigarettes: Implications for Health Promotion in the Asian Pacific Region.

    Science.gov (United States)

    Jancey, Jonine; Maycock, Bruce; McCausland, Kahlia; Howat, Peter

    2018-03-01

    Since their introduction to the United States in 2007, electronic cigarettes (e-cigarettes) use has grown exponentially. This rapid growth in e-cigarette use has been heralded by some as a potential important public health measure that could ultimately replace tobacco cigarettes, while others recommend a cautionary approach until there is clear evidence they will not become "new tobacco" bringing a possible myriad of other problems. E-cigarettes may have real benefits, however they do expose users and those nearby to organic compounds, solvents and particulate matter, with there being limited data relating to their health impact. It is unclear as to whether this relatively new device has the potential to exacerbate nicotine addictions, or play a part in reducing harm and smoking cessation. The fundamental requirement of public health practice is to do no harm and from the inconclusive evidence we have to date on e-cigarettes, it appears a cautious approach is warranted. This commentary reviews evidence that supports a cautious approach to e-cigarette availability in Australia and the Asian Pacific region.

  9. Genetic variants in promoters and coding regions of the muscle glycogen synthase and the insulin-responsive GLUT4 genes in NIDDM

    DEFF Research Database (Denmark)

    Bjørbaek, C; Echwald, Søren Morgenthaler; Hubricht, P

    1994-01-01

    To examine the hypothesis that variants in the regulatory or coding regions of the glycogen synthase (GS) and insulin-responsive glucose transporter (GLUT4) genes contribute to insulin-resistant glucose processing of muscle from non-insulin-dependent diabetes mellitus (NIDDM) patients, promoter...... volunteers. By applying inverse polymerase chain reaction and direct DNA sequencing, 532 base pairs (bp) of the GS promoter were identified and the transcriptional start site determined by primer extension. SSCP scanning of the promoter region detected five single nucleotide substitutions, positioned at 42......'-untranslated region, and the coding region of the GLUT4 gene showed four polymorphisms, all single nucleotide substitutions, positioned at -581, 1, 30, and 582. None of the three changes in the regulatory region of the gene had any major influence on expression of the GLUT4 gene in muscle. The variant at 582...

  10. Identification of a 450-bp region of human papillomavirus type 1 that promotes episomal replication in Saccharomyces cerevisiae

    International Nuclear Information System (INIS)

    Chattopadhyay, Anasuya; Schmidt, Martin C.; Khan, Saleem A.

    2005-01-01

    Human papillomaviruses (HPVs) replicate as nuclear plasmids in infected cells. Since the DNA replication machinery is generally conserved between humans and Saccharomyces cerevisiae, we studied whether HPV-1 DNA can replicate in yeast. Plasmids containing a selectable marker (with or without a yeast centromere) and either the full-length HPV-1 genome or various regions of the viral long control region (LCR) and the 3' end of the L1 gene were introduced into S. cerevisiae and their ability to replicate episomally was investigated. Our results show that HPV-1 sequences promote episomal replication of plasmids although the yeast centromere is required for plasmid retention. We have mapped the autonomously replicating sequence activity of HPV-1 DNA to a 450 base-pair sequence (HPV-1 nt 6783-7232) that includes 293 nucleotides from the 5' region of the viral LCR and 157 nucleotides from the 3' end of the L1 gene. The HPV-1 ARS does not include the binding sites for the viral E1 and E2 proteins, and these proteins are dispensable for replication in S. cerevisiae

  11. Analysis of upstream promoter region and corresponding 5’ UTR of glucokinase (GCK gene in horse breeds

    Directory of Open Access Journals (Sweden)

    L. Minieri

    2010-04-01

    Full Text Available A region of glucokinase (GCK gene was sequenced in 14 horses of 14 different breeds. The resulting GCK nucleotide sequence (GenBank number EF136885 showed 77% homology with human GCK gene portion containing the upstream promoter region and the corresponding 5’ UTR of the exon 1. Conserved regulatory sequences near the putative transcriptional start site were identified. The obtained sequences were aligned to detect polymorphism. A new C>T transition within the 5’ UTR of exon 1 was found. Allele frequencies of this polymorphism were studied by PCR-RFLP in 193 horses of 14 breeds (Bardigiano, 21; Esperia Pony, 5; Haflinger, 10; Italian Heavy Draught Horse, 28; Italian Saddle, 25; Italian Trotter, 16; Lipizzan, 12; Maremmano, 15; Murgese, 14; Norico, 10; Salernitano, 12; Thoroughbred, 10; Tolfetano, 7 and Ventasso Horse, 8. The polymorphism was found in all breeds and differences in allelic frequencies among the breeds were observed. The new SNP identified within a regulative region of GCK gene, which plays an important role in insulin secretion and feeding behaviour, could be used for association studies with performance traits of the horses.

  12. Nonrandom community assembly and high temporal turnover promote regional coexistence in tropics but not temperate zone.

    Science.gov (United States)

    Freestone, Amy L; Inouye, Brian D

    2015-01-01

    A persistent challenge for ecologists is understanding the ecological mechanisms that maintain global patterns of biodiversity, particularly the latitudinal diversity gradient of peak species richness in the tropics. Spatial and temporal variation in community composition contribute to these patterns of biodiversity, but how this variation and its underlying processes change across latitude remains unresolved. Using a model system of sessile marine invertebrates across 25 degrees of latitude, from the temperate zone to the tropics, we tested the prediction that spatial and temporal patterns of taxonomic richness and composition, and the community assembly processes underlying these patterns, will differ across latitude. Specifically, we predicted that high beta diversity (spatial variation in composition) and high temporal turnover contribute to the high species richness of the tropics. Using a standardized experimental approach that controls for several confounding factors that hinder interpretation of prior studies, we present results that support our predictions. In the temperate zone, communities were more similar across spatial scales from centimeters to tens of kilometers and temporal scales up to one year than at lower latitudes. Since the patterns at northern latitudes were congruent with a null model, stochastic assembly processes are implicated. In contrast, the communities in the tropics were a dynamic spatial and temporal mosaic, with low similarity even across small spatial scales and high temporal turnover at both local and regional scales. Unlike the temperate zone, deterministic community assembly processes such as predation likely contributed to the high beta diversity in the tropics. Our results suggest that community assembly processes and temporal dynamics vary across latitude and help structure and maintain latitudinal patterns of diversity.

  13. Effect of gamma irradiation on microbial quality of minimally processed carrot and lettuce: A case study in Greater Accra region of Ghana

    International Nuclear Information System (INIS)

    Frimpong, G.K.; Kottoh, I.D.; Ofosu, D.O.; Larbi, D.

    2015-01-01

    The effect of ionizing radiation on the microbiological quality on minimally processed carrot and lettuce was studied. The aim was to investigate the effect of irradiation as a sanitizing agent on the bacteriological quality of some raw eaten salad vegetables obtained from retailers in Accra, Ghana. Minimally processed carrot and lettuce were analysed for total viable count, total coliform count and pathogenic organisms. The samples collected were treated and analysed for a 15 day period. The total viable count for carrot ranged from 1.49 to 14.01 log 10 cfu/10 g while that of lettuce was 0.70 to 8.5 7 log 10 cfu/10 g. It was also observed that total coliform count for carrot was 1.46–7.53 log 10 cfu/10 g and 0.14–7.35 log 10 cfu/10 g for lettuce. The predominant pathogenic organisms identified were Bacillus cereus, Cronobacter sakazakii, Staphylococcus aureus, and Klebsiella spp. It was concluded that 2 kGy was most effective for medium dose treatment of minimally processed carrot and lettuce. - Highlights: • The microbial load on the cut-vegetables was beyond acceptable level for consumption. • The microbial contamination of carrot was found to be higher than that of lettuce. • 2 kGy was most appropriate in treating cut-vegetables for microbial safety

  14. Effect of gamma irradiation on microbial quality of minimally processed carrot and lettuce: A case study in Greater Accra region of Ghana

    Science.gov (United States)

    Frimpong, G. K.; Kottoh, I. D.; Ofosu, D. O.; Larbi, D.

    2015-05-01

    The effect of ionizing radiation on the microbiological quality on minimally processed carrot and lettuce was studied. The aim was to investigate the effect of irradiation as a sanitizing agent on the bacteriological quality of some raw eaten salad vegetables obtained from retailers in Accra, Ghana. Minimally processed carrot and lettuce were analysed for total viable count, total coliform count and pathogenic organisms. The samples collected were treated and analysed for a 15 day period. The total viable count for carrot ranged from 1.49 to 14.01 log10 cfu/10 g while that of lettuce was 0.70 to 8.5 7 log10 cfu/10 g. It was also observed that total coliform count for carrot was 1.46-7.53 log10 cfu/10 g and 0.14-7.35 log10 cfu/10 g for lettuce. The predominant pathogenic organisms identified were Bacillus cereus, Cronobacter sakazakii, Staphylococcus aureus, and Klebsiella spp. It was concluded that 2 kGy was most effective for medium dose treatment of minimally processed carrot and lettuce.

  15. The effect of phenobarbital on the methylation level of the p16 promoter region in rat liver

    International Nuclear Information System (INIS)

    Kostka, Grazyna; Urbanek, Katarzyna; Ludwicki, Jan K.

    2007-01-01

    It has been suggested that non-genotoxic carcinogens (NGCs) may cause modification of the DNA methylation status. We studied the effects of phenobarbital (PB) - a non-genotoxic rodent liver carcinogen - on the methylation level of the promoter region of the p16 suppressor gene, as well as on hepatomegaly, DNA synthesis, and DNA-methyltransferase (DNMTs) activity in the rat liver. Male Wistar rats received PB in 1, 3 or 14 daily oral doses (at 24-h intervals), each equivalent to 1/10 of the LD 50 value. The study showed that PB has caused persistent elevation in relative liver weight (RLW) as well as a transient increase in DNA synthesis. This suggests that the PB-induced increase in RLW was due to a combination of both hyperplasia and hypertrophy of liver cells. The effect of PB on DNA synthesis corresponded to an increase in the methylation pattern of the p16 promoter sequence. Methylation of cytosine in the analyzed CpG sites of the p16 gene was found after short exposure of the animals to PB. Treatment of rats with PB for 1 and 3 days also produced an increase in nuclear DNMTs activity. After prolonged administration (14 days), DNA synthesis declined, returning to the control level. No changes in methylation of the p16 gene nor in DNMTs activity were observed. The reversibility of early induced changes in target tissues is a mark characteristic of tumor promoters. Thus, transient changes in methylation of the p16 gene, although their direct role in the mechanisms of PB toxicity, including its carcinogenic action, remains doubtful, may therefore be a significant element of such processes

  16. Combgap Promotes Ovarian Niche Development and Chromatin Association of EcR-Binding Regions in BR-C.

    Science.gov (United States)

    Hitrik, Anna; Popliker, Malka; Gancz, Dana; Mukamel, Zohar; Lifshitz, Aviezer; Schwartzman, Omer; Tanay, Amos; Gilboa, Lilach

    2016-11-01

    The development of niches for tissue-specific stem cells is an important aspect of stem cell biology. Determination of niche size and niche numbers during organogenesis involves precise control of gene expression. How this is achieved in the context of a complex chromatin landscape is largely unknown. Here we show that the nuclear protein Combgap (Cg) supports correct ovarian niche formation in Drosophila by controlling ecdysone-Receptor (EcR)- mediated transcription and long-range chromatin contacts in the broad locus (BR-C). Both cg and BR-C promote ovarian growth and the development of niches for germ line stem cells. BR-C levels were lower when Combgap was either reduced or over-expressed, indicating an intricate regulation of the BR-C locus by Combgap. Polytene chromosome stains showed that Cg co-localizes with EcR, the major regulator of BR-C, at the BR-C locus and that EcR binding to chromatin was sensitive to changes in Cg levels. Proximity ligation assay indicated that the two proteins could reside in the same complex. Finally, chromatin conformation analysis revealed that EcR-bound regions within BR-C, which span ~30 KBs, contacted each other. Significantly, these contacts were stabilized in an ecdysone- and Combgap-dependent manner. Together, these results highlight Combgap as a novel regulator of chromatin structure that promotes transcription of ecdysone target genes and ovarian niche formation.

  17. High fructose consumption induces DNA methylation at PPARα and CPT1A promoter regions in the rat liver

    Energy Technology Data Exchange (ETDEWEB)

    Ohashi, Koji [Department of Clinical Biochemistry, Fujita Health University School of Health Sciences, Toyoake (Japan); Munetsuna, Eiji [Department of Biochemistry, Fujita Health University School of Medicine, Toyoake (Japan); Yamada, Hiroya, E-mail: hyamada@fujita-hu.ac.jp [Department of Hygiene, Fujita Health University School of Medicine, Toyoake (Japan); Ando, Yoshitaka [Department of Joint Research Laboratory of Clinical Medicine, Fujita Health University Hospital, Toyoake (Japan); Yamazaki, Mirai; Taromaru, Nao; Nagura, Ayuri; Ishikawa, Hiroaki [Department of Clinical Biochemistry, Fujita Health University School of Health Sciences, Toyoake (Japan); Suzuki, Koji [Department of Public Health, Fujita Health University School of Health Sciences, Toyoake (Japan); Teradaira, Ryoji [Department of Clinical Biochemistry, Fujita Health University School of Health Sciences, Toyoake (Japan); Hashimoto, Shuji [Department of Hygiene, Fujita Health University School of Medicine, Toyoake (Japan)

    2015-12-04

    DNA methylation status is affected by environmental factors, including nutrition. Fructose consumption is considered a risk factor for the conditions that make up metabolic syndrome such as dyslipidemia. However, the pathogenetic mechanism by which fructose consumption leads to metabolic syndrome is unclear. Based on observations that epigenetic modifications are closely related to induction of metabolic syndrome, we hypothesized that fructose-induced metabolic syndrome is caused by epigenetic alterations. Male SD rats were designated to receive water or 20% fructose solution for 14 weeks. mRNA levels for peroxisome proliferator-activated receptor alpha (PPARα) and carnitine palmitoyltransferase 1A (CPT1A) was analyzed using Real-time PCR. Restriction digestion and real-time PCR (qAMP) was used for the analysis of DNA methylation status. Hepatic lipid accumulation was also observed by fructose intake. Fructose feeding also significantly decreased mRNA levels for PPARα and CPT1A. qAMP analysis demonstrated the hypermethylation of promoter regions of PPARα and CTP1A genes. Fructose-mediated attenuated gene expression may be mediated by alterations of DNA methylation status, and pathogenesis of metabolic syndrome induced by fructose relates to DNA methylation status. - Highlights: • No general consensus has been reached regarding the molecular mechanisms of the pathogenesis of fructose-induced diseases. • Significant increase in hepatic total methylation level was observed after fructose-supplemented feeding. • Fructose feeding significantly decreased mRNA levels for PPARα and CPT1A. • qAMP analysis demonstrated the hypermethylation of promoter regions of PPARα and CTP1A genes. • Fructose-mediated attenuated gene expression may be mediated by alterations of DNA methylation status in rat liver.

  18. Competitive Promoter-Associated Matrix Attachment Region Binding of the Arid3a and Cux1 Transcription Factors

    Directory of Open Access Journals (Sweden)

    Dongkyoon Kim

    2017-12-01

    Full Text Available Arid3a/Bright/Dril1 is a B cell-specific transactivator that regulates immunoglobulin heavy chain (IgH gene transcription by binding promoter and enhancer-associated matrix attachment regions (MARs within the IgH gene locus. Promoter MAR-mediated Arid3a transactivation is antagonized by direct competition of MAR binding by Cux1/CDP—a ubiquitously expressed repressor originally termed NF-μNR. We report that the NF-μNR complex includes Arid3a in B cells but not in non-B cells through mobility shift assays. The binding activity of NF-μNR and Arid3a in B cells is reciprocally altered during the cell division cycle and by the B cell mitogen lipopolysaccharide LPS. LPS treatment had no effect on Arid3a localization but increased its total abundance within the nucleus and cytoplasm. We show that this increased level of Arid3a is capable of displacing Cux from the MARs to facilitate IgH gene transcription. Finally, we showed that the MARs (termed Bf150 and Tx125 associated with the VH1 rearranged variable region expressed in the S107 murine plasmacytoma, can repress reporter gene transcription in non-B cells and that they can relieve the repression mediated by Eμ enhancer in B cells. These results have significant implications for early human development and demonstrate that MARs in IgH locus, NF-µNR and Arid3a regulate IgH gene expression in a concerted fashion. This paves the way for future studies examining the misregulation of this pathway in pediatric disease.

  19. High fructose consumption induces DNA methylation at PPARα and CPT1A promoter regions in the rat liver

    International Nuclear Information System (INIS)

    Ohashi, Koji; Munetsuna, Eiji; Yamada, Hiroya; Ando, Yoshitaka; Yamazaki, Mirai; Taromaru, Nao; Nagura, Ayuri; Ishikawa, Hiroaki; Suzuki, Koji; Teradaira, Ryoji; Hashimoto, Shuji

    2015-01-01

    DNA methylation status is affected by environmental factors, including nutrition. Fructose consumption is considered a risk factor for the conditions that make up metabolic syndrome such as dyslipidemia. However, the pathogenetic mechanism by which fructose consumption leads to metabolic syndrome is unclear. Based on observations that epigenetic modifications are closely related to induction of metabolic syndrome, we hypothesized that fructose-induced metabolic syndrome is caused by epigenetic alterations. Male SD rats were designated to receive water or 20% fructose solution for 14 weeks. mRNA levels for peroxisome proliferator-activated receptor alpha (PPARα) and carnitine palmitoyltransferase 1A (CPT1A) was analyzed using Real-time PCR. Restriction digestion and real-time PCR (qAMP) was used for the analysis of DNA methylation status. Hepatic lipid accumulation was also observed by fructose intake. Fructose feeding also significantly decreased mRNA levels for PPARα and CPT1A. qAMP analysis demonstrated the hypermethylation of promoter regions of PPARα and CTP1A genes. Fructose-mediated attenuated gene expression may be mediated by alterations of DNA methylation status, and pathogenesis of metabolic syndrome induced by fructose relates to DNA methylation status. - Highlights: • No general consensus has been reached regarding the molecular mechanisms of the pathogenesis of fructose-induced diseases. • Significant increase in hepatic total methylation level was observed after fructose-supplemented feeding. • Fructose feeding significantly decreased mRNA levels for PPARα and CPT1A. • qAMP analysis demonstrated the hypermethylation of promoter regions of PPARα and CTP1A genes. • Fructose-mediated attenuated gene expression may be mediated by alterations of DNA methylation status in rat liver.

  20. Green Tourism in Mountain Regions - Reducing Vulnerability and Promoting People and Place Centric Development in the Himalayas

    Institute of Scientific and Technical Information of China (English)

    R. B. Singh; D. K. Mishra

    2004-01-01

    In recent years, mountain regions are attracting great attention to Indian tourists in general and foreign tourists in particular. The potential mountain resources for promoting green tourism are enormous in the form of natural and cultural heritage such as biosphere reserves, flora and fauna, lakes and rivers and traditional rural resources. In order to utilise tourism industry market, uncontrolled numbers of tourists and related haphazard infrastructural facilities in the vulnerable mountain regions pose serious environmental implications. The ecological pressures are threatening land, water and wild life resources through direct and indirect environmental impacts together with generation of solid and liquid wastes, so green tourism is emerging as an important task in order to develop new relationship between communities, government agencies and private sectors. The strategy focuses on ecological understanding, environmental protection and ecodevelopment. The major attributes of the green tourism include environmental conservation and education and distribution of income to local people based on strong partnership. Various knowledge systems go a long way for achieving the goals of the green tourism, which creates awareness about the value of environmental resources.Mountains have ecological, recreational, educational and scientific values, which need to be utilised in sustainable way. Various tourist activities and facilities need to be diversified in order to achieve multiple benefits including scientific field excursion,recreation in natural and cultural areas, community festivals and sport tourisms. Green tourism considers tourism development as an integral part of a national and regional development. The paper discusses the social, economic and environmental dimensions of the green tourism with particular reference to village tourism development programme taking empirical evidences from the Himalaya. Such programme also minimises biophysical and human

  1. Functional Analysis of Promoter Region from Eel Cytochrome P450 1A1 Gene in Transgenic Medaka.

    Science.gov (United States)

    Ogino; Itakura; Kato; Aoki; Sato

    1999-07-01

    : Transcription of the CYP1A1 genes in mammals and fish is stimulated by polyaromatic hydrocarbons. DNA sequencing analysis revealed that CYP1A1 gene in eel (Anguilla japonica) contains two kinds of putative cis-acting regulatory elements, XRE (xenobiotic-responsive element) and ERE (estrogen-responsive element). XRE is known as the enhancer that is responsible for the inducibility of the genes of CYP1A1 and some other drug-metabolizing enzymes. In the eel CYP1A1 gene, XRE motifs are distributed as follows: five times in the region from -2136 to -1125 bp, XRE(-6) to (-2); once in the proximal basal promoter region, XRE(-1); and once in the first intron, XRE(+1). The region between XRE(-2) and XRE(-1) contains three ERE motifs. To investigate the function of the cis-acting regulatory elements in the eel CYP1A1 gene, recombinant plasmids prepared with its 5' upstream sequence and the structural gene for luciferase were microinjected into fertilized eggs of medaka at the one-cell stage. Hatched fry were treated with 3-methylcholanthrene, and the transcription efficiency was assayed using competitive polymerase chain reaction analysis. Deletion of the region containing the five XREs, XRE(-6) to XRE(-2), and the point mutation of XRE(-1) reduced the inducible expressions by 75% and 56%, respectively, showing apparent dependency of the drug induction on the XREs. Constitutive expression, however, was not significantly affected by deletion or disruption of the XREs. When the region between XRE(-2) and XRE(-1) containing no XREs but three ERE motifs was internally deleted, the inducible expression and the constitutive expression were reduced by 88% and 75%, respectively. Replacement of this region with a partial fragment of eel CYP1A1 complementary DNA, with slight alteration of the distance between the five XREs and XRE(-1), reduced the inducible expression and the constitutive expression by 91% and 60%, respectively. These results strongly suggest that not only XRE but

  2. [The first exploration of a minimally invasive lysis subcutaneouly for the treatment of gluteal muscle contracture based on relatively safe region around standard injection point of gluteal muscle].

    Science.gov (United States)

    Xiao, Ying; Tang, Zhi-hong; Zhang, Si-rong; Zou, Guo-yao; Xiao, Rong-chi; Liu, Rui-duan; Hu, Jun-zu

    2011-06-01

    To explore the solution of choosing the minimally invasive incision site for gluteal muscle contracture patient based on standard injection point of gluteal muscle. from September 2008 to August 2010, 25 patients (14 males and 11 females with an average of 16.5 years, ranging from 12 to 26 years) with injected gluteal muscle contracture were prospectively studied. The course of disease was from 6 to 12 years. Firstly, the connective skin Surface line from anterior superior iliac spine to coccyx (line AD) was delineated and the point (point O) was marked out as the standard gluteal muscle injection site which was on the one-third of the distance from the anterior superior iliac spine(point A) to the coccyx (point D). Secondly, the anterior and posterior edge lines of surface projection of the gluteal muscle contracture banding (line a, line p) were delineated. Thirdly, the distance from B to O and C to O (B is the point of intersection of line a and line AD,C is the point of intersection of line P and line AD)were measured which was the intersection of line a,p and line AD to point O. Lastly, the minimally invasive surgery was operformed via the skin entry of point C. OB = (0 +/- 0.76) cm, OC = (2.86 +/- 0.78) cm, BC = (2.86 +/- 1.01) cm,the mean postoperative drainage was less than 10 ml,there was no nerve damage,hematoma and other complications. All patients achieved the function of squatting in 4 to 6 days. The solution of choosing the minimally invasive incision site based on standard injection point of gluteal muscle has advantages of positioning precisely,handling easily, recoverying quickly, less trauma and safety, etc.

  3. DNA methylation in Cosmc promoter region and aberrantly glycosylated IgA1 associated with pediatric IgA nephropathy.

    Directory of Open Access Journals (Sweden)

    Qiang Sun

    Full Text Available IgA nephropathy (IgAN is one of the most common glomerular diseases leading to end-stage renal failure. Elevation of aberrantly glycosylated IgA1 is a key feature of it. The expression of the specific molecular chaperone of core1ß1, 3galactosyl transferase (Cosmc is known to be reduced in IgAN. We aimed to investigate whether the methylation of CpG islands of Cosmc gene promoter region could act as a possible mechanism responsible for down-regulation of Cosmc and related higher secretion of aberrantly glycosylated IgA1in lymphocytes from children with IgA nephropathy. Three groups were included: IgAN children (n = 26, other renal diseases (n = 11 and healthy children (n = 13. B-lymphocytes were isolated and cultured, treated or not with IL-4 or 5-Aza-2'-deoxycytidine (AZA. The levels of DNA methylation of Cosmc promotor region were not significantly different between the lymphocytes of the three children populations (P = 0.113, but there were significant differences between IgAN lymphocytes and lymphocytes of the other two children populations after IL-4 (P<0.0001 or AZA (P<0.0001. Cosmc mRNA expression was low in IgAN lymphocytes compared to the other two groups (P<0.0001. The level of aberrantly glycosylated IgA1 was markedly higher in IgAN group compared to the other groups (P<0.0001. After treatment with IL-4, the levels of Cosmc DNA methylation and aberrantly glycosylated IgA1 in IgAN lymphocytes were remarkably higher than the other two groups (P<0.0001 with more markedly decreased Cosmc mRNA content (P<0.0001. After treatment with AZA, the levels in IgAN lymphocytes were decreased, but was still remarkably higher than the other two groups (P<0.0001, while Cosmc mRNA content in IgAN lymphocytes were more markedly increased than the other two groups (P<0.0001. The alteration of DNA methylation by IL-4 or AZA specifically correlates in IgAN lymphocytes with alterations in Cosmc mRNA expression and with the level of aberrantly glycosylated

  4. Systematic screening for mutations in the promoter and the coding region of the 5-HT{sub 1A} gene

    Energy Technology Data Exchange (ETDEWEB)

    Erdmann, J.; Shimron-Abarbanell, D.; Cichon, S. [Univ. of Bonn (Germany)] [and others

    1995-10-09

    In the present study we sought to identify genetic variation in the 5-HT{sub 1A} receptor gene which through alteration of protein function or level of expression might contribute to the genetic predisposition to neuropsychiatric diseases. Genomic DNA samples from 159 unrelated subjects (including 45 schizophrenic, 46 bipolar affective, and 43 patients with Tourette`s syndrome, as well as 25 healthy controls) were investigated by single-strand conformation analysis. Overlapping PCR (polymerase chain reaction) fragments covered the whole coding sequence as well as the 5{prime} untranslated region of the 5-HT{sub 1A} gene. The region upstream to the coding sequence we investigated contains a functional promoter. We found two rare nucleotide sequence variants. Both mutations are located in the coding region of the gene: a coding mutation (A{yields}G) in nucleotide position 82 which leads to an amino acid exchange (Ile{yields}Val) in position 28 of the receptor protein and a silent mutation (C{yields}T) in nucleotide position 549. The occurrence of the Ile-28-Val substitution was studied in an extended sample of patients (n = 352) and controls (n = 210) but was found in similar frequencies in all groups. Thus, this mutation is unlikely to play a significant role in the genetic predisposition to the diseases investigated. In conclusion, our study does not provide evidence that the 5-HT{sub 1A} gene plays either a major or a minor role in the genetic predisposition to schizophrenia, bipolar affective disorder, or Tourette`s syndrome. 29 refs., 4 figs., 1 tab.

  5. Increased fire frequency promotes stronger spatial genetic structure and natural selection at regional and local scales in Pinus halepensis Mill.

    Science.gov (United States)

    Budde, Katharina B; González-Martínez, Santiago C; Navascués, Miguel; Burgarella, Concetta; Mosca, Elena; Lorenzo, Zaida; Zabal-Aguirre, Mario; Vendramin, Giovanni G; Verdú, Miguel; Pausas, Juli G; Heuertz, Myriam

    2017-04-01

    The recurrence of wildfires is predicted to increase due to global climate change, resulting in severe impacts on biodiversity and ecosystem functioning. Recurrent fires can drive plant adaptation and reduce genetic diversity; however, the underlying population genetic processes have not been studied in detail. In this study, the neutral and adaptive evolutionary effects of contrasting fire regimes were examined in the keystone tree species Pinus halepensis Mill. (Aleppo pine), a fire-adapted conifer. The genetic diversity, demographic history and spatial genetic structure were assessed at local (within-population) and regional scales for populations exposed to different crown fire frequencies. Eight natural P. halepensis stands were sampled in the east of the Iberian Peninsula, five of them in a region exposed to frequent crown fires (HiFi) and three of them in an adjacent region with a low frequency of crown fires (LoFi). Samples were genotyped at nine neutral simple sequence repeats (SSRs) and at 251 single nucleotide polymorphisms (SNPs) from coding regions, some of them potentially important for fire adaptation. Fire regime had no effects on genetic diversity or demographic history. Three high-differentiation outlier SNPs were identified between HiFi and LoFi stands, suggesting fire-related selection at the regional scale. At the local scale, fine-scale spatial genetic structure (SGS) was overall weak as expected for a wind-pollinated and wind-dispersed tree species. HiFi stands displayed a stronger SGS than LoFi stands at SNPs, which probably reflected the simultaneous post-fire recruitment of co-dispersed related seeds. SNPs with exceptionally strong SGS, a proxy for microenvironmental selection, were only reliably identified under the HiFi regime. An increasing fire frequency as predicted due to global change can promote increased SGS with stronger family structures and alter natural selection in P. halepensis and in plants with similar life history traits

  6. Analysis of polymorphisms in the promoter region and protein levels of interleukin-6 gene among gout patients.

    Science.gov (United States)

    Tsai, P-C; Chen, C-J; Lai, H-M; Chang, S-J

    2008-01-01

    To explore the associations between the polymorphisms and protein levels of interleukin-6 (IL-6) gene and gout disease. A total of 120 male gout patients and 184 healthy controls were enrolled. Each patient was matched with 1-2 gout-free controls by age within three years. Four polymorphisms in the promoter of IL-6 gene, including -597G/A, -572C/G, -373A(m)T(n), and -174G/C, and the IL-6 levels were analyzed. The clinical characteristics and biochemical markers in plasma were measured, including age of gout onset, duration of gout history, tophus number, gout attack frequency, uric acid, total cholesterol, triglycerides and creatinine. The mean IL-6 level for gout patients was 9.80 (+/-11.76 pg/ml) which showed no significant difference from the controls (7.06+/-7.58 pg/ml, p=0.230). When the IL-6 levels were dichotomized according to the median value (5 pg/ml), there were significantly higher proportions of the gout patients (59.66%) than controls (44%) with high IL-6 levels (OR=1.88, 95% CI=1.17-3.02, p=0.008). Unique genotype was found at polymorphisms -174G/C and -597G/A. Neither the polymorphisms -572C/G nor -373A(m)T(n) in the genotype or allele distributions showed a significant association related to clinical characteristics, biochemical markers, IL-6 levels or gout disease (all p>0.05). Those with gout disease have greater proportions of high IL-6 levels in plasma than controls, and there is no significant association between the four polymorphisms in the promoter region of IL-6 gene and gout disease.

  7. Effect of Promoter Region Mutations and mgrA Overexpression on Transcription of norA, Which Encodes a Staphylococcus aureus Multidrug Efflux Transporter

    OpenAIRE

    Kaatz, Glenn W.; Thyagarajan, Rama V.; Seo, Susan M.

    2005-01-01

    NorA is a Staphylococcus aureus multidrug transporter that confers resistance to structurally distinct compounds. The MgrA global regulatory protein is reported to augment norA expression when mgrA is overexpressed from an undefined plasmid-based promoter. Further details about norA regulatory mechanisms are scant. A chromosomal norA::lacZ transcriptional fusion was constructed in different S. aureus strains, and allele replacement was used to define the relevance of promoter region sequences...

  8. Polymorphism of the promoter region and exon 1 of the CTLA4 gene in endemic pemphigus foliaceus (fogo selvagem

    Directory of Open Access Journals (Sweden)

    D.P. Pavoni

    2006-09-01

    Full Text Available Endemic pemphigus foliaceus (EPF is an autoimmune bullous skin disease characterized by acantholysis and antibodies against a desmosomal protein, desmoglein 1. Genetic and environmental factors contribute to development of this multifactorial disease. HLA class II and some cytokine gene polymorphisms are the only genetic markers thus far known to be associated with susceptibility to or protection from EPF. The cytotoxic T-lymphocyte antigen-4 gene (CTLA4 encodes a key immunoreceptor molecule that regulates and inhibits T-cell proliferation. It participates in the regulatory process controlling autoreactivity and therefore has been considered a strong candidate gene in autoimmune diseases. In the search for genes that might influence EPF pathogenesis, we analyzed variants of the CTLA4 gene in a sample of 118 patients and 291 controls from a Brazilian population. This is the first study investigating the possible role of polymorphisms of the 2q33 chromosomal region in differential susceptibility to pemphigus foliaceus. Promoter region and exon 1 single nucleotide polymorphisms -318 (C,T and 49 (A,G were genotyped using sequence-specific oligonucleotide probes after amplification by the polymerase chain reaction. The allelic and genotypic frequencies did not differ significantly between the patient and the control groups (-318T: 9.8 and 10.9%, 49G: 33.0 and 35.2% were the allelic frequencies in patients and controls, respectively. In addition, no significant difference was found when the patient and control population samples were stratified by the presence of HLA-DRB1 alleles. We conclude that the CTLA4 -318 (C,T and 49 (A,G polymorphisms do not play a major role in EPF development.

  9. RNA polymerase II interacts with the promoter region of the noninduced hsp70 gene in Drosophila melanogaster cells

    International Nuclear Information System (INIS)

    Gilmour, D.S.; Lis, J.T.

    1986-01-01

    By using a protein-DNA cross-linking method, we examined the in vivo distribution of RNA polymerase II on the hsp70 heat shock gene in Drosophila melanogaster Schneider line 2 cells. In heat shock-induced cells, a high level of RNA polymerase II was detected on the entire gene, while in noninduced cells, the RNA polymerase II was confined to the 5' end of the hsp70 gene, predominantly between nucleotides -12 and +65 relative to the start of transcription. This association of RNA polymerase II was apparent whether the cross-linking was performed by a 10-min UV irradiation of chilled cells with mercury vapor lamps or by a 40-microsecond irradiation of cells with a high-energy xenon flash lamp. We hypothesize that RNA polymerase II has access to, and a high affinity for, the promoter region of this gene before induction, and this poised RNA polymerase II may be critical in the mechanism of transcription activation

  10. Injection current minimization of InAs/InGaAs quantum dot laser by optimization of its active region and reflectivity of laser cavity edges

    International Nuclear Information System (INIS)

    Korenev, V V; Savelyev, A V; Zhukov, A E; Maximov, M V

    2015-01-01

    The ways to optimize key parameters of active region and edge reflectivity of edge- emitting semiconductor quantum dot laser are provided. It is shown that in the case of optimal cavity length and sufficiently large dispersion lasing spectrum of a given width can be obtained at injection current up to an order of magnitude lower in comparison to non-optimized sample. The influence of internal loss and edge reflection is also studied in details. (paper)

  11. Injection current minimization of InAs/InGaAs quantum dot laser by optimization of its active region and reflectivity of laser cavity edges

    Science.gov (United States)

    Korenev, V. V.; Savelyev, A. V.; Zhukov, A. E.; Maximov, M. V.

    2015-11-01

    The ways to optimize key parameters of active region and edge reflectivity of edge- emitting semiconductor quantum dot laser are provided. It is shown that in the case of optimal cavity length and sufficiently large dispersion lasing spectrum of a given width can be obtained at injection current up to an order of magnitude lower in comparison to non-optimized sample. The influence of internal loss and edge reflection is also studied in details.

  12. The minimal non-minimal standard model

    International Nuclear Information System (INIS)

    Bij, J.J. van der

    2006-01-01

    In this Letter I discuss a class of extensions of the standard model that have a minimal number of possible parameters, but can in principle explain dark matter and inflation. It is pointed out that the so-called new minimal standard model contains a large number of parameters that can be put to zero, without affecting the renormalizability of the model. With the extra restrictions one might call it the minimal (new) non-minimal standard model (MNMSM). A few hidden discrete variables are present. It is argued that the inflaton should be higher-dimensional. Experimental consequences for the LHC and the ILC are discussed

  13. Determination of single-nucleotide polymorphism in the proximal promoter region of apolipoprotein M gene in coronary artery diseases

    Directory of Open Access Journals (Sweden)

    Lu Zheng

    2009-09-01

    Full Text Available Lu Zheng1, Guanghua Luo1, Xiaoying Zhang1, Jun Zhang1, Jiang Zhu1, Jiang Wei1, Qinfeng Mu1, Lujun Chen1, Peter Nilsson-Ehle2, Ning Xu21Comprehensive Laboratory, The Third Affiliated Hospital, Suzhou University, Changzhou China; 2Division of Clinical Chemistry and Pharmacology, Department of Laboratory Medicine, Lund University, Lund, SwedenObjective: It has been reported that single-nucleotide polymorphism (SNP in the proximal promoter region of apolipoprotein M (apoM gene may confer the risk in the development of type 2 diabetes (T2D and coronary artery disease (CAD in the Han Chinese. However, in a recent study demonstrated that plasma apoM level did not correlated to the coronary heart disease. In the present studies, we investigated the SNP T-778C of apoM gene in CAD patients and controls in the Han Chinese population. Moreover we examined whether serum apoM levels could be influenced by this promoter mutation.Material and methods: One hundred twenty-six CAD patients and 118 non-CAD patients were subjected in the present study. All patients were confirmed by the angiography. The genotyping of polymorphisms T-778C in apoM promoter was determined by real-time polymerase chain reaction. Serum apoM levels were semi-quantitatively determined by the dot-blotting analysis. Results: Distribution of apoM T-778C genotype in non-CAD patients was as following: 84.7% were T/T, 15.3% were T/C and 0.0% was C/C. T allele frequencies were 92.4% and C allele, 7.6%. In the CAD patients, 99 patients (78.6% had the T/T genotype, 25 patients (19.8% with T/C genotype and 2 patients (1.6% with C/C genotype. The allele frequency was 88.5% for the T allele and 11.5% for the C allele. There was no statistical significant difference of serum apoM levels found in these three genotypes.Conclusions: There was no significant difference in allele or genotype frequencies between CAD patients and non-CAD patients. Binary logistic regression analysis with adjustments for age

  14. The relationship in Japanese infants between a genetic polymorphism in the promoter region of the insulin-like growth factor I gene and the plasma level.

    Science.gov (United States)

    Kinoshita, Yumiko; Kizaki, Zenro; Ishihara, Yasunori; Nakajima, Hisakazu; Adachi, Shinsuke; Kosaka, Kitaro; Kinugasa, Akihiko; Sugimoto, Tohru

    2007-01-01

    Evidence is accumulating that the promoter region of the insulin-like growth factor I (IGF-I) gene polymorphism and low levels of IGF-I are associated with type 2 diabetes, cardiovascular disease and birth weight; however, the number of wild-type alleles is different in each country. This study aimed to examine the 737/738 marker, a cytosine-adenine repeat in the promoter region of the IGF-I gene polymorphism, and plasma IGF-I levels in Japanese infants and analyze the genetic background. Data were collected for 15 months in Kyoto Prefectural University of Medicine. The body composition parameters of all infants were determined at birth. At 5 days after birth, we took blood samples to measure the product size of the promoter region of the IGF-I gene polymorphism and plasma IGF-I. In a population-based sample of 160 subjects, 6 different alleles and 16 genotypes were identified in the promoter region of the IGF-I gene polymorphism. The existence of a 196-bp allele has proved to result in a low plasma IGF-I level, a small head and chest circumference (p body composition parameters in Japanese infants. Our results suggest genetical influence on prenatal growth and serum IGF-I levels.

  15. ARCAL. Regional co-operative arrangements for the promotion of nuclear science and technology in Latin America, Phase I (1985-1990)

    International Nuclear Information System (INIS)

    Gillen, V.A.

    1990-09-01

    The Regional Co-operative Arrangement for the Promotion of Nuclear Science and Technology in Latin America, ARCAL, has completed its first five-year phase (1985-1989). This booklet summarizes the first phase of the ARCAL programme and contains descriptions of projects in the fields of agriculture, medicine, industry and energy

  16. Serotonin Transporter Promoter Region (5-HTTLPR) Polymorphism Is Not Associated With Paroxetine-Induced Ejaculation Delay in Dutch Men With Lifelong Premature Ejaculation

    NARCIS (Netherlands)

    Janssen, Paddy K. C.; Zwinderman, Aeilko H.; Olivier, Berend; Waldinger, Marcel D.

    2014-01-01

    To investigate the association between the 5-HT-transporter-gene-linked promoter region (5-HTTLPR) polymorphism and 20-mg paroxetine-induced ejaculation delay in men with lifelong premature ejaculation (LPE). This was a prospective study of 10 weeks of paroxetine treatment in 54 men with LPE.

  17. Serotonin Transporter Promoter Region (5-HTTLPR) Polymorphism Is Not Associated With Paroxetine-Induced Ejaculation Delay in Dutch Men With Lifelong Premature Ejaculation

    NARCIS (Netherlands)

    Janssen, Paddy K C; Zwinderman, Aeilko H; Olivier, Berend; Waldinger, Marcel D

    PURPOSE: To investigate the association between the 5-HT-transporter-gene-linked promoter region (5-HTTLPR) polymorphism and 20-mg paroxetine-induced ejaculation delay in men with lifelong premature ejaculation (LPE). MATERIALS AND METHODS: This was a prospective study of 10 weeks of paroxetine

  18. Insulin VNTR and IGF-1 promoter region polymorphisms are not associated with body composition in early childhood: The generation R study

    NARCIS (Netherlands)

    J.A.J.B.M. Maas (Janneke); D.O. Mook-Kanamori (Dennis); L. Ay (Lamise); R.P.M. Steegers-Theunissen (Régine); P. Tikka-Kleemola (Päivi); A. Hofman (Albert); A.C.S. Hokken-Koelega (Anita); V.W.V. Jaddoe (Vincent)

    2010-01-01

    textabstractObjective: The objective of this study was to examine the associations between insulin gene variable number of tandem repeats (INS VNTR) and insulin-like growth factor 1 (IGF1) gene promoter region polymorphisms with body composition in early childhood. Methods: This study was embedded

  19. Association of human liver bilirubin UDP-glucuronyltransferase activity with a polymorphism in the promoter region of the UGT1A1 gene

    NARCIS (Netherlands)

    Raijmakers, MTM; Jansen, PLM; Steegers, EAP; Peters, WHM

    Background/Aims: Gilbert's syndrome is a benign form of a deficiency in bilirubin glucuronidation. It is associated with a homozygous polymorphism, A(TA)(7)TAA instead of A(TA)(6)TAA, in the TATA-box of the promoter region of the bilirubin UDP-glucuronyltransferase gene. In this study the

  20. The mRNA expression and histological integrity in rat forebrain motor and sensory regions are minimally affected by acrylamide exposure through drinking water

    International Nuclear Information System (INIS)

    Bowyer, John F.; Latendresse, John R.; Delongchamp, Robert R.; Warbritton, Alan R.; Thomas, Monzy; Divine, Becky; Doerge, Daniel R.

    2009-01-01

    A study was undertaken to determine whether alterations in the gene expression or overt histological signs of neurotoxicity in selected regions of the forebrain might occur from acrylamide exposure via drinking water. Gene expression at the mRNA level was evaluated by cDNA array and/or RT-PCR analysis in the striatum, substantia nigra and parietal cortex of rat after a 2-week acrylamide exposure. The highest dose tested (maximally tolerated) of approximately 44 mg/kg/day resulted in a significant decreased body weight, sluggishness, and locomotor activity reduction. These physiological effects were not accompanied by prominent changes in gene expression in the forebrain. All the expression changes seen in the 1200 genes that were evaluated in the three brain regions were ≤ 1.5-fold, and most not significant. Very few, if any, statistically significant changes were seen in mRNA levels of the more than 50 genes directly related to the cholinergic, noradrenergic, GABAergic or glutamatergic neurotransmitter systems in the striatum, substantia nigra or parietal cortex. All the expression changes observed in genes related to dopaminergic function were less than 1.5-fold and not statistically significant and the 5HT1b receptor was the only serotonin-related gene affected. Therefore, gene expression changes were few and modest in basal ganglia and sensory cortex at a time when the behavioral manifestations of acrylamide toxicity had become prominent. No histological evidence of axonal, dendritic or neuronal cell body damage was found in the forebrain due to the acrylamide exposure. As well, microglial activation was not present. These findings are consistent with the absence of expression changes in genes related to changes in neuroinflammation or neurotoxicity. Over all, these data suggest that oral ingestion of acrylamide in drinking water or food, even at maximally tolerable levels, induced neither marked changes in gene expression nor neurotoxicity in the motor and

  1. Minimally processed fruit salad enriched with Lactobacillus ...

    African Journals Online (AJOL)

    paula

    2015-06-17

    Jun 17, 2015 ... Minimal processing promotes browning of some vegetal tissues due to cell membrane disruption, which results in the release of oxidative enzymes. This study evaluated the efficiency of citric acid, ascorbic acid, sodium metabisulfite and L-cysteine hydrochloride to retard enzymatic browning of minimally.

  2. Minimally processed fruit salad enriched with Lactobacillus ...

    African Journals Online (AJOL)

    Minimal processing promotes browning of some vegetal tissues due to cell membrane disruption, which results in the release of oxidative enzymes. This study evaluated the efficiency of citric acid, ascorbic acid, sodium metabisulfite and L-cysteine hydrochloride to retard enzymatic browning of minimally processed fruit ...

  3. TSA-induced DNMT1 down-regulation represses hTERT expression via recruiting CTCF into demethylated core promoter region of hTERT in HCT116.

    Science.gov (United States)

    Choi, Jee-Hye; Min, Na Young; Park, Jina; Kim, Jin Hong; Park, Soo Hyun; Ko, Young Jong; Kang, Yoonsung; Moon, Young Joon; Rhee, Sangmyung; Ham, Seung Wook; Park, Ae Ja; Lee, Kwang-Ho

    2010-01-01

    Trichostatin A (TSA), an inhibitor of histone deacetylase, is a well-known antitumor agent that effectively and selectively induces tumor growth arrest and apoptosis. Recently, it was reported that hTERT is one of the primary targets for TSA-induced apoptosis in cancer cells but the mechanism of which has not yet been elucidated. In the present study, to better understand the epigenetic regulation mechanism responsible for the repression of hTERT by TSA, we examined expression of hTERT in the HCT116 colon cancer cell line after treatment with TSA and performed site-specific CpG methylation analysis of the hTERT promoter. We found that TSA-induced the demethylation of site-specific CpGs on the promoter of hTERT, which was caused by down-regulation of DNA methyltransferase 1 (DNMT1). Among the demethylated region, the 31st-33rd CpGs contained a binding site for CTCF, an inhibitor of hTERT transcription. ChIP analysis revealed that TSA-induced demethylation of the 31st-33rd CpGs promoted CTCF binding on hTERT promoter, leading to repression of hTERT. Taken together, down-regulation of DNMT1 by TSA caused demethylation of a CTCF binding site on the hTERT promoter, the result of which was repression of hTERT via recruitment of CTCF to the promoter. Copyright 2009 Elsevier Inc. All rights reserved.

  4. IkappaBalpha polymorphism at promoter region (rs2233408) influences the susceptibility of gastric cancer in Chinese.

    Science.gov (United States)

    Wang, Shiyan; Tian, Linwei; Zeng, Zhirong; Zhang, Mingdong; Wu, Kaichun; Chen, Minhu; Fan, Daiming; Hu, Pinjin; Sung, Joseph J Y; Yu, Jun

    2010-02-05

    Nuclear factor of kappa B inhibitor alpha (I kappaB alpha) protein is implicated in regulating a variety of cellular process from inflammation to tumorigenesis. The objective of this study was to investigate the susceptibility of rs2233408 T/C genotype in the promoter region of I kappaB alpha to gastric cancer and the association of this polymorphism with clinicopathologic variables in gastric cancer patients. A population-based case-control study was conducted between 1999 and 2006 in Guangdong Province, China. A total of 564 gastric cancer patients and 566 healthy controls were enrolled in this study. rs2233408 genotypes in I kappaB alpha were analyzed by TaqMan SNP genotyping assay. Both rs2233408 T homozygote (TT) and T heterozygotes (TC and TT) had significantly reduced gastric cancer risk (TT: OR = 0.250, 95% CI = 0.069-0.909, P = 0.035; TC and TT: OR = 0.721, 95% CI = 0.530-0.981, P = 0.037), compared with rs2233408 C homozygote (CC). rs2233408 T heterozygotes were significantly associated with reduced risk of intestinal-type gastric cancer with ORs of 0.648 (95% CI = 0.459-0.916, P = 0.014), but not with the diffuse or mix type of gastric cancer. The association between rs2233408 T heterozygotes and gastric cancer appeared more apparent in the older patients (age>40) (OR = 0.674, 95% CI = 0.484-0.939, P = 0.02). rs2233408 T heterozygotes was associated with non-cardiac gastric cancer (OR = 0.594, 95% CI = 0.411-0.859, P = 0.006), but not with cardiac gastric cancer. However, rs2233408 polymorphism was not associated with the prognosis of gastric cancer patients. I kappaB alpha rs2233408 T heterozygotes were associated with reduced risk of gastric cancer, especially for the development of certain subtypes of gastric cancer in Chinese population.

  5. Variability in the precore and core promoter regions of HBV strains in Morocco: characterization and impact on liver disease progression.

    Directory of Open Access Journals (Sweden)

    Bouchra Kitab

    Full Text Available BACKGROUND: Hepatitis B virus (HBV is one of the most common human pathogens that cause aggressive hepatitis and advanced liver disease (AdLD, including liver cirrhosis and Hepatocellular Carcinoma. The persistence of active HBV replication and liver damage after the loss of hepatitis B e antigen (HBeAg has been frequently associated with mutations in the pre-core (pre-C and core promoter (CP regions of HBV genome that abolish or reduce HBeAg expression. The purpose of this study was to assess the prevalence of pre-C and CP mutations and their impact on the subsequent course of liver disease in Morocco. METHODS/PRINCIPAL FINDINGS: A cohort of 186 patients with HBeAg-negative chronic HBV infection was studied (81 inactive carriers, 69 with active chronic hepatitis, 36 with AdLD. Pre-C and CP mutations were analyzed by PCR-direct sequencing method. The pre-C stop codon G1896A mutation was the most frequent (83.9% and was associated with a lower risk of AdLD development (OR, 0.4; 95% CI, 0.15-1.04; p = 0.04. HBV-DNA levels in patients with G1896A were not significantly different from the other patients carrying wild-type strains (p = 0.84. CP mutations C1653T, T1753V, A1762T/G1764A, and C1766T/T1768A were associated with higher HBV-DNA level and increased liver disease severity. Multiple logistic regression analysis showed that older age (≥ 40 years, male sex, high viral load (>4.3 log(10 IU/mL and CP mutations C1653T, T1753V, A1762T/G1764A, and C1766T/T1768A were independent risk factors for AdLD development. Combination of these mutations was significantly associated with AdLD (OR, 7.52; 95% CI, 4.8-8; p<0.0001. CONCLUSIONS: This study shows for the first time the association of HBV viral load and CP mutations with the severity of liver disease in Moroccan HBV chronic carriers. The examination of CP mutations alone or in combination could be helpful for prediction of the clinical outcome.

  6. IκBα polymorphism at promoter region (rs2233408 influences the susceptibility of gastric cancer in Chinese

    Directory of Open Access Journals (Sweden)

    Sung Joseph JY

    2010-02-01

    Full Text Available Abstract Background Nuclear factor of kappa B inhibitor alpha (IκBα protein is implicated in regulating a variety of cellular process from inflammation to tumorigenesis. The objective of this study was to investigate the susceptibility of rs2233408 T/C genotype in the promoter region of IκBα to gastric cancer and the association of this polymorphism with clinicopathologic variables in gastric cancer patients. Methods A population-based case-control study was conducted between 1999 and 2006 in Guangdong Province, China. A total of 564 gastric cancer patients and 566 healthy controls were enrolled in this study. rs2233408 genotypes in IκBα were analyzed by TaqMan SNP genotyping assay. Results Both rs2233408 T homozygote (TT and T heterozygotes (TC and TT had significantly reduced gastric cancer risk (TT: OR = 0.250, 95% CI = 0.069-0.909, P = 0.035; TC and TT: OR = 0.721, 95% CI = 0.530-0.981, P = 0.037, compared with rs2233408 C homozygote (CC. rs2233408 T heterozygotes were significantly associated with reduced risk of intestinal-type gastric cancer with ORs of 0.648 (95% CI = 0.459-0.916, P = 0.014, but not with the diffuse or mix type of gastric cancer. The association between rs2233408 T heterozygotes and gastric cancer appeared more apparent in the older patients (age>40 (OR = 0.674, 95% CI = 0.484-0.939, P = 0.02. rs2233408 T heterozygotes was associated with non-cardiac gastric cancer (OR = 0.594, 95% CI = 0.411-0.859, P = 0.006, but not with cardiac gastric cancer. However, rs2233408 polymorphism was not associated with the prognosis of gastric cancer patients. Conclusions IκBα rs2233408 T heterozygotes were associated with reduced risk of gastric cancer, especially for the development of certain subtypes of gastric cancer in Chinese population.

  7. The first year experience of occupational therapy students at an Australian regional university: Promoting student retention and developing a regional and remote workforce.

    Science.gov (United States)

    Boehm, Jackie; Cordier, Reinie; Thomas, Yvonne; Tanner, Bronwyn; Salata, Karen

    2017-02-01

    Student retention at regional universities is important in addressing regional and remote workforce shortages. Students attending regional universities are more likely to work in regional areas. First year experience at university plays a key role in student retention. This study aimed to explore factors influencing the first year experience of occupational therapy students at a regional Australian university. Surveys were administered to 58 second year occupational therapy students in the first week of second year. Data were analysed using descriptive statistics, inferential statistics (Pearson χ 2 ; Spearman rho) and summarising descriptive responses. An Australian regional university. Second year undergraduate occupational therapy students. Factors influencing students' decisions to study and continue studying occupational therapy; factors enhancing first year experience of university. Fifty-four students completed the survey (93.1%). A quarter (25.9%) of students considered leaving the course during the first year. The primary influence for continuing was the teaching and learning experience. Most valued supports were orientation week (36.7%) and the first year coordinator (36.7%). The importance of the first year experience in retaining occupational therapy students is highlighted. Engagement with other students and staff and academic support are important factors in facilitating student retention. It is important to understand the unique factors influencing students' decisions, particularly those from regional and remote areas, to enter and continue in tertiary education to assist in implementing supports and strategies to improve student retention. © 2015 National Rural Health Alliance Inc.

  8. Regional differences in awareness of tobacco advertising and promotion in China: findings from the ITC China Survey.

    Science.gov (United States)

    Yang, Yan; Li, Lin; Yong, Hua-Hie; Borland, Ron; Wu, Xi; Li, Qiang; Wu, Changbao; Foong, Kin

    2010-04-01

    To examine whether levels of, and factors related to, awareness of tobacco advertising and promotion differ across six cities in China. Data from wave 1 of the International Tobacco Control (ITC) China Survey (April to August 2006) were analysed. The ITC China Survey employed a multistage sampling design in Beijing, Shenyang, Shanghai, Changsha, Guangzhou and Yinchuan. Face-to-face interviews were conducted with a total of 4763 smokers and 1259 non-smokers. Multivariate logistic regression models were used to identify factors associated with awareness of tobacco advertising and promotion. The overall levels of noticing advertisements varied considerably by city. Cities reporting lower levels of advertising tended to report higher levels of point of sale activity. Noticing tobacco industry promotions was associated with more positive attitudes to tobacco companies. The awareness of tobacco advertising and promotional activities was not homogeneous across the six Chinese cities, suggesting variations in the tobacco industry's activities and the diversity of implementing a central set of laws to restrict tobacco promotion. This study clearly demonstrates the need to work with the implementation agencies if national laws are to be properly enforced.

  9. Identification of the promoter region required for human adiponectin gene transcription: Association with CCAAT/enhancer binding protein-β and tumor necrosis factor-α

    International Nuclear Information System (INIS)

    Kita, Atsushi; Yamasaki, Hironori; Kuwahara, Hironaga; Moriuchi, Akie; Fukushima, Keiko; Kobayashi, Masakazu; Fukushima, Tetsuya; Takahashi, Ryoko; Abiru, Norio; Uotani, Shigeo; Kawasaki, Eiji; Eguchi, Katsumi

    2005-01-01

    Adiponectin, an adipose tissue-specific plasma protein, is involved in insulin sensitizing and has anti-atherosclerotic properties. Plasma levels of adiponectin are decreased in obese individuals and patients with type 2 diabetes with insulin resistance. Tumor necrosis factor-α (TNF-α) decreases the expression of adiponectin in adipocytes. The aims of the present study were: (1) to identify the promoter region responsible for basal transcription of the human adiponectin gene, and (2) to investigate the mechanism by which adiponectin was regulated by TNF-α. The human adiponectin promoter (2.1 kb) was isolated and used for luciferase reporter analysis by transient transfection into 3T3-L1 adipocytes. Deletion analysis demonstrated that the promoter region from -676 to +41 was sufficient for basal transcriptional activity. Mutation analysis of putative response elements for sterol regulatory element binding protein (SREBP) (-431 to -423) and CCAAT/enhancer binding protein (C/EBP) (-230 to -224) showed that both elements were required for basal promoter activity. Adiponectin transcription was increased 3-fold in cells that over-expressed constitutively active C/EBP-β. Electrophoretic mobility shift assay, using nuclear extract from 3T3-L1 cells and the -258 to -199 region as a probe, demonstrated specific DNA-protein binding, which was abolished by TNF-α treatment. The present data indicate that the putative response elements for SREBP and C/EBP are required for human adiponectin promoter activity, and that suppression by TNF-α may, at least in part, be associated with inactivation of C/EBP-β

  10. Promoter-region hypermethylation and expression downregulation of Yy1 (Yin yang 1) in preneoplastic liver lesions in a thioacetamide rat hepatocarcinogenesis model

    International Nuclear Information System (INIS)

    Abe, Hajime; Ogawa, Takashi; Wang, Liyun; Kimura, Masayuki; Tanaka, Takeshi; Morita, Reiko; Yoshida, Toshinori; Shibutani, Makoto

    2014-01-01

    Thioacetamide (TAA) has been used to develop a rodent model for hepatocarcinogenesis. To determine the genes with epigenetic modifications in early hepatocarcinogenesis, we did a genome-wide scan for hypermethylated promoter regions using CpG island microarrays in TAA-promoted rat liver tissue. Eight genes were selected based on the microarray profile; of these, Yy1 and Wdr45b were confirmed to be hypermethylated by methylation-specific polymerase chain reaction (PCR) and pyrosequencing and downregulated by real-time reverse transcription PCR. Non-neoplastic liver cells had nuclear Yy1 immunoreactivity, while preneoplastic foci with glutathione S-transferase placental form (GST-P) immunoreactivity had decreased Yy1 immunoreactivity. The incidence of these foci was proportional to the dose of TAA administered. Co-expression analysis of gene products downstream of Yy1 revealed increased nuclear phospho-c-Myc + foci as well as nuclear and cytoplasmic p21 Cip1+ foci in Yy1 − or GST-P + foci in response to TAA-promotion dose. Although the absolute number of cells was low, the incidence of death receptor 5 − foci was increased in Yy1 − foci in proportion to the TAA dose. Yy1 − /GST-P + foci revealed a higher number of proliferating cell nuclear antigen (PCNA)-immunoreactive cells than Yy1 + /GST-P + foci, while cleaved caspase-3 + cells were unchanged between Yy1 – /GST-P + and Yy1 + /GST-P + foci. In the case of Wdr45b, most GST-P + foci were Wdr45b – and were not increased by TAA promotion. These results suggest involvement of Yy1 in the epigenetic gene regulation at the early stages of TAA promoted cell proliferation and concomitant cell cycle arrest in preneoplastic lesions. - Highlights: • Epigenetically downregulated genes were searched in TAA-promnoted rat livers. • Yy1 and Wdr45b showed promoter-region hypermethylation and mRNA downregulation. • TAA promoted increase of preneoplastic Yy1 – /GST-P + foci showing high proliferation. • TAA

  11. A shared promoter region suggests a common ancestor for the human VCX/Y, SPANX, and CSAG gene families and the murine CYPT family

    DEFF Research Database (Denmark)

    Hansen, Martin A; Nielsen, John E; Retelska, Dorota

    2008-01-01

    , sequences corresponding to the shared promoter region of the CYPT family were identified at 39 loci. Most loci were located immediately upstream of genes belonging to the VCX/Y, SPANX, or CSAG gene families. Sequence comparison of the loci revealed a conserved CYPT promoter-like (CPL) element featuring TATA...... cell types. The genomic regions harboring the gene families were rich in direct and inverted segmental duplications (SD), which may facilitate gene conversion and rapid evolution. The conserved CPL and the common expression profiles suggest that the human VCX/Y, SPANX, and CSAG2 gene families together......Many testis-specific genes from the sex chromosomes are subject to rapid evolution, which can make it difficult to identify murine genes in the human genome. The murine CYPT gene family includes 15 members, but orthologs were undetectable in the human genome. However, using refined homology search...

  12. PTSD and DNA Methylation in Select Immune Function Gene Promoter Regions: A Repeated Measures Case-control Study of U.S. Military Service Members

    Science.gov (United States)

    2013-06-24

    other relevant exposures which may influ- ence DNA methylation , such as dietary factors ( folate , vitamin B12 intake) (Fenech, 2001; Piyathilake and...ARTICLE published: 24 June 2013 doi: 10.3389/fpsyt.2013.00056 PTSD and DNA methylation in select immune function gene promoter regions: a repeated measures...largely unknown. Dis- tinct expression signatures for PTSD have been found, in particular for immune activation transcripts. DNA methylation may be

  13. Regional economic impacts of the unconventional promotion of natural gas (Hydraulic Fracturing). Preliminary study; Regionaloekonomische Auswirkungen der unkonventionellen Erdgasfoerderung (Hydraulic Fracturing). Vorstudie

    Energy Technology Data Exchange (ETDEWEB)

    Bizer, Kilian; Bossmeyer, Christoph

    2012-07-01

    Actually, there is a controversial public discussion on the exploitation of conventional natural gas by means of hydraulic fracturing (Fracking). The contribution under consideration examines the geologic, toxicological or technical as well as legal points of contact with respect to the different effects for the actor groups. Based on the existing scientific realizations, the regional economic effects of the fracking technology and the subsequent promotion of unconventional natural gas deposits have to be worked out.

  14. Regularity of Minimal Surfaces

    CERN Document Server

    Dierkes, Ulrich; Tromba, Anthony J; Kuster, Albrecht

    2010-01-01

    "Regularity of Minimal Surfaces" begins with a survey of minimal surfaces with free boundaries. Following this, the basic results concerning the boundary behaviour of minimal surfaces and H-surfaces with fixed or free boundaries are studied. In particular, the asymptotic expansions at interior and boundary branch points are derived, leading to general Gauss-Bonnet formulas. Furthermore, gradient estimates and asymptotic expansions for minimal surfaces with only piecewise smooth boundaries are obtained. One of the main features of free boundary value problems for minimal surfaces is t

  15. Genetic basis of olfactory cognition: extremely high level of DNA sequence polymorphism in promoter regions of the human olfactory receptor genes revealed using the 1000 Genomes Project dataset.

    Science.gov (United States)

    Ignatieva, Elena V; Levitsky, Victor G; Yudin, Nikolay S; Moshkin, Mikhail P; Kolchanov, Nikolay A

    2014-01-01

    The molecular mechanism of olfactory cognition is very complicated. Olfactory cognition is initiated by olfactory receptor proteins (odorant receptors), which are activated by olfactory stimuli (ligands). Olfactory receptors are the initial player in the signal transduction cascade producing a nerve impulse, which is transmitted to the brain. The sensitivity to a particular ligand depends on the expression level of multiple proteins involved in the process of olfactory cognition: olfactory receptor proteins, proteins that participate in signal transduction cascade, etc. The expression level of each gene is controlled by its regulatory regions, and especially, by the promoter [a region of DNA about 100-1000 base pairs long located upstream of the transcription start site (TSS)]. We analyzed single nucleotide polymorphisms using human whole-genome data from the 1000 Genomes Project and revealed an extremely high level of single nucleotide polymorphisms in promoter regions of olfactory receptor genes and HLA genes. We hypothesized that the high level of polymorphisms in olfactory receptor promoters was responsible for the diversity in regulatory mechanisms controlling the expression levels of olfactory receptor proteins. Such diversity of regulatory mechanisms may cause the great variability of olfactory cognition of numerous environmental olfactory stimuli perceived by human beings (air pollutants, human body odors, odors in culinary etc.). In turn, this variability may provide a wide range of emotional and behavioral reactions related to the vast variety of olfactory stimuli.

  16. Genetic basis of olfactory cognition: extremely high level of DNA sequence polymorphism in promoter regions of the human olfactory receptor genes revealed using the 1000 Genomes Project dataset

    Directory of Open Access Journals (Sweden)

    Elena V. Ignatieva

    2014-03-01

    Full Text Available The molecular mechanism of olfactory cognition is very complicated. Olfactory cognition is initiated by olfactory receptor proteins (odorant receptors, which are activated by olfactory stimuli (ligands. Olfactory receptors are the initial player in the signal transduction cascade producing a nerve impulse, which is transmitted to the brain. The sensitivity to a particular ligand depends on the expression level of multiple proteins involved in the process of olfactory cognition: olfactory receptor proteins, proteins that participate in signal transduction cascade, etc. The expression level of each gene is controlled by its regulatory regions, and especially, by the promoter (a region of DNA about 100–1000 base pairs long located upstream of the transcription start site. We analyzed single nucleotide polymorphisms using human whole-genome data from the 1000 Genomes Project and revealed an extremely high level of single nucleotide polymorphisms in promoter regions of olfactory receptor genes and HLA genes. We hypothesized that the high level of polymorphisms in olfactory receptor promoters was responsible for the diversity in regulatory mechanisms controlling the expression levels of olfactory receptor proteins. Such diversity of regulatory mechanisms may cause the great variability of olfactory cognition of numerous environmental olfactory stimuli perceived by human beings (air pollutants, human body odors, odors in culinary etc.. In turn, this variability may provide a wide range of emotional and behavioral reactions related to the vast variety of olfactory stimuli.

  17. Identification, occurrence, and validation of DRE and ABRE Cis-regulatory motifs in the promoter regions of genes of Arabidopsis thaliana.

    Science.gov (United States)

    Mishra, Sonal; Shukla, Aparna; Upadhyay, Swati; Sanchita; Sharma, Pooja; Singh, Seema; Phukan, Ujjal J; Meena, Abha; Khan, Feroz; Tripathi, Vineeta; Shukla, Rakesh Kumar; Shrama, Ashok

    2014-04-01

    Plants posses a complex co-regulatory network which helps them to elicit a response under diverse adverse conditions. We used an in silico approach to identify the genes with both DRE and ABRE motifs in their promoter regions in Arabidopsis thaliana. Our results showed that Arabidopsis contains a set of 2,052 genes with ABRE and DRE motifs in their promoter regions. Approximately 72% or more of the total predicted 2,052 genes had a gap distance of less than 400 bp between DRE and ABRE motifs. For positional orientation of the DRE and ABRE motifs, we found that the DR form (one in direct and the other one in reverse orientation) was more prevalent than other forms. These predicted 2,052 genes include 155 transcription factors. Using microarray data from The Arabidopsis Information Resource (TAIR) database, we present 44 transcription factors out of 155 which are upregulated by more than twofold in response to osmotic stress and ABA treatment. Fifty-one transcripts from the one predicted above were validated using semiquantitative expression analysis to support the microarray data in TAIR. Taken together, we report a set of genes containing both DRE and ABRE motifs in their promoter regions in A. thaliana, which can be useful to understand the role of ABA under osmotic stress condition. © 2013 Institute of Botany, Chinese Academy of Sciences.

  18. Isolation and analysis of a multifunctional triterpene synthase KcMS promoter region from mangrove plant kandelia candel

    Science.gov (United States)

    Basyuni, M.; Wati, R.; Sulistiyono, N.; Sumardi; Oku, H.; Baba, S.; Sagami, H.

    2018-03-01

    Molecular cloning of Kandelia candel KcMS gene has previously been cloned and encoded a multifunctional triterpene synthase. In this study, the KcMS gene promoter was cloned through Genome walking, sequenced, and analyzed. A 1,358 bp genomic DNA fragment of KcMS promoter was obtained. PLACE and PlantCARE analysis of the KcMS promoter revealed that there was some regulatory elements in response to environmental signals and involved in the regulation of gene expression. Results showed that four kinds of elements are regulated by hormone binding, namely 2 MeJA-responsiveness elements (CGTCA-motif and TGACG-motif), the ABRE (TACGTG) involved in abscisic acid responsiveness, gibberellin-related GARE-motif (AAACAGA), and the TGA-element (AACGAC) as an auxin-responsive element. Several elements in the KcMS have been shown in other plants to be responsive to abiotic stress. These motifs were MBS (CAACTG), TC-rich repeats, and eight light responsive elements. The KcMS promoter was also involved in the activation of defense genes in plants such as HSE (AAAAAATTC) and four circadian control elements (CAANNNNATC). The presence of multipotential regulatory motifs suggested that KcMS may be involved in regulation of plant tolerance to several types of stresses.

  19. Promoting sustainable potato agriculture in the Andean region by supplemental calcium nutrition and breeding for frost tolerance

    Science.gov (United States)

    Collaborative research in Peru sought to promote sustainable potato production and, mitigate adverse impacts of climate change through two approaches: first calcium amendments to increase crop yield and, second to enhance frost tolerance in native potatoes. All the multi-year, multi-location experim...

  20. Regulatory elements in the promoter region of the rat gene encoding the acyl-CoA-binding protein

    DEFF Research Database (Denmark)

    Elholm, M; Bjerking, G; Knudsen, J

    1996-01-01

    for the ACBP DR-1 element. Addition of peroxisome proliferators (PP) to H4IIEC3 rat hepatoma cells led to an increase in the ACBP mRNA level, indicating that the DR-1 element could be a functional peroxisome proliferator responsive element (PPRE). Analysis of the ACBP promoter by transient transfection showed...

  1. DNA methylation of specific CpG sites in the promoter region regulates the transcription of the mouse oxytocin receptor.

    Directory of Open Access Journals (Sweden)

    Shimrat Mamrut

    Full Text Available Oxytocin is a peptide hormone, well known for its role in labor and suckling, and most recently for its involvement in mammalian social behavior. All central and peripheral actions of oxytocin are mediated through the oxytocin receptor, which is the product of a single gene. Transcription of the oxytocin receptor is subject to regulation by gonadal steroid hormones, and is profoundly elevated in the uterus and mammary glands during parturition. DNA methylation is a major epigenetic mechanism that regulates gene transcription, and has been linked to reduced expression of the oxytocin receptor in individuals with autism. Here, we hypothesized that transcription of the mouse oxytocin receptor is regulated by DNA methylation of specific sites in its promoter, in a tissue-specific manner. Hypothalamus-derived GT1-7, and mammary-derived 4T1 murine cell lines displayed negative correlations between oxytocin receptor transcription and methylation of the gene promoter, and demethylation caused a significant enhancement of oxytocin receptor transcription in 4T1 cells. Using a reporter gene assay, we showed that methylation of specific sites in the gene promoter, including an estrogen response element, significantly inhibits transcription. Furthermore, methylation of the oxytocin receptor promoter was found to be differentially correlated with oxytocin receptor expression in mammary glands and the uterus of virgin and post-partum mice, suggesting that it plays a distinct role in oxytocin receptor transcription among tissues and under different physiological conditions. Together, these results support the hypothesis that the expression of the mouse oxytocin receptor gene is epigenetically regulated by DNA methylation of its promoter.

  2. Genome-wide Anaplasma phagocytophilum AnkA-DNA interactions are enriched in intergenic regions and gene promoters and correlate with infection-induced differential gene expression.

    Directory of Open Access Journals (Sweden)

    J Stephen Dumler

    2016-09-01

    Full Text Available Anaplasma phagocytophilum, an obligate intracellular prokaryote, infects neutrophils and alters cardinal functions via reprogrammed transcription. Large contiguous regions of neutrophil chromosomes are differentially expressed during infection. Secreted A. phagocytophilum effector AnkA transits into the neutrophil or granulocyte nucleus to complex with DNA in heterochromatin across all chromosomes. AnkA binds to gene promoters to dampen cis-transcription and also has features of matrix attachment region (MAR-binding proteins that regulate three-dimensional chromatin architecture and coordinate transcriptional programs encoded in topologically-associated chromatin domains. We hypothesize that identification of additional AnkA binding sites will better delineate how A. phagocytophilum infection results in reprogramming of the neutrophil genome. Using AnkA-binding ChIP-seq, we showed that AnkA binds broadly throughout all chromosomes in a reproducible pattern, especially at: i intergenic regions predicted to be matrix attachment regions (MARs; ii within predicted lamina-associated domains; and iii at promoters ≤3,000 bp upstream of transcriptional start sites. These findings provide genome-wide support for AnkA as a regulator of cis-gene transcription. Moreover, the dominant mark of AnkA in distal intergenic regions known to be AT-enriched, coupled with frequent enrichment in the nuclear lamina, provides strong support for its role as a MAR-binding protein and genome re-organizer. AnkA must be considered a prime candidate to promote neutrophil reprogramming and subsequent functional changes that belie improved microbial fitness and pathogenicity.

  3. Building an Entrepreneurial University in Brazil: The Role and Potential of University-Industry Linkages in Promoting Regional Economic Development

    Science.gov (United States)

    Amaral, Marcelo; Ferreira, Andre; Teodoro, Pitias

    2011-01-01

    This study is part of a broader research project, conducted by the Triple Helix Research Group--Brazil, focusing on university-industry-government linkages in the state of Rio de Janeiro. The case study reported here is that of the Regional University of Volta Redonda: the aim was to develop an understanding of how a regional university can be…

  4. Minimal dilaton model

    Directory of Open Access Journals (Sweden)

    Oda Kin-ya

    2013-05-01

    Full Text Available Both the ATLAS and CMS experiments at the LHC have reported the observation of the particle of mass around 125 GeV which is consistent to the Standard Model (SM Higgs boson, but with an excess of events beyond the SM expectation in the diphoton decay channel at each of them. There still remains room for a logical possibility that we are not seeing the SM Higgs but something else. Here we introduce the minimal dilaton model in which the LHC signals are explained by an extra singlet scalar of the mass around 125 GeV that slightly mixes with the SM Higgs heavier than 600 GeV. When this scalar has a vacuum expectation value well beyond the electroweak scale, it can be identified as a linearly realized version of a dilaton field. Though the current experimental constraints from the Higgs search disfavors such a region, the singlet scalar model itself still provides a viable alternative to the SM Higgs in interpreting its search results.

  5. Minimal mirror twin Higgs

    Energy Technology Data Exchange (ETDEWEB)

    Barbieri, Riccardo [Institute of Theoretical Studies, ETH Zurich,CH-8092 Zurich (Switzerland); Scuola Normale Superiore,Piazza dei Cavalieri 7, 56126 Pisa (Italy); Hall, Lawrence J.; Harigaya, Keisuke [Department of Physics, University of California,Berkeley, California 94720 (United States); Theoretical Physics Group, Lawrence Berkeley National Laboratory,Berkeley, California 94720 (United States)

    2016-11-29

    In a Mirror Twin World with a maximally symmetric Higgs sector the little hierarchy of the Standard Model can be significantly mitigated, perhaps displacing the cutoff scale above the LHC reach. We show that consistency with observations requires that the Z{sub 2} parity exchanging the Standard Model with its mirror be broken in the Yukawa couplings. A minimal such effective field theory, with this sole Z{sub 2} breaking, can generate the Z{sub 2} breaking in the Higgs sector necessary for the Twin Higgs mechanism. The theory has constrained and correlated signals in Higgs decays, direct Dark Matter Detection and Dark Radiation, all within reach of foreseen experiments, over a region of parameter space where the fine-tuning for the electroweak scale is 10-50%. For dark matter, both mirror neutrons and a variety of self-interacting mirror atoms are considered. Neutrino mass signals and the effects of a possible additional Z{sub 2} breaking from the vacuum expectation values of B−L breaking fields are also discussed.

  6. Promoting biogas production and using it as transport fuel in the Helsinki region; Suunnitelma liikennebiokaasun tuotannon ja kaeytoen edistaemiseksi Helsingin seudulla

    Energy Technology Data Exchange (ETDEWEB)

    Rasi, S.; Havukainen, J.; Uusitalo, V.; Andersson, R.; Manninen, K.; Aro-Heinilae, E.; Rintala, J.

    2012-11-01

    The main objective of the project was to promote biogas production and its use as transport fuel. The aims in the four Finnish and two Estonian case areas were to reduce the amount and improve the sustainable use of waste and sludge, to promote biogas production, to start biogas use as transport fuel and to provide tools for implementing the aims. The total biomethane potential in the Helsinki region corresponds to approximately 450 GWh/a. The most potential user for biomethane is public transport. The total amount of biomethane would suffice for 80% of the busses operating in the Helsinki region. Using biogas as a transport fuel instead of energy production in the Helsinki region would result in emission reductions (13 000 t{sub CO2,eq}/a). However if the fuel replacing biogas in energy production would be renewable, the emission reductions would be significantly greater. The economical assessment indicates that the production of biogas is economically feasible if all the produced gas can be sold. Biogas produced near the natural gas grid can also be transported to the Helsinki region where there are better possibilities to find uses for it. In this way, for example, gas that is produced in Kymenlaakso but is not consumed there can be transported via the natural gas grid, assuming that the production plant is reasonably close to the grid. (orig.)

  7. Health-care users, key community informants and primary health care workers' views on health, health promotion, health assets and deficits: qualitative study in seven Spanish regions.

    Science.gov (United States)

    Pons-Vigués, Mariona; Berenguera, Anna; Coma-Auli, Núria; Pombo-Ramos, Haizea; March, Sebastià; Asensio-Martínez, Angela; Moreno-Peral, Patricia; Mora-Simón, Sara; Martínez-Andrés, Maria; Pujol-Ribera, Enriqueta

    2017-06-13

    Although some articles have analysed the definitions of health and health promotion from the perspective of health-care users and health care professionals, no published studies include the simultaneous participation of health-care users, primary health care professionals and key community informants. Understanding the perception of health and health promotion amongst these different stakeholders is crucial for the design and implementation of successful, equitable and sustainable measures that improve the health and wellbeing of populations. Furthermore, the identification of different health assets and deficits by the different informants will generate new evidence to promote healthy behaviours, improve community health and wellbeing and reduce preventable inequalities. The objective of this study is to explore the concept of health and health promotion and to compare health assets and deficits as identified by health-care users, key community informants and primary health care workers with the ultimate purpose to collect the necessary data for the design and implementation of a successful health promotion intervention. A descriptive-interpretive qualitative research was conducted with 276 participants from 14 primary care centres of 7 Spanish regions. Theoretical sampling was used for selection. We organized 11 discussion groups and 2 triangular groups with health-care users; 30 semi-structured interviews with key community informants; and 14 discussion groups with primary health care workers. A thematic content analysis was carried out. Health-care users and key community informants agree that health is a complex, broad, multifactorial concept that encompasses several interrelated dimensions (physical, psychological-emotional, social, occupational, intellectual, spiritual and environmental). The three participants' profiles consider health promotion indispensable despite defining it as complex and vague. In fact, most health-care users admit to having

  8. Minimally invasive orthognathic surgery.

    Science.gov (United States)

    Resnick, Cory M; Kaban, Leonard B; Troulis, Maria J

    2009-02-01

    Minimally invasive surgery is defined as the discipline in which operative procedures are performed in novel ways to diminish the sequelae of standard surgical dissections. The goals of minimally invasive surgery are to reduce tissue trauma and to minimize bleeding, edema, and injury, thereby improving the rate and quality of healing. In orthognathic surgery, there are two minimally invasive techniques that can be used separately or in combination: (1) endoscopic exposure and (2) distraction osteogenesis. This article describes the historical developments of the fields of orthognathic surgery and minimally invasive surgery, as well as the integration of the two disciplines. Indications, techniques, and the most current outcome data for specific minimally invasive orthognathic surgical procedures are presented.

  9. Correlates of minimal dating.

    Science.gov (United States)

    Leck, Kira

    2006-10-01

    Researchers have associated minimal dating with numerous factors. The present author tested shyness, introversion, physical attractiveness, performance evaluation, anxiety, social skill, social self-esteem, and loneliness to determine the nature of their relationships with 2 measures of self-reported minimal dating in a sample of 175 college students. For women, shyness, introversion, physical attractiveness, self-rated anxiety, social self-esteem, and loneliness correlated with 1 or both measures of minimal dating. For men, physical attractiveness, observer-rated social skill, social self-esteem, and loneliness correlated with 1 or both measures of minimal dating. The patterns of relationships were not identical for the 2 indicators of minimal dating, indicating the possibility that minimal dating is not a single construct as researchers previously believed. The present author discussed implications and suggestions for future researchers.

  10. Attitudes, Beliefs and Predictors of Male Circumcision Promotion among Medical University Students in a Traditionally Non-Circumcising Region

    Directory of Open Access Journals (Sweden)

    Maria Ganczak

    2017-09-01

    Full Text Available Objective: To evaluate the beliefs of medical university students regarding male circumcision (MC, as well as attitudes and the predictors of its promotion in the case of adults at risk of HIV. Methods: A cross-sectional survey was conducted between 2013–2016 at the Medical University in Szczecin, Poland, among final year Polish/foreign students from Northern Europe, using a standardized questionnaire. Results: There were 539 participants, median age 25 years, 40.8% males, and 66.8% were Polish nationals. The MC rate was 16.7%. Regarding HIV/AIDS knowledge, 66.6% of the students scored more than 75%; and, 34.2% knew that MC reduces the risk of HIV infection. One in eleven respondents (9.1% believed that circumcised men felt more intense sexual pleasure. More than half of the respondents (54.8% declared that they would recommend MC to adult patients at risk for HIV. The belief that circumcised men felt more intense sexual pleasure, and knowledge on MC regarding HIV risk reduction was associated with greater odds of recommending adult MC (OR = 3.35 and OR = 2.13, respectively. Conclusions: Poor knowledge of its benefits and a low willingness to promote the procedure—strongly dependent on personal beliefs—suggest that medical students may need additional training to help them to discuss MC more openly with adult men at risk for HIV infection. Knowledge may be an effective tool when making decisions regarding MC promotion.

  11. Hexavalent Chromium Minimization Strategy

    Science.gov (United States)

    2011-05-01

    Logistics 4 Initiative - DoD Hexavalent Chromium Minimization Non- Chrome Primer IIEXAVAJ ENT CHRO:M I~UMI CHROMIUM (VII Oil CrfVli.J CANCEfl HAnRD CD...Management Office of the Secretary of Defense Hexavalent Chromium Minimization Strategy Report Documentation Page Form ApprovedOMB No. 0704-0188...00-2011 4. TITLE AND SUBTITLE Hexavalent Chromium Minimization Strategy 5a. CONTRACT NUMBER 5b. GRANT NUMBER 5c. PROGRAM ELEMENT NUMBER 6

  12. Minimal Super Technicolor

    DEFF Research Database (Denmark)

    Antola, M.; Di Chiara, S.; Sannino, F.

    2011-01-01

    We introduce novel extensions of the Standard Model featuring a supersymmetric technicolor sector (supertechnicolor). As the first minimal conformal supertechnicolor model we consider N=4 Super Yang-Mills which breaks to N=1 via the electroweak interactions. This is a well defined, economical......, between unparticle physics and Minimal Walking Technicolor. We consider also other N =1 extensions of the Minimal Walking Technicolor model. The new models allow all the standard model matter fields to acquire a mass....

  13. Allelic variation of the inducible costimulator (ICOS) gene: detection of polymorphisms, analysis of the promoter region, and extended haplotype estimation

    DEFF Research Database (Denmark)

    Andersen, A.D.H.; Lange, Marianne; Lillevang, S.T.

    2003-01-01

    The human chromosome region 2q33 including the three costimulatory molecules CD28, CTLA-4 and ICOS, has been subject to much attention due to its linkage to a number of autoimmune diseases. The search for the causal relationship of this linkage has revealed several polymorphisms, but no variations...... in the amino acid sequences except for one polymorphism in, the leader sequence of CTLA-4. In the present study, we examined the ICOS gene of an unrelated group of healthy donors from the Danish population. We were able to report 16 intronic SNP, one intronic G-insert and two repeat regions in intron 4......, consistent with the [T](n) and the [GT](n) regions reported in a Japanese study. Putative haplotypes for the established SNP and repeat polymorphisms have been estimated by computational analysis. Sequencing of similar to3500 by of the upstream region of ICOS revealed an additional eight SNP of which two...

  14. 3. Promotion of environment protection of sea and near-sea region. Swinoujscie 12-14 October 1994

    International Nuclear Information System (INIS)

    1994-01-01

    The great number of problems connected with environment protection near shore marine zone, beach protection, effluent transport in ground and surface waters in region of North Port of Poland as well as technical solutions of water purification and legal problems have been discussed during the conference. All observations and experimental works have been carried out in that region. Among reported works two of them have been devoted to application of nuclear methods in interesting merit

  15. Identification and characterisation of a G-quadruplex forming sequence in the promoter region of nuclear factor (erythroid-derived 2)-like 2 (Nrf2)

    Energy Technology Data Exchange (ETDEWEB)

    Waller, Zoë A.E., E-mail: z.waller@uea.ac.uk; Howell, Lesley A.; MacDonald, Colin J.; O’Connell, Maria A.; Searcey, Mark, E-mail: m.searcey@uea.ac.uk

    2014-04-25

    Highlights: • Discovery of a G-quadruplex forming sequence in the promoter sequence of Nrf2. • Characterisation of the G-quadruplex by UV, CD and NMR. • Conformational switching of G-quadruplex induced by 9-aminoacridine. - Abstract: The transcription factor nuclear factor (erythroid-derived 2)-like 2 (Nrf2) regulates multiple antioxidants, Phase II detoxification enzymes and other cytoprotective enzymes in cells. Activation of Nrf2 is recognised as being of potential therapeutic benefit in inflammatory-diseases whereas more recently, it has become clear that the inhibition of Nrf2 may have benefit in the alleviation of resistance in some tumour types. A potential G-quadruplex forming sequence was identified in the promoter region of Nrf2, close to a number of putative transcription factor binding sites. Characterisation of the sequence 5’-d[GGGAAGGGAGCAAGGGCGGGAGGG]-3’ using CD spectroscopy, imino proton NMR resonances and UV melting experiments demonstrated the formation of a parallel intramolecular G-quadruplex in the presence of K{sup +} ions. Incubation with 9-aminoacridine ligands induced a switch from antiparallel to parallel forms. The presence of a G-quadruplex forming sequence in the promoter region of Nrf2 suggests an approach to targeting the production of the protein through stabilisation of the structure, thereby avoiding resistance to antitumour drugs.

  16. Promoter trans-activation of protooncogenes c-fos and c-myc, but not c-Ha-ras, by products of adenovirus early region 1A

    International Nuclear Information System (INIS)

    Sassone-Corsi, P.; Borrelli, E.

    1987-01-01

    The E1A (early region 1A) oncogene products of adenovirus type 2 trans-activate the other early viral transcription units, as well as some cellular promoters. Using a short-term cotransfection assay in murine NIH 3T3 fibroblasts, we show that c-fos and c-myc promoter activities are stimulated by the E1A proteins, whereas c-Ha-ras transcription is not affected. The product of E1A 13S mRNA is responsible for the trans-activation, whereas the 12S mRNA product has no effect. Analysis of the c-fos promoter sequences required for the E1A stimulation shows that responsive sequences are located between positions -402 and -240 upstream of the transcription initiation site. This same region also contains the c-fos serum-responsive element. Furthermore, transcription of the endogenous c-fos gene in HeLa cells is increased after E1A transfection

  17. A Peptide Derived from the HIV-1 gp120 Coreceptor-Binding Region Promotes Formation of PAP248-286 Amyloid Fibrils to Enhance HIV-1 Infection.

    Directory of Open Access Journals (Sweden)

    Jinquan Chen

    Full Text Available Semen is a major vehicle for HIV transmission. Prostatic acid phosphatase (PAP fragments, such as PAP248-286, in human semen can form amyloid fibrils to enhance HIV infection. Other endogenous or exogenous factors present during sexual intercourse have also been reported to promote the formation of seminal amyloid fibrils.Here, we demonstrated that a synthetic 15-residue peptide derived from the HIV-1 gp120 coreceptor-binding region, designated enhancing peptide 2 (EP2, can rapidly self-assemble into nanofibers. These EP2-derivated nanofibers promptly accelerated the formation of semen amyloid fibrils by PAP248-286, as shown by Thioflavin T (ThT and Congo red assays. The amyloid fibrils presented similar morphology, assessed via transmission electron microscopy (TEM, in the presence or absence of EP2. Circular dichroism (CD spectroscopy revealed that EP2 accelerates PAP248-286 amyloid fibril formation by promoting the structural transition of PAP248-286 from a random coil into a cross-β-sheet. Newly formed semen amyloid fibrils effectively enhanced HIV-1 infection in TZM-bl cells and U87 cells by promoting the binding of HIV-1 virions to target cells.Nanofibers composed of EP2 promote the formation of PAP248-286 amyloid fibrils and enhance HIV-1 infection.

  18. Specific interactions between transcription factors and the promoter-regulatory region of the human cytomegalovirus major immediate-early gene

    International Nuclear Information System (INIS)

    Ghazal, P.; Lubon, H.; Hennighausen, L.

    1988-01-01

    Repeat sequence motifs as well as unique sequences between nucleotides -150 and -22 of the human cytomegalovirus immediate-early 1 gene interact in vitro with nuclear proteins. The authors show that a transcriptional element between nucleotides -91 and -65 stimulated promoter activity in vivo and in vitro by binding specific cellular transcription factors. Finally, a common sequence motif, (T)TGG/AC, present in 15 of the determined binding sites suggests a particular class of nuclear factors associated with the immediate-early 1 gene

  19. Minimizing Mutual Couping

    DEFF Research Database (Denmark)

    2010-01-01

    Disclosed herein are techniques, systems, and methods relating to minimizing mutual coupling between a first antenna and a second antenna.......Disclosed herein are techniques, systems, and methods relating to minimizing mutual coupling between a first antenna and a second antenna....

  20. Ruled Laguerre minimal surfaces

    KAUST Repository

    Skopenkov, Mikhail; Pottmann, Helmut; Grohs, Philipp

    2011-01-01

    A Laguerre minimal surface is an immersed surface in ℝ 3 being an extremal of the functional ∫ (H 2/K-1)dA. In the present paper, we prove that the only ruled Laguerre minimal surfaces are up to isometry the surfaces ℝ (φλ) = (Aφ, Bφ, Cφ + D cos 2φ

  1. [Drug registries: post-marketing evaluation of the benefit-risk profile and promotion of appropriateness. The regional point of view].

    Science.gov (United States)

    Martelli, Luisa; Venegoni, Mauro

    2013-06-01

    Italian Regions and the Italian regulatory agency share a common interest in promoting the appropriateness of drug use, containing drug expenditure and acquiring additional evidence on the effectiveness and safety of drugs. Drug registries can help attaining these objectives. Specifically, the registries implemented in Italy were able to cover the first two objectives, whereas some critical issues were raised on the third one. For instance, the data recorded in the registries are not available at regional level to conduct safety and effectiveness investigations. This is a paradox, when considering that drugs included in the registries have a risk-benefit profile that is only partially defined at the moment of marketing. Currently, researchers and regions can conduct epidemiological research (cohort and case control studies), on the basis of record-linkage procedures, on all drugs prescribed in general practice (which are older drugs with a better defined risk-benefit profile). The expected outcomes of registries should be more clearly defined: when the main aim is to promote appropriateness, the recording of only a very limited amount of data should be required (to avoid a bureaucratic burden on clinicians).The Italian centers of the ENCePP network might play an important role in planning and conducting drug registries: through the presence in the steering committees of the registries, and in conducting epidemiological studies that make the most of this powerful instrument.

  2. CRA-1 uncovers a double-strand break-dependent pathway promoting the assembly of central region proteins on chromosome axes during C. elegans meiosis.

    Science.gov (United States)

    Smolikov, Sarit; Schild-Prüfert, Kristina; Colaiácovo, Mónica P

    2008-06-06

    The synaptonemal complex (SC), a tripartite proteinaceous structure that forms between homologous chromosomes during meiosis, is crucial for faithful chromosome segregation. Here we identify CRA-1, a novel and conserved protein that is required for the assembly of the central region of the SC during C. elegans meiosis. In the absence of CRA-1, central region components fail to extensively localize onto chromosomes at early prophase and instead mostly surround the chromatin at this stage. Later in prophase, central region proteins polymerize along chromosome axes, but for the most part fail to connect the axes of paired homologous chromosomes. This defect results in an inability to stabilize homologous pairing interactions, altered double-strand break (DSB) repair progression, and a lack of chiasmata. Surprisingly, DSB formation and repair are required to promote the polymerization of the central region components along meiotic chromosome axes in cra-1 mutants. In the absence of both CRA-1 and any one of the C. elegans homologs of SPO11, MRE11, RAD51, or MSH5, the polymerization observed along chromosome axes is perturbed, resulting in the formation of aggregates of the SC central region proteins. While radiation-induced DSBs rescue this polymerization in cra-1; spo-11 mutants, they fail to do so in cra-1; mre-11, cra-1; rad-51, and cra-1; msh-5 mutants. Taken together, our studies place CRA-1 as a key component in promoting the assembly of a tripartite SC structure. Moreover, they reveal a scenario in which DSB formation and repair can drive the polymerization of SC components along chromosome axes in C. elegans.

  3. Sequence analysis of the Epstein-Barr virus (EBV) latent membrane protein-1 gene and promoter region

    DEFF Research Database (Denmark)

    Sandvej, Kristian; Gratama, J W; Munch, M

    1997-01-01

    Sequence variations in the Epstein-Barr virus (EBV) encoded latent membrane protein-1 (LMP-1) gene have been described in a Chinese nasopharyngeal carcinoma-derived isolate (CAO), and in viral isolates from various EBV-associated tumors. It has been suggested that these genetic changes, which...... include loss of a Xho I restriction site (position 169425) and a C-terminal 30-base pair (bp) deletion (position 168287-168256), define EBV genotypes associated with increased tumorigenicity or with disease among particular geographic populations. To determine the frequency of LMP-1 variations in European...... wild-type virus isolates, we sequenced the LMP-1 promoter and gene in EBV from lymphoblastoid cell lines from healthy carriers and patients without EBV-associated disease. Sequence changes were often present, and defined at least four main groups of viral isolates, which we designate Groups A through D...

  4. Enhancement of RNA synthesis by promoter duplication in tombusviruses

    International Nuclear Information System (INIS)

    Panavas, T.; Panaviene, Z.; Pogany, J.; Nagy, P.D.

    2003-01-01

    Replication of tombusviruses, small plus-strand RNA viruses of plants, is regulated by cis-acting elements present in the viral RNA. The role of cis-acting elements can be studied in vitro by using a partially purified RNA-dependent RNA polymerase (RdRp) preparation obtained from tombusvirus-infected plants , Virology 276, 279- 288). Here, we demonstrate that the minus-strand RNA of tombusviruses contains, in addition to the 3'-terminal minimal plus-strand initiation promoter, a second cis-acting element, termed the promoter proximal enhancer (PPE). The PPE element enhanced RNA synthesis by almost threefold from the adjacent minimal promoter in the in vitro assay. The sequence of the PPE element is 70% similar to the minimal promoter, suggesting that sequence duplication of the minimal promoter may have been the mechanism leading to the generation of the PPE. Consistent with this proposal, replacement of the PPE element with the minimal promoter, which resulted in a perfectly duplicated promoter region, preserved its enhancer-like function. In contrast, mutagenesis of the PPE element or its replacement with an artificial G/C-rich sequence abolished its stimulative effect on initiation of RNA synthesis in vitro. In vivo experiments are also consistent with the role of the PPE element in enhancement of tombusvirus replication. Sequence comparison of several tombusviruses and related carmoviruses further supports the finding that duplication of minimal promoter sequences may have been an important mechanism during the evolution of cis-acting elements in tombusviruses and related RNA viruses

  5. Temporal transcription of the lactococcal temperate phage TP901-1 and DNA sequence of the early promoter region

    DEFF Research Database (Denmark)

    Madsen, Hans Peter Lynge; Hammer, Karin

    1998-01-01

    to a phage repressor, a single-stranded DNA-binding protein, a topoisomerase, a Cro-like protein and two other phage proteins of unknown function were detected. The gene arrangement in the early transcribed region of TP901-1 thus consists of two transcriptional units: one from PR containing four genes......, of which at least two (the integrase gene and putative repressor) are needed for lysogeny, and the divergent and longer transcriptional unit from PL, presumably encoding functions required for the lytic life cycle. ORFs with homology to proteins involved in DNA replication were identified on the latter......Transcriptional analysis by Northern blotting identified clusters of early, middle and late transcribed regions of the temperate lactococcal bacteriophage TP901-1 during one-step growth experiments. The latent period was found to be 65 min and the burst size 40 +/- 10. The eight early transcripts...

  6. Effect of price and in-store promotion on sales: a study of distinct regions in an emerging market

    OpenAIRE

    Sanchez, Juan Machado

    2016-01-01

    Increasing competition caused by globalization, high growth of some emerging markets and stagnation of developed economies motivate Consumer Packaged Goods (CPGs) manufacturers to drive their attention to emerging markets. These companies are expected to adapt their marketing activities to the particularities of these markets in order to succeed. In a country classified as emerging market, regions are not alike and some contrasts can be identified. In addition, divergences of marketing variab...

  7. Immediate-early gene region of human cytomegalovirus trans-activates the promoter of human immunodeficiency virus

    International Nuclear Information System (INIS)

    Davis, M.G.; Kenney, S.C.; Kamine, J.; Pagano, J.S.; Huang, E.S.

    1987-01-01

    Almost all homosexual patients with acquired immunodeficiency syndrome are also actively infected with human cytomegalovirus (HCMV). The authors have hypothesized that an interaction between HCMV and human immunodeficiency virus (HIV), the agent that causes acquired immunodeficiency syndrome, may exist at a molecular level and contribute to the manifestations of HIV infection. In this report, they demonstrate that the immediate-early gene region of HCMV, in particular immediate-early region 2, trans-activates the expression of the bacterial gene chloramphenicol acetyltransferase that is fused to the HIV long terminal repeat and carried by plasmid pHIV-CAT. The HCMV immediate-early trans-activator increases the level of mRNA from the plamid pHIV-CAT. The sequences of HIV that are responsive to trans-activation by the HDMV immediate-early region are distinct from HIV sequences that are required for response to the HIV tat. The stimulation of HIV gene expression by HDMV gene functions could enhance the consequences of HIV infection in persons with previous or concurrent HCMV infection

  8. Minimizing Exposure at Work

    Science.gov (United States)

    ; Environment Human Health Animal Health Safe Use Practices Food Safety Environment Air Water Soil Wildlife Home Page Pesticide Health and Safety Information Safe Use Practices Minimizing Exposure at Work Pesticides - Pennsylvania State University Cooperative Extension Personal Protective Equipment for Working

  9. Minimalism. Clip and Save.

    Science.gov (United States)

    Hubbard, Guy

    2002-01-01

    Provides background information on the art movement called "Minimalism" discussing why it started and its characteristics. Includes learning activities and information on the artist, Donald Judd. Includes a reproduction of one of his art works and discusses its content. (CMK)

  10. Ruled Laguerre minimal surfaces

    KAUST Repository

    Skopenkov, Mikhail

    2011-10-30

    A Laguerre minimal surface is an immersed surface in ℝ 3 being an extremal of the functional ∫ (H 2/K-1)dA. In the present paper, we prove that the only ruled Laguerre minimal surfaces are up to isometry the surfaces ℝ (φλ) = (Aφ, Bφ, Cφ + D cos 2φ) + λ(sin φ, cos φ, 0), where A,B,C,D ε ℝ are fixed. To achieve invariance under Laguerre transformations, we also derive all Laguerre minimal surfaces that are enveloped by a family of cones. The methodology is based on the isotropic model of Laguerre geometry. In this model a Laguerre minimal surface enveloped by a family of cones corresponds to a graph of a biharmonic function carrying a family of isotropic circles. We classify such functions by showing that the top view of the family of circles is a pencil. © 2011 Springer-Verlag.

  11. Minimal and careful processing

    OpenAIRE

    Nielsen, Thorkild

    2004-01-01

    In several standards, guidelines and publications, organic food processing is strongly associated with "minimal processing" and "careful processing". The term "minimal processing" is nowadays often used in the general food processing industry and described in literature. The term "careful processing" is used more specifically within organic food processing but is not yet clearly defined. The concept of carefulness seems to fit very well with the processing of organic foods, especially if it i...

  12. Studies of genetic variability of the glucose transporter 2 promoter in patients with type 2 diabetes mellitus

    DEFF Research Database (Denmark)

    Møller, A M; Jensen, N M; Pildal, J

    2001-01-01

    This study was performed to test the hypothesis that genetic variation in the promoter of the glucose transporter 2 (GLUT2) might predispose to prediabetic phenotypes or type 2 diabetes. A total of 1611 bp comprising the minimal promoter region of the GLUT2 gene were examined by combined single-s......-tolerant subjects. In conclusion, we found no evidence supporting the hypothesis that genetic variability in the minimal promoter of the GLUT2 is associated with type 2 diabetes or prediabetic phenotypes in the Danish population.......This study was performed to test the hypothesis that genetic variation in the promoter of the glucose transporter 2 (GLUT2) might predispose to prediabetic phenotypes or type 2 diabetes. A total of 1611 bp comprising the minimal promoter region of the GLUT2 gene were examined by combined single...

  13. ESR1 gene promoter region methylation in free circulating DNA and its correlation with estrogen receptor protein expression in tumor tissue in breast cancer patients

    International Nuclear Information System (INIS)

    Martínez-Galán, Joaquina; Ríos, Sandra; Delgado, Juan Ramón; Torres-Torres, Blanca; Núñez, María Isabel; López-Peñalver, Jesús; Del Moral, Rosario; Ruiz De Almodóvar, José Mariano; Menjón, Salomón; Concha, Ángel; Chamorro, Clara

    2014-01-01

    Tumor expression of estrogen receptor (ER) is an important marker of prognosis, and is predictive of response to endocrine therapy in breast cancer. Several studies have observed that epigenetic events, such methylation of cytosines and deacetylation of histones, are involved in the complex mechanisms that regulate promoter transcription. However, the exact interplay of these factors in transcription activity is not well understood. In this study, we explored the relationship between ER expression status in tumor tissue samples and the methylation of the 5′ CpG promoter region of the estrogen receptor gene (ESR1) isolated from free circulating DNA (fcDNA) in plasma samples from breast cancer patients. Patients (n = 110) with non-metastatic breast cancer had analyses performed of ER expression (luminal phenotype in tumor tissue, by immunohistochemistry method), and the ESR1-DNA methylation status (fcDNA in plasma, by quantitative methylation specific PCR technique). Our results showed a significant association between presence of methylated ESR1 in patients with breast cancer and ER negative status in the tumor tissue (p = 0.0179). There was a trend towards a higher probability of ESR1-methylation in those phenotypes with poor prognosis i.e. 80% of triple negative patients, 60% of HER2 patients, compared to 28% and 5.9% of patients with better prognosis such as luminal A and luminal B, respectively. Silencing, by methylation, of the promoter region of the ESR1 affects the expression of the estrogen receptor protein in tumors of breast cancer patients; high methylation of ESR1-DNA is associated with estrogen receptor negative status which, in turn, may be implicated in the patient’s resistance to hormonal treatment in breast cancer. As such, epigenetic markers in plasma may be of interest as new targets for anticancer therapy, especially with respect to endocrine treatment

  14. Workshop to promote the ratification of the protocol on heavy metals across the entire UN ECE region

    Energy Technology Data Exchange (ETDEWEB)

    NONE

    2009-12-15

    Within the workshop of the German Federal Environment Agency (Dessau-Rosslau, Federal Republic of Germany) at 14th to 16th May, 2008 in Yerevan (Armenia), the following lectures were held: (1) The convention and its protocols - framework and requirements (Tea Aulavuo); (2) Development of the heavy metals protocol up to now (D. Jost); (3) Experiences in transposing the obligations of the HM protocol into national law (Ivan Angelov); (4) Evaluation of concentrations of air pollutants and depositions of HM over the EECCA region (Ilia Ilyin); (5) The effectiveness of the HM protocol - emission reductions and costs (TNO-study) (M. van het Bolscher); (6) Technologies and techniques and their emission reduction potential and costs (Andre Peeters Weem); (7) Synergies of reduction of HM and particulate matter (Katja Kraus); (8) Critical loads / critical levels and effects of HM - integrated assessment (Jean-Paul Hettelingh); (9) Additional technical measures / options and their reduction potential (M. van het Bolscher); (10) Overview of the situation in the EECCA region - evaluation of a questionnaire of the Secretariat of the LRTAP Convention and ideas on revising the protocol and its annexes (Johan Sliggers); (11) Future aims of the TF (Katja Kraus).

  15. Y-12 Plant waste minimization strategy

    International Nuclear Information System (INIS)

    Kane, M.A.

    1987-01-01

    The 1984 Amendments to the Resource Conservation and Recovery Act (RCRA) mandate that waste minimization be a major element of hazardous waste management. In response to this mandate and the increasing costs for waste treatment, storage, and disposal, the Oak Ridge Y-12 Plant developed a waste minimization program to encompass all types of wastes. Thus, waste minimization has become an integral part of the overall waste management program. Unlike traditional approaches, waste minimization focuses on controlling waste at the beginning of production instead of the end. This approach includes: (1) substituting nonhazardous process materials for hazardous ones, (2) recycling or reusing waste effluents, (3) segregating nonhazardous waste from hazardous and radioactive waste, and (4) modifying processes to generate less waste or less toxic waste. An effective waste minimization program must provide the appropriate incentives for generators to reduce their waste and provide the necessary support mechanisms to identify opportunities for waste minimization. This presentation focuses on the Y-12 Plant's strategy to implement a comprehensive waste minimization program. This approach consists of four major program elements: (1) promotional campaign, (2) process evaluation for waste minimization opportunities, (3) waste generation tracking system, and (4) information exchange network. The presentation also examines some of the accomplishments of the program and issues which need to be resolved

  16. Waste Minimization Measurement and Progress Reporting

    International Nuclear Information System (INIS)

    Stone, K.A.

    1995-01-01

    Westinghouse Savannah River Company is implementing productivity improvement concepts into the Waste Minimization Program by focusing on the positive initiatives taken to reduce waste generation at the Savannah River Site. Previous performance measures, based only on waste generation rates, proved to be an ineffective metric for measuring performance and promoting continuous improvements within the Program. Impacts of mission changes and non-routine operations impeded development of baseline waste generation rates and often negated waste generation trending reports. A system was developed to quantify, document and track innovative activities that impact waste volume and radioactivity/toxicity reductions. This system coupled with Management-driven waste disposal avoidance goals is proving to be a powerful tool to promote waste minimization awareness and the implementation of waste reduction initiatives. Measurement of waste not generated, in addition to waste generated, increases the credibility of the Waste Minimization Program, improves sharing of success stories, and supports development of regulatory and management reports

  17. Effects of changes in Italian bioenergy promotion schemes for agricultural biogas projects: Insights from a regional optimization model

    International Nuclear Information System (INIS)

    Chinese, D.; Patrizio, P.; Nardin, G.

    2014-01-01

    Italy has witnessed an extraordinary growth in biogas generation from livestock effluents and agricultural activities in the last few years as well as a severe isomorphic process, leading to a market dominance of 999 kW power plants owned by “entrepreneurial farms”. Under the pressure of the economic crisis in the country, the Italian government has restructured renewable energy support schemes, introducing a new program in 2013. In this paper, the effects of the previous and current support schemes on the optimal plant size, feedstock mix and profitability were investigated by introducing a spatially explicit biogas supply chain optimization model, which accounts for different incentive structures. By applying the model to a regional case study, homogenization observed to date is recognized as a result of former incentive structures. Considerable reductions in local economic potentials for agricultural biogas power plants without external heat use, are estimated. New plants are likely to be manure-based and due to the lower energy density of such feedstock, wider supply chains are expected although optimal plant size will be smaller. The new support scheme will therefore most likely eliminate past distortions but also slow down investments in agricultural biogas plants. - Highlights: • We review the evolution of agricultural biogas support schemes in Italy over last 20 years. • A biogas supply chain optimization model which accounts for feed-in-tariffs is introduced. • The model is applied to a regional case study under the two most recent support schemes. • Incentives in force until 2013 caused homogenization towards maize based 999 kW el plants. • Wider, manure based supply chains feeding smaller plants are expected with future incentives

  18. Control of growth promotion (CGP) and screening for malnutrition in central region and Lomé-Commune, January to June 2013 Togo

    International Nuclear Information System (INIS)

    Touglo, Adavi Lonlon; Bouraima, Mouawiyatou; Agbozouhoue, A. Eya; Bebou, Midassirou; Tchapo, Dapou; Akolly, Koffi

    2014-01-01

    Full text: Background: Control of Growth Promotion (CGP) is an activity that can detect early if the child has a developmental problem and investigate the cause and take appropriate decisions to overcome the consequences. In Togo, the goal in 2013 is to weigh at least 80 % of children 0-5 years during the sessions of CGP. What are the levels achieved this goal after the first semester and the problems of malnutrition detected? Method: We conducted a descriptive cross-sectional study data collected in the quarterly reports in two regions of Togo, Lomé - Commune in the South and Central Region in the North. The study involved data from the first semester of 2013 in all districts of the two regions. Database monitoring activities at national level CGP was used. Data from the two regions were separated and analyzed using Excel. Comparison tests of proportions were made using Epi Info 7. Results: Detection rate of nutritional status by the CGP in the first half of 2013 was 29% of the total target of 155,423 children under 5 years in the two regions. This rate was higher for the Central region (33 %) than for Lomé-Commune (26 %). No district has reached half of the goals. Their rates vary from 17.9 % and 18 % respectively for District No. 2 and District No. 4 of Lomé-Commune to 39.7% for the District of Tchaoudjo. The malnutrition rate was 8.8 %. This rate is higher in the Central region (10.9 %) than in Lomé-Commune (6.8 %) with a RR = 1.59, 95% CI = [1.50 to 1.69]. Severe malnutrition was 1.4 %. It is predominant in Lomé-commune (1.7 %) than in the Central region (1.1%) with a RR = 1.55, 95% CI = [1.32 to 1.82]. Conclusion: All districts in the two regions are below the target detection rate in the first half. The CGP has detected cases of moderate and severe malnutrition. To compare that rates with the survey data, the screening tools must be standard and adequate. (author)

  19. C-terminal region of MAP7 domain containing protein 3 (MAP7D3 promotes microtubule polymerization by binding at the C-terminal tail of tubulin.

    Directory of Open Access Journals (Sweden)

    Saroj Yadav

    Full Text Available MAP7 domain containing protein 3 (MAP7D3, a newly identified microtubule associated protein, has been shown to promote microtubule assembly and stability. Its microtubule binding region has been reported to consist of two coiled coil motifs located at the N-terminus. It possesses a MAP7 domain near the C-terminus and belongs to the microtubule associated protein 7 (MAP7 family. The MAP7 domain of MAP7 protein has been shown to bind to kinesin-1; however, the role of MAP7 domain in MAP7D3 remains unknown. Based on the bioinformatics analysis of MAP7D3, we hypothesized that the MAP7 domain of MAP7D3 may have microtubule binding activity. Indeed, we found that MAP7 domain of MAP7D3 bound to microtubules as well as enhanced the assembly of microtubules in vitro. Interestingly, a longer fragment MDCT that contained the MAP7 domain (MD with the C-terminal tail (CT of the protein promoted microtubule polymerization to a greater extent than MD and CT individually. MDCT stabilized microtubules against dilution induced disassembly. MDCT bound to reconstituted microtubules with an apparent dissociation constant of 3.0 ± 0.5 µM. An immunostaining experiment showed that MDCT localized along the length of the preassembled microtubules. Competition experiments with tau indicated that MDCT shares its binding site on microtubules with tau. Further, we present evidence indicating that MDCT binds to the C-terminal tail of tubulin. In addition, MDCT could bind to tubulin in HeLa cell extract. Here, we report a microtubule binding region in the C-terminal region of MAP7D3 that may have a role in regulating microtubule assembly dynamics.

  20. Waste minimization assessment procedure

    International Nuclear Information System (INIS)

    Kellythorne, L.L.

    1993-01-01

    Perry Nuclear Power Plant began developing a waste minimization plan early in 1991. In March of 1991 the plan was documented following a similar format to that described in the EPA Waste Minimization Opportunity Assessment Manual. Initial implementation involved obtaining management's commitment to support a waste minimization effort. The primary assessment goal was to identify all hazardous waste streams and to evaluate those streams for minimization opportunities. As implementation of the plan proceeded, non-hazardous waste streams routinely generated in large volumes were also evaluated for minimization opportunities. The next step included collection of process and facility data which would be useful in helping the facility accomplish its assessment goals. This paper describes the resources that were used and which were most valuable in identifying both the hazardous and non-hazardous waste streams that existed on site. For each material identified as a waste stream, additional information regarding the materials use, manufacturer, EPA hazardous waste number and DOT hazard class was also gathered. Once waste streams were evaluated for potential source reduction, recycling, re-use, re-sale, or burning for heat recovery, with disposal as the last viable alternative

  1. Down-regulation of human topoisomerase IIα expression correlates with relative amounts of specificity factors Sp1 and Sp3 bound at proximal and distal promoter regions

    Directory of Open Access Journals (Sweden)

    Isaacs Richard J

    2007-05-01

    Full Text Available Abstract Background Topoisomerase IIα has been shown to be down-regulated in doxorubicin-resistant cell lines. The specificity proteins Sp1 and Sp3 have been implicated in regulation of topoisomerase IIα transcription, although the mechanism by which they regulate expression is not fully understood. Sp1 has been shown to bind specifically to both proximal and distal GC elements of the human topoisomerase IIα promoter in vitro, while Sp3 binds only to the distal GC element unless additional flanking sequences are included. While Sp1 is thought to be an activator of human topoisomerase IIα, the functional significance of Sp3 binding is not known. Therefore, we sought to determine the functional relationship between Sp1 and Sp3 binding to the topoisomerase IIα promoter in vivo. We investigated endogenous levels of Sp1, Sp3 and topoisomerase IIα as well as binding of both Sp1 and Sp3 to the GC boxes of the topoisomerase IIα promoter in breast cancer cell lines in vivo after short term doxorubicin exposure. Results Functional effects of Sp1 and Sp3 were studied using transient cotransfection assays using a topoisomerase IIα promoter reporter construct. The in vivo interactions of Sp1 and Sp3 with the GC elements of the topoisomerase IIα promoter were studied in doxorubicin-treated breast cancer cell lines using chromatin immunoprecipitation assays. Relative amounts of endogenous proteins were measured using immunoblotting. In vivo DNA looping mediated by proteins bound at the GC1 and GC2 elements was studied using the chromatin conformation capture assay. Both Sp1 and Sp3 bound to the GC1 and GC2 regions. Sp1 and Sp3 were transcriptional activators and repressors respectively, with Sp3 repression being dominant over Sp1-mediated activation. The GC1 and GC2 elements are linked in vivo to form a loop, thus bringing distal regulatory elements and their cognate transcription factors into close proximity with the transcription start site

  2. Methylation in the promoter regions of WT1, NKX6-1 and DBC1 genes in cervical cancer tissues of Uygur women in Xinjiang

    Directory of Open Access Journals (Sweden)

    Dan Wu

    Full Text Available Abstract This study aimed to explore: 1 DNA methylation in the promoter regions of Wilms tumor gene 1 (WT1, NK6 transcription factor related locus 1 gene (NKX6-1 and Deleted in bladder cancer 1 (DBC1 gene in cervical cancer tissues of Uygur women in Xinjiang, and 2 the correlation of gene methylation with the infection of HPV16/18 viruses. We detected HPV16/18 infection in 43 normal cervical tissues, 30 cervical intraepithelial neoplasia lesions (CIN and 48 cervical cancer tissues with polymerase chain reaction (PCR method. Methylation in the promoter regions of the WT1, NKX6-1 and DBC1 genes in the above-mentioned tissues was measured by methylation-specific PCR (MSP and cloning sequencing. The expression level of these three genes was measured by real-time PCR (qPCR in 10 methylation-positive cervical cancer tissues and 10 methylation-negative normal cervical tissues. We found that the infection of HPV16 in normal cervical tissues, CIN and cervical cancer tissues was 14.0, 36.7 and 66.7%, respectively. The infection of HPV18 was 0, 6.7 and 10.4%, respectively. The methylation rates of WT1, NKX6-1 and DBC1 genes were 7.0, 11.6 and 23.3% in normal cervical tissues, 36.7, 46.7 and 30.0% in CIN tissues, and 89.6, 77.1 and 85.4% in cervical cancer tissues. Furthermore, WT1, NKX6-1 and DBC1 genes were hypermethylated in the high-grade squamous intraepithelial lesion (CIN2, CIN3 and in the cervical cancer tissues with infection of HPV16/18 (both P< 0.05. The expression of WT1, NKX6-1 and DBC1 was significantly lower in the methylation-positive cervical cancer tissues than in methylation-negative normal cervical tissues. Our findings indicated that methylation in the promoter regions of WT1, NKX6-1 and DBC1 is correlated with cervical cancer tumorigenesis in Uygur women. The infection of HPV16/18 might be correlated with methylation in these genes. Gene inactivation caused by methylation might be related to the incidence and development of cervical

  3. Minimal quantization and confinement

    International Nuclear Information System (INIS)

    Ilieva, N.P.; Kalinowskij, Yu.L.; Nguyen Suan Han; Pervushin, V.N.

    1987-01-01

    A ''minimal'' version of the Hamiltonian quantization based on the explicit solution of the Gauss equation and on the gauge-invariance principle is considered. By the example of the one-particle Green function we show that the requirement for gauge invariance leads to relativistic covariance of the theory and to more proper definition of the Faddeev - Popov integral that does not depend on the gauge choice. The ''minimal'' quantization is applied to consider the gauge-ambiguity problem and a new topological mechanism of confinement

  4. Minimal Composite Inflation

    DEFF Research Database (Denmark)

    Channuie, Phongpichit; Jark Joergensen, Jakob; Sannino, Francesco

    2011-01-01

    We investigate models in which the inflaton emerges as a composite field of a four dimensional, strongly interacting and nonsupersymmetric gauge theory featuring purely fermionic matter. We show that it is possible to obtain successful inflation via non-minimal coupling to gravity, and that the u......We investigate models in which the inflaton emerges as a composite field of a four dimensional, strongly interacting and nonsupersymmetric gauge theory featuring purely fermionic matter. We show that it is possible to obtain successful inflation via non-minimal coupling to gravity...

  5. Minimalism and Speakers’ Intuitions

    Directory of Open Access Journals (Sweden)

    Matías Gariazzo

    2011-08-01

    Full Text Available Minimalism proposes a semantics that does not account for speakers’ intuitions about the truth conditions of a range of sentences or utterances. Thus, a challenge for this view is to offer an explanation of how its assignment of semantic contents to these sentences is grounded in their use. Such an account was mainly offered by Soames, but also suggested by Cappelen and Lepore. The article criticizes this explanation by presenting four kinds of counterexamples to it, and arrives at the conclusion that minimalism has not successfully answered the above-mentioned challenge.

  6. Minimal open strings

    International Nuclear Information System (INIS)

    Hosomichi, Kazuo

    2008-01-01

    We study FZZT-branes and open string amplitudes in (p, q) minimal string theory. We focus on the simplest boundary changing operators in two-matrix models, and identify the corresponding operators in worldsheet theory through the comparison of amplitudes. Along the way, we find a novel linear relation among FZZT boundary states in minimal string theory. We also show that the boundary ground ring is realized on physical open string operators in a very simple manner, and discuss its use for perturbative computation of higher open string amplitudes.

  7. The OSMATER project: promotion of stone materials from the Verbano-Cusio-Ossola region (Italy) and the Canton Ticino (Switzerland).

    Science.gov (United States)

    Cavallo, Alessandro; Antonella Dino, Giovanna

    2013-04-01

    The OSMATER (sub-Alpine Observatory Materials Territory Restoration) project, funded by the Piedmont Region (Italy) and the European Community, involved four Italian scientific bodies (Polytechnic of Turin, University of Turin, University of Milan-Bicocca, University of Bologna) and Switzerland (SUPSI). The aim was to investigate the present and historical quarrying and processing activities in the cross-border area between the Ossola Valley (Italy) and the Canton Ticino (Switzerland), and the use of dimension stones in local and national architecture. These materials are in many ways a "unique case", for their abundance and lithological variety. In the past, their extraction, processing and application characterized in a decisive way the architectural and constructive culture, both in terms of prestigious architecture and civil buildings, establishing a relationship between "stones and culture", "territory and its resources". In recent years, many of these traditions are losing importance and interest: this results in a loss of knowledge and historical memory, due mainly to the drastic changes in the market. The loss of this knowledge is likely to become irreversible in the short term, with the disappearance of people and social groups depositary of tradition. We can deduce that the creation of an "observatory", like OSMATER, is desirable and essential indeed, if we want to preserve the historical memory of the stone industry of an entire production area. The OSMATER project aimed the knowledge, recovery and enhancement of the architectural and cultural heritage of the cross-border area, through the census and classification of rocks, quarries (both active and historical - since Roman age), monuments and construction techniques typical of the sub-Alpine region, in order to create a documentation centre through a dedicated website. The first phase of the project was devoted to the identification of architectural works built with stone materials, with particular

  8. Eukaryotic elongation factor 1-beta interacts with the 5' untranslated region of the M gene of Nipah virus to promote mRNA translation.

    Science.gov (United States)

    Uchida, Shotaro; Sato, Hiroki; Yoneda, Misako; Kai, Chieko

    2016-09-01

    Nipah virus belongs to the genus Henipavirus in the family Paramyxoviridae, and its RNA genome is larger than those of other paramyxoviruses because it has long untranslated regions (UTRs) in each gene. However, the functions of these UTRs are not fully understood. In this study, we investigated the functions of the 5' UTRs and found that the 5' UTR of the M gene upregulated the translation of a reporter gene. Using an RNA pull-down assay, we showed that eukaryotic elongation factor 1-beta (EEF1B2) interacts with nucleotides 81-100 of the M 5' UTR and specifically enhances its translation efficiency. Our results suggest that the M 5' UTR promotes the production of M protein and viral budding by recruiting EEF1B2.

  9. Factor H binds to the hypervariable region of many Streptococcus pyogenes M proteins but does not promote phagocytosis resistance or acute virulence

    DEFF Research Database (Denmark)

    Gustafsson, Caj Ulrik Mattias; Lannergård, Jonas; Nilsson, Olof Rickard

    2013-01-01

    Many pathogens express a surface protein that binds the human complement regulator factor H (FH), as first described for Streptococcus pyogenes and the antiphagocytic M6 protein. It is commonly assumed that FH recruited to an M protein enhances virulence by protecting the bacteria against...... represents a distinct ligand-binding domain. The isolated HVRs specifically interacted with FH among all human serum proteins, interacted with the same region in FH and showed species specificity, but exhibited little or no antigenic cross-reactivity. Although these findings suggested that FH recruited...... to an M protein promotes virulence, studies in transgenic mice did not demonstrate a role for bound FH during acute infection. Moreover, phagocytosis tests indicated that ability to bind FH is neither sufficient nor necessary for S. pyogenes to resist killing in whole human blood. While these data shed...

  10. Imperial Tax System and Regional Development in the Eighteenth Century. The Monopoly of Tobacco as a Means for Economic Promotion in Louisiana

    Directory of Open Access Journals (Sweden)

    Laura Náter

    2004-07-01

    Full Text Available This paper analyzes Spain's Eighteenth-century tobacco policies in Louisiana, where it created a fiscal institution for mainly political reasons, subordinating economical yields and revenues to the  region's political  and  strategic needs.  This  case contrasts with the management  and exploitation of the same institution in other  Spanish colonial  properties,  which  also held monopolies of different products, including tobacco.  This study  shows that the tobacco monopoly was during the Eighteenth-century one of the Real Hacienda's favorite fiscal instruments for increasing revenues with which to promote economic development in certain colonies. The author's main conclusions refer to the mechanisms  through which the Real Hacienda de la Nueva  España used tobacco revenues to strengthen the economy of Louisiana.

  11. Minimal model holography

    International Nuclear Information System (INIS)

    Gaberdiel, Matthias R; Gopakumar, Rajesh

    2013-01-01

    We review the duality relating 2D W N minimal model conformal field theories, in a large-N ’t Hooft like limit, to higher spin gravitational theories on AdS 3 . This article is part of a special issue of Journal of Physics A: Mathematical and Theoretical devoted to ‘Higher spin theories and holography’. (review)

  12. Minimal constrained supergravity

    Energy Technology Data Exchange (ETDEWEB)

    Cribiori, N. [Dipartimento di Fisica e Astronomia “Galileo Galilei”, Università di Padova, Via Marzolo 8, 35131 Padova (Italy); INFN, Sezione di Padova, Via Marzolo 8, 35131 Padova (Italy); Dall' Agata, G., E-mail: dallagat@pd.infn.it [Dipartimento di Fisica e Astronomia “Galileo Galilei”, Università di Padova, Via Marzolo 8, 35131 Padova (Italy); INFN, Sezione di Padova, Via Marzolo 8, 35131 Padova (Italy); Farakos, F. [Dipartimento di Fisica e Astronomia “Galileo Galilei”, Università di Padova, Via Marzolo 8, 35131 Padova (Italy); INFN, Sezione di Padova, Via Marzolo 8, 35131 Padova (Italy); Porrati, M. [Center for Cosmology and Particle Physics, Department of Physics, New York University, 4 Washington Place, New York, NY 10003 (United States)

    2017-01-10

    We describe minimal supergravity models where supersymmetry is non-linearly realized via constrained superfields. We show that the resulting actions differ from the so called “de Sitter” supergravities because we consider constraints eliminating directly the auxiliary fields of the gravity multiplet.

  13. Hazardous waste minimization

    International Nuclear Information System (INIS)

    Freeman, H.

    1990-01-01

    This book presents an overview of waste minimization. Covers applications of technology to waste reduction, techniques for implementing programs, incorporation of programs into R and D, strategies for private industry and the public sector, and case studies of programs already in effect

  14. Minimally invasive distal pancreatectomy

    NARCIS (Netherlands)

    Røsok, Bård I.; de Rooij, Thijs; van Hilst, Jony; Diener, Markus K.; Allen, Peter J.; Vollmer, Charles M.; Kooby, David A.; Shrikhande, Shailesh V.; Asbun, Horacio J.; Barkun, Jeffrey; Besselink, Marc G.; Boggi, Ugo; Conlon, Kevin; Han, Ho Seong; Hansen, Paul; Kendrick, Michael L.; Kooby, David; Montagnini, Andre L.; Palanivelu, Chinnasamy; Wakabayashi, Go; Zeh, Herbert J.

    2017-01-01

    The first International conference on Minimally Invasive Pancreas Resection was arranged in conjunction with the annual meeting of the International Hepato-Pancreato-Biliary Association (IHPBA), in Sao Paulo, Brazil on April 19th 2016. The presented evidence and outcomes resulting from the session

  15. Minimal DBM Substraction

    DEFF Research Database (Denmark)

    David, Alexandre; Håkansson, John; G. Larsen, Kim

    In this paper we present an algorithm to compute DBM substractions with a guaranteed minimal number of splits and disjoint DBMs to avoid any redundance. The substraction is one of the few operations that result in a non-convex zone, and thus, requires splitting. It is of prime importance to reduce...

  16. Minimal constrained supergravity

    Directory of Open Access Journals (Sweden)

    N. Cribiori

    2017-01-01

    Full Text Available We describe minimal supergravity models where supersymmetry is non-linearly realized via constrained superfields. We show that the resulting actions differ from the so called “de Sitter” supergravities because we consider constraints eliminating directly the auxiliary fields of the gravity multiplet.

  17. Minimal constrained supergravity

    International Nuclear Information System (INIS)

    Cribiori, N.; Dall'Agata, G.; Farakos, F.; Porrati, M.

    2017-01-01

    We describe minimal supergravity models where supersymmetry is non-linearly realized via constrained superfields. We show that the resulting actions differ from the so called “de Sitter” supergravities because we consider constraints eliminating directly the auxiliary fields of the gravity multiplet.

  18. A Specific Mutation in the Promoter Region of the Silent cel Cluster Accounts for the Appearance of Lactose-Utilizing Lactococcus lactis MG1363

    Science.gov (United States)

    Solopova, Ana; Bachmann, Herwig; Teusink, Bas; Kok, Jan; Neves, Ana Rute

    2012-01-01

    The Lactococcus lactis laboratory strain MG1363 has been described to be unable to utilize lactose. However, in a rich medium supplemented with lactose as the sole carbon source, it starts to grow after prolonged incubation periods. Transcriptome analyses showed that L. lactis MG1363 Lac+ cells expressed celB, encoding a putative cellobiose-specific phosphotransferase system (PTS) IIC component, which is normally silent in MG1363 Lac− cells. Nucleotide sequence analysis of the cel cluster of a Lac+ isolate revealed a change from one of the guanines to adenine in the promoter region. We showed here that one particular mutation, taking place at increased frequency, accounts for the lactose-utilizing phenotype occurring in MG1363 cultures. The G-to-A transition creates a −10 element at an optimal distance from the −35 element. Thus, a fully active promoter is created, allowing transcription of the otherwise cryptic cluster. Nuclear magnetic resonance (NMR) spectroscopy results show that MG1363 Lac+ uses a novel pathway of lactose utilization. PMID:22660716

  19. Characterization of the bovine pregnancy-associated glycoprotein gene family – analysis of gene sequences, regulatory regions within the promoter and expression of selected genes

    Directory of Open Access Journals (Sweden)

    Walker Angela M

    2009-04-01

    Full Text Available Abstract Background The Pregnancy-associated glycoproteins (PAGs belong to a large family of aspartic peptidases expressed exclusively in the placenta of species in the Artiodactyla order. In cattle, the PAG gene family is comprised of at least 22 transcribed genes, as well as some variants. Phylogenetic analyses have shown that the PAG family segregates into 'ancient' and 'modern' groupings. Along with sequence differences between family members, there are clear distinctions in their spatio-temporal distribution and in their relative level of expression. In this report, 1 we performed an in silico analysis of the bovine genome to further characterize the PAG gene family, 2 we scrutinized proximal promoter sequences of the PAG genes to evaluate the evolution pressures operating on them and to identify putative regulatory regions, 3 we determined relative transcript abundance of selected PAGs during pregnancy and, 4 we performed preliminary characterization of the putative regulatory elements for one of the candidate PAGs, bovine (bo PAG-2. Results From our analysis of the bovine genome, we identified 18 distinct PAG genes and 14 pseudogenes. We observed that the first 500 base pairs upstream of the translational start site contained multiple regions that are conserved among all boPAGs. However, a preponderance of conserved regions, that harbor recognition sites for putative transcriptional factors (TFs, were found to be unique to the modern boPAG grouping, but not the ancient boPAGs. We gathered evidence by means of Q-PCR and screening of EST databases to show that boPAG-2 is the most abundant of all boPAG transcripts. Finally, we provided preliminary evidence for the role of ETS- and DDVL-related TFs in the regulation of the boPAG-2 gene. Conclusion PAGs represent a relatively large gene family in the bovine genome. The proximal promoter regions of these genes display differences in putative TF binding sites, likely contributing to observed

  20. Clinical significance of SNP (rs2596542 in histocompatibility complex class I-related gene A promoter region among hepatitis C virus related hepatocellular carcinoma cases

    Directory of Open Access Journals (Sweden)

    Amal A. Mohamed

    2017-07-01

    Full Text Available The major histocompatibility complex class I-related gene A (MICA is an antigen induced by stress and performs an integral role in immune responses as an anti-infectious and antitumor agent. This work was designed to investigate whether (SNP rs2596542C/T in MICA promoter region is predictive of liver cirrhosis (LC and hepatocellular carcinoma (HCC or not. Forty-seven healthy controls and 94 HCV-infected patients, subdivided into 47 LC and 47 HCC subjects were enrolled in this study. SNP association was studied using real time PCR and soluble serum MICA concentration was measured using ELISA. Results showed that heterozygous genotype rs2596542CT was significantly (P = 0.022 distributed between HCC and LC related CHC patients. The sMICA was significantly higher (P = 0.0001 among HCC and LC. No significant association (P = 0.56 between rs2596542CT genotypes and sMICA levels was observed. Studying SNP rs2596542C/T association with HCC and LC susceptibility revealed that statistical significant differences (P = 0.013, P = 0.027 were only observed between SNP rs2596542C/T and each of HCC and LC, respectively, versus healthy controls, indicating that the rs2596542C/T genetic variation is not a significant contributor to HCC development in LC patients. Moreover, the T allele was considered a risk factor for HCC and LC vulnerability in HCV patients (OR = 1.93 and 2.1, respectively, while the C allele contributes to decreasing HCC risk. Therefore, SNP (rs2596542C/T in MICA promoter region and sMICA levels might be potential useful markers in the assessment of liver disease progression to LC and HCC.

  1. Effect of metallothionein core promoter region polymorphism on cadmium, zinc and copper levels in autopsy kidney tissues from a Turkish population

    International Nuclear Information System (INIS)

    Kayaalti, Zeliha; Mergen, Goerkem; Soeylemezoglu, Tuelin

    2010-01-01

    Metallothioneins (MTs) are metal-binding, low molecular weight proteins and are involved in pathophysiological processes like metabolism of essential metals, metal ion homeostasis and detoxification of heavy metals. Metallothionein expression is induced by various heavy metals especially cadmium, mercury and zinc; MTs suppress toxicity of heavy metals by binding themselves to these metals. The aim of this study was to investigate the association between the - 5 A/G metallothionein 2A (MT2A) single nucleotide polymorphism (SNP) and Cd, Zn and Cu levels in the renal cortex from autopsy cases. MT2A core promoter region - 5 A/G SNP was analyzed by PCR-RFLP method using 114 autopsy kidney tissues and the genotype frequencies of this polymorphism were found as 87.7% homozygote typical (AA), 11.4% heterozygote (AG) and 0.9% homozygote atypical (GG). In order to assess the Cd, Zn and Cu levels in the same autopsy kidney tissues, a dual atomic absorption spectrophotometer system was used and the average levels of Cd, Zn and Cu were measured as 95.54 ± 65.58 μg/g, 181.20 ± 87.72 μg/g and 17.14 ± 16.28 μg/g, respectively. As a result, no statistical association was found between the - 5 A/G SNP in the MT2A gene and the Zn and Cu levels in the renal cortex (p > 0.05), but considerably high accumulation of Cd was monitored for individuals having AG (151.24 ± 60.21 μg/g) and GG genotypes (153.09 μg/g) compared with individuals having AA genotype (87.72 ± 62.98 μg/g) (p < 0.05). These results show that the core promoter region polymorphism of metallothionein 2A increases the accumulation of Cd in human renal cortex.

  2. Environmental stress affects DNA methylation of a CpG rich promoter region of serotonin transporter gene in a nurse cohort.

    Directory of Open Access Journals (Sweden)

    Jukka S Alasaari

    Full Text Available Shift-working nurses are exposed to a stressful work environment, which puts them at an increased risk for burnout and depression. We explored the effect of environmental stress on serotonin transporter gene (SLC6A4 promoter methylation among nurses from high and low work stress environments.Using bisulfite sequencing, we investigated the methylation status of five CpG residues of a CpG-rich region in the promoter of SLC6A4 by comparing female shift working nurses from a high work stress environment (n = 24 to low work stress environment (n = 25. We also analyzed the association of 5-HTTLPR polymorphism at 5' end of SLC6A4. Work stress was assessed by the Karasek's Model and possible signs of burnout or depression were measured by the Maslach Burnout Index General Survey and Beck Depression Index. Methylation levels were assessed by bisulfite sequencing of DNA extracted from peripheral blood leucocytes. Restriction enzyme treatment followed by standard PCR was used to identify 5-HTTLPR genotypes.We found that nurses in the high stress environment had significantly lower promoter methylation levels at all five CpG residues compared to nurses in the low stress environment (p<0.01. There was no significant interaction of 5-HTTLPR genotype and work stress with methylation (p = 0.58. In unadjusted (bivariate analysis, burnout was not significantly associated to methylation levels. However, when mutually adjusted for both, burnout and work stress were significant contributors (p = 0.038 and p<0.0001 respectively to methylation levels.Our findings show that environmental stress is concurrent with decreased methylation of the SLC6A4 promoter. This may lead to increased transcriptional activity of the gene, increased reuptake of serotonin from synaptic clefts, and termination of the activity of serotonin. This could present a possible coping mechanism for environmental stress in humans that could eventually increase risk for disturbed functional

  3. Minimal abdominal incisions

    Directory of Open Access Journals (Sweden)

    João Carlos Magi

    2017-04-01

    Full Text Available Minimally invasive procedures aim to resolve the disease with minimal trauma to the body, resulting in a rapid return to activities and in reductions of infection, complications, costs and pain. Minimally incised laparotomy, sometimes referred to as minilaparotomy, is an example of such minimally invasive procedures. The aim of this study is to demonstrate the feasibility and utility of laparotomy with minimal incision based on the literature and exemplifying with a case. The case in question describes reconstruction of the intestinal transit with the use of this incision. Male, young, HIV-positive patient in a late postoperative of ileotiflectomy, terminal ileostomy and closing of the ascending colon by an acute perforating abdomen, due to ileocolonic tuberculosis. The barium enema showed a proximal stump of the right colon near the ileostomy. The access to the cavity was made through the orifice resulting from the release of the stoma, with a lateral-lateral ileo-colonic anastomosis with a 25 mm circular stapler and manual closure of the ileal stump. These surgeries require their own tactics, such as rigor in the lysis of adhesions, tissue traction, and hemostasis, in addition to requiring surgeon dexterity – but without the need for investments in technology; moreover, the learning curve is reported as being lower than that for videolaparoscopy. Laparotomy with minimal incision should be considered as a valid and viable option in the treatment of surgical conditions. Resumo: Procedimentos minimamente invasivos visam resolver a doença com o mínimo de trauma ao organismo, resultando em retorno rápido às atividades, reduções nas infecções, complicações, custos e na dor. A laparotomia com incisão mínima, algumas vezes referida como minilaparotomia, é um exemplo desses procedimentos minimamente invasivos. O objetivo deste trabalho é demonstrar a viabilidade e utilidade das laparotomias com incisão mínima com base na literatura e

  4. Minimal Walking Technicolor

    DEFF Research Database (Denmark)

    Foadi, Roshan; Frandsen, Mads Toudal; A. Ryttov, T.

    2007-01-01

    Different theoretical and phenomenological aspects of the Minimal and Nonminimal Walking Technicolor theories have recently been studied. The goal here is to make the models ready for collider phenomenology. We do this by constructing the low energy effective theory containing scalars......, pseudoscalars, vector mesons and other fields predicted by the minimal walking theory. We construct their self-interactions and interactions with standard model fields. Using the Weinberg sum rules, opportunely modified to take into account the walking behavior of the underlying gauge theory, we find...... interesting relations for the spin-one spectrum. We derive the electroweak parameters using the newly constructed effective theory and compare the results with the underlying gauge theory. Our analysis is sufficiently general such that the resulting model can be used to represent a generic walking technicolor...

  5. Mycobacterium leprae specific genomic target in the promoter region of probable 4-alpha-glucanotransferase (ML1545) gene with potential sensitivity for polymerase chain reaction based diagnosis of leprosy.

    Science.gov (United States)

    Sundeep Chaitanya, V; Das, Madhusmita; Eisenbach, Tiffany L; Amoako, Angela; Rajan, Lakshmi; Horo, Ilse; Ebenezer, Mannam

    2016-06-01

    With the absence of an effective diagnostic tool for leprosy, cases with negative bacteriological index and limited clinical manifestations often pose diagnostic challenges. In this study, we investigated the utility of a novel Mycobacterium leprae specific 112-bp DNA sequence in the promoter region of probable 4-alpha-glucanotransferase (pseudogene, ML1545) for polymerase chain reaction (PCR) based diagnosis of leprosy in comparison to that of the RLEP gene. DNA was extracted from slit skin scrapings of 180 newly diagnosed untreated leprosy cases that were classified as per Ridley Jopling classifications and bacteriological index (BI). Primers were designed using Primer Blast 3.0 and PCR was performed with annealing temperatures of 61°C for ML1545 and 58°C for the RLEP gene using conventional gradient PCR. The results indicated a significant increase in PCR positivity of ML1545 when compared to RLEP across the study groups (164/180 [91.11%] were positive for ML1545 whereas 114/180 (63.33%) were positive for RLEP [pleprosy cases with negative BI, 28 (48.28%) were positive for RLEP and 48 (82.76%) were positive for ML1545 (p=.0001, z=3.8). Of the 42 borderline tuberculoid leprosy cases, 23 (54.76%) were positive for RLEP whereas 37 (88.09%) were positive for ML1545 (pleprosy and BI-positive groups. ML1545 can be a potential gene target for PCR-based diagnosis of leprosy especially in cases where clinical manifestations were minimal. Copyright © 2016 Asian-African Society for Mycobacteriology. Published by Elsevier Ltd. All rights reserved.

  6. Staphylococcus aureus RNAIII binds to two distant regions of coa mRNA to arrest translation and promote mRNA degradation.

    Directory of Open Access Journals (Sweden)

    Clément Chevalier

    2010-03-01

    Full Text Available Staphylococcus aureus RNAIII is the intracellular effector of the quorum sensing system that temporally controls a large number of virulence factors including exoproteins and cell-wall-associated proteins. Staphylocoagulase is one major virulence factor, which promotes clotting of human plasma. Like the major cell surface protein A, the expression of staphylocoagulase is strongly repressed by the quorum sensing system at the post-exponential growth phase. Here we used a combination of approaches in vivo and in vitro to analyze the mechanism used by RNAIII to regulate the expression of staphylocoagulase. Our data show that RNAIII represses the synthesis of the protein through a direct binding with the mRNA. Structure mapping shows that two distant regions of RNAIII interact with coa mRNA and that the mRNA harbors a conserved signature as found in other RNAIII-target mRNAs. The resulting complex is composed of an imperfect duplex masking the Shine-Dalgarno sequence of coa mRNA and of a loop-loop interaction occurring downstream in the coding region. The imperfect duplex is sufficient to prevent the formation of the ribosomal initiation complex and to repress the expression of a reporter gene in vivo. In addition, the double-strand-specific endoribonuclease III cleaves the two regions of the mRNA bound to RNAIII that may contribute to the degradation of the repressed mRNA. This study validates another direct target of RNAIII that plays a role in virulence. It also illustrates the diversity of RNAIII-mRNA topologies and how these multiple RNAIII-mRNA interactions would mediate virulence regulation.

  7. Integration Host Factor (IHF binds to the promoter region of the phtD operon involved in phaseolotoxin synthesis in P. syringae pv. phaseolicola NPS3121

    Directory of Open Access Journals (Sweden)

    Álvarez-Morales Ariel

    2011-05-01

    Full Text Available Abstract Background Pseudomonas syringae pv. phaseolicola, the causal agent of halo blight disease in beans, produces a toxin known as phaseolotoxin, in whose synthesis participate a group of genes organized within the genome in a region known as the "Pht cluster". This region, which is thought to have been acquired by horizontal gene transfer, includes 5 transcriptional units, two monocistronic (argK, phtL and three polycistronic (phtA, phtD, phtM, whose expression is temperature dependent. So far, the regulatory mechanisms involved in phaseolotoxin synthesis have not been elucidated and the only well-established fact is the requirement of low temperatures for its synthesis. In this work, we searched for regulatory proteins that could be involved in phaseolotoxin synthesis, focusing on the regulation of the phtD operon. Results In this study we identified the global regulator IHF (Integration Host Factor, which binds to the promoter region of the phtD operon, exerting a negative effect on the expression of this operon. This is the first regulatory protein identified as part of the phaseolotoxin synthesis system. Our findings suggest that the Pht cluster was similarly regulated in the ancestral cluster by IHF or similar protein, and integrated into the global regulatory mechanism of P. syringae pv. phaseolicola, after the horizontal gene transfer event by using the host IHF protein. Conclusion This study identifies the IHF protein as one element involved in the regulation of phaseolotoxin synthesis in P. syringae pv. phaseolicola NPS3121 and provides new insights into the regulatory mechanisms involved in phaseolotoxin production.

  8. A common polymorphism in the promoter region of the TNFSF4 gene is associated with lower allele-specific expression and risk of myocardial infarction.

    Directory of Open Access Journals (Sweden)

    Massimiliano Ria

    Full Text Available BACKGROUND: The TNFSF4/TNFRSF4 system, along with several other receptor-ligand pairs, is involved in the recruitment and activation of T-cells and is therefore tentatively implicated in atherosclerosis and acute coronary syndromes. We have previously shown that genetic variants in TNFSF4 are associated with myocardial infarction (MI in women. This prompted functional studies of TNFSF4 expression. METHODS AND RESULTS: Based on a screening of the TNFSF4 genomic region, a promoter polymorphism (rs45454293 and a haplotype were identified, conceivably involved in gene regulation. The rs45454293T-allele, in agreement with the linked rs3850641G-allele, proved to be associated with increased risk of MI in women. Haplotype-specific chromatin immunoprecipitation of activated polymerase II, as a measure of transcriptional activity in vivo, suggested that the haplotype including the rs45454293 and rs3850641 polymorphisms is functionally important, the rs45454293T- and rs3850641G-alleles being associated with lower transcriptional activity in cells heterozygous for both polymorphisms. The functional role of rs45454293 on transcriptional levels of TNFSF4 was clarified by luciferase reporter assays, where the rs45454293T-allele decreased gene expression when compared with the rs45454293C-allele, while the rs3850641 SNP did not have any effect on TNFSF4 promoter activity. Electromobility shift assay showed that the rs45454293 polymorphism, but not rs3850641, affects the binding of nuclear factors, thus suggesting that the lower transcriptional activity is attributed to binding of one or more transcriptional repressor(s to the T-allele. CONCLUSIONS: Our data indicate that the TNFSF4 rs45454293T-allele is associated with lower TNFSF4 expression and increased risk of MI.

  9. SRSF1-3 contributes to diversification of the immunoglobulin variable region gene by promoting accumulation of AID in the nucleus.

    Science.gov (United States)

    Kawaguchi, Yuka; Nariki, Hiroaki; Kawamoto, Naoko; Kanehiro, Yuichi; Miyazaki, Satoshi; Suzuki, Mari; Magari, Masaki; Tokumitsu, Hiroshi; Kanayama, Naoki

    2017-04-01

    Activation-induced cytidine deaminase (AID) is essential for diversification of the Ig variable region (IgV). AID is excluded from the nucleus, where it normally functions. However, the molecular mechanisms responsible for regulating AID localization remain to be elucidated. The SR-protein splicing factor SRSF1 is a nucleocytoplasmic shuttling protein, a splicing isoform of which called SRSF1-3, has previously been shown to contribute to IgV diversification in chicken DT40 cells. In this study, we examined whether SRSF1-3 functions in IgV diversification by promoting nuclear localization of AID. AID expressed alone was localized predominantly in the cytoplasm. In contrast, co-expression of AID with SRSF1-3 led to the nuclear accumulation of both AID and SRSF1-3 and the formation of a protein complex that contained them both, although SRSF1-3 was dispensable for nuclear import of AID. Expression of either SRSF1-3 or a C-terminally-truncated AID mutant increased IgV diversification in DT40 cells. However, overexpression of exogenous SRSF1-3 was unable to further enhance IgV diversification in DT40 cells expressing the truncated AID mutant, although SRSF1-3 was able to form a protein complex with the AID mutant. These results suggest that SRSF1-3 promotes nuclear localization of AID probably by forming a nuclear protein complex, which might stabilize nuclear AID and induce IgV diversification in an AID C-terminus-dependent manner. Copyright © 2017 Elsevier Inc. All rights reserved.

  10. Legal incentives for minimizing waste

    International Nuclear Information System (INIS)

    Clearwater, S.W.; Scanlon, J.M.

    1991-01-01

    Waste minimization, or pollution prevention, has become an integral component of federal and state environmental regulation. Minimizing waste offers many economic and public relations benefits. In addition, waste minimization efforts can also dramatically reduce potential criminal requirements. This paper addresses the legal incentives for minimizing waste under current and proposed environmental laws and regulations

  11. An Intergenic Region Shared by At4g35985 and At4g35987 in Arabidopsis thaliana Is a Tissue Specific and Stress Inducible Bidirectional Promoter Analyzed in Transgenic Arabidopsis and Tobacco Plants

    Science.gov (United States)

    Banerjee, Joydeep; Sahoo, Dipak Kumar; Dey, Nrisingha; Houtz, Robert L.; Maiti, Indu Bhushan

    2013-01-01

    On chromosome 4 in the Arabidopsis genome, two neighboring genes (calmodulin methyl transferase At4g35987 and senescence associated gene At4g35985) are located in a head-to-head divergent orientation sharing a putative bidirectional promoter. This 1258 bp intergenic region contains a number of environmental stress responsive and tissue specific cis-regulatory elements. Transcript analysis of At4g35985 and At4g35987 genes by quantitative real time PCR showed tissue specific and stress inducible expression profiles. We tested the bidirectional promoter-function of the intergenic region shared by the divergent genes At4g35985 and At4g35987 using two reporter genes (GFP and GUS) in both orientations in transient tobacco protoplast and Agro-infiltration assays, as well as in stably transformed transgenic Arabidopsis and tobacco plants. In transient assays with GFP and GUS reporter genes the At4g35985 promoter (P85) showed stronger expression (about 3.5 fold) compared to the At4g35987 promoter (P87). The tissue specific as well as stress responsive functional nature of the bidirectional promoter was evaluated in independent transgenic Arabidopsis and tobacco lines. Expression of P85 activity was detected in the midrib of leaves, leaf trichomes, apical meristemic regions, throughout the root, lateral roots and flowers. The expression of P87 was observed in leaf-tip, hydathodes, apical meristem, root tips, emerging lateral root tips, root stele region and in floral tissues. The bidirectional promoter in both orientations shows differential up-regulation (2.5 to 3 fold) under salt stress. Use of such regulatory elements of bidirectional promoters showing spatial and stress inducible promoter-functions in heterologous system might be an important tool for plant biotechnology and gene stacking applications. PMID:24260266

  12. An intergenic region shared by At4g35985 and At4g35987 in Arabidopsis thaliana is a tissue specific and stress inducible bidirectional promoter analyzed in transgenic arabidopsis and tobacco plants.

    Directory of Open Access Journals (Sweden)

    Joydeep Banerjee

    Full Text Available On chromosome 4 in the Arabidopsis genome, two neighboring genes (calmodulin methyl transferase At4g35987 and senescence associated gene At4g35985 are located in a head-to-head divergent orientation sharing a putative bidirectional promoter. This 1258 bp intergenic region contains a number of environmental stress responsive and tissue specific cis-regulatory elements. Transcript analysis of At4g35985 and At4g35987 genes by quantitative real time PCR showed tissue specific and stress inducible expression profiles. We tested the bidirectional promoter-function of the intergenic region shared by the divergent genes At4g35985 and At4g35987 using two reporter genes (GFP and GUS in both orientations in transient tobacco protoplast and Agro-infiltration assays, as well as in stably transformed transgenic Arabidopsis and tobacco plants. In transient assays with GFP and GUS reporter genes the At4g35985 promoter (P85 showed stronger expression (about 3.5 fold compared to the At4g35987 promoter (P87. The tissue specific as well as stress responsive functional nature of the bidirectional promoter was evaluated in independent transgenic Arabidopsis and tobacco lines. Expression of P85 activity was detected in the midrib of leaves, leaf trichomes, apical meristemic regions, throughout the root, lateral roots and flowers. The expression of P87 was observed in leaf-tip, hydathodes, apical meristem, root tips, emerging lateral root tips, root stele region and in floral tissues. The bidirectional promoter in both orientations shows differential up-regulation (2.5 to 3 fold under salt stress. Use of such regulatory elements of bidirectional promoters showing spatial and stress inducible promoter-functions in heterologous system might be an important tool for plant biotechnology and gene stacking applications.

  13. The ZOOM minimization package

    International Nuclear Information System (INIS)

    Fischler, Mark S.; Sachs, D.

    2004-01-01

    A new object-oriented Minimization package is available for distribution in the same manner as CLHEP. This package, designed for use in HEP applications, has all the capabilities of Minuit, but is a re-write from scratch, adhering to modern C++ design principles. A primary goal of this package is extensibility in several directions, so that its capabilities can be kept fresh with as little maintenance effort as possible. This package is distinguished by the priority that was assigned to C++ design issues, and the focus on producing an extensible system that will resist becoming obsolete

  14. Minimizing the Pacman effect

    International Nuclear Information System (INIS)

    Ritson, D.; Chou, W.

    1997-10-01

    The Pacman bunches will experience two deleterious effects: tune shift and orbit displacement. It is known that the tune shift can be compensated by arranging crossing planes 900 relative to each other at successive interaction points (lPs). This paper gives an analytical estimate of the Pacman orbit displacement for a single as well as for two crossings. For the latter, it can be minimized by using equal phase advances from one IP to another. In the LHC, this displacement is in any event small and can be neglected

  15. Minimally Invasive Parathyroidectomy

    Directory of Open Access Journals (Sweden)

    Lee F. Starker

    2011-01-01

    Full Text Available Minimally invasive parathyroidectomy (MIP is an operative approach for the treatment of primary hyperparathyroidism (pHPT. Currently, routine use of improved preoperative localization studies, cervical block anesthesia in the conscious patient, and intraoperative parathyroid hormone analyses aid in guiding surgical therapy. MIP requires less surgical dissection causing decreased trauma to tissues, can be performed safely in the ambulatory setting, and is at least as effective as standard cervical exploration. This paper reviews advances in preoperative localization, anesthetic techniques, and intraoperative management of patients undergoing MIP for the treatment of pHPT.

  16. The effect of metallothionein 2A core promoter region single-nucleotide polymorphism on accumulation of toxic metals in sinonasal inverted papilloma tissues

    Energy Technology Data Exchange (ETDEWEB)

    Starska, Katarzyna, E-mail: katarzyna.starska@umed.lodz.pl [I Department of Otolaryngology and Laryngological Oncology, Medical University of Łódź, Kopcinskiego 22, 90-153 Łódź (Poland); Bryś, Magdalena; Forma, Ewa [Department of Cytobiochemistry, University of Łódź, Pomorska 142/143, 90-236 Łódź (Poland); Olszewski, Jurek; Pietkiewicz, Piotr [II Department of Otolaryngology and Laryngological Oncology, Medical University of Łódź, Żeromskiego 113, 90-549 Łódź (Poland); Lewy-Trenda, Iwona; Danilewicz, Marian [Department of Pathology, Medical University of Łódź, Pomorska 251, 92-213 Łódź (Poland); Krześlak, Anna [Department of Cytobiochemistry, University of Łódź, Pomorska 142/143, 90-236 Łódź (Poland)

    2015-06-15

    Metallothioneins (MTs) are intracellular thiol-rich heavy metal-binding proteins which join trace metal ions protecting cells against heavy metal toxicity and regulate metal distribution and donation to various enzymes and transcription factors. The goal of this study was to identify the − 5 A/G (rs28366003) single-nucleotide polymorphism (SNP) in the core promoter region of the MT2A gene, and to investigate its effect on allele-specific gene expression and Cd, Zn, Cu and Ni content in sinonasal inverted papilloma tissue (IP), with non-cancerous sinonasal mucosa (NCM) as a control. The MT2A promoter region − 5 A/G SNP was identified by restriction fragment length polymorphism using 117 IP and 132 NCM. MT2A gene analysis was performed by quantitative real-time PCR. Metal levels were analyzed by flame atomic absorption spectrometry. The frequency of A allele carriage was 99.2% and 100% in IP and NCM, respectively. The G allele carriage was detected in 23.9% of IP and in 12.1% of the NCM samples. As a result, a significant association of − 5 A/G SNP in MT2A gene with mRNA expression in both groups was determined. A significant association was identified between the − 5 A/G SNP in the MT2A gene with mRNA expression in both groups. A highly significant association was detected between the rs28366003 genotype and Cd and Zn content in IP. Furthermore, significant differences were identified between A/A and A/G genotype with regard to the type of metal contaminant. The Spearman rank correlation results showed the MT2A gene expression and both Cd and Cu levels were negatively correlated. The results obtained in this study suggest that the − 5 A/G SNP in the MT2A gene may have an effect on allele-specific gene expression and toxic metal accumulation in sinonasal inverted papilloma. - Highlights: • MT2A gene expression and metal content in sinonasal inverted papilloma tissues • Association between SNP (rs28366003) and expression of MT2A • Significant

  17. Polymorphisms in the presumptive promoter region of the SLC2A9 gene are associated with gout in a Chinese male population.

    Science.gov (United States)

    Li, Changgui; Chu, Nan; Wang, Binbin; Wang, Jing; Luan, Jian; Han, Lin; Meng, Dongmei; Wang, Yunlong; Suo, Peisu; Cheng, Longfei; Ma, Xu; Miao, Zhimin; Liu, Shiguo

    2012-01-01

    Glucose transporter 9 (GLUT9) is a high-capacity/low-affinity urate transporter. To date, several recent genome-wide association studies (GWAS) and follow-up studies have identified genetic variants of SLC2A9 associated with urate concentrations and susceptibility to gout. We therefore investigated associations between gout and polymorphisms and haplotypes in the presumptive promoter region of GLUT9 in Chinese males. The approximately 2000 bp presumptive promoter region upstream of the start site of exon 1 of GLUT9 was sequenced and subjected to genetic analysis. A genotype-phenotype correlation was performed and polymorphisms-induced changes in transcription factor binding sites were predicted. Of 21 SNPs identified in GLUT9, five had not been previously reported. Two of the SNPs (rs13124007 and rs6850166) were associated with susceptibility to gout (p = 0.009 and p = 0.042, respectively). The C allele of rs13124007 appeared to be the risk allele for predisposition to gout (p = 0.006, OR 1.709 [95% CI 1.162-2.514]). For rs6850166, an increased risk of gout was associated with the A allele (p = 0.029, OR 1.645 [95% CI 1.050-2.577]). After Bonferroni correction, there was statistically difference in rs13124007 allele frequencies between gout cases and controls (P = 0.042). Haplotype analyses showed that haplotype GG was a protective haplotype (p = 0.0053) and haplotype CA was associated with increased risk of gout (p = 0.0326). Genotype-phenotype analysis among gout patients revealed an association of rs13124007 with serum triglycerides levels (P = 0.001). The C to G substitution in polymorphism rs13124007 resulted in a loss of a binding site for transcription factor interferon regulatory factor 1 (IRF-1). Polymorphisms rs13124007 and rs6850166 are associated with susceptibility to gout in Chinese males.

  18. Factor H Binds to the Hypervariable Region of Many Streptococcus pyogenes M Proteins but Does Not Promote Phagocytosis Resistance or Acute Virulence

    Science.gov (United States)

    Kristensen, Bodil M.; Olsen, John E.; Harris, Claire L.; Ufret-Vincenty, Rafael L.; Stålhammar-Carlemalm, Margaretha; Lindahl, Gunnar

    2013-01-01

    Many pathogens express a surface protein that binds the human complement regulator factor H (FH), as first described for Streptococcus pyogenes and the antiphagocytic M6 protein. It is commonly assumed that FH recruited to an M protein enhances virulence by protecting the bacteria against complement deposition and phagocytosis, but the role of FH-binding in S. pyogenes pathogenesis has remained unclear and controversial. Here, we studied seven purified M proteins for ability to bind FH and found that FH binds to the M5, M6 and M18 proteins but not the M1, M3, M4 and M22 proteins. Extensive immunochemical analysis indicated that FH binds solely to the hypervariable region (HVR) of an M protein, suggesting that selection has favored the ability of certain HVRs to bind FH. These FH-binding HVRs could be studied as isolated polypeptides that retain ability to bind FH, implying that an FH-binding HVR represents a distinct ligand-binding domain. The isolated HVRs specifically interacted with FH among all human serum proteins, interacted with the same region in FH and showed species specificity, but exhibited little or no antigenic cross-reactivity. Although these findings suggested that FH recruited to an M protein promotes virulence, studies in transgenic mice did not demonstrate a role for bound FH during acute infection. Moreover, phagocytosis tests indicated that ability to bind FH is neither sufficient nor necessary for S. pyogenes to resist killing in whole human blood. While these data shed new light on the HVR of M proteins, they suggest that FH-binding may affect S. pyogenes virulence by mechanisms not assessed in currently used model systems. PMID:23637608

  19. Factor H binds to the hypervariable region of many Streptococcus pyogenes M proteins but does not promote phagocytosis resistance or acute virulence.

    Directory of Open Access Journals (Sweden)

    Mattias C U Gustafsson

    Full Text Available Many pathogens express a surface protein that binds the human complement regulator factor H (FH, as first described for Streptococcus pyogenes and the antiphagocytic M6 protein. It is commonly assumed that FH recruited to an M protein enhances virulence by protecting the bacteria against complement deposition and phagocytosis, but the role of FH-binding in S. pyogenes pathogenesis has remained unclear and controversial. Here, we studied seven purified M proteins for ability to bind FH and found that FH binds to the M5, M6 and M18 proteins but not the M1, M3, M4 and M22 proteins. Extensive immunochemical analysis indicated that FH binds solely to the hypervariable region (HVR of an M protein, suggesting that selection has favored the ability of certain HVRs to bind FH. These FH-binding HVRs could be studied as isolated polypeptides that retain ability to bind FH, implying that an FH-binding HVR represents a distinct ligand-binding domain. The isolated HVRs specifically interacted with FH among all human serum proteins, interacted with the same region in FH and showed species specificity, but exhibited little or no antigenic cross-reactivity. Although these findings suggested that FH recruited to an M protein promotes virulence, studies in transgenic mice did not demonstrate a role for bound FH during acute infection. Moreover, phagocytosis tests indicated that ability to bind FH is neither sufficient nor necessary for S. pyogenes to resist killing in whole human blood. While these data shed new light on the HVR of M proteins, they suggest that FH-binding may affect S. pyogenes virulence by mechanisms not assessed in currently used model systems.

  20. Mutagenesis of the lac promoter region in M13 mp10 phage DNA by 4'-hydroxymethyl-4,5',8-trimethylpsoralen

    International Nuclear Information System (INIS)

    Piette, J.; Decuyper-Debergh, D.; Gamper, H.

    1985-01-01

    Double-stranded M13 phage DNA (M13 mp10 replicative form) was photoreacted with 4'-hydroxymethyl-4,5',8-trimethylpsoralen, using light of wavelength greater than 320 nm or greater than 390 nm to generate predominantly crosslinks or monoadducts, respectively. The damaged DNAs were scored for inactivation and mutagenesis after transfection into Escherichia coli. The appearance of light-blue or colorless plaques on indicator medium showed that mutation had occurred in the lac insert of the viral DNA. A comparison of the consequences of the two phototreatments with psoralen supports the idea that crosslinks are both more lethal and more mutagenic than monoadducts. Numerous mutant clones partially or totally deficient in beta-galactosidase were plaque-purified and amplified. The viral DNA of each clone was sequenced by the dideoxy chain-terminating procedure. All of the observed base-pair changes were mapped to the lac promoter region and consisted of 3 transition, 14 transversion, and 6 single base-pair frame-shift mutations. The predominant mutation was a T.A----G.C transversion

  1. A multistakeholder platform to promote health and prevent noncommunicable diseases in the region of the Americas: the Pan American Health Organization partners forum for action.

    Science.gov (United States)

    Hospedales, C James; Jané-Llopis, Eva

    2011-08-01

    Noncommunicable diseases (NCDs) and obesity are the most serious health problem facing the countries of the Americas in terms of avoidable deaths as well as costs to governments, families, and business. The main causes are ageing of the population, and widespread risks such as tobacco use, unhealthy diet, physical inactivity, and harmful use of alcohol, linked to major changes in the way we live and work, to public policies, cultural norms, and private sector forces. Underlying determinants are globalization, urbanization, poverty, education, gender, ethnicity, and access to health services. Yet, approximately 80% of cardiovascular disease and diabetes, and 40% of cancer, are preventable through a range of cost-effective population and individual measures for those at high risk of living with NCDs. However, the multisectoral nature of NCDs requires a cross-sector response to succeed. Several governments have commenced intersectoral efforts, and civil society and private sector also have many initiatives, but the responses are fragmented and skewed. The Partners Forum is being launched by the Pan American Health Organization in collaboration with the World Economic Forum and a set of partners including member states, partners in civil society, and partners in the private sector, as a multisector platform to catalyze, recognize, and scale up collaborative action to promote health and prevent and control NCDs at regional, subregional, and country level. The principles of partnership and lessons learned from other partnership experiences are being used in its design.

  2. The -2549 insertion/deletion polymorphism in the promoter region of VEGF is associated with the risk of recurrent spontaneous abortion.

    Science.gov (United States)

    Hashemi, Mohammad; Danesh, Hiva; Bizhani, Fatemeh; Mokhtari, Mojgan; Bahari, Gholamreza; Tabasi, Farhad; Taheri, Mohsen

    2018-03-01

    Recurrent spontaneous abortion (RSA) is a common health problem affecting women of reproductive age. Altered expression of vascular endothelial growth factor ( VEGF ) has been associated with spontaneous abortion. The present case-control study aimed to evaluate the impact of the 18-bp insertion/deletion (ins/del) polymorphism (rs35569394) in the promoter region of the VEGF gene on idiopathic RSA. Genomic DNA from 93 patients with RSA and 93 healthy fertile women of southeastern Iran was isolated using the salting-out method. Genotyping of the rs35569394 variant was performed by a polymerase chain reaction (PCR) method. The findings indicated that the VEGF 18-bp ins/del variant significantly increased the risk of RSA under codominant (ins/ins vs. del/del; OR=2.85, 95% CI=1.31-6.22, P=0.019), dominant (del/ins+ins/ins vs. del/del; OR=2.19, 95% CI=1.20-4.01, P=0.015) and allelic (ins vs. del; OR=1.90, 95% CI=1.25-2.88, P=0.003) inheritance models. In summary, the findings propose a significant association between the VEGF 18-bp ins/del polymorphism and risk of RSA in a sample of the southeast Iranian population. Further studies on larger sample sizes and different ethnicities are required to validate the present findings.

  3. Minimal conformal model

    Energy Technology Data Exchange (ETDEWEB)

    Helmboldt, Alexander; Humbert, Pascal; Lindner, Manfred; Smirnov, Juri [Max-Planck-Institut fuer Kernphysik, Heidelberg (Germany)

    2016-07-01

    The gauge hierarchy problem is one of the crucial drawbacks of the standard model of particle physics (SM) and thus has triggered model building over the last decades. Its most famous solution is the introduction of low-scale supersymmetry. However, without any significant signs of supersymmetric particles at the LHC to date, it makes sense to devise alternative mechanisms to remedy the hierarchy problem. One such mechanism is based on classically scale-invariant extensions of the SM, in which both the electroweak symmetry and the (anomalous) scale symmetry are broken radiatively via the Coleman-Weinberg mechanism. Apart from giving an introduction to classically scale-invariant models, the talk presents our results on obtaining a theoretically consistent minimal extension of the SM, which reproduces the correct low-scale phenomenology.

  4. Minimal Reducts with Grasp

    Directory of Open Access Journals (Sweden)

    Iris Iddaly Mendez Gurrola

    2011-03-01

    Full Text Available The proper detection of patient level of dementia is important to offer the suitable treatment. The diagnosis is based on certain criteria, reflected in the clinical examinations. From these examinations emerge the limitations and the degree in which each patient is in. In order to reduce the total of limitations to be evaluated, we used the rough set theory, this theory has been applied in areas of the artificial intelligence such as decision analysis, expert systems, knowledge discovery, classification with multiple attributes. In our case this theory is applied to find the minimal limitations set or reduct that generate the same classification that considering all the limitations, to fulfill this purpose we development an algorithm GRASP (Greedy Randomized Adaptive Search Procedure.

  5. Minimally extended SILH

    International Nuclear Information System (INIS)

    Chala, Mikael; Grojean, Christophe; Humboldt-Univ. Berlin; Lima, Leonardo de; Univ. Estadual Paulista, Sao Paulo

    2017-03-01

    Higgs boson compositeness is a phenomenologically viable scenario addressing the hierarchy problem. In minimal models, the Higgs boson is the only degree of freedom of the strong sector below the strong interaction scale. We present here the simplest extension of such a framework with an additional composite spin-zero singlet. To this end, we adopt an effective field theory approach and develop a set of rules to estimate the size of the various operator coefficients, relating them to the parameters of the strong sector and its structural features. As a result, we obtain the patterns of new interactions affecting both the new singlet and the Higgs boson's physics. We identify the characteristics of the singlet field which cause its effects on Higgs physics to dominate over the ones inherited from the composite nature of the Higgs boson. Our effective field theory construction is supported by comparisons with explicit UV models.

  6. Minimally extended SILH

    Energy Technology Data Exchange (ETDEWEB)

    Chala, Mikael [Deutsches Elektronen-Synchrotron (DESY), Hamburg (Germany); Valencia Univ. (Spain). Dept. de Fisica Teorica y IFIC; Durieux, Gauthier; Matsedonskyi, Oleksii [Deutsches Elektronen-Synchrotron (DESY), Hamburg (Germany); Grojean, Christophe [Deutsches Elektronen-Synchrotron (DESY), Hamburg (Germany); Humboldt-Univ. Berlin (Germany). Inst. fuer Physik; Lima, Leonardo de [Deutsches Elektronen-Synchrotron (DESY), Hamburg (Germany); Univ. Estadual Paulista, Sao Paulo (Brazil). Inst. de Fisica Teorica

    2017-03-15

    Higgs boson compositeness is a phenomenologically viable scenario addressing the hierarchy problem. In minimal models, the Higgs boson is the only degree of freedom of the strong sector below the strong interaction scale. We present here the simplest extension of such a framework with an additional composite spin-zero singlet. To this end, we adopt an effective field theory approach and develop a set of rules to estimate the size of the various operator coefficients, relating them to the parameters of the strong sector and its structural features. As a result, we obtain the patterns of new interactions affecting both the new singlet and the Higgs boson's physics. We identify the characteristics of the singlet field which cause its effects on Higgs physics to dominate over the ones inherited from the composite nature of the Higgs boson. Our effective field theory construction is supported by comparisons with explicit UV models.

  7. Understanding, promoting and protecting geodiversity and geoheritage of the Piemonte region (Italy) through innovative techniques and public engagement in Earth Science studies

    Science.gov (United States)

    Giardino, Marco; Lozar, Francesca; Perotti, Luigi; Palomba, Mauro; Groppo, Chiara; Natalicchio, Marcello; Ghiraldi, Luca; Beltramo, Riccardo; Lombardo, Vincenzo

    2016-04-01

    The onset of Antropocene demonstrates the importance of considering both 1) geodiversity and 2) geoheritage as parts of the landscape "interfaces" where relationships between natural and socio-economic systems can be studied and interpreted. By definition: 1) is the variety, recognizable in nature ("diversity"), of geological features (rocks, minerals, fossils…), of geomorphological environments (and related forms and processes) and of soil characteristics; 2) is an integral part of the global natural heritage focusing on unique, special and representative sites of geological interests (geosites l.s.). In the Antropocene, both 1) and 2) hold a dynamic character, as the result of actions and interactions of natural and/or human factors. Therefore, geodiversity and geoheritage studies are essential for breaking down geological environments and human territories into their main parts and to understand the variables and mechanisms that control their changes. In this perspective, results of the multidisciplinary project PROGEO-Piemonte ("PROactive management of GEOlogical heritage in the Piemonte Region") are presented here: an innovative approach for assessing geodiversity in order to select areas of high potential value of geoheritage to be enhanced by targeted management actions. Since the geodiversity of Piemonte is materialized by elements of high scientific, educational, tourism, etc. value, the geosites where this geoheritage is preserved have been comprehensively analysed and characterized for encompassing both public and private interests. 9 strategic geothematic areas have been selected in the Piemonte Region to test this approach, and to improve social engagement aimed at protecting and promoting geodiversity ad geoheritage. The investigated areas represent the multifaceted geodiversity of Piemonte; each area is characterized by high potential for scientific studies, enhancement of public understanding of science, recreation activities and for economic

  8. Health Promotion and Wellness Staffing Methods

    National Research Council Canada - National Science Library

    Thomsen, Kim

    1999-01-01

    .... Health promotion and wellness programs positively influence the military mission readiness and force protection, increase productivity, reduce health care costs, minimize illness and non-battle...

  9. Qualitative analysis of Adenomatous Polyposis Coli promoter: Hypermethylation, engagement and effects on survival of patients with esophageal cancer in a high risk region of the world, a potential molecular marker

    International Nuclear Information System (INIS)

    Zare, Maryam; Jazii, Ferdous Rastgar; Alivand, Mohammad Reza; Nasseri, Negin Karimi; Malekzadeh, Reza; Yazdanbod, Mansour

    2009-01-01

    Squamous cell carcinoma of esophagus (SCCE) occurs at a high incidence rate in certain parts of the world. This feature necessitates that different aspects of the disease and in particular genetic characteristics be investigated in such regions. In addition, such investigations might lead to achievement of molecular markers helpful for early detection, successful treatment and follow up of the disease. Adenomatous Polyposis Coli (APC) promoter hypermethylation has been shown to be a suitable marker for both serum and solid tumors of adenocarcinoma of esophagus. We investigated the status of APC promoter hypermethylation in Iranian patients, compared the results with the former studies, and evaluated its applicability as a candidate molecular marker by examining association between survival of SCCE patients and APC promoter methylation. For evaluating the status of APC promoter hypermethylation and its association with SCCE, a qualitative methylation specific PCR (MSP) was used. DNA was extracted and digested with an appropriate restriction enzyme, treated with sodium bisulfite in agarose beads and amplified in two-step PCR reaction by applying either methylated or unmethylated promoter specific primers. Universally methylated DNA and methylase treated blood DNA of healthy donors were used as positive controls as well. Survival of patients was followed up for two years after treatment and survival rate of patients with methylated APC promoter was compared with that of unmethylated patients. Assessment of APC promoter methylation revealed that normal tissues were unmethylated, while twenty out of forty five (44.4%) tumor tissues were hypermethylated either in one or both alleles of APC. Among the tissues in which methylation was detected, seven were hypermethylated in both alleles while the other thirteen were hypermethylated in one of the two alleles of APC. Analyzing two-year survival rate of patients with respect to promoter hypermethylation showed a lower rate of

  10. Qualitative analysis of Adenomatous Polyposis Coli promoter: Hypermethylation, engagement and effects on survival of patients with esophageal cancer in a high risk region of the world, a potential molecular marker

    Directory of Open Access Journals (Sweden)

    Nasseri Negin

    2009-01-01

    Full Text Available Abstract Background Squamous cell carcinoma of esophagus (SCCE occurs at a high incidence rate in certain parts of the world. This feature necessitates that different aspects of the disease and in particular genetic characteristics be investigated in such regions. In addition, such investigations might lead to achievement of molecular markers helpful for early detection, successful treatment and follow up of the disease. Adenomatous Polyposis Coli (APC promoter hypermethylation has been shown to be a suitable marker for both serum and solid tumors of adenocarcinoma of esophagus. We investigated the status of APC promoter hypermethylation in Iranian patients, compared the results with the former studies, and evaluated its applicability as a candidate molecular marker by examining association between survival of SCCE patients and APC promoter methylation. Methods For evaluating the status of APC promoter hypermethylation and its association with SCCE, a qualitative methylation specific PCR (MSP was used. DNA was extracted and digested with an appropriate restriction enzyme, treated with sodium bisulfite in agarose beads and amplified in two-step PCR reaction by applying either methylated or unmethylated promoter specific primers. Universally methylated DNA and methylase treated blood DNA of healthy donors were used as positive controls as well. Survival of patients was followed up for two years after treatment and survival rate of patients with methylated APC promoter was compared with that of unmethylated patients. Results Assessment of APC promoter methylation revealed that normal tissues were unmethylated, while twenty out of forty five (44.4% tumor tissues were hypermethylated either in one or both alleles of APC. Among the tissues in which methylation was detected, seven were hypermethylated in both alleles while the other thirteen were hypermethylated in one of the two alleles of APC. Analyzing two-year survival rate of patients with respect

  11. Minimalism through intraoperative functional mapping.

    Science.gov (United States)

    Berger, M S

    1996-01-01

    Intraoperative stimulation mapping may be used to avoid unnecessary risk to functional regions subserving language and sensori-motor pathways. Based on the data presented here, language localization is variable in the entire population, with only certainty existing for the inferior frontal region responsible for motor speech. Anatomical landmarks such as the anterior temporal tip for temporal lobe language sites and the posterior aspect of the lateral sphenoid wing for the frontal lobe language zones are unreliable in avoiding postoperative aphasias. Thus, individual mapping to identify essential language sites has the greatest likelihood of avoiding permanent deficits in naming, reading, and motor speech. In a similar approach, motor and sensory pathways from the cortex and underlying white matter may be reliably stimulated and mapped in both awake and asleep patients. Although these techniques require an additional operative time and equipment nominally priced, the result is often gratifying, as postoperative morbidity has been greatly reduced in the process of incorporating these surgical strategies. The patients quality of life is improved in terms of seizure control, with or without antiepileptic drugs. This avoids having to perform a second costly operative procedure, which is routinely done when extraoperative stimulation and recording is done via subdural grids. In addition, an aggressive tumor resection at the initial operation lengthens the time to tumor recurrence and often obviates the need for a subsequent reoperation. Thus, intraoperative functional mapping may be best alluded to as a surgical technique that results in "minimalism in the long term".

  12. Waste minimization at Chalk River Laboratories

    International Nuclear Information System (INIS)

    Kranz, P.; Wong, P.C.F.

    2011-01-01

    Waste minimization supports Atomic Energy of Canada Limited (AECL) Environment Policy with regard to pollution prevention and has positive impacts on the environment, human health and safety, and economy. In accordance with the principle of pollution prevention, the quantities and degree of hazard of wastes requiring storage or disposition at facilities within or external to AECL sites shall be minimized, following the principles of Prevent, Reduce, Reuse, and Recycle, to the extent practical. Waste minimization is an important element in the Waste Management Program. The Waste Management Program has implemented various initiatives for waste minimization since 2007. The key initiatives have focused on waste reduction, segregation and recycling, and included: 1) developed waste minimization requirements and recycling procedure to establish the framework for applying the Waste Minimization Hierarchy; 2) performed waste minimization assessments for the facilities, which generate significant amounts of waste, to identify the opportunities for waste reduction and assist the waste generators to develop waste reduction targets and action plans to achieve the targets; 3) implemented the colour-coded, standardized waste and recycling containers to enhance waste segregation; 4) established partnership with external agents for recycling; 5) extended the likely clean waste and recyclables collection to selected active areas; 6) provided on-going communications to promote waste reduction and increase awareness for recycling; and 7) continually monitored performance, with respect to waste minimization, to identify opportunities for improvement and to communicate these improvements. After implementation of waste minimization initiatives at CRL, the solid waste volume generated from routine operations at CRL has significantly decreased, while the amount of recyclables diverted from the onsite landfill has significantly increased since 2007. The overall refuse volume generated at

  13. Waste minimization at Chalk River Laboratories

    Energy Technology Data Exchange (ETDEWEB)

    Kranz, P.; Wong, P.C.F. [Atomic Energy of Canada Limited, Chalk River, ON (Canada)

    2011-07-01

    Waste minimization supports Atomic Energy of Canada Limited (AECL) Environment Policy with regard to pollution prevention and has positive impacts on the environment, human health and safety, and economy. In accordance with the principle of pollution prevention, the quantities and degree of hazard of wastes requiring storage or disposition at facilities within or external to AECL sites shall be minimized, following the principles of Prevent, Reduce, Reuse, and Recycle, to the extent practical. Waste minimization is an important element in the Waste Management Program. The Waste Management Program has implemented various initiatives for waste minimization since 2007. The key initiatives have focused on waste reduction, segregation and recycling, and included: 1) developed waste minimization requirements and recycling procedure to establish the framework for applying the Waste Minimization Hierarchy; 2) performed waste minimization assessments for the facilities, which generate significant amounts of waste, to identify the opportunities for waste reduction and assist the waste generators to develop waste reduction targets and action plans to achieve the targets; 3) implemented the colour-coded, standardized waste and recycling containers to enhance waste segregation; 4) established partnership with external agents for recycling; 5) extended the likely clean waste and recyclables collection to selected active areas; 6) provided on-going communications to promote waste reduction and increase awareness for recycling; and 7) continually monitored performance, with respect to waste minimization, to identify opportunities for improvement and to communicate these improvements. After implementation of waste minimization initiatives at CRL, the solid waste volume generated from routine operations at CRL has significantly decreased, while the amount of recyclables diverted from the onsite landfill has significantly increased since 2007. The overall refuse volume generated at

  14. Minimal Marking: A Success Story

    Science.gov (United States)

    McNeilly, Anne

    2014-01-01

    The minimal-marking project conducted in Ryerson's School of Journalism throughout 2012 and early 2013 resulted in significantly higher grammar scores in two first-year classes of minimally marked university students when compared to two traditionally marked classes. The "minimal-marking" concept (Haswell, 1983), which requires…

  15. Swarm robotics and minimalism

    Science.gov (United States)

    Sharkey, Amanda J. C.

    2007-09-01

    Swarm Robotics (SR) is closely related to Swarm Intelligence, and both were initially inspired by studies of social insects. Their guiding principles are based on their biological inspiration and take the form of an emphasis on decentralized local control and communication. Earlier studies went a step further in emphasizing the use of simple reactive robots that only communicate indirectly through the environment. More recently SR studies have moved beyond these constraints to explore the use of non-reactive robots that communicate directly, and that can learn and represent their environment. There is no clear agreement in the literature about how far such extensions of the original principles could go. Should there be any limitations on the individual abilities of the robots used in SR studies? Should knowledge of the capabilities of social insects lead to constraints on the capabilities of individual robots in SR studies? There is a lack of explicit discussion of such questions, and researchers have adopted a variety of constraints for a variety of reasons. A simple taxonomy of swarm robotics is presented here with the aim of addressing and clarifying these questions. The taxonomy distinguishes subareas of SR based on the emphases and justifications for minimalism and individual simplicity.

  16. Fast nonconvex nonsmooth minimization methods for image restoration and reconstruction.

    Science.gov (United States)

    Nikolova, Mila; Ng, Michael K; Tam, Chi-Pan

    2010-12-01

    Nonconvex nonsmooth regularization has advantages over convex regularization for restoring images with neat edges. However, its practical interest used to be limited by the difficulty of the computational stage which requires a nonconvex nonsmooth minimization. In this paper, we deal with nonconvex nonsmooth minimization methods for image restoration and reconstruction. Our theoretical results show that the solution of the nonconvex nonsmooth minimization problem is composed of constant regions surrounded by closed contours and neat edges. The main goal of this paper is to develop fast minimization algorithms to solve the nonconvex nonsmooth minimization problem. Our experimental results show that the effectiveness and efficiency of the proposed algorithms.

  17. Susceptibility to gastric cancer and polymorphisms of insertion/deletion at the intron 3 of the XRCC4 and VNTR at the promoter region of the XRCC5.

    Science.gov (United States)

    Saadat, Mostafa; Pashaei, Samira; Amerizade, Foroozan

    2015-07-01

    The genes encoding X-ray repair cross-complementing group 4 (XRCC4; OMIM: 194363) and 5 (XRCC5; OMIM: 194364) are involved in repair of DNA double-strand breaks. To investigating the associations between polymorphisms of Insertion/Deletion (I/D, rs28360071) in the intron 3 of the XRCC4 and VNTR in the promoter region of the XRCC5 and risk of gastric cancer, the present study was carried out. We included 159 (56 females, 103 males) with gastric cancer and 242 (75 females, 167 males) healthy blood donors frequency matched for age and gender. Using PCR-based methods, the genotypes of the study polymorphisms were determined. The alleles of VNTR XRCC5 polymorphism divided into two groups: L (0 and 1 repeats) and H (2 and 3 repeats) alleles. For the I/D XRCC4 polymorphism, after stratification of the subjects according to their family history (FH) of cancer, either the ID (OR = 3.19, 95%CI: 1.35-7.50, P = 0.008) or the DD genotypes (OR = 4.62, 95%CI: 1.63-13.0, P = 0.004) among positive FH persons, increased the risk of gastric cancer compared with the reference group (persons who have negative FH and II genotype). For the VNTR XRCC5 polymorphism, the LH + HH genotypes among positive FH persons, increased the risk of gastric cancer compared with the reference group (persons who have negative FH and LL genotype) (OR = 2.88, 95%CI: 1.34-6.18, P = 0.006). Sensitivity analysis showed that the above mentioned associations were not occurred due to the maldistribution of the genotypes among missing data. The present study suggests that both polymorphisms of the XRCC4 and XRCC5 might be risk factors for gastric cancer development especially among persons with positive FH.

  18. Wake-promoting actions of median nerve stimulation in TBI-induced coma: An investigation of orexin-A and orexin receptor 1 in the hypothalamic region.

    Science.gov (United States)

    Zhong, Ying-Jun; Feng, Zhen; Wang, Liang; Wei, Tian-Qi

    2015-09-01

    A coma is a serious complication, which can occur following traumatic brain injury (TBI), for which no effective treatment has been established. Previous studies have suggested that neural electrical stimulation, including median nerve stimulation (MNS), may be an effective method for treating patients in a coma, and orexin‑A, an excitatory hypothalamic neuropeptide, may be involved in wakefulness. However, the exact mechanisms underlying this involvement remain to be elucidated. The present study aimed to examine the arousal‑promoting role of MNS in rats in a TBI‑induced coma and to investigate the potential mechanisms involved. A total of 90 rats were divided into three groups, comprising a control group, sham‑stimulated (TBI) group and a stimulated (TBI + MNS) group. MNS was performed on the animals, which were in a TBI‑induced comatose state. Changes in the behavior of the rats were observed following MNS. Subsequently, hypothalamic tissues were extracted from the rats 6, 12 and 24 h following TBI or MNS, respectively. The expression levels of orexin‑A and orexin receptor‑1 (OX1R) in the hypothalamus were examined using immunohistochemistry, western blotting and an enzyme‑linked immunosorbent assay. The results demonstrated that 21 rats subjected to TBI‑induced coma exhibited a restored righting reflex and response to pain stimuli following MNS. In addition, ignificant differences in the expression levels of orexin‑A and OXIR were observed among the three groups and among the time‑points. Orexin‑A and OX1R were upregulated following MNS. The rats in the stimulated group reacted to the MNS and exhibited a re‑awakening response. The results of the present study indicated that MNS may be a therapeutic option for TBI‑induced coma. The mechanism may be associated with increasing expression levels of the excitatory hypothalamic neuropeptide, orexin-A, and its receptor, OX1R, in the hypothalamic region.

  19. Influence of A-21T and C-262T genetic polymorphisms at the promoter region of the catalase (CAT) on gene expression.

    Science.gov (United States)

    Saify, Khyber; Saadat, Iraj; Saadat, Mostafa

    2016-09-01

    Catalase (CAT, OMIM: 115500) is one of the major antioxidant enzymes, which plays an important role in the clearance of reactive oxygen species. Three genetic polymorphisms of A-21T (rs7943316), C-262T (rs1001179), and C-844T (rs769214) in the promoter region of the CAT have been reported. It has been suggested that these polymorphisms may alter the recognition sites of transcriptional factors, therefore it might be concluded that these polymorphisms may alter the expression levels of the gene. The aim of the present study is to evaluate the associations between these genetic variations and the CAT mRNA levels in human peripheral blood cells. The present study consisted of 47 healthy students of Shiraz University (south-west Iran). Genotypes of the CAT polymorphisms were determined by PCR based method. The quantitative CAT mRNA expression levels were investigated using quantitative real-time PCR. Analysis of variance revealed significant differences between the study genotypes (For A-21T polymorphism: F = 7.45; df = 2, 44; P = 0.002; For C-262T polymorphism: F = 15.17; df = 2, 44; P CAT in the AC/TT, TC/TC, TC/TT, and TC/TC diplotypes significantly were higher than the mRNA levels in AC/AC diplotype. There was a significant difference between the study genotypes (F = 9.24; df = 5, 41; P CAT mRNA levels compared with the AC/AC diplotype. The present findings indicated that these polymorphisms were significantly associated with the gene expression.

  20. Serotonin Transporter Promoter Region (5-HTTLPR) Polymorphism Is Not Associated With Paroxetine-Induced Ejaculation Delay in Dutch Men With Lifelong Premature Ejaculation

    Science.gov (United States)

    Janssen, Paddy K.C.; Zwinderman, Aeilko H.; Olivier, Berend

    2014-01-01

    Purpose To investigate the association between the 5-HT-transporter-gene-linked promoter region (5-HTTLPR) polymorphism and 20-mg paroxetine-induced ejaculation delay in men with lifelong premature ejaculation (LPE). Materials and Methods This was a prospective study of 10 weeks of paroxetine treatment in 54 men with LPE. Intravaginal ejaculation latency time (IELT) was measured by stopwatch. Controls consisted of 92 Caucasian men. All men with LPE were genotyped for the 5-HTTLPR polymorphism. Allele frequencies and genotypes of short (S) and long (L) variants of the polymorphism were compared between patients and controls. Associations between the LL, SL, and SS genotypes and fold increase of mean IELT were investigated. Results Of the 54 patients, 43 (79.6%) responded to 20-mg paroxetine treatment with an ejaculation delay, whereas 11 patients (20.4%) did not respond; 44%, 18%, and 18% of the patients showed a fold increase in mean IELT of 2-10, 10-20, and more than 20, respectively. Of the 54 men, 14 (25.9%) had the LL genotype, 29 (53.7%) had the SL genotype, and 11 (20.4%) had the SS genotype. In the 92 controls, the LL, SL, and SS genotypes were present in 27 (29.3%), 41 (44.6%), and 24 (26.1%), respectively. No statistically significant differences were found in 5-HTTLPR allelic variations or in 5-HTTLPR gene variations. In all men treated with 20 mg paroxetine, analysis of variance of the natural logarithm of fold increase in the IELT showed no statistically significant difference according to genotype (p=0.83). Conclusions The 5-HTTLPR polymorphism is not associated with daily 20-mg paroxetine treatment-induced ejaculation delay in men with LPE. PMID:24578810

  1. Waste minimization for commercial radioactive materials users generating low-level radioactive waste

    International Nuclear Information System (INIS)

    Fischer, D.K.; Gitt, M.; Williams, G.A.; Branch, S.; Otis, M.D.; McKenzie-Carter, M.A.; Schurman, D.L.

    1991-07-01

    The objective of this document is to provide a resource for all states and compact regions interested in promoting the minimization of low-level radioactive waste (LLW). This project was initiated by the Commonwealth of Massachusetts, and Massachusetts waste streams have been used as examples; however, the methods of analysis presented here are applicable to similar waste streams generated elsewhere. This document is a guide for states/compact regions to use in developing a system to evaluate and prioritize various waste minimization techniques in order to encourage individual radioactive materials users (LLW generators) to consider these techniques in their own independent evaluations. This review discusses the application of specific waste minimization techniques to waste streams characteristic of three categories of radioactive materials users: (1) industrial operations using radioactive materials in the manufacture of commercial products, (2) health care institutions, including hospitals and clinics, and (3) educational and research institutions. Massachusetts waste stream characterization data from key radioactive materials users in each category are used to illustrate the applicability of various minimization techniques. The utility group is not included because extensive information specific to this category of LLW generators is available in the literature

  2. Image denoising by a direct variational minimization

    Directory of Open Access Journals (Sweden)

    Pilipović Stevan

    2011-01-01

    Full Text Available Abstract In this article we introduce a novel method for the image de-noising which combines a mathematically well-posdenes of the variational modeling with the efficiency of a patch-based approach in the field of image processing. It based on a direct minimization of an energy functional containing a minimal surface regularizer that uses fractional gradient. The minimization is obtained on every predefined patch of the image, independently. By doing so, we avoid the use of an artificial time PDE model with its inherent problems of finding optimal stopping time, as well as the optimal time step. Moreover, we control the level of image smoothing on each patch (and thus on the whole image by adapting the Lagrange multiplier using the information on the level of discontinuities on a particular patch, which we obtain by pre-processing. In order to reduce the average number of vectors in the approximation generator and still to obtain the minimal degradation, we combine a Ritz variational method for the actual minimization on a patch, and a complementary fractional variational principle. Thus, the proposed method becomes computationally feasible and applicable for practical purposes. We confirm our claims with experimental results, by comparing the proposed method with a couple of PDE-based methods, where we get significantly better denoising results specially on the oscillatory regions.

  3. A meta-analysis of the effects of the 5-hydroxytryptamine transporter gene-linked promoter region polymorphism on susceptibility to lifelong premature ejaculation.

    Directory of Open Access Journals (Sweden)

    Lijie Zhu

    Full Text Available OBJECTIVE: Premature ejaculation (PE has been reported as the most common male sexual dysfunction with global prevalence rates estimated at approximately 30%. The neurobiogenesis of ejaculation is very complex and involves the serotoninergic (5-hydroxytryptamine, 5-HT system. Recently, genetic polymorphisms located on SLC6A4 gene codifying for 5-HT transporter (5-HTT, the major regulator of serotonic neurotransmission, have been linked with the pathogenesis and risk of PE. Apparently studies of this type of polymorphism in PE have show conflicting results. METHODS: A meta-analysis was performed that are available in relation with 5-HTT gene-linked promoter region (5-HTTLPR polymorphism and the risk of lifelong PE (LPE in men to clarify this relationship. We searched Pubmed and Embase (last search updated on Aug 2012 using 'premature ejaculation', 'polymorphism or variant', 'genotype', 'ejaculatory function', and 'rapid ejaculation' as keywords and reference lists of studies corresponded to the inclusion criteria for meta-analysis. These studies involved the total number of 481 LPE men and 466 health control men subjects. Odds ratio (OR and 95% confidence intervals (CIs were used to evaluate this relationship. RESULTS: In the overall analysis, significant associations between LPE risk and 5-HTTLPR polymorphism were found (L-allele vs. S-allele OR = 0.86, 95% CI = 0.79-0.95, P = 0.002; LL vs. SS: OR = 0.80, 95% CI = 0.68-0.95, P = 0.009; LS vs. SS: OR = 0.85, 95% CI = 0.76-0.97, P = 0.012 and LL+LS vs. SS: OR = 0.88, 95% CI = 0.81-0.95, P = 0.002. Moreover, in subgroup analysis based on ethnicity, similar significant associations were detected. The Egger's test did not reveal presence of a publication bias. CONCLUSIONS: Our investigations demonstrate that 5-HTTLPR (L>S polymorphism might protect men against LPE risk. Further studies based on larger sample size and gene-environment interactions should

  4. Profile, knowledge, and work patterns of a cadre of maternal, newborn, and child health CHWs focusing on preventive and promotive services in Morogoro Region, Tanzania.

    Science.gov (United States)

    LeFevre, Amnesty E; Mpembeni, Rose; Chitama, Dereck; George, Asha S; Mohan, Diwakar; Urassa, David P; Gupta, Shivam; Feldhaus, Isabelle; Pereira, Audrey; Kilewo, Charles; Chebet, Joy J; Cooper, Chelsea M; Besana, Giulia; Lutale, Harriet; Bishanga, Dunstan; Mtete, Emmanuel; Semu, Helen; Baqui, Abdullah H; Killewo, Japhet; Winch, Peter J

    2015-12-24

    Despite impressive decreases in under-five mortality, progress in reducing maternal and neonatal mortality in Tanzania has been slow. We present an evaluation of a cadre of maternal, newborn, and child health community health worker (MNCH CHW) focused on preventive and promotive services during the antenatal and postpartum periods in Morogoro Region, Tanzania. Study findings review the effect of several critical design elements on knowledge, time allocation, service delivery, satisfaction, and motivation. A quantitative survey on service delivery and knowledge was administered to 228 (of 238 trained) MNCH CHWs. Results are compared against surveys administered to (1) providers in nine health centers (n = 88) and (2) CHWs (n = 53) identified in the same districts prior to the program's start. Service delivery outputs were measured by register data and through a time motion study conducted among a sub-sample of 33 randomly selected MNCH CHWs. Ninety-seven percent of MNCH CHWs (n = 228) were interviewed: 55% male, 58% married, and 52% with secondary school education or higher. MNCH CHWs when compared to earlier CHWs were more likely to be unmarried, younger, and more educated. Mean MNCH CHW knowledge scores were <50% for 8 of 10 MNCH domains assessed and comparable to those observed for health center providers but lower than those for earlier CHWs. MNCH CHWs reported covering a mean of 186 households and were observed to provide MNCH services for 5 h weekly. Attendance of monthly facility-based supervision meetings was nearly universal and focused largely on registers, yet data quality assessments highlighted inconsistencies. Despite program plans to provide financial incentives and bicycles for transport, only 56% of CHWs had received financial incentives and none received bicycles. Initial rollout of MNCH CHWs yields important insights into addressing program challenges. The social profile of CHWs was not significantly associated with knowledge or

  5. Separations: The path to waste minimization

    International Nuclear Information System (INIS)

    Bell, J.T.

    1992-01-01

    Waste materials usually are composed of large amounts of innocuous and frequently useful components mixed with lesser amounts of one or more hazardous components. The ultimate path to waste minimization is the separation of the lesser quantities of hazardous components from the innocuous components, and then recycle the useful components. This vision is so simple that everyone would be expected to properly manage waste. Several parameters interfere with this proper waste management, which encourages the open-quotes sweep it under the rugclose quotes or the open-quotes bury it allclose quotes attitudes, both of which delay and complicate proper waste management. The two primary parameters that interfere with proper waste management are: economics drives a process to a product without concerns of waste minimization, and emergency needs for immediate production of a product usually delays proper waste management. A third parameter in recent years is also interfering with proper waste management: quick relief of waste insults to political and public perceptions is promoting the open-quotes bury it allclose quotes attitude. A fourth parameter can promote better waste management for any scenario that suffers either or all of the first three parameters: separations technology can minimize wastes when the application of this technology is not voided by influence of the first three parameters. The US Department of Energy's management of nuclear waste has been seriously affected by the above four parameters. This paper includes several points about how the generation and management of DOE wastes have been, and continue to be, affected by these parameters. Particular separations technologies for minimizing the DOE wastes that must be stored for long periods are highlighted

  6. A pilot study investigating of the nature of point-of-sale alcohol promotions in bottle shops in a large Australian regional city.

    Science.gov (United States)

    Jones, Sandra C; Lynch, Melissa

    2007-08-01

    The promotion of alcohol by retailers and media can contribute to a culture of excessive alcohol consumption, but the effect of non-advertising alcohol promotions has largely been neglected. This study sought to gather initial data on this important area. An observational study of alcohol point-of-sale promotions in the Wollongong CBD area, conducted in July-August 2005. We identified 17 different promotions in three categories: gift with purchase; competitions; and buy some, get some free. Given previous research demonstrating the relationship between increased alcohol consumption and both ownership of alcohol-related merchandise and reduced per unit price, it appears that point-of-sale promotions may have the potential to further increase alcohol consumption among young people. Only when the extent and impact of such promotions is demonstrated will we be in a position to effectively advocate for appropriate regulations to ensure young people are not exposed to marketing strategies that further increase their exposure to alcohol-related harms.

  7. HDAC inhibitors TSA and sodium butyrate enhanced the human IL-5 expression by altering histone acetylation status at its promoter region.

    Science.gov (United States)

    Han, Songyan; Lu, Jun; Zhang, Yu; Cheng, Cao; Li, Lin; Han, Liping; Huang, Baiqu

    2007-02-15

    The expression of IL-5 correlated tightly with the maturation and differentiation of eosinophils, and is considered as a cytokine responsible for allergic inflammation. We report here that inhibition of HDAC activity by Trichostatin A (TSA) and sodium butyrate (NaBu), the two specific HDAC inhibitors, resulted in the elevation of both endogenous and exogenous activity of IL-5 promoter. We demonstrated that both the mRNA expression and protein production of IL-5 were stimulated by TSA and NaBu treatments. ChIP assays showed that treatments of TSA and NaBu caused hyperacetylation of histones H3 and H4 on IL-5 promoter in Jurkat cells, which consequently promoted the exogenous luciferase activity driven by this promoter. Moreover, site-directed mutagenesis studies showed that the binding sites for transcription factors NFAT, GATA3 and YY1 on IL-5 promoter were critical for the effects of TSA and NaBu, suggesting that the transcriptional activation of IL-5 gene by these inhibitors was achieved by affecting HDAC function on IL-5 promoter via transcription factors. These data will contribute to elucidating the unique mechanism of IL-5 transcriptional control and to the therapy of allergic disorders related to IL-5.

  8. Global Analysis of Minimal Surfaces

    CERN Document Server

    Dierkes, Ulrich; Tromba, Anthony J

    2010-01-01

    Many properties of minimal surfaces are of a global nature, and this is already true for the results treated in the first two volumes of the treatise. Part I of the present book can be viewed as an extension of these results. For instance, the first two chapters deal with existence, regularity and uniqueness theorems for minimal surfaces with partially free boundaries. Here one of the main features is the possibility of 'edge-crawling' along free parts of the boundary. The third chapter deals with a priori estimates for minimal surfaces in higher dimensions and for minimizers of singular integ

  9. Minimal Surfaces for Hitchin Representations

    DEFF Research Database (Denmark)

    Li, Qiongling; Dai, Song

    2018-01-01

    . In this paper, we investigate the properties of immersed minimal surfaces inside symmetric space associated to a subloci of Hitchin component: $q_n$ and $q_{n-1}$ case. First, we show that the pullback metric of the minimal surface dominates a constant multiple of the hyperbolic metric in the same conformal...... class and has a strong rigidity property. Secondly, we show that the immersed minimal surface is never tangential to any flat inside the symmetric space. As a direct corollary, the pullback metric of the minimal surface is always strictly negatively curved. In the end, we find a fully decoupled system...

  10. Konstitusionalitas Standar Pelayanan Minimal

    Directory of Open Access Journals (Sweden)

    Habib Muchsin Syafingi

    2017-08-01

    Full Text Available The purpose of local government is to realize the people’s prosperity through improving services, empowerment, community participation, and enhancement of regional competitiveness. As part of the central government, the local government is responsible for improving public services based on the Minimum Service Standard on the local government obligatory matters that related to the basic needs of the community. The principle of Minimum Service Standard is different from the principle in the Act No. 25 of 2009 about Public Service which tends to emphasize on standard aspects of public goods and public services and more likely focuses toward the realization of good governance. The concern of Minimum Service Standards is the realization of the society’s welfare as one of the state goals. The philosophy of this Minimum Service Standard is the improvement of public’s quality and access to public services which is should be realized in various indicators. The preparation of indicators along with its achievements and its per year target are intended to evaluate easily and also simplify the planning and budgeting process every year. The obligatory matters of local government related to basic needs should be developed by the ministry concerned and implemented by the local government including education, health, public works and spatial, housing and settlement and social. These government duties based on the result of the study that the Minimum Service Standar on those affairs is the further implementation of the constitutional provisions of the 1945 Constitution, so that the drafting and application of Minimum Service Standar has a clear constitutional foundation.

  11. Health Promotion Behaviours and Level of Activities of Daily Living and Instrumental Activities of Daily Living Among Elderly People in West Region of Tehran: A Cross-Sectional Survey

    Directory of Open Access Journals (Sweden)

    Aghil Habibi Sola

    2007-10-01

    Full Text Available Objectives: As individuals live longer, health promotion behaviors get even more important, particularly with regard to maintaining functional independence and improving quality of life. The purpose of this study was to explore the relationship between health promotion behaviors and level of Activities of Daily Living (ADL and Instrumental Activities of Daily Living (IADL among elderly people in west region of Tehran. Methods & Materials: This was a descriptive-correlational study. A multi-stage sample of 410 community residents who were over 60 years old were selected from west region of Tehran. Participants who consented to participate in the study were interviewed with a structured questionnaire. The questionnaire consisted of 2-part; Health Promotion Behavior Checklist and questions related to status of physical functioning, which includes activities of daily living (ADLs and instrumental activities of daily living (IADLs. Descriptive statistics and T-test were used to data analysis. Results: The results of the study showed that there were significant relations between ADLs and ' exercise or walking', 'drinking milk, eating dairy and meat', 'eating vegetables and fruits', 'low salt diet' and 'low fat diet' (P<0.05. Furthermore there were significant relations between the IADLs and 'smoking cessation', 'alcohol abstinence', 'exercise or walking', 'drinking milk, eating dairy and meat', 'eating vegetables and fruits', 'low salt diet' and 'low fat diet' (P<0.05. Conclusion: Study showed, health promotion behaviors and level of ADL and IADL are related meaningfully. Health care professionals should enhance the physical functioning in elderly people by facilitating health promotion behaviors through formal health promotion programs which focus on regular diet, exercise, and regular physical check-ups which will maintain and increase a healthy and active life.

  12. Minimal changes in health status questionnaires: distinction between minimally detectable change and minimally important change

    Directory of Open Access Journals (Sweden)

    Knol Dirk L

    2006-08-01

    Full Text Available Abstract Changes in scores on health status questionnaires are difficult to interpret. Several methods to determine minimally important changes (MICs have been proposed which can broadly be divided in distribution-based and anchor-based methods. Comparisons of these methods have led to insight into essential differences between these approaches. Some authors have tried to come to a uniform measure for the MIC, such as 0.5 standard deviation and the value of one standard error of measurement (SEM. Others have emphasized the diversity of MIC values, depending on the type of anchor, the definition of minimal importance on the anchor, and characteristics of the disease under study. A closer look makes clear that some distribution-based methods have been merely focused on minimally detectable changes. For assessing minimally important changes, anchor-based methods are preferred, as they include a definition of what is minimally important. Acknowledging the distinction between minimally detectable and minimally important changes is useful, not only to avoid confusion among MIC methods, but also to gain information on two important benchmarks on the scale of a health status measurement instrument. Appreciating the distinction, it becomes possible to judge whether the minimally detectable change of a measurement instrument is sufficiently small to detect minimally important changes.

  13. Waste minimization handbook, Volume 1

    International Nuclear Information System (INIS)

    Boing, L.E.; Coffey, M.J.

    1995-12-01

    This technical guide presents various methods used by industry to minimize low-level radioactive waste (LLW) generated during decommissioning and decontamination (D and D) activities. Such activities generate significant amounts of LLW during their operations. Waste minimization refers to any measure, procedure, or technique that reduces the amount of waste generated during a specific operation or project. Preventive waste minimization techniques implemented when a project is initiated can significantly reduce waste. Techniques implemented during decontamination activities reduce the cost of decommissioning. The application of waste minimization techniques is not limited to D and D activities; it is also useful during any phase of a facility's life cycle. This compendium will be supplemented with a second volume of abstracts of hundreds of papers related to minimizing low-level nuclear waste. This second volume is expected to be released in late 1996

  14. Waste minimization handbook, Volume 1

    Energy Technology Data Exchange (ETDEWEB)

    Boing, L.E.; Coffey, M.J.

    1995-12-01

    This technical guide presents various methods used by industry to minimize low-level radioactive waste (LLW) generated during decommissioning and decontamination (D and D) activities. Such activities generate significant amounts of LLW during their operations. Waste minimization refers to any measure, procedure, or technique that reduces the amount of waste generated during a specific operation or project. Preventive waste minimization techniques implemented when a project is initiated can significantly reduce waste. Techniques implemented during decontamination activities reduce the cost of decommissioning. The application of waste minimization techniques is not limited to D and D activities; it is also useful during any phase of a facility`s life cycle. This compendium will be supplemented with a second volume of abstracts of hundreds of papers related to minimizing low-level nuclear waste. This second volume is expected to be released in late 1996.

  15. Minimal Webs in Riemannian Manifolds

    DEFF Research Database (Denmark)

    Markvorsen, Steen

    2008-01-01

    For a given combinatorial graph $G$ a {\\it geometrization} $(G, g)$ of the graph is obtained by considering each edge of the graph as a $1-$dimensional manifold with an associated metric $g$. In this paper we are concerned with {\\it minimal isometric immersions} of geometrized graphs $(G, g......)$ into Riemannian manifolds $(N^{n}, h)$. Such immersions we call {\\em{minimal webs}}. They admit a natural 'geometric' extension of the intrinsic combinatorial discrete Laplacian. The geometric Laplacian on minimal webs enjoys standard properties such as the maximum principle and the divergence theorems, which...... are of instrumental importance for the applications. We apply these properties to show that minimal webs in ambient Riemannian spaces share several analytic and geometric properties with their smooth (minimal submanifold) counterparts in such spaces. In particular we use appropriate versions of the divergence...

  16. Large-scale chromatin immunoprecipitation with promoter sequence microarray analysis of the interaction of the NSs protein of Rift Valley fever virus with regulatory DNA regions of the host genome.

    Science.gov (United States)

    Benferhat, Rima; Josse, Thibaut; Albaud, Benoit; Gentien, David; Mansuroglu, Zeyni; Marcato, Vasco; Souès, Sylvie; Le Bonniec, Bernard; Bouloy, Michèle; Bonnefoy, Eliette

    2012-10-01

    Rift Valley fever virus (RVFV) is a highly pathogenic Phlebovirus that infects humans and ruminants. Initially confined to Africa, RVFV has spread outside Africa and presently represents a high risk to other geographic regions. It is responsible for high fatality rates in sheep and cattle. In humans, RVFV can induce hepatitis, encephalitis, retinitis, or fatal hemorrhagic fever. The nonstructural NSs protein that is the major virulence factor is found in the nuclei of infected cells where it associates with cellular transcription factors and cofactors. In previous work, we have shown that NSs interacts with the promoter region of the beta interferon gene abnormally maintaining the promoter in a repressed state. In this work, we performed a genome-wide analysis of the interactions between NSs and the host genome using a genome-wide chromatin immunoprecipitation combined with promoter sequence microarray, the ChIP-on-chip technique. Several cellular promoter regions were identified as significantly interacting with NSs, and the establishment of NSs interactions with these regions was often found linked to deregulation of expression of the corresponding genes. Among annotated NSs-interacting genes were present not only genes regulating innate immunity and inflammation but also genes regulating cellular pathways that have not yet been identified as targeted by RVFV. Several of these pathways, such as cell adhesion, axonal guidance, development, and coagulation were closely related to RVFV-induced disorders. In particular, we show in this work that NSs targeted and modified the expression of genes coding for coagulation factors, demonstrating for the first time that this hemorrhagic virus impairs the host coagulation cascade at the transcriptional level.

  17. Regulation of ALF promoter activity in Xenopus oocytes.

    Directory of Open Access Journals (Sweden)

    Dan Li

    Full Text Available BACKGROUND: In this report we evaluate the use of Xenopus laevis oocytes as a matched germ cell system for characterizing the organization and transcriptional activity of a germ cell-specific X. laevis promoter. PRINCIPAL FINDINGS: The promoter from the ALF transcription factor gene was cloned from X. laevis genomic DNA using a PCR-based genomic walking approach. The endogenous ALF gene was characterized by RACE and RT-PCR for transcription start site usage, and by sodium bisulfite sequencing to determine its methylation status in somatic and oocyte tissues. Homology between the X. laevis ALF promoter sequence and those from human, chimpanzee, macaque, mouse, rat, cow, pig, horse, dog, chicken and X. tropicalis was relatively low, making it difficult to use such comparisons to identify putative regulatory elements. However, microinjected promoter constructs were very active in oocytes and the minimal promoter could be narrowed by PCR-mediated deletion to a region as short as 63 base pairs. Additional experiments using a series of site-specific promoter mutants identified two cis-elements within the 63 base pair minimal promoter that were critical for activity. Both elements (A and B were specifically recognized by proteins present in crude oocyte extracts based on oligonucleotide competition assays. The activity of promoter constructs in oocytes and in transfected somatic Xenopus XLK-WG kidney epithelial cells was quite different, indicating that the two cell types are not functionally equivalent and are not interchangeable as assay systems. CONCLUSIONS: Overall the results provide the first detailed characterization of the organization of a germ cell-specific Xenopus promoter and demonstrate the feasibility of using immature frog oocytes as an assay system for dissecting the biochemistry of germ cell gene regulation.

  18. Minimal Poems Written in 1979 Minimal Poems Written in 1979

    Directory of Open Access Journals (Sweden)

    Sandra Sirangelo Maggio

    2008-04-01

    Full Text Available The reading of M. van der Slice's Minimal Poems Written in 1979 (the work, actually, has no title reminded me of a book I have seen a long time ago. called Truth, which had not even a single word printed inside. In either case we have a sample of how often excentricities can prove efficient means of artistic creativity, in this new literary trend known as Minimalism. The reading of M. van der Slice's Minimal Poems Written in 1979 (the work, actually, has no title reminded me of a book I have seen a long time ago. called Truth, which had not even a single word printed inside. In either case we have a sample of how often excentricities can prove efficient means of artistic creativity, in this new literary trend known as Minimalism.

  19. The Effect of Point of Sale Promotions on the Alcohol Purchasing Behaviour of Young People in Metropolitan, Regional and Rural Australia

    Science.gov (United States)

    Jones, Sandra C.; Smith, Kylie M.

    2011-01-01

    This study, part of a larger project examining marketing and alcohol, looked specifically at the effects of point of sale (POS) promotions on young people, with a view to providing evidence which could be used to inform policy and regulation in this area. A series of focus groups were conducted in three different locations with young people aged…

  20. A 200 bp region of the pea ENOD12 promoter is sufficient for nodule-specific and nod factor induced expression

    DEFF Research Database (Denmark)

    Vijn, I; Christiansen, H; Lauridsen, P

    1995-01-01

    previously described. The isolation and characterization of a PsENOD12A genomic clone is presented in this paper. By using a Vicia hirsuta-Agrobacterium rhizogenes transformation system it is shown that both genes have a similar expression pattern in transgenic V. hirsuta root nodules. Promoter analyses...

  1. Domains of apolipoprotein E contributing to triglyceride and cholesterol homeostasis in vivo. Carboxyl-terminal region 203-299 promotes hepatic very low density lipoprotein-triglyceride secretion

    NARCIS (Netherlands)

    Kypreos, K.E.; Dijk, K.W. van; Zee, A. van der; Havekes, L.M.; Zannis, V.I.

    2001-01-01

    Apolipoprotein (apo) E has been implicated in cholesterol and triglyceride homeostasis in humans. At physiological concentration apoE promotes efficient clearance of apoE-containing lipoprotein remnants. However, high apoE plasma levels correlate with high plasma triglyceride levels. We have used

  2. Minimal Flavour Violation and Beyond

    CERN Document Server

    Isidori, Gino

    2012-01-01

    We review the formulation of the Minimal Flavour Violation (MFV) hypothesis in the quark sector, as well as some "variations on a theme" based on smaller flavour symmetry groups and/or less minimal breaking terms. We also review how these hypotheses can be tested in B decays and by means of other flavour-physics observables. The phenomenological consequences of MFV are discussed both in general terms, employing a general effective theory approach, and in the specific context of the Minimal Supersymmetric extension of the SM.

  3. Minimizing waste in environmental restoration

    International Nuclear Information System (INIS)

    Thuot, J.R.; Moos, L.

    1996-01-01

    Environmental restoration, decontamination and decommissioning, and facility dismantlement projects are not typically known for their waste minimization and pollution prevention efforts. Typical projects are driven by schedules and milestones with little attention given to cost or waste minimization. Conventional wisdom in these projects is that the waste already exists and cannot be reduced or minimized; however, there are significant areas where waste and cost can be reduced by careful planning and execution. Waste reduction can occur in three ways: beneficial reuse or recycling, segregation of waste types, and reducing generation of secondary waste

  4. Minimizing waste in environmental restoration

    International Nuclear Information System (INIS)

    Moos, L.; Thuot, J.R.

    1996-01-01

    Environmental restoration, decontamination and decommissioning and facility dismantelment projects are not typically known for their waste minimization and pollution prevention efforts. Typical projects are driven by schedules and milestones with little attention given to cost or waste minimization. Conventional wisdom in these projects is that the waste already exists and cannot be reduced or minimized. In fact, however, there are three significant areas where waste and cost can be reduced. Waste reduction can occur in three ways: beneficial reuse or recycling; segregation of waste types; and reducing generation of secondary waste. This paper will discuss several examples of reuse, recycle, segregation, and secondary waste reduction at ANL restoration programs

  5. An allelic polymorphism within the human tumor necrosis factor alpha promoter region is strongly associated with HLA A1, B8, and DR3 alleles

    NARCIS (Netherlands)

    Wilson, A. G.; de Vries, N. [=Niek; Pociot, F.; di Giovine, F. S.; van der Putte, L. B.; Duff, G. W.

    1993-01-01

    The tumor necrosis factor (TNF) alpha gene lies within the class III region of the major histocompatibility complex (MHC), telomeric to the class II and centromeric to the class I region. We have recently described the first polymorphism within the human TNF-alpha locus. This is biallelic and lies

  6. Sludge minimization technologies - an overview

    Energy Technology Data Exchange (ETDEWEB)

    Oedegaard, Hallvard

    2003-07-01

    The management of wastewater sludge from wastewater treatment plants represents one of the major challenges in wastewater treatment today. The cost of the sludge treatment amounts to more that the cost of the liquid in many cases. Therefore the focus on and interest in sludge minimization is steadily increasing. In the paper an overview is given for sludge minimization (sludge mass reduction) options. It is demonstrated that sludge minimization may be a result of reduced production of sludge and/or disintegration processes that may take place both in the wastewater treatment stage and in the sludge stage. Various sludge disintegration technologies for sludge minimization are discussed, including mechanical methods (focusing on stirred ball-mill, high-pressure homogenizer, ultrasonic disintegrator), chemical methods (focusing on the use of ozone), physical methods (focusing on thermal and thermal/chemical hydrolysis) and biological methods (focusing on enzymatic processes). (author)

  7. Wilson loops in minimal surfaces

    International Nuclear Information System (INIS)

    Drukker, Nadav; Gross, David J.; Ooguri, Hirosi

    1999-01-01

    The AdS/CFT correspondence suggests that the Wilson loop of the large N gauge theory with N = 4 supersymmetry in 4 dimensions is described by a minimal surface in AdS 5 x S 5 . The authors examine various aspects of this proposal, comparing gauge theory expectations with computations of minimal surfaces. There is a distinguished class of loops, which the authors call BPS loops, whose expectation values are free from ultra-violet divergence. They formulate the loop equation for such loops. To the extent that they have checked, the minimal surface in AdS 5 x S 5 gives a solution of the equation. The authors also discuss the zig-zag symmetry of the loop operator. In the N = 4 gauge theory, they expect the zig-zag symmetry to hold when the loop does not couple the scalar fields in the supermultiplet. They will show how this is realized for the minimal surface

  8. Classical strings and minimal surfaces

    International Nuclear Information System (INIS)

    Urbantke, H.

    1986-01-01

    Real Lorentzian forms of some complex or complexified Euclidean minimal surfaces are obtained as an application of H.A. Schwarz' solution to the initial value problem or a search for surfaces admitting a group of Poincare transformations. (Author)

  9. Minimal Gromov-Witten rings

    International Nuclear Information System (INIS)

    Przyjalkowski, V V

    2008-01-01

    We construct an abstract theory of Gromov-Witten invariants of genus 0 for quantum minimal Fano varieties (a minimal class of varieties which is natural from the quantum cohomological viewpoint). Namely, we consider the minimal Gromov-Witten ring: a commutative algebra whose generators and relations are of the form used in the Gromov-Witten theory of Fano varieties (of unspecified dimension). The Gromov-Witten theory of any quantum minimal variety is a homomorphism from this ring to C. We prove an abstract reconstruction theorem which says that this ring is isomorphic to the free commutative ring generated by 'prime two-pointed invariants'. We also find solutions of the differential equation of type DN for a Fano variety of dimension N in terms of the generating series of one-pointed Gromov-Witten invariants

  10. Wilson loops and minimal surfaces

    International Nuclear Information System (INIS)

    Drukker, Nadav; Gross, David J.; Ooguri, Hirosi

    1999-01-01

    The AdS-CFT correspondence suggests that the Wilson loop of the large N gauge theory with N=4 supersymmetry in four dimensions is described by a minimal surface in AdS 5 xS 5 . We examine various aspects of this proposal, comparing gauge theory expectations with computations of minimal surfaces. There is a distinguished class of loops, which we call BPS loops, whose expectation values are free from ultraviolet divergence. We formulate the loop equation for such loops. To the extent that we have checked, the minimal surface in AdS 5 xS 5 gives a solution of the equation. We also discuss the zigzag symmetry of the loop operator. In the N=4 gauge theory, we expect the zigzag symmetry to hold when the loop does not couple the scalar fields in the supermultiplet. We will show how this is realized for the minimal surface. (c) 1999 The American Physical Society

  11. Minimal string theory is logarithmic

    International Nuclear Information System (INIS)

    Ishimoto, Yukitaka; Yamaguchi, Shun-ichi

    2005-01-01

    We study the simplest examples of minimal string theory whose worldsheet description is the unitary (p,q) minimal model coupled to two-dimensional gravity ( Liouville field theory). In the Liouville sector, we show that four-point correlation functions of 'tachyons' exhibit logarithmic singularities, and that the theory turns out to be logarithmic. The relation with Zamolodchikov's logarithmic degenerate fields is also discussed. Our result holds for generic values of (p,q)

  12. Annual Waste Minimization Summary Report

    International Nuclear Information System (INIS)

    Haworth, D.M.

    2011-01-01

    This report summarizes the waste minimization efforts undertaken by National Security TechnoIogies, LLC, for the U. S. Department of Energy, National Nuclear Security Administration Nevada Site Office (NNSA/NSO), during calendar year 2010. The NNSA/NSO Pollution Prevention Program establishes a process to reduce the volume and toxicity of waste generated by NNSA/NSO activities and ensures that proposed methods of treatment, storage, and/or disposal of waste minimize potential threats to human health and the environment.

  13. Performance of health product risk management and surveillance conducted by health personnel at sub-district health promotion hospitals in the northeast region of Thailand

    OpenAIRE

    Kanjanarach, Tipaporn; Jaisa-ard, Raksaworn; Poonaovarat, Nantawan

    2014-01-01

    Tipaporn Kanjanarach,1,2 Raksaworn Jaisa-ard,1,2 Nantawan Poonaovarat3 1Faculty of Pharmaceutical Sciences, Khon Kaen University, Khon Kaen, Thailand; 2Center for Research and Development of Herbal Health Products, Khon Kaen University, Khon Kaen, Thailand; 3Health Consumer Protection, Chaiyapum Health Provincial Office, Chaiyapum, Thailand Background: Health personnel at sub-district health promotion hospitals (SD-HPHs) are assigned to take responsibility for 15 activities related to health...

  14. Commercial radioactive waste minimization program development guidance

    International Nuclear Information System (INIS)

    Fischer, D.K.

    1991-01-01

    This document is one of two prepared by the EG ampersand G Idaho, Inc., Waste Management Technical Support Program Group, National Low-Level Waste Management Program Unit. One of several Department of Energy responsibilities stated in the Amendments Act of 1985 is to provide technical assistance to compact regions Host States, and nonmember States (to the extent provided in appropriations acts) in establishing waste minimization program plans. Technical assistance includes, among other things, the development of technical guidelines for volume reduction options. Pursuant to this defined responsibility, the Department of Energy (through EG ampersand G Idaho, Inc.) has prepared this report, which includes guidance on defining a program, State/compact commission participation, and waste minimization program plans

  15. An HDAC2-TET1 switch at distinct chromatin regions significantly promotes the maturation of pre-iPS to iPS cells

    Science.gov (United States)

    Wei, Tingyi; Chen, Wen; Wang, Xiukun; Zhang, Man; Chen, Jiayu; Zhu, Songcheng; Chen, Long; Yang, Dandan; Wang, Guiying; Jia, Wenwen; Yu, Yangyang; Duan, Tao; Wu, Minjuan; Liu, Houqi; Gao, Shaorong; Kang, Jiuhong

    2015-01-01

    The maturation of induced pluripotent stem cells (iPS) is one of the limiting steps of somatic cell reprogramming, but the underlying mechanism is largely unknown. Here, we reported that knockdown of histone deacetylase 2 (HDAC2) specifically promoted the maturation of iPS cells. Further studies showed that HDAC2 knockdown significantly increased histone acetylation, facilitated TET1 binding and DNA demethylation at the promoters of iPS cell maturation-related genes during the transition of pre-iPS cells to a fully reprogrammed state. We also found that HDAC2 competed with TET1 in the binding of the RbAp46 protein at the promoters of maturation genes and knockdown of TET1 markedly prevented the activation of these genes. Collectively, our data not only demonstrated a novel intrinsic mechanism that the HDAC2-TET1 switch critically regulates iPS cell maturation, but also revealed an underlying mechanism of the interplay between histone acetylation and DNA demethylation in gene regulation. PMID:25934799

  16. Minimal but non-minimal inflation and electroweak symmetry breaking

    Energy Technology Data Exchange (ETDEWEB)

    Marzola, Luca [National Institute of Chemical Physics and Biophysics,Rävala 10, 10143 Tallinn (Estonia); Institute of Physics, University of Tartu,Ravila 14c, 50411 Tartu (Estonia); Racioppi, Antonio [National Institute of Chemical Physics and Biophysics,Rävala 10, 10143 Tallinn (Estonia)

    2016-10-07

    We consider the most minimal scale invariant extension of the standard model that allows for successful radiative electroweak symmetry breaking and inflation. The framework involves an extra scalar singlet, that plays the rôle of the inflaton, and is compatibile with current experimental bounds owing to the non-minimal coupling of the latter to gravity. This inflationary scenario predicts a very low tensor-to-scalar ratio r≈10{sup −3}, typical of Higgs-inflation models, but in contrast yields a scalar spectral index n{sub s}≃0.97 which departs from the Starobinsky limit. We briefly discuss the collider phenomenology of the framework.

  17. Characterization of a putative cis-regulatory element that controls transcriptional activity of the pig uroplakin II gene promoter

    International Nuclear Information System (INIS)

    Kwon, Deug-Nam; Park, Mi-Ryung; Park, Jong-Yi; Cho, Ssang-Goo; Park, Chankyu; Oh, Jae-Wook; Song, Hyuk; Kim, Jae-Hwan; Kim, Jin-Hoi

    2011-01-01

    Highlights: → The sequences of -604 to -84 bp of the pUPII promoter contained the region of a putative negative cis-regulatory element. → The core promoter was located in the 5F-1. → Transcription factor HNF4 can directly bind in the pUPII core promoter region, which plays a critical role in controlling promoter activity. → These features of the pUPII promoter are fundamental to development of a target-specific vector. -- Abstract: Uroplakin II (UPII) is a one of the integral membrane proteins synthesized as a major differentiation product of mammalian urothelium. UPII gene expression is bladder specific and differentiation dependent, but little is known about its transcription response elements and molecular mechanism. To identify the cis-regulatory elements in the pig UPII (pUPII) gene promoter region, we constructed pUPII 5' upstream region deletion mutants and demonstrated that each of the deletion mutants participates in controlling the expression of the pUPII gene in human bladder carcinoma RT4 cells. We also identified a new core promoter region and putative negative cis-regulatory element within a minimal promoter region. In addition, we showed that hepatocyte nuclear factor 4 (HNF4) can directly bind in the pUPII core promoter (5F-1) region, which plays a critical role in controlling promoter activity. Transient cotransfection experiments showed that HNF4 positively regulates pUPII gene promoter activity. Thus, the binding element and its binding protein, HNF4 transcription factor, may be involved in the mechanism that specifically regulates pUPII gene transcription.

  18. Using the ANGELO model to develop the children's healthy living program multilevel intervention to promote obesity preventing behaviors for young children in the U.S.-affiliated Pacific Region.

    Science.gov (United States)

    Braun, Kathryn L; Nigg, Claudio R; Fialkowski, Marie K; Butel, Jean; Hollyer, James R; Barber, L Robert; Bersamin, Andrea; Coleman, Patricia; Teo-Martin, Ursula; Vargo, Agnes M; Novotny, Rachel

    2014-12-01

    Almost 40% of children are overweight or obese by age 8 years in the US-Affiliated Pacific, inclusive of the five jurisdictions of Alaska, Hawaii, American Samoa, Guam, and the Commonwealth of the Northern Mariana Islands. This article describes how the Children's Healthy Living (CHL) Program used the ANGELO (Analysis Grid for Environments/Elements Linked to Obesity) model to design a regional intervention to increase fruit and vegetable intake, water consumption, physical activity, and sleep duration and decrease recreational screen time and sugar-sweetened beverage consumption in young children ages 2-8 years. Using the ANGELO model, CHL (1) engaged community to identify preferred intervention strategies, (2) reviewed scientific literature, (3) merged findings from community and literature, and (4) formulated the regional intervention. More than 900 community members across the Pacific helped identify intervention strategies on importance and feasibility. Nine common intervention strategies emerged. Participants supported the idea of a regional intervention while noting that cultural and resource differences would require flexibility in its implementation in the five jurisdictions. Community findings were merged with the effective obesity-reducing strategies identified in the literature, resulting in a regional intervention with four cross-cutting functions: (1) initiate or strengthen school wellness policies; (2) partner and advocate for environmental change; (3) promote CHL messages; and (4) train trainers to promote CHL behavioral objectives for children ages 2-8 years. These broad functions guided intervention activities and allowed communities to tailor activities to maximize intervention fit. Using the ANGELO model assured that the regional intervention was evidence based while recognizing jurisdiction context, which should increase effectiveness and sustainability.

  19. Minimal modification to tribimaximal mixing

    International Nuclear Information System (INIS)

    He Xiaogang; Zee, A.

    2011-01-01

    We explore some ways of minimally modifying the neutrino mixing matrix from tribimaximal, characterized by introducing at most one mixing angle and a CP violating phase thus extending our earlier work. One minimal modification, motivated to some extent by group theoretic considerations, is a simple case with the elements V α2 of the second column in the mixing matrix equal to 1/√(3). Modifications by keeping one of the columns or one of the rows unchanged from tribimaximal mixing all belong to the class of minimal modification. Some of the cases have interesting experimentally testable consequences. In particular, the T2K and MINOS collaborations have recently reported indications of a nonzero θ 13 . For the cases we consider, the new data sharply constrain the CP violating phase angle δ, with δ close to 0 (in some cases) and π disfavored.

  20. Topological gravity with minimal matter

    International Nuclear Information System (INIS)

    Li Keke

    1991-01-01

    Topological minimal matter, obtained by twisting the minimal N = 2 supeconformal field theory, is coupled to two-dimensional topological gravity. The free field formulation of the coupled system allows explicit representations of BRST charge, physical operators and their correlation functions. The contact terms of the physical operators may be evaluated by extending the argument used in a recent solution of topological gravity without matter. The consistency of the contact terms in correlation functions implies recursion relations which coincide with the Virasoro constraints derived from the multi-matrix models. Topological gravity with minimal matter thus provides the field theoretic description for the multi-matrix models of two-dimensional quantum gravity. (orig.)

  1. Minimal Marking: A Success Story

    Directory of Open Access Journals (Sweden)

    Anne McNeilly

    2014-11-01

    Full Text Available The minimal-marking project conducted in Ryerson’s School of Journalism throughout 2012 and early 2013 resulted in significantly higher grammar scores in two first-year classes of minimally marked university students when compared to two traditionally marked classes. The “minimal-marking” concept (Haswell, 1983, which requires dramatically more student engagement, resulted in more successful learning outcomes for surface-level knowledge acquisition than the more traditional approach of “teacher-corrects-all.” Results suggest it would be effective, not just for grammar, punctuation, and word usage, the objective here, but for any material that requires rote-memory learning, such as the Associated Press or Canadian Press style rules used by news publications across North America.

  2. The Role of National Human Rights Institutions (NHRIs) and Regional Networks in Promoting Human Rights and Health related to Sexual Orientation and Gender Identity (SOGI) in Southeast Asia

    NARCIS (Netherlands)

    Holzhacker, Ronald

    The UN is increasingly a place where a critical discussion about human rights and sexual orientation and gender identity is taking place. An important institutional component of the UN system of protection of human rights is the creation of National Human Rights Institutions (NHRIs). The regional

  3. Early life adversity and serotonin transporter gene variation interact to affect DNA methylation of the corticotropin-releasing factor gene promoter region in the adult rat brain

    NARCIS (Netherlands)

    Doelen, R.H.A. van der; Arnoldussen, I.A.C.; Ghareh, H.; Och, L. van; Homberg, J.R.; Kozicz, L.T.

    2015-01-01

    The interaction between childhood maltreatment and the serotonin transporter (5-HTT) gene linked polymorphic region has been associated with increased risk to develop major depression. This Gene x Environment interaction has furthermore been linked with increased levels of anxiety and glucocorticoid

  4. DOF-binding sites additively contribute to guard cell-specificity of AtMYB60 promoter

    Directory of Open Access Journals (Sweden)

    Cominelli Eleonora

    2011-11-01

    Full Text Available Abstract Background We previously demonstrated that the Arabidopsis thaliana AtMYB60 protein is an R2R3MYB transcription factor required for stomatal opening. AtMYB60 is specifically expressed in guard cells and down-regulated at the transcriptional levels by the phytohormone ABA. Results To investigate the molecular mechanisms governing AtMYB60 expression, its promoter was dissected through deletion and mutagenesis analyses. By studying different versions of AtMYB60 promoter::GUS reporter fusions in transgenic plants we were able to demonstrate a modular organization for the AtMYB60 promoter. Particularly we defined: a minimal promoter sufficient to confer guard cell-specific activity to the reporter gene; the distinct roles of different DOF-binding sites organised in a cluster in the minimal promoter in determining guard cell-specific expression; the promoter regions responsible for the enhancement of activity in guard cells; a promoter region responsible for the negative transcriptional regulation by ABA. Moreover from the analysis of single and multiple mutants we could rule out the involvement of a group of DOF proteins, known as CDFs, already characterised for their involvement in flowering time, in the regulation of AtMYB60 expression. Conclusions These findings shed light on the regulation of gene expression in guard cells and provide new promoter modules as useful tools for manipulating gene expression in guard cells, both for physiological studies and future biotechnological applications.

  5. Non-minimal inflation revisited

    International Nuclear Information System (INIS)

    Nozari, Kourosh; Shafizadeh, Somayeh

    2010-01-01

    We reconsider an inflationary model that inflaton field is non-minimally coupled to gravity. We study the parameter space of the model up to the second (and in some cases third) order of the slow-roll parameters. We calculate inflation parameters in both Jordan and Einstein frames, and the results are compared in these two frames and also with observations. Using the recent observational data from combined WMAP5+SDSS+SNIa datasets, we study constraints imposed on our model parameters, especially the non-minimal coupling ξ.

  6. Minimal Flavor Constraints for Technicolor

    DEFF Research Database (Denmark)

    Sakuma, Hidenori; Sannino, Francesco

    2010-01-01

    We analyze the constraints on the the vacuum polarization of the standard model gauge bosons from a minimal set of flavor observables valid for a general class of models of dynamical electroweak symmetry breaking. We will show that the constraints have a strong impact on the self-coupling and mas......We analyze the constraints on the the vacuum polarization of the standard model gauge bosons from a minimal set of flavor observables valid for a general class of models of dynamical electroweak symmetry breaking. We will show that the constraints have a strong impact on the self...

  7. Harm minimization among teenage drinkers

    DEFF Research Database (Denmark)

    Jørgensen, Morten Hulvej; Curtis, Tine; Christensen, Pia Haudrup

    2007-01-01

    AIM: To examine strategies of harm minimization employed by teenage drinkers. DESIGN, SETTING AND PARTICIPANTS: Two periods of ethnographic fieldwork were conducted in a rural Danish community of approximately 2000 inhabitants. The fieldwork included 50 days of participant observation among 13....... In regulating the social context of drinking they relied on their personal experiences more than on formalized knowledge about alcohol and harm, which they had learned from prevention campaigns and educational programmes. CONCLUSIONS: In this study we found that teenagers may help each other to minimize alcohol...

  8. Health disparities among the western, central and eastern rural regions of China after a decade of health promotion and disease prevention programming.

    Science.gov (United States)

    Zhang, Xi-Fan; Tian, Xiang-Yang; Cheng, Yu-Lan; Feng, Zhan-Chun; Wang, Liang; Southerland, Jodi

    2015-08-01

    Health disparities between the western, central and eastern regions of rural China, and the impact of national health improvement policies and programming were assessed. A total of 400 counties were randomly sampled. ANOVA and Logistic regression modeling were employed to estimate differences in health outcomes and determinants. Significant differences were found between the western, central and eastern rural regions in community infrastructure and health outcomes. From 2000 to 2010, health indicators in rural China were improved significantly, and the infant mortality rate (IMR), maternal mortality rate (MMR) and under 5 mortality rate (U5MR) had fallen by 62.79%, 71.74% and 61.92%, respectively. Central rural China had the greatest decrease in IMR (65.05%); whereas, western rural China had the greatest reduction in MMR (72.99%) but smallest reduction in U5MR (57.36%). Despite these improvements, Logistic regression analysis showed regional differences in key health outcome indicators (odds ratios): IMR (central: 2.13; western: 5.31), U5MR (central: 2.25; western: 5.69), MMR (central: 1.94; western: 3.31), and prevalence of infectious diseases (central: 1.62; western: 3.58). The community infrastructure and health outcomes of the western and central rural regions of China have been improved markedly during the first decade of the 21st century. However, health disparities still exist across the three regions. National efforts to increase per capita income, community empowerment and mobilization, community infrastructure, capacity of rural health facilities, and health literacy would be effective policy options to attain health equity.

  9. [Clonage of the "malA" region of "Escherichia coli" K12: nucleotide sequence of the regulatory region and the promoters, identification and purification of the MalT-activator protein (author's transl)].

    Science.gov (United States)

    Raibaud, O; Débarbouillé, M; Cossart, P

    1982-01-01

    A 5,800-bp (base pair) HindIII-EcoRI DNA fragment containing malT, the positive regulator gene of the maltose regulon, and most of malP, the structural gene for maltodextrin phosphorylase, was cloned into pBR322. A sequence of 802 bp was established in a DNA segment containing the promotor for malPQ and the promoter for malT. A total of 611 bp separates the initiation codons for these two genes, which are transcribed in opposite directions. The malT product was identified as a 94,000 dalton polypeptide.

  10. Isoperimetric inequalities for minimal graphs

    International Nuclear Information System (INIS)

    Pacelli Bessa, G.; Montenegro, J.F.

    2007-09-01

    Based on Markvorsen and Palmer's work on mean time exit and isoperimetric inequalities we establish slightly better isoperimetric inequalities and mean time exit estimates for minimal graphs in N x R. We also prove isoperimetric inequalities for submanifolds of Hadamard spaces with tamed second fundamental form. (author)

  11. A Defense of Semantic Minimalism

    Science.gov (United States)

    Kim, Su

    2012-01-01

    Semantic Minimalism is a position about the semantic content of declarative sentences, i.e., the content that is determined entirely by syntax. It is defined by the following two points: "Point 1": The semantic content is a complete/truth-conditional proposition. "Point 2": The semantic content is useful to a theory of…

  12. Torsional Rigidity of Minimal Submanifolds

    DEFF Research Database (Denmark)

    Markvorsen, Steen; Palmer, Vicente

    2006-01-01

    We prove explicit upper bounds for the torsional rigidity of extrinsic domains of minimal submanifolds $P^m$ in ambient Riemannian manifolds $N^n$ with a pole $p$. The upper bounds are given in terms of the torsional rigidities of corresponding Schwarz symmetrizations of the domains in warped...

  13. The debate on minimal deterrence

    International Nuclear Information System (INIS)

    Arbatov, A.; Karp, R.C.; Toth, T.

    1993-01-01

    Revitalization of debates on minimal nuclear deterrence at the present time is induced by the end of the Cold War and a number of unilateral and bilateral actions by the great powers to curtail nuclear arms race and reduce nuclear weapons arsenals

  14. LLNL Waste Minimization Program Plan

    International Nuclear Information System (INIS)

    1990-01-01

    This document is the February 14, 1990 version of the LLNL Waste Minimization Program Plan (WMPP). The Waste Minimization Policy field has undergone continuous changes since its formal inception in the 1984 HSWA legislation. The first LLNL WMPP, Revision A, is dated March 1985. A series of informal revision were made on approximately a semi-annual basis. This Revision 2 is the third formal issuance of the WMPP document. EPA has issued a proposed new policy statement on source reduction and recycling. This policy reflects a preventative strategy to reduce or eliminate the generation of environmentally-harmful pollutants which may be released to the air, land surface, water, or ground water. In accordance with this new policy new guidance to hazardous waste generators on the elements of a Waste Minimization Program was issued. In response to these policies, DOE has revised and issued implementation guidance for DOE Order 5400.1, Waste Minimization Plan and Waste Reduction reporting of DOE Hazardous, Radioactive, and Radioactive Mixed Wastes, final draft January 1990. This WMPP is formatted to meet the current DOE guidance outlines. The current WMPP will be revised to reflect all of these proposed changes when guidelines are established. Updates, changes and revisions to the overall LLNL WMPP will be made as appropriate to reflect ever-changing regulatory requirements. 3 figs., 4 tabs

  15. Minimizing TLD-DRD differences

    International Nuclear Information System (INIS)

    Riley, D.L.; McCoy, R.A.; Connell, W.D.

    1987-01-01

    When substantial differences exist in exposures recorded by TLD's and DRD's, it is often necessary to perform an exposure investigation to reconcile the difference. In working with several operating plants, the authors have observed a number of causes for these differences. This paper outlines these observations and discusses procedures that can be used to minimize them

  16. Acquiring minimally invasive surgical skills

    NARCIS (Netherlands)

    Hiemstra, Ellen

    2012-01-01

    Many topics in surgical skills education have been implemented without a solid scientific basis. For that reason we have tried to find this scientific basis. We have focused on training and evaluation of minimally invasive surgical skills in a training setting and in practice in the operating room.

  17. Geothermal development promotion survey report. No. 26. Akan region; 1988-1991 chinetsu kaihatsu sokushin chosa hokokusho. No. 26 Akan chiiki

    Energy Technology Data Exchange (ETDEWEB)

    NONE

    1992-03-01

    The results of surveys conducted in the Akan region, Hokkaido, in fiscal 1988-1990 are compiled in this report. Conducted were a geological/alteration zone survey, geochemical survey, gravity prospecting, electromagnetic surveillance (simplified magnetotelluric method), electric prospecting (Schlumberger method), electric prospecting (mise-a-la-masse method), heat flow rate survey, test boring, geothermal water survey, environmental impact survey, and so forth. The surveys resulted in conclusions mentioned below. Fractures running NE-SW are dominant, and those closely related to prominent geothermal signs are found in the Akan Seibu fault group in the western part of the Akan region. The test boring results show that there are high-temperature zones of 292.1 degrees C, 194.9 degrees C, and 245.9 degrees C. Geothermal fluids were discharged by well N2-AK-7 at a rate of 4.7-4.8 t/h in steam and 0.3-0.4 t/h in neutral SO{sub 4}-HCO{sub 3} type geothermal water. High-temperature steam-dominated geothermal resources are expected to exist deep in the ground in this region, and the area where the Akan Seibu fault group is distributed may be named as a location containing promising geothermal resources. (NEDO)

  18. Report of the researcher exchange promotion project on the environmental issues in the Asia-Pacific region; Asia/Taiheiyo chiiki kankyo mondai kenkyusha koryu sokushin jigyo hokokusho

    Energy Technology Data Exchange (ETDEWEB)

    NONE

    1997-03-01

    Proposals have been made for the establishment of a network (ETERNET-APR) linking those involved in the research and development of environmental technology in the Asia-Pacific region in order to limit the environmental impact of industrial activity. By pursuing active exchanges of information and personnel, researchers in environmental technology in the Asia-Pacific region have been making serious efforts to establish such a network. This fiscal year, the Internet Web site of the ETERNET-APR has been created using the data collected to date. This database includes information on some 350 researchers and 200 research projects from seven countries. The first international symposium was successfully held at Environmental Research Institute of Chulalongkorn University in Thailand (ERIC), hosting 200 environmental researchers from 10 countries in the Asia-Pacific region. Tripartite sister laboratories ties among the National Institute for Resources and Environment (NIRE) and three Korean laboratories were forged. The sister laboratory project between ICETT and ERIC is also proving effective. These successes prove that intraregional joint research, the objective of ETERNET-APR, has begun to take shape in this year

  19. Hazardous waste minimization tracking system

    International Nuclear Information System (INIS)

    Railan, R.

    1994-01-01

    Under RCRA section 3002 9(b) and 3005f(h), hazardous waste generators and owners/operators of treatment, storage, and disposal facilities (TSDFs) are required to certify that they have a program in place to reduce the volume or quantity and toxicity of hazardous waste to the degree determined to be economically practicable. In many cases, there are environmental, as well as, economic benefits, for agencies that pursue pollution prevention options. Several state governments have already enacted waste minimization legislation (e.g., Massachusetts Toxic Use Reduction Act of 1989, and Oregon Toxic Use Reduction Act and Hazardous Waste Reduction Act, July 2, 1989). About twenty six other states have established legislation that will mandate some type of waste minimization program and/or facility planning. The need to address the HAZMIN (Hazardous Waste Minimization) Program at government agencies and private industries has prompted us to identify the importance of managing The HAZMIN Program, and tracking various aspects of the program, as well as the progress made in this area. The open-quotes WASTEclose quotes is a tracking system, which can be used and modified in maintaining the information related to Hazardous Waste Minimization Program, in a manageable fashion. This program maintains, modifies, and retrieves information related to hazardous waste minimization and recycling, and provides automated report generating capabilities. It has a built-in menu, which can be printed either in part or in full. There are instructions on preparing The Annual Waste Report, and The Annual Recycling Report. The program is very user friendly. This program is available in 3.5 inch or 5 1/4 inch floppy disks. A computer with 640K memory is required

  20. Single nucleotide polymorphisms in the promoter region of the IL1B gene influence outcome in multiple myeloma patients treated with high-dose chemotherapy independently of relapse treatment with thalidomide and bortezomib

    DEFF Research Database (Denmark)

    Vangsted, Annette J.; Klausen, Tobias W.; Abildgaard, Niels

    2011-01-01

    the impact on outcome of HDT, INF-α maintenance treatment, and treatment with thalidomide and bortezomib at relapse, in relation to the major identified functional polymorphisms in the promoter region of IL1B. The wild-type C-allele of IL1B C-3737T and non-carriage of the IL1B promoter haplotype TGT (−3737T...... carrying the wild-type C-allele of IL1B C-3737T (HR, 1.6 (1.1–2.4)). Furthermore, among INF-α treated patients, gene–gene interaction studies on IL1B C-3737T and NFКB1-94ins/del ATTG revealed a fourfold increase in TTF for homozygous carriers of wild-type alleles at both loci as compared to variant allele...... carriers at both loci. No relation to genotype and outcome was found for relapse patients treated with thalidomide or bortezomib. Our results indicate that a subpopulation of myeloma patients carrying the wild-type C-allele of IL1B C-3737T and non-carriers of the promoter haplotype TGT (−3737T, −1464G...

  1. An ethnographic action research study to investigate the experiences of Bindjareb women participating in the cooking and nutrition component of an Aboriginal health promotion programme in regional Western Australia.

    Science.gov (United States)

    Nilson, Caroline; Kearing-Salmon, Karrie-Anne; Morrison, Paul; Fetherston, Catherine

    2015-12-01

    To investigate the experiences of women participating in a cooking and nutrition component of a health promotion research initiative in an Australian Aboriginal regional community. Weekly facilitated cooking and nutrition classes were conducted during school terms over 12 months. An ethnographic action research study was conducted for the programme duration with data gathered by participant and direct observation, four yarning groups and six individual yarning sessions. The aim was to determine the ways the cooking and nutrition component facilitated lifestyle change, enabled engagement, encouraged community ownership and influenced community action. Regional Bindjareb community in the Nyungar nation of Western Australia. A sample of seventeen Aboriginal women aged between 18 and 60 years from the two kinships in two towns in one shire took part in the study. The recruitment and consent process was managed by community Elders and leaders. Major themes emerged highlighting the development of participants and their recognition of the need for change: the impact of history on current nutritional health of Indigenous Australians; acknowledging shame; challenges of change around nutrition and healthy eating; the undermining effect of mistrust and limited resources; the importance of community control when developing health promotion programmes; finding life purpose through learning; and the need for planning and partnerships to achieve community determination. Suggested principles for developing cooking and nutrition interventions are: consideration of community needs; understanding the impact of historical factors on health; understanding family and community tensions; and the engagement of long-term partnerships to develop community determination.

  2. SRSF1-3 contributes to diversification of the immunoglobulin variable region gene by promoting accumulation of AID in the nucleus

    OpenAIRE

    Kawaguchi, Yuka; Nariki, Hiroaki; Kawamoto, Naoko; Kanehiro, Yuichi; Miyazaki, Satoshi; Suzuki, Mari; Magari, Masaki; Tokumitsu, Hiroshi; Kanayama, Naoki

    2017-01-01

     Activation-induced cytidine deaminase (AID) is essential for diversification of the Ig variable region (IgV). AID is excluded from the nucleus, where it normally functions. However, the molecular mechanisms responsible for regulating AID localization remain to be elucidated. The SR-protein splicing factor SRSF1 is a nucleocytoplasmic shuttling protein, a splicing isoform of which called SRSF1-3, has previously been shown to contribute to IgV diversification in chicken DT40 cells. In this stu...

  3. Investigation of -308G>A and -1031T>C polymorphisms in the TNFA promoter region in Polish peptic ulcer patients.

    Science.gov (United States)

    Sałagacka, Aleksandra; Żebrowska, Marta; Jeleń, Agnieszka; Mirowski, Marek; Balcerczak, Ewa

    2014-11-01

    Tumor necrosis factor α (TNF-α) encoded by TNFA is a key mediator in inflammation, a precursor condition for peptic ulceration. Promoter polymorphisms of TNFA that influence its transcriptional activity and TNF-α production are known. TNFA-308G>A (rs1800629) and TNFA-1031T>C (rs1799964), which are responsible for increased TNFA transcription, could influence the risk of peptic ulceration. This study aimed to investigate these polymorphisms and to evaluate their association with peptic ulcer disease and Helicobacter pylori infection in the Polish population. Gastric mucosa specimens obtained from 177 Polish peptic ulcer patients were used to conduct rapid urease tests and to assess the investigated polymorphisms by polymerase chain reaction-restriction fragment length polymorphism. Genotyping data were compared with the results obtained from healthy individuals of Polish origin. There were no significant differences in genotype and allele frequency of the investigated polymorphisms between peptic ulcer patients and healthy individuals. No associations between the frequencies of particular genotypes and alleles for both single-nucleotide polymorphisms (SNPs) and the presence of H. pylori infection in peptic ulcer patients and in subgroups of men and women with peptic ulcer disease were found. The investigated SNPs are not risk factors for either peptic ulcer or H. pylori infection development in the Polish population. The results require verification in a larger cohort.

  4. Geothermal development promotion survey report. No. 25. Hishikari region; 1987-1989 chinetsu kaihatsu sokushin chosa hokokusho. No. 22 Hishikari chiiki

    Energy Technology Data Exchange (ETDEWEB)

    NONE

    1990-03-01

    The results of surveys conducted in the Hishikari region, Kagoshima Prefecture, in fiscal 1987-1989 are compiled in this report. Conducted were a geological/alteration zone survey, geochemical survey, electric prospecting, electromagnetic surveillance, gravity prospecting, heat flow rate survey, test boring, environmental impact survey, and so forth. The surveys resulted in conclusions mentioned below. According to the underground temperature distribution based on the results of the heat flow rate survey, test boring, and so forth, temperature is low at the western part of the Hishikari region where there is a low gravity anomaly and high in the zone in the ENE-WSW direction where there is a high gravity anomaly. The present ground temperature is lower than the fluid inclusion homogenization temperature by approximately 120-140 degrees C. It is deduced that the geothermal water reservoir lies in the Quatenary volcanic rocks or in a fracture zone that develops in the Shimanto supergroup. It is inferred that the geothermal water producing the hot spring water all originates in meteoric water staying long in the ground. It is also inferred that volcanic gas or the like contributes but a little to the formation of the geothermal system but that the contribution is great of the heat supplied from the magma pool. (NEDO)

  5. Geothermal development promotion survey report. No. 28. Eastern part of Obanazawa region; 1988-1990 chinetsu kaihatsu sokushin chosa hokokusho. No. 28 Obanazawa tobu chiiki

    Energy Technology Data Exchange (ETDEWEB)

    NONE

    1991-03-01

    The results of surveys conducted in the eastern part of Obanazawa region, Yamagata Prefecture, in fiscal 1988-1989 are compiled in this report. Conducted were a geological/alteration zone survey, geochemical survey, electromagnetic surveillance (TDEM - time domain electromagnetic method), gravity prospecting (review of gravity data), electric prospecting (Schlumberger method), heat flow rate survey, test boring, environmental impact survey, and so forth. Conclusions are mentioned below. It is inferred that the water of the Ginzan hot spring of the neutral Cl-SO{sub 4} type originates in meteoric water in mountains high above the mean sea level in the western side and that the hot spring water is produced when water heated to approximately 170 degrees C at a depth (1,500-2,000 meters below mean sea level) in the Ginzan hot spring district, where the ground temperature is the highest in this region, is diluted by groundwater near the surface at its ultimate stage of ascent. The survey results disclose that possibilities are quite low that a high-temperature sector of 200 degrees C or higher is found at a level not deeper than 2,000 meters from the ground surface. Accordingly, no geothermal development by flash steam power generation is feasible at the present stage at any economically acceptable depth. (NEDO)

  6. Geothermal development promotion survey report. No. 29. Upper reach region of Oita river; 1988-1990 chinetsu kaihatsu sokushin chosa hokokusho. No. 29 Oitagawa joryu chiiki

    Energy Technology Data Exchange (ETDEWEB)

    NONE

    1991-03-01

    The results of surveys conducted in the Oita river region, Oita Prefecture, in fiscal 1988-1989 are compiled in this report. Conducted were a geological/alteration zone survey, geochemical survey, electric prospecting (Schlumberger method), electromagnetic surveillance (simplified magnetotelluric method), electromagnetic surveillance (EMAP - Environmental Monitoring and Assessment Program method), heat flow rate survey, test boring, environmental impact survey, and so forth. Conclusions are mentioned below. It is inferred that the geothermal fluid results from groundwater originating in meteoric water, that the meteoric water takes many years to flow from the mountainous region into the ground where it is stored mainly in the Shonai stratum, that the stored water is warmed by heat from rocks in the neighborhood for development into a geothermal fluid, and that the geothermal fluid finally forms a hot spring water reservoir. Hot spring water reservoirs are found widely distributed in the basin of the Oita river. In view of the ground temperature distribution and the hot spring water geochemical temperature determined by structure boring, it is concluded that possibilities are quite low that there exists a high-temperature geothermal fluid usable for power generation. (NEDO)

  7. Minimalism and the Pragmatic Frame

    Directory of Open Access Journals (Sweden)

    Ana Falcato

    2016-02-01

    Full Text Available In the debate between literalism and contextualism in semantics, Kent Bach’s project is often taken to stand on the latter side of the divide. In this paper I argue this is a misleading assumption and justify it by contrasting Bach’s assessment of the theoretical eliminability of minimal propositions arguably expressed by well-formed sentences with standard minimalist views, and by further contrasting his account of the division of interpretative processes ascribable to the semantics and pragmatics of a language with a parallel analysis carried out by the most radical opponent to semantic minimalism, i.e., by occasionalism. If my analysis proves right, the sum of its conclusions amounts to a refusal of Bach’s main dichotomies.

  8. Serotonin transporter promoter region (5-HTTLPR) polymorphism is associated with the intravaginal ejaculation latency time in Dutch men with lifelong premature ejaculation.

    Science.gov (United States)

    Janssen, Paddy K C; Bakker, Steven C; Réthelyi, Janos; Zwinderman, Aeilko H; Touw, Daan J; Olivier, Berend; Waldinger, Marcel D

    2009-01-01

    Lifelong premature ejaculation (LPE) is characterized by persistent intravaginal ejaculation latency times (IELTs) of less than 1 minute, and has been postulated as a neurobiological dysfunction with genetic vulnerability for the short IELTs, related to disturbances of central serotonin (5-hydroxytryptamine [5-HT]) neurotransmission and 5-HT receptor functioning. To investigate the relationship between 5-HT transporter gene-linked polymorphism (5-HTTLPR) and short IELTs in men with lifelong PE. A prospective study was conducted in 89 Dutch Caucasian men with lifelong PE. IELT during coitus was assessed by stopwatch over a 1-month period. Controls consisted of 92 Dutch Caucasian men. All men with LPE were genotyped for a 5-HTT-promoter polymorphism. Allele frequencies and genotypes of short (S) and long (L) variants of 5-HTTLPR polymorphism were compared between patients and controls. Association between LL, SL, and SS genotypes, and the natural logarithm of the IELT in men with LPE was investigated. IELT measured by stopwatch, 5-HTTLPR polymorphism. In men with lifelong PE, the geometric mean, median, and natural mean IELTs were 21, 26, and 32 seconds, respectively. There were no significant differences in the 5-HTT polymorphism alleles and genotypes between 89 Dutch Caucasian men with LPE (S 47%, L 53%/LL 29%, SL 48%, SS 22%) and 92 Dutch Caucasian controls (S 48%, L 52%/LL 29%, SL 45%, SS 26%). In men with lifelong PE there was a statistically significant difference between LL, SL, and SS genotypes in their geometric mean IELT (P IELTs than the SS and SL genotypes. The 5-HTTLPR polymorphism is associated with significant effects on the latency to ejaculate in men with lifelong PE. Men with SS and SL genotypes have 100% and 90% longer ejaculation time, respectively than men with LL genotypes.

  9. Principle of minimal work fluctuations.

    Science.gov (United States)

    Xiao, Gaoyang; Gong, Jiangbin

    2015-08-01

    Understanding and manipulating work fluctuations in microscale and nanoscale systems are of both fundamental and practical interest. For example, in considering the Jarzynski equality 〈e-βW〉=e-βΔF, a change in the fluctuations of e-βW may impact how rapidly the statistical average of e-βW converges towards the theoretical value e-βΔF, where W is the work, β is the inverse temperature, and ΔF is the free energy difference between two equilibrium states. Motivated by our previous study aiming at the suppression of work fluctuations, here we obtain a principle of minimal work fluctuations. In brief, adiabatic processes as treated in quantum and classical adiabatic theorems yield the minimal fluctuations in e-βW. In the quantum domain, if a system initially prepared at thermal equilibrium is subjected to a work protocol but isolated from a bath during the time evolution, then a quantum adiabatic process without energy level crossing (or an assisted adiabatic process reaching the same final states as in a conventional adiabatic process) yields the minimal fluctuations in e-βW, where W is the quantum work defined by two energy measurements at the beginning and at the end of the process. In the classical domain where the classical work protocol is realizable by an adiabatic process, then the classical adiabatic process also yields the minimal fluctuations in e-βW. Numerical experiments based on a Landau-Zener process confirm our theory in the quantum domain, and our theory in the classical domain explains our previous numerical findings regarding the suppression of classical work fluctuations [G. Y. Xiao and J. B. Gong, Phys. Rev. E 90, 052132 (2014)].

  10. Optimizing Processes to Minimize Risk

    Science.gov (United States)

    Loyd, David

    2017-01-01

    NASA, like the other hazardous industries, has suffered very catastrophic losses. Human error will likely never be completely eliminated as a factor in our failures. When you can't eliminate risk, focus on mitigating the worst consequences and recovering operations. Bolstering processes to emphasize the role of integration and problem solving is key to success. Building an effective Safety Culture bolsters skill-based performance that minimizes risk and encourages successful engagement.

  11. Minimal Length, Measurability and Gravity

    Directory of Open Access Journals (Sweden)

    Alexander Shalyt-Margolin

    2016-03-01

    Full Text Available The present work is a continuation of the previous papers written by the author on the subject. In terms of the measurability (or measurable quantities notion introduced in a minimal length theory, first the consideration is given to a quantum theory in the momentum representation. The same terms are used to consider the Markov gravity model that here illustrates the general approach to studies of gravity in terms of measurable quantities.

  12. [Minimally invasive coronary artery surgery].

    Science.gov (United States)

    Zalaquett, R; Howard, M; Irarrázaval, M J; Morán, S; Maturana, G; Becker, P; Medel, J; Sacco, C; Lema, G; Canessa, R; Cruz, F

    1999-01-01

    There is a growing interest to perform a left internal mammary artery (LIMA) graft to the left anterior descending coronary artery (LAD) on a beating heart through a minimally invasive access to the chest cavity. To report the experience with minimally invasive coronary artery surgery. Analysis of 11 patients aged 48 to 79 years old with single vessel disease that, between 1996 and 1997, had a LIMA graft to the LAD performed through a minimally invasive left anterior mediastinotomy, without cardiopulmonary bypass. A 6 to 10 cm left parasternal incision was done. The LIMA to the LAD anastomosis was done after pharmacological heart rate and blood pressure control and a period of ischemic pre conditioning. Graft patency was confirmed intraoperatively by standard Doppler techniques. Patients were followed for a mean of 11.6 months (7-15 months). All patients were extubated in the operating room and transferred out of the intensive care unit on the next morning. Seven patients were discharged on the third postoperative day. Duplex scanning confirmed graft patency in all patients before discharge; in two patients, it was confirmed additionally by arteriography. There was no hospital mortality, no perioperative myocardial infarction and no bleeding problems. After follow up, ten patients were free of angina, in functional class I and pleased with the surgical and cosmetic results. One patient developed atypical angina on the seventh postoperative month and a selective arteriography confirmed stenosis of the anastomosis. A successful angioplasty of the original LAD lesion was carried out. A minimally invasive left anterior mediastinotomy is a good surgical access to perform a successful LIMA to LAD graft without cardiopulmonary bypass, allowing a shorter hospital stay and earlier postoperative recovery. However, a larger experience and a longer follow up is required to define its role in the treatment of coronary artery disease.

  13. Minimal massive 3D gravity

    International Nuclear Information System (INIS)

    Bergshoeff, Eric; Merbis, Wout; Hohm, Olaf; Routh, Alasdair J; Townsend, Paul K

    2014-01-01

    We present an alternative to topologically massive gravity (TMG) with the same ‘minimal’ bulk properties; i.e. a single local degree of freedom that is realized as a massive graviton in linearization about an anti-de Sitter (AdS) vacuum. However, in contrast to TMG, the new ‘minimal massive gravity’ has both a positive energy graviton and positive central charges for the asymptotic AdS-boundary conformal algebra. (paper)

  14. Construction schedules slack time minimizing

    Science.gov (United States)

    Krzemiński, Michał

    2017-07-01

    The article presents two copyright models for minimizing downtime working brigades. Models have been developed for construction schedules performed using the method of work uniform. Application of flow shop models is possible and useful for the implementation of large objects, which can be divided into plots. The article also presents a condition describing gives which model should be used, as well as a brief example of optimization schedule. The optimization results confirm the legitimacy of the work on the newly-developed models.

  15. Acquiring minimally invasive surgical skills

    OpenAIRE

    Hiemstra, Ellen

    2012-01-01

    Many topics in surgical skills education have been implemented without a solid scientific basis. For that reason we have tried to find this scientific basis. We have focused on training and evaluation of minimally invasive surgical skills in a training setting and in practice in the operating room. This thesis has led to an enlarged insight in the organization of surgical skills training during residency training of surgical medical specialists.

  16. A Salmonella typhimurium-translocated Glycerophospholipid:Cholesterol Acyltransferase Promotes Virulence by Binding to the RhoA Protein Switch Regions

    Energy Technology Data Exchange (ETDEWEB)

    LaRock, Doris L.; Brzovic, Peter S.; Levin, Itay; Blanc, Marie-Pierre; Miller, Samuel I.

    2012-08-24

    Salmonella enterica serovar typhimurium translocates a glycerophospholipid: cholesterol acyltransferase (SseJ) into the host cytosol after its entry into mammalian cells. SseJ is recruited to the cytoplasmic face of the host cell phagosome membrane where it is activated upon binding the small GTPase, RhoA. SseJ is regulated similarly to cognate eukaryotic effectors, as only the GTP-bound form of RhoA family members stimulates enzymatic activity. Using NMR and biochemistry, this work demonstrates that SseJ competes effectively with Rhotekin, ROCK, and PKN1 in binding to a similar RhoA surface. The RhoA surface that binds SseJ includes the regulatory switch regions that control activation of mammalian effectors. These data were used to create RhoA mutants with altered SseJ binding and activation. This structure-function analysis supports a model in which SseJ activation occurs predominantly through binding to residues within switch region II. We further defined the nature of the interaction between SseJ and RhoA by constructing SseJ mutants in the RhoA binding surface. These data indicate that SseJ binding to RhoA is required for recruitment of SseJ to the endosomal network and for full Salmonella virulence for inbred susceptible mice, indicating that regulation of SseJ by small GTPases is an important virulence strategy of this bacterial pathogen. The dependence of a bacterial effector on regulation by a mammalian GTPase defines further how intimately host pathogen interactions have coevolved through similar and divergent evolutionary strategies.

  17. Health Promotion

    DEFF Research Database (Denmark)

    Povlsen, Lene; Borup, I.

    2015-01-01

    and Adolescent Health Promotion', Salutogenesis - from theory to practice' and Health, Stress and Coping'. More than half of all doctoral theses undertaken at NHV during these years had health promotion as their theme. As a derivative, the Nordic Health Promotion Research Network (NHPRN) was established in 2007......In 1953 when the Nordic School of Public Health was founded, the aim of public health programmes was disease prevention more than health promotion. This was not unusual, since at this time health usually was seen as the opposite of disease and illness. However, with the Ottawa Charter of 1986......, the World Health Organization made a crucial change to view health not as a goal in itself but as the means to a full life. In this way, health promotion became a first priority and fundamental action for the modern society. This insight eventually reached NHV and in 2002 - 50 years after the foundation...

  18. Sensitivity of MLL-rearranged AML cells to all-trans retinoic acid is associated with the level of H3K4me2 in the RARα promoter region

    International Nuclear Information System (INIS)

    Sakamoto, K; Imamura, T; Yano, M; Yoshida, H; Fujiki, A; Hirashima, Y; Hosoi, H

    2014-01-01

    All-trans retinoic acid (ATRA) is well established as differentiation therapy for acute promyelocytic leukemia (APL) in which the PML–RARα (promyelocytic leukemia-retinoic acid receptor α) fusion protein causes blockade of the retinoic acid (RA) pathway; however, in types of acute myeloid leukemia (AML) other than APL, the mechanism of RA pathway inactivation is not fully understood. This study revealed the potential mechanism of high ATRA sensitivity of mixed-lineage leukemia (MLL)-AF9-positive AML compared with MLL-AF4/5q31-positive AML. Treatment with ATRA induced significant myeloid differentiation accompanied by upregulation of RARα, C/EBPα, C/EBPε and PU.1 in MLL-AF9-positive but not in MLL-AF4/5q31-positive cells. Combining ATRA with cytarabine had a synergistic antileukemic effect in MLL-AF9-positive cells in vitro. The level of dimethyl histone H3 lysine 4 (H3K4me2) in the RARα gene-promoter region, PU.1 upstream regulatory region (URE) and RUNX1+24/+25 intronic enhancer was higher in MLL-AF9-positive cells than in MLL-AF4-positive cells, and inhibiting lysine-specific demethylase 1, which acts as a histone demethylase inhibitor, reactivated ATRA sensitivity in MLL-AF4-positive cells. These findings suggest that the level of H3K4me2 in the RARα gene-promoter region, PU.1 URE and RUNX1 intronic enhancer is determined by the MLL-fusion partner. Our findings provide insight into the mechanisms of ATRA sensitivity in AML and novel treatment strategies for ATRA-resistant AML

  19. MinGenome: An In Silico Top-Down Approach for the Synthesis of Minimized Genomes.

    Science.gov (United States)

    Wang, Lin; Maranas, Costas D

    2018-02-16

    Genome minimized strains offer advantages as production chassis by reducing transcriptional cost, eliminating competing functions and limiting unwanted regulatory interactions. Existing approaches for identifying stretches of DNA to remove are largely ad hoc based on information on presumably dispensable regions through experimentally determined nonessential genes and comparative genomics. Here we introduce a versatile genome reduction algorithm MinGenome that implements a mixed-integer linear programming (MILP) algorithm to identify in size descending order all dispensable contiguous sequences without affecting the organism's growth or other desirable traits. Known essential genes or genes that cause significant fitness or performance loss can be flagged and their deletion can be prohibited. MinGenome also preserves needed transcription factors and promoter regions ensuring that retained genes will be properly transcribed while also avoiding the simultaneous deletion of synthetic lethal pairs. The potential benefit of removing even larger contiguous stretches of DNA if only one or two essential genes (to be reinserted elsewhere) are within the deleted sequence is explored. We applied the algorithm to design a minimized E. coli strain and found that we were able to recapitulate the long deletions identified in previous experimental studies and discover alternative combinations of deletions that have not yet been explored in vivo.

  20. Use of porous silicon to minimize oxidation induced stacking fault defects in silicon

    International Nuclear Information System (INIS)

    Shieh, S.Y.; Evans, J.W.

    1992-01-01

    This paper presents methods for minimizing stacking fault defects, generated during oxidation of silicon, include damaging the back of the wafer or depositing poly-silicon on the back. In either case a highly defective structure is created and this is capable of gettering either self-interstitials or impurities which promote nucleation of stacking fault defects. A novel method of minimizing these defects is to form a patch of porous silicon on the back of the wafer by electrochemical etching. Annealing under inert gas prior to oxidation may then result in the necessary gettering. Experiments were carried out in which wafers were subjected to this treatment. Subsequent to oxidation, the wafers were etched to remove oxide and reveal defects. The regions of the wafer adjacent to the porous silicon patch were defect-free, whereas remote regions had defects. Deep level transient spectroscopy has been used to examine the gettering capability of porous silicon, and the paper discusses the mechanism by which the porous silicon getters

  1. Fish but Not Macroinvertebrates Promote Trophic Cascading Effects in High Density Submersed Plant Experimental Lake Food Webs in Two Contrasting Climate Regions

    Directory of Open Access Journals (Sweden)

    Carlos Iglesias

    2017-07-01

    Full Text Available Predators play a key role in the functioning of shallow lakes. Differences between the response of temperate and subtropical systems to fish predation have been proposed, but experimental evidence is scarce. To elucidate cascading effects produced by predators in contrasting climatic zones, we conducted a mesocosm experiment in three pairs of lakes in Uruguay and Denmark. We used two typical planktivorous-omnivorous fish species (Jenynsia multidentata + Cnesterodon decemmaculatus and Gasterosteus aculeatus + Perca fluviatilis and one littoral omnivorous-predatory macroinvertebrate (Palaemonetes argentinus and Gammarus lacustris, alone and combined, in numbers resembling natural densities. Fish predation on zooplankton increased phytoplankton biomass in both climate zones, whereas the effects of predatory macroinvertebrates on zooplankton and phytoplankton were not significant in either climate zone. Macroinvertebrates (that freely colonized the sampling devices were diminished by fish in both climate areas; however, periphyton biomass did not vary among treatments. Our experiments demonstrated that fish affected the structure of both planktonic and littoral herbivorous communities in both climate regions, with a visible positive cascading effect on phytoplankton biomass, but no effects on periphyton. Altogether, fish impacts appeared to be a strong driver of turbid water conditions in shallow lakes regardless of climatic zone by indirectly contributing to increasing phytoplankton biomass.

  2. Geothermal development promotion survey report. No. 22. Noboribetsu region; 1987-1990 chinetsu kaihatsu sokushin chosa hokokusho. No. 22 Noboribetsu chiiki

    Energy Technology Data Exchange (ETDEWEB)

    NONE

    1991-03-01

    The results of surveys conducted in the Noboribetsu region, Hokkaido, in fiscal 1987-1989 are compiled in this report. Conducted in the surveys were a geological/alteration zone survey, geochemical survey, electromagnetic surveillance (simplified magnetotelluric method), electric prospecting (Schlumberger method), electric prospecting (mise-a-la-masse method), heat flow rate survey, structural boring, precision structural boring, environmental exploration well, geothermal water survey, environmental impact survey, and so forth. Conclusions reached on the basis of the survey results are described below. It is supposed that a horizon, positioned in the Osarugawa stratum in the Karls Noboribetsu zone or in a fissure system in the Omagarisawa stratum below the Osarugawa stratum, contains a geothermal reservoir. The hot water at the Noboribetsu hot spring originates in gas or geothermal water separated from the deep-seated geothermal water while that at the Karls hot spring or the like originates in meteoric water built up in higher places. Although an area abundant in geothermal fluids is supposed to exist in the Karls-Noboribetsu zone, yet a section located between the Karls-Noboribetsu zone and the Noboribetsu hot spring area also draws attention as a zone having a potential to store geothermal fluids. (NEDO)

  3. National promotional campaign

    Directory of Open Access Journals (Sweden)

    Pekevski Siniša

    2008-01-01

    Full Text Available Taking an attention to promotion as operational variable in marketing effort, author focused on so called ways of creating national images. As a case of very interesting activity paper discuss an experience of regional chamber of Croatia with activities in upgrading international recognition of national products as well as country as destination in such context.

  4. Minimal families of curves on surfaces

    KAUST Repository

    Lubbes, Niels

    2014-01-01

    A minimal family of curves on an embedded surface is defined as a 1-dimensional family of rational curves of minimal degree, which cover the surface. We classify such minimal families using constructive methods. This allows us to compute the minimal

  5. Report on fiscal 1995 project to promote an exchange of researchers on environmental problems in the Asia-Pacific region; 1995 nendo itakujigyo (Asia/Taiheiyo chiiki kankyo mondai kenkyusha koryu sokushin jigyo hokokusho)

    Energy Technology Data Exchange (ETDEWEB)

    NONE

    1996-03-01

    For the purpose of solving environmental problems caused in association with the increasing industrial activities in the Asia-Pacific region, the construction of a research network is being advanced aiming at promoting exchanges with researchers of other countries and activating information exchanges. Investigators were sent overseas to grasp the present situation, and researchers participated in a symposium on the APEC environmental technology cooperation for mutual understanding and personal interchange. In the overseas survey, visits were paid mainly to national research institutes and universities in India and Thailand. Positive approval was obtained on the construction of the ETERNET APR (Environmental Technology Research Network in the Asia-Pacific Region). In the symposium on the APEC environmental technology cooperation held in Nagoya, researchers participated mostly in the second session and made earnest discussions with researchers from other countries. The necessity and importance of the network was emphasized. Countries which participated the symposium have problems common to each, and it was greatly significant to meet together and discuss together. The environmental problem is on a global scale, and it is necessary to make close exchange/interchange of information/opinion on a long term basis and to tackle it in the whole Asia-Pacific region. 3 tabs.

  6. Achieve a Better Understanding of Cloud and Precipitation Processes for the Promotion of Water Security in Arid and Semi-Arid Regions

    Science.gov (United States)

    Farrah, S.; Al Yazidi, O.

    2016-12-01

    has been recently replaced by a new drive to solve the technical obstacles impeding its potential. There is now a real prospect that this science will come of age and play its rightful part in boosting sustainable water supplies for people at risk in arid and semi-arid regions of the world.

  7. Regionalism, Regionalization and Regional Development

    Directory of Open Access Journals (Sweden)

    Liviu C. Andrei

    2016-03-01

    Full Text Available Sustained development is a concept associating other concepts, in its turn, in the EU practice, e.g. regionalism, regionalizing and afferent policies, here including structural policies. This below text, dedicated to integration concepts, will limit on the other hand to regionalizing, otherwise an aspect typical to Europe and to the EU. On the other hand, two aspects come up to strengthen this field of ideas, i.e. the region (al-regionalism-(regional development triplet has either its own history or precise individual outline of terms.

  8. Minimal families of curves on surfaces

    KAUST Repository

    Lubbes, Niels

    2014-11-01

    A minimal family of curves on an embedded surface is defined as a 1-dimensional family of rational curves of minimal degree, which cover the surface. We classify such minimal families using constructive methods. This allows us to compute the minimal families of a given surface.The classification of minimal families of curves can be reduced to the classification of minimal families which cover weak Del Pezzo surfaces. We classify the minimal families of weak Del Pezzo surfaces and present a table with the number of minimal families of each weak Del Pezzo surface up to Weyl equivalence.As an application of this classification we generalize some results of Schicho. We classify algebraic surfaces that carry a family of conics. We determine the minimal lexicographic degree for the parametrization of a surface that carries at least 2 minimal families. © 2014 Elsevier B.V.

  9. Minimally invasive approach of panfacial fractures

    Directory of Open Access Journals (Sweden)

    Yudi Wijaya

    2017-08-01

    Full Text Available Background. Panfacial fractures involves fractures of several bones of face. They are associated with malocclusion, dish face deformity, enopthalmos, diplopia, cerebrospinal fluid leak and soft tissue injuries. Purpose. The purpose of this paper is to present a case of minimizing surgical wound and morbidity. Case. A 40 year old female presented with severe maxillofacial injuries caused by motor vehicle collisions about 5 days prior to admission. The assessment of the patient is mild head injury, panfacial fractures, lacerated wound at face,  rupture of globe of occular sinistra. An open reduction and internal fixation  (ORIF and enucleation of globe occular sinistra was performed.  Intraoral vestibular incision is made in the upper and lower vestibular region. Mucoperiosteal flap elevation of vestibular will exposure of the anterior maxilla and mandibular fractures. Intermaksilary fixation within 3 week and restore aesthetic with prosthesis fitting eyeball and denture. Discusion. The goal of  treatment of  panfacial fracture is to restore both the functions and pre-injury 3-dimensional facial contours. To achieve this goal two common  sequences of management of Panfacial fractures are proposed, “Bottom up and inside out” or “Top down and outside in”. Other sequences exist but there are variations of these two major approaches. Conclusion. A minimally invasive approach to  the fracture site is an alternative method  to manage panfacial fracture with a simple, effective and lower complication rate.

  10. Identification of a novel temperature sensitive promoter in cho cells

    Directory of Open Access Journals (Sweden)

    Hesse Friedemann

    2011-05-01

    Full Text Available Abstract Background The Chinese hamster ovary (CHO expression system is the leading production platform for manufacturing biopharmaceuticals for the treatment of numerous human diseases. Efforts to optimize the production process also include the genetic construct encoding the therapeutic gene. Here we report about the successful identification of an endogenous highly active gene promoter obtained from CHO cells which shows conditionally inducible gene expression at reduced temperature. Results Based on CHO microarray expression data abundantly transcribed genes were selected as potential promoter candidates. The S100a6 (calcyclin and its flanking regions were identified from a genomic CHO-K1 lambda-phage library. Computational analyses showed a predicted TSS, a TATA-box and several TFBSs within the 1.5 kb region upstream the ATG start signal. Various constructs were investigated for promoter activity at 37°C and 33°C in transient luciferase reporter gene assays. Most constructs showed expression levels even higher than the SV40 control and on average a more than two-fold increase at lower temperature. We identified the core promoter sequence (222 bp comprising two SP1 sites and could show a further increase in activity by duplication of this minimal sequence. Conclusions This novel CHO promoter permits conditionally high-level gene expression. Upon a shift to 33°C, a two to three-fold increase of basal productivity (already higher than SV40 promoter is achieved. This property is of particular advantage for a process with reduced expression during initial cell growth followed by the production phase at low temperature with a boost in expression. Additionally, production of toxic proteins becomes feasible, since cell metabolism and gene expression do not directly interfere. The CHO S100a6 promoter can be characterized as cold-shock responsive with the potential for improving process performance of mammalian expression systems.

  11. In vitro binding of Sorghum bicolor transcription factors ABI4 and ABI5 to a conserved region of a GA 2-OXIDASE promoter: possible role of this interaction in the expression of seed dormancy.

    Science.gov (United States)

    Cantoro, Renata; Crocco, Carlos Daniel; Benech-Arnold, Roberto Luis; Rodríguez, María Verónica

    2013-12-01

    The precise adjustment of the timing of dormancy release according to final grain usage is still a challenge for many cereal crops. Grain sorghum [Sorghum bicolor (L.) Moench] shows wide intraspecific variability in dormancy level and susceptibility to pre-harvest sprouting (PHS). Both embryo sensitivity to abscisic acid (ABA) and gibberellin (GA) metabolism play an important role in the expression of dormancy of the developing sorghum grain. In previous works, it was shown that, simultaneously with a greater embryo sensitivity to ABA and higher expression of SbABA-INSENSITIVE 4 (SbABI4) and SbABA-INSENSITIVE 5 (SbABI5), dormant grains accumulate less active GA4 due to a more active GA catabolism. In this work, it is demonstrated that the ABA signalling components SbABI4 and SbABI5 interact in vitro with a fragment of the SbGA 2-OXIDASE 3 (SbGA2ox3) promoter containing an ABA-responsive complex (ABRC). Both transcription factors were able to bind the promoter, although not simultaneously, suggesting that they might compete for the same cis-acting regulatory sequences. A biological role for these interactions in the expression of dormancy of sorghum grains is proposed: either SbABI4 and/or SbABI5 activate transcription of the SbGA2ox3 gene in vivo and promote SbGA2ox3 protein accumulation; this would result in active degradation of GA4, thus preventing germination of dormant grains. A comparative analysis of the 5'-regulatory region of GA2oxs from both monocots and dicots is also presented; conservation of the ABRC in closely related GA2oxs from Brachypodium distachyon and rice suggest that these species might share the same regulatory mechanism as proposed for grain sorghum.

  12. Euclidean wormholes with minimally coupled scalar fields

    International Nuclear Information System (INIS)

    Ruz, Soumendranath; Modak, Bijan; Debnath, Subhra; Sanyal, Abhik Kumar

    2013-01-01

    A detailed study of quantum and semiclassical Euclidean wormholes for Einstein's theory with a minimally coupled scalar field has been performed for a class of potentials. Massless, constant, massive (quadratic in the scalar field) and inverse (linear) potentials admit the Hawking and Page wormhole boundary condition both in the classically forbidden and allowed regions. An inverse quartic potential has been found to exhibit a semiclassical wormhole configuration. Classical wormholes under a suitable back-reaction leading to a finite radius of the throat, where the strong energy condition is satisfied, have been found for the zero, constant, quadratic and exponential potentials. Treating such classical Euclidean wormholes as an initial condition, a late stage of cosmological evolution has been found to remain unaltered from standard Friedmann cosmology, except for the constant potential which under the back-reaction produces a term like a negative cosmological constant. (paper)

  13. Higgs Phenomenology of Minimal Universal Extra Dimensions

    Directory of Open Access Journals (Sweden)

    Kakizaki Mitsuru

    2012-06-01

    Full Text Available The minimal model of Universal Extra Dimensions (MUED is briefly reviewed. We explain how the cross-sections for Higgs production via gluon fusion and decay into photons are modified, relative the the Standard Model (SM values, by KK particles running in loops, leading to an enhancement of the gg → h → γγ and gg → h → W+W− cross-sections. ATLAS and CMS searches for the SM Higgs in these channels are reinterpreted in the context of MUED and used to place new limits on the MUED parameter space. Only a small region of between 1 and 3 GeV around mh = 125 GeV for 500 GeV < R−1 < 1600 GeV remains open at the 95 % confidence level.

  14. Low energy implications of minimal superstring unification

    International Nuclear Information System (INIS)

    Khalil, S.; Vissani, F.; Masiero, A.

    1995-11-01

    We study the phenomenological implications of effective supergravities based on string vacua with spontaneously broken N =1 supersymmetry by dilation and moduli F-terms. We further require Minimal String Unification, namely that large string threshold corrections ensure the correct unification of the gauge couplings at the grand unification scale. The whole supersymmetric mass spectrum turns out to be determined in terms of only two independent parameters, the dilaton-moduli mixing angle and the gravitino mass. In particular we discuss the region of the parameter space where at least one superpartner is ''visible'' at LEPII. We find that the most likely candidates are the scalar partner of the right-handed electron and the lightest chargino, with interesting correlations between their masses and with the mass of the lightest higgs. We show how discovering SUSY particles at LEPII might rather sharply discriminate between scenarios with pure dilaton SUSY breaking and mixed dilaton-moduli breaking. (author). 10 refs, 7 figs

  15. LLNL Waste Minimization Program Plan

    International Nuclear Information System (INIS)

    1990-05-01

    This document is the February 14, 1990 version of the LLNL Waste Minimization Program Plan (WMPP). Now legislation at the federal level is being introduced. Passage will result in new EPA regulations and also DOE orders. At the state level the Hazardous Waste Reduction and Management Review Act of 1989 was signed by the Governor. DHS is currently promulgating regulations to implement the new law. EPA has issued a proposed new policy statement on source reduction and recycling. This policy reflects a preventative strategy to reduce or eliminate the generation of environmentally-harmful pollutants which may be released to the air, land surface, water, or ground water. In accordance with this policy new guidance to hazardous waste generators on the elements of a Waste Minimization Program was issued. This WMPP is formatted to meet the current DOE guidance outlines. The current WMPP will be revised to reflect all of these proposed changes when guidelines are established. Updates, changes and revisions to the overall LLNL WMPP will be made as appropriate to reflect ever-changing regulatory requirements

  16. Symmetry breaking for drag minimization

    Science.gov (United States)

    Roper, Marcus; Squires, Todd M.; Brenner, Michael P.

    2005-11-01

    For locomotion at high Reynolds numbers drag minimization favors fore-aft asymmetric slender shapes with blunt noses and sharp trailing edges. On the other hand, in an inertialess fluid the drag experienced by a body is independent of whether it travels forward or backward through the fluid, so there is no advantage to having a single preferred swimming direction. In fact numerically determined minimum drag shapes are known to exhibit almost no fore-aft asymmetry even at moderate Re. We show that asymmetry persists, albeit extremely weakly, down to vanishingly small Re, scaling asymptotically as Re^3. The need to minimize drag to maximize speed for a given propulsive capacity gives one possible mechanism for the increasing asymmetry in the body plans seen in nature, as organisms increase in size and swimming speed from bacteria like E-Coli up to pursuit predator fish such as tuna. If it is the dominant mechanism, then this signature scaling will be observed in the shapes of motile micro-organisms.

  17. Role of heteroplasmic mutations in the mitochondrial genome and the ID4 gene promoter methylation region in the pathogenesis of chronic aplastic anemia in patients suffering from Kidney yin deficiency.

    Science.gov (United States)

    Cui, Xing; Wang, Jing-Yi; Liu, Kui; Cui, Si-Yuan; Zhang, Jie; Luo, Ya-Qin; Wang, Xin

    2016-06-01

    To analyze changes in gene amplification in the mitochondrial genome and in the ID4 gene promoter methylation region in patients with chronic aplastic anemia (CAA) suffering from Kidney (Shen) yin deficiency or Kidney yang deficiency. Bone marrow and oral epithelium samples were collected from CAA patients with Kidney yin deficiency or Kidney yang deficiency (20 cases). Bone marrow samples were collected from 20 healthy volunteers. The mitochondrial genome was amplified by polymerase chain reaction (PCR), and PCR products were used for sequencing and analysis. Higher mutational rates were observed in the ND1-2, ND4-6, and CYTB genes in CAA patients suffering from Kidney yin deficiency. Moreover, the ID4 gene was unmethylated in bone marrow samples from healthy individuals, but was methylated in some CAA patients suffering from Kidney yin deficiency (positive rate, 60%) and Kidney yang deficiency (positive rate, 55%). These data supported that gene mutations can alter the expression of respiratory chain enzyme complexes in CAA patients, resulting in energy metabolism impairment and promoting the physiological and pathological processes of hematopoietic failure. Functional impairment of the mitochondrial respiration chain induced by gene mutation may be an important reason for hematopoietic failure in patients with CAA. This change is closely related to maternal inheritance and Kidney yin deficiency. Finally, these data supported the assertion that it is easy to treat disease in patients suffering from yang deficiency and difficult to treat disease in patients suffering from yin deficiency.

  18. Report on the project for spread/promotion of technology for the industrial waste optimized treatment in the Asian region (International Symposium `98); Asia chiiki sangyo haikibutsu tekiseika shori gijutsu nado fukyu sokushin jigyo (symposium kaisai) hokokusho

    Energy Technology Data Exchange (ETDEWEB)

    NONE

    1998-03-01

    In Japan and Asian countries, the optimized treatment of industrial waste is the problem with the economic growth. Border-crossing movement of the waste for promotion of the renewable use is also a problem. Therefore, the International Symposium `98 on the industrial waste problem in the Asian region was held. China, Thailand, the Philippines and Korea were invited to Japan to give lectures. MITI of Japan reported on the present situation of Japan and the cooperation with Asian countries. The industrial circle reported on efforts for environmental protection measures to be taken, the industrial waste problem at companies which advanced into Asian countries, effects of the Basel Convention on recycling activities, Japan`s role in Asia, etc. In the panel discussion, promotion of cooperation for recycling technology and Japan`s support for formulating strategy on the industrial waste were requested to Japan, and the construction of an Asian area network was proposed. Concerning the cooperative system between governments and private companies, it was concluded that it was necessary to discuss it considering the actual state of each country. Importance of recycle and information exchange was realized again. 10 refs., 15 figs., 27 tabs.

  19. Laparoscopic colonic resection in inflammatory bowel disease: minimal surgery, minimal access and minimal hospital stay.

    LENUS (Irish Health Repository)

    Boyle, E

    2008-11-01

    Laparoscopic surgery for inflammatory bowel disease (IBD) is technically demanding but can offer improved short-term outcomes. The introduction of minimally invasive surgery (MIS) as the default operative approach for IBD, however, may have inherent learning curve-associated disadvantages. We hypothesise that the establishment of MIS as the standard operative approach does not increase patient morbidity as assessed in the initial period of its introduction into a specialised unit, and that it confers earlier postoperative gastrointestinal recovery and reduced hospitalisation compared with conventional open resection.

  20. Studies of genetic variability of the glucose transporter 2 promoter in patients with type 2 diabetes mellitus

    DEFF Research Database (Denmark)

    Møller, A M; Jensen, N M; Pildal, J

    2001-01-01

    This study was performed to test the hypothesis that genetic variation in the promoter of the glucose transporter 2 (GLUT2) might predispose to prediabetic phenotypes or type 2 diabetes. A total of 1611 bp comprising the minimal promoter region of the GLUT2 gene were examined by combined single......-tolerant subjects. In conclusion, we found no evidence supporting the hypothesis that genetic variability in the minimal promoter of the GLUT2 is associated with type 2 diabetes or prediabetic phenotypes in the Danish population.......-strand conformational polymorphism and heteroduplex analysis followed by direct sequencing of identified variants on genomic DNA from 96 randomly recruited Danish type 2 diabetic patients. We identified 4 nucleotide variants, -447g-->a, -149c-->a, -122t-->c, and -44g-->a. None of the variants were positioned in known...

  1. Opioid gene expression changes and post-translational histone modifications at promoter regions in the rat nucleus accumbens after acute and repeated 3,4-methylenedioxy-methamphetamine (MDMA) exposure.

    Science.gov (United States)

    Caputi, Francesca Felicia; Palmisano, Martina; Carboni, Lucia; Candeletti, Sanzio; Romualdi, Patrizia

    2016-12-01

    The recreational drug of abuse 3,4-methylenedioxymethamphetamine (MDMA) has been shown to produce neurotoxic damage and long-lasting changes in several brain areas. In addition to the involvement of serotoninergic and dopaminergic systems, little information exists about the contribution of nociceptin/orphaninFQ (N/OFQ)-NOP and dynorphin (DYN)-KOP systems in neuronal adaptations evoked by MDMA. Here we investigated the behavioral and molecular effects induced by acute (8mg/kg) or repeated (8mg/kg twice daily for seven days) MDMA exposure. MDMA exposure affected body weight gain and induced hyperlocomotion; this latter effect progressively decreased after repeated administration. Gene expression analysis indicated a down-regulation of the N/OFQ system and an up-regulation of the DYN system in the nucleus accumbens (NAc), highlighting an opposite systems regulation in response to MDMA exposure. Since histone modifications have been strongly associated to the addiction-related maladaptive changes, we examined two permissive (acH3K9 and me3H3K4) and two repressive transcription marks (me3H3K27 and me2H3K9) at the pertinent opioid gene promoter regions. Chromatin immunoprecipitation assays revealed that acute MDMA increased me3H3K4 at the pN/OFQ, pDYN and NOP promoters. Following acute and repeated treatment a significant decrease of acH3K9 at the pN/OFQ promoter was observed, which correlated with gene expression results. Acute treatment caused an acH3K9 increase and a me2H3K9 decrease at the pDYN promoter which matched its mRNA up-regulation. Our data indicate that the activation of the DYNergic stress system together with the inactivation of the N/OFQergic anti-stress system contribute to the neuroadaptive actions of MDMA and offer novel epigenetic information associated with MDMA abuse. Copyright © 2016 Elsevier Ltd. All rights reserved.

  2. Minimally invasive aortic valve replacement

    DEFF Research Database (Denmark)

    Foghsgaard, Signe; Schmidt, Thomas Andersen; Kjaergard, Henrik K

    2009-01-01

    In this descriptive prospective study, we evaluate the outcomes of surgery in 98 patients who were scheduled to undergo minimally invasive aortic valve replacement. These patients were compared with a group of 50 patients who underwent scheduled aortic valve replacement through a full sternotomy...... operations were completed as mini-sternotomies, 4 died later of noncardiac causes. The aortic cross-clamp and perfusion times were significantly different across all groups (P replacement...... is an excellent operation in selected patients, but its true advantages over conventional aortic valve replacement (other than a smaller scar) await evaluation by means of randomized clinical trial. The "extended mini-aortic valve replacement" operation, on the other hand, is a risky procedure that should...

  3. Minimization over randomly selected lines

    Directory of Open Access Journals (Sweden)

    Ismet Sahin

    2013-07-01

    Full Text Available This paper presents a population-based evolutionary optimization method for minimizing a given cost function. The mutation operator of this method selects randomly oriented lines in the cost function domain, constructs quadratic functions interpolating the cost function at three different points over each line, and uses extrema of the quadratics as mutated points. The crossover operator modifies each mutated point based on components of two points in population, instead of one point as is usually performed in other evolutionary algorithms. The stopping criterion of this method depends on the number of almost degenerate quadratics. We demonstrate that the proposed method with these mutation and crossover operations achieves faster and more robust convergence than the well-known Differential Evolution and Particle Swarm algorithms.

  4. Strategies to Minimize Antibiotic Resistance

    Directory of Open Access Journals (Sweden)

    Sang Hee Lee

    2013-09-01

    Full Text Available Antibiotic resistance can be reduced by using antibiotics prudently based on guidelines of antimicrobial stewardship programs (ASPs and various data such as pharmacokinetic (PK and pharmacodynamic (PD properties of antibiotics, diagnostic testing, antimicrobial susceptibility testing (AST, clinical response, and effects on the microbiota, as well as by new antibiotic developments. The controlled use of antibiotics in food animals is another cornerstone among efforts to reduce antibiotic resistance. All major resistance-control strategies recommend education for patients, children (e.g., through schools and day care, the public, and relevant healthcare professionals (e.g., primary-care physicians, pharmacists, and medical students regarding unique features of bacterial infections and antibiotics, prudent antibiotic prescribing as a positive construct, and personal hygiene (e.g., handwashing. The problem of antibiotic resistance can be minimized only by concerted efforts of all members of society for ensuring the continued efficiency of antibiotics.

  5. A minimally invasive smile enhancement.

    Science.gov (United States)

    Peck, Fred H

    2014-01-01

    Minimally invasive dentistry refers to a wide variety of dental treatments. On the restorative aspect of dental procedures, direct resin bonding can be a very conservative treatment option for the patient. When tooth structure does not need to be removed, the patient benefits. Proper treatment planning is essential to determine how conservative the restorative treatment will be. This article describes the diagnosis, treatment options, and procedural techniques in the restoration of 4 maxillary anterior teeth with direct composite resin. The procedural steps are reviewed with regard to placing the composite and the variety of colors needed to ensure a natural result. Finishing and polishing of the composite are critical to ending with a natural looking dentition that the patient will be pleased with for many years.

  6. Waste minimization in analytical methods

    International Nuclear Information System (INIS)

    Green, D.W.; Smith, L.L.; Crain, J.S.; Boparai, A.S.; Kiely, J.T.; Yaeger, J.S. Schilling, J.B.

    1995-01-01

    The US Department of Energy (DOE) will require a large number of waste characterizations over a multi-year period to accomplish the Department's goals in environmental restoration and waste management. Estimates vary, but two million analyses annually are expected. The waste generated by the analytical procedures used for characterizations is a significant source of new DOE waste. Success in reducing the volume of secondary waste and the costs of handling this waste would significantly decrease the overall cost of this DOE program. Selection of appropriate analytical methods depends on the intended use of the resultant data. It is not always necessary to use a high-powered analytical method, typically at higher cost, to obtain data needed to make decisions about waste management. Indeed, for samples taken from some heterogeneous systems, the meaning of high accuracy becomes clouded if the data generated are intended to measure a property of this system. Among the factors to be considered in selecting the analytical method are the lower limit of detection, accuracy, turnaround time, cost, reproducibility (precision), interferences, and simplicity. Occasionally, there must be tradeoffs among these factors to achieve the multiple goals of a characterization program. The purpose of the work described here is to add waste minimization to the list of characteristics to be considered. In this paper the authors present results of modifying analytical methods for waste characterization to reduce both the cost of analysis and volume of secondary wastes. Although tradeoffs may be required to minimize waste while still generating data of acceptable quality for the decision-making process, they have data demonstrating that wastes can be reduced in some cases without sacrificing accuracy or precision

  7. Single amino acid changes in the 6K1-CI region can promote the alternative adaptation of Prunus- and Nicotiana-propagated Plum pox virus C isolates to either host.

    Science.gov (United States)

    Calvo, María; Malinowski, Tadeusz; García, Juan Antonio

    2014-02-01

    Plum pox virus (PPV) C is one of the less common PPV strains and specifically infects cherry trees in nature. Making use of two PPV-C isolates that display different pathogenicity features, i.e., SwCMp, which had been adapted to Nicotiana species, and BY101, which had been isolated from cherry rootstock L2 (Prunus lannesiana) and propagated only in cherry species, we have generated two infective full-length cDNA clones in order to determine which viral factors are involved in the adaptation to each host. According to our results, the C-P3(PIPO)/6K1/N-CI (cylindrical inclusion) region contains overlapping but not coincident viral determinants involved in symptoms development, local viral amplification, and systemic movement capacity. Amino acid changes in this region promoting the adaptation to N. benthamiana or P. avium have trade-off effects in the alternative host. In both cases, adaptation can be achieved through single amino acid changes in the NIapro protease recognition motif between 6K1 and CI or in nearby sequences. Thus, we hypothesize that the potyvirus polyprotein processing could depend on specific host factors and the adaptation of PPV-C isolates to particular hosts relies on a fine regulation of the proteolytic cleavage of the 6K1-CI junction.

  8. Resveratrol in Patients with Minimal Hepatic Encephalopathy

    Directory of Open Access Journals (Sweden)

    Giulia Malaguarnera

    2018-03-01

    Full Text Available Background: Minimal Hepatic Encephalopathy (MHE is characterized by an impairment of social interaction, emotional behavior, sleep disorders, physical and mental symptoms, and diminished Quality of Life (QoL. The aim of our study is evaluating the potential liver health promoting a perspective of Resveratrol (RV activities and evaluate whether RV treatment may improve health related quality of life (HRQL and reduce depression and anxiety in patients with MHE. Methods: We evaluated depression using the Beck Depression Inventory test, anxiety with State-trait anxiety inventory test, quality of life through SF-36 test, and ammonia serum levels in 70 MHE patients that were randomized into two groups. Results: In the comparison between RV group and placebo group we observed a decrease in Back Depression Inventory (BDI (p < 0.001, in State-trait anxiety inventory (STAI (p < 0.001, and improve in physical function (p < 0.001, in role physical (p < 0.05, in body pain (p < 0.05, in general health (p < 0.001, in vitality (p < 0.05, and in social function (p < 0.001. Conclusions: Resveratrol showed efficacy in the treatment of depression, anxiety, and ammonia serum levels, and improved the quality of life Of MHE patients.

  9. Prochlorococcus: Advantages and Limits of Minimalism

    Science.gov (United States)

    Partensky, Frédéric; Garczarek, Laurence

    2010-01-01

    Prochlorococcus is the key phytoplanktonic organism of tropical gyres, large ocean regions that are depleted of the essential macronutrients needed for photosynthesis and cell growth. This cyanobacterium has adapted itself to oligotrophy by minimizing the resources necessary for life through a drastic reduction of cell and genome sizes. This rarely observed strategy in free-living organisms has conferred on Prochlorococcus a considerable advantage over other phototrophs, including its closest relative Synechococcus, for life in this vast yet little variable ecosystem. However, this strategy seems to reach its limits in the upper layer of the S Pacific gyre, the most oligotrophic region of the world ocean. By losing some important genes and/or functions during evolution, Prochlorococcus has seemingly become dependent on co-occurring microorganisms. In this review, we present some of the recent advances in the ecology, biology, and evolution of Prochlorococcus, which because of its ecological importance and tiny genome is rapidly imposing itself as a model organism in environmental microbiology.

  10. Establishment of a non-governmental regional approach to La Plata River Basin integrated watershed management promoted throughout three international workshops supported by UN and Japanese agencies, led by ILEC

    Science.gov (United States)

    Calcagno, Alberto; Yamashiki, Yosuke; Mugetti, Ana

    2002-08-01

    The La Plata River Basin is one of the largest international river basins in the world, with an area of about 3 million km2. It spreads across five countries (Argentina, Bolivia, Brazil, Paraguay and Uruguay), and its water resources are essential for their economic development. Together with reservoir development, extensive deforestation, intensive agriculture practices and large urban developments took place in the Paraná, Paraguay and Uruguay basins, affecting environmental conditions and raising important issues concerning water resources use and conservation. Therefore, the need to promote participatory and cooperative efforts among water resources stakeholders, as well as the systematic exchange of information and experiences on common regional problems among organizations and experts from throughout the basin who are devoted to water resources use and management, was reported by researchers and managers gathered at the First and Second International Workshops on Regional Approaches for Reservoir Development and Management in the La Plata River Basin (held in 1991 and 1994). As a concrete response to this need, the efforts of a number of organizations from various countries within the basin, with the support of international and national governmental organizations, resulted in the foundation of La Plata River Basin Environmental Research and Management Network (RIGA) in March 2001. This was within the framework of the Third International Workshop, which was precisely one of the short-term activities included in the RIGA Action Plan. During the preparatory processes for the RIGA Network, the presence of Japanese cooperation supporting the La Plata River Basin Workshops through a non-governmental international organization (ILEC) played an important role in stimulating such an organization-based joint approach in the basin. This outcome, although not originally planned, constituted a welcomed byproduct of its main specific interest in the region, which was the

  11. Cyclone Simulation via Action Minimization

    Science.gov (United States)

    Plotkin, D. A.; Weare, J.; Abbot, D. S.

    2016-12-01

    A postulated impact of climate change is an increase in intensity of tropical cyclones (TCs). This hypothesized effect results from the fact that TCs are powered subsaturated boundary layer air picking up water vapor from the surface ocean as it flows inwards towards the eye. This water vapor serves as the energy input for TCs, which can be idealized as heat engines. The inflowing air has a nearly identical temperature as the surface ocean; therefore, warming of the surface leads to a warmer atmospheric boundary layer. By the Clausius-Clapeyron relationship, warmer boundary layer air can hold more water vapor and thus results in more energetic storms. Changes in TC intensity are difficult to predict due to the presence of fine structures (e.g. convective structures and rainbands) with length scales of less than 1 km, while general circulation models (GCMs) generally have horizontal resolutions of tens of kilometers. The models are therefore unable to capture these features, which are critical to accurately simulating cyclone structure and intensity. Further, strong TCs are rare events, meaning that long multi-decadal simulations are necessary to generate meaningful statistics about intense TC activity. This adds to the computational expense, making it yet more difficult to generate accurate statistics about long-term changes in TC intensity due to global warming via direct simulation. We take an alternative approach, applying action minimization techniques developed in molecular dynamics to the WRF weather/climate model. We construct artificial model trajectories that lead from quiescent (TC-free) states to TC states, then minimize the deviation of these trajectories from true model dynamics. We can thus create Monte Carlo model ensembles that are biased towards cyclogenesis, which reduces computational expense by limiting time spent in non-TC states. This allows for: 1) selective interrogation of model states with TCs; 2) finding the likeliest paths for

  12. Against explanatory minimalism in psychiatry

    Directory of Open Access Journals (Sweden)

    Tim eThornton

    2015-12-01

    Full Text Available The idea that psychiatry contains, in principle, a series of levels of explanation has been criticised both as empirically false but also, by Campbell, as unintelligible because it presupposes a discredited pre-Humean view of causation. Campbell’s criticism is based on an interventionist-inspired denial that mechanisms and rational connections underpin physical and mental causation respectively and hence underpin levels of explanation. These claims echo some superficially similar remarks in Wittgenstein’s Zettel. But attention to the context of Wittgenstein’s remarks suggests a reason to reject explanatory minimalism in psychiatry and reinstate a Wittgensteinian notion of level of explanation. Only in a context broader than the one provided by interventionism is the ascription of propositional attitudes, even in the puzzling case of delusions, justified. Such a view, informed by Wittgenstein, can reconcile the idea that the ascription mental phenomena presupposes a particular level of explanation with the rejection of an a priori claim about its connection to a neurological level of explanation.

  13. Against Explanatory Minimalism in Psychiatry.

    Science.gov (United States)

    Thornton, Tim

    2015-01-01

    The idea that psychiatry contains, in principle, a series of levels of explanation has been criticized not only as empirically false but also, by Campbell, as unintelligible because it presupposes a discredited pre-Humean view of causation. Campbell's criticism is based on an interventionist-inspired denial that mechanisms and rational connections underpin physical and mental causation, respectively, and hence underpin levels of explanation. These claims echo some superficially similar remarks in Wittgenstein's Zettel. But attention to the context of Wittgenstein's remarks suggests a reason to reject explanatory minimalism in psychiatry and reinstate a Wittgensteinian notion of levels of explanation. Only in a context broader than the one provided by interventionism is that the ascription of propositional attitudes, even in the puzzling case of delusions, justified. Such a view, informed by Wittgenstein, can reconcile the idea that the ascription mental phenomena presupposes a particular level of explanation with the rejection of an a priori claim about its connection to a neurological level of explanation.

  14. Robotic assisted minimally invasive surgery

    Directory of Open Access Journals (Sweden)

    Palep Jaydeep

    2009-01-01

    Full Text Available The term "robot" was coined by the Czech playright Karel Capek in 1921 in his play Rossom′s Universal Robots. The word "robot" is from the check word robota which means forced labor.The era of robots in surgery commenced in 1994 when the first AESOP (voice controlled camera holder prototype robot was used clinically in 1993 and then marketed as the first surgical robot ever in 1994 by the US FDA. Since then many robot prototypes like the Endoassist (Armstrong Healthcare Ltd., High Wycombe, Buck, UK, FIPS endoarm (Karlsruhe Research Center, Karlsruhe, Germany have been developed to add to the functions of the robot and try and increase its utility. Integrated Surgical Systems (now Intuitive Surgery, Inc. redesigned the SRI Green Telepresence Surgery system and created the daVinci Surgical System ® classified as a master-slave surgical system. It uses true 3-D visualization and EndoWrist ® . It was approved by FDA in July 2000 for general laparoscopic surgery, in November 2002 for mitral valve repair surgery. The da Vinci robot is currently being used in various fields such as urology, general surgery, gynecology, cardio-thoracic, pediatric and ENT surgery. It provides several advantages to conventional laparoscopy such as 3D vision, motion scaling, intuitive movements, visual immersion and tremor filtration. The advent of robotics has increased the use of minimally invasive surgery among laparoscopically naοve surgeons and expanded the repertoire of experienced surgeons to include more advanced and complex reconstructions.

  15. A Further Analysis of the Relationship between Yellow Ripe-Fruit Color and the Capsanthin-Capsorubin Synthase Gene in Pepper (Capsicum sp.) Indicated a New Mutant Variant in C. annuum and a Tandem Repeat Structure in Promoter Region

    Science.gov (United States)

    Gui, Xiao-Ling; Chang, Xiao-Bei; Gong, Zhen-Hui

    2013-01-01

    Mature pepper (Capsicum sp.) fruits come in a variety of colors, including red, orange, yellow, brown, and white. To better understand the genetic and regulatory relationships between the yellow fruit phenotype and the capsanthin-capsorubin synthase gene (Ccs), we examined 156 Capsicum varieties, most of which were collected from Northwest Chinese landraces. A new ccs variant was identified in the yellow fruit cultivar CK7. Cluster analysis revealed that CK7, which belongs to the C. annuum species, has low genetic similarity to other yellow C. annuum varieties. In the coding sequence of this ccs allele, we detected a premature stop codon derived from a C to G change, as well as a downstream frame-shift caused by a 1-bp nucleotide deletion. In addition, the expression of the gene was detected in mature CK7 fruit. Furthermore, the promoter sequences of Ccs from some pepper varieties were examined, and we detected a 176-bp tandem repeat sequence in the promoter region. In all C. annuum varieties examined in this study, the repeat number was three, compared with four in two C. chinense accessions. The sequence similarity ranged from 84.8% to 97.7% among the four types of repeats, and some putative cis-elements were also found in every repeat. This suggests that the transcriptional regulation of Ccs expression is complex. Based on the analysis of the novel C. annuum mutation reported here, along with the studies of three mutation types in yellow C. annuum and C. chinense accessions, we suggest that the mechanism leading to the production of yellow color fruit may be not as complex as that leading to orange fruit production. PMID:23637942

  16. The − 5 A/G single-nucleotide polymorphism in the core promoter region of MT2A and its effect on allele-specific gene expression and Cd, Zn and Cu levels in laryngeal cancer

    Energy Technology Data Exchange (ETDEWEB)

    Starska, Katarzyna, E-mail: katarzyna.starska@umed.lodz.pl [I Department of Otolaryngology and Laryngological Oncology, Medical University of Łódź, Kopcinskiego 22, 90-153 Łódź (Poland); Krześlak, Anna; Forma, Ewa [Department of Cytobiochemistry, University of Łódź, Pomorska 142/143, 90-236 Łódź (Poland); Olszewski, Jurek [II Department of Otolaryngology and Laryngological Oncology, Medical University of Łódź, Żeromskiego 113, 90-549 Łódź (Poland); Morawiec-Sztandera, Alina [Department of Head and Neck Surgery, Medical University of Łódź, Paderewskiego 4, 93-509 Łódź (Poland); Aleksandrowicz, Paweł [Department of Otolaryngology and Laryngological Oncology, Medical University of Lublin, Jaczewskiego 8, 20-954 Lublin (Poland); Lewy-Trenda, Iwona [Department of Pathology, Medical University of Łódź, Pomorska 251, 92-213 Łódź (Poland); and others

    2014-10-15

    Metallothioneins (MTs) are low molecular weight, cysteine-rich heavy metal-binding proteins which participate in the mechanisms of Zn homeostasis, and protect against toxic metals. MTs contain metal-thiolate cluster groups and suppress metal toxicity by binding to them. The aim of this study was to determine the − 5 A/G (rs28366003) single-nucleotide polymorphism (SNP) in the core promoter region of the MT2A gene and to investigate its effect on allele-specific gene expression and Cd, Zn and Cu content in squamous cell laryngeal cancer (SCC) and non-cancerous laryngeal mucosa (NCM) as a control. The MT2A promoter region − 5 A/G SNP was determined by restriction fragment length polymorphism using 323 SCC and 116 NCM. MT2A gene analysis was performed by quantitative real-time PCR. The frequency of A allele carriage was 94.2% and 91.8% in SCC and NCM, respectively, while G allele carriage was detected in 5.8% and 8.2% of SCC and NCM samples, respectively. As a result, a significant association was identified between the − 5 A/G SNP in the MT2A gene with mRNA expression in both groups. Metal levels were analyzed by flame atomic absorption spectrometry. The significant differences were identified between A/A and both the A/G and G/G genotypes, with regard to the concentration of the contaminating metal. The Spearman rank correlation results showed that the MT2A expression and Cd, Zn, Cu levels were negatively correlated. Results obtained in this study suggest that − 5 A/G SNP in MT2A gene may have an effect on allele-specific gene expression and accumulation of metal levels in laryngeal cancer. - Highlights: • MT2A gene expression and metal content in laryngeal cancer tissues • Association between SNP (rs28366003) and expression of MT2A • Significant associations between the SNP and Cd, Zn and Cu levels • Negative correlation between MT2A gene expression and Cd, Zn and Cu levels.

  17. The − 5 A/G single-nucleotide polymorphism in the core promoter region of MT2A and its effect on allele-specific gene expression and Cd, Zn and Cu levels in laryngeal cancer

    International Nuclear Information System (INIS)

    Starska, Katarzyna; Krześlak, Anna; Forma, Ewa; Olszewski, Jurek; Morawiec-Sztandera, Alina; Aleksandrowicz, Paweł; Lewy-Trenda, Iwona

    2014-01-01

    Metallothioneins (MTs) are low molecular weight, cysteine-rich heavy metal-binding proteins which participate in the mechanisms of Zn homeostasis, and protect against toxic metals. MTs contain metal-thiolate cluster groups and suppress metal toxicity by binding to them. The aim of this study was to determine the − 5 A/G (rs28366003) single-nucleotide polymorphism (SNP) in the core promoter region of the MT2A gene and to investigate its effect on allele-specific gene expression and Cd, Zn and Cu content in squamous cell laryngeal cancer (SCC) and non-cancerous laryngeal mucosa (NCM) as a control. The MT2A promoter region − 5 A/G SNP was determined by restriction fragment length polymorphism using 323 SCC and 116 NCM. MT2A gene analysis was performed by quantitative real-time PCR. The frequency of A allele carriage was 94.2% and 91.8% in SCC and NCM, respectively, while G allele carriage was detected in 5.8% and 8.2% of SCC and NCM samples, respectively. As a result, a significant association was identified between the − 5 A/G SNP in the MT2A gene with mRNA expression in both groups. Metal levels were analyzed by flame atomic absorption spectrometry. The significant differences were identified between A/A and both the A/G and G/G genotypes, with regard to the concentration of the contaminating metal. The Spearman rank correlation results showed that the MT2A expression and Cd, Zn, Cu levels were negatively correlated. Results obtained in this study suggest that − 5 A/G SNP in MT2A gene may have an effect on allele-specific gene expression and accumulation of metal levels in laryngeal cancer. - Highlights: • MT2A gene expression and metal content in laryngeal cancer tissues • Association between SNP (rs28366003) and expression of MT2A • Significant associations between the SNP and Cd, Zn and Cu levels • Negative correlation between MT2A gene expression and Cd, Zn and Cu levels

  18. Is non-minimal inflation eternal?

    International Nuclear Information System (INIS)

    Feng, Chao-Jun; Li, Xin-Zhou

    2010-01-01

    The possibility that the non-minimal coupling inflation could be eternal is investigated. We calculate the quantum fluctuation of the inflaton in a Hubble time and find that it has the same value as that in the minimal case in the slow-roll limit. Armed with this result, we have studied some concrete non-minimal inflationary models including the chaotic inflation and the natural inflation, in which the inflaton is non-minimally coupled to the gravity. We find that the non-minimal coupling inflation could be eternal in some parameter spaces.

  19. Minimal nuclear energy density functional

    Science.gov (United States)

    Bulgac, Aurel; Forbes, Michael McNeil; Jin, Shi; Perez, Rodrigo Navarro; Schunck, Nicolas

    2018-04-01

    We present a minimal nuclear energy density functional (NEDF) called "SeaLL1" that has the smallest number of possible phenomenological parameters to date. SeaLL1 is defined by seven significant phenomenological parameters, each related to a specific nuclear property. It describes the nuclear masses of even-even nuclei with a mean energy error of 0.97 MeV and a standard deviation of 1.46 MeV , two-neutron and two-proton separation energies with rms errors of 0.69 MeV and 0.59 MeV respectively, and the charge radii of 345 even-even nuclei with a mean error ɛr=0.022 fm and a standard deviation σr=0.025 fm . SeaLL1 incorporates constraints on the equation of state (EoS) of pure neutron matter from quantum Monte Carlo calculations with chiral effective field theory two-body (NN ) interactions at the next-to-next-to-next-to leading order (N3LO) level and three-body (NNN ) interactions at the next-to-next-to leading order (N2LO) level. Two of the seven parameters are related to the saturation density and the energy per particle of the homogeneous symmetric nuclear matter, one is related to the nuclear surface tension, two are related to the symmetry energy and its density dependence, one is related to the strength of the spin-orbit interaction, and one is the coupling constant of the pairing interaction. We identify additional phenomenological parameters that have little effect on ground-state properties but can be used to fine-tune features such as the Thomas-Reiche-Kuhn sum rule, the excitation energy of the giant dipole and Gamow-Teller resonances, the static dipole electric polarizability, and the neutron skin thickness.

  20. Minimal models of multidimensional computations.

    Directory of Open Access Journals (Sweden)

    Jeffrey D Fitzgerald

    2011-03-01

    Full Text Available The multidimensional computations performed by many biological systems are often characterized with limited information about the correlations between inputs and outputs. Given this limitation, our approach is to construct the maximum noise entropy response function of the system, leading to a closed-form and minimally biased model consistent with a given set of constraints on the input/output moments; the result is equivalent to conditional random field models from machine learning. For systems with binary outputs, such as neurons encoding sensory stimuli, the maximum noise entropy models are logistic functions whose arguments depend on the constraints. A constraint on the average output turns the binary maximum noise entropy models into minimum mutual information models, allowing for the calculation of the information content of the constraints and an information theoretic characterization of the system's computations. We use this approach to analyze the nonlinear input/output functions in macaque retina and thalamus; although these systems have been previously shown to be responsive to two input dimensions, the functional form of the response function in this reduced space had not been unambiguously identified. A second order model based on the logistic function is found to be both necessary and sufficient to accurately describe the neural responses to naturalistic stimuli, accounting for an average of 93% of the mutual information with a small number of parameters. Thus, despite the fact that the stimulus is highly non-Gaussian, the vast majority of the information in the neural responses is related to first and second order correlations. Our results suggest a principled and unbiased way to model multidimensional computations and determine the statistics of the inputs that are being encoded in the outputs.

  1. Health promotion.

    Science.gov (United States)

    Miyake, S; Lucas-Miyake, M

    1989-01-01

    This article will describe a marketing model for the development of a role for occupational therapy in the industrial market. Health promotion activities are used as a means to diversify existing revenue bases by establishing new referral sources in industry. The technique of need satisfaction -selling or marketing one's services to a customer based on needs expressed by the customer - is reviewed, and implementation of this approach is described from two settings, one in psychiatry and the other in rehabilitation.

  2. Westinghouse Hanford Company waste minimization actions

    International Nuclear Information System (INIS)

    Greenhalgh, W.O.

    1988-09-01

    Companies that generate hazardous waste materials are now required by national regulations to establish a waste minimization program. Accordingly, in FY88 the Westinghouse Hanford Company formed a waste minimization team organization. The purpose of the team is to assist the company in its efforts to minimize the generation of waste, train personnel on waste minimization techniques, document successful waste minimization effects, track dollar savings realized, and to publicize and administer an employee incentive program. A number of significant actions have been successful, resulting in the savings of materials and dollars. The team itself has been successful in establishing some worthwhile minimization projects. This document briefly describes the waste minimization actions that have been successful to date. 2 refs., 26 figs., 3 tabs

  3. A new variation in the promoter region, the -604 C>T, and the Leu72Met polymorphism of the ghrelin gene are associated with protection to insulin resistance.

    Science.gov (United States)

    Zavarella, S; Petrone, A; Zampetti, S; Gueorguiev, M; Spoletini, M; Mein, C A; Leto, G; Korbonits, M; Buzzetti, R

    2008-04-01

    Previous studies suggested that polymorphisms in the coding region of the preproghrelin were involved in the etiology of obesity and might modulate glucose-induced insulin secretion. We evaluated the association of a new variation, -604C>T, in the promoter region of the ghrelin gene, of Leu72Met (247C>A) and of Gln90Leu (265A>T), all haplotype-tagging single nucleotide polymorphisms (SNPs), with measures of insulin sensitivity in 1420 adult individuals. The three SNPs were genotyped using ABI PRISM 7900 HT Sequence Detection System. We used multiple linear regression analysis for quantitative traits and THESIAS software for haplotype analysis. We observed a protective effect exerted by Met72 variant of Leu72Met SNP on insulin resistance parameters; a significant decreasing trend from Leu/Leu to Leu/Met and to Met/Met homozygous subjects in triglycerides, fasting insulin levels and HOMA-IR index (P=0.02, 0.01 and 0.003, respectively), and, consistently, an increase in ghrelin levels (P=0.003) was found. A significant decrease from CC to TC and to TT genotypes in insulin levels and HOMA-IR index was also detected (P=0.00l for both), but only in subjects homozygous for Leu72, where the protective effect of Met72 was not present. The haplotype analysis results supported the data obtained by the evaluation of each single SNP, showing the highest value of insulin levels and HOMA-IR index in the -604(c)247(c) haplotype intermediate value in -604(T)247(C) and lowest value in -604(C)247(A). Our observations suggest a protective role of the Met72 variant and of -604 T allele in modulating insulin resistance. These SNPs or an unknown functional variant in linkage disequilibrium could increase ghrelin levels and probably insulin sensitivity.

  4. Decreased expression of lysyl hydroxylase 2 (LH2) in skin fibroblasts from three Ehlers-Danlos patients does not result from mutations in either the coding or proximal promoter region of the LH2 gene.

    Science.gov (United States)

    Walker, L C; Teebi, A S; Marini, J C; De Paepe, A; Malfait, F; Atsawasuwan, P; Yamauchi, M; Yeowell, H N

    2004-12-01

    The Ehlers-Danlos syndromes (EDS) are a heterogeneous group of inherited connective tissue disorders characterized by tissue fragility, hyperelasticity of the skin and joint hypermobility. This phenotype, accompanied by kyphoscoliosis and/or ocular fragility, is present in patients with the autosomal recessive type VI form of EDS. These patients have significantly decreased levels of lysyl hydroxylase (LH) activity, due to mutations in the LH1 gene. LH hydroxylates specific lysine residues in the collagen molecule that are precursors for the formation of cross-links which provide collagen with its tensile strength. No disorder has been directly linked to decreased expression of LH2 and LH3, two other isoforms of LH. This study describes 3 patients with mixed phenotypes of EDS, who have significantly decreased mRNAs for LH2, but normal levels of LH1 and LH3 mRNAs, in their skin fibroblasts. In contrast to the effect of LH1 deficiency in EDS VI patients, the decreased expression of LH2 does not affect LH activity, bifunctional collagen cross-links (measured after reduction as dihydroxylysinonorleucine (DHLNL) and hydroxylysinonorleucine (HLNL)), or helical lysine hydroxylation in these cell lines. Sequence analysis of full length LH2 cDNAs and 1kb of the promoter region of LH2 does not show mutations that could explain the decreased expression of LH2. These results suggest that the deficiency of LH2 in these fibroblasts may be caused by changes in other factors required for the expression of LH2.

  5. Correlations of CTLA-4 exon-1 49 A/G and promoter region 318C/T polymorphisms with the therapeutic efficacy of 131 I radionuclide in graves' disease in Chinese Han population.

    Science.gov (United States)

    Han, Xin-Rui; Wen, Xin; Wang, Shan; Fan, Shao-Hua; Zhuang, Juan; Wang, Yong-Jian; Zhang, Zi-Feng; Li, Meng-Qiu; Hu, Bin; Shan, Qun; Sun, Chun-Hui; Bao, Ya-Xing; Wu, Dong-Mei; Lu, Jun; Zheng, Yuan-Lin

    2017-08-04

    Graves' disease is an autoimmune process in which the thyroid gland is triggered by autoantibodies, resulting in hyperthyroidism. The purpose of the present study is to elucidate whether exon-1 49 A/G and promoter region 318C/T polymorphisms in the CTLA-4 gene. This study consisted of 653 eligible patients with Graves' disease. After receiving 131I radionuclide therapy, these patients were classified into the remission and non-remission groups. A logistic regression-based model was used to analyze independent factors affecting the patient response to 131I radionuclide therapy. The results showed that CTLA-4 49 A/G was closely related to the efficacy of 131 I treatment for Graves' disease (AG + GG vs. AA: OR = 6.543, 95%CI = 2.611 ∼ 16.40, P Graves' disease. Logistic regression analysis indicated that thyroid weight (OR = 0.963, 95%CI = 0.944 ∼ 0.982, P Graves' disease. These data indicated that CTLA-4 exon-1 49 A/G polymorphism may be associated with patient response to radionuclide 131 I therapy in Graves' disease. © 2017 Wiley Periodicals, Inc.

  6. [Effect of transcription activity regulated by VNTR-ZNF and -14C/T variants in the promoter region of ATP-binding cassette transporter 1 in HepG2 cells].

    Science.gov (United States)

    Gao, Shenxia; Zhao, Lili; Zhang, Ying; Mao, Yongmin

    2016-10-01

    To explore the effect of VNTR-ZNF and -14C/T variants of the promoter region of the ABCA1 gene on the transcription activity of genes in vitro. The recombinants were constructed by ligating DNA fragment containing VNTR-ZNF ACCCC inserted/deleted allele with or without -14C/T substitution fragments with a PGL2-basic vector containing luciferase reporter gene. The recombinants were then transfected into HepG2 cells using the cationic lipid method. After 48 h, transfected cells were collected and used to detect the luciferase activity. Luciferase activity of PGL2-ZNF-ACCCCDel was greater than that of PGL2-ZNF-ACCCCIns. Luciferase activity of PGL2-ZNFDel-14C was greater than that of PGL2-ZNFDel-14T, PGL2-ZNFIns-14C, PGL2-ZNFIns-14T. Compared with the insertion type, the ACCCC-deleted type of VNTR-ZNF can significantly enhance the transcription activity of ABCA1. And co-transfection of -14 C allele can further enhance this activity.

  7. Promoting industrialisation

    International Nuclear Information System (INIS)

    Hayfield, F.

    1986-04-01

    When the first nuclear power programme is decided upon, automatically the country has to initiate in parallel a programme to modify or add to its current industrial structure and resources. The extent of this new industrialisation depends upon many factors which both, the Government and the Industries have to consider. The Government has a vital role which includes the setting up of the background against which the industrial promotion should take place and in many cases may have also to play an active role all along this programme. Equally, the existing industries have an important role so as to achieve the most efficient participation in the nuclear programme. Invariably the industrial promotional programme will incur a certain degree of transfer of technology, the extent depending on the policies adopted. For this technology transfer to take place efficiently, both the donor and the receiver have to recognise each other's legitimate ambitions and fears. The transfer of technology is a process having a high human content and both donor and receiver have to take this into account. This can be further complicated when there is a difference in culture between them. Technology transfer is carried out within a contractual and organisational framework which will identify the donor (licensor) and the receiver (licensee). This framework may take various forms from a simple cooperative agreement, through a joint-venture organisation right to a standard contract between two separate entities. Each arrangement has its advantages and drawbacks and requires investment of different degrees. One of the keys to a successful industrial promotion is having it carried out in a timely fashion which will be parallel with the nuclear power programme. Experience in some countries has shown the problems when the industrialisation is out of phase with the programme whilst in other cases this industrialisation was at a level and scale unjustified. (author)

  8. Novel point mutations and mutational complexes in the enhancer II, core promoter and precore regions of hepatitis B virus genotype D1 associated with hepatocellular carcinoma in Saudi Arabia.

    Science.gov (United States)

    Khan, Anis; Al Balwi, Mohammed A; Tanaka, Yasuhito; Hajeer, Ali; Sanai, Faisal M; Al Abdulkarim, Ibrahim; Al Ayyar, Latifah; Badri, Motasim; Saudi, Dib; Tamimi, Waleed; Mizokami, Masashi; Al Knawy, Bandar

    2013-12-15

    In this study, a cohort of 182 patients [55 hepatocellular carcinoma (HCC) and 127 non-HCC] infected with hepatitis B virus (HBV) in Saudi Arabia was investigated to study the relationship between sequence variation in the enhancer II (EnhII), basal core promoter (BCP) and precore regions of HBV genotype D (HBV/D) and the risk of HCC. HBV genotypes were determined by sequencing analysis and/or enzyme-linked immunosorbent assay. Variations in the EnhII, BCP and precore regions were compared between 107 non-HCC and 45 HCC patients infected with HBV/D, followed by age-matched analysis of 40 cases versus equal number of controls. Age and male gender were significantly associated with HCC (p = 0.0001 and p = 0.03, respectively). Serological markers such as aspartate aminotransferase, albumin and anti-HBe were significantly associated with HCC (p = 0.0001 for all), whereas HBeAg positivity was associated with non-HCC (p = 0.0001). The most prevalent HBV genotype was HBV/D (94%), followed by HBV/E (4%), HBV/A (1.6%) and HBV/C (0.5%). For HBV/D1, genomic mutations associated with HCC were T1673/G1679, G1727, C1741, C1761, A1757/T1764/G1766, T1773, T1773/G1775 and C1909. Age- and gender-adjusted stepwise logistic regression analysis indicated that mutations G1727 [odds ratio (OR) = 18.3; 95% confidence interval (CI) = 2.8-118.4; p = 0.002], A1757/T1764/G1766 (OR = 4.7; 95% CI = 1.3-17.2; p = 0.01) and T1773 (OR = 14.06; 95% CI = 2.3-84.8; p = 0.004) are independent predictors of HCC development. These results implicate novel individual and combination patterns of mutations in the X/precore region of HBV/D1 as predictors of HCC. Risk stratification based on these mutation complexes would be useful in determining high-risk patients and improving diagnostic and treatment strategies for HBV/D1. Copyright © 2013 UICC.

  9. Wormholes minimally violating the null energy condition

    Energy Technology Data Exchange (ETDEWEB)

    Bouhmadi-López, Mariam [Departamento de Física, Universidade da Beira Interior, 6200 Covilhã (Portugal); Lobo, Francisco S N; Martín-Moruno, Prado, E-mail: mariam.bouhmadi@ehu.es, E-mail: fslobo@fc.ul.pt, E-mail: pmmoruno@fc.ul.pt [Centro de Astronomia e Astrofísica da Universidade de Lisboa, Campo Grande, Edifício C8, 1749-016 Lisboa (Portugal)

    2014-11-01

    We consider novel wormhole solutions supported by a matter content that minimally violates the null energy condition. More specifically, we consider an equation of state in which the sum of the energy density and radial pressure is proportional to a constant with a value smaller than that of the inverse area characterising the system, i.e., the area of the wormhole mouth. This approach is motivated by a recently proposed cosmological event, denoted {sup t}he little sibling of the big rip{sup ,} where the Hubble rate and the scale factor blow up but the cosmic derivative of the Hubble rate does not [1]. By using the cut-and-paste approach, we match interior spherically symmetric wormhole solutions to an exterior Schwarzschild geometry, and analyse the stability of the thin-shell to linearized spherically symmetric perturbations around static solutions, by choosing suitable properties for the exotic material residing on the junction interface radius. Furthermore, we also consider an inhomogeneous generalization of the equation of state considered above and analyse the respective stability regions. In particular, we obtain a specific wormhole solution with an asymptotic behaviour corresponding to a global monopole.

  10. [Minimally invasive approach for cervical spondylotic radiculopathy].

    Science.gov (United States)

    Ding, Liang; Sun, Taicun; Huang, Yonghui

    2010-01-01

    To summarize the recent minimally invasive approach for cervical spondylotic radiculopathy (CSR). The recent literature at home and abroad concerning minimally invasive approach for CSR was reviewed and summarized. There were two techniques of minimally invasive approach for CSR at present: percutaneous puncture techniques and endoscopic techniques. The degenerate intervertebral disc was resected or nucleolysis by percutaneous puncture technique if CSR was caused by mild or moderate intervertebral disc herniations. The cervical microendoscopic discectomy and foraminotomy was an effective minimally invasive approach which could provide a clear view. The endoscopy techniques were suitable to treat CSR caused by foraminal osteophytes, lateral disc herniations, local ligamentum flavum thickening and spondylotic foraminal stenosis. The minimally invasive procedure has the advantages of simple handling, minimally invasive and low incidence of complications. But the scope of indications is relatively narrow at present.

  11. Four inducible promoters for controlled gene expression in the oleaginous yeast Rhodotorula toruloides

    Directory of Open Access Journals (Sweden)

    Alexander Michael Bedford Johns

    2016-10-01

    Full Text Available Rhodotorula (Rhodosporidium toruloides is an oleaginous yeast with great biotechnological potential, capable of accumulating lipid up to 70 % of its dry biomass, and of carotenoid biosynthesis. However, few molecular genetic tools are available for manipulation of this basidiomycete yeast and its high genomic GC content can make routine cloning difficult. We have developed plasmid vectors for transformation of R. toruloides which include elements for Saccharomyces cerevisiae in-yeast assembly; this method is robust to the assembly of GC-rich DNA and of large plasmids. Using such vectors we screened for controllable promoters, and identified inducible promoters from the genes NAR1, ICL1, CTR3 and MET16. These four promoters have independent induction/repression conditions and exhibit different levels and rates of induction in R. toruloides, making them appropriate for controllable transgene expression in different experimental situations. Nested deletions were used to identify regulatory regions in the four promoters, and to delimit the minimal inducible promoters, which are as small as 200 bp for the NAR1 promoter. The NAR1 promoter shows very tight regulation under repressed conditions as determined both by an EGFP reporter gene and by conditional rescue of a leu2 mutant. These new tools facilitate molecular genetic manipulation and controllable gene expression in R. toruloides.

  12. Lithium modulation of the human inositol monophosphatase 2 (IMPA2) promoter

    International Nuclear Information System (INIS)

    Seelan, Ratnam S.; Parthasarathy, Latha K.; Parthasarathy, Ranga N.

    2004-01-01

    The inositol-signaling pathway is a therapeutic target for lithium in the treatment of bipolar disorder. Inositol monophosphatases (IMPases) play a key role in inositol signaling. Lithium's ability to inhibit IMPase 1 is well known, but its effect on IMPase 2 or on the transcriptional regulation of these genes has not been studied. Here, we report the identification and characterization of the minimal promoter of IMPA2 (encoding IMPase 2) in HeLa (epithelial) and SK-N-AS (neuronal) cells. IMPA2 promoter activity appears to be contributed by different elements in the 5' flanking region, suggesting that the gene is differentially regulated in neuronal and non-neuronal cells. Furthermore, IMPA2 promoter activity in both cell lines is downregulated, in a dose-dependent manner, by lithium after treatment for only 24 h. This effect is also observed in vivo. Our results suggest a possible role for IMPA2 in bipolar disorder

  13. Corporate tax minimization and stock price reactions

    OpenAIRE

    Blaufus, Kay; Möhlmann, Axel; Schwäbe, Alexander

    2016-01-01

    Tax minimization strategies may lead to significant tax savings, which could, in turn, increase firm value. However, such strategies are also associated with significant costs, such as expected penalties and planning, agency, and reputation costs. The overall impact of firms' tax minimization strategies on firm value is, therefore, unclear. To investigate whether corporate tax minimization increases firm value, we analyze the stock price reaction to news concerning corporate tax avoidance or ...

  14. Polymorphism rs189037C > T in the promoter region of the ATM gene may associate with reduced risk of T2DM in older adults in China: a case control study.

    Science.gov (United States)

    Ding, Xiang; Hao, Qiukui; Yang, Ming; Chen, Tie; Chen, Shanping; Yue, Jirong; Leng, Sean X; Dong, Birong

    2017-08-14

    Recent evidence indicates that ataxia telangiectasia mutated (ATM) is a cytoplasmic protein that involves in insulin signaling pathways. When ATM gene is mutated, this event appears to contribute to the development of insulin resistance and type 2 diabetes mellitus (T2DM). Up to date, little information about the relationship between ATM gene polymorphism and T2DM is available. This study aimed to explore potential association between a genetic variant [single nucleotide polymorphism (SNP), i.e. rs189037C > T] in the ATM promoter region and T2DM in older adults in China. We conducted a 1:1 age- and sex-matched case-control study. It enrolled 160 patients including 80 type 2 diabetic and 80 nondiabetic patients who were aged 60 years and above. Genotyping of the polymorphism rs189037 in the promoter of the ATM gene was performed using polymerase chain reaction-restriction fragment length polymorphism. Chi-square test or Fisher's exact test (when an expected cell count was ATM rs189037 polymorphism and T2DM (P = 0.037). The frequency of CT genotype is much higher in patients without T2DM than in diabetics (60.0% versus 40.0%, P = 0.012). After adjustment of the major confounding factors, such difference remained significant (OR for non-T2DM is 2.62, 95%CI = 1.05-6.53, P = 0.038). Similar effect of CT genotype on T2DM was observed in male population (adjusted: OR = 0.27, 95%CI = 0.09-0.84, P = 0.024). In addition, the percentage of TT genotype in diabetics with coronary artery disease (CAD) was considerably lower than in those without CAD (17.9% versus 61.5%, P = 0.004). Our study suggests that the ATM rs189037 polymorphism is associated with reduced risk of T2DM in older adult population in China. Specifically, CT heterozygote seems to be associated with a lower risk of T2DM than CC or TT genotype, especially in male older adults. Moreover, TT genotype may reduce the risk of CAD in diabetic patients.

  15. Safety control and minimization of radioactive wastes

    International Nuclear Information System (INIS)

    Wang Jinming; Rong Feng; Li Jinyan; Wang Xin

    2010-01-01

    Compared with the developed countries, the safety control and minimization of the radwastes in China are under-developed. The research of measures for the safety control and minimization of the radwastes is very important for the safety control of the radwastes, and the reduction of the treatment and disposal cost and environment radiation hazards. This paper has systematically discussed the safety control and the minimization of the radwastes produced in the nuclear fuel circulation, nuclear technology applications and the process of decommission of nuclear facilities, and has provided some measures and methods for the safety control and minimization of the radwastes. (authors)

  16. Characterization of promoter of EgPAL1, a novel PAL gene from the oil palm Elaeis guineensis Jacq.

    Science.gov (United States)

    Yusuf, Chong Yu Lok; Abdullah, Janna Ong; Shaharuddin, Noor Azmi; Abu Seman, Idris; Abdullah, Mohd Puad

    2018-02-01

    The oil palm EgPAL1 gene promoter and its regulatory region were functional as a promoter in the heterologous system of Arabidopsis according to the cis-acting elements present in that region. The promoter was developmentally regulated, vascular tissue specific and responsive to water stress agents. Phenylalanine ammonia lyase (PAL, EC 4.3.1.24) is the key enzyme of the phenylpropanoid pathway which plays important roles in plant development and adaptation. To date, there is no report on the study of PAL from oil palm (Elaeis guineensis), an economically important oil crop. In this study, the 5' regulatory sequence of a highly divergent oil palm PAL gene (EgPAL1) was isolated and fused with GUS in Arabidopsis to create two transgenic plants carrying the minimal promoter with (2302 bp) and without its regulatory elements (139 bp). The regulatory sequence contained cis-acting elements known to be important for plant development and stress response including the AC-II element for lignin biosynthesis and several stress responsive elements. The promoter and its regulatory region were fully functional in Arabidopsis. Its activities were characterised by two common fundamental features of PAL which are responsive to plant internal developmental programme and external factors. The promoter was developmentally regulated in certain organs; highly active in young organs but less active or inactive in mature organs. The presence of the AC elements and global activity of the EgPAL1 promoter in all organs resembled the property of lignin-related genes. The existence of the MBS element and enhancement of the promoter activity by PEG reflected the behaviour of drought-responsive genes. Our findings provide a platform for evaluating oil palm gene promoters in the heterologous system of Arabidopsis and give insights into the activities of EgPAL1 promoter in oil palm.

  17. AGRIEMAS project. Pilot project for promotion of environmental management system in the small and medium industries alimentary of region Abruzzo (Italy); Il progetto AGRIEMAS: un progetto pilota per la promozione di un sistema comunitario di ecogestione e audit nelle piccole e medie imprese del settore agroindustriale della regione Abruzzo

    Energy Technology Data Exchange (ETDEWEB)

    Luciani, R.; Andriola, L.; Brunetti, N. [ENEA Centro Ricerche Casaccia, S. Maria di Galeria, RM (Italy). Dipt. Ambiente; Vignati, S. [ENEA Centro Ricerche Casaccia, S. Maria di Galeria, RM (Italy). Dipt. Energia; Paci, S. [ENEA Centro Ricerche Casaccia, S. Maria di Galeria, RM (Italy). Dipt. Innovazione; Iacoboni, S.; Bonfitto, E. [ARSAA - Agenzia Regionale per i Servizi di Sviluppo Agricolo (Italy)

    1999-07-01

    The topic discussed in this report can be inserted within the context of case studies carried out by ENEA (National Agency for New Technology, Energy and the Environment) in the promotion of environmental management systems (EMAS - ISO14000). EMAS has a voluntary character; it intends to replace conflicting relations between control authority and firm with relations centred on a dialogue and action agreed upon by the parties, on the basis of impartial and reliable information. The report about AGRIEMAS pilot project illustrates the procedure for applying this regulation to the small and medium food industries of Region Abruzzo. [Italian] L'argomento del rappprto si inserisce nel contesto degli studi effettuati dall'ENEA nell'ambito della promozione dei sistemi di gestione ambientale (EMAS-ISO14000). Lo strumento EMAS, che ha carattere di volontarieta', intende sostituire un rapporto di tipo conflittuale fra autorita' di controllo e impresa con un rapporto centrato su un dialogo ed un'azione concertata tra le parti, sulle basi di un'informativa obiettiva ed affidabile. Il rapporto sul progetto pilota AGRIEMAS illustra il percorso per l'applicazione del regolamento EMAS nelle piccole e medie imprese del settore agroindustriale della regione Abruzzo.

  18. Single nucleotide polymorphisms (SNPs at CDH1 promoter region in familial gastric cancer Polimorfismos de nucleótido único (SNPs en la región promotora CDH1 en cáncer gástrico familiar

    Directory of Open Access Journals (Sweden)

    A. Ramos-de la Medina

    2006-01-01

    Full Text Available Introduction: gastric cancer is the most frequent gastrointestinal malignancy in Mexico and the proportion of patients younger than 40 years is one of the highest reported in the world literature. Recently several families with familial diffuse gastric cancer have been identified at the National Institute of Medical Sciences and Nutrition. Germline mutations in the E-cadherin gene (CHD1 have been described that result in the development of diffuse hereditary gastric cancer in young patients. Methods: the complete coding sequence at exons 1 to 16 and the promoter region of CDH1 was amplified by polymerase chain reaction in peripheral blood samples of two patients with early onset familial diffuse gastric cancer. Results: no germline inactivating mutations of CHD1 were found on either patient. Single nucleotide polymorphisms -160 C→A were detected in the promoter region of CDH1 in both patients. Conclusions: the polymorphism -160 C→A theoretically confers an increased risk of developing diffuse gastric cancer. The relatives of these patients may an increased risk of gastric cancer among other tumors. There is presently not enough evidence to consider the -160 C→A polymorphism an etiologic factor of diffuse gastric cancer in these patients since the frequency and type of genetic alterations of CDH1 are largely unknown in the Mexican population. It will be necessary to conduct epidemiologic studies in the Mexican population to determine the influence that genetic alterations have on the genesis of diffuse gastric carcinoma.Introducción: el cáncer gástrico es la neoplasia más frecuente del tracto gastrointestinal en México y la proporción de pacientes menores de 40 años es una de las más altas reportadas en la literatura mundial. Recientemente se han identificado en el Instituto Nacional de Ciencias Médicas y Nutrición varias familias con cáncer gástrico difuso familiar. Múltiples mutaciones germinales del gene de E-cadherina (CHD1

  19. Long-term exposure to PM2.5 lowers influenza virus resistance via down-regulating pulmonary macrophage Kdm6a and mediates histones modification in IL-6 and IFN-β promoter regions.

    Science.gov (United States)

    Ma, Jing-Hui; Song, Shao-Hua; Guo, Meng; Zhou, Ji; Liu, Fang; Peng, Li; Fu, Zhi-Ren

    2017-11-18

    Atmospheric particulates, especially PM2.5, not only damage the respiratory system, but also play important roles in pulmonary immunity. China is influenced by atmospheric diffusion conditions, industrial manufacturers, and heating and discharging. PM2.5 levels in the air rise substantially in the winter, which is also a period of flu high-incidence. Although an epidemiological link exists between PM2.5 and flu, we do not understand how long-term PM2.5 inhalation affects pulmonary immunity and the influenza virus response. Our study has prepared an in vivo PM2.5 mouse pharyngeal wall drop-in model and has found that PM2.5 exposure leads to mouse inflammatory injuries and furthers influenza A infection. Our results suggest that short-term exposure to PM2.5 significantly enhances the survival rate of influenza A-contaminated mice, while long-term PM2.5 inhalation lowers the capacity of pulmonary macrophages to secrete IL-6 and IFN-β. A disorder in the pulmonary innate defense system results in increased death rates following influenza infection. On a macromolecular level, this mechamism involves Kdm6a down-regulation after long-term exposure to PM 2.5 and a resultant increase in H3K4 and H3K9 methylation in IL-6 and IFN-β promoter regions. In summary, PM2.5 causes injuries of lung tissue cells and downregulates immune defense mechanisms in the lung. Copyright © 2017. Published by Elsevier Inc.

  20. Twitter as a Potential Disaster Risk Reduction Tool. Part III: Evaluating Variables that Promoted Regional Twitter Use for At-risk Populations During the 2013 Hattiesburg F4 Tornado.

    Science.gov (United States)

    Cooper, Guy Paul; Yeager, Violet; Burkle, Frederick M; Subbarao, Italo

    2015-06-29

    Study goals attempt to identify the variables most commonly associated with successful tweeted messages and determine which variables have the most influence in promoting exponential dissemination of information (viral spreading of the message) and trending (becoming popular) in the given disaster affected region. Part II describes the detailed extraction and triangulation filtration methodological approach to acquiring twitter data for the 2013 Hattiesburg Tornado. The data was then divided into two 48 hour windows before and after the tornado impact with a 2 hour pre-tornado buffer to capture tweets just prior to impact. Criteria-based analysis was completed for Tweets and users. The top 100 pre-Tornado and post-Tornado retweeted users were compared to establish the variability among the top retweeted users during the 4 day span.  Pre-Tornado variables that were correlated to higher retweeted rates include total user tweets (0.324), and total times message retweeted (0.530).  Post-Tornado variables that were correlated to higher retweeted rates include total hashtags in a retweet (0.538) and hashtags #Tornado (0.378) and #Hattiesburg (0.254). Overall hashtags usage significantly increased during the storm. Pre-storm there were 5,763 tweets with a hashtag and post-storm there was 13,598 using hashtags. Twitter's unique features allow it to be considered a unique social media tool applicable for emergency managers and public health officials for rapid and accurate two way communication.  Additionally, understanding how variables can be properly manipulated plays a key role in understanding how to use this social media platform for effective, accurate, and rapid mass information communication.

  1. Minimizing electrode contamination in an electrochemical cell

    Science.gov (United States)

    Kim, Yu Seung; Zelenay, Piotr; Johnston, Christina

    2014-12-09

    An electrochemical cell assembly that is expected to prevent or at least minimize electrode contamination includes one or more getters that trap a component or components leached from a first electrode and prevents or at least minimizes them from contaminating a second electrode.

  2. Matthew Arnold and Minimal Competency Testing.

    Science.gov (United States)

    Tuman, Myron C.

    1979-01-01

    Presents arguments by Robert Lowe and Matthew Arnold on the 19th century British "Payment by Results" Plan, whereby schools received funds for students who passed minimal competency tests. Emphasizes that the Victorian experience produced acrimonious teachers with low morale and encourages contemporary minimal testing advocates not to…

  3. The minimal manual: is less really more?

    NARCIS (Netherlands)

    Lazonder, Adrianus W.; van der Meij, Hans

    1993-01-01

    Carroll, Smith-Kerker, Ford and Mazur-Rimetz (The minimal manual, Human-Computer Interaction , 3, 123-153, 1987) have introduced the minimal manual as an alternative to standard self-instruction manuals. While their research indicates strong gains, only a few attempts have been made to validate

  4. Making the Most of Minimalism in Music.

    Science.gov (United States)

    Geiersbach, Frederick J.

    1998-01-01

    Describes the minimalist movement in music. Discusses generations of minimalist musicians and, in general, the minimalist approach. Considers various ways that minimalist strategies can be integrated into the music classroom focusing on (1) minimalism and (2) student-centered composition and principles of minimalism for use with elementary band…

  5. The relative volume growth of minimal submanifolds

    DEFF Research Database (Denmark)

    Markvorsen, Steen; Palmer, V.

    2002-01-01

    The volume growth of certain well-defined subsets of minimal submanifolds in riemannian spaces are compared with the volume growth of balls and spheres ill space forms of constant curvature.......The volume growth of certain well-defined subsets of minimal submanifolds in riemannian spaces are compared with the volume growth of balls and spheres ill space forms of constant curvature....

  6. Specialized minimal PDFs for optimized LHC calculations

    NARCIS (Netherlands)

    Carrazza, Stefano; Forte, Stefano; Kassabov, Zahari; Rojo, Juan

    2016-01-01

    We present a methodology for the construction of parton distribution functions (PDFs) designed to provide an accurate representation of PDF uncertainties for specific processes or classes of processes with a minimal number of PDF error sets: specialized minimal PDF sets, or SM-PDFs. We construct

  7. Minimal SUSY SO(10) and Yukawa unification

    International Nuclear Information System (INIS)

    Okada, Nobuchika

    2013-01-01

    The minimal supersymmetric (SUSY) SO(10) model, where only two Higgs multiplets {10⊕126-bar} are utilized for Yukawa couplings with matter fields, can nicely fit the neutrino oscillation parameters as well as charged fermion masses and mixing angles. In the fitting of the fermion mass matrix data, the largest element in the Yukawa coupling with the 126-bar -plet Higgs (Y 126 ) is found to be of order one, so that the right see-saw scale should be provided by Higgs vacuum expectation values (VEVs) of β(10 14 GeV). This fact causes a serious problem, namely, the gauge coupling unification is spoiled because of the presence of many exotic Higgs multiples emerging at the see-saw scale. In order to solve this problem, we consider a unification between bottom-quark and tau Yukawa couplings (b - τ Yukawa coupling unification) at the grand unified theory (GUT) scale, due to threshold corrections of superpartners to the Yukawa couplings at the 1 TeV scale. When the b - τ Yukawa coupling unification is very accurate, the largest element in Y 126 can become β(0.01), so that the right see-saw scale is realized by the GUT scale VEV and the usual gauge coupling unification is maintained. Since the b - τ Yukawa unification alters the Yukawa coupling data at the GUT scale, we re-analyze the fitting of the fermion mass matrix data by taking all the relevant free parameters into account. Unfortunately, we find that no parameter region shows up to give a nice fit for the current neutrino oscillation data and therefore, the usual picture of the gauge coupling unification cannot accommodate the fermion mass matrix data fitting in our procedure.

  8. Theories of minimalism in architecture: Post scriptum

    Directory of Open Access Journals (Sweden)

    Stevanović Vladimir

    2012-01-01

    Full Text Available Owing to the period of intensive development in the last decade of XX century, architectural phenomenon called Minimalism in Architecture was remembered as the Style of the Nineties, which is characterized, morphologically speaking, by simplicity and formal reduction. Simultaneously with its development in practice, on a theoretical level several dominant interpretative models were able to establish themselves. The new millennium and time distance bring new problems; therefore this paper represents a discussion on specific theorization related to Minimalism in Architecture that can bear the designation of post scriptum, because their development starts after the constitutional period of architectural minimalist discourse. In XXI century theories, the problem of definition of minimalism remains important topic, approached by theorists through resolving on the axis: Modernism - Minimal Art - Postmodernism - Minimalism in Architecture. With regard to this, analyzed texts can be categorized in two groups: 1 texts of affirmative nature and historical-associative approach in which minimalism is identified with anything that is simple and reduced, in an idealizing manner, relied mostly on the existing hypotheses; 2 critically oriented texts, in which authors reconsider adequacy of the very term 'minimalism' in the context of architecture and take a metacritical attitude towards previous texts.

  9. Complications of minimally invasive cosmetic procedures: Prevention and management

    Directory of Open Access Journals (Sweden)

    Lauren L Levy

    2012-01-01

    Full Text Available Over the past decade, facial rejuvenation procedures to circumvent traditional surgery have become increasingly popular. Office-based, minimally invasive procedures can promote a youthful appearance with minimal downtime and low risk of complications. Injectable botulinum toxin (BoNT, soft-tissue fillers, and chemical peels are among the most popular non-invasive rejuvenation procedures, and each has unique applications for improving facial aesthetics. Despite the simplicity and reliability of office-based procedures, complications can occur even with an astute and experienced injector. The goal of any procedure is to perform it properly and safely; thus, early recognition of complications when they do occur is paramount in dictating prevention of long-term sequelae. The most common complications from BoNT and soft-tissue filler injection are bruising, erythema and pain. With chemical peels, it is not uncommon to have erythema, irritation and burning. Fortunately, these side effects are normally transient and have simple remedies. More serious complications include muscle paralysis from BoNT, granuloma formation from soft-tissue filler placement and scarring from chemical peels. Thankfully, these complications are rare and can be avoided with excellent procedure technique, knowledge of facial anatomy, proper patient selection, and appropriate pre- and post-skin care. This article reviews complications of office-based, minimally invasive procedures, with emphasis on prevention and management. Practitioners providing these treatments should be well versed in this subject matter in order to deliver the highest quality care.

  10. Regulation of the intronic promoter of rat estrogen receptor alpha gene, responsible for truncated estrogen receptor product-1 expression.

    Science.gov (United States)

    Schausi, Diane; Tiffoche, Christophe; Thieulant, Marie-Lise

    2003-07-01

    We have characterized the intronic promoter of the rat estrogen receptor (ER) alpha gene, responsible for the lactotrope-specific truncated ER product (TERP)-1 isoform expression. Transcriptional regulation was investigated by transient transfections using 5'-deletion constructs. TERP promoter constructs were highly active in MMQ cells, a pure lactotrope cell line, whereas a low basal activity was detected in alphaT3-1 gonadotrope cells or in COS-7 monkey kidney cells. Serial deletion analysis revealed that 1) a minimal -693-bp region encompassing the TATA box is sufficient to allow lactotrope-specific expression; 2) the promoter contains strong positive cis-acting elements both in the distal and proximal regions, and 3) the region spanning the -1698/-1194 region includes repressor elements. Transient transfection studies, EMSAs, and gel shifts demonstrated that estrogen activates the TERP promoter via an estrogen-responsive element (ERE1) located within the proximal region. Mutation of ERE1 site completely abolishes the estradiol-dependent transcription, indicating that ERE1 site is sufficient to confer estrogen responsiveness to TERP promoter. In addition, ERalpha action was synergized by transfection of the pituitary-specific factor Pit-1. EMSAs showed that a single Pit-1 DNA binding element in the vicinity of the TATA box is sufficient to confer response by the TERP promoter. In conclusion, we demonstrated, for the first time, that TERP promoter regulation involves ERE and Pit-1 cis-elements and corresponding trans-acting factors, which could play a role in the physiological changes that occur in TERP-1 transcription in lactotrope cells.

  11. Comprehensive analysis of the MLH1 promoter region in 480 patients with colorectal cancer and 1150 controls reveals new variants including one with a heritable constitutional MLH1 epimutation.

    Science.gov (United States)

    Morak, Monika; Ibisler, Ayseguel; Keller, Gisela; Jessen, Ellen; Laner, Andreas; Gonzales-Fassrainer, Daniela; Locher, Melanie; Massdorf, Trisari; Nissen, Anke M; Benet-Pagès, Anna; Holinski-Feder, Elke

    2018-04-01

    Germline defects in MLH1 , MSH2 , MSH6 and PMS2 predisposing for Lynch syndrome (LS) are mainly based on sequence changes, whereas a constitutional epimutation of MLH1 (CEM) is exceptionally rare. This abnormal MLH1 promoter methylation is not hereditary when arising de novo, whereas a stably heritable and variant-induced CEM was described for one single allele. We searched for MLH1 promoter variants causing a germline or somatic methylation induction or transcriptional repression. We analysed the MLH1 promoter sequence in five different patient groups with colorectal cancer (CRC) (n=480) composed of patients with i) CEM (n=16), ii) unsolved loss of MLH1 expression in CRC (n=37), iii) CpG-island methylator-phenotype CRC (n=102), iv) patients with LS (n=83) and v) MLH1-proficient CRC (n=242) as controls. 1150 patients with non-LS tumours also served as controls to correctly judge the results. We detected 10 rare MLH1 promoter variants. One novel, complex MLH1 variant c.-63_-58delins18 is present in a patient with CRC with CEM and his sister, both showing a complete allele-specific promoter methylation and transcriptional silencing. The other nine promoter variants detected in 17 individuals were not associated with methylation. For four of these, a normal, biallelic MLH1 expression was found in the patients' cDNA. We report the second promoter variant stably inducing a hereditary CEM. Concerning the classification of promoter variants, we discuss contradictory results from the literature for two variants, describe classification discrepancies between existing rules for five variants, suggest the (re-)classification of five promoter variants to (likely) benign and regard four variants as functionally unclear. © Article author(s) (or their employer(s) unless otherwise stated in the text of the article) 2018. All rights reserved. No commercial use is permitted unless otherwise expressly granted.

  12. Technology applications for radioactive waste minimization

    International Nuclear Information System (INIS)

    Devgun, J.S.

    1994-01-01

    The nuclear power industry has achieved one of the most successful examples of waste minimization. The annual volume of low-level radioactive waste shipped for disposal per reactor has decreased to approximately one-fifth the volume about a decade ago. In addition, the curie content of the total waste shipped for disposal has decreased. This paper will discuss the regulatory drivers and economic factors for waste minimization and describe the application of technologies for achieving waste minimization for low-level radioactive waste with examples from the nuclear power industry

  13. Graphical approach for multiple values logic minimization

    Science.gov (United States)

    Awwal, Abdul Ahad S.; Iftekharuddin, Khan M.

    1999-03-01

    Multiple valued logic (MVL) is sought for designing high complexity, highly compact, parallel digital circuits. However, the practical realization of an MVL-based system is dependent on optimization of cost, which directly affects the optical setup. We propose a minimization technique for MVL logic optimization based on graphical visualization, such as a Karnaugh map. The proposed method is utilized to solve signed-digit binary and trinary logic minimization problems. The usefulness of the minimization technique is demonstrated for the optical implementation of MVL circuits.

  14. Minimal covariant observables identifying all pure states

    Energy Technology Data Exchange (ETDEWEB)

    Carmeli, Claudio, E-mail: claudio.carmeli@gmail.com [D.I.M.E., Università di Genova, Via Cadorna 2, I-17100 Savona (Italy); I.N.F.N., Sezione di Genova, Via Dodecaneso 33, I-16146 Genova (Italy); Heinosaari, Teiko, E-mail: teiko.heinosaari@utu.fi [Turku Centre for Quantum Physics, Department of Physics and Astronomy, University of Turku (Finland); Toigo, Alessandro, E-mail: alessandro.toigo@polimi.it [Dipartimento di Matematica, Politecnico di Milano, Piazza Leonardo da Vinci 32, I-20133 Milano (Italy); I.N.F.N., Sezione di Milano, Via Celoria 16, I-20133 Milano (Italy)

    2013-09-02

    It has been recently shown by Heinosaari, Mazzarella and Wolf (2013) [1] that an observable that identifies all pure states of a d-dimensional quantum system has minimally 4d−4 outcomes or slightly less (the exact number depending on d). However, no simple construction of this type of minimal observable is known. We investigate covariant observables that identify all pure states and have minimal number of outcomes. It is shown that the existence of this kind of observables depends on the dimension of the Hilbert space.

  15. Minimal free resolutions over complete intersections

    CERN Document Server

    Eisenbud, David

    2016-01-01

    This book introduces a theory of higher matrix factorizations for regular sequences and uses it to describe the minimal free resolutions of high syzygy modules over complete intersections. Such resolutions have attracted attention ever since the elegant construction of the minimal free resolution of the residue field by Tate in 1957. The theory extends the theory of matrix factorizations of a non-zero divisor, initiated by Eisenbud in 1980, which yields a description of the eventual structure of minimal free resolutions over a hypersurface ring. Matrix factorizations have had many other uses in a wide range of mathematical fields, from singularity theory to mathematical physics.

  16. Transience and capacity of minimal submanifolds

    DEFF Research Database (Denmark)

    Markvorsen, Steen; Palmer, V.

    2003-01-01

    We prove explicit lower bounds for the capacity of annular domains of minimal submanifolds P-m in ambient Riemannian spaces N-n with sectional curvatures bounded from above. We characterize the situations in which the lower bounds for the capacity are actually attained. Furthermore we apply...... these bounds to prove that Brownian motion defined on a complete minimal submanifold is transient when the ambient space is a negatively curved Hadamard-Cartan manifold. The proof stems directly from the capacity bounds and also covers the case of minimal submanifolds of dimension m > 2 in Euclidean spaces....

  17. Non-minimal Wu-Yang monopole

    International Nuclear Information System (INIS)

    Balakin, A.B.; Zayats, A.E.

    2007-01-01

    We discuss new exact spherically symmetric static solutions to non-minimally extended Einstein-Yang-Mills equations. The obtained solution to the Yang-Mills subsystem is interpreted as a non-minimal Wu-Yang monopole solution. We focus on the analysis of two classes of the exact solutions to the gravitational field equations. Solutions of the first class belong to the Reissner-Nordstroem type, i.e., they are characterized by horizons and by the singularity at the point of origin. The solutions of the second class are regular ones. The horizons and singularities of a new type, the non-minimal ones, are indicated

  18. Assessment of LANL waste minimization plan

    International Nuclear Information System (INIS)

    Davis, K.D.; McNair, D.A.; Jennrich, E.A.; Lund, D.M.

    1991-04-01

    The objective of this report is to evaluate the Los Alamos National Laboratory (LANL) Waste Minimization Plan to determine if it meets applicable internal (DOE) and regulatory requirements. The intent of the effort is to assess the higher level elements of the documentation to determine if they have been addressed rather than the detailed mechanics of the program's implementation. The requirement for a Waste Minimization Plan is based in several DOE Orders as well as environmental laws and regulations. Table 2-1 provides a list of the major documents or regulations that require waste minimization efforts. The table also summarizes the applicable requirements

  19. Waste minimization and pollution prevention awareness plan

    Energy Technology Data Exchange (ETDEWEB)

    1991-05-31

    The purpose of this plan is to document the Lawrence Livermore National Laboratory (LLNL) Waste Minimization and Pollution Prevention Awareness Program. The plan specifies those activities and methods that are or will be employed to reduce the quantity and toxicity of wastes generated at the site. The intent of this plan is to respond to and comply with (DOE's) policy and guidelines concerning the need for pollution prevention. The Plan is composed of a LLNL Waste Minimization and Pollution Prevention Awareness Program Plan and, as attachments, Program- and Department-specific waste minimization plans. This format reflects the fact that waste minimization is considered a line management responsibility and is to be addressed by each of the Programs and Departments. 14 refs.

  20. On ``minimally curved spacetimes'' in general relativity

    OpenAIRE

    Dadhich, Naresh

    1997-01-01

    We consider a spacetime corresponding to uniform relativistic potential analogus to Newtonian potential as an example of ``minimally curved spacetime''. We also consider a radially symmetric analogue of the Rindler spacetime of uniform proper accelerat