WorldWideScience

Sample records for microcystin-lr extraction optimization

  1. Microcystin-LR Induced Immunotoxicity in Mammals

    Directory of Open Access Journals (Sweden)

    Yaqoob Lone

    2016-01-01

    Full Text Available Microcystins are toxic molecules produced by cyanobacterial blooms due to water eutrophication. Exposure to microcystins is a global health problem because of its association with various other pathological effects and people all over the world are exposed to microcystins on a regular basis. Evidence shows that microcystin-LR (MC-LR may adversely affect the immune system, but its specific effects on immune functions are lacking. In the present review, immunotoxicological effects associated with MC-LR in animals, humans, and in vitro models have been reported. Overall, the data shows that chronic exposure to MC-LR has the potential to impair vital immune responses which could lead to increased risk of various diseases including cancers. Studies in animal and in vitro models have provided some pivotal understanding into the potential mechanisms of MC-LR related immunotoxicity suggesting that further investigation, particularly in humans, is required to better understand the relationship between development of disease and the MC-LR exposure.

  2. Evaluation of the transfer and the accumulation of microcystins in tomato (Solanum lycopersicum cultivar MicroTom) tissues using a cyanobacterial extract containing microcystins and the radiolabeled microcystin-LR ("1"4C-MC-LR)

    International Nuclear Information System (INIS)

    Corbel, Sylvain; Mougin, Christian; Nélieu, Sylvie; Delarue, Ghislaine; Bouaïcha, Noureddine

    2016-01-01

    Microcystins are the most common cyanotoxins and may be expected wherever blooms of cyanobacteria occur in surface waters. Their persistence both in the irrigation water and in the soil can lead to their transfer and bioaccumulation into agricultural plants. The aim of this work was to investigate microcystin accumulation in Solanum lycopersicum cultivar MicroTom. The plant was exposed to either Microcystis aeruginosa crude extracts containing up to 100 μg eq. MC-LR L"−"1 in a soil–plant system for 90 days or pure radiolabeled "1"4C-MC-LR in a hydroponic condition for 48 h. Toxin bioaccumulation in the soil and different plant tissues was assessed both by the PP2A inhibition assay and by liquid chromatography-mass spectrometry (LC/MS/MS). After 90 days of exposure, microcystins persisted in the soil and their free extractable concentrations accumulated were very low varying between 1.6 and 3.9 μg eq. MC-LR kg"−"1 DW. Free MC-LR was detected only in roots and leaves with concentrations varying between 4.5 and 8.1 μg kg"−"1 DW and between 0.29 and 0.55 μg kg"−"1 DW, respectively. By using radioactivity ("1"4C-MC-LR), the results have reported a growing accumulation of toxins within the organs roots > leaves > stems and allowed them to confirm the absence of MC-LR in fruits after 48 h of exposure. The bioconcentration factor (BCF) was 13.6 in roots, 4.5 in leaves, and 1.4 in stems. On the other hand, the results highlight the presence of two radioactive fractions in different plant tissues. The non-extractable fraction of radioactivity, corresponding to the covalently bound MC-LR, was higher than that of the extractable fraction only in roots and leaves reaching 56% and 71% of the total accumulated toxin, respectively. Therefore, results raise that monitoring programs must monitor the presence of MCs in the irrigation water to avoid the transfer and accumulation of these toxins in crops. - Graphical abstract: Bioconcentration factors in organs of the

  3. Evaluation of the transfer and the accumulation of microcystins in tomato (Solanum lycopersicum cultivar MicroTom) tissues using a cyanobacterial extract containing microcystins and the radiolabeled microcystin-LR ({sup 14}C-MC-LR)

    Energy Technology Data Exchange (ETDEWEB)

    Corbel, Sylvain [INRA, UMR1402 ECOSYS, F-78850 Thiverval-Grignon (France); AgroParisTech, UMR1402 ECOSYS, F-78850 Thiverval-Grignon (France); Laboratoire Ecologie, Systématique et Evolution, UMR8079, Univ. Paris-Sud/CNRS/AgroParisTech, Université Paris-Sud, F-91405 Orsay (France); Mougin, Christian; Nélieu, Sylvie; Delarue, Ghislaine [INRA, UMR1402 ECOSYS, F-78850 Thiverval-Grignon (France); AgroParisTech, UMR1402 ECOSYS, F-78850 Thiverval-Grignon (France); Bouaïcha, Noureddine, E-mail: noureddine.bouaicha@u-psud.fr [Laboratoire Ecologie, Systématique et Evolution, UMR8079, Univ. Paris-Sud/CNRS/AgroParisTech, Université Paris-Sud, F-91405 Orsay (France)

    2016-01-15

    Microcystins are the most common cyanotoxins and may be expected wherever blooms of cyanobacteria occur in surface waters. Their persistence both in the irrigation water and in the soil can lead to their transfer and bioaccumulation into agricultural plants. The aim of this work was to investigate microcystin accumulation in Solanum lycopersicum cultivar MicroTom. The plant was exposed to either Microcystis aeruginosa crude extracts containing up to 100 μg eq. MC-LR L{sup −1} in a soil–plant system for 90 days or pure radiolabeled {sup 14}C-MC-LR in a hydroponic condition for 48 h. Toxin bioaccumulation in the soil and different plant tissues was assessed both by the PP2A inhibition assay and by liquid chromatography-mass spectrometry (LC/MS/MS). After 90 days of exposure, microcystins persisted in the soil and their free extractable concentrations accumulated were very low varying between 1.6 and 3.9 μg eq. MC-LR kg{sup −1} DW. Free MC-LR was detected only in roots and leaves with concentrations varying between 4.5 and 8.1 μg kg{sup −1} DW and between 0.29 and 0.55 μg kg{sup −1} DW, respectively. By using radioactivity ({sup 14}C-MC-LR), the results have reported a growing accumulation of toxins within the organs roots > leaves > stems and allowed them to confirm the absence of MC-LR in fruits after 48 h of exposure. The bioconcentration factor (BCF) was 13.6 in roots, 4.5 in leaves, and 1.4 in stems. On the other hand, the results highlight the presence of two radioactive fractions in different plant tissues. The non-extractable fraction of radioactivity, corresponding to the covalently bound MC-LR, was higher than that of the extractable fraction only in roots and leaves reaching 56% and 71% of the total accumulated toxin, respectively. Therefore, results raise that monitoring programs must monitor the presence of MCs in the irrigation water to avoid the transfer and accumulation of these toxins in crops. - Graphical abstract: Bioconcentration

  4. Laboratory studies of dissolved radiolabelled microcystin-LR in lake water

    DEFF Research Database (Denmark)

    Hyenstrand, Per; Rohrlack, Thomas; Beattie, Kenneth A

    2003-01-01

    The fate of dissolved microcystin-LR was studied in laboratory experiments using surface water taken from a eutrophic lake. Based on initial range finding, a concentration of 50 microg l(-1) dissolved 14C-microcystin-LR was selected for subsequent time-course experiments. The first was performed ...... fractions. The study demonstrated that biodegradation of dissolved microcystin-LR occurred in water collected at a lake surface with carbon dioxide as a major end-product....

  5. Monitoring of microcystin-LR in Luvuvhu River catchment ...

    African Journals Online (AJOL)

    The main aim of this study is to assess the levels of microcystin-LR in Luvuvhu River catchment and to assess the physicochemical parameters that may promote the growth of cyanobacteria. The level of microcystin-LR in some of the sampling sites was <0.18 ìg/l except for one site (Luvuvhu River just before the confluence ...

  6. Microcystin-LR equivalent concentrations in fish tissue during a ...

    African Journals Online (AJOL)

    The effects of a decomposing cyanobacteria bloom on water quality and the accumulation of microcystin-LR equivalent toxin in fish at Loskop Dam were studied in May 2012. Enzyme-linked immunosorbent assay [ELISA] was used to confirm the presence of microcystin-LR equivalent in the water and to determine the ...

  7. Rapid Isolation of a Single-Chain Antibody against the Cyanobacterial Toxin Microcystin-LR by Phage Display and Its Use in the Immunoaffinity Concentration of Microcystins from Water

    Science.gov (United States)

    McElhiney, Jacqui; Drever, Mathew; Lawton, Linda A.; Porter, Andy J.

    2002-01-01

    A naïve (unimmunized) human semisynthetic phage display library was employed to isolate recombinant antibody fragments against the cyanobacterial hepatotoxin microcystin-LR. Selected antibody scFv genes were cloned into a soluble expression vector and expressed in Escherichia coli for characterization against purified microcystin-LR by competition enzyme-linked immunosorbent assay (ELISA). The most sensitive single-chain antibody (scAb) isolated was capable of detecting microcystin-LR at levels below the World Health Organization limit in drinking water (1 μg liter−1) and cross-reacted with three other purified microcystin variants (microcystin-RR, -LW, and -LF) and the related cyanotoxin nodularin. Extracts of the cyanobacterium Microcystis aeruginosa were assayed by ELISA, and quantifications of microcystins in toxic samples showed good correlation with analysis by high-performance liquid chromatography. Immobilized scAb was also used to prepare immunoaffinity columns, which were assessed for the ability to concentrate microcystin-LR from water for subsequent analysis by high-performance liquid chromatography. Anti-microcystin-LR scAb was immobilized on columns via a hexahistidine tag, ensuring maximum exposure of antigen binding sites, and the performance of the columns was evaluated by directly applying 150 ml of distilled water spiked with 4 μg of purified microcystin-LR. The procedure was simple, and a recovery rate of 94% was achieved following elution in 1 ml of 100% methanol. Large-scale, low-cost production of anti-microcystin-LR scAb in E. coli is an exciting prospect for the development of biosensors and on-line monitoring systems for microcystins and will also facilitate a range of immunoaffinity applications for the cleanup and concentration of these toxins from environmental samples. PMID:12406716

  8. Microcystin-LR in surface water of Ponjavica river

    Directory of Open Access Journals (Sweden)

    Natić Dejan

    2012-01-01

    Full Text Available Background/Aim. Cyanobacterial toxins befall a group of various compounds according to chemical structure and health effects on people and animals. The most significant in this large group of compounds are microcystins. Their presence in water used for human consumption causes serious health problems, liver beeing the target organ. Microcystins are spread all over the world. Waterblooms of cyanobacterias and their cyanotoxins are also common in the majority of surface waters in Serbia. The aim of this study was to propose HPLC method for determination of mikrocystin-LR, to validate the method and to use it for determination of microcystin-LR in the surface water of the river Ponjavica. The Ponjavica is very eutrophic water and has ideal conditions for the cyanobacterial growth. Methods. Sample of water form the Ponjavica river were collected during the summer 2008. Coupled columns (HLB, Sep-Pak, were used for sample preparation and HPLC/PDA method was used for quantification of microcystin- LR. Results. Parameters of validation show that the proposed method is simple, fast, sensitive (0.1 mg/L and selective with the yield of 89%-92%. The measuring uncertainty of

  9. Detoxification of microcystin-LR in water by Portulaca oleracea cv.

    Science.gov (United States)

    Isobe, Takatoshi; Okuhata, Hiroshi; Miyasaka, Hitoshi; Jeon, Bong-Seok; Park, Ho-Dong

    2014-03-01

    Microcystin-LR (0.02 μg/ml) in the hydroculture medium of Portulaca oleracea cv., became below the detection level (<0.0001 μg/ml) by HPLC analysis after 7 days. The toxicity of microcystin estimated with protein phosphatase inhibition assay, however, remained at 37% of the initial level, indicating that microcystin-LR was transformed by P. oleracea cv. into unknown compound(s) of lower toxicity. Copyright © 2013 The Society for Biotechnology, Japan. Published by Elsevier B.V. All rights reserved.

  10. Microcystin-LR induces anoikis resistance to the hepatocyte uptake transporter OATP1B3-expressing cell lines

    International Nuclear Information System (INIS)

    Takano, Hiroyuki; Takumi, Shota; Ikema, Satoshi; Mizoue, Nozomi; Hotta, Yuki; Shiozaki, Kazuhiro; Sugiyama, Yasumasa; Furukawa, Tatsuhiko; Komatsu, Masaharu

    2014-01-01

    Microcystin-LR is a cyclic peptide released by several bloom-forming cyanobacteria. Understanding the mechanism of microcystin-LR toxicity is important, because of the both potencies of its acute cytotoxicity and tumor-promoting activity in hepatocytes of animals and humans. Recently, we have reported that the expression of human hepatocyte uptake transporter OATP1B3 was critical for the selective uptake of microcystin-LR into hepatocytes and for induction of its fatal cytotoxicity. In this study, we demonstrated a novel function of microcystin-LR which induced bipotential changes including anoikis resistance and cytoskeleton reorganization to OATP1B3-transfected HEK293 cells (HEK293-OATP1B3). After exposure to microcystin-LR, HEK293-OATP1B3 cells were divided to the floating cells and remaining adherent cells. After collection and reseeding the floating cells into a fresh flask, cells were confluently proliferated (HEK293-OATP1B3-FL) under the microcystin-LR-free condition. Both the proliferated HEK293-OATP1B3-FL and remaining adherent HEK293-OATP1B3-AD cells changed the character with down- and up-regulation of E-cadherin, respectively. Additionally, these cells acquired resistance to microcystin-LR. These results suggest that microcystin-LR could be associated with not only tumor promotion, but also epithelial–mesenchymal transition-mediated cancer metastasis. Furthermore, microcystin-LR might induce the cytoskeleton reorganization be accompanied epithelial–mesenchymal transition

  11. Antioxidant Effect of Curcumin Against Microcystin- LR-Induced ...

    African Journals Online (AJOL)

    Purpose: To investigate the effect of curcumin on microcystin-LR (MC-LR)- induced renal oxidative damage in Balb/c mice. Methods: 40 male Balb/c mice were assigned randomly to 4 groups each having 10 mice. One group served as normal (saline treated) while another group was used as curcumin control. The third ...

  12. Combined toxicity of microcystin-LR and copper on lettuce (Lactuca sativa L.).

    Science.gov (United States)

    Cao, Qing; Steinman, Alan D; Wan, Xiang; Xie, Liqiang

    2018-05-10

    Microcystins and copper commonly co-exist in the natural environment, but their combined toxicity remains unclear, especially in terrestrial plants. The present study investigated the toxicity effects of microcystin-LR (0, 5, 50, 500, 1000 μg L -1 ) and copper (0, 50, 500, 1000, 2000 μg L -1 ), both individually and in mixture, on the germination, growth and oxidative response of lettuce. The bioaccumulation of microcystin-LR and copper was also evaluated. Results showed that the decrease in lettuce germination induced by copper alone was not significantly different from that induced by the mixture, and the combined toxicity assessment showed a simple additive effect. Lettuce growth was not significantly reduced by microcystin-LR alone, whereas it was significantly reduced by copper alone and the mixture when copper concentration was higher than 500 μg L -1 . High concentrations of microcystin-LR (1000 μg L -1 ) and copper (≥50 μg L -1 ),as well as their mixture (≥50 + 500 μg L -1 ), induced oxidative stress in lettuce. A synergistic effect on the growth and antioxidative system of lettuce was observed when exposed to low concentrations of the mixture (≤50 + 500 μg L -1 ), whereas an antagonistic effect was observed at high concentrations (≥1000 + 2000 μg L -1 ). Moreover, the interaction of microcystin-LR and copper can increase their accumulation in lettuce. Our results suggest that the toxicity effects of microcystin-LR and copper are exacerbated when they co-exist in the natural environment at low concentrations, which not only negatively affects plant growth but also poses a potential risk to human health via the food chain. Copyright © 2018. Published by Elsevier Ltd.

  13. Comprehensive insights into microcystin-LR effects on hepatic lipid metabolism using cross-omics technologies

    International Nuclear Information System (INIS)

    Zhang, Zongyao; Zhang, Xu-Xiang; Wu, Bing; Yin, Jinbao; Yu, Yunjiang; Yang, Liuyan

    2016-01-01

    Highlights: • Use of cross-omics technologies to evaluate toxic effects of microcystin-LR. • Disturbance of hepatic lipid metabolism by oral exposure to microcystin-LR. • Crucial roles of gut microbial community shift in the metabolic disturbance induced by microcystin-LR. - Abstract: Microcystin-LR (MC-LR) can induce hepatic tissue damages and molecular toxicities, but its effects on lipid metabolism remain unknown. This study investigated the effects of MC-LR exposure on mice lipid metabolism and uncovered the underlying mechanism through metabonomic, transcriptomic and metagenomic analyses after administration of mice with MC-LR by gavage for 28 d. Increased liver weight and abdominal fat weight, and evident hepatic lipid vacuoles accumulation were observed in the mice fed with 0.2 mg/kg/d MC-LR. Serum nuclear magnetic resonance analysis showed that MC-LR treatment altered the levels of serum metabolites including triglyceride, unsaturated fatty acid (UFA) and very low density lipoprotein. Digital Gene Expression technology was used to reveal differential expression of hepatic transcriptomes, demonstrating that MC-LR treatment disturbed hepatic UFA biosynthesis and activated peroxisome proliferator-activated receptor (PPAR) signaling pathways via Pparγ, Fabp1 and Fabp2 over-expression. Metagenomic analyses of gut microbiota revealed that MC-LR exposure also increased abundant ratio of Firmicutes vs. Bacteroidetes in gut and altered biosynthetic pathways of various microbial metabolic and pro-inflammatory molecules. In conclusion, oral MC-LR exposure can induce hepatic lipid metabolism disorder mediated by UFA biosynthesis and PPAR activation, and gut microbial community shift may play an important role in the metabolic disturbance.

  14. Comprehensive insights into microcystin-LR effects on hepatic lipid metabolism using cross-omics technologies

    Energy Technology Data Exchange (ETDEWEB)

    Zhang, Zongyao [State Key Laboratory of Pollution Control and Resource Reuse, School of the Environment, Nanjing University, Nanjing 210023 (China); Center for Environmental Health Research, South China Institute of Environmental Sciences, The Ministry of Environmental Protection of PRC, Guangzhou 510655 (China); Zhang, Xu-Xiang, E-mail: zhangxx@nju.edu.cn [State Key Laboratory of Pollution Control and Resource Reuse, School of the Environment, Nanjing University, Nanjing 210023 (China); Wu, Bing; Yin, Jinbao [State Key Laboratory of Pollution Control and Resource Reuse, School of the Environment, Nanjing University, Nanjing 210023 (China); Yu, Yunjiang [Center for Environmental Health Research, South China Institute of Environmental Sciences, The Ministry of Environmental Protection of PRC, Guangzhou 510655 (China); Yang, Liuyan, E-mail: yangly@nju.edu.cn [State Key Laboratory of Pollution Control and Resource Reuse, School of the Environment, Nanjing University, Nanjing 210023 (China)

    2016-09-05

    Highlights: • Use of cross-omics technologies to evaluate toxic effects of microcystin-LR. • Disturbance of hepatic lipid metabolism by oral exposure to microcystin-LR. • Crucial roles of gut microbial community shift in the metabolic disturbance induced by microcystin-LR. - Abstract: Microcystin-LR (MC-LR) can induce hepatic tissue damages and molecular toxicities, but its effects on lipid metabolism remain unknown. This study investigated the effects of MC-LR exposure on mice lipid metabolism and uncovered the underlying mechanism through metabonomic, transcriptomic and metagenomic analyses after administration of mice with MC-LR by gavage for 28 d. Increased liver weight and abdominal fat weight, and evident hepatic lipid vacuoles accumulation were observed in the mice fed with 0.2 mg/kg/d MC-LR. Serum nuclear magnetic resonance analysis showed that MC-LR treatment altered the levels of serum metabolites including triglyceride, unsaturated fatty acid (UFA) and very low density lipoprotein. Digital Gene Expression technology was used to reveal differential expression of hepatic transcriptomes, demonstrating that MC-LR treatment disturbed hepatic UFA biosynthesis and activated peroxisome proliferator-activated receptor (PPAR) signaling pathways via Pparγ, Fabp1 and Fabp2 over-expression. Metagenomic analyses of gut microbiota revealed that MC-LR exposure also increased abundant ratio of Firmicutes vs. Bacteroidetes in gut and altered biosynthetic pathways of various microbial metabolic and pro-inflammatory molecules. In conclusion, oral MC-LR exposure can induce hepatic lipid metabolism disorder mediated by UFA biosynthesis and PPAR activation, and gut microbial community shift may play an important role in the metabolic disturbance.

  15. Theoretical spectroscopic study of the conjugate microcystin-LR-europium cryptate

    Energy Technology Data Exchange (ETDEWEB)

    Santos, Julio G.; Dutra, Jose Diogo L.; Costa Junior, Nivan B. da; Freire, Ricardo O., E-mail: rfreire@ufs.br [Universidade Federal de Sergipe (UFS), Sao Cristovao, SE (Brazil). Departamento de Quimica; Alves Junior, Severino; Sa, Gilberto F. de [Universidade Federal de Pernambuco (UFPE), Recife, PE (Brazil). Departamento de Quimica Fundamental

    2013-02-15

    In this work, theoretical tools were used to study spectroscopic properties of the conjugate microcystin-LR-europium cryptate. The Sparkle/AM1 model was applied to predict the geometry of the system and the INDO/S-CIS model was used to calculate the excited state energies. Based on the Judd-Ofelt theory, the intensity parameters were predicted and a theoretical model based on the theory of the 4f-4f transitions was applied to calculate energy transfer and backtransfer rates, radiative and non-radiative decay rates, quantum efficiency and quantum yield. A detailed study of the luminescent properties of the conjugate Microcystin-LR-europium cryptate was carried out. The results show that the theoretical quantum yield of luminescence of 23% is in good agreement with the experimental value published. This fact suggests that this theoretical protocol can be used to design new systems in order to improve their luminescence properties. The results suggest that this luminescent system may be a good conjugate for using in assay ELISA for detection by luminescence of the Microcystin-LR in water. (author)

  16. The uptake kinetics and immunotoxic effects of microcystin-LR in human and chicken peripheral blood lymphocytes in vitro

    International Nuclear Information System (INIS)

    Lankoff, Anna; Carmichael, Wayne W.; Grasman, Keith A.; Yuan, Moucun

    2004-01-01

    Microcystin-LR is a cyanobacterial heptapeptide that presents acute and chronic hazards to animal and human health. We investigated the influence of this toxin on human and chicken immune system modulation in vitro. Peripheral blood lymphocytes were treated with microcystin-LR at environmentally relevant doses of 1, 10 and 25 μg/ml for 12, 24, 48, 72 h (for proliferation assay cells were treated for 72 h). T-cell and B-cell proliferation as well as apoptosis and necrosis were determined in human and chicken samples. IL-2 and IL-6 production by human lymphocytes also was measured. In addition, uptake kinetics of microcystin-LR into human and chicken peripheral blood lymphocytes were calculated by Liquid Chromatography (LS) /Mass Spectrometry (MS) analysis. At the highest dose microcystin-LR decreased T-cell proliferation and all doses of microcystin-LR inhibited B-cell proliferation. The frequency of apoptotic and necrotic cells increased in a dose and time-dependent manner. Human lymphocytes responded to stimulation with microcystin-LR by increased production of IL-6 and decreased production of IL-2. Human lymphocytes were able to uptake from 0.014 to 1.663 μg/ml and chicken lymphocytes from 0.035 to 1.733 μg/ml of the microcystin-LR added to the cultures, depending on the treatment time and dose. In conclusion, microcystin-LR acted as an immunomodulator in cytokine production and down-regulated lymphocyte functions by induction of apoptosis and necrosis. However, further studies dealing with the influence of microcystin-LR on expression cytokine genes and transcription factors are necessary to confirm these hypotheses

  17. Dynamics of Total Microcystin LR Concentration in Three Subtropical Hydroelectric Generation Reservoirs in Uruguay, South America.

    Science.gov (United States)

    González-Piana, Mauricio; Fabián, Daniel; Piccardo, Andrea; Chalar, Guillermo

    2017-10-01

    This study analyzed the temporal dynamics of total microcystin LR concentrations between the years of 2012 and 2015 in the Bonete, Baygorria and Palmar hydroelectric generation reservoirs in the central region of the Negro River, Uruguay. The three reservoirs showed differents total microcystin LR concentration, with no significant differences among them. Over 20 sampling dates, the three reservoirs exhibited total microcystin LR concentrations on eight occasions that corresponded to a slight to moderate human health risk according to WHO guideline values for recreational waters. By determining the concentration of microcystin LR in cyanobacterial biomass, we identified cyanobacterial populations that occurred over time with varying degrees of toxin production (maximal 85.4 µg/mm 3 ). The microcystin LR concentration in Bonete was positively correlated with temperature (r = 0.587) and cyanobacterial biomass (r = 0.736), in Baygorria with cyanobacterial biomass (r = 0.521), and in Palmar with temperature (r = 0.500) and negatively correlated with ammonia (r = -0.492). Action is needed to reduce the presence of toxic cyanobacteria in these systems. A decrease in the use of agrochemicals and management changes in the reservoir basins could be successful long-term measures.

  18. Microcystin-LR Induces Apoptosis via NF-κB /iNOS Pathway in INS-1 Cells

    Directory of Open Access Journals (Sweden)

    Kai Shen

    2011-07-01

    Full Text Available Cyanobacterial toxins, especially the microcystins, are found in eutrophied waters throughout the world, and their potential to impact on human and animal health is a cause for concern. Microcystin-LR (MC-LR is one of the common toxic microcystin congeners and occurs frequently in diverse water systems. Recent work suggested that apoptosis plays a major role in the toxic effects induced by MC-LR in hepatocytes. However, the roles of MC-LR in pancreatic beta cells have not been fully established. The aim of the present study was to assess possible in vitro effects of MC-LR on cell apoptosis in the rat insulinoma cell line, INS-1. Our results demonstrated that MC-LR promoted selectively activation of NF-κB (increasing nuclear p50/p65 translocation and increased the mRNA and protein levels of induced nitric oxide synthase (iNOS. The chronic treatment with MC-LR stimulated nitric oxide (NO production derived from iNOS and induced apoptosis in a dose dependent manner in INS-1 cells. Meanwhile, this effect was inhibited by the NF-κB inhibitor PDTC, which reversed the apoptosis induced by MC-LR. Our observations indicate that MC-LR induced cell apoptosis via an iNOS-dependent pathway. A well-known nuclear transcription factor, NF-κB, is activated and mediates intracellular nitric oxide synthesis. We suggest that the apoptosis induced by chronic MC-LR in vivo presents a possible cause of β-cell dysfunction, as a key environmental factor in the development of diabetes mellitus.

  19. Synthesis of visible light sensitized S, N and C co-doped polymorphic TiO2 for Microcystin-LR MC-LR removal

    Science.gov (United States)

    Microcystin-LR (MC-LR) is considered as one of the most widespread and toxic cyanotoxins, which had been discovered to be hepatotoxic, cytotoxic and neurotoxic. It is the only cyanotoxin that has been proposed by Word Health Organization (WHO) for a provisional guideline (1 ppb) ...

  20. Inactivation Kinetics of the Cyanobacterial Toxin Microcystin-LR by Free Chlorine

    Science.gov (United States)

    Worldwide, the increasing occurrence of toxins produced by cyanobacteria in water bodies used as source waters for drinking water has become an important public health issue. Microcystin-LR is one of the most commonly found cyanotoxins. A detailed evaluation of the free chlorine ...

  1. Stability of cyanotoxins, microcystin-LR, microcystin-RR and nodularin in seawater and BG-11 medium of different salinity

    Directory of Open Access Journals (Sweden)

    Hanna Mazur

    2001-09-01

    Full Text Available Microcystins and nodularin are potent hepatotoxins produced by fresh and seawater cyanobacteria. The persistence of three hepatotoxins - microcystin-LR, microcystin-RR and nodularin - was investigated in sterile BG-11 medium of different salinity and in water collected from the Gulf of Gdansk. After 21 days of incubation at 17 ± 1oC and constant illumination of about 40 µmol photon m-2 s-1 the concentration of toxins decreased by about 30-37%. No significant changes in toxin concentration in the BG-11 media of different salinity were observed. When toxins were incubated in non-sterile seawater, their concentrations decreased markedly. It is likely that some strains of bacteria are responsible for the breakdown of the toxins. Nodularin turned out to be more resistant to biodegradation than the two microcystins. The influence of certain components of cyanobacteria cells on the accelerated rate of toxin degradation was also considered.

  2. Accumulation of free and covalently bound microcystins in tissues of Lymnaea stagnalis (Gastropoda) following toxic cyanobacteria or dissolved microcystin-LR exposure

    International Nuclear Information System (INIS)

    Lance, Emilie; Neffling, Milla-Riina; Gerard, Claudia; Meriluoto, Jussi; Bormans, Myriam

    2010-01-01

    Accumulation of free microcystins (MCs) in freshwater gastropods has been demonstrated but accumulation of MCs covalently bound to tissues has never been considered so far. Here, we follow the accumulation of total (free and bound) MCs in Lymnaea stagnalis exposed to i) dissolved MC-LR (33 and 100 μg L -1 ) and ii) Planktothrix agardhii suspensions producing 5 and 33 μg MC-LR equivalents L -1 over a 5-week period, and after a 3-week depuration period. Snails exposed to dissolved MC-LR accumulated up to 0.26 μg total MCs g -1 dry weight (DW), with no detection of bound MCs. Snails exposed to MCs producing P. agardhii accumulated up to 69.9 μg total MCs g -1 DW, of which from 17.7 to 66.7% were bound. After depuration, up to 15.3 μg g -1 DW of bound MCs were detected in snails previously exposed to toxic cyanobacteria, representing a potential source of MCs transfer through the food web. - The study concerns accumulation and elimination of both free and bound microcystins (MCs) in tissues of a gastropod exposed to MCs producing cyanobacteria or dissolved MC-LR.

  3. Accumulation of free and covalently bound microcystins in tissues of Lymnaea stagnalis (Gastropoda) following toxic cyanobacteria or dissolved microcystin-LR exposure

    Energy Technology Data Exchange (ETDEWEB)

    Lance, Emilie, E-mail: emilie.lance@live.f [UMR CNRS Ecobio 6553, University of Rennes 1, Campus de Beaulieu, 265 Avenue du General Leclerc, 35042 Rennes Cedex (France); Neffling, Milla-Riina [Department of Biochemistry and Pharmacy, Abo Akademi University, Tykistoekatu 6, FI-20520 Turku (Finland); Gerard, Claudia [UMR CNRS Ecobio 6553, University of Rennes 1, Campus de Beaulieu, 265 Avenue du General Leclerc, 35042 Rennes Cedex (France); Meriluoto, Jussi [Department of Biochemistry and Pharmacy, Abo Akademi University, Tykistoekatu 6, FI-20520 Turku (Finland); Bormans, Myriam [UMR CNRS Ecobio 6553, University of Rennes 1, Campus de Beaulieu, 265 Avenue du General Leclerc, 35042 Rennes Cedex (France)

    2010-03-15

    Accumulation of free microcystins (MCs) in freshwater gastropods has been demonstrated but accumulation of MCs covalently bound to tissues has never been considered so far. Here, we follow the accumulation of total (free and bound) MCs in Lymnaea stagnalis exposed to i) dissolved MC-LR (33 and 100 mug L{sup -1}) and ii) Planktothrix agardhii suspensions producing 5 and 33 mug MC-LR equivalents L{sup -1} over a 5-week period, and after a 3-week depuration period. Snails exposed to dissolved MC-LR accumulated up to 0.26 mug total MCs g{sup -1} dry weight (DW), with no detection of bound MCs. Snails exposed to MCs producing P. agardhii accumulated up to 69.9 mug total MCs g{sup -1} DW, of which from 17.7 to 66.7% were bound. After depuration, up to 15.3 mug g{sup -1} DW of bound MCs were detected in snails previously exposed to toxic cyanobacteria, representing a potential source of MCs transfer through the food web. - The study concerns accumulation and elimination of both free and bound microcystins (MCs) in tissues of a gastropod exposed to MCs producing cyanobacteria or dissolved MC-LR.

  4. Roles of miRNAs in microcystin-LR-induced Sertoli cell toxicity

    Energy Technology Data Exchange (ETDEWEB)

    Zhou, Yuan [Immunology and Reproduction Biology Laboratory & State Key Laboratory of Analytical Chemistry for Life Science, Medical School, Nanjing University, Nanjing, Jiangsu 210093 (China); Jiangsu Key Laboratory of Molecular Medicine, Nanjing University, Nanjing, Jiangsu 210093 (China); Wang, Hui [The Centre for Individualized Medication, Linköping University Hospital, Linköping University, Linköping SE-58185 (Sweden); Wang, Cong [Immunology and Reproduction Biology Laboratory & State Key Laboratory of Analytical Chemistry for Life Science, Medical School, Nanjing University, Nanjing, Jiangsu 210093 (China); Jiangsu Key Laboratory of Molecular Medicine, Nanjing University, Nanjing, Jiangsu 210093 (China); Qiu, Xuefeng [Department of Urology, Affiliated Drum Tower Hospital, School of Medicine, Nanjing University, Nanjing 210008 (China); Benson, Mikael [The Centre for Individualized Medication, Linköping University Hospital, Linköping University, Linköping SE-58185 (Sweden); Yin, Xiaoqin [Immunology and Reproduction Biology Laboratory & State Key Laboratory of Analytical Chemistry for Life Science, Medical School, Nanjing University, Nanjing, Jiangsu 210093 (China); Jiangsu Key Laboratory of Molecular Medicine, Nanjing University, Nanjing, Jiangsu 210093 (China); Xiang, Zou [Department of Microbiology and Immunology, Mucosal Immunobiology and Vaccine Research Center, Institute of Biomedicine, University of Gothenburg, Gothenburg (Sweden); Li, Dongmei, E-mail: lidm@nju.edu.cn [Immunology and Reproduction Biology Laboratory & State Key Laboratory of Analytical Chemistry for Life Science, Medical School, Nanjing University, Nanjing, Jiangsu 210093 (China); Jiangsu Key Laboratory of Molecular Medicine, Nanjing University, Nanjing, Jiangsu 210093 (China); and others

    2015-08-15

    Microcystin (MC)-LR, a cyclic heptapeptide, is a potent reproductive system toxin. To understand the molecular mechanisms of MC-induced reproductive system cytotoxicity, we evaluated global changes of miRNA and mRNA expression in mouse Sertoli cells following MC-LR treatment. Our results revealed that the exposure to MC-LR resulted in an altered miRNA expression profile that might be responsible for the modulation of mRNA expression. Bio-functional analysis indicated that the altered genes were involved in specific cellular processes, including cell death and proliferation. Target gene analysis suggested that junction injury in Sertoli cells exposed to MC-LR might be mediated by miRNAs through the regulation of the Sertoli cell-Sertoli cell pathway. Collectively, these findings may enhance our understanding on the modes of action of MC-LR on mouse Sertoli cells as well as the molecular mechanisms underlying the toxicity of MC-LR on the male reproductive system. - Highlights: • miRNAs were altered in Sertoli cells exposed to MC-LR. • Alerted genes were involved in different cell functions including the cell morphology. • MC-LR adversely affected Sertoli cell junction formation through the regulating miRNAs.

  5. A Multi-Walled Carbon Nanotube-based Biosensor for Monitoring Microcystin-LR in Sources of Drinking Water Supplies

    Science.gov (United States)

    A multi-walled carbon nanotube-based electrochemical biosensor is developed for monitoring microcystin-LR (MC-LR), a toxic cyanobacterial toxin, in sources of drinking water supplies. The biosensor electrodes are fabricated using dense, mm-long multi-walled CNT (MWCNT) arrays gro...

  6. Effects of microcystin-LR, cylindrospermopsin and a microcystin-LR/cylindrospermopsin mixture on growth, oxidative stress and mineral content in lettuce plants (Lactuca sativa L.).

    Science.gov (United States)

    Freitas, Marisa; Azevedo, Joana; Pinto, Edgar; Neves, Joana; Campos, Alexandre; Vasconcelos, Vitor

    2015-06-01

    Toxic cyanobacterial blooms are documented worldwide as an emerging environmental concern. Recent studies support the hypothesis that microcystin-LR (MC-LR) and cylindrospermopsin (CYN) produce toxic effects in crop plants. Lettuce (Lactuca sativa L.) is an important commercial leafy vegetable that supplies essential elements for human nutrition; thus, the study of its sensitivity to MC-LR, CYN and a MC-LR/CYN mixture is of major relevance. This study aimed to assess the effects of environmentally relevant concentrations (1, 10 and 100 µg/L) of MC-LR, CYN and a MC-LR/CYN mixture on growth, antioxidant defense system and mineral content in lettuce plants. In almost all treatments, an increase in root fresh weight was obtained; however, the fresh weight of leaves was significantly decreased in plants exposed to 100 µg/L concentrations of each toxin and the toxin mixture. Overall, GST activity was significantly increased in roots, contrary to GPx activity, which decreased in roots and leaves. The mineral content in lettuce leaves changed due to its exposure to cyanotoxins; in general, the mineral content decreased with MC-LR and increased with CYN, and apparently these effects are time and concentration-dependent. The effects of the MC-LR/CYN mixture were almost always similar to the single cyanotoxins, although MC-LR seems to be more toxic than CYN. Our results suggest that lettuce plants in non-early stages of development are able to cope with lower concentrations of MC-LR, CYN and the MC-LR/CYN mixture; however, higher concentrations (100 µg/L) can affect both lettuce yield and nutritional quality. Copyright © 2015 Elsevier Inc. All rights reserved.

  7. Investigations into the biodegradation of microcystin-LR in wastewaters

    International Nuclear Information System (INIS)

    Ho, Lionel; Hoefel, Daniel; Palazot, Sebastien; Sawade, Emma; Newcombe, Gayle; Saint, Christopher P.; Brookes, Justin D.

    2010-01-01

    Microcystins are potent hepatotoxins that can be produced by cyanobacteria. These organisms can proliferate in wastewaters due to a number of factors including high concentrations of nutrients for growth. As treated wastewaters are now being considered as supplementary drinking water sources, in addition to their frequent use for irrigated agriculture, it is imperative that these wastewaters are free of toxins such as microcystins. This study investigated the potential for biodegradation of microcystin-LR (MCLR) in wastewaters through a biological sand filtration experiment and in static batch reactor experiments. MCLR was effectively removed at a range of concentrations and at various temperatures, with degradation attributed to the action of microorganisms indigenous to the wastewaters. No hepatotoxic by-products were detected following the degradation of MCLR as determined by a protein phosphatase inhibition assay. Using TaqMan polymerase chain reaction, the first gene involved in bacterial degradation of MCLR (mlrA) was detected and the responsible bacteria shown to increase with the amount of MCLR being degraded. This finding suggested that the degradation of MCLR was dependent upon the abundance of MCLR-degrading organisms present within the wastewater, and that MCLR may provide bacteria with a significant carbon source for proliferation; in turn increasing MCLR removal.

  8. Solar photo-Fenton treatment of microcystin-LR in aqueous environment: Transformation products and toxicity in different water matrices

    Science.gov (United States)

    Transformation products and toxicity patterns of microcystin-LR (MC-LR), a common cyanotoxin in freshwaters, during degradation by solar photo-Fenton process were studied in the absence and presence of two major water components, namely fulvic acid and alkalinity. The transformat...

  9. Oxidation of microcystin-LR by the Fenton process : Kinetics, degradation intermediates, water quality and toxicity assessment

    NARCIS (Netherlands)

    Park, Jeong-Ann; Yang, Boram; Park, Chanhyuk; Choi, Jae-Woo; van Genuchten, Case M.|info:eu-repo/dai/nl/413489647; Lee, Sang-Hyup

    2017-01-01

    The Fenton process was assessed as a cost-effective technology for the removal of Microcystin-LR (MC-LR) among UV, UV/H2O2, and Fenton process according to efficiency and electrical energy per order (EE/O). The determined practical concentrations of the Fenton reagents were 5 mg/L Fe(II) and 5 mg/L

  10. Process optimization for microcystin-LR degradation by Response Surface Methodology and mechanism analysis in gas-liquid hybrid discharge system.

    Science.gov (United States)

    Zhang, Yi; Wei, Hanyu; Xin, Qing; Wang, Mingang; Wang, Qi; Wang, Qiang; Cong, Yanqing

    2016-12-01

    A gas-liquid hybrid discharge system was applied to microcystin-LR (MC-LR) degradation. MC-LR degradation was completed after 1 min under a pulsed high voltage of 16 kV, gas-liquid interface gap of 10 mm and oxygen flow rate of 160 L/h. The Box-Behnken Design was proposed in Response Surface Methodology to evaluate the influence of pulsed high voltage, electrode distance and oxygen flow rate on MC-LR removal efficiency. Multiple regression analysis, focused on multivariable factors, was employed and a reduced cubic model was developed. The ANOVA analysis shows that the model is significant and the model prediction on MC-LR removal was also validated with experimental data. The optimum conditions for the process are obtained at pulsed voltage of 16 kV, gas-liquid interface gap of 10 mm and oxygen flow rate of 120 L/h with ta removal efficiency of MC-LR of 96.6%. The addition of catalysts (TiO 2 or Fe 2+ ) in the gas-liquid hybrid discharge system was found to enhance the removal of MC-LR. The intermediates of MC-LR degradation were analyzed by liquid chromatography/mass spectrometry. The degradation pathway proposed envisaged the oxidation of hydroxyl radicals and ozone, and attack of high-energy electrons on the unsaturated double bonds of Adda and Mdha, with MC-LR finally decomposing into small molecular products. Copyright © 2016 Elsevier Ltd. All rights reserved.

  11. Similar uptake profiles of microcystin-LR and -RR in an in vitro human intestinal model

    International Nuclear Information System (INIS)

    Zeller, P.; Clement, M.; Fessard, V.

    2011-01-01

    Highlights: → First description of in vitro cellular uptake of MCs into intestinal cells. → OATP 3A1 and OATP 4A1 are expressed in Caco-2 cell membranes. → MC-LR and MC-RR show similar uptake in Caco-2 cells. → MCs are probably excreted from Caco-2 cells by an active mechanism. -- Abstract: Microcystins (MCs) are cyclic hepatotoxins produced by various species of cyanobacteria. Their structure includes two variable amino acids (AA) leading to more than 80 MC variants. In this study, we focused on the most common variant, microcystin-LR (MC-LR), and microcystin-RR (MC-RR), a variant differing by only one AA. Despite their structural similarity, MC-LR elicits higher liver toxicity than MC-RR partly due to a discrepancy in their uptake by hepatic organic anion transporters (OATP 1B1 and 1B3). However, even though ingestion is the major pathway of human exposure to MCs, intestinal absorption of MCs has been poorly addressed. Consequently, we investigated the cellular uptake of the two MC variants in the human intestinal cell line Caco-2 by immunolocalization using an anti-MC antibody. Caco-2 cells were treated for 30 min to 24 h with several concentrations (1-50 μM) of both variants. We first confirmed the localization of OATP 3A1 and 4A1 at the cell membrane of Caco-2 cells. Our study also revealed a rapid uptake of both variants in less than 1 h. The uptake profiles of the two variants did not differ in our immunostaining study neither with respect to concentration nor the time of exposure. Furthermore, we have demonstrated for the first time the nuclear localization of MC-RR and confirmed that of MC-LR. Finally, our results suggest a facilitated uptake and an active excretion of MC-LR and MC-RR in Caco-2 cells. Further investigation on the role of OATP 3A1 and 4A1 in MC uptake should be useful to clarify the mechanism of intestinal absorption of MCs and contribute in risk assessment of cyanotoxin exposure.

  12. Kinetic and mechanistic study of microcystin-LR degradation by nitrous acid under ultraviolet irradiation.

    Science.gov (United States)

    Ma, Qingwei; Ren, Jing; Huang, Honghui; Wang, Shoubing; Wang, Xiangrong; Fan, Zhengqiu

    2012-05-15

    Degradation of microcystin-LR (MC-LR) in the presence of nitrous acid (HNO(2)) under irradiation of 365nm ultraviolet (UV) was studied for the first time. The influence of initial conditions including pH value, NaNO(2) concentration, MC-LR concentration and UV intensity were studied. MC-LR was degraded in the presence of HNO(2); enhanced degradation of MC-LR was observed with 365nm UV irradiation, caused by the generation of hydroxyl radicals through the photolysis of HNO(2). The degradation processes of MC-LR could well fit the pseudo-first-order kinetics. Mass spectrometry was applied for identification of the byproducts and the analysis of degradation mechanisms. Major degradation pathways were proposed according to the results of LC-MS analysis. The degradation of MC-LR was initiated via three major pathways: attack of hydroxyl radicals on the conjugated carbon double bonds of Adda, attack of hydroxyl radicals on the benzene ring of Adda, and attack of nitrosonium ion on the benzene ring of Adda. Copyright © 2012 Elsevier B.V. All rights reserved.

  13. Microcystin-LR induced reactive oxygen species mediate cytoskeletal disruption and apoptosis of hepatocytes in Cyprinus carpio L.

    Directory of Open Access Journals (Sweden)

    Jinlin Jiang

    Full Text Available Microcystins (MCs are a group of cyclic hepatotoxic peptides produced by cyanobacteria. Microcystin-LR (MC-LR contains Leucine (L and Arginine (R in the variable positions, and is one of the most common and potently toxic peptides. MC-LR can inhibit protein phosphatase type 1 and type 2A (PP1 and PP2A activities and induce excessive production of reactive oxygen species (ROS. The underlying mechanism of the inhibition of PP1 and PP2A has been extensively studied. The over-production of ROS is considered to be another main mechanism behind MC-LR toxicity; however, the detailed toxicological mechanism involved in over-production of ROS in carp (Cyprinus carpio L. remains largely unclear. In our present study, the hydroxyl radical (•OH was significantly induced in the liver of carp after a relatively short-term exposure to MC-LR. The elevated reactive oxygen species (ROS production may play an important role in the disruption of microtubule structure. Pre-injection of the antioxidant N-acetyl-cysteine (NAC provided significant protection to the cytoskeleton, however buthionine sulfoximine (BSO exacerbated cytoskeletal destruction. In addition, the elevated ROS formation induced the expression of apoptosis-related genes, including p38, JNKa, and bcl-2. A significant increase in apoptotic cells was observed at 12-48 hours. Our study further supports evidence that ROS are involved in MC-LR induced damage to liver cells in carp, and indicates the need for further study of the molecular mechanisms behind MC-LR toxicity.

  14. Microcystin-LR Induced Reactive Oxygen Species Mediate Cytoskeletal Disruption and Apoptosis of Hepatocytes in Cyprinus carpio L.

    Science.gov (United States)

    Jiang, Jinlin; Shan, Zhengjun; Xu, Weili; Wang, Xiaorong; Zhou, Junying; Kong, Deyang; Xu, Jing

    2013-01-01

    Microcystins (MCs) are a group of cyclic hepatotoxic peptides produced by cyanobacteria. Microcystin-LR (MC-LR) contains Leucine (L) and Arginine (R) in the variable positions, and is one of the most common and potently toxic peptides. MC-LR can inhibit protein phosphatase type 1 and type 2A (PP1 and PP2A) activities and induce excessive production of reactive oxygen species (ROS). The underlying mechanism of the inhibition of PP1 and PP2A has been extensively studied. The over-production of ROS is considered to be another main mechanism behind MC-LR toxicity; however, the detailed toxicological mechanism involved in over-production of ROS in carp (Cyprinus carpio L.) remains largely unclear. In our present study, the hydroxyl radical (•OH) was significantly induced in the liver of carp after a relatively short-term exposure to MC-LR. The elevated reactive oxygen species (ROS) production may play an important role in the disruption of microtubule structure. Pre-injection of the antioxidant N-acetyl-cysteine (NAC) provided significant protection to the cytoskeleton, however buthionine sulfoximine (BSO) exacerbated cytoskeletal destruction. In addition, the elevated ROS formation induced the expression of apoptosis-related genes, including p38, JNKa, and bcl-2. A significant increase in apoptotic cells was observed at 12 - 48 hours. Our study further supports evidence that ROS are involved in MC-LR induced damage to liver cells in carp, and indicates the need for further study of the molecular mechanisms behind MC-LR toxicity. PMID:24376844

  15. Dynamics of microcystins-LR and -RR in the phytoplanktivorous silver carp in a sub-chronic toxicity experiment

    International Nuclear Information System (INIS)

    Xie Liqiang; Xie Ping; Ozawa, Kazuhiko; Honma, Takamitsu; Yokoyama, Atsushi; Park, Ho-Dong

    2004-01-01

    A sub-chronic toxicity experiment was conducted to examine tissue distribution and depuration of two microcystins (microcystin-LR and microcystin -RR) in the phytoplanktivorous filter-feeding silver carp during a course of 80 days. Two large tanks (A, B) were used, and in Tank A, the fish were fed naturally with fresh Microcystis viridis cells (collected from a eutrophic pond) throughout the experiment, while in Tank B, the food of the fish were M. viridis cells for the first 40 days and then changed to artificial carp feed. High Performance Liquid Chromatography (HPLC) was used to measure MC-LR and MC-RR in the M. viridis cells, the seston, and the intestine, blood, liver and muscle tissue of silver carp at an interval of 20 days. MC-RR and MC-LR in the collected Microcystis cells varied between 268-580 and 110-292 μg g -1 DW, respectively. In Tank A, MC-RR and MC-LR varied between 41.5-99.5 and 6.9-15.8 μg g -1 DW in the seston, respectively. The maximum MC-RR in the blood, liver and muscle of the fish was 49.7, 17.8 and 1.77 μg g -1 DW, respectively. No MC-LR was detectable in the muscle and blood samples of the silver carp in spite of the abundant presence of this toxin in the intestines (for the liver, there was only one case when a relatively minor quantity was detected). These findings contrast with previous experimental results on rainbow trout. Perhaps silver carp has a mechanism to degrade MC-LR actively and to inhibit MC-LR transportation across the intestines. The depuration of MC-RR concentrations occurred slowly than uptakes in blood, liver and muscle, and the depuration rate was in the order of blood>liver>muscle. The grazing ability of silver carp on toxic cyanobacteria suggests an applicability of using phytoplanktivorous fish to counteract cyanotoxin contamination in eutrophic waters. - Silver carp are tolerant of cyanobacterial toxins, and might be used to control toxic algal blooms in highly eutrophic lakes

  16. Removal of microcystin-LR from drinking water using a bamboo-based charcoal adsorbent modified with chitosan.

    Science.gov (United States)

    Zhang, Hangjun; Zhu, Guoying; Jia, Xiuying; Ding, Ying; Zhang, Mi; Gao, Qing; Hu, Ciming; Xu, Shuying

    2011-01-01

    A new kind of low-cost syntactic adsorbent from bamboo charcoal and chitosan was developed for the removal of microcystin-LR from drinking water. Removal efficiency was higher for the syntactic adsorbent when the amount of bamboo charcoal was increased. The optimum dose ratio of bamboo charcoal to chitosan was 6:4, and the optimum amount was 15 mg/L; equilibrium time was 6 hr. The adsorption isotherm was non-linear and could be simulated by the Freundlich model (R2 = 0.9337). Adsorption efficiency was strongly affected by pH and natural organic matter (NOM). Removal efficiency was 16% higher at pH 3 than at pH 9. Efficiency rate was reduced by 15% with 25 mg/L NOM (UV254 = 0.089 cm(-1)) in drinking water. This study demonstrated that the bamboo charcoal modified with chitosan can effectively remove microcystin-LR from drinking water.

  17. Analysis of intracellular and extracellular microcystin variants in sediments and pore waters by accelerated solvent extraction and high performance liquid chromatography-tandem mass spectrometry

    International Nuclear Information System (INIS)

    Zastepa, Arthur; Pick, Frances R.; Blais, Jules M.; Saleem, Ammar

    2015-01-01

    Highlights: • First analytical method for intracellular microcystins (MCs) in sediment. • Includes a suite of variants (LR, 7dm LR, RR, YR, WR, LA, LF, LY, LW) and nodularin. • Reports the first measurements of MCs in sediment pore waters. • MCs detected in >100 year old lake sediments suggesting long-term preservation. • Sediment-pore water distribution (K d ) differed between variants suggesting differences in environmental fate. - Abstract: The fate and persistence of microcystin cyanotoxins in aquatic ecosystems remains poorly understood in part due to the lack of analytical methods for microcystins in sediments. Existing methods have been limited to the extraction of a few extracellular microcystins of similar chemistry. We developed a single analytical method, consisting of accelerated solvent extraction, hydrophilic–lipophilic balance solid phase extraction, and reversed phase high performance liquid chromatography-tandem mass spectrometry, suitable for the extraction and quantitation of both intracellular and extracellular cyanotoxins in sediments as well as pore waters. Recoveries of nine microcystins, representing the chemical diversity of microcystins, and nodularin (a marine analogue) ranged between 75 and 98% with one, microcystin-RR (MC-RR), at 50%. Chromatographic separation of these analytes was achieved within 7.5 min and the method detection limits were between 1.1 and 2.5 ng g −1 dry weight (dw). The robustness of the method was demonstrated on sediment cores collected from seven Canadian lakes of diverse geography and trophic states. Individual microcystin variants reached a maximum concentration of 829 ng g −1 dw on sediment particles and 132 ng mL −1 in pore waters and could be detected in sediments as deep as 41 cm (>100 years in age). MC-LR, -RR, and -LA were more often detected while MC-YR, -LY, -LF, and -LW were less common. The analytical method enabled us to estimate sediment-pore water distribution coefficients (K d

  18. Analysis of intracellular and extracellular microcystin variants in sediments and pore waters by accelerated solvent extraction and high performance liquid chromatography-tandem mass spectrometry

    Energy Technology Data Exchange (ETDEWEB)

    Zastepa, Arthur, E-mail: arthur.zastepa@gmail.com; Pick, Frances R.; Blais, Jules M.; Saleem, Ammar

    2015-05-04

    Highlights: • First analytical method for intracellular microcystins (MCs) in sediment. • Includes a suite of variants (LR, {sup 7dm}LR, RR, YR, WR, LA, LF, LY, LW) and nodularin. • Reports the first measurements of MCs in sediment pore waters. • MCs detected in >100 year old lake sediments suggesting long-term preservation. • Sediment-pore water distribution (K{sub d}) differed between variants suggesting differences in environmental fate. - Abstract: The fate and persistence of microcystin cyanotoxins in aquatic ecosystems remains poorly understood in part due to the lack of analytical methods for microcystins in sediments. Existing methods have been limited to the extraction of a few extracellular microcystins of similar chemistry. We developed a single analytical method, consisting of accelerated solvent extraction, hydrophilic–lipophilic balance solid phase extraction, and reversed phase high performance liquid chromatography-tandem mass spectrometry, suitable for the extraction and quantitation of both intracellular and extracellular cyanotoxins in sediments as well as pore waters. Recoveries of nine microcystins, representing the chemical diversity of microcystins, and nodularin (a marine analogue) ranged between 75 and 98% with one, microcystin-RR (MC-RR), at 50%. Chromatographic separation of these analytes was achieved within 7.5 min and the method detection limits were between 1.1 and 2.5 ng g{sup −1} dry weight (dw). The robustness of the method was demonstrated on sediment cores collected from seven Canadian lakes of diverse geography and trophic states. Individual microcystin variants reached a maximum concentration of 829 ng g{sup −1} dw on sediment particles and 132 ng mL{sup −1} in pore waters and could be detected in sediments as deep as 41 cm (>100 years in age). MC-LR, -RR, and -LA were more often detected while MC-YR, -LY, -LF, and -LW were less common. The analytical method enabled us to estimate sediment-pore water

  19. Detection and quantification of microcystins (cyanobacterial hepatotoxins) with recombinant antibody fragments isolated from a naïve human phage display library.

    Science.gov (United States)

    McElhiney, J; Lawton, L A; Porter, A J

    2000-12-01

    Single-chain antibody fragments against the cyanobacterial hepatotoxin microcystin-LR were isolated from a naive human phage display library and expressed in Escherichia coli. In competition enzyme-linked immunosorbent assay (ELISA), the most sensitive antibody clone selected from the library detected free microcystin-LR with an IC(50) value of 4 microM. It was found to cross react with three other microcystin variants - microcystin-RR, microcystin-LW and microcystin-LF - and detected microcystins in extracts of the cyanobacterium Microcystis aeruginosa, found to contain the toxins by high-performance liquid chromatography (HPLC). The quantification of microcystins in these extracts by ELISA and HPLC showed good correlation. Although the antibody isolated in this study was considerably less sensitive than the polyclonal and monoclonal antibodies already available for microcystin detection, phage display technology represents a cheaper, more rapid alternative for the production of anti-microcystin antibodies than the methods currently in use.

  20. Microcystin-LR equivalent concentrations in fish tissue during a postbloom Microcystis exposure in Loskop Dam, South Africa

    CSIR Research Space (South Africa)

    Nchabeleng, T

    2014-12-01

    Full Text Available The effects of a decomposing cyanobacteria bloom on water quality and the accumulation of microcystin-LR equivalent toxin in fish at Loskop Dam were studied in May 2012. Enzyme-linked immunosorbent assay [ELISA] was used to confirm the presence...

  1. A 3D graphene-based biosensor as an early microcystin-LR screening tool in sources of drinking water supply

    International Nuclear Information System (INIS)

    Zhang, Wei; Han, Changseok; Jia, Baoping; Saint, Christopher; Nadagouda, Mallikarjuna; Falaras, Polycarpos; Sygellou, Labrini; Vogiazi, Vasileia; Dionysiou, Dionysios D.

    2017-01-01

    Highlights: • 3D graphene-based biosensors can detect MC-LR with remarkable sensitivity. • Good linear correlation between electron-transfer resistance and MC-LR concentration. • A detection limit of 0.04 μg/L MC-LR was accomplished. - Abstract: Recent advances in graphene synthesis and understanding of properties have led to enormous applications in a variety of areas. Graphene and its unique electrical properties can favor electrochemical biosensor applications for aqueous toxin monitoring. Graphene-based biosensors can be used as an alternative to time-consuming, expensive and non-portable conventional methods of analysis involved in water quality monitoring and assessment. In this work, we showcased a three-dimensional (3D) graphene-based biosensor for microcystin-LR (MC-LR) detection and quantification. We report the efficient functionalization and immobilization of microcystin-LR and its antibodies on the facile synthesized CVD 3D graphene. The modified graphene electrodes were characterized by X-ray photoelectron spectroscopy and micro-Raman spectroscopy. Cyclic voltammetry and electrochemical impedance spectroscopy were used to electrochemically characterize the biochemical events on the electrodes. Specifically, as-prepared 3D graphene-based biosensors can detect MC-LR with remarkable sensitivity due to its macro-porous structure and large surface area, and high conductivity. A very good linear correlation of the electron-transfer resistance (R"2 = 0.93) was achieved over 0.05 and 20 μg/L MC-LR concentration range. Also, a detection limit of 0.05 μg/L was accomplished, which is much lower than the World Health Organization (WHO) provisional guideline limit of MC-LR concentration (i.e. 1 μg/L) in drinking water.

  2. Effects of different algaecides on the photosynthetic capacity, cell integrity and microcystin-LR release of Microcystis aeruginosa

    International Nuclear Information System (INIS)

    Zhou, Shiqing; Shao, Yisheng; Gao, Naiyun; Deng, Yang; Qiao, Junlian; Ou, Huase; Deng, Jing

    2013-01-01

    Bench scale tests were conducted to study the effects of four common algaecides, including copper sulfate, hydrogen peroxide, diuron and ethyl 2-methylacetoacetate (EMA) on the photosynthetic capacity, cell integrity and microcystin-LR (MC-LR) release of Microcystis aeruginosa. The release of potassium (K + ) from cell membrane during algaecide exposure was also analyzed. The three typical photosynthetic parameters, including the effective quantum yield (φ e ), photosynthetic efficiency (α) and maximal electron transport rate (rETR max ), were measured by a pulse amplitude modulated (PAM) fluorometry. Results showed that the photosynthetic capacity was all inhibited by the four algaecides, to different degrees, by limiting the energy capture in photosynthesis, and blocking the electron transfer chain in primary reaction. For example, at high diuron concentration (7.5 mg L −1 ), φ e , α and rETR max decreased from 0.46 to 0.19 (p −2 s −1 /μmol photons m −2 s −1 , and from 160.7 to 0.1 (p −2 s −1 compared with the control group after 96 h of exposure, respectively. Furthermore, the increase of algaecide dose could lead to the cell lysis, as well as release of intracellular MC-LR that enhanced the accumulation of extracellular MC-LR. The order of MC-LR release potential for the four algaecides was CuSO 4 > H 2 O 2 > diuron > EMA. Highlights: • PAM was used to investigate the effects of algaecides on Microcystis aeruginosa. • We estimate the release of potassium (K + ) from cell membrane for cell lysis. • The risk of microcystin-LR release was evaluated after algaecides exposure. • The order of MC-LR release potential was copper sulfate > hydrogen peroxide > diuron > ethyl 2-methylacetoacetate

  3. Kinetic and mechanistic study of microcystin-LR degradation by nitrous acid under ultraviolet irradiation

    International Nuclear Information System (INIS)

    Ma, Qingwei; Ren, Jing; Huang, Honghui; Wang, Shoubing; Wang, Xiangrong; Fan, Zhengqiu

    2012-01-01

    Highlights: ► For the first time, degradation of MC-LR by nitrous acid under UV 365 nm was discovered. ► The effects of factors on MC-LR degradation were analyzed based on kinetic study. ► Mass spectrometry was applied for identification of intermediates and products. ► Special intermediates involved in this study were identified. ► Degradation mechanisms were proposed according to the results of LC–MS analysis. - Abstract: Degradation of microcystin-LR (MC-LR) in the presence of nitrous acid (HNO 2 ) under irradiation of 365 nm ultraviolet (UV) was studied for the first time. The influence of initial conditions including pH value, NaNO 2 concentration, MC-LR concentration and UV intensity were studied. MC-LR was degraded in the presence of HNO 2 ; enhanced degradation of MC-LR was observed with 365 nm UV irradiation, caused by the generation of hydroxyl radicals through the photolysis of HNO 2 . The degradation processes of MC-LR could well fit the pseudo-first-order kinetics. Mass spectrometry was applied for identification of the byproducts and the analysis of degradation mechanisms. Major degradation pathways were proposed according to the results of LC–MS analysis. The degradation of MC-LR was initiated via three major pathways: attack of hydroxyl radicals on the conjugated carbon double bonds of Adda, attack of hydroxyl radicals on the benzene ring of Adda, and attack of nitrosonium ion on the benzene ring of Adda.

  4. Kinetic and mechanistic study of microcystin-LR degradation by nitrous acid under ultraviolet irradiation

    Energy Technology Data Exchange (ETDEWEB)

    Ma, Qingwei; Ren, Jing [Department of Environmental Science and Engineering, Fudan University, Shanghai 200433 (China); Huang, Honghui [Key Laboratory of Fisheries Ecology Environment, Ministry of Agriculture, Guangzhou 510300 (China); Wang, Shoubing [Department of Environmental Science and Engineering, Fudan University, Shanghai 200433 (China); Wang, Xiangrong, E-mail: xrxrwang@vip.sina.com [Department of Environmental Science and Engineering, Fudan University, Shanghai 200433 (China); Fan, Zhengqiu, E-mail: zhqfan@fudan.edu.cn [Department of Environmental Science and Engineering, Fudan University, Shanghai 200433 (China)

    2012-05-15

    Highlights: Black-Right-Pointing-Pointer For the first time, degradation of MC-LR by nitrous acid under UV 365 nm was discovered. Black-Right-Pointing-Pointer The effects of factors on MC-LR degradation were analyzed based on kinetic study. Black-Right-Pointing-Pointer Mass spectrometry was applied for identification of intermediates and products. Black-Right-Pointing-Pointer Special intermediates involved in this study were identified. Black-Right-Pointing-Pointer Degradation mechanisms were proposed according to the results of LC-MS analysis. - Abstract: Degradation of microcystin-LR (MC-LR) in the presence of nitrous acid (HNO{sub 2}) under irradiation of 365 nm ultraviolet (UV) was studied for the first time. The influence of initial conditions including pH value, NaNO{sub 2} concentration, MC-LR concentration and UV intensity were studied. MC-LR was degraded in the presence of HNO{sub 2}; enhanced degradation of MC-LR was observed with 365 nm UV irradiation, caused by the generation of hydroxyl radicals through the photolysis of HNO{sub 2}. The degradation processes of MC-LR could well fit the pseudo-first-order kinetics. Mass spectrometry was applied for identification of the byproducts and the analysis of degradation mechanisms. Major degradation pathways were proposed according to the results of LC-MS analysis. The degradation of MC-LR was initiated via three major pathways: attack of hydroxyl radicals on the conjugated carbon double bonds of Adda, attack of hydroxyl radicals on the benzene ring of Adda, and attack of nitrosonium ion on the benzene ring of Adda.

