WorldWideScience

Sample records for midsporulation element mse

  1. Networks, Micro Small Enterprises (MSE'S) and Performance: the ...

    African Journals Online (AJOL)

    Networks, Micro Small Enterprises (MSE'S) and Performance: the Case of Kenya. ... Abstract. This paper examines the role of informal personal networks in determining. Micro Small Enterprises (MSE's) ... Article Metrics. Metrics Loading .

  2. Evaluation of ITER MSE Viewing Optics

    Energy Technology Data Exchange (ETDEWEB)

    Allen, S; Lerner, S; Morris, K; Jayakumar, J; Holcomb, C; Makowski, M; Latkowski, J; Chipman, R

    2007-03-26

    The Motional Stark Effect (MSE) diagnostic on ITER determines the local plasma current density by measuring the polarization angle of light resulting from the interaction of a high energy neutral heating beam and the tokamak plasma. This light signal has to be transmitted from the edge and core of the plasma to a polarization analyzer located in the port plug. The optical system should either preserve the polarization information, or it should be possible to reliably calibrate any changes induced by the optics. This LLNL Work for Others project for the US ITER Project Office (USIPO) is focused on the design of the viewing optics for both the edge and core MSE systems. Several design constraints were considered, including: image quality, lack of polarization aberrations, ease of construction and cost of mirrors, neutron shielding, and geometric layout in the equatorial port plugs. The edge MSE optics are located in ITER equatorial port 3 and view Heating Beam 5, and the core system is located in equatorial port 1 viewing heating beam 4. The current work is an extension of previous preliminary design work completed by the ITER central team (ITER resources were not available to complete a detailed optimization of this system, and then the MSE was assigned to the US). The optimization of the optical systems at this level was done with the ZEMAX optical ray tracing code. The final LLNL designs decreased the ''blur'' in the optical system by nearly an order of magnitude, and the polarization blur was reduced by a factor of 3. The mirror sizes were reduced with an estimated cost savings of a factor of 3. The throughput of the system was greater than or equal to the previous ITER design. It was found that optical ray tracing was necessary to accurately measure the throughput. Metal mirrors, while they can introduce polarization aberrations, were used close to the plasma because of the anticipated high heat, particle, and neutron loads. These mirrors

  3. Patriot Advanced Capability-3 Missile Segment Enhancement (PAC-3 MSE)

    Science.gov (United States)

    2015-12-01

    sustainment reliability will exceed 20 hours MTBCMF. Will be demonstrated during Post Deployment Build -8 and Radar Digital Processor- Configuration...Technology and Logistics) PAC-3 MSE December 2015 SAR March 21, 2016 09:42:58 UNCLASSIFIED 4 COL John M. Eggert Lower Tier Project Office Building 5250...PAC-3 MSE) is a high velocity, hit-to-kill, surface -to-air missile capable of intercepting and destroying Tactical Ballistic Missiles (TBM) and air

  4. Analysing correlation between the MSE index and global stock markets

    OpenAIRE

    Ellul, Reuben

    2015-01-01

    The paper investigates the time-varying correlation between the Malta Stock Exchange (MSE) index, and five major international stock markets. An MGARCH-DCC approach is employed to measure the degree to which the MSE moves with other stock markets. Daily returns on these six stock exchange indices were computed and used to calculate dynamic conditional correlations (DCCs) between the markets. The results indicate that the local stock market appears not to be driven by the same forces that shap...

  5. The MSE Budget in Hindcast Experiments During DYNAMO

    Science.gov (United States)

    Hannah, W.; Maloney, E. D.

    2013-12-01

    The Dynamics of the MJO (DYNAMO) field campaign took place in the Indian Ocean during boreal fall and winter of 2011-2012 to collect observations of the initiation of the Madden-Julian Oscillation (MJO). Hindcast experiments are conducted with an atmospheric general circulation model with varying values of a dilute CAPE entrainment rate parameter for the first two MJO events of DYNAMO from 01 October - 15 December 2011. Higher entrainment rates better reproduce the gross features of precipitation and zonal wind, with MJO hindcast skill up to 20 days. Simulations with lower entrainment rapidly diverge from observations such that no coherent MJO convective signal is present after five days, and the model has no MJO skill beyond 12 days. Analysis of the tropical Indian Ocean column moist static energy (MSE) budget reveals that the simulations with superior MJO performance are characterized by strong positive vertical MSE advection, indicating that convection and associated divergent circulations act to moisten the column. This is inconsistent with ERA-I reanalysis in which vertical MSE advection contributes a drying tendency on average. All simulations have weaker MSE tendency due to MSE sources such as radiation and surface fluxes compared to reanalysis. The concept of gross moist stability (GMS) is invoked to interpret these MSE budget results in a normalized framework relevant to moisture mode theory. A larger entrainment rate is found to produce negative effective GMS (which includes vertical advection and all MSE sources), in agreement with observations, indicating a favorable environment for moisture mode amplification. However, the simulations with higher entrainment appear to get the right answer for the wrong reason because unrealistically strong positive vertical MSE advective tendencies per unit convective activity appear to compensate for weak radiation and surface flux feedbacks.

  6. MSE observatory: a revised and optimized astronomical facility

    Science.gov (United States)

    Bauman, Steven E.; Angers, Mathieu; Benedict, Tom; Crampton, David; Flagey, Nicolas; Gedig, Mike; Green, Greg; Liu, Andy; Lo, David; Loewen, Nathan; McConnachie, Alan; Murowinski, Rick; Racine, René; Salmon, Derrick; Stiemer, Siegfried; Szeto, Kei; Wu, Di

    2016-07-01

    The Canada-France-Hawaii-Telescope Corporation (CFHT) plans to repurpose its observatory on the summit of Maunakea and operate a (60 segment) 11.25m aperture wide field spectroscopic survey telescope, the Maunakea Spectroscopic Explorer (MSE). The prime focus telescope will be equipped with dedicated instrumentation to take advantage of one of the best sites in the northern hemisphere and offer its users the ability to perform large surveys. Central themes of the development plan are reusing and upgrading wherever possible. MSE will reuse the CFHT site and build upon the existing observatory infrastructure, using the same building and telescope pier as CFHT, while minimizing environmental impact on the summit. MSE will require structural support upgrades to the building to meet the latest building seismic code requirements and accommodate a new larger telescope and upgraded enclosure. It will be necessary to replace the current dome since a larger slit opening is needed for a larger telescope. MSE will use a thermal management system to remove heat generated by loads from the building, flush excess heat from lower levels, and maintain the observing environment temperature. This paper describes the design approach for redeveloping the CFHT facility for MSE. Once the project is completed the new facility will be almost indistinguishable on the outside from the current CFHT observatory. Past experience and lessons learned from CFHT staff and the astronomical community will be used to create a modern, optimized, and transformative scientific data collecting machine.

  7. Results from the NSTX MSE-CIF diagnostic

    Science.gov (United States)

    Yuh, Howard Y.; Levinton, F. M.; Menard, J. E.

    2006-10-01

    A twelve channel Collisionally-Induced Fluorescence Motional Stark Effect diagnostic, covering the plasma minor radius on the outboard side, is routinely operated for the primary purpose of providing internal magnetic pitch angle measurements for equilibrium reconstruction. While the NSTX MSE-CIF requires the use of novel high-throughput, narrow bandpass (0.07 nm) Lyot filters to operate at low magnetic field (0.3-0.55T), a traditional PEM-based polarimeter is used to make the angular measurement. The polarimeter is calibrated by reconciling MSE measured angles with magnetic reconstructions during beam injection into gas-fill-torus with vacuum fields. It has recently been suggested that fast ions resulting from ionization of the beam neutrals with the fill gas may contaminate the measured angle by emitting additional Balmer-alpha after re-neutralizing via charge-exchange. Results from 3D simulations of this widely used MSE calibration technique from several machine geometries, including NSTX, C-Mod, and ITER will be presented. Highlights from MSE results for the 2006 NSTX run campaign will also be presented. Supported by DOE contracts DE-FG02-99ER54520 and DE-AC02-76CH03073.

  8. VOLATILITY AND KURTOSIS OF DAILY STOCK RETURNS AT MSE

    Directory of Open Access Journals (Sweden)

    Zoran Ivanovski

    2015-12-01

    Full Text Available Prominent financial stock pricing models are built on assumption that asset returns follow a normal (Gaussian distribution. However, many authors argue that in the practice stock returns are often characterized by skewness and kurtosis, so we test the existence of the Gaussian distribution of stock returns and calculate the kurtosis of several stocks at the Macedonian Stock Exchange (MSE. Obtaining information about the shape of distribution is an important step for models of pricing risky assets. The daily stock returns at Macedonian Stock Exchange (MSE are characterized by high volatility and non-Gaussian behaviors as well as they are extremely leptokurtic. The analysis of MSE time series stock returns determine volatility clustering and high kurtosis. The fact that daily stock returns at MSE are not normally distributed put into doubt results that rely heavily on this assumption and have significant implications for portfolio management. We consider this stock market as good representatives of emerging markets. Therefore, we argue that our results are valid for other similar emerging stock markets.

  9. Analytical and Numerical Evaluation of Limit States of MSE Wall Structure

    Directory of Open Access Journals (Sweden)

    Drusa Marián

    2016-12-01

    Full Text Available Simplification of the design of Mechanically Stabilized Earth wall structures (MSE wall or MSEW is now an important factor that helps us not only to save a time and costs, but also to achieve the desired results more reliably. It is quite common way in practice, that the designer of a section of motorway or railway line gives order for design to a supplier of geosynthetics materials. However, supplier company has experience and skills, but a general designer does not review the safety level of design and its efficiency, and is simply incorporating into the overall design of the construction project. Actually, large number of analytical computational methods for analysis and design of MSE walls or similar structures are known. The problem of these analytical methods is the verification of deformations and global stability of structure. The article aims to clarify two methods of calculating the internal stability of MSE wall and their comparison with FEM numerical model. Comparison of design approaches allows us to draft an effective retaining wall and tells us about the appropriateness of using a reinforcing element.

  10. Analytical and Numerical Evaluation of Limit States of MSE Wall Structure

    Science.gov (United States)

    Drusa, Marián; Vlček, Jozef; Holičková, Martina; Kais, Ladislav

    2016-12-01

    Simplification of the design of Mechanically Stabilized Earth wall structures (MSE wall or MSEW) is now an important factor that helps us not only to save a time and costs, but also to achieve the desired results more reliably. It is quite common way in practice, that the designer of a section of motorway or railway line gives order for design to a supplier of geosynthetics materials. However, supplier company has experience and skills, but a general designer does not review the safety level of design and its efficiency, and is simply incorporating into the overall design of the construction project. Actually, large number of analytical computational methods for analysis and design of MSE walls or similar structures are known. The problem of these analytical methods is the verification of deformations and global stability of structure. The article aims to clarify two methods of calculating the internal stability of MSE wall and their comparison with FEM numerical model. Comparison of design approaches allows us to draft an effective retaining wall and tells us about the appropriateness of using a reinforcing element.

  11. Intra-shot MSE Calibration Technique For LHCD Experiments

    Energy Technology Data Exchange (ETDEWEB)

    Ko, Jinseok; Scott, Steve; Shiraiwa, Syun' ichi; Greenwald, Martin; Parker, Ronald; Wallace, Gregory

    2009-11-23

    The spurious drift in pitch angle of order several degrees measured by the Motional Stark Effect (MSE) diagnostic in the Alcator C-Mod tokamak1 over the course of an experimental run day has precluded direct utilization of independent absolute calibrations. Recently, the underlying cause of the drift has been identified as thermal stress-induced birefringence in a set of in-vessel lenses. The shot-to-shot drift can be avoided by using MSE to measure only the change in pitch angle between a reference phase and a phase of physical interest within a single plasma discharge. This intra-shot calibration technique has been applied to the Lower Hybrid Current Drive (LHCD) experiments and the measured current profiles qualitatively demonstrate several predictions of LHCD theory such as an inverse dependence of current drive efficiency on the parallel refractive index and the presence of off-axis current drive.

  12. Life beyond MSE and R2 — improving validation of predictive models with observations

    Science.gov (United States)

    Papritz, Andreas; Nussbaum, Madlene

    2017-04-01

    Machine learning and statistical predictive methods are evaluated by the closeness of predictions to observations of a test dataset. Common criteria for rating predictive methods are bias and mean square error (MSE), characterizing systematic and random prediction errors. Many studies also report R2-values, but their meaning is not always clear (correlation between observations and predictions or MSE skill score; Wilks, 2011). The same criteria are also used for choosing tuning parameters of predictive procedures by cross-validation and bagging (e.g. Hastie et al., 2009). For evident reasons, atmospheric sciences have developed a rich box of tools for forecast verification. Specific criteria have been proposed for evaluating deterministic and probabilistic predictions of binary, multinomial, ordinal and continuous responses (see reviews by Wilks, 2011, Jollie and Stephenson, 2012 and Gneiting et al., 2007). It appears that these techniques are not very well-known in the geosciences community interested in machine learning. In our presentation we review techniques that offer more insight into proximity of data and predictions than bias, MSE and R2 alone. We mention here only examples: (i) Graphing observations vs. predictions is usually more appropriate than the reverse (Piñeiro et al., 2008). (ii) The decomposition of the Brier score score (= MSE for probabilistic predictions of binary yes/no data) into reliability and resolution reveals (conditional) bias and capability of discriminating yes/no observations by the predictions. We illustrate the approaches by applications from digital soil mapping studies. Gneiting, T., Balabdaoui, F., and Raftery, A. E. (2007). Probabilistic forecasts, calibration and sharpness. Journal of the Royal Statistical Society Series B, 69, 243-268. Hastie, T., Tibshirani, R., and Friedman, J. (2009). The Elements of Statistical Learning; Data Mining, Inference and Prediction. Springer, New York, second edition. Jolliffe, I. T. and

  13. A LINEAR HYBRID MODEL OF MSE AND BEM FOR FLOATING STRUCTURES IN COASTAL ZONES

    Institute of Scientific and Technical Information of China (English)

    ZHANG Jun; MIAO Guo-ping

    2006-01-01

    A linear hybrid model of Mild Slope Equation (MSE) and Boundary Element Method (BEM) is developed to study the wave propagation around floating structures in coastal zones. Both the wave refraction under the influence of topography and the wave diffraction by floating structures are considered. Hence, the model provides wave properties around the coastal floating structures of arbitrary shape but also the wave forces on and the hydrodynamic characteristics of the structures. Different approaches are compared to demonstrate the validity of the present hybrid model. Several numerical tests are carried out for the cases of pontoons under different circumstances. The results show that the influence of topography on the hydrodynamic characteristics of floating structures in coastal regions is important and must not be ignored in the most wave period range with practical interests.

  14. On the MSE Performance and Optimization of Regularized Problems

    KAUST Repository

    Alrashdi, Ayed

    2016-11-01

    The amount of data that has been measured, transmitted/received, and stored in the recent years has dramatically increased. So, today, we are in the world of big data. Fortunately, in many applications, we can take advantages of possible structures and patterns in the data to overcome the curse of dimensionality. The most well known structures include sparsity, low-rankness, block sparsity. This includes a wide range of applications such as machine learning, medical imaging, signal processing, social networks and computer vision. This also led to a specific interest in recovering signals from noisy compressed measurements (Compressed Sensing (CS) problem). Such problems are generally ill-posed unless the signal is structured. The structure can be captured by a regularizer function. This gives rise to a potential interest in regularized inverse problems, where the process of reconstructing the structured signal can be modeled as a regularized problem. This thesis particularly focuses on finding the optimal regularization parameter for such problems, such as ridge regression, LASSO, square-root LASSO and low-rank Generalized LASSO. Our goal is to optimally tune the regularizer to minimize the mean-squared error (MSE) of the solution when the noise variance or structure parameters are unknown. The analysis is based on the framework of the Convex Gaussian Min-max Theorem (CGMT) that has been used recently to precisely predict performance errors.

  15. Robust MSE precoder for imperfectly known MIMO wireless correlated channel

    Institute of Scientific and Technical Information of China (English)

    MA Peng-fei; ZHAO Hui; WANG Wen-bo

    2009-01-01

    Aimed at that only one form of channel statistic information is utilized in traditional robust precoder schemes: either the channel mean or the transmit antenna correlation in multiple-input multiple-output (MIMO) wireless system, this paper proposes robust precoder designs which exploit both of statistic information to minimize the equalization mean-square error (MSE) with power constraint. Two different power constraints are studied. Besides the usual sum power constraint over all antennas, the per-antenna power constraint is imposed at transmitter in this paper. Since each antenna has its own amplifier, individual power constraint on each antenna is more realistic. Especially in MIMO-OFDM systems, the Peak-to-Average Ratio (PAR) is one of main practical problems. Simulations show that the proposed schemes have better performance than traditional normalized zero forcing schemes for imperfectly known correlated channel. Moreover, per-antenna power constraint can efficiently decrease the demand of dynamic range of power amplifier on each transmit antenna, especially in MIMO-OFDM systems.

  16. MHD marking using the MSE polarimeter optics in ILW JET plasmas

    Science.gov (United States)

    Reyes Cortes, S.; Alper, B.; Alves, D.; Baruzzo, M.; Bernardo, J.; Buratti, P.; Coelho, R.; Challis, C.; Chapman, I.; Hawkes, N.; Hender, T. C.; Hobirk, J.; Joffrin, E.

    2016-11-01

    In this communication we propose a novel diagnostic technique, which uses the collection optics of the JET Motional Stark Effect (MSE) diagnostic, to perform polarimetry marking of observed MHD in high temperature plasma regimes. To introduce the technique, first we will present measurements of the coherence between MSE polarimeter, electron cyclotron emission, and Mirnov coil signals aiming to show the feasibility of the method. The next step consists of measuring the amplitude fluctuation of the raw MSE polarimeter signals, for each MSE channel, following carefully the MHD frequency on Mirnov coil data spectrograms. A variety of experimental examples in JET ITER-Like Wall (ILW) plasmas are presented, providing an adequate picture and interpretation for the MSE optics polarimeter technique.

  17. On the Convexity of the MSE Region of Single-Antenna Users

    CERN Document Server

    Hunger, Raphael

    2008-01-01

    We prove convexity of the sum-power constrained mean square error (MSE) region in case of two single-antenna users communicating with a multi-antenna base station. Due to the MSE duality this holds both for the vector broadcast channel and the dual multiple access channel. Increasing the number of users to more than two, we show by means of a simple counter-example that the resulting MSE region is not necessarily convex any longer, even under the assumption of single-antenna users. In conjunction with our former observation that the two user MSE region is not necessarily convex for two multi-antenna users, this extends and corrects the hitherto existing notion of the MSE region geometry.

  18. MHD marking using the MSE polarimeter optics in ILW JET plasmas

    CERN Document Server

    Reyes Cortes, S.; Alves, D.; Baruzzo, M.; Bernardo, J.; Buratti, P.; Coelho, R.; Challis, C.; Chapman, I.; Hawkes, N.; Hender, T.C.; Hobirk, J.; Joffrin, E.

    2016-01-01

    In this communication we propose a novel diagnostic technique, which uses the collection optics of the JET Motional Stark Effect (MSE) diagnostic, to perform polarimetry marking of observed MHD in high temperature plasma regimes. To introduce the technique, first we will present measurements of the coherence between MSE polarimeter, electron cyclotron emission, and Mirnov coil signals aiming to show the feasibility of the method. The next step consists of measuring the amplitude fluctuation of the raw MSE polarimeter signals, for each MSE channel, following carefully the MHD frequency on Mirnov coil data spectrograms. A variety of experimental examples in JET ITER-Like Wall (ILW) plasmas are presented, providing an adequate picture and interpretation for the MSE optics polarimeter technique.

  19. Tokamak-independent software analysis suite for multi-spectral line-polarization MSE diagnostics

    Science.gov (United States)

    Scott, S. D.; Mumgaard, R. T.

    2016-11-01

    A tokamak-independent analysis suite has been developed to process data from Motional Stark Effect (mse) diagnostics. The software supports multi-spectral line-polarization mse diagnostics which simultaneously measure emission at the mse σ and π lines as well as at two "background" wavelengths that are displaced from the mse spectrum by a few nanometers. This analysis accurately estimates the amplitude of partially polarized background light at the σ and π wavelengths even in situations where the background light changes rapidly in time and space, a distinct improvement over traditional "time-interpolation" background estimation. The signal amplitude at many frequencies is computed using a numerical-beat algorithm which allows the retardance of the mse photo-elastic modulators (pem's) to be monitored during routine operation. It also allows the use of summed intensities at multiple frequencies in the calculation of polarization direction, which increases the effective signal strength and reduces sensitivity to pem retardance drift. The software allows the polarization angles to be corrected for calibration drift using a system that illuminates the mse diagnostic with polarized light at four known polarization angles within ten seconds of a plasma discharge. The software suite is modular, parallelized, and portable to other facilities.

  20. Usage-Centered Design Approach in Design of Malaysia Sexuality Education (MSE) Courseware

    Science.gov (United States)

    Chan, S. L.; Jaafar, A.

    The problems amongst juveniles increased every year, especially rape case of minor. Therefore, the government of Malaysia has introduced the National Sexuality Education Guideline on 2005. An early study related to the perception of teachers and students toward the sexuality education curriculum taught in secondary schools currently was carried out in 2008. The study showed that there are big gaps between the perception of the teachers and the students towards several issues of Malaysia sexuality education today. The Malaysia Sexuality Education (MSE) courseware was designed based on few learning theories approach. Then MSE was executed through a comprehensive methodology which the model ADDIE integrated with Usage-Centered Design to achieve high usability courseware. In conclusion, the effort of developing the MSE is hopefully will be a solution to the current problem that happens in Malaysia sexuality education now.

  1. Syntheses, structures, optical properties, and electronic structures of KBaMSe{sub 3} (M = As, Sb)

    Energy Technology Data Exchange (ETDEWEB)

    Yin, Wenlong [Key Laboratory of Functional Crystals and Laser Technology, Technical Institute of Physics and Chemistry, Chinese Academy of Sciences, Beijing 100190 (China); Institute of Chemical Materials, China Academy of Engineering Physics, P.O. Box 919-306 Mianyang 621900 (China); Feng, Kai; Kang, Lei [Key Laboratory of Functional Crystals and Laser Technology, Technical Institute of Physics and Chemistry, Chinese Academy of Sciences, Beijing 100190 (China); University of the Chinese Academy of Sciences, Beijing 100049 (China); Kang, Bin; Deng, Jianguo [Institute of Chemical Materials, China Academy of Engineering Physics, P.O. Box 919-306 Mianyang 621900 (China); Lin, Zheshuai [Key Laboratory of Functional Crystals and Laser Technology, Technical Institute of Physics and Chemistry, Chinese Academy of Sciences, Beijing 100190 (China); Yao, Jiyong, E-mail: jyao@mail.ipc.ac.cn [Key Laboratory of Functional Crystals and Laser Technology, Technical Institute of Physics and Chemistry, Chinese Academy of Sciences, Beijing 100190 (China); Wu, Yicheng [Key Laboratory of Functional Crystals and Laser Technology, Technical Institute of Physics and Chemistry, Chinese Academy of Sciences, Beijing 100190 (China)

    2014-12-25

    Graphical abstract: KBaMSe{sub 3} (M = As, Sb) are isostructural and crystallize in the centrosymmetric monoclinic space group P2{sub 1}/c with zero-dimensional structures containing totally isolated MSe{sub 3} (M = As, Sb) pyramids with K{sup +} and Ba{sup 2+} cations lying between them. - Highlights: • Two new quaternary chalcogenides KBaMSe{sub 3} (M = As, Sb) were synthesized. • They are isostructural and crystallize in the centrosymmetric space group P2{sub 1}/c. • They adopt a zero-dimensional structure containing isolated MSe{sub 3} trigonal pyramids. • The optical band gaps are 2.26 (2) eV for KBaAsSe{sub 3} and 2.04 (2) eV for KBaSbSe{sub 3}. • KBaMSe{sub 3} (M = As, Sb) are indirect band gap semiconductors. - Abstract: The first two members in the quaternary A/A′/M/Q (A = alkali metal; A′ = alkaline-earth metal; M = As, Sb, Bi; Q = S, Se, Te) system, namely the KBaMSe{sub 3} (M = As, Sb) selenides, have been synthesized by solid state reactions. They are isostructural and crystallize in the centrosymmetric space group P2{sub 1}/c of the monoclinic system. In the structure, the trivalent M atom (M = As, Sb) is coordinated to three Se atoms forming a trigonal pyramid with the Se atoms serving as the triangle base, showing the stereochemical activity of the ns{sup 2} lone pair electron. The MSe{sub 3} (M = As, Sb) trigonal pyramids are totally isolated from each other with K{sup +} and Ba{sup 2+} cations located between them. The optical band gaps of 2.26 (2) eV for KBaAsSe{sub 3} and 2.04 (2) eV for KBaSbSe{sub 3}, were deduced from the diffuse reflectance spectra. The first principles calculations were performed to study the electronic structures of KBaMSe{sub 3} (M = As, Sb) compounds and the results indicated that these two compounds are indirect band gap semiconductors.

  2. MSE-THERMO: Integrated computer system for application of chemical thermodynamics in materials science and engineering

    Energy Technology Data Exchange (ETDEWEB)

    Leitner, J.; Chuchvalec, P.; Vonka, P. [Inst. of Chemical Technology, Prague (Czech Republic)

    1995-08-01

    MSE-THERMO is an integrated computer system embodying thermochemical databases with sophisticated computational software for diverse thermodynamic calculations. It consists of a database MSE-DATA, where thermodynamic data for pure substances are stored, as well as programs for the calculation of thermodynamic functions of pure substances, changes of thermodynamic functions for chemical reactions, ternary phase diagrams in a subsolidus region, phase stability diagrams, and equilibrium composition of multicomponents and multiphases systems. Datafiles as well as computational software tools are at present intensively extended.

  3. The multi-spectral line-polarization MSE system on Alcator C-Mod

    Energy Technology Data Exchange (ETDEWEB)

    Mumgaard, R. T., E-mail: mumgaard@psfc.mit.edu; Khoury, M. [Plasma Science and Fusion Center, Massachusetts Institute of Technology, Cambridge, Massachusetts 02139 (United States); Scott, S. D. [Princeton Plasma Physics Laboratory, Princeton, New Jersey 08540 (United States)

    2016-11-15

    A multi-spectral line-polarization motional Stark effect (MSE-MSLP) diagnostic has been developed for the Alcator C-Mod tokamak wherein the Stokes vector is measured in multiple wavelength bands simultaneously on the same sightline to enable better polarized background subtraction. A ten-sightline, four wavelength MSE-MSLP detector system was designed, constructed, and qualified. This system consists of a high-throughput polychromator for each sightline designed to provide large étendue and precise spectral filtering in a cost-effective manner. Each polychromator utilizes four narrow bandpass interference filters and four custom large diameter avalanche photodiode detectors. Two filters collect light to the red and blue of the MSE emission spectrum while the remaining two filters collect the beam pi and sigma emission generated at the same viewing volume. The filter wavelengths are temperature tuned using custom ovens in an automated manner. All system functions are remote controllable and the system can be easily retrofitted to existing single-wavelength line-polarization MSE systems.

  4. The multi-spectral line-polarization MSE system on Alcator C-Mod

    Science.gov (United States)

    Mumgaard, R. T.; Scott, S. D.; Khoury, M.

    2016-11-01

    A multi-spectral line-polarization motional Stark effect (MSE-MSLP) diagnostic has been developed for the Alcator C-Mod tokamak wherein the Stokes vector is measured in multiple wavelength bands simultaneously on the same sightline to enable better polarized background subtraction. A ten-sightline, four wavelength MSE-MSLP detector system was designed, constructed, and qualified. This system consists of a high-throughput polychromator for each sightline designed to provide large étendue and precise spectral filtering in a cost-effective manner. Each polychromator utilizes four narrow bandpass interference filters and four custom large diameter avalanche photodiode detectors. Two filters collect light to the red and blue of the MSE emission spectrum while the remaining two filters collect the beam pi and sigma emission generated at the same viewing volume. The filter wavelengths are temperature tuned using custom ovens in an automated manner. All system functions are remote controllable and the system can be easily retrofitted to existing single-wavelength line-polarization MSE systems.

  5. Mauna Kea Spectrographic Explorer (MSE): a conceptual design for multi-object high resolution spectrograph

    Science.gov (United States)

    Zhang, Kai; Zhu, Yongtian; Hu, Zhongwen

    2016-08-01

    The Maunakea Spectroscopic Explorer (MSE) project will transform the CFHT 3.6m optical telescope into a 10m class dedicated multi-object spectroscopic facility, with an ability to simultaneously measure thousands of objects with a spectral resolution range spanning 2,000 to 40,000. MSE will develop two spectrographic facilities to meet the science requirements. These are respectively, the Low/Medium Resolution spectrographs (LMRS) and High Resolution spectrographs (HRS). Multi-object high resolution spectrographs with total of 1,156 fibers is a big challenge, one that has never been attempted for a 10m class telescope. To date, most spectral survey facilities work in single order low/medium resolution mode, and only a few Wide Field Spectrographs (WFS) provide a cross-dispersion high resolution mode with a limited number of orders. Nanjing Institute of Astronomical Optics and Technology (NIAOT) propose a conceptual design with the use of novel image slicer arrays and single order immersed Volume Phase Holographic (VPH) grating for the MSE multi-object high resolution spectrographs. The conceptual scheme contains six identical fiber-link spectrographs, each of which simultaneously covers three restricted bands (λ/30, λ/30, λ/15) in the optical regime, with spectral resolution of 40,000 in Blue/Visible bands (400nm / 490nm) and 20,000 in Red band (650nm). The details of the design is presented in this paper.

  6. An Overview Of The Motional Stark Effect Diagnostic On DIII-D And Design Work For An ITER MSE

    Energy Technology Data Exchange (ETDEWEB)

    Holcomb, C T; Allen, S L; Makowski, M A; Jayakumar, R J; Gu, M F; Lerner, S; Morris, K L; Latkowski, J; Moller, J M; Meyer, W; Ellis, R; Geer, R; Behne, D; Chipman, R; Smith, P; McClain, S

    2007-09-20

    The advanced tokamak research program at DIII-D relies critically on the measurement of the current density profile. This was made possible by the development of a Motional Stark Effect (MSE) polarimeter that was first installed in 1992. Three major upgrades have since occurred, and improvements in our understanding of critical performance issues and calibration techniques are ongoing. In parallel with these improvements, we have drawn on our DIII-D experience to begin studies and design work for MSE on burning plasmas and ITER. This paper first reviews how Motional Stark Effect polarimetry (MSE) is used to determine the tokamak current profile. It uses the DIII-D MSE system as an example, and shows results from the latest upgrade that incorporates an array of channels from a new counter-Ip injected neutral beam. The various calibration techniques presently used are reviewed. High-leverage or unresolved issues affecting MSE performance and reliability in ITER are discussed. Next, we show a four-mirror collection optics design for the two ITER MSE views. Finally, we discuss measurements of the polarization properties of a few candidate mirrors for the ITER MSE.

  7. GeMSE: A new Low-Background Facility for Meteorite and Material Screening

    CERN Document Server

    von Sivers, M; Rosén, Å V; Schumann, M

    2015-01-01

    We are currently setting up a facility for low-background gamma-ray spectrometry based on a HPGe detector. It is dedicated to material screening for the XENON and DARWIN dark matter projects as well as to the characterization of meteorites. The detector will be installed in a medium depth ($\\sim$620 m.w.e.) underground laboratory in Switzerland with several layers of shielding and an active muon-veto. The GeMSE facility will be operational by fall 2015 with an expected background rate of $\\sim$250 counts/day (100-2700 keV).

  8. GeMSE: A new low-background facility for meteorite and material screening

    Science.gov (United States)

    Sivers, M. V.; Hofmann, B. A.; Rosén, Å. V.; Schumann, M.

    2015-08-01

    We are currently setting up a facility for low-background gamma-ray spectrometry based on a HPGe detector. It is dedicated to material screening for the XENON and DARWIN dark matter projects as well as to the characterization of meteorites. The detector will be installed in a medium depth (˜620 m.w.e.) underground laboratory in Switzerland with several layers of shielding and an active muon-veto. The GeMSE facility will be operational by fall 2015 with an expected background rate of ˜250 counts/day (100-2700 keV).

  9. MSE/SSE discrimination methods of the PC-HPGe detector

    Institute of Scientific and Technical Information of China (English)

    L(U) Zi-Feng; LI Yu-Lan; LI Jin; YUE Qian; LI Yuan-Jing

    2012-01-01

    Having advantages of low capacitance and low energy threshold,the PC-HPGe (Point-Contact High Purity Germanium) detector has found its application in the direct detection of WIMP(Weak Interaction Massive Particle) in CDEX (China Darkmatter Experiment).The MSE (Multi-Site Event) and SSE(Single-Site Event) discrimination methods of the PC-HPGe detector are introduced in this article,including their physical basis,the electronics system and the algorithms to implement them.Behaviors of the PC-HPGe detector are studied intensively through this research and finally the experimental results of the LE discrimination method are presented.

  10. Study of the seismic performance of hybrid A-frame micropile/MSE (mechanically stabilized earth) wall

    Science.gov (United States)

    Chen, Yumin; Zhang, Zhichao; Liu, Hanlong

    2017-04-01

    The Hybrid A-Frame Micropile/MSE (mechanically stabilized earth) Wall suitable for mountain roadways is put forward in this study: a pair of vertical and inclined micropiles goes through the backfill region of a highway MSE Wall from the road surface and are then anchored into the foundation. The pile cap and grade beam are placed on the pile tops, and then a road barrier is connected to the grade beam by connecting pieces. The MSE wall's global stability, local stability and impact resistance of the road barrier can be enhanced simultaneously by this design. In order to validate the serviceability of the hybrid A-frame micropile/MSE wall and the reliability of the numerical method, scale model tests and a corresponding numerical simulation were conducted. Then, the seismic performance of the MSE walls before and after reinforcement with micropiles was studied comparatively through numerical methods. The results indicate that the hybrid A-frame micropile/MSE wall can effectively control earthquake-induced deformation, differential settlement at the road surface, bearing pressure on the bottom and acceleration by means of a rigid-soft combination of micropiles and MSE. The accumulated displacement under earthquakes with amplitude of 0.1‒0.5 g is reduced by 36.3%‒46.5%, and the acceleration amplification factor on the top of the wall is reduced by 13.4%, 15.7% and 19.3% based on 0.1, 0.3 and 0.5 g input earthquake loading, respectively. In addition, the earthquake-induced failure mode of the MSE wall in steep terrain is the sliding of the MSE region along the backslope, while the micropiles effectively control the sliding trend. The maximum earthquake-induced pile bending moment is in the interface between MSE and slope foundation, so it is necessary to strengthen the reinforcement of the pile body in the interface. Hence, it is proven that the hybrid A-frame micropile/MSE wall system has good seismic performance.

  11. Solvothermal synthesis, structure and physical properties of Cs[Cr(en)2MSe4] (M = Ge, Sn) with [MSe4](4-) tetrahedra as chelating ligand.

    Science.gov (United States)

    Wang, Yingqi; Wang, Ruiqi; Liu, Qinglong; Lai, Xiaofang; Zhang, Xian; Chen, Haijie; Zheng, Chong; Lin, Jianhua; Huang, Fuqiang

    2016-05-31

    Two chromium chalcogenide Cs[Cr(en)2GeSe4] () and Cs[Cr(en)2SnSe4] () have been synthesized by a solvothermal method. Both compounds crystallize in the monoclinic space group P21/n. The structures of the two compounds are characterized by isolated [Cr(en)2MSe4](-) clusters separated by Cs(+) ions. The optical properties of the two compounds were measured which indicate a similar band gap of 1.58 eV. DFT calculations demonstrated that the valance band maximum (VBM) consist of Cr 3d orbitals and Se 4p orbitals while the conductive band minimum (CBM) are composed of Cr 3d orbitals for both compounds, which explains their similar optical band gap energies. Both compounds possess paramagnetic behaviors with the effective magnetic moment of 3.97μB for Cs[Cr(en)2GeSe4] and 3.91μB for Cs[Cr(en)2SnSe4], respectively. Field-dependent magnetization measurements demonstrated their potential as magnetocaloric materials, with the magnetic entropy change of 11.6 J (kg K)(-1) for Cs[Cr(en)2GeSe4], and 14.2 J (kg K)(-1) for Cs[Cr(en)2SnSe4].

  12. Magnetic Field Measurements in NSTX-U with the MSE-LIF Diagnostic

    Science.gov (United States)

    Levinton, Fred; Foley, Jill; Dicicco, Darrell; Cylinder, David; La Fleur, Hannah; Yuh, Howard

    2014-10-01

    The motional Stark effect with laser-induced fluorescence diagnostic (MSE-LIF) was installed on NSTX during the 2011 run year. The MSE-LIF will enable radially resolved measurements of the magnetic field pitch angle and magnitude, both of which can be used to constrain plasma equilibrium reconstructions. A diagnostic neutral beam with low axial energy spread, low divergence, and high reliability has been developed. It operates routinely at 35 kV and 40 mA. A laser has been developed with high power (~10 W) and optimal linewidth matched to the energy spread of the neutral beam (~6 GHz). The laser wavelength is near 651 nm for a match to the Doppler-shifted Balmer-alpha transition in the beam neutrals. The unique high-power, moderate linewidth laser system utilizes a 19 emitter diode laser bar and feedback from a volume Bragg grating for line width narrowing. A magnetic shield protects the ion source from the NSTX stray fields. Initial data in a gas-filled torus and low magnetic fields was taken on NSTX. Several improvements have been made to the system during the NSTX upgrade, including adding more spatial channels and several laser improvements. Supported by USDOE Grant No. DE-FG02-01ER54616.

  13. MSE measurements for sawtooth and non-inductive current drive studies in KSTAR

    Science.gov (United States)

    Ko, J.; Park, H.; Bea, Y. S.; Chung, J.; Jeon, Y. M.

    2016-10-01

    Two major topics where the measurement of the magnetic-field-line rotational transform profiles in toroidal plasma systems include the long-standing issue of complete versus incomplete reconnection model of the sawtooth instability and the issue with future reactor-relevant tokamak devices in which non-inductive steady state current sustainment is essential. The motional Stark effect (MSE) diagnostic based on the photoelastic-modulator (PEM) approach is one of the most reliable means to measure the internal magnetic pitch, and thus the rotational transform, or its reciprocal (q), profiles. The MSE system has been commissioned for the Korea Superconducting Tokamak Advanced Research (KSTAR) along with the development of various techniques to minimize systematic offset errors such as Faraday rotation and mis-alignment of the bandpass filters. The diagnostic has revealed the central q is well correlated with the sawtooth oscillation, maintaining its value above unity during the MHD quiescent period and that the response of the q profile to external current drive such as electron cyclotron wave injection not only involves the local change of the pitch angle gradient but also a significant shift of the magnetic topology due to the wave energy transport. Work supported by the Ministry of Science, ICT and Future Planning, Korea.

  14. Optical investigations of high pressure glow discharges based on MSE arrays

    Energy Technology Data Exchange (ETDEWEB)

    Penache, C.; Hohn, O.; Schmidt-Boecking, H. [Frankfurt Univ. (Germany); Spielberger, L. [Deutsche Gesellschaft fuer Technische Zusammenarbeit GmbH (GTZ), Eschborn (Germany); Braeuning-Demian, A.; Penache, D. [Gesellschaft fuer Schwerionenforschung mbH, Darmstadt (Germany)

    2001-07-01

    The micro-structure-electrode (MSE) arrays are providing a non-thermal high pressure plasma. These arrays consist of a matrix of holes perforated in a thin multilayer made out of two metallic foils separated by a dielectric. The holes diameter and the thickness of the insulator spacer need to be around 100 {mu}m to allow for the MSE operation at pressure ranging from 0.1 to 1 bar and above. In this work single direct current microdischarges and systems of parallel operated holes in argon at 0.2 bar have been optically investigated. The spatial distribution of the emitted light has been monitored by a digital camera connected to an optical microscope. The UV photon emission has been recorded by a position sensitive photon detector allowing for space and time resolved measurements. Its time resolution of about 1 nsec makes possible the investigation of fast processes, e.g. the constriction of the discharge. Due to its typical position resolution of 100 {mu}m, this detector needs to be used in combination with an optical system allowing for the magnification of the discharge area. The optical appearance show a stable, volume filling glow discharge, fact proved also by the typical current-voltage characteristic.

  15. The GeMSE Facility for Low-Background {\\gamma}-Ray Spectrometry

    CERN Document Server

    Sivers, M v; Rosén, Å V; Schumann, M

    2016-01-01

    We describe a new high-purity germanium (HPGe) detector setup for low-background {\\gamma}-ray spectrometry. The GeMSE facility is dedicated to material screening for rare event searches in astroparticle physics as well as to the characterization of meteorites. It is installed in a medium depth (~620 m.w.e.) underground laboratory in Switzerland in a multi-layer shielding and is equipped with an active muon veto. We have reached a very competitive integral background rate of (246$\\pm$2) counts/day (100-2700 keV) which allows the measurement of radioactive contaminations in the $\\mathcal{O}$(50){\\mu}Bq/kg range. We describe the data analysis based on Bayesian statistics, background simulations, the efficiency calibration and first sample measurements.

  16. Joint Source and Relay Precoding Designs for MIMO Two-Way Relaying Based on MSE Criterion

    CERN Document Server

    Wang, Rui

    2011-01-01

    Properly designed precoders can significantly improve the spectral efficiency of multiple-input multiple-output (MIMO) relay systems. In this paper, we investigate joint source and relay precoding design based on the mean-square-error (MSE) criterion in MIMO two-way relay systems, where two multi-antenna source nodes exchange information via a multi-antenna amplify-and-forward relay node. This problem is non-convex and its optimal solution remains unsolved. Aiming to find an efficient way to solve the problem, we first decouple the primal problem into three tractable sub-problems, and then propose an iterative precoding design algorithm based on alternating optimization. The solution to each sub-problem is optimal and unique, thus the convergence of the iterative algorithm is guaranteed. Secondly, we propose a structured precoding design to lower the computational complexity. The proposed precoding structure is able to parallelize the channels in the multiple access (MAC) phase and broadcast (BC) phase. It th...

  17. The GeMSE facility for low-background γ-ray spectrometry

    Science.gov (United States)

    von Sivers, M.; Hofmann, B. A.; Rosén, Å. V.; Schumann, M.

    2016-12-01

    We describe a new high-purity germanium (HPGe) detector setup for low-background γ-ray spectrometry. The GeMSE facility (Germanium Material and meteorite Screening Experiment) is dedicated to material screening for rare event searches in astroparticle physics as well as to the characterization of meteorites. It is installed in a medium depth (~620 m.w.e.) underground laboratory in Switzerland in a multi-layer shielding and is equipped with an active muon veto. We have reached a very competitive integral background rate of (246±2) counts/day (100-2700 keV) and measured a sensitivity of ~0.5-0.6 mBq/kg for long-lived isotopes from the 238U/232Th chains in a ~1 kg sample screened for ~27 days. An extrapolation to higher sample masses and measurement times suggests a maximum sensitivity in the O(50) \\textmu Bq/kg range. We describe the data analysis based on Bayesian statistics, background simulations, the efficiency calibration and first sample measurements.

  18. Design and Analysis of LDGM-Based Codes for MSE Quantization

    CERN Document Server

    Wang, Qingchuan

    2008-01-01

    Approaching the 1.5329-dB shaping (granular) gain limit in mean-squared error (MSE) quantization of R^n is important in a number of problems, notably dirty-paper coding. For this purpose, we start with a binary low-density generator-matrix (LDGM) code, and construct the quantization codebook by periodically repeating its set of binary codewords, or them mapped to m-ary ones with Gray mapping. The quantization algorithm is based on belief propagation, and it uses a decimation procedure to do the guessing necessary for convergence. Using the results of a true typical decimator (TTD) as reference, it is shown that the asymptotic performance of the proposed quantizer can be characterized by certain monotonicity conditions on the code's fixed point properties, which can be analyzed with density evolution, and degree distribution optimization can be carried out accordingly. When the number of iterations is finite, the resulting loss is made amenable to analysis through the introduction of a recovery algorithm from ...

  19. Magnetic field amplitude and pitch angle measurements using Spectral MSE on EAST and Alcator C-Mod

    Science.gov (United States)

    Liao, Ken; Rowan, William; Fu, Jia; Lyu, Bo; Li, Ying-Ying; Marchuk, Oleksandr; Ralchenko, Yuri

    2016-10-01

    Magnetic field amplitude and pitch angle measurements follow from the analysis of the Motional Stark Effect spectrum emitted by high energy neutral beam emission in tokamaks. Here we focus on deriving these quantities on EAST and Alcator C-Mod. These measurements provide a cross check for the polarimetry MSE diagnostics, and also act as a proof of principle for a spectral MSE diagnostic, which could potentially provide real-time measurements of the magnetic field and be used to increase the accuracy of equilibrium reconstruction. Measurement uncertainty is evaluated using the NBASS synthetic diagnostic. The same code allows design of measurements with improved accuracy such as spectral measurements techniques which take advantage of polarization. Accurate fitting of the MSE spectrum requires taking into account non-statistical beam excited state populations. The spectral MSE analysis techniques have applications to measurement of the beam density, which allows for improved analysis of the charge exchange recombination spectroscopy diagnostic. Resolution of beam components improves with increased beam energy and magnetic field, so these techniques have high applicability to future fusion devices. Supported by USDoE Award DE-FG03- 96ER-54373.

  20. Traveling wave solutions of the (2 + 1-dimensional Zoomeron equation and the Burgers equations via the MSE method and the Exp-function method

    Directory of Open Access Journals (Sweden)

    Kamruzzaman Khan

    2014-03-01

    Full Text Available The modified simple equation (MSE method is promising for finding exact traveling wave solutions of nonlinear evolution equations (NLEEs in mathematical physics. In this letter, we investigate solutions of the (2 + 1-dimensional Zoomeron equation and the (2 + 1-dimensional Burgers equation by using the MSE method and the Exp-function method. The competence of the methods for constructing exact solutions has been established.

  1. Analysis of membrane proteome by data-dependent LC-MS/MS combined with data-independent LC-MSE technique

    Directory of Open Access Journals (Sweden)

    Joseph Kwon

    2010-03-01

    Full Text Available Proteomics work resembles the search for a needle in a haystack. The identification of protein biomarker requires the removal of the false protein data from the whole protein mixture. For high quality proteomic data, even a strict filtration step using the false discovery rate (FDR is insufficient for obtaining perfect protein information from the biological samples. In this study, the cyanobacterial whole membrane fraction was applied to the data-dependent analysis (DDA mode of LC-MS/MS, which was used along with the data-independent LC-MSE technique in order to evaluate the membrane proteomic data. Furthermore, the identified MSE-information (MSE-i data based on the peptide mass and the retention time were validated by the other database search, i.e., the probability-based MASCOT and de novo search engine PEAKS. In this present study, 208 cyanobacterial proteins with FDR of 5% were identified using the data-independent nano-UPLC/MSE acquisition with the Protein Lynx Global Server (PLGS, and 56 of these proteins were the predicted membrane proteins. When a total of 208 MSE-i proteomic data were applied to the DDA mode of LC-MS/MS, the number of identified membrane proteins was 26 and 33 from MASCOT and PEAKS with a FDR of 5%, respectively. The number of totally overlapped membrane proteins was 25. Therefore, the data-independent LC-MSE identified more proteins with a high confidence.

  2. High Voltage Ramp Generator for Electro-Optically Tunable Filter for the MSE-CIF Diagnostics on NSTX.

    Science.gov (United States)

    Wu, Ying; Levinton, Fred

    2004-11-01

    The motional Stark effect (MSE) diagnostic is routinely used to determine the q-profile in large fusion devices. To apply the MSE diagnostic to experiments with low magnetic fields such as NSTX (<1 T), a tunable birefringent Lyot filter is used with high throughput and high resolution which allows for a good signal-to-noise ratio. The birefringent filter is made from lithium-niobate crystals, which are coated with a layer of indium tin-oxide (ITO). The ITO layer is a transparent conductive coating. By applying an electric field across the crystal the index of refraction is varied. This allows tunability of the filter. Putting multiple crystals together and tuning them individually it is possible to pass certain wavelengths of light and reject others. A high voltage ramp generator circuit is under development to ramp a 5 kV signal using a simple design involving MOSFET ladders. The goal is to design the circuit so that it can ramp ±5000 volts at a frequency of around 1 kHz. This would allow the filter to sweep over a range of ˜ 1nm.

  3. The application of methylation specific electrophoresis (MSE to DNA methylation analysis of the 5' CpG island of mucin in cancer cells

    Directory of Open Access Journals (Sweden)

    Yokoyama Seiya

    2012-02-01

    Full Text Available Abstract Background Methylation of CpG sites in genomic DNA plays an important role in gene regulation and especially in gene silencing. We have reported mechanisms of epigenetic regulation for expression of mucins, which are markers of malignancy potential and early detection of human neoplasms. Epigenetic changes in promoter regions appear to be the first step in expression of mucins. Thus, detection of promoter methylation status is important for early diagnosis of cancer, monitoring of tumor behavior, and evaluating the response of tumors to targeted therapy. However, conventional analytical methods for DNA methylation require a large amount of DNA and have low sensitivity. Methods Here, we report a modified version of the bisulfite-DGGE (denaturing gradient gel electrophoresis using a nested PCR approach. We designated this method as methylation specific electrophoresis (MSE. The MSE method is comprised of the following steps: (a bisulfite treatment of genomic DNA, (b amplification of the target DNA by a nested PCR approach and (c applying to DGGE. To examine whether the MSE method is able to analyze DNA methylation of mucin genes in various samples, we apply it to DNA obtained from state cell lines, ethanol-fixed colonic crypts and human pancreatic juices. Result The MSE method greatly decreases the amount of input DNA. The lower detection limit for distinguishing different methylation status is Conclusions The MSE method can provide a qualitative information of methylated sequence profile. The MSE method allows sensitive and specific analysis of the DNA methylation pattern of almost any block of multiple CpG sites. The MSE method can be applied to analysis of DNA methylation status in many different clinical samples, and this may facilitate identification of new risk markers.

  4. WAEI/MSE: uma instância do processo WAE para micro e pequenas empresas de software = WAEI/MSE: an instance of the WAE process for micro and small software enterprises

    Directory of Open Access Journals (Sweden)

    Francisco Virginio Maracci

    2009-04-01

    Full Text Available Em Micro e Pequenas Empresas de Software (MPEs, geralmente, não há umprocesso sistemático de desenvolvimento de software. Um dos motivos é que essas empresas consideram os processos tradicionais extensos. Assim, normalmente, essas empresas são classificadas em nível 1 de maturidade do CMMI (Capability Maturity Model Integration. O objetivo deste artigo é apresentar uma instância do processo WAE (WebApplication Extension, a fim de auxiliar especificamente as MPEs que desenvolvem software Web a alavancarem o nível de capacidade de seu processo de desenvolvimento de software. A instância foi validada durante sua aplicação no desenvolvimento de um software comercialcom o apoio da Coordenadoria de Web da Unoeste e em outros três estudos de caso. In Micro and Small Enterprises (MSE of software, there is usuallynot a systematic software development process. One of the reasons is that these enterprises consider the traditional processes extensive. Thus, these enterprises are usually classified in level 1 of maturity of the CMMI (Capability Maturity Model Integration. The objective ofthis paper is to present a proposal for a software development process, in order to aid specifically MSEs that build Web software, to help them increase the capacity level of their processes. The process was validated during its application in development of software with the support of the Unoeste Web Coordination.

  5. Detailed DFT studies of the electronic structure and optical properties of KBaMSe{sub 3} (M = As, Sb)

    Energy Technology Data Exchange (ETDEWEB)

    Azam, Sikander; Khan, Saleem Ayaz; Khan, Wilayat [New Technologies – Research Center, University of West Bohemia, Univerzitni 8, 306 14 Pilsen (Czech Republic); Muhammad, Saleh; Udin, Haleem [Materials Modeling Lab, Department of Physics, Hazara University, Mansehra (Pakistan); Murtaza, G., E-mail: murtaza@icp.edu.pk [Materials Modeling Laboratory, Department of Physics, Islamia College University, Peshawar (Pakistan); Khenata, R., E-mail: khenata_rabah@yahoo.fr [Laboratoire de Physique Quantique et de Modélisation Mathématique (LPQ3M), Département de Technologie, Université de Mascara, Mascara 29000 (Algeria); Shah, Fahad Ali [Materials Modeling Lab, Department of Physics, Hazara University, Mansehra (Pakistan); Minar, Jan [New Technologies – Research Center, University of West Bohemia, Univerzitni 8, 306 14 Pilsen (Czech Republic); Ahmed, W.K. [ERU, College of Engineering, United Arab Emirates University, Al Ain (United Arab Emirates)

    2015-09-25

    Highlights: • The compounds are studied by FP-LAPW method within LDA, GGA, EV-GGA approximations. • All the compounds show indirect band gap nature. • Bonding nature is mixed covalent and ionic. • High absorption peaks and reflectivity ensures there utility in optoelectronic devices. - Abstract: Bonding nature as well as the electronic band structure, electronic charge density and optical properties of KBaMSe{sub 3} (M = As, Sb) compounds have been calculated using a full-potential augmented plane wave (FP-LAPW) method within the density functional theory. The exchange–correlation potential was handled with LDA and PBE-GGA approximations. Moreover, the Engel–Vosko generalized gradient approximation (EV-GGA) and the modified Beck–Johnson potential (mBJ) were also applied to improve the electronic band structure calculations. The study of band structure shows that KBaAsSe{sub 3}/KBaSbSe{sub 3} compounds have an indirect band gap of 2.08/2.10 eV which are in close agreement with the experimental data. The bonding nature has been studied as well using the electronic charge density (ECD) contour in the (1 0 1) crystallographic plane. It has been revealed that As/Sb–O atoms forms a strong covalent, while Ba–Se atoms form weak covalent bonding and the ionic bonding is mainly found between K and Ba atoms. Moreover, the complex dielectric function, absorption coefficient, refractive index, energy-loss spectrum and reflectivity have been estimated. From the reflectivity spectra, we found that KBaAsSe{sub 3} compound shows greater reflectivity than KBaSbSe{sub 3}, which means that KBaAsSe{sub 3} compound can be used as shielding material in visible and also in ultra violet region.

  6. Rapid synthesis of an aluminum-rich MSE-type zeolite by the hydrothermal conversion of an FAU-type zeolite.

    Science.gov (United States)

    Inagaki, Satoshi; Tsuboi, Yasuyuki; Nishita, Yuji; Syahylah, Tuan; Wakihara, Toru; Kubota, Yoshihiro

    2013-06-10

    An aluminum-rich MSE-type zeolite (Si/Al is as small as 7) has been successfully synthesized in a remarkably short crystallization period of only 3 days by the hydrothermal conversion of an FAU-type zeolite, presumably by the assembly of four-membered-ring (4-R) aluminosilicate oligomers supplied by the double 6-R (D6R) components of the FAU framework with the aid of the structure-directing agents and seed crystals. The dealuminated version of the aluminum-rich MSE-type zeolite showed a high level of coke durability in addition to a significant yield of propylene, which indicates that this novel zeolitic material is suitable for industrial applications as a highly selective and long-lived catalyst.

  7. MS(E) based multiplex protein analysis quantified important allergenic proteins and detected relevant peptides carrying known epitopes in wheat grain extracts.

    Science.gov (United States)

    Uvackova, Lubica; Skultety, Ludovit; Bekesova, Slavka; McClain, Scott; Hajduch, Martin

    2013-11-01

    The amount of clinically relevant, allergy-related proteins in wheat grain is still largely unknown. The application of proteomics may create a platform not only for identification and characterization, but also for quantitation of these proteins. The aim of this study was to evaluate the data-independent quantitative mass spectrometry (MS(E)) approach in combination with 76 wheat allergenic sequences downloaded from the AllergenOnline database ( www.allergenonline.org ) as a starting point. Alcohol soluble extracts of gliadin and glutenin proteins were analyzed. This approach has resulted in identification and quantification of 15 allergenic protein isoforms that belong to amylase/trypsin inhibitors, γ-gliadins, and high or low molecular weight glutenins. Additionally, several peptides carrying four previously discovered epitopes of γ-gliadin B precursor have been detected. These data were validated against the UniProt database, which contained 11764 Triticeae protein sequences. The identified allergens are discussed in relation to Baker's asthma, food allergy, wheat dependent exercise induced anaphylaxis, atopic dermatitis, and celiac disease (i.e., gluten-sensitive enteropathy). In summary, the results showed that the MS(E) approach is suitable for quantitative analysis and allergens profiling in wheat varieties and/or other food matrices.

  8. Dynamic properties of magneto-sensitive elastomer cantilevers as adaptive sensor elements

    Science.gov (United States)

    Becker, T. I.; Raikher, Yu L.; Stolbov, O. V.; Böhm, V.; Zimmermann, K.

    2017-09-01

    In engineering applications, one of the actual scientific challenges is a development of sensor systems with complex adaptive behaviour and operating sensitivity. Smart materials like magneto-sensitive elastomers (MSEs) offer great potential for designing such intelligent devices, because they possess unique magnetic-field dependent properties. This paper deals with the investigation of the free vibrational behaviour displayed by cantilever beams made of MSEs containing magnetically soft particles in the presence of a uniform magnetic field. The presented setup is considered as a prototype of a sensitive unit for transforming mechanical stimuli of the base into vibrations of the MSE element, which could be converted in a facile way into electromagnetic signals for measuring and analysing. It is shown experimentally that for the MSE beams of several different lengths and compositions, the first eigenfrequency depends strongly on the strength of the applied magnetic field. The developed theoretical model extends the conventional vibrational dynamics of thin rods to allow for the ponderomotive torque induced by magneto-mechanical interactions experienced by an MSE beam. The model has two adjustable parameters that characterise the geometric configuration of the cantilever beam and its magnetic material properties. It is found that the values of these parameters are ‘universally’ valid, i.e., they provide good agreement between the theoretical eigenfrequency dependencies and the experimental results for all used MSE beams. The evidence presented ensures a good basis for further investigations of the sensitivity and amplitude-frequency characteristics of MSE vibration sensor elements.

  9. Minimum mean squared error (MSE) adjustment and the optimal Tykhonov-Phillips regularization parameter via reproducing best invariant quadratic uniformly unbiased estimates (repro-BIQUUE)

    Science.gov (United States)

    Schaffrin, Burkhard

    2008-02-01

    In a linear Gauss-Markov model, the parameter estimates from BLUUE (Best Linear Uniformly Unbiased Estimate) are not robust against possible outliers in the observations. Moreover, by giving up the unbiasedness constraint, the mean squared error (MSE) risk may be further reduced, in particular when the problem is ill-posed. In this paper, the α-weighted S-homBLE (Best homogeneously Linear Estimate) is derived via formulas originally used for variance component estimation on the basis of the repro-BIQUUE (reproducing Best Invariant Quadratic Uniformly Unbiased Estimate) principle in a model with stochastic prior information. In the present model, however, such prior information is not included, which allows the comparison of the stochastic approach (α-weighted S-homBLE) with the well-established algebraic approach of Tykhonov-Phillips regularization, also known as R-HAPS (Hybrid APproximation Solution), whenever the inverse of the “substitute matrix” S exists and is chosen as the R matrix that defines the relative impact of the regularizing term on the final result.

  10. Label-free LC-MSe in tissue and serum reveals protein networks underlying differences between benign and malignant serous ovarian tumors.

    Directory of Open Access Journals (Sweden)

    Wouter Wegdam

    Full Text Available PURPOSE: To identify proteins and (molecular/biological pathways associated with differences between benign and malignant epithelial ovarian tumors. EXPERIMENTAL PROCEDURES: Serum of six patients with a serous adenocarcinoma of the ovary was collected before treatment, with a control group consisting of six matched patients with a serous cystadenoma. In addition to the serum, homogeneous regions of cells exhibiting uniform histology were isolated from benign and cancerous tissue by laser microdissection. We subsequently employed label-free liquid chromatography tandem mass spectrometry (LC-MSe to identify proteins in these serum and tissues samples. Analyses of differential expression between samples were performed using Bioconductor packages and in-house scripts in the statistical software package R. Hierarchical clustering and pathway enrichment analyses were performed, as well as network enrichment and interactome analysis using MetaCore. RESULTS: In total, we identified 20 and 71 proteins that were significantly differentially expressed between benign and malignant serum and tissue samples, respectively. The differentially expressed protein sets in serum and tissue largely differed with only 2 proteins in common. MetaCore network analysis, however inferred GCR-alpha and Sp1 as common transcriptional regulators. Interactome analysis highlighted 14-3-3 zeta/delta, 14-3-3 beta/alpha, Alpha-actinin 4, HSP60, and PCBP1 as critical proteins in the tumor proteome signature based on their relative overconnectivity. The data have been deposited to the ProteomeXchange with identifier PXD001084. DISCUSSION: Our analysis identified proteins with both novel and previously known associations to ovarian cancer biology. Despite the small overlap between differentially expressed protein sets in serum and tissue, APOA1 and Serotransferrin were significantly lower expressed in both serum and cancer tissue samples, suggesting a tissue-derived effect in serum

  11. Toxic Elements

    DEFF Research Database (Denmark)

    Hajeb, Parvaneh; Shakibazadeh, Shahram; Sloth, Jens Jørgen

    2016-01-01

    Food is considered the main source of toxic element (arsenic, cadmium, lead, and mercury) exposure to humans, and they can cause major public health effects. In this chapter, we discuss the most important sources for toxic element in food and the foodstuffs which are significant contributors...... to human exposure. The occurrence of each element in food classes from different regions is presented. Some of the current toxicological risk assessments on toxic elements, the human health effect of each toxic element, and their contents in the food legislations are presented. An overview of analytical...... techniques and challenges for determination of toxic elements in food is also given....

  12. An element

    Energy Technology Data Exchange (ETDEWEB)

    Nakamura, K.; Iidzima, K.

    1983-03-30

    An anode of a light metal is used in the element, along with an electrolyte which consists of an ether solvent and an ionogenic additive in the form of a salt of dithiocarbamic acid. The element has good discharge characteristics.

  13. Ultra high performance liquid chromatography coupled to quadruple time-of-flight with MS(E) technology used for qualitative analysis of non-volatile oxidation markers in sliced packed mushrooms (Agaricus Bisporus).

    Science.gov (United States)

    Wrona, Magdalena; Pezo, Davinson; Canellas, Elena; Nerín, Cristina

    2016-02-05

    61 different non-volatile compounds were determined in Agaricus Bisporus sliced mushrooms using UHPLC/Q-TOF with MS(E) technology. Both positive and negative electrospray ionization were applied. Chemical profile of three parts of mushroom was created: cap, gills and stipe. The analysed mushrooms were oxidized to identify the non-volatile markers in their parts. MarkerLynx(®) was proposed as a powerful tool to distinguish mushrooms purchased in different countries (Spain and Portugal) by determining their non-volatile markers. Some metabolites were identified. Surprisingly a mix of polyethylene glycols (PEGs) was detected in cap and gills of mushrooms. Whole mushrooms were considered as vegetable resistant to migration from packaging compounds. Additionally migration tests were performed to determine the source of migrating compounds.

  14. PELTIER ELEMENTS

    CERN Document Server

    Tani, Laurits

    2015-01-01

    To control Peltier elements, temperature controller was used. I used TEC-1091 that was manufactured my Meerstetter Engineering. To gain control with the temperature controller, software had to be intalled on a controlling PC. There were different modes to control the Peltier: Tempererature controller to control temperature, Static current/voltage to control voltage and current and LIVE ON/OFF to auto-tune the controller respectively to the system. Also, since near the collision pipe there is much radiation, radiation-proof Peltier elements have to be used. To gain the best results, I had to find the most efficient Peltier elements and try to get their cold side to -40 degrees Celsius.

  15. Element Research.

    Science.gov (United States)

    Herald, Christine

    2001-01-01

    Describes a research assignment for 8th grade students on the elements of the periodic table. Students use web-based resources and a chemistry handbook to gather information, construct concept maps, and present the findings to the full class using the mode of their choice: a humorous story, a slideshow or gameboard, a brochure, a song, or skit.…

  16. PAH determination based on a rapid and novel gas purge-microsyringe extraction (GP-MSE) technique in road dust of Shanghai, China: Characterization, source apportionment, and health risk assessment.

    Science.gov (United States)

    Zheng, Xin; Yang, Yi; Liu, Min; Yu, Yingpeng; Zhou, John L; Li, Donghao

    2016-07-01

    A novel cleanup technique termed as gas purge-microsyringe extraction (GP-MSE) was evaluated and applied for polycyclic aromatic hydrocarbon (PAH) determination in road dust samples. A total of 68 road dust samples covering almost the entire Shanghai area were analyzed for 16 priority PAHs using gas chromatography-mass spectrometry. The results indicate that the total PAH concentrations over the investigated sites ranged from 1.04μg/g to 134.02μg/g dw with an average of 13.84μg/g. High-molecular-weight compounds (4-6 rings PAHs) were significantly dominant in the total mass of PAHs, and accounted for 77.85% to 93.62%. Diagnostic ratio analysis showed that the road dust PAHs were mainly from the mixture of petroleum and biomass/coal combustions. Principal component analysis in conjunction with multiple linear regression indicated that the two major origins of road dust PAHs were vehicular emissions and biomass/fossil fuel combustions, which contributed 66.7% and 18.8% to the total road dust PAH burden, respectively. The concentration of benzo[a]pyrene equivalent (BaPeq) varied from 0.16μg/g to 24.47μg/g. The six highly carcinogenic PAH species (benz(a)anthracene, benzo(a)pyrene, benzo(b)fluoranthene, benzo(k)fluoranthene, dibenz(a,h)anthracene, and indeno(1,2,3-cd)pyrene) accounted for 98.57% of the total BaPeq concentration. Thus, the toxicity of PAHs in road dust was highly associated with high-molecular-weight compounds.

  17. Discrete Element Modeling

    Energy Technology Data Exchange (ETDEWEB)

    Morris, J; Johnson, S

    2007-12-03

    The Distinct Element Method (also frequently referred to as the Discrete Element Method) (DEM) is a Lagrangian numerical technique where the computational domain consists of discrete solid elements which interact via compliant contacts. This can be contrasted with Finite Element Methods where the computational domain is assumed to represent a continuum (although many modern implementations of the FEM can accommodate some Distinct Element capabilities). Often the terms Discrete Element Method and Distinct Element Method are used interchangeably in the literature, although Cundall and Hart (1992) suggested that Discrete Element Methods should be a more inclusive term covering Distinct Element Methods, Displacement Discontinuity Analysis and Modal Methods. In this work, DEM specifically refers to the Distinct Element Method, where the discrete elements interact via compliant contacts, in contrast with Displacement Discontinuity Analysis where the contacts are rigid and all compliance is taken up by the adjacent intact material.

  18. Data Element Registry Services

    Data.gov (United States)

    U.S. Environmental Protection Agency — Data Element Registry Services (DERS) is a resource for information about value lists (aka code sets / pick lists), data dictionaries, data elements, and EPA data...

  19. Element-ary Development.

    Science.gov (United States)

    Schamp, Homer W., Jr.

    1989-01-01

    Describes the historic development of the periodic table from the four-element theory to the Lavoisier's table. Presents a table listing the old and new names of chemicals and the Lavoisier's table of elements. Lists two references. (YP)

  20. On Element SDD Approximability

    CERN Document Server

    Avron, Haim; Toledo, Sivan

    2009-01-01

    This short communication shows that in some cases scalar elliptic finite element matrices cannot be approximated well by an SDD matrix. We also give a theoretical analysis of a simple heuristic method for approximating an element by an SDD matrix.

  1. Elemental Chemical Puzzlers

    Science.gov (United States)

    Thomas, Nicholas C.

    2009-01-01

    This paper provides nine short chemically based puzzles or problems extensible for use with students from middle school to college. Some of these will strengthen students' recognition of individual elements and element names. Others require students to focus on the salient properties of given chemical elements.

  2. Comparative analysis between three different methodologies for design of MSE walls: FHWA NHI-10-024, BS 8006 and EBGEO; Actualidad del Diseno de Muros de Suelo Reforzado Analisis Comparativo entre La FHWA NHI-10-024 (USA), BS 8006 (Gran Bretana) y EBGEO (Alemania)

    Energy Technology Data Exchange (ETDEWEB)

    Galindo Mondragon, A.

    2014-07-01

    This document reflects the current practice for design of MSE walls using Partial coefficients. A deep compassion between three of the most applied methodologies around the world for the design of this type of structures has been done (Galindo, 2012). In the study, almost all the limit states involved in an external and internal analysis were analyzed. The methodologies under study are the FHWA NHI-10-024 (2009), BS-8006 ((2010) and EBGEO (2010) used in United States, Great Britain and Germany, respectively. Like a complement of the analysis, the results of two examples developed with the three methodologies are presented, showing that exist a tendency to a more conservative wall design for EBGEO and BS 8006 in comparison with FHWA. (Author)

  3. Rare (Earth Elements [score

    Directory of Open Access Journals (Sweden)

    Camilo Méndez

    2014-12-01

    Full Text Available Rare (Earth Elements is a cycle of works for solo piano. The cycle was inspired by James Dillon’s Book of Elements (Vol. I-V. The complete cycle will consist of 14 pieces; one for each selected rare (earth element. The chosen elements are Neodymium, Erbium, Tellurium, Hafnium, Tantalum, Technetium, Indium, Dysprosium, Lanthanium, Cerium, Europium, Terbium, Yttrium and Darmstadtium. These elements were selected due to their special atomic properties that in many cases make them extremely valuable for the development of new technologies, and also because of their scarcity. To date, only 4 works have been completed Yttrium, Technetium, Indium and Tellurium.

  4. Musikalske elementer i musikaler

    OpenAIRE

    Jensen, Linnea Reitan

    2014-01-01

    Denne masteroppgaven undersøker hvordan musikalske elementer kan bli brukt i musikaler for å påvirke den dramaturgiske helheten. Gjennom både musikalsk og dramaturgisk analyse viser jeg hvordan elementer i musikk kan ha innvirkning på forestillingens dramaturgi. In this master thesis I am aiming to examine the musical elements used in the songs in musicals. Music is an important element in the musical, and therefore I want to look at how some musical elements can contribute to the musical'...

  5. Finite element procedures

    CERN Document Server

    Bathe, Klaus-Jürgen

    2015-01-01

    Finite element procedures are now an important and frequently indispensable part of engineering analyses and scientific investigations. This book focuses on finite element procedures that are very useful and are widely employed. Formulations for the linear and nonlinear analyses of solids and structures, fluids, and multiphysics problems are presented, appropriate finite elements are discussed, and solution techniques for the governing finite element equations are given. The book presents general, reliable, and effective procedures that are fundamental and can be expected to be in use for a long time. The given procedures form also the foundations of recent developments in the field.

  6. Main: -300ELEMENT [PLACE

    Lifescience Database Archive (English)

    Full Text Available -300ELEMENT S000122 11-May-2006 (last modified) kehi Present upstream of the promot...er from the B-hordein gene of barley and the alpha-gliadin, gamma-gliadin, and low molecular weight glutenin... genes of wheat; See S000001 -300CORE; See S000002 -300MOTIF; -300 element; hordein; gliadin; glutenin; seed; wheat (Triticum aestivum) TGHAAARK ...

  7. A dry element

    Energy Technology Data Exchange (ETDEWEB)

    Kimura, T.; Ota, A.

    1983-08-11

    The agglomerate for the element is made from activated charcoal powder, an electrically conducting additive and a neutral electrolyte. The activated charcoal makes up 30 to 50 percent of the weight of the agglomerate. It is a mixture of hydrophobized and unhydrophobized powder in a ratio of 85 to 70 to 15 to 30. The element has high discharge characteristics.

  8. A battery element

    Energy Technology Data Exchange (ETDEWEB)

    Nakai, M.; Koboyasi, S.; Oisi, K.; Okadzaki, R.; Ota, A.

    1983-07-29

    An anode made of an alkaline or an alkaline earth metal and an electrolyte based on an organic solvent are used in the element. A mixture of Mn203 and Mn304 in a 9 to 1 to 3 to 7 ratio serves as the cathode. The element has a stable discharge curve at a nominal voltage of 1.5 volts.

  9. The solar element

    DEFF Research Database (Denmark)

    Kragh, Helge

    2009-01-01

    Apart from hydrogen, helium is the most abundant chemical element in the universe, and yet it was only discovered on the Earth in 1895. Its early history is unique because it encompasses astronomy as well as chemistry, two sciences which the spectroscope brought into contact during the second half...... of the nineteenth century. In the modest form of a yellow spectral line known as D3, 'helium' was sometimes supposed to exist in the Sun's atmosphere, an idea which is traditionally ascribed to J. Norman Lockyer. Did Lockyer discover helium as a solar element? How was the suggestion received by chemists, physicists...... elements might be different. The complex story of how helium became established as both a solar and terrestrial element involves precise observations as well as airy speculations. It is a story that is unique among the discovery histories of the chemical elements....

  10. Flow Element Models

    DEFF Research Database (Denmark)

    Heiselberg, Per; Nielsen, Peter V.

    Air distribution in ventilated rooms is a flow process that can be divided into different elements such as supply air jets, exhaust flows, thermal plumes, boundary layer flows, infiltration and gravity currents. These flow elements are isolated volumes where the air movement is controlled...... by a restricted number of parameters, and the air movement is fairly independent of the general flow in the enclosure. In many practical situations, the most convenient· method is to design the air distribution system using flow element theory....

  11. Discovery of element 112

    Energy Technology Data Exchange (ETDEWEB)

    Hofmann, S. [GSI, Darmstadt (Germany)

    1996-12-31

    The new elements 110, 111, and 112 were synthesized and unambiguously identified in experiments at SHIP. Due to strong shell effects the dominant decay mode is not fission, but emission of alpha particles. Theoretical investigations predict that maximum shell effects should exist in nuclei near proton number 114 and neutron number 184. Measurements give hope that isotopes of element 114 close to the island of spherical Superheavy Elements could be produced by fusion reactions using {sup 118}Pb as target. systematic studies of the reaction cross-sections indicate that transfer of nucleons is the important process to initiate the fusion.

  12. Finite element mesh generation

    CERN Document Server

    Lo, Daniel SH

    2014-01-01

    Highlights the Progression of Meshing Technologies and Their ApplicationsFinite Element Mesh Generation provides a concise and comprehensive guide to the application of finite element mesh generation over 2D domains, curved surfaces, and 3D space. Organised according to the geometry and dimension of the problem domains, it develops from the basic meshing algorithms to the most advanced schemes to deal with problems with specific requirements such as boundary conformity, adaptive and anisotropic elements, shape qualities, and mesh optimization. It sets out the fundamentals of popular techniques

  13. Divergent picornavirus IRES elements

    DEFF Research Database (Denmark)

    Belsham, Graham

    2009-01-01

    Internal ribosome entry site (IRES) elements were first identified about 20 years ago within the 5' untranslated region of picornavirus RNAs. They direct a cap-independent mechanism of translation initiation on the viral RNA. Within the picornavirus family it is now known that there are four...... classes of IRES element which vary in size (450-270nt), they also have different, complex, secondary structures and distinct requirements for cellular proteins to allow them to function. This review describes the features of each class of picornavirus IRES element but focuses on the characteristics...... of the most recently described group, initially identified within the porcine teschovirus-1 RNA, which has strong similarities to the IRES elements from within the genomes of hepatitis C virus and the pestiviruses which are members of the flavivirus family. The selection of the initiation codon...

  14. New functionalities in abundant element oxides: ubiquitous element strategy.

    Science.gov (United States)

    Hosono, Hideo; Hayashi, Katsuro; Kamiya, Toshio; Atou, Toshiyuki; Susaki, Tomofumi

    2011-06-01

    While most ceramics are composed of ubiquitous elements (the ten most abundant elements within the Earth's crust), many advanced materials are based on rare elements. A 'rare-element crisis' is approaching owing to the imbalance between the limited supply of rare elements and the increasing demand. Therefore, we propose a 'ubiquitous element strategy' for materials research, which aims to apply abundant elements in a variety of innovative applications. Creation of innovative oxide materials and devices based on conventional ceramics is one specific challenge. This review describes the concept of ubiquitous element strategy and gives some highlights of our recent research on the synthesis of electronic, thermionic and structural materials using ubiquitous elements.

  15. New roof element system

    DEFF Research Database (Denmark)

    Ditlev, Jesper; Rudbeck, Claus Christian

    1997-01-01

    The aim of the project has been to develop an element system for warm deck roofs which, from a thermal and economical point of view, can deal with the future demands for heat loss coefficients for low slope roofs.......The aim of the project has been to develop an element system for warm deck roofs which, from a thermal and economical point of view, can deal with the future demands for heat loss coefficients for low slope roofs....

  16. Novel porcine repetitive elements

    Directory of Open Access Journals (Sweden)

    Nonneman Dan J

    2006-12-01

    Full Text Available Abstract Background Repetitive elements comprise ~45% of mammalian genomes and are increasingly known to impact genomic function by contributing to the genomic architecture, by direct regulation of gene expression and by affecting genomic size, diversity and evolution. The ubiquity and increasingly understood importance of repetitive elements contribute to the need to identify and annotate them. We set out to identify previously uncharacterized repetitive DNA in the porcine genome. Once found, we characterized the prevalence of these repeats in other mammals. Results We discovered 27 repetitive elements in 220 BACs covering 1% of the porcine genome (Comparative Vertebrate Sequencing Initiative; CVSI. These repeats varied in length from 55 to 1059 nucleotides. To estimate copy numbers, we went to an independent source of data, the BAC-end sequences (Wellcome Trust Sanger Institute, covering approximately 15% of the porcine genome. Copy numbers in BAC-ends were less than one hundred for 6 repeat elements, between 100 and 1000 for 16 and between 1,000 and 10,000 for 5. Several of the repeat elements were found in the bovine genome and we have identified two with orthologous sites, indicating that these elements were present in their common ancestor. None of the repeat elements were found in primate, rodent or dog genomes. We were unable to identify any of the replication machinery common to active transposable elements in these newly identified repeats. Conclusion The presence of both orthologous and non-orthologous sites indicates that some sites existed prior to speciation and some were generated later. The identification of low to moderate copy number repetitive DNA that is specific to artiodactyls will be critical in the assembly of livestock genomes and studies of comparative genomics.

  17. New roof element system

    DEFF Research Database (Denmark)

    Ditlev, Jesper; Rudbeck, Claus Christian

    1997-01-01

    The aim of the project has been to develop an element system for warm deck roofs which, from a thermal and economical point of view, can deal with the future demands for heat loss coefficients for low slope roofs.......The aim of the project has been to develop an element system for warm deck roofs which, from a thermal and economical point of view, can deal with the future demands for heat loss coefficients for low slope roofs....

  18. Structural elements design manual

    CERN Document Server

    Draycott, Trevor

    2012-01-01

    Gives clear explanations of the logical design sequence for structural elements. The Structural Engineer says: `The book explains, in simple terms, and with many examples, Code of Practice methods for sizing structural sections in timber, concrete,masonry and steel. It is the combination into one book of section sizing methods in each of these materials that makes this text so useful....Students will find this an essential support text to the Codes of Practice in their study of element sizing'.

  19. A battery element

    Energy Technology Data Exchange (ETDEWEB)

    Vatanabe, U.; Aoki, K.; Ito, K.; Ogava, K.; Okadzaki, R.

    1983-07-29

    An anode made of a light metal is used in the element, along with an anhydrous liquid electrolyte and a cathode made of CuC12(CFn)x or another material. The current tap of the anode is made from aluminum, gold, silver or another metal of the platinum group and the current tap may be coated with this metal. The thickness of the coating is 0.1 to 1 micrometer. The element has a long storage life.

  20. Atoms, molecules & elements

    CERN Document Server

    Graybill, George

    2007-01-01

    Young scientists will be thrilled to explore the invisible world of atoms, molecules and elements. Our resource provides ready-to-use information and activities for remedial students using simplified language and vocabulary. Students will label each part of the atom, learn what compounds are, and explore the patterns in the periodic table of elements to find calcium (Ca), chlorine (Cl), and helium (He) through hands-on activities.

  1. Trace elements in dialysis.

    Science.gov (United States)

    Filler, Guido; Felder, Sarah

    2014-08-01

    In end-stage chronic kidney disease (CKD), pediatric nephrologists must consider the homeostasis of the multiple water-soluble ions that are influenced by renal replacement therapy (RRT). While certain ions such as potassium and calcium are closely monitored, little is known about the handling of trace elements in pediatric dialysis. RRT may lead to accumulation of toxic trace elements, either due to insufficient elimination or due to contamination, or to excessive removal of essential trace elements. However, trace elements are not routinely monitored in dialysis patients and no mechanism for these deficits or toxicities has been established. This review summarizes the handling of trace elements, with particular attention to pediatric data. The best data describe lead and indicate that there is a higher prevalence of elevated lead (Pb, atomic number 82) levels in children on RRT when compared to adults. Lead is particularly toxic in neurodevelopment and lead levels should therefore be monitored. Monitoring of zinc (Zn, atomic number 30) and selenium (Se, atomic number 34) may be indicated in the monitoring of all pediatric dialysis patients to reduce morbidity from deficiency. Prospective studies evaluating the impact of abnormal trace elements and the possible therapeutic value of intervention are required.

  2. 172 Networks, Micro Small Enterprises (MSE'S) and Performance ...

    African Journals Online (AJOL)

    User

    Indexed African Journals Online: www.ajol.info. An International ... Given the importance of this sector in areas of employment creation, growth and poverty alleviation ... respect to the instrumental role of social capital, Marketing Network Model.

  3. Ultra performance liquid chromatography coupled with electrospray and atmospheric pressure chemical ionization (ESCi)-quadrupole time-of-flight mass spectrometry with novel mass spectrometry(Elevated Energy) (MS(E)) data collection technique: determination and pharmacokinetics, tissue distribution and biliary excretion study of ergone in rat.

    Science.gov (United States)

    Zhao, Ying-Yong; Cheng, Xian-Long; Wei, Feng; Bai, Xu; Lin, Rui-Chao

    2012-07-01

    Ergosta-4,6,8(14),22-tetraen-3-one (ergone) has been proved to have novel antitumor effects on HepG2 cells. The aim of this study was to investigate the pharmacokinetics, tissue distribution, and biliary excretion of ergone in rats following a single oral administration (5, 10, and 20 mg/kg). The levels of ergone in plasma, tissues, and bile were measured by ultra performance liquid chromatography coupled with electrospray and atmospheric pressure chemical ionization (ESCi)-quadrupole time-of-flight mass spectrometry with novel mass spectrometry(Elevated Energy) (MS(E)) data collection technique method. The results show ergone was distributed and eliminated from rat plasma and in non-linear pharmacokinetics from a dose range of 5-20 mg/kg. The ergone was found to distribute widely in the internal organs, with tissue concentrations in order of lungs, spleen, liver, intestine, kidneys, heart, stomach, parorchis, teasticles, and brain. At 12 h after dosing, the tissue concentrations in the organs were markedly decreased. The lungs, spleen, and liver were the dominant organs with high tissue concentrations that might be the primary sites for metabolism and elimination of ergone. Total recoveries of ergone within 24 h in bile were 34.14%.

  4. Fuel Element Technical Manual

    Energy Technology Data Exchange (ETDEWEB)

    Burley, H.H. [ed.

    1956-08-01

    It is the purpose of the Fuel Element Technical Manual to Provide a single document describing the fabrication processes used in the manufacture of the fuel element as well as the technical bases for these processes. The manual will be instrumental in the indoctrination of personnel new to the field and will provide a single data reference for all personnel involved in the design or manufacture of the fuel element. The material contained in this manual was assembled by members of the Engineering Department and the Manufacturing Department at the Hanford Atomic Products Operation between the dates October, 1955 and June, 1956. Arrangement of the manual. The manual is divided into six parts: Part I--introduction; Part II--technical bases; Part III--process; Part IV--plant and equipment; Part V--process control and improvement; and VI--safety.

  5. Creativity Management Key Elements

    Directory of Open Access Journals (Sweden)

    Rosa María Fuchs Ángeles

    2015-09-01

    Full Text Available Organizations are constantly looking towards innovation. In order to reach it they must foment creativity. This paper analyzes a series of elements considered in the organizational creativity management and proposes a model with the indispensable factors that organizations should consider to reach it. These elements are: culture and organizational environment, strategy, structure, communication, relation with customers, human resources (recruiting, training, job design, compensation, promotion, and performance evaluation, long term orientation and the organizational life cycle. Having the analysis of those elements as a basis, the indispensable pillars on management creativity are identified. The proposed model is based on 5 pillars: the alignment between strategic, culture and organizational structure, called by the authors 'Holy Trinity'; intern publicity; customer’s voice; recognition and a look towards future. Finally, the case of an innovative Peruvian enterprise is presented from the model’s perspective and the study conclusions.

  6. Elemental analysis in biotechnology.

    Science.gov (United States)

    Hann, Stephan; Dernovics, Mihaly; Koellensperger, Gunda

    2015-02-01

    This article focuses on analytical strategies integrating atomic spectroscopy in biotechnology. The rationale behind developing such methods is inherently linked to unique features of the key technique in elemental analysis, which is inductively coupled plasma mass spectrometry: (1) the high sensitivity and selectivity of state of the art instrumentation, (2) the possibility of accurate absolute quantification even in complex matrices, (3) the capability of combining elemental detectors with chromatographic separation methods and the versatility of the latter approach, (4) the complementarity of inorganic and organic mass spectrometry, (5) the multi-element capability and finally (6) the capability of isotopic analysis. The article highlights the most recent bio-analytical developments exploiting these methodological advantages and shows the potential in biotechnological applications.

  7. Advanced finite element technologies

    CERN Document Server

    Wriggers, Peter

    2016-01-01

    The book presents an overview of the state of research of advanced finite element technologies. Besides the mathematical analysis, the finite element development and their engineering applications are shown to the reader. The authors give a survey of the methods and technologies concerning efficiency, robustness and performance aspects. The book covers the topics of mathematical foundations for variational approaches and the mathematical understanding of the analytical requirements of modern finite element methods. Special attention is paid to finite deformations, adaptive strategies, incompressible, isotropic or anisotropic material behavior and the mathematical and numerical treatment of the well-known locking phenomenon. Beyond that new results for the introduced approaches are presented especially for challenging nonlinear problems.

  8. An alkaline element

    Energy Technology Data Exchange (ETDEWEB)

    Arita, T.; Murakami, K.; Okha, K.

    1983-04-28

    A cathode with a dual layer active mass is installed in the disk shaped alkaline silver and zinc element. The first layer, which is turned towards the anode, contains 85 parts Ag2O, 5 parts electrolytic MnO2 and 10 parts graphite. The second layer, which contacts the bottom of the element, contains 35 parts Ag2O, 60 parts electrolytic MnO2 and 5 parts graphite. The electrical capacity of the first and second layers is 60 and 40, respectively. The first layer may be discharged with a high current density and the second layer with less current density. The element has high characteristics with comparatively low cost.

  9. Intelligent Elements for ISHM

    Science.gov (United States)

    Schmalzel, John L.; Morris, Jon; Turowski, Mark; Figueroa, Fernando; Oostdyk, Rebecca

    2008-01-01

    There are a number of architecture models for implementing Integrated Systems Health Management (ISHM) capabilities. For example, approaches based on the OSA-CBM and OSA-EAI models, or specific architectures developed in response to local needs. NASA s John C. Stennis Space Center (SSC) has developed one such version of an extensible architecture in support of rocket engine testing that integrates a palette of functions in order to achieve an ISHM capability. Among the functional capabilities that are supported by the framework are: prognostic models, anomaly detection, a data base of supporting health information, root cause analysis, intelligent elements, and integrated awareness. This paper focuses on the role that intelligent elements can play in ISHM architectures. We define an intelligent element as a smart element with sufficient computing capacity to support anomaly detection or other algorithms in support of ISHM functions. A smart element has the capabilities of supporting networked implementations of IEEE 1451.x smart sensor and actuator protocols. The ISHM group at SSC has been actively developing intelligent elements in conjunction with several partners at other Centers, universities, and companies as part of our ISHM approach for better supporting rocket engine testing. We have developed several implementations. Among the key features for these intelligent sensors is support for IEEE 1451.1 and incorporation of a suite of algorithms for determination of sensor health. Regardless of the potential advantages that can be achieved using intelligent sensors, existing large-scale systems are still based on conventional sensors and data acquisition systems. In order to bring the benefits of intelligent sensors to these environments, we have also developed virtual implementations of intelligent sensors.

  10. Elements of social security

    DEFF Research Database (Denmark)

    Hansen, Hans

    (Alte Länder). This is the 9th and last edition of the publication,covering income levels and rules for social security and personal taxation for 1999. Basis for the projections to 1999 income levels is the 1998 data (in some cases 1999 data)for OECD's Taxing Wages as reported by national experts.......Elements of Social Security is a comparative study of important elements of the social security systems in Denmark (DK), Sweden (S), Finland (FIN), Austria (A), Germany (D), the Netherlands (NL), Great Britain (GB) and Canada (CAN). It should be emphasized that Germany is the former West Germany...

  11. Rocket propulsion elements

    CERN Document Server

    Sutton, George P

    2011-01-01

    The definitive text on rocket propulsion-now revised to reflect advancements in the field For sixty years, Sutton's Rocket Propulsion Elements has been regarded as the single most authoritative sourcebook on rocket propulsion technology. As with the previous edition, coauthored with Oscar Biblarz, the Eighth Edition of Rocket Propulsion Elements offers a thorough introduction to basic principles of rocket propulsion for guided missiles, space flight, or satellite flight. It describes the physical mechanisms and designs for various types of rockets' and provides an unders

  12. Finite element analysis

    CERN Document Server

    2010-01-01

    Finite element analysis is an engineering method for the numerical analysis of complex structures. This book provides a bird's eye view on this very broad matter through 27 original and innovative research studies exhibiting various investigation directions. Through its chapters the reader will have access to works related to Biomedical Engineering, Materials Engineering, Process Analysis and Civil Engineering. The text is addressed not only to researchers, but also to professional engineers, engineering lecturers and students seeking to gain a better understanding of where Finite Element Analysis stands today.

  13. Finite elements and approximation

    CERN Document Server

    Zienkiewicz, O C

    2006-01-01

    A powerful tool for the approximate solution of differential equations, the finite element is extensively used in industry and research. This book offers students of engineering and physics a comprehensive view of the principles involved, with numerous illustrative examples and exercises.Starting with continuum boundary value problems and the need for numerical discretization, the text examines finite difference methods, weighted residual methods in the context of continuous trial functions, and piecewise defined trial functions and the finite element method. Additional topics include higher o

  14. Elements of social security

    DEFF Research Database (Denmark)

    Hansen, Hans

    Elements of Social Security is a comparative study of important elements of the social security systems in Denmark (DK), Sweden (S), Finland (FIN), Austria (A), Germany (D), the Netherlands (NL), Great Britain (GB) and Canada (CAN). It should be emphasized that Germany is the former West Germany...... (Alte Länder). This is the 9th and last edition of the publication,covering income levels and rules for social security and personal taxation for 1999. Basis for the projections to 1999 income levels is the 1998 data (in some cases 1999 data)for OECD's Taxing Wages as reported by national experts....

  15. Elements of linear space

    CERN Document Server

    Amir-Moez, A R; Sneddon, I N

    1962-01-01

    Elements of Linear Space is a detailed treatment of the elements of linear spaces, including real spaces with no more than three dimensions and complex n-dimensional spaces. The geometry of conic sections and quadric surfaces is considered, along with algebraic structures, especially vector spaces and transformations. Problems drawn from various branches of geometry are given.Comprised of 12 chapters, this volume begins with an introduction to real Euclidean space, followed by a discussion on linear transformations and matrices. The addition and multiplication of transformations and matrices a

  16. Annihilators of nilpotent elements

    Directory of Open Access Journals (Sweden)

    Abraham A. Klein

    2005-01-01

    Full Text Available Let x be a nilpotent element of an infinite ring R (not necessarily with 1. We prove that A(x—the two-sided annihilator of x—has a large intersection with any infinite ideal I of R in the sense that card(A(x∩I=cardI. In particular, cardA(x=cardR; and this is applied to prove that if N is the set of nilpotent elements of R and R≠N, then card(R\\N≥cardN.

  17. Archaeal extrachromosomal genetic elements

    DEFF Research Database (Denmark)

    Wang, Haina; Peng, Nan; Shah, Shiraz Ali

    2015-01-01

    SUMMARY: Research on archaeal extrachromosomal genetic elements (ECEs) has progressed rapidly in the past decade. To date, over 60 archaeal viruses and 60 plasmids have been isolated. These archaeal viruses exhibit an exceptional diversity in morphology, with a wide array of shapes, such as spind......SUMMARY: Research on archaeal extrachromosomal genetic elements (ECEs) has progressed rapidly in the past decade. To date, over 60 archaeal viruses and 60 plasmids have been isolated. These archaeal viruses exhibit an exceptional diversity in morphology, with a wide array of shapes...

  18. An alkaline element

    Energy Technology Data Exchange (ETDEWEB)

    Obi, F.

    1983-09-29

    A current tap pressed into the anode is installed in the central part of the top of the element. There is an internal top made of plastic under the top. There is a projection in the center of the top with an opening, through which the current tap is passed. The edge of the plastic top serves as an insulation lining between the metallic top and the body, which serves as the current tap for the cathode. A separator is placed between the anode and the cathode. Electrolyte leaks are prevented in the slotted disk elements.

  19. Beam transport elements

    CERN Multimedia

    1965-01-01

    Two of the beam transport elements for the slow ejection system. On the left, a quadrupole 1.2 m long with a 5 cm aperture, capable of producing a gradient of 5000 gauss. On the right, a 1 m bending magnet with a 4 cm gap; its field is 20 000 gauss.

  20. Movies and Literary Elements.

    Science.gov (United States)

    Keller, Rodney D.

    1987-01-01

    Recommends using movie clips to stimulate students' interest in reading a novel as well as to teach elements of fiction such as plot, character, setting, symbol, irony, and theme. Describes each clip and provides study questions. Includes a listing of movies made from books. (NH)

  1. Elements of Social Security

    DEFF Research Database (Denmark)

    Hansen, Hans

    Elements of Social Security contains an overview of important benefit schemes in Denmark, Sweden, Finland, Germany, the Netherlands, Great Britain and Canada. The schemes are categorized according to common sets of criteria and compared. Stylized cases illustrate the impact on disposable income...

  2. Light element ceramics

    OpenAIRE

    Rao, KJ; Varma, KBR; Raju, AR

    1988-01-01

    An overview of a few structually important light element ceramics is presented. Included in the overview are silicon nitide, sialon, aluminium nitride, boron carbide and silicon carbide. Methods of preparation, characterization and industrial applications of these ceramics are summarized. Mechanical properties, industrial production techniques and principal uses of these ceramics are emphasized.

  3. Water, the intangible element

    NARCIS (Netherlands)

    Schotting, R.J.

    2009-01-01

    Water is the key to life. No living creature can survive without water. Too much water or polluted water are serious threats to mankind. Managing this intangible element is complex, not only in wet deltaic regions but also in the (semi-)arid regions of the world. Combined efforts of the hydro(geo)lo

  4. CEDS Addresses: Rubric Elements

    Science.gov (United States)

    US Department of Education, 2015

    2015-01-01

    Common Education Data Standards (CEDS) Version 4 introduced a common data vocabulary for defining rubrics in a data system. The CEDS elements support digital representations of both holistic and analytic rubrics. This document shares examples of holistic and analytic project rubrics, available CEDS Connections, and a logical model showing the…

  5. The elements of life

    Directory of Open Access Journals (Sweden)

    Sergey P. Fedotov

    2016-11-01

    Full Text Available Article "Elements of Life" offers a hypothesis about the relationship of the phenomenon of traditional Chinese medicine with the physical laws. It shows the principle of forming a sequence of daily activity of the acupuncture meridians as a consequence of the Doppler effect in the process of flowing around the planet Earth by cosmic wind (by Ether. In accordance with this specification the daily structure of meridians had been built. It is suggested that the essence of the Chinese Qi (Chi are vibrations of a certain range in the medium. Consequently, it became possible to set the interrelation of frequencies of the visible spectrum with certain meridians. It is shown that the topological relationship of ancient (barrier points of the Five Elements (Wu-Shu points are associated with the wave lengths of the so-called Qi. It is shown also that the essence of the Wu-Xing law is based on daily circulation patterns of meridians. The examples of the surrounding world, including pulses processes in the human body, are confirming the above mentioned theses. A correlation diagram between the main elements by Dr. Samohotsky A.S. (dissertation "The experience of the definition of medical laws", 1946 and the Five Elements of traditional Chinese philosophy is established. The above represented hypotheses are yet introduced in practice in form of pulse spectral analysis system.

  6. Elements of Social Security

    DEFF Research Database (Denmark)

    Hansen, Hans

    Elements of Social Security contains an overview of important benefit schemes in Denmark, Sweden, Finland, Germany, Great Britain, the Netherlands and Canada. The schemes are categorized according to common sets of criteria and compared. Stylized cases illustrate the impact on disposable income...

  7. Elements of Social Security

    DEFF Research Database (Denmark)

    Hansen, Hans

    Elements of Social Security contains an overview of important benefit schemes in Denmark, Sweden, Finland, Austria, Germany, the Netherlands, Great Britain and Canada. The schemes are categorized according to common sets of criteria and compared. Stylized cases illustrate the impact on disposable...

  8. Elemental Chem Lab

    Science.gov (United States)

    Franco Mariscal, Antonio Joaquin

    2008-01-01

    This educative material uses the symbols of 45 elements to spell the names of 32 types of laboratory equipment usually found in chemical labs. This teaching material has been divided into three puzzles according to the type of the laboratory equipment: (i) glassware as reaction vessels or containers; (ii) glassware for measuring, addition or…

  9. Reference: -300ELEMENT [PLACE

    Lifescience Database Archive (English)

    Full Text Available -300ELEMENT Kreis M, Williamson MS, Forde J, Schmitz D, Clark J, Buxton B, Pywell J..., Marris C, Henderson J, Harris N, Shewry PR, Forde BG, Miflin BJ Differential gene expression in the developing barley endosperm. Philos Trans R Soc Lond B314:355-365 (1986) ...

  10. Inside finite elements

    CERN Document Server

    Weiser, Martin

    2016-01-01

    All relevant implementation aspects of finite element methods are discussed in this book. The focus is on algorithms and data structures as well as on their concrete implementation. Theory is covered as far as it gives insight into the construction of algorithms. Throughout the exercises a complete FE-solver for scalar 2D problems will be implemented in Matlab/Octave.

  11. Element-topology-independent preconditioners for parallel finite element computations

    Science.gov (United States)

    Park, K. C.; Alexander, Scott

    1992-01-01

    A family of preconditioners for the solution of finite element equations are presented, which are element-topology independent and thus can be applicable to element order-free parallel computations. A key feature of the present preconditioners is the repeated use of element connectivity matrices and their left and right inverses. The properties and performance of the present preconditioners are demonstrated via beam and two-dimensional finite element matrices for implicit time integration computations.

  12. Element-topology-independent preconditioners for parallel finite element computations

    Science.gov (United States)

    Park, K. C.; Alexander, Scott

    1992-01-01

    A family of preconditioners for the solution of finite element equations are presented, which are element-topology independent and thus can be applicable to element order-free parallel computations. A key feature of the present preconditioners is the repeated use of element connectivity matrices and their left and right inverses. The properties and performance of the present preconditioners are demonstrated via beam and two-dimensional finite element matrices for implicit time integration computations.

  13. Elements of quantum optics

    CERN Document Server

    Meystre, Pierre

    2007-01-01

    Elements of Quantum Optics gives a self-contained and broad coverage of the basic elements necessary to understand and carry out research in laser physics and quantum optics, including a review of basic quantum mechanics and pedagogical introductions to system-reservoir interactions and to second quantization. The text reveals the close connection between many seemingly unrelated topics, such as probe absorption, four-wave mixing, optical instabilities, resonance fluorescence and squeezing. It also comprises discussions of cavity quantum electrodynamics and atom optics. The 4th edition includes a new chapter on quantum entanglement and quantum information, as well as added discussions of the quantum beam splitter, electromagnetically induced transparency, slow light, and the input-output formalism needed to understand many problems in quantum optics. It also provides an expanded treatment of the minimum-coupling Hamiltonian and a simple derivation of the Gross-Pitaevskii equation, an important gateway to rese...

  14. Elements of String Cosmology

    Science.gov (United States)

    Gasperini, Maurizio

    2011-03-01

    Preface; Acknowledgements; Notation, units and conventions; 1. A short review of standard and inflationary cosmology; 2. The basic string cosmology equations; 3. Conformal invariance and string effective action; 4. Duality symmetries and cosmological solutions; 5. Inflationary kinematics; 6. The string phase; 7. The cosmic background of relic gravitational waves; 8. Scalar perturbations and the anisotropy of the CMB radiation; 9. Dilaton phenomenology; 10. Elements of brane cosmology; Index.

  15. Quantum theory elements

    CERN Document Server

    Bates, David Robert

    1962-01-01

    Quantum Theory: A Treatise in Three Volumes, I: Elements focuses on the principles, methodologies, and approaches involved in quantum theory, including quantum mechanics, linear combinations, collisions, and transitions. The selection first elaborates on the fundamental principles of quantum mechanics, exactly soluble bound state problems, and continuum. Discussions focus on delta function normalization, spherically symmetric potentials, rectangular potential wells, harmonic oscillators, spherically symmetrical potentials, Coulomb potential, axiomatic basis, consequences of first three postula

  16. Nuclear fuel element

    Science.gov (United States)

    Meadowcroft, Ronald Ross; Bain, Alastair Stewart

    1977-01-01

    A nuclear fuel element wherein a tubular cladding of zirconium or a zirconium alloy has a fission gas plenum chamber which is held against collapse by the loops of a spacer in the form of a tube which has been deformed inwardly at three equally spaced, circumferential positions to provide three loops. A heat resistant disc of, say, graphite separates nuclear fuel pellets within the cladding from the plenum chamber. The spacer is of zirconium or a zirconium alloy.

  17. A sealing element

    Energy Technology Data Exchange (ETDEWEB)

    Obi, F.; Takada, K.

    1983-09-22

    A sealing lining made of a mixture of polyethylene or polypropylene with an additive which prevents destruction of the lining is used in the element. The content of the additive in the mixture is 10 to 30 percent by mass. The additive basically consists of polyethylene. Carboxyl groups are introduced into the polymer as an anion and sodium, potassium and molybdenum are introduced as the cation.

  18. New Aperture Partitioning Element

    Science.gov (United States)

    Griffin, S.; Calef, B.; Williams, S.

    Postprocessing in an optical system can be aided by adding an optical element to partition the pupil into a number of segments. When imaging through the atmosphere, the recorded data are blurred by temperature-induced variations in the index of refraction along the line of sight. Using speckle imaging techniques developed in the astronomy community, this blurring can be corrected to some degree. The effectiveness of these techniques is diminished by redundant baselines in the pupil. Partitioning the pupil reduces the degree of baseline redundancy, and therefore improves the quality of images that can be obtained from the system. It is possible to implement the described approach on an optical system with a segmented primary mirror, but not very practical. This is because most optical systems do not have segmented primary mirrors, and those that do have relatively low bandwidth positioning of segments due to their large mass and inertia. It is much more practical to position an active aperture partitioning element at an aft optics pupil of the optical system. This paper describes the design, implementation and testing of a new aperture partitioning element that is completely reflective and reconfigurable. The device uses four independent, annular segments that can be positioned with a high degree of accuracy without impacting optical wavefront of each segment. This mirror has been produced and is currently deployed and working on the 3.6 m telescope.

  19. Helium the disappearing element

    CERN Document Server

    Sears, Wheeler M

    2015-01-01

    The subject of the book is helium, the element, and its use in myriad applications including MRI machines, particle accelerators, space telescopes, and of course balloons and blimps. It was at the birth of our Universe, or the Big Bang, where the majority of cosmic helium was created; and stellar helium production continues. Although helium is the second most abundant element in the Universe, it is actually quite rare here on Earth and only exists because of radioactive elements deep within the Earth. This book includes a detailed history of the discovery of helium, of the commercial industry built around it, how the helium we actually encounter is produced within the Earth, and the state of the helium industry today. The gas that most people associate with birthday party balloons is running out. “Who cares?” you might ask. Well, without helium, MRI machines could not function, rockets could not go into space, particle accelerators such as those used by CERN could not operate, fiber optic cables would not...

  20. The transuranium elements: From neptunium and plutonium to element 112

    Energy Technology Data Exchange (ETDEWEB)

    Hoffman, D.C. [California Univ., Berkeley, CA (United States)]|[Lawrence Livermore National Lab., CA (United States)

    1996-07-26

    Beginning in the 1930`s, both chemists and physicists became interested in synthesizing new artificial elements. The first transuranium element, Np, was synthesized in 1940. Over the past six decades, 20 transuranium elements have been produced. A review of the synthesis is given. The procedure of naming the heavy elements is also discussed. It appears feasible to produce elements 113 and 114. With the Berkeley Gas-filled Separator, it should be possible to reach the superheavy elements in the region of the spherical Z=114 shell, but with fewer neutrons than the N=184 spherical shell. 57 refs, 6 figs.

  1. Method of securing filter elements

    Energy Technology Data Exchange (ETDEWEB)

    Brown, Erik P.; Haslam, Jeffery L.; Mitchell, Mark A.

    2016-10-04

    A filter securing system including a filter unit body housing; at least one tubular filter element positioned in the filter unit body housing, the tubular filter element having a closed top and an open bottom; a dimple in either the filter unit body housing or the top of the tubular filter element; and a socket in either the filter unit body housing or the top of the tubular filter element that receives the dimple in either the filter unit body housing or the top of the tubular filter element to secure the tubular filter element to the filter unit body housing.

  2. It is elemental

    DEFF Research Database (Denmark)

    Delgado-Baquerizo, Manuel; Reich, Peter B.; Khachane, Amit N.

    2017-01-01

    It is well established that resource quantity and elemental stoichiometry play major roles in shaping below and aboveground plant biodiversity, but their importance for shaping microbial diversity in soil remains unclear. Here, we used statistical modeling on a regional database covering 179...... diversity and composition were primarily driven by variation in soil resource stoichiometry (total C:N:P ratios), itself linked to different land uses, and secondarily driven by other important biodiversity drivers such as climate, soil spatial heterogeneity, soil pH, root influence (plant-soil microbe...

  3. Elements of energy conversion

    CERN Document Server

    Russell, Charles R

    2013-01-01

    Elements of Energy Conversion brings together scattered information on the subject of energy conversion and presents it in terms of the fundamental thermodynamics that apply to energy conversion by any process. Emphasis is given to the development of the theory of heat engines because these are and will remain most important power sources. Descriptive material is then presented to provide elementary information on all important energy conversion devices. The book contains 10 chapters and opens with a discussion of forms of energy, energy sources and storage, and energy conversion. This is foll

  4. Osteoporosis and trace elements

    DEFF Research Database (Denmark)

    Aaseth, J.; Boivin, G.; Andersen, Ole

    2012-01-01

    More than 200 million people are affected by osteoporosis worldwide, as estimated by 2 million annual hip fractures and other debilitating bone fractures (vertebrae compression and Colles' fractures). Osteoporosis is a multi-factorial disease with potential contributions from genetic, endocrine...... in new bone and results in a net gain in bone mass, but may be associated with a tissue of poor quality. Aluminum induces impairment of bone formation. Gallium and cadmium suppresses bone turnover. However, exact involvements of the trace elements in osteoporosis have not yet been fully clarified...

  5. Elements of probability theory

    CERN Document Server

    Rumshiskii, L Z

    1965-01-01

    Elements of Probability Theory presents the methods of the theory of probability. This book is divided into seven chapters that discuss the general rule for the multiplication of probabilities, the fundamental properties of the subject matter, and the classical definition of probability. The introductory chapters deal with the functions of random variables; continuous random variables; numerical characteristics of probability distributions; center of the probability distribution of a random variable; definition of the law of large numbers; stability of the sample mean and the method of moments

  6. Elements of real analysis

    CERN Document Server

    Sprecher, David A

    2010-01-01

    This classic text in introductory analysis delineates and explores the intermediate steps between the basics of calculus and the ultimate stage of mathematics: abstraction and generalization.Since many abstractions and generalizations originate with the real line, the author has made it the unifying theme of the text, constructing the real number system from the point of view of a Cauchy sequence (a step which Dr. Sprecher feels is essential to learn what the real number system is).The material covered in Elements of Real Analysis should be accessible to those who have completed a course in

  7. Elements of analytical dynamics

    CERN Document Server

    Kurth, Rudolph; Stark, M

    1976-01-01

    Elements of Analytical Dynamics deals with dynamics, which studies the relationship between motion of material bodies and the forces acting on them. This book is a compilation of lectures given by the author at the Georgia and Institute of Technology and formed a part of a course in Topological Dynamics. The book begins by discussing the notions of space and time and their basic properties. It then discusses the Hamilton-Jacobi theory and Hamilton's principle and first integrals. The text concludes with a discussion on Jacobi's geometric interpretation of conservative systems. This book will

  8. Analytical elements of mechanics

    CERN Document Server

    Kane, Thomas R

    2013-01-01

    Analytical Elements of Mechanics, Volume 1, is the first of two volumes intended for use in courses in classical mechanics. The books aim to provide students and teachers with a text consistent in content and format with the author's ideas regarding the subject matter and teaching of mechanics, and to disseminate these ideas. The book opens with a detailed exposition of vector algebra, and no prior knowledge of this subject is required. This is followed by a chapter on the topic of mass centers, which is presented as a logical extension of concepts introduced in connection with centroids. A

  9. [Healthcare marketing elements].

    Science.gov (United States)

    Ameri, Cinzia; Fiorini, Fulvio

    2014-01-01

    Marketing puts its foundation on a few key concepts: need-demand, product-service, satisfaction, exchange, market, or business structure manufacturing / supply. The combination of these elements allows you to build an effective marketing strategy. Crucial in this respect is to remember the Porter matrix, which shows that for a correct analysis of the relevant market is necessary to refer to the "five forces at play", ie: customers, competitors, new entrants and substitutes threat. Another key lever for proper marketing oriented approach is the continuous and constant monitoring of the application, anticipating their dissatisfactions.

  10. Elements of Architecture

    DEFF Research Database (Denmark)

    Elements of Architecture explores new ways of engaging architecture in archaeology. It conceives of architecture both as the physical evidence of past societies and as existing beyond the physical environment, considering how people in the past have not just dwelled in buildings but have existed...... and affective impacts, of these material remains. The contributions in this volume investigate the way time, performance and movement, both physically and emotionally, are central aspects of understanding architectural assemblages. It is a book about the constellations of people, places and things that emerge...

  11. Ring-laser gyroscope system using dispersive element(s)

    Science.gov (United States)

    Smith, David D. (Inventor)

    2010-01-01

    A ring-laser gyroscope system includes a ring-laser gyroscope (RLG) and at least one dispersive element optically coupled to the RLG's ring-shaped optical path. Each dispersive element has a resonant frequency that is approximately equal to the RLG's lasing frequency. A group index of refraction defined collectively by the dispersive element(s) has (i) a real portion that is greater than zero and less than one, and (ii) an imaginary portion that is less than zero.

  12. NIH Common Data Elements Repository

    Data.gov (United States)

    U.S. Department of Health & Human Services — The NIH Common Data Elements (CDE) Repository has been designed to provide access to structured human and machine-readable definitions of data elements that have...

  13. An efficient rectangular plate element

    Institute of Scientific and Technical Information of China (English)

    2001-01-01

    A new 12-parameter rectangular plate element is presented by useof the double set parameter method. The error in the energy norm is of order O(h2), one order higher than the commonly used Adini nonconforming element.

  14. Trace element emissions from coal

    Energy Technology Data Exchange (ETDEWEB)

    NONE

    2012-09-15

    Trace elements are emitted during coal combustion. The quantity, in general, depends on the physical and chemical properties of the element itself, the concentration of the element in the coal, the combustion conditions and the type of particulate control device used, and its collection efficiency as a function of particle size. Some trace elements become concentrated in certain particle streams following combustion such as bottom ash, fly ash, and flue gas particulate matter, while others do not. Various classification schemes have been developed to describe this partitioning behaviour. These classification schemes generally distinguish between: Class 1: elements that are approximately equally concentrated in the fly ash and bottom ash, or show little or no fine particle enrichment, examples include Mn, Be, Co and Cr; Class 2: elements that are enriched in the fly ash relative to bottom ash, or show increasing enrichment with decreasing particle size, examples include As, Cd, Pb and Sb; Class 3: elements which are emitted in the gas phase (primarily Hg (not discussed in this review), and in some cases, Se). Control of class 1 trace elements is directly related to control of total particulate matter emissions, while control of the class 2 elements depends on collection of fine particulates. Due to the variability in particulate control device efficiencies, emission rates of these elements can vary substantially. The volatility of class 3 elements means that particulate controls have only a limited impact on the emissions of these elements.

  15. REACTOR FUEL ELEMENTS TESTING CONTAINER

    Science.gov (United States)

    Whitham, G.K.; Smith, R.R.

    1963-01-15

    This patent shows a method for detecting leaks in jacketed fuel elements. The element is placed in a sealed tank within a nuclear reactor, and, while the reactor operates, the element is sparged with gas. The gas is then led outside the reactor and monitored for radioactive Xe or Kr. (AEC)

  16. ELEMENTAL FORMS OF HOSPITALITY

    Directory of Open Access Journals (Sweden)

    Maximiliano Emanuel Korstanje

    2010-11-01

    Full Text Available Modern studies emphasized on the needs of researching the hospitality as relevant aspects of tourism and hospitality fields. Anyway, these approaches are inextricably intertwined to the industry of tourism and do not take seriously the anthropological and sociological roots of hospitality. In fact, the hotel seems to be a partial sphere of hospitality at all. Under this context, the present paper explores the issue of hospitality enrooted in the political and economic indo-European principle of free-transit which is associated to a much broader origin.  Starting from the premise etymologically hostel and hospital share similar origins, we follow the contributions of J Derrida to determine the elements that formed the hospitality up to date.

  17. COLOR- SENSITIZED SOLAR ELEMENTS

    Directory of Open Access Journals (Sweden)

    Gish R. A.

    2016-05-01

    Full Text Available Photovoltaic devices are a promising solution to the energy crisis, because they generate electricity directly from sunlight, without producing CO2. While color-sensitized batteries are the most studied element, mainly due to its low cost and high efficiency solar energy conversion into electricity. Until recently, the color-sensitized solar cells performance was less than 1%, however, the use of titanium dioxide as the anode material have greatly raised their efficiency. The advantages of titanium dioxide is primarily in the low cost, but its use provides high light capture efficiency, with external quantum efficiency (efficiency incident photon - charge, usually in the range of 60-90% using nanocrystal forms in comparison with

  18. Ucla, escuela elemental

    Directory of Open Access Journals (Sweden)

    Neutra, Richard J.

    1962-03-01

    Full Text Available La Escuela Elemental de Preparación de la Universidad de California, en Los Angeles, está dedicada a la educación e investigación y preparación del profesorado de la infancia. Se ha construido en un paraje maravilloso, de frondosa vegetación, frente a un terreno bastante quebrado, circunstancia que presta mayor encanto al conjunto, construido con gran pericia y adaptación al paisaje a base de una dominante horizontalidad, con materiales sencillos (ladrillos, hierro y madera y gran comunicación con la naturaleza mediante grandes cristaleras correderas que ensanchan las clases y las suplementan hacia el jardín de acuerdo con las nuevas normas y prácticas docentes.

  19. The fantastic four.. elements

    Science.gov (United States)

    Marsili, Antonella; D'Addezio, Giuliana; Rubbia, Giuliana; Ramieri, Caterina; Todaro, Riccardo; Scipilliti, Francesca; Tosto, Eleonora

    2015-04-01

    With a "Sunday between territory and music to 'National Institute of Geophysics and Volcanology," October 12, 2014 the headquarters of INGV Roma kicked off the activities of the second edition of the Week of Planet Earth. The laboratory of scientific outreach and museum activities together with volunteers of the National Civil Service have organized the whole day dedicated to the dissemination of earth sciences, involving adults and children. Especially for primary school children a laboratory was made involving three amusing activities all aimed at inspiring respect for the Earth: a theatrical representation called "The Fantastic 4... elements", a behavioral game and a nursery rhyme reading. The theater as a means of communication of science is an innovative and creative way to introduce children to important scientific concepts. The use of this methodology and simple language favoring the emotional involvement of the child facilitating learning. The main character is a child, chosen to facilitate the identification of the spectators with the protagonist, that through a fantastic journey discovers the importance of the four elements of our planet: earth, fire, air and water. As a second step, volunteers involved children in reading a nursery rhyme "the ABC to become a Friend of the Earth" inviting them to protect and respect the environment and its resources. Finally, the behavioral game gave indications about behaviors to adopt to safeguard the planet. Volunteers introduced a billboard divided into two colors, green to indicate the right behaviors and red for the wrong ones. Each child, after reading a card with indication on the behavior to adopt, had to decide if they were correct or not with respect to the environment safeguard. After listening to the children's answer, the volunteer gave the correct explanation about the appropriate behavior to adopt. At the end of the activities, each child received a certificate as "a friend of Planet Earth".

  20. An element by element spectral element method for elastic wave modeling

    Institute of Scientific and Technical Information of China (English)

    LIN Weijun; WANG Xiuming; ZHANG Hailan

    2006-01-01

    The spectral element method which combines the advantages of spectral method with those of finite element method,provides an efficient tool in simulating elastic wave equation in complex medium. Based on weak form of elastodynamic equations, mathematical formulations for Legendre spectral element method are presented. The wave field on an element is discretized using high-order Lagrange interpolation, and integration over the element is accomplished based upon the Gauss-Lobatto-Legendre integration rule. This results in a diagonal mass matrix which leads to a greatly simplified algorithm. In addition, the element by element technique is introduced in our method to reduce the memory sizes and improve the computation efficiency. Finally, some numerical examples are presented to demonstrate the spectral accuracy and the efficiency. Because of combinations of the finite element scheme and spectral algorithms, this method can be used for complex models, including free surface boundaries and strong heterogeneity.

  1. Novel high-performance element in the electromagnetic finite-element method--node-edge element

    Institute of Scientific and Technical Information of China (English)

    Sheng Xinqing; Peng Zhen

    2008-01-01

    It is known in the computational electromagnetics (CEM) that the node element has a relative well-conditioned matrix,but suffers from the spurious solution problem; whereas the edge element has no spurious solutions,but usually produces an ill-conditioned matrix.Particularly,when the mesh is over dense,the iterative solution of the matrix equation from edge element converges very slowly.Based on the node element and edge element,a node-edge element is presented,which has no spurious solutions and better-conditioned matrix.Numerical experiments demonstrate that the proposed node-edge element is more efficient than now-widely used edge element.

  2. The Chemistry of Superheavy Elements

    CERN Document Server

    Schädel, M

    2003-01-01

    The chemistry of transactinide or superheavy elements has reached element 108. Preparations are under way to leap to element 112 and beyond. The current status of this atom-at-a-time chemical research and its future perspectives are reviewed from an experimental point of view together with some of the interesting results from n -rich nuclides near and at the N=162 neutron shell. Experimental techniques and important results enlightening typical chemical properties of elements 104 through 108 are presented in an exemplary way. From the results of these experiments it is justified to place these elements in the Periodic Table of the Elements in to groups 4 through 8, respectively. However, mainly due to the influence of relativistic effects, it is no longer possible to deduce detailed chemical properties of these superheavy elements simply from this position.

  3. Chemistry of the superheavy elements.

    Science.gov (United States)

    Schädel, Matthias

    2015-03-13

    The quest for superheavy elements (SHEs) is driven by the desire to find and explore one of the extreme limits of existence of matter. These elements exist solely due to their nuclear shell stabilization. All 15 presently 'known' SHEs (11 are officially 'discovered' and named) up to element 118 are short-lived and are man-made atom-at-a-time in heavy ion induced nuclear reactions. They are identical to the transactinide elements located in the seventh period of the periodic table beginning with rutherfordium (element 104), dubnium (element 105) and seaborgium (element 106) in groups 4, 5 and 6, respectively. Their chemical properties are often surprising and unexpected from simple extrapolations. After hassium (element 108), chemistry has now reached copernicium (element 112) and flerovium (element 114). For the later ones, the focus is on questions of their metallic or possibly noble gas-like character originating from interplay of most pronounced relativistic effects and electron-shell effects. SHEs provide unique opportunities to get insights into the influence of strong relativistic effects on the atomic electrons and to probe 'relativistically' influenced chemical properties and the architecture of the periodic table at its farthest reach. In addition, they establish a test bench to challenge the validity and predictive power of modern fully relativistic quantum chemical models.

  4. Vesta's Elemental Composition

    Science.gov (United States)

    Prettyman, T. H.; Beck, A. W.; Feldman, W. C.; Lawrence, D. J.; McCoy, T. J.; McSween, H. Y.; Mittlefehldt, D. W.; Peplowski, P. N.; Raymond, C. A.; Reedy, R. C.; Russell, C. T.; Titus, T. N.; Toplis, M. J.; Yamashita, N.

    2014-01-01

    Many lines of evidence (e.g. common geochemistry, chronology, O-isotope trends, and the presence of different HED rock types in polymict breccias) indicate that the howardite, eucrite, and diogenite (HED) meteorites originated from a single parent body. Meteorite studies show that this protoplanet underwent igneous differentiation to form a metallic core, an ultramafic mantle, and a basaltic crust. A spectroscopic match between the HEDs and 4 Vesta along with a plausible mechanism for their transfer to Earth, perhaps as chips off V-type asteroids ejected from Vesta's southern impact basin, supports the consensus view that many of these achondritic meteorites are samples of Vesta's crust and upper mantle. The HED-Vesta connection was put to the test by the NASA Dawn mission, which spent a year in close proximity to Vesta. Measurements by Dawn's three instruments, redundant Framing Cameras (FC), a Visible-InfraRed (VIR) spectrometer, and a Gamma Ray and Neutron Detector (GRaND), along with radio science have strengthened the link. Gravity measurements by Dawn are consistent with a differentiated, silicate body, with a dense Fe-rich core. The range of pyroxene compositions determined by VIR overlaps that of the howardites. Elemental abundances determined by nuclear spectroscopy are also consistent with HED-compositions. Observations by GRaND provided a new view of Vesta inaccessible by telescopic observations. Here, we summarize the results of Dawn's geochemical investigation of Vesta and their implications.

  5. EAF optimal managing elements

    Science.gov (United States)

    Ioana, A.; Constantin, N.; Dragna, E. C.

    2017-01-01

    Electric Arc Furnaces (EAF) is an important and complex aggregate. We present elements of EAF operating efficiency. The reliability of the EAF is mainly determined by electric circuit reliability and especially of the transformator of the furnace. This due to the fact that, in an electric steel plant, the objective „24 tapping/day” involves. Due to the complexity of the process, the EAF operation needs a computer usage and, in his componence, it must have two independent calculation units (UC1) and (UC2). Based on these two input sets (Σi1) and ((Σi2), the calculation unit (UC1) builds the general operation procedure based on mathematical methods. For that purpose, there are used the results of the 5 mathematical methods: the mathematical model to write-off the function objective (M.F.O.); the mathematical model of calculating the charge (M.C.C.); the mathematical model of conducting the effective melt (M.C.M.); the mathematical model of reheating the charge (M.R.C.); the mathematical model of blasting the reactive dusts (M.B.R.D.).

  6. EDGE-ORIENTED HEXAGONAL ELEMENTS

    Institute of Scientific and Technical Information of China (English)

    Chao Yang; Jiachang Sun

    2007-01-01

    In this paper, two new nonconforming hexagonal elements are presented, which are based on the trilinear function space Q(3)1 and are edge-oriented, analogical to the case of the rotated Q1 quadrilateral element. A priori error estimates are given to show that the new elements achieve first-order accuracy in the energy norm and second-order accuracy in the L2 norm. This theoretical result is confirmed by the numerical tests.

  7. Matrix elements of unstable states

    CERN Document Server

    Bernard, V; Meißner, U -G; Rusetsky, A

    2012-01-01

    Using the language of non-relativistic effective Lagrangians, we formulate a systematic framework for the calculation of resonance matrix elements in lattice QCD. The generalization of the L\\"uscher-Lellouch formula for these matrix elements is derived. We further discuss in detail the procedure of the analytic continuation of the resonance matrix elements into the complex energy plane and investigate the infinite-volume limit.

  8. Photoshop Elements 10 For Dummies

    CERN Document Server

    Obermeier, Barbara

    2011-01-01

    Perfect your photos and images with this "focused" guide to the latest version of Photoshop Elements For most of us, the professional-level Photoshop is overkill for our needs. Amateur photographers and photo enthusiasts turn to Photoshop Elements for a powerful but simpler way to edit and retouch their snapshots. Photoshop Elements 10 For Dummies, fully updated and revised for the latest release of this software product, helps you navigate Elements to create, edit, fix, share, and organize the high-quality images you desire. Full color pages bring the techniques to life and make taking great

  9. Gamification Elements for Learning Applications

    Directory of Open Access Journals (Sweden)

    Firas Layth Khaleel

    2016-12-01

    Full Text Available Gamification technique is getting popular to be implemented in learning or training application. It is referred to the use of game elements or game thinking in a non-game context in order to increase engagement between students and learning application. Since there are many elements of games that are identified from previous works, this study focuses on game elements from Gamification technique that positively affect learning when applied to a learning application. Therefore, the objectives of this research are to identify game elements that can be gamified in a learning application; and to verify those elements by multiple users (gamers, students, and experts. Suitable game elements are identified through literature reviews. Two approaches are used to verify these elements; interview experts and administer a survey to gamers and students. The finding of this study suggests the use of a group of game elements with three aims, (1 increase the level of fun and entertainment; (2 motivate students to challenge each other; and (3 improve gaming and learning skills. In a further study, these elements will be implemented in a learning application and its effectiveness shall be tested.

  10. Clean Elements in Abelian Rings

    Indian Academy of Sciences (India)

    Angelina Y M Chin

    2009-04-01

    Let be a ring with identity. An element in is said to be clean if it is the sum of a unit and an idempotent. is said to be clean if all of its elements are clean. If every idempotent in is central, then is said to be abelian. In this paper we obtain some conditions equivalent to being clean in an abelian ring.

  11. Repetitive elements in parasitic protozoa

    Directory of Open Access Journals (Sweden)

    Clayton Christine

    2010-05-01

    Full Text Available Abstract A recent paper published in BMC Genomics suggests that retrotransposition may be active in the human gut parasite Entamoeba histolytica. This adds to our knowledge of the various types of repetitive elements in parasitic protists and the potential influence of such elements on pathogenicity. See research article http://www.biomedcentral.com/1471-2164/11/321

  12. SNTP program fuel element design

    Science.gov (United States)

    Walton, Lewis A.; Ales, Matthew W.

    1993-06-01

    The SNTP program is evaluating the feasibility of utilizing a particle bed reactor to develop a high-performance nuclear thermal rocket engine. The optimum fuel element arrangement depends on the power level desired and the intended application. The key components of the fuel element have been developed and are being tested.

  13. RESEARCH METHODS OF LOCATIVE ELEMENT

    Directory of Open Access Journals (Sweden)

    SULAYMANOVA N.J.

    2012-01-01

    Full Text Available The article is devoted to the methods of investigation of locative elements. Sentence analysis with locative elements is taken according to the results of component analysis in the system of contradicting – opposition. More over the article is full of examples related to the description of various syntactic units.

  14. Single element hydrogen sensing material

    NARCIS (Netherlands)

    Dam, B.; Boelsma, C.

    2015-01-01

    The present invention relates to a single element thin-film device, to a method for producing a thin-film device, to a single element for detecting hydrogen absorption, to a hydrogen sensor, to an apparatus for detecting hydrogen and to an electro-magnetic transformer comprising said sensor. A thin-

  15. Solution of Finite Element Equations

    DEFF Research Database (Denmark)

    Krenk, Steen

    An important step in solving any problem by the finite element method is the solution of the global equations. Numerical solution of linear equations is a subject covered in most courses in numerical analysis. However, the equations encountered in most finite element applications have some special...

  16. Chemical experiments with superheavy elements.

    Science.gov (United States)

    Türler, Andreas

    2010-01-01

    Unnoticed by many chemists, the Periodic Table of the Elements has been extended significantly in the last couple of years and the 7th period has very recently been completed with eka-Rn (element 118) currently being the heaviest element whose synthesis has been reported. These 'superheavy' elements (also called transactinides with atomic number > or = 104 (Rf)) have been artificially synthesized in fusion reactions at accelerators in minute quantities of a few single atoms. In addition, all isotopes of the transactinide elements are radioactive and decay with rather short half-lives. Nevertheless, it has been possible in some cases to investigate experimentally chemical properties of transactinide elements and even synthesize simple compounds. The experimental investigation of superheavy elements is especially intriguing, since theoretical calculations predict significant deviations from periodic trends due to the influence of strong relativistic effects. In this contribution first experiments with hassium (Hs, atomic number 108), copernicium (Cn, atomic number 112) and element 114 (eka-Pb) are reviewed.

  17. Massively Parallel Finite Element Programming

    KAUST Repository

    Heister, Timo

    2010-01-01

    Today\\'s large finite element simulations require parallel algorithms to scale on clusters with thousands or tens of thousands of processor cores. We present data structures and algorithms to take advantage of the power of high performance computers in generic finite element codes. Existing generic finite element libraries often restrict the parallelization to parallel linear algebra routines. This is a limiting factor when solving on more than a few hundreds of cores. We describe routines for distributed storage of all major components coupled with efficient, scalable algorithms. We give an overview of our effort to enable the modern and generic finite element library deal.II to take advantage of the power of large clusters. In particular, we describe the construction of a distributed mesh and develop algorithms to fully parallelize the finite element calculation. Numerical results demonstrate good scalability. © 2010 Springer-Verlag.

  18. Chemical elements distribution in cells

    Science.gov (United States)

    Ortega, R.

    2005-04-01

    Analysing, imaging and understanding the cellular chemistry, from macromolecules to monoatomic elements, is probably a major challenge for the scientific community after the conclusion of the genome project. In order to probe the distribution of elements in cells, especially the so-called inorganic elements, it is necessary to apply microanalytical techniques with sub-micrometer resolution and high chemical sensitivity. This paper presents the current status of chemical element imaging inside cells, and a comparison of the different analytical techniques available: nuclear microprobe, electron microprobe and electron energy loss spectroscopy, synchrotron radiation microprobe, secondary ion mass spectrometry and fluorescence microscopy methods. Examples of intracellular chemical elements distributions relevant to cancer pharmacology, medical imaging, metal carcinogenesis and neuropathology studies obtained by nuclear microprobe and other microanalytical techniques are presented.

  19. Second order tensor finite element

    Science.gov (United States)

    Oden, J. Tinsley; Fly, J.; Berry, C.; Tworzydlo, W.; Vadaketh, S.; Bass, J.

    1990-01-01

    The results of a research and software development effort are presented for the finite element modeling of the static and dynamic behavior of anisotropic materials, with emphasis on single crystal alloys. Various versions of two dimensional and three dimensional hybrid finite elements were implemented and compared with displacement-based elements. Both static and dynamic cases are considered. The hybrid elements developed in the project were incorporated into the SPAR finite element code. In an extension of the first phase of the project, optimization of experimental tests for anisotropic materials was addressed. In particular, the problem of calculating material properties from tensile tests and of calculating stresses from strain measurements were considered. For both cases, numerical procedures and software for the optimization of strain gauge and material axes orientation were developed.

  20. Kriging-Based Finite Element Method: Element-By-Element Kriging Interpolation

    Directory of Open Access Journals (Sweden)

    W. Kanok-Nukulchai

    2009-01-01

    Full Text Available An enhancement of the finite element method with Kriging shape functions (K-FEM was recently proposed. In this method, the field variables of a boundary value problem are approximated using ‘element-by-element’ piecewise Kriging interpolation (el-KI. For each element, the interpolation function is constructed from a set of nodes within a prescribed domain of influence comprising the element and its several layers of neighbouring elements. This paper presents a numerical study on the accuracy and convergence of the el-KI in function fitting problems. Several examples of functions in two-dimensional space are employed in this study. The results show that very accurate function fittings and excellent convergence can be attained by the el-KI.

  1. Imaging techniques for elements and element species in plant science.

    Science.gov (United States)

    Wu, Bei; Becker, J Sabine

    2012-05-01

    Revealing the uptake, transport, localization and speciation of both essential and toxic elements in plants is important for understanding plant homeostasis and metabolism, subsequently, providing information for food and nutrient studies, agriculture activities, as well as environmental research. In the last decade, emerging techniques for elemental imaging and speciation analysis allowed us to obtain increasing knowledge of elemental distribution and availabilities in plants. Chemical imaging techniques include mass spectrometric methods such as secondary ionization mass spectrometry (SIMS), laser ablation inductively coupled plasma mass spectrometry (LA-ICP-MS) and synchrotron-based techniques such as X-ray fluorescence spectroscopy (SRXRF), and so forth. On the other hand, X-ray absorption spectroscopy (XAS) based on synchrotron radiation is capable of in situ investigation of local atomic structure around the central element of interest. This technique can also be operated in tandem with SRXRF to image each element species of interest within plant tissue. In this review, the principles and state-of-the-art of these techniques regarding sample preparation, advantages and limitations, and improvement of sensitivity and spatial resolution are discussed. New results with respect to elemental distribution and speciation in plants revealed by these techniques are presented.

  2. Transposable elements: The enemies within.

    Science.gov (United States)

    Scarfò, Irene; Pellegrino, Elisa; Mereu, Elisabetta; Inghirami, Giorgio; Piva, Roberto

    2016-10-01

    Understanding transformation mechanisms other than genetic aberrations has recently captured the attention of cancer researchers. To date, the role of transposable elements (TEs) in tumor development remains largely undefined. However, an increasing number of studies have reported that loss of epigenetic control causes TE reactivation and consequent oncogenic transcription. Here, we discuss principal examples of TEs-driven oncogenesis. Available data suggest that long terminal repeats and long interspersed nuclear elements play a pivotal role as alternative promoters. These findings provide definitive experimental evidence that repetitive elements are a powerful underestimated force toward oncogenesis and open the possibility to new therapeutic treatments.

  3. Matrix Elements for Hylleraas CI

    Science.gov (United States)

    Harris, Frank E.

    The limitation to at most a single interelectron distance in individual configurations of a Hylleraas-type multiconfiguration wave function restricts significantly the types of integrals occurring in matrix elements for energy calculations, but even then if the formulation is not handled efficiently the angular parts of these integrals escalate to create expressions of great complexity. This presentation reviews ways in which the angular-momentum calculus can be employed to systematize and simplify the matrix element formulas, particularly those for the kinetic-energy matrix elements.

  4. quadratic spline finite element method

    Directory of Open Access Journals (Sweden)

    A. R. Bahadir

    2002-01-01

    Full Text Available The problem of heat transfer in a Positive Temperature Coefficient (PTC thermistor, which may form one element of an electric circuit, is solved numerically by a finite element method. The approach used is based on Galerkin finite element using quadratic splines as shape functions. The resulting system of ordinary differential equations is solved by the finite difference method. Comparison is made with numerical and analytical solutions and the accuracy of the computed solutions indicates that the method is well suited for the solution of the PTC thermistor problem.

  5. Finite element computational fluid mechanics

    Science.gov (United States)

    Baker, A. J.

    1983-01-01

    Finite element analysis as applied to the broad spectrum of computational fluid mechanics is analyzed. The finite element solution methodology is derived, developed, and applied directly to the differential equation systems governing classes of problems in fluid mechanics. The heat conduction equation is used to reveal the essence and elegance of finite element theory, including higher order accuracy and convergence. The algorithm is extended to the pervasive nonlinearity of the Navier-Stokes equations. A specific fluid mechanics problem class is analyzed with an even mix of theory and applications, including turbulence closure and the solution of turbulent flows.

  6. Sensing Device with Whisker Elements

    Science.gov (United States)

    Hartmann, Mitra J. (Inventor); Solomon, Joseph H. (Inventor)

    2013-01-01

    A sensing device includes an elongated whisker element having a flexible cantilever region and a base region where a change in moment or curvature is generated by bending of the cantilever region when it contacts an object. One or more sensor elements cooperatively associated with the whisker element provide one or more output signals that is/are representative of two orthogonal components of change in moment or curvature at the whisker base region to permit determination of object distance, fluid velocity profile, or object contour (shape) with accounting for lateral slip of the whisker element and frictional characteristics of the object. Multiple sensing devices can be arranged in arrays in a manner to sense object contour without or with adjustment for lateral slip.

  7. An efficient rectangular plate element

    Institute of Scientific and Technical Information of China (English)

    SHI; Zhongci

    2001-01-01

    [1]Shi Zhong-ci, On the accuracy of the quasi-conforming and generalize conforming finite elements, Chin. Ann. Math., 1990, 11B: 148.[2]Shi Zhong-ci, Chen Shao-chun, Huang Hong-ci, Plate elements with high accuracy, Collec. Geom. Anal. Math. Phys. (ed. Li Ta-Tsien), Singapore: World Scientific, 1997, 155—164.[3]Chen Shao-chun, Shi Zhong-ci, Double set parameter method for the construction of the element stiffness matrix, Mathematica Numerica Sinica (in Chinese), 1991, 13: 286.[4]Ciarlet, P., The Finite Element Method for Elliptic Problems, Amsterdam: North-Holland, 1978.

  8. Finite element methods for engineers

    CERN Document Server

    Fenner, Roger T

    2013-01-01

    This book is intended as a textbook providing a deliberately simple introduction to finite element methods in a way that should be readily understandable to engineers, both students and practising professionals. Only the very simplest elements are considered, mainly two dimensional three-noded “constant strain triangles”, with simple linear variation of the relevant variables. Chapters of the book deal with structural problems (beams), classification of a broad range of engineering into harmonic and biharmonic types, finite element analysis of harmonic problems, and finite element analysis of biharmonic problems (plane stress and plane strain). Full Fortran programs are listed and explained in detail, and a range of practical problems solved in the text. Despite being somewhat unfashionable for general programming purposes, the Fortran language remains very widely used in engineering. The programs listed, which were originally developed for use on mainframe computers, have been thoroughly updated for use ...

  9. Alu elements and hominid phylogenetics

    Science.gov (United States)

    Salem, Abdel-Halim; Ray, David A.; Xing, Jinchuan; Callinan, Pauline A.; Myers, Jeremy S.; Hedges, Dale J.; Garber, Randall K.; Witherspoon, David J.; Jorde, Lynn B.; Batzer, Mark A.

    2003-01-01

    Alu elements have inserted in primate genomes throughout the evolution of the order. One particular Alu lineage (Ye) began amplifying relatively early in hominid evolution and continued propagating at a low level as many of its members are found in a variety of hominid genomes. This study represents the first conclusive application of short interspersed elements, which are considered nearly homoplasy-free, to elucidate the phylogeny of hominids. Phylogenetic analysis of Alu Ye5 elements and elements from several other subfamilies reveals high levels of support for monophyly of Hominidae, tribe Hominini and subtribe Hominina. Here we present the strongest evidence reported to date for a sister relationship between humans and chimpanzees while clearly distinguishing the chimpanzee and human lineages. PMID:14561894

  10. Naturalistic Elements in The Egg

    Institute of Scientific and Technical Information of China (English)

    惠菲菲

    2013-01-01

    The purpose of the study is to analyze the naturalistic elements in The Egg, which is taken from the collection of short stories, The Triumph of the Egg. The study states the ideology and technique of naturalism and then exams how naturalistic ele-ments are revealed in the fiction. Then it comes to the conclusion that the family is defeated by the egg and the life of human be-ings is under control of complicated forces from both inside and outside.

  11. Elements of EAF automation processes

    Science.gov (United States)

    Ioana, A.; Constantin, N.; Dragna, E. C.

    2017-01-01

    Our article presents elements of Electric Arc Furnace (EAF) automation. So, we present and analyze detailed two automation schemes: the scheme of electrical EAF automation system; the scheme of thermic EAF automation system. The application results of these scheme of automation consists in: the sensitive reduction of specific consummation of electrical energy of Electric Arc Furnace, increasing the productivity of Electric Arc Furnace, increase the quality of the developed steel, increasing the durability of the building elements of Electric Arc Furnace.

  12. PROPOSAL OF NEW OPTICAL ELEMENTS

    Directory of Open Access Journals (Sweden)

    Goce Chadzitaskos

    2013-10-01

    Full Text Available A overview of our patented proposals of new optical elements is presented. The elements are suitable for laser pulse analysis, telescopy, X-ray microscopy and X-ray telescopy. They are based on the interference properties of light: a special grating for a double slit pattern, parabolic strip imaging for a telescope, and Bragg’s condition for X-ray scattering on a slice of a single crystal for X-raymicroscopy and X-ray telescopy.

  13. Programming the finite element method

    CERN Document Server

    Smith, I M; Margetts, L

    2013-01-01

    Many students, engineers, scientists and researchers have benefited from the practical, programming-oriented style of the previous editions of Programming the Finite Element Method, learning how to develop computer programs to solve specific engineering problems using the finite element method. This new fifth edition offers timely revisions that include programs and subroutine libraries fully updated to Fortran 2003, which are freely available online, and provides updated material on advances in parallel computing, thermal stress analysis, plasticity return algorithms, convection boundary c

  14. [Unusual elements in renal calculi].

    Science.gov (United States)

    Rodríguez-Miñón Cifuentes, J L; Salvador, E; Traba Villameytide, M L

    2006-01-01

    A group of 54 renal calculi were spontaneously passed renal stone after a nephritic colic. Two groups of calculi were found: papillary and non-papillary calculi. All calculi were analyzed by infrared spectroscopy and electronic microscopy scan (EMS) and EDAX. When the stones were analyzed with EDAX, elements such as C, N, O, Na, S, Mg, Al, Si, Cl, K, Ca, Mn, Fe, Ni, Zn were detected. The possible origin of these elements is discussed in this work.

  15. Nuclear chemistry of transactinide elements

    Energy Technology Data Exchange (ETDEWEB)

    Nagame, Yuichiro [Japan Atomic Energy Research Inst., Tokai, Ibaraki (Japan). Tokai Research Establishment

    1997-07-01

    The current status on the nuclear chemistry studies of transactinide elements is reviewed. The production of transactinides in heavy ion reactions is briefly discussed, and nuclear properties on the stability of transactinides are presented. Chemical properties of the trans-actinide elements 104, 105 and 106, and a typical experimental technique used to study these properties on an atom-at-a-time base are introduced. (author)

  16. Spectral element simulation of ultrafiltration

    DEFF Research Database (Denmark)

    Hansen, M.; Barker, Vincent A.; Hassager, Ole

    1998-01-01

    A spectral element method for simulating stationary 2-D ultrafiltration is presented. The mathematical model is comprised of the Navier-Stokes equations for the velocity field of the fluid and a transport equation for the concentration of the solute. In addition to the presence of the velocity...... vector in the transport equation, the system is coupled by the dependency of the fluid viscosity on the solute concentration and by a concentration-dependent boundary condition for the Navier-Stokes equations at the membrane surface. The spectral element discretization yields a nonlinear algebraic system....... The performance of the spectral element code when applied to several ultrafiltration problems is reported. (C) 1998 Elsevier Science Ltd. All rights reserved....

  17. Element-Based Computational Model

    Directory of Open Access Journals (Sweden)

    Conrad Mueller

    2012-02-01

    Full Text Available A variation on the data-flow model is proposed to use for developing parallel architectures. While the model is a data driven model it has significant differences to the data-flow model. The proposed model has an evaluation cycleof processing elements (encapsulated data that is similar to the instruction cycle of the von Neumann model. The elements contain the information required to process them. The model is inherently parallel. An emulation of the model has been implemented. The objective of this paper is to motivate support for taking the research further. Using matrix multiplication as a case study, the element/data-flow based model is compared with the instruction-based model. This is done using complexity analysis followed by empirical testing to verify this analysis. The positive results are given as motivation for the research to be taken to the next stage - that is, implementing the model using FPGAs.

  18. Physical model of Nernst element

    Energy Technology Data Exchange (ETDEWEB)

    Nakamura, Hiroaki [Venture Business Lab., Nagoya Univ., Nagoya (Japan); Ikeda, Kazuaki; Yamaguchi, Satarou

    1998-08-01

    Generation of electric power by the Nernst effect is a new application of a semiconductor. A key point of this proposal is to find materials with a high thermomagnetic figure-of-merit, which are called Nernst elements. In order to find candidates of the Nernst element, a physical model to describe its transport phenomena is needed. As the first model, we began with a parabolic two-band model in classical statistics. According to this model, we selected InSb as candidates of the Nernst element and measured their transport coefficients in magnetic fields up to 4 Tesla within a temperature region from 270 K to 330 K. In this region, we calculated transport coefficients numerically by our physical model. For InSb, experimental data are coincident with theoretical values in strong magnetic field. (author)

  19. Mechanical Analogies of Fractional Elements

    Institute of Scientific and Technical Information of China (English)

    HU Kai-Xin; ZHU Ke-Qin

    2009-01-01

    A Fractional element model describes a special kind of viscoelastic material.Its stress is proportional to the fractional-order derivative of strain. Physically the mechanical analogies of fractional elements can be represented by spring-dashpot fractal networks. We introduce a constitutive operator in the constitutive equations of viscoelastic materials.To derive constitutive operators for spring-dashpot fractal networks, we use Heaviside operational calculus, which provides explicit answers not otherwise obtainable simply.Then the series-parallel formulas for the constitutive operator are derived. Using these formulas, a constitutive equation of fractional element with 1/2-order derivative is obtained.Finally we find the way to derive the constitutive equations with other fractional-order derivatives and their mechanical analogies.

  20. SUPERCONVERGENCE ANALYSIS FOR CUBIC TRIANGULAR ELEMENT OF THE FINITE ELEMENT

    Institute of Scientific and Technical Information of China (English)

    Qi-ding Zhu

    2000-01-01

    In this paper, we construct a projection interpolation for cubic triangular ele- ment by using othogonal expansion triangular method. We show two fundamental formulas of estimation on a special partion and obtain a superconvergence result of 1 -e order higher for the placement function and its tangential derivative on the third order Lobatto points and Gauss points on each edge of triangular element.

  1. Fractal elements and their applications

    CERN Document Server

    Gil’mutdinov, Anis Kharisovich; El-Khazali, Reyad

    2017-01-01

    This book describes a new type of passive electronic components, called fractal elements, from a theoretical and practical point of view. The authors discuss in detail the physical implementation and design of fractal devices for application in fractional-order signal processing and systems. The concepts of fractals and fractal signals are explained, as well as the fundamentals of fractional calculus. Several implementations of fractional impedances are discussed, along with comparison of their performance characteristics. Details of design, schematics, fundamental techniques and implementation of RC-based fractal elements are provided. .

  2. Transposable elements and circular DNAs

    KAUST Repository

    Mourier, Tobias

    2016-09-26

    Circular DNAs are extra-chromosomal fragments that become circularized by genomic recombination events. We have recently shown that yeast LTR elements generate circular DNAs through recombination events between their flanking long terminal repeats (LTRs). Similarly, circular DNAs can be generated by recombination between LTRs residing at different genomic loci, in which case the circular DNA will contain the intervening sequence. In yeast, this can result in gene copy number variations when circles contain genes and origins of replication. Here, I speculate on the potential and implications of circular DNAs generated through recombination between human transposable elements.

  3. Finite elements of nonlinear continua

    CERN Document Server

    Oden, J T

    2000-01-01

    Geared toward undergraduate and graduate students, this text extends applications of the finite element method from linear problems in elastic structures to a broad class of practical, nonlinear problems in continuum mechanics. It treats both theory and applications from a general and unifying point of view.The text reviews the thermomechanical principles of continuous media and the properties of the finite element method, and then brings them together to produce discrete physical models of nonlinear continua. The mathematical properties of these models are analyzed, along with the numerical s

  4. Organic chemistry of elemental phosphorus

    Energy Technology Data Exchange (ETDEWEB)

    Milyukov, V A; Budnikova, Yulia H; Sinyashin, Oleg G [A.E. Arbuzov Institute of Organic and Physical Chemistry, Kazan Scientific Centre of the Russian Academy of Sciences, Kazan (Russian Federation)

    2005-09-30

    The principal achievements and the modern trends in the development of the chemistry of elemental phosphorus are analysed, described systematically and generalised. The possibilities and advantages of the preparation of organophosphorus compounds directly from white phosphorus are demonstrated. Attention is focused on the activation and transformation of elemental phosphorus in the coordination sphere of transition metal complexes. The mechanisms of the reactions of white phosphorus with nucleophilic and electrophilic reagents are discussed. Electrochemical approaches to the synthesis of organic phosphorus derivatives based on white phosphorus are considered.

  5. FINITE ELEMENT ANALYSIS OF STRUCTURES

    Directory of Open Access Journals (Sweden)

    PECINGINA OLIMPIA-MIOARA

    2015-05-01

    Full Text Available The application of finite element method is analytical when solutions can not be applied for deeper study analyzes static, dynamic or other types of requirements in different points of the structures .In practice it is necessary to know the behavior of the structure or certain parts components of the machine under the influence of certain factors static and dynamic . The application of finite element in the optimization of components leads to economic growth , to increase reliability and durability organs studied, thus the machine itself.

  6. Elements of spatial data quality

    CERN Document Server

    Guptill, SC

    1995-01-01

    Elements of Spatial Data Quality outlines the need and suggests potential categories for the content of a comprehensive statement of data quality that must be imbedded in the metadata that accompanies the transfer of a digital spatial data file or is available in a separate metadata catalog. Members of the International Cartographic Association's Commission on Spatial Data Quality have identified seven elements of data quality: positional accuracy, attribute accuracy, completeness, logical consistency, lineage, semantic accuracy and temporal information. In the book the authors describe: compo

  7. A high temperature fuel element

    Energy Technology Data Exchange (ETDEWEB)

    Sekido, A.; Nakai, M.; Ninomiya, Y.

    1982-12-21

    A solid electrolyte which conducts electricity with heating by oxygen ions and operates at a temperature of 1,000C is used in the element. The cathode, besides the ionic conductivity in oxygen, has an electron conductivity. The anode has electron conductivity. Substances such as Bi203, into which oxides of alkaline earth metals are added, are used for making the cathode. The electrolyte consists of ZrO2 and Y2O3, to which CaO is added. WC, to which an H2 type fuel is fed, serves as the anode. The element has a long service life.

  8. A 3D pyramid spline element

    Institute of Scientific and Technical Information of China (English)

    Juan Chen; Chong-Jun Li; Wan-Ji Chen

    2011-01-01

    In this paper,a 13-node pyramid spline element is derived by using the tetrahedron volume coordinates and the B-net method,which achieves the second order completeness in Cartesian coordinates.Some appropriate examples were employed to evaluate the performance of the proposed element.The numerical results show that the spline element has much better performance compared with the isoparametric serendipity element Q20 and its degenerate pyramid element P13 especially when mesh is distorted,and it is comparable to the Lagrange element Q27.It has been demonstrated that the spline finite element method is an efficient tool for developing high accuracy elements.

  9. Nuclear fuel elements design, fabrication and performance

    CERN Document Server

    Frost, Brian R T

    1982-01-01

    Nuclear Fuel Elements: Design, Fabrication and Performance is concerned with the design, fabrication, and performance of nuclear fuel elements, with emphasis on fast reactor fuel elements. Topics range from fuel types and the irradiation behavior of fuels to cladding and duct materials, fuel element design and modeling, fuel element performance testing and qualification, and the performance of water reactor fuels. Fast reactor fuel elements, research and test reactor fuel elements, and unconventional fuel elements are also covered. This volume consists of 12 chapters and begins with an overvie

  10. Backfire antennas with dipole elements

    DEFF Research Database (Denmark)

    Nielsen, Erik Dragø; Pontoppidan, Knud

    1970-01-01

    A method is set up for a theoretical investigation of arbitrary backfire antennas based upon dipole structures. The mutual impedance between the dipole elements of the antenna is taken into account, and the field radiated due to a surface wave reflector of finite extent is determined by calculating...

  11. Actinomycete integrative and conjugative elements

    NARCIS (Netherlands)

    Poele, Evelien M. te; Bolhuis, Henk; Dijkhuizen, Lubbert

    2008-01-01

    This paper reviews current knowledge on actinomycete integrative and conjugative elements (AICEs). The best characterised AICEs, pSAM2 of Streptomyces ambofaciens (10.9 kb), SLP1 (17.3 kb) of Streptomyces coelicolor and pMEA300 of Amycolatopsis methanolica (13.3 kb), are present as integrative eleme

  12. Evidence for primordial superheavy elements

    Energy Technology Data Exchange (ETDEWEB)

    Gentry, R.V.; Cahill, T.A.; Fletcher, N.R.; Kaufmann, H.C.; Medsker, L.R.; Nelson, J.W.; Flocchini, R.G.

    1976-07-05

    Microscopic crystalline monazite inclusions showing giant halo formation in biotite mica have been analyzed by the method of proton-induced x-ray emission. The observed x-ray energy spectra are best explained by the presence of a number of superheavy elements. (AIP)

  13. Environmental research on actinide elements

    Energy Technology Data Exchange (ETDEWEB)

    Pinder, J.E. III; Alberts, J.J.; McLeod, K.W.; Schreckhise, R.G. (eds.)

    1987-08-01

    The papers synthesize the results of research sponsored by DOE's Office of Health and Environmental Research on the behavior of transuranic and actinide elements in the environment. Separate abstracts have been prepared for the 21 individual papers. (ACR)

  14. On Gothic Elements in Beloved

    Institute of Scientific and Technical Information of China (English)

    任欢

    2016-01-01

    Toni Morrison,a well-known female writer,won Nobel Prize for literature in 1993.Beloved,her fifth novel,wins great popu-larity among readers and it is famous for adopting gothic genre to represent black people’s trauma and deal with it.This paper aims at analy-zing the gothic elements demonstrated in this novel.

  15. Gothic Elements in Folding Beijing

    Institute of Scientific and Technical Information of China (English)

    Hua Yan

    2016-01-01

    The study claims that Folding Beijing can not only be read as science fiction but also as Gothic literature,in which perspective,Gothic Elements such as Gothic Setting, Gothic Wanderer and Transgressions,and Gothic Terror are discussed respectively.

  16. Dynamic and Transient Infinite Elements

    CERN Document Server

    Zhao, Chongbin

    2009-01-01

    Intends to provide the theory and the application of dynamic and transient infinite elements for simulating the far fields of infinite domains involved in many of scientific and engineering problems, based on the author's own work over the years. This title is suitable for computational geoscientists, geotechnical engineers, and civil engineers.

  17. Elements of a Spatial Web

    DEFF Research Database (Denmark)

    Jensen, Christian S.

    2010-01-01

    and are relevant to a text argument. An important element in enabling such queries is to be able to rank spatial web objects. Another is to be able to determine the relevance of an object to a query. Yet another is to enable the efficient processing of such queries. The talk covers recent results on spatial web...

  18. Compact Fuel Element Environment Test

    Science.gov (United States)

    Bradley, D. E.; Mireles, O. R.; Hickman, R. R.; Broadway, J. W.

    2012-01-01

    Deep space missions with large payloads require high specific impulse (I(sub sp)) and relatively high thrust to achieve mission goals in reasonable time frames. Conventional, storable propellants produce average I(sub sp). Nuclear thermal rockets (NTRs) capable of high I(sub sp) thrust have been proposed. NTR employs heat produced by fission reaction to heat and therefore accelerate hydrogen, which is then forced through a rocket nozzle providing thrust. Fuel element temperatures are very high (up to 3,000 K) and hydrogen is highly reactive with most materials at high temperatures. Data covering the effects of high-temperature hydrogen exposure on fuel elements are limited. The primary concern is the mechanical failure of fuel elements that employ high melting point metals, ceramics, or a combination (cermet) as a structural matrix into which the nuclear fuel is distributed. It is not necessary to include fissile material in test samples intended to explore high-temperature hydrogen exposure of the structural support matrices. A small-scale test bed designed to heat fuel element samples via noncontact radio frequency heating and expose samples to hydrogen for typical mission durations has been developed to assist in optimal material and manufacturing process selection without employing fissile material. This Technical Memorandum details the test bed design and results of testing conducted to date.

  19. High performance rolling element bearing

    Science.gov (United States)

    Bursey, Jr., Roger W. (Inventor); Olinger, Jr., John B. (Inventor); Owen, Samuel S. (Inventor); Poole, William E. (Inventor); Haluck, David A. (Inventor)

    1993-01-01

    A high performance rolling element bearing (5) which is particularly suitable for use in a cryogenically cooled environment, comprises a composite cage (45) formed from glass fibers disposed in a solid lubricant matrix of a fluorocarbon polymer. The cage includes inserts (50) formed from a mixture of a soft metal and a solid lubricant such as a fluorocarbon polymer.

  20. Presidential elements in government: introduction

    NARCIS (Netherlands)

    Reestman, J.H.

    2006-01-01

    The editorial board of the European Constitutional Law Review has solicited a number of contributions on presidential elements in government systems in Europe. At the origin of the project are some recent sweeping interventions of heads of state in the political arena. These are notably the (suspens

  1. Naturalistic Elements in Sister Carrie

    Institute of Scientific and Technical Information of China (English)

    刘艳晖

    2007-01-01

    @@ Theodore Dreiser is considered to be a controversial writer.His first novel.Sister Carrie makes a new way of presenting re-ality.This paper discusses the naturalistic elements from the de-tailed description of the environment in that society.

  2. Trace elements: implications for nursing.

    Science.gov (United States)

    Hayter, J

    1980-01-01

    Although most were unknown a few years ago, present evidence indicates that at least 25 trace elements have some pertinence to health. Unlike vitamins, they cannot be synthesized. Some trace elements are now considered important only because of their harmful effects but traces of them may be essential. Zinc is especially important during puberty, pregnancy and menopause and is related to protein metabolism. Both fluoride and cadmium accumulate in the body year after year. Cadmium is positively correlated with several chronic diseases, especially hypertension. It is obtained from smoking and drinking soft water. Silicon, generally associated with silicosis, may be necessary for healthy bone and connective tissue. Chromium, believed to be the glucose tolerance factor, is obtained from brewer's yeast, spices, and whole wheat products. Copper deficiency may be implicated in a wide range of cardiovascular and blood related disorders. Either marginal deficiencies or slight excesses of most trace elements are harmful. Nurses should instruct patients to avoid highly refined foods, fad diets, or synthetic and fabricated foods. A well balanced and varied diet is the best safeguard against trace element excesses or deficiencies.

  3. Trace elements and rat pouchitis.

    Science.gov (United States)

    Drzymała-Czyż, Sławomira; Banasiewicz, Tomasz; Walas, Stanisław; Kościński, Tomasz; Wenska-Chyży, Ewa; Drews, Michał; Walkowiak, Jarosław

    2012-01-01

    The procedure of restorative proctocolectomy is associated with a complete removal of the colon and slight reduction of ileum length, which together can lead to systemic shortages of trace elements. Inflammatory changes in the pouch mucosa may also have some impact. However, there is no data on trace elements in pouchitis. Therefore, in the present study we aimed to assess the effect of acute pouchitis on the status of selected trace elements in rats. Restorative proctocolectomy with the construction of intestinal J-pouch was performed in twenty-four Wistar rats. Three weeks after the surgery, pouchitis was induced. Eight untreated rats created the control group. Liver concentrations of selected micronutrients (Zn, Cu, Co, Mn, Se) were measured in both groups six weeks later, using inductively coupled plasma mass spectrometry. Liver concentrations of trace elements did not differ between the study and the control groups. However, copper, cobalt and selenium concentrations [μg/g] were statistically lower (p<0.02, p<0.05 and p<0.04, respectively) in rats with severe pouchitis (n=9) as compared with rats with mild pouchitis (n=7) [median (range): Cu--7.05 (3.02-14.57) vs 10.47 (5.16-14.97); Co--0.55 (0.37-0.96) vs 0.61 (0.52-0.86); Se--1.17 (0.69-1.54) vs 1.18 (0.29-1.91)]. In conclusion, it seems that acute pouchitis can lead to a significant deficiency of trace elements.

  4. Superheavy-element spectroscopy: Correlations along element 115 decay chains

    Directory of Open Access Journals (Sweden)

    Rudolph D.

    2016-01-01

    Full Text Available Following a brief summary of the region of the heaviest atomic nuclei yet created in the laboratory, data on more than hundred α-decay chains associated with the production of element 115 are combined to investigate time and energy correlations along the observed decay chains. Several of these are analysed using a new method for statistical assessments of lifetimes in sets of decay chains.

  5. An improved optimal elemental method for updating finite element models

    Institute of Scientific and Technical Information of China (English)

    Duan Zhongdong(段忠东); Spencer B.F.; Yan Guirong(闫桂荣); Ou Jinping(欧进萍)

    2004-01-01

    The optimal matrix method and optimal elemental method used to update finite element models may not provide accurate results. This situation occurs when the test modal model is incomplete, as is often the case in practice. An improved optimal elemental method is presented that defines a new objective function, and as a byproduct, circumvents the need for mass normalized modal shapes, which are also not readily available in practice. To solve the group of nonlinear equations created by the improved optimal method, the Lagrange multiplier method and Matlab function fmincon are employed. To deal with actual complex structures,the float-encoding genetic algorithm (FGA) is introduced to enhance the capability of the improved method. Two examples, a 7-degree of freedom (DOF) mass-spring system and a 53-DOF planar frame, respectively, are updated using the improved method.Thc example results demonstrate the advantages of the improved method over existing optimal methods, and show that the genetic algorithm is an effective way to update the models used for actual complex structures.

  6. Reliability-Based Optimization of Structural Elements

    DEFF Research Database (Denmark)

    Sørensen, John Dalsgaard

    In this paper structural elements from an optimization point of view are considered, i.e. only the geometry of a structural element is optimized. Reliability modelling of the structural element is discussed both from an element point of view and from a system point of view. The optimization...

  7. Low cost, lightweight fuel cell elements

    Science.gov (United States)

    Kindler, Andrew (Inventor)

    2001-01-01

    New fuel cell elements for use in liquid feed fuel cells are provided. The elements including biplates and endplates are low in cost, light in weight, and allow high efficiency operation. Electrically conductive elements are also a part of the fuel cell elements.

  8. The Transuranium Elements - Present Status: Nobel Lecture

    Science.gov (United States)

    Seaborg, G. T.

    1951-12-12

    The discovery of the transuranium elements and the work done on them up to the present time are reviewed. The properties of these elements, their relationship to other elements, their place in the periodic table, and the possibility of production and identification of other transuranium elements are discussed briefly.

  9. Representation Elements of Spatial Thinking

    Science.gov (United States)

    Fiantika, F. R.

    2017-04-01

    This paper aims to add a reference in revealing spatial thinking. There several definitions of spatial thinking but it is not easy to defining it. We can start to discuss the concept, its basic a forming representation. Initially, the five sense catch the natural phenomenon and forward it to memory for processing. Abstraction plays a role in processing information into a concept. There are two types of representation, namely internal representation and external representation. The internal representation is also known as mental representation; this representation is in the human mind. The external representation may include images, auditory and kinesthetic which can be used to describe, explain and communicate the structure, operation, the function of the object as well as relationships. There are two main elements, representations properties and object relationships. These elements play a role in forming a representation.

  10. DOLFIN: Automated Finite Element Computing

    CERN Document Server

    Logg, Anders; 10.1145/1731022.1731030

    2011-01-01

    We describe here a library aimed at automating the solution of partial differential equations using the finite element method. By employing novel techniques for automated code generation, the library combines a high level of expressiveness with efficient computation. Finite element variational forms may be expressed in near mathematical notation, from which low-level code is automatically generated, compiled and seamlessly integrated with efficient implementations of computational meshes and high-performance linear algebra. Easy-to-use object-oriented interfaces to the library are provided in the form of a C++ library and a Python module. This paper discusses the mathematical abstractions and methods used in the design of the library and its implementation. A number of examples are presented to demonstrate the use of the library in application code.

  11. Finite elements methods in mechanics

    CERN Document Server

    Eslami, M Reza

    2014-01-01

    This book covers all basic areas of mechanical engineering, such as fluid mechanics, heat conduction, beams, and elasticity with detailed derivations for the mass, stiffness, and force matrices. It is especially designed to give physical feeling to the reader for finite element approximation by the introduction of finite elements to the elevation of elastic membrane. A detailed treatment of computer methods with numerical examples are provided. In the fluid mechanics chapter, the conventional and vorticity transport formulations for viscous incompressible fluid flow with discussion on the method of solution are presented. The variational and Galerkin formulations of the heat conduction, beams, and elasticity problems are also discussed in detail. Three computer codes are provided to solve the elastic membrane problem. One of them solves the Poisson’s equation. The second computer program handles the two dimensional elasticity problems, and the third one presents the three dimensional transient heat conducti...

  12. Automation of finite element methods

    CERN Document Server

    Korelc, Jože

    2016-01-01

    New finite elements are needed as well in research as in industry environments for the development of virtual prediction techniques. The design and implementation of novel finite elements for specific purposes is a tedious and time consuming task, especially for nonlinear formulations. The automation of this process can help to speed up this process considerably since the generation of the final computer code can be accelerated by order of several magnitudes. This book provides the reader with the required knowledge needed to employ modern automatic tools like AceGen within solid mechanics in a successful way. It covers the range from the theoretical background, algorithmic treatments to many different applications. The book is written for advanced students in the engineering field and for researchers in educational and industrial environments.

  13. Surface energies of elemental crystals

    Science.gov (United States)

    Tran, Richard; Xu, Zihan; Radhakrishnan, Balachandran; Winston, Donald; Sun, Wenhao; Persson, Kristin A.; Ong, Shyue Ping

    2016-09-01

    The surface energy is a fundamental property of the different facets of a crystal that is crucial to the understanding of various phenomena like surface segregation, roughening, catalytic activity, and the crystal’s equilibrium shape. Such surface phenomena are especially important at the nanoscale, where the large surface area to volume ratios lead to properties that are significantly different from the bulk. In this work, we present the largest database of calculated surface energies for elemental crystals to date. This database contains the surface energies of more than 100 polymorphs of about 70 elements, up to a maximum Miller index of two and three for non-cubic and cubic crystals, respectively. Well-known reconstruction schemes are also accounted for. The database is systematically improvable and has been rigorously validated against previous experimental and computational data where available. We will describe the methodology used in constructing the database, and how it can be accessed for further studies and design of materials.

  14. Selective Smoothed Finite Element Method

    Institute of Scientific and Technical Information of China (English)

    2007-01-01

    The paper examines three selective schemes for the smoothed finite element method (SFEM) which was formulated by incorporating a cell-wise strain smoothing operation into the standard compatible finite element method (FEM). These selective SFEM schemes were formulated based on three selective integration FEM schemes with similar properties found between the number of smoothing cells in the SFEM and the number of Gaussian integration points in the FEM. Both scheme 1 and scheme 2 are free of nearly incompressible locking, but scheme 2 is more general and gives better results than scheme 1. In addition, scheme 2 can be applied to anisotropic and nonlinear situations, while scheme 1 can only be applied to isotropic and linear situations. Scheme 3 is free of shear locking. This scheme can be applied to plate and shell problems. Results of the numerical study show that the selective SFEM schemes give more accurate results than the FEM schemes.

  15. Composite oxygen ion transport element

    Science.gov (United States)

    Chen, Jack C.; Besecker, Charles J.; Chen, Hancun; Robinson, Earil T.

    2007-06-12

    A composite oxygen ion transport element that has a layered structure formed by a dense layer to transport oxygen ions and electrons and a porous support layer to provide mechanical support. The dense layer can be formed of a mixture of a mixed conductor, an ionic conductor, and a metal. The porous support layer can be fabricated from an oxide dispersion strengthened metal, a metal-reinforced intermetallic alloy, a boron-doped Mo.sub.5Si.sub.3-based intermetallic alloy or combinations thereof. The support layer can be provided with a network of non-interconnected pores and each of said pores communicates between opposite surfaces of said support layer. Such a support layer can be advantageously employed to reduce diffusion resistance in any type of element, including those using a different material makeup than that outlined above.

  16. ADAPTIVE ELLIPSOIDAL ACOUSTIC INFINITE ELEMENT

    Institute of Scientific and Technical Information of China (English)

    Yang Ruiliang; Wang Hongzhen

    2004-01-01

    It is shown that the basis of the ellipsoidal acoustic infinite element Burnett method,the multipole expansion,cannot represent real ellipsoidal acoustic field exactly.To solve the problem,a weight of angular direction is added to the multipole expansion.The comparison of the modified method and the prime method shows that the modified method can describe and solve the ellipsoidal acoustic field more accurately than ever.A dilating sphere is used to test the new method further.Unlike other infinite element methods,varied ratio of the ellipsoidal artificial boundary instead of sphere is used.The pressure value of the artificial boundary is utilized as the initial value of the new method.Then the radiating phenomena of the ellipsoidal acoustic field can be researched using the new method.These examples show the feasibility of the adaptive method.

  17. LOG PERIODIC DIPOLE ARRAY WITH PARASITIC ELEMENTS

    Science.gov (United States)

    The design and measured characteristics of dipole and monopole versions of a log periodic array with parasitic elements are discussed. In a dipole...array with parasitic elements, these elements are used in place of every alternate dipole, thereby eliminating the need of a twisted feed arrangement...for the elements to obtain log periodic performance of the anntenna. This design with parasitic elements lends itself to a monopole version of the

  18. CONSTRAINED QUADRILATERAL NONCONFORMING ROTATED Q1 ELEMENT

    Institute of Scientific and Technical Information of China (English)

    Jun Hu; Zhong-ci Shi

    2005-01-01

    In this paper, we define a new nonconforming quadrilateral finite element based on the nonconforming rotated Q1 element by enforcing a constraint on each element, which has only three degrees of freedom. We investigate the consistency, approximation, superclose property, discrete Green's function and superconvergence of this element. Moreover, we propose a new postprocessing technique and apply it to this element. It is proved that the postprocessed discrete solution is superconvergent under a mild assumption on the mesh.

  19. Elements of Bayesian experimental design

    Energy Technology Data Exchange (ETDEWEB)

    Sivia, D.S. [Rutherford Appleton Lab., Oxon (United Kingdom)

    1997-09-01

    We consider some elements of the Bayesian approach that are important for optimal experimental design. While the underlying principles used are very general, and are explained in detail in a recent tutorial text, they are applied here to the specific case of characterising the inferential value of different resolution peakshapes. This particular issue was considered earlier by Silver, Sivia and Pynn (1989, 1990a, 1990b), and the following presentation confirms and extends the conclusions of their analysis.

  20. Moessbauer spectroscopy with actinide elements

    Energy Technology Data Exchange (ETDEWEB)

    Potzel, W.; Moser, J.; Asch, L.; Kalvius, G.M. (Technische Univ. Muenchen, Garching (Germany, F.R.)

    1983-01-01

    Although formally equivalent to the lanthanide (4f) elements, the light actinides show a much more varied behaviour due to the larger spatial extent and ionizability of the 5f electrons. The application of Moessbauer spectroscopy for the determination of electronic properties of the actinides is outlined. Emphasis is put on high pressure Moessbauer experiments using the 60 keV transition in /sup 237/Np to study questions of delocalization of 5f electrons.

  1. Origin of the Chemical Elements

    CERN Document Server

    Rauscher, T

    2010-01-01

    This review provides the necessary background from astrophysics, nuclear, and particle physics to understand the cosmic origin of the chemical elements. It reflects the year 2009 state of the art in this extremely quickly developing interdisciplinary research direction. The discussion summarizes the nucleosynthetic processes in the course of the evolution of the Universe and the galaxies contained within, including primordial nucleosynthesis, stellar evolution, and explosive nucleosynthesis in single and binary systems.

  2. Blade-element/momentum theory

    DEFF Research Database (Denmark)

    Sørensen, Jens Nørkær

    2016-01-01

    Although there exists a large variety of methods for predicting performance and loadings of wind turbines, the only approach used today by wind turbine manufacturers is based on the blade-element/momentum (BEM) theory by Glauert (Aerodynamic theory. Springer, Berlin, pp. 169-360, 1935). A basic...... assumption in the BEM theory is that the flow takes place in independent stream tubes and that the loading is determined from two-dimensional sectional airfoil characteristics....

  3. Conrad's Skeptical Elements in Nostromo

    Institute of Scientific and Technical Information of China (English)

    何旭

    2016-01-01

    The Paper analyze the skeptical elements in Nostromo through mostly the analysis of the values held by different char-acter and their respective destiny. Conrad expresses his skepticism towards material interest through the character of Charles Gould, who firmly believes that material interests alone can bring order and peace to the country. But his success is temporary. Eventually success of his silver mine not only intensifies political conflicts but also brings him disillusionment and loneliness.

  4. Peridynamic Multiscale Finite Element Methods

    Energy Technology Data Exchange (ETDEWEB)

    Costa, Timothy [Sandia National Lab. (SNL-NM), Albuquerque, NM (United States); Bond, Stephen D. [Sandia National Lab. (SNL-NM), Albuquerque, NM (United States); Littlewood, David John [Sandia National Lab. (SNL-NM), Albuquerque, NM (United States); Moore, Stan Gerald [Sandia National Lab. (SNL-NM), Albuquerque, NM (United States)

    2015-12-01

    The problem of computing quantum-accurate design-scale solutions to mechanics problems is rich with applications and serves as the background to modern multiscale science research. The prob- lem can be broken into component problems comprised of communicating across adjacent scales, which when strung together create a pipeline for information to travel from quantum scales to design scales. Traditionally, this involves connections between a) quantum electronic structure calculations and molecular dynamics and between b) molecular dynamics and local partial differ- ential equation models at the design scale. The second step, b), is particularly challenging since the appropriate scales of molecular dynamic and local partial differential equation models do not overlap. The peridynamic model for continuum mechanics provides an advantage in this endeavor, as the basic equations of peridynamics are valid at a wide range of scales limiting from the classical partial differential equation models valid at the design scale to the scale of molecular dynamics. In this work we focus on the development of multiscale finite element methods for the peridynamic model, in an effort to create a mathematically consistent channel for microscale information to travel from the upper limits of the molecular dynamics scale to the design scale. In particular, we first develop a Nonlocal Multiscale Finite Element Method which solves the peridynamic model at multiple scales to include microscale information at the coarse-scale. We then consider a method that solves a fine-scale peridynamic model to build element-support basis functions for a coarse- scale local partial differential equation model, called the Mixed Locality Multiscale Finite Element Method. Given decades of research and development into finite element codes for the local partial differential equation models of continuum mechanics there is a strong desire to couple local and nonlocal models to leverage the speed and state of the

  5. Adobe Photoshop Elements 10 unleash the hidden performance of Elements

    CERN Document Server

    Galer, Mark

    2011-01-01

    Master the most powerful photo editing tools and techniques that Elements has to offer! Using step-by-step projects, Mark Galer will have you creating stunning images in no time at all. Whether you want to create impressive, seamless montages, optimize your photos for perfect print quality, or simply enhance your images for maximum impact, Maximum Performance will give you the skills and know-how you need to create professional quality results. Featured projects teach you how to work with multilayered 16 bit/channel files, as well as convert to black and white using Adobe Camera Raw, create

  6. Finite element analysis of elasto-plastic plate bending problems using transition rectangular plate elements

    Institute of Scientific and Technical Information of China (English)

    Bahattin Kanber; O.Yavuz Bozkurt

    2006-01-01

    In this work,the finite element analysis of the elasto-plastic plate bending problems is carried out using transition rectangular plate elements.The shape functions of the transition plate elements are derived based on a practical rule.The transition plate elements are all quadrilateral and can be used to obtain efficient finite element models using minimum number of elements.The mesh convergence rates of the models including the transition elements are compared with the regular element models.To verify the developed elements,simple tests are demonstrated and various elasto-plastic problems are solved.Their results are compared with ANSYS results.

  7. Implementing wavelet transform with SAW elements

    Institute of Scientific and Technical Information of China (English)

    LU; Wenke(卢文科); ZHU; Changchun(朱长纯); LIU; Junhua(刘君华); LIU; Qinghong(刘清洪)

    2003-01-01

    In the design of the finger-overlap envelope according to the envelope of wavelet function, it is concluded that the pulse-response function of the interdigital transducer (IDT) for surface acoustic wave (SAW) is identical to the wavelet function. SAW type of the wavelet-transform element is manufactured. A new method of using two wavelet-transform elements to manufacture the reconstruction element of the wavelet transform is proposed. The sources of the element error are analyzed, and the methods for reducing the error are put forward. SAW type of the wavelet transformation element and its reconstruction element have the following three characteristics: (i) the implementing methods of the wavelet transform element and its reconstruction element are simple, and free of complicated mathematical algorithms of the wavelet transform; (ii) because one of SAW element is fast, the response velocities of SAW type of the wavelet transform element and its reconstruction element are also fast; (iii) the costs of the wavelet transform element and its reconstruction element are low, so the elements may be manufactured in a large quantity.

  8. Fluidic Elements based on Coanda Effect

    Directory of Open Access Journals (Sweden)

    Constantin OLIVOTTO

    2010-12-01

    Full Text Available This paper contains first some definitions and classifications regarding the fluidic elements. Thegeneral current status is presented, nominating the main specific elements based on the Coanda effect developedspecially in Romania. In particularly the development of an original bistable element using industrial compressedair at industrial pressure supply is presented. The function of this element is based on the controlled attachmentof the main jet at a curved wall through the Coanda effect. The methods used for particular calculation andexperiments are nominated. The main application of these elements was to develop a specific execution element:a fluidic step–by-step motor based on the Coanda effect.

  9. ACCURACY ANALYSIS FOR QUASI-CAREY ELEMENT

    Institute of Scientific and Technical Information of China (English)

    Dongyang SHI; Xiaobin HAO

    2008-01-01

    In this paper, a new triangular element (Quasi-Carey element) is constructed by the idea of Specht element. It is shown that this Quasi-Carey element possesses a very special property, i.e.,the consistency error is of order O(h2), one order higher than its interpolation error when the exact solution belongs to Ha(Ω). However, the interpolation error and consistency error of Carey element are of order O(h). It seems that the above special property has never been seen for other triangular elements for the second order problems.

  10. Formulations of a hydromechanical interface element

    Institute of Scientific and Technical Information of China (English)

    Zhong-Zhi Fu; Si-Hong Liu

    2011-01-01

    A hydromechanical interface element is proposed for the consideration of the hydraulic-mechanical coupling effect along the interface.The fully coupled governing equations and the relevant finite element formulations are derived in detail for the interface element.All the involved matrices are of the same form as those of a solid element,which makes the incorporation of the model into a finite element program straightforward.Three examples are then numerically simulated using the interface element.Reasonable results confirm the correctness of the proposed model and motivate its application in hydromechanical contact problems in the future.

  11. Sunspots, Starspots, and Elemental Abundances

    Science.gov (United States)

    Doschek, George A.; Warren, Harry P.

    2017-08-01

    The composition of plasma in solar and stellar atmospheres is not fixed, but varies from feature to feature. These variations are organized by the First Ionization Potential (FIP) of the element. Solar measurements often indicate that low FIP elements (10 eV, such as C, N, O, Ar, He) compared to abundances in the photosphere. Stellar observations have also shown similar enrichments. An inverse FIP effect, where the low FIP elements are depleted, has been observed in stellar coronae of stars believed to have large starspots in their photospheres. The abundances are important for determining radiative loss rates in models, tracing the origin of the slow solar wind, and for understanding wave propagation in the chromosphere and corona. Recently, inverse FIP effects have been discovered in the Sun (Doschek, Warren, & Feldman 2015, ApJ, 808, L7) from spectra obtained by the Extreme-ultraviolet Imaging Spectrometer (EIS) on the Hinode spacecraft. The inverse FIP regions seem always to be near sunspots and cover only a very small area (characteristic length = a few arcseconds). However, in pursuing the search for inverse FIP regions, we have found that in some sunspot groups the coronal abundance at a temperature of 3-4 MK can be near photospheric over much larger areas of the sun near the sunspots (e.g., 6,000 arcsec2). Also, sometimes the abundances at 3-4 MK are in between coronal and photospheric values. This can occur in small areas of an active region. It is predicted (Laming 2015, Sol. Phys., 12, 2) that the FIP effect should be highly variable in the corona. Several examples of coronal abundance variations are presented. Our work indicates that a comprehensive re-investigation of solar abundances is highly desirable. This work is supported by a NASA Hinode grant.

  12. Elemental composition of Malawian rice.

    Science.gov (United States)

    Joy, Edward J M; Louise Ander, E; Broadley, Martin R; Young, Scott D; Chilimba, Allan D C; Hamilton, Elliott M; Watts, Michael J

    2016-07-20

    Widespread potential dietary deficiencies of calcium (Ca), iron (Fe), iodine (I), selenium (Se) and zinc (Zn) have been identified in Malawi. Several deficiencies are likely to be compounded by high phytic acid (PA) consumption. Rice (Oryza sativa) is commonly consumed in some Malawian populations, and its mineral micronutrient content is important for food security. The considerable irrigation requirements and flooded conditions of paddy soils can also introduce or mobilise potentially toxic elements including arsenic (As), cadmium (Cd) and lead (Pb). The aim of this study was to determine the mineral composition of rice sampled from farmers' fields and markets in Malawi. Rice was sampled from 18 extension planning areas across Malawi with 21 white (i.e. polished) and 33 brown samples collected. Elemental composition was determined by inductively coupled plasma-mass spectrometry (ICP-MS). Arsenic speciation was performed using high-performance liquid chromatography (HPLC)-ICP-MS. Concentration of PA was determined using a PA-total phosphorus assay. Median total concentrations (mg kg(-1), dry weight) of elements important for human nutrition in brown and white rice, respectively, were: Ca = 66.5 and 37.8; Cu = 3.65 and 2.49; Fe = 22.1 and 7.2; I = 0.006 and Biofortification strategies could significantly increase Se and Zn concentrations and require further investigation. Concentrations of Fe in rice grain varied greatly, and this was likely due to contamination of rice samples with soil. Risk of As, Cd or Pb toxicity due to rice consumption in Malawi appears to be minimal.

  13. Duration judgements over multiple elements

    Directory of Open Access Journals (Sweden)

    Inci eAyhan

    2012-11-01

    Full Text Available We investigated the limits of the number of events observers can simultaneously time. For single targets occurring in one of eight positions sensitivity to duration was improved for spatially pre-cued items as compared to post-cued items indicating that exogenous driven attention can improve duration discrimination. Sensitivity to duration for pre-cued items was also marginally better for single items as compared to eight items indicating that even after the allocation of focal attention, distracter items can interfere with the encoding of duration. For an eight item array discrimination was worse for post-cued locations as compared to pre-cued locations indicating both that attention can improve duration discrimination performance and that it was not possible to access a perfect memory trace of the duration of eight elements. The interference from the distracters in the pre-cued eight item array may reflect some mandatory averaging of target and distracter events. To further explore duration averaging we asked subjects to explicitly compare average durations of multiple item arrays against a single item standard duration. Duration discrimination thresholds were significantly lower for single elements as compared to multiple elements, showing that averaging, either automatically or intentionally, impairs duration discrimination. There was no set size effect. Performance was the same for averages of two and eight items, but performance with even an average of two items was worse than for one item. This was also true for sequential presentation indicating poor performance was not due to limits on the division of attention across items. Rather performance appears to be limited by an inability to remember or aggregate duration information from two or more items. Although it is possible to manipulate perceived duration locally, there appears to be no perceptual mechanisms for aggregating local durations across space.

  14. Elements of abstract harmonic analysis

    CERN Document Server

    Bachman, George

    2013-01-01

    Elements of Abstract Harmonic Analysis provides an introduction to the fundamental concepts and basic theorems of abstract harmonic analysis. In order to give a reasonably complete and self-contained introduction to the subject, most of the proofs have been presented in great detail thereby making the development understandable to a very wide audience. Exercises have been supplied at the end of each chapter. Some of these are meant to extend the theory slightly while others should serve to test the reader's understanding of the material presented. The first chapter and part of the second give

  15. Elements of critical incident debriefing.

    Science.gov (United States)

    Curtis, J M

    1995-08-01

    The present paper lists a number of specific therapeutic steps involved in critical incident debriefing. These therapeutic suggestions, while by no means exhaustive, include (a) identification, (b) labeling, (c) articulation, (d) expression, (e) externalization, (f) ventilation, (g) validation, and (h) acceptance. More careful attention to these specific elements--regardless of debriefers' training and backgrounds--might improve therapeutic consistency for trauma victims afflicted with stress-related symptoms. Further applications of these therapeutic steps were also suggested for other types of behavioral problems.

  16. Main Elements for Upscaling Recreation

    DEFF Research Database (Denmark)

    Zandersen, Marianne; Termansen, Mette

    2012-01-01

    This report provides information on the main elements used to scale up modelled local visitor flow data to regional level based on recreational de-mand models. These models are described in Report #1. This report also provides information on data sources such as spatial data (e.g. land cov......-er/land use information), demographic information. The report is accom-pagnied with a spatial database for the regional case of forest recreation in Northern Zealand, Denmark. The spatial database contains forest polygons; forest attribute; estimation of total annual number of visits per site; and es...

  17. Elements of partial differential equations

    CERN Document Server

    Sneddon, Ian N

    2006-01-01

    Geared toward students of applied rather than pure mathematics, this volume introduces elements of partial differential equations. Its focus is primarily upon finding solutions to particular equations rather than general theory.Topics include ordinary differential equations in more than two variables, partial differential equations of the first and second orders, Laplace's equation, the wave equation, and the diffusion equation. A helpful Appendix offers information on systems of surfaces, and solutions to the odd-numbered problems appear at the end of the book. Readers pursuing independent st

  18. INDUSTRIAL DESIGN ELEMENTS IN MARKETING

    Directory of Open Access Journals (Sweden)

    TOCARIU Liliana

    2015-06-01

    Full Text Available Industrial design represents an important 20th century phenomenon, which contributed to the spectacular development of human society. There are a lot of domains in which the insertion of the industrial design methods and theories is extremely necessary, becoming common practice. Marketing uses industrial design elements in order to draw up advertisements for products, to develop logos or packaging with all its attached factors, to organise promotional sales with the view of penetrating a certain market or of appealing to a large number of consumers.

  19. Nuclear reactor fuel element. Kernreaktorbrennelement

    Energy Technology Data Exchange (ETDEWEB)

    Lippert, H.J.

    1985-03-28

    The fuel element box for a BWR is situated with a corner bolt on the inside in one corner of its top on the top side of the top plate. This corner bolt is screwed down with a bolt with a corner part which is provided with leaf springs outside on two sides, where the bolt has a smaller diameter and an expansion shank. The bolt is held captive to the bolt head on the top and the holder on the bottom of the corner part. The holder is a locknut. If the expansion forces are too great, the bolt can only break at the expansion shank.

  20. Basic Elements of Knowledge Management

    Directory of Open Access Journals (Sweden)

    Marcin W. Staniewski

    2007-10-01

    Full Text Available The article is a review of basic knowledge management terminology. It presents such a description as: knowledge resources levels (data, information, knowledge, and wisdom, knowledge sources (internal, external, and knowledge typology (implicit, tacit or individual, social. Moreover the article characterizes knowledge management process, knowledge management system and main knowledge management strategies (codification, personalization. At the end of the article there is mentioned the knowledge creating process (the concept of knowledge creation spiral and the role of Intelligence Technology (IT and organizational culture as main elements supporting knowledge management implementation in organizations.

  1. New alternating direction procedures in finite element analysis based upon EBE approximate factorizations. [element-by-element

    Science.gov (United States)

    Hughes, T. J. R.; Winget, J.; Levit, I.; Tezduyar, T. E.

    1983-01-01

    Element-by-element approximate factorization procedures are proposed for solving the large finite element equation systems which arise in computational mechanics. A variety of techniques are compared on problems of structural mechanics, heat conduction and fluid mechanics. The results obtained suggest considerable potential for the methods described.

  2. Analysis of composite structural elements

    Directory of Open Access Journals (Sweden)

    A. Baier

    2010-12-01

    Full Text Available Purpose: The themes of the study are composite structural components. For this purpose have been designed and built several research positions.Design/methodology/approach: Using different structural materials to build new device components requires multiple tests of the components. Research posts were designed in the advanced graphical program CAx Siemens NX 7.5. Analysed samples were made from the glass fibre, aramid and carbon of various weights. Due to the specific use of composite materials it focuses on the elements in the form of plates and flat bars. For the examination of experimental strain gauge technique was used bead, the force sensor and displacement sensor. The experimental methods were compared with computer simulation using the FEM.Findings: The aim of this study was to determine the basic material constants and a comparison of the experimental method and the method of computer simulation.Research limitations/implications: Change the number of layers and how to connect the laminate with the steel plate changes mechanical properties of the structural component.Practical implications: The ultimate result will be knowledge on the different forms of laminates, such as material properties, the stresses in all layers, strain and comparing the results obtained by two methods.Originality/value: The expected outcome of the study will be the composition and method of joining composite laminate with a steel plate to the possible application in the repair and construction of structural elements of freight wagons.

  3. Fuel elements of thermionic converters

    Energy Technology Data Exchange (ETDEWEB)

    Hunter, R.L. [ed.] [Sandia National Labs., Albuquerque, NM (United States). Environmental Systems Assessment Dept.; Gontar, A.S.; Nelidov, M.V.; Nikolaev, Yu.V.; Schulepov, L.N. [RI SIA Lutch, Podolsk (Russian Federation)

    1997-01-01

    Work on thermionic nuclear power systems has been performed in Russia within the framework of the TOPAZ reactor program since the early 1960s. In the TOPAZ in-core thermionic convertor reactor design, the fuel element`s cladding is also the thermionic convertor`s emitter. Deformation of the emitter can lead to short-circuiting and is the primary cause of premature TRC failure. Such deformation can be the result of fuel swelling, thermocycling, or increased unilateral pressure on the emitter due to the release of gaseous fission products. Much of the work on TRCs has concentrated on preventing or mitigating emitter deformation by improving the following materials and structures: nuclear fuel; emitter materials; electrical insulators; moderator and reflector materials; and gas-exhaust device. In addition, considerable effort has been directed toward the development of experimental techniques that accurately mimic operational conditions and toward the creation of analytical and numerical models that allow operational conditions and behavior to be predicted without the expense and time demands of in-pile tests. New and modified materials and structures for the cores of thermionic NPSs and new fabrication processes for the materials have ensured the possibility of creating thermionic NPSs for a wide range of powers, from tens to several hundreds of kilowatts, with life spans of 5 to 10 years.

  4. Disease management contracting: key elements.

    Science.gov (United States)

    Knutson, D J

    1996-01-01

    Although the data at the outset of a contractual agreement can often be incomplete or inaccurate, and the analytical tools necessary to interpret these data are still being developed, partners about to enter a disease management (DM) arrangement can nonetheless take steps to ensure that the relationship will be sound and successful. Pharmaceutical firms (and other service providers) wishing to enter into DM relationships with managed-care organizations must consider several important factors of the contracting process to protect their financial interests and benefit from the partnership, particularly in the first 1 to 2 years of the arrangement. This paper provides recommendations for both general strategies and financial elements of DM contracting, and defines several contractual elements that can help to secure a harmonious and profitable partnership. These suggestions address concerns for various types of partnerships, including risk-sharing and fee-for-service plans. Early and careful consideration of the legal aspects of the DM business can protect companies from incurring significant, unanticipated losses.

  5. METHODOLOGICAL ELEMENTS OF SITUATIONAL ANALYSIS

    Directory of Open Access Journals (Sweden)

    Tetyana KOVALCHUK

    2016-07-01

    Full Text Available The article deals with the investigation of theoretical and methodological principles of situational analysis. The necessity of situational analysis is proved in modern conditions. The notion “situational analysis” is determined. We have concluded that situational analysis is a continuous system study which purpose is to identify dangerous situation signs, to evaluate comprehensively such signs influenced by a system of objective and subjective factors, to search for motivated targeted actions used to eliminate adverse effects of the exposure of the system to the situation now and in the future and to develop the managerial actions needed to bring the system back to norm. It is developed a methodological approach to the situational analysis, its goal is substantiated, proved the expediency of diagnostic, evaluative and searching functions in the process of situational analysis. The basic methodological elements of the situational analysis are grounded. The substantiation of the principal methodological elements of system analysis will enable the analyst to develop adaptive methods able to take into account the peculiar features of a unique object which is a situation that has emerged in a complex system, to diagnose such situation and subject it to system and in-depth analysis, to identify risks opportunities, to make timely management decisions as required by a particular period.

  6. Fuel elements of thermionic converters

    Energy Technology Data Exchange (ETDEWEB)

    Hunter, R.L. [ed.] [Sandia National Labs., Albuquerque, NM (United States). Environmental Systems Assessment Dept.; Gontar, A.S.; Nelidov, M.V.; Nikolaev, Yu.V.; Schulepov, L.N. [RI SIA Lutch, Podolsk (Russian Federation)

    1997-01-01

    Work on thermionic nuclear power systems has been performed in Russia within the framework of the TOPAZ reactor program since the early 1960s. In the TOPAZ in-core thermionic convertor reactor design, the fuel element`s cladding is also the thermionic convertor`s emitter. Deformation of the emitter can lead to short-circuiting and is the primary cause of premature TRC failure. Such deformation can be the result of fuel swelling, thermocycling, or increased unilateral pressure on the emitter due to the release of gaseous fission products. Much of the work on TRCs has concentrated on preventing or mitigating emitter deformation by improving the following materials and structures: nuclear fuel; emitter materials; electrical insulators; moderator and reflector materials; and gas-exhaust device. In addition, considerable effort has been directed toward the development of experimental techniques that accurately mimic operational conditions and toward the creation of analytical and numerical models that allow operational conditions and behavior to be predicted without the expense and time demands of in-pile tests. New and modified materials and structures for the cores of thermionic NPSs and new fabrication processes for the materials have ensured the possibility of creating thermionic NPSs for a wide range of powers, from tens to several hundreds of kilowatts, with life spans of 5 to 10 years.

  7. Recovery of trans-plutonium elements; Recuperation des elements transplutoniens

    Energy Technology Data Exchange (ETDEWEB)

    Espie, J.Y.; Poncet, B.; Simon, A. [Commissariat a l' Energie Atomique, Saclay (France). Centre d' Etudes Nucleaires

    1970-07-01

    The object of this work is to study the recovery of americium and curium from the fission-product solution obtained from the processing of irradiated fuel elements made of natural metallic uranium alloyed with aluminium, iron and silicon; these elements have been subjected to an average irradiation of 4000 MW days/ton in a gas-graphite type reactor having a thermal power of 3.7 MW/ton of uranium. The process used consists of 3 extraction cycles and one americium-curium separation: - 1) extraction cycle in 40 per cent TBP: extraction of actinides and lanthanides; elimination of fission products; - 2) extraction cycle in 8 per cent D2EHPA: decontamination from the fission products, decontamination of actinides from lanthanides; - 3) extraction cycle in 40 per cent TBP: separation of the complexing agent and concentration of the actinides; - 4) americium-curium separation by precipitation. (authors) [French] Cette etude a pour objet, la recuperation de l'americium et du curium de la solution de produits de fission provenant du traitement de combustibles irradies a base d'uranium naturel metallique allie a l'aluminium, le fer, et le silicium, et ayant subi une irradiation moyenne de 4000 MWj/t dans une pile du type graphite-gaz, dont la puissance thermique est de 3.7 MW/t d'uranium. Le procede utilise comprend 3 cycles d'extraction et une separation americium-curium: - 1. cycle d'extraction dans le TBP a 40 pour cent: extraction des actinides et des lanthanides, elimination des produits de fission; - 2. cycle d'extraction dans le D2EHPA a 8 pour cent: decontamination en produits de fission, decontamination des actinides en lanthanides; - 3. cycle d'extraction dans le TBP a 40 pour cent: separation du complexant et concentration des actinides; - 4. separation americium-curium par precipitation. (auteurs)

  8. Infinite Possibilities for the Finite Element.

    Science.gov (United States)

    Finlayson, Bruce A.

    1981-01-01

    Describes the uses of finite element methods in solving problems of heat transfer, fluid flow, etc. Suggests that engineers should know the general concepts and be able to apply the principles of finite element methods. (Author/WB)

  9. Finite element differential forms on cubical meshes

    CERN Document Server

    Arnold, Douglas N

    2012-01-01

    We develop a family of finite element spaces of differential forms defined on cubical meshes in any number of dimensions. The family contains elements of all polynomial degrees and all form degrees. In two dimensions, these include the serendipity finite elements and the rectangular BDM elements. In three dimensions they include a recent generalization of the serendipity spaces, and new H(curl) and H(div) finite element spaces. Spaces in the family can be combined to give finite element subcomplexes of the de Rham complex which satisfy the basic hypotheses of the finite element exterior calculus, and hence can be used for stable discretization of a variety of problems. The construction and properties of the spaces are established in a uniform manner using finite element exterior calculus.

  10. Superconvergence for rectangular serendipity finite elements

    Institute of Scientific and Technical Information of China (English)

    CHEN; Chuanmiao(陈传淼)

    2003-01-01

    Based on an orthogonal expansion and orthogonality correction in an element, superconvergenceat symmetric points for any degree rectangular serendipity finite element approximation to second order ellipticproblem is proved, and its behaviour up to the boundary is also discussed.

  11. Microarray of programmable electrochemically active elements

    DEFF Research Database (Denmark)

    McCaskill, John; Maeke, Thomas; Straczek, Lukas

    Possible applications of the MICREAgents Dock, a two dimensional array of programmable electrochemically active elements, to Alife.......Possible applications of the MICREAgents Dock, a two dimensional array of programmable electrochemically active elements, to Alife....

  12. Natural wetland emissions of methylated trace elements

    NARCIS (Netherlands)

    Vriens, B.; Lenz, M.; Charlet, L.; Berg, M.; Winkel, L.H.E.

    2014-01-01

    Natural wetlands are well known for their significant methane emissions. However, trace element emissions via biomethylation and subsequent volatilization from pristine wetlands are virtually unstudied, even though wetlands constitute large reservoirs for trace elements. Here we show that the averag

  13. Continuous finite element methods for Hamiltonian systems

    Institute of Scientific and Technical Information of China (English)

    2007-01-01

    By applying the continuous finite element methods of ordinary differential equations, the linear element methods are proved having second-order pseudo-symplectic scheme and the quadratic element methods are proved having third-order pseudosymplectic scheme respectively for general Hamiltonian systems, and they both keep energy conservative. The finite element methods are proved to be symplectic as well as energy conservative for linear Hamiltonian systems. The numerical results are in agreement with theory.

  14. A unified architecture of transcriptional regulatory elements

    DEFF Research Database (Denmark)

    Andersson, Robin; Sandelin, Albin Gustav; Danko, Charles G.

    2015-01-01

    Gene expression is precisely controlled in time and space through the integration of signals that act at gene promoters and gene-distal enhancers. Classically, promoters and enhancers are considered separate classes of regulatory elements, often distinguished by histone modifications. However...... and enhancers are considered a single class of functional element, with a unified architecture for transcription initiation. The context of interacting regulatory elements and the surrounding sequences determine local transcriptional output as well as the enhancer and promoter activities of individual elements....

  15. Analytic matrix elements with shifted correlated Gaussians

    DEFF Research Database (Denmark)

    Fedorov, D. V.

    2017-01-01

    Matrix elements between shifted correlated Gaussians of various potentials with several form-factors are calculated analytically. Analytic matrix elements are of importance for the correlated Gaussian method in quantum few-body physics.......Matrix elements between shifted correlated Gaussians of various potentials with several form-factors are calculated analytically. Analytic matrix elements are of importance for the correlated Gaussian method in quantum few-body physics....

  16. Finite element analysis of flexible, rotating blades

    Science.gov (United States)

    Mcgee, Oliver G.

    1987-01-01

    A reference guide that can be used when using the finite element method to approximate the static and dynamic behavior of flexible, rotating blades is given. Important parameters such as twist, sweep, camber, co-planar shell elements, centrifugal loads, and inertia properties are studied. Comparisons are made between NASTRAN elements through published benchmark tests. The main purpose is to summarize blade modeling strategies and to document capabilities and limitations (for flexible, rotating blades) of various NASTRAN elements.

  17. Superheavy Element Research at Tasca at GSI

    Science.gov (United States)

    Düllmann, Christoph E.

    2014-09-01

    Experiments on the synthesis of the heaviest elements are in the center of the current research program on superheavy elements at GSI Darmstadt. At the gas-filled recoil separator TASCA, search experiments for the new elements 119 and 120 have been performed in the reactions 50Ti + 249Bk and 50Ti + 249Cf, respectively, and the production of element 117 in the reaction 48Ca + 249Bk was studied. The experiments were performed successfully and the data are currently under analysis.

  18. Elements from chlorine to calcium nuclear reactions

    CERN Document Server

    Kunz, Wunibald

    1968-01-01

    Nuclear Tables: Part II Nuclear Reactions, Volume 3: The Elements from Chlorine to Calcium contains tabulations of the nuclear reaction values of elements chlorine, argon, potassium, and calcium. These tabulations provide the calculated Q-values of the elements and their isotopes. This book will be of value to general chemistry researchers.

  19. Data Element Dictionary: Facilities. Preliminary Draft.

    Science.gov (United States)

    Thomas, Charles R.

    The draft includes--(1) comments on file structure, (2) descriptions of dictionary organization and format, (3) alphabetical lists of elements, and (4) facilities related elements in dictionary form. The data element definitions in this draft are compatible with the Higher Education Facilities Classification and Inventory Procedures Manual, which…

  20. 40 CFR 721.10068 - Elemental mercury.

    Science.gov (United States)

    2010-07-01

    ... 40 Protection of Environment 30 2010-07-01 2010-07-01 false Elemental mercury. 721.10068 Section... Substances § 721.10068 Elemental mercury. (a) Definitions. The definitions in § 721.3 apply to this section... elemental mercury (CAS. No. 7439-97-6) is subject to reporting under this section for the significant...

  1. Main: ELEMENT1GMLBC3 [PLACE

    Lifescience Database Archive (English)

    Full Text Available ELEMENT1GMLBC3 S000319 7-Sep-2000 (last modified) seki Element 1 found in the promo...ter of soybean (G.m.) leghaemoglobin lbc3 gene; Binding site of nuclear extract from soybean nodules; Locate...Element 2 share a common motif; See S000320; nodule; leghaemoglobin; lbc3; root; Soybean (Glycine max) GATATATTAATATTTTATTTTATA ...

  2. An Improved Triangular Element With Drilling Rotations

    DEFF Research Database (Denmark)

    Damkilde, Lars; Grønne, Mikael

    2002-01-01

    by rotations in the corner nodes. Compared to Allman's plane element which was the first succesfull implementation of drilling rotations the proposed element has extra displacements in the mid-side nodes parallel to the element sides. The performance should therefore be better and closer to the LST...

  3. Element Cycles: An Environmental Chemistry Board Game

    Science.gov (United States)

    Pippins, Tracy; Anderson, Cody M.; Poindexter, Eric F.; Sultemeier, S. Whitney; Schultz, Linda D.

    2011-01-01

    "Element Cycles" is an activity designed to reinforce correlation of essential elements and their different forms in the ecosystem. Students are assigned essential elements to research as homework, then share results, and construct game boards with four ecosphere sections: geosphere (earth), hydrosphere (water), atmosphere (air), and biosphere…

  4. Element Cycles: An Environmental Chemistry Board Game

    Science.gov (United States)

    Pippins, Tracy; Anderson, Cody M.; Poindexter, Eric F.; Sultemeier, S. Whitney; Schultz, Linda D.

    2011-01-01

    "Element Cycles" is an activity designed to reinforce correlation of essential elements and their different forms in the ecosystem. Students are assigned essential elements to research as homework, then share results, and construct game boards with four ecosphere sections: geosphere (earth), hydrosphere (water), atmosphere (air), and biosphere…

  5. Superheavy elements: existence, classification and experiment

    OpenAIRE

    Kostyghin, V. A.; Vaschenko, V. M.; Loza, Ye. A.

    2012-01-01

    This paper proposes spatial periodic table developed based on classic electron shell structure model. The periodic table determines location and chemical properties of superheavy elements. 14 new long-living superheavy elements found by Proton-21 laboratory and one long-living superheavy element found by A.Marinov were identified.

  6. Downhole elemental analysis with LIBS

    Science.gov (United States)

    Moreschini, P.; Zacny, K.; Rickman, D.

    2011-12-01

    In this paper we discuss a novel instrument, currently under development at Honeybee Robotics with SBIR funding from NASA. The device is designed to characterize elemental composition as a function of depth in non-terrestrial geological formations. The instrument consists of a miniaturized LIBS analyzer integrated in a 2" diameter drill string. While the drill provides subsurface access, the LIBS analyzer provides information on the elemental composition of the borehole wall. This instrument has a variety of space applications ranging from exploration of the Moon for which it was originally designed, to Mars, as well as a variety of terrestrial applications. Subsurface analysis is usually performed by sample acquisition through a drill or excavator, followed by sample preparation and subsequent sample presentation to an instrument or suite of instruments. An alternative approach consisting in bringing a miniaturized version of the instrument to the sample has many advantages over the traditional methodology, as it allows faster response, reduced probability of cross-contamination and a simplification in the sampling mechanisms. LIBS functions by focusing a high energy laser on a material inducing a plasma consisting of a small fraction of the material under analysis. Optical emission from the plasma, analyzed by a spectrometer, can be used to determine elemental composition. A triangulation sensor located in the sensor head determines the distance of the sensor from the borehole wall. An actuator modifies the position of the sensor accordingly, in order to compensate for changes due to the profile of the borehole walls. This is necessary because LIBS measurements are negatively affected by changes in the relative position of the focus of the laser with respect to the position of the sample (commonly referred to as the "lens to sample distance"). Profiling the borehole is done by adjusting the position of the sensor with a vertical stage; a second actuator at the

  7. Common Data Elements in Radiology.

    Science.gov (United States)

    Rubin, Daniel L; Kahn, Charles E

    2017-06-01

    Diagnostic radiologists generally produce unstructured information in the form of images and narrative text reports. Although designed for human consumption, radiologic reports contain a wealth of information that could be valuable for clinical care, research, and quality improvement if that information could be extracted by automated systems. Unfortunately, the lack of structure in radiologic reports limits the ability of information systems to share information easily with other systems. A common data element (CDE)-a unit of information used in a shared, predefined fashion-can improve the ability to exchange information seamlessly among information systems. In this article, a model and a repository of radiologic CDEs is described, and three important applications are highlighted. CDEs can help advance radiologic practice, research, and performance improvement, and thus, it is crucial that CDEs be adopted widely in radiologic information systems. (©) RSNA, 2016.

  8. Elements of the cognitive universe

    Science.gov (United States)

    Topsøe, Flemming

    2017-06-01

    "The least biased inference, taking available information into account, is the one with maximum entropy". So we are taught by Jaynes. The many followers from a broad spectrum of the natural and social sciences point to the wisdom of this principle, the maximum entropy principle, MaxEnt. But "entropy" need not be tied only to classical entropy and thus to probabilistic thinking. In fact, the arguments found in Jaynes' writings and elsewhere can, as we shall attempt to demonstrate, profitably be revisited, elaborated and transformed to apply in a much more general abstract setting. The approach is based on game theoretical thinking. Philosophical considerations dealing with notions of cognition - basically truth and belief - lie behind. Quantitative elements are introduced via a concept of description effort. An interpretation of Tsallis Entropy is indicated.

  9. Elements of algebraic coding systems

    CERN Document Server

    Cardoso da Rocha, Jr, Valdemar

    2014-01-01

    Elements of Algebraic Coding Systems is an introductory textto algebraic coding theory. In the first chapter, you'll gain insideknowledge of coding fundamentals, which is essential for a deeperunderstanding of state-of-the-art coding systems.This book is a quick reference for those who are unfamiliar withthis topic, as well as for use with specific applications such as cryptographyand communication. Linear error-correcting block codesthrough elementary principles span eleven chapters of the text.Cyclic codes, some finite field algebra, Goppa codes, algebraic decodingalgorithms, and applications in public-key cryptography andsecret-key cryptography are discussed, including problems and solutionsat the end of each chapter. Three appendices cover the Gilbertbound and some related derivations, a derivation of the Mac-Williams' identities based on the probability of undetected error,and two important tools for algebraic decoding-namely, the finitefield Fourier transform and the Euclidean algorithm for polynomials.

  10. Thermionic fuel element technology status

    Science.gov (United States)

    Holland, J. W.; Horner, M. W.; Yang, L.

    1985-01-01

    The results of research, conducted between the mid-1960s and 1973, on the multiconverter thermionic fuel elements (TFEs) that comprise the reactor core of an SP-100 thermionic reactor system are presented. Fueled-emitter technology, insulator technology and cell and TFE assembly technology of the prototypical TFEs which were tested in-pile and out-of-pile during these years are described. The proto-TFEs have demonstrated reproducible performance within 5 percent and no premature failures within the 1.5 yr of operation (with projected 3-yr lifetimes). The two primary life-limiting factors had been identified as thermionic emitter dimensional increase due to interactions with the fuel and electrical insulator structural damage from fast neutrons. Multiple options for extending TFE lifetimes to 7 yr or longer are available and will be investigated in the 1984-1985 SP-100 program for resolution of critical technology issues. Design diagrams and test graphs are included.

  11. Spectroscopy of the Heaviest Elements

    Science.gov (United States)

    Clark, Roderick

    2009-10-01

    The specific ``magic'' proton and neutron numbers, representing major spherical shell gaps, beyond 208Pb are a matter of considerable debate. It is well established that nuclei near Z=100, N=152 (252Fm) have well-deformed prolate shapes. By performing prompt and delayed gamma-ray spectroscopy on deformed transfermium nuclei we can learn about the single-particle structure, shell gaps, pairing correlations, and excitation modes in the heaviest nuclei. After a brief overview of state-of-the-art measurements, I will describe recent results from experiments at the 88-Inch Cyclotron of the Lawrence Berkeley National Laboratory which use the Berkeley Gas-filled Separator (BGS). I will then discuss the prospects of a new generation of spectroscopy measurements on the heaviest elements when the BGS is used in conjunction with the GRETINA gamma--ray tracking array.

  12. A New Geochemical Classification of Elements

    Institute of Scientific and Technical Information of China (English)

    Qi Changmou; L. Lynn Chyi

    2001-01-01

    The geochemical classification proposed by Goldschmidt was based on meteoritic analysis and elemental partition in blast furnace. There are many surprises when applied to the discussion of natural occurrences. A modified classification of elements based on basic chemical properties and their occurrences. A modified classification of elements based on basic chemical properties and their occurrences in nature is, therefore, proposed for students learning geochemistry and geologists working in the field. Elements are classified into six groups including lithophile, oxyphile, siderophile, chalcophile, biophile, and atmophile elements. Five terms are taken from Goldshcmidt's original classification. Oxyphile is a new term.

  13. Remediation using trace element humate surfactant

    Energy Technology Data Exchange (ETDEWEB)

    Riddle, Catherine Lynn; Taylor, Steven Cheney; Bruhn, Debra Fox

    2016-08-30

    A method of remediation at a remediation site having one or more undesirable conditions in which one or more soil characteristics, preferably soil pH and/or elemental concentrations, are measured at a remediation site. A trace element humate surfactant composition is prepared comprising a humate solution, element solution and at least one surfactant. The prepared trace element humate surfactant composition is then dispensed onto the remediation site whereby the trace element humate surfactant composition will reduce the amount of undesirable compounds by promoting growth of native species activity. By promoting native species activity, remediation occurs quickly and environmental impact is minimal.

  14. Pump element for a tube pump

    DEFF Research Database (Denmark)

    2011-01-01

    The invention relates to a tube pump comprising a tube and a pump element inserted in the tube, where the pump element comprises a rod element and a first and a second non-return valve member positioned a distance apart on the rod element. The valve members are oriented in the same direction rela...... to a part of the tube. The invention further relates to a method for creating a flow of a fluid within an at least partly flexible tube by means of a pump element as mentioned above.......The invention relates to a tube pump comprising a tube and a pump element inserted in the tube, where the pump element comprises a rod element and a first and a second non-return valve member positioned a distance apart on the rod element. The valve members are oriented in the same direction...... portion acts to alternately close and open the valve members thereby generating a fluid flow through the tube. The invention further relates to a pump element comprising at least two non-return valve members connected by a rod element, and for insertion in an at least partly flexible tube in such tube...

  15. Transition elements based on transfinite interpolation

    Science.gov (United States)

    Odabas, Onur R.; Sarigul-Klijn, Nesrin

    1993-01-01

    In this study the transfinite interpolation methodology, a 'blending-function' method in particular, is utilized for the formulation of transition elements. The method offers a formal way of meeting continuity requirements in a transition element. Element shape functions are derived by blending the continuity requirements of individual boundary segments. The blending directions are naturally orthogonal in rectangular domains therefore interpolation of the boundaries over rectangular 2D and 3D elements can be performed with minimal effort. In triangular domains, however, the choice of blending directions and interpolants is not straightforward. For that reason, two interpolation techniques are proposed for blending of the boundaries of triangular domains. A series of transition elements of various classes compatible with elements of different orders and dimensions is developed and the full potential of the transfinite interpolation, as it applies to element formulation, is explored.

  16. Rare earth elements: end use and recyclability

    Science.gov (United States)

    Goonan, Thomas G.

    2011-01-01

    Rare earth elements are used in mature markets (such as catalysts, glassmaking, lighting, and metallurgy), which account for 59 percent of the total worldwide consumption of rare earth elements, and in newer, high-growth markets (such as battery alloys, ceramics, and permanent magnets), which account for 41 percent of the total worldwide consumption of rare earth elements. In mature market segments, lanthanum and cerium constitute about 80 percent of rare earth elements used, and in new market segments, dysprosium, neodymium, and praseodymium account for about 85 percent of rare earth elements used. Regardless of the end use, rare earth elements are not recycled in large quantities, but could be if recycling became mandated or very high prices of rare earth elements made recycling feasible.

  17. A NOVEL ELLIPSOIDAL ACOUSTIC INFINITE ELEMENT

    Institute of Scientific and Technical Information of China (English)

    YANG Rui-liang; WANG Hong-zhen

    2005-01-01

    A novel ellipsoidal acoustic infinite element is proposed. It is based a new pressure representation, which can describe and solve the ellipsoidal acoustic field more exactly. The shape functions of this novel acoustic infinite element are similar .to the Burnett's method, while the weight functions are defined as the product of the complex conjugates of the shaped functions and an additional weighting factor. The code of this method is cheap to generate as for 1-D element because only 1-D integral needs to be numerical. Coupling with the standard finite element, this method provides a capability for very efficiently modeling acoustic fields surrounding structures of virtually any practical shape. This novel method was deduced in brief and the conclusion was kept in detail. To test the feasibility of this novel method efficiently, in the examples the infinite elements were considered, excluding the finite elements relative. This novel ellipsoidal acoustic infinite element can deduce the analytic solution of an oscillating sphere. The example of a prolate spheroid shows that the novel infinite element is superior to the boundary element and other acoustic infinite elements. Analytical and numerical results of these examples show that this novel method is feasible.

  18. Trace Element Management in Rice

    Directory of Open Access Journals (Sweden)

    Abin Sebastian

    2015-08-01

    Full Text Available Trace elements (TEs are vital for the operation of metabolic pathways that promote growth and structural integrity. Paddy soils are often prone to TE limitation due to intensive cultivation and irrigation practices. Apart from this, rice paddies are potentially contaminated with transition metals such as Cd, which are often referred to as toxic TEs. Deficiency of TEs in the soil not only delays plant growth but also causes exposure of plant roots to toxic TEs. Fine-tuning of nutrient cycling in the rice field is a practical solution to cope with TEs deficiency. Adjustment of soil physicochemical properties, biological process such as microbial activities, and fertilization helps to control TEs mobilization in soil. Modifications in root architecture, metal transporters activity, and physiological processes are also promising approaches to enhance TEs accumulation in grains. Through genetic manipulation, these modifications help to increase TE mining capacity of rice plants as well as transport and trafficking of TEs into the grains. The present review summarizes that regulation of TE mobilization in soil, and the genetic improvement of TE acquisition traits help to boost essential TE content in rice grain.

  19. Recycling of Rare Earth Elements

    Science.gov (United States)

    Lorenz, Tom; Bertau, Martin

    2017-01-01

    Any development of an effective process for rare earth (RE) recycling has become more and more challenging, especially in recent years. Since 2011, when commodity prices of REs had met their all-time maximum, prices have dropped rapidly by more than 90 %. An economic process able to offset these fluctuations has to take unconventional methods into account beside well-known strategies like acid/basic leaching or solvent extraction. The solid-state chlorination provides such an unconventional method for mobilizing RE elements from waste streams. Instead of hydrochloric acid this kind of chlorination decomposes NH4Cl thermally to release up to 400 °C hot HCl gas. After cooling the resulting solid metal chlorides may be easily dissolved in pH-adjusted water. Without producing strongly acidic wastes and with NH4Cl as cheap source for hydrogen chloride, solid-state chlorination provides various advantages in terms of costs and disposal. In the course of the SepSELSA project this method was examined, adjusted and optimized for RE recycling from fluorescent lamp scraps as well as Fe14Nd2B magnets. Thereby many surprising influences and trends required various analytic methods to examine the reasons and special mechanisms behind them.

  20. Interstitial Functionalization in elemental Si

    Science.gov (United States)

    Kiefer, Boris; Fohtung, Edwin

    Societies in the 21st century will face many challenges. Materials science and materials design will be essential to address and master some if not all of these challenges. Semiconductors are among the most important technological material classes. Properties such as electrical transport are strongly affected by defects and a central goal continues to be the reduction of defect densities as much as possible in these compounds. Here we present results of interstitial Fe doping in elemental Si using first-principles DFT calculations. The preliminary results show that Fe will only occupy octahedral interstitial sites. The analysis of the electronic structure shows that the compounds are ferromagnetic and that a bandgap opens as interstitial Fe concentrations decrease, with a possible intermittent semi-metallic phase. The formation energy for interstitial Fe is unfavorable, as expected, by ~1.5 eV but becomes favorable as the chemical potential of Fe increases. Therefore, we expect that biasing the system with an external electrical field will lead to the formation of these materials. Thus, our results show that interstitial defects can be beneficial for the design of functionalities that differ significantly from those of the host material.

  1. Functional Metamirrors Using Bianisotropic Elements

    Science.gov (United States)

    Asadchy, V. S.; Ra'di, Y.; Vehmas, J.; Tretyakov, S. A.

    2015-03-01

    Conventional mirrors obey the simple reflection law that a plane wave is reflected as a plane wave, at the same angle. To engineer spatial distributions of fields reflected from a mirror, one can either shape the reflector or position some phase-correcting elements on top of a mirror surface. Here we show, both theoretically and experimentally, that full-power reflection with general control over the reflected wave phase is possible with a single-layer array of deeply subwavelength inclusions. These proposed artificial surfaces, metamirrors, provide various functions of shaped or nonuniform reflectors without utilizing any mirror. This can be achieved only if the forward and backward scattering of the inclusions in the array can be engineered independently, and we prove that it is possible using electrically and magnetically polarizable inclusions. The proposed subwavelength inclusions possess desired reflecting properties at the operational frequency band, while at other frequencies the array is practically transparent. The metamirror concept leads to a variety of applications over the entire electromagnetic spectrum, such as optically transparent focusing antennas for satellites, multifrequency reflector antennas for radio astronomy, low-profile conformal antennas for telecommunications, and nanoreflectarray antennas for integrated optics.

  2. Quantum mechanics and elements of reality

    OpenAIRE

    Mohrhoff, Ulrich

    1999-01-01

    It is widely accepted that a Born probability of 1 is sufficient for the existence of a corresponding element of reality. Recently Vaidman has extended this idea to the ABL probabilities of the time-symmetrized version of quantum mechanics originated by Aharonov, Bergmann, and Lebowitz. Several authors have objected to Vaidman's time-symmetrized elements of reality without casting doubt on the widely accepted sufficiency condition for `ordinary' elements of reality. In this paper I show that ...

  3. DETERMINATION OF IMPURITY ELEMENTS IN ALUMINIUM

    Institute of Scientific and Technical Information of China (English)

    侯小琳; 张永保

    1994-01-01

    Twenty five impurity elements in aluminium applied as reactor material are determined.Titanium and nickel are determined with epithermal neutron activation analysis(NAA),magnesium and silicon by inductance coupling plasma emission spectra(ICP),other elements by thermal NAA.The fission coefficient of uranium is given by an experiment,the interferences of uranium to Ce,Nd,Mo,Zr,La,Sm are subtracted.The detection limits of these methods to all of impurity elements in aluminium are calculated.

  4. Superheavy Elements Challenge Experimental and Theoretical Chemistry

    CERN Document Server

    Zvára, I

    2003-01-01

    When reflecting on the story of superheavy elements, the an experimenter, acknowledges the role, which the predictions of nuclear and chemical theories have played in ongoing studies. Today, the problems of major interest for experimental chemistry are the studies of elements 112 and 114 including their chemical identification. Advanced quantum chemistry calculations of atoms and molecules would be of much help. First experiments with element 112 evidence that the metal is much more volatile and inert than mercury.

  5. Noncoding Elements: Evolution and Epigenetic Regulation

    KAUST Repository

    Seridi, Loqmane

    2016-03-09

    When the human genome project was completed, it revealed a surprising result. 98% of the genome did not code for protein of which more than 50% are repeats— later known as ”Junk DNA”. However, comparative genomics unveiled that many noncoding elements are evolutionarily constrained; thus luckily to have a role in genome stability and regulation. Though, their exact functions remained largely unknown. Several large international consortia such as the Functional Annotation of Mammalian Genomes (FANTOM) and the Encyclopedia of DNA Elements (ENCODE) were set to understand the structure and the regulation of the genome. Specifically, these endeavors aim to measure and reveal the transcribed components and functional elements of the genome. One of the most the striking findings of these efforts is that most of the genome is transcribed, including non-conserved noncoding elements and repeat elements. Specifically, we investigated the evolution and epigenetic properties of noncoding elements. 1. We compared genomes of evolutionarily distant species and showed the ubiquity of constrained noncoding elements in metazoa. 2. By integrating multi-omic data (such as transcriptome, nucleosome profiling, histone modifications), I conducted a comprehensive analysis of epigenetic properties (chromatin states) of conserved noncoding elements in insects. We showed that those elements have distinct and protective sequence features, undergo dynamic epigenetic regulation, and appear to be associated with the structural components of the chromatin, replication origins, and nuclear matrix. 3. I focused on the relationship between enhancers and repetitive elements. Using Cap Analysis of Gene Expression (CAGE) and RNASeq, I compiled a full catalog of active enhancers (a class of noncoding elements) during myogenesis of human primary cells of healthy donors and donors affected by Duchenne muscular dystrophy (DMD). Comparing the two time-courses, a significant change in the epigenetic

  6. Exact finite elements for conduction and convection

    Science.gov (United States)

    Thornton, E. A.; Dechaumphai, P.; Tamma, K. K.

    1981-01-01

    An appproach for developing exact one dimensional conduction-convection finite elements is presented. Exact interpolation functions are derived based on solutions to the governing differential equations by employing a nodeless parameter. Exact interpolation functions are presented for combined heat transfer in several solids of different shapes, and for combined heat transfer in a flow passage. Numerical results demonstrate that exact one dimensional elements offer advantages over elements based on approximate interpolation functions. Previously announced in STAR as N81-31507

  7. Domain decomposition methods for mortar finite elements

    Energy Technology Data Exchange (ETDEWEB)

    Widlund, O.

    1996-12-31

    In the last few years, domain decomposition methods, previously developed and tested for standard finite element methods and elliptic problems, have been extended and modified to work for mortar and other nonconforming finite element methods. A survey will be given of work carried out jointly with Yves Achdou, Mario Casarin, Maksymilian Dryja and Yvon Maday. Results on the p- and h-p-version finite elements will also be discussed.

  8. Composite structure of auxin response elements.

    Science.gov (United States)

    Ulmasov, T; Liu, Z B; Hagen, G; Guilfoyle, T J

    1995-10-01

    The auxin-responsive soybean GH3 gene promoter is composed of multiple auxin response elements (AuxREs), and each AuxRE contributes incrementally to the strong auxin inducibility to the promoter. Two independent AuxREs of 25 bp (D1) and 32 bp (D4) contain the sequence TGTCTC. Results presented here show that the TGTCTC element in D1 and D4 is required but not sufficient for auxin inducibility in carrot protoplast transient expression assays. Additional nucleotides upstream of TGTCTC are also required for auxin inducibility. These upstream sequences showed constitutive activity and no auxin inducibility when part or all of the TGTCTC element was mutated or deleted. In D1, the constitutive element overlaps the 5' portion of TGTCTC; in D4, the constitutive element is separated from TGTCTC. An 11-bp element in D1, CCTCGTGTCTC, conferred auxin inducibility to a minimal cauliflower mosaic virus 35S promoter in transgenic tobacco seedlings as well as in carrot protoplasts (i.e., transient expression assays). Both constitutive elements bound specifically to plant nuclear proteins, and the constitutive element in D1 bound to a recombinant soybean basic leucine zipper transcription factor with G-box specificity. To demonstrate further the composite nature of AuxREs and the ability of the TGTCTC element to confer auxin inducibility, we created a novel AuxRE by placing a yeast GAL4 DNA binding site adjacent to the TGTCTC element. Expression of a GAL4-c-Rel transactivator in the presence of this novel AuxRE resulted in auxin-inducible expression. Our results indicate that at least some AuxREs have a composite structure consisting of a constitutive element adjacent to a conserved TGTCTC element that confers auxin inducibility.

  9. Benchmarking the QUAD4/TRIA3 element

    Science.gov (United States)

    Pitrof, Stephen M.; Venkayya, Vipperla B.

    1993-01-01

    The QUAD4 and TRIA3 elements are the primary plate/shell elements in NASTRAN. These elements enable the user to analyze thin plate/shell structures for membrane, bending and shear phenomena. They are also very new elements in the NASTRAN library. These elements are extremely versatile and constitute a substantially enhanced analysis capability in NASTRAN. However, with the versatility comes the burden of understanding a myriad of modeling implications and their effect on accuracy and analysis quality. The validity of many aspects of these elements were established through a series of benchmark problem results and comparison with those available in the literature and obtained from other programs like MSC/NASTRAN and CSAR/NASTRAN. Never-the-less such a comparison is never complete because of the new and creative use of these elements in complex modeling situations. One of the important features of QUAD4 and TRIA3 elements is the offset capability which allows the midsurface of the plate to be noncoincident with the surface of the grid points. None of the previous elements, with the exception of bar (beam), has this capability. The offset capability played a crucial role in the design of QUAD4 and TRIA3 elements. It allowed modeling layered composites, laminated plates and sandwich plates with the metal and composite face sheets. Even though the basic implementation of the offset capability is found to be sound in the previous applications, there is some uncertainty in relatively simple applications. The main purpose of this paper is to test the integrity of the offset capability and provide guidelines for its effective use. For the purpose of simplicity, references in this paper to the QUAD4 element will also include the TRIA3 element.

  10. The elements of life and medicines.

    Science.gov (United States)

    Chellan, Prinessa; Sadler, Peter J

    2015-03-13

    Which elements are essential for human life? Here we make an element-by-element journey through the periodic table and attempt to assess whether elements are essential or not, and if they are, whether there is a relevant code for them in the human genome. There are many difficulties such as the human biochemistry of several so-called essential elements is not well understood, and it is not clear how we should classify elements that are involved in the destruction of invading microorganisms, or elements which are essential for microorganisms with which we live in symbiosis. In general, genes do not code for the elements themselves, but for specific chemical species, i.e. for the element, its oxidation state, type and number of coordinated ligands, and the coordination geometry. Today, the biological periodic table is in a position somewhat similar to Mendeleev's chemical periodic table of 1869: there are gaps and we need to do more research to fill them. The periodic table also offers potential for novel therapeutic and diagnostic agents, based on not only essential elements, but also non-essential elements, and on radionuclides. Although the potential for inorganic chemistry in medicine was realized more than 2000 years ago, this area of research is still in its infancy. Future advances in the design of inorganic drugs require more knowledge of their mechanism of action, including target sites and metabolism. Temporal speciation of elements in their biological environments at the atomic level is a major challenge, for which new methods are urgently needed.

  11. Photoshop Elements 8 After the Shoot

    CERN Document Server

    Fitzgerald, Mark

    2010-01-01

    A handy, full-color reference for using Photoshop Elements 8 while on the go. Photoshop Elements combines an easy-to-use set of features and enhancements with image editing power in an affordable program. The newest version—Photoshop Elements 8—features more online integration with products like the new Flash-based Web galleries. Featuring a convenient trim size that goes where you go, this portable guide is essential reading for Elements users and especially suited if you are a mobile user who wants to edit and post your digital photographs while on the go.: Serves as a portable reference for

  12. Jucys-Murphy elements for partition algebras

    CERN Document Server

    Enyang, John

    2010-01-01

    An inductive formula is given for a family of elements which are shown to play a role in the partition algebras which is analogous to the part played by classical Jucys-Murphy elements in the symmetric group. Using Schur-Weyl duality it is shown that the aforementioned inductive definition is equivalent to the combinatorial definition given by Halverson and Ram for Jucys-Murphy elements of partition algebras. As a consequence of the inductive formula for Jucys-Murphy elements, a new presentation for partition algebras in terms of certain involutions is also derived.

  13. Trace Elements in Ovaries: Measurement and Physiology.

    Science.gov (United States)

    Ceko, Melanie J; O'Leary, Sean; Harris, Hugh H; Hummitzsch, Katja; Rodgers, Raymond J

    2016-04-01

    Traditionally, research in the field of trace element biology and human and animal health has largely depended on epidemiological methods to demonstrate involvement in biological processes. These studies were typically followed by trace element supplementation trials or attempts at identification of the biochemical pathways involved. With the discovery of biological molecules that contain the trace elements, such as matrix metalloproteinases containing zinc (Zn), cytochrome P450 enzymes containing iron (Fe), and selenoproteins containing selenium (Se), much of the current research focuses on these molecules, and, hence, only indirectly on trace elements themselves. This review focuses largely on two synchrotron-based x-ray techniques: X-ray absorption spectroscopy and x-ray fluorescence imaging that can be used to identify the in situ speciation and distribution of trace elements in tissues, using our recent studies of bovine ovaries, where the distribution of Fe, Se, Zn, and bromine were determined. It also discusses the value of other techniques, such as inductively coupled plasma mass spectrometry, used to garner information about the concentrations and elemental state of the trace elements. These applications to measure trace elemental distributions in bovine ovaries at high resolutions provide new insights into possible roles for trace elements in the ovary.

  14. Unified Framework for Finite Element Assembly

    CERN Document Server

    Alnæs, Martin Sandve; Mardal, Kent-Andre; Skavhaug, Ola; Langtangen, Hans Petter; 10.1504/IJCSE.2009.029160

    2012-01-01

    At the heart of any finite element simulation is the assembly of matrices and vectors from discrete variational forms. We propose a general interface between problem-specific and general-purpose components of finite element programs. This interface is called Unified Form-assembly Code (UFC). A wide range of finite element problems is covered, including mixed finite elements and discontinuous Galerkin methods. We discuss how the UFC interface enables implementations of variational form evaluation to be independent of mesh and linear algebra components. UFC does not depend on any external libraries, and is released into the public domain.

  15. EDITORIAL: King of the elements? King of the elements?

    Science.gov (United States)

    Demming, Anna

    2010-07-01

    Throughout the history of science, carbon-based research has played a defining role in the development of a range of fundamental and technological fields. It was used in Avagadro's definition of the mole in the early 18th century, it provides the 'backbone' of molecules in organic compounds, and in the environmental debate currently raging in the press and international government discussions, the 'carbon footprint' has become the metric of our species' impact on our planet. Also in nanotechnology, with the discovery of various wonder materials, carbon is once again asserting its claim as king of the elements. Until the 1980s the only known forms of carbon were diamond, graphite and amorphous carbon, as in soot or charcoal. In 1985 Robert Curl, Harold Kroto and Richard Smalley reported the existence of fullerenes, spherical structures comprising hexagonal carbon rings [1], work for which they won the Nobel Prize for Chemistry in 1996 [2]. The discovery of fullerenes was followed in 1991 by Sumio Ijima with the discovery of rolled graphite sheets, the carbon nanotube [3]. The discovery of these novel carbon nanostructures inspired researchers in a range of fields, largely as a result of the extraordinary capacity for investigations of these structures to reveal ever more intriguing properties. One of the fascinating properties attributed to carbon nanotubes is their phenomenal strength, with a Young's modulus of single walled carbon nanotubes approaching a terapascal [4]. Ingenious methods of harnessing this strength have since been developed, including bucky paper, a term used to refer to a mat of randomly self-entangled carbon nanotubes. Steven Crannford and Markus Buehler have recently reported a novel computational technique for probing the mechanical properties of these structures and show that the Young's modulus of bucky paper can be tuned by manipulation of the carbon nanotube type and density [5]. The electrical properties of carbon nanotubes, which depend

  16. Why do probabilistic finite element analysis ?

    CERN Document Server

    Thacker, B H

    2008-01-01

    The intention of this book is to provide an introduction to performing probabilistic finite element analysis. As a short guideline, the objective is to inform the reader of the use, benefits and issues associated with performing probabilistic finite element analysis without excessive theory or mathematical detail.

  17. Quadrature representation of finite element variational forms

    DEFF Research Database (Denmark)

    Ølgaard, Kristian Breum; Wells, Garth N.

    2012-01-01

    This chapter addresses the conventional run-time quadrature approach for the numerical integration of local element tensors associated with finite element variational forms, and in particular automated optimizations that can be performed to reduce the number of floating point operations...

  18. Kazhdan-Lusztig polynomials of boolean elements

    CERN Document Server

    Mongelli, Pietro

    2011-01-01

    We give closed combinatorial product formulas for Kazhdan-Lusztig poynomials and their parabolic analogue of type q in the case of boolean elements, introduced in [M. Marietti, Boolean elements in Kazhdan-Lusztig theory, J. Algebra 295 (2006)], in Coxeter groups whose Coxeter graph is a tree.

  19. 42 CFR 56.203 - Project elements.

    Science.gov (United States)

    2010-10-01

    ... SERVICES Grants for Planning and Developing Migrant Health Centers § 56.203 Project elements. A project for... population, based on the assessment prepared pursuant to paragraph (b) of this section which indicates in... 42 Public Health 1 2010-10-01 2010-10-01 false Project elements. 56.203 Section 56.203...

  20. 42 CFR 51c.203 - Project elements.

    Science.gov (United States)

    2010-10-01

    ... SERVICES Grants for Planning and Developing Community Health Centers § 51c.203 Project elements. A project... fulfill the needs identified in the assessment prepared pursuant to paragraph (a) of this section and how... 42 Public Health 1 2010-10-01 2010-10-01 false Project elements. 51c.203 Section 51c.203...

  1. The forgotten Elements of Action Learning

    DEFF Research Database (Denmark)

    Nunez, Heilyn Camacho; Aguirre, María

    The aim of this article is to provide a discussion and description of some topics of action learning that are not so commonly discussed in the literature and that I have called ‘the forgotten elements of action learning’. Those elements are dealing with Revans’ moral, spiritual and ethical reflec...

  2. Reference: ELEMENT2GMLBC3 [PLACE

    Lifescience Database Archive (English)

    Full Text Available ELEMENT2GMLBC3 Jensen EO, Marcker KA, Schell J, de Bruijn J Interaction of a nodule... specific, trans-acting factor with distinct DNA elements in the soybean leghaemoglobin lbc3 5' upstream region EMBO J 7:1265-1271 (1988) ...

  3. Reference: ELEMENT1GMLBC3 [PLACE

    Lifescience Database Archive (English)

    Full Text Available ELEMENT1GMLBC3 Jensen EO, Marcker KA, Schell J, de Bruijn J Interaction of a nodule... specific, trans-acting factor with distinct DNA elements in the soybean leghaemoglobin lbc3 5' upstream region EMBO J 7:1265-1271 (1988) ...

  4. Enhanced patch test of finite element methods

    Institute of Scientific and Technical Information of China (English)

    CHEN; Wanji

    2006-01-01

    Theoretically, the constant stress patch test is not rigorous. Also, either the patch test of non-zero constant shear for Mindlin plate problem or non-zero strain gradient curvature of the microstructures cannot be performed. To improve the theory of the patch test, in this paper, based on the variational principle with relaxed continuity requirement of nonconforming element for homogeneous differential equations, the author proposed the individual element condition for passing the patch test and the convergence condition of the element: besides passing the patch test, the element function should include the rigid body modes and constant strain modes and satisfy the weak continuity condition, and no extra zero energy modes occur. Moreover, the author further established a variational principle with relaxed continuity requirement of nonconforming element for inhomogeneous differential equations, the enhanced patch test condition and the individual element condition. To assure the convergence of the element that should pass the enhanced patch test, the element function should include the rigid body modes and non-zero strain modes which satisfied the equilibrium equations, and no spurious zero energy modes occur and should satisfy new weak continuity condition. The theory of the enhanced patch test proposed in this paper can be applied to both homogeneous and inhomogeneous differential equations. Based on this theory, the patch test of the non-zero constant shear stress for Mindlin plate and the C0-1 patch test of the non-zero constant curvature for the couple stress/strain gradient theory were established.

  5. 47 CFR 97.505 - Element credit.

    Science.gov (United States)

    2010-10-01

    ... 47 Telecommunication 5 2010-10-01 2010-10-01 false Element credit. 97.505 Section 97.505... SERVICE Qualifying Examination Systems § 97.505 Element credit. (a) The administering VEs must give credit.... (b) No examination credit, except as herein provided, shall be allowed on the basis of holding or...

  6. Finite-Element Software for Conceptual Design

    DEFF Research Database (Denmark)

    Lindemann, J.; Sandberg, G.; Damkilde, Lars

    2010-01-01

    and research. Forcepad is an effort to provide a conceptual design and teaching tool in a finite-element software package. Forcepad is a two-dimensional finite-element application based on the same conceptual model as image editing applications such as Adobe Photoshop or Microsoft Paint. Instead of using...

  7. MODERATOR ELEMENTS FOR UNIFORM POWER NUCLEAR REACTOR

    Science.gov (United States)

    Balent, R.

    1963-03-12

    This patent describes a method of obtaining a flatter flux and more uniform power generation across the core of a nuclear reactor. The method comprises using moderator elements having differing moderating strength. The elements have an increasing amount of the better moderating material as a function of radial and/or axial distance from the reactor core center. (AEC)

  8. Just-in-time elements and benefits

    CERN Document Server

    García-Alcaraz, Jorge Luis

    2016-01-01

    This book reports the elements required for implementing Just in Time (JIT) technique in companies. The main reasons for low implementation processes and the main benefits from the successful implementation of them are highlighted in this book. Structural equation models are presented to help identify the essential elements in JIT.

  9. Explicit free‐floating beam element

    DEFF Research Database (Denmark)

    Nielsen, Martin Bjerre; Krenk, Steen

    2014-01-01

    via scalar products of the element related vectors. This leads to a homogeneous quadratic strain definition in terms of the generalized displacements, whereby the elastic energy becomes at most bi‐quadratic. Additionally, the use of independent equilibrium modes to set up the element stiffness avoids...

  10. Non-linear finite element modeling

    DEFF Research Database (Denmark)

    Mikkelsen, Lars Pilgaard

    The note is written for courses in "Non-linear finite element method". The note has been used by the author teaching non-linear finite element modeling at Civil Engineering at Aalborg University, Computational Mechanics at Aalborg University Esbjerg, Structural Engineering at the University...... on the governing equations and methods of implementing....

  11. Protein export elements from Lactococcus lactis

    NARCIS (Netherlands)

    Perez-Martinez, Gaspar; Kok, Jan; Venema, Gerhardus; Dijl, Jan Maarten van; Smith, Hilda; Bron, Sierd

    1992-01-01

    Broad-host-range plasmids carrying α-amylase or β-lactamase reporter genes lacking a signal sequence were used to select export elements from Lactococcus lactis chromosomal DNA that could function as signal sequences. Fragments containing such elements were identified by their ability to direct the

  12. Key Instructional Design Elements for Distance Education.

    Science.gov (United States)

    Zheng, Lihua; Smaldino, Sharon

    2003-01-01

    Suggests that distance education instructors need to understand and apply important instructional design elements in order to successfully fulfill their role as instructional designers. Reviews the most recent literature pertaining to designing instruction in distance education. Identifies some key instructional design elements for teaching at a…

  13. Micromagnetic simulations of semielliptical permalloy elements

    Energy Technology Data Exchange (ETDEWEB)

    Waifalkar, P.P.; Patil, P.S. [Thin Film Materials Laboratory, Department of Physics, Shivaji University, Kolhapur 416004, Maharashtra (India); Patil, P.B., E-mail: prashantphy@gmail.com [Department of Physics, The New College, Kolhapur 416012, Maharashtra (India)

    2014-09-01

    Magnetic spin configuration of patterned semielliptical permalloy elements useful for transportation of biofunctionlized magnetic particles was investigated by micromagnetic simulations. A demagnetized state at zero field shows a stable vortex state around the center. Application of 100 Oe field along a short axis of semiellipse was found to be sufficient to completely saturate the element along the field direction.

  14. Protein export elements from Lactococcus lactis

    NARCIS (Netherlands)

    Perez-Martinez, Gaspar; Kok, Jan; Venema, Gerhardus; Dijl, Jan Maarten van; Smith, Hilda; Bron, Sierd

    Broad-host-range plasmids carrying α-amylase or β-lactamase reporter genes lacking a signal sequence were used to select export elements from Lactococcus lactis chromosomal DNA that could function as signal sequences. Fragments containing such elements were identified by their ability to direct the

  15. Thermodynamic Data For 50 Chemical Elements

    Science.gov (United States)

    Mcbride, Bonnie J.; Gordon, Sanford; Reno, Martin A.

    1995-01-01

    Report presents data on thermo-dynamic properties of 50 chemical elements, isotope (deuterium) of one of elements, and electron gas, all in standard reference states. Data tabulated as functions of temperature; also given in form of least-squares-fit coefficients of two functional forms for heat capacities at constant pressure in standard states, with constants of integration for enthalpy and entropy.

  16. Trace elements in animal production systems

    NARCIS (Netherlands)

    Schlegel, P.; Durosoy, S.; Jongbloed, A.W.

    2008-01-01

    This book deals with trace elements, such as cobalt, copper, iron, manganese, selenium and zinc which are essential to modern animal nutrition, but are increasingly detrimental to soil and water quality in today's globalized production. The goal in finding a sustainable balance between trace element

  17. A method for making an alkaline element

    Energy Technology Data Exchange (ETDEWEB)

    Obi, F.; Takada, K.

    1983-05-11

    A mixture of asphalt with polybutene is applied to the contacting surfaces of the body top and the hermetically sealing stuffing. After assembly the element is heated to a temperature which exceeds the softening point of the mixture. The edge of the body is rolled in. The element has high reliability.

  18. Multi-Element Lean Direct Injection Combustor Single Element Demonstration Project

    Data.gov (United States)

    National Aeronautics and Space Administration — We propose to demonstrate the feasibility in a single element of a Multi-Element Lean Direct Injection, ME-LDI, Combustion concept. The concept will have the...

  19. A new multiresolution finite element method based on a multiresolution quadrilateral plate element

    CERN Document Server

    Xia, YiMing

    2014-01-01

    A new multiresolution quadrilateral plate element is proposed and a multiresolution finite element method is hence presented. The multiresolution analysis (MRA) framework is formulated out of a mutually nesting displacement subspace sequence, whose basis functions are constructed of scaling and shifting on the element domain of basic node shape function. The basic node shape function is constructed by extending shape function around a specific node. The MRA endows the proposed element with the resolution level (RL) to adjust the element node number, thus modulating structural analysis accuracy accordingly. As a result, the traditional 4-node quadrilateral plate element and method is a monoresolution one and also a special case of the proposed element and method. The meshing for the monoresolution plate element model is based on the empiricism while the RL adjusting for the multiresolution is laid on the rigorous mathematical basis. The accuracy of a structural analysis is fully determined by the RL, not by th...

  20. A multiresolution finite element method based on a new locking-free rectangular Mindlin plate element

    CERN Document Server

    Xia, Yi-Ming

    2015-01-01

    A locking-free rectangular Mindlin plate element with a new multi-resolution analysis (MRA) is proposed and a multireolution finite element method is hence presented. The MRA framework is formulated out of a mutually nesting displacement subspace sequence. The MRA endows the proposed element with the resolution level (RL) to adjust the element node number, thus modulating structural analysis accuracy accordingly. As a result, the traditional 4-node rectangular Mindlin plate element and method is a mono-resolution one and also a special case of the proposed element and method. The meshing for the monoresolution plate element model is based on the empiricism while the RL adjusting for the multiresolution is laid on the rigorous mathematical basis. The accuracy of a structural analysis is actually determined by the RL, not by the mesh. The rational MRA enables the implementation of the multiresolution Mindlin plate element method to be more rational and efficient than that of the conventional monoresolution or o...

  1. An Improved Linear Tetrahedral Element for Plasticity

    Energy Technology Data Exchange (ETDEWEB)

    Puso, M

    2005-04-25

    A stabilized, nodally integrated linear tetrahedral is formulated and analyzed. It is well known that linear tetrahedral elements perform poorly in problems with plasticity, nearly incompressible materials, and acute bending. For a variety of reasons, linear tetrahedral elements are preferable to quadratic tetrahedral elements in most nonlinear problems. Whereas, mixed methods work well for linear hexahedral elements, they don't for linear tetrahedrals. On the other hand, automatic mesh generation is typically not feasible for building many 3D hexahedral meshes. A stabilized, nodally integrated linear tetrahedral is developed and shown to perform very well in problems with plasticity, nearly incompressible materials and acute bending. Furthermore, the formulation is analytically and numerically shown to be stable and optimally convergent. The element is demonstrated to perform well in several standard linear and nonlinear benchmarks.

  2. Rolling Element Bearing Stiffness Matrix Determination (Presentation)

    Energy Technology Data Exchange (ETDEWEB)

    Guo, Y.; Parker, R.

    2014-01-01

    Current theoretical bearing models differ in their stiffness estimates because of different model assumptions. In this study, a finite element/contact mechanics model is developed for rolling element bearings with the focus of obtaining accurate bearing stiffness for a wide range of bearing types and parameters. A combined surface integral and finite element method is used to solve for the contact mechanics between the rolling elements and races. This model captures the time-dependent characteristics of the bearing contact due to the orbital motion of the rolling elements. A numerical method is developed to determine the full bearing stiffness matrix corresponding to two radial, one axial, and two angular coordinates; the rotation about the shaft axis is free by design. This proposed stiffness determination method is validated against experiments in the literature and compared to existing analytical models and widely used advanced computational methods. The fully-populated stiffness matrix demonstrates the coupling between bearing radial, axial, and tilting bearing deflections.

  3. Element 74, the Wolfram Versus Tungsten Controversy

    Energy Technology Data Exchange (ETDEWEB)

    Holden,N.E.

    2008-08-11

    Two and a quarter centuries ago, a heavy mineral ore was found which was thought to contain a new chemical element called heavy stone (or tungsten in Swedish). A few years later, the metal was separated from its oxide and the new element (Z=74) was called wolfram. Over the years since that time, both the names wolfram and tungsten were attached to this element in various countries. Sixty years ago, IUPAC chose wolfram as the official name for the element. A few years later, under pressure from the press in the USA, the alternative name tungsten was also allowed by IUPAC. Now the original, official name 'wolfram' has been deleted by IUPAC as one of the two alternate names for the element. The history of this controversy is described here.

  4. LOCKING-FREE DEGENERATED ISOPARAMETRIC SHELL ELEMENT

    Institute of Scientific and Technical Information of China (English)

    章向明; 王安稳; 何汉林

    2001-01-01

    An 8-noded locking-free degenerated isoparametric shell element is presented.A revised interpolation for shear strain terms was constructed in natural co-ordinate system such that all necessary modes ( translation, rotation and constant curvature ) are preserved,which can be used to eliminate shear locking. A revised interpolation for membrane strains was produced in the local Cartesian co-ordinate system to overcome membrane locking behavior. The new 8-noded element has the proper rank, with the requisite number of zero eigenvalues each associated with a rigid mode. The element does not exhibit membrane or shear locking for large span-thickness ratio. The element does not form element mechanisms or extra spurious zero energy modes. Therefore, it can be used for both thin and thick shells.

  5. Writing analytic element programs in Python.

    Science.gov (United States)

    Bakker, Mark; Kelson, Victor A

    2009-01-01

    The analytic element method is a mesh-free approach for modeling ground water flow at both the local and the regional scale. With the advent of the Python object-oriented programming language, it has become relatively easy to write analytic element programs. In this article, an introduction is given of the basic principles of the analytic element method and of the Python programming language. A simple, yet flexible, object-oriented design is presented for analytic element codes using multiple inheritance. New types of analytic elements may be added without the need for any changes in the existing part of the code. The presented code may be used to model flow to wells (with either a specified discharge or drawdown) and streams (with a specified head). The code may be extended by any hydrogeologist with a healthy appetite for writing computer code to solve more complicated ground water flow problems.

  6. Pump element for a tube pump

    DEFF Research Database (Denmark)

    2011-01-01

    relative to the rod element so as to allow for a fluid flow in the tube through the first valve member, along the rod element, and through the second valve member. The tube comprises an at least partly flexible tube portion between the valve members such that a repeated deformation of the flexible tube...... portion acts to alternately close and open the valve members thereby generating a fluid flow through the tube. The invention further relates to a pump element comprising at least two non-return valve members connected by a rod element, and for insertion in an at least partly flexible tube in such tube...... pump as mentioned above, thereby acting to generate a fluid flow through the tube upon repeated deformation of the tube between the two valve members. The pump element may comprise a connecting part for coupling to another tube and may comprise a sealing part establishing a fluid tight connection...

  7. Analysis and Design of a Context Adaptable SAD/MSE Architecture

    Directory of Open Access Journals (Sweden)

    Arvind Sudarsanam

    2009-01-01

    Full Text Available Design of flexible multimedia accelerators that can cater to multiple algorithms is being aggressively pursued in the media processors community. Such an approach is justified in the era of sub-45 nm technology where an increasingly dominating leakage power component is forcing designers to make the best possible use of on-chip resources. In this paper we present an analysis of two commonly used window-based operations (sum of absolute differences and mean squared error across a variety of search patterns and block sizes (2×3, 5×5, etc.. We propose a context adaptable architecture that has (i configurable 2D systolic array and (ii 2D Configurable Register Array (CRA. CRA can cater to variable pixel access patterns while reusing fetched pixels across search windows. Benefits of proposed architecture when compared to 15 other published architectures are adaptability, high throughput, and low latency at a cost of increased footprint, when ported on a Xilinx FPGA.

  8. Investigation of fast ion pressure effects in ASDEX Upgrade by spectral MSE measurements

    Science.gov (United States)

    Reimer, René; Dinklage, Andreas; Wolf, Robert; Dunne, Mike; Geiger, Benedikt; Hobirk, Jörg; Reich, Matthias; ASDEX Upgrade Team; McCarthy, Patrick J.

    2017-04-01

    High precision measurements of fast ion effects on the magnetic equilibrium in the ASDEX Upgrade tokamak have been conducted in a high-power (10 MW) neutral-beam injection discharge. An improved analysis of the spectral motional Stark effect data based on forward-modeling, including the Zeeman effect, fine-structure and non-statistical sub-level distribution, revealed changes in the order of 1% in |B| . The results were found to be consistent with results from the equilibrium solver CLISTE. The measurements allowed us to derive the fast ion pressure fraction to be Δ {{p}\\text{FI}}/{{p}\\text{mhd}}≈ 10 % and variations of the fast ion pressure are consistent with calculations of the transport code TRANSP. The results advance the understanding of fast ion confinement and magneto-hydrodynamic stability in the presence of fast ions.

  9. Statistic analysis in treatment of complications of vertebral-spinal trauma (by MSE data

    Directory of Open Access Journals (Sweden)

    Pedachenko Ye.H.

    2013-03-01

    Full Text Available The analysis of treatment of 130 patients with the complicated spinal trauma by the data of medical-social expertise was conducted. In the majority of patients (64%, because of the complicated spinal trauma the conservative methods of treatment were applied. In more than half (51% of patients treated con¬servatively, there was the unremoved compression of spinal cord or its radices, 24% patients were operated in the sharp period of the complicated spinal trauma, 4% of them were re-operated over course of time. Due to unremoved compression 12% were operated in the period of rehabilitation.

  10. Mobile genetic elements in protozoan parasites

    Indian Academy of Sciences (India)

    Sudha Bhattacharya; Abhijeet Bakre; Alok Bhattacharya

    2002-08-01

    Mobile genetic elements, by virtue of their ability to move to new chromosomal locations, are considered important in shaping the evolutionary course of the genome. They are widespread in the biological kingdom. Among the protozoan parasites several types of transposable elements are encountered. The largest variety is seen in the trypanosomatids—Trypanosoma brucei, Trypanosoma cruzi and Crithidia fasciculata. They contain elements that insert site-specifically in the spliced-leader RNA genes, and others that are dispersed in a variety of genomic locations. Giardia lamblia contains three families of transposable elements. Two of these are subtelomeric in location while one is chromosome-internal. Entamoeba histolytica has an abundant retrotransposon dispersed in the genome. Nucleotide sequence analysis of all the elements shows that they are all retrotransposons, and, with the exception of one class of elements in T. cruzi, all of them are non-long-terminal-repeat retrotransposons. Although most copies have accumulated mutations, they can potentially encode reverse transcriptase, endonuclease and nucleic-acid-binding activities. Functionally and phylogenetically they do not belong to a single lineage, showing that retrotransposons were acquired early in the evolution of protozoan parasites. Many of the potentially autonomous elements that encode their own transposition functions have nonautonomous counterparts that probably utilize the functions in trans. In this respect these elements are similar to the mammalian LINEs and SINEs (long and short interspersed DNA elements), showing a common theme in the evolution of retrotransposons. So far there is no report of a DNA transposon in any protozoan parasite. The genome projects that are under way for most of these organisms will help understand the evolution and possible function of these genetic elements.

  11. PRECONDITIONING HIGHER ORDER FINITE ELEMENT SYSTEMS BY ALGEBRAIC MULTIGRID METHOD OF LINEAR ELEMENTS

    Institute of Scientific and Technical Information of China (English)

    Yun-qing Huang; Shi Shu; Xi-jun Yu

    2006-01-01

    We present and analyze a robust preconditioned conjugate gradient method for the higher order Lagrangian finite element systems of a class of elliptic problems. An auxiliary linear element stiffness matrix is chosen to be the preconditioner for higher order finite elements. Then an algebraic multigrid method of linear finite element is applied for solving the preconditioner. The optimal condition number which is independent of the mesh size is obtained. Numerical experiments confirm the efficiency of the algorithm.

  12. Mortar Upwind Finite Volume Element Method with Crouzeix-Raviart Element for Parabolic Convection Diffusion Problems

    Institute of Scientific and Technical Information of China (English)

    2006-01-01

    In this paper, we study the semi-discrete mortar upwind finite volume element method with the Crouzeix-Raviart element for the parabolic convection diffusion problems.It is proved that the semi-discrete mortar upwind finite volume element approximations derived are convergent in the H1- and L2-norms.

  13. Analysis of bender element test interpretation using the discrete element method

    NARCIS (Netherlands)

    O’Donovan, J.; O’Sullivan, C.; Marketos, G.; Muir Wood, D.

    2015-01-01

    While bender element testing is now well-established as a laboratory technique to determine soil stiffness, a robust technique to interpret the data remains elusive. A discrete element method (DEM) model of a face-centred cubic packing of uniform spheres was created to simulate bender element tests

  14. The Connection between the Properties of Elements and Compounds; Mineralogical-Crystallochemical Classification of Elements

    OpenAIRE

    Godovikov, Alexander A.; Hariya, Yu

    1987-01-01

    The described mineralogical-crystallochemical classification bears some similar features with geochemical classification of elements. This similarity emphasizes a greater importance in conforming the vast practical data on petrology. The present classification also bears some resemblance to the technical classification of elements by Berg (1929). The similarity seems logical since the mineralogical. crystallochemical classification of elements unites them on the basis of crystallochemical sim...

  15. Moving KML geometry elements within Google Earth

    Science.gov (United States)

    Zhu, Liang-feng; Wang, Xi-feng; Pan, Xin

    2014-11-01

    During the process of modeling and visualizing geospatial information on the Google Earth virtual globe, there is an increasing demand to carry out such operations as moving geospatial objects defined by KML geometry elements horizontally or vertically. Due to the absence of the functionality and user interface for performing the moving transformation, it is either hard or impossible to interactively move multiple geospatial objects only using the existing Google Earth desktop application, especially when the data sets are in large volume. In this paper, we present a general framework and associated implementation methods for moving multiple KML geometry elements within Google Earth. In our proposed framework, we first load KML objects into the Google Earth plug-in, and then extract KML geometry elements from the imported KML objects. Subsequently, we interactively control the movement distance along a specified orientation by employing a custom user interface, calculate the transformed geographic location for each KML geometry element, and adjust geographic coordinates of the points in each KML objects. And finally, transformed KML geometry elements can be displayed in Google Earth for 3D visualization and spatial analysis. A key advantage of the proposed framework is that it provides a simple, uniform and efficient user interface for moving multiple KML geometry elements within Google Earth. More importantly, the proposed framework and associated implementations can be conveniently integrated into other customizable Google Earth applications to support interactively visualizing and analyzing geospatial objects defined by KML geometry elements.

  16. Combining classifiers for robust PICO element detection

    Directory of Open Access Journals (Sweden)

    Grad Roland

    2010-05-01

    Full Text Available Abstract Background Formulating a clinical information need in terms of the four atomic parts which are Population/Problem, Intervention, Comparison and Outcome (known as PICO elements facilitates searching for a precise answer within a large medical citation database. However, using PICO defined items in the information retrieval process requires a search engine to be able to detect and index PICO elements in the collection in order for the system to retrieve relevant documents. Methods In this study, we tested multiple supervised classification algorithms and their combinations for detecting PICO elements within medical abstracts. Using the structural descriptors that are embedded in some medical abstracts, we have automatically gathered large training/testing data sets for each PICO element. Results Combining multiple classifiers using a weighted linear combination of their prediction scores achieves promising results with an f-measure score of 86.3% for P, 67% for I and 56.6% for O. Conclusions Our experiments on the identification of PICO elements showed that the task is very challenging. Nevertheless, the performance achieved by our identification method is competitive with previously published results and shows that this task can be achieved with a high accuracy for the P element but lower ones for I and O elements.

  17. Genome-wide identification of enhancer elements.

    Science.gov (United States)

    Tulin, Sarah; Barsi, Julius C; Bocconcelli, Carlo; Smith, Joel

    2016-01-01

    We present a prospective genome-wide regulatory element database for the sea urchin embryo and the modified chromosome capture-related methodology used to create it. The method we developed is termed GRIP-seq for genome-wide regulatory element immunoprecipitation and combines features of chromosome conformation capture, chromatin immunoprecipitation, and paired-end next-generation sequencing with molecular steps that enrich for active cis-regulatory elements associated with basal transcriptional machinery. The first GRIP-seq database, available to the community, comes from S. purpuratus 24 hpf embryos and takes advantage of the extremely well-characterized cis-regulatory elements in this system for validation. In addition, using the GRIP-seq database, we identify and experimentally validate a novel, intronic cis-regulatory element at the onecut locus. We find GRIP-seq signal sensitively identifies active cis-regulatory elements with a high signal-to-noise ratio for both distal and intronic elements. This promising GRIP-seq protocol has the potential to address a rate-limiting step in resolving comprehensive, predictive network models in all systems.

  18. The dynamic stiffness matrix of two-dimensional elements: application to Kirchhoff's plate continuous elements

    Science.gov (United States)

    Casimir, J. B.; Kevorkian, S.; Vinh, T.

    2005-10-01

    This paper describes a procedure for building the dynamic stiffness matrix of two-dimensional elements with free edge boundary conditions. The dynamic stiffness matrix is the basis of the continuous element method. Then, the formulation is used to build a Kirchhoff rectangular plate element. Gorman's method of boundary condition decomposition and Levy's series are used to obtain the strong solution of the elementary problem. A symbolic computation software partially performs the construction of the dynamic stiffness matrix from this solution. The performances of the element are evaluated from comparisons with harmonic responses of plates obtained by the finite element method.

  19. APPLICATION OF SUB-ELEMENT AND MICRO-ELEMENT IN BEM WITH ROLLER BEARING LOAD

    Institute of Scientific and Technical Information of China (English)

    Shu Xuedao; Xing Xidong

    2004-01-01

    Aiming at the discontinuous traction on contact elements of roller bearing, new concepts of sub- and micro-element are put forward. In the sub-element and micro-element, traction influence coefficient has been modified, which is calculated by the former boundary element method (BEM) with roller bearing load. Hence, three-dimensional distribution of load on roller bearing is calculated accurately. In practice, it has been proved that this method has higher calculation accuracy. An effective numerical method is offered for analyzing load characteristics of roller bearing to improve service longevity of roller bearing and operation efficiency of rolling mill.

  20. MRT fuel element inspection at Dounreay

    Energy Technology Data Exchange (ETDEWEB)

    Gibson, J.

    1997-08-01

    To ensure that their production and inspection processes are performed in an acceptable manner, ie. auditable and traceable, the MTR Fuel Element Fabrication Plant at Dounreay operates to a documented quality system. This quality system, together with the fuel element manufacturing and inspection operations, has been independently certified to ISO9002-1987, EN29002-1987 and BS5750:Pt2:1987 by Lloyd`s Register Quality Assurance Limited (LRQA). This certification also provides dual accreditation to the relevant German, Dutch and Australian certification bodies. This paper briefly describes the quality system, together with the various inspection stages involved in the manufacture of MTR fuel elements at Dounreay.

  1. 模糊Prime元%Fuzzy Prime Elements

    Institute of Scientific and Technical Information of China (English)

    饶三平

    2012-01-01

    基于完备剩余格,本文在模糊完备格中,引入模糊Prime元概念.给出了模糊Prime元的等价刻画,证明了所有的模糊Prime元构成的模糊集是模糊完全分配格.%Based on complete residuated lattices, the concept of fuzzy Prime elements in fuzzy complete lattices is given, then the equivalent characterization of fuzzy Prime elements is obtained. We also prove that the fuzzy subsets of fuzzy Prime elements is a fuzzy completely distributice lattice.

  2. The Electronic Structure of Heavy Element Complexes

    Energy Technology Data Exchange (ETDEWEB)

    Bursten, Bruce E.

    2000-07-25

    The area of study is the bonding in heavy element complexes, and the application of more sophisticated electronic structure theories. Progress is recounted in several areas: (a) technological advances and current methodologies - Relativistic effects are extremely important in gaining an understanding of the electronic structure of compounds of the actinides, transactinides, and other heavy elements. Therefore, a major part of the continual benchmarking was the proper inclusion of the appropriate relativistic effects for the properties under study. (b) specific applications - These include organoactinide sandwich complexes, CO activation by actinide atoms, and theoretical studies of molecules of the transactinide elements. Finally, specific directions in proposed research are described.

  3. Finite element analysis of optical waveguides

    Science.gov (United States)

    Mabaya, N.; Lagasse, P. E.; Vandenbulcke, P.

    1981-06-01

    Several finite element programs for the computation of the guided modes of optical waveguides are presented. The advantages and limitations of a very general program for the analysis of anisotropic guides are presented. A possible solution to the problem of the spurious numerical modes, encountered when calculating higher order modes, is proposed. For isotropic waveguides, it is shown that both EH- and HE-type modes can be very accurately approximated by two different scalar finite element programs. Finally, a boundary perturbation method is outlined that makes it possible to calculate the attenuation coefficient of leaky modes in single material guides, starting from a finite element calculation.

  4. Photoshop Elements 10 The Missing Manual

    CERN Document Server

    Brundage, Barbara

    2011-01-01

    Elements 10 offers much of Photoshop's power without the huge price tag. It's a great tool for most image-editing buffs-whether you're a photographer, scrapbooker, or aspiring graphic artist. But Elements still doesn't come with a useful manual. This bestselling book helps you get the most out of the program, from the basics to advanced tips for both Windows and Mac users. The important stuff you need to know: Quickly learn your way around. Customize Elements to suit your working style.Get to work right away. Import, organize, and make quick image fixes with ease.Retouch any image. Learn how

  5. Finite Element Computational Dynamics of Rotating Systems

    Directory of Open Access Journals (Sweden)

    Jaroslav Mackerle

    1999-01-01

    Full Text Available This bibliography lists references to papers, conference proceedings and theses/dissertations dealing with finite element analysis of rotor dynamics problems that were published in 1994–1998. It contains 319 citations. Also included, as separate subsections, are finite element analyses of rotor elements – discs, shafts, spindles, and blades. Topics dealing with fracture mechanics, contact and stability problems of rotating machinery are also considered in specific sections. The last part of the bibliography presents papers dealing with specific industrial applications.

  6. Mineral elements in milk and dairy products

    Directory of Open Access Journals (Sweden)

    Šimun Zamberlin

    2012-06-01

    Full Text Available Mineral elements occur in milk and dairy products as inorganic ions and salts, as well as part of organic molecules, such as proteins, fats, carbohydrates and nucleic acids. The chemical form of mineral elements is important because it determines their absorption in the intestine and their biological utilization. The mineral composition of milk is not constant because it depends on lactation phase, nutritional status of the animal, and environmental and genetic factors. The objective of this research is to point out the research results of chemical form, content and nutritional importance of individual mineral elements that are present in various milks and dairy products.

  7. Photoshop Elements 9 the missing manual

    CERN Document Server

    Brundage, Barbara

    2010-01-01

    Elements 9 offers much of Photoshop's power without the huge price tag. It's an ideal tool for most image-editing buffs -- including scrapbookers, photographers, and aspiring graphic artists. But Elements still doesn't come with a decent manual. This bestselling book will help you get the most out of the program, from the basics to advanced tips for both Windows and Mac. Quickly learn your way around. Customize Elements to suit your working style.Get to work right away. Import, organize, and make quick image fixes with ease.Retouch any image. Learn how to repair and restore your old and damag

  8. Photoshop Elements 5 The Missing Manual

    CERN Document Server

    Brundage, Barbara

    2006-01-01

    Anyone still think that Adobe Photoshop Elements is a toy version of the real thing? As the most popular photo-editing program on the market, Photoshop Elements not only has Photoshop's marvelous powers, but also has capabilities the mothership lacks. Each new version includes more tools designed specifically for today's consumer digital photo enthusiasts. The latest edition, Photoshop Elements 5, solidifies the reputation of this superb and inexpensive product with new scrapbook features, a link to online photo services, and many other improvements. In fact, there's so much to Photoshop Ele

  9. Error computation for adaptive finite element analysis

    CERN Document Server

    Khan, A A; Memon, I R; Ming, X Y

    2002-01-01

    The paper gives a simple numerical procedure for computations of errors generated by the discretisation process of finite element method. The procedure given is based on the ZZ error estimator which is believed to be reasonable accurate and thus can be readily implemented in any existing finite element codes. The devised procedure not only estimates the global energy norm error but also evaluates the local errors in individual elements. In the example, the given procedure is combined with an adaptive refinement procedure, which provides guidance for optimal mesh designing and allows the user to obtain a desired accuracy with a limited number of interaction. (author)

  10. The Superheavy Elements and Anti-Gravity

    Science.gov (United States)

    Anastasovski, Petar K.

    2004-02-01

    The essence of any propulsion concept is to overcome gravity. Anti-gravity is a natural means to achieve this. Thus, the technology to pursue anti-gravity, by using superheavy elements, may provide a new propulsion paradigm. The theory of superluminal relativity provides a hypothesis for existence of elements with atomic number up to Z = 145, some of which may possess anti-gravity properties. Analysis results show that curved space-time exists demonstrating both gravitic and anti-gravitic properties not only around nuclei but inside the nuclei as well. Two groups of elements (Z Hawking, in honour of Stephen W. Hawking.

  11. Studying Extrachromosomal Genetic Elements in Sulfolobus

    DEFF Research Database (Denmark)

    Guannan, Liu

    facilitated the characterization of viruses, plasmids and membrane vesicles. Studying the interactions between Sulfolobus and extrachromosomal genetic elements has provided many new insights into basic molecular processes. Secreted membrane vesicle seems to be a common characteristic for Sulfolobus. In order...... of random chromosomal fragments, including IS elements. The results suggest that membrane vesicles could serve as vehicles for the inter-cellular transport of genetic material. A variant of ATV, ATV2, was isolated that infected a newly isolated Sulfolobus solfataricus P3 strain. Comparative genomics......, whereas the deactivation of pKEF9 in S. solfataricus was caused by mobile elements after it had integrated into the host genome....

  12. Electrical machine analysis using finite elements

    CERN Document Server

    Bianchi, Nicola

    2005-01-01

    OUTLINE OF ELECTROMAGNETIC FIELDSVector AnalysisElectromagnetic FieldsFundamental Equations SummaryReferencesBASIC PRINCIPLES OF FINITE ELEMENT METHODSIntroductionField Problems with Boundary ConditionsClassical Method for the Field Problem SolutionThe Classical Residual Method (Galerkin's Method)The Classical Variational Method (Rayleigh-Ritz's Method)The Finite Element MethodReferencesAPPLICATIONS OF THE FINITE ELEMENT METHOD TO TWO-DIMENSIONAL FIELDSIntroductionLinear Interpolation of the Function fApplication of the Variational MethodSimple Descriptions of Electromagnetic FieldsAppendix: I

  13. Studying Extrachromosomal Genetic Elements in Sulfolobus

    DEFF Research Database (Denmark)

    Guannan, Liu

    facilitated the characterization of viruses, plasmids and membrane vesicles. Studying the interactions between Sulfolobus and extrachromosomal genetic elements has provided many new insights into basic molecular processes. Secreted membrane vesicle seems to be a common characteristic for Sulfolobus. In order...... of random chromosomal fragments, including IS elements. The results suggest that membrane vesicles could serve as vehicles for the inter-cellular transport of genetic material. A variant of ATV, ATV2, was isolated that infected a newly isolated Sulfolobus solfataricus P3 strain. Comparative genomics......, whereas the deactivation of pKEF9 in S. solfataricus was caused by mobile elements after it had integrated into the host genome....

  14. The ENCODE (ENCyclopedia Of DNA Elements) Project.

    Science.gov (United States)

    2004-10-22

    The ENCyclopedia Of DNA Elements (ENCODE) Project aims to identify all functional elements in the human genome sequence. The pilot phase of the Project is focused on a specified 30 megabases (approximately 1%) of the human genome sequence and is organized as an international consortium of computational and laboratory-based scientists working to develop and apply high-throughput approaches for detecting all sequence elements that confer biological function. The results of this pilot phase will guide future efforts to analyze the entire human genome.

  15. The extraction behaviors of transuranic elements

    Energy Technology Data Exchange (ETDEWEB)

    Byeon, Kee Hoh; Lee, Eil Hee; Kwon, Seon Gil; Kim, Kwang Wook; Yang, Han Beom; Chung, Dong Yong; Lim, Jae Kwan; Shin, Hyun Kyoo; Kim, Soo Ho

    1999-10-01

    We have studied the distribution data between organic and aqueous phases and the related reaction data in the state of extraction equilibrium for neptunium, americium and curium of transuranic elements, and also studied the chemical properties for these chemical elements. In the results of study, distribution coefficients of transuranic elements such as Np(IV), Np(V), Np(VI) Am(III), CM(III) and the redox reactions of neptunium were rearranged numerically with the data in the published literatures. (author)

  16. Environmental monitoring for some transuranium elements

    Energy Technology Data Exchange (ETDEWEB)

    Sedlet, J.; Golchert, N.W.

    1977-01-01

    Knowledge of contemporary environmental levels of transuranium elements is necessary as baseline information if the future impact of nuclear fuel plants and power reactors is to be evaluated. The chemical behavior of these elements at low concentrations in the environment is also important in hazard prediction. This paper describes methods for the analysis of environmental materials for several transuranium elements and summarizes the results for the past several years. In some cases comparison with natural uranium and thorium was useful, and their concentrations were also determined.

  17. Will Finite Elements Replace Structural Mechanics?

    Science.gov (United States)

    Ojalvo, I. U.

    1984-01-01

    This paper presents a personal view regarding the need for a continued interest and activity in structural methods in general, while viewing finite elements and the computer as simply two specific tools for assisting in this endeavor. An attempt is made to provide some insight as to why finite element methods seem to have "won the war," and to give examples of their more (and less) intelligent use. Items addressed include a highlight of unnecessary limitations of many existing standard finite element codes and where it is felt that further development work is needed.

  18. On Hybrid and mixed finite element methods

    Science.gov (United States)

    Pian, T. H. H.

    1981-01-01

    Three versions of the assumed stress hybrid model in finite element methods and the corresponding variational principles for the formulation are presented. Examples of rank deficiency for stiffness matrices by the hybrid stress model are given and their corresponding kinematic deformation modes are identified. A discussion of the derivation of general semi-Loof elements for plates and shells by the hybrid stress method is given. It is shown that the equilibrium model by Fraeijs de Veubeke can be derived by the approach of the hybrid stress model as a special case of semi-Loof elements.

  19. Unconscious emotional effects of packaging design elements

    DEFF Research Database (Denmark)

    Liao, Lewis; Corsi, Armando; Lockshin, Larry;

    This research investigates consumers’ unconscious emotional responses to packaging elements such as image, colour and font. The intensity and valence of the emotional response, in reaction to these packaging elements, is established by the use of skin conductance tests and facial electromyography...... on a convenience sample of 120 participants. The results suggest that image is the only element able to generate a significant effect on consumers’ unconscious emotional response. In addition, the results also suggest the interaction between image and colour has a significant effect on consumers’ unconscious...

  20. Use of SCC in Prefabricated Concrete Elements

    DEFF Research Database (Denmark)

    Thrane, Lars Nyholm; Lauritsen, Ib

    2004-01-01

    This paper presents observations made on the use of self-compacting concrete for pre-cast elements at Byggebjerg Beton A/S during the last 3 years. The elements include L- and sandwich elements and are mainly produced for agriculture purposes. In general, the flow properties and air content...... of the concrete to achieve a good surface quality with a limited number of blowholes. For horizontal castings it is important to keep the concrete flowing to avoid casting joints. Blocking is avoided by using the right type of spacers and a maximum size aggregate of 8mm. However, if the concrete has to flow over...

  1. Finite Dynamic Elements and Modal Analysis

    Directory of Open Access Journals (Sweden)

    N.J. Fergusson

    1993-01-01

    Full Text Available A general modal analysis scheme is derived for forced response that makes use of high accuracy modes computed by the dynamic element method. The new procedure differs from the usual modal analysis in that the modes are obtained from a power series expansion for the dynamic stiffness matrix that includes an extra dynamic correction term in addition to the static stiffness matrix and the consistent mass matrix based on static displacement. A cantilevered beam example is used to demonstrate the relative accuracies of the dynamic element and the traditional finite element methods.

  2. Superconvergence of tricubic block finite elements

    Institute of Scientific and Technical Information of China (English)

    2009-01-01

    In this paper, we first introduce interpolation operator of projection type in three dimen- sions, from which we derive weak estimates for tricubic block finite elements. Then using the estimate for the W 2, 1-seminorm of the discrete derivative Green’s function and the weak estimates, we show that the tricubic block finite element solution uh and the tricubic interpolant of projection type Πh3u have superclose gradient in the pointwise sense of the L∞-norm. Finally, this supercloseness is applied to superconvergence analysis, and the global superconvergence of the finite element approximation is derived.

  3. Integrating Environmentally Responsive Elements in Buildings

    DEFF Research Database (Denmark)

    Heiselberg, Per; Andresen, Inger; Perino, Marco

    2006-01-01

    Significant improvement have been achieved on efficiency improvements of specific building elements like the building envelope and building equipment and services and whilst most building elements still offer opportunities for efficiency improvements, the greatest future potential lie...... with technologies that promote the integration of responsive building elements and building services in integrated building concepts. In order to address some of these issues an international research effort, IEA-ECBCS Annex 44 has been initiated. The paper especially presents the annex activities regarding...... development of Energy and Environmental Building concepts including discussion of the selected design strategy and technical solutions, the integrated design approach and design methods and tools....

  4. Comparative study of different Schlieren diffracting elements

    Indian Academy of Sciences (India)

    Raj Kumar; Sushil K Kaura; D P Chhachhia; D Mohan; A K Aggarwal

    2008-01-01

    This paper presents an analysis of diffraction effects taking place at different Schlieren diffracting elements. Two types of diffraction effects are prominent in the Schlieren schemes. One is diffraction of direct light (source image) at the Schlieren element, which limits the sensitivity and resolution of Schlieren systems. The second type is the diffraction of light deflected from the test object at the Schlieren-diffracting element. This second type of diffraction degrades the quality of Schlieren results. Experimental results showing the effect of diffraction of light deflected from the test object at a phase knife-edge, corner of a square phase aperture and an optical fiber tip as Schlieren diffracting elements have been presented and discussed.

  5. Comix, a New Matrix Element Generator

    Energy Technology Data Exchange (ETDEWEB)

    Gleisberg, Tanju; /SLAC; Hoche, Stefan; /Durham U., IPPP

    2008-09-03

    We present a new tree-level matrix element generator, based on the color dressed Berends-Giele recursive relations. We discuss two new algorithms for phase space integration, dedicated to be used with large multiplicities and color sampling.

  6. NEW RSW & Wall Medium Mixed Element Grid

    Data.gov (United States)

    National Aeronautics and Space Administration — RSW Medium Mixed Element Grid with Viscous Wind Tunnel Wall at the root. This grid is for a node-based unstructured solver. Quad Surface Faces= 18432 Tria Surface...

  7. Elements with Square Roots in Finite Groups

    Institute of Scientific and Technical Information of China (English)

    M.S. Lucido; M.R. Pournaki

    2005-01-01

    In this paper, we study the probability that a randomly chosen element in a finite group has a square root, in particular the simple groups of Lie type of rank 1, the sporadic finite simple groups and the alternating groups.

  8. ANALYTICAL ELEMENT MODELING OF COASTAL AQUIFERS

    Science.gov (United States)

    Four topics were studied concerning the modeling of groundwater flow in coastal aquifers with analytic elements: (1) practical experience was obtained by constructing a groundwater model of the shallow aquifers below the Delmarva Peninsula USA using the commercial program MVAEM; ...

  9. Finite element methods a practical guide

    CERN Document Server

    Whiteley, Jonathan

    2017-01-01

    This book presents practical applications of the finite element method to general differential equations. The underlying strategy of deriving the finite element solution is introduced using linear ordinary differential equations, thus allowing the basic concepts of the finite element solution to be introduced without being obscured by the additional mathematical detail required when applying this technique to partial differential equations. The author generalizes the presented approach to partial differential equations which include nonlinearities. The book also includes variations of the finite element method such as different classes of meshes and basic functions. Practical application of the theory is emphasised, with development of all concepts leading ultimately to a description of their computational implementation illustrated using Matlab functions. The target audience primarily comprises applied researchers and practitioners in engineering, but the book may also be beneficial for graduate students.

  10. Moving Finite Elements in 2-D.

    Science.gov (United States)

    1984-08-06

    34 . - ; .-’- . - . -- .- -. . - -.. -- ; -. - - - - - ." . ,- . -••. - - ; . IOSR : TR. SAI-84/1299 (0 N MOVING FINITE ELEMENTS IN 2-I Final Report AFOSR Contract: F4962U-81-C-UO73 Program Manager

  11. Advanced finite element method in structural engineering

    CERN Document Server

    Long, Yu-Qiu; Long, Zhi-Fei

    2009-01-01

    This book systematically introduces the research work on the Finite Element Method completed over the past 25 years. Original theoretical achievements and their applications in the fields of structural engineering and computational mechanics are discussed.

  12. Rare earth elements in nuclear medicine

    OpenAIRE

    Kodina G.E.; Kulakov V.N.; Sheino I.N.

    2014-01-01

    The review focuses on the key applications of stable and radioactive isotopes of rare earth elements in the technology of nuclear medicine, radionuclide diagnostics and therapy, as well as magnetic resonance imaging and binary radiotherapy technologies.

  13. Rare earth elements in nuclear medicine

    Directory of Open Access Journals (Sweden)

    Kodina G.E.

    2014-12-01

    Full Text Available The review focuses on the key applications of stable and radioactive isotopes of rare earth elements in the technology of nuclear medicine, radionuclide diagnostics and therapy, as well as magnetic resonance imaging and binary radiotherapy technologies.

  14. Origin of the Biologically Important Elements

    Science.gov (United States)

    Trimble, Virginia

    The chemical elements most widely distributed in terrestrial living creatures are the ones (apart from inert helium and neon) that are commonest in the Universe - hydrogen, oxygen, carbon, and nitrogen. A chemically different Universe would clearly have different biology, if any. We explore here the nuclear processes in stars, the early Universe, and elsewhere that have produced these common elements, and, while we are at it, also encounter the production of lithium, gold, uranium, and other elements of sociological, if not biological, importance. The relevant processes are, for the most part, well understood. Much less well understood is the overall history of chemical evolution of the Galaxy, from pure hydrogen and helium to the mix of elements we see today. One implication is that we cannot do a very good job of estimating how many stars and which ones might be orbited by habitable planets.

  15. Computation of Asteroid Proper Elements: Recent Advances

    Science.gov (United States)

    Knežević, Z.

    2017-06-01

    The recent advances in computation of asteroid proper elements are briefly reviewed. Although not representing real breakthroughs in computation and stability assessment of proper elements, these advances can still be considered as important improvements offering solutions to some practical problems encountered in the past. The problem of getting unrealistic values of perihelion frequency for very low eccentricity orbits is solved by computing frequencies using the frequency-modified Fourier transform. The synthetic resonant proper elements adjusted to a given secular resonance helped to prove the existence of Astraea asteroid family. The preliminary assessment of stability with time of proper elements computed by means of the analytical theory provides a good indication of their poorer performance with respect to their synthetic counterparts, and advocates in favor of ceasing their regular maintenance; the final decision should, however, be taken on the basis of more comprehensive and reliable direct estimate of their individual and sample average deviations from constancy.

  16. Interaction Between Flow Elements in Large Enclosures

    DEFF Research Database (Denmark)

    Heiselberg, Per

    In this paper experiments in a scale model are used as a first attempt to investigate how different flow elements such as supply air jets, thermal plumes and free convection flows interact with each other in a large enclosure, if the path of each individual flow element changes and if this influe......In this paper experiments in a scale model are used as a first attempt to investigate how different flow elements such as supply air jets, thermal plumes and free convection flows interact with each other in a large enclosure, if the path of each individual flow element changes...... and if this influences the overall air flow pattern in the enclosure. The main emphasis has been put on the pathways of chilled free air jets and whether the convective flows from both distributed and concentrated heat sources affect the pathway of the jet and the air flow pattern in the enclosure as a function...

  17. NEW RSW & Wall Fine Mixed Element Grid

    Data.gov (United States)

    National Aeronautics and Space Administration — RSW Fine Mixed Element Grid with viscous root wind tunnel wall. This grid is for a node-based unstructured solver. Quad Surface Faces= 38016 Tria Surface Faces=...

  18. NEW RSW & Wall Coarse Mixed Element Grid

    Data.gov (United States)

    National Aeronautics and Space Administration — This is the Coarse Mixed Element Grid for the RSW with a viscous wall at the root. This grid is for a node-based unstructured solver. Quad Surface Faces= 9728 Tria...

  19. 23 Elemental Composition of Suspended Particulate Matter ...

    African Journals Online (AJOL)

    `123456789jkl''''#

    coarse and fine particulate matter fractions at the higher height. The elements Cu, Zn, ... dense population, high density housing, the ..... could be in the vapor phase at the higher height. .... precipitation from a remote background site in. India.

  20. Nuclear Thermal Rocket Element Environmental Simulator (NTREES)

    Science.gov (United States)

    Schoenfeld, Michael

    2009-01-01

    A detailed description of the Nuclear Thermal Rocket Element Environmental Simulator (NTREES) is presented. The contents include: 1) Design Requirements; 2) NTREES Layout; 3) Data Acquisition and Control System Schematics; 4) NTREES System Schematic; and 5) NTREES Setup.

  1. Finite element modeling of corneal strip extensometry

    CSIR Research Space (South Africa)

    Botha, N

    2012-12-01

    Full Text Available numerically modelled in several studies, this study focusses on accurately modelling the strip extensiometry test. Two methods were considered to simulate the experimental conditions namely, a single phase and a two phase method. A finite element model...

  2. PROXIMATE AND ELEMENTAL COMPOSITION OF WHITE GRUBS

    African Journals Online (AJOL)

    DR. AMINU

    1.23% (protein, lipids, carbohydrates and ash) and (moisture content) 34.01 ± 1.00%. The lipid and protein ... advised. Keywords: White grubs, Proximate Analysis, Essential element, Nutrient .... of important enzyme reactions: the oxidation of.

  3. Experimental Finite Element Approach for Stress Analysis

    Directory of Open Access Journals (Sweden)

    Ahmet Erklig

    2014-01-01

    Full Text Available This study aims to determining the strain gauge location points in the problems of stress concentration, and it includes both experimental and numerical results. Strain gauges were proposed to be positioned to corresponding locations on beam and blocks to related node of elements of finite element models. Linear and nonlinear cases were studied. Cantilever beam problem was selected as the linear case to approve the approach and conforming contact problem was selected as the nonlinear case. An identical mesh structure was prepared for the finite element and the experimental models. The finite element analysis was carried out with ANSYS. It was shown that the results of the experimental and the numerical studies were in good agreement.

  4. Conforming finite elements with embedded strong discontinuities

    NARCIS (Netherlands)

    Dias-da-Costa, D.; Alfaiate, J.; Sluys, L.J.; Areias, P.; Fernandes, C.; Julio, E.

    2012-01-01

    The possibility of embedding strong discontinuities into finite elements allowed the simulation of different problems, namely, brickwork masonry fracture, dynamic fracture, failure in finite strain problems and simulation of reinforcement concrete members. However, despite the significant contributi

  5. Elemental tracers for Chinese source dust

    Institute of Scientific and Technical Information of China (English)

    张小曳; 张光宇; 朱光华; 张德二; 安芷生; 陈拓; 黄湘萍

    1996-01-01

    The mass-particle size distributions of 10 dust-carrying elements in aerosol particles were determined tor 12 sites in desert regions of northern China. The desert dust is proved to he of origin of eolian loess deposited on the Loess Plateau. Their transport to the loess was mainly attributable to the non-dust storm processes under the interglacial climate condition. The impact ot" dust storm on the accumulation of the loess increased in the glacial stage. On the basis of the signatures of 4 dust elements (Al. Fe, Mg and Sc). Chinese dust is believed to have 3 major desert sources (northwestern deserts, northern high dust deserts and northern low dust deserts). With a chemical element balance model, an elemental tracer system is established to proportion the export of China-source dust.

  6. Human Exploration Telerobotics (HET2): Astrobee Element

    Data.gov (United States)

    National Aeronautics and Space Administration — The HET2 Astrobee Element will focus on developing a new free-flying robot suitable for performing IVA work on the International Space Station (ISS). The new robot...

  7. Influence of chemical elements on mammalian spermatozoa.

    Science.gov (United States)

    Marzec-Wróblewska, U; Kamiński, P; Lakota, P

    2012-01-01

    Exposure to heavy metals is the most important risk factor in the assessment of spermatogenesis. About 30-40 % cases of infertility are caused by the male factor, and most of them are due to the small quantity of spermatozoa or to inferior spermatozoa quality. The negative impact on sperm motility, morphology and concentration of such chemical elements as Al, Cr, Cd, Pb or Fe was observed, while positive influence was noticed for Zn, Mg, and Ca. The influence of Mn, Cu, Ni or Se on spermatozoa is ambiguous. Chemical elements known as necessary for capacitation and acrosome reaction are Zn, Mg and Ca, while Cd and Pb disturb initiation and progress of the acrosome reaction. The positive effect of chemical elements Al, Cd, Cr, Cu, Ni, Pb, Se, and Zn, lies in their protection against oxidative stress. On the other hand, Al, Cu and Ni induce structural changes in the testes and epididymis or influence interactions with other chemical elements.

  8. Integrating Responsive Building Elements in Buildings

    DEFF Research Database (Denmark)

    Haase, Matthias; Amato, Alex; Heiselberg, Per

    2006-01-01

    There is a global need for a more sustainable building development. About 50% of energy is used in buildings indicating that buildings provide a considerable potential for operational energy savings. Studies were conducted with the following objectives: to perform a state-of-the-art review...... energy strategies to develop guidelines and procedures for estimation of environmental performance of responsive building elements and integrated building concepts This paper introduces the ideas of this collaborative work and discusses its usefulness for Hong Kong and China. Special focus was put...... of responsive building elements, of integrated building concepts and of environmental performance assessment methods to improve and optimize responsive building elements to develop and optimize new building concepts with integration of responsive building elements, HVAC-systems as well as natural and renewable...

  9. New Variational Formulations of Hybrid Stress Elements

    Science.gov (United States)

    Pian, T. H. H.; Sumihara, K.; Kang, D.

    1984-01-01

    In the variational formulations of finite elements by the Hu-Washizu and Hellinger-Reissner principles the stress equilibrium condition is maintained by the inclusion of internal displacements which function as the Lagrange multipliers for the constraints. These versions permit the use of natural coordinates and the relaxation of the equilibrium conditions and render considerable improvements in the assumed stress hybrid elements. These include the derivation of invariant hybrid elements which possess the ideal qualities such as minimum sensitivity to geometric distortions, minimum number of independent stress parameters, rank sufficient, and ability to represent constant strain states and bending moments. Another application is the formulation of semiLoof thin shell elements which can yield excellent results for many severe test cases because the rigid body nodes, the momentless membrane strains, and the inextensional bending modes are all represented.

  10. PLANE INFINITE ANALYTICAL ELEMENT AND HAMILTONIAN SYSTEM

    Institute of Scientific and Technical Information of China (English)

    孙雁; 周钢; 刘正兴

    2003-01-01

    It is not convenient to solve those engineering problems defined in an infinitefield by using FEM. An infinite area can be divided into a regular infinite external area anda finite internal area. The finite internal area was dealt with by the FEM and the regularinfinite external area was settled in a polar coordinate. All governing equations weretransformed into the Hamiltonian system. The methods of variable separation andeigenfunction expansion were used to derive the stiffness matrix of a new infinite analyticalelement. This new element, like a super finite element, can be combined with commonlyused finite elements. The proposed method was verified by numerical case studies. Theresults show that the preparation work is very simple, the infinite analytical element has ahigh precision, and it can be used conveniently. The method can also be easily extended to a three-dimensional problem.

  11. A survey of mixed finite element methods

    Science.gov (United States)

    Brezzi, F.

    1987-01-01

    This paper is an introduction to and an overview of mixed finite element methods. It discusses the mixed formulation of certain basic problems in elasticity and hydrodynamics. It also discusses special techniques for solving the discrete problem.

  12. Diffractive Optical Elements for Dynamic Optical Coupling

    Institute of Scientific and Technical Information of China (English)

    Changhe Zhou; Xin Zhao; Liren Liu

    2003-01-01

    Diffractive optical elements such as the complementary Dammann gratings are incorporated for dynamic optical fiber splitting and combining. Experimental results of 1′8 dynamic optical couplings are presented.

  13. Diffractive Optical Elements for Dynamic Optical Coupling

    Institute of Scientific and Technical Information of China (English)

    2003-01-01

    Diffractive optical elements such as the complementary Dammann gratings are incorporated for dynamic optical fiber splitting and combining. Experimental results of 1×8 dynamic optical couplings are presented.

  14. Trace element geochemistry of CR chondrite metal

    CERN Document Server

    Jacquet, Emmanuel; Alard, Olivier; Kearsley, Anton T; Gounelle, Matthieu

    2015-01-01

    We report trace element analyses by laser ablation inductively coupled plasma mass spectrometry of metal grains from 9 different CR chondrites, distinguishing grains from chondrule interior ("interior grains"), chondrule surficial shells ("margin grains") and the matrix ("isolated grains"). Save for a few anomalous grains, Ni-normalized trace element patterns are similar for all three petrographical settings, with largely unfractionated refractory siderophile elements and depleted volatile Au, Cu, Ag, S. All types of grains are interpreted to derive from a common precursor approximated by the least melted, fine-grained objects in CR chondrites. This also excludes recondensation of metal vapor as the origin of the bulk of margin grains. The metal precursors presumably formed by incomplete condensation, with evidence for high-temperature isolation of refractory platinum-group-element (PGE)-rich condensates before mixing with lower temperature PGE-depleted condensates. The rounded shape of the Ni-rich, interior ...

  15. ANALYTICAL ELEMENT MODELING OF COASTAL AQUIFERS

    Science.gov (United States)

    Four topics were studied concerning the modeling of groundwater flow in coastal aquifers with analytic elements: (1) practical experience was obtained by constructing a groundwater model of the shallow aquifers below the Delmarva Peninsula USA using the commercial program MVAEM; ...

  16. 3-wave mixing Josephson dipole element

    Science.gov (United States)

    Frattini, N. E.; Vool, U.; Shankar, S.; Narla, A.; Sliwa, K. M.; Devoret, M. H.

    2017-05-01

    Parametric conversion and amplification based on three-wave mixing are powerful primitives for efficient quantum operations. For superconducting qubits, such operations can be realized with a quadrupole Josephson junction element, the Josephson Ring Modulator, which behaves as a loss-less three-wave mixer. However, combining multiple quadrupole elements is a difficult task so it would be advantageous to have a three-wave dipole element that could be tessellated for increased power handling and/or information throughput. Here, we present a dipole circuit element with third-order nonlinearity, which implements three-wave mixing. Experimental results for a non-degenerate amplifier based on the proposed third-order nonlinearity are reported.

  17. The proposal of the closure element pipe

    Directory of Open Access Journals (Sweden)

    Fojtášek Kamil

    2017-01-01

    Full Text Available The present paper summarizes the basic equations describing the behavior of butterfly valves during the fluid flow. Butterfly valves are used as a safety element in the energy industry, petrochemical industry, in steam lines etc. The paper describes the theoretical determination of the control torque on the closure element, the torque causes the opening and closing of butterfly valve. Determination of this torque depends on many factors, geometry of the closure element, misalignment to the axis of fluid flow, control method of valve, method of imposition of the moving member and of course on the operating parameters. Correct determination of the torque affects the proper design butterfly valves and ensure its functionality, which can prevent damage to other elements of the monitoring system.

  18. The proposal of the closure element pipe

    Science.gov (United States)

    Fojtášek, Kamil; Krutil, Jaroslav; Dvořák, Lukáš

    The present paper summarizes the basic equations describing the behavior of butterfly valves during the fluid flow. Butterfly valves are used as a safety element in the energy industry, petrochemical industry, in steam lines etc. The paper describes the theoretical determination of the control torque on the closure element, the torque causes the opening and closing of butterfly valve. Determination of this torque depends on many factors, geometry of the closure element, misalignment to the axis of fluid flow, control method of valve, method of imposition of the moving member and of course on the operating parameters. Correct determination of the torque affects the proper design butterfly valves and ensure its functionality, which can prevent damage to other elements of the monitoring system.

  19. A method for making a dry element

    Energy Technology Data Exchange (ETDEWEB)

    Abe, T.; Isikhara, K.; Kimura, T.; Momose, K.; Sakata, Y.

    1983-08-11

    The agglomerate is coated along the lateral surface by a separator and is enclosed in a zinc cylinder which serves as the anode. A separating plate is installed in the upper part of the agglomerate between the agglomerate and the anode. A current outlead is attached to the anode. The element is inserted into a body, pressing the plate into the agglomerate with a punch which has a recess. A guide cylinder is used for precise installation of the element. The space between the plate and the body in the upper part of the element is filled with wax or another substance. Short circuiting (KZ) between the current outlead and the agglomerate is prevented in the element.

  20. Discovery announced of four new elements

    Science.gov (United States)

    Banks, Michael

    2016-02-01

    The International Union of Pure and Applied Chemistry (IUPAC) and the International Union of Pure and Applied Physics (IUPAP) have announced the discovery of four new elements: 113, 115, 117 and 118 - completing the periodic table's seventh row.

  1. Elements and formulae of special relativity

    CERN Document Server

    Guggenheim, E A

    2013-01-01

    Elements and Formulae of Special Relativity presents elements and formulas of the theory of special relativity and covers topics ranging from kinematics and propagation of light to mechanics of single bodies, hydrodynamics, and thermodynamics. Vector operators, electromagnetic fields, electrodynamics, and statistical mechanics are also explored. This book is comprised of 13 chapters and begins by introducing the reader to the kinematics of special relativity, paying particular attention to formulas required for transformations between two frames of reference. Attention then turns to the propag

  2. Stretchable semiconductor elements and stretchable electrical circuits

    Science.gov (United States)

    Rogers, John A.; Khang, Dahl-Young; Menard, Etienne

    2009-07-07

    The invention provides methods and devices for fabricating printable semiconductor elements and assembling printable semiconductor elements onto substrate surfaces. Methods, devices and device components of the present invention are capable of generating a wide range of flexible electronic and optoelectronic devices and arrays of devices on substrates comprising polymeric materials. The present invention also provides stretchable semiconductor structures and stretchable electronic devices capable of good performance in stretched configurations.

  3. Finite element modeling of the human pelvis

    Energy Technology Data Exchange (ETDEWEB)

    Carlson, B.

    1995-11-01

    A finite element model of the human pelvis was created using a commercial wire frame image as a template. To test the final mesh, the model`s mechanical behavior was analyzed through finite element analysis and the results were displayed graphically as stress concentrations. In the future, this grid of the pelvis will be integrated with a full leg model and used in side-impact car collision simulations.

  4. How Cultural Elements Affect Business English Translation

    Institute of Scientific and Technical Information of China (English)

    路萱

    2008-01-01

    Transnational,cross -racial,cross -cultural exchanges are becoming increasingly extensive and frequent,and mutual contacts and commercial intercourse of different peoples show that cultural interchange and cultural integration,accompanied by economic integration,to some extent, have come to every aspect of life and to every participant. This article concentrates on the impact of cultural elements in business English translation while analyzing the relationship between cultural elements and translation in the Chinese perspective.

  5. Surgery simulation using fast finite elements

    DEFF Research Database (Denmark)

    Bro-Nielsen, Morten

    1996-01-01

    This paper describes our recent work on real-time surgery simulation using fast finite element models of linear elasticity. In addition, we discuss various improvements in terms of speed and realism......This paper describes our recent work on real-time surgery simulation using fast finite element models of linear elasticity. In addition, we discuss various improvements in terms of speed and realism...

  6. Main: ELEMENT2GMLBC3 [PLACE

    Lifescience Database Archive (English)

    Full Text Available ELEMENT2GMLBC3 S000320 7-Sep-2000 (last modified) seki Element 2 found in the promo...ter of soybean (G.m.) leghaemoglobin lbc3 gene; Binding site of nuclear extract from soybean nodules; Locate...nt 2 is highly conserved in other soybean lb gene promoter regions; See S000319; nodule; leghaemoglobin; lbc3; root; Soybean (Glycine max) CTTAAATTATTTATTT ...

  7. Molecular clusters of the main group elements

    CERN Document Server

    Driess, Matthias

    2008-01-01

    ""To summarize, Molecular Clusters of the Main Group Elements is certainly not a popular science book, nor is it a textbook; it is a very good, up-to-date collection of articles for the specialist. Als Fazit bleibt: Molecular Clusters of the Main Group Elements ist sicher kein populissenschaftliches Werk, auch kein Lehrbuch, aber eine gelungene, hoch aktuelle Zusammenstellung fen interessierten Fachmann."" -Michael Ruck, TU Dresden, Angewandte Chemie, 2004 - 116/36 + International Edition 2004 - 43/36

  8. Trace elements in coals of eastern Donbas

    Energy Technology Data Exchange (ETDEWEB)

    Taranushich, F.F. [All Russian Research & Geological Prospecting Institute for Coal Deposits, Rostov Na Donu (Russian Federation)

    2003-02-01

    Peculiarities of trace element (TE) distribution in coals of the eastern Donets Basin (Donbas) are discussed. The correlation of TE distribution with specific features of the geological setting of the region can testify to the hydrothermal introduction of trace elements or their redistribution in fluid-active zones. The geochemical regionalization of eastern Donbas is based on TE distribution. Strontium-gold-base metal, tungsten, and selenium geochemical belts and a rare metal geochemical block are outlined.

  9. The finite element method in electromagnetics

    CERN Document Server

    Jin, Jianming

    2014-01-01

    A new edition of the leading textbook on the finite element method, incorporating major advancements and further applications in the field of electromagnetics The finite element method (FEM) is a powerful simulation technique used to solve boundary-value problems in a variety of engineering circumstances. It has been widely used for analysis of electromagnetic fields in antennas, radar scattering, RF and microwave engineering, high-speed/high-frequency circuits, wireless communication, electromagnetic compatibility, photonics, remote sensing, biomedical engineering, and space exploration. The

  10. Visual examinations of K west fuel elements

    Energy Technology Data Exchange (ETDEWEB)

    Pitner, A.L., Fluor Daniel Hanford

    1997-02-03

    Over 250 fuel assemblies stored in sealed canisters in the K West Basin were extracted and visually examined for damage. Substantial damage was expected based on high cesium levels previously measured in water samples taken from these canisters. About 11% of the inner elements and 45% of the outer elements were found to be failed in these examinations. Canisters that had cesium levels of I curie or more generally had multiple instances of major fuel damage.

  11. A NOTE ON FINITE ELEMENT WAVELETS

    Institute of Scientific and Technical Information of China (English)

    谌秋辉; 陈翰麟

    2001-01-01

    The refinability and approximation order of finite element multi-scale vector are discussed in [1]. But the coefficients in the conditions of approximation order of finite element multi-scale vector are incorrect there. The main purpose of this note is to make a correction of the error in the main result of [1]. These coefficients are very important for the properties of wavelets, such as vanishing moments and regularity.

  12. Predictions of synthesizing element 119 and 120

    Institute of Scientific and Technical Information of China (English)

    2011-01-01

    The evaporation residue cross sections of synthesizing superheavy nuclei Z=119, 120 are calculated by different sets of master equations with different dynamical variables. Two methods basically predicted similar results that the Ca induced hot fusion can 48 produce element 119 easier than produce 120, and the evaporation residue cross sections for 119 are detectable by current advanced techniques, while the evaporation residue cross sections are below 0.1 pb for producing element 120.

  13. Poole-frenkel piezoconductive element and sensor

    Science.gov (United States)

    Habermehl, Scott D.

    2004-08-03

    A new class of highly sensitive piezoconductive strain sensor elements and sensors has been invented. The new elements function under conditions such that electrical conductivity is dominated by Poole-Frenkel transport. A substantial piezoconductive effect appears in this regime, allowing the new sensors to exhibit sensitivity to applied strain as much as two orders of magnitude in excess of prior art sensors based on doped silicon.

  14. Element sharing in interleaved antenna arrays

    CSIR Research Space (South Africa)

    Du Plessis, WP

    2012-03-01

    Full Text Available to obtain improved solutions and have been successfully applied to a wide variety of problems. These problems include thinned- 2 Start Stop Initialisation Selection Crossover Terminate?Y N Fitness calculation Penalty Repair Mutation Fig. 1. A... 40 50 60 70 80 90 Filling factor (% ) Shared elements Thinned Inverse Subarray 1 Subarray 2 Fig. 5. The filling factor as a function of the number of shared elements for the penalty-function GA results in Fig. 4 other. Additionally...

  15. Børnehaven De fire Elementer

    DEFF Research Database (Denmark)

    Sørensen, Hanne Værum

    I projektet undersøges og beskrives arbejdet i børnehaven De fire Elementer, med særligt fokus på kønsopdelingen fire formiddage om ugen.......I projektet undersøges og beskrives arbejdet i børnehaven De fire Elementer, med særligt fokus på kønsopdelingen fire formiddage om ugen....

  16. Transcriptional activity of transposable elements in coelacanth.

    Science.gov (United States)

    Forconi, Mariko; Chalopin, Domitille; Barucca, Marco; Biscotti, Maria Assunta; De Moro, Gianluca; Galiana, Delphine; Gerdol, Marco; Pallavicini, Alberto; Canapa, Adriana; Olmo, Ettore; Volff, Jean-Nicolas

    2014-09-01

    The morphological stasis of coelacanths has long suggested a slow evolutionary rate. General genomic stasis might also imply a decrease of transposable elements activity. To evaluate the potential activity of transposable elements (TEs) in "living fossil" species, transcriptomic data of Latimeria chalumnae and its Indonesian congener Latimeria menadoensis were compared through the RNA-sequencing mapping procedures in three different organs (liver, testis, and muscle). The analysis of coelacanth transcriptomes highlights a significant percentage of transcribed TEs in both species. Major contributors are LINE retrotransposons, especially from the CR1 family. Furthermore, some particular elements such as a LF-SINE and a LINE2 sequences seem to be more expressed than other elements. The amount of TEs expressed in testis suggests possible transposition burst in incoming generations. Moreover, significant amount of TEs in liver and muscle transcriptomes were also observed. Analyses of elements displaying marked organ-specific expression gave us the opportunity to highlight exaptation cases, that is, the recruitment of TEs as new cellular genes, but also to identify a new Latimeria-specific family of Short Interspersed Nuclear Elements called CoeG-SINEs. Overall, transcriptome results do not seem to be in line with a slow-evolving genome with poor TE activity.

  17. The Last Element of Mendeleev's Periodic Table

    Science.gov (United States)

    Khazan, Albert

    2010-02-01

    Despite much achievements of the synthesis for super-heavy elements (10 new elements were obtained during the last 25 years), the experts in Mendeleev's Periodic Table have not answered the most fundamental question: where the Table ends? The calculations produced on the basis of Quantum Mechanics (the physical conditions in micro-scales) do not not answer this question till now. In my study of chemical compounds, I focused onto the physical conditions observed in macro-scales (the subjects of the regular physics and chemistry). Thus, the Law of Hyperboles was discovered in the Periodic Table: given any chemical compound, the contents of any element in it (per 1 gram-atom), including the contents of unknown elements, whose atomic masses can be set up arbitrarily, is described by the equation of a equilateral hyperbola Y=K/X. The tops of all the arcs are distributed along a real axis crossing the line Y=1 in the point of abscissa 411.66, which manifests the actual atomic mass of the last (heaviest) element of the Periodic Table: its location is Period 8, Group 1; its atomic mass is 411.66, its number is 155 (Khazan A. Upper Limit in Mendeleev's Periodic Table --- Element No.155. Svenska fysikarkivet, 2009). )

  18. Macro-Elements and Trace Elements in Cereal Grains Cultivated in Latvia

    Directory of Open Access Journals (Sweden)

    Jākobsone Ida

    2015-09-01

    Full Text Available Cereal-based foods have great importance in the compensation of micro- and trace element deficiency, because 50% of the foods produced worldwide are made up of cereal grains. The aim of the research was to determine the concentration of macro-elements and trace elements in different cereals cultivated in Latvia. Various cereals were used in the research: rye (n = 45, barley (n = 54, spring wheat (n = 27, winter wheat (n = 53, triticale (n = 45 and oats (n = 42. Thirteen macro- and trace elements (Cd, Pb, Ni, Cr, Al, Cu, K, Na, Mn, Fe, Zn, Mg, Ca were determined in cereal grain samples (n = 266. Macro-elements and trace elements varied significantly (p < 0.01 or p < 0.001. The highest concentrations of macro- and trace elements were found in oats and the lowest in rye. The obtained data will expand the opportunity for food and nutrition scientists to evaluate content of the examined elements in grain products, and dietary consumption (bioavailability of the examined macro-elements and trace elements.

  19. Comparison of hexahedral and tetrahedral elements in finite element analysis of the foot and footwear.

    Science.gov (United States)

    Tadepalli, Srinivas C; Erdemir, Ahmet; Cavanagh, Peter R

    2011-08-11

    Finite element analysis has been widely used in the field of foot and footwear biomechanics to determine plantar pressures as well as stresses and strains within soft tissue and footwear materials. When dealing with anatomical structures such as the foot, hexahedral mesh generation accounts for most of the model development time due to geometric complexities imposed by branching and embedded structures. Tetrahedral meshing, which can be more easily automated, has been the approach of choice to date in foot and footwear biomechanics. Here we use the nonlinear finite element program Abaqus (Simulia, Providence, RI) to examine the advantages and disadvantages of tetrahedral and hexahedral elements under compression and shear loading, material incompressibility, and frictional contact conditions, which are commonly seen in foot and footwear biomechanics. This study demonstrated that for a range of simulation conditions, hybrid hexahedral elements (Abaqus C3D8H) consistently performed well while hybrid linear tetrahedral elements (Abaqus C3D4H) performed poorly. On the other hand, enhanced quadratic tetrahedral elements with improved stress visualization (Abaqus C3D10I) performed as well as the hybrid hexahedral elements in terms of contact pressure and contact shear stress predictions. Although the enhanced quadratic tetrahedral element simulations were computationally expensive compared to hexahedral element simulations in both barefoot and footwear conditions, the enhanced quadratic tetrahedral element formulation seems to be very promising for foot and footwear applications as a result of decreased labor and expedited model development, all related to facilitated mesh generation.

  20. A flat triangular shell element with Loof nodes

    DEFF Research Database (Denmark)

    Poulsen, Peter Noe; Damkilde, Lars

    1996-01-01

    In the formulation of flat shell elements it is difficult to achieve inter-element compatibility between membrane and transverse displacements for non-coplanar elements. Many elements lack proper nodal degrees of freedom to model intersections making the assembly of elements troublesome. A flat...... triangular shell element is established by a combination of a new plate bending element DKTL and the well-known linear membrane strain element LST, and for this element the above-mentioned deficiences are avoided. The plate bending element DKTL is based on Discrete Kirchhoff Theory and Loof nodes. The nodal...... configuration of the element is similar to the SemiLoof element, and the formulation is an improvement of a previous formulation. The element is used for both linear statics, linear buckling and geometrical non-linear analysis, and numerical examples are presented to show the robustness, accuracy and quick...

  1. A Family of Uniform Strain Tetrahedral Elements and a Method for Connecting Dissimilar Finite Element Meshes

    Energy Technology Data Exchange (ETDEWEB)

    Dohrmann, C.R.; Heinstein, M.W.; Jung, J.; Key, S.W.

    1999-01-01

    This report documents a collection of papers on a family of uniform strain tetrahedral finite elements and their connection to different element types. Also included in the report are two papers which address the general problem of connecting dissimilar meshes in two and three dimensions. Much of the work presented here was motivated by the development of the tetrahedral element described in the report "A Suitable Low-Order, Eight-Node Tetrahedral Finite Element For Solids," by S. W. Key {ital et al.}, SAND98-0756, March 1998. Two basic issues addressed by the papers are: (1) the performance of alternative tetrahedral elements with uniform strain and enhanced uniform strain formulations, and (2) the proper connection of tetrahedral and other element types when two meshes are "tied" together to represent a single continuous domain.

  2. A review of flexibility-based finite element method for beam-column elements

    Institute of Scientific and Technical Information of China (English)

    LI Shuang; ZHAI Changhai; XIE Lili

    2009-01-01

    For material nonlinear problem, elements derived with the flexibility-based method are more accurate than classical elements derived with the stiffness-based method. A review of the current state of the art of the flexibility-based finite element method is provided to enhance the robustness of structure analysis. The research on beam-column elements is the mainstream in the research on flexibility-based finite element method at present. The original development of flexibility-based finite element method is reviewed, and the further development of this method is then presented in several specific aspects, such as geometrically nonlinear analysis and dynamic analysis. The further research needed to be carried out in the future is finally discussed.

  3. COUPLING OF ASSUMED STRESS FINITE ELEMENT AND BOUNDARY ELEMENT METHODS WITH STRESS-TRACTION EQUILIBRIUM

    Institute of Scientific and Technical Information of China (English)

    GUZELBEY Ibrahim H.; KANBER Bahattin; AKPOLAT Abdullah

    2004-01-01

    In this study, the stress based finite element method is coupled with the boundary element method in two different ways. In the first one, the ordinary distribution matrix is used for coupling. In the second one, the stress traction equilibrium is used at the interface line of both regions as a new coupling process. This new coupling procedure is presented without a distribution matrix. Several case studies are solved for the validation of the developed coupling procedure. The results of case studies are compared with the distribution matrix coupling, displacement based finite element method, assumed stress finite element method, boundary element method, ANSYS and analytical results whenever possible. It is shown that the coupling of the stress traction equilibrium with assumed stress finite elements gives as accurate results as those by the distribution matrix coupling.

  4. Comparison of boundary element and finite element methods in spur gear root stress analysis

    Science.gov (United States)

    Sun, H.; Mavriplis, D.; Huston, R. L.; Oswald, F. B.

    1989-01-01

    The boundary element method (BEM) is used to compute fillet stress concentration in spur gear teeth. The results are shown to compare favorably with analogous results obtained using the finite element method (FEM). A partially supported thin rim gear is studied. The loading is applied at the pitch point. A three-dimensional analysis is conducted using both the BEM and FEM (NASTRAN). The results are also compared with those of a two-dimensional finite element model. An advantage of the BEM over the FEM is that fewer elements are needed with the BEM. Indeed, in the current study the BEM used 92 elements and 270 nodes whereas the FEM used 320 elements and 2037 nodes. Moreover, since the BEM is especially useful in problems with high stress gradients it is potentially a very useful tool for fillet stress analyses.

  5. Production of heavy elements in inhomogeneous cosmologies

    Science.gov (United States)

    Rauscher, Thomas; Applegate, James H.; Cowan, John J.; Thielemann, Friedrich-Karl; Wiescher, Michael

    1994-07-01

    Baryon density inhomogeneities during big bang nucleosynthesis can result from a variety of possible causes (e.g., quantum chromodynamic and electroweak phase transitions; cosmic strings). We present here the consequences of such inhomogeneities with special emphasis on the production of heavy elements in a parameter study, varying the global baryon-to-photon ratio eta (which is related to the baryon density and the Hubble constant via eta10 = 64.94 Omegab(H0/50)2 and the length scale of the density inhomogeneities. The production of heavy elements beyond Fe can only occur in neutron-rich environments; thus, we limit our study to neutron-rich zones, originating from neutron diffusion into low-density regions. In this first calculation including elements heavier than Si, we prove an earlier hypothesis that under such conditions r-process elements can be produced, strongly enhanced by the process of fission cycling. Primordial r-process abundances are, however, very sensitive to the choice of eta. Significant amounts, comparable to or larger than the (permitted) floor of heavy-element abundances found in low-metallicity stars at the onset of galactic evolution, can only be obtained for values in excess of eta10 = 133 (i.e., Omegab(h50)2 = 2.0; e.g., Omegab = 1, H0 = 71, or Omegab = 0.5, H0 = 100) and large length scales of inhomogeneities, which minimize the back-diffusion of neutrons into proton-rich regions. Recent investigations analyzing the primordial abundances of light elements seem to set tighter limits, eta10 less than 26 to 39 (Omega b)(h50)2 less than 0.4 to 0.6, from He-4 and apparently considerably lower values based on Li, Be, and B. Under such conditions the predicted abundances of heavy elements are a factor of 105 or more below presently observable limits.

  6. Swedish Chemists and Discovery of the Elements

    Science.gov (United States)

    Thomsen, Volker

    1996-10-01

    All of the elements not already known from antiquity were discovered in Europe and North America. So which country ranks number one on the discovery list? The question occurred to me while leafing through reference 1 in search of thermodynamic data on silicon. Never having seen such a tabulation, I wondered if it might prove useful in teaching. The question has a sports-related flavor that will appeal to many students. Personally, I picked England or Germany for #1. The actual result is surprising. The ranking considering only up to atomic number 103 is as follows: Note: Where two or more independent discoveries have been made, each country is credited. In the "others" category Austria and Denmark each has two discoveries. The remaining countries, with one each, are Finland, Italy, Mexico, Poland, Romania, Russia, and Spain. The high place for the USA is primarily due to the work done at Berkeley and Los Alamos on the transuranics. Without these discoveries, the US would have tied with Switzerland at three elements. Perhaps the most interesting aspect of this tabulation is that Swedish chemists have discovered the most elements. Four chemists alone account for twelve of the 20 discoveries: Baron Jöns Jakob Berzelius (1779-1848) is credited with four elements. His pupil, friend, and assistant, Carl Gustav Mosander (1797-1858) discovered three. P. T. Cleve also found three elements and Karl Wilhelm Scheele (1742-1786) discovered two. Biographical research on the Swedish chemists is a suitable assignment at the introductory level. Reasons for the predominance of Swedish chemists presents a challenging student research topic in the history of chemistry. Another interesting question at the introductory level is, transuranics aside, who discovered the most elements? At the more advanced level the question becomes, why? Literature Cited: 1. Emsley, J. The Elements; Clarendon: Oxford, 1989.

  7. Superheavy Element Studies with TASCA at GSI: Spectroscopy of Element 115 Decay Chains

    Science.gov (United States)

    Rudolph, Dirk

    Experimental campaigns on investigations of the superheavy elements 115, 117, 119, and 120 were conducted 2011 and 2012 at the gas-filled "TransActinide Separator and Chemistry Apparatus" (TASCA) at the GSI Helmholtzzentrum für Schwerionenforschung, Darmstadt, Germany. Nuclear structure implications of first-ever α-photon coincidence spectroscopy on element 115 and its daughters obtained with the TASISpec set-up are discussed, likewise possible connections between decay chains associated with elements 115 and 117.

  8. NEW ALGORITHM OF COUPLING ELEMENT-FREE GALERKIN WITH FINITE ELEMENT METHOD

    Institute of Scientific and Technical Information of China (English)

    ZHAO Guang-ming; SONG Shun-cheng

    2005-01-01

    Through the construction of a new ramp function, the element-free Galerkin method and finite element coupling method were applied to the whole field, and was made fit for the structure of element nodes within the interface regions, both satisfying the essential boundary conditions and deploying meshless nodes and finite elements in a convenient and flexible way, which can meet the requirements of computation for complicated field. The comparison between the results of the present study and the corresponding analytical solutions shows this method is feasible and effective.

  9. Adaptive finite element-element-free Galerkin coupling method for bulk metal forming processes

    Institute of Scientific and Technical Information of China (English)

    Lei-chao LIU; Xiang-huai DONG; Cong-xin LI

    2009-01-01

    An adaptive finite element-element-free Galerkin (FE-EFG) coupling method is proposed and developed for the numerical simulation of bulk metal forming processes. This approach is able to adaptively convert distorted FE elements to EFG domain in analysis. A new scheme to implement adaptive conversion and coupling is presented. The coupling method takes both advantages of finite element method (FEM) and meshless methods. It is capable of handling large deformations with no need of remeshing procedures, while it is computationally more efficient than those full meshless methods. The effectiveness of the proposed method is demonstrated with the numerical simulations of the bulk metal forming processes including forging and extrusion.

  10. Augmented weak forms and element-by-element preconditioners: Efficient iterative strategies for structural finite elements. A preliminary study

    Science.gov (United States)

    Muller, A.; Hughes, T. J. R.

    1984-01-01

    A weak formulation in structural analysis that provides well conditioned matrices suitable for iterative solutions is presented. A mixed formulation ensures the proper representation of the problem and the constitutive relations are added in a penalized form. The problem is solved by a double conjugate gradient algorithm combined with an element by element approximate factorization procedure. The double conjugate gradient strategy resembles Uzawa's variable-length type algorithms the main difference is the presence of quadratic terms in the mixed variables. In the case of shear deformable beams these terms ensure that the proper finite thickness solution is obtained.

  11. Repetitive Elements in Mycoplasma hyopneumoniae Transcriptional Regulation

    Science.gov (United States)

    Cattani, Amanda Malvessi; Siqueira, Franciele Maboni; Guedes, Rafael Lucas Muniz; Schrank, Irene Silveira

    2016-01-01

    Transcriptional regulation, a multiple-step process, is still poorly understood in the important pig pathogen Mycoplasma hyopneumoniae. Basic motifs like promoters and terminators have already been described, but no other cis-regulatory elements have been found. DNA repeat sequences have been shown to be an interesting potential source of cis-regulatory elements. In this work, a genome-wide search for tandem and palindromic repetitive elements was performed in the intergenic regions of all coding sequences from M. hyopneumoniae strain 7448. Computational analysis demonstrated the presence of 144 tandem repeats and 1,171 palindromic elements. The DNA repeat sequences were distributed within the 5’ upstream regions of 86% of transcriptional units of M. hyopneumoniae strain 7448. Comparative analysis between distinct repetitive sequences found in related mycoplasma genomes demonstrated different percentages of conservation among pathogenic and nonpathogenic strains. qPCR assays revealed differential expression among genes showing variable numbers of repetitive elements. In addition, repeats found in 206 genes already described to be differentially regulated under different culture conditions of M. hyopneumoniae strain 232 showed almost 80% conservation in relation to M. hyopneumoniae strain 7448 repeats. Altogether, these findings suggest a potential regulatory role of tandem and palindromic DNA repeats in the M. hyopneumoniae transcriptional profile. PMID:28005945

  12. Trace elements in termites by PIXE analysis

    Science.gov (United States)

    Yoshimura, T.; Kagemori, N.; Kawai, S.; Sera, K.; Futatsugawa, S.

    2002-04-01

    Trace elements in a Japanese subterranean xylophagous termite, Coptotermes formosanus Shiraki, were analyzed by the PIXE method. The total amount of the 14 predominant elements out of 27 detected in an intact termite was higher in a soldier termite (23 000 μg/g) than in a worker termite (10 000 μg/g). A block of wood ( Pinus densiflora Sieb. et Zucc.) for termite feed had a much lower concentration (3600 μg/g) compared with that in an intact termite. This probably relates the functional bio-condensation and/or bio-recycling of trace elements in C. formosanus. When a termite was separated into three anatomical parts, head, degutted body and gut, the worker gut contained the highest total amount of the 14 predominant measured elements (31 000 μg/g). This might be correlated with the higher activity of food digestion and energy production in the worker gut. Moreover, the mandible of the soldier head, with an exoskeleton that is intensely hardened, showed a preferential distribution of Mn and Fe. These results suggest that the characteristic localization of elements will be closely related to the functional role of the individual anatomical part of C. formosanus.

  13. Deletion of ultraconserved elements yields viable mice

    Energy Technology Data Exchange (ETDEWEB)

    Ahituv, Nadav; Zhu, Yiwen; Visel, Axel; Holt, Amy; Afzal, Veena; Pennacchio, Len A.; Rubin, Edward M.

    2007-07-15

    Ultraconserved elements have been suggested to retainextended perfect sequence identity between the human, mouse, and ratgenomes due to essential functional properties. To investigate thenecessities of these elements in vivo, we removed four non-codingultraconserved elements (ranging in length from 222 to 731 base pairs)from the mouse genome. To maximize the likelihood of observing aphenotype, we chose to delete elements that function as enhancers in amouse transgenic assay and that are near genes that exhibit markedphenotypes both when completely inactivated in the mouse as well as whentheir expression is altered due to other genomic modifications.Remarkably, all four resulting lines of mice lacking these ultraconservedelements were viable and fertile, and failed to reveal any criticalabnormalities when assayed for a variety of phenotypes including growth,longevity, pathology and metabolism. In addition more targeted screens,informed by the abnormalities observed in mice where genes in proximityto the investigated elements had been altered, also failed to revealnotable abnormalities. These results, while not inclusive of all thepossible phenotypic impact of the deleted sequences, indicate thatextreme sequence constraint does not necessarily reflect crucialfunctions required for viability.

  14. Trace elements in termites by PIXE analysis

    Energy Technology Data Exchange (ETDEWEB)

    Yoshimura, T. E-mail: tsuyoshi@termite.kuwri.kyoto-u.ac.jp; Kagemori, N.; Kawai, S.; Sera, K.; Futatsugawa, S

    2002-04-01

    Trace elements in a Japanese subterranean xylophagous termite, Coptotermes formosanus Shiraki, were analyzed by the PIXE method. The total amount of the 14 predominant elements out of 27 detected in an intact termite was higher in a soldier termite (23 000 {mu}g/g) than in a worker termite (10 000 {mu}g/g). A block of wood (Pinus densiflora Sieb. et Zucc.) for termite feed had a much lower concentration (3600 {mu}g/g) compared with that in an intact termite. This probably relates the functional bio-condensation and/or bio-recycling of trace elements in C. formosanus. When a termite was separated into three anatomical parts, head, degutted body and gut, the worker gut contained the highest total amount of the 14 predominant measured elements (31 000 {mu}g/g). This might be correlated with the higher activity of food digestion and energy production in the worker gut. Moreover, the mandible of the soldier head, with an exoskeleton that is intensely hardened, showed a preferential distribution of Mn and Fe. These results suggest that the characteristic localization of elements will be closely related to the functional role of the individual anatomical part of C. formosanus.

  15. Transposable elements in the Anopheles funestus transcriptome.

    Science.gov (United States)

    Fernández-Medina, Rita D; Carareto, Claudia M A; Struchiner, Cláudio J; Ribeiro, José M C

    2017-06-01

    Transposable elements (TEs) are present in most of the eukaryotic genomes and their impact on genome evolution is increasingly recognized. Although there is extensive information on the TEs present in several eukaryotic genomes, less is known about the expression of these elements at the transcriptome level. Here we present a detailed analysis regarding the expression of TEs in Anopheles funestus, the second most important vector of human malaria in Africa. Several transcriptionally active TE families belonging both to Class I and II were identified and characterized. Interestingly, we have identified a full-length putative active element (including the presence of full length TIRs in the genomic sequence) belonging to the hAT superfamily, which presents active members in other insect genomes. This work contributes to a comprehensive understanding of the landscape of transposable elements in A. funestus transcriptome. Our results reveal that TEs are abundant and diverse in the mosquito and that most of the TE families found in the genome are represented in the mosquito transcriptome, a fact that could indicate activity of these elements.The vast diversity of TEs expressed in A. funestus suggests that there is ongoing amplification of several families in this organism.

  16. Trace elements in glucometabolic disorders: an update

    Directory of Open Access Journals (Sweden)

    Wiernsperger Nicolas

    2010-12-01

    Full Text Available Abstract Many trace elements, among which metals, are indispensable for proper functioning of a myriad of biochemical reactions, more particularly as enzyme cofactors. This is particularly true for the vast set of processes involved in regulation of glucose homeostasis, being it in glucose metabolism itself or in hormonal control, especially insulin. The role and importance of trace elements such as chromium, zinc, selenium, lithium and vanadium are much less evident and subjected to chronic debate. This review updates our actual knowledge concerning these five trace elements. A careful survey of the literature shows that while theoretical postulates from some key roles of these elements had led to real hopes for therapy of insulin resistance and diabetes, the limited experience based on available data indicates that beneficial effects and use of most of them are subjected to caution, given the narrow window between safe and unsafe doses. Clear therapeutic benefit in these pathologies is presently doubtful but some data indicate that these metals may have a clinical interest in patients presenting deficiencies in individual metal levels. The same holds true for an association of some trace elements such as chromium or zinc with oral antidiabetics. However, this area is essentially unexplored in adequate clinical trials, which are worth being performed.

  17. Trace element determination in different milk slurries.

    Science.gov (United States)

    García, E M; Lorenzo, M L; Cabrera, C; López, M C; Sánchez, J

    1999-11-01

    We have studied the contents of trace elements of nutritional or toxicological interest in 90 samples of whole, low-fat, skim, condensed, evaporated and powdered milks. Slurries of the samples were prepared with Triton X-100 and analysed using electrothermal atomic absorption spectrometry. The temperature-time programme of the graphite oven was optimized for each element, and the accuracy, precision, selectivity and sensitivity of the method were verified. Concentrations of the trace elements we investigated were: Pb 0-0.211 microgram/g, Cd 0-28.985 ng/g, Al 0.528-4.025 micrograms/g, Cu 0.041-0.370 microgram/g, Cr 0-0.177 microgram/g, Mn 0.024-0.145 microgram/g, Se 0-23.333 ng/g, Zn 0.297-0.827 microgram/g and Ni 0.058-1.750 micrograms/g. (A value of zero indicates that the element was undetectable by our methods.) Concentrations of the pairs of elements Cu-Cd, Mn-Cd, Mn-Cu, Zn-Mn, Ni-Cu, Ni-Mn and Ni-Zn were significantly correlated (P milk analyzed.

  18. Biological toxicity of lanthanide elements on algae.

    Science.gov (United States)

    Tai, Peidong; Zhao, Qing; Su, Dan; Li, Peijun; Stagnitti, Frank

    2010-08-01

    The biological toxicity of lanthanides on marine monocellular algae was investigated. The specific objective of this research was to establish the relationship between the abundance in the seawater of lanthanides and their biological toxicities on marine monocellular algae. The results showed that all single lanthanides had similar toxic effects on Skeletonema costatum. High concentrations of lanthanides (29.04+/-0.61 micromol L(-1)) resulted in 50% reduction in growth of algae compared to the controls (0 micromol L(-1)) after 96 h (96 h-EC50). The biological toxicity of 13 lanthanides on marine monocellular algae was unrelated with the abundance of different lanthanide elements in nature, and the "Harkins rule" was not appropriate for the lanthanides. A mixed solution that contained equivalent concentrations of each lanthanide element had the same inhibition effect on algae cells as each individual lanthanide element at the same total concentration. This phenomenon is unique compared to the groups of other elements in the periodic table. Hence, we speculate that the monocellular organisms might not be able to sufficiently differentiate between the almost chemically identical lanthanide elements.

  19. Evolution of Alu elements toward enhancers.

    Science.gov (United States)

    Su, Ming; Han, Dali; Boyd-Kirkup, Jerome; Yu, Xiaoming; Han, Jing-Dong J

    2014-04-24

    The human genome contains approximately one million Alu repetitive elements comprising 10% of the genome, yet their functions are not well understood. Here, we show that Alu elements resemble enhancers. Alu elements are bound by two well-phased nucleosomes that contain histones bearing marks of active chromatin, and they show tissue-specific enrichment for the enhancer mark H3K4me1. A proportion of Alu elements were experimentally validated as bona fide active enhancers with an in vitro reporter assay. In addition, Hi-C data indicate that Alus show long-range interactions with gene promoters. We also find that Alus are generally more conserved when located in the proximal upstream region of genes. Their similarity to enhancers becomes more prominent with their age in the human genome, following a clear evolutionary continuum reminiscent of the evolutionary pattern of proto-genes. Therefore, we conclude that some Alu elements can function as enhancers and propose that many more may be proto-enhancers that serve as a repertoire for the de novo birth of enhancers.

  20. Peach Bottom test element program. Final report

    Energy Technology Data Exchange (ETDEWEB)

    Saurwein, J.J.; Holzgraf, J.F.; MIller, C.M.; Myers, B.F.; Wallroth, C.F.

    1982-11-01

    Thirty-three test elements were irradiated in the Peach Bottom high-temperature gas-cooled reactor (HTGR) as part of the testing program for advanced HTGRs. Extensive postirradiation examinations and evaluations of 21 of these irradiation experiments were performed. The test element irradiations were simulated using HTGR design codes and data. Calculated fuel burnups, power profiles, fast neutron fluences, and temperatures were verified via destructive burnup measurements, gamma scanning, and in-pile thermocouple readings corrected for decalibration effects. Analytical techniques were developed to improve the quality of temperature predictions through feedback of nuclear measurements into thermal calculations. Dimensional measurements, pressure burst tests, diametral compression tests, ring-cutting tests, strip-cutting tests, and four-point bend tests were performed to measure residual stress, strain, and strength distributions in H-327 graphite structures irradiated in the test elements.

  1. Endangered Elements of the Periodic Table

    Indian Academy of Sciences (India)

    Dhrubajyoti Chattopadhyay

    2017-01-01

    Recent studies show that nearly 40% of the 118 elements thatmake up everything – from the chemist’s arsenal to a varietyof consumer products, are facing depleting supplies. Basedon this data, in 2011, Mike Pitts and his colleagues at theChemistry Innovation Knowledge Transfer Network developeda new type of periodic table. Their analysis revealedthat 44 elements are facing limited supply, or are under thethreat of becoming scarce or inaccessible. These includes allof the rare earth elements, as well as zinc, gallium, germanium,helium, silver, and even phosphorus. The Royal Societyof Chemistry has also published a color-coded periodictable, indicating the ‘endangered elements’. The objective ofthis article is to draw attention to this issue, and create awarenessabout the scientific, social and economic impacts of thisproblem.

  2. Diffractive elements performance in chromatic confocal microscopy

    Energy Technology Data Exchange (ETDEWEB)

    Garzon, J; Duque, D; Alean, A; Toledo, M [Grupo de Optica y EspectroscopIa, Centro de Ciencia Basica, Universidad Pontificia Bolivariana. Medellin (Colombia); Meneses, J [Laboratorio de Optica y Tratamiento de Senales, Instituto de Fisica, Universidad Industrial de Santander, Bucaramanga (Colombia); Gharbi, T, E-mail: jgarzonr10@une.net.co [Laboratoire d' Optique P. M. Duffieux, UMR-6603 CNR/Universite de Franche-Comte. 16 route de Gray, 25030 Besancon Cedex (France)

    2011-01-01

    The Confocal Laser Scanning Microscopy (CLSM) has been widely used in the semiconductor industry and biomedicine because of its depth discrimination capability. Subsequent to this technique has been developed in recent years Chromatic Confocal Microscopy. This method retains the same principle of confocal and offers the added advantage of removing the axial movement of the moving system. This advantage is usually accomplished with an optical element that generates a longitudinal chromatic aberration and a coding system that relates the axial position of each point of the sample with the wavelength that is focused on each. The present paper shows the performance of compact chromatic confocal microscope when some different diffractive elements are used for generation of longitudinal chromatic aberration. Diffractive elements, according to the process and manufacturing parameters, may have different diffraction efficiency and focus a specific wavelength in a specific focal position. The performance assessment is carried out with various light sources which exhibit an incoherent behaviour and a broad spectral width.

  3. Fundamental aspects of nuclear reactor fuel elements

    Energy Technology Data Exchange (ETDEWEB)

    Olander, D.R.

    1976-01-01

    The book presented is designed to function both as a text for first-year graduate courses in nuclear materials and as a reference for workers involved in the materials design and performance aspects of nuclear power plants. The contents are arranged under the following chapter headings: statistical thermodynamics, thermal properties of solids, crystal structures, cohesive energy of solids, chemical equilibrium, point defects in solids, diffusion in solids, dislocations and grain boundaries, equation of state of UO/sub 2/, fuel element thermal performance, fuel chemistry, behavior of solid fission products in oxide fuel elements, swelling due to fission gases, pore migration and fuel restructuring kinetics, fission gas release, mechanical properties of UO/sub 2/, radiation damage, radiation effects in metals, interaction of sodium and stainless steel, modeling of the structural behavior of fuel elements and assemblies. (DG)

  4. Standard cost elements for technology programs

    Science.gov (United States)

    Christensen, Carisa B.; Wagenfuehrer, Carl

    1992-01-01

    The suitable structure for an effective and accurate cost estimate for general purposes is discussed in the context of a NASA technology program. Cost elements are defined for research, management, and facility-construction portions of technology programs. Attention is given to the mechanisms for insuring the viability of spending programs, and the need for program managers is established for effecting timely fund disbursement. Formal, structures, and intuitive techniques are discussed for cost-estimate development, and cost-estimate defensibility can be improved with increased documentation. NASA policies for cash management are examined to demonstrate the importance of the ability to obligate funds and the ability to cost contracted funds. The NASA approach to consistent cost justification is set forth with a list of standard cost-element definitions. The cost elements reflect the three primary concerns of cost estimates: the identification of major assumptions, the specification of secondary analytic assumptions, and the status of program factors.

  5. Earth Abundant Element Type I Clathrate Phases

    Directory of Open Access Journals (Sweden)

    Susan M. Kauzlarich

    2016-08-01

    Full Text Available Earth abundant element clathrate phases are of interest for a number of applications ranging from photovoltaics to thermoelectrics. Silicon-containing type I clathrate is a framework structure with the stoichiometry A8-xSi46 (A = guest atom such as alkali metal that can be tuned by alloying and doping with other elements. The type I clathrate framework can be described as being composed of two types of polyhedral cages made up of tetrahedrally coordinated Si: pentagonal dodecahedra with 20 atoms and tetrakaidecahedra with 24 atoms in the ratio of 2:6. The cation sites, A, are found in the center of each polyhedral cage. This review focuses on the newest discoveries in the group 13-silicon type I clathrate family: A8E8Si38 (A = alkali metal; E = Al, Ga and their properties. Possible approaches to new phases based on earth abundant elements and their potential applications will be discussed.

  6. ['Door de beugel': resorption at dental elements].

    Science.gov (United States)

    Leunisse, M; Barendrecht, D S

    2015-09-01

    A twenty-year-old man was referred to an orthodontist for orthodontic re-treatment of dental element 32 by his dentist and a periodontist. At the buccal surface of the dental element a significant gingival resorption had occurred and the root of the element was located outside of the processus alveolaris buccally. This case will be presented at the thematic tour 'Door de beugel: team up' on 27 October 2015, which is organised by the Nederlandse Vereniging van Tandartsen (Dutch Dentists' Society) and will be held at 4 different locations in the Netherlands. Readers of the Nederlands Tijdschrift voor Tandheelkunde get an exclusive preview of the case. The treatment of choice will be published in the December 2015 issue.

  7. An element with an anhydrous liquid electrolyte

    Energy Technology Data Exchange (ETDEWEB)

    Toda, K.; Isiguro, Y.; Ota, K.; Sinoda, K.; Yamamoto, K.

    1983-01-01

    A light element metal of the lithium or sodium type is used in the element, along with a cathode of Mo02 or CuF2 and an anyhdrous liquid electrolyte from an oganic solvent with an ionogenic additive. An adsorbent which has a composition corresponding to the formula Mx/n((A102)x(Si02)y) with zH20, where M is the ion of sodium, potassium or calcium; n is the valency M and x, y and z are the coefficients which show the content of A102, Si02 and H20, respectively, is introduced into the cathode, separator or electrolyte. The element has high storage life.

  8. Nanoscience and nanotechnology of f elements

    Energy Technology Data Exchange (ETDEWEB)

    Felinto, Maria Claudia F.C. [Instituto de Pesquisas Energeticas e Nucleares (IPEN), Sao Paulo, SP (Brazil)]. E-mail: mfelinto@ipen.br; Brito, Hermi F. [Sao Paulo Univ., SP (Brazil). Inst. de Quimica]. E-mail: hefbrito@iq.usp.br

    2005-07-01

    Medicaments that are carried via blood flow to sick organs; an electronic equipment capable of evaluating quality of beverages twice more sensitive than the human palate; magnets inside plastic micro-spheres that could help remove oil stains from the sea. Products that seem to have been taken from science fiction films, things that could never be part of our grandfather's imagination, they are actually the marvels of one more technological revolution: the nanotechnology. In this context, lanthanides and actinides elements play a fundamental role due to their singular chemical and physical properties. They appear as fundamental materials in a large range of areas such as, new materials applied to fuel element, sensors, electronics, drugs and markers (radio isotope), probes etc. The aim of this work is to review the chemistry and physics properties of these elements approaching this new technology point of view, emphasizing their nuclear applications. (author)

  9. Latest Trends in Finite Element Analysis

    Directory of Open Access Journals (Sweden)

    L. S. Madhav

    1996-01-01

    Full Text Available This paper highlights the advances in computer graphics and the computational power of the processors which have promoted a method of analysis, applicable to almost all the fields of engineering. The advantages of the computers have been judiciously used in the design of algorithms, based on the principles of finite difference, finite element, boundary element, etc., intended for the analysis of engineering components. The concept of finite element method which has been generalised with the availability of commercial software, is also reviewed with a special emphasis on the future trends. The modelling and visualisation techniques have also been discussed with an inner perspective on future of visual display of multidimensional complex information. The application of these techniques in some fields is also indicated.

  10. Elements, topology, and T-shirts

    CERN Document Server

    Fraundorf, P

    2006-01-01

    Consider the network of elements connected by adjacency in atomic number and periodic table column. If all elements except H-He are connected by identical springs and constrained to a z-spiral in 2D, a map sans spring-crossing results for various values of rest length in units of the H-He distance. If the z-spiral is removed, and the network allowed to relax in 3D, the resulting surface with three holes has the topology of a T-shirt or open-handle teapot. Mapping this to a shirt's front-back pattern yields a 2D table of elemental inter-connects in tabular (nearly rectilinear) form. Sample applications: The flat spiral (like other spiral patterns) might serve as basis for an educational board game, while the T-shirt table might serve as a starting point for ``topologically informed'' classroom periodic-table design projects with wearable awards.

  11. HTGR fuel element structural design considerations

    Energy Technology Data Exchange (ETDEWEB)

    Alloway, R.; Gorholt, W.; Ho, F.; Vollman, R.; Yu, H.

    1986-09-01

    The structural design of the large HTGR prismatic core fuel elements involve the interaction of four engineering disciplines: nuclear physics, thermo-hydraulics, structural and material science. Fuel element stress analysis techniques and the development of structural criteria are discussed in the context of an overview of the entire design process. The core of the proposed 2240 MW(t) HTGR is described as an example where the design process was used. Probabalistic stress analysis techniques coupled with probabalistic risk analysis (PRA) to develop structural criteria to account for uncertainty are described. The PRA provides a means for ensuring that the proposed structural criteria are consistent with plant investment and safety risk goals. The evaluation of cracked fuel elements removed from the Fort St. Vrain reactor in the USA is discussed in the context of stress analysis uncertainty and structural criteria development.

  12. Finite Element Methods and Their Applications

    CERN Document Server

    Chen, Zhangxin

    2005-01-01

    This book serves as a text for one- or two-semester courses for upper-level undergraduates and beginning graduate students and as a professional reference for people who want to solve partial differential equations (PDEs) using finite element methods. The author has attempted to introduce every concept in the simplest possible setting and maintain a level of treatment that is as rigorous as possible without being unnecessarily abstract. Quite a lot of attention is given to discontinuous finite elements, characteristic finite elements, and to the applications in fluid and solid mechanics including applications to porous media flow, and applications to semiconductor modeling. An extensive set of exercises and references in each chapter are provided.

  13. Fractional Order Element Based Impedance Matching

    KAUST Repository

    Radwan, Ahmed Gomaa

    2014-06-24

    Disclosed are various embodiments of methods and systems related to fractional order element based impedance matching. In one embodiment, a method includes aligning a traditional Smith chart (|.alpha.|=1) with a fractional order Smith chart (|.alpha.|.noteq.1). A load impedance is located on the traditional Smith chart and projected onto the fractional order Smith chart. A fractional order matching element is determined by transitioning along a matching circle of the fractional order Smith chart based at least in part upon characteristic line impedance. In another embodiment, a system includes a fractional order impedance matching application executed in a computing device. The fractional order impedance matching application includes logic that obtains a first set of Smith chart coordinates at a first order, determines a second set of Smith chart coordinates at a second order, and determines a fractional order matching element from the second set of Smith chart coordinates.

  14. Stochastic finite elements: Where is the physics?

    Directory of Open Access Journals (Sweden)

    Ostoja-Starzewski Martin

    2011-01-01

    Full Text Available The micromechanics based on the Hill-Mandel condition indicates that the majority of stochastic finite element methods hinge on random field (RF models of material properties (such as Hooke’s law having no physical content, or even at odds with physics. At the same time, that condition allows one to set up the RFs of stiffness and compliance tensors in function of the mesoscale and actual random microstructure of the given material. The mesoscale is defined through a Statistical Volume Element (SVE, i.e. a material domain below the Representative Volume Element (RVE level. The paper outlines a procedure for stochastic scale-dependent homogenization leading to a determination of mesoscale one-point and two-point statistics and, thus, a construction of analytical RF models.

  15. Matrix elements from moments of correlation functions

    CERN Document Server

    Bouchard, Chris; Orginos, Kostas; Richards, David

    2016-01-01

    Momentum-space derivatives of matrix elements can be related to their coordinate-space moments through the Fourier transform. We derive these expressions as a function of momentum transfer $Q^2$ for asymptotic in/out states consisting of a single hadron. We calculate corrections to the finite volume moments by studying the spatial dependence of the lattice correlation functions. This method permits the computation of not only the values of matrix elements at momenta accessible on the lattice, but also the momentum-space derivatives, providing {\\it a priori} information about the $Q^2$ dependence of form factors. As a specific application we use the method, at a single lattice spacing and with unphysically heavy quarks, to directly obtain the slope of the isovector form factor at various $Q^2$, whence the isovector charge radius. The method has potential application in the calculation of any hadronic matrix element with momentum transfer, including those relevant to hadronic weak decays.

  16. Revolution in Orthodontics: Finite element analysis

    Science.gov (United States)

    Singh, Johar Rajvinder; Kambalyal, Prabhuraj; Jain, Megha; Khandelwal, Piyush

    2016-01-01

    Engineering has not only developed in the field of medicine but has also become quite established in the field of dentistry, especially Orthodontics. Finite element analysis (FEA) is a computational procedure to calculate the stress in an element, which performs a model solution. This structural analysis allows the determination of stress resulting from external force, pressure, thermal change, and other factors. This method is extremely useful for indicating mechanical aspects of biomaterials and human tissues that can hardly be measured in vivo. The results obtained can then be studied using visualization software within the finite element method (FEM) to view a variety of parameters, and to fully identify implications of the analysis. This is a review to show the applications of FEM in Orthodontics. It is extremely important to verify what the purpose of the study is in order to correctly apply FEM. PMID:27114948

  17. Orthotropic rotation-free thin shell elements

    CERN Document Server

    Munglani, Gautam; Wittel, Falk K; Herrmann, Hans J

    2015-01-01

    A method to simulate orthotropic behaviour in thin shell finite elements is proposed. The approach is based on the transformation of shape function derivatives, resulting in a new orthogonal basis aligned to a specified preferred direction for all elements. This transformation is carried out solely in the undeformed state leaving minimal additional impact on the computational effort expended to simulate orthotropic materials compared to isotropic, resulting in a straightforward and highly efficient implementation. This method is implemented for rotation-free triangular shells using the finite element framework built on the Kirchhoff--Love theory employing subdivision surfaces. The accuracy of this approach is demonstrated using the deformation of a pinched hemispherical shell (with a 18{\\deg} hole) standard benchmark. To showcase the efficiency of this implementation, the wrinkling of orthotropic sheets under shear displacement is analyzed. It is found that orthotropic subdivision shells are able to capture t...

  18. Cultural Elements of English Movie Title

    Institute of Scientific and Technical Information of China (English)

    张琼

    2013-01-01

    Movie title is the name of a movie which to some extent determines the audience ’s choice to watch the movie or not. English movie title, as a special kind of English language, reflects language and culture of the specific English country. To better understand and appreciate the movie, it is essential to understand the cultural elements of the English movie title. The thesis with start with the introduction of movie title and its naming approaches, then analyze the three cultural elements that is historical, reli-gious and linguistic cultural elements in English movie title in the hope of providing helpful background knowledge for Chinese audience to better appreciate the English culture.

  19. Accelerated Matrix Element Method with Parallel Computing

    CERN Document Server

    Schouten, Doug; Stelzer, Bernd

    2014-01-01

    The matrix element method utilizes ab initio calculations of probability densities as powerful discriminants for processes of interest in experimental particle physics. The method has already been used successfully at previous and current collider experiments. However, the computational complexity of this method for final states with many particles and degrees of freedom sets it at a disadvantage compared to supervised classification methods such as decision trees, k nearest-neighbour, or neural networks. This note presents a concrete implementation of the matrix element technique using graphics processing units. Due to the intrinsic parallelizability of multidimensional integration, dramatic speedups can be readily achieved, which makes the matrix element technique viable for general usage at collider experiments.

  20. Matrix elements from moments of correlation functions

    Energy Technology Data Exchange (ETDEWEB)

    Chang, Chia Cheng [SLAC National Accelerator Lab., Menlo Park, CA (United States); Bouchard, Chris [College of William and Mary, Williamsburg, VA (United States); Orginos, Konstantinos [Thomas Jefferson National Accelerator Facility (TJNAF), Newport News, VA (United States); College of William and Mary, Williamsburg, VA (United States); Richards, David G. [Thomas Jefferson National Accelerator Facility (TJNAF), Newport News, VA (United States)

    2016-10-01

    Momentum-space derivatives of matrix elements can be related to their coordinate-space moments through the Fourier transform. We derive these expressions as a function of momentum transfer Q2 for asymptotic in/out states consisting of a single hadron. We calculate corrections to the finite volume moments by studying the spatial dependence of the lattice correlation functions. This method permits the computation of not only the values of matrix elements at momenta accessible on the lattice, but also the momentum-space derivatives, providing {\\it a priori} information about the Q2 dependence of form factors. As a specific application we use the method, at a single lattice spacing and with unphysically heavy quarks, to directly obtain the slope of the isovector form factor at various Q2, whence the isovector charge radius. The method has potential application in the calculation of any hadronic matrix element with momentum transfer, including those relevant to hadronic weak decays.

  1. Finite element analysis of tibial fractures

    DEFF Research Database (Denmark)

    Wong, Christian Nai En; Mikkelsen, Mikkel Peter W; Hansen, Leif Berner

    2010-01-01

    INTRODUCTION: Fractures of the tibial shaft are relatively common injuries. There are indications that tibial shaft fractures share characteristics in terms of site, type and local fracture mechanisms. In this study, we aimed to set up a mathematical, computer-based model using finite element...... analysis of the bones of the lower leg to examine if such a model is adequate for prediction of fracture locations and patterns. In future studies, we aim to use these biomechanical results to examine fracture prevention, among others, and to simulate different types of osteosynthesis and the process...... Project. The data consisted of 21,219 3D elements with a cortical shell and a trabecular core. Three types of load of torsion, a direct lateral load and axial compression were applied. RESULTS: The finite element linear static analysis resulted in relevant fracture localizations and indicated relevant...

  2. Diffractive optical elements written by photodeposition

    Science.gov (United States)

    Baal-Zedaka, I.; Hava, S.; Mirchin, N.; Margolin, R.; Zagon, M.; Lapsker, I.; Azoulay, J.; Peled, A.

    2003-03-01

    In this work direct laser writing of diffractive optical elements (DOE) by photodeposition (PD) of amorphous selenium (a-Se) from colloid solutions has been investigated. We used a computer controlled laser scanner for patterning thin film micro-profiles creating thus planar optical elements by direct beam writing on surfaces immersed in a liquid phase PD cell. The laser employed was an argon ion laser at 488 nm wavelength, with powers up to 55 mW, for writing typically 25-250 μm wide lines of 200 nm thickness at rates of about 150 μm/s. Various elements made of photodeposited thin films on polymethyl-methacrylate (PMMA) substrates were produced for prototyping microlenses, linear grating arrays, cylindrical and circular profiled DOE patterns.

  3. Diffractive optical elements written by photodeposition

    Energy Technology Data Exchange (ETDEWEB)

    Baal-Zedaka, I.; Hava, S.; Mirchin, N.; Margolin, R.; Zagon, M.; Lapsker, I.; Azoulay, J.; Peled, A

    2003-03-15

    In this work direct laser writing of diffractive optical elements (DOE) by photodeposition (PD) of amorphous selenium (a-Se) from colloid solutions has been investigated. We used a computer controlled laser scanner for patterning thin film micro-profiles creating thus planar optical elements by direct beam writing on surfaces immersed in a liquid phase PD cell. The laser employed was an argon ion laser at 488 nm wavelength, with powers up to 55 mW, for writing typically 25-250 {mu}m wide lines of 200 nm thickness at rates of about 150 {mu}m/s. Various elements made of photodeposited thin films on polymethyl-methacrylate (PMMA) substrates were produced for prototyping microlenses, linear grating arrays, cylindrical and circular profiled DOE patterns.

  4. Thresholds in shock response across the elements

    Science.gov (United States)

    Bourne, F. L.; Bourne, N. K.

    2017-01-01

    Compendia of shock data have been assembled across national laboratories across the world. Previous work has shown a threshold in behaviour for materials; the weak shock limit. This corresponds to the stress state at which the shock is overdriven in a single front. Here the shock velocity-particle velocity data for elements and compounds has been systematically analysed to note discontinuities in the data. A range of materials show such features and the form of the discontinuity in each case is analysed. Some of these are found to correspond to martensitic phase transformations as expected whilst others are more difficult to classify. Particular groups within the elements show characteristic forms according to their groupings within the periodic table. Typical datasets are presented and trends in behaviour are noted for a range of elements.

  5. Alloy element redistribution during sintering of powder metallurgy steels

    OpenAIRE

    Tahir, Abdul Malik

    2014-01-01

    Homogenization of alloying elements is desired during sintering of powder metallurgy components. The redistribution processes such as penetration of liquid phase into the interparticle/grain boundaries of solid particles and subsequent solid-state  diffusion of alloy element(s) in the base powder, are important for the effective homogenization of alloy element(s) during liquid phase sintering of the mixed powders. The aim of this study is to increase the understanding of alloy element redistr...

  6. Utilization of Large Cohesive Interface Elements for Delamination Simulation

    DEFF Research Database (Denmark)

    Bak, Brian Lau Verndal; Lund, Erik

    2012-01-01

    This paper describes the difficulties of utilizing large interface elements in delamination simulation. Solutions to increase the size of applicable interface elements are described and cover numerical integration of the element and modifications of the cohesive law.......This paper describes the difficulties of utilizing large interface elements in delamination simulation. Solutions to increase the size of applicable interface elements are described and cover numerical integration of the element and modifications of the cohesive law....

  7. Elemental analysis of silver coins by PIXE technique

    Energy Technology Data Exchange (ETDEWEB)

    Tripathy, B.B. [Department of Physics, Silicon Institute of Technology, Patia, Bhubaneswar 751 024 (India); Rautray, Tapash R. [Department of Dental Biomaterials, School of Dentistry, Kyungpook National University, 2-188-1 Samduk -dong, Jung-gu, Daegu 700 412 (Korea, Republic of); ARASMIN, G. Udayagiri, Kandhamal, Orissa 762 100 (India)], E-mail: tapash.rautray@gmail.com; Rautray, A.C. [ARASMIN, G. Udayagiri, Kandhamal, Orissa 762 100 (India); Vijayan, V. [Praveen Institute of Radiation Technology, Flat No. 9A, Avvai Street, New Perungalathur, Chennai 600 063 (India)

    2010-03-15

    Elemental analysis of nine Indian silver coins during British rule was carried out by proton induced X-ray emission spectroscopy. Eight elements, namely Cr, Fe, Ni, Cu, Zn, As, Ag, and Pb were determined in the present study. Ag and Cu were found to be the major elements, Zn was the only minor element and all other elements are present at the trace level. The variation of the elemental concentration may be due to the use of different ores for making coins.

  8. Using reciprocity in Boundary Element Calculations

    DEFF Research Database (Denmark)

    Juhl, Peter Møller; Cutanda Henriquez, Vicente

    2010-01-01

    The concept of reciprocity is widely used in both theoretical and experimental work. In Boundary Element calculations reciprocity is sometimes employed in the solution of computationally expensive scattering problems, which sometimes can be more efficiently dealt with when formulated...... as the reciprocal radiation problem. The present paper concerns the situation of having a point source (which is reciprocal to a point receiver) at or near a discretized boundary element surface. The accuracy of the original and the reciprocal problem is compared in a test case for which an analytical solution...

  9. A way for synthesis of superheavy elements

    Energy Technology Data Exchange (ETDEWEB)

    Ohta, M.; Aritomo, Y.; Wada, T. [Konan Univ., Kobe (Japan). Dept. of Physics; Abe, Y.

    1997-05-01

    Fusion-fission process in heavy systems are analyzed by Smoluchowski equation taking into account the temperature dependent shell correction energy. The evaporation residue cross sections of superheavy elements have been shown to have an optimum value at a certain temperature, due to the balance between the diffusibility for fusion at high temperature and the restoration of the shell correction energy against fission at low temperature. The essential element which realize an significant yield for the (HI, 4-5n) reaction in superheavy mass region is found to be the characteristic time for cooling by neutron evaporation. (author)

  10. Elemental distribution in human femoral head

    Energy Technology Data Exchange (ETDEWEB)

    Santos, C., E-mail: catia.santos@itn.pt [Dep. Física, Faculdade de Ciências e Tecnologia, Universidade Nova de Lisboa, 2829-516 Caparica (Portugal); Centro de Física Nuclear da Universidade de Lisboa, 1649-003 Lisboa (Portugal); Campus Tecnológico e Nuclear, IST/CTN, Universidade Técnica de Lisboa E.N. 10, 2686-953 Sacavém (Portugal); Fonseca, M. [Dep. Física, Faculdade de Ciências e Tecnologia, Universidade Nova de Lisboa, 2829-516 Caparica (Portugal); Centro de Física Nuclear da Universidade de Lisboa, 1649-003 Lisboa (Portugal); Universidade Europeia|Laureate International Universities, 1500-210 Lisboa (Portugal); Corregidor, V. [Campus Tecnológico e Nuclear, IST/CTN, Universidade Técnica de Lisboa E.N. 10, 2686-953 Sacavém (Portugal); Silva, H. [Dep. Física, Faculdade de Ciências e Tecnologia, Universidade Nova de Lisboa, 2829-516 Caparica (Portugal); Centro de Física Nuclear da Universidade de Lisboa, 1649-003 Lisboa (Portugal); Campus Tecnológico e Nuclear, IST/CTN, Universidade Técnica de Lisboa E.N. 10, 2686-953 Sacavém (Portugal); Luís, H.; Jesus, A.P. [Dep. Física, Faculdade de Ciências e Tecnologia, Universidade Nova de Lisboa, 2829-516 Caparica (Portugal); Centro de Física Nuclear da Universidade de Lisboa, 1649-003 Lisboa (Portugal); and others

    2014-07-15

    Osteoporosis is the most common bone disease with severe symptoms and harmful effects on the patient quality of life. Because abnormal distribution and concentration of the major and trace elements may help to characterize the disease, ion beam analysis is applied to the study of bone samples. Proton Induced X-ray Emission and Elastic Backscattering Spectrometry are applied for qualitative and quantitative analysis of an osteoporotic bone sample, for the determination of the Ca/P ratio and analysis of the distribution of major and trace elements. The analysis was made both in trabecular and cortical bone and the results are in agreement with the information found in literature.

  11. Lumped elements for RF and microwave circuits

    CERN Document Server

    Bahl, Inder

    2003-01-01

    Due to the unprecedented growth in wireless applications over the past decade, development of low-cost solutions for RF and microwave communication systems has become of great importance. This practical new book is the first comprehensive treatment of lumped elements, which are playing a critical role in the development of the circuits that make these cost-effective systems possible. The books offers you an in-depth understanding of the different types of RF and microwave circuit elements, including inductors, capacitors, resistors, transformers, via holes, airbridges, and crossovers. Support

  12. Finite elements for analysis and design

    CERN Document Server

    Akin, J E; Davenport, J H

    1994-01-01

    The finite element method (FEM) is an analysis tool for problem-solving used throughout applied mathematics, engineering, and scientific computing. Finite Elements for Analysis and Design provides a thoroughlyrevised and up-to-date account of this important tool and its numerous applications, with added emphasis on basic theory. Numerous worked examples are included to illustrate the material.Key Features* Akin clearly explains the FEM, a numerical analysis tool for problem-solving throughout applied mathematics, engineering and scientific computing* Basic theory has bee

  13. Analyzing effective elements in agile supply chain

    Directory of Open Access Journals (Sweden)

    Babak Jamshidi Navid

    2012-01-01

    Full Text Available Agile supply chain plays an important role on having efficient production planning. There are different factors affecting the efficiency of a supply chain and the attempt of this paper is to find the most important elements in agile supply chain. The proposed model of this paper gathers decision makers' opinions and based on DEMATEL technique determines the most important items. The preliminary results of this survey indicate that we could divide the factors into four groups and two elements including automation and utilization of technical tools of relations and information play the most important roles among other factors.

  14. Elemental mercury poisoning probably causes cortical myoclonus.

    Science.gov (United States)

    Ragothaman, Mona; Kulkarni, Girish; Ashraf, Valappil V; Pal, Pramod K; Chickabasavaiah, Yasha; Shankar, Susarla K; Govindappa, Srikanth S; Satishchandra, Parthasarthy; Muthane, Uday B

    2007-10-15

    Mercury toxicity causes postural tremors, commonly referred to as "mercurial tremors," and cerebellar dysfunction. A 23-year woman, 2 years after injecting herself with elemental mercury developed disabling generalized myoclonus and ataxia. Electrophysiological studies confirmed the myoclonus was probably of cortical origin. Her deficits progressed over 2 years and improved after subcutaneous mercury deposits at the injection site were surgically cleared. Myoclonus of cortical origin has never been described in mercury poisoning. It is important to ask patients presenting with jerks about exposure to elemental mercury even if they have a progressive illness, as it is a potentially reversible condition as in our patient.

  15. Elemental microanalysis in ecophysiology using ion microbeam

    Energy Technology Data Exchange (ETDEWEB)

    Przybylowicz, W.J. E-mail: przybylowicz@tlabs.ac.za; Mesjasz-Przybylowicz, J.; Migula, P.; Turnau, K.; Nakonieczny, M.; Augustyniak, M.; Glowacka, E

    2004-06-01

    A few recent applications of elemental microanalysis based on proton beam in ecophysiology and ecotoxicology are shown. They are related to biofiltering capabilities of mycorrhiza (symbiosis between fungi and plant roots) and to plant-insect herbivore interactions. The reported results were obtained at iThemba LABS, South Africa. PIXE and BS techniques were simultaneously used. True elemental maps were generated using a VMS version and PC version of GeoPIXE (GeoPIXE I and II). Further analysis was performed using PIXE and BS spectra extracted from list-mode data and corresponding to specific organs of an insect or a plant.

  16. Electrochemical Cells with Intermediate Capacitor Elements

    CERN Document Server

    Grebel, Haim

    2015-01-01

    Our goal is to electronically regulate electrochemical cells. For this, we introduced a third element, called the gate, which was placed between the cathode and the anode electrodes of the cell. Voltage applied to this element controlled the local potential of the electrolyte, thus impacting the flow of ions within the cell. The flow of ions was monitored by the electronic current in the external cell's circuit. We provide simulations and experimental data as proof to the validity of this concept. This is but the first step towards a demonstration of a two-dimensional, bi-carrier ion transistors.

  17. Elemental distribution in human femoral head

    Science.gov (United States)

    Santos, C.; Fonseca, M.; Corregidor, V.; Silva, H.; Luís, H.; Jesus, A. P.; Branco, J.; Alves, L. C.

    2014-07-01

    Osteoporosis is the most common bone disease with severe symptoms and harmful effects on the patient quality of life. Because abnormal distribution and concentration of the major and trace elements may help to characterize the disease, ion beam analysis is applied to the study of bone samples. Proton Induced X-ray Emission and Elastic Backscattering Spectrometry are applied for qualitative and quantitative analysis of an osteoporotic bone sample, for the determination of the Ca/P ratio and analysis of the distribution of major and trace elements. The analysis was made both in trabecular and cortical bone and the results are in agreement with the information found in literature.

  18. Stability and `volatility ` of element 104 oxychloride

    Energy Technology Data Exchange (ETDEWEB)

    Eichler, B.; Gaeggeler, H.W. [Paul Scherrer Inst. (PSI), Villigen (Switzerland)

    1997-09-01

    The formation enthalpies {Delta}H{sup *} of solid and gaseous oxychlorides of element 104 from free atoms were estimated by extrapolation. Stability and volatility of these compounds are compared to those of the homologous and neighbouring elements in the periodic system. It can be supposed that in a gas adsorption chromatographic process with oxygen containing chlorinating carrier gas the transport with the carrier gas flow occurs in the chemical state 104Cl{sub 4}. Only in the absorbed state the compound 104OCl{sub 2} is formed. (author) 1 fig., 3 refs.

  19. Nonlinear Finite Element Analysis of Ocean Cables

    Institute of Scientific and Technical Information of China (English)

    Nam-Il KIM; Sang-Soo JEON; Moon-Young KIM

    2004-01-01

    This study has focused on developing numerical procedures for the dynamic nonlinear analysis of cable structures subjected to wave forces and ground motions in the ocean. A geometrically nonlinear finite element procedure using the isoparametric curved cable element based on the Lagrangian formulation is briefly summarized. A simple and accurate method to determine the initial equilibrium state of cable systems associated with self-weights, buoyancy and the motion of end points is presented using the load incremental method combined with penalty method. Also the Newmark method is used for dynamic nonlinear analysis of ocean cables. Numerical examples are presented to validate the present numerical method.

  20. Light element evolution resulting from WMAP data

    CERN Document Server

    Romano, D; Matteucci, F; Chiappini, C; Romano, Donatella; Tosi, Monica; Matteucci, Francesca; Chiappini, Cristina

    2003-01-01

    The recent determination of the baryon-to-photon ratio from WMAP data by Spergel et al. (2003) allows one to fix with unprecedented precision the primordial abundances of the light elements D, 3He, 4He and 7Li in the framework of the standard model of big bang nucleosynthesis. We adopt these primordial abundances and discuss the implications for Galactic chemical evolution, stellar evolution and nucleosynthesis of the light elements. The model predictions on D, 3He and 4He are in excellent agreement with the available data, while a significant depletion of 7Li in low-metallicity stars is required to reproduce the Spite plateau.

  1. Structural elements design manual working with Eurocodes

    CERN Document Server

    Draycott, Trevor

    2009-01-01

    Structural Elements Design Manual: Working With Eurocodes is the structural engineers 'companion volume' to the four Eurocodes on the structural use of timber, concrete, masonry and steelwork. For the student at higher technician or first degree level it provides a single source of information on the behaviour and practical design of the main elements of the building structure. With plenty of worked examples and diagrams, it is a useful textbook not only for students of structural and civil engineering, but also for those on courses in related subjects such as

  2. Razonamiento algebraico elemental: propuestas para el aula

    Directory of Open Access Journals (Sweden)

    Walter F. Castro G

    2014-09-01

    Full Text Available En este artículo se aborda el problema de la enseñanza de álgebra en la escuela primaria. Se discute lo que se entiende como “early álgebra” y se presentan varios enfoques sobre la introducción del álgebra en la escuela elemental. En correspondencia con los enfoques, se discuten tanto algunas tareas de razonamiento algebraico elemental que pueden ser implantadas en el aula, como algunas de las características algebraicas atribuidas. Finalmente, se presenta una propuesta para asignar niveles o grados de algebrización a algunas tareas.

  3. Spectroscopy of element 115 decay chains

    Energy Technology Data Exchange (ETDEWEB)

    Rudolph, Dirk [Lund University, Sweden; Forsberg, U. [Lund University, Sweden; Golubev, P. [Lund University, Sweden; Sarmiento, L. G. [Lund University, Sweden; Yakushev, A. [Gesellschaft fur Schwerionenforschung (GSI), Germany; Andersson, L.-L. [Johannes Gutenberg-Universitaet Mainz, Mainz, Germany; Di Nitto, A. [Johannes Gutenberg-Universitaet Mainz, Mainz, Germany; Duehllmann, Ch. E. [Gesellschaft fur Schwerionenforschung (GSI), Germany; Gates, J. M. [Lawrence Berkeley National Laboratory (LBNL); Gregorich, K. E. [Lawrence Berkeley National Laboratory (LBNL); Gross, Carl J [ORNL; Hessberger, F. P. [Gesellschaft fur Schwerionenforschung (GSI), Germany; Herzberg, R.-D [University of Liverpool; Khuyagbaatar, J. [Johannes Gutenberg-Universitaet Mainz, Mainz, Germany; Kratz, J. V. [Johannes Gutenberg-Universitaet Mainz, Mainz, Germany; Rykaczewski, Krzysztof Piotr [ORNL; Schaedel, M. [Gesellschaft fur Schwerionenforschung (GSI), Germany; Aberg, S. [Lund University, Sweden; Ackermann, D. [GSI-Hemholtzzentrum fur Schwerionenforschung, Darmstadt, Germany; Block, M. [Gesellschaft fur Schwerionenforschung (GSI), Germany; Brand, H. [Gesellschaft fur Schwerionenforschung (GSI), Germany; Carlsson, B. G. [Lund University, Sweden; Cox, D. [University of Liverpool; Derkx, X. [Johannes Gutenberg-Universitaet Mainz, Mainz, Germany; Eberhardt, K. [Johannes Gutenberg-Universitaet Mainz, Mainz, Germany; Even, J. [Johannes Gutenberg-Universitaet Mainz, Mainz, Germany; Fahlander, C. [Lund University, Sweden; Gerl, J. [Gesellschaft fur Schwerionenforschung (GSI), Germany; Jaeger, E. [Gesellschaft fur Schwerionenforschung (GSI), Germany; Kindler, B. [Gesellschaft fur Schwerionenforschung (GSI), Germany; Krier, J. [Gesellschaft fur Schwerionenforschung (GSI), Germany; Kojouharov, I. [Gesellschaft fur Schwerionenforschung (GSI), Germany; Kurz, N. [Gesellschaft fur Schwerionenforschung (GSI), Germany; Lommel, B. [Gesellschaft fur Schwerionenforschung (GSI), Germany; Mistry, A. [University of Liverpool; Mokry, C. [Johannes Gutenberg-Universitaet Mainz, Mainz, Germany; Nitsche, H. [Lawrence Berkeley National Laboratory (LBNL); Omtvedt, J. P. [Paul Scherrer Institut, Villigen, Switzerland; Papadakis, P. [University of Liverpool; Ragnarsson, I. [Lund University, Sweden; Runke, J. [Gesellschaft fur Schwerionenforschung (GSI), Germany; Schaffner, H. [Gesellschaft fur Schwerionenforschung (GSI), Germany; Schausten, B. [Gesellschaft fur Schwerionenforschung (GSI), Germany; Thoerle-Pospiech, P. [Johannes Gutenberg-Universitaet Mainz, Mainz, Germany; Torres, T. [Gesellschaft fur Schwerionenforschung (GSI), Germany; Traut, T. [Johannes Gutenberg-Universitaet Mainz, Mainz, Germany; Trautmann, N. [Johannes Gutenberg-Universitaet Mainz, Mainz, Germany; Tuerler, A. [Paul Scherrer Institut, Villigen, Switzerland; Ward, A. [University of Liverpool; Ward, D. E. [Lund University, Sweden; Wiehl, N. [Johannes Gutenberg-Universitaet Mainz, Mainz, Germany

    2013-01-01

    A high-resolution a, X-ray and -ray coincidence spectroscopy experiment was conducted at the GSI Helmholtzzentrum fu r Schwerionenforschung. Thirty correlated a-decay chains were detected following the fusion-evaporation reaction 48Ca + 243Am. The observations are consistent with previous assignments of similar decay chains to originate from element Z = 115. The data includes first candidates of fingerprinting the decay step Mt --> Bh with characteristic X rays. For the first time, precise spectroscopy allows the derivation of excitation schemes of isotopes along the decay chains starting with elements Z > 112. Comprehensive Monte-Carlo simulations accompany the data analysis. Nuclear structure models provide a first level interpretation.

  4. An element with a liquid, anhydrous electrolyte

    Energy Technology Data Exchange (ETDEWEB)

    Nankay, S.; Indzima, T.; Toyeguti, Y.

    1982-09-01

    A liquid anhydrous element and a heat treated Mn0/sub 2/ cathode, to which sodium silicate in the form of Na/sub 2/0 with 5/2Si0/sub 2/ liquid glass is added in a volume of 3 grams per 100 grams of Mn0/sub 2/ is used in the element with a light metal, lithium type anode. Moreover 4.5 grams of acetylene soot is added to the active cathode mass. A fluorine bearing resin is used as the binder. The cathode stores well.

  5. Spectroscopy of element 115 decay chains.

    Science.gov (United States)

    Rudolph, D; Forsberg, U; Golubev, P; Sarmiento, L G; Yakushev, A; Andersson, L-L; Di Nitto, A; Düllmann, Ch E; Gates, J M; Gregorich, K E; Gross, C J; Heßberger, F P; Herzberg, R-D; Khuyagbaatar, J; Kratz, J V; Rykaczewski, K; Schädel, M; Åberg, S; Ackermann, D; Block, M; Brand, H; Carlsson, B G; Cox, D; Derkx, X; Eberhardt, K; Even, J; Fahlander, C; Gerl, J; Jäger, E; Kindler, B; Krier, J; Kojouharov, I; Kurz, N; Lommel, B; Mistry, A; Mokry, C; Nitsche, H; Omtvedt, J P; Papadakis, P; Ragnarsson, I; Runke, J; Schaffner, H; Schausten, B; Thörle-Pospiech, P; Torres, T; Traut, T; Trautmann, N; Türler, A; Ward, A; Ward, D E; Wiehl, N

    2013-09-13

    A high-resolution α, x-ray, and γ-ray coincidence spectroscopy experiment was conducted at the GSI Helmholtzzentrum für Schwerionenforschung. Thirty correlated α-decay chains were detected following the fusion-evaporation reaction 48Ca + 243Am. The observations are consistent with previous assignments of similar decay chains to originate from element Z=115. For the first time, precise spectroscopy allows the derivation of excitation schemes of isotopes along the decay chains starting with elements Z>112. Comprehensive Monte Carlo simulations accompany the data analysis. Nuclear structure models provide a first level interpretation.

  6. Osmolality of elemental and semi-elemental formulas supplemented with nonprotein energy supplements.

    Science.gov (United States)

    Pereira-da-Silva, L; Pitta-Grós Dias, M; Virella, D; Serelha, M

    2008-12-01

    Elemental and semi-elemental formulas are used to feed infants with short bowel syndrome, who may not be able to tolerate feeds of more than 310 mOsm kg(-1). The present study aimed to measure the osmolality of elemental and semi-elemental formulas at different concentrations, with and without the addition of nonprotein energy supplements. The osmolality of one elemental and three semi-elemental formulas was measured by the freezing point depression method at concentrations of 10, 12, 14 and 16 g per 100 mL, with and without 10% or 20% of additional calories, in the form of glucose polymers and medium chain triglycerides. Inter-analysis and intra-analysis coefficients of variation of the measurements were less than 3.9%. The mean osmolalities of formulas reconstituted up to 12 g per 100 mL did not exceed 305.3 mOsm kg(-1), even with added energy supplements. The mean osmolalities of formulas at 14 and 16 g per 100 mL, with or without added energy supplements varied between 205.8 and 421.6 mOsm kg(-1). A comprehensive list of elemental and semi-elemental formulas at different concentrations, enriched or not with calories, is made available. This will enable professionals to customize feeds with the optimum composition, without exceeding the osmolality suggested for infants with short bowel syndrome.

  7. A combination of a connector for glass elements and such glass elements

    NARCIS (Netherlands)

    Veer, F.A.

    2014-01-01

    A combination of a connector for glass elements and such glass elements to provide a loadbearing glass construc- tion that comprises at least one glass post and at least one glass beam that are arranged adjacent to each other, wherein the connector is arranged to provide a rotationally fixed

  8. The Role of the Element Rhodium in the Hyperbolic Law of the Periodic Table of Elements

    Directory of Open Access Journals (Sweden)

    Albert Khazan

    2008-07-01

    Full Text Available The role of the element rhodium as an independent affirmation of calculations by the Hyperbolic Law and validity of all its relations is shown herein. The deviation in calculation by this method of the atomic mass of heaviest element is 0.0024%, and its coefficient of scaling 0.001-0.005%.

  9. Electron Configuration, and Element No.155 of the Periodic Table of Elements

    Directory of Open Access Journals (Sweden)

    Khazan A.

    2011-04-01

    Full Text Available Blocks of the Electron Configuration in the atom are considered with taking into account that the electron configuration should cover also element No.155. It is shown that the electron configuration formula of element No.155, in its graphical representation, completely satisfies Gaussian curve.

  10. 7 CFR 29.1101 - Elements of quality and degrees of each element.

    Science.gov (United States)

    2010-01-01

    ... 7 Agriculture 2 2010-01-01 2010-01-01 false Elements of quality and degrees of each element. 29.1101 Section 29.1101 Agriculture Regulations of the Department of Agriculture AGRICULTURAL MARKETING SERVICE (Standards, Inspections, Marketing Practices), DEPARTMENT OF AGRICULTURE COMMODITY STANDARDS AND STANDARD CONTAINER REGULATIONS...

  11. The double-lined spectroscopic binary $\\alpha$ Andromedae orbital elements and elemental abundances

    CERN Document Server

    Ryabchikova, T A; Adelman, S J

    1998-01-01

    We performed a spectroscopic study of the SB2 Mercury-Manganese star alpha And. Our measurements of the secondary's radial velocities result in improved orbital elements. The secondary shows abundances typical of the metallic-line stars: a Ca deficiency, small overabundances of the iron-peak elements, and 1.0 dex overabundances of Sr and Ba.

  12. A comparison of boundary element and finite element methods for modeling axisymmetric polymeric drop deformation

    NARCIS (Netherlands)

    Hooper, Russell; Toose, E.M.; Macosko, Christopher W.; Derby, Jeffrey J.

    2001-01-01

    A modified boundary element method (BEM) and the DEVSS-G finite element method (FEM) are applied to model the deformation of a polymeric drop suspended in another fluid subjected to start-up uniaxial extensional flow. The effects of viscoelasticity, via the Oldroyd-B differential model, are

  13. Exploring the Everyday Context of Chemical Elements: Discovering the Elements of Car Components

    Science.gov (United States)

    Franco-Mariscal, Antonio Joaquín

    2015-01-01

    This paper presents a project about the chemical elements made by 15-year-old Spanish high school students of Chemistry. It focuses on context-based teaching combined with the advantages of creating a large mural which subsequently is exposed in the school. The project consisted of researching the chemical elements in the different materials that…

  14. Electron Configuration, and Element No.155 of the Periodic Table of Elements

    Directory of Open Access Journals (Sweden)

    Khazan A.

    2011-04-01

    Full Text Available Blocks of the Electron Configuration in the atom are considered with taking into ac- count that the electron configuration should cover also element No.155. It is shown that the electron configuration formula of element No.155, in its graphical representation, completely satisfies Gaussian curve.

  15. Scattering optical elements: stand-alone optical elements exploiting multiple light scattering

    CERN Document Server

    Park, Jongchan; Park, Chunghyun; Lee, KyeoReh; Lee, Heon; Cho, Yong-Hoon; Park, YongKeun

    2016-01-01

    Optical design and fabrication techniques are crucial for making optical elements. From conventional lenses to diffractive optical elements, and to recent metasurfaces, various types of optical elements have been proposed to manipulate light where optical materials are fabricated into desired structures. Here, we propose a scattering optical element (SOE) which exploits multiple light scattering and wavefront shaping. Instead of fabricating optical materials, the SOE consists of a disordered medium and a photopolymer-based wavefront recorder, with shapes the wavefront of impinging light on demand. With the proposed stand-alone SOEs, we experimentally demonstrate control of various properties of light, including intensity, polarisation, spectral frequency and near field. Due to the tremendous freedom brought about by disordered media, the proposed approach will provide unexplored routes to manipulate arbitrary optical fields in stand-alone optical elements.

  16. Age-related changes of elements in the anterior commissures and the relationships among their elements.

    Science.gov (United States)

    Ongkana, Nutcharin; Tohno, Setsuko; Tohno, Yoshiyuki; Suwannahoy, Patipath; Mahakkanukrauh, Pasuk; Azuma, Cho; Minami, Takeshi

    2010-06-01

    To elucidate compositional changes of the anterior commissure with aging, the authors investigated age-related changes of elements in the anterior commissures and the relationships among their elements. After ordinary dissection at Nara Medical University was finished, the anterior commissures were resected from 45 subjects, ranging in age from 70 to 101 years. The subjects consisted of 22 men and 23 women. After ashing with nitric acid and perchloric acid, the element content of the anterior commissures was determined by inductively coupled plasma-atomic emission spectrometry. The seven element contents of Ca, P, S, Mg, Zn, Fe, and Na did not change significantly in the anterior commissures with aging. Regarding the relationships among their element contents, significant correlations were found among the contents of Ca, Mg, Zn, and Na in the anterior commissures. The gender difference that the Zn content was significantly higher in men than in women was found in the anterior commissure.

  17. FINITE ELEMENT METHODS FOR THE NAVIER-STOKES EQUATIONS BY H(div) ELEMENTS

    Institute of Scientific and Technical Information of China (English)

    Junping Wang; Xiaoshen Wang; Xiu Ye

    2008-01-01

    We derived and analyzed a new numerical scheme for the Navier-Stokes equations by using H(div) conforming finite elements. A great deal of effort was given to an establishment of some Sobolev-type inequalities for piecewise smooth functions. In particular, the newly derived Sobolev inequalities were employed to provide a mathematical theory for the H(div) finite element scheme. For example, it was proved that the new finite element scheme has solutions which admit a certain boundedness in terms of the input data. A solution uniqueness was also possible when the input data satisfies a certain smallness condition. Optimal-order error estimates for the corresponding finite element solutions were established in various Sobolev norms. The finite element solutions from the new scheme feature a full satisfaction of the continuity equation which is highly demanded in scientific computing.

  18. Microarray of programmable electrochemically active elements

    DEFF Research Database (Denmark)

    S. McCaskill, John; Maeke, Thomas; Straczek, Lukas;

    2016-01-01

    This paper describes possible applications of a two dimensional array of programmable electrochemically active elements to Alife. The array has been developed as part of the MICREA-gents project, and after several design phases, is now a mature enough device for general use beyond the project. Here...

  19. Elemental Abundances of Solar Sibling Candidates

    Science.gov (United States)

    Ramírez, I.; Bajkova, A. T.; Bobylev, V. V.; Roederer, I. U.; Lambert, D. L.; Endl, M.; Cochran, W. D.; MacQueen, P. J.; Wittenmyer, R. A.

    2014-06-01

    Dynamical information along with survey data on metallicity and in some cases age have been used recently by some authors to search for candidates of stars that were born in the cluster where the Sun formed. We have acquired high-resolution, high signal-to-noise ratio spectra for 30 of these objects to determine, using detailed elemental abundance analysis, if they could be true solar siblings. Only two of the candidates are found to have solar chemical composition. Updated modeling of the stars' past orbits in a realistic Galactic potential reveals that one of them, HD 162826, satisfies both chemical and dynamical conditions for being a sibling of the Sun. Measurements of rare-element abundances for this star further confirm its solar composition, with the only possible exception of Sm. Analysis of long-term high-precision radial velocity data rules out the presence of hot Jupiters and confirms that this star is not in a binary system. We find that chemical tagging does not necessarily benefit from studying as many elements as possible but instead from identifying and carefully measuring the abundances of those elements that show large star-to-star scatter at a given metallicity. Future searches employing data products from ongoing massive astrometric and spectroscopic surveys can be optimized by acknowledging this fact.

  20. Performance Modelling of Timber Facade Elements

    NARCIS (Netherlands)

    Surmeli-Anac, A.N.

    2013-01-01

    Windows and doors are essential elements of buildings. These seemingly simple components have become increasingly complex over the last decades. They have to fulfil an increased number of functions which ask for contradictory solutions and need to comply with more and more severe requirements.