  5. Effects of different algaecides on the photosynthetic capacity, cell integrity and microcystin-LR release of Microcystis aeruginosa

    Energy Technology Data Exchange (ETDEWEB)

    Zhou, Shiqing [State Key Laboratory of Pollution Control and Resource Reuse, Tongji University, Shanghai 200092 (China); Shao, Yisheng, E-mail: yishengshao@163.com [State Key Laboratory of Pollution Control and Resource Reuse, Tongji University, Shanghai 200092 (China); China Academy of Urban Planning and Design, Beijing 100037 (China); Gao, Naiyun [State Key Laboratory of Pollution Control and Resource Reuse, Tongji University, Shanghai 200092 (China); Deng, Yang [Department of Earth and Environmental Studies, Montclair State University, Montclair NJ 07043 (United States); Qiao, Junlian; Ou, Huase; Deng, Jing [State Key Laboratory of Pollution Control and Resource Reuse, Tongji University, Shanghai 200092 (China)

    2013-10-01

    Bench scale tests were conducted to study the effects of four common algaecides, including copper sulfate, hydrogen peroxide, diuron and ethyl 2-methylacetoacetate (EMA) on the photosynthetic capacity, cell integrity and microcystin-LR (MC-LR) release of Microcystis aeruginosa. The release of potassium (K{sup +}) from cell membrane during algaecide exposure was also analyzed. The three typical photosynthetic parameters, including the effective quantum yield (φ{sub e}), photosynthetic efficiency (α) and maximal electron transport rate (rETR{sub max}), were measured by a pulse amplitude modulated (PAM) fluorometry. Results showed that the photosynthetic capacity was all inhibited by the four algaecides, to different degrees, by limiting the energy capture in photosynthesis, and blocking the electron transfer chain in primary reaction. For example, at high diuron concentration (7.5 mg L{sup −1}), φ{sub e}, α and rETR{sub max} decreased from 0.46 to 0.19 (p < 0.01), from 0.20 to 0.01 (p < 0.01) μmol electrons m{sup −2} s{sup −1}/μmol photons m{sup −2} s{sup −1}, and from 160.7 to 0.1 (p < 0.001) μmol m{sup −2} s{sup −1} compared with the control group after 96 h of exposure, respectively. Furthermore, the increase of algaecide dose could lead to the cell lysis, as well as release of intracellular MC-LR that enhanced the accumulation of extracellular MC-LR. The order of MC-LR release potential for the four algaecides was CuSO{sub 4} > H{sub 2}O{sub 2} > diuron > EMA. Highlights: • PAM was used to investigate the effects of algaecides on Microcystis aeruginosa. • We estimate the release of potassium (K{sup +}) from cell membrane for cell lysis. • The risk of microcystin-LR release was evaluated after algaecides exposure. • The order of MC-LR release potential was copper sulfate > hydrogen peroxide > diuron > ethyl 2-methylacetoacetate.

  6. Tissue distribution, excretion and hepatic biotransformation of microcystin-LR in mice

    International Nuclear Information System (INIS)

    Robinson, N.A.; Pace, J.G.; Matson, C.F.; Miura, G.A.; Lawrence, W.B.

    1991-01-01

    The distribution, excretion and hepatic metabolism of [3H]microcystin-LR (sublethal i.v.) were measured in mice. Plasma elimination was biexponential with alpha- and beta-phase half-lives of 0.8 and 6.9 min, respectively. At 60 min, liver contained 67 +/- 4% of dose. Through the 6-day study the amount of hepatic radioactivity did not change whereas 23.7 +/- 1.7% of the dose was excreted; 9.2 +/- 1.0% in urine and 14.5 +/- 1.1% in feces. Approximately 60% of the urine and fecal radiolabel 6 and 12 hr postinjection was the parent toxin. Hepatic cytosol, which contained 70 +/- 2% of the hepatic radiolabel (1 hr through 6 days), was prepared for high-performance liquid chromatography analysis by heat denaturation, pronase digestion and C18 Sep Pak extraction. At 1 hr, 35 +/- 2% of the radiolabel was insoluble or C18 Sep Pak-bound; 43 +/- 3% was associated with a peak of retention time (rt) 6.6 min, and 16 +/- 3% with the parent toxin (rt 9.4 min). After 6 days, 8 +/- 1% was C18 Sep Pak-bound or insoluble; 5 +/- 0% occurred at rt 6.6 min, 17 +/- 1% with parent and 60 +/- 2% was associated with rt 8.1 min. Two other peaks, rt 4.9 and 5.6 min, appeared transiently. Analysis of hepatic cytosol by desalting chromatography under nondenaturing and denaturing conditions revealed that all of the radiolabel was associated with cytosolic components, and 83 +/- 5% was bound covalently through 1 day. By day 6 the amount of covalently bound isotope decreased to 42 +/- 11%. This is the first study to describe the long-term hepatic retention of microcystin toxin and documents putative detoxication products

  7. Accumulation of free and covalently bound microcystins in tissues of Lymnaea stagnalis (Gastropoda) following toxic cyanobacteria or dissolved microcystin-LR exposure.

    Science.gov (United States)

    Lance, Emilie; Neffling, Milla-Riina; Gérard, Claudia; Meriluoto, Jussi; Bormans, Myriam

    2010-03-01

    Accumulation of free microcystins (MCs) in freshwater gastropods has been demonstrated but accumulation of MCs covalently bound to tissues has never been considered so far. Here, we follow the accumulation of total (free and bound) MCs in Lymnaea stagnalis exposed to i) dissolved MC-LR (33 and 100 microg L(-1)) and ii) Planktothrix agardhii suspensions producing 5 and 33 microg MC-LR equivalents L(-1) over a 5-week period, and after a 3-week depuration period. Snails exposed to dissolved MC-LR accumulated up to 0.26 microg total MCs g(-1) dry weight (DW), with no detection of bound MCs. Snails exposed to MCs producing P. agardhii accumulated up to 69.9 microg total MCs g(-1) DW, of which from 17.7 to 66.7% were bound. After depuration, up to 15.3 microg g(-1) DW of bound MCs were detected in snails previously exposed to toxic cyanobacteria, representing a potential source of MCs transfer through the food web. Copyright (c) 2009 Elsevier Ltd. All rights reserved.

  8. Sex-dependent effects of microcystin-LR on hypothalamic-pituitary-gonad axis and gametogenesis of adult zebrafish

    Science.gov (United States)

    Liu, Wanjing; Chen, Chuanyue; Chen, Liang; Wang, Li; Li, Jian; Chen, Yuanyuan; Jin, Jienan; Kawan, Atufa; Zhang, Xuezhen

    2016-03-01

    While microcystins (MCs) have been reported to exert reproductive toxicity on fish with a sex-dependent effect, the underlying mechanism has been rarely investigated. In the present study, zebrafish were exposed to 1, 5 and 20 μg/L MC-LR for 30 d. The gonad-somatic index declined in all treated males. 17β-estradiol (E2), testosterone (T), 11-keto testosterone (11-KT) and follicle-stimulating hormone (FSH) levels increased in serum from all treated females, while T, FSH and luteinizing hormone (LH) levels changed in all treated males. Histomorphological observation showed that MC-LR exposure evidently retarded oogenesis and spermatogenesis. Transcriptional changes of 22 genes of the hypothalamic-pituitary-gonad (HPG) axis exhibited sex-specific responses, and the relationship between gene transcriptions and gametogenesis was evaluated by principle component analysis (PCA). Major contributors to PC1 (gnrh2, gnrhr3, ar, lhr, hmgra, hmgrb and cyp19a) were positively correlated with the number of post-vitellogenic oocytes, while PC1 (gnrh2, lhβ, erβ, fshr, cyp11a and 17βhsd) were positively correlated with the number of spermatozoa. The protein levels of 17βHSD and CYP19a were affected in both females and males. In conclusion, this study first investigated the sex-dependent effects of microcystins on fish reproduction and revealed some important molecular biomarkers related to gametogenesis in zebrafish suffered from MC-LR.

  9. Adsorption of microcystin-LR on mesoporous carbons and its potential use in drinking water source.

    Science.gov (United States)

    Park, Jeong-Ann; Jung, Sung-Mok; Yi, In-Geol; Choi, Jae-Woo; Kim, Song-Bae; Lee, Sang-Hyup

    2017-06-01

    Microcystin-LR (MC-LR) is a common toxin derived from cyanobacterial blooms an effective, rapid and non-toxic method needs to be developed for its removal from drinking water treatment plants (DWTP). For an adsorption-based method, mesoporous carbon can be a promising supplemental adsorbent. The effect of mesoporous carbon (MC1, MC2, and MC3) properties and water quality parameters on the adsorption of MC-LR were investigated and the results were analyzed by kinetic, isotherm, thermodynamic, Derjaguin-Landau-Verwey-Overbeek (DLVO), and intraparticle diffusion models. MC1 was the most appropriate type for the removal of MC-LR with a maximum adsorption capacity of 35,670.49 μg/g. Adsorption of MC-LR is a spontaneous reaction dominated by van der Waals interactions. Pore sizes of 8.5-14 nm enhance the pore diffusion of MC-LR from the surface to the mesopores of MC1. The adsorption capacity was not sensitive to changes in the pH (3.2-8.0) and the existence of organic matter (2-5 mg/L). Furthermore, the final concentration of MC-LR was below the WHO guideline level after a 10-min reaction with 20 mg/L of MC1 in the Nak-Dong River, a drinking water source. The MC-LR adsorption mainly competed with humic substances (500-1000 g/mole); however, they did not have a great effect on adsorption. Copyright © 2017. Published by Elsevier Ltd.

  10. Dynamics of Protein Phosphatase Gene Expression in Corbicula fluminea Exposed to Microcystin-LR and to Toxic Microcystis aeruginosa Cells

    Directory of Open Access Journals (Sweden)

    Vitor Vasconcelos

    2011-12-01

    Full Text Available This study investigated the in vivo effects of microcystins on gene expression of several phosphoprotein phosphatases (PPP in the freshwater clam Corbicula fluminea with two different exposure scenarios. Clams were exposed for 96 h to 5 µg L−1 of dissolved microcystin-LR and the relative changes of gene expression of three different types of PPP (PPP1, 2 and 4 were analyzed by quantitative real-time PCR. The results showed a significant induction of PPP2 gene expression in the visceral mass. In contrast, the cyanotoxin did not cause any significant changes on PPP1 and PPP4 gene expression. Based on these results, we studied alterations in transcriptional patterns in parallel with enzymatic activity of C. fluminea for PPP2, induced by a Microcystis aeruginosa toxic strain (1 × 105 cells cm−3 during 96 h. The relative changes of gene expression and enzyme activity in visceral mass were analyzed by quantitative real-time PCR and colorimetric assays respectively. The clams exhibited a significant reduction of PPP2 activity with a concomitant enhancement of gene expression. Considering all the results we can conclude that the exposure to an ecologically relevant concentration of pure or intracellular microcystins (-LR promoted an in vivo effect on PPP2 gene expression in C. fluminea.

  11. Effects of microcystin-LR and cylindrospermopsin on plant-soil systems: A review of their relevance for agricultural plant quality and public health

    Energy Technology Data Exchange (ETDEWEB)

    Machado, J.; Campos, A. [Interdisciplinary Centre of Marine and Environmental Research (CIIMAR/CIMAR), University of Porto, Rua dos Bragas 289, P 4050-123 Porto (Portugal); Vasconcelos, V. [Interdisciplinary Centre of Marine and Environmental Research (CIIMAR/CIMAR), University of Porto, Rua dos Bragas 289, P 4050-123 Porto (Portugal); Department of Biology, Faculty of Sciences, University of Porto, Rua do Campo Alegre, P 4069-007 Porto (Portugal); Freitas, M., E-mail: maf@ess.ipp.pt [Interdisciplinary Centre of Marine and Environmental Research (CIIMAR/CIMAR), University of Porto, Rua dos Bragas 289, P 4050-123 Porto (Portugal); Polytechnic Institute of Porto, Department of Environmental Health, School of Allied Health Technologies, CISA/Research Center in Environment and Health, Rua de Valente Perfeito, 322, P 440-330 Gaia (Portugal)

    2017-02-15

    Toxic cyanobacterial blooms are recognized as an emerging environmental threat worldwide. Although microcystin-LR is the most frequently documented cyanotoxin, studies on cylindrospermopsin have been increasing due to the invasive nature of cylindrospermopsin-producing cyanobacteria. The number of studies regarding the effects of cyanotoxins on agricultural plants has increased in recent years, and it has been suggested that the presence of microcystin-LR and cylindrospermopsin in irrigation water may cause toxic effects in edible plants. The uptake of these cyanotoxins by agricultural plants has been shown to induce morphological and physiological changes that lead to a potential loss of productivity. There is also evidence that edible terrestrial plants can bioaccumulate cyanotoxins in their tissues in a concentration dependent-manner. Moreover, the number of consecutive cycles of watering and planting in addition to the potential persistence of microcystin-LR and cylindrospermopsin in the environment are likely to result in groundwater contamination. The use of cyanotoxin-contaminated water for agricultural purposes may therefore represent a threat to both food security and food safety. However, the deleterious effects of cyanotoxins on agricultural plants and public health seem to be dependent on the concentrations studied, which in most cases are non-environmentally relevant. Interestingly, at ecologically relevant concentrations, the productivity and nutritional quality of some agricultural plants seem not to be impaired and may even be enhanced. However, studies assessing if the potential tolerance of agricultural plants to these concentrations can result in cyanotoxin and allergen accumulation in the edible tissues are lacking. This review combines the most current information available regarding this topic with a realistic assessment of the impact of cyanobacterial toxins on agricultural plants, groundwater quality and public health. - Highlights:

  12. Effects of microcystin-LR and cylindrospermopsin on plant-soil systems: A review of their relevance for agricultural plant quality and public health

    International Nuclear Information System (INIS)

    Machado, J.; Campos, A.; Vasconcelos, V.; Freitas, M.

    2017-01-01

    Toxic cyanobacterial blooms are recognized as an emerging environmental threat worldwide. Although microcystin-LR is the most frequently documented cyanotoxin, studies on cylindrospermopsin have been increasing due to the invasive nature of cylindrospermopsin-producing cyanobacteria. The number of studies regarding the effects of cyanotoxins on agricultural plants has increased in recent years, and it has been suggested that the presence of microcystin-LR and cylindrospermopsin in irrigation water may cause toxic effects in edible plants. The uptake of these cyanotoxins by agricultural plants has been shown to induce morphological and physiological changes that lead to a potential loss of productivity. There is also evidence that edible terrestrial plants can bioaccumulate cyanotoxins in their tissues in a concentration dependent-manner. Moreover, the number of consecutive cycles of watering and planting in addition to the potential persistence of microcystin-LR and cylindrospermopsin in the environment are likely to result in groundwater contamination. The use of cyanotoxin-contaminated water for agricultural purposes may therefore represent a threat to both food security and food safety. However, the deleterious effects of cyanotoxins on agricultural plants and public health seem to be dependent on the concentrations studied, which in most cases are non-environmentally relevant. Interestingly, at ecologically relevant concentrations, the productivity and nutritional quality of some agricultural plants seem not to be impaired and may even be enhanced. However, studies assessing if the potential tolerance of agricultural plants to these concentrations can result in cyanotoxin and allergen accumulation in the edible tissues are lacking. This review combines the most current information available regarding this topic with a realistic assessment of the impact of cyanobacterial toxins on agricultural plants, groundwater quality and public health. - Highlights:

  13. METHOD 544. DETERMINATION OF MICROCYSTINS AND NODULARIN IN DRINKING WATER BY SOLID PHASE EXTRACTION AND LIQUID CHROMATOGRAPHY/TANDEM MASS SPECTROMETRY (LC/MS/MS)

    Science.gov (United States)

    Method 544 is an accurate and precise analytical method to determine six microcystins (including MC-LR) and nodularin in drinking water using solid phase extraction and liquid chromatography tandem mass spectrometry (SPE-LC/MS/MS). The advantage of this SPE-LC/MS/MS is its sensi...

  14. Determination of microcystin-LR in drinking water using UPLC tandem mass spectrometry-matrix effects and measurement.

    Science.gov (United States)

    Li, Wei; Duan, Jinming; Niu, Chaoying; Qiang, Naichen; Mulcahy, Dennis

    2011-10-01

    A simple detection method using ultra-performance liquid chromatography electrospray ionisation tandem mass spectrometry (UPLC-ESI-MS-MS) coupled with the sample dilution method for determining trace microcystin-LR (MC-LR) in drinking water is presented. The limit of detection (LOD) was 0.04 µg/L and the limit of quantitation (LOQ) was 0.1 µg/L. Water matrix effects of ionic strength, dissolved organic carbon (DOC) and pH were examined. The results indicate that signal detection intensity for MC-LR was significantly suppressed as the ionic strength increased from ultrapure water condition, whereas it increased slightly with solution pH and DOC at low concentrations. However, addition of methanol (MeOH) into the sample was able to counter the signal suppression effects. In this study, dilution of the tap water sample by adding 4% MeOH (v/v) was observed to be adequate to compensate for the signal suppression. The recoveries of the samples fortified with MC-LR (0.2, 1, and 10 µg/L) for three different tap water samples ranged from 84.4% to 112.9%.

  15. Homogeneous time-resolved fluoroimmunoassay of microcystin-LR using layered WS2 nanosheets as a transducer

    Science.gov (United States)

    Qin, Xiaodan; Wang, Yuanxiu; Song, Bo; Wang, Xin; Ma, Hua; Yuan, Jingli

    2017-06-01

    A homogeneous time-resolved fluoroimmunoassay method for rapid and sensitive detection of microcystin-LR (MC-LR) in water samples was developed based on the interaction between water-soluble WS2 nanosheets and the conjugate of MC-LR with a luminescent Eu3+ complex BHHBCB-Eu3+ (BHHBCB: 1,2-bis[4‧-(1″,1″,1″,2″,2″,3″,3″-heptafluoro-4″,6″-hexanedion-6″-yl)- benzyl]-4-chlorosulfobenzene). The large lateral dimensions and high surface areas of two-dimensional layered WS2 nanosheets enable easy adsorption of the MC-LR-BHHBCB-Eu3+ conjugate, that lead to efficient quenching of the luminescence of Eu3+ complex via energy transfer or electron transfer process. However, the addition of monoclonal anti-MC-LR antibody can induce the formation of MC-LR-BHHBCB-Eu3+/antibody immune complex, which prevents the interaction between WS2 nanosheets and MC-LR-BHHBCB-Eu3+ to result in the restoration of Eu3+ luminescence. This signal transduction mechanism made it possible for analysis of the target MC-LR in a homogeneous system. The present method has advantages of rapidity and simplicity since the B/F (bound reagent/free reagent) separation steps, the solid-phase carrier and antibody labeling or modification process are not necessary. The proposed immunosensing system displayed a wide linear range, good precision and accuracy, and comparable sensitivity with a detection limit of 0.3 μg l-1, which satisfied the World Health Organization (WHO) provisional guideline limit of 1.0 μg l-1 for MC-LR in drinking water.

  16. A novel photocatalytic material for removing microcystin-LR under visible light irradiation: degradation characteristics and mechanisms.

    Directory of Open Access Journals (Sweden)

    Xin Sui

    Full Text Available Microcystin-LR (MC-LR, a common toxic species in contaminated aquatic systems, persists for long periods because of its cyclic structure. Ag3PO4 is an environment-friendly photocatalyst with relatively good degradation capacity for hazardous organic pollutants. This study aimed to investigate the degradation capacity of Ag3PO4 for MC-LR under visible light.An Ag3PO4 photocatalyst was synthesized by the ion-exchange method and characterized by X-ray diffraction, field-emission scanning electron microscope, and UV-Vis spectrophotometer. MC-LR was quantified in each sample through high-performance liquid chromatograph. The degradation efficiency of MC-LR was affected by initial pH, initial Ag3PO4 concentration, initial MC-LR concentration, and recycle experiments. The degradation intermediates of MC-LR were examined by liquid chromatography-mass spectrometry (LC/MS.The degradation process can be well fitted with the pseudo-first-order kinetic model. The maximum MC-LR degradation rate of 99.98% can be obtained within 5 h under the following optimum conditions: pH of 5.01, Ag3PO4 concentration of 26.67 g/L, and MC-LR concentration of 9.06 mg/L. Nine intermediates were detected and analyzed by LC/MS. Three main degradation pathways were proposed based on the molecular weight of the intermediates and the reaction mechanism: (1 hydroxylation on the aromatic ring of Adda, (2 hydroxylation on the diene bonds of Adda, and (3 internal interactions on the cyclic structure of MC-LR.Ag3PO4 is a highly efficient catalyst for MC-LR degradation in aqueous solutions.

  17. Effects of the naturally-occurring contaminant microcystins on the Azolla filiculoides-Anabaena azollae symbiosis.

    Science.gov (United States)

    Pereira, A L; Monteiro, B; Azevedo, J; Campos, A; Osório, H; Vasconcelos, V

    2015-08-01

    Harmful algal blooms (HABs) contaminate aquatic ecosystems and are responsible for animal poisoning worldwide. We conducted a toxicity test with the aquatic fern and the biofertilizer, Azolla filiculoides. The sporophytes were exposed to three concentrations (0.01, 0.1 and 1μgmL(-1)) of a microcystin (MC) cyanobacterial crude extract and purified MC-LR. The growth of A. filiculoides decreased only at 1μgmL(-1) crude extract concentration while with MC-LR it decreased at all the tested concentrations, indicating that the presence of other compounds in the crude extract altered toxicity and stimulated the fern growth at lower concentrations (0.01 and 0.1μgmL(-1)). Both phycoerythrocyanin and allophycocyanin levels decreased in all the concentrations of crude extract and MC-LR. The phycocyanin had a marked increase at 0.1μgmL(-1) crude extract concentration and a marked decrease at 1μgmL(-1) MC-LR concentration. These changes in the phycobiliprotein content indicate a shift in the antenna pigments of the cyanobionts of A. filiculoides. The changes in two oxidative stress enzymes, glutathione reductase for the crude extract assay and glutathione peroxidase for MC-LR assay, points towards the induction of stress defense responses. The low bioconcentration factor in both crude extract and MC-LR treatments can suggest the low uptake of microcystins, and indicates that the aquatic fern can be used as a biofertilizer and as animal feed but is not suitable for MC phytoremediation. Copyright © 2015 Elsevier Inc. All rights reserved.

  18. A simple highly sensitive and selective aptamer-based colorimetric sensor for environmental toxins microcystin-LR in water samples.

    Science.gov (United States)

    Li, Xiuyan; Cheng, Ruojie; Shi, Huijie; Tang, Bo; Xiao, Hanshuang; Zhao, Guohua

    2016-03-05

    A simple and highly sensitive aptamer-based colorimetric sensor was developed for selective detection of Microcystin-LR (MC-LR). The aptamer (ABA) was employed as recognition element which could bind MC-LR with high-affinity, while gold nanoparticles (AuNPs) worked as sensing materials whose plasma resonance absorption peaks red shifted upon binding of the targets at a high concentration of sodium chloride. With the addition of MC-LR, the random coil aptamer adsorbed on Au NPs altered into regulated structure to form MC-LR-aptamer complexes and broke away from the surface of Au NPs, leading to the aggregation of AuNPs, and the color converted from red to blue due to the interparticle plasmon coupling. Results showed that our aptamer-based colorimetric sensor exhibited rapid and sensitive detection performance for MC-LR with linear range from 0.5 nM to 7.5 μM and the detection limit reached 0.37 nM. Meanwhile, the pollutants usually coexisting with MC-LR in pollutant water samples had not demonstrated disturbance for detecting of MC-LR. The mechanism was also proposed suggesting that high affinity interaction between aptamer and MC-LR significantly enhanced the sensitivity and selectivity for MC-LR detection. Besides, the established method was utilized in analyzing real water samples and splendid sensitivity and selectivity were obtained as well. Copyright © 2015 Elsevier B.V. All rights reserved.

  19. Microcystin-LR removal from aqueous solutions using a magnetically separable N-doped TiO2 nanocomposite under visible light irradiation

    Science.gov (United States)

    The performance of magnetically separable N-doped TiO2 was found to be significantly improved when compared with a non-magnetic N-doped TiO2 for the aqueous removal of cyanotoxin Microcystin-LR. The observed enhanced photocatalytic activity may be related to the presence of ferri...

  20. Chronic exposure to microcystin-LR affected mitochondrial DNA maintenance and caused pathological changes of lung tissue in mice

    International Nuclear Information System (INIS)

    Li, Xinxiu; Xu, Lizhi; Zhou, Wei; Zhao, Qingya; Wang, Yaping

    2016-01-01

    Microcystin-LR (MC-LR), an important variant of cyanotoxin family, was frequently encountered in the contaminated aquatic environment and taken as a potent hepatotoxin. However, a little was known on the association between the long-term MC-LR exposure and lung damage. In this study, we investigated the changes of the pulmonary histopathology, mitochondrial DNA (mtDNA) integrity and the expression of mtDNA encoded genes in the mice with chronic exposed to MC-LR at different concentrations (1, 5, 10, 20 and 40 μg/L) for 12 months. Our results showed that the long-term and persistent exposure to MC-LR disturbed the balance of redox system, influenced mtDNA stability, changed the expression of mitochondrial genes in the lung cells. Notably, MC-LR exposure influenced the level of inflammatory cytokines and resulted in thickening of the alveolar septa. In conclusion, chronic exposure to MC-LR affected mtDNA maintenance, and caused lung impairment in mice. - Highlights: • A simulated natural exposure to MC-LR caused the lung pathological changes. • The chronic exposure disturbed the redox system balance of lung tissue cells. • The chronic exposure impaired the mtDNA stability and mitochondria function. • The lung was one of the vulnerable organs to MC-LR exposure in mice. - Long-term exposure to MC-LR in drinking water disturbed the balance of redox system, affected mitochondrial DNA maintenance and caused lung impairment in mice.

  1. Detection of the cyanobacterial hepatotoxins microcystins

    International Nuclear Information System (INIS)

    McElhiney, Jacqui; Lawton, Linda A.

    2005-01-01

    Concern regarding the presence of microcystins in drinking water and their possible contamination in food (e.g., salad vegetables, fish, shellfish) has resulted in the need for reliable methods for the detection and accurate quantification of this class of toxins. Currently, routine analysis of microcystins is most commonly carried out using high-performance liquid chromatography with photodiode array detection (HPLC-PDA), although more sensitive biological assays such as antibody-based ELISAs and protein phosphatase inhibition assays have also proven useful. However, many of these methods have been hindered by the availability of a wide range of purified microcystins. Although over 60 variants have now been reported, only a very small number are commercially available and calibrated standards are not yet obtainable. This has led to the common practice of reporting microcystin-LR equivalence regardless of which variant is present. The increased availability of HPLC with online mass spectral analysis (HPLC-MS) may facilitate more accurate detection of toxin variants but as several microcystins share the same molecular mass, definitive identification can be difficult. A further difficulty in analyzing microcystins is the requirement for sample processing before analysis. Solid phase extraction (SPE) is typically used to enrich environmental concentrations of microcystins, or to eliminate contaminants from complex samples such as animal and plant tissues. Recently, new technologies employing recombinant antibodies and molecularly imprinted polymers have been exploited to develop assays and biosensors for microcystins. These novel detection systems are highly sensitive, often do not require sample processing, and offer a simpler, less expensive alternative to analytical techniques. They have also been successfully employed in solid phase extraction formats for the concentration and clean up of environmental samples before HPLC analysis

  2. Estimation of Ion Competition via Correlated Responsivity Offset in Linear Ion Trap Mass Spectrometry Analysis: Theory and Practical Use in the Analysis of Cyanobacterial Hepatotoxin Microcystin-LR in Extracts of Food Additives

    Science.gov (United States)

    Hrouzek, Pavel; Štys, Dalibor; Martens, Harald

    2013-01-01

    Responsivity is a conversion qualification of a measurement device given by the functional dependence between the input and output quantities. A concentration-response-dependent calibration curve represents the most simple experiment for the measurement of responsivity in mass spectrometry. The cyanobacterial hepatotoxin microcystin-LR content in complex biological matrices of food additives was chosen as a model example of a typical problem. The calibration curves for pure microcystin and its mixtures with extracts of green alga and fish meat were reconstructed from the series of measurement. A novel approach for the quantitative estimation of ion competition in ESI is proposed in this paper. We define the correlated responsivity offset in the intensity values using the approximation of minimal correlation given by the matrix to the target mass values of the analyte. The estimation of the matrix influence enables the approximation of the position of a priori unknown responsivity and was easily evaluated using a simple algorithm. The method itself is directly derived from the basic attributes of the theory of measurements. There is sufficient agreement between the theoretical and experimental values. However, some theoretical issues are discussed to avoid misinterpretations and excessive expectations. PMID:23586036

  3. Estimation of Ion Competition via Correlated Responsivity Offset in Linear Ion Trap Mass Spectrometry Analysis: Theory and Practical Use in the Analysis of Cyanobacterial Hepatotoxin Microcystin-LR in Extracts of Food Additives

    Directory of Open Access Journals (Sweden)

    Jan Urban

    2013-01-01

    Full Text Available Responsivity is a conversion qualification of a measurement device given by the functional dependence between the input and output quantities. A concentration-response-dependent calibration curve represents the most simple experiment for the measurement of responsivity in mass spectrometry. The cyanobacterial hepatotoxin microcystin-LR content in complex biological matrices of food additives was chosen as a model example of a typical problem. The calibration curves for pure microcystin and its mixtures with extracts of green alga and fish meat were reconstructed from the series of measurement. A novel approach for the quantitative estimation of ion competition in ESI is proposed in this paper. We define the correlated responsivity offset in the intensity values using the approximation of minimal correlation given by the matrix to the target mass values of the analyte. The estimation of the matrix influence enables the approximation of the position of a priori unknown responsivity and was easily evaluated using a simple algorithm. The method itself is directly derived from the basic attributes of the theory of measurements. There is sufficient agreement between the theoretical and experimental values. However, some theoretical issues are discussed to avoid misinterpretations and excessive expectations.

  4. Estimation of ion competition via correlated responsivity offset in linear ion trap mass spectrometry analysis: theory and practical use in the analysis of cyanobacterial hepatotoxin microcystin-LR in extracts of food additives.

    Science.gov (United States)

    Urban, Jan; Hrouzek, Pavel; Stys, Dalibor; Martens, Harald

    2013-01-01

    Responsivity is a conversion qualification of a measurement device given by the functional dependence between the input and output quantities. A concentration-response-dependent calibration curve represents the most simple experiment for the measurement of responsivity in mass spectrometry. The cyanobacterial hepatotoxin microcystin-LR content in complex biological matrices of food additives was chosen as a model example of a typical problem. The calibration curves for pure microcystin and its mixtures with extracts of green alga and fish meat were reconstructed from the series of measurement. A novel approach for the quantitative estimation of ion competition in ESI is proposed in this paper. We define the correlated responsivity offset in the intensity values using the approximation of minimal correlation given by the matrix to the target mass values of the analyte. The estimation of the matrix influence enables the approximation of the position of a priori unknown responsivity and was easily evaluated using a simple algorithm. The method itself is directly derived from the basic attributes of the theory of measurements. There is sufficient agreement between the theoretical and experimental values. However, some theoretical issues are discussed to avoid misinterpretations and excessive expectations.

  5. Comparative Studies on the pH Dependence of DOW of Microcystin-RR and -LR Using LC-MS

    Directory of Open Access Journals (Sweden)

    Gaodao Liang

    2011-01-01

    Full Text Available Microcystins (MCs are well known worldwide as hepatotoxins produced by cyanobacteria, but little is known about the physicochemical properties of these compounds. The dependence of the n-octanol/water distribution ratio (DOW of MC-RR and -LR to pH was measured by high-performance liquid chromatography combined with mass spectrometry (LC-MS. There was a remarkable difference in such relationships between MC-RR and -LR. The log DOW of MC-LR decreased from 1.63 at pH 1.0 to -1.26 at pH 6.5, and stabilized between -1.04 and -1.56 at a pH of 6.5~12.0; log DOW of MC-RR varied between -1.24 and -0.67 at a pH of 1.00~4.00, and stabilized between -1.20 and -1.54 at a pH of 4.00~12.00. The difference of hydrophobicity in acidic condition between MC-RR and -LR is important, not only for the analytical method of both toxins, but perhaps also for understanding the difference of toxicity to animals between the two toxins.

  6. High performance sulfur, nitrogen and carbon doped mesoporous anatase–brookite TiO2 photocatalyst for the removal of microcystin-LR under visible light irradiation

    International Nuclear Information System (INIS)

    El-Sheikh, Said M.; Zhang, Geshan; El-Hosainy, Hamza M.; Ismail, Adel A.; O'Shea, Kevin E.; Falaras, Polycarpos; Kontos, Athanassios G.; Dionysiou, Dionysios D.

    2014-01-01

    Graphical abstract: - Highlights: • Synthesis of tailor-designed C, N and S doped titania anatase–brookite nano-heterojunction photocatalyst. • Microcystin-LR was completely removed in the presence of doped sample under visible light. • The MC-LR degradation rate achieved by the doped sample was much better than that of un-doped sample under visible light. - Abstract: Carbon, nitrogen and sulfur (C, N and S) doped mesoporous anatase–brookite nano-heterojunction titania photocatalysts have been synthesized through a simple sol–gel method in the presence of triblock copolymer Pluronic P123. XRD and Raman spectra revealed the formation of anatase and brookite mixed phases. XPS spectra indicated the presence of C, N and S dopants. The TEM images demonstrated the formation of almost monodisperse titania nanoparticles with particle sizes of approximately 10 nm. N 2 isotherm measurements confirmed that both doped and undoped titania anatase–brookite materials have mesoporous structure. The photocatalytic degradation of the cyanotoxin microcystin-LR (MC-LR) has been investigated using these novel nanomaterials under visible light illumination. The photocatalytic efficiency of the mesoporous titania anatase–brookite photocatalyst dramatically increased with the addition of the C, N and S non-metal, achieving complete degradation (∼100%) of MC-LR. The results demonstrate the advantages of the synthetic approach and the great potential of the visible light activated C, N, and S doped titania photocatalysts for the treatment of organic micropollutants in contaminated waters under visible light

  7. Analysis of intracellular and extracellular microcystin variants in sediments and pore waters by accelerated solvent extraction and high performance liquid chromatography-tandem mass spectrometry.

    Science.gov (United States)

    Zastepa, Arthur; Pick, Frances R; Blais, Jules M; Saleem, Ammar

    2015-05-04

    The fate and persistence of microcystin cyanotoxins in aquatic ecosystems remains poorly understood in part due to the lack of analytical methods for microcystins in sediments. Existing methods have been limited to the extraction of a few extracellular microcystins of similar chemistry. We developed a single analytical method, consisting of accelerated solvent extraction, hydrophilic-lipophilic balance solid phase extraction, and reversed phase high performance liquid chromatography-tandem mass spectrometry, suitable for the extraction and quantitation of both intracellular and extracellular cyanotoxins in sediments as well as pore waters. Recoveries of nine microcystins, representing the chemical diversity of microcystins, and nodularin (a marine analogue) ranged between 75 and 98% with one, microcystin-RR (MC-RR), at 50%. Chromatographic separation of these analytes was achieved within 7.5 min and the method detection limits were between 1.1 and 2.5 ng g(-1) dry weight (dw). The robustness of the method was demonstrated on sediment cores collected from seven Canadian lakes of diverse geography and trophic states. Individual microcystin variants reached a maximum concentration of 829 ng g(-1) dw on sediment particles and 132 ng mL(-1) in pore waters and could be detected in sediments as deep as 41 cm (>100 years in age). MC-LR, -RR, and -LA were more often detected while MC-YR, -LY, -LF, and -LW were less common. The analytical method enabled us to estimate sediment-pore water distribution coefficients (K(d)), MC-RR had the highest affinity for sediment particles (log K(d)=1.3) while MC-LA had the lowest affinity (log K(d)=-0.4), partitioning mainly into pore waters. Our findings confirm that sediments serve as a reservoir for microcystins but suggest that some variants may diffuse into overlying water thereby constituting a new route of exposure following the dissipation of toxic blooms. The method is well suited to determine the fate and persistence of different

  8. Non-competitive ELISA with broad specificity for microcystins and nodularins

    Directory of Open Access Journals (Sweden)

    Sultana Akter

    2017-05-01

    Full Text Available Simple and cost-effective methods with sufficient sensitivities for preliminary screening of cyanobacterial toxins are in high demand for assessing water quality and safety. We have recently developed a highly sensitive and rapid time-resolved fluorometry based non-competitive immunoassay for detection of microcystins and nodularins. The assay is based on a synthetic broad-specific anti-immunocomplex antibody SA51D1 capable of recognizing the immunocomplex formed by a generic anti-Adda monoclonal antibody (mAb bound to either microcystins or nodularins. Using the same antibody pair, here we describe a very simple and cost-efficient non-competitive ELISA test for microcystins and nodularins based on conventional alkaline phosphatase (AP activity measurement. The recombinant SA51D1 single-chain fragment of antibody variable domain (scFv was produced as a fusion with bacterial alkaline phosphatase in Escherichia coli. After one step affinity purification through His-tag, the scFv-AP fusion protein could directly be used in the assay. For the assay, toxin standard/sample, biotinylated anti-Adda mAb and the scFv-AP were incubated together for one hour on streptavidin-coated microtiter wells, washed and AP activity was then measured by incubating (1 h at 37 ˚C with chromogenic substrate para-nitrophenylphosphate (pNPP. The assay was capable of detecting all the eleven tested toxin variants (microcystin-LR, -dmLR, -RR, -dmRR, -YR, LA -LY, -LF -LW, -WR, and nodularin-R below WHO guide line value of 1 µg L-1. The detection limit (based on blank+3SD response for microcystin-LR was ~0.2 µg L-1. The assay was verified using spiked (0.25 - 4 µg L-1 of microcystin-LR tap, river and lake water samples with recoveries from 64 to 101%. The assay showed good correlation (r2>0.9 with four reference methods for its performance in detecting extracted intracellular microcystin/nodularin from 17 natural surface water samples. The described easy-to-perform assay

  9. The interactive effects of microcystin-LR and cylindrospermopsin on the growth rate of the freshwater algae Chlorella vulgaris.

    Science.gov (United States)

    Pinheiro, Carlos; Azevedo, Joana; Campos, Alexandre; Vasconcelos, Vítor; Loureiro, Susana

    2016-05-01

    Microcystin-LR (MC-LR) and cylindrospermopsin (CYN) are the most representative cyanobacterial cyanotoxins. They have been simultaneously detected in aquatic systems, but their combined ecotoxicological effects to aquatic organisms, especially microalgae, is unknown. In this study, we examined the effects of these cyanotoxins individually and as a binary mixture on the growth rate of the freshwater algae Chlorella vulgaris. Using the MIXTOX tool, the reference model concentration addition (CA) was selected to evaluate the combined effects of MC-LR and CYN on the growth of the freshwater green algae due to its conservative prediction of mixture effect for putative similar or dissimilar acting chemicals. Deviations from the CA model such as synergism/antagonism, dose-ratio and dose-level dependency were also assessed. In single exposures, our results demonstrated that MC-LR and CYN had different impacts on the growth rates of C. vulgaris at the highest tested concentrations, being CYN the most toxic. In the mixture exposure trial, MC-LR and CYN showed a synergistic deviation from the conceptual model CA as the best descriptive model. MC-LR individually was not toxic even at high concentrations (37 mg L(-1)); however, the presence of MC-LR at much lower concentrations (0.4-16.7 mg L(-1)) increased the CYN toxicity. From these results, the combined exposure of MC-LR and CYN should be considered for risk assessment of mixtures as the toxicity may be underestimated when looking only at the single cyanotoxins and not their combination. This study also represents an important step to understand the interactions among MC-LR and CYN detected previously in aquatic systems.

  10. Oxidação de microcistinas-LR em águas pelo íon ferrato(VI Aqueous oxidation of microcystin-LR by ferrate(VI

    Directory of Open Access Journals (Sweden)

    Sérgio João de Luca

    2010-03-01

    Full Text Available Toxinas de cianobactérias têm se tornado um grave problema na produção segura de água para consumo humano e animal. Técnicas convencionais de tratamento falham em atingir padrões de potabilidade. O ferrato(VI de potássio, um composto oxidante e coagulante, mostra potencialidade no tratamento de águas contaminadas. Neste trabalho, são apresentados resultados da oxidação pelo ferrato(VI de uma toxina gerada por cianobactérias, a microcistina-LR. Ensaios de cinética de oxidação e de teste de jarros mostram um valor médio de 0,012 min-1 para a constante de taxa de reação de pseudoprimeira ordem, para concentrações de MC-LR de 100 a 200 µg.L-1 na água bruta. Dosagens de 1,6 a 5,0 mg.L-1 de ferrato(VI sugerem o atendimento ao padrão de potabilidade para microcistinas, mostrando que o oxidante poderá ser empregado como coadjuvante no tratamento de água.Algae toxins are becoming a severe problem in the water treatment industry, especially for human and animal consumption. Traditional treatment processes have failed in complying with water supply standards. Potassium ferrate(VI is a powerful oxidant, disinfectant and, also, a coagulant. In this paper, the results of microcystin-LR oxidation by ferrate(VI ion are presented. Kinetic and jar tests showed a average value of 0,012 min-1 for the pseudo first order reaction rate constant, for 100 and 200 µg.L-1 concentration of MC-LR. Ferrate(VI dosages between 1.6 and 5.0 mg.L-1 suggest that water supply standards for MC-LR can be reached, which means that the oxidant may be employed as coadjuvant in water treatment.

  11. A pM leveled photoelectrochemical sensor for microcystin-LR based on surface molecularly imprinted TiO2@CNTs nanostructure.

    Science.gov (United States)

    Liu, Meichuan; Ding, Xue; Yang, Qiwei; Wang, Yu; Zhao, Guohua; Yang, Nianjun

    2017-06-05

    A simple and highly sensitive photoelectrochemical (PEC) sensor towards Microcystin-LR (MC-LR), a kind of typical cyanobacterial toxin in water samples, was developed on a surface molecular imprinted TiO 2 coated multiwalled carbon nanotubes (MI-TiO 2 @CNTs) hybrid nanostructure. It was synthesized using a feasible two-step sol-gel method combining with in situ surface molecular imprinting technique (MIT). With a controllable core-shell tube casing structure, the resultant MI-TiO 2 @CNTs are enhanced greatly in visible-light driven response capacity. In comparison with the traditional TiO 2 (P25) and non-imprinted (NI-)TiO 2 @CNTs, the MI-TiO 2 @CNTs based PEC sensor showed a much higher photoelectric oxidation capacity towards MC-LR. Using this sensor, the determination of MC-LR was doable in a wide linear range from 1.0pM to 3.0nM with a high photocurrent response sensitivity. An outstanding selectivity towards MC-LR was further achieved with this sensor, proven by simultaneously monitoring 100-fold potential co-existing interferences. The superiority of the obtained MC-LR sensor in sensitivity and selectivity is mainly attributed to the high specific surface area and excellent photoelectric activity of TiO 2 @CNTs heterojunction structure, as well as the abundant active recognition sites on its functionalized molecular imprinting surface. A promising PEC analysis platform with high sensitivity and selectivity for MC-LR has thus been provided. Copyright © 2017 Elsevier B.V. All rights reserved.

  12. Electrochemical Aptatoxisensor Responses on Nanocomposites Containing Electro-Deposited Silver Nanoparticles on Poly(Propyleneimine Dendrimer for the Detection of Microcystin-LR in Freshwater

    Directory of Open Access Journals (Sweden)

    Mawethu P. Bilibana

    2016-11-01

    Full Text Available A sensitive and reagentless electrochemical aptatoxisensor was developed on cobalt (II salicylaldiimine metallodendrimer (SDD–Co(II doped with electro-synthesized silver nanoparticles (AgNPs for microcystin-LR (L, l-leucine; R, l-arginine, or MC-LR, detection in the nanomolar range. The GCE|SDD–Co(II|AgNPs aptatoxisensor was fabricated with 5’ thiolated aptamer through self-assembly on the modified surface of the glassy carbon electrode (GCE and the electronic response was measured using cyclic voltammetry (CV. Specific binding of MC-LR with the aptamer on GCE|SDD–Co(II|AgNPs aptatoxisensor caused the formation of a complex that resulted in steric hindrance and electrostatic repulsion culminating in variation of the corresponding peak current of the electrochemical probe. The aptatoxisensor showed a linear response for MC-LR between 0.1 and 1.1 µg·L−1 and the calculated limit of detection (LOD was 0.04 µg·L−1. In the detection of MC-LR in water samples, the aptatoxisensor proved to be highly sensitive and stable, performed well in the presence of interfering analog and was comparable to the conventional analytical techniques. The results demonstrate that the constructed MC-LR aptatoxisensor is a suitable device for routine quantification of MC-LR in freshwater and environmental samples.

  13. Detection of trace microcystin-LR on a 20 MHz QCM sensor coated with in situ self-assembled MIPs.

    Science.gov (United States)

    He, Hao; Zhou, Lianqun; Wang, Yi; Li, Chuanyu; Yao, Jia; Zhang, Wei; Zhang, Qingwen; Li, Mingyu; Li, Haiwen; Dong, Wen-fei

    2015-01-01

    A 20 MHz quartz crystal microbalance (QCM) sensor coated with in situ self-assembled molecularly imprinted polymers (MIPs) was presented for the detection of trace microcystin-LR (MC-LR) in drinking water. The sensor performance obtained using the in situ self-assembled MIPs was compared with traditionally synthesized MIPs on 20 MHz and normal 10 MHz QCM chip. The results show that the response increases by more than 60% when using the in situ self-assembly method compared using the traditionally method while the 20 MHz QCM chip provides four-fold higher response than the 10 MHz one. Therefore, the in situ self-assembled MIPs coated on a high frequency QCM chip was used in the sensor performance test to detect MC-LR in tap water. It showed a limit of detection (LOD) of 0.04 nM which is lower than the safety guideline level (1 nM MC-LR) of drinking water in China. The low sensor response to other analogs indicated the high specificity of the sensor to MC-LR. The sensor showed high stability and low signal variation less than 2.58% after regeneration. The lake water sample analysis shows the sensor is possible for practical use. The combination of the higher frequency QCM with the in situ self-assembled MIPs provides a good candidate for the detection of other small molecules. Copyright © 2014 Elsevier B.V. All rights reserved.

  14. Microcystin-LR nanobody screening from an alpaca phage display nanobody library and its expression and application.

    Science.gov (United States)

    Xu, Chongxin; Yang, Ying; Liu, Liwen; Li, Jianhong; Liu, Xiaoqin; Zhang, Xiao; Liu, Yuan; Zhang, Cunzheng; Liu, Xianjin

    2018-04-30

    Microcystin-LR (MC-LR) is a type of biotoxin that pollutes the ecological environment and food. The study aimed to obtain new nanobodies from phage nanobody library for determination of MC-LR. The toxin was conjugated to keyhole limpet haemocyanin (KLH) and bovine serum albumin (BSA), respectively, then the conjugates were used as coated antigens for enrichment (coated MC-LR-KLH) and screening (coated MC-LR-BSA) of MC-LR phage nanobodies from an alpaca phage display nanobody library. The antigen-specific phage particles were enriched effectively with four rounds of biopanning. At the last round of enrichment, total 20 positive monoclonal phage nanobodies were obtained from the library, which were analyzed after monoclonal phage enzyme linked immunosorbent assay (ELISA), colony PCR and DNA sequencing. The most three positive nanobody genes, ANAb12, ANAb9 and ANAb7 were cloned into pET26b vector, then the nanobodies were expressed in Escherichia coli BL21 respectively. After being purified, the molecular weight (M.W.) of all nanobodies were approximate 15kDa with sodium dodecyl sulfate polyacrylamide gel electrophoresis (SDS-PAGE). The purified nanobodies, ANAb12, ANAb9 and ANAb7 were used to establish the indirect competitive ELISA (IC-ELISA) for MC-LR, and their half-maximum inhibition concentrations (IC 50 ) were 0.87, 1.17 and 1.47μg/L, their detection limits (IC 10 ) were 0.06, 0.08 and 0.12μg/L, respectively. All of them showed strong cross-reactivity (CRs) of 82.7-116.9% for MC-RR, MC-YR and MC-WR, and weak CRs of less than 4.56% for MC-LW, less than 0.1% for MC-LY and MC-LF. It was found that all the IC-ELISAs for MC-LR spiked in tap water samples detection were with good accuracy, stability and repeatability, their recoveries were 84.0-106.5%, coefficient of variations (CVs) were 3.4-10.6%. These results showed that IC-ELISA based on the nanobodies from the alpaca phage display antibody library were promising for high sensitive determination of multiple

  15. Cell density dependence of Microcystis aeruginosa responses to copper algaecide concentrations: Implications for microcystin-LR release.

    Science.gov (United States)

    Kinley, Ciera M; Iwinski, Kyla J; Hendrikse, Maas; Geer, Tyler D; Rodgers, John H

    2017-11-01

    Along with mechanistic models, predictions of exposure-response relationships for copper are often derived from laboratory toxicity experiments with standardized experimental exposures and conditions. For predictions of copper toxicity to algae, cell density is a critical factor often overlooked. For pulse exposures of copper-based algaecides in aquatic systems, cell density can significantly influence copper sorbed by the algal population, and consequent responses. A cyanobacterium, Microcystis aeruginosa, was exposed to a copper-based algaecide over a range of cell densities to model the density-dependence of exposures, and effects on microcystin-LR (MC-LR) release. Copper exposure concentrations were arrayed to result in a gradient of MC-LR release, and masses of copper sorbed to algal populations were measured following exposures. While copper exposure concentrations eliciting comparable MC-LR release ranged an order of magnitude (24-h EC50s 0.03-0.3mg Cu/L) among cell densities of 10 6 through 10 7 cells/mL, copper doses (mg Cu/mg algae) were similar (24-h EC50s 0.005-0.006mg Cu/mg algae). Comparisons of MC-LR release as a function of copper exposure concentrations and doses provided a metric of the density dependence of algal responses in the context of copper-based algaecide applications. Combined with estimates of other site-specific factors (e.g. water characteristics) and fate processes (e.g. dilution and dispersion, sorption to organic matter and sediments), measuring exposure-response relationships for specific cell densities can refine predictions for in situ exposures and algal responses. These measurements can in turn decrease the likelihood of amending unnecessary copper concentrations to aquatic systems, and minimize risks for non-target aquatic organisms. Copyright © 2017 Elsevier Inc. All rights reserved.

  16. Intraperitoneal exposure of whitefish to microcystin-LR induces rapid liver injury followed by regeneration and resilience to subsequent exposures

    International Nuclear Information System (INIS)

    Woźny, Maciej; Lewczuk, Bogdan; Ziółkowska, Natalia; Gomułka, Piotr; Dobosz, Stefan; Łakomiak, Alicja; Florczyk, Maciej; Brzuzan, Paweł

    2016-01-01

    To date, there has been no systematic approach comprehensively describing the sequence of pathological changes in fish during prolonged exposure to microcystin-LR (MC-LR). Towards this aim, juvenile whitefish individuals received an intraperitoneal injection with pure MC-LR, and the injection was repeated every week to maintain continuous exposure for 28 days. During the exposure period, growth and condition of the fish were assessed based on biometric measurements. Additionally, selected biochemical markers were analysed in the fishes' blood, and their livers were carefully examined for morphological, ultrastructural, and molecular changes. The higher dose of MC-LR (100 μg·kg −1 ) caused severe liver injury at the beginning of the exposure period, whereas the lower dose (10 μg·kg −1 ) caused less, probably reversible injury, and its effects began to be observed later in the exposure period. These marked changes were accompanied by substantial MC-LR uptake by the liver. However, starting on the 7th day of exposure, cell debris began to be removed by phagocytes, then by 14th day, proliferation of liver cells had markedly increased, which led to reconstruction of the liver parenchyma at the end of the treatment. Surprisingly, despite weekly-repeated intraperitoneal injections, MC-LR did not accumulate over time of exposure which suggests its limited uptake in the later phase of exposure. In support, mRNA expression of the membrane transport protein oatp1d was decreased at the same time as the regenerative processes were observed. Our study shows that closing of active membrane transport may serve as one defence mechanism against further MC-LR intoxication. - Highlights: • The study presents pathological changes in whitefish during prolonged MC-LR exposure. • After early, severe injury, the damaged liver parenchyma of the fish regenerated. • Endoplasmic reticulum, cytoskeleton, and chromatin were the main targets for MC-LR. • MC-LR did not

  17. Ecological risk assessment of microcystin-LR in the upstream section of the Haihe River based on a species sensitivity distribution model.

    Science.gov (United States)

    Niu, Zhiguang; Du, Lei; Li, Jiafu; Zhang, Ying; Lv, Zhiwei

    2018-02-01

    The eutrophication of surface water has been the main problem of water quality management in recent decades, and the ecological risk of microcystin-LR (MC-LR), which is the by-product of eutrophication, has drawn more attention worldwide. The aims of our study were to determine the predicted no effect concentration (PNEC) of MC-LR and to assess the ecological risk of MC-LR in the upstream section of the Haihe River. HC 5 (hazardous concentration for 5% of biological species) and PNEC were obtained from a species sensitivity distribution (SSD) model, which was constructed with the acute toxicity data of MC-LR on aquatic organisms. The concentrations of MC-LR in the upstream section of the Haihe River from April to August of 2015 were analysed, and the ecological risk characteristics of MC-LR were evaluated based on the SSD model. The results showed that the HC 5 of MC-LR in freshwater was 17.18 μg/L and PNEC was 5.73 μg/L. The concentrations of MC-LR ranged from 0.68 μg/L to 32.21 μg/L and were obviously higher in summer than in spring. The values of the risk quotient (RQ) ranged from 0.12 to 5.62, suggesting that the risk of MC-LR for aquatic organisms in the river was at a medium or high level during the study period. Compared with other waterbodies in the world, the pollution level of MC-LR in the Haihe River was at a moderate level. This research could promote the study of the ecological risk of MC-LR at the ecosystem level. Copyright © 2017 Elsevier Ltd. All rights reserved.

  18. A comprehensive immunoassay for the detection of microcystins in waters based on polyclonal antibodies

    International Nuclear Information System (INIS)

    Sheng Jianwu; He Miao; Shi Hanchang; Qian Yi

    2006-01-01

    Microcystins (MCs) are a group of closely related toxic cyclic heptapeptides produced by common cyanobacteria (blue-green algae), and microcystin-leucine-arginine (MC-LR) is among the most frequent and most toxic microcystin congeners. In this study, a free amino group was introduced to MC-LR at its seventh amino acid residue with 2-mercaptoethylamine, and the product aminoethyl-MC-LR was coupled to bovine serum albumin (BSA) and horseradish peroxidise (HRP) by glutaraldehyde to be complete antigen (MC-LR-BSA) and labelled hapten (MC-LR-HRP), respectively. Polyclonal antibodies against MC-LR were generated by immunization with MC-LR-BSA. A direct competitive enzyme-linked immunosorbent assay (dc-ELISA) was established to detect the MCs in waters, which showed a good cross-reactivity with MC-LR, MC-RR, MC-YR, MC-LF, MC-LW and nodularin, and have a detection limit for MC-LR 0.12 μg L -1 , the 50% inhibition concentration (IC 50 ) for MC-LR was 0.63 ± 0.06 μg L -1 and the quantitative detection range was from 0.17 to 2.32 μg L -1 , the analysis result of water samples showed good recovery and reliability. So the comprehensive and reliable dc-ELISA will well potentially suit for sensitive analysis for total MCs in drinking as well as resource water samples

  19. Degradation mechanisms of Microcystin-LR during UV-B photolysis and UV/H2O2 processes: Byproducts and pathways.

    Science.gov (United States)

    Moon, Bo-Ram; Kim, Tae-Kyoung; Kim, Moon-Kyung; Choi, Jaewon; Zoh, Kyung-Duk

    2017-10-01

    The removal and degradation pathways of microcystin-LR (MC-LR, [M+H] +  = 995.6) in UV-B photolysis and UV-B/H 2 O 2 processes were examined using liquid chromatography-tandem mass spectrometry. The UV/H 2 O 2 process was more efficient than UV-B photolysis for MC-LR removal. Eight by-products were newly identified in the UV-B photolysis ([M+H] +  = 414.3, 417.3, 709.6, 428.9, 608.6, 847.5, 807.4, and 823.6), and eleven by-products were identified in the UV-B/H 2 O 2 process ([M+H] +  = 707.4, 414.7, 429.3, 445.3, 608.6, 1052.0, 313.4, 823.6, 357.3, 245.2, and 805.7). Most of the MC-LR by-products had lower [M+H] + values than the MC-LR itself during both processes, except for the [M+H] + value of 1052.0 during UV-B photolysis. Based on identified by-products and peak area patterns, we proposed potential degradation pathways during the two processes. Bond cleavage and intramolecular electron rearrangement by electron pair in the nitrogen atom were the major reactions during UV-B photolysis and UV-B/H 2 O 2 processes, and hydroxylation by OH radical and the adduct formation reaction between the produced by-products were identified as additional pathways during the UV-B/H 2 O 2 process. Meanwhile, the degradation by-products identified from MC-LR during UV-B/H 2 O 2 process can be further degraded by increasing H 2 O 2 dose. Copyright © 2017 Elsevier Ltd. All rights reserved.

  20. Microcystin production in epiphytic cyanobacteria on submerged macrophytes.

    Science.gov (United States)

    Mohamed, Zakaria A; Al Shehri, Abdulrahman M

    2010-06-15

    Cyanotoxins have been largely studied in planktonic and benthic cyanobacteria, but microcystin (MCYST) production in epiphytic cyanobacteria has not been reported yet. The present study reports for the first time the MCYST production in epiphytic cyanobacteria on submerged macrophytes. During this study, four common submerged macrophytes in eutrophic pond in Saudi Arabia were surveyed for the presence of toxic epiphytic cyanobacteria. The results showed that chlorophyll-a and total biovolume of epiphytic cyanobacteria differed significantly among submerged plants with highest values obtained in Stratiotes aloides and lowest in Elodea canadensis. Epiphytic materials collected from Ceratophyllum demersum and S. aloides had higher species diversities than materials collected from E. canadensis and Myriophyllum verticillatum. The cyanobacteria, Merismopedia tenuissima and Leptolyngbya boryana were recorded with a high abundance in epiphytic materials collected from all submerged macrohpytes. Based on Enzyme-linked immunosorbent assay (ELISA), these two species were found to produce MCYSTs (MCYSTs) with concentrations of 1438 and 630 microg g(-1) dry weight, respectively. HPLC analysis of the methanolic extracts of the two species showed that M. tenuissima extract contained MCYST-RR and -LR/demethyl LR plus 3 minor unidentified MCYSTs, while L. boryana extract contained MCYST-YR, -LR/demethyl LR, and 2 minor unidentified MCYSTs. This study suggests that epiphytic species should be considered during monitoring of toxic cyanobacteria in water sources. 2010 Elsevier Ltd. All rights reserved.

  1. Associations between chlorophyll a and various microcystin-LR health advisory concentrations [version 1; referees: 1 approved, 2 approved with reservations

    Directory of Open Access Journals (Sweden)

    Jeffrey W. Hollister

    2016-02-01

    Full Text Available Cyanobacteria harmful algal blooms (cHABs are associated with a wide range of adverse health effects that stem mostly from the presence of cyanotoxins. To help protect against these impacts, several health advisory levels have been set for some toxins. In particular, one of the more common toxins, microcystin-LR, has several advisory levels set for drinking water and recreational use. However, compared to other water quality measures, field measurements of microcystin-LR are not commonly available due to cost and advanced understanding required to interpret results. Addressing these issues will take time and resources. Thus, there is utility in finding indicators of microcystin-LR that are already widely available, can be estimated quickly and in situ, and used as a first defense against high concentrations of microcystin-LR. Chlorophyll a is commonly measured, can be estimated in situ, and has been shown to be positively associated with microcystin-LR. In this paper, we use this association to provide estimates of chlorophyll a concentrations that are indicative of a higher probability of exceeding select health advisory concentrations for microcystin-LR. Using the 2007 National Lakes Assessment and a conditional probability approach, we identify chlorophyll a concentrations that are more likely than not to be associated with an exceedance of a microcystin-LR health advisory level. We look at the recent US EPA health advisories for drinking water as well as the World Health Organization levels for drinking water and recreational use and identify a range of chlorophyll a thresholds. A 50% chance of exceeding one of the microcystin-LR advisory concentrations of 0.3, 1, 1.6, and 2 g/L is associated with chlorophyll a concentration thresholds of 23.4, 67.0, 83.5, and 105.8, respectively. When managing for these various microcystin-LR levels, exceeding these reported chlorophyll a concentrations should be a trigger for

  2. Discovery of Rare and Highly Toxic Microcystins from Lichen-Associated Cyanobacterium Nostoc sp. Strain IO-102-I

    Science.gov (United States)

    Oksanen, Ilona; Jokela, Jouni; Fewer, David P.; Wahlsten, Matti; Rikkinen, Jouko; Sivonen, Kaarina

    2004-01-01

    The production of hepatotoxic cyclic heptapeptides, microcystins, is almost exclusively reported from planktonic cyanobacteria. Here we show that a terrestrial cyanobacterium Nostoc sp. strain IO-102-I isolated from a lichen association produces six different microcystins. Microcystins were identified with liquid chromatography-UV mass spectrometry by their retention times, UV spectra, mass fragmentation, and comparison to microcystins from the aquatic Nostoc sp. strain 152. The dominant microcystin produced by Nostoc sp. strain IO-102-I was the highly toxic [ADMAdda5]microcystin-LR, which accounted for ca. 80% of the total microcystins. We assigned a structure of [DMAdda5]microcystin-LR and [d-Asp3,ADMAdda5]microcystin-LR and a partial structure of three new [ADMAdda5]-XR type of microcystin variants. Interestingly, Nostoc spp. strains IO-102-I and 152 synthesized only the rare ADMAdda and DMAdda subfamilies of microcystin variants. Phylogenetic analyses demonstrated congruence between genes involved directly in microcystin biosynthesis and the 16S rRNA and rpoC1 genes of Nostoc sp. strain IO-102-I. Nostoc sp. strain 152 and the Nostoc sp. strain IO-102-I are distantly related, revealing a sporadic distribution of toxin production in the genus Nostoc. Nostoc sp. strain IO-102-I is closely related to Nostoc punctiforme PCC 73102 and other symbiotic Nostoc strains and most likely belongs to this species. Together, this suggests that other terrestrial and aquatic strains of the genus Nostoc may have retained the genes necessary for microcystin biosynthesis. PMID:15466511

  3. Intraperitoneal exposure of whitefish to microcystin-LR induces rapid liver injury followed by regeneration and resilience to subsequent exposures

    Energy Technology Data Exchange (ETDEWEB)

    Woźny, Maciej, E-mail: maciej.wozny@uwm.edu.pl [Department of Environmental Biotechnology, Faculty of Environmental Sciences, University of Warmia and Mazury in Olsztyn, ul. Słoneczna 45G, 10-709 Olsztyn (Poland); Lewczuk, Bogdan; Ziółkowska, Natalia [Department of Histology and Embryology, Faculty of Veterinary Medicine, University of Warmia and Mazury in Olsztyn, ul. M. Oczapowskiego 13, 10-713 Olsztyn (Poland); Gomułka, Piotr [Department of Ichthyology, Faculty of Environmental Sciences, University of Warmia and Mazury in Olsztyn, ul. M. Oczapowskiego 5, 10-719 Olsztyn (Poland); Dobosz, Stefan [Department of the Salmonid Research in Rutki, Inland Fisheries Institute in Olsztyn, Rutki, 83-330 Żukowo (Poland); Łakomiak, Alicja; Florczyk, Maciej; Brzuzan, Paweł [Department of Environmental Biotechnology, Faculty of Environmental Sciences, University of Warmia and Mazury in Olsztyn, ul. Słoneczna 45G, 10-709 Olsztyn (Poland)

    2016-12-15

    To date, there has been no systematic approach comprehensively describing the sequence of pathological changes in fish during prolonged exposure to microcystin-LR (MC-LR). Towards this aim, juvenile whitefish individuals received an intraperitoneal injection with pure MC-LR, and the injection was repeated every week to maintain continuous exposure for 28 days. During the exposure period, growth and condition of the fish were assessed based on biometric measurements. Additionally, selected biochemical markers were analysed in the fishes' blood, and their livers were carefully examined for morphological, ultrastructural, and molecular changes. The higher dose of MC-LR (100 μg·kg{sup −1}) caused severe liver injury at the beginning of the exposure period, whereas the lower dose (10 μg·kg{sup −1}) caused less, probably reversible injury, and its effects began to be observed later in the exposure period. These marked changes were accompanied by substantial MC-LR uptake by the liver. However, starting on the 7th day of exposure, cell debris began to be removed by phagocytes, then by 14th day, proliferation of liver cells had markedly increased, which led to reconstruction of the liver parenchyma at the end of the treatment. Surprisingly, despite weekly-repeated intraperitoneal injections, MC-LR did not accumulate over time of exposure which suggests its limited uptake in the later phase of exposure. In support, mRNA expression of the membrane transport protein oatp1d was decreased at the same time as the regenerative processes were observed. Our study shows that closing of active membrane transport may serve as one defence mechanism against further MC-LR intoxication. - Highlights: • The study presents pathological changes in whitefish during prolonged MC-LR exposure. • After early, severe injury, the damaged liver parenchyma of the fish regenerated. • Endoplasmic reticulum, cytoskeleton, and chromatin were the main targets for MC-LR. • MC-LR did not

  4. Impacts of microcystin, a cyanobacterial toxin, on laboratory rodents in vivo

    Directory of Open Access Journals (Sweden)

    Andrea Ziková

    2008-01-01

    Full Text Available Cyanobacterial water blooms became a global problem/issue because beside a dramatic deterioration of water quality parameters they also produce cyanobacterial toxins being harmful for animals and humans. Cyanotoxins especially the most prominent one, microcystin-LR (MC-LR, are of major concern and they have been reported to cause even death of mammals following ingestion or ingurgitation due to hepatotoxic modes of action. The aim of the recent study is to summarize briefly the impacts of microcystin on laboratory rodents, mice and rats, being used as models for other mammals including human beings. Most experimental approaches used intraperitoneal rather than oral and intratracheal application of microcystins, especially MC-LR, being the most efficient way to induce adverse impacts on different target organs. However, no matter how the exposure of rodents was performed, microcystins induced severe harmful impacts on the different target organs, preferentially the liver, for instances hemorrhages and apoptosis in liver, liver tumours, adverse effects on gut, kidney, testis and epididymis including spermatogenesis, on lung, on serum parameters and on progeny. In addition to these histological findings, microcystin was found to affect specifically biochemical parameters of target organs such as enzymes e.g. GST, CAT, GR, GPX, SOD, AST, ALT, γ-GT, protein phosphatases, SDH, SoDH and LDH or stress proteins such as HSP-70 and further parameters such as hepatic sulfhydryl content, GSH depletion, total bilirubin, urea nitrogen, and creatinine. Gene array analyses revealed that microcystin affects genes related to actin organization, cell cycle, apoptosis, cellular redox potential, cell signalling, albumin metabolism, glucose homeostasis pathway and organic anion transport polypeptide system. In combination with a further proteomics approach the proteomic analyses indicate that liver apoptosis induced by microcystin can be induced by two pathways: the

  5. Photocatalytic degradation and mineralization of microcystin-LR under UV-A, solar and visible light using nanostructured nitrogen doped TiO2

    International Nuclear Information System (INIS)

    Triantis, T.M.; Fotiou, T.; Kaloudis, T.; Kontos, A.G.; Falaras, P.; Dionysiou, D.D.; Pelaez, M.; Hiskia, A.

    2012-01-01

    Highlights: ► N-TiO 2 exhibited effective degradation of MC-LR under UV-A, solar and visible light. ► Complete photocatalytic mineralization of MC-LR was achieved under UV-A and solar light. ► The organic nitrogen is mainly released as ammonium and nitrate ions. - Abstract: In an attempt to face serious environmental hazards, the degradation of microcystin-LR (MC-LR), one of the most common and more toxic water soluble cyanotoxin compounds released by cyanobacteria blooms, was investigated using nitrogen doped TiO 2 (N-TiO 2 ) photocatalyst, under UV-A, solar and visible light. Commercial Degussa P25 TiO 2 , Kronos and reference TiO 2 nanopowders were used for comparison. It was found that under UV-A irradiation, all photocatalysts were effective in toxin elimination. The higher MC-LR degradation (99%) was observed with Degussa P25 TiO 2 followed by N-TiO 2 with 96% toxin destruction after 20 min of illumination. Under solar light illumination, N-TiO 2 nanocatalyst exhibits similar photocatalytic activity with that of commercially available materials such as Degussa P25 and Kronos TiO 2 for the destruction of MC-LR. Upon irradiation with visible light Degussa P25 practically did not show any response, while the N-TiO 2 displayed remarkable photocatalytic efficiency. In addition, it has been shown that photodegradation products did not present any significant protein phosphatase inhibition activity, proving that toxicity is proportional only to the remaining MC-LR in solution. Finally, total organic carbon (TOC) and inorganic ions (NO 2 − , NO 3 − and NH 4 + ) determinations confirmed that complete photocatalytic mineralization of MC-LR was achieved under both UV-A and solar light.

  6. Tissue distributions and seasonal dynamics of the hepatotoxic microcystins-LR and -RR in a freshwater snail (Bellamya aeruginosa) from a large shallow, eutrophic lake of the subtropical China

    International Nuclear Information System (INIS)

    Chen Jun; Xie Ping; Guo Longgen; Zheng Li; Ni Leyi

    2005-01-01

    Tissue distributions and seasonal dynamics of the hepatotoxic microcystins-LR and -RR in a freshwater snail (Bellamya aeruginosa) were studied monthly in a large shallow, eutrophic lake of the subtropical China during June-November, 2003. Microcystins (MCs) were quantitatively determined by High-Performance Liquid Chromatography (HPLC) with a qualitative analysis by a Finnigan LC-MS system. On the average of the study period, hepatopancreas was the highest in MC contents (mean 4.14 and range 1.06-7.42 μg g -1 DW), followed by digestive tracts (mean 1.69 and range 0.8-4.54 μg g -1 DW) and gonad (mean 0.715 and range 0-2.62 μg g -1 DW), whereas foot was the least (mean 0.01 and range 0-0.06 μg g -1 DW). There was a positive correlation in MC contents between digestive tracts and hepatopancreas. A constantly higher MC content in hepatopancreas than in digestive tracts indicates a substantial bioaccumulation of MCs in the hepatopancreas of the snail. The average ratio of MC-LR/MC-RR showed a steady increase from digestive tracts (0.44) to hepatopancreas (0.63) and to gonad (0.96), suggesting that MC-LR was more resistant to degradation in the snail. Since most MCs were present in the hepatopancreas, digestive tracts and gonad with only a very small amount in the edible foot, the risk to human health may not be significant if these toxic parts are removed prior to snail consumption. However, the possible transference of toxins along food chains should not be a negligible concern. - Snails bioaccumulate microcystins in their hepatopancreas, gut and gonad, posing a risk to human consumers

  7. Liquid chromatography/negative electrospray ionization ion trap MS(2) mass spectrometry application for the determination of microcystins occurrence in Southern Portugal water reservoirs.

    Science.gov (United States)

    Rodrigues, M A; Reis, M P; Mateus, M C

    2013-11-01

    Microcystins (MCs) are toxins produced by cyanobacteria which are common organisms in the phytoplankton of eutrophic lakes, rivers and freshwater reservoirs. In the present work, a novel method of liquid chromatography-electrospray ion trap tandem mass spectrometry (LC/ESI/Ion trap-MS/MS), operated in the negative ionization mode, was developed for the analysis of these cyanotoxins. The method was applied to determine the amounts of total microcystins-LR, -YR and -RR in two water reservoirs in Southern Portugal, namely Alqueva and Beliche. A total of 30 water samples were analysed along 2011. Solid phase extraction (SPE) was used for sample cleaning-up and analyte enrichment. The extracted toxins were separated on a C18 column with a gradient of acetonitrile/water with 0.1% formic acid. Detection of microcystins was carried out using multiple reaction monitoring (MRM) in the negative polarity mode, as this method gave a higher selectivity. The MC-RR, YR and LR quantification limits were 17.9, 31.7 and 15.8 ng/L, respectively; quite below the limits recommended by WHO guidelines for drinking water (1 μg/L). Total MC highest concentrations were found in the warm months of June, July and September in Alqueva sampling sites, with concentrations of MC LR and RR ranging 17-344 and 25-212 ng/L, respectively, showing comparable results for MC-RR and LR and slightly lower concentration of MC-YR. Detected values for Beliche reservoir were below quantification limits. Copyright © 2013 Elsevier Ltd. All rights reserved.

  8. Photocatalytic degradation and mineralization of microcystin-LR under UV-A, solar and visible light using nanostructured nitrogen doped TiO{sub 2}

    Energy Technology Data Exchange (ETDEWEB)

    Triantis, T.M.; Fotiou, T. [Laboratory of Catalytic - Photocatalytic Processes (Solar Energy - Environment), Institute of Physical Chemistry, National Center for Scientific Research ' Demokritos' , Neapoleos 25, 15310 Agia Paraskevi, Attiki (Greece); Kaloudis, T. [Organic Micropollutants Laboratory, Athens Water Supply and Sewerage Company (EYDAP SA), WTP Aharnon, Menidi (Greece); Kontos, A.G.; Falaras, P. [Laboratory of Photo-redox Conversion and Storage of Solar Energy, Institute of Physical Chemistry, National Center for Scientific Research ' Demokritos' , Neapoleos 25, 15310 Agia Paraskevi, Attiki (Greece); Dionysiou, D.D.; Pelaez, M. [Environmental Engineering and Science Program, School of Energy, Environmental, Biological and Medical Engineering, University of Cincinnati, OH 45221-0012 (United States); Hiskia, A., E-mail: hiskia@chem.demokritos.gr [Laboratory of Catalytic - Photocatalytic Processes (Solar Energy - Environment), Institute of Physical Chemistry, National Center for Scientific Research ' Demokritos' , Neapoleos 25, 15310 Agia Paraskevi, Attiki (Greece)

    2012-04-15

    Highlights: Black-Right-Pointing-Pointer N-TiO{sub 2} exhibited effective degradation of MC-LR under UV-A, solar and visible light. Black-Right-Pointing-Pointer Complete photocatalytic mineralization of MC-LR was achieved under UV-A and solar light. Black-Right-Pointing-Pointer The organic nitrogen is mainly released as ammonium and nitrate ions. - Abstract: In an attempt to face serious environmental hazards, the degradation of microcystin-LR (MC-LR), one of the most common and more toxic water soluble cyanotoxin compounds released by cyanobacteria blooms, was investigated using nitrogen doped TiO{sub 2} (N-TiO{sub 2}) photocatalyst, under UV-A, solar and visible light. Commercial Degussa P25 TiO{sub 2}, Kronos and reference TiO{sub 2} nanopowders were used for comparison. It was found that under UV-A irradiation, all photocatalysts were effective in toxin elimination. The higher MC-LR degradation (99%) was observed with Degussa P25 TiO{sub 2} followed by N-TiO{sub 2} with 96% toxin destruction after 20 min of illumination. Under solar light illumination, N-TiO{sub 2} nanocatalyst exhibits similar photocatalytic activity with that of commercially available materials such as Degussa P25 and Kronos TiO{sub 2} for the destruction of MC-LR. Upon irradiation with visible light Degussa P25 practically did not show any response, while the N-TiO{sub 2} displayed remarkable photocatalytic efficiency. In addition, it has been shown that photodegradation products did not present any significant protein phosphatase inhibition activity, proving that toxicity is proportional only to the remaining MC-LR in solution. Finally, total organic carbon (TOC) and inorganic ions (NO{sub 2}{sup -}, NO{sub 3}{sup -} and NH{sub 4}{sup +}) determinations confirmed that complete photocatalytic mineralization of MC-LR was achieved under both UV-A and solar light.

  9. Microcystin-LR and Cylindrospermopsin Induced Alterations in Chromatin Organization of Plant Cells

    Science.gov (United States)

    Máthé, Csaba; M-Hamvas, Márta; Vasas, Gábor

    2013-01-01

    Cyanobacteria produce metabolites with diverse bioactivities, structures and pharmacological properties. The effects of microcystins (MCYs), a family of peptide type protein-phosphatase inhibitors and cylindrospermopsin (CYN), an alkaloid type of protein synthesis blocker will be discussed in this review. We are focusing mainly on cyanotoxin-induced changes of chromatin organization and their possible cellular mechanisms. The particularities of plant cells explain the importance of such studies. Preprophase bands (PPBs) are premitotic cytoskeletal structures important in the determination of plant cell division plane. Phragmoplasts are cytoskeletal structures involved in plant cytokinesis. Both cyanotoxins induce the formation of multipolar spindles and disrupted phragmoplasts, leading to abnormal sister chromatid segregation during mitosis. Thus, MCY and CYN are probably inducing alterations of chromosome number. MCY induces programmed cell death: chromatin condensation, nucleus fragmentation, necrosis, alterations of nuclease and protease enzyme activities and patterns. The above effects may be related to elevated reactive oxygen species (ROS) and/or disfunctioning of microtubule associated proteins. Specific effects: MCY-LR induces histone H3 hyperphosphorylation leading to incomplete chromatid segregation and the formation of micronuclei. CYN induces the formation of split or double PPB directly related to protein synthesis inhibition. Cyanotoxins are powerful tools in the study of plant cell organization. PMID:24084787

  10. Microcystin-LR and Cylindrospermopsin Induced Alterations in Chromatin Organization of Plant Cells

    Directory of Open Access Journals (Sweden)

    Gábor Vasas

    2013-09-01

    Full Text Available Cyanobacteria produce metabolites with diverse bioactivities, structures and pharmacological properties. The effects of microcystins (MCYs, a family of peptide type protein-phosphatase inhibitors and cylindrospermopsin (CYN, an alkaloid type of protein synthesis blocker will be discussed in this review. We are focusing mainly on cyanotoxin-induced changes of chromatin organization and their possible cellular mechanisms. The particularities of plant cells explain the importance of such studies. Preprophase bands (PPBs are premitotic cytoskeletal structures important in the determination of plant cell division plane. Phragmoplasts are cytoskeletal structures involved in plant cytokinesis. Both cyanotoxins induce the formation of multipolar spindles and disrupted phragmoplasts, leading to abnormal sister chromatid segregation during mitosis. Thus, MCY and CYN are probably inducing alterations of chromosome number. MCY induces programmed cell death: chromatin condensation, nucleus fragmentation, necrosis, alterations of nuclease and protease enzyme activities and patterns. The above effects may be related to elevated reactive oxygen species (ROS and/or disfunctioning of microtubule associated proteins. Specific effects: MCY-LR induces histone H3 hyperphosphorylation leading to incomplete chromatid segregation and the formation of micronuclei. CYN induces the formation of split or double PPB directly related to protein synthesis inhibition. Cyanotoxins are powerful tools in the study of plant cell organization.

  11. Allelopathic effects of microcystin-LR on the germination, growth and metabolism of five charophyte species and a submerged angiosperm.

    Science.gov (United States)

    Rojo, Carmen; Segura, Matilde; Cortés, Francisco; Rodrigo, María A

    2013-11-15

    Microcystins (MCs) are produced by cyanobacteria in aquatic environments and adversely affect macrophytes at very high concentrations. However, the effects of MC on macrophytes at concentrations of environmental relevance are largely unknown. The main objective of this study was to analyze the allelopathic effects of MC-LR at natural concentrations (1, 8 and 16 μg MC-LR/L) on five charophyte species (Chara aspera, C. baltica, C. hispida, C. vulgaris and Nitella hyalina) and the angiosperm Myriophyllum spicatum. Macrophyte specimens were obtained from a restored area located in Albufera de València Natural Park, a protected coastal Mediterranean wetland. Two different experiments were conducted involving (i) the addition of MC-LR to natural sediment to evaluate its effects on seed germination and (ii) the addition of MC-LR to water cultures of macrophytes to evaluate its effects on growth and metabolic functions. In water, the MC-LR concentration decreased by 84% in two weeks; the loss was not significant in sediment. The first seedlings (all C. hispida) emerged from the wetland sediment following a delay of a few days in the presence of MC-LR. The germination rates in 8 and 16 μg MC-LR/L treatments were 44% and 11% of that occurring in the absence of MC, but these differences disappeared over time. The final density was 6-7 germlings/dm(3). Final germling length was unaffected by MC-LR. Rotifers (Lecane spp.) emerging from the natural sediment during the experiment were favored by MC-LR; the opposite pattern was observed in the cladoceran Daphnia magna. The growth rates of C. vulgaris, C. baltica and N. hyalina were unaffected by MC exposure, whereas those of C. hispida and C. aspera were reduced in the MC treatments relative to the control treatment. The concentration of chlorophyll-a and the in vivo net photosynthetic rate were lower in the presence of MC-LR, even at the lowest concentration, for all of the characeans tested. M. spicatum was sensitive to the

  12. Microcystin-LR exposure induces developmental neurotoxicity in zebrafish embryo

    International Nuclear Information System (INIS)

    Wu, Qin; Yan, Wei; Liu, Chunsheng; Li, Li; Yu, Liqin; Zhao, Sujuan; Li, Guangyu

    2016-01-01

    Microcystin-LR (MCLR) is a commonly acting potent hepatotoxin and has been pointed out of potentially causing developmental neurotoxicity, but the exact mechanism is little known. In this study, zebrafish embryos were exposed to 0, 0.8, 1.6 or 3.2 mg/L MCLR for 120 h. MCLR exposure through submersion caused serious hatching delay and body length decrease. The content of MCLR in zebrafish larvae was analyzed and the results demonstrated that MCLR can accumulate in zebrafish larvae. The locomotor speed of zebrafish larvae was decreased. Furthermore, the dopamine and acetylcholine (ACh) content were detected to be significantly decreased in MCLR exposure groups. And the acetylcholinesterase (AChE) activity was significantly increased after exposure to 1.6 and 3.2 mg/L MCLR. The transcription pattern of manf, chrnα7 and ache gene was consistent with the change of the dopamine content, ACh content and AChE activity. Gene expression involved in the development of neurons was also measured. α1-tubulin and shha gene expression were down-regulated, whereas mbp and gap43 gene expression were observed to be significantly up-regulated upon exposure to MCLR. The above results indicated that MCLR-induced developmental toxicity might attribute to the disorder of cholinergic system, dopaminergic signaling, and the development of neurons. - Highlights: • MCLR accumulation induces developmental neurotoxicity in zebrafish embryo. • The decrease of dopamine levels might be associated with the MCLR-induced developmental neurotoxicity in zebrafish larvae. • The alternation of cholinergic system might contribute to the change of neurobehavior in zebrafish larvae exposure with MCLR. - MCLR accumulation induces developmental neurotoxicity by affecting cholinergic system, dopaminergic signaling, and the development of neurons in zebrafish embryo.

  13. Characteristics of competitive uptake between Microcystin-LR and natural organic matter (NOM) fractions using strongly basic anion exchange resins.

    Science.gov (United States)

    Dixit, Fuhar; Barbeau, Benoit; Mohseni, Madjid

    2018-03-29

    Microcystins are the most commonly occurring cyanotoxins, and have been extensively studied across the globe. In the present study, a strongly basic anion exchange resin was employed to investigate the removal of Microcystin-LR (MCLR), one of the most toxic microcystin variants. Factors influencing the uptake behavior included the MCLR and resin concentrations, resin dosage, and natural organic matter (NOM) characteristics, specifically, the charge density and molecular weight distribution of source water NOM. Equivalent background concentration (EBC) was employed to evaluate the competitive uptake between NOM and MCLR. The experimental data were compared with different mathematical and physical models and pore diffusion was determined as the rate-limiting step. The resin dose/solute concentration ratio played a key role in the MCLR uptake process and MCLR removal was attributed primarily to electrostatic attractions. Charge density and molecular weight distribution of the background NOM fractions played a major role in MCLR removal at lower resin dosages (200 mg/L ∼ 1 mL/L and below), where a competitive uptake was observed due to the limited exchange sites. Further, evidences of pore blockage and site reduction were also observed in the presence of humics and larger molecular weight organic fractions, where a four-fold reduction in the MCLR uptake was observed. Comparable results were obtained for laboratory studies on synthetic laboratory water and surface water under similar conditions. Given their excellent performance and low cost, anion exchange resins are expected to present promising potentials for applications involving the removal of removal of algal toxins and NOM from surface waters. Copyright © 2018 Elsevier Ltd. All rights reserved.

  14. Pulsed nitrogen supply induces dynamic changes in the amino acid compositionand microcystin production of the harmful cyanobacterium Planktothrix agardhii

    NARCIS (Netherlands)

    Van de Waal, D.B.; Ferreruela, G.; Tonk, L.; Van Donk, E.; Huisman, J.; Visser, P.M.; Matthijs, H.C.P.

    2010-01-01

    Planktothrix agardhii is a widespread harmful cyanobacterium of eutrophic waters, and can produce the hepatotoxins [Asp3]microcystin-LR and [Asp3]microcystin-RR. These two microcystin variants differ in their first variable amino acid position, which is occupied by either leucine (L) or arginine

  15. Effects of microcystins contamination on soil enzyme activities and microbial community in two typical lakeside soils.

    Science.gov (United States)

    Cao, Qing; Steinman, Alan D; Su, Xiaomei; Xie, Liqiang

    2017-12-01

    A 30-day indoor incubation experiment was conducted to investigate the effects of different concentrations of microcystin (1, 10, 100 and 1000 μg eq. MC-LR L -1 ) on soil enzyme activity, soil respiration, physiological profiles, potential nitrification, and microbial abundance (total bacteria, total fungi, ammonia-oxidizing bacteria and archaea) in two lakeside soils in China (Soil A from the lakeside of Lake Poyanghu at Jiujiang; Soil B from the lakeside of Lake Taihu at Suzhou). Of the enzymes tested, only phenol oxidase activity was negatively affected by microcystin application. In contrast, dehydrogenase activity was stimulated in the 1000 μg treatment, and a stimulatory effect also occurred with soil respiration in contaminated soil. The metabolic profiles of the microbial communities indicated that overall carbon metabolic activity in the soils treated with high microcystin concentrations was inhibited, and high concentrations of microcystin also led to different patterns of potential carbon utilization. High microcystin concentrations (100, 1000 μg eq. MC-LR L -1 in Soil A; 10, 100 1000 μg eq. MC-LR L -1 in Soil B) significantly decreased soil potential nitrification rate. Furthermore, the decrease in soil potential nitrification rate was positively correlated with the decrease of the amoA gene abundance, which corresponds to the ammonia-oxidizing bacterial community. We conclude that application of microcystin-enriched irrigation water can significantly impact soil microbial community structure and function. Copyright © 2017 Elsevier Ltd. All rights reserved.

  16. Pulsed nitrogen supply induces dynamic changes in the amino acid composition and microcystin production of the harmful cyanobacterium Planktothrix agardhii

    NARCIS (Netherlands)

    van de Waal, D.B.; Ferreruela, G.; Tonk, L.; van Donk, E.; Huisman, J.; Visser, P.M.; Matthijs, H.C.P.

    2010-01-01

    Planktothrix agardhii is a widespread harmful cyanobacterium of eutrophic waters, and can produce the hepatotoxins [Asp3]microcystin-LR and [Asp3]microcystin-RR. These two microcystin variants differ in their first variable amino acid position, which is occupied by either leucine (L) or arginine

  17. Microbial activity and bacterial community structure during degradation of microcystins

    DEFF Research Database (Denmark)

    Christoffersen, K.; Lyck, Susanne; Winding, A.

    2002-01-01

    experiments were analysed by polymerase chain reaction-density gradient gel electrophoresis (PCR-DGGE) of 16S rDNA, which showed that the indigenous bacterial community responded quickly to the addition of lysates. Our study confirms that bacteria can efficiently degrade microcystins in natural waters....... It was hypothesised that the bacterial community from a lake with frequent occurrence of toxic cyanobacteria can degrade microcystin along with other organic compounds. The initial dissolved microcystin concentrations ranged between 10 and 136 mug 1(-1) (microcystin-LR equivalents) in the laboratory experiment, using...... experiment to evaluate the effects of organic lysates on bacterial proliferation in the absence of microcystin. An exponential decline of the dissolved toxins was observed in all cases with toxins present, and the degradation rates ranged between 0.5 and 1.0 d(-1). No lag phases were observed but slow...

  18. Determination of six microcystins and nodularin in surface and drinking waters by on-line solid phase extraction-ultra high pressure liquid chromatography tandem mass spectrometry.

    Science.gov (United States)

    Beltrán, Eduardo; Ibáñez, María; Sancho, Juan Vicente; Hernández, Félix

    2012-11-30

    Microcystins and nodularin are cyclic peptides hepatotoxins produced by cyanobacterial genera (blue-green algae). Toxic cyanobacterial blooms are a worldwide problem, as reported in several countries, like China, Australia, or the United States. Therefore, it is necessary to develop sensitive and reliable analytical methodology to determine this type of toxins in water at parts per billion levels, or even lower. In this work, the potential of solid-phase extraction coupled on-line to ultra-high-pressure liquid chromatography/electrospray tandem mass spectrometry (SPE-UHPLC-MS/MS) has been investigated for the efficient quantification and confirmation of microcystins LR, RR, YR, LY, LW, LF and nodularin in surface and drinking water samples, at sub-ppb levels. The method developed involves the injection of only 1 mL of water sample into the on-line SPE-UHPLC-MS/MS system and allows the rapid determination of the compounds selected (8 min of chromatographic run), avoiding laborious sample treatment. The method was validated in surface and drinking water by means of recovery experiments at 0.25 and 1 μg L(-1). Average recoveries (n=5) ranged from 71 to 116%, with relative standard deviations (RSDs) lower than 15%. For microcystins LR, RR, YR and nodularin, a third level was also assayed (0.1 μg L(-1)) obtaining satisfactory data too. Limits of detection between 0.002 and 0.0405 μg L(-1) were estimated (0.0005 μg L(-1) for nodularin). The developed method was applied to the analysis of water samples collected in the province of Castellón (Spain). The acquisition of three MS/MS transitions for each compound allowed the unequivocal confirmation of positive samples, which was supported by the accomplishment of ion intensity ratios and retention time when compared with reference standards. Copyright © 2012 Elsevier B.V. All rights reserved.

  19. Ultra-trace levels analysis of microcystins and nodularin in surface water by on-line solid-phase extraction with high-performance liquid chromatography tandem mass spectrometry.

    Science.gov (United States)

    Balest, Lydia; Murgolo, Sapia; Sciancalepore, Lucia; Montemurro, Patrizia; Abis, Pier Paolo; Pastore, Carlo; Mascolo, Giuseppe

    2016-06-01

    An on-line solid phase extraction coupled with high-performance liquid chromatography in tandem with mass spectrometry (on-line SPE/HPLC/MS-MS) method for the determination of five microcystins and nodularin in surface waters at submicrogram per liter concentrations has been optimized. Maximum recoveries were achieved by carefully optimizing the extraction sample volume, loading solvent, wash solvent, and pH of the sample. The developed method was also validated according to both UNI EN ISO IEC 17025 and UNICHIM guidelines. Specifically, ten analytical runs were performed at three different concentration levels using a reference mix solution containing the six analytes. The method was applied for monitoring the concentrations of microcystins and nodularin in real surface water during a sampling campaign of 9 months in which the ELISA method was used as standard official method. The results of the two methods were compared showing good agreement when the highest concentration values of MCs were found. Graphical abstract An on-line SPE/HPLC/MS-MS method for the determination of five microcystins and nodularin in surface waters at sub μg L(-1) was optimized and compared with ELISA assay method for real samples.

  20. Development of a rapid and sensitive battery of bioassays for risk assessment of cyanobacterial microcystin-LR in drinking water of rural water treatment plants, South Africa

    CSIR Research Space (South Africa)

    Oberholster, Paul J

    2009-09-01

    Full Text Available minor and Lemna gibba are the most commonly tested species used in numerous studies in first world countries as indi- cator macrophyte species (Marwood et al., 2001). No clear trend exists to the relative sensitivities of the dif- ferent duckweed..., Gu KD, Lam PKA, Yang M, Fong WF (2000). Study on the cytotoxicity of microcystin-LR on cultured cells. Chemosphere, 41: 143-147. Cowgill UM, Milazzo DP, Landenberger BD (1991). The sensitivity of Lemma gibba G-3 and four clones of Lemna minor...

  1. Bioreactor Study Employing Bacteria with Enhanced Activity toward Cyanobacterial Toxins Microcystins

    Directory of Open Access Journals (Sweden)

    Dariusz Dziga

    2014-08-01

    Full Text Available An important aim of white (grey biotechnology is bioremediation, where microbes are employed to remove unwanted chemicals. Microcystins (MCs and other cyanobacterial toxins are not industrial or agricultural pollutants; however, their occurrence as a consequence of human activity and water reservoir eutrophication is regarded as anthropogenic. Microbial degradation of microcystins is suggested as an alternative to chemical and physical methods of their elimination. This paper describes a possible technique of the practical application of the biodegradation process. The idea relies on the utilization of bacteria with a significantly enhanced MC-degradation ability (in comparison with wild strains. The cells of an Escherichia coli laboratory strain expressing microcystinase (MlrA responsible for the detoxification of MCs were immobilized in alginate beads. The degradation potency of the tested bioreactors was monitored by HPLC detection of linear microcystin LR (MC-LR as the MlrA degradation product. An open system based on a column filled with alginate-entrapped cells was shown to operate more efficiently than a closed system (alginate beads shaken in a glass container. The maximal degradation rate calculated per one liter of carrier was 219.9 µg h−1 of degraded MC-LR. A comparison of the efficiency of the described system with other biological and chemo-physical proposals suggests that this new idea presents several advantages and is worth investigating in future studies.

  2. Detection of freshwater cyanotoxins and measurement of masked microcystins in tilapia from Southeast Asian aquaculture farms.

    Science.gov (United States)

    Greer, Brett; Maul, Ronald; Campbell, Katrina; Elliott, Christopher T

    2017-06-01

    Recently, there has been a rise in freshwater harmful algal blooms (HABs) globally, as well as increasing aquaculture practices. HABs can produce cyanotoxins, many of which are hepatotoxins. An ultra-performance liquid chromatography tandem mass spectrometry method was developed and validated for nine cyanotoxins across three classes including six microcystins, nodularin, cylindrospermopsin and anatoxin-a. The method was used to analyse free cyanotoxin(s) in muscle (n = 34), liver (n = 17) and egg (n = 9) tissue samples of 34 fish sourced from aquaculture farms in Southeast Asia. Conjugated microcystin was analysed by Lemieux oxidation to ascertain the total amount of microcystin present in muscle. Some tilapia accumulated free microcystin-LR in the muscle tissue at a mean of 15.45 μg/kg dry weight (dw), with total microcystin levels detected at a mean level of 110.1 μg/kg dw, indicating that the amount of conjugated or masked microcystin present in the fish muscle accounted for 85% of the total. Higher levels of cyanotoxin were detected in the livers, with approximately 60% of those tested being positive for microcystin-LR and microcystin-LF, along with cylindrospermopsin. Two fish from one of the aquaculture farms contained cylindrospermopsin in the eggs; the first time this has been reported. The estimated daily intake for free and total microcystins in fish muscle tissue was 2 and 14 times higher, respectively, than the tolerable daily intake value. This survey presents the requirement for further monitoring of cyanotoxins, including masked microcystins, in aquaculture farming in these regions and beyond, along with the implementation of guidelines to safeguard human health. Graphical abstract ᅟ.

  3. Lettuce (Lactuca sativa L.) leaf-proteome profiles after exposure to cylindrospermopsin and a microcystin-LR/cylindrospermopsin mixture: a concentration-dependent response.

    Science.gov (United States)

    Freitas, Marisa; Campos, Alexandre; Azevedo, Joana; Barreiro, Aldo; Planchon, Sébastien; Renaut, Jenny; Vasconcelos, Vitor

    2015-02-01

    The intensification of agricultural productivity is an important challenge worldwide. However, environmental stressors can provide challenges to this intensification. The progressive occurrence of the cyanotoxins cylindrospermopsin (CYN) and microcystin-LR (MC-LR) as a potential consequence of eutrophication and climate change is of increasing concern in the agricultural sector because it has been reported that these cyanotoxins exert harmful effects in crop plants. A proteomic-based approach has been shown to be a suitable tool for the detection and identification of the primary responses of organisms exposed to cyanotoxins. The aim of this study was to compare the leaf-proteome profiles of lettuce plants exposed to environmentally relevant concentrations of CYN and a MC-LR/CYN mixture. Lettuce plants were exposed to 1, 10, and 100 μg/l CYN and a MC-LR/CYN mixture for five days. The proteins of lettuce leaves were separated by two-dimensional electrophoresis (2-DE), and those that were differentially abundant were then identified by matrix-assisted laser desorption/ionization time of flight-mass spectrometry (MALDI-TOF/TOF MS). The biological functions of the proteins that were most represented in both experiments were photosynthesis and carbon metabolism and stress/defense response. Proteins involved in protein synthesis and signal transduction were also highly observed in the MC-LR/CYN experiment. Although distinct protein abundance patterns were observed in both experiments, the effects appear to be concentration-dependent, and the effects of the mixture were clearly stronger than those of CYN alone. The obtained results highlight the putative tolerance of lettuce to CYN at concentrations up to 100 μg/l. Furthermore, the combination of CYN with MC-LR at low concentrations (1 μg/l) stimulated a significant increase in the fresh weight (fr. wt) of lettuce leaves and at the proteomic level resulted in the increase in abundance of a high number of proteins. In

  4. Growth and microcystin production of a Brazilian Microcystis aeruginosa strain (LTPNA 02 under different nutrient conditions

    Directory of Open Access Journals (Sweden)

    Stella Bortoli

    Full Text Available Cyanobacteria are prokaryotic and photosynthetic organisms, which can produce a wide range of bioactive compounds with different properties; including a variety of toxic compounds, also known as cyanotoxins. In this work, we describe the isolation of seven cyanobacterial strains from two reservoirs in São Paulo State, Brazil. Seven different chemical variants of microcystins (MC-RR, MC-LR, MC-YR, MC-LF, MC-LW, and two demethylated variants, dm-MC-RR and dm-MC-LR were detected in three of the ten isolated strains. One particular Microcystis aeruginosa strain (LTPNA 02 was chosen to evaluate its growth by cell count, and its toxin production under seven different nutritional regimes. We observed different growth behaviors in the logarithmic growth period for only three experiments (p < 0.05. The total growth analysis identified four experiments as different from the control (p < 0.01. Three microcystin variants (MC-RR, MC-LR and MC-YR were quantified by liquid chromatography-tandem mass spectrometry. At the experimental end, the toxin content was unchanged when comparing cell growth in ASM-1 (N:P = 1, MLA and BG-11 (N:P = 10 medium. In all other experiments, the lowest microcystin production was observed from cells grown in Bold 3N medium during the exponential growth phase. The highest microcystin content was observed in cultures using BG-11(N:P = 100 medium.

  5. Activity and Transcriptional Responses of Hepatopancreatic Biotransformation and Antioxidant Enzymes in the Oriental River Prawn Macrobrachium nipponense Exposed to Microcystin-LR

    Directory of Open Access Journals (Sweden)

    Julin Yuan

    2015-10-01

    Full Text Available Microcystins (MCs are a major group of cyanotoxins with side effects in many organisms; thus, compounds in this group are recognized as potent stressors and health hazards in aquatic ecosystems. In order to assess the toxicity of MCs and detoxification mechanism of freshwater shrimp Macrobrachium nipponense, the full-length cDNAs of the glutathione S-transferase (gst and catalase (cat genes were isolated from the hepatopancreas. The transcription level and activity changes in the biotransformation enzyme (glutathione S-transferase (GST and antioxidant enzymes (superoxide dismutase (SOD, catalase (CAT, glutathione peroxidase (GPx in the hepatopancreas of M. nipponense exposed to MC-LR (0.2, 1, 5, and 25 μg/L for 12, 24, 72 and 96 h were analyzed. The results showed that the isolated full-length cDNAs of cat and gst genes from M. nipponense displayed a high similarity to other crustaceans, and their mRNAs were mainly expressed in the hepatopancreas. MC-LR caused significant increase of GST activity following 48–96 h (p < 0.05 and an increase in SOD activity especially in 24- and 48-h exposures. CAT activity was activated when exposed to MC-LR in 12-, 24- and 48-h exposures and then it was inhibited at 96-h exposure. There was no significant effect on GPx activity after the 12- and 24-h exposures, whereas it was significantly stimulated after the 72- and 96-h exposures (p < 0.05. The transcription was altered similarly to enzyme activity, but the transcriptional response was generally more immediate and had greater amplitude than enzymatic response, particularly for GST. All of the results suggested that MC-LR can induce antioxidative modulation variations in M. nipponense hepatopancreas in order to eliminate oxidative damage.

  6. Protein phosphatase 2A inhibition and subsequent cytoskeleton reorganization contributes to cell migration caused by microcystin-LR in human laryngeal epithelial cells (Hep-2).

    Science.gov (United States)

    Wang, Beilei; Liu, Jinghui; Huang, Pu; Xu, Kailun; Wang, Hanying; Wang, Xiaofeng; Guo, Zonglou; Xu, Lihong

    2017-03-01

    The major toxic mechanism of Microcystin-LR is inhibition of the activity of protein phosphatase 2A (PP2A), resulting in a series of cytotoxic effects. Our previous studies have demonstrated that microcystin-LR (MCLR) induced very different molecular effects in normal cells and the tumor cell line SMMC7721. To further explore the MCLR toxicity mechanism in tumor cells, human laryngeal epithelial cells (Hep-2) was examined in this study. Western blot, immunofluorescence, immunoprecipitation, and transwell migration assay were used to detect the effects of MCLR on PP2A activity, PP2A substrates, cytoskeleton, and cell migration. The results showed that the protein level of PP2A subunits and the posttranslational modification of the catalytic subunit were altered and that the binding of the AC core enzyme as well as the binding of PP2A/C and α4, was also affected. As PP2A substrates, the phosphorylation of MAPK pathway members, p38, ERK1/2, and the cytoskeleton-associated proteins, Hsp27, VASP, Tau, and Ezrin were increased. Furthermore, MCLR induced reorganization of the cytoskeleton and promoted cell migration. Taken together, direct covalent binding to PP2A/C, alteration of the protein levels and posttranslational modification, as well as the binding of subunits, are the main pattern for the effects of MCLR on PP2A in Hep-2. A dose-dependent change in p-Tau and p-Ezrin due to PP2A inhibition may contribute to the changes in the cytoskeleton and be related to the cell migration in Hep-2. Our data provide a comprehensive exposition of the MCLR mechanism on tumor cells. © 2016 Wiley Periodicals, Inc. Environ Toxicol 32: 890-903, 2017. © 2016 Wiley Periodicals, Inc.

  7. First report of an Anabaena Bory strain containing microcystin-LR in ...

    African Journals Online (AJOL)

    In South Africa, little is known about the production of microcystin by the genus Anabaena Bory. In April 2012, during a cyanobacterial bloom event in Theewaterskloof Dam, Western Cape province, the plankton was sampled on 10 occasions. The dominant algae belonged to the genus Anabaena, a family of filamentous ...

  8. Toxicoproteomic approach to develop biomakers for microcystins using Medaka fish

    International Nuclear Information System (INIS)

    Mezhoud, Karim; Daniele, Praseuth; Simone, Puiseaux-Daol; Jean, Christophe

    2008-01-01

    Microcystins (MCs) are hepato toxins with a potent inhibitor activity of protein phosphatases P P1 and PP2A. These non-ribosomal peptides are getting more and more attention due to their acute toxicity and potent tumor-promoting activity. These toxins are produced by freshwater cyanobacteria. we report a toxicological study conducted on aquatic animal models such as the medaka fish. to date, the detailed mechanisms underlying the toxicity of microcystins are unknown. MC-leucine-arginine (MC-LR) is the most toxic and the most commonly encountered variant of MCs in aquatic environment. it has been used for toxicological investigations on the liver of intoxicated medeka. We performed differential proteome analyses of MC-LR - treated and untreated medaka fish in order to investigate the mechanisms of establishment of early responses to the toxin. The identification of proteins involved in these early responses might constitute candidates as bio markers of MC-LR exposure. Cytosolic proteins from livers of exposed or non-exposed medaka were resolved by 2D electrophoresis and detected using stains specific for phosphoproteins and for whole proteinaceous content. Overall, phosphoproteomic 2D maps. Of these 15 proteins, only two could not be identified by mass spectrometry. Among the other identified proteins, phenylalanine hydroxylase and keratin 18 (type I) showed variations in phosphoryl content in agreement with inhibition of PP2A activity after exposure of the fish to MC-LR. The other identified proteins exhibited variations in their expression level. The identified proteins appear to be involved in cytoskeleton assembly, cell signalling, oxidative w tress and apoptosis. The functional implications of responses to MC-LR exposure of these proteins are discussed. The methodology described in this report should be widely generalizable to a number of tissues and organisms, thus helping in the search for bio markers of MC-LR contamination

  9. Microcystis aeruginos strain [D-Leu1] Mcyst-LR producer, from Buenos Aires province, Argentina

    Directory of Open Access Journals (Sweden)

    Lorena Rosso

    2014-04-01

    Full Text Available Objective: To show the toxicological and phylogenetic characterization of a native Microcystis aeruginosa (M. aeruginosa strain (named CAAT 2005-3 isolated from a water body of Buenos Aires province, Argentine. Methods: A M. aeruginosa strain was isolated from the drainage canal of the sewage treatment in the town of Pila, Buenos Aires province, Argentina and acclimated to laboratory conditions. The amplification of cpcBA-IGS Phcocyanin (PC, intergenic spacer and flanking regions was carried out in order to build a phylogenetic tree. An exactive/orbitrap mass spectrometer equipped with an electrospray ionization source (Thermo Fisher Scientific, Bremen, Germany was used for the LC/ESI-HRMS microcystins analysis. The number of cell/mL and [D-Leu1] Mcyst-LR production obtained as a function of time was modelled using the Gompertz equation. Results: The phylogenetic analysis showed that the sequence clustered with others M. aeruginosa sequences obtained from NCBI. The first Argentinian strain of M. aeruginosa (CAAT 2005-3 growing under culture conditions maintains the typical colonial architecture of M. aeruginosa with profuse mucilage. M. aeruginosa CAAT 2005-3 expresses a toxin variant, that was identified by LC-HRMS/Orbitrapas as [D-Leu1] microcystin-LR ([M+H]+=1 037.8 m/z. Conclusions: [D-Leu1] microcystin-LR has been also detected in M. aeruginosa samples from Canada, Brazil and Argentina. This work provides the basis for technological development and production of analytical standards of toxins present in our region.

  10. Production of a broad specificity antibody for the development and validation of an optical SPR screening method for free and intracellular microcystins and nodularin in cyanobacteria cultures.

    Science.gov (United States)

    Devlin, Shauna; Meneely, Julie P; Greer, Brett; Campbell, Katrina; Vasconcelos, Vitor; Elliott, Christopher T

    2014-05-01

    A highly sensitive broad specificity monoclonal antibody was produced and characterised for microcystin detection through the development of a rapid surface plasmon resonance (SPR) optical biosensor based immunoassay. The antibody displayed the following cross-reactivity: MC-LR 100%; MC-RR 108%; MC-YR 68%; MC-LA 69%; MC-LW 71%; MC-LF 68%; and Nodularin 94%. Microcystin-LR was covalently attached to a CM5 chip and with the monoclonal antibody was employed in a competitive 4 min injection assay to detect total microcystins in water samples below the WHO recommended limit (1 µg/L). A 'total microcystin' level was determined by measuring free and intracellular concentrations in cyanobacterial culture samples as this toxin is an endotoxin. Glass bead beating was used to lyse the cells as a rapid extraction procedure. This method was validated according to European Commission Decision 96/23/EC criteria. The method was proven to measure intracellular microcystin levels, the main source of the toxin, which often goes undetected by other analytical procedures and is advantageous in that it can be used for the monitoring of blooms to provide an early warning of toxicity. It was shown to be repeatable and reproducible, with recoveries from spiked samples ranging from 74 to 123%, and had % CVs below 10% for intra-assay analysis and 15% for inter-assay analysis. The detection capability of the assay was calculated as 0.5 ng/mL for extracellular toxins and 0.05 ng/mL for intracellular microcystins. A comparison of the SPR method with LC-MS/MS was achieved by testing six Microcystis aeruginosa cultures and this study yielded a correlation R(2) value of 0.9989. Copyright © 2014 Elsevier B.V. All rights reserved.

  11. Inhibition of Microcystis aeruginosa and microcystin- LR with one ...

    African Journals Online (AJOL)

    Yomi

    2State Key Laboratory of Urban Water Resource and Environment, Harbin Institute of Technology, Harbin 150001,. China. ... industrial wastewater and domestic sewage. One of the .... LR detected by high performance liquid chromatography.

  12. Acute Exposure to Microcystin-Producing Cyanobacterium Microcystis aeruginosa Alters Adult Zebrafish (Danio rerio Swimming Performance Parameters

    Directory of Open Access Journals (Sweden)

    Luiza Wilges Kist

    2011-01-01

    Full Text Available Microcystins (MCs are toxins produced by cyanobacteria (blue-green algae, primarily Microcystis aeruginosa, forming water blooms worldwide. When an organism is exposed to environmental perturbations, alterations in normal behavioral patterns occur. Behavioral repertoire represents the consequence of a diversity of physiological and biochemical alterations. In this study, we assessed behavioral patterns and whole-body cortisol levels of adult zebrafish (Danio rerio exposed to cell culture of the microcystin-producing cyanobacterium M. aeruginosa (MC-LR, strain RST9501. MC-LR exposure (100 μg/L decreased by 63% the distance traveled and increased threefold the immobility time when compared to the control group. Interestingly, no significant alterations in the number of line crossings were found at the same MC-LR concentration and time of exposure. When animals were exposed to 50 and 100 μg/L, MC-LR promoted a significant increase (around 93% in the time spent in the bottom portion of the tank, suggesting an anxiogenic effect. The results also showed that none of the MC-LR concentrations tested promoted significant alterations in absolute turn angle, path efficiency, social behavior, or whole-body cortisol level. These findings indicate that behavior is susceptible to MC-LR exposure and provide evidence for a better understanding of the ecological consequences of toxic algal blooms.

  13. Iron based sustainable greener technologies to treat cyanobacteria and microcystin-LR in water

    Czech Academy of Sciences Publication Activity Database

    Sharma, V. K.; Chen, L.; Maršálek, Blahoslav; Zbořil, R.; O'Shea, K. E.; Dionysiou, D. D.

    2017-01-01

    Roč. 17, č. 1 (2017), s. 107-114 ISSN 1606-9749 Institutional support: RVO:67985939 Keywords : detoxification * microcystin * oxidation Subject RIV: CC - Organic Chemistry OBOR OECD: Environmental biotechnology Impact factor: 0.573, year: 2016

  14. Photocatalytic Cellulosic Electrospun Fibers for the Degradation of Potent Cyanobacteria Toxin Microcystin-LR

    Science.gov (United States)

    2012-01-01

    visible light activated or UV light activated), the surface area of the fiber mat, and loading solution pH all have an effect on the distribution of...photocatalysis with nanoparticles (such as titania, TiO2 ) show tremendous promise as a simple and energy efficient tech- nology for water purification and...LR (MC-LR). MC- LR is one of the most commonly found cyanobacteria toxins generated by the more frequently occurring cyanobacteria algae blooms in

  15. Comparison of Protein Phosphatase Inhibition Assay with LC-MS/MS for Diagnosis of Microcystin Toxicosis in Veterinary Cases

    Directory of Open Access Journals (Sweden)

    Caroline E. Moore

    2016-03-01

    Full Text Available Microcystins are acute hepatotoxins of increasing global concern in drinking and recreational waters and are a major health risk to humans and animals. Produced by cyanobacteria, microcystins inhibit serine/threonine protein phosphatase 1 (PP1. A cost-effective PP1 assay using p-nitrophenyl phosphate was developed to quickly assess water and rumen content samples. Significant inhibition was determined via a linear model, which compared increasing volumes of sample to the log-transformed ratio of the exposed rate over the control rate of PP1 activity. To test the usefulness of this model in diagnostic case investigations, samples from two veterinary cases were tested. In August 2013 fifteen cattle died around two ponds in Kentucky. While one pond and three tested rumen contents had significant PP1 inhibition and detectable levels of microcystin-LR, the other pond did not. In August 2013, a dog became fatally ill after swimming in Clear Lake, California. Lake water samples collected one and four weeks after the dog presented with clinical signs inhibited PP1 activity. Subsequent analysis using liquid chromatography-mass spectrometry (LC-MS/MS detected microcystin congeners -LR, -LA, -RR and -LF but not -YR. These diagnostic investigations illustrate the advantages of using functional assays in combination with LC-MS/MS.

  16. An SPR biosensor for the detection of microcystins in drinking water

    Czech Academy of Sciences Publication Activity Database

    Herranz, S.; Bocková, Markéta; Marazuela, M. D.; Homola, Jiří; Moreno-Bondi, M. C.

    2010-01-01

    Roč. 398, č. 6 (2010), s. 2625-2634 ISSN 1618-2642 R&D Projects: GA AV ČR KAN200670701; GA MŠk OC09058 Institutional research plan: CEZ:AV0Z20670512 Keywords : Microcystin-LR * Label-free biosensor * Surface plasmon resonance Subject RIV: JA - Electronics ; Optoelectronics, Electrical Engineering Impact factor: 3.841, year: 2010

  17. Laboratory simulated transport of microcystin-LR and cylindrospermopsin in groundwater under the influence of stormwater ponds: implications for harvesting of infiltrated stormwater

    Science.gov (United States)

    O'Reilly, Andrew M.; Wanielista, Martin P.; Loftin, Keith A.; Chang, Ni-Bin; Schirmer, Mario; Hoehn, Eduard; Vogt, Tobias

    2011-01-01

    Water shortages in the southeastern United States have led to a need for more intensive management and usage of stormwater for beneficial uses such as irrigation. Harvesting of infiltrated stormwater from horizontal wells in sandy aquifer sediments beneath stormwater ponds has emerged as an alternative in need of evaluation. Cyanobacteria may proliferate in stormwater ponds; cyanotoxins produced by these organisms represent potential public health concerns. Results of two, saturated flow, sand column experiments indicate breakthrough of microcystin-LR (MCLR) and cylindrospermopsin (CYL) within 1―2 pore volumes indicating little removal attributable to sorption. Concentration-based MCLR removal efficiencies up to 90% were achieved, which we hypothesize were predominantly due to biodegradation. In contrast, CYL removal efficiencies were generally less than 15%. On the basis of these results, removal of sandy soil in the stormwater pond bottom and addition of sorption media with greater binding affinities to cyanotoxins may enhance natural attenuation processes prior to water withdrawal.

  18. Alteration in the Expression of Cytochrome P450s (CYP1A1, CYP2E1, and CYP3A11 in the Liver of Mouse Induced by Microcystin-LR

    Directory of Open Access Journals (Sweden)

    Bangjun Zhang

    2015-03-01

    Full Text Available Microcystins (MCs are cyclic heptapeptide toxins and can accumulate in the liver. Cytochrome P450s (CYPs play an important role in the biotransformation of endogenous substances and xenobiotics in animals. It is unclear if the CYPs are affected by MCs exposure. The objective of this study was to evaluate the effects of microcystin-LR (MCLR on cytochrome P450 isozymes (CYP1A1, CYP2E1, and CYP3A11 at mRNA level, protein content, and enzyme activity in the liver of mice the received daily, intraperitoneally, 2, 4, and 8 µg/kg body weight of MCLR for seven days. The result showed that MCLR significantly decreased ethoxyresorufin-O-deethylase (EROD (CYP1A1 and erythromycin N-demthylase (ERND (CYP3A11 activities and increased aniline hydroxylase (ANH activity (CYP2E1 in the liver of mice during the period of exposure. Our findings suggest that MCLR exposure may disrupt the function of CYPs in liver, which may be partly attributed to the toxicity of MCLR in mice.

  19. Development and single-laboratory validation of a UHPLC-MS/MS method for quantitation of microcystins and nodularin in natural water, cyanobacteria, shellfish and algal supplement tablet powders.

    Science.gov (United States)

    Turner, Andrew D; Waack, Julia; Lewis, Adam; Edwards, Christine; Lawton, Linda

    2018-02-01

    A simple, rapid UHPLC-MS/MS method has been developed and optimised for the quantitation of microcystins and nodularin in wide variety of sample matrices. Microcystin analogues targeted were MC-LR, MC-RR, MC-LA, MC-LY, MC-LF, LC-LW, MC-YR, MC-WR, [Asp3] MC-LR, [Dha7] MC-LR, MC-HilR and MC-HtyR. Optimisation studies were conducted to develop a simple, quick and efficient extraction protocol without the need for complex pre-analysis concentration procedures, together with a rapid sub 5min chromatographic separation of toxins in shellfish and algal supplement tablet powders, as well as water and cyanobacterial bloom samples. Validation studies were undertaken on each matrix-analyte combination to the full method performance characteristics following international guidelines. The method was found to be specific and linear over the full calibration range. Method sensitivity in terms of limits of detection, quantitation and reporting were found to be significantly improved in comparison to LC-UV methods and applicable to the analysis of each of the four matrices. Overall, acceptable recoveries were determined for each of the matrices studied, with associated precision and within-laboratory reproducibility well within expected guidance limits. Results from the formalised ruggedness analysis of all available cyanotoxins, showed that the method was robust for all parameters investigated. The results presented here show that the optimised LC-MS/MS method for cyanotoxins is fit for the purpose of detection and quantitation of a range of microcystins and nodularin in shellfish, algal supplement tablet powder, water and cyanobacteria. The method provides a valuable early warning tool for the rapid, routine extraction and analysis of natural waters, cyanobacterial blooms, algal powders, food supplements and shellfish tissues, enabling monitoring labs to supplement traditional microscopy techniques and report toxicity results within a short timeframe of sample receipt. The new

  20. Detection of free and covalently bound microcystins in different tissues (liver, intestines, gills, and muscles) of rainbow trout (Oncorhynchus mykiss) by liquid chromatography–tandem mass spectrometry: Method characterization

    International Nuclear Information System (INIS)

    Cadel-Six, Sabrina; Moyenga, David; Magny, Stéphanie; Trotereau, Sophie; Edery, Marc; Krys, Sophie

    2014-01-01

    So far only a few publications have explored the development of extraction methods of cyanotoxin extracted from complex matrices. With regard to cyanobacterial microcystins (MCs), the data on the contamination of the flesh of aquatic organisms is hard to compare and very limited due to the lack of validated methods. In recent years, evidence that both free and bound fractions of toxin are found in these tissues has highlighted the need to develop effective methods of quantification. Several techniques do exist, but only the Lemieux oxidation has so far been used to investigate complex tissue matrices. In this study, protocols based on the Lemieux approach were adapted for the quantitative chemical analysis of free MC-LR and MMPB derived from bound toxin in the tissues of juvenile trout gavaged with MC-LR. Afterwards, the NF V03 110 guideline was used to characterize the protocols elaborated and evaluate their effectiveness. -- Highlights: • We adapted the quantitative chemical analysis of free and total MC for the tissues of trout. • We characterize with the NF V03 110 guideline the protocols for free MC-LR and MMPB. • We quantify the free MC-LR and MMPB in the tissues of trout gavaged with MC-LR. -- We develop and characterize with the guideline NF V03 110 the protocols for the extraction and quantification of the free and total MC for different matrices

  1. Influence of Cyanobacterial Bloom on Freshwater Biocoenosis. Use of Bioassays for Cyanobacterial Microcystins Toxicity Assessment

    Science.gov (United States)

    Piontek, Marlena; Czyżewska, Wanda

    2017-03-01

    The issues presented in this study concern a very important problem of the occurrence of cyanobacterial blooms in surface water used for water supply purposes. The objective of this study was to analyze the occurrence of cyanotoxic risk in the catchment area of the Obrzyca River (including Sławskie lake which is the beginning of the river), which is a source of drinking water for the inhabitants of Zielona Góra. In order to evaluate toxicity of cyanobacterial bloom it was conducted toxicological testing using aquatic invertebrates (Daphnia magna, Dugesia tigrina) and heterotrophic bacteria (Escherichia coli, Enterococcus faecalis, Pseudomonas fluorescens). Test samples were collected from May to October, 2012. The most toxic was a sample collected from Lake Sławskie on 20th October when cyanobacteria bloom with a predominance of Microcystis aeruginosa occurred and the amount of microcystins was the largest. The methanol extract of the sample was toxic only above a concentration of 6·103 mg·dm-3. The lethal concentration (48-h LC 50) for Daphnia magna was 3.09·103 and for Dugesia tigrina (240-h LC 50) 1.51·103 mg·dm-3 of microcystins (MC-LR, MC-YR and MC-RR). The same extract stimulated growth of Escherichia coli and Enterococcus faecalis cells.

  2. Microcystin production and ecological physiology of Caribbean black band disease cyanobacteria.

    Science.gov (United States)

    Stanić, Dina; Oehrle, Stuart; Gantar, Miroslav; Richardson, Laurie L

    2011-04-01

    Molecular studies of black band disease (BBD), a coral disease found on tropical and subtropical reefs worldwide, have shown that one 16S rRNA gene sequence is ubiquitous. This sequence has been reported to be a member of the cyanobacterial genus Oscillatoria. In this study, extracts of two cultured laboratory strains of BBD Oscillatoria, and for comparison two strains of BBD Geitlerinema, all isolated from reefs of the wider Caribbean, were analysed using Ultra-Performance Liquid Chromatography-Tandem Quad Mass Spectrometry (UPLC-MS/MS). The cyanotoxin microcystin-LR (MC-LR) was found in all strains, and one Geitlerinema strain additionally produced MC-YR. Growth experiments that monitored toxin production using enzyme-linked immunosorbent assay (ELISA) showed that BBD Oscillatoria produced yields of MC-LR equivalent (0.02-0.04 mg g(-1)) independent of biomass and culture conditions (varying temperature, pH, light and organic carbon). This pattern is different from BBD Geitlerinema, which increased production of MC-LR equivalent in the presence of organic carbon in the light and dark and at a relatively lower temperature. These results indicate that different species and strains of BBD cyanobacteria, which can occur in the same BBD infection, may contribute to BBD pathobiology by producing different toxins and different amounts of toxin at different stages in the disease process. This is the first detailed study of laboratory cultures of the ubiquitous BBD cyanobacterium Oscillatoria sp. isolated from Caribbean reefs. © 2010 Society for Applied Microbiology and Blackwell Publishing Ltd.

  3. Microcystin-LR and Cylindrospermopsin Induced Alterations in Chromatin Organization of Plant Cells

    OpenAIRE

    Máthé, Csaba; Mikóné Hamvas, Márta; Vasas, Gábor

    2013-01-01

    Cyanobacteria produce metabolites with diverse bioactivities, structures and pharmacological properties. The effects of microcystins (MCYs), a family of peptide type protein-phosphatase inhibitors and cylindrospermopsin (CYN), an alkaloid type of protein synthesis blocker will be discussed in this review. We are focusing mainly on cyanotoxin-induced changes of chromatin organization and their possible cellular mechanisms. The particularities of plant cells explain the importance of such studi...

  4. The organic anion transport polypeptide 1d1 (Oatp1d1) mediates hepatocellular uptake of phalloidin and microcystin into skate liver.

    Science.gov (United States)

    Meier-Abt, F; Hammann-Hänni, A; Stieger, B; Ballatori, N; Boyer, J L

    2007-02-01

    Organic anion transporting polypeptides (rodent Oatp; human OATP) mediate cellular uptake of numerous organic compounds including xenobiotic toxins into mammalian hepatocytes. In the little skate Leucoraja erinacea a liver-specific Oatp (Oatp1d1, also called sOatp) has been identified and suggested to represent an evolutionarily ancient precursor of the mammalian liver OATP1B1 (human), Oatp1b2 (rat), and OATP1B3 (human). The present study tested whether Oatp1d1 shares functional transport activity of the xenobiotic oligopeptide toxins phalloidin and microcystin with the mammalian liver Oatps/OATPs. The phalloidin analogue [(3)H]-demethylphalloin was taken up into skate hepatocytes with high affinity (Km approximately 0.4 microM), and uptake could be inhibited by phalloidin and a variety of typical Oatp/OATP substrates such as bromosulfophthalein, bile salts, estrone-3-sulfate, cyclosporine A and high concentrations of microcystin-LR (Ki approximately 150 microM). When expressed in Xenopus laevis oocytes Oatp1d1 increased uptake of demethylphalloin (Km approximately 2.2 microM) and microcystin-LR (Km approximately 27 microM) 2- to 3-fold over water-injected oocytes, whereas the alternative skate liver organic anion transporter, the dimeric Ostalpha/beta, exhibited no phalloidin and only minor microcystin-LR transport. Also, the closest mammalian Oatp1d1 orthologue, the human brain and testis OATP1C1, did not show any phalloidin transport activity. These results demonstrate that the evolutionarily ancient Oatp1d1 is able to mediate uptake of cyclic oligopeptide toxins into skate liver. The findings support the notion that Oatp1d1 is a precursor of the liver-specific mammalian Oatps/OATPs and that its transport properties are closely associated with certain forms of toxic liver injury such as for example protein phosphatase inhibition by the water-borne toxin microcystin.

  5. The organic anion transport polypeptide 1d1 (Oatp1d1) mediates hepatocellular uptake of phalloidin and microcystin into skate liver

    International Nuclear Information System (INIS)

    Meier-Abt, F.; Hammann-Haenni, A.; Stieger, B.; Ballatori, N.; Boyer, J.L.

    2007-01-01

    Organic anion transporting polypeptides (rodent Oatp; human OATP) mediate cellular uptake of numerous organic compounds including xenobiotic toxins into mammalian hepatocytes. In the little skate Leucoraja erinacea a liver-specific Oatp (Oatp1d1, also called sOatp) has been identified and suggested to represent an evolutionarily ancient precursor of the mammalian liver OATP1B1 (human), Oatp1b2 (rat), and OATP1B3 (human). The present study tested whether Oatp1d1 shares functional transport activity of the xenobiotic oligopeptide toxins phalloidin and microcystin with the mammalian liver Oatps/OATPs. The phalloidin analogue [ 3 H]-demethylphalloin was taken up into skate hepatocytes with high affinity (Km ∼ 0.4 μM), and uptake could be inhibited by phalloidin and a variety of typical Oatp/OATP substrates such as bromosulfophthalein, bile salts, estrone-3-sulfate, cyclosporine A and high concentrations of microcystin-LR (Ki ∼ 150 μM). When expressed in Xenopus laevis oocytes Oatp1d1 increased uptake of demethylphalloin (Km ∼ 2.2 μM) and microcystin-LR (Km ∼ 27 μM) 2- to 3-fold over water-injected oocytes, whereas the alternative skate liver organic anion transporter, the dimeric Ostα/β, exhibited no phalloidin and only minor microcystin-LR transport. Also, the closest mammalian Oatp1d1 orthologue, the human brain and testis OATP1C1, did not show any phalloidin transport activity. These results demonstrate that the evolutionarily ancient Oatp1d1 is able to mediate uptake of cyclic oligopeptide toxins into skate liver. The findings support the notion that Oatp1d1 is a precursor of the liver-specific mammalian Oatps/OATPs and that its transport properties are closely associated with certain forms of toxic liver injury such as for example protein phosphatase inhibition by the water-borne toxin microcystin

  6. Sublethal microcystin exposure and biochemical outcomes among hemodialysis patients.

    Directory of Open Access Journals (Sweden)

    Elizabeth D Hilborn

    Full Text Available Cyanobacteria are commonly-occurring contaminants of surface waters worldwide. Microcystins, potent hepatotoxins, are among the best characterized cyanotoxins. During November, 2001, a group of 44 hemodialysis patients were exposed to microcystins via contaminated dialysate. Serum microcystin concentrations were quantified with enzyme-linked immunosorbent assay which measures free serum microcystin LR equivalents (ME. We describe serum ME concentrations and biochemical outcomes among a subset of patients during 8 weeks following exposure. Thirteen patients were included; 6 were males, patients' median age was 45 years (range 16-80, one was seropositive for hepatitis B surface antigen. The median serum ME concentration was 0.33 ng/mL (range: <0.16-0.96. One hundred thirty nine blood samples were collected following exposure. Patients' biochemical outcomes varied, but overall indicated a mixed liver injury. Linear regression evaluated each patient's weekly mean biochemical outcome with their maximum serum ME concentration; a measure of the extrinsic pathway of clotting function, prothrombin time, was negatively and significantly associated with serum ME concentrations. This group of exposed patients' biochemical outcomes display evidence of a mixed liver injury temporally associated with microcystin exposure. Interpretation of biochemical outcomes are complicated by the study population's underlying chronic disease status. It is clear that dialysis patients are a distinct 'at risk' group for cyanotoxin exposures due to direct intravenous exposure to dialysate prepared from surface drinking water supplies. Careful monitoring and treatment of water supplies used to prepare dialysate is required to prevent future cyanotoxin exposure events.

  7. Development of an ELISA and Immunochromatographic Strip for Highly Sensitive Detection of Microcystin-LR

    Directory of Open Access Journals (Sweden)

    Liqiang Liu

    2014-08-01

    Full Text Available A monoclonal antibody for microcystin–leucine–arginine (MC-LR was produced by cell fusion. The immunogen was synthesized in two steps. First, ovalbumin/ bovine serum albumin was conjugated with 6-acetylthiohexanoic acid using a carbodiimide EDC (1-ethyl-3-[3-dimethylaminopropyl]carbodiimide hydrochloride/ NHS (N-hydroxysulfosuccinimide reaction. After dialysis, the protein was reacted with MC-LR based on a free radical reaction under basic solution conditions. The protein conjugate was used for immunization based on low volume. The antibodies were identified by indirect competitive (icELISA and were subjected to tap water and lake water analysis. The concentration causing 50% inhibition of binding of MC-LR (IC50 by the competitive indirect ELISA was 0.27 ng/mL. Cross-reactivity to the MC-RR, MC-YR and MC-WR was good. The tap water and lake water matrices had no effect on the detection limit. The analytical recovery of MC-LR in the water samples in the icELISA was 94%–110%. Based on this antibody, an immunochromatographic biosensor was developed with a cut-off value of 1 ng/mL, which could satisfy the requirement of the World Health Organization for MC-LR detection in drinking water. This biosensor could be therefore be used as a fast screening tool in the field detection of MC-LR.

  8. Co-occurrence of non-toxic (cyanopeptolin) and toxic (microcystin) peptides in a bloom of Microcystis sp. from a Chilean lake.

    Science.gov (United States)

    Neumann, U; Campos, V; Cantarero, S; Urrutia, H; Heinze, R; Weckesser, J; Erhard, M

    2000-06-01

    A cyanobacterial bloom occurring in 1998 in lake Tres Pascualas (Concepción/Chile) was found to be dominated by Microcystis sp. The bloom contained both non-toxic (cyanopeptolin-type) and hepatotoxic (microcystin-type) peptides. Cyanopeptolin structure of the non-toxic peptides (called cyanopeptolin VW-1 and VW-2, respectively) was revealed by matrix assisted laser desorption ionization mass spectrometry (MALDI-TOF-MS) of whole cells, showing dominant molecular ions at m/z = 975 and m/z 995, respectively. On post source decay (PSD), both cyanopeptolins showed fragments deriving from Ahp-Phe-MTyr (3-amino-6-hydroxy-2-piperidone), the characteristic partial structure of cyanopeptolins. The amounts of each of the two cyanopeptolins could only roughly be estimated to be >0.1% of bloom material dry weight. In addition the blooms contained microcystins (20 microg/g bloom dry weight as determined by RP-HPLC, 13 microg/g according to ELISA determination). MALDI-TOF-MS revealed several structural variants of microcystin: MCYST-RR (microcystin with Arg and Arg, indicated by m/z 1,038 and confirmed by PSD revealing a m/z = 135 fragment deriving from the Adda side chain, MCYST-FR (microcystin with Phe and Arg, indicated by m/z = 1,015). The presence of [Asp(3)]-MCYST-LR (microcystin with Leu and Arg, Asp non-methylated, indicated by m/z 981), and [Asp(3)]-MCYST-YR (microcystin with Tyr and Arg, Asp non-methylated, indicated by m/z 1,031) were likely. The relative amounts of the peptides varied between February, April, and May. Whole cell extracts from the bloom material revealed specific enzyme inhibitory activities. The serin-proteases trypsin, plasmin, elastase were inhibited, assumable due to the cyanopeptolins found. Elastase and the cysteine-protease papain were not inhibited, inhibitions of protein kinase and glutathione S-transferase (GST) were low. Strong inhibition was observed with protein-phosphatase-1, likely due to the microcystins present in the samples.

  9. Identificação de microcistina LR ao nível molecular empregando microscopia de força atômica

    Directory of Open Access Journals (Sweden)

    Augusto Etchegaray

    2010-01-01

    Full Text Available Microcystins are non-ribosomal peptides that must be detected for its health concern. Here, microcystin LR and its specific antibody were respectively tethered to the substrate and to the tip of an atomic force microscope, after surface functionalization using 3-aminopropyltriethoxysilane and glutaraldehyde. Functionalization was confirmed comparing topographic images taken on bare and modified tips. Force versus distance curves were successfully used to measure the specific antibody-antigen interactions comparing with a control in which microcystin was initially blocked by incubation with free antibodies. The results showed unequivocally the specific recognition of MLR, suggesting that this method could be useful for biosensor development.

  10. Life-cycle exposure to microcystin-LR interferes with the reproductive endocrine system of male zebrafish.

    Science.gov (United States)

    Su, Yujing; Li, Li; Hou, Jie; Wu, Ning; Lin, Wang; Li, Guangyu

    2016-06-01

    Recently, MC-LR reproductive toxicity drew great attention. Limited information was available on endocrine-disrupting effects of MC-LR on the reproduction system in fish. In the present study, zebrafish hatchlings (5 d post-fertilization) were exposed to 0, 0.3, 3 and 30μg/L MC-LR for 90 d until they reached sexual maturity. Male zebrafish were selected, and changes in growth and developmental parameters, testicular histological structure as well as the levels of gonadal steroid hormones were studied along with the related-gene transcriptional responses in the hypothalamic-pituitary-gonadal axis (HPG-axis). The results, for the first time, show a life cycle exposure to MC-LR causes growth inhibition, testicular damage and delayed sperm maturation. A significant decrease in T/E2 ratio indicated that MC-LR disrupted sex steroid hormones balance. The changes in transcriptional responses of HPG-axis related genes revealed that MC-LR promoted the conversion of T to E2 in circulating blood. It was also noted that vtg1 mRNA expression in the liver was up-regulated, which implied that MC-LR could induce estrogenic-like effects at environmentally relevant concentrations and long-term exposure. Our findings indicated that a life cycle exposure to MC-LR causes endocrine disruption with organic and functional damage of the testis, which might compromise the quality of life for the survivors and pose a potent threat on fish reproduction and thus population dynamics in MCs-contaminated aquatic environments. Copyright © 2016 Elsevier B.V. All rights reserved.

  11. In situ studies on the distribution patterns and dynamics of microcystins in a biomanipulation fish - bighead carp (Aristichthys nobilis)

    International Nuclear Information System (INIS)

    Chen Jun; Xie Ping; Zhang Dawen; Lei Hehua

    2007-01-01

    The distribution and dynamics of microcystins in various organs of the phytoplanktivorous bighead carp were studied monthly in Lake Taihu, which is dominated by toxic cyanobacteria. There was a good agreement between LC-MS and HPLC-UV determinations. Average recoveries of spiked fish samples were 63% for MC-RR and 71% for MC-LR. The highest MC contents in intestine, liver, kidney and spleen were 85.67, 2.83, 1.70 and 1.57 μg g -1 DW, respectively. MCs were much higher in mid-gut walls (1.22 μg g -1 DW) than in hind- and fore-gut walls (0.31 and 0.18 μg g -1 DW, respectively), suggesting the importance of mid-gut wall as major site for MC absorption. A cysteine conjugate of MC-LR was detected frequently in kidney. Among the muscle samples analyzed, 25% were above the provisional tolerable daily intake level by WHO. Bighead is strongly resistant to microcystins and can be used as biomanipulation fish to counteract cyanotoxin contamination in eutrophic waters. - Bighead carp is resistant to microcystins and can be used as biomanipulation fish to counteract cyanotoxin contamination

  12. Influence of Cyanobacterial Bloom on Freshwater Biocoenosis. Use of Bioassays for Cyanobacterial Microcystins Toxicity Assessment

    Directory of Open Access Journals (Sweden)

    Piontek Marlena

    2017-03-01

    Full Text Available The issues presented in this study concern a very important problem of the occurrence of cyanobacterial blooms in surface water used for water supply purposes. The objective of this study was to analyze the occurrence of cyanotoxic risk in the catchment area of the Obrzyca River (including Sławskie lake which is the beginning of the river, which is a source of drinking water for the inhabitants of Zielona Góra. In order to evaluate toxicity of cyanobacterial bloom it was conducted toxicological testing using aquatic invertebrates (Daphnia magna, Dugesia tigrina and heterotrophic bacteria (Escherichia coli, Enterococcus faecalis, Pseudomonas fluorescens. Test samples were collected from May to October, 2012. The most toxic was a sample collected from Lake Sławskie on 20th October when cyanobacteria bloom with a predominance of Microcystis aeruginosa occurred and the amount of microcystins was the largest. The methanol extract of the sample was toxic only above a concentration of 6·103 mg·dm-3. The lethal concentration (48-h LC 50 for Daphnia magna was 3.09·103 and for Dugesia tigrina (240-h LC 50 1.51·103 mg·dm-3 of microcystins (MC-LR, MC-YR and MC-RR. The same extract stimulated growth of Escherichia coli and Enterococcus faecalis cells.

  13. Guidance values for microcystins in water and cyanobacterial supplement products (blue-green algal supplements): a reasonable or misguided approach?

    International Nuclear Information System (INIS)

    Dietrich, Daniel; Hoeger, Stefan

    2005-01-01

    This article reviews current scientific knowledge on the toxicity and carcinogenicity of microcystins and compares this to the guidance values proposed for microcystins in water by the World Health Organization, and for blue-green algal food supplements by the Oregon State Department of Health. The basis of the risk assessment underlying these guidance values is viewed as being critical due to overt deficiencies in the data used for its generation: (i) use of one microcystin congener only (microcystin-LR), while the other presently known nearly 80 congeners are largely disregarded, (ii) new knowledge regarding potential neuro and renal toxicity of microcystins in humans and (iii) the inadequacies of assessing realistic microcystin exposures in humans and especially in children via blue-green algal food supplements. In reiterating the state-of-the-art toxicology database on microcystins and in the light of new data on the high degree of toxin contamination of algal food supplements, this review clearly demonstrates the need for improved kinetic data of microcystins in humans and for discussion concerning uncertainty factors, which may result in a lowering of the present guidance values and an increased routine control of water bodies and food supplements for toxin contamination. Similar to the approach taken previously by authorities for dioxin or PCB risk assessment, the use of a toxin equivalent approach to the risk assessment of microcystins is proposed

  14. Application of a microcystin extraction method specific for enzyme inhibition assays

    International Nuclear Information System (INIS)

    Sevilla Miguel, E.; Simienk, H.; Calvin Tienza, V.; Razquin Casquero, P.; Peleato Sanchez, M. L.; Mata Vallespin, L.

    2009-01-01

    A method for the determination of intracellular and dissolved microcystins in non treated water is proposed. The results obtained with this method, based on a phosphatase inhibition assay, are compared with those for HPLC- UV. Potential interferences of the phosphatase inhibition assays like pigments or the endogenous phosphatase activity present in cyanobacteria did not have any adverse effect on assay results. Besides, the recovery of microcystins in field samples with the proposed method was found to be high than 90% in all tested samples. A number of samples from different origins and appearances were also analyzed for their microcystin content. (Author) 27 refs

  15. Development of a silicone-membrane passive sampler for monitoring cylindrospermopsin and microcystin LR-YR-RR in natural waters

    Science.gov (United States)

    Nyoni, Hlengilizwe; Mamba, Bhekie B.; Msagati, Titus A. M.

    2017-08-01

    Silicone membrane tubes were functionalised by filling them with synthesised γ-Fe2O3 nanoparticles and used as a passive sampling device for monitoring microcystins and cylindrospermopsin in aquatic environments. This novel device was calibrated for the measurement of microcystin and cylindrospermopsin concentrations in water. The effect of temperature and hydrodynamics on the sampler performance was studied in a flow-through system under controlled conditions. The chemical uptake of microcystins (MCs) and cylindrospermopsin (CYN) into the passive sampler remained linear and integrative throughout the exposure period. The rate of accumulation of most of the MC compounds tested was dependent on temperature and flow velocity. The use of 13C labelled polychlorinated biphenyls as performance reference compounds (PRCs) in silicone membrane/γ-Fe2O3 nanoparticle passive sampler, Chemcatcher and polar organic chemical integrative sampler (POCIS) was evaluated. The majority of PRCs improved the semi quantitative nature of water concentration estimated by the three samplers. The corrected sampling rate values of model biotoxin compounds were used to estimate the time-weighted average concentrations in natural cyanobacterial water blooms of the Hartbeespoort dam. The corrected sampling rates RScorr values varied from 0.1140 to 0.5628 Ld-1 between samplers with silicone membrane having the least RScorr values compared to the Chemcatcher and POCIS. The three passive sampling devises provided a more relevant picture of the biotoxin concentration in the Hartbeespoort dam. The results suggested that the three sampling devices are suitable for use in monitoring microcystins and cylindrospermopsin concentrations in aquatic environments.

  16. Isolation, Identification and Phenotypic Characterization of Microcystin-Degrading Bacteria from Lake Erie

    Science.gov (United States)

    Krishnan, A.; Mou, X. J.

    2015-12-01

    Lake Erie, the smallest and warmest lake among the Laurentian Great Lakes, is known for its problem of eutrophication and frequent occurrence of harmful cyanobacterial blooms (CyanoHABs). One major harmful effect of CyanoHABs is the production of cyanotoxins, especially microcystins. Microcystins (MC) are a group of hepatotoxins and the predominant variant of them is MC-LR. Field measurements and lab experiments indicate that MC degradation in Lake Erie is mainly carried out by indigenous bacteria. However, our knowledge on taxa involved in this process is very limited. This study aimed to fill this knowledge gap using a culture-dependent approach. Water and surface sediment samples were collected from Lake Erie in 2014 and 2015 and enriched with MC-LR. Cells were plated on a number of culturing media. The obtained pure bacterial cultures were screened for MC degrading abilities by MT2 BIO-LOG assays and by growing cells in liquid media containing MC-LR as the sole carbon source. In the latter experiment, MC concentrations were measured using HPLC. Isolates showing positive MC degradation activities in the screening steps were designated MC+ bacteria and characterized based on their phenotypic properties, including colony pigmentation, elevation, opacity, margin, gram nature and motility. The taxonomic identity of MC+ bacteria was determined by 16S rRNA gene full-length DNA sequencing. The presence of mlrA, a gene encoding MC cleavage pathway, was detected by PCR. Our culturing efforts obtained 520 pure cultures; 44 of them were identified as MC+. These MC+ isolates showed diversity in taxonomic identities and differed in their morphology, gram nature, colony characteristics and motility. PCR amplification of mlrA gene yield negative results for all MC+ isolates, indicating that the primers that were used may not be ubiquitous enough to cover the heterogeneity of mlrA genes or, more likely, alternative degradative genes/pathways were employed by Lake Erie bacteria

  17. Occurrence of the Microcystins MC-LW and MC-LF in Dutch Surface Waters and Their Contribution to Total Microcystin Toxicity

    Directory of Open Access Journals (Sweden)

    Elisabeth J. Faassen

    2013-07-01

    Full Text Available Microcystins (MCs are the most frequently found cyanobacterial toxins in freshwater systems. Many MC variants have been identified and variants differ in their toxicity. Recent studies showed that the variants MC-LW and MC-LF might be more toxic than MC-LR, the variant that is most abundant and mostly used for risk assessments. As little is known about the presence of these two variants in The Netherlands, we determined their occurrence by analyzing 88 water samples and 10 scum samples for eight MC variants ((dm-7-MC-RR, MC-YR, (dm-7-MC-LR, MC-LY, MC-LW and MC-LF by liquid chromatography with tandem mass spectrometry detection. All analyzed MC variants were detected, and MC-LW and/or MC-LF were present in 32% of the MC containing water samples. When MC-LW and MC-LF were present, they contributed to nearly 10% of the total MC concentrations, but due to their suspected high toxicity, their average contribution to the total MC toxicity was estimated to be at least 45%. Given the frequent occurrence and possible high toxicity of MC-LW and MC-LF, it seems better to base health risk assessments on the toxicity contributions of different MC variants than on MC-LR concentrations alone.

  18. Hepatotoxicity associated with microcystin/ Hepatotoxicidade associada à microcistina

    Directory of Open Access Journals (Sweden)

    Ana Paula Frederico Rodrigues Loureiro Bracarense

    2008-08-01

    Full Text Available Urban and industrial discharges, intense agricultural exploitation and fisheries have been causing the eutrophication in both drinking and recreational waters. A frequent consequence of eutrophication in waters is the massive development of cyanobacteria. The occurrence of these blooms induces a severe problem, as Microcystis aeruginosa, the most widespread distributed cyanobacteria, can produce microcystins (MC. Toxic effects of MC have been described in liver, lungs, stomach, and intestine. Deaths in wildlife, livestock and human beings were also associated with MC exposition. MC exposition can occurs directly by ingestion, inhalation, contact, intravenous inoculation of contaminated water (hemodialysis or indirectly, by the consumption of animals, as fish and mollusks, the majors ingestors of cyanobacteria and its toxins. The most toxic MC, an also the most common is microcystin-LR (MC-LR, that has the liver as the main target organ. Microcystin is taken up specifically into the liver by bile acid transporters and, after entering the cytoplasm, inhibit protein phosphatases 1 and 2A, which leads to the increase in protein phosphorylation. This effect has two main consequences: the destruction of cytoskeleton directly causing cytotoxic effects, and deregulation of cell division, leading to tumor-promoting activity. Acute exposition to MC induces severe intrahepatic hemorrhage, necrosis and apoptosis, while chronic exposure can cause hepatic or intestinal neoplasia. It has been documented that MC hepatotoxicity is closely associated with intracellular reactive oxygen species formation. Natural degradation of microcystins depends on the solar radiation and bacteria. If degradation is insufficient, MC will persist in the freshwater food chain. Microcystin contamination of waters is therefore a hazard to human and animal health, so efforts to avoid eutrophication of waters sources are essential, in order to minimize the risks to public health

  19. Analysis of the use of microcystin-contaminated water in the growth and nutritional quality of the root-vegetable, Daucus carota.

    Science.gov (United States)

    Machado, J; Azevedo, J; Freitas, M; Pinto, E; Almeida, A; Vasconcelos, V; Campos, A

    2017-01-01

    Toxic cyanobacterial blooms are often observed in freshwaters and may reflect the increased eutrophication of these environments and alterations in climate. Cyanotoxins, such as microcystins (MCs), are an effective threat to many life forms, ranging from plants to humans. Despite the research conducted to date on cyanotoxins, the risks associated to the use of contaminated water in agriculture require further elucidation. To tackle this aim, a research was conducted with the root-vegetable Daucus carota. The specific aims of this work were the following: (i) to evaluate the effects of MC-LR on the plant growth and photosynthesis; (ii) to evaluate the nutritional quality of carrot roots; and (iii) to measure bioaccumulation. To this purpose, young carrots were grown in soil during 1 month in natural conditions and exposed to Mycrocystis aeruginosa aqueous extracts containing environmentally realistic concentrations of MC-LR (10 and 50 MC-LR μg/L). The results showed that MC-LR may decrease root growth after 28 days of exposure to 50 μg/L and increase photosynthetic efficiency. We also observed changes in mineral and vitamin content in carrots as a result of the exposure to contaminated water. Moreover, MC-LR was detected in carrot roots by ELISA at very low concentration 5.23 ± 0.47 ng MC eq./g FW. The soil retained 52.7 % of the toxin potentially available for plants. This result could be attributed to MC-LR adsorption by soil particles or due to microbial degradation of the toxin. We conclude that the prolonged use of MC-LR-contaminated water may affect crop growth, alter the nutritional value of vegetable products, and potentiate contamination.

  20. Simultaneous Microcystis Algicidal and Microcystin Degrading Capability by a Single Acinetobacter Bacterial Strain.

    Science.gov (United States)

    Li, Hong; Ai, Hainan; Kang, Li; Sun, Xingfu; He, Qiang

    2016-11-01

    Measures for removal of toxic harmful algal blooms often cause lysis of algal cells and release of microcystins (MCs). In this study, Acinetobacter sp. CMDB-2 that exhibits distinct algal lysing activity and MCs degradation capability was isolated. The physiological response and morphological characteristics of toxin-producing Microcystis aeruginosa, the dynamics of intra- and extracellular MC-LR concentration were studied in an algal/bacterial cocultured system. The results demonstrated that Acinetobacter sp. CMDB-2 caused thorough decomposition of algal cells and impairment of photosynthesis within 24 h. Enhanced algal lysis and MC-LR release appeared with increasing bacterial density from 1 × 10 3 to 1 × 10 7 cells/mL; however, the MC-LR was reduced by nearly 94% within 14 h irrespective of bacterial density. Measurement of extracellular and intracellular MC-LR revealed that the toxin was decreased by 92% in bacterial cell incubated systems relative to control and bacterial cell-free filtrate systems. The results confirmed that the bacterial metabolite caused 92% lysis of Microcystis aeruginosa cells, whereas the bacterial cells were responsible for approximately 91% reduction of MC-LR. The joint efforts of the bacterium and its metabolite accomplished the sustainable removal of algae and MC-LR. This is the first report of a single bacterial strain that achieves these dual actions.

  1. Chitosan-cellulose composite materials: Preparation, Characterization and application for removal of microcystin

    Energy Technology Data Exchange (ETDEWEB)

    Tran, Chieu D., E-mail: chieu.tran@marquette.edu [Department of Chemistry, Marquette University, P.O. Box 1881, Milwaukee, WI 53201 (United States); Duri, Simon [Department of Chemistry, Marquette University, P.O. Box 1881, Milwaukee, WI 53201 (United States); Delneri, Ambra; Franko, Mladen [Laboratory for Environmental Research, University of Nova Gorica, Vipavska 13, 5001 Nova Gorica (Slovenia)

    2013-05-15

    Highlights: •A novel and recyclable synthetic method using an ionic liquid, a Green Solvent. •Ecocomposite materials were synthesized from cellulose (CEL) and chitosan (CS). •Adding CEL into CS substantially increases tensile strength of the composite. •The composite is much better adsorbent for cyanotoxins than other materials. •The composite can be reused because adsorbed microcystin can be desorbed. -- Abstract: We developed a simple and one-step method to prepare biocompatible composites from cellulose (CEL) and chitosan (CS). [BMIm{sup +}Cl{sup −}], an ionic liquid (IL), was used as a green solvent to dissolve and prepare the [CEL + CS] composites. Since majority (>88%) of IL used was recovered for reuse by distilling the aqueous washings of [CEL + CS], the method is recyclable. XRD, FTIR, NIR, {sup 13}C CP-MAS-NMR and SEM were used to monitor the dissolution and to characterize the composites. The composite was found to have combined advantages of their components: superior mechanical strength (from CEL) and excellent adsorption capability for microcystin-LR, a deadly toxin produced by cyanobacteria (from CS). Specifically, the mechanical strength of the composites increased with CEL loading; e.g., up to 5× increase in tensile strength was achieved by adding 80% of CEL into CS. Kinetic results of adsorption confirm that unique properties of CS remain intact in the composite, i.e., it is not only a very good adsorbent for microcystin but also is better than all other available adsorbents. For example, it can adsorb 4× times more microcystin than the best reported adsorbent. Importantly, the microcystin adsorbed can be quantitatively desorbed to enable the composite to be reused with similar adsorption efficiency.

  2. Chitosan-cellulose composite materials: Preparation, Characterization and application for removal of microcystin

    International Nuclear Information System (INIS)

    Tran, Chieu D.; Duri, Simon; Delneri, Ambra; Franko, Mladen

    2013-01-01

    Highlights: •A novel and recyclable synthetic method using an ionic liquid, a Green Solvent. •Ecocomposite materials were synthesized from cellulose (CEL) and chitosan (CS). •Adding CEL into CS substantially increases tensile strength of the composite. •The composite is much better adsorbent for cyanotoxins than other materials. •The composite can be reused because adsorbed microcystin can be desorbed. -- Abstract: We developed a simple and one-step method to prepare biocompatible composites from cellulose (CEL) and chitosan (CS). [BMIm + Cl − ], an ionic liquid (IL), was used as a green solvent to dissolve and prepare the [CEL + CS] composites. Since majority (>88%) of IL used was recovered for reuse by distilling the aqueous washings of [CEL + CS], the method is recyclable. XRD, FTIR, NIR, 13 C CP-MAS-NMR and SEM were used to monitor the dissolution and to characterize the composites. The composite was found to have combined advantages of their components: superior mechanical strength (from CEL) and excellent adsorption capability for microcystin-LR, a deadly toxin produced by cyanobacteria (from CS). Specifically, the mechanical strength of the composites increased with CEL loading; e.g., up to 5× increase in tensile strength was achieved by adding 80% of CEL into CS. Kinetic results of adsorption confirm that unique properties of CS remain intact in the composite, i.e., it is not only a very good adsorbent for microcystin but also is better than all other available adsorbents. For example, it can adsorb 4× times more microcystin than the best reported adsorbent. Importantly, the microcystin adsorbed can be quantitatively desorbed to enable the composite to be reused with similar adsorption efficiency

  3. Toxic Cyanobacteria in Svalbard: Chemical Diversity of Microcystins Detected Using a Liquid Chromatography Mass Spectrometry Precursor Ion Screening Method

    Directory of Open Access Journals (Sweden)

    Julia Kleinteich

    2018-04-01

    Full Text Available Cyanobacteria synthesize a large variety of secondary metabolites including toxins. Microcystins (MCs with hepato- and neurotoxic potential are well studied in bloom-forming planktonic species of temperate and tropical regions. Cyanobacterial biofilms thriving in the polar regions have recently emerged as a rich source for cyanobacterial secondary metabolites including previously undescribed congeners of microcystin. However, detection and detailed identification of these compounds is difficult due to unusual sample matrices and structural congeners produced. We here report a time-efficient liquid chromatography-mass spectrometry (LC-MS precursor ion screening method that facilitates microcystin detection and identification. We applied this method to detect six different MC congeners in 8 out of 26 microbial mat samples of the Svalbard Archipelago in the Arctic. The congeners, of which [Asp3, ADMAdda5, Dhb7] MC-LR was most abundant, were similar to those reported in other polar habitats. Microcystins were also determined using an Adda-specific enzyme-linked immunosorbent assay (Adda-ELISA. Nostoc sp. was identified as a putative toxin producer using molecular methods that targeted 16S rRNA genes and genes involved in microcystin production. The mcy genes detected showed highest similarities to other Arctic or Antarctic sequences. The LC-MS precursor ion screening method could be useful for microcystin detection in unusual matrices such as benthic biofilms or lichen.

  4. Inhibition of gap-junctional intercellular communication and activation of mitogen-activated protein kinases by cyanobacterial extracts--indications of novel tumor-promoting cyanotoxins?

    Science.gov (United States)

    Bláha, Ludĕk; Babica, Pavel; Hilscherová, Klára; Upham, Brad L

    2010-01-01

    Toxicity and liver tumor promotion of cyanotoxins microcystins have been extensively studied. However, recent studies document that other metabolites present in the complex cyanobacterial water blooms may also have adverse health effects. In this study we used rat liver epithelial stem-like cells (WB-F344) to examine the effects of cyanobacterial extracts on two established markers of tumor promotion, inhibition of gap-junctional intercellular communication (GJIC) and activation of mitogen-activated protein kinases (MAPKs) - ERK1/2. Extracts of cyanobacteria (laboratory cultures of Microcystis aeruginosa and Aphanizomenon flos-aquae and water blooms dominated by these species) inhibited GJIC and activated MAPKs in a dose-dependent manner (effective concentrations ranging 0.5-5mgd.w./mL). Effects were independent of the microcystin content and the strongest responses were elicited by the extracts of Aphanizomenon sp. Neither pure microcystin-LR nor cylindrospermopsin inhibited GJIC or activated MAPKs. Modulations of GJIC and MAPKs appeared to be specific to cyanobacterial extracts since extracts from green alga Chlamydomonas reinhardtii, heterotrophic bacterium Klebsiella terrigena, and isolated bacterial lipopolysaccharides had no comparable effects. Our study provides the first evidence on the existence of unknown cyanobacterial toxic metabolites that affect in vitro biomarkers of tumor promotion, i.e. inhibition of GJIC and activation of MAPKs.

  5. Occurrence of Microcystis aeruginosa and microcystins in Río de la Plata river (Argentina

    Directory of Open Access Journals (Sweden)

    Darío Andrinolo

    2007-07-01

    Full Text Available This paper is the first report on microcystins producer blooms of Microcystis aeruginosa in the Argentinean coast of the Río de la Plata river, the most important drinking water supply of Argentina. The distribution of toxic cyanobacterium Microcystis cf. aeruginosa blooms in the Argentinean coast of the Rio de la Plata river was studied from December 2003 and January 2006. Microcystis aeruginosa persisted in the river with values ranged between 0 - 7.8 10(4 cells ml-1. Samples of two Microcystis aeruginosa water blooms were collected at La Plata river and were analyzed by the mouse bioassay and by high-performance liquid chromatography with Diode-array and MS detector. The samples showed high hepatotoxicity in mouse bioassay and, in accordance, important amount of microcystins. The bloom samples contained microcystins LR and a variant of microcystin with a molecular ion [M+H]+= 1037.8 m/z as major components. The total toxin content found in these samples was 0.94μg/mg and 0.69μg/mg of lyophilised cells. We conclude that the presence of toxic clones of Microcystis aeruginosa in the Argentinean coast of the Río de la Plata is an actual sanitary and environmental problem and that further studies are necessary to make the risk assessment.

  6. Roles of piRNAs in microcystin-leucine-arginine (MC-LR) induced reproductive toxicity in testis on male offspring.

    Science.gov (United States)

    Zhang, Ling; Zhang, Hui; Zhang, Huan; Benson, Mikael; Han, Xiaodong; Li, Dongmei

    2017-07-01

    In the present study, we evaluated the toxic effects on the testis of the male offspring of MC-LR exposure during fetal and lactational periods. Pregnant females were distributed into two experimental groups: control group and MC-LR group which were exposed to 0 and 10 μg/L of MC-LR, respectively, through drinking water separately during fetal and lactational periods. At the age of 30 days after birth, the male offspring were euthanized. The body weight, testis index, and histomorphology change were observed and the global changes of piwi-interacting RNA (piRNA) expression were evaluated. The results revealed that MC-LR was found in the testis of male offspring, body weight and testis index decreased significantly, and testicular tissue structure was damaged in the MC-LR group. In addition, the exposure to MC-LR resulted in an altered piRNA expression profile and an increase of the cell apoptosis and a decrease of the cell proliferation in the testis of the male offspring. It was reasonable to speculate that the toxic effects on reproductive system of the male offspring in MC-LR group might be mediated by piRNAs through the regulation of the target genes. As far as we are aware, this is the first report showing that MC-LR could play a role in disorder of proliferative and cell apoptosis in the testis of the male offspring by the maternal transmission effect of toxicity. Copyright © 2017 Elsevier Ltd. All rights reserved.

  7. Lettuce irrigated with contaminated water: Photosynthetic effects, antioxidative response and bioaccumulation of microcystin congeners.

    Science.gov (United States)

    Bittencourt-Oliveira, Maria do Carmo; Cordeiro-Araújo, Micheline Kézia; Chia, Mathias Ahii; Arruda-Neto, João Dias de Toledo; de Oliveira, Ênio Tiago; dos Santos, Flávio

    2016-06-01

    The use of microcystins (MCs) contaminated water to irrigate crop plants represents a human health risk due to their bioaccumulation potential. In addition, MCs cause oxidative stress and negatively influence photosynthetic activities in plants. The present study was aimed at investigating the effect of MCs on photosynthetic parameters and antioxidative response of lettuce. Furthermore, the bioaccumulation factor (BAF) of total MCs, MC-LR and MC-RR in the vegetable after irrigation with contaminated water was determined. Lettuce crops were irrigated for 15 days with water containing cyanobacterial crude extracts (Microcystis aeruginosa) with MC-LR (0.0, 0.5, 2.0, 5.0 and 10.0 µg L(-1)), MC-RR (0.0, 0.15, 0.5, 1.5 and 3.0 µg L(-1)) and total MCs (0.0, 0.65, 2.5, 6.5 and 13.0 µg L(-1)). Increased net photosynthetic rate, stomatal conductance, leaf tissue transpiration and intercellular CO2 concentration were recorded in lettuce exposed to different MCs concentrations. Antioxidant response showed that glutathione S-transferase activity was down-regulated in the presence of MCs. On the other hand, superoxide dismutase, catalase and peroxidase activities were upregulated with increasing MCs concentrations. The bioaccumulation factor (BAF) of total MCs and MC-LR was highest at 6.50 and 5.00 µg L(-1), respectively, while for MC-RR, the highest BAF was recorded at 1.50 µg L(-1) concentration. The amount of total MCs, MC-LR and MC-RR bioacumulated in lettuce was highest at the highest exposure concentrations. However, at the lowest exposure concentration, there were no detectable levels of MC-LR, MC-RR and total MCs in lettuce. Thus, the bioaccumulation of MCs in lettuce varies according to the exposure concentration. In addition, the extent of physiological response of lettuce to the toxins relies on exposure concentrations. Copyright © 2016 Elsevier Inc. All rights reserved.

  8. The Effect of Cyanobacterial Biomass Enrichment by Centrifugation and GF/C Filtration on Subsequent Microcystin Measurement

    Directory of Open Access Journals (Sweden)

    Shelley Rogers

    2015-03-01

    Full Text Available Microcystins are cyclic peptides produced by multiple cyanobacterial genera. After accumulation in the liver of animals they inhibit eukaryotic serine/threonine protein phosphatases, causing liver disease or death. Accurate detection/quantification of microcystins is essential to ensure safe water resources and to enable research on this toxin. Previous methodological comparisons have focused on detection and extraction techniques, but have not investigated the commonly used biomass enrichment steps. These enrichment steps could modulate toxin production as recent studies have demonstrated that high cyanobacterial cell densities cause increased microcystin levels. In this study, three microcystin-producing strains were processed using no cell enrichment steps (by direct freezing at three temperatures and with biomass enrichment (by centrifugation or GF/C filtration. After extraction, microcystins were analyzed using liquid chromatography-tandem mass spectrometry. All processing methods tested, except GF/C filtration, resulted in comparable microcystin quotas for all strains. The low yields observed for the filtration samples were caused by adsorption of arginine-containing microcystins to the GF/C filters. Whilst biomass enrichment did not affect microcystin metabolism over the time-frame of normal sample processing, problems associated with GF/C filtration were identified. The most widely applicable processing method was direct freezing of samples as it could be utilized in both field and laboratory environments.

  9. Characteristics of UV-MicroO3 Reactor and Its Application to Microcystins Degradation during Surface Water Treatment

    Directory of Open Access Journals (Sweden)

    Guangcan Zhu

    2015-01-01

    Full Text Available The UV-ozone (UV-O3 process is not widely applied in wastewater and potable water treatment partly for the relatively high cost since complicated UV radiation and ozone generating systems are utilized. The UV-microozone (UV-microO3, a new advanced process that can solve the abovementioned problems, was introduced in this study. The effects of air flux, air pressure, and air humidity on generation and concentration of O3 in UV-microO3 reactor were investigated. The utilization of this UV-microO3 reactor in microcystins (MCs degradation was also carried out. Experimental results indicated that the optimum air flux in the reactor equipped with 37 mm diameter quartz tube was determined to be 18∼25 L/h for efficient O3 generation. The air pressure and humidity in UV-microO3 reactor should be low enough in order to get optimum O3 output. Moreover, microcystin-RR, YR, and LR (MC-RR, MC-YR, and MC-LR could be degraded effectively by UV-microO3 process. The degradation of different MCs was characterized by first-order reaction kinetics. The pseudofirst-order kinetic constants for MC-RR, MC-YR, and MC-LR degradation were 0.0093, 0.0215, and 0.0286 min−1, respectively. Glucose had no influence on MC degradation through UV-microO3. The UV-microO3 process is hence recommended as a suitable advanced treatment method for dissolved MCs degradation.

  10. Characterization of a microcystin and detection of microcystin synthetase genes from a Brazilian isolate of Nostoc.

    Science.gov (United States)

    Genuário, Diego Bonaldo; Silva-Stenico, Maria Estela; Welker, Martin; Beraldo Moraes, Luiz Alberto; Fiore, Marli Fátima

    2010-04-01

    A nostocalean nitrogen-fixing cyanobacterium isolated from an eutrophic freshwater reservoir located in Piracicaba, São Paulo, Brazil, was evaluated for the production of hepatotoxic cyclic heptapeptides, microcystins. Morphologically this new cyanobacterium strain appears closest to Nostoc, however, in the phylogenetic analysis of 16S rRNA gene it falls into a highly stable cluster distantly only related to the typical Nostoc cluster. Extracts of Nostoc sp. CENA88 cultured cells, investigated using ELISA assay, gave positive results and the microcystin profile revealed by ESI-Q-TOF/MS/MS analysis confirmed the production of [Dha(7)]MCYST-YR. Further, Nostoc sp. CENA88 genomic DNA was analyzed by PCR for sequences of mcyD, mcyE and mcyG genes of microcystin synthetase (mcy) cluster. The result revealed the presence of mcyD, mcyE and mcyG genes with similarities to those from mcy of Nostoc sp. strains 152 and IO-102-I and other cyanobacterial genera. The phylogenetic tree based on concatenated McyG, McyD and McyE amino acids clustered the sequences according to cyanobacterial genera, with exception of the Nostoc sp. CENA88 sequence, which was placed in a clade distantly related from other Nostoc strains, as previously observed also in the 16S rRNA phylogenetic analysis. The present study describes for the first time a Brazilian Nostoc microcystin producer and also the occurrence of demethyl MCYST-YR variant in this genus. The sequenced Nostoc genes involved in the microcystin synthesis can contribute to a better understanding of the toxigenicity and evolution of this cyanotoxin. Copyright 2009 Elsevier Ltd. All rights reserved.

  11. Effects of thermal treatments during cooking, microwave oven and boiling, on the unconjugated microcystin concentration in muscle of fish (Oreochromis niloticus).

    Science.gov (United States)

    Guzmán-Guillén, Remedios; Prieto, Ana I; Moreno, Isabel; Soria, Ma Eugenia; Cameán, Ana M

    2011-09-01

    Understanding the factors that contribute to the risk from fish consumption is a relevant public health concern due to potential adverse effects of cyanobacterial toxins. The aim of this work was to study the influence of two usual cooking practices, microwave oven and boiling, on the microcystin (MCs) concentration in fish muscle (Tilapia, Oreochromis niloticus) spiked with a stock solution (500 μL) containing a mixture of three toxins (MC-LR, MC-RR, and MC-YR) (1.5 μg/mL of each toxin). Two different variables were investigated: time of cooking in the microwaves treatment (1 or 5 min), and way of boiling, "boiled muscle" or "continuously heated muscle". All samples were then lyophilized and MCs were extracted and purified (Oasis HLB cartridge) and quantified by HPLC-MS. Furthermore, the waters in which the samples boiled were also analyzed after their purification. The results suggest a reduction on MC-LR (36%) and MC-YR (24.6%) in samples cooked in the microwave for 5 min. Major changes were found when the fish was cooked by the continuous boiling, with a decrease of 45.0% (MC-RR), 56.4% (MC-YR) and 59.3% (MC-LR). More studies are necessary to elucidate the mechanisms involved when aquatic food is submitted to usual cooking practices. Copyright © 2011 Elsevier Ltd. All rights reserved.

  12. Simultaneous optimization of the ultrasound-assisted extraction for phenolic compounds content and antioxidant activity of Lycium ruthenicum Murr. fruit using response surface methodology.

    Science.gov (United States)

    Chen, Shasha; Zeng, Zhi; Hu, Na; Bai, Bo; Wang, Honglun; Suo, Yourui

    2018-03-01

    Lycium ruthenicum Murr. (LR) is a functional food that plays an important role in anti-oxidation due to its high level of phenolic compounds. This study aims to optimize ultrasound-assisted extraction (UAE) of phenolic compounds and antioxidant activities of obtained extracts from LR using response surface methodology (RSM). A four-factor-three-level Box-Behnken design (BBD) was employed to discuss the following extracting parameters: extraction time (X 1 ), ultrasonic power (X 2 ), solvent to sample ratio (X 3 ) and solvent concentration (X 4 ). The analysis of variance (ANOVA) results revealed that the solvent to sample ratio had a significant influence on all responses, while the extraction time had no statistically significant effect on phenolic compounds. The optimum values of the combination of phenolic compounds and antioxidant activities were obtained for X 1 =30min, X 2 =100W, X 3 =40mL/g, and X 4 =33% (v/v). Five phenolic acids, including chlorogenic acid, caffeic acid, syringic acid, p-coumaric acid and ferulic acid, were analyzed by HPLC. Our results indicated that optimization extraction is vital for the quantification of phenolic compounds and antioxidant activity in LR, which may be contributed to large-scale industrial applications and future pharmacological activities research. Copyright © 2017 Elsevier Ltd. All rights reserved.

  13. Detection of free and covalently bound microcystins in animal tissues by liquid chromatography-tandem mass spectrometry

    International Nuclear Information System (INIS)

    Neffling, Milla-Riina; Lance, Emilie; Meriluoto, Jussi

    2010-01-01

    Microcystins are cyanobacterial hepatotoxins capable of accumulation into animal tissues. The toxins act by inhibiting specific protein phosphatases and both non-covalent and covalent interactions occur. The 2-methyl-3-methoxy-4-phenylbutyric acid (MMPB) method determines the total, i.e. the sum of free and protein-bound microcystin in tissues. The aim of the method development in this paper was to tackle the problems with the MMPB methodology: the rather laborious workflow and the loss of material during different steps of the method. In the optimised workflow the oxidation recovery was of acceptable level (29-40%), the extraction efficiency good (62-97%), but the signal suppression effect from the matrix remained severe in our system (16-37% signal left). The extraction efficiency for the determination of the free, extractable microcystins, was found to be good, 52-100%, depending on the sample and the toxin variant and concentration. - The study concerns method development for the LC-MS-MS analysis of both free and protein-bound microcystin in tissue materials.

  14. Detection of free and covalently bound microcystins in animal tissues by liquid chromatography-tandem mass spectrometry

    Energy Technology Data Exchange (ETDEWEB)

    Neffling, Milla-Riina, E-mail: mneffling@gmail.co [Department of Biochemistry and Pharmacy, Abo Akademi University, Tykistoekatu 6 A, Biocity 3rd floor, FI-20520, Turku (Finland); Lance, Emilie [UMR CNRS Ecobio 6553, University of Rennes 1, Avenue du General Leclerc, 35042, Rennes Cedex (France); Meriluoto, Jussi [Department of Biochemistry and Pharmacy, Abo Akademi University, Tykistoekatu 6 A, Biocity 3rd floor, FI-20520, Turku (Finland)

    2010-03-15

    Microcystins are cyanobacterial hepatotoxins capable of accumulation into animal tissues. The toxins act by inhibiting specific protein phosphatases and both non-covalent and covalent interactions occur. The 2-methyl-3-methoxy-4-phenylbutyric acid (MMPB) method determines the total, i.e. the sum of free and protein-bound microcystin in tissues. The aim of the method development in this paper was to tackle the problems with the MMPB methodology: the rather laborious workflow and the loss of material during different steps of the method. In the optimised workflow the oxidation recovery was of acceptable level (29-40%), the extraction efficiency good (62-97%), but the signal suppression effect from the matrix remained severe in our system (16-37% signal left). The extraction efficiency for the determination of the free, extractable microcystins, was found to be good, 52-100%, depending on the sample and the toxin variant and concentration. - The study concerns method development for the LC-MS-MS analysis of both free and protein-bound microcystin in tissue materials.

  15. Toxicity and genotoxicity in Astyanax bimaculatus (Characidae induced by microcystins from a bloom of Microcystis spp

    Directory of Open Access Journals (Sweden)

    Ricardo Rocha Pavan da Silva

    2010-01-01

    Full Text Available Studies of genotoxicity in fish caused by cyanobacterial microcystins can be useful both in determining the sensitivity of native species, as well as comparing exposure routes. The genotoxicity caused by the microcystins LR and LA from a bloom collected in a eutrophic lake, was revealed in the fish Astyanax bimaculatus, a native species from South America. LC50 (72 h was determined as 242.81 µg L-1 and LD50 (72 h as 49.19 µg kg-1 bw. There was a significant increase of DNA damage in peripheral erythrocytes, following intraperitoneal injection (ip with tested concentrations of 24.58 µg kg-1 bw and 36.88 µg kg-1 bw, as well as through body exposure to a concentration of 103.72 µg L-1. Micronucleus (MN induction was observed after ip injections of 24.58 µg kg-1 bw and 36.88 µg kg-1 bw for 72 h, as well as following body exposure for 72 at 103.72 µg L-1. Thus, both exposure routes resulted in MN induction and DNA damage. Apoptosis-necrosis testing was carried out only by ip injection with concentrations of 24.58 µg -1 bw and 36.88 µg kg-1 bw. Exposure to microcystins at lower concentrations induced more apoptosis than necrosis in peripheral erythrocytes, whereas exposure at higher concentrations gave rise to both conditions. Thus, Astyanax bimaculatus can be considered as a species sensitive to the genotoxic effects caused by microcystins.

  16. Detection of free and covalently bound microcystins in animal tissues by liquid chromatography-tandem mass spectrometry.

    Science.gov (United States)

    Neffling, Milla-Riina; Lance, Emilie; Meriluoto, Jussi

    2010-03-01

    Microcystins are cyanobacterial hepatotoxins capable of accumulation into animal tissues. The toxins act by inhibiting specific protein phosphatases and both non-covalent and covalent interactions occur. The 2-methyl-3-methoxy-4-phenylbutyric acid (MMPB) method determines the total, i.e. the sum of free and protein-bound microcystin in tissues. The aim of the method development in this paper was to tackle the problems with the MMPB methodology: the rather laborious workflow and the loss of material during different steps of the method. In the optimised workflow the oxidation recovery was of acceptable level (29-40%), the extraction efficiency good (62-97%), but the signal suppression effect from the matrix remained severe in our system (16-37% signal left). The extraction efficiency for the determination of the free, extractable microcystins, was found to be good, 52-100%, depending on the sample and the toxin variant and concentration. Copyright (c) 2009 Elsevier Ltd. All rights reserved.

  17. Removal of MCs by Bi2O2CO3: adsorption and the potential of photocatalytic degradation.

    Science.gov (United States)

    Wang, Yujiao; Cao, Yanqiu; Li, Hongmei; Gong, Aijun; Han, Jintao; Qian, Zhen; Chao, Wenran

    2018-04-01

    Microcystins (MCs) is a kind of hepatotoxin, which is the secondary metabolite of cyanobacteria. Bi 2 O 2 CO 3 (BOC) is a kind of cheap and nontoxic semiconductor material. BOC was synthetized by solvothermal method and then microcystin-LR (MC-LR) and microcystin-RR (MC-RR) were removed by BOC, through adsorption and photocatalytic degradation. When the dosage of BOC is 6 g/L, the MC-LR and MC-RR in the natural water sample can be completely adsorbed in 30 min and then after 12 h irradiation, MC-LR and MC-RR were photocatalytically degraded by BOC.

  18. Reproduction impairment and endocrine disruption in female zebrafish after long-term exposure to MC-LR: A life cycle assessment.

    Science.gov (United States)

    Hou, Jie; Li, Li; Wu, Ning; Su, Yujing; Lin, Wang; Li, Guangyu; Gu, Zemao

    2016-01-01

    Microcystin-LR (MC-LR) has been found to cause reproductive and developmental impairments as well as to disrupt sex hormone homeostasis of fish during acute and sub-chronic toxic experiments. However, fish in natural environments are continuously exposed to MC-LR throughout their entire life cycle as opposed to short-term exposure. Here, we tested the hypothesis that the mechanism by which MC-LR harms female fish reproduction and development within natural water bodies is through interference of the reproductive endocrine system. In the present study, zebrafish hatchlings (5 d post-fertilization) were exposed to 0, 0.3, 3 and 30 μg/L MC-LR for 90 d until reaching sexual maturity. Female zebrafish were selected, and the changes in growth and developmental indicators, ovarian ultrastructure as well as the levels of gonadal steroid hormones and vitellogenin (VTG) were examined along with the transcription of related genes in the hypothalamic-pituitary-gonadal-liver axis (HPGL-axis). The results showed for the first time, a life cycle exposure to MC-LR caused growth inhibition, decreased ovary weight and ovarian ultra-pathological lesions. Decreased ovarian testosterone levels indicated that MC-LR disrupted sex steroid hormone balance. Significantly up-regulated transcription of brain FSHβ and LHβ along with ovarian ERα, FSHR and LHR suggested positive feedback regulation in the HPGL-axis was induced as a compensatory mechanism for MC-LR damage. It was also noted that ovarian VTG content and hepatic ERα and VTG1 expression were all down-regulated, which might be responsible for reduced vitellus storage noted in our histological observations. Our findings indicate that a life cycle exposure to MC-LR impairs the development and reproduction of female zebrafish by disrupting the transcription of related HPGL-axis genes, suggesting that MC-LR has potential adverse effects on fish reproduction and thus population dynamics in MCs-contaminated aquatic environment

  19. Microcystin mcyA and mcyE Gene Abundances Are Not Appropriate Indicators of Microcystin Concentrations in Lakes.

    Science.gov (United States)

    Beversdorf, Lucas J; Chaston, Sheena D; Miller, Todd R; McMahon, Katherine D

    2015-01-01

    Cyanobacterial harmful algal blooms (cyanoHABs) are a primary source of water quality degradation in eutrophic lakes. The occurrence of cyanoHABs is ubiquitous and expected to increase with current climate and land use change scenarios. However, it is currently unknown what environmental parameters are important for indicating the presence of cyanoHAB toxins making them difficult to predict or even monitor on time-scales relevant to protecting public health. Using qPCR, we aimed to quantify genes within the microcystin operon (mcy) to determine which cyanobacterial taxa, and what percentage of the total cyanobacterial community, were responsible for microcystin production in four eutrophic lakes. We targeted Microcystis-16S, mcyA, and Microcystis, Planktothrix, and Anabaena-specific mcyE genes. We also measured microcystins and several biological, chemical, and physical parameters--such as temperature, lake stability, nutrients, pigments and cyanobacterial community composition (CCC)--to search for possible correlations to gene copy abundance and MC production. All four lakes contained Microcystis-mcyE genes and high percentages of toxic Microcystis, suggesting Microcystis was the dominant microcystin producer. However, all genes were highly variable temporally, and in few cases, correlated with increased temperature and nutrients as the summer progressed. Interestingly, toxin gene abundances (and biomass indicators) were anti-correlated with microcystin in all lakes except the largest lake, Lake Mendota. Similarly, gene abundance and microcystins differentially correlated to CCC in all lakes. Thus, we conclude that the presence of microcystin genes are not a useful tool for eliciting an ecological role for toxins in the environment, nor are microcystin genes (e.g. DNA) a good indicator of toxins in the environment.

  20. Can we effectively degrade microcystins? - Implications on human health

    DEFF Research Database (Denmark)

    de la Cruz, Armah A; Antoniou, Maria; Hiskia, Anastasia

    2011-01-01

    leading to the disruption of cascade of events important in the regulation and control of cellular processes. Covalent binding of microcystins with phosphatases is thought to be responsible for the cytotoxic and genotoxic effects of microcystins. In addition, microcystins can trigger oxidative stress......Microcystins are cyclic heptapeptide toxins produced by a number of genera of cyanobacteria. They are ubiquitous in bodies of water worldwide and pose significant hazard to human, plant, and animal health. Microcystins are primarily hepatotoxins known to inhibit serine-threonine phosphatases...... harmful bloom events. Combination of conventional and advanced oxidation technologies can potentially remove 100% of microcystins in water even in turbid conditions. This review covers selected treatment technologies to degrade microcystins in water....

  1. Co-Occurrence of Microcystins and Taste-and-Odor Compounds in Drinking Water Source and Their Removal in a Full-Scale Drinking Water Treatment Plant

    Science.gov (United States)

    Feng, Muhua; Xu, Xiangen; Liu, Feifei; Ke, Fan; Li, Wenchao

    2018-01-01

    The co-occurrence of cyanotoxins and taste-and-odor compounds are a growing concern for drinking water treatment plants (DWTPs) suffering cyanobacteria in water resources. The dissolved and cell-bound forms of three microcystin (MC) congeners (MC-LR, MC-RR and MC-YR) and four taste-and-odor compounds (geosmin, 2-methyl isoborneol, β-cyclocitral and β-ionone) were investigated monthly from August 2011 to July 2012 in the eastern drinking water source of Lake Chaohu. The total concentrations of microcystins and taste-and-odor compounds reached 8.86 μg/L and 250.7 ng/L, respectively. The seasonal trends of microcystins were not consistent with those of the taste-and-odor compounds, which were accompanied by dominant species Microcystis and Dolichospermum. The fate of the cyanobacteria and metabolites were determined simultaneously after the processes of coagulation/flocculation, sedimentation, filtration and chlorination in the associated full-scale DWTP. The dissolved fractions with elevated concentrations were detected after some steps and the breakthrough of cyanobacteria and metabolites were even observed in finished water. Chlorophyll-a limits at intake were established for the drinking water source based on our investigation of multiple metabolites, seasonal variations and their elimination rates in the DWTP. Not only microcystins but also taste-and-odor compounds should be taken into account to guide the management in source water and in DWTPs. PMID:29301296

  2. Reproduction impairment and endocrine disruption in female zebrafish after long-term exposure to MC-LR: A life cycle assessment

    International Nuclear Information System (INIS)

    Hou, Jie; Li, Li; Wu, Ning; Su, Yujing; Lin, Wang; Li, Guangyu; Gu, Zemao

    2016-01-01

    Microcystin-LR (MC-LR) has been found to cause reproductive and developmental impairments as well as to disrupt sex hormone homeostasis of fish during acute and sub-chronic toxic experiments. However, fish in natural environments are continuously exposed to MC-LR throughout their entire life cycle as opposed to short-term exposure. Here, we tested the hypothesis that the mechanism by which MC-LR harms female fish reproduction and development within natural water bodies is through interference of the reproductive endocrine system. In the present study, zebrafish hatchlings (5 d post-fertilization) were exposed to 0, 0.3, 3 and 30 μg/L MC-LR for 90 d until reaching sexual maturity. Female zebrafish were selected, and the changes in growth and developmental indicators, ovarian ultrastructure as well as the levels of gonadal steroid hormones and vitellogenin (VTG) were examined along with the transcription of related genes in the hypothalamic–pituitary–gonadal–liver axis (HPGL-axis). The results showed for the first time, a life cycle exposure to MC-LR caused growth inhibition, decreased ovary weight and ovarian ultra-pathological lesions. Decreased ovarian testosterone levels indicated that MC-LR disrupted sex steroid hormone balance. Significantly up-regulated transcription of brain FSHβ and LHβ along with ovarian ERα, FSHR and LHR suggested positive feedback regulation in the HPGL-axis was induced as a compensatory mechanism for MC-LR damage. It was also noted that ovarian VTG content and hepatic ERα and VTG1 expression were all down-regulated, which might be responsible for reduced vitellus storage noted in our histological observations. Our findings indicate that a life cycle exposure to MC-LR impairs the development and reproduction of female zebrafish by disrupting the transcription of related HPGL-axis genes, suggesting that MC-LR has potential adverse effects on fish reproduction and thus population dynamics in MCs-contaminated aquatic

  3. Critical Role of Endoplasmic Reticulum Stress in Cognitive Impairment Induced by Microcystin-LR

    Directory of Open Access Journals (Sweden)

    Fei Cai

    2015-11-01

    Full Text Available Recent studies showed that cyanobacteria-derived microcystin-leucine-arginine (MCLR can cause hippocampal pathological damage and trigger cognitive impairment; but the underlying mechanisms have not been well understood. The objective of the present study was to investigate the mechanism of MCLR-induced cognitive deficit; with a focus on endoplasmic reticulum (ER stress. The Morris water maze test and electrophysiological study demonstrated that MCLR caused spatial memory injury in male Wistar rats; which could be inhibited by ER stress blocker; tauroursodeoxycholic acid (TUDCA. Meanwhile; real-time polymerase chain reaction (real-time PCR and immunohistochemistry demonstrated that the expression level of the 78-kDa glucose-regulated protein (GRP78; C/EBP homologous protein (CHOP and caspase 12 were significantly up-regulated. These effects were rescued by co-administration of TUDCA. In agreement with this; we also observed that treatment of rats with TUDCA blocked the alterations in ER ultrastructure and apoptotic cell death in CA1 neurons from rats exposed to MCLR. Taken together; the present results suggested that ER stress plays an important role in potential memory impairments in rats treated with MCLR; and amelioration of ER stress may serve as a novel strategy to alleviate damaged cognitive function triggered by MCLR.

  4. Microcystin accumulation and potential effects on antioxidant capacity of leaves and fruits of Capsicum annuum.

    Science.gov (United States)

    Drobac, Damjana; Tokodi, Nada; Kiprovski, Biljana; Malenčić, Djordje; Važić, Tamara; Nybom, Sonja; Meriluoto, Jussi; Svirčev, Zorica

    2017-01-01

    Surface water, often used for irrigation purposes, may sometimes be contaminated with blooming cyanobacteria and thereby may contain their potent and harmful toxins. Cyanotoxins adversely affect many terrestrial plants, and accumulate in plant tissues that are subsequently ingested by humans. Studies were undertaken to (1) examine the bioaccumulation of microcystins (MCs) in leaves and fruits of pepper Capsicum annuum and (2) examine the potential effects of MCs on antioxidant capacity of these organs. Plants were irrigated with water containing MCs for a period of 3 mo. Data showed that MCs did not accumulate in leaves; however, in fruits the presence of the MC-LR (0.118 ng/mg dry weight) and dmMC-LR (0.077 ng/mg dry weight) was detected. The concentrations of MC-LR in fruit approached the acceptable guideline values and tolerable daily intake for this toxin. Lipid peroxidation levels and flavonoids content were significantly enhanced in both organs of treated plants, while total phenolic concentrations were not markedly variable between control and treated plants. Significant decrease in 1,1-diphenyl-2-picrylhydrazyl (DPPH) scavenging capacity was noted for both organs. The levels of superoxide anion in fruits and hydroxyl radical in leaves were markedly reduced. Data suggest that exposure to MCs significantly reduced antioxidant capacity of experimental plants, indicating that MCs affected antioxidant systems in C. annuum.

  5. Methods for determining microcystins (peptide hepatotoxins) and microcystin-producing cyanobacteria.

    Science.gov (United States)

    Sangolkar, Lalita N; Maske, Sarika S; Chakrabarti, Tapan

    2006-11-01

    Episodes of cyanobacterial toxic blooms and fatalities to animals and humans due to cyanobacterial toxins (CBT) are known worldwide. The hepatotoxins and neurotoxins (cyanotoxins) produced by bloom-forming cyanobacteria have been the cause of human and animal health hazards and even death. Prevailing concentration of cell bound endotoxin, exotoxin and the toxin variants depend on developmental stages of the bloom and the cyanobacterial (CB) species involved. Toxic and non-toxic strains do not show any predictable morphological difference. The current instrumental, immunological and molecular methods applied for determining microcystins (peptide hepatotoxins) and microcystin-producing cyanobacteria are reviewed.

  6. An integrated omic analysis of hepatic alteration in medaka fish chronically exposed to cyanotoxins with possible mechanisms of reproductive toxicity.

    Science.gov (United States)

    Qiao, Qin; Le Manach, Séverine; Huet, Hélène; Duvernois-Berthet, Evelyne; Chaouch, Soraya; Duval, Charlotte; Sotton, Benoit; Ponger, Loïc; Marie, Arul; Mathéron, Lucrèce; Lennon, Sarah; Bolbach, Gérard; Djediat, Chakib; Bernard, Cécile; Edery, Marc; Marie, Benjamin

    2016-12-01

    Cyanobacterial blooms threaten human health as well as the population of other living organisms in the aquatic environment, particularly due to the production of natural toxic components, the cyanotoxin. So far, the most studied cyanotoxins are microcystins (MCs). In this study, the hepatic alterations at histological, proteome and transcriptome levels were evaluated in female and male medaka fish chronically exposed to 1 and 5 μg L -1 microcystin-LR (MC-LR) and to the extract of MC-producing Microcystis aeruginosa PCC 7820 (5 μg L -1 of equivalent MC-LR) by balneation for 28 days, aiming at enhancing our understanding of the potential reproductive toxicity of cyanotoxins in aquatic vertebrate models. Indeed, both MC and Microcystis extract adversely affect reproductive parameters including fecundity and egg hatchability. The liver of toxin treated female fish present glycogen storage loss and cellular damages. The quantitative proteomics analysis revealed that the quantities of 225 hepatic proteins are dysregulated. In particular, a notable decrease in protein quantities of vitellogenin and choriogenin was observed, which could explain the decrease in reproductive output. Liver transcriptome analysis through Illumina RNA-seq reveals that over 100-400 genes are differentially expressed under 5 μg L -1  MC-LR and Microcystis extract treatments, respectively. Ingenuity pathway analysis of the omic data attests that various metabolic pathways, such as energy production, protein biosynthesis and lipid metabolism, are disturbed by both MC-LR and the Microcystis extract, which could provoke the observed reproductive impairment. The transcriptomics analysis also constitutes the first report of the impairment of circadian rhythm-related gene induced by MCs. This study contributes to a better understanding of the potential consequences of chronic exposure of fish to environmental concentrations of cyanotoxins, suggesting that Microcystis extract could impact a

  7. Adaptive local surface refinement based on LR NURBS and its application to contact

    Science.gov (United States)

    Zimmermann, Christopher; Sauer, Roger A.

    2017-12-01

    A novel adaptive local surface refinement technique based on Locally Refined Non-Uniform Rational B-Splines (LR NURBS) is presented. LR NURBS can model complex geometries exactly and are the rational extension of LR B-splines. The local representation of the parameter space overcomes the drawback of non-existent local refinement in standard NURBS-based isogeometric analysis. For a convenient embedding into general finite element codes, the Bézier extraction operator for LR NURBS is formulated. An automatic remeshing technique is presented that allows adaptive local refinement and coarsening of LR NURBS. In this work, LR NURBS are applied to contact computations of 3D solids and membranes. For solids, LR NURBS-enriched finite elements are used to discretize the contact surfaces with LR NURBS finite elements, while the rest of the body is discretized by linear Lagrange finite elements. For membranes, the entire surface is discretized by LR NURBS. Various numerical examples are shown, and they demonstrate the benefit of using LR NURBS: Compared to uniform refinement, LR NURBS can achieve high accuracy at lower computational cost.

  8. Comparative Measurement of Microcystins in Diverse Surface ...

    Science.gov (United States)

    The measurement of microcystins, cyanotoxins associated with cyanobacterial blooms which are increasingly prevalent in inland waters, is complicated by the diversity of congeners which have been observed in the environment. At present, more than 150 microcystin congeners have been identified, and this poses a significant challenge to analytical methods intended to assess human health risks in surface and drinking water systems. The most widely employed analytical method at present is the ADDA-ELISA technique which is potentially sensitive to all microcystins, but it is primarily intended as a semi-quantitative method, and questions have been raised regarding the potential for cross-reactivity and false positives. LC-MS/MS methods targeting specific congeners, such as US EPA Method 544, are intended for use as a secondary confirmation following a positive ELISA response, but these techniques can target only those congeners for which commercial standards are available. Accordingly, they are not suitable for ascertaining the safety of a given water sample, given the potential for omitting unknown microcystin congeners which might be present.An alternative approach involves oxidative transformation of microcystins to a common product, 2-methyl-3-methoxy-4-phenylbutyric acid, or MMPB. Measuring MMPB by LC-MS/MS can potentially provide a metric for the sum of all microcystin congeners present in a sample, subject to the efficiency and overall yield of conversion. The

  9. Identification of microcystins from three collection strains of Microcystis aeruginosa

    International Nuclear Information System (INIS)

    Campo, Francisca F. del; Ouahid, Youness

    2010-01-01

    Microcystins (MCs) are toxic cyclic heptapeptides produced by various cyanobacteria genera, especially Microcystis. We identified 10 out of 12 MCs produced by three Microcystis aeruginosa strains from cyanobacteria collections, UTEX 2666, UTEX 2670 and UAM 1303, by using two analytical methods: Matrix-assisted Laser Desorption Ionization Time of Flight Mass Spectrometry (MALDI-TOF/MS) and HPLC Photodiode Array Detector coupled to a hybrid Quadrupole Time of Flight Mass Spectrometry (HPLC-PDA-QTOF/MS). MALDI-TOF/MS failed to detect non-polar MCs, such as MC-LY and MC-LW. HPLC-QTOF/MS permitted the accurate identification of most MCs present in methanolic extracts. Besides, three new MCs, namely: [D-Glu(OCH 3 ) 6 , D-Asp 3 ] MC-LAba, MC-YL and MC-YM were detected by HPLC-QTOF/MS. - Three new microcystin variants identified by HPLC-QTOF/MS.

  10. Microcystin-LR detection in water by the Fabry-Pérot interferometer using an optical fibre coated with a sol-gel imprinted sensing membrane.

    Science.gov (United States)

    Queirós, Raquel B; Silva, S O; Noronha, J P; Frazão, O; Jorge, P; Aguilar, G; Marques, P V S; Sales, M G F

    2011-05-15

    Cyanobacteria deteriorate the water quality and are responsible for emerging outbreaks and epidemics causing harmful diseases in Humans and animals because of their toxins. Microcystin-LR (MCT) is one of the most relevant cyanotoxin, being the most widely studied hepatotoxin. For safety purposes, the World Health Organization recommends a maximum value of 1 μg L(-1) of MCT in drinking water. Therefore, there is a great demand for remote and real-time sensing techniques to detect and quantify MCT. In this work a Fabry-Pérot sensing probe based on an optical fibre tip coated with a MCT selective thin film is presented. The membranes were developed by imprinting MCT in a sol-gel matrix that was applied over the tip of the fibre by dip coating. The imprinting effect was obtained by curing the sol-gel membrane, prepared with (3-aminopropyl) trimethoxysilane (APTMS), diphenyl-dimethoxysilane (DPDMS), tetraethoxysilane (TEOS), in the presence of MCT. The imprinting effect was tested by preparing a similar membrane without template. In general, the fibre Fabry-Pérot with a Molecular Imprinted Polymer (MIP) sensor showed low thermal effect, thus avoiding the need of temperature control in field applications. It presented a linear response to MCT concentration within 0.3-1.4 μg L(-1) with a sensitivity of -12.4±0.7 nm L μg(-1). The corresponding Non-Imprinted Polymer (NIP) displayed linear behaviour for the same MCT concentration range, but with much less sensitivity, of -5.9±0.2 nm L μg(-1). The method shows excellent selectivity for MCT against other species co-existing with the analyte in environmental waters. It was successfully applied to the determination of MCT in contaminated samples. The main advantages of the proposed optical sensor include high sensitivity and specificity, low-cost, robustness, easy preparation and preservation. Copyright © 2011 Elsevier B.V. All rights reserved.

  11. Occurrence of Toxic Cyanobacterial Blooms in Rio de la Plata Estuary, Argentina: Field Study and Data Analysis

    Science.gov (United States)

    Giannuzzi, L.; Carvajal, G.; Corradini, M. G.; Araujo Andrade, C.; Echenique, R.; Andrinolo, D.

    2012-01-01

    Water samples were collected during 3 years (2004–2007) at three sampling sites in the Rio de la Plata estuary. Thirteen biological, physical, and chemical parameters were determined on the water samples. The presence of microcystin-LR in the reservoir samples, and also in domestic water samples, was confirmed and quantified. Microcystin-LR concentration ranged between 0.02 and 8.6 μg.L−1. Principal components analysis was used to identify the factors promoting cyanobacteria growth. The proliferation of cyanobacteria was accompanied by the presence of high total and fecal coliforms bacteria (>1500 MNP/100 mL), temperature ≥25°C, and total phosphorus content ≥1.24 mg·L−1. The observed fluctuating patterns of Microcystis aeruginosa, total coliforms, and Microcystin-LR were also described by probabilistic models based on the log-normal and extreme value distributions. The sampling sites were compared in terms of the distribution parameters and the probability of observing high concentrations for Microcystis aeruginosa, total coliforms, and microcystin-LR concentration. PMID:22523486

  12. Optimization of laboratory scale production and purification of ...

    African Journals Online (AJOL)

    Microcystin content is however highly variable and optimised culture conditions are essential to produce viable yields of microcystin for purification. We describe the optimization of culture conditions and evaluation of various purification methods to enhance the yield of microcystin from laboratory scale culture.

  13. SCREENING OF Lr GENES PROVIDING RESISTANCE TO LEAF RUST IN WHEATH USING MULTIPLEX PCR METHOD

    Directory of Open Access Journals (Sweden)

    Mehmet AYBEKE

    2015-12-01

    Full Text Available Leaf rust is a fungal disease in wheat that causes significant decrease in yield around the world. In Turkey, several genes, including leaf rust-resistant (Lr Lr9, Lr19, Lr24 and Lr28, have been found to induce disease resistance. To obtain resistant cultivars during the breeding process, screening of these genes in various specimens is crucial. Thus, we aimed in the present study primarily to improve the multiplex polymerase chain reaction (PCR methodology by which four Lr genes could be simultaneously screened in plant samples carrying these genes. Serial PCR experiments were carried out for determination of optimal PCR conditions for each Lr gene and in all studies nursery lines were used. PCR conditions were determined as follows: 35 cycles of 95°C for denaturation (30 s, 58°C for annealing (30 s and 72°C for elongation (60 s, with an initial 94°C denaturation (3 min and a 72°C extension (30 min. The primers used in the PCR runs were as follows: Lr9F: TCCTTTTATTCCGCACGCCGG, Lr9R: CCACACTACCCCAAAGAGACG; Lr19F: CATCCTTGGGGACCTC, Lr19R: CCAGCTCGCATACATCCA; Lr24F: TCTAGTCTGTACATGGGGGC, Lr24R: TGGCACATGAACTCCATACG; Lr28F: CCCGGCATAAGTCTATGGTT, Lr28R: CAATGAATGAGATACGTGAA. We found that the optimum annealing temperature for all four genes was 61°C and extension temperatures were 62°C or 64°C. Finally, using this new PCR method, we successfully screened these genes in specimens carrying only one single Lr gene. Optimal multiplex PCR conditions were; denaturation at 94°C for 1 min, 35 extension cycles [94°C for 30 s, 57–61ºC (ideal 61°C for 30 s, and 64–68°C for 2 min] and final extension at 72°C for 30 min. In addition, we achieved positive results when running the optimised multiplex PCR tests on Lr19, Lr24 and Lr28. Future studies are planned to expand new wide multiplex PCR method to include all other Lr genes.

  14. Fast screening and quantitation of microcystins in microalgae dietary supplement products and water by liquid chromatography coupled to time of flight mass spectrometry

    International Nuclear Information System (INIS)

    Ortelli, Didier; Edder, Patrick; Cognard, Emmanuelle; Jan, Philippe

    2008-01-01

    Cyanobacteria, commonly called 'blue-green algae', may accumulate in surface water supplies as 'blooms' and may concentrate on the surface as blue-green 'scums'. Some species of cyanobacteria produce toxins and are of relevance to water supplies and to microalgae dietary supplements. To ensure the safety of drinking water and blue-green algae products, analyses are the only way to determine the presence or absence of toxins. This paper shows the use of ultra performance liquid chromatography (UPLC) coupled to orthogonal acceleration time of flight (TOF) mass spectrometry for the detection and quantitation of microcystins. The method presented is very sensitive, simple, fast, robust and did not require fastidious clean-up step. Limits of detection of 0.1 μg L -1 in water and 0.1-0.2 μg g -1 in microalgae samples were achieved. Method performances were satisfactory and appropriate for monitoring of water and dietary supplements. The method was applied in routine to samples taken from Swiss market or buy on internet website. Among 19 samples, six showed the presence of microcystins LR and LA at harmful levels

  15. First Identification of the Toxicity of Microcystins on Pancreatic Islet Function in Humans and the Involved Potential Biomarkers.

    Science.gov (United States)

    Zhao, Yanyan; Xue, Qingju; Su, Xiaomei; Xie, Liqiang; Yan, Yunjun; Wang, Lixiao; Steinman, Alan D

    2016-03-15

    Microcystins (MCs) produced by cyanobacteria have been recognized as a major public health threat. However, the toxicity of MCs to humans is still largely unknown. In this study, we examined the changes in pancreatic islet function in fishers exposed to ambient levels of MCs at Lake Taihu and, using a mouse model, explored the molecular mechanisms involved in toxicity. MCs content in the serum of fishers tested positive, with a range from 0.10 to 0.64 μg/L. Both lower blood insulin levels (2.26 ± 0.96 μIU/mL) and impaired fasting glucose were found in participants from the Meiliang Bay area in Lake Taihu, where MC-LR levels were substantially greater than the MC threshold established by WHO for drinking water. Animal experiments showed that glucose level increased by 27.9% in mice exposed to 5 μg/kg bw and decreased by 41.5% in mice exposed to 20 μg/kg bw. Blood insulin levels declined by 21.9% and 56.2% in mice exposed to 5 and 20 μg/kg bw MC-LR, respectively, which was consistent with the results observed in fishers. Furthermore, the diabetes gene pdx1 and several other proteins (such as Ppp3ca, Ide, Marcks, Pgk1, Suclg1, Ndufs4) involved in insulin secretion were identified for the first time in mice following MC-LR exposure; these biomarkers were considered responsible for MC-LR induced islet dysfunction. This study suggests that subchronic exposure to environmental levels of MCs may increase the risk of the occurrence of diabetes in humans.

  16. Heterologous expression of mlrA in a photoautotrophic host - Engineering cyanobacteria to degrade microcystins.

    Science.gov (United States)

    Dexter, Jason; Dziga, Dariusz; Lv, Jing; Zhu, Junqi; Strzalka, Wojciech; Maksylewicz, Anna; Maroszek, Magdalena; Marek, Sylwia; Fu, Pengcheng

    2018-06-01

    In this report, we establish proof-of-principle demonstrating for the first time genetic engineering of a photoautotrophic microorganism for bioremediation of naturally occurring cyanotoxins. In model cyanobacterium Synechocystis sp. PCC 6803 we have heterologously expressed Sphingopyxis sp. USTB-05 microcystinase (MlrA) bearing a 23 amino acid N-terminus secretion peptide from native Synechocystis sp. PCC 6803 PilA (sll1694). The resultant whole cell biocatalyst displayed about 3 times higher activity against microcystin-LR compared to a native MlrA host (Sphingomonas sp. ACM 3962), normalized for optical density. In addition, MlrA activity was found to be almost entirely located in the cyanobacterial cytosolic fraction, despite the presence of the secretion tag, with crude cellular extracts showing MlrA activity comparable to extracts from MlrA expressing E. coli. Furthermore, despite approximately 9.4-fold higher initial MlrA activity of a whole cell E. coli biocatalyst, utilization of a photoautotrophic chassis resulted in prolonged stability of MlrA activity when cultured under semi-natural conditions (using lake water), with the heterologous MlrA biocatalytic activity of the E. coli culture disappearing after 4 days, while the cyanobacterial host displayed activity (3% of initial activity) after 9 days. In addition, the cyanobacterial cell density was maintained over the duration of this experiment while the cell density of the E. coli culture rapidly declined. Lastly, failure to establish a stable cyanobacterial isolate expressing native MlrA (without the N-terminus tag) via the strong cpcB560 promoter draws attention to the use of peptide tags to positively modulate expression of potentially toxic proteins. Copyright © 2018 Elsevier Ltd. All rights reserved.

  17. Microcystin in cyanobacterial blooms in a Chilean lake.

    Science.gov (United States)

    Campos, V; Cantarero, S; Urrutia, H; Heinze, R; Wirsing, B; Neumann, U; Weckesser, J

    1999-05-01

    Cyanobacterial blooms dominated by Microcystis sp. occurred in lake Rocuant ("marisma", near Concepción/Chile) in February 1995 and 1996. In the bloom samples collected in both years the hepatotoxin microcystin was detected by RP-HPLC in both samples and in the sample of 1995 also by a toxicity assay using primary rat hepatocytes. In the bloom of 1995, the microcystin content of the dry bloom biomass was determined to be 130 micrograms/g on the basis of the RP-HPLC peak area and 800 micrograms/g on the basis of the rat hepatotoxicity assay, respectively. In the bloom of 1996, RP-HPLC analysis revealed a microcystin content of 8.13 micrograms/g bloom material dry weight. In this year no hepatotoxicity was measured using a concentration range up to 0.8 mg (d. w.) of bloom material per ml in the rat hepatotoxicity assay. This is the first report on the detection of microcystins in Chilean water bodies.

  18. Effect of chlorination by-products on the quantitation of microcystins in finished drinking water.

    Science.gov (United States)

    Rosenblum, Laura; Zaffiro, Alan; Adams, William A; Wendelken, Steven C

    2017-11-01

    Microcystins are toxic peptides that can be produced by cyanobacteria in harmful algal blooms (HABs). Various analytical techniques have been developed to quantify microcystins in drinking water, including liquid chromatography tandem mass spectrometry (LC/MS/MS), enzyme linked immunosorbent assay (ELISA), and oxidative cleavage to produce 2-methyl-3-methoxy-4-phenylbutyric acid (MMPB) with detection by LC/MS/MS, the "MMPB method". Both the ELISA and MMPB methods quantify microcystins by detecting a portion of the molecule common to most microcystins. However, there is little research evaluating the effect of microcystin chlorination by-products potentially produced during drinking water treatment on analytical results. To evaluate this potential, chlorinated drinking water samples were fortified with various microcystin congeners in bench-scale studies. The samples were allowed to react, followed by a comparison of microcystin concentrations measured using the three methods. The congener-specific LC/MS/MS method selectively quantified microcystins and was not affected by the presence of chlorination by-products. The ELISA results were similar to those obtained by LC/MS/MS for most microcystin congeners, but results deviated for a particular microcystin containing a variable amino acid susceptible to oxidation. The concentrations measured by the MMPB method were at least five-fold higher than the concentrations of microcystin measured by the other methods and demonstrate that detection of MMPB does not necessarily correlate to intact microcystin toxins in finished drinking water. Published by Elsevier Ltd.

  19. Microcystis aeruginosa : source of toxic microcystins in drinking water

    African Journals Online (AJOL)

    , which is the most common toxic cyanobacterium in eutrophic freshwater. The association of environmental parameters with cyanobacterial blooms and the toxicity of microcystin are discussed. Also, the synthesis of the microcystins, as well as ...

  20. Sublethal microcystin exposure and biochemical outcomes among hemodialysis patients

    Science.gov (United States)

    Cyanobacteria are commonly-occurring contaminants of surface waters worldwide. Microcystins, potent hepatotoxins, are among the best characterized cyanotoxins. During November, 2001, a group of 44 hemodialysis patients were exposed to microcystins via contaminated dialysate. Seru...

  1. Metagenomic identification of bacterioplankton taxa and pathways involved in microcystin degradation in lake erie.

    Directory of Open Access Journals (Sweden)

    Xiaozhen Mou

    Full Text Available Cyanobacterial harmful blooms (CyanoHABs that produce microcystins are appearing in an increasing number of freshwater ecosystems worldwide, damaging quality of water for use by human and aquatic life. Heterotrophic bacteria assemblages are thought to be important in transforming and detoxifying microcystins in natural environments. However, little is known about their taxonomic composition or pathways involved in the process. To address this knowledge gap, we compared the metagenomes of Lake Erie free-living bacterioplankton assemblages in laboratory microcosms amended with microcystins relative to unamended controls. A diverse array of bacterial phyla were responsive to elevated supply of microcystins, including Acidobacteria, Actinobacteria, Bacteroidetes, Planctomycetes, Proteobacteria of the alpha, beta, gamma, delta and epsilon subdivisions and Verrucomicrobia. At more detailed taxonomic levels, Methylophilales (mainly in genus Methylotenera and Burkholderiales (mainly in genera Bordetella, Burkholderia, Cupriavidus, Polaromonas, Ralstonia, Polynucleobacter and Variovorax of Betaproteobacteria were suggested to be more important in microcystin degradation than Sphingomonadales of Alphaproteobacteria. The latter taxa were previously thought to be major microcystin degraders. Homologs to known microcystin-degrading genes (mlr were not overrepresented in microcystin-amended metagenomes, indicating that Lake Erie bacterioplankton might employ alternative genes and/or pathways in microcystin degradation. Genes for xenobiotic metabolism were overrepresented in microcystin-amended microcosms, suggesting they are important in bacterial degradation of microcystin, a phenomenon that has been identified previously only in eukaryotic systems.

  2. Ingestion of microcystins by Daphnia: Intestinal uptake and toxic effects

    DEFF Research Database (Denmark)

    Rohrlack, T.; Christoffersen, K.; Dittmann, E.

    2005-01-01

    We investigated the intestinal uptake and adverse effects of microcystins ingested with Microcystis on Daphnia galeata. The gut structure, blood microcystin concentration, appearance, and movements of Daphnia fed Microcystis PCC 7806 or a microcystin-deficient PCC 7806 mutant were monitored over ...

  3. Risk of combined exposure of birds to cyanobacterial biomass containing microcystins, acetylcholinesterase inhibitor and anticoagulant.

    Science.gov (United States)

    Ondracek, Karel; Bandouchova, Hana; Damkova, Veronika; Hilscherova, Klara; Kral, Jiri; Osickova, Jitka; Mlcakova, Veronika; Pohanka, Miroslav; Skochova, Hana; Vitula, Frantisek; Treml, Frantisek; Pikula, Jiri

    2012-01-01

    The objective of this study was to examine the hypothesis that a combination of cyanobacterial biomass containing microcystins, acetylcholinesterase inhibitor and anticoagulant can enhance avian toxic effects produced by single exposures only. A total of 48 two-month-old Japanese quails (Coturnix coturnix japonica) with average body weight of 160 g were randomly divided into 8 experimental groups of six birds and sex ratio of 1:1. Experimental groups of control Japanese quails (C) and birds exposed to single and combined sub-lethal doses of paraoxon (P), bromadiolone (B), and microcystins in cyanobacterial biomass (M) included: C, P, P+B, B, B+M, P+M, M, and P+B+M. During the 10-day exposure birds in the respective groups received biomass containing 61.62 µg microcystins daily (i.e. 26.54 µg MC-RR, 7.62 µg MC-YR and 27.39 µg MC-LR), two 250 μg/kg doses of paraoxon, and two 500 mg/kg doses of bromadiolone. Group responses were compared using standard plasma biochemistry and antioxidant/oxidative stress parameters in tissues. While single and double combinations of toxicants induced responses in individual biochemical parameters measured and evaluated using univariate statistical analysis, those in the triple exposure were most extensive. The principal component analysis of antioxidant/oxidative stress parameters (glutathione reductase, lipid peroxidation, and ferric reducing antioxidant power) in tissues (liver, kidney, heart, brain, lungs, gonads, and pectoralis major muscle) clearly separated the triple group (P+B+M) from all single and double exposure groups and the control and indicated thus marked joint effects in the overall pattern of antioxidant/oxidative stress responses of this group. The separation was driven by the modification of the ferric reducing antioxidant power levels in heart and brain and the cardiac lipid peroxidation level, in particular. This experiment contributes to the understanding of the pathogenic mechanisms of combined sub

  4. Hot and toxic: Temperature regulates microcystin release from cyanobacteria.

    Science.gov (United States)

    Walls, Jeremy T; Wyatt, Kevin H; Doll, Jason C; Rubenstein, Eric M; Rober, Allison R

    2018-01-01

    The mechanisms regulating toxin release by cyanobacteria are poorly understood despite the threat cyanotoxins pose to water quality and human health globally. To determine the potential for temperature to regulate microcystin release by toxin-producing cyanobacteria, we evaluated seasonal patterns of water temperature, cyanobacteria biomass, and extracellular microcystin concentration in a eutrophic freshwater lake dominated by Planktothrix agardhii. We replicated seasonal variation in water temperature in a concurrent laboratory incubation experiment designed to evaluate cause-effect relationships between temperature and toxin release. Lake temperature ranged from 3 to 27°C and cyanobacteria biomass increased with warming up to 18°C, but declined rapidly thereafter with further increases in temperature. Extracellular microcystin concentration was tightly coupled with temperature and was most elevated between 20 and 25°C, which was concurrent with the decline in cyanobacteria biomass. A similar trend was observed in laboratory incubations where productivity-specific microcystin release was most elevated between 20 and 25°C and then declined sharply at 30°C. We applied generalized linear mixed modeling to evaluate the strength of water temperature as a predictor of cyanobacteria abundance and microcystin release, and determined that warming≥20°C would result in a 36% increase in microcystin release when Chlorophyll a was ≤50μgl -1 . These results show a temperature threshold for toxin release in P. agardhii, which demonstrates a potential to use water temperature to forecast bloom severity in eutrophic lakes where blooms can persist year-round with varying degrees of toxicity. Copyright © 2017 Elsevier B.V. All rights reserved.

  5. Microcystin Prevalence throughout Lentic Waterbodies in Coastal Southern California

    Directory of Open Access Journals (Sweden)

    Meredith D. A. Howard

    2017-07-01

    Full Text Available Toxin producing cyanobacterial blooms have increased globally in recent decades in both frequency and intensity. Despite the recognition of this growing risk, the extent and magnitude of cyanobacterial blooms and cyanotoxin prevalence is poorly characterized in the heavily populated region of southern California. Recent assessments of lentic waterbodies (depressional wetlands, lakes, reservoirs and coastal lagoons determined the prevalence of microcystins and, in some cases, additional cyanotoxins. Microcystins were present in all waterbody types surveyed although toxin concentrations were generally low across most habitats, as only a small number of sites exceeded California’s recreational health thresholds for acute toxicity. Results from passive samplers (Solid Phase Adsorption Toxin Tracking (SPATT indicated microcystins were prevalent throughout lentic waterbodies and that traditional discrete samples underestimated the presence of microcystins. Multiple cyanotoxins were detected simultaneously in some systems, indicating multiple stressors, the risk of which is uncertain since health thresholds are based on exposures to single toxins. Anatoxin-a was detected for the first time from lakes in southern California. The persistence of detectable microcystins across years and seasons indicates a low-level, chronic risk through both direct and indirect exposure. The influence of toxic cyanobacterial blooms is a more complex stressor than presently recognized and should be included in water quality monitoring programs.

  6. Detection of microcystin and other cyanotoxins in lakes at Isle Royale National Park, Pictured Rocks National Lakeshore, and Sleeping Bear Dunes National Lakeshore, northern Michigan, 2012–13

    Science.gov (United States)

    Fuller, Lori M.; Brennan, Angela K.; Fogarty, Lisa R.; Loftin, Keith A.; Johnson, Heather E.; VanderMeulen, David D.; Lafrancois, Brenda Moraska

    2017-12-05

    is filtered surface water.Approximately 18 percent of the samples (39 of 211 samples) were analyzed by LC/MS/MS to confirm the ELISA results and to evaluate the samples for a larger suite of algal toxins. In general, the microcystin results between the ELISA and LC/MS/MS methods were similar; although, the ELISA results tended to be slightly higher than the summation of LC/MS/MS microcystin congeners. The slightly higher ELISA results might be because the ELISA microcystin method is reactive with the ADDA functional group common to all microcystins, and because not all microcystin congeners are included in the LC/MS/MS method. The LC/MS/MS method indicated that the congener microcystin-LR was the most frequently detected, followed by microcystin-WR and microcystin-YR.Sixteen of the lakes included in this study also were monitored by the NPS for nutrients. Total phosphorus (TP) concentrations were, on average, highest at the ISRO lakes, whereas total nitrogen (TN) concentrations were highest at SLBE. The average annual TN:TP ratios for the 16 lakes within the national park and national lakeshores ranged from ratios of 20 to 89. Overall, results indicated a slight increase in percentage of microcystin detections with an increase in the TN:TP ratio (R-squared 0.269 and 0.340, respectively [2012 and 2013 combined dataset] derived from linear regression).This study also indicated that even in the absence of visible algal blooms, microcystin may be present. Most microcystin concentrations did not exceed the EPA’s 10-day health advisory drinking-water benchmark. In general, these results provide a useful baseline with which to evaluate potential future changes in algal toxin concentrations.

  7. Chlorination and ozonation differentially reduced the microcystin content and tumour promoting activity of a complex cyanobacterial extract

    Czech Academy of Sciences Publication Activity Database

    Sovadinová, I.; Babica, Pavel; Adamovský, O.; Alpatova, A.; Tarabara, V.; Upham, B. L.; Bláha, L.

    2017-01-01

    Roč. 8, č. 1 (2017), s. 107-120 ISSN 1947-573X Institutional support: RVO:67985939 Keywords : microcystin * chlorination * ozonation * water treatment * toxicity Subject RIV: DJ - Water Pollution ; Quality OBOR OECD: Environmental sciences (social aspects to be 5.7)

  8. Differentiation between microcystin contaminated and uncontaminated fish by determination of unconjugated MCs using an ELISA anti-Adda test based on receiver-operating characteristic curves threshold values: application to Tinca tinca from natural ponds.

    Science.gov (United States)

    Moreno, Isabel María; Herrador, M Ángeles; Atencio, Loyda; Puerto, María; González, A Gustavo; Cameán, Ana María

    2011-02-01

    The aim of this study was to evaluate whether the enzyme-linked immunosorbent assay (ELISA) anti-Adda technique could be used to monitor free microcystins (MCs) in biological samples from fish naturally exposed to toxic cyanobacteria by using receiver operating characteristic (ROC) curve software to establish an optimal cut-off value for MCs. The cut-off value determined by ROC curve analysis in tench (Tinca tinca) exposed to MCs under laboratory conditions by ROC curve analysis was 5.90-μg MCs/kg tissue dry weight (d.w.) with a sensitivity of 93.3%. This value was applied in fish samples from natural ponds (Extremadura, Spain) in order to asses its potential MCs bioaccumulation by classifying samples as either true positive (TP), false positive (FP), true negative (TN), or false negative (FN). In this work, it has been demonstrated that toxic cyanobacteria, mainly Microcystis aeruginosa, Aphanizomenon issatchenkoi, and Anabaena spiroides, were present in two of these ponds, Barruecos de Abajo (BDown) and Barruecos de Arriba (BUp). The MCs levels were detected in waters from both ponds with an anti-MC-LR ELISA immunoassay and were of similar values (between 3.8-6.5-μg MC-LR equivalent/L in BDown pond and 4.8-6.0-μg MC-LR equivalent/L in BUp). The MCs cut-off values were applied in livers from fish collected from these two ponds using the ELISA anti-Adda technique. A total of 83% of samples from BDown pond and only 42% from BUp were TP with values of free MCs higher than 8.8-μg MCs/kg tissue (d.w.). Copyright © 2009 Wiley Periodicals, Inc.

  9. Assessment of the mutagenic potential of cyanobacterial extracts and pure cyanotoxins.

    Science.gov (United States)

    Sieroslawska, Anna

    2013-11-01

    The aim of the study was to assess the mutagenic potential of extracts obtained from the cyanobacterial bloom-forming cells harvested from the water body located in Lubelszczyzna region of southeastern Poland. Three cyanotoxins, microcystin-LR, cylindrospermopsin and anatoxin-a were detected in some of the studied samples in different concentrations. All extracts were assessed for their potential mutagenic effects with the use of a short-term bacterial assay, the Ames test. Mutagenic activity was observed in four of all ten studied extracts, mainly toward the Salmonella typhimurium TA100 strain. On the contrary, the cyanotoxins in purified forms occurred not to be mutagenic or cytotoxic towards S. typhimurium TA98, TA100, TA1535, TA1537 and Escherichia coli WP2 uvrA and WP2 [pKM101] up to a concentration of 10 μg/ml. Similarly, there were no effects after bacteria exposure to the mixture of purified toxins. It has been also detected that after fractionation, genotoxic impact of previously mutagenic extracts was weaker and the highest potency in revertant induction possessed fractions containing very hydrophilic compounds. The results indicate, that while tested cyanotoxins were not directly responsible for the observed mutagenicity of the extracts analysed, some synergistic interactions with other unidentified cyanobacterial-derived factors involved in the process are possible. Copyright © 2013 Elsevier Ltd. All rights reserved.

  10. Sensitivity of salad greens (Lactuca sativa L. and Eruca sativa Mill. exposed to crude extracts of toxic and non-toxic cyanobacteria

    Directory of Open Access Journals (Sweden)

    MC. Bittencourt-Oliveira

    Full Text Available We evaluated the effect of crude extracts of the microcystin-producing (MC+ cyanobacteria Microcystis aeruginosa on seed germination and initial development of lettuce and arugula, at concentrations between 0.5 μg.L–1 and 100 μg.L–1 of MC-LR equivalent, and compared it to crude extracts of the same species without the toxin (MC–. Crude extracts of the cyanobacteria with MC (+ and without MC (– caused different effects on seed germination and initial development of the salad green seedlings, lettuce being more sensitive to both extracts when compared to arugula. Crude extracts of M. aeruginosa (MC+ caused more evident effects on seed germination and initial development of both species of salad greens than MC–. Concentrations of 75 μg.L–1 and 100 μg.L–1 of MC–LR equivalent induced a greater occurrence of abnormal seedlings in lettuce, due to necrosis of the radicle and shortening of this organ in normal seedlings, as well as the reduction in total chlorophyll content and increase in the activity of the antioxidant enzyme peroxidase (POD. The MC– extract caused no harmful effects to seed germination and initial development of seedlings of arugula. However, in lettuce, it caused elevation of POD enzyme activity, decrease in seed germination at concentrations of 75 μg.L–1 (MC-75 and 100 μg.L–1 (MC-100, and shortening of the radicle length, suggesting that other compounds present in the cyanobacteria extracts contributed to this result. Crude extracts of M. aeruginosa (MC– may contain other compounds, besides the cyanotoxins, capable of causing inhibitory or stimulatory effects on seed germination and initial development of salad green seedlings. Arugula was more sensitive to the crude extracts of M. aeruginosa (MC+ and (MC– and to other possible compounds produced by the cyanobacteria.

  11. Phytotoxicity associated to microcystins: a review

    Directory of Open Access Journals (Sweden)

    MC Bittencourt-Oliveira

    Full Text Available Microcystins (MC are the most studied toxins of cyanobacteria since they are widely distributed and account for several cases of human and animal poisoning, being potent inhibitors of the serine/threonine protein phosphatases 1 (PP1 and 2A (PP2A. The phosphatases PP1 and PP2A are also present in plants, which may also suffer adverse effects due to the inhibition of these enzymes. In aquatic plants, biomass reduction is usually observed after absorption of cyanotoxins, which can bioaccumulate in its tissues. In terrestrial plants, the effects caused by microcystins vary from inhibition to stimulation as the individuals develop from seedling to adult, and include reduction of protein phosphatases 1 and 2A, oxidative stress, decreased photosynthetic activity and even cell apoptosis, as well as bioaccumulation in plant tissues. Thus, the irrigation of crop plants by water contaminated with microcystins is not only an economic problem but becomes a public health issue because of the possibility of food contamination, and this route of exposure requires careful monitoring by the responsible authorities.

  12. Recurrent adenylation domain replacement in the microcystin synthetase gene cluster

    Directory of Open Access Journals (Sweden)

    Laakso Kati

    2007-10-01

    Full Text Available Abstract Background Microcystins are small cyclic heptapeptide toxins produced by a range of distantly related cyanobacteria. Microcystins are synthesized on large NRPS-PKS enzyme complexes. Many structural variants of microcystins are produced simulatenously. A recombination event between the first module of mcyB (mcyB1 and mcyC in the microcystin synthetase gene cluster is linked to the simultaneous production of microcystin variants in strains of the genus Microcystis. Results Here we undertook a phylogenetic study to investigate the order and timing of recombination between the mcyB1 and mcyC genes in a diverse selection of microcystin producing cyanobacteria. Our results provide support for complex evolutionary processes taking place at the mcyB1 and mcyC adenylation domains which recognize and activate the amino acids found at X and Z positions. We find evidence for recent recombination between mcyB1 and mcyC in strains of the genera Anabaena, Microcystis, and Hapalosiphon. We also find clear evidence for independent adenylation domain conversion of mcyB1 by unrelated peptide synthetase modules in strains of the genera Nostoc and Microcystis. The recombination events replace only the adenylation domain in each case and the condensation domains of mcyB1 and mcyC are not transferred together with the adenylation domain. Our findings demonstrate that the mcyB1 and mcyC adenylation domains are recombination hotspots in the microcystin synthetase gene cluster. Conclusion Recombination is thought to be one of the main mechanisms driving the diversification of NRPSs. However, there is very little information on how recombination takes place in nature. This study demonstrates that functional peptide synthetases are created in nature through transfer of adenylation domains without the concomitant transfer of condensation domains.

  13. Can microcystins affect zooplankton structure community in tropical eutrophic reservoirs?

    Directory of Open Access Journals (Sweden)

    T. A. S. V. Paes

    Full Text Available Abstract The aim of our study was to assess whether cyanotoxins (microcystins can affect the composition of the zooplankton community, leading to domination of microzooplankton forms (protozoans and rotifers. Temporal variations in concentrations of microcystins and zooplankton biomass were analyzed in three eutrophic reservoirs in the semi-arid northeast region of Brazil. The concentration of microcystins in water proved to be correlated with the cyanobacterial biovolume, indicating the contributions from colonial forms such as Microcystis in the production of cyanotoxins. At the community level, the total biomass of zooplankton was not correlated with the concentration of microcystin (r2 = 0.00; P > 0.001, but in a population-level analysis, the biomass of rotifers and cladocerans showed a weak positive correlation. Cyclopoid copepods, which are considered to be relatively inefficient in ingesting cyanobacteria, were negatively correlated (r2 = – 0.01; P > 0.01 with the concentration of cyanotoxins. Surprisingly, the biomass of calanoid copepods was positively correlated with the microcystin concentration (r2 = 0.44; P > 0.001. The results indicate that allelopathic control mechanisms (negative effects of microcystin on zooplankton biomass do not seem to substantially affect the composition of mesozooplankton, which showed a constant and high biomass compared to the microzooplankton (rotifers. These results may be important to better understand the trophic interactions between zooplankton and cyanobacteria and the potential effects of allelopathic compounds on zooplankton.

  14. The presence of the cyanobacterial toxin microcystin in black band disease of corals.

    Science.gov (United States)

    Richardson, Laurie L; Sekar, Raju; Myers, Jamie L; Gantar, Miroslav; Voss, Joshua D; Kaczmarsky, Longin; Remily, Elizabeth R; Boyer, Gregory L; Zimba, Paul V

    2007-07-01

    Black band disease (BBD) is a migrating, cyanobacterial dominated, sulfide-rich microbial mat that moves across coral colonies lysing coral tissue. While it is known that BBD sulfate-reducing bacteria contribute to BBD pathogenicity by production of sulfide, additional mechanisms of toxicity may be involved. Using HPLC/MS, the cyanotoxin microcystin was detected in 22 field samples of BBD collected from five coral species on nine reefs of the wider Caribbean (Florida Keys and Bahamas). Two cyanobacterial cultures isolated from BBD, Geitlerinema and Leptolyngbya sp. contained microcystin based on HPLC/MS, with toxic activity confirmed using the protein phosphatase inhibition assay. The gene mcyA from the microcystin synthesis complex was detected in two field samples and from both BBD cyanobacterial cultures. Microcystin was not detected in six BBD samples from a different area of the Caribbean (St Croix, USVI) and the Philippines, suggesting regional specificity for BBD microcystin. This is the first report of the presence of microcystin in a coral disease.

  15. Freshwater algae competition and correlation between their growth and microcystin production.

    Science.gov (United States)

    Álvarez, Xana; Valero, Enrique; Cancela, Ángeles; Sánchez, Ángel

    2016-11-01

    There are some different freshwater algae in Eutrophic reservoirs which bloom with specific environmental conditions, and some of them are cyanobacteria. In this investigation, we have cultivated microalgae present in natural water samples from a eutrophic reservoir. Variations in temperature and light were evaluated, as well as the competition among different green algae and cyanobacteria. There were three different freshwater algae growing together, Scenedesmus sp., Kirchneriella sp. and Microcystis aeruginosa, this cyanobacterium was the algae that reached the highest development and growth during the culture. While the algae grew, the concentration of toxin (microcystin-LR) increased until it reached the highest levels at 570 μg g -1 . Blooms occurred at temperatures of 28 ± 1.5 °C and light cycles of longer hours of light than dark. This took place during the summer months, from June to September (in the study area). At temperatures below 18 °C, algae did not grow. Blooms were reproduced to a laboratory scale in different conditions in order to understand the development of freshwater algae, as well as to help decision-making about water supply from that reservoir.

  16. Evaluation of genotoxic potential of neurotoxin anatoxin-a with the use of umuC test.

    Science.gov (United States)

    Sieroslawska, Anna; Rymuszka, Anna

    2010-01-01

    The aim of this study was to evaluate genotoxicity of anatoxin-a, cyanotoxin of neurotoxic activity. Additionally, other frequently detected cyanotoxin of previously described genotoxic potential, microcystin-LR, was used at the same concentrations, as well as the mixture of both toxins, anatoxin-a and microcystin-LR. Genotoxicity of the toxins was determined with the use of the umuC assay, in which the induction and expression of the umuC - lacZ reporter gene was assessed. The test was conducted on Salmonella typhimurium TA 1535/pSK1002 strain, with and without metabolic transformation. The toxin concentrations were 0.25, 0.5, 1 and 2 µg/ml. The exposure time was 2 h. The highest inefficient concentration of anatoxin-a without metabolic transformation was 0.25 µg/ml, of microcystin-LR was 0.5 µg/ml and in case of the toxin mixture all used concentrations induced the umuC gene. When S9 fraction was added to the samples, no effects were detected. To our knowledge, this is the first report on genotoxic effects of anatoxin-a. Although the study is preliminary and needs further research, however, indicates the new potential activity of the toxin, as well as the possible increase of genotoxicity of other cyanotoxins, more stable in the environment, e.g. microcystin-LR.

  17. [ADMAdda5]-microcystins in Planktothrix agardhii strain PH-123 (cyanobacteria) -  importance for monitoring of microcystins in the environment

    DEFF Research Database (Denmark)

    Laub, J.; Henriksen, P.; Brittain, S.M.

    2002-01-01

    Two major and two minor microcystins (MCYST) were isolated from a hepatotoxic Danish strain of Planktothrix agardhii (Gomont) Anagnostidis et Komárek by reversed-phase high-performance liquid chromatography. The microcystins were characterized by UV spectroscopy, amino acid analysis, fast atom bo...... in Wiley InterScience (www.interscience.wiley.com). DOI 10.1002/tox.10042...

  18. Bioelectricity generation and microcystins removal in a blue-green algae powered microbial fuel cell

    International Nuclear Information System (INIS)

    Yuan Yong; Chen Qing; Zhou Shungui; Zhuang Li; Hu Pei

    2011-01-01

    Bioelectricity production from blue-green algae was examined in a single chamber tubular microbial fuel cell (MFC). The blue-green algae powered MFC produced a maximum power density of 114 mW/m 2 at a current density of 0.55 mA/m 2 . Coupled with the bioenergy generation, high removal efficiencies of chemical oxygen demand (COD) and nitrogen were also achieved in MFCs. Over 78.9% of total chemical oxygen demand (TCOD), 80.0% of soluble chemical oxygen demand (SCOD), 91.0% of total nitrogen (total-N) and 96.8% ammonium-nitrogen (NH 3 -N) were removed under closed circuit conditions in 12 days, which were much more effective than those under open circuit and anaerobic reactor conditions. Most importantly, the MFC showed great ability to remove microcystins released from blue-green algae. Over 90.7% of MC-RR and 91.1% of MC-LR were removed under closed circuit conditions (500 Ω). This study showed that the MFC could provide a potential means for electricity production from blue-green algae coupling algae toxins removal.

  19. Hepatotoxic Seafood Poisoning (HSP Due to Microcystins: A Threat from the Ocean?

    Directory of Open Access Journals (Sweden)

    Evangelos Briasoulis

    2013-08-01

    Full Text Available Cyanobacterial blooms are a major and growing problem for freshwater ecosystems worldwide that increasingly concerns public health, with an average of 60% of blooms known to be toxic. The most studied cyanobacterial toxins belong to a family of cyclic heptapeptide hepatotoxins, called microcystins. The microcystins are stable hydrophilic cyclic heptapeptides with a potential to cause cell damage following cellular uptake via organic anion-transporting proteins (OATP. Their intracellular biologic effects presumably involve inhibition of catalytic subunits of protein phosphatases (PP1 and PP2A and glutathione depletion. The microcystins produced by cyanobacteria pose a serious problem to human health, if they contaminate drinking water or food. These toxins are collectively responsible for human fatalities, as well as continued and widespread poisoning of wild and domestic animals. Although intoxications of aquatic organisms by microcystins have been widely documented for freshwater ecosystems, such poisonings in marine environments have only occasionally been reported. Moreover, these poisonings have been attributed to freshwater cyanobacterial species invading seas of lower salinity (e.g., the Baltic or to the discharge of freshwater microcystins into the ocean. However, recent data suggest that microcystins are also being produced in the oceans by a number of cosmopolitan marine species, so that Hepatotoxic Seafood Poisoning (HSP is increasingly recognized as a major health risk that follows consumption of contaminated seafood.

  20. Co-operative effects in tumorigenicity. The microcystin example

    International Nuclear Information System (INIS)

    Sedmak, B.; Suput, D.

    2002-01-01

    Cyanobacteria have been implicated in many deaths of livestock, wildlife and human throughout the world. They produce a broad range of biologically active substances including proteinase inhibitors, endotoxins (LPS), which are generally present in gram-negative bacteria, and a variety of other toxic compounds. These substances are released in the water environment during the senescence of the bloom and can penetrate in the water supply system. Little attention has been paid to possible synergistic interactions between these biologically active substances in tumor promotion and tumor initiation. With few exceptions, the vast majority of experiments used for the human risk assessment of cyanobacteria have been performed using purified microcystins. To evaluate liver injuries such as cirrhosis and hepatocellular carcinoma high doses of pure microcystins have been used. The present paper presents an attempt to verify the possible synergistic effects of different biologically active substances we have tested the toxic effects of lyophilized hepatotoxic cyanobacteria in comparison to the effects produced by the same amounts of purified microcystins. (author)

  1. Microcystin‐LR Detected in a Low Molecular Weight  Fraction from a Crude Extract of Zoanthus sociatus

    Directory of Open Access Journals (Sweden)

    Dany Domínguez‐Pérez

    2017-03-01

    Full Text Available Cnidarian constitutes a great source of bioactive compounds. However, research involving peptides from organisms belonging to the order Zoanthidea has received very little attention, contrasting to the numerous studies of the order Actiniaria, from which hundreds of toxic peptides and proteins have been reported. In this work, we performed a mass spectrometry analysis of a low molecular weight (LMW fraction previously reported as lethal to mice. The low molecular weight (LMW fraction was obtained by gel filtration of a Zoanthus sociatus (order Zoanthidea crude extract with a Sephadex G‐50, and then analyzed by matrix‐assisted laser desorption/ionization time‐of‐flight/time‐of‐flight (MALDI‐TOF/TOF mass spectrometry (MS in positive ion reflector mode from m/z 700 to m/z 4000. Afterwards, some of the most intense and representative MS ions were fragmented by MS/MS with no significant results obtained by Protein Pilot protein identification software and the Mascot algorithm search. However, microcystin masses were detected by mass‐matching against libraries of non‐ribosomal peptide database (NORINE. Subsequent reversed‐phase C18 HPLC (in isocratic elution mode and mass spectrometry analyses corroborated the presence of the cyanotoxin Microcystin‐LR (MC‐LR. To the best of our knowledge, this finding constitutes the first report of MC‐LR in Z. sociatus, and one of the few evidences of such cyanotoxin in cnidarians.

  2. Estimating microcystin levels at recreational sites in western Lake Erie and Ohio

    Science.gov (United States)

    Francy, Donna S.; Brady, Amie M. G.; Ecker, Christopher D.; Graham, Jennifer L.; Stelzer, Erin A.; Struffolino, Pamela; Loftin, Keith A.

    2016-01-01

    Cyanobacterial harmful algal blooms (cyanoHABs) and associated toxins, such as microcystin, are a major global water-quality issue. Water-resource managers need tools to quickly predict when and where toxin-producing cyanoHABs will occur. This could be done by using site-specific models that estimate the potential for elevated toxin concentrations that cause public health concerns. With this study, samples were collected at three Ohio lakes to identify environmental and water-quality factors to develop linear-regression models to estimate microcystin levels. Measures of the algal community (phycocyanin, cyanobacterial biovolume, and cyanobacterial gene concentrations) and pH were most strongly correlated with microcystin concentrations. Cyanobacterial genes were quantified for general cyanobacteria, general Microcystis and Dolichospermum, and for microcystin synthetase (mcyE) for Microcystis, Dolichospermum, and Planktothrix. For phycocyanin, the relations were different between sites and were different between hand-held measurements on-site and nearby continuous monitor measurements for the same site. Continuous measurements of parameters such as phycocyanin, pH, and temperature over multiple days showed the highest correlations to microcystin concentrations. The development of models with high R2values (0.81–0.90), sensitivities (92%), and specificities (100%) for estimating microcystin concentrations above or below the Ohio Recreational Public Health Advisory level of 6 μg L−1 was demonstrated for one site; these statistics may change as more data are collected in subsequent years. This study showed that models could be developed for estimates of exceeding a microcystin threshold concentration at a recreational freshwater lake site, with potential to expand their use to provide relevant public health information to water resource managers and the public for both recreational and drinking waters.

  3. Solving LR Conflicts Through Context Aware Scanning

    Science.gov (United States)

    Leon, C. Rodriguez; Forte, L. Garcia

    2011-09-01

    This paper presents a new algorithm to compute the exact list of tokens expected by any LR syntax analyzer at any point of the scanning process. The lexer can, at any time, compute the exact list of valid tokens to return only tokens in this set. In the case than more than one matching token is in the valid set, the lexer can resort to a nested LR parser to disambiguate. Allowing nested LR parsing requires some slight modifications when building the LR parsing tables. We also show how LR parsers can parse conflictive and inherently ambiguous languages using a combination of nested parsing and context aware scanning. These expanded lexical analyzers can be generated from high level specifications.

  4. Microcystin Detection Characteristics of Fluorescence Immunochromatography and High Performance Liquid Chromatography

    International Nuclear Information System (INIS)

    Pyo, Dong Jin; Park, Geun Young; Choi, Jong Chon; Oh, Chang Suk

    2005-01-01

    Different detection characteristics of fluorescence immunochromatography method and high performance liquid chromatography (HPLC) method for the analysis of cyanobacterial toxins were studied. In particular, low and high limits of detection, detection time and reproducibility and detectable microcystin species were compared when fluorescence immunochromatography method and high performance liquid chromatography method were applied for the detection of microcystin (MC), a cyclic peptide toxin of the freshwater cyanobacterium Microcystis aeruginosa. A Fluorescence immunochromatography assay system has the unique advantages of short detection time and low detection limit, and high performance liquid chromatography detection method has the strong advantage of individual quantifications of several species of microcystins

  5. Non-microcystin producing Microcystis wesenbergii (Komarek) Komarek (Cyanobacteria) representing a main waterbloom-forming species in Chinese waters

    International Nuclear Information System (INIS)

    Xu Yao; Wu Zhongxing; Yu Boshi; Peng Xin; Yu Gongliang; Wei Zhihong; Wang Guoxiang; Li Renhui

    2008-01-01

    It is well known that several morphospecies of Microcystis, such as Microcystis aeruginosa (Kuetzing) Lemmermann and Microcystis viridis (A. Brown) Lemmermann can produce hepatotoxic microcystins. However, previous studies gave contradictory conclusions about microcystin production of Microcystis wesenbergii (Komarek) Komarek. In the present study, ten Microcystis morphospecies were identified in waterblooms of seven Chinese waterbodies, and Microcystis wesenbergii was shown as the dominant species in these waters. More than 250 single colonies of M. wesenbergii were chosen, under morphological identification, to examine whether M. wesenbergii produce hepatotoxic microcystin by using multiplex PCR for molecular detection of a region (mcyA) of microcystin synthesis genes, and chemical analyses of microcystin content by ELISA and HPLC for 21 isolated strains of M. wesenbergii from these waters were also performed. Both molecular and chemical methods demonstrated that M. wesenbergii from Chinese waters did not produce microcystin. - Both molecular and chemical methods demonstrated that Microcystis wesenbergii was not a microcystin producer in Chinese waters

  6. Unifying LL and LR parsing

    NARCIS (Netherlands)

    W.H.L.M. Pijls (Wim)

    1993-01-01

    textabstractIn parsing theory, LL parsing and LR parsing are regarded to be two distinct methods. In this paper the relation between these methods is clarified.As shown in literature on parsing theory, for every context-free grammar, a so-called non-deterministic LR(0) automaton can be constructed.

  7. Discovery of Rare and Highly Toxic Microcystins from Lichen-Associated Cyanobacterium Nostoc sp. Strain IO-102-I

    OpenAIRE

    Oksanen, Ilona; Jokela, Jouni; Fewer, David P.; Wahlsten, Matti; Rikkinen, Jouko; Sivonen, Kaarina

    2004-01-01

    The production of hepatotoxic cyclic heptapeptides, microcystins, is almost exclusively reported from planktonic cyanobacteria. Here we show that a terrestrial cyanobacterium Nostoc sp. strain IO-102-I isolated from a lichen association produces six different microcystins. Microcystins were identified with liquid chromatography-UV mass spectrometry by their retention times, UV spectra, mass fragmentation, and comparison to microcystins from the aquatic Nostoc sp. strain 152. The dominant micr...

  8. Dog Poisonings Associated with a Microcystis aeruginosa Bloom in the Netherlands

    Directory of Open Access Journals (Sweden)

    Miquel Lürling

    2013-03-01

    Full Text Available In early autumn 2011, three dogs died after they had been exposed to a Microcystis aeruginosa bloom on Lake Amstelmeer, The Netherlands. The cyanobacterial scum from the lake contained up to 5.27 × 103 μg g−1 dry-weight microcystin, the vomit of one of the dogs contained on average 94 µg microcystin g−1 dry-weight. In both cases, microcystin-LR was the most abundant variant. This is the first report of dog deaths associated with a Microcystis bloom and microcystin poisoning in The Netherlands.

  9. [Investigation of toxigenic microcystis and microcystin pollution in Huayuankou Conservation Pool of Yellow River].

    Science.gov (United States)

    Ban, Haiqun; Ba, Yue; Cheng, Xuemin; Wang, Guangzhou

    2007-09-01

    To investigate the contaminative, condition of planktonic algae, cyanobacteria, toxigenic microcystis and microcystin in Huayuankou Conservation Pool of Yellow River. From March 2005 to January 2006, water samples were taken 15 times by 2. 5L plastic sampler from Huayuankou Conservation Pool. The density of algae were counted by using blood cell counter. Phycocyanin intergenic spacer region (PC-IGS) and microcystin synthetase gene B (mcyB) of toxigenic microcystis was identified by the whole cell PCR. The concentration of microcystin was determined by ELISA kit. The positive results of PCR and ELISA were compared. Bacillariophyta, chlorophyta, cyanophyta (cyanobacteria) and euglenophyta were main algaes in Huayuankou conservation pool, and the dominant algae and cell density changed seasonally. Algae cell density and cyanobacteria cell density were higher in summer and autumn than in spring and winter. From July to November, 2005, PC-IGS and mcyB were detected positively by whole cell PCR. Microcystin was positively detected from July, the concentration of microcystin changed from 0 to 0.25microg/L, it was more higher in summer than other seasons. Toxigenic microcystis and microcystin could be detected in Huayuankou Conservation Pool of Yellow River. Whole cell PCR could be used to identify toxigenic microcystis.

  10. A Global Analysis of the Relationship between Concentrations of Microcystins in Water and Fish

    Directory of Open Access Journals (Sweden)

    Natalie M. Flores

    2018-02-01

    Full Text Available Cyanobacteria, the primary bloom-forming organisms in fresh water, elicit a spectrum of problems in lentic systems. The most immediate concern for people and animals are cyanobacterial toxins, which have been detected at variable concentrations in water and fish around the world. Cyanotoxins can transfer through food webs, potentially increasing the risk of exposure to people who eat fish from affected waters, yet little is known about how cyanotoxins fluctuate in wild fish tissues. We collated existing studies on cyanotoxins in fish and fresh water from lakes around the world into a global dataset to test the hypothesis that cyanotoxin concentrations in fish increase with water toxin concentrations. We limited our quantitative analysis to microcystins because data on other cyanotoxins in fish were sparse, but we provided a qualitative summary of other cyanotoxins reported in wild, freshwater fish tissues. We found a positive relationship between intracellular microcystin in water samples and microcystin in fish tissues that had been analyzed by assay methods (enzyme-linked immunosorbent assay and protein phosphatase inhibition assay. We expected microcystin to be found in increasingly higher concentrations from carnivorous to omnivorous to planktivorous fishes. We found, however, that omnivores generally had the highest tissue microcystin concentrations. Additionally, we found contrasting results for the level of microcystin in different tissue types depending on the toxin analysis method. Because microcystin and other cyanotoxins have the potential to impact public health, our results underline the current need for comprehensive and uniform detection methods for the analysis of cyanotoxins in complex matrices.

  11. Effects of cell-bound microcystins on survival and feeding of Daphnia spp

    DEFF Research Database (Denmark)

    Rohrlack, T; Dittmann, E; Börner, T

    2001-01-01

    The influence of cell-bound microcystins on the survival time and feeding rates of six Daphnia clones belonging to five common species was studied. To do this, the effects of the microcystin-producing Microcystis strain PCC7806 and its mutant, which has been genetically engineered to knock out mi...

  12. Evidence for a novel marine harmful algal bloom: cyanotoxin (microcystin transfer from land to sea otters.

    Directory of Open Access Journals (Sweden)

    Melissa A Miller

    Full Text Available "Super-blooms" of cyanobacteria that produce potent and environmentally persistent biotoxins (microcystins are an emerging global health issue in freshwater habitats. Monitoring of the marine environment for secondary impacts has been minimal, although microcystin-contaminated freshwater is known to be entering marine ecosystems. Here we confirm deaths of marine mammals from microcystin intoxication and provide evidence implicating land-sea flow with trophic transfer through marine invertebrates as the most likely route of exposure. This hypothesis was evaluated through environmental detection of potential freshwater and marine microcystin sources, sea otter necropsy with biochemical analysis of tissues and evaluation of bioaccumulation of freshwater microcystins by marine invertebrates. Ocean discharge of freshwater microcystins was confirmed for three nutrient-impaired rivers flowing into the Monterey Bay National Marine Sanctuary, and microcystin concentrations up to 2,900 ppm (2.9 million ppb were detected in a freshwater lake and downstream tributaries to within 1 km of the ocean. Deaths of 21 southern sea otters, a federally listed threatened species, were linked to microcystin intoxication. Finally, farmed and free-living marine clams, mussels and oysters of species that are often consumed by sea otters and humans exhibited significant biomagnification (to 107 times ambient water levels and slow depuration of freshwater cyanotoxins, suggesting a potentially serious environmental and public health threat that extends from the lowest trophic levels of nutrient-impaired freshwater habitat to apex marine predators. Microcystin-poisoned sea otters were commonly recovered near river mouths and harbors and contaminated marine bivalves were implicated as the most likely source of this potent hepatotoxin for wild otters. This is the first report of deaths of marine mammals due to cyanotoxins and confirms the existence of a novel class of marine

  13. Evidence for a novel marine harmful algal bloom: Cyanotoxin (Microcystin) transfer from land to sea otters

    Science.gov (United States)

    Miller, Melissa A.; Kudela, Raphael M.; Mekebri, Abdu; Crane, Dave; Oates, Stori C.; Tinker, M. Timothy; Staedler, Michelle; Miller, Woutrina A.; Toy-Choutka, Sharon; Dominik, Clare; Hardin, Dane; Langlois, Gregg; Murray, Michael; Ward, Kim; Jessup, David A.

    2010-01-01

    "Super-blooms" of cyanobacteria that produce potent and environmentally persistent biotoxins (microcystins) are an emerging global health issue in freshwater habitats. Monitoring of the marine environment for secondary impacts has been minimal, although microcystin-contaminated freshwater is known to be entering marine ecosystems. Here we confirm deaths of marine mammals from microcystin intoxication and provide evidence implicating land-sea flow with trophic transfer through marine invertebrates as the most likely route of exposure. This hypothesis was evaluated through environmental detection of potential freshwater and marine microcystin sources, sea otter necropsy with biochemical analysis of tissues and evaluation of bioaccumulation of freshwater microcystins by marine invertebrates. Ocean discharge of freshwater microcystins was confirmed for three nutrient-impaired rivers flowing into the Monterey Bay National Marine Sanctuary, and microcystin concentrations up to 2,900 ppm (2.9 million ppb) were detected in a freshwater lake and downstream tributaries to within 1 km of the ocean. Deaths of 21 southern sea otters, a federally listed threatened species, were linked to microcystin intoxication. Finally, farmed and free-living marine clams, mussels and oysters of species that are often consumed by sea otters and humans exhibited significant biomagnification (to 107 times ambient water levels) and slow depuration of freshwater cyanotoxins, suggesting a potentially serious environmental and public health threat that extends from the lowest trophic levels of nutrient-impaired freshwater habitat to apex marine predators. Microcystin-poisoned sea otters were commonly recovered near river mouths and harbors and contaminated marine bivalves were implicated as the most likely source of this potent hepatotoxin for wild otters. This is the first report of deaths of marine mammals due to cyanotoxins and confirms the existence of a novel class of marine "harmful algal

  14. Antioxidative response of the three macrophytes Ceratophyllum demersum, Egeria densa, and Hydrilla verticillata to a time dependent exposure of cell-free crude extracts containing three microcystins from cyanobacterial blooms of Lake Amatitlán, Guatemala.

    Science.gov (United States)

    Romero-Oliva, Claudia Suseth; Contardo-Jara, Valeska; Pflugmacher, Stephan

    2015-06-01

    Microcystins (MCs) produced by cyanobacteria in natural environments are a potential risk to the integrity of ecosystems. In this study, the effects of cyanobacterial cell-free crude extracts from a Microcystis aeruginosa bloom containing three MC-congeners MC-LR, -RR, and -YR at environmental relevant concentrations of 49.3±2.9, 49.8±5.9, and 6.9±3.8μg/L, respectively, were evaluated on Ceratophyllum demersum (L.), Egeria densa (Planch.), and Hydrilla verticillata (L.f.). Effects on photosynthetic pigments (total chlorophyll (chl), chl a, chl b, and carotenoids), enzymatic defense led by catalase (CAT), peroxidase (POD) and glutathione reductase (GR), and biotransformation enzyme glutathione S-transferase (GST) were measured after 1, 4, and 8h and after 1, 3, 7, and 14 days of exposure. Results show that in all exposed macrophytes, photosynthetic pigments were negatively affected. While chl a and total chl decreased with increasing exposure time, a parallel increase in chl b was observed after 8h. Concomitant increase of ∼5, 16, and 34% of antioxidant carotenoid concentration in exposed C. demersum, E. densa, and H. verticillata, respectively, was also displayed. Enzymatic antioxidant defense systems in all exposed macrophytes were initiated within the first hour of exposure. In exposed E. densa, highest values of CAT and GR activities were observed after 4 and 8h, respectively, while in exposed H. verticillata highest value of POD activity was observed after 8h. An early induction with a significant increase of biotransformation enzyme GST was observed in E. densa after 4h and in C. demersum and H. verticillata after 8h. These results are the first to show rapid induction of stress and further possible MC biotransformation (based on the activation of GST enzymatic activity included in MC metabolization during the biotransformation mechanism) in macrophytes exposed to crude extract containing a mixture of MCs. Copyright © 2015 Elsevier B.V. All rights

  15. Presumptive Iatrogenic Microcystin-Associated Liver Failure and Encephalopathy in a Holsteiner Gelding.

    Science.gov (United States)

    Mittelman, N S; Engiles, J B; Murphy, L; Vudathala, D; Johnson, A L

    2016-09-01

    An 8-year-old Holsteiner gelding was presented for evaluation of anorexia, obtundation, icterus, and mild colic signs of 48 hours duration. History, physical examination, and initial diagnostics were suggestive of hepatic disease and encephalopathy. Microcystin toxicosis was suspected based on historical administration of a cyanobacteria supplement, associated serum biochemistry abnormalities, and characteristic histopathological changes. Microcystin contamination was confirmed in both supplement containers fed to the horse. Fulminant hepatic failure and encephalopathy progressed resulting in euthanasia. Necropsy findings were consistent with microcystin induced liver failure. Copyright © 2016 The Authors. Journal of Veterinary Internal Medicine published by Wiley Periodicals, Inc. on behalf of the American College of Veterinary Internal Medicine.

  16. Antilisterial activity of a broad-spectrum bacteriocin, enterocin LR/6 from Enterococcus faecium LR/6.

    Science.gov (United States)

    Kumar, Manoj; Srivastava, Sheela

    2010-10-01

    Enterocin LR/6, a purified bacteriocin, exhibited broad inhibitory spectrum both against related as well as some food-borne pathogens such as Listeria monocytogenes, Yersinia enterocolitica, Aeromonas sp., Shigella sp., and Bacillus licheniformis. In this investigation, we have focused on L. monocytogenes as the target organism, as it is not only an important pathogen but can also survive over a wide range of environmental conditions such as refrigeration temperature, low pH, and high-salt concentration. This allows the pathogen to overcome many food preservation and safety barriers and poses a potential risk to human health. The enterocin LR/6 showed a bactericidal action against L. monocytogenes and completely inhibited the growth on agar plates, supplemented with 200 AU/ml of enterocin LR/6. The effectiveness of enterocin LR/6 in completely killing a population of acid-adapted (pH 5.2, 2 h) L. monocytogenes exposed to different temperatures (4-37 degrees C), pH (2.5-8.0), and osmotic (up to 30% NaCl) stress is reported here. This paper focuses on the key issue of killing of the acid-adapted L. monocytogenes cells under adverse environmental conditions.

  17. Recreational Exposure to Low Concentrations of Microcystins During an Algal Bloom in a Small Lake

    Directory of Open Access Journals (Sweden)

    Yung-Sung Cheng

    2008-06-01

    Full Text Available We measured microcystins in blood from people at risk for swallowing water or inhaling spray while swimming, water skiing, jet skiing, or boating during an algal bloom. We monitored water samples from a small lake as a Microcystis aeruginosa bloom developed. We recruited 97 people planning recreational activities in that lake and seven others who volunteered to recreate in a nearby bloom-free lake. We conducted our field study within a week of finding a 10-μg/L microcystin concentration. We analyzed water, air, and human blood samples for water quality, potential human pathogens, algal taxonomy, and microcystin concentrations. We interviewed study participants for demographic and current health symptom information. Water samples were assayed for potential respiratory viruses (adenoviruses and enteroviruses, but none were detected. We did find low concentrations of Escherichia coli, indicating fecal contamination. We found low levels of microcystins (2 μg/L to 5 μg/L in the water and (<0.1 ng/m3 in the aerosol samples. Blood levels of microcystins for all participants were below the limit of detection (0.147μg/L. Given this low exposure level, study participants reported no symptom increases following recreational exposure to microcystins. This is the first study to report that water-based recreational activities can expose people to very low concentrations of aerosol-borne microcystins; we recently conducted another field study to assess exposures to higher concentrations of these algal toxins.

  18. On-line solid-phase extraction coupled to liquid chromatography tandem mass spectrometry for the analysis of cyanotoxins in algal blooms.

    Science.gov (United States)

    Fayad, Paul B; Roy-Lachapelle, Audrey; Duy, Sung Vo; Prévost, Michèle; Sauvé, Sébastien

    2015-12-15

    An analytical method based on on-line SPE-LC-HESI-MS/MS has been developed for the detection and quantification of eight selected cyanotoxins in algal bloom waters that include mycrocystins, anatoxin-a and cylindrospermopsin. The injection volume was 2 mL according to the expected concentration of cyanotoxins in matrix. The method provides an analysis time of 7 min per sample, acceptable recovery values (91-101%), good precision (RSD cyanotoxins. All of the targeted cyanotoxins were detected with the exception of cylindrospermopsin. In addition, it was found that total microcystin concentrations in several surface water samples exceeded the proposed guidelines established by the province of Québec in Canada of 1.5 μg L(-1) as well as the World Health Organization of 1 μg L(-1) for both free and cell-bound microcystin-LR equivalent. Copyright © 2015 Elsevier Ltd. All rights reserved.

  19. LR: Compact connectivity representation for triangle meshes

    Energy Technology Data Exchange (ETDEWEB)

    Gurung, T; Luffel, M; Lindstrom, P; Rossignac, J

    2011-01-28

    We propose LR (Laced Ring) - a simple data structure for representing the connectivity of manifold triangle meshes. LR provides the option to store on average either 1.08 references per triangle or 26.2 bits per triangle. Its construction, from an input mesh that supports constant-time adjacency queries, has linear space and time complexity, and involves ordering most vertices along a nearly-Hamiltonian cycle. LR is best suited for applications that process meshes with fixed connectivity, as any changes to the connectivity require the data structure to be rebuilt. We provide an implementation of the set of standard random-access, constant-time operators for traversing a mesh, and show that LR often saves both space and traversal time over competing representations.

  20. Microcystin Biosynthesis and mcyA Expression in Geographically Distinct Microcystis Strains under Different Nitrogen, Phosphorus, and Boron Regimes

    Directory of Open Access Journals (Sweden)

    Ankita Srivastava

    2016-01-01

    Full Text Available Roles of nutrients and other environmental variables in development of cyanobacterial bloom and its toxicity are complex and not well understood. We have monitored the photoautotrophic growth, total microcystin concentration, and microcystins synthetase gene (mcyA expression in lab-grown strains of Microcystis NIES 843 (reference strain, KW (Wangsong Reservoir, South Korea, and Durgakund (Varanasi, India under different nutrient regimes (nitrogen, phosphorus, and boron. Higher level of nitrogen and boron resulted in increased growth (avg. 5 and 6.5 Chl a mg/L, resp., total microcystin concentrations (avg. 1.185 and 7.153 mg/L, resp., and mcyA transcript but its expression was not directly correlated with total microcystin concentrations in the target strains. Interestingly, Durgakund strain had much lower microcystin content and lacked microcystin-YR variant over NIES 843 and KW. It is inferred that microcystin concentration and its variants are strain specific. We have also examined the heterotrophic bacteria associated with cyanobacterial bloom in Durgakund Pond and Wangsong Reservoir which were found to be enriched in Alpha-, Beta-, and Gammaproteobacteria and that could influence the bloom dynamics.

  1. Short communication: Emergence of a new race of leaf rust with combined virulence to Lr14a and Lr72 genes on durum wheat

    Energy Technology Data Exchange (ETDEWEB)

    Soleiman, N.H; Solis, I.; Soliman, M.H.; Sillero, J.C.; Villegas, D.; Alvaro, F.; Royo, C.; Serra, J.; Ammar, K.; Martínez-Moreno, F.

    2016-11-01

    Leaf rust is a foliar disease caused by the fungus Puccinia triticina that may severely reduce durum wheat yield. Resistance to this pathogen is common in modern durum germplasm but is frequently based on Lr72 and Lr14a. After accounts of races with virulence to Lr14a gene in France in 2000, the present study reports the detection in 2013 for the first time of a new race with virulence to Lr14a and Lr72. The aim of this work was to characterize the virulence pattern of four Spanish isolates with virulence to Lr14a, and to discuss the consequences of this presence. Rusted leaves from cultivars ‘Don Jaime’ (Lr14a) and ‘Gallareta’ (Lr72) were collected in 2013 in the field at two Spanish sites, one in the south (near Cadiz) and another in the north (near Girona). Spores from single pustule for each cultivar and site were multiplied on susceptible cultivar ‘Don Rafael’. Then, the four isolates were inoculated on a set of 19 isogenic lines Thatcher to characterize their virulence spectrum. All isolates presented the same virulence pattern. They were virulent on both Lr14a and Lr72 and the race was named DBB/BS. This race was very similar to those reported in 2009-11, but with added virulence to Lr14a. The resistance based on Lr14a has therefore been overcome in Spain, by a new race that has likely emerged via stepwise mutation from the local predominating races. This information is important to guide breeders in their breeding programmes and gene deployment strategies. (Author)

  2. Contamination by Microcystis and microcystins of blue-green algae food supplements (BGAS) on the Italian market and possible risk for the exposed population.

    Science.gov (United States)

    Vichi, Susanna; Lavorini, Paolo; Funari, Enzo; Scardala, Simona; Testai, Emanuela

    2012-12-01

    Blue green algae supplements (BGAS) are generally proposed as health-promoting natural products for their purported beneficial effects. Spirulina spp. and Aphanizomenon flos aquae are mainly used in BGAS production. They are usually collected from the natural environment, where other potentially toxic cyanobacteria can be present, making possible BGAS contamination by cyanotoxins, with potential risk for human health. In this work we apply a combined approach, by using chemical and molecular techniques, on BGAS of 17 brands available in Italy. Samples containing Spirulina-only were free of contamination. The Aphanizomenon flos aquae-based samples were contaminated by highly variable levels of microcystins (MC-LR and MC-LA congeners), up to 5.2 μg MC-LR equivalents per gram product. The highest variability (up to 50 fold) was among batches of the same brand, although intra-batch differences were also evidenced. PCR analyses were positive only for the presence of Microcystis sp., identified as the toxin-producing species responsible for contamination. At the maximum contamination levels found, a risk for consumers can be expected following chronic or sub-chronic exposure to a reasonable daily BGAS consumption of 4 g. The need for a strict monitoring by producers and Health Authority to assure an adequate protection for consumers is underscored. Copyright © 2012 Elsevier Ltd. All rights reserved.

  3. Development of an integrated laboratory system for the monitoring of cyanotoxins in surface and drinking waters.

    Science.gov (United States)

    Triantis, Theodoros; Tsimeli, Katerina; Kaloudis, Triantafyllos; Thanassoulias, Nicholas; Lytras, Efthymios; Hiskia, Anastasia

    2010-05-01

    A system of analytical processes has been developed in order to serve as a cost-effective scheme for the monitoring of cyanobacterial toxins on a quantitative basis, in surface and drinking waters. Five cyclic peptide hepatotoxins, microcystin-LR, -RR, -YR, -LA and nodularin were chosen as the target compounds. Two different enzyme-linked immunosorbent assays (ELISA) were validated in order to serve as primary quantitative screening tools. Validation results showed that the ELISA methods are sufficiently specific and sensitive with limits of detection (LODs) around 0.1 microg/L, however, matrix effects should be considered, especially with surface water samples or bacterial mass methanolic extracts. A colorimetric protein phosphatase inhibition assay (PPIA) utilizing protein phosphatase 2A and p-nitrophenyl phosphate as substrate, was applied in microplate format in order to serve as a quantitative screening method for the detection of the toxic activity associated with cyclic peptide hepatotoxins, at concentration levels >0.2 microg/L of MC-LR equivalents. A fast HPLC/PDA method has been developed for the determination of microcystins, by using a short, 50mm C18 column, with 1.8 microm particle size. Using this method a 10-fold reduction of sample run time was achieved and sufficient separation of microcystins was accomplished in less than 3 min. Finally, the analytical system includes an LC/MS/MS method that was developed for the determination of the 5 target compounds after SPE extraction. The method achieves extremely low limits of detection (<0.02 microg/L), in both surface and drinking waters and it is used for identification and verification purposes as well as for determinations at the ppt level. An analytical protocol that includes the above methods has been designed and validated through the analysis of a number of real samples. Copyright 2009 Elsevier Ltd. All rights reserved.

  4. LRSYS, PASCAL LR(1) Parser Generator System

    International Nuclear Information System (INIS)

    O'Hair, K.

    1991-01-01

    Description of program or function: LRSYS is a complete LR(1) parser generator system written entirely in a portable subset of Pascal. The system, LRSYS, includes a grammar analyzer program (LR) which reads a context-free (BNF) grammar as input and produces LR(1) parsing tables as output, a lexical analyzer generator (LEX) which reads regular expressions created by the REG process as input and produces lexical tables as output, and various parser skeletons that get merged with the tables to produce complete parsers (SMAKE). Current parser skeletons include Pascal, FORTRAN 77, and C. In addition, the CRAY1, DEC VAX11 version contains LRLTRAN and CFT- FORTRAN 77 skeletons. Other language skeletons can easily be added to the system. LRSYS is based on the LR program (NESC Abstract 822)

  5. Significance of microcystin production by benthic communities in water treatment systems of arid zones.

    Science.gov (United States)

    Hurtado, I; Aboal, M; Zafra, E; Campillo, D

    2008-02-01

    The study of the dynamics of phytobenthic and phytoplankton communities was undertaken, during a year, in the regulation reservoir associated with a water treatment plant (WTP), which provides the city of Murcia (Spain) with drinking water. Water samples were collected in different stages of the treatment. In the reservoir, the presence of dissolved and intracellular microcystins is constant, both in benthos and in plankton. The collected samples show a positive correlation between the dissolved microcystins and the benthic ones in the reservoir itself, as well as in an upstream reservoir (Ojós Reservoir). The treatment process (ozone+clarification+ozone+activated carbon) is very effective in the removal of toxins, and the drinking water produced is totally free of microcystins. The incorporation of the benthic communities in the routine check for the presence of microcystins is recommended, since it is not compulsory according to the current legislation.

  6. A prospective validation of the IOTA logistic regression models (LR1 and LR2) in comparison to subjective pattern recognition for the diagnosis of ovarian cancer.

    Science.gov (United States)

    Nunes, Natalie; Ambler, Gareth; Hoo, Wee-Liak; Naftalin, Joel; Foo, Xulin; Widschwendter, Martin; Jurkovic, Davor

    2013-11-01

    This study aimed to assess the accuracy of the International Ovarian Tumour Analysis (IOTA) logistic regression models (LR1 and LR2) and that of subjective pattern recognition (PR) for the diagnosis of ovarian cancer. This was a prospective single-center study in a general gynecology unit of a tertiary hospital during 33 months. There were 292 consecutive women who underwent surgery after an ultrasound diagnosis of an adnexal tumor. All examinations were by a single level 2 ultrasound operator, according to the IOTA guidelines. The malignancy likelihood was calculated using the IOTA LR1 and LR2. The women were then examined separately by an expert operator using subjective PR. These were compared to operative findings and histology. The sensitivity, specificity, area under the curve (AUC), and accuracy of the 3 methods were calculated and compared. The AUCs for LR1 and LR2 were 0.94 [95% confidence interval (CI), 0.92-0.97] and 0.93 (95% CI, 0.90-0.96), respectively. Subjective PR gave a positive likelihood ratio (LR+ve) of 13.9 (95% CI, 7.84-24.6) and a LR-ve of 0.049 (95% CI, 0.022-0.107). The corresponding LR+ve and LR-ve for LR1 were 3.33 (95% CI, 2.85-3.55) and 0.03 (95% CI, 0.01-0.10), and for LR2 were 3.58 (95% CI, 2.77-4.63) and 0.052 (95% CI, 0.022-0.123). The accuracy of PR was 0.942 (95% CI, 0.908-0.966), which was significantly higher when compared with 0.829 (95% CI, 0.781-0.870) for LR1 and 0.836 (95% CI, 0.788-0.872) for LR2 (P IOTA LR1 and LR2 were similar in nonexpert's hands when compared to the original and validation IOTA studies. The PR method was the more accurate test to diagnose ovarian cancer than either of the IOTA models.

  7. Application of Orthogonal Design to Optimize Extraction of ...

    African Journals Online (AJOL)

    Purpose: To optimize the extraction technology of polysaccharides from Cynomorium songaricum Rupr by ultrasonic-assisted extraction (UAE). Methods: Four parameters including ultrasonic power, ratio of raw material to water, extraction temperature, and extraction time were optimized by orthogonal design. The effects of ...

  8. Molecular cloning of manganese superoxide dismutase gene in the cladoceran Daphnia magna: Effects of microcystin, nitrite, and cadmium on gene expression profiles

    Energy Technology Data Exchange (ETDEWEB)

    Lyu, Kai; Zhu, Xuexia; Chen, Rui [Jiangsu Key Laboratory for Biodiversity and Biotechnology, School of Biological Sciences, Nanjing Normal University, 1 Wenyuan Road, Nanjing 210023 (China); Chen, Yafen [State Key Laboratory for Lake Science and Environment, Nanjing Institute of Geography and Limnology, the Chinese Academy of Sciences, Nanjing 210008 (China); Yang, Zhou, E-mail: yangzhou@njnu.edu.cn [Jiangsu Key Laboratory for Biodiversity and Biotechnology, School of Biological Sciences, Nanjing Normal University, 1 Wenyuan Road, Nanjing 210023 (China)

    2014-03-01

    Graphical abstract: - Highlights: • Daphnia magna MnSOD (Dm-MnSOD) was identified and revealed MnSOD-family features. • The expression of Dm-MnSOD decreased with increased developmental stages. • Dm-MnSOD transcript was kinetically up-regulated by microcystin, nitrite and Cd. • Response of SOD to ubiquitous waterborne pollutants in D. magna was elucidated. • Dm-MnSOD gene is a potential biomarker indicating pollutants in the environment. - Abstract: Superoxide dismutases (SODs) are metalloenzymes that represent one important line of defense against oxidative stress produced by reactive oxygen species in aerobic organisms. Generally, waterborne pollutants caused by irregular anthropogenic activities often result in oxidative damage in aquatic organisms. The aim of this study was to molecularly characterize the manganese superoxide dismutase gene (Dm-MnSOD) in the waterflea, Daphnia magna, and evaluate the mRNA expression patterns quantified by real-time PCR after exposure to three common waterborne pollutants (microcystin-LR, nitrite, and cadmium). The results showed that the full-length Dm-MnSOD sequence consists of 954 bp nucleotides, encoding 215 amino acids, showing well-conserved domains that are required for metal binding and several common characteristics, such as two MnSOD domains. The deduced amino acid sequence of Dm-MnSOD shared over 70% similarity with homologues from Bythograea thermydron, Dromia personata, Cancer pagurus, and Scylla paramamosain. Dm-MnSOD gene expression was up-regulated in response to exposure to the three chemicals tested. The overall results indicated that Dm-MnSOD gene is an inducible gene and potential biomarker indicating these pollutants in the environment.

  9. Assessment of uptake and phytotoxicity of cyanobacterial extracts containing microcystins or cylindrospermopsin on parsley (Petroselinum crispum L.) and coriander (Coriandrum sativum L).

    Science.gov (United States)

    Pereira, Ana L; Azevedo, Joana; Vasconcelos, Vitor

    2017-01-01

    Blooms of harmful cyanobacteria that synthesize cyanotoxins are increasing worldwide. Agronomic plants can uptake these cyanotoxins and given that plants are ultimately ingested by humans, this represents a public health problem. In this research, parsley and coriander grown in soil and watered through 7 days with crude extracts containing microcystins (MCs) or cylindrospermopsin (CYN) in 0.1-1 μg mL -1 concentration range were evaluated concerning their biomass, biochemical parameters and uptake of cyanotoxins. Although biomass, chlorophylls (a and b), carotenoids and glutathione-S-transferase of parsley and coriander exposed to the crude extracts containing MC or CYN had shown variations, these values were not statistically significantly different. Protein synthesis is not inhibited in coriander exposed to MC or CYN and in parsley exposed to MC. Also, glutathione reductase (GR) and glutathione peroxidase (GPx) in parsley and coriander was not affected by exposure to MC, and in coriander, the CYN did not induce statistically significant differences in these two antioxidative enzymes. Only parsley showed statistically significant increase in protein content exposed to 0.5 μg CYN mL -1 (3.981 ± 0.099 mg g -1 FW) compared to control (2.484 ± 0.145 mg g -1 FW), statistically significant decrease in GR exposed to 0.1 μg CYN mL -1 (0.684 ± 0.117 nmol min -1  mg -1 protein) compared to control (1.30 ± 0.06 nmol min -1  mg -1 protein) and statistically significant increase in GPx exposed to 1 μg CYN mL -1 (0.054 ± 0.026 nmol min -1  mg -1 protein) compared to 0.5 μg CYN mL -1 (0.003 ± 0.001 nmol min -1  mg -1 protein). These changes may be due to the induction of defensive mechanisms by plants by the presence of toxic compounds in the soil or probably to a low generation of reactive oxygen species. Furthermore, the parsley and coriander leaves and stems after 10 days of exposure did not accumulate microcystins or

  10. Toxin composition of the 2016 Microcystis aeruginosa bloom in the St. Lucie Estuary, Florida.

    Science.gov (United States)

    Oehrle, Stuart; Rodriguez-Matos, Marliette; Cartamil, Michael; Zavala, Cristian; Rein, Kathleen S

    2017-11-01

    A bloom of the cyanobacteria, Microcystis aeruginosa occurred in the St. Lucie Estuary during the summer of 2016, stimulated by the release of waters from Lake Okeechobee. This cyanobacterium produces the microcystins, a suite of heptapeptide hepatotoxins. The toxin composition of the bloom was analyzed and was compared to an archived bloom sample from 2005. Microcystin-LR was the most abundant toxin with lesser amounts of microcystin variants. Nodularin, cylindrospermopsin and anatoxin-a were not detected. Copyright © 2017 Elsevier Ltd. All rights reserved.

  11. Effect of calcium and magnesium on the antimicrobial action of enterocin LR/6 produced by Enterococcus faecium LR/6.

    Science.gov (United States)

    Kumar, Manoj; Srivastava, Sheela

    2011-06-01

    Enterococci are well-known producers of antimicrobial peptides (enterocins) that possess potential as biopreservatives in food. In this study, divalent cations and release of intracellular potassium were used to assess the mechanism of interaction and killing of enterocin LR/6 produced by Enterococcus faecium LR/6 on three target Gram-positive and Gram-negative bacteria, namely Micrococcus luteus, Enterococcus sp. strain LR/3 and Escherichia coli K-12. Whilst treatment with enterocin LR/6 in all cases led to a significant loss of viability, suggesting a bactericidal mode of action, E. coli K-12 showed better tolerance than the other two strains. Bacteriocins have generally been reported to create pores in the membrane of sensitive cells and this function is diminished by divalent cations. In this study it was shown that Ca(2+) and Mg(2+) markedly improved the viability of enterocin LR/6-treated cells in a concentration-dependent manner. K(+) release as a sign of membrane leakiness was higher in M. luteus compared with the other two test strains. In agreement with the viability response, pre-exposure to Ca(2+) and Mg(2+) substantially reduced the amount of K(+) leakage by M. luteus and Enterococcus sp.; in the case of E. coli K-12, no leakage of K(+) was recorded. These results suggest that enterocin LR/6, which possesses good antibacterial potential, may not be very effective as a preservative in foods containing high concentrations of calcium and magnesium. Copyright © 2011 Elsevier B.V. and the International Society of Chemotherapy. All rights reserved.

  12. Approximate Solution of LR Fuzzy Sylvester Matrix Equations

    Directory of Open Access Journals (Sweden)

    Xiaobin Guo

    2013-01-01

    Full Text Available The fuzzy Sylvester matrix equation AX~+X~B=C~ in which A,B are m×m and n×n crisp matrices, respectively, and C~ is an m×n LR fuzzy numbers matrix is investigated. Based on the Kronecker product of matrices, we convert the fuzzy Sylvester matrix equation into an LR fuzzy linear system. Then we extend the fuzzy linear system into two systems of linear equations according to the arithmetic operations of LR fuzzy numbers. The fuzzy approximate solution of the original fuzzy matrix equation is obtained by solving the crisp linear systems. The existence condition of the LR fuzzy solution is also discussed. Some examples are given to illustrate the proposed method.

  13. Associations between chlorophyll a and various microcystin health advisory concentrations [version 2; referees: 1 approved, 2 approved with reservations

    Directory of Open Access Journals (Sweden)

    Jeffrey W. Hollister

    2016-06-01

    Full Text Available Cyanobacteria harmful algal blooms (cHABs are associated with a wide range of adverse health effects that stem mostly from the presence of cyanotoxins. To help protect against these impacts, several health advisory levels have been set for some toxins. In particular, one of the more common toxins, microcystin, has several advisory levels set for drinking water and recreational use. However, compared to other water quality measures, field measurements of microcystin are not commonly available due to cost and advanced understanding required to interpret results. Addressing these issues will take time and resources. Thus, there is utility in finding indicators of microcystin that are already widely available, can be estimated quickly and in situ, and used as a first defense against high levels of microcystin. Chlorophyll a is commonly measured, can be estimated in situ, and has been shown to be positively associated with microcystin. In this paper, we use this association to provide estimates of chlorophyll a concentrations that are indicative of a higher probability of exceeding select health advisory concentrations for microcystin. Using the 2007 National Lakes Assessment and a conditional probability approach, we identify chlorophyll a concentrations that are more likely than not to be associated with an exceedance of a microcystin health advisory level. We look at the recent US EPA health advisories for drinking water as well as the World Health Organization levels for drinking water and recreational use and identify a range of chlorophyll a thresholds. A 50% chance of exceeding one of the specific advisory microcystin concentrations of 0.3, 1, 1.6, and 2 μg/L is associated with chlorophyll a concentration thresholds of 23, 68, 84, and 104 μg/L, respectively. When managing for these various microcystin levels, exceeding these reported chlorophyll a concentrations should be a trigger for further testing and possible management action.

  14. Fast, rugged and sensitive ultra high pressure liquid chromatography tandem mass spectrometry method for analysis of cyanotoxins in raw water and drinking water--First findings of anatoxins, cylindrospermopsins and microcystin variants in Swedish source waters and infiltration ponds.

    Science.gov (United States)

    Pekar, Heidi; Westerberg, Erik; Bruno, Oscar; Lääne, Ants; Persson, Kenneth M; Sundström, L Fredrik; Thim, Anna-Maria

    2016-01-15

    Freshwater blooms of cyanobacteria (blue-green algae) in source waters are generally composed of several different strains with the capability to produce a variety of toxins. The major exposure routes for humans are direct contact with recreational waters and ingestion of drinking water not efficiently treated. The ultra high pressure liquid chromatography tandem mass spectrometry based analytical method presented here allows simultaneous analysis of 22 cyanotoxins from different toxin groups, including anatoxins, cylindrospermopsins, nodularin and microcystins in raw water and drinking water. The use of reference standards enables correct identification of toxins as well as precision of the quantification and due to matrix effects, recovery correction is required. The multi-toxin group method presented here, does not compromise sensitivity, despite the large number of analytes. The limit of quantification was set to 0.1 μg/L for 75% of the cyanotoxins in drinking water and 0.5 μg/L for all cyanotoxins in raw water, which is compliant with the WHO guidance value for microcystin-LR. The matrix effects experienced during analysis were reasonable for most analytes, considering the large volume injected into the mass spectrometer. The time of analysis, including lysing of cell bound toxins, is less than three hours. Furthermore, the method was tested in Swedish source waters and infiltration ponds resulting in evidence of presence of anatoxin, homo-anatoxin, cylindrospermopsin and several variants of microcystins for the first time in Sweden, proving its usefulness. Copyright © 2015 The Authors. Published by Elsevier B.V. All rights reserved.

  15. Quantification of microcystin-producing microcystis in freshwater ...

    African Journals Online (AJOL)

    Total Microcystis spp (microcystinproducing and non-producing strains) were quantified in the three selected study areas with the determination of the copy numbers of the phycocyanin (PC) operon. Microcystin-producing gene copy numbers were quantified using specific primer pair, amplifying the mcyB gene. Microcystis ...

  16. Warming Affects Growth Rates and Microcystin Production in Tropical Bloom-Forming Microcystis Strains

    Directory of Open Access Journals (Sweden)

    Trung Bui

    2018-03-01

    Full Text Available Warming climate is predicted to promote cyanobacterial blooms but the toxicity of cyanobacteria under global warming is less well studied. We tested the hypothesis that raising temperature may lead to increased growth rates but to decreased microcystin (MC production in tropical Microcystis strains. To this end, six Microcystis strains were isolated from different water bodies in Southern Vietnam. They were grown in triplicate at 27 °C (low, 31 °C (medium, 35 °C (high and 37 °C (extreme. Chlorophyll-a-, particle- and MC concentrations as well as dry-weights were determined. All strains yielded higher biomass in terms of chlorophyll-a concentration and dry-weight at 31 °C compared to 27 °C and then either stabilised, slightly increased or declined with higher temperature. Five strains easily grew at 37 °C but one could not survive at 37 °C. When temperature was increased from 27 °C to 37 °C total MC concentration decreased by 35% in strains with MC-LR as the dominant variant and by 94% in strains with MC-RR. MC quota expressed per particle, per unit chlorophyll-a and per unit dry-weight significantly declined with higher temperatures. This study shows that warming can prompt the growth of some tropical Microcystis strains but that these strains become less toxic.

  17. Accident dynamics of LR-0 reactor

    International Nuclear Information System (INIS)

    Vorisek, M.; Tinka, I.

    1981-01-01

    The results are given of calculating the accident dynamics of the LR-0 light water experimental zero power reactor. Calculations of the time dependence of power, the total released energy, the temperature of fuel and its cladding were made using program FATRAP for different values of the total inserted reactivity. Using the results, an analysis is made of hypothetic accident states of the LR-0 reactor. The results are shown graphically. (J.B.)

  18. Characterization of Enzymatic Activity of MlrB and MlrC Proteins Involved in Bacterial Degradation of Cyanotoxins Microcystins.

    Science.gov (United States)

    Dziga, Dariusz; Zielinska, Gabriela; Wladyka, Benedykt; Bochenska, Oliwia; Maksylewicz, Anna; Strzalka, Wojciech; Meriluoto, Jussi

    2016-03-16

    Bacterial degradation of toxic microcystins produced by cyanobacteria is a common phenomenon. However, our understanding of the mechanisms of these processes is rudimentary. In this paper several novel discoveries regarding the action of the enzymes of the mlr cluster responsible for microcystin biodegradation are presented using recombinant proteins. In particular, the predicted active sites of the recombinant MlrB and MlrC were analyzed using functional enzymes and their inactive muteins. A new degradation intermediate, a hexapeptide derived from linearized microcystins by MlrC, was discovered. Furthermore, the involvement of MlrA and MlrB in further degradation of the hexapeptides was confirmed and a corrected biochemical pathway of microcystin biodegradation has been proposed.

  19. Characterization of Enzymatic Activity of MlrB and MlrC Proteins Involved in Bacterial Degradation of Cyanotoxins Microcystins

    Directory of Open Access Journals (Sweden)

    Dariusz Dziga

    2016-03-01

    Full Text Available Bacterial degradation of toxic microcystins produced by cyanobacteria is a common phenomenon. However, our understanding of the mechanisms of these processes is rudimentary. In this paper several novel discoveries regarding the action of the enzymes of the mlr cluster responsible for microcystin biodegradation are presented using recombinant proteins. In particular, the predicted active sites of the recombinant MlrB and MlrC were analyzed using functional enzymes and their inactive muteins. A new degradation intermediate, a hexapeptide derived from linearized microcystins by MlrC, was discovered. Furthermore, the involvement of MlrA and MlrB in further degradation of the hexapeptides was confirmed and a corrected biochemical pathway of microcystin biodegradation has been proposed.

  20. Eutrophication and warming boost cyanobacterial biomass and microcystins

    NARCIS (Netherlands)

    Lurling, Miguel; Oosterhout, Jean; Faassen, Els

    2017-01-01

    Eutrophication and warming are key drivers of cyanobacterial blooms, but their combined effects on microcystin (MC) concentrations are less studied. We tested the hypothesis that warming promotes cyanobacterial abundance in a natural plankton community and that eutrophication enhances cyanobacterial

  1. Presence of microcystin during events of algal blooms in Araruama Lagoon

    Directory of Open Access Journals (Sweden)

    Manildo Marcião de Oliveira

    2012-04-01

    Full Text Available Algal blooms are phenomena produced by anthropogenic activities, despite the possible natural causes. In Araruama Lagoon, blooms occurred in 2005 and in subsequent years, causing profound changes in phytoplankton communities. These episodes triggered events of extensive fish mortality associated with low levels of dissolved oxygen. Another adverse effect associated with blooms is the production of harmful toxins such as phycotoxins produced by eukaryotic microalgae and cyanotoxins produced by cyanobacteria. Samples of fish (mullet and menhaden and seston showed levels of microcystin by enzyme-linked immunosorbent assay (ELISA, also a seston sample (São Pedro d'Aldeia on 08/22/2007, in a period not related to fish mortality, showed cells which contained genes encoding microcystin synthetase, an enzyme responsible for the synthesis of microcystin. The succession of microalgae with the concomitant presence of potentially toxic cyanobacteria draws attention to the risk of chronic exposure by the population that uses fish as their main protein source.

  2. Validação de método analítico livre de acetonitrila para análise de microcistinas por cromatografia líquida de alta eficiência

    Directory of Open Access Journals (Sweden)

    Sérvio Túlio Alves Cassini

    2013-01-01

    Full Text Available Blooms of cyanobacteria represent a public health risk due to their cyanotoxins such as microcystins. Liquid chromatography techniques to separate and quantify microcystins invariably use acetonitrile as the organic component of the mobile phase. The price and availability of acetonitrile together with its elevated toxicity encourage the validation of acetonitrile-free methods of microcystin analysis. In this work, methanol was employed as the organic solvent of the mobile phase and the validation method was performed with different environmental water samples. The method showed limits of detection between 0.17 and 0.25 µg/L and of quantification between 0.55 and 0.82 µg/L for the microcystin variants: -RR, -YR, -LR, -LA.

  3. The profound effects of microcystin on cardiac antioxidant enzymes, mitochondrial function and cardiac toxicity in rat

    International Nuclear Information System (INIS)

    Qiu Tong; Xie Ping; Liu Ying; Li Guangyu; Xiong Qian; Hao Le; Li Huiying

    2009-01-01

    Deaths from microcystin toxication have widely been attributed to hypovolemic shock due to hepatic interstitial hemorrhage, while some recent studies suggest that cardiogenic complication is also involved. So far, information on cardiotoxic effects of MC has been rare and the underlying mechanism is still puzzling. The present study examined toxic effects of microcystins on heart muscle of rats intravenously injected with extracted MC at two doses, 0.16LD 50 (14 μg MC-LReq kg -1 body weight) and 1LD 50 (87 μg MC-LReq kg -1 body weight). In the dead rats, both TTC staining and maximum elevations of troponin I levels confirmed myocardial infarction after MC exposure, besides a serious interstitial hemorrhage in liver. In the 1LD 50 dose group, the coincident falls in heart rate and blood pressure were related to mitochondria dysfunction in heart, while increases in creatine kinase and troponin I levels indicated cardiac cell injury. The corresponding pathological alterations were mainly characterized as loss of adherence between cardiac myocytes and swollen or ruptured mitochondria at the ultrastructural level. MC administration at a dose of 1LD 50 not only enhanced activities and up-regulated mRNA transcription levels of antioxidant enzymes, but also increased GSH content. At both doses, level of lipid peroxides increased obviously, suggesting serious oxidative stress in mitochondria. Simultaneously, complex I and III were significantly inhibited, indicating blocks in electron flow along the mitochondrial respiratory chain in heart. In conclusion, the findings of this study implicate a role for MC-induced cardiotoxicity as a potential factor that should be considered when evaluating the mechanisms of death associated with microcystin intoxication in Brazil

  4. The hydration enthalpies of Md3+ and Lr3+

    International Nuclear Information System (INIS)

    Bruechle, W.; Schaedel, M.; Scherer, U.W.; Kratz, J.V.

    1987-10-01

    Lawrencium (3-min 260 Lr) and lighter actinides were produced in the bombardement of a 249 Bk target with 18 O ions and loaded onto a cation exchange column in 0.05 M α-hydroxy-isobutyrate solution at pH = 4.85 together with the radioactive lanthanide tracers 166 Ho, 171 Er, and 171 Tm. In elutions with 0.12 M α-hydroxy-isobutyrate solution (pH = 4.85) trivalent Lr was eluted exactly together with the Er tracer and Md close to Ho. Lr elutes much later than expected based on the known elution positions of the lighter actinides and the expected analogy to the elution positions of the homologous lanthanides. From the measured elution positions, ionic radii were calculated for Lr 3+ and Md 3+ . Semiempirical models allow the calculation of the heat of hydration from the ionic radii, resulting in ΔH hyd ≅ - 3654 kJ/mol for Md 3+ and ΔH hyd ≅ - 3689 kJ/mol for Lr 3+ . (orig.)

  5. L-R asymmetry in gut's

    International Nuclear Information System (INIS)

    Karadayi, H.R.

    1982-01-01

    An idea of L-R asymmetry is proposed for the grand unification schemes. The idea provides an intrinsic mechanism to obtain standard model charges of fermions in the case of more than one weak gauge boson. It is elaborated within a scheme based on the partial symmetry SU(4)sub(C)xSU(2)sub(L)xSU(2)sub(R) where the coupling constants gsub(L) and gsub(R) corresponding to the chiral SU(2) factors are assumed to be different from each other. Then, the embedding of this structure within the simple symmetry SO(10) is shown. In both cases, a consistent description of vector particle masses is given. These two schemes are considered as primary models to realize the L-R asymmetry idea due to the lack of family unification. However, in a subsequent work, we will show that the SO(14) unification of the three families can be obtained within the framework of L-R asymmetry. All formulations are carried out with the aid of a mathematical method that we recently proposed for the Lie algebra representations of classical groups. (author)

  6. Comparative Measurement of Microcystins in Diverse Surface Waters using ADDA-ELISA, LC-MS/MS, and MMPB Technical

    Science.gov (United States)

    The measurement of microcystins, cyanotoxins associated with cyanobacterial blooms which are increasingly prevalent in inland waters, is complicated by the diversity of congeners which have been observed in the environment. At present, more than 150 microcystin congeners have bee...

  7. Comparative measurement of microcystins in diverse surface waters using ADDA-ELISA, LC-MS/MS, and MMPB techniques

    Science.gov (United States)

    The measurement of microcystins, cyanotoxins associated with cyanobacterial blooms which are increasingly prevalent in inland waters, is complicated by the diversity of congeners which have been observed in the environment. At present, more than 150 microcystin congeners have bee...

  8. Sparse Representations-Based Super-Resolution of Key-Frames Extracted from Frames-Sequences Generated by a Visual Sensor Network

    Directory of Open Access Journals (Sweden)

    Muhammad Sajjad

    2014-02-01

    Full Text Available Visual sensor networks (VSNs usually generate a low-resolution (LR frame-sequence due to energy and processing constraints. These LR-frames are not very appropriate for use in certain surveillance applications. It is very important to enhance the resolution of the captured LR-frames using resolution enhancement schemes. In this paper, an effective framework for a super-resolution (SR scheme is proposed that enhances the resolution of LR key-frames extracted from frame-sequences captured by visual-sensors. In a VSN, a visual processing hub (VPH collects a huge amount of visual data from camera sensors. In the proposed framework, at the VPH, key-frames are extracted using our recent key-frame extraction technique and are streamed to the base station (BS after compression. A novel effective SR scheme is applied at BS to produce a high-resolution (HR output from the received key-frames. The proposed SR scheme uses optimized orthogonal matching pursuit (OOMP for sparse-representation recovery in SR. OOMP does better in terms of detecting true sparsity than orthogonal matching pursuit (OMP. This property of the OOMP helps produce a HR image which is closer to the original image. The K-SVD dictionary learning procedure is incorporated for dictionary learning. Batch-OMP improves the dictionary learning process by removing the limitation in handling a large set of observed signals. Experimental results validate the effectiveness of the proposed scheme and show its superiority over other state-of-the-art schemes.

  9. Sparse representations-based super-resolution of key-frames extracted from frames-sequences generated by a visual sensor network.

    Science.gov (United States)

    Sajjad, Muhammad; Mehmood, Irfan; Baik, Sung Wook

    2014-02-21

    Visual sensor networks (VSNs) usually generate a low-resolution (LR) frame-sequence due to energy and processing constraints. These LR-frames are not very appropriate for use in certain surveillance applications. It is very important to enhance the resolution of the captured LR-frames using resolution enhancement schemes. In this paper, an effective framework for a super-resolution (SR) scheme is proposed that enhances the resolution of LR key-frames extracted from frame-sequences captured by visual-sensors. In a VSN, a visual processing hub (VPH) collects a huge amount of visual data from camera sensors. In the proposed framework, at the VPH, key-frames are extracted using our recent key-frame extraction technique and are streamed to the base station (BS) after compression. A novel effective SR scheme is applied at BS to produce a high-resolution (HR) output from the received key-frames. The proposed SR scheme uses optimized orthogonal matching pursuit (OOMP) for sparse-representation recovery in SR. OOMP does better in terms of detecting true sparsity than orthogonal matching pursuit (OMP). This property of the OOMP helps produce a HR image which is closer to the original image. The K-SVD dictionary learning procedure is incorporated for dictionary learning. Batch-OMP improves the dictionary learning process by removing the limitation in handling a large set of observed signals. Experimental results validate the effectiveness of the proposed scheme and show its superiority over other state-of-the-art schemes.

  10. Pseudodiarrhoea in zebra mussels Dreissena polymorpha (Pallas) exposed to microcystins.

    Science.gov (United States)

    Juhel, Guillaume; Davenport, John; O'Halloran, John; Culloty, Sarah; Ramsay, Ruth; James, Kevin; Furey, Ambrose; Allis, Orla

    2006-03-01

    Microcystins are produced by bloom-forming cyanobacteria and pose significant health and ecological problems. In this study we show that zebra mussels respond differently to different strains of Microcystis aeruginosa, and that a highly toxic strain causes zebra mussels to produce large quantities of mucous pseudofaeces, 'pseudodiarrhoea', that are periodically expelled hydraulically through the pedal gape by shell valve adductions rather than by the normal ciliary tracts. Analysis of the pseudofaecal ejecta showed that the proportion of Microcystis aeruginosa relative to Asterionella formosa was high in the pseudofaeces and even higher in the 'pseudodiarrhoea' when a mixed diet was given to the mussels. This confirms that very toxic Microcystis aeruginosa were preferentially being rejected by comparison with the non-toxic diatom in the pseudofaeces and even more so in the 'pseudodiarrhoea'. Such selective rejection was not observed with low or non-toxic strains and would therefore tend to enhance the presence of toxic Microcystis aeruginosa in mixed Microcystis aeruginosa cyanobacterial blooms, as well as transferring toxins from the water column to the benthos. The observed acute irritant response to the toxin represents the first demonstration of an adverse sublethal effect of microcystins on invertebrate ecophysiology. Our results also suggest that it could be a specific response to microcystin-LF, a little studied toxin variant.

  11. Variation in the response of the invasive species Potamopyrgus antipodarum (Smith) to natural (cyanobacterial toxin) and anthropogenic (herbicide atrazine) stressors

    International Nuclear Information System (INIS)

    Gerard, Claudia; Poullain, Virginie

    2005-01-01

    In the context of increasing freshwater pollution, the impact on life-traits (survival, growth and fecundity) and locomotion of Potamopyrgus antipodarum of a 5-week field-concentration exposure to the cyanobacterial toxin microcystin-LR and the triazine herbicide, atrazine was studied. Whatever the age of exposed snails (juveniles, subadults, adults), microcystin-LR induced a decrease in survival, growth and fecundity but had no effect on locomotion. Atrazine induced a decrease in locomotory activity but had no significant effect on the life-traits. These results are discussed in terms of consequences to field populations. - At concentrations relevant to the field, cyanobacterial toxins (natural) and atrazine (anthropogenic) are detrimental to the gastropod Potamopyrgus antipodarum, with a greater toxicity for the natural (vs anthropogenic) stressor

  12. Variation in the response of the invasive species Potamopyrgus antipodarum (Smith) to natural (cyanobacterial toxin) and anthropogenic (herbicide atrazine) stressors

    Energy Technology Data Exchange (ETDEWEB)

    Gerard, Claudia [UMR CNRS Ecobio 6553, Equipe Physiologie et Ecophysiologie, Universite de Rennes 1, Avenue du General Leclerc, 35042 Rennes cedex (France)]. E-mail: claudia.gerard@univ-rennes1.fr; Poullain, Virginie [UMR CNRS Ecobio 6553, Equipe Physiologie et Ecophysiologie, Universite de Rennes 1, Avenue du General Leclerc, 35042 Rennes cedex (France)

    2005-11-15

    In the context of increasing freshwater pollution, the impact on life-traits (survival, growth and fecundity) and locomotion of Potamopyrgus antipodarum of a 5-week field-concentration exposure to the cyanobacterial toxin microcystin-LR and the triazine herbicide, atrazine was studied. Whatever the age of exposed snails (juveniles, subadults, adults), microcystin-LR induced a decrease in survival, growth and fecundity but had no effect on locomotion. Atrazine induced a decrease in locomotory activity but had no significant effect on the life-traits. These results are discussed in terms of consequences to field populations. - At concentrations relevant to the field, cyanobacterial toxins (natural) and atrazine (anthropogenic) are detrimental to the gastropod Potamopyrgus antipodarum, with a greater toxicity for the natural (vs anthropogenic) stressor.

  13. In vitro genotoxicity of microcystin-RR on primary cultured rat hepatocites and Hep G2 cell line detected by Comet assay

    International Nuclear Information System (INIS)

    Zegura, B.; Filipic, M.; Lah Turnsek, T.; Sedmak, B.; Suput, D.

    2002-01-01

    Microcystins are hepatotoxic cyclic heptapeptides produced by different species of bloom forming cyanobacteria (Microcystis, Anabaena, Nostoc Oscillatoria). The primary target of the toxin is the liver. The uptake of microcystins into the hepatocites occurs via carrier-mediated transport system. Microcystins cause cytoskeletal damage, necrosis and pooling of blood in the liver, with a consequent increase in the liver weight. The cause of death is a massive hepatic haemorrhage. Microcystins are inhibitors of serine/threonine protein phosphatases 1 and 2A and act as tumor-promoters. Ito and coworkers demonstrated that microcystins induced neoplastic nodules in the liver after repeated injections without an initiator, which indicates that they might act also as tumor initiators. The aim of our studies was to elucidate possible genotoxic effects of microcystin-RR (MCYST-RR) at molecular level using Comet assay. The Comet assay is a sensitive method for detection of DNA strand breaks at the level of a single cell. DNA single-strand breaks can lead to mutations, which are the first step in carcinogensis. (author)

  14. Toxic cyanobacteria strains isolated from blooms in the Guadiana River (southwestern Spain

    Directory of Open Access Journals (Sweden)

    ISABEL M MORENO

    2004-01-01

    Full Text Available This paper describes the occurrence of toxic cyanobacteria along the Guadiana River over its course between Mérida and Badajoz (Extremadura, Spain. Water sampling for phytoplankton quantification and toxin analysis was carried out regularly between 1999 and 2001 in six different locations, including two shallow, slow-flowing river sites, two streamed river sites and two drinking water reservoirs. The cyanobacterial community differed significantly between these locations, especially during the summer. The predominant genera were Microcystis, Oscillatoria, Aphanizomenon and Anabaena. Using an ELISA assay the total microcystin contents of natural water samples from the most eutrophic locations ranged from 0.10 _ 21.86 mg mcyst-LR equivalent·L-1 in Valdelacalzada and 0.10-11.3 µg mcyst-LR equivalent·L-1 in Vitonogales, and a seasonal variation of toxin content was observed. The amount of microcystins produced by each strain was determined by ELISA assay and the detection and identification of microcystin variants of three toxic strains of Microcystis aeruginosa was performed by high performance liquid chromatography (HPLC. The analysis of microcystins of the cultured strains revealed that toxin production was variable among different strains of M. aeruginosa isolated either from different blooms or from the same bloom.

  15. Improving microcystin monitoring relevance in recreative waters: A regional case-study (Brittany, Western France, Europe).

    Science.gov (United States)

    Pitois, Frédéric; Vezie, Chantal; Thoraval, Isabelle; Baurès, Estelle

    2016-05-01

    Cyanobacteria and their toxins are known as a health hazard in recreative and distributed waters. Monitoring data from 2004 to 2011 were collected at regional scale to characterize exposition parameters to microcystins in Brittany (Western France). The data show that cyanobacteria populations are experiencing a composition shift leading to a longer duration of cell densities higher than WHO alert levels 2 and 3. Microcystins however appear to be more frequently detected with subacute concentrations in low cell density samples than in high cell density samples or during bloom episodes. Positive relations are described between microcystin concentrations, detection frequencies and cyanobacteria biovolumes, allowing for a novel definition of alert levels and decision framework following WHO recommendations. Copyright © 2015 Elsevier GmbH. All rights reserved.

  16. Environmental influence on cyanobacteria abundance and microcystin toxin production in a shallow temperate lake.

    Science.gov (United States)

    Lee, Tammy A; Rollwagen-Bollens, Gretchen; Bollens, Stephen M; Faber-Hammond, Joshua J

    2015-04-01

    The increasing frequency of harmful cyanobacterial blooms in freshwater systems is a commonly recognized problem due to detrimental effects on water quality. Vancouver Lake, a shallow, tidally influenced lake in the flood plain of the Columbia River within the city of Vancouver, WA, USA, has experienced numerous summertime cyanobacterial blooms, dominated by Aphanizomenon sp. and Anabaena sp. Cyanobacteria abundance and toxin (microcystin) levels have been monitored in this popular urban lake for several years; however, no previous studies have identified which cyanobacteria species produce toxins, nor analyzed how changes in environmental variables contribute to the fluctuations in toxic cyanobacteria populations. We used a suite of molecular techniques to analyze water samples from Vancouver Lake over two summer bloom cycles (2009 and 2010). Both intracellular and extracellular microcystin concentrations were measured using an ELISA kit. Intracellular microcystin concentrations exceeded WHO guidelines for recreational waters several times throughout the sampling period. PCR results demonstrated that Microcystis sp. was the sole microcystin-producing cyanobacteria species present in Vancouver Lake, although Microcystis sp. was rarely detected in microscopical counts. qPCR results indicated that the majority of the Microcystis sp. population contained the toxin-producing gene (mcyE), although Microcystis sp. abundance rarely exceeded 1 percent of overall cyanobacteria abundance. Non-metric multidimensional scaling (NMDS) revealed that PO4-P was the main environmental variable influencing the abundance of toxic and non-toxic cyanobacteria, as well as intracellular microcystin concentrations. Our study underscores the importance of using molecular genetic techniques, in addition to traditional microscopy, to assess the importance of less conspicuous species in the dynamics of harmful algal blooms. Copyright © 2014 Elsevier Inc. All rights reserved.

  17. Bioaccumulation of microcystins in invasive bivalves: A case study from the boreal lagoon ecosystem

    Directory of Open Access Journals (Sweden)

    Aistė Paldavičienė

    2015-01-01

    Full Text Available In the current study we present the first report on the bioaccumulation of microcystins (MC in zebra mussel Dreissena polymorpha from the eutrophic brackish water Curonian Lagoon. The bioaccumulation capacity was related to age structure of mussels and ambient environmental conditions. We also discuss the relevant implications of these findings for biomonitoring of toxic cyanobacteria blooms in the Curonian Lagoon and potential consequences for D. polymorpha cultivation activities considered for the futures as remediation measure. Samples for the analysis were collected twice per year, in June and September, in 2006, 2007 and 2008, from two sites within the littoral zone of the lagoon. The highest microcystin concentrations were measured in mussels larger than 30 mm length and sampled in 2006 (when a severe toxic cyanobacteria bloom occurred. In the following years, a consistent reduction in bioaccumulated MC concentration was noticed. However, certain amount of microcystin was recorded in mussel tissues in 2007 and 2008, when no cyanotoxins were reported in the phytoplankton. Considering high depuration rates and presence of cyanotoxins in the bottom sediments well after the recorded toxic blooms, we assume mechanism of secondary contamination when microcystin residuals could be uptaken by mussels with resuspended sediment particles.

  18. Addition of phosphotungstic acid to ethanol for dehydration improves both the ultrastructure and antigenicity of pituitary tissue embedded in LR White acrylic resin.

    Science.gov (United States)

    Sakai, Yuko; Hosaka, Masahiro; Hira, Yoshiki; Watanabe, Tsuyoshi

    2005-12-01

    Although hydrophilic acrylic resins including LR White have been widely utilized as embedding media for immunocytochemical use, the constituents of tissues are often extracted by the resin monomer during the infiltration process of the embedment, resulting in a discernible impairment of the ultrastructure when the tissue is weakly fixed only with aldehydes. To minimize the extraction by the resin monomer, the embedding procedure with LR White resin was reexamined in the present study. Among the treatments tested, a partial dehydration with 70% ethanol containing 2% phosphotungstic acid (PTA) well preserved the ultrastructure of the pituitary tissue without spoiling the antigenicity of LHbeta and other representative markers for the Golgi apparatus. In addition, treatment with 1% tannic acid (TA) prior to the dehydration described above synergistically improved both the ultrastructure and antigenicity of the tissue so that the orientation of the Golgi apparatus could be determined by double immunogold labeling with commercially available anti-GM130 and anti-TGN38 antibodies. The ultrathin sections from the LR White-embedded tissue treated with TA and dehydrated in 70% ethanol containing 2% PTA also enhanced contrast without conventional heavy-metal staining with uranyl acetate and lead citrate. Our findings further suggest that the precipitation of TA and PTA protected the tissue from being extracted during the embedment, probably because an insoluble complex was transiently formed with the constituents of the tissue. This simple modification of the LR White embedment can extend the application of post-embedding immunocytochemistry as an alternative to pre-embedding immunolabeling with frozen ultrathin sections.

  19. Extraction optimization and characterization of polysaccharide ...

    African Journals Online (AJOL)

    Purpose: To investigate the optimum extraction conditions of polysaccharides from Pinellia Rhizoma (PRP) and their antioxidant activities. Methods: Response surface methodology (RSM) was applied to optimize the water extraction conditions of PRP by Box-Benhnken design (BBD). A high performance liquid ...

  20. Bioaccumulation of microcystins in two freshwater gastropods from a cyanobacteria-bloom plateau lake, Lake Dianchi

    International Nuclear Information System (INIS)

    Zhang Junqian; Wang Zhi; Song Zhuoyan; Xie Zhicai; Li Lin; Song, Lirong

    2012-01-01

    To investigate the bioaccumulation patterns of microcystins (MCs) in organs of two gastropods, samples were collected in Lake Dianchi monthly from May to October, 2008, when cyanobacteria typically bloom. The average MCs concentrations for Radix swinhoei (pulmonate) and Margarya melanioides (prosobranch) tended to be similar for the different organs: the highest values in the hepatopancreas (9.33 by 3.74 μg/g DW), followed by digestive tracts (1.66 by 3.03 μg/g DW), gonads (0.45 by 1.34 μg/g DW) and muscles (0.22 by 0.40 μg/g DW). Pulmonate had higher value than prosobranch because of the stronger bioaccumulation ability in hepatopancreas. The levels in organs of R. swinhoei were correlated with environmentally dissolved MCs, but influenced by intracellular MCs for M. melanioides. The estimated MCs concentrations in edible parts of M. melanioides were beyond the WHO’s provisional tolerable daily intake (0.04 μg/kg), suggesting the risk of consumption of M. melanioides from the lake. Highlights: ► We probe bioaccumulated patterns of microcystins in organs of pulmonate and prosobranch. ► The highest microcystins in hepatopancreas for both snails. ► The higher microcystins for pulmonate results from the stronger bioaccumulation ability in hepatopancreas. ► Environmentally dissolved microcystins are the main sources for pulmonate, but intracellular for prosobranch. ► Suggesting the risk of consumption snails in the studying regions. - Higher bioaccumulation MCs level for pulmonate mainly contributed to the stronger bioaccumulation ability in its hepatopancreas.

  1. Analysis of Microcystins in Cyanobacterial Blooms from Freshwater Bodies in England

    Directory of Open Access Journals (Sweden)

    Andrew D. Turner

    2018-01-01

    Full Text Available Cyanobacterial blooms in freshwater bodies in England are currently monitored reactively, with samples containing more than 20,000 cells/mL of potentially toxin-producing species by light microscopy resulting in action by the water body owner. Whilst significantly reducing the risk of microcystin exposure, there is little data describing the levels of these toxins present in cyanobacterial blooms. This study focused on the quantitative LC-MS/MS analysis of microcystins in freshwater samples, collected across England during 2016 and found to contain potentially toxin-producing cyanobacteria. More than 50% of samples contained quantifiable concentrations of microcystins, with approximately 13% exceeding the WHO medium health threshold of 20 μg/L. Toxic samples were confirmed over a nine-month period, with a clear increase in toxins during late summer, but with no apparent geographical patterns. No statistical relationships were found between total toxin concentrations and environmental parameters. Complex toxin profiles were determined and profile clusters were unrelated to cyanobacterial species, although a dominance of MC-RR was determined in water samples from sites associated with lower rainfall. 100% of samples with toxins above the 20 μg/L limit contained cell densities above 20,000 cells/mL or cyanobacterial scum, showing the current regime is suitable for public health. Conversely, with only 18% of cell density threshold samples having total microcystins above 20 μg/L, there is the potential for reactive water closures to unnecessarily impact upon the socio-economics of the local population. In the future, routine analysis of bloom samples by LC-MS/MS would provide a beneficial confirmatory approach to the current microscopic assessment, aiding both public health and the needs of water users and industry.

  2. Destruction of microcystins (cyanotoxins) by UV-254 nm-based direct photolysis and advanced oxidation processes (AOPs): influence of variable amino acids on the degradation kinetics and reaction mechanisms.

    Science.gov (United States)

    He, Xuexiang; de la Cruz, Armah A; Hiskia, Anastasia; Kaloudis, Triantafyllos; O'Shea, Kevin; Dionysiou, Dionysios D

    2015-05-01

    Hepatotoxic microcystins (MCs) are the most frequently detected group of cyanobacterial toxins. This study investigated the degradation of common MC variants in water, MC-LR, MC-RR, MC-YR and MC-LA, by UV-254 nm-based processes, UV only, UV/H2O2, UV/S2O8(2-) and UV/HSO5(-). Limited direct photolysis of MCs was observed, while the addition of an oxidant significantly improved the degradation efficiency with an order of UV/S2O8(2-) > UV/HSO5(-) > UV/H2O2 at the same initial molar concentration of the oxidant. The removal of MC-LR by UV/H2O2 appeared to be faster than another cyanotoxin, cylindrospermopsin, at either the same initial molar concentration or the same initial organic carbon concentration of the toxin. It suggested a faster reaction of MC-LR with hydroxyl radical, which was further supported by the determined second-order rate constant of MCs with hydroxyl radical. Both isomerization and photohydration byproducts were observed in UV only process for all four MCs; while in UV/H2O2, hydroxylation and diene-Adda double bond cleavage byproducts were detected. The presence of a tyrosine in the structure of MC-YR significantly promoted the formation of monohydroxylation byproduct m/z 1061; while the presence of a second arginine in MC-RR led to the elimination of a guanidine group and the absence of double bond cleavage byproducts. It was therefore demonstrated in this study that the variable amino acids in the structure of MCs influenced not only the degradation kinetics but also the preferable reaction mechanisms. Copyright © 2015 Elsevier Ltd. All rights reserved.

  3. Simultaneous removal of potent cyanotoxins from water using magnetophoretic nanoparticle of polypyrrole: adsorption kinetic and isotherm study.

    Science.gov (United States)

    Hena, S; Rozi, R; Tabassum, S; Huda, A

    2016-08-01

    Cyanotoxins, microcystins and cylindrospermopsin, are potent toxins produced by cyanobacteria in potable water supplies. This study investigated the removal of cyanotoxins from aqueous media by magnetophoretic nanoparticle of polypyrrole adsorbent. The adsorption process was pH dependent with maximum adsorption occurring at pH 7 for microcystin-LA, LR, and YR and at pH 9 for microcystin-RR and cylindrospermopsin (CYN). Kinetic studies and adsorption isotherms reflected better fit for pseudo-second-order rate and Langmuir isotherm model, respectively. Thermodynamic calculations showed that the cyanotoxin adsorption process is endothermic and spontaneous in nature. The regenerated adsorbent can be successfully reused without appreciable loss of its original capacity.

  4. Assessment of co-seismic landslide susceptibility using LR and ...

    Indian Academy of Sciences (India)

    Suchita Shrestha

    2018-03-28

    Mar 28, 2018 ... statistical methods, namely Logistic Regression. (LR) and Analysis ... The LR method has been applied by various researchers ... many bivariate models need that the independent variables be .... through a point (per unit contour length), and tan β is the ..... by multivariate statistical techniques; Nat. Hazards ...

  5. Hepatic Proteome Sensitivity in Rainbow Trout after Chronically Exposed to a Human Pharmaceutical Verapamil

    Czech Academy of Sciences Publication Activity Database

    Li, Z.; H.; Li, P.; Šulc, Miroslav; Hulák, M.; Randák, T.

    2012-01-01

    Roč. 11, č. 1 (2012), s. 1-7 ISSN 1535-9476 Institutional research plan: CEZ:AV0Z50200510 Keywords : STRESS-RESPONSE * MICROCYSTIN-LR * PROTEINS Subject RIV: CE - Biochemistry Impact factor: 7.251, year: 2012

  6. Development and validation of a rapid method for microcystins in fish and comparing LC-MS/MS results with ELISA

    Science.gov (United States)

    Microcystins (MCs) are the most common cyanotoxins found world-wide in freshwater, brackish and marine environments. The rapid and accurate analysis of microcystins and nodularin in fish tissue is important for determining occurrence, monitoring trends, and exposure monitoring for risk assessment a...

  7. Degradation of cyanotoxins (microcystin) in drinking water using photoelectrooxidation.

    Science.gov (United States)

    Garcia, A C A; Rodrigues, M A S; Xavier, J L N; Gazulla, V; Meneguzzi, A; Bernardes, A M

    2015-05-01

    The discharge of sewage and industrial effluents containing high concentrations of pollutants in water bodies increases eutrophication. Cyanobacteria, some of the organisms whose growth is promoted by high nutrient concentrations, are resistant and produce several types of toxins, known as cyanotoxins, highly harmful to human beings. Current water treatment systems for the public water supply are not efficient in degradation of toxins. Advanced oxidation processes (AOP) have been tested for the removal of cyanotoxins, and the results have been positive. This study examines the application of photoelectrooxidation in the degradation of cyanotoxins (microcystins). The performance of the oxidative processes involved was evaluated separately: Photocatalysis, Electrolysis and Photoelectrooxidation. Results showed that the electrical current and UV radiation were directly associated with toxin degradation. The PEO system is efficient in removing cyanotoxins, and the reduction rate reached 99%. The final concentration of toxin was less than 1 µg/L of microcystin in the treated solution.

  8. Degradation of cyanotoxins (microcystin in drinking water using photoelectrooxidation

    Directory of Open Access Journals (Sweden)

    ACA Garcia

    Full Text Available The discharge of sewage and industrial effluents containing high concentrations of pollutants in water bodies increases eutrophication. Cyanobacteria, some of the organisms whose growth is promoted by high nutrient concentrations, are resistant and produce several types of toxins, known as cyanotoxins, highly harmful to human beings. Current water treatment systems for the public water supply are not efficient in degradation of toxins. Advanced oxidation processes (AOP have been tested for the removal of cyanotoxins, and the results have been positive. This study examines the application of photoelectrooxidation in the degradation of cyanotoxins (microcystins. The performance of the oxidative processes involved was evaluated separately: Photocatalysis, Electrolysis and Photoelectrooxidation. Results showed that the electrical current and UV radiation were directly associated with toxin degradation. The PEO system is efficient in removing cyanotoxins, and the reduction rate reached 99%. The final concentration of toxin was less than 1 µg/L of microcystin in the treated solution.

  9. Assessment of microcystins in lake water and fish (Mugilidae, Liza sp.) in the largest Spanish coastal lake.

    Science.gov (United States)

    Romo, Susana; Fernández, Francisca; Ouahid, Youness; Barón-Sola, Ángel

    2012-01-01

    Cyanobacteria dominance and cyanotoxin production can become major threats to humans and aquatic life, especially in warm shallow lakes, which are often dominated by cyanobacteria. This study investigates the occurrence and distribution of microcystins (MCYST) in water, cell-bound and in the tissues of the commercial mugilid Liza sp. in the largest, coastal, Spanish Mediterranean lake (Albufera of Valencia). This is the first report concerning microcystin accumulation in tissues of mugilid fish species. Considerable amounts of microcystins were found in the water and seston, which correlated with development of Microcystis aeruginosa populations in the lake. The MCYST concentrations found in Lake Albufera (mean 1.7 and 17 μg/L and maximum 16 and 120 μg/L in water and seston, respectively) exceeded by one to two orders of magnitude the guideline levels proposed by the World Health Organization and were higher than that reported in other lakes of the Mediterranean zone. The presence of MCYST was found in all the fishes studied and accumulated differently among tissues of the commercial species Liza sp. Toxin accumulation in fish tissues showed that although the target organ for MCYST was the liver, high concentrations of microcystins were also found in other analysed tissues (liver>intestine>gills>muscle). Human tolerable daily intake for microcystins is assessed relative to the WHO guidelines, and potential toxicological risks for humans, wildlife and related ecosystems of the lake are discussed.

  10. A toxic cyanobacterial bloom in an urban coastal lake, Rio Grande do Sul state, Southern Brazil

    Directory of Open Access Journals (Sweden)

    Luciana Retz de Carvalho

    2008-12-01

    Full Text Available Reports of cyanobacterial blooms developing worldwide have considerably increased, and, in most cases, the predominant toxins are microcystins. The present study reports a cyanobacterial bloom in Lake Violão, Torres, Rio Grande do Sul State, in January 2005. Samples collected on January 13, 2005, were submitted to taxonomical, toxicological, and chemical studies. The taxonomical analysis showed many different species of cyanobacteria, and that Microcystis protocystis and Sphaerocavum cf. brasiliense were dominant. Besides these, Microcystis panniformis, Anabaena oumiana,Cylindrospermopsis raciborskii, and Anabaenopsis elenkinii f. circularis were also present. The toxicity of the bloom was confirmed through intraperitoneal tests in mice, and chemical analyses of bloom extracts showed that the major substance was anabaenopeptin F, followed by anabaenopeptin B, microcystin-LR, and microcystin-RR.O número de relatos de ocorrências de florações de cianobactérias em todo o mundo vem aumentando consideravelmente e na maioria desses episódios, as toxinas dominantes são as microcistinas. O presente estudo relata a ocorrência de floração na Lagoa do Violão, município de Torres, RS, em janeiro de 2005. As amostras coletadas em 13/01/2005 foram submetidas a estudos taxonômicos, toxicológicos e químicos. O exame microscópico do fitoplancton mostrou a dominância das espécies Microcystis protocystis e Sphaerocavum cf. brasiliense; foram observadas, também, Microcystis panniformis, Anabaena oumiana,Cylindrospermopsis raciborskii e Anabaenopsis elenkinii f. circularis. A toxicidade da floração foi confirmada através de ensaio intraperitonial em camundongos e a análise química de extratos obtidos da biomassa liofilizada mostrou que a substância majoritária era a anabaenopeptina F, seguida por anabaenopeptina B, microcistina-LR e microcistina-RR.

  11. Using an enzyme linked immunosorbent assay (ELISA) and a protein phosphatase inhibition assay (PPIA) for the detection of microcystins and nodularins.

    Science.gov (United States)

    Carmichael, W W; An, J

    1999-01-01

    Cyanotoxins produced by cyanobacteria (blue-green algae) include potent neurotoxins and hepatotoxins. The hepatotoxins include cyclic peptide microcystins and nodularins plus the alkaloid cylindrospermopsins. Among the cyanotoxins the microcystins have proven to be the most widespread, and are most often implicated in animal and human poisonings. This paper presents a practical guide to two widely used methods for detecting and quantifying microcystins and nodularins in environmental samples-the enzyme linked immunosorbant assay (ELISA) and the protein phosphatase inhibition assay (PPIA).

  12. Culture-based Identification Of Microcystin-Degrading Bacteria In the Sandusky Bay and Maumee Bay of Lake Erie

    Science.gov (United States)

    Ormiston, A.; Mou, X.

    2012-12-01

    Harmful cyanobacteria blooms (cyanoHABs) are a serious issue that affects wildlife, human health, recreation and local economics worldwide. CyanoHABs produce cyanotoxins, such as microcystins (MCs) that lead to skin irritation, illness and liver tumors. Bacterially mediated degradation of MCs plays a key role to transform these toxic substrates to less harmful metabolites in natural environments. However, only a few Sphingomonos species have been isolated for degradation of MCs and many of which are from other habitats such as water plants. This project aims to isolate and identify bacteria that can degrade MC-LR and MC-RR, two major forms of MCs found during cyanoHABs in Lake Erie. Water samples were collected from the surface of Sandusky Bay and Maumee Bay of Lake Erie and immediately filtered through 3.0 -μm-pore-size membrane filters to obtain bacterioplankton fraction. The filtrates were amended with excessive inorganic nitrogen and phosphorus compounds and incubated in the dark for a week to purposely establish a carbon-limited condition. Afterwards, enrichment microcosms were established in flasks filled with pre-incubated bacterioplankton and single MC compounds (final concentration 10 μM). Once cell growth was confirmed by flow cytometry-based cell counting, bacterial cells in enriched microcosms were transferred onto solid surfaces, i.e., GFF filter and noble agar for colony isolation. Obtained single colonies were inoculated in defined liquid media with MCs as single carbon source. DNA was extracted from each purified isolate and analyzed by restriction fragment length polymorphism analysis (RFLP). A total of 18 different RFLP banding patterns were found, indicating MC-degrading bacteria may be heterogeneous in studied water samples. 16S rRNA genes of selected bacterial isolates were PCR amplified and sequenced for taxonomic identification. Our results demonstrated that MCs can be degraded by multiple bacterial species in Lake Erie. Future directions

  13. The cyanobacteria toxins, microcystins – emerging risks to human health

    Science.gov (United States)

    Dialysis patients appear to be at increased risk for exposure to cyanobacteria toxins; episodes of microcystin (MCYST) exposure via dialysate during 1996 and 2001 have been previously reported. During 2001, as many as 44 renal insufficiency patients were exposed to contaminated d...

  14. Extraction optimization and characterization of polysaccharide ...

    African Journals Online (AJOL)

    Keywords: Pinellia rhizoma, Polysaccharides Optimization extraction, Monosaccharide composition,. Antioxidant ..... mean yield of PRP was 2.47 %. Therefore ... Table 3: Analysis of variance (ANOVA) for the fitted quadratic polynomial model.

  15. Optimal Management of Geothermal Heat Extraction

    Science.gov (United States)

    Patel, I. H.; Bielicki, J. M.; Buscheck, T. A.

    2015-12-01

    Geothermal energy technologies use the constant heat flux from the subsurface in order to produce heat or electricity for societal use. As such, a geothermal energy system is not inherently variable, like systems based on wind and solar resources, and an operator can conceivably control the rate at which heat is extracted and used directly, or converted into a commodity that is used. Although geothermal heat is a renewable resource, this heat can be depleted over time if the rate of heat extraction exceeds the natural rate of renewal (Rybach, 2003). For heat extraction used for commodities that are sold on the market, sustainability entails balancing the rate at which the reservoir renews with the rate at which heat is extracted and converted into profit, on a net present value basis. We present a model that couples natural resource economic approaches for managing renewable resources with simulations of geothermal reservoir performance in order to develop an optimal heat mining strategy that balances economic gain with the performance and renewability of the reservoir. Similar optimal control approaches have been extensively studied for renewable natural resource management of fisheries and forests (Bonfil, 2005; Gordon, 1954; Weitzman, 2003). Those models determine an optimal path of extraction of fish or timber, by balancing the regeneration of stocks of fish or timber that are not harvested with the profit from the sale of the fish or timber that is harvested. Our model balances the regeneration of reservoir temperature with the net proceeds from extracting heat and converting it to electricity that is sold to consumers. We used the Non-isothermal Unconfined-confined Flow and Transport (NUFT) model (Hao, Sun, & Nitao, 2011) to simulate the performance of a sedimentary geothermal reservoir under a variety of geologic and operational situations. The results of NUFT are incorporated into the natural resource economics model to determine production strategies that

  16. Optimization of extraction of phenolic content from conyza bonariensis

    International Nuclear Information System (INIS)

    Thabit, R.A.S.; Cheng, X.R.

    2014-01-01

    This study aims to find out the effects of solvent type (ethanol, water, and ionic liquid (1-butyl-3-methylimidazolium bromide)(BMIM)Br), time (30-90min), and microwave power (200 - 600w) on extraction rate, antioxidant activity, and total phenolic content (TPC) of Conyza bonariensis. The functional components from C. bonariensis were extracted using high efficient microwave-assisted extraction technology. The experiments were carried out according to 17 runs with 3 variables and three levels for the optimization in response surface methodology (RSM) system. The extracts were analyzed by spectrophotometeric methods for the antioxidant and TPC. The optimal conditions for extraction rate, antioxidant and TPC were determined by RSM. The Box Behnken design (BBD) showed the polynomial. The optimal conditions, including (BMIM)Br as the solvent with 45.47 min and 300.60 w power, lead to the best extraction rate (25.94%), maximum DPPH radical scavenging (95.90%) and maximum TPC (174.18 mg GAE/g). Under these conditions, the experimental extraction rate was 25.13 ± 0.85 %, DPPH radical scavenging was 93.8 ± 1.67% and TPC was 171.5 ± 1.06mg GAE/g of the C. bonariensis extract, which matched with the predicted values. (author)

  17. Molecular and analysis of a phenylalanine ammonia-lyase gene (LrPAL2) from Lycoris radiata.

    Science.gov (United States)

    Jiang, Yumei; Xia, Bing; Liang, Lijian; Li, Xiaodan; Xu, Sheng; Peng, Feng; Wang, Ren

    2013-03-01

    Phenylalanine ammonia-lyase (PAL), the first enzyme of phenylpropanoid biosynthesis, participates in the biosynthesis of flavonoids, lignins, stilbenes and many other compounds. In this study, we cloned a 2,326 bp full-length PAL2 gene from Lycoris radiata by using degenerate oligonucleotide primer PCR (DOP-PCR) and the rapid amplification of cDNA ends method. The cDNA contains a 2,124 bp coding region encoding 707 amino acids. The LrPAL2 shares about 77.0 % nucleic acid identity and 83 % amino acid identity with LrPAL1. Furthermore, genome sequence analysis demonstrated that LrPAL2 gene contains one intron and two exons. The 5' flanking sequence of LrPAL2 was also cloned by self-formed adaptor PCR (SEFA-PCR), and a group of putative cis-acting elements such as TATA box, CAAT box, G box, TC-rich repeats, CGTCA motif and TCA-element were identified. The LrPAL2 was detected in all tissues examined, with high abundance in bulbs at leaf sprouting stage and in petals at blooming stage. Besides, LrPAL2 drastically responded to MJ, SNP and UV, moderately responded to GA and SA, and a little increased under wounding. Comparison of LrPAL2 expression and LrPAL1 expression demonstrated that LrPAL2 can be more significantly induced than LrPAL1 under the above treatments, and LrPAL2 transcripts accumulated prominently at blooming stage, especially in petals, while LrPAL1 transcripts did not accumulated significantly at blooming stage. All these results suggested that LrPAL2 might play distinct roles in different branches of the phenylpropanoid pathway.

  18. Optimization of polysaccharides extracted from Verbena officinalis L ...

    African Journals Online (AJOL)

    Purpose: To investigate polysaccharides (PEV) extracted from the aerial part of Verbena officinalis L. and their inhibitory effects on the invasion and metastasis of colorectal cancer (CRC) cells. Methods: PEV was extracted by water and the optimization of extraction conditions was performed using a Box-Benhnken design ...

  19. Colorimetric test for the monitoring of microcystins in cyanobacterial culture and environmental samples from southeast - Brazil Teste colorimétrico usado para o monitoramento de microcistina em cultivo de cianobactérias e em amostras de florações ambientais do sudeste do Brasil

    Directory of Open Access Journals (Sweden)

    Vanessa P.S. Almeida

    2006-06-01

    Full Text Available Microcystins are hepatotoxic heptapeptides produced by some cyanobacterial genera under determined physico-chemical conditions in the environment, which are responsible for the intoxication and death of animals and humans. The detection of microcystins in potable water or recreational water is not carried out routinely in the majority of Brazilian states. The protein phosphatase 1 (PP1 inhibition test is a simple, rapid and reproducible colorimetric method. The applicability of the PP1 inhibition test was tested using Microcystis aeruginosa (strain 1, UFRJ- toxin producer grown under controlled light and temperature condition (12/12h light/dark using 30 muE.m².s-1 at 23ºC in a bioreactor. The total concentrations of P (24, 6 and 4 muM and Fe (4 and 1 muM were varied in ASM-1medium and their effects on the growth rates and toxin production were analyzed. A standard curve of PP1 inhibition by microcystin-LR reached detection limit of 0.01 ng.mL-1. Under the highest concentrations of P (24 muM and Fe (4 muM, the production of microcystin was detected throughout the growth experiment. The highest concentration of microcystin was observed at 6 muM P while at 1 muM Fe, PP1 inhibition was not detected. Samples from environmental blooms in water reservoirs used for human and animal consumption, from southeast Brazil (Belo Horizonte/MG, were tested and quantified for microcystin presence by the PP1 colorimetric test. The concentration of microcystin varied from undetectable to 100 ng.mL-1 in the environmental samples with Microcistis flos-aquae as the predominant cyanobacterial strain.Microcistinas (MC são heptapeptídeos de ação neuro e hepatotóxica produzidas por alguns gêneros de cianobactérias em determinadas condições físico-químicas do ambiente e são responsáveis pela morte e intoxicação de animais e humanos. A detecção de MC em água destinada ao consumo no Brasil ainda não é realizada na maioria dos estados brasileiros. O

  20. Bead-based competitive fluorescence immunoassay for sensitive and rapid diagnosis of cyanotoxin risk in drinking water.

    Science.gov (United States)

    Yu, Hye-Weon; Jang, Am; Kim, Lan Hee; Kim, Sung-Jo; Kim, In S

    2011-09-15

    Due to the increased occurrence of cyanobacterial blooms and their toxins in drinking water sources, effective management based on a sensitive and rapid analytical method is in high demand for security of safe water sources and environmental human health. Here, a competitive fluorescence immunoassay of microcystin-LR (MCYST-LR) is developed in an attempt to improve the sensitivity, analysis time, and ease-of-manipulation of analysis. To serve this aim, a bead-based suspension assay was introduced based on two major sensing elements: an antibody-conjugated quantum dot (QD) detection probe and an antigen-immobilized magnetic bead (MB) competitor. The assay was composed of three steps: the competitive immunological reaction of QD detection probes against analytes and MB competitors, magnetic separation and washing, and the optical signal generation of QDs. The fluorescence intensity was found to be inversely proportional to the MCYST-LR concentration. Under optimized conditions, the proposed assay performed well for the identification and quantitative analysis of MCYST-LR (within 30 min in the range of 0.42-25 μg/L, with a limit of detection of 0.03 μg/L). It is thus expected that this enhanced assay can contribute both to the sensitive and rapid diagnosis of cyanotoxin risk in drinking water and effective management procedures.

  1. Oxidative elimination of cyanotoxins: comparison of ozone, chlorine, chlorine dioxide and permanganate.

    Science.gov (United States)

    Rodríguez, Eva; Onstad, Gretchen D; Kull, Tomas P J; Metcalf, James S; Acero, Juan L; von Gunten, Urs

    2007-08-01

    As the World Health Organization (WHO) progresses with provisional Drinking Water Guidelines of 1 microg/L for microcystin-LR and a proposed Guideline of 1 microg/L for cylindrospermopsin, efficient treatment strategies are needed to prevent cyanotoxins such as these from reaching consumers. A kinetic database has been compiled for the oxidative treatment of three cyanotoxins: microcystin-LR (MC-LR), cylindrospermopsin (CYN), and anatoxin-a (ANTX) with ozone, chlorine, chlorine dioxide and permanganate. This kinetic database contains rate constants not previously reported and determined in the present work (e.g. for permanganate oxidation of ANTX and chlorine dioxide oxidation of CYN and ANTX), together with previously published rate constants for the remaining oxidation processes. Second-order rate constants measured in pure aqueous solutions of these toxins could be used in a kinetic model to predict the toxin oxidation efficiency of ozone, chlorine, chlorine dioxide and permanganate when applied to natural waters. Oxidants were applied to water from a eutrophic Swiss lake (Lake Greifensee) in static-dose testing and dynamic time-resolved experiments to confirm predictions from the kinetic database, and to investigate the effects of a natural matrix on toxin oxidation and by-product formation. Overall, permanganate can effectively oxidize ANTX and MC-LR, while chlorine will oxidize CYN and MC-LR and ozone is capable of oxidizing all three toxins with the highest rate. The formation of trihalomethanes (THMs) in the treated water may be a restriction to the application of sufficiently high-chlorine doses.

  2. Gold nanomaterials for the selective capturing and SERS diagnosis of toxins in aqueous and biological fluids

    DEFF Research Database (Denmark)

    Hassanain, Waleed A.; Izake, Emad L.; Schmidt, Michael Stenbæk

    2017-01-01

    the extractor nanoparticles within 5min by manipulating the pH environment of the nanoparticles. The regenerated extractor nanoparticles maintained their capture efficiency and, therefore, were re-used to capture of MC-LR from successive samples. The released purified toxin was screened within 10min on gold......A highly sensitive nanosensing method for the combined selective capture and SERS detection of Microcystin-LR (MC-LR) in blood plasma has been developed. The new method utilizes gold coated magnetic nanoparticles that are functionalized with anti MC-LR antibody Fab' fragments for the selective...... capture of MC-LR from aqueous media and blood plasma. Using an oriented immobilization approach, the Fab' fragments are covalently attached to gold surface to form a monolayer with high capture efficiency towards the toxin. After the selective capture, the purified MC-LR molecules were released from...

  3. The wheat resistance gene Lr34 results in the constitutive induction of multiple defense pathways in transgenic barley.

    Science.gov (United States)

    Chauhan, Harsh; Boni, Rainer; Bucher, Rahel; Kuhn, Benjamin; Buchmann, Gabriele; Sucher, Justine; Selter, Liselotte L; Hensel, Goetz; Kumlehn, Jochen; Bigler, Laurent; Glauser, Gaëtan; Wicker, Thomas; Krattinger, Simon G; Keller, Beat

    2015-10-01

    The wheat gene Lr34 encodes an ABCG-type transporter which provides durable resistance against multiple pathogens. Lr34 is functional as a transgene in barley, but its mode of action has remained largely unknown both in wheat and barley. Here we studied gene expression in uninfected barley lines transgenic for Lr34. Genes from multiple defense pathways contributing to basal and inducible disease resistance were constitutively active in seedlings and mature leaves. In addition, the hormones jasmonic acid and salicylic acid were induced to high levels, and increased levels of lignin as well as hordatines were observed. These results demonstrate a strong, constitutive re-programming of metabolism by Lr34. The resistant Lr34 allele (Lr34res) encodes a protein that differs by two amino acid polymorphisms from the susceptible Lr34sus allele. The deletion of a single phenylalanine residue in Lr34sus was sufficient to induce the characteristic Lr34-based responses. Combination of Lr34res and Lr34sus in the same plant resulted in a reduction of Lr34res expression by 8- to 20-fold when the low-expressing Lr34res line BG8 was used as a parent. Crosses with the high-expressing Lr34res line BG9 resulted in an increase of Lr34sus expression by 13- to 16-fold in progenies that inherited both alleles. These results indicate an interaction of the two Lr34 alleles on the transcriptional level. Reduction of Lr34res expression in BG8 crosses reduced the negative pleiotropic effects of Lr34res on barley growth and vigor without compromising disease resistance, suggesting that transgenic combination of Lr34res and Lr34sus can result in agronomically useful resistance. © 2015 The Authors The Plant Journal © 2015 John Wiley & Sons Ltd.

  4. High-resolution temperature-based optimization for hyperthermia treatment planning

    International Nuclear Information System (INIS)

    Kok, H P; Haaren, P M A van; Kamer, J B Van de; Wiersma, J; Dijk, J D P Van; Crezee, J

    2005-01-01

    In regional hyperthermia, optimization techniques are valuable in order to obtain amplitude/phase settings for the applicators to achieve maximal tumour heating without toxicity to normal tissue. We implemented a temperature-based optimization technique and maximized tumour temperature with constraints on normal tissue temperature to prevent hot spots. E-field distributions are the primary input for the optimization method. Due to computer limitations we are restricted to a resolution of 1 x 1 x 1 cm 3 for E-field calculations, too low for reliable treatment planning. A major problem is the fact that hot spots at low-resolution (LR) do not always correspond to hot spots at high-resolution (HR), and vice versa. Thus, HR temperature-based optimization is necessary for adequate treatment planning and satisfactory results cannot be obtained with LR strategies. To obtain HR power density (PD) distributions from LR E-field calculations, a quasi-static zooming technique has been developed earlier at the UMC Utrecht. However, quasi-static zooming does not preserve phase information and therefore it does not provide the HR E-field information required for direct HR optimization. We combined quasi-static zooming with the optimization method to obtain a millimetre resolution temperature-based optimization strategy. First we performed a LR (1 cm) optimization and used the obtained settings to calculate the HR (2 mm) PD and corresponding HR temperature distribution. Next, we performed a HR optimization using an estimation of the new HR temperature distribution based on previous calculations. This estimation is based on the assumption that the HR and LR temperature distributions, though strongly different, respond in a similar way to amplitude/phase steering. To verify the newly obtained settings, we calculate the corresponding HR temperature distribution. This method was applied to several clinical situations and found to work very well. Deviations of this estimation method for

  5. Optimization of a flow injection analysis system for multiple solvent extraction

    International Nuclear Information System (INIS)

    Rossi, T.M.; Shelly, D.C.; Warner, I.M.

    1982-01-01

    The performance of a multistage flow injection analysis solvent extraction system has been optimized. The effect of solvent segmentation devices, extraction coils, and phase separators on performance characteristics is discussed. Theoretical consideration is given to the effects and determination of dispersion and the extraction dynamics within both glass and Teflon extraction coils. The optimized system has a sample recovery similar to an identical manual procedure and a 1.5% relative standard deviation between injections. Sample throughput time is under 5 min. These characteristics represent significant improvements over the performance of the same system before optimization. 6 figures, 2 tables

  6. Monitoring of microcystin-LR in Luvuvhu River catchment ...

    African Journals Online (AJOL)

    user

    2011-01-17

    Jan 17, 2011 ... The water quality of the shallow hand dug wells and reservoir water were almost similar. .... formation of Sibasa basalt in the area (SRR, 2001). The cyanobacteria usually ... 3D). The nitrate level in sampling site 2 exceeded 6 mg/l. DWAF guideline .... The 1 µg/l is the safe limit suggested by the Word. Health ...

  7. Optimization of microwave assisted extraction (MAE) and soxhlet extraction of phenolic compound from licorice root.

    Science.gov (United States)

    Karami, Zohreh; Emam-Djomeh, Zahra; Mirzaee, Habib Allah; Khomeiri, Morteza; Mahoonak, Alireza Sadeghi; Aydani, Emad

    2015-06-01

    In present study, response surface methodology was used to optimize extraction condition of phenolic compounds from licorice root by microwave application. Investigated factors were solvent (ethanol 80 %, methanol 80 % and water), liquid/solid ratio (10:1-25:1) and time (2-6 min). Experiments were designed according to the central composite rotatable design. The results showed that extraction conditions had significant effect on the extraction yield of phenolic compounds and antioxidant capacities. Optimal condition in microwave assisted method were ethanol 80 % as solvent, extraction time of 5-6 min and liquid/solid ratio of 12.7/1. Results were compared with those obtained by soxhlet extraction. In soxhlet extraction, Optimum conditions were extraction time of 6 h for ethanol 80 % as solvent. Value of phenolic compounds and extraction yield of licorice root in microwave assisted (MAE), and soxhlet were 47.47 mg/g and 16.38 %, 41.709 mg/g and 14.49 %, respectively. These results implied that MAE was more efficient extracting method than soxhlet.

  8. Optimization-based Method for Automated Road Network Extraction

    International Nuclear Information System (INIS)

    Xiong, D

    2001-01-01

    Automated road information extraction has significant applicability in transportation. It provides a means for creating, maintaining, and updating transportation network databases that are needed for purposes ranging from traffic management to automated vehicle navigation and guidance. This paper is to review literature on the subject of road extraction and to describe a study of an optimization-based method for automated road network extraction

  9. Degradation of natural toxins by phthalocyanines-example of cyanobacterial toxin, microcystin

    Czech Academy of Sciences Publication Activity Database

    Jančula, D.; Blahová, L.; Karásková, M.; Maršálek, Blahoslav

    2010-01-01

    Roč. 62, č. 2 (2010), s. 273-278 ISSN 0273-1223 R&D Projects: GA MŠk 1M0571 Institutional research plan: CEZ:AV0Z60050516 Keywords : microcystin * phthalocyanine * singled oxygen Subject RIV: EF - Botanics Impact factor: 1.056, year: 2010

  10. Limited Stability of Microcystins in Oligopeptide Compositions of Microcystis aeruginosa (Cyanobacteria: Implications in the Definition of Chemotypes

    Directory of Open Access Journals (Sweden)

    Ramsy Agha

    2013-06-01

    Full Text Available The occurrence of diverse oligopeptides in cyanobacteria, including the cyanotoxins microcystins, has been recently used to classify individual clones into sub-specific oligopeptide chemotypes, whose composition and dynamics modulate microcystin concentrations in cyanobacterial blooms. Cyanobacterial chemotyping allows the study of the ecology of chemotypical subpopulations, which have been shown to possess dissimilar ecological traits. However, the stability of chemotypes under changing abiotic conditions is usually assumed and has not been assessed in detail. We monitored oligopeptide patterns of three strains of Microcystis aeruginosa under different nutrient and light conditions. MALDI-TOF MS revealed alterations in the microcystins signatures under N and P poor conditions and high light intensities (150 and 400 μmol photons m−2s−1. Variations in the general oligopeptide composition were caused by a gradual disappearance of microcystins with low relative intensity signals from the fingerprint. The extent of such variations seems to be closely related to physiological stress caused by treatments. Under identical clonal compositions, alterations in the oligopeptide fingerprint may be misinterpreted as apparent shifts in chemotype succession. We discuss the nature of such variations, as well as the consequent implications in the use of cyanobacterial chemotyping in studies at the subpopulation level and propose new guidance for the definition of chemotypes as a consistent subpopulation marker.

  11. Fusion of hyperspectral remote sensing data for near real-time monitoring of microcystin distribution in Lake Erie

    Science.gov (United States)

    Vannah, Benjamin; Chang, Ni-Bin

    2013-09-01

    Urban growth and agricultural production have caused an influx of nutrients into Lake Erie, leading to eutrophic zones. These conditions result in the formation of algal blooms, some of which are toxic due to the presence of Microcystis (a cyanobacteria), which produces the hepatotoxin microcystin. Microcystis has a unique advantage over its competition as a result of the invasive zebra mussel population that filters algae out of the water column except for the toxic Microcystis. The toxin threatens human health and the ecosystem, and it is a concern for water treatment plants using the lake water as a tap water source. This presentation demonstrates the prototype of a near real-time early warning system using Integrated Data Fusion techniques with the aid of both hyperspectral remote sensing data to determine spatiotemporal microcystin concentrations. The temporal resolution of MODIS is fused with the higher spatial and spectral resolution of MERIS to create synthetic images on a daily basis. As a demonstration, the spatiotemporal distributions of microcystin within western Lake Erie are reconstructed using the band data from the fused products and applied machine-learning techniques. Analysis of the results through statistical indices confirmed that the this type of algorithm has better potential to accurately estimating microcystin concentrations in the lake, which is better than current two band models and other computational intelligence models.

  12. Response Surface Optimized Extraction of Total Triterpene Acids ...

    African Journals Online (AJOL)

    Purpose: To optimize extraction of total triterpene acids from loquat leaf and evaluate their in vitro antioxidant activities. Methods: The independent variables were ethanol concentration, extraction time, and solvent ratio, while the dependent variable was content of total triterpene acids. Composite design and response ...

  13. Stacked Denoise Autoencoder Based Feature Extraction and Classification for Hyperspectral Images

    Directory of Open Access Journals (Sweden)

    Chen Xing

    2016-01-01

    Full Text Available Deep learning methods have been successfully applied to learn feature representations for high-dimensional data, where the learned features are able to reveal the nonlinear properties exhibited in the data. In this paper, deep learning method is exploited for feature extraction of hyperspectral data, and the extracted features can provide good discriminability for classification task. Training a deep network for feature extraction and classification includes unsupervised pretraining and supervised fine-tuning. We utilized stacked denoise autoencoder (SDAE method to pretrain the network, which is robust to noise. In the top layer of the network, logistic regression (LR approach is utilized to perform supervised fine-tuning and classification. Since sparsity of features might improve the separation capability, we utilized rectified linear unit (ReLU as activation function in SDAE to extract high level and sparse features. Experimental results using Hyperion, AVIRIS, and ROSIS hyperspectral data demonstrated that the SDAE pretraining in conjunction with the LR fine-tuning and classification (SDAE_LR can achieve higher accuracies than the popular support vector machine (SVM classifier.

  14. Optimization of microwave-assisted extraction conditions for preparing lignan-rich extract from Saraca asoca bark using Box-Behnken design.

    Science.gov (United States)

    Mishra, Shikha; Aeri, Vidhu

    2016-07-01

    Lyoniside is the major constituent of Saraca asoca Linn. (Caesalpiniaceae) bark. There is an immediate need to develop an efficient method to isolate its chemical constituents, since it is a therapeutically important plant. A rapid extraction method for lyoniside based on microwave-assisted extraction of S. asoca bark was developed and optimized using response surface methodology (RSM). Lyoniside was analyzed and quantified by high-performance liquid chromatography coupled with ultraviolet detection (HPLC-UV). The extraction solvent ratio (%), material solvent ratio (g/ml) and extraction time (min) were optimized using Box-Behnken design (BBD) to obtain the highest extraction efficiency. The optimal conditions were the use of 1:30 material solvent ratio with 70:30 mixture of methanol:water for 10 min duration. The optimized microwave-assisted extraction yielded 9.4 mg/g of lyoniside content in comparison to reflux extraction under identical conditions which yielded 4.2 mg/g of lyoniside content. Under optimum conditions, the experimental values agreed closely with the predicted values. The analysis of variance (ANOVA) indicated a high goodness-of-fit model and the success of the RSM method for optimizing lyoniside extraction from the bark of S. asoca. All the three variables significantly affected the lyoniside content. Increased polarity of solvent medium enhances the lyoniside yield. The present study shows the applicability of microwave-assisted extraction in extraction of lyoniside from S. asoca bark.

  15. Cyanobacteria and microcystin contamination in untreated and treated drinking water in Ghana

    Czech Academy of Sciences Publication Activity Database

    Addico, G.N.D.; Hardege, J. D.; Kohoutek, J.; Degraft-Johnson, K. A. A.; Babica, Pavel

    2017-01-01

    Roč. 8, č. 1 (2017), s. 92-106 ISSN 1947-573X Institutional support: RVO:67985939 Keywords : Ghana * microcystin * drinking water treatment Subject RIV: DJ - Water Pollution ; Quality OBOR OECD: Environmental sciences (social aspects to be 5.7)

  16. Toxin content and cytotoxicity of algal dietary supplements

    Energy Technology Data Exchange (ETDEWEB)

    Heussner, A.H.; Mazija, L. [Human and Environmental Toxicology, University of Konstanz, 78457 Konstanz (Germany); Fastner, J. [Federal Environmental Agency, Section II 3.3—Drinking-water resources and treatment, Berlin (Germany); Dietrich, D.R., E-mail: daniel.dietrich@uni-konstanz.de [Human and Environmental Toxicology, University of Konstanz, 78457 Konstanz (Germany)

    2012-12-01

    Blue-green algae (Spirulina sp., Aphanizomenon flos-aquae) and Chlorella sp. are commercially distributed as organic algae dietary supplements. Cyanobacterial dietary products in particular have raised serious concerns, as they appeared to be contaminated with toxins e.g. microcystins (MCs) and consumers repeatedly reported adverse health effects following consumption of these products. The aim of this study was to determine the toxin contamination and the in vitro cytotoxicity of algae dietary supplement products marketed in Germany. In thirteen products consisting of Aph. flos-aquae, Spirulina and Chlorella or mixtures thereof, MCs, nodularins, saxitoxins, anatoxin-a and cylindrospermopsin were analyzed. Five products tested in an earlier market study were re-analyzed for comparison. Product samples were extracted and analyzed for cytotoxicity in A549 cells as well as for toxin levels by (1) phosphatase inhibition assay (PPIA), (2) Adda-ELISA and (3) LC–MS/MS. In addition, all samples were analyzed by PCR for the presence of the mcyE gene, a part of the microcystin and nodularin synthetase gene cluster. Only Aph. flos-aquae products were tested positive for MCs as well as the presence of mcyE. The contamination levels of the MC-positive samples were ≤ 1 μg MC-LR equivalents g{sup −1} dw. None of the other toxins were found in any of the products. However, extracts from all products were cytotoxic. In light of the findings, the distribution and commercial sale of Aph. flos-aquae products, whether pure or mixed formulations, for human consumption appear highly questionable. -- Highlights: ► Marketed algae dietary supplements were analyzed for toxins. ► Methods: Phosphatase inhibition assay (PPIA), Adda-ELISA, LC-MS/MS. ► Aph. flos-aquae products all tested positive for microcystins. ► Products tested negative for nodularins, saxitoxins, anatoxin-a, cylindrospermopsin. ► Extracts from all products were cytotoxic.

  17. Land use patterns, ecoregion, and microcystin relationships in U.S. lakes and reservoirs: a preliminary evaluation

    Science.gov (United States)

    Beaver, John R.; Manis, Erin E.; Loftin, Keith A.; Graham, Jennifer L.; Pollard, Amina I.; Mitchell, Richard M.

    2014-01-01

    A statistically significant association was found between the concentration of total microcystin, a common class of cyanotoxins, in surface waters of lakes and reservoirs in the continental U.S. with watershed land use using data from 1156 water bodies sampled between May and October 2007 as part of the USEPA National Lakes Assessment. Nearly two thirds (65.8%) of the samples with microcystin concentrations ≥1.0 μg/L (n = 126) were limited to three nutrient and water quality-based ecoregions (Corn Belt and Northern Great Plains, Mostly Glaciated Dairy Region, South Central Cultivated Great Plains) in watersheds with strong agricultural influence. canonical correlation analysis (CCA) indicated that both microcystin concentrations and cyanobacteria abundance were positively correlated with total nitrogen, dissolved organic carbon, and temperature; correlations with total phosphorus and water clarity were not as strong. This study supports a number of regional lake studies that suggest that land use practices are related to cyanobacteria abundance, and extends the potential impacts of agricultural land use in watersheds to include the production of cyanotoxins in lakes.

  18. The wheat Lr34 multipathogen resistance gene confers resistance to anthracnose and rust in sorghum.

    Science.gov (United States)

    Schnippenkoetter, Wendelin; Lo, Clive; Liu, Guoquan; Dibley, Katherine; Chan, Wai Lung; White, Jodie; Milne, Ricky; Zwart, Alexander; Kwong, Eunjung; Keller, Beat; Godwin, Ian; Krattinger, Simon G; Lagudah, Evans

    2017-11-01

    The ability of the wheat Lr34 multipathogen resistance gene (Lr34res) to function across a wide taxonomic boundary was investigated in transgenic Sorghum bicolor. Increased resistance to sorghum rust and anthracnose disease symptoms following infection with the biotrophic pathogen Puccinia purpurea and the hemibiotroph Colletotrichum sublineolum, respectively, occurred in transgenic plants expressing the Lr34res ABC transporter. Transgenic sorghum lines that highly expressed the wheat Lr34res gene exhibited immunity to sorghum rust compared to the low-expressing single copy Lr34res genotype that conferred partial resistance. Pathogen-induced pigmentation mediated by flavonoid phytoalexins was evident on transgenic sorghum leaves following P. purpurea infection within 24-72 h, which paralleled Lr34res gene expression. Elevated expression of flavone synthase II, flavanone 4-reductase and dihydroflavonol reductase genes which control the biosynthesis of flavonoid phytoalexins characterized the highly expressing Lr34res transgenic lines 24-h post-inoculation with P. purpurea. Metabolite analysis of mesocotyls infected with C. sublineolum showed increased levels of 3-deoxyanthocyanidin metabolites were associated with Lr34res expression, concomitant with reduced symptoms of anthracnose. © 2017 The Authors. Plant Biotechnology Journal published by Society for Experimental Biology and The Association of Applied Biologists and John Wiley & Sons Ltd.

  19. Landslide susceptibility mapping using decision-tree based CHi-squared automatic interaction detection (CHAID) and Logistic regression (LR) integration

    International Nuclear Information System (INIS)

    Althuwaynee, Omar F; Pradhan, Biswajeet; Ahmad, Noordin

    2014-01-01

    This article uses methodology based on chi-squared automatic interaction detection (CHAID), as a multivariate method that has an automatic classification capacity to analyse large numbers of landslide conditioning factors. This new algorithm was developed to overcome the subjectivity of the manual categorization of scale data of landslide conditioning factors, and to predict rainfall-induced susceptibility map in Kuala Lumpur city and surrounding areas using geographic information system (GIS). The main objective of this article is to use CHi-squared automatic interaction detection (CHAID) method to perform the best classification fit for each conditioning factor, then, combining it with logistic regression (LR). LR model was used to find the corresponding coefficients of best fitting function that assess the optimal terminal nodes. A cluster pattern of landslide locations was extracted in previous study using nearest neighbor index (NNI), which were then used to identify the clustered landslide locations range. Clustered locations were used as model training data with 14 landslide conditioning factors such as; topographic derived parameters, lithology, NDVI, land use and land cover maps. Pearson chi-squared value was used to find the best classification fit between the dependent variable and conditioning factors. Finally the relationship between conditioning factors were assessed and the landslide susceptibility map (LSM) was produced. An area under the curve (AUC) was used to test the model reliability and prediction capability with the training and validation landslide locations respectively. This study proved the efficiency and reliability of decision tree (DT) model in landslide susceptibility mapping. Also it provided a valuable scientific basis for spatial decision making in planning and urban management studies

  20. Landslide susceptibility mapping using decision-tree based CHi-squared automatic interaction detection (CHAID) and Logistic regression (LR) integration

    Science.gov (United States)

    Althuwaynee, Omar F.; Pradhan, Biswajeet; Ahmad, Noordin

    2014-06-01

    This article uses methodology based on chi-squared automatic interaction detection (CHAID), as a multivariate method that has an automatic classification capacity to analyse large numbers of landslide conditioning factors. This new algorithm was developed to overcome the subjectivity of the manual categorization of scale data of landslide conditioning factors, and to predict rainfall-induced susceptibility map in Kuala Lumpur city and surrounding areas using geographic information system (GIS). The main objective of this article is to use CHi-squared automatic interaction detection (CHAID) method to perform the best classification fit for each conditioning factor, then, combining it with logistic regression (LR). LR model was used to find the corresponding coefficients of best fitting function that assess the optimal terminal nodes. A cluster pattern of landslide locations was extracted in previous study using nearest neighbor index (NNI), which were then used to identify the clustered landslide locations range. Clustered locations were used as model training data with 14 landslide conditioning factors such as; topographic derived parameters, lithology, NDVI, land use and land cover maps. Pearson chi-squared value was used to find the best classification fit between the dependent variable and conditioning factors. Finally the relationship between conditioning factors were assessed and the landslide susceptibility map (LSM) was produced. An area under the curve (AUC) was used to test the model reliability and prediction capability with the training and validation landslide locations respectively. This study proved the efficiency and reliability of decision tree (DT) model in landslide susceptibility mapping. Also it provided a valuable scientific basis for spatial decision making in planning and urban management studies.

  1. Experimental Study On The Optimization Of Extraction Process Of ...

    African Journals Online (AJOL)

    The objective is to study the extraction process of garlic oil and its antibacterial effects. Materials and Methods: CO2 Supercritical extraction was used to investigate the optimal processing conditions for garlic oil extraction; filter paper test and suspension dilution test were applied to determine the bacteriostatic action of ...

  2. Using H2O2 treatments for the degradation of cyanobacteria and microcystins in a shallow hypertrophic reservoir.

    Science.gov (United States)

    Papadimitriou, Theodoti; Kormas, Konstantinos; Dionysiou, Dionysios D; Laspidou, Chrysi

    2016-11-01

    Toxins produced by cyanobacteria in freshwater ecosystems constitute a serious health risk worldwide for humans that may use the affected water bodies for recreation, drinking water, and/or irrigation. Cyanotoxins have also been deemed responsible for loss of animal life in many places around the world. This paper explores the effect of H 2 O 2 treatments on cyanobacteria and microcystins in natural samples from a hypertrophic reservoir in microcosm experiments. According to the results, cyanobacteria were more easily affected by H 2 O 2 than by other phytoplanktonic groups. This was shown by the increase in the fractions of chlorophyll-a (a proxy for phytoplankton) and chlorophyll-b (a proxy for green algae) over total phytoplankton pigments and the decrease in the fraction of phycocyanin (a proxy for cyanobacteria) over total phytoplankton pigments. Thus, while an overall increase in phytoplankton occurred, a preferential decrease in cyanobacteria was observed with H 2 O 2 treatments over a few hours. Moreover, significant degradation of total microcystins was observed under H 2 O 2 treatments, while more microcystins were degraded when UV radiation was used in combination with H 2 O 2 . The combination of H 2 O 2 and ultraviolet (UV) treatment in natural samples resulted in total microcystin concentrations that were below the World Health Organization limit for safe consumption of drinking water of 1 μg/L. Although further investigation into the effects of H 2 O 2 addition on ecosystem function must be performed, our results show that the application of H 2 O 2 could be a promising method for the degradation of microcystins in reservoirs and the reduction of public health risks related to the occurrence of harmful algal blooms.

  3. Optimization study of fructans extraction from Agave tequilana Weber azul variety

    Directory of Open Access Journals (Sweden)

    Jesús Aarón SALAZAR-LEYVA

    Full Text Available Abstract Agave tequilana Weber azul variety is a valuable source of fructans. In this study, a response surface methodology was employed to optimize the extraction yield of fructans from agave pines. A Box Behnken factorial design was applied to evaluate the effects of several conditions such as extraction temperature, water raw material ratio and extraction time on extraction yield. Under the optimum extraction conditions (extraction temperature of 79.1 °C, water raw material ratio of 5.13 mL/g, and extraction time of 1.48 h fructans extraction yield was 83.12%. The chromatographic profile of the agave crude extract presented four peaks, out of which fructans were the most preponderant (~87%. The obtained results suggest that the response surface methodology is adequate to optimize fructans extraction from Agave tequilana Weber azul variety.

  4. Pitavastatin attenuates the PDGF-induced LR11/uPA receptor-mediated migration of smooth muscle cells

    International Nuclear Information System (INIS)

    Jiang, Meizi; Bujo, Hideaki; Zhu, Yanjuan; Yamazaki, Hiroyuki; Hirayama, Satoshi; Kanaki, Tatsuro; Shibasaki, Manabu; Takahashi, Kazuo; Schneider, Wolfgang J.; Saito, Yasushi

    2006-01-01

    Statins, inhibitors of HMG-CoA reductase, elicit various actions on vascular cells including the modulation of proliferation and migration of smooth muscle cells (SMCs). Here, we have elucidated the mechanism by which statins, in particular pitavastatin, attenuate the migration activity of SMCs. The expression of LR11, a member of the LDL receptor family and an enhancer of cell surface localization of urokinase-type plasminogen activator receptor (uPAR), is increased in cultured SMCs by treatment with PDGF-BB. Pitavastatin attenuates the PDGF-BB -induced surface expression of LR11 and uPAR. The increased migration of SMCs observed both upon overexpression of LR11 and via stimulation of secretion of soluble LR11 is not reversed by pitavastatin. In vivo studies showed that the SMCs expressing LR11 in plaques are almost congruent with intimal cells expressing nonmuscle myosin heavy chain (SMemb). Pitavastatin reduced the expression of LR11 and SMemb, and the levels of LR11, uPAR, and SMemb in cultured intimal SMCs were reduced to those seen in medial SMCs. We propose that this statin reduces PDGF-induced migration through the attenuation of the LR11/uPAR system in SMCs. Modulation of the LR11/uPAR system with statins suggests a novel treatment strategy for atherogenesis based on suppression of intimal SMC migration

  5. LR-90 prevents methylglyoxal-induced oxidative stress and apoptosis in human endothelial cells

    Science.gov (United States)

    Figarola, James L.; Singhal, Jyotsana; Rahbar, Samuel; Awasthi, Sanjay

    2014-01-01

    Methylglyoxal (MGO) is a highly reactive dicarbonyl compound known to induce cellular injury and cytoxicity, including apoptosis in vascular cells. Vascular endothelial cell apoptosis has been implicated in the pathophysiology and progression of atherosclerosis. We investigated whether the advanced glycation end-product inhibitor LR-90 could prevent MGO-induced apoptosis in human umbilical vascular endothelial cells (HUVECs). HUVECs were pre-treated with LR-90 and then stimulated with MGO. Cell morphology, cytotoxicity and apoptosis were evaluated by light microscopy, MTT assay, and Annexin V-FITC and propidium iodide double staining, respectively. Levels of Bax, Bcl-2, cytochrome c, mitogen-activated protein kinases (MAPKs) and caspase activities were assessed by Western blotting. Reactive oxygen species (ROS) generation and mitochondrial membrane potential (MMP) were measured with fluorescent probes. LR-90 dose-dependently prevented MGO-associated HUVEC cytotoxicity and apoptotic biochemical changes such as loss of MMP, increased Bax/Bcl-2 protein ratio, mitochondrial cytochrome c release and activation of caspase-3 and 9. Additionally, LR-90 blocked intracellular ROS formation and MAPK (p44/p42, p38, JNK) activation, though the latter seem to be not directly involved in MGO-induced HUVEC apoptosis. LR-90 prevents MGO-induced HUVEC apoptosis by inhibiting ROS and associated mitochondrial-dependent apoptotic signaling cascades, suggesting that LR-90 possess cytoprotective ability which could be beneficial in prevention of diabetic related-atherosclerosis. PMID:24615331

  6. Neutron activation analysis for the optimal sampling and extraction of extractable organohalogens in human hari

    International Nuclear Information System (INIS)

    Zhang, H.; Chai, Z.F.; Sun, H.B.; Xu, H.F.

    2005-01-01

    Many persistent organohalogen compounds such as DDTs and polychlorinated biphenyls have caused seriously environmental pollution problem that now involves all life. It is know that neutron activation analysis (NAA) is a very convenient method for halogen analysis and is also the only method currently available for simultaneously determining organic chlorine, bromine and iodine in one extract. Human hair is a convenient material to evaluate the burden of such compounds in human body and dan be easily collected from people over wide ranges of age, sex, residential areas, eating habits and working environments. To effectively extract organohalogen compounds from human hair, in present work the optimal Soxhelt-extraction time of extractable organohalogen (EOX) and extractable persistent organohalogen (EPOX) from hair of different lengths were studied by NAA. The results indicated that the optimal Soxhelt-extraction time of EOX and EPOX from human hair was 8-11 h, and the highest EOX and EPOX contents were observed in hair powder extract. The concentrations of both EOX and EPOX in different hair sections were in the order of hair powder ≥ 2 mm > 5 mm, which stated that hair samples milled into hair powder or cut into very short sections were not only for homogeneous. hair sample but for the best hair extraction efficiency.

  7. Toxicology of microcystins with reference to cases of human intoxications and epidemiological investigations of exposures to cyanobacteria and cyanotoxins.

    Science.gov (United States)

    Svirčev, Zorica; Drobac, Damjana; Tokodi, Nada; Mijović, Biljana; Codd, Geoffrey A; Meriluoto, Jussi

    2017-02-01

    Blooms of cyanobacteria have been documented throughout history, all over the world. Mass populations of these organisms typically present hazards to human health and are known for the production of a wide range of highly toxic metabolites-cyanotoxins, of which among the most common and most investigated are the microcystins. The toxicity of the family of microcystin congeners to animal and cell models has received much attention; however, less is known about their negative effects on human health, whether via acute or chronic exposure. Useful information may be acquired through epidemiological studies since they can contribute to knowledge of the relationships between cyanotoxins and human health in environmental settings. The aim of this review is to compile and evaluate the available published reports and epidemiological investigations of human health incidents associated with exposure to mass populations of cyanobacteria from throughout the world and to identify the occurrence and likely role of microcystins in these events. After an initial screening of 134 publications, 42 publications (25 on the chronic and 17 on the acute effects of cyanotoxins) describing 33 cases of poisonings by cyanobacterial toxins in 11 countries were reviewed. The countries were Australia, China, Sri Lanka, Namibia, Serbia, Sweden, UK, Portugal, Brazil, USA, and Canada. At least 36 publications link cyanobacteria/cyanotoxins including microcystins to adverse human health effects. The studies were published between 1960 and 2016. Although the scattered epidemiological evidence does not provide a definitive conclusion, it can serve as additional information for the medical assessment of the role of microcystins in cancer development and other human health problems. This paper discusses the major cases of cyanotoxin poisonings as well as the strengths, weaknesses, and importance of the performed epidemiological research. This study also proposes some recommendations for future

  8. A spontaneous mutant of microcystin biosynthesis: genetic characterization and effect on Daphnia

    DEFF Research Database (Denmark)

    Kabernick, M.; Rohrlack, T.; Christoffersen, K.

    2001-01-01

    . Regardless of microcystin content, both Daphnia exhibited significantly reduced ingestion rates when fed with either strain of M. aeruginosa compared with the green alga Scenedesmus acutus. A disruption of the molting process in both Daphnia spp. was noted when these species were fed with MRC cells...

  9. Extraction optimization of mucilage from Basil (Ocimum basilicum L.) seeds using response surface methodology.

    Science.gov (United States)

    Nazir, Sadaf; Wani, Idrees Ahmed; Masoodi, Farooq Ahmad

    2017-05-01

    Aqueous extraction of basil seed mucilage was optimized using response surface methodology. A Central Composite Rotatable Design (CCRD) for modeling of three independent variables: temperature (40-91 °C); extraction time (1.6-3.3 h) and water/seed ratio (18:1-77:1) was used to study the response for yield. Experimental values for extraction yield ranged from 7.86 to 20.5 g/100 g. Extraction yield was significantly ( P  < 0.05) affected by all the variables. Temperature and water/seed ratio were found to have pronounced effect while the extraction time was found to have minor possible effects. Graphical optimization determined the optimal conditions for the extraction of mucilage. The optimal condition predicted an extraction yield of 20.49 g/100 g at 56.7 °C, 1.6 h, and a water/seed ratio of 66.84:1. Optimal conditions were determined to obtain highest extraction yield. Results indicated that water/seed ratio was the most significant parameter, followed by temperature and time.

  10. Optimization of TRPO process parameters for americium extraction from high level waste

    International Nuclear Information System (INIS)

    Chen Jing; Wang Jianchen; Song Chongli

    2001-01-01

    The numerical calculations for Am multistage fractional extraction by trialkyl phosphine oxide (TRPO) were verified by a hot test. 1750L/t-U high level waste (HLW) was used as the feed to the TRPO process. The analysis used the simple objective function to minimize the total waste content in the TRPO process streams. Some process parameters were optimized after other parameters were selected. The optimal process parameters for Am extraction by TRPO are: 10 stages for extraction and 2 stages for scrubbing; a flow rate ratio of 0.931 for extraction and 4.42 for scrubbing; nitric acid concentration of 1.35 mol/L for the feed and 0.5 mol/L for the scrubbing solution. Finally, the nitric acid and Am concentration profiles in the optimal TRPO extraction process are given

  11. Optimization of the extraction of curcumin from Curcuma longa rhizomes

    Directory of Open Access Journals (Sweden)

    Viviane P. Paulucci

    2012-10-01

    Full Text Available The aim of this work was to study the effect of dynamic maceration factors upon the curcumin content of Curcuma longa L., Zingiberaceae, extracts and to determine the optimum set of parameters for the extraction of curcumin using a 2(5 full factorial design and the response surface methodology. Under the established conditions, the content of soluble solids and curcumin in the extracts ranged from 0.8 to 3.4%, and from 0.1 to 1.8%, respectively. The most influential variable observed for the extraction was the ethanolic strength of the solvent. The optimized condition involves an extraction time of 12 h, agitation speed of 30 rpm, drug to solvent ratio of 1/6, extraction temperature of 80 ºC and the solvent with ethanolic strength of 70%. The data reported herein are useful for further developments of curcuma phytopharmaceutical intermediate products with optimized characteristics.

  12. Crystallization and preliminary crystallographic analysis of human LR11 Vps10p domain

    International Nuclear Information System (INIS)

    Nakata, Zenzaburo; Nagae, Masamichi; Yasui, Norihisa; Bujo, Hideaki; Nogi, Terukazu; Takagi, Junichi

    2010-01-01

    LR11/sorLA contains in its extracellular region a large (∼700-residue) Vps10p domain that is implicated in its intracellular protein-trafficking function. Here, the expression, purification, crystallization and preliminary crystallographic characterization of this domain are described. Low-density lipoprotein receptor (LDLR) relative with 11 binding repeats (LR11; also known as sorLA) is genetically associated with late-onset Alzheimer’s disease and is thought to be involved in neurodegenerative processes. LR11 contains a vacuolar protein-sorting 10 protein (Vps10p) domain. As this domain has been implicated in protein–protein interaction in other receptors, its structure and function are of great biological interest. Human LR11 Vps10p domain was expressed in mammalian cells and the purified protein was crystallized using the hanging-drop vapour-diffusion method. Enzymatic deglycosylation of the sample was critical to obtaining diffraction-quality crystals. Deglycosylated LR11 Vps10p-domain crystals belonged to the hexagonal space group P6 1 22. A diffraction data set was collected to 2.4 Å resolution and a clear molecular-replacement solution was obtained

  13. Optimization of ultrasonic extraction of phenolic antioxidants from green tea using response surface methodology.

    Science.gov (United States)

    Lee, Lan-Sook; Lee, Namhyouck; Kim, Young Ho; Lee, Chang-Ho; Hong, Sang Pil; Jeon, Yeo-Won; Kim, Young-Eon

    2013-10-31

    Response surface methodology (RSM) has been used to optimize the extraction conditions of antioxidants with relatively low caffeine content from green tea by using ultrasonic extraction. The predicted optimal conditions for the highest antioxidant activity and minimum caffeine level were found at 19.7% ethanol, 26.4 min extraction time, and 24.0 ° C extraction temperature. In the predicted optimal conditions, the experimental values were very close to the predicted values. Moreover, the ratio of (EGCg + ECg)/EGC was identified a major factor contributing to the antioxidant activity of green tea extracts. In this study, ultrasonic extraction showed that the ethanol concentration and extraction time used for antioxidant extraction could be remarkably reduced without a decrease in antioxidant activity compared to the conventional extraction conditions.

  14. Optimization of Ultrasonic Extraction of Phenolic Antioxidants from Green Tea Using Response Surface Methodology

    OpenAIRE

    Lee, Lan-Sook; Lee, Namhyouck; Kim, Young; Lee, Chang-Ho; Hong, Sang; Jeon, Yeo-Won; Kim, Young-Eon

    2013-01-01

    Response surface methodology (RSM) has been used to optimize the extraction conditions of antioxidants with relatively low caffeine content from green tea by using ultrasonic extraction. The predicted optimal conditions for the highest antioxidant activity and minimum caffeine level were found at 19.7% ethanol, 26.4 min extraction time, and 24.0 °C extraction temperature. In the predicted optimal conditions, the experimental values were very close to the predicted values. Moreover, the ratio ...

  15. Warming affects growth rates and microcystin production in tropical bloom-forming microcystis strains

    NARCIS (Netherlands)

    Bui, Trung; Dao, Thanh Son; Vo, Truong Giang; Lürling, Miquel

    2018-01-01

    Warming climate is predicted to promote cyanobacterial blooms but the toxicity of cyanobacteria under global warming is less well studied. We tested the hypothesis that raising temperature may lead to increased growth rates but to decreased microcystin (MC) production in tropical Microcystis

  16. Main: 1LR5 [RPSD[Archive

    Lifescience Database Archive (English)

    Full Text Available Aux311; Zea Mays Molecule: Auxin Binding Protein 1; Chain: A, B, C, D; Engineered: Yes; Mutation: Yes Protei...-.|EMBL; L08425; AAA33430.1; -.|PIR; S16262; S16262.|PDB; 1LR5; X-ray; A/B/C/D=39-201.|PDB; 1LRH; X-ray; A/B/C/D=39-201.|Mai

  17. Optimization of ultrasound-assisted extraction (UAE) of phenolic compounds from olive cake.

    Science.gov (United States)

    Mojerlou, Zohreh; Elhamirad, Amirhhossein

    2018-03-01

    The use of ultrasound in ultrasound-assisted extraction (UAE) is one of the main applications of this technology in food industry. This study aimed to optimize UAE conditions for olive cake extract (OCE) through response surface methodology (RSM). The optimal UAE conditions were obtained with extraction temperature of 56 °C, extraction time of 3 min, duty cycle of 0.6 s, and solid to solvent ratio of 3.6%. At the optimum conditions, the total phenolic compounds (TPC) content and antioxidant activity (AA) were measured 4.04 mg/g and 68.9%, respectively. The linear term of temperature had the most effect on TPC content and AA of OCE prepared by UAE. Protocatechuic acid and cinnamic acid were characterized as the highest (19.5%) and lowest (1.6%) phenolic compound measured in OCE extracted by UAE. This research revealed that UAE is an effective method to extract phenolic compounds from olive cake. RSM successfully optimized UAE conditions for OCE.

  18. Plant Phenolics Extraction from Flos Chrysanthemi: Response Surface Methodology Based Optimization and the Correlation Between Extracts and Free Radical Scavenging Activity.

    Science.gov (United States)

    Wu, Yanfang; Wang, Xinsheng; Xue, Jintao; Fan, Enguo

    2017-11-01

    Huaiju is one of the most famous and widely used Flos Chrysanthemi (FC) for medicinal purposes in China. Although various investigations aimed at phenolics extraction from other FC have been reported, a thorough optimization of the phenolics extraction conditions from Huaiju has not been achieved. This work applied the widely used response surface methodology (RSM) to investigate the effects of 3 independent variables including ethanol concentration (%), extraction time (min), and solvent-to-material ratio (mL/g) on the ultrasound-assisted extraction (UAE) of phenolics from FC. The data suggested the optimal UAE condition was an ethanol concentration of 75.3% and extraction time of 43.5 min, whereas the ratio of solvent to material has no significant effect. When the free radical scavenging ability was used as an indicator for a successful extraction, a similar optimal extraction was achieved with an ethanol concentration of 72.8%, extraction time of 44.3 min, and the ratio of solvent to material was 29.5 mL/g. Furthermore, a moderate correlation between the antioxidant activity of TP extract and the content of extracted phenolic compounds was observed. Moreover, a well consistent of the experimental values under optimal conditions with those predicted values suggests RSM successfully optimized the UAE conditions for phenolics extraction from FC. The work of the research investigated the plant phenolics in Flos Chrysanthemi and antioxidant capacities. These results of this study can support the development of antioxidant additive and relative food. © 2017 The Authors. Journal of Food Science published by Wiley Periodicals, Inc. on behalf of Institute of Food Technologists.

  19. A review of reproductive toxicity of microcystins

    International Nuclear Information System (INIS)

    Chen, Liang; Chen, Jun; Zhang, Xuezhen; Xie, Ping

    2016-01-01

    Highlights: • Reproductive toxicity of MCs on mammals, fishes, amphibians, and birds is reviewed. • PP1/2A inhibition and oxidative stress are important toxic mechanisms of MCs. • Reproductive toxicity of MCs may be closely related to endocrine-disrupting effects. • The trans-generational toxicity of microcystins is a matter of concern. • Data concerning female reproductive and sex-specific effects of MCs are lacking. - Abstract: Animal studies provide strong evidence of positive associations between microcystins (MCs) exposure and reproductive toxicity, representing a threat to human reproductive health and the biodiversity of wild life. This paper reviews current knowledge of the reproductive toxicity of MCs, with regard to mammals, fishes, amphibians, and birds, mostly in males. Toxicity of MCs is primarily governed by the inhibition of protein phosphatases 1 and 2A (PP1 and PP2A) and disturbance of cellular phosphorylation balance. MCs exposure is related to excessive production of reactive oxygen species (ROS) and oxidative stress, leading to cytoskeleton disruption, mitochondria dysfunction, endoplasmic reticulum (ER) stress, and DNA damage. MCs induce cell apoptosis mediated by the mitochondrial and ROS and ER pathways. Through PP1/2A inhibition and oxidative stress, MCs lead to differential expression/activity of transcriptional factors and proteins involved in the pathways of cellular differentiation, proliferation, and tumor promotion. MC-induced DNA damage is also involved in carcinogenicity. Apart from a direct effect on testes and ovaries, MCs indirectly affect sex hormones by damaging the hypothalamic-pituitary-gonad (HPG) axis and liver. Parental exposure to MCs may result in hepatotoxicity and neurotoxicity of offspring. We also summarize the current research gaps which should be addressed by further studies.

  20. A review of reproductive toxicity of microcystins

    Energy Technology Data Exchange (ETDEWEB)

    Chen, Liang, E-mail: chan91@yeah.net [Donghu Experimental Station of Lake Ecosystems, State Key Laboratory of Freshwater Ecology and Biotechnology, Institute of Hydrobiology, Chinese Academy of Sciences, Wuhan 430072 (China); University of Chinese Academy of Sciences, Beijing 100049 (China); Chen, Jun, E-mail: chenjun@ihb.ac.cn [Donghu Experimental Station of Lake Ecosystems, State Key Laboratory of Freshwater Ecology and Biotechnology, Institute of Hydrobiology, Chinese Academy of Sciences, Wuhan 430072 (China); Zhang, Xuezhen, E-mail: xuezhen@mail.hzau.edu.cn [College of Fisheries, Huazhong Agricultural University, Freshwater Aquaculture Collaborative Innovation Center of Hubei Province, Wuhan 430070 (China); Xie, Ping, E-mail: xieping@ihb.ac.cn [Donghu Experimental Station of Lake Ecosystems, State Key Laboratory of Freshwater Ecology and Biotechnology, Institute of Hydrobiology, Chinese Academy of Sciences, Wuhan 430072 (China)

    2016-01-15

    Highlights: • Reproductive toxicity of MCs on mammals, fishes, amphibians, and birds is reviewed. • PP1/2A inhibition and oxidative stress are important toxic mechanisms of MCs. • Reproductive toxicity of MCs may be closely related to endocrine-disrupting effects. • The trans-generational toxicity of microcystins is a matter of concern. • Data concerning female reproductive and sex-specific effects of MCs are lacking. - Abstract: Animal studies provide strong evidence of positive associations between microcystins (MCs) exposure and reproductive toxicity, representing a threat to human reproductive health and the biodiversity of wild life. This paper reviews current knowledge of the reproductive toxicity of MCs, with regard to mammals, fishes, amphibians, and birds, mostly in males. Toxicity of MCs is primarily governed by the inhibition of protein phosphatases 1 and 2A (PP1 and PP2A) and disturbance of cellular phosphorylation balance. MCs exposure is related to excessive production of reactive oxygen species (ROS) and oxidative stress, leading to cytoskeleton disruption, mitochondria dysfunction, endoplasmic reticulum (ER) stress, and DNA damage. MCs induce cell apoptosis mediated by the mitochondrial and ROS and ER pathways. Through PP1/2A inhibition and oxidative stress, MCs lead to differential expression/activity of transcriptional factors and proteins involved in the pathways of cellular differentiation, proliferation, and tumor promotion. MC-induced DNA damage is also involved in carcinogenicity. Apart from a direct effect on testes and ovaries, MCs indirectly affect sex hormones by damaging the hypothalamic-pituitary-gonad (HPG) axis and liver. Parental exposure to MCs may result in hepatotoxicity and neurotoxicity of offspring. We also summarize the current research gaps which should be addressed by further studies.

  1. Some investigations and use of LR-115 track detectors for radon measurements

    CERN Document Server

    Amrani, D

    2001-01-01

    Closed passive integrating radon dosimeters based on the use of cellulose nitrate (LR-115 type II) have been developed for assessment of long term radon exposure. This paper presents and comments the results of investigations, of registration efficiency, calibration factors, linearity tests and lower limit of detection for LR-115 detectors from different batches.

  2. Optimization of Ultrasonic Extraction of Phenolic Antioxidants from Green Tea Using Response Surface Methodology

    Directory of Open Access Journals (Sweden)

    Lan-Sook Lee

    2013-10-01

    Full Text Available Response surface methodology (RSM has been used to optimize the extraction conditions of antioxidants with relatively low caffeine content from green tea by using ultrasonic extraction. The predicted optimal conditions for the highest antioxidant activity and minimum caffeine level were found at 19.7% ethanol, 26.4 min extraction time, and 24.0 °C extraction temperature. In the predicted optimal conditions, the experimental values were very close to the predicted values. Moreover, the ratio of (EGCg + ECg/EGC was identified a major factor contributing to the antioxidant activity of green tea extracts. In this study, ultrasonic extraction showed that the ethanol concentration and extraction time used for antioxidant extraction could be remarkably reduced without a decrease in antioxidant activity compared to the conventional extraction conditions.

  3. MICROCYSTIN ANALYSIS IN HUMAN SERA AND LIVER FROM HUMAN FATALITIES IN CARUARU, BRAZIL 1996

    Science.gov (United States)

    The detection of cyanotoxins, especially hepatotoxic microcystins in tissue, is of growing interest to scientists, clinicians, and public health officials because cyanotoxins can contaminate surface waters that are used for drinking and recreational purposes. Documentation of hum...

  4. Cyanobacterial and microcystins dynamics following the application of hydrogen peroxide to waste stabilisation ponds

    Science.gov (United States)

    Barrington, D. J.; Ghadouani, A.; Ivey, G. N.

    2013-06-01

    Cyanobacteria and cyanotoxins are a risk to human and ecological health, and a hindrance to biological wastewater treatment. This study investigated the use of hydrogen peroxide (H2O2) for the removal of cyanobacteria and cyanotoxins from within waste stabilization ponds (WSPs). The daily dynamics of cyanobacteria and microcystins (commonly occurring cyanotoxins) were examined following the addition of H2O2 to wastewater within both the laboratory and at the full scale within a maturation WSP, the final pond in a wastewater treatment plant. Hydrogen peroxide treatment at concentrations ≥ 0.1 mg H2O2 μg-1 total phytoplankton chlorophyll a led to the lysis of cyanobacteria, in turn releasing intracellular microcystins to the dissolved state. In the full-scale trial, dissolved microcystins were then degraded to negligible concentrations by H2O2 and environmental processes within five days. A shift in the phytoplankton assemblage towards beneficial Chlorophyta species was also observed within days of H2O2 addition. However, within weeks, the Chlorophyta population was significantly reduced by the re-establishment of toxic cyanobacterial species. This re-establishment was likely due to the inflow of cyanobacteria from ponds earlier in the treatment train, suggesting that whilst H2O2 may be a suitable short-term management technique, it must be coupled with control over inflows if it is to improve WSP performance in the longer term.

  5. Cyanobacterial and microcystins dynamics following the application of hydrogen peroxide to waste stabilisation ponds

    Directory of Open Access Journals (Sweden)

    D. J. Barrington

    2013-06-01

    Full Text Available Cyanobacteria and cyanotoxins are a risk to human and ecological health, and a hindrance to biological wastewater treatment. This study investigated the use of hydrogen peroxide (H2O2 for the removal of cyanobacteria and cyanotoxins from within waste stabilization ponds (WSPs. The daily dynamics of cyanobacteria and microcystins (commonly occurring cyanotoxins were examined following the addition of H2O2 to wastewater within both the laboratory and at the full scale within a maturation WSP, the final pond in a wastewater treatment plant. Hydrogen peroxide treatment at concentrations ≥ 0.1 mg H2O2 μg−1 total phytoplankton chlorophyll a led to the lysis of cyanobacteria, in turn releasing intracellular microcystins to the dissolved state. In the full-scale trial, dissolved microcystins were then degraded to negligible concentrations by H2O2 and environmental processes within five days. A shift in the phytoplankton assemblage towards beneficial Chlorophyta species was also observed within days of H2O2 addition. However, within weeks, the Chlorophyta population was significantly reduced by the re-establishment of toxic cyanobacterial species. This re-establishment was likely due to the inflow of cyanobacteria from ponds earlier in the treatment train, suggesting that whilst H2O2 may be a suitable short-term management technique, it must be coupled with control over inflows if it is to improve WSP performance in the longer term.

  6. Optimization of β-cyclodextrin-based flavonol extraction from apple pomace using response surface methodology.

    Science.gov (United States)

    Parmar, Indu; Sharma, Sowmya; Rupasinghe, H P Vasantha

    2015-04-01

    The present study investigated five cyclodextrins (CDs) for the extraction of flavonols from apple pomace powder and optimized β-CD based extraction of total flavonols using response surface methodology. A 2(3) central composite design with β-CD concentration (0-5 g 100 mL(-1)), extraction temperature (20-72 °C), extraction time (6-48 h) and second-order quadratic model for the total flavonol yield (mg 100 g(-1) DM) was selected to generate the response surface curves. The optimal conditions obtained were: β-CD concentration, 2.8 g 100 mL(-1); extraction temperature, 45 °C and extraction time, 25.6 h that predicted the extraction of 166.6 mg total flavonols 100 g(-1) DM. The predicted amount was comparable to the experimental amount of 151.5 mg total flavonols 100 g(-1) DM obtained from optimal β-CD based parameters, thereby giving a low absolute error and adequacy of fitted model. In addition, the results from optimized extraction conditions showed values similar to those obtained through previously established solvent based sonication assisted flavonol extraction procedure. To the best of our knowledge, this is the first study to optimize aqueous β-CD based flavonol extraction which presents an environmentally safe method for value-addition to under-utilized bio resources.

  7. Analysis of WRKY transcription factors and characterization of two Botrytis cinerea-responsive LrWRKY genes from Lilium regale.

    Science.gov (United States)

    Cui, Qi; Yan, Xiao; Gao, Xue; Zhang, Dong-Mei; He, Heng-Bin; Jia, Gui-Xia

    2018-06-01

    A major constraint in producing lilies is gray mold caused by Botrytis elliptica and B. cinerea. WRKY transcription factors play important roles in plant immune responses. However, limited information is available about the WRKY gene family in lily plants. In this study, 23 LrWRKY genes with complete WRKY domains were identified from the Botrytis-resistant species Lilium regale. The putative WRKY genes were divided into seven subgroups (Group I, IIa-e, and III) according to their structural features. Sequence alignment revealed that LrWRKY proteins have a highly conserved WRKYGQK domain and a variant, the WRKYGKK domain, and these proteins generally contained similar motif compositions throughout the same subgroup. Functional annotation predicted they might be involved in biological processes related to abiotic and biotic stresses. A qRT-PCR analysis confirmed that expression of six LrWRKY genes in L. regale or the susceptible Asian hybrid 'Yale' was induced by B. cinerea infection. Among these genes, LrWRKY4, LrWRKY8 and LrWRKY10 were expressed at a higher level in L. regale than 'Yale', while the expression of LrWRKY6 and LrWRKY12 was lower in L. regale. Furthermore, LrWRKY4 and LrWRKY12 genes, which also respond to salicylic acid (SA) and methyl jasmonate (MeJA) treatments, were isolated from L. regale. Subcellular localization analysis determined that they were targeted to the nucleus. Constitutive expression of LrWRKY4 and LrWRKY12 in Arabidopsis resulted in plants that were more resistant to B. cinerea than wild-type plants. This resistance was coupled with the transcriptional changes of SA and JA-responsive genes. Overall, our study provides valuable information about the structural and functional characterization of LrWRKY genes that will not only deepen our understanding of the molecular mechanisms underlying the defense of lily against B. cinerea but also offer potential targets for cultivar improvement via biotechnology. Copyright © 2018 Elsevier Masson

  8. An optimized DNA extraction protocol for benthic Didymosphenia geminata.

    Science.gov (United States)

    Uyua, Noelia Mariel; Manrique, Julieta Marina; Jones, Leandro Roberto

    2014-09-01

    Didymosphenia geminata mats display few cells in relation to extracellular material and contain polysaccharides and heavy metals that interfere with molecular studies. We describe an optimized DNA extraction protocol that help to overcome these difficulties. Our protocol outperformed five previously described DNA extraction techniques. Copyright © 2014 Elsevier B.V. All rights reserved.

  9. Parametric optimization of rice bran oil extraction using response surface methodology

    Directory of Open Access Journals (Sweden)

    Ahmad Syed W.

    2016-09-01

    Full Text Available Use of bran oil in various edible and nonedible industries is very common. In this research work, efficient and optimized methodology for the recovery of rice bran oil has been investigated. The present statistical study includes parametric optimization, based on experimental results of rice bran oil extraction. In this study, three solvents, acetone, ethanol and solvent mixture (SM [acetone: ethanol (1:1 v/v] were employed in extraction investigations. Response surface methodology (RSM, an optimization technique, was exploited for this purpose. A five level central composite design (CCD consisting four operating parameter, like temperature, stirring rate, solvent-bran ratio and contact time were examined to optimize rice bran oil extraction. Experimental results showed that oil recovery can be enhanced from 71% to 82% when temperature, solvent-bran ratio, stirring rate and contact time were kept at 55°C, 6:1, 180 rpm and 45 minutes, respectively while fixing the pH of the mixture at 7.1.

  10. Optimal Information Extraction of Laser Scanning Dataset by Scale-Adaptive Reduction

    Science.gov (United States)

    Zang, Y.; Yang, B.

    2018-04-01

    3D laser technology is widely used to collocate the surface information of object. For various applications, we need to extract a good perceptual quality point cloud from the scanned points. To solve the problem, most of existing methods extract important points based on a fixed scale. However, geometric features of 3D object come from various geometric scales. We propose a multi-scale construction method based on radial basis function. For each scale, important points are extracted from the point cloud based on their importance. We apply a perception metric Just-Noticeable-Difference to measure degradation of each geometric scale. Finally, scale-adaptive optimal information extraction is realized. Experiments are undertaken to evaluate the effective of the proposed method, suggesting a reliable solution for optimal information extraction of object.

  11. OPTIMAL INFORMATION EXTRACTION OF LASER SCANNING DATASET BY SCALE-ADAPTIVE REDUCTION

    Directory of Open Access Journals (Sweden)

    Y. Zang

    2018-04-01

    Full Text Available 3D laser technology is widely used to collocate the surface information of object. For various applications, we need to extract a good perceptual quality point cloud from the scanned points. To solve the problem, most of existing methods extract important points based on a fixed scale. However, geometric features of 3D object come from various geometric scales. We propose a multi-scale construction method based on radial basis function. For each scale, important points are extracted from the point cloud based on their importance. We apply a perception metric Just-Noticeable-Difference to measure degradation of each geometric scale. Finally, scale-adaptive optimal information extraction is realized. Experiments are undertaken to evaluate the effective of the proposed method, suggesting a reliable solution for optimal information extraction of object.

  12. Application of DNA RFLP procedures in interspecific gene transfer: The Lr19 translocation of wheat

    International Nuclear Information System (INIS)

    Prins, R.; Marais, G.F.; Marais, A.S.; Pretorius, Z.A.; Janse, B.J.H.

    1998-01-01

    Twenty-nine lines with deletions in the Lr19 ('Indis') translocated chromosome segment were used to physically map Thinopyrum Restriction Fragment Length Polymorphism (RFLP) loci as well as the Sr25 and Sdl loci. The relative distances between marker loci on the translocation were then calculated. The information was then used as an aid to characterize several recombined forms of the translocation. The data confirmed the reported homoeology between the Lr19 segment and chromosome arm 7DL of wheat. Also, it seems that the Lr19 translocation in 'Indis' is very similar to the Lr19 segment in the T4 source and that the former may not derive from Thinopyrum distichum. Near-isogenic lines of the recombined segments were derived and used to study their expression of leaf rust resistance. It became evident that only one potentially useful recombinant was obtained in an earlier attempt to induce allosyndetic pairing between the Lr19 translocation and 7DL of wheat. (author)

  13. Quality assurance for environmental radon measurements by LR115 nuclear track detectors

    Energy Technology Data Exchange (ETDEWEB)

    Gomaa, M A [National Network of Radiation Physics, Atomic Energy Authority, Cairo (Egypt); Hafez, A F [Physics Department, Faculty of Science, Alexandria Univercity, Alexandria (Egypt); Hussein, A S [Radiation Protection Department, Nuclear Power Plants Authority, Cairo (Egypt)

    2007-06-15

    Passive radon dosimeters based on LR115 nuclear track detectors are very attractive for assessment of radon exposure. For developing countries wishing to undertake national radon survey the most appropriate techniques are those making use of LR115 detectors. These detectors are small, cheap, simple, and non-hazardous and provide an entirely adequate tool for large scale use in assessing levels of radon over several months because of the short - term fluctuations in radon concentrations. In this paper, the principles and philosophy in order to improve the quality and reliability of radon exposure under a quality assurance (QA) program are presented . Also examples of how a QA program of radon measurements by LR115 detectors using the can-techniques are well defined and applied.

  14. Quality assurance for environmental radon measurements by LR115 nuclear track detectors

    International Nuclear Information System (INIS)

    Gomaa, M.A.; Hafez, A.F.; Hussein, A.S.

    2007-01-01

    Passive radon dosimeters based on LR115 nuclear track detectors are very attractive for assessment of radon exposure. For developing countries wishing to undertake national radon survey the most appropriate techniques are those making use of LR115 detectors. These detectors are small, cheap, simple, and non-hazardous and provide an entirely adequate tool for large scale use in assessing levels of radon over several months because of the short - term fluctuations in radon concentrations. In this paper, the principles and philosophy in order to improve the quality and reliability of radon exposure under a quality assurance (QA) program are presented . Also examples of how a QA program of radon measurements by LR115 detectors using the can-techniques are well defined and applied

  15. The interaction between nitrobenzene and Microcystis aeruginosa and its potential to impact water quality.

    Science.gov (United States)

    Liu, Zhiquan; Cui, Fuyi; Ma, Hua; Fan, Zhenqiang; Zhao, Zhiwei; Hou, Zhenling; Liu, Dongmei; Jia, Xuebin

    2013-08-01

    The potential water quality problems caused by the interaction between nitrobezene (NB) and Microcystis aeruginosa was investigated by studying the growth inhibition, the haloacetic acids formation potential (HAAFP) and the secretion of microcystin-LR (MC-LR). The results showed that NB can inhibit the growth of M. aeruginosa, and the value of EC50 increased with the increase of initial algal density. Although NB can hardly react with chlorine to form HAAs, the presence of NB can enhance the HAAFP productivity. The secretion of the intracellular MC-LR is constant under the steady experimental conditions. However, the presence of NB can reduce the MC-LR productivity of M. aeruginosa. Overall, the increased disinfection risk caused by the interaction has more important effect on the safety of drinking water quality than the benefit of the decreased MC-LR productivity, and should be serious considered when the water contained NB and M. aeruginosa is used as drinking water source. Copyright © 2013 Elsevier Ltd. All rights reserved.

  16. New reactive polymer for protein immobilisation on sensor surfaces.

    Science.gov (United States)

    Kyprianou, Dimitris; Guerreiro, Antonio R; Chianella, Iva; Piletska, Elena V; Fowler, Steven A; Karim, Kal; Whitcombe, Michael J; Turner, Anthony P F; Piletsky, Sergey A

    2009-01-01

    Immobilisation of biorecognition elements on transducer surfaces is a key step in the development of biosensors. The immobilisation needs to be fast, cheap and most importantly should not affect the biorecognition activity of the immobilised receptor. A novel protocol for the covalent immobilisation of biomolecules containing primary amines using an inexpensive and simple polymer is presented. This tri-dimensional (3D) network leads to a random immobilisation of antibodies on the polymer and ensures the availability of a high percentage of antibody binding sites. The reactivity of the polymer is based on the reaction between primary amines and thioacetal groups included in the polymer network. These functional groups (thioacetal) do not need any further activation in order to react with proteins, making it attractive for sensor fabrication. The novel polymer also contains thiol derivative groups (disulphide groups or thioethers) that promote self-assembling on a metal transducer surface. For demonstration purposes the polymer was immobilised on Au Biacore chips. The resulting polymer layer was characterised using contact angle meter, atomic force microscopy (AFM) and ellipsometry. A general protocol suitable for the immobilisation of bovine serum albumin (BSA), enzymes and antibodies such as polyclonal anti-microcystin-LR antibody and monoclonal anti-prostate specific antigen (anti-PSA) antibody was then optimised. The affinity characteristics of developed immunosensors were investigated in reaction with microcystin-LR, and PSA. The calculated detection limit for analytes depended on the properties of antibodies. The detection limit for microcystin-LR was 10 ngmL(-1) and for PSA 0.01 ngmL(-1). The non-specific binding of analytes to synthesised polymers was very low. The polymer-coated chips were stored for up to 2 months without any noticeable deterioration in their ability to react with proteins. These findings make this new polymer very promising for the

  17. Optimization of enzyme-assisted extraction and characterization of polysaccharides from Hericium erinaceus.

    Science.gov (United States)

    Zhu, Yang; Li, Qian; Mao, Guanghua; Zou, Ye; Feng, Weiwei; Zheng, Daheng; Wang, Wei; Zhou, Lulu; Zhang, Tianxiu; Yang, Jun; Yang, Liuqing; Wu, Xiangyang

    2014-01-30

    The enzyme-assisted extraction (EAE) of polysaccharides from the fruits of Hericium erinaceus was studied. In this study, response surface methodology and the Box-Behnken design based on single-factor and orthogonal experiments were applied to optimize the EAE conditions. The optimal extraction conditions were as follows: a pH of 5.71, a temperature of 52.03°C and a time of 33.79 min. The optimal extraction conditions resulted in the highest H. erinaceus polysaccharides (HEP) yield, with a value 13.46 ± 0.37%, which represented an increase of 67.72% compared to hot water extraction (HWE). The polysaccharides were characterized by FT-IR, SEM, CD, AFM, and GC. The results showed that HEP was composed of mannose, glucose, xylose, and galactose in a molar ratio of 15.16:5.55:4.21:1. The functional groups of the H. erinaceus polysaccharides extracted by HWE and EAE were fundamentally identical but had apparent conformational changes. Copyright © 2013 Elsevier Ltd. All rights reserved.

  18. Response Surface Optimized Extraction of Total Triterpene Acids ...

    African Journals Online (AJOL)

    Tropical Journal of Pharmaceutical Research May 2014; 13 (5): 787-792 ... surface method were used to optimize the extraction process, while antioxidant activity was evaluated in vitro using α ... Response surface methodology is increasingly.

  19. The optimization extraction of exopolysacchrides and its antioxidant ...

    African Journals Online (AJOL)

    lenovo

    2012-03-13

    Mar 13, 2012 ... Extraction optimization of exopolysaccharide produced ... 4College of Chemistry and Material Science, Shandong Agricultural University, Taian, Shandong 271018, PR China. 5The First .... access to water and food for 30 day.

  20. Optimized remedial groundwater extraction using linear programming

    International Nuclear Information System (INIS)

    Quinn, J.J.

    1995-01-01

    Groundwater extraction systems are typically installed to remediate contaminant plumes or prevent further spread of contamination. These systems are expensive to install and maintain. A traditional approach to designing such a wellfield uses a series of trial-and-error simulations to test the effects of various well locations and pump rates. However, the optimal locations and pump rates of extraction wells are difficult to determine when objectives related to the site hydrogeology and potential pumping scheme are considered. This paper describes a case study of an application of linear programming theory to determine optimal well placement and pump rates. The objectives of the pumping scheme were to contain contaminant migration and reduce contaminant concentrations while minimizing the total amount of water pumped and treated. Past site activities at the area under study included disposal of contaminants in pits. Several groundwater plumes have been identified, and others may be present. The area of concern is bordered on three sides by a wetland, which receives a portion of its input budget as groundwater discharge from the pits. Optimization of the containment pumping scheme was intended to meet three goals: (1) prevent discharge of contaminated groundwater to the wetland, (2) minimize the total water pumped and treated (cost benefit), and (3) avoid dewatering of the wetland (cost and ecological benefits). Possible well locations were placed at known source areas. To constrain the problem, the optimization program was instructed to prevent any flow toward the wetland along a user-specified border. In this manner, the optimization routine selects well locations and pump rates so that a groundwater divide is produced along this boundary

  1. Use of cyanopigment determination as an indicator of cyanotoxins in drinking water.

    Science.gov (United States)

    Schmidt, Wido; Petzoldt, Heike; Bornmann, Katrin; Imhof, Lutz; Moldaenke, Christian

    2009-01-01

    The indicator function of the fluorescence signals of the cyanopigments phycocyanin and phycoerythrin as early warning parameters against the microcystins in drinking water was investigated by lab- and pilot-scale studies. The early warning function of the fluorescence signals was examined with regard to the signals' real-time character, their sensitivity and the behaviour of the cyanopigments in different treatment stages in comparison to microcystins. Fluorescence measurements confirmed the real-time character, since they can be carried out on-site without the pre-concentration of pigments. The limit of detection of phycoerythrin is determined at 0.7 microg/L and of phycocyanin at 5.3 microg/L respectively. If the pigment/microcystin ratio is known and calculated to be higher than 1, very low microcystin concentrations can be estimated by the fluorescence signals. The compared behaviour of both pigments and selected microcystins (MC-LR and MC-RR) during water treatment shows that pigments have an early warning function against microcystins in conventional treatment stages using pre-oxidation with permanganate, powdered-activated carbon and chlorination. In contrast, cyanopigments do not have an early warning function if chlorine dioxide is used as a pre-oxidant or final disinfection agent. In order to use pigment control measurements in drinking water treatment the initial pigment/toxin ratio of the raw water must be known.

  2. Occurrence and elimination of cyanobacterial toxins in drinking water treatment plants

    International Nuclear Information System (INIS)

    Hoeger, Stefan J.; Hitzfeld, Bettina C.; Dietrich, Daniel R.

    2005-01-01

    Toxin-producing cyanobacteria (blue-green algae) are abundant in surface waters used as drinking water resources. The toxicity of one group of these toxins, the microcystins, and their presence in surface waters used for drinking water production has prompted the World Health Organization (WHO) to publish a provisional guideline value of 1.0 μg microcystin (MC)-LR/l drinking water. To verify the efficiency of two different water treatment systems with respect to reduction of cyanobacterial toxins, the concentrations of MC in water samples from surface waters and their associated water treatment plants in Switzerland and Germany were investigated. Toxin concentrations in samples from drinking water treatment plants ranged from below 1.0 μg MC-LR equiv./l to more than 8.0 μg/l in raw water and were distinctly below 1.0 μg/l after treatment. In addition, data to the worldwide occurrence of cyanobacteria in raw and final water of water works and the corresponding guidelines for cyanobacterial toxins in drinking water worldwide are summarized

  3. Nucleic acid protocols: Extraction and optimization

    Directory of Open Access Journals (Sweden)

    Saeed El-Ashram

    2016-12-01

    Full Text Available Yield and quality are fundamental features for any researchers during nucleic acid extraction. Here, we describe a simplified, semi-unified, effective, and toxic material free protocol for extracting DNA and RNA from different prokaryotic and eukaryotic sources exploiting the physical and chemical properties of nucleic acids. Furthermore, this protocol showed that DNA and RNA are under triple protection (i.e. EDTA, SDS and NaCl during lysis step, and this environment is improper for RNase to have DNA liberated of RNA and even for DNase to degrade the DNA. Therefore, the complete removal of RNA under RNase influence is achieved when RNase is added after DNA extraction, which gives optimal quality with any protocols. Similarly, DNA contamination in an isolated RNA is degraded by DNase to obtain high-quality RNA. Our protocol is the protocol of choice in terms of simplicity, recovery time, environmental safety, amount, purity, PCR and RT-PCR applicability.

  4. Optimization of microwave assisted extraction (MAE) and soxhlet extraction of phenolic compound from licorice root

    OpenAIRE

    Karami, Zohreh; Emam-Djomeh, Zahra; Mirzaee, Habib Allah; Khomeiri, Morteza; Mahoonak, Alireza Sadeghi; Aydani, Emad

    2014-01-01

    In present study, response surface methodology was used to optimize extraction condition of phenolic compounds from licorice root by microwave application. Investigated factors were solvent (ethanol 80 %, methanol 80 % and water), liquid/solid ratio (10:1–25:1) and time (2–6 min). Experiments were designed according to the central composite rotatable design. The results showed that extraction conditions had significant effect on the extraction yield of phenolic compounds and antioxidant capac...

  5. Optimization of Subcritical Water Extraction of Resveratrol from Grape Seeds by Response Surface Methodology

    Directory of Open Access Journals (Sweden)

    Yajie Tian

    2017-03-01

    Full Text Available The subcritical water extraction (SWE is a high-efficiency and environment-friendly extraction method. The extraction of resveratrol (RES of grape seeds obtained from the wine production process was proposed using subcritical water extraction (SWE. The effects of different extraction process parameters on RES yield were investigated by single factors. Extraction optimization was conducted using response surface methodology (RSM. Extraction temperature was proven to be the most significant factor influencing RES yield. The optimal conditions was as follows: extraction pressure of 1.02 MPa, temperature of 152.32 °C, time of 24.89 min, and a solid/solvent ratio of 1:15 g/mL. Under these optimal conditions, the predicted extraction RES yield was 6.90 μg/g and the recoveries was up to 91.98%. Compared to other previous studies, this method required less pollution and less treatment time to extract RES from grape seeds. From these results, added economic value to this agroindustrial residue is proposed using environmentally friendly extraction techniques.

  6. Optimization of ultrasonic-assisted extraction of pomegranate (Punica granatum L.) seed oil.

    Science.gov (United States)

    Tian, Yuting; Xu, Zhenbo; Zheng, Baodong; Martin Lo, Y

    2013-01-01

    The effectiveness of ultrasonic-assisted extraction (UAE) of pomegranate seed oil (PSO) was evaluated using a variety of solvents. Petroleum ether was the most effective for oil extraction, followed by n-hexane, ethyl acetate, diethyl ether, acetone, and isopropanol. Several variables, such as ultrasonic power, extraction temperature, extraction time, and the ratio of solvent volume and seed weight (S/S ratio) were studied for optimization using response surface methodology (RSM). The highest oil yield, 25.11% (w/w), was obtained using petroleum ether under optimal conditions for ultrasonic power, extraction temperature, extraction time, and S/S ratio at 140 W, 40 °C, 36 min, and 10 ml/g, respectively. The PSO yield extracted by UAE was significantly higher than by using Soxhlet extraction (SE; 20.50%) and supercriti cal fluid extraction (SFE; 15.72%). The fatty acid compositions were significantly different among the PSO extracted by Soxhlet extraction, SFE, and UAE, with punicic acid (>65%) being the most dominant using UAE. Copyright © 2012 Elsevier B.V. All rights reserved.

  7. Optimization of antioxidant phenolic compounds extraction from quinoa (Chenopodium quinoa) seeds.

    Science.gov (United States)

    Carciochi, Ramiro Ariel; Manrique, Guillermo Daniel; Dimitrov, Krasimir

    2015-07-01

    The objective of this study was to optimize the extraction conditions of phenolic and flavonoids compounds from quinoa (Chenopodium quinoa) seeds using ultrasound assistance technology. A randomized central composite face-centered design was used to evaluate the effect of extraction temperature, ethanol concentration in the solvent, and ultrasound power on the total phenolic content (TPC), total flavonoid content (TFC) and antioxidant activity by response surface analysis. Predicted model equations were obtained to describe the experimental data regarding TPC, TFC and antioxidant activity, with significant variation in the linear, quadratic, and interaction effects of the independent variables. Regression analysis showed that more than 88 % of the variability was explained by the models. The best extraction conditions obtained by simultaneous maximization of the responses were: extraction temperature of 60 °C, 80 % ethanol as solvent and non-application of ultrasounds. Under the optimal conditions, the corresponding predicted response values were 103.6 mg GAE/100 g dry weight (dw), 25.0 mg quercetin equiv./100 g dw and 28.6 % DPPH radical scavenging, for TPC, TFC and antioxidant activity, respectively. The experimental values agreed with those predicted within a 95 % confidence level, indicating the suitability of the employed model. HPLC analysis of the obtained extracts confirmed the highest phenolic compound yield in the extract obtained under optimal extraction conditions. Considering the characteristics of the antioxidant-rich extracts obtained, they could be consider for potential application in the food industry, as nutraceutical and functional foods ingredient or well as replacement of synthetic antioxidants.

  8. Degradation of microcystin-RR using boron-doped diamond electrode

    International Nuclear Information System (INIS)

    Zhang Chunyong; Fu Degang; Gu Zhongze

    2009-01-01

    Microcystins (MCs), produced by blue-green algae, are one of the most common naturally occurring toxins found in natural environment. The presence of MCs in drinking water sources poses a great threat to people's health. In this study, the degradation behavior of microcystin-RR on boron-doped diamond (BDD) electrode was investigated under galvanostatic conditions. Such parameters as reaction time, supporting electrolyte and applied current density were varied in order to determine their effects on this oxidation process. The experimental results revealed the suitability of electrochemical processes employing BDD electrode for removing MC-RR from the solution. However, the efficient removal of MC-RR only occurred in the presence of sodium chloride that acted as redox mediators and the reaction was mainly affected by the chloride concentration (c NaCl ) and applied current density (I appl ). Full and quick removal of 0.50 μg/ml MC-RR in solution was achieved when the operating conditions of c NaCl and I appl were 20 mM and 46.3 mA/cm 2 , or 35 mM and 18.2 mA/cm 2 respectively. The kinetics for MC-RR degradation followed a pesudo-first order reaction in most cases, indicating the process was under mass transfer control. As a result of its excellent performance, the BDD technology could be considered as a promising alternative to promote the degradation of MC-RR than chlorination in drinking water supplies.

  9. Optimization of microwave-assisted extraction and supercritical fluid extraction of carbamate pesticides in soil by experimental design methodology.

    Science.gov (United States)

    Sun, Lei; Lee, Hian Kee

    2003-10-03

    Orthogonal array design (OAD) was applied for the first time to optimize microwave-assisted extraction (MAE) and supercritical fluid extraction (SFE) conditions for the analysis of four carbamates (propoxur, propham, methiocarb, chlorpropham) from soil. The theory and methodology of a new OA16 (4(4)) matrix derived from a OA16 (2(15)) matrix were developed during the MAE optimization. An analysis of variance technique was employed as the data analysis strategy in this study. Determinations of analytes were completed using high-performance liquid chromatography (HPLC) with UV detection. Four carbamates were successfully extracted from soil with recoveries ranging from 85 to 105% with good reproducibility (approximately 4.9% RSD) under the optimum MAE conditions: 30 ml methanol, 80 degrees C extraction temperature, and 6-min microwave heating. An OA8 (2(7)) matrix was employed for the SFE optimization. The average recoveries and RSD of the analytes from spiked soil by SFE were 92 and 5.5%, respectively except for propham (66.3+/-7.9%), under the following conditions: heating for 30 min at 60 degrees C under supercritical CO2 at 300 kg/cm2 modified with 10% (v/v) methanol. The composition of the supercritical fluid was demonstrated to be a crucial factor in the extraction. The addition of a small volume (10%) of methanol to CO2 greatly enhanced the recoveries of carbamates. A comparison of MAE with SFE was also conducted. The results indicated that >85% average recoveries were obtained by both optimized extraction techniques, and slightly higher recoveries of three carbamates (propoxur, propham and methiocarb) were achieved using MAE. SFE showed slightly higher recovery for chlorpropham (93 vs. 87% for MAE). The effects of time-aged soil on the extraction of analytes were examined and the results obtained by both methods were also compared.

  10. Extraction Optimization and Antioxidant Properties of African Eggplant (Solanum macrocarpon Leaf Polyphenols

    Directory of Open Access Journals (Sweden)

    A. A. Famuwagun

    2017-01-01

    Full Text Available Optimization of the yield, total phenolic content (TPC, and total antioxidant activities (TAA of polyphenol concentrates extracted from Solanum macrocarpon leaves was studied using response surface methodology. The process variables investigated included extraction temperature (30, 50, and 70°C, extraction time (2, 4, and 6 h, and dried leaf powder : water ratio (1 : 10, 1 : 20, and 1 : 30 w/v. Box–Behnken design resulted in 15 experimental runs. The results showed the following optimum extraction conditions: temperature, 49.05°C; extraction time, 243 min; leaf powder : water ratio, 1 : 22 w/v. The optimized extraction conditions gave polyphenol concentrate yield, TPC, and TAA values of 24.94%, 421.09 mg GAE/g, and 23.81 mg AAE/g, respectively. Results of the in vitro antioxidant activities of the polyphenol concentrate showed 2, 2-diphenyl-2-picrylhydrazyl hydrate, metal chelating ability, and ferric reducing ability values of 76.78%, 80.22%, and 56.46 mg AAE/g, respectively. The study concludes that the experimental values compared closely with the predicted values, which indicates suitability of the model employed for polyphenol extraction optimization from dried S. macrocarpon leaves.

  11. Optimization of focused ultrasonic extraction of propellant components determined by gas chromatography/mass spectrometry.

    Science.gov (United States)

    Fryš, Ondřej; Česla, Petr; Bajerová, Petra; Adam, Martin; Ventura, Karel

    2012-09-15

    A method for focused ultrasonic extraction of nitroglycerin, triphenyl amine and acetyl tributyl citrate presented in double-base propellant samples following by the gas chromatography/mass spectrometry analysis was developed. A face-centered central composite design of the experiments and response surface modeling was used for optimization of the time, amplitude and sample amount. The dichloromethane was used as the extractant solvent. The optimal extraction conditions with respect to the maximum yield of the lowest abundant compound triphenyl amine were found at the 20 min extraction time, 35% amplitude of ultrasonic waves and 2.5 g of the propellant sample. The results obtained under optimal conditions were compared with the results achieved with validated Soxhlet extraction method, which is typically used for isolation and pre-concentration of compounds from the samples of explosives. The extraction yields for acetyl tributyl citrate using both extraction methods were comparable; however, the yield of ultrasonic extraction of nitroglycerin and triphenyl amine was lower than using Soxhlet extraction. The possible sources of different extraction yields are estimated and discussed. Copyright © 2012 Elsevier B.V. All rights reserved.

  12. Optimizing pressurized liquid extraction of microbial lipids using the response surface method.

    Science.gov (United States)

    Cescut, J; Severac, E; Molina-Jouve, C; Uribelarrea, J-L

    2011-01-21

    Response surface methodology (RSM) was used for the determination of optimum extraction parameters to reach maximum lipid extraction yield with yeast. Total lipids were extracted from oleaginous yeast (Rhodotorula glutinis) using pressurized liquid extraction (PLE). The effects of extraction parameters on lipid extraction yield were studied by employing a second-order central composite design. The optimal condition was obtained as three cycles of 15 min at 100°C with a ratio of 144 g of hydromatrix per 100 g of dry cell weight. Different analysis methods were used to compare the optimized PLE method with two conventional methods (Soxhlet and modification of Bligh and Dyer methods) under efficiency, selectivity and reproducibility criteria thanks to gravimetric analysis, GC with flame ionization detector, High Performance Liquid Chromatography linked to Evaporative Light Scattering Detector (HPLC-ELSD) and thin-layer chromatographic analysis. For each sample, the lipid extraction yield with optimized PLE was higher than those obtained with referenced methods (Soxhlet and Bligh and Dyer methods with, respectively, a recovery of 78% and 85% compared to PLE method). Moreover, the use of PLE led to major advantages such as an analysis time reduction by a factor of 10 and solvent quantity reduction by 70%, compared with traditional extraction methods. Copyright © 2010 Elsevier B.V. All rights reserved.

  13. Optimization of the Ocimum basilicum L. extraction process regarding the antioxidant activity

    Directory of Open Access Journals (Sweden)

    Vidović Senka S.

    2012-01-01

    Full Text Available The levels of input variables (temperature and extraction solvent that optimize a particular response (total phenols content, total flavonoids content and antioxidant activity of the Ocimum basilicum L. extraction process were determined by the response surface methodology (RSM. The influence of theextraction temperature on extraction process was investigated in the range from 33.8ºC to 76.2ºC, as well as of extraction solvent ethanol, in the range of concentrations from 21.7% to 78.3%. For the preparation of basil dry extract, characterized with minimal IC50 value, the calculated optimal values of temperature and ethanol concentration were: 75.33ºC and 73.66% (w/w. [Projekat Ministarstva nauke Republike Srbije, br. TR 31013

  14. Prospective evaluation of IOTA logistic regression models LR1 and LR2 in comparison with subjective pattern recognition for diagnosis of ovarian cancer in an outpatient setting.

    Science.gov (United States)

    Nunes, N; Ambler, G; Foo, X; Widschwendter, M; Jurkovic, D

    2018-06-01

    To determine whether International Ovarian Tumor Analysis (IOTA) logistic regression models LR1 and LR2 developed for the preoperative diagnosis of ovarian cancer could also be used to differentiate between benign and malignant adnexal tumors in the population of women attending gynecology outpatient clinics. This was a single-center prospective observational study of consecutive women attending our gynecological diagnostic outpatient unit, recruited between May 2009 and January 2012. All the women were first examined by a Level-II ultrasound operator. In those diagnosed with adnexal tumors, the IOTA-LR1/2 protocol was used to evaluate the masses. The LR1 and LR2 models were then used to assess the risk of malignancy. Subsequently, the women were also examined by a Level-III examiner, who used pattern recognition to differentiate between benign and malignant tumors. Women with an ultrasound diagnosis of malignancy were offered surgery, while asymptomatic women with presumed benign lesions were offered conservative management with a minimum follow-up of 12 months. The initial diagnosis was compared with two reference standards: histological findings and/or a comparative assessment of tumor morphology on follow-up ultrasound scans. All women for whom the tumor classification on follow-up changed from benign to malignant were offered surgery. In the final analysis, 489 women who had either or both of the reference standards were included. Their mean age was 50 years (range, 16-91 years) and 45% were postmenopausal. Of the included women, 342/489 (69.9%) had surgery and 147/489 (30.1%) were managed conservatively. The malignancy rate was 137/489 (28.0%). Overall, sensitivities of LR1 and LR2 for the diagnosis of malignancy were 97.1% (95% CI, 92.7-99.2%) and 94.9% (95% CI, 89.8-97.9%) and specificities were 77.3% (95% CI, 72.5-81.5%) and 76.7% (95% CI, 71.9-81.0%), respectively (P > 0.05). In comparison with pattern recognition (sensitivity 94.2% (95% CI, 88

  15. Subchronic toxicity of Nile tilapia with different exposure routes to Microcystis aeruginosa: Histopathology, liver functions, and oxidative stress biomarkers

    Directory of Open Access Journals (Sweden)

    H. M. R. Abdel-Latif

    2017-08-01

    Full Text Available Background: Toxic cyanobacterial blooms (Microcystis aeruginosa contains microcystins [MCs] have been reported to induce clinicopathological alterations as well as different oxidative stress in aquatic biota. Aim: Three-week subchronic exposure experiment was carried out on Nile tilapia, to determine their effects on fish behavior, tissues, liver functions, antioxidant enzymes, and lipid peroxidation. Materials and Methods: Fish were exposed to four main treatments; orally fed diet plus toxic cells of M. aeruginosa (containing 3500 μg/g MC-LR, immersion in 500 μg MC-LR/L, intraperitoneal injection of M. aeruginosa MC-LR with a dose of 0.1 ml of extracted toxin at a dose of 200 μg/kg bwt, and the fourth one served as a control group, then the fish were sacrificed at the end of 3rd week of exposure. Results: The results revealed no recorded mortality with obvious behavioral changes and an enlarged liver with the congested gall bladder. Histopathology demonstrated fragmentation, hyalinization, and necrosis of the subcutaneous musculature marked fatty degeneration, and vacuolation of hepatopancreatic cells with adhesion of the secondary gill lamellae associated with severe leukocytic infiltration. Furthermore, liver functions enzymes (aspartate aminotransferase and alanine aminotransferase, and the activities of glutathione peroxidase, glutathione reductase, lipid peroxidase, and catalase enzymes were significantly increased in all treatments starting from the 2nd week as compared to the control levels. Conclusion: In this context, the study addresses the possible toxicological impacts of toxic M. aeruginosa contain MC-LR to Nile tilapia, and the results investigated that MC-LR is toxic to Nile tilapia in different routes of exposure as well as different doses.

  16. Optimizing the extraction of antibacterial compounds from pineapple leaf fiber

    Directory of Open Access Journals (Sweden)

    Zhuang Zhikai

    2016-01-01

    Full Text Available Five different solvents (petroleum ether, chloroform, ethyl acetate, acetone, and distilled water were used to extract antibacterial compounds from pineapple leaf fiber. Compounds extracted using acetone showed the greatest antibacterial effect against Escherichia coli, measured by inhibition zone diameter. Three extraction parameters including temperature, time and solid-liquid ratio were optimized through orthogonal experiment based on single factor investigations for achieving maximum active substance extraction rate and bacteriostatic effect. Results showed that using acetone, the optimum extraction conditions for temperature, time and solid-liquid ratio were 45°C, 8 h, and 1:40 (g/ml, respectively.

  17. Optimized digital feature extraction in the FERMI microsystem

    International Nuclear Information System (INIS)

    Alexanian, H.; Appelquist, G.; Bailly, P.

    1995-01-01

    We describe the digital filter section of the FERMI readout microsystem. The filter section, consisting of two separate filter blocks, extracts the pulse amplitude and time information for the first-level trigger process and performs a highly accurate energy measurement for higher-level triggering and data readout purposes. An FIR-order statistic hybrid filter structure is used to improve the amplitude extraction performance. Using a training procedure the filters are optimized to produce a precise and accurate output in the presence of electronics and pile-up noise, sample timing jitter and the superposition of high-energy pulses. As the FERMI system resides inside the detector where accessibility is limited, the filter implementations are presented together with fault tolerance considerations. The filter section is modelled with the VHDL hardware descriptive language and the subsystems are further optimized to minimize the system latency and circuit area. ((orig.))

  18. SPEXTRA: Optimal extraction code for long-slit spectra in crowded fields

    Science.gov (United States)

    Sarkisyan, A. N.; Vinokurov, A. S.; Solovieva, Yu. N.; Sholukhova, O. N.; Kostenkov, A. E.; Fabrika, S. N.

    2017-10-01

    We present a code for the optimal extraction of long-slit 2D spectra in crowded stellar fields. Its main advantage and difference from the existing spectrum extraction codes is the presence of a graphical user interface (GUI) and a convenient visualization system of data and extraction parameters. On the whole, the package is designed to study stars in crowded fields of nearby galaxies and star clusters in galaxies. Apart from the spectrum extraction for several stars which are closely located or superimposed, it allows the spectra of objects to be extracted with subtraction of superimposed nebulae of different shapes and different degrees of ionization. The package can also be used to study single stars in the case of a strong background. In the current version, the optimal extraction of 2D spectra with an aperture and the Gaussian function as PSF (point spread function) is proposed. In the future, the package will be supplemented with the possibility to build a PSF based on a Moffat function. We present the details of GUI, illustrate main features of the package, and show results of extraction of the several interesting spectra of objects from different telescopes.

  19. Liquid chromatography-high resolution mass spectrometric methods for the surveillance monitoring of cyanotoxins in freshwaters.

    Science.gov (United States)

    Bogialli, Sara; Bortolini, Claudio; Di Gangi, Iole Maria; Di Gregorio, Federica Nigro; Lucentini, Luca; Favaro, Gabriella; Pastore, Paolo

    2017-08-01

    A comprehensive risk management on human exposure to cyanotoxins, whose production is actually unpredictable, is limited by reliable analytical tools for monitoring as many toxic algal metabolites as possible. Two analytical approaches based on a LC-QTOF system for target analysis and suspect screening of cyanotoxins in freshwater were presented. A database with 369 compounds belonging to cyanobacterial metabolites was developed and used for a retrospective data analysis based on high resolution mass spectrometry (HRMS). HRMS fragmentation of the suspect cyanotoxin precursor ions was subsequently performed for correctly identifying the specific variants. Alternatively, an automatic tandem HRMS analysis tailored for cyanotoxins was performed in a single chromatographic run, using the developed database as a preferred precursor ions list. Twenty-five extracts of surface and drinking waters contaminated by cyanobacteria were processed. The identification of seven uncommon microcystins (M(O)R, MC-FR, MSer 7 -YR, D-Asp 3 MSer 7 -LR, MSer 7 -LR, dmAdda-LR and dmAdda-YR) and 6 anabaenopeptins (A, B, F, MM850, MM864, oscyllamide Y) was reported. Several isobaric variants, fully separated by chromatography, were pointed out. The developed methods are proposed to be used by environmental and health agencies for strengthening the surveillance monitoring of cyanotoxins in water. Copyright © 2017 Elsevier B.V. All rights reserved.

  20. 76 FR 60937 - Draft License Renewal Interim Staff Guidance LR-ISG-2011-02; Aging Management Program for Steam...

    Science.gov (United States)

    2011-09-30

    ...-2011-02; Aging Management Program for Steam Generators AGENCY: Nuclear Regulatory Commission. ACTION... License Renewal Interim Staff Guidance (LR-ISG), LR-ISG-2011-02, ``Aging Management Program for Steam... using Revision 3 of NEI 97-06 to manage steam generator aging. The Draft LR-ISG revises the NRC staff's...

  1. Experimental additions of aluminum sulfate and ammonium nitrate to in situ mesocosms to reduce cyanobacterial biovolume and microcystin concentration

    Science.gov (United States)

    Harris, Ted D.; Wilhelm, Frank M.; Graham, Jennifer L.; Loftin, Keith A.

    2014-01-01

    Recent studies suggest that nitrogen additions to increase the total nitrogen:total phosphorus (TN:TP) ratio may reduce cyanobacterial biovolume and microcystin concentration in reservoirs. In systems where TP is >100 μg/L, however, nitrogen additions to increase the TN:TP ratio could cause ammonia, nitrate, or nitrite toxicity to terrestrial and aquatic organisms. Reducing phosphorus via aluminum sulfate (alum) may be needed prior to nitrogen additions aimed at increasing the TN:TP ratio. We experimentally tested this sequential management approach in large in situ mesocosms (70.7 m3) to examine effects on cyanobacteria and microcystin concentration. Because alum removes nutrients and most seston from the water column, alum treatment reduced both TN and TP, leaving post-treatment TN:TP ratios similar to pre-treatment ratios. Cyanobacterial biovolume was reduced after alum addition, but the percent composition (i.e., relative) cyanobacterial abundance remained unchanged. A single ammonium nitrate (nitrogen) addition increased the TN:TP ratio 7-fold. After the TN:TP ratio was >50 (by weight), cyanobacterial biovolume and abundance were reduced, and chrysophyte and cryptophyte biovolume and abundance increased compared to the alum treatment. Microcystin was not detectable until the TN:TP ratio was <50. Although both treatments reduced cyanobacteria, only the nitrogen treatment seemed to stimulate energy flow from primary producers to zooplankton, which suggests that combining alum and nitrogen treatments may be a viable in-lake management strategy to reduce cyanobacteria and possibly microcystin concentrations in high-phosphorus systems. Additional studies are needed to define best management practices before combined alum and nitrogen additions are implemented as a reservoir management strategy.

  2. Optimizing conditions for enzymatic extraction of sunflower oil

    Directory of Open Access Journals (Sweden)

    Badr, F. H.

    1992-10-01

    Full Text Available Sunflower seed oil was extracted with an enzymatic processes using different hydrolytic enzymes: cellulase, hemicellulase, animal proteinase, acid proteinase, pectinase and pectinex, as compared to enzyme - free aqueous extraction. All the hydrolytic enzymes enhanced oil extraction from sunflower seeds. The most optimal conditions for oil extraction from sunflower seeds were: 2% enzyme concentration, 30% substrate concentration and 3 hrs period. Using Boganov and Buchkov equation showed that time must be prolonged to get higher yields. The maximum yield during 3 hrs extraction with enzymatic process ranged between 44,5%-57,1% of the soxhlet extractable oil. The potency of the investigated enzymes in extracting oil was in the following order: acid proteinase > cellulase > hemicellulase > animal proteinase > pectinex > pectinase when compared at the previous optimal conditions.

    Aceite de semilla de girasol fue extraído mediante un proceso enzimático usando diferentes enzimas hidrolíticos: celulasa, hemicelulasa, proteinasa animal, proteinasa acida, pectinasa y pectinex, comparando con la extracción acuosa libre de enzima. Todos los enzimas hidrolíticos incrementan la extracción de aceites de semilla de girasol. Las condiciones óptimas para la extracción de aceite a partir de semillas de girasol fueron: 2% de concentración de enzima, 30% de concentración de sustrato y un período de 3 horas. La ecuación de Boganov y Buchkov mostró que el tiempo debe ser prolongado para alcanzar altos rendimientos. El máximo rendimiento durante tres horas de extracción con proceso enzimático osciló entre el 44,5%-57,1% del aceite extraído con soxhlet. La potencia de los enzimas investigados en la extracción de aceite siguió el orden: proteinasa acida > celulasa > hemicelulasa > proteinasa animal > pectinex > pectinasa cuando fue previamente comparado con las condiciones óptimas.

  3. Main: 1LR4 [RPSD[Archive

    Lifescience Database Archive (English)

    Full Text Available 1LR4 トウモロコシ Corn Zea mays L. Casein Kinase Ii, Alpha Chain Name=Ack2; Zea Mays Mole...cule: Protein Kinase Ck2; Chain: A; Synonym: Casein Kinase Ii, Alpha Chain; Engineered: Yes Transferase 2.7....ray; A=2-326.|PDB; 1M2Q; X-ray; A=2-328.|PDB; 1M2R; X-ray; A=2-328.|PDB; 1OM1; X-ray; A=1-332.|Mai

  4. WWER-440 control assembly local power peaking investigation on LR-0 reactor

    International Nuclear Information System (INIS)

    Mikus, J.

    2002-01-01

    This paper presents information concerning the local power peaking problem induced by the WWER-440 control assembly and the investigation possibilities on the light water, zero power reactor LR-0 at the Nuclear Research Institute (NRI) Rez plc. A brief description is given about the disposable control assembly model, experimental arrangement and conditions on the LR-0 reactor with regard to the earlier performed investigations as well as to the relevant measurements to be realized in the near future.(abstract)

  5. A further study of the (CR-LR) difference technique for retrospective radon exposure assessment

    International Nuclear Information System (INIS)

    Nikezic, D.; Yip, C.W.Y.; Leung, S.Y.Y.; Leung, J.K.C.; Yu, K.N.

    2006-01-01

    The (CR-LR) difference technique, based on the CR-39 and LR 115 detectors, for the determination of implanted 210 Po in glass after deposition of short-lived radon progeny, was analyzed in details in this paper. The sensitivities of both detectors were calculated using the Monte Carlo method with V functions particularly derived in our previous works for the detectors used in the present experiments. The dependency of the sensitivity ratio on the removed layer of both detectors was determined and verified experimentally. The simulated sensitivity ratios correlate well with the experimental ones. A major finding of the present work is that the sensitivity ratio between the CR-39 and LR 115 detectors depends only weakly on the ratio between the 238 U and 232 Th concentrations in the glass samples. This is crucial for the application of the (CR-LR) difference technique for retrospective radon exposure assessments, since measurements of the 238 U and 232 Th concentrations in the relatively small real-life glass samples will make the retrospective radon exposure assessments impractical

  6. An acute case of intoxication with cyanobacteria and cyanotoxins in recreational water in Salto Grande Dam, Argentina.

    Science.gov (United States)

    Giannuzzi, Leda; Sedan, Daniela; Echenique, Ricardo; Andrinolo, Dario

    2011-01-01

    Cyanobacterial blooms and hepatotoxic microcystins (MCs) usually occur in summer, constituting a sanitary and environmental problem in Salto Grande Dam, Argentina. Water sports and recreational activities take place in summer in this lake. We reported an acute case of cyanobacterial poisoning in Salto Grande dam, Argentina, which occurred in January 2007. Accidentally, a young man was immersed in an intense bloom of Microcystis spp. A level of 48.6 μg·L(-1) of microcystin-LR was detected in water samples. Four hours after exposure, the patient showed nausea, abdominal pain and fever. Three days later, dyspnea and respiratory distress were reported. The patient was hospitalized in intensive care and diagnosed with an atypical pneumonia. Finally, a week after the exposure, the patient developed a hepatotoxicosis with a significant increase of hepatic damage biomarkers (ALT, AST and γGT). Complete recovery took place within 20 days. This is the first study to show an acute intoxication with microcystin-producing cyanobacteria blooms in recreational water.

  7. Optimization of aqueous extraction process to enhance the ...

    African Journals Online (AJOL)

    Kumar Sudhir

    2014-02-12

    Feb 12, 2014 ... Aqueous extraction process was optimized to reduce endotoxins from mixed ... management and minimizes the initial capital costs for ... of about 40%, was suggested to be an economic ... industry and as the nutraceutical food for human due to ... economical production of industrial enzymes and as feed.

  8. Microcystin uptake and biochemical responses in the freshwater clam Corbicula leana P. exposed to toxic and non-toxic Microcystis aeruginosa: Evidence of tolerance to cyanotoxins.

    Science.gov (United States)

    Pham, Thanh-Luu; Shimizu, Kazuya; Dao, Thanh-Son; Hong-Do, Lan-Chi; Utsumi, Motoo

    2015-01-01

    We investigated the accumulation and adverse effects of toxic and non-toxic Microcystis in the edible clam Corbicula leana . Treated clams were exposed to toxic Microcystis at 100 μg of MC (microcystin)-LR eq  L -1 for 10 days. The experimental organism was then placed in toxin-free water and fed on non-toxic Microcystis for the following 10 days for depuration. Filtering rates (FRs) by C. leana of toxic and non-toxic Microcystis and of the green alga Chlorella vulgaris as a control were estimated. Adverse effects were evaluated though the activity of catalase (CAT), superoxide dismutase (SOD) and glutathione S-transferase (GST). Clam accumulated MCs (up to 12.7 ± 2.5 μg g -1 dry weight (DW) of free MC and 4.2 ± 0.6 μg g -1 DW of covalently bound MC). Our results suggest that although both toxic and non-toxic cyanobacteria caused adverse effects by inducing the detoxification and antioxidant defense system, the clam was quite resistant to cyanotoxins. The estimated MC concentration in C. leana was far beyond the World Health Organization's (WHO) provisional tolerable daily intake (0.04 μg kg -1  day -1 ), suggesting that consuming clams harvested during cyanobacterial blooms carries a high health risk.

  9. Optimization on Extraction Engineering of the Anti - inflammatory Bioactive Materials from Ainsliaea Fragrans Champ

    Directory of Open Access Journals (Sweden)

    Yang Jie

    2016-01-01

    Full Text Available Ainsliaea fragrans Champ.(A.fragrans is a traditional Chinese herbal, phenolic compounds was the major anti - inflammatory bioactive constituents. To improve the bioavailability and enhanced the curative effect of A.fragrans, the anti - inflammatory effect of phenolic acids and the “non-active” group of control vectors constitute a new biomedical material, which is of great significance to the treatment of diseases inflammation. Hence, in this thesis, regarding the total phenolic acid transfer rate as the indicator, L9(34 orthogonal design was used to optimize the extraction process of total Phenolic acid from A.fragrans by reflux extraction method on solvent dosage, extraction times and extraction time.The optimal extraction technology was as follows: 15 times of water volume, reflux extraction 3 times, extraction time 60 min. The result of pharmacological activity indicated anti-inflammatory effect: 95% ethanol extraction > water extraction > 30% ethanol extraction > 60% ethanol extraction.

  10. Production of cyanopeptolins, anabaenopeptins, and microcystins by the harmful cyanobacteria Anabaena 90 and Microcystis PCC 7806

    NARCIS (Netherlands)

    Tonk, L.; Welker, M.; Huisman, J.; Visser, P.M.

    2009-01-01

    This study investigated the effects of light intensity, temperature, and phosphorus limitation on the peptide production of the cyanobacteria Microcystis PCC 7806 and Anabaena 90. Microcystis PCC 7806 produced two microcystin variants and three cyanopeptolins, whereas Anabaena 90 produced four

  11. Optimization of composition and technology for tablets containing aspen bark extract

    Directory of Open Access Journals (Sweden)

    O. I. Onуshkiv

    2015-04-01

    Full Text Available Summary. Influence of quantitativefactorsof basic quality parameters has been investigated for tabletscontainingextractofaspenbark, receivedbydirect pressingmethodand mathematicalplanningof experiment.To set the optimal composition of tablets containingaspen bark extract the proportion ofProsolv 90, Ludiflash and Polyplasdone XL 10 has been studied. The relationship between the studied factors and parameters of tablets’ regression models has been described. As a result tablets containing aspen bark extractwith mentioned above formula match necessary pharmaco-technological parameters of State Pharmacopoeia of Ukraine. Introduction.Peptic and duodenal ulcer are serious problems in modern medicine. According to statistics this disease is found in 12,83 % of the adult population in Ukraine [1]. Among the remedies for treatment and prevention of peptic ulcers we can find herbal medicines that may be used in the treatment of pre-peptic conditions and during an acute period as a means of adjuvant therapy in combination with strong remedies [2]. An antacid, cytoprotective, anti-inflammatory and reparative actions of aspen bark extract were proved by the researches of domestic and foreign scientists [3, 4]. Previously, we researched the mutual influence of excipients on the main indicators of quality of aspen bark extract tablets obtained by direct compression method. Due to these researches the best excipientshave been selected. It is necessary to establish the optimal quantitative proportion of excipients in order to obtain the tablets with suitable parameters that satisfy the requirements of the State Pharmacopoeia of Ukraine (SPU [5, 6]. Rational selection of excipients requires wide range of studies to obtain the optimal composition of the tablets containing aspen bark extract. Using mathematical planning of the experiment gives the possibility to reduce the number of experiments and to obtain the most detailed results of researches about effects

  12. Extraction Optimization of Water-Extracted Mycelial Polysaccharide from Endophytic Fungus Fusarium oxysporum Dzf17 by Response Surface Methodology

    Directory of Open Access Journals (Sweden)

    Ligang Zhou

    2012-05-01

    Full Text Available Water-extracted mycelial polysaccharide (WPS from the endophytic fungus Fusarium oxysporum Dzf17 isolated from Dioscorea zingiberensis was found to be an efficient elicitor to enhance diosgenin accumulation in D. zingigerensis cultures, and also demonstrated antioxidant activity. In this study, response surface methodology (RSM was employed to optimize the extraction process of WPS from F. oxysporum Dzf17 using Box-Behnken design (BBD. The ranges of the factors investigated were 1–3 h for extraction time (X1, 80–100 °C for extraction temperature (X2, and 20–40 (v/w for ratio of water volume (mL to raw material weight (g (X3. The experimental data obtained were fitted to a second-order polynomial equation using multiple regression analysis. Statistical analysis showed that the polynomial regression model was in good agreement with the experimental results with the determination coefficient (R2 of 0.9978. By solving the regression equation and analyzing the response surface contour plots, the extraction parameters were optimized as 1.7 h for extraction time, 95 °C for extraction temperature, 39 (v/w for ratio of water volume (mL to raw material weight (g, and with 2 extractions. The maximum value (10.862% of WPS yield was obtained when the WPS extraction process was conducted under the optimal conditions.

  13. Responses of the antioxidative and biotransformation enzymes in the aquatic fungus Mucor hiemalis exposed to cyanotoxins.

    Science.gov (United States)

    Balsano, Evelyn; Esterhuizen-Londt, Maranda; Hoque, Enamul; Lima, Stephan Pflugmacher

    2017-08-01

    To investigate antioxidative and biotransformation enzyme responses in Mucor hiemalis towards cyanotoxins considering its use in mycoremediation applications. Catalase (CAT), glutathione reductase (GR), and glutathione peroxidase (GPx) in M. hiemalis maintained their activities at all tested microcystin-LR (MC-LR) exposure concentrations. Cytosolic glutathione S-transferase (GST) activity decreased with exposure to 100 µg MC-LR l -1 while microsomal GST remained constant. Cylindrospermopsin (CYN) at 100 µg l -1 led to an increase in CAT activity and inhibition of GR, as well as to a concentration-dependent GPx inhibition. Microsomal GST was inhibited at all concentrations tested. β-N-methylamino-L-alanine (BMAA) inhibited GR activity in a concentration-dependent manner, however, CAT, GPx, and GST remained unaffected. M. hiemalis showed enhanced oxidative stress tolerance and intact biotransformation enzyme activity towards MC-LR and BMAA in comparison to CYN, confirming its applicability in bioreactor technology in terms of viability and survival in their presence.

  14. Optimization of liquid-liquid extraction of biosurfactants from corn steep liquor.

    Science.gov (United States)

    Vecino, X; Barbosa-Pereira, L; Devesa-Rey, R; Cruz, J M; Moldes, A B

    2015-09-01

    In this work, the optimization of the operational conditions for the chloroform-based extraction of surface-active compounds from corn steep liquor (CSL) was carried out and the nutritional properties of the remnant aqueous phase (CSL-less biosurfactant) was evaluated as microbial fermentation medium. The optimal conditions to obtain biosurfactants from CSL were as follows: chloroform/CSL ratio 2 (v/v), 56 °C at extraction times >30 min. At the optima conditions, 100 % of biosurfactant extract can be obtained from CSL, obtaining 12.0 ± 0.5 g of biosurfactant extract/Kg of CSL. The critical micelle concentration (CMC) of the biosurfactant extract was 399.4 mg L(-1). This value is similar to the CMC of cetrimonium bromide (CTAB), a cationic surfactant used in the formulation of nanoparticles. The extraction of biosurfactant can be also carried out at room temperature although in this case, the extraction yield decreased about 15 %. The extraction of surface-active compounds from agroindustrial streams can suppose important advances for the bio-based surfactants industry. Biosurfactants obtained in this work are not only more eco-friendly than chemical detergents but also can be cost competitive with its chemical counterparts. Furthermore, after the extraction of surface-active compounds, CSL-less biosurfactant was found to be suitable as nutritional supplement for lactic acid bacteria, maintaining its nutritional properties in comparison with regular CSL.

  15. Continuous Linguistic Rhetorical Education as a Means of Optimizing Language Policy in Russian Multinational Regions

    Science.gov (United States)

    Vorozhbitova, Alexandra A.; Konovalova, Galina M.; Ogneva, Tatiana N.; Chekulaeva, Natalia Y.

    2017-01-01

    Drawing on the function of Russian as a state language the paper proposes a concept of continuous linguistic rhetorical (LR) education perceived as a means of optimizing language policy in Russian multinational regions. LR education as an innovative pedagogical system shapes a learner's readiness for self-projection as a strong linguistic…

  16. Microcystin assimilation and detoxification by Daphnia spp. in two ecosystems of different cyanotoxin concentrations

    Directory of Open Access Journals (Sweden)

    Adrianna Wojtal-Frankiewicz

    2013-02-01

    Full Text Available Microcystins (MCs, the main group of cyanotoxins, can induce oxidative stress in the cells of aquatic animals. This study evaluated the sensitivity of daphniids – from two ecosystems characterised by different trophic states and habitat levels of cyanobacteria abundance – to microcystin toxicity by analysing oxidative stress parameters and MC detoxification ability. As a study site, we chose the eutrophic Sulejow reservoir, which has regular annual toxic cyanobacterial blooms, and the mesotrophic lake Białe, where low abundances of cyanobacteria have only recently appeared. We found much higher accumulations of MCs in tissues of Daphnia spp. in lake Białe, despite low toxin concentrations in this ecosystem compared with the Sulejow reservoir. Simultaneously, high levels of lipid peroxidation (LPO and a significant decrease in glutathione (GSH were observed in daphniid cells in lake Białe, while LPO levels were generally lower and GSH concentration more stable in the Sulejow reservoir. Catalase activity, which reflects more efficient oxidative protection, was always significantly higher in the reservoir than in lake Białe. These results demonstrate that generations of daphniids from the Sulejow reservoir had more effective antioxidant systems protecting them against the accumulation of cyanobacterial toxins; thereby, they are less susceptible to toxic effects than the daphniids from lake Białe. However, the presence of conjugate forms of microcystins (MC-GSH and MC-Cys in tissues of the studied animals indicated the ability for MC detoxification by daphniids from the Sulejow reservoir and lake Białe. Nevertheless, the high effectiveness of antioxidant systems in daphniids coexisting with cyanobacteria for a long time in the Sulejow reservoir indicates the importance of a selective pressure exerted by toxic cyanobacterial strains that favours the most resistant daphniid genotypes.

  17. Impact of microcystin containing diets on physiological performance of Nile tilapia (Oreochromis niloticus) concerning stress and growth

    Czech Academy of Sciences Publication Activity Database

    Ziková, A.; Trubiroha, A.; Wiegand, C.; Wuertz, S.; Rennert, B.; Pflugmacher, S.; Kopp, Radovan; Mareš, J.; Kloas, W.

    2010-01-01

    Roč. 29, č. 3 (2010), s. 561-568 ISSN 0730-7268 Institutional research plan: CEZ:AV0Z60050516 Keywords : microcystin * Nile tilapia * physiological performance Subject RIV: EF - Botanics Impact factor: 3.026, year: 2010

  18. Optimization of moderators and beam extraction at the ESS

    DEFF Research Database (Denmark)

    Holst Andersen, Ken; Bertelsen, Mads; Zanini, Luca

    2018-01-01

    A global approach coupling the moderator to the beam extraction system has been applied for the design optimization of the thermal and cold moderators of the European Spallation Source (ESS), which will be the brightest neutron source in the world for condensed-matter studies. The design is based...... on the recently developed high-brightness low-dimensional moderator concepts. Para-hydrogen is used for the cold neutron source, while thermal neutrons are provided by moderation in water. The overall moderation configuration was chosen in order to satisfy a range of requirements on bispectral extraction......, beamport configuration and instrument performance. All instruments are served by a single moderator assembly above the target, arranged in a `butterfly' geometry with a height of 3cm. This was determined to be the optimal height for trade-off between high brightness and efficient guide illumination...

  19. Low-priced, time-saving, reliable and stable LR-115 counting system

    International Nuclear Information System (INIS)

    Tchorz-Trzeciakiewicz, D.E.

    2015-01-01

    Nuclear alpha particles leave etches (tracks) when they hit the surface of a LR-115 detector. The density of these tracks is used to measure radon concentration. Counting these tracks by human sense is tedious and time-consuming procedure and may introduce counting error, whereas most available automatic and semiautomatic counting systems are expensive or complex. An uncomplicated, robust, reliable and stable counting system using freely available on the Internet software as Digimizer™ and PhotoScape was developed and proposed. The effectiveness of the proposed procedure was evaluated by comparing the amount of tracks counted by software with the amount of tracks counted manually for 223 detectors. The percentage error for each analysed detector was obtained as a difference between automatic and manual counts divided by manual count. For more than 97% of detectors, the percentage errors oscillated between −3% and 3%. - Highlights: • Semiautomatic, uncomplicated procedure was proposed to count the amount of alpha tracks. • Freely available software on the Internet used as alpha tracks counting system for LR-115. • LR-115 detectors used to measure radon concentration and radon exhalation rate

  20. Modification of cyanobacterial bloom-derived biomass using potassium permanganate enhanced the removal of microcystins and adsorption capacity toward cadmium (II)

    International Nuclear Information System (INIS)

    Shao, Jihai; Gu, Ji-Dong; Peng, Liang; Luo, Si; Luo, Huili; Yan, Zhiyong; Wu, Genyi

    2014-01-01

    Highlights: • Potassium permanganate removed microcystins in the cyanobacterial bloom-derived biomass (CBDB). • Potassium permanganate oxidation caused the transformation of hydroxyl to carboxyl on the CBDB. • Manganese dioxide was formed on the surface of CBDB. • Potassium permanganate oxidation process increased the adsorption capacity of CBDB toward Cd(II). - Abstract: Cyanobacterial biomass shows high adsorption capacity toward heavy metal ions. However, the cyanotoxins in the cyanobacterial biomass inhibit its application in heavy metals removal. In order to safely and effectively remove Cd(II) from water using cyanobacterial bloom-derived biomass (CBDB), KMnO 4 was used to modify CBDB. The results indicated that the microcystins in the CBDB were successfully removed by KMnO 4 . Potassium permanganate oxidation caused the transformation of hydroxyl to carboxyl on the CBDB, and formed manganese dioxide on the surface of CBDB. The oxidized CBDB showed higher adsorption capacity toward Cd(II) than that of unoxidized treatment. The optimal KMnO 4 concentration for increasing the adsorption capacity of CBDB toward Cd(II) was 0.2 g/L. The adsorption isotherm of Cd(II) by oxidized- or unoxidized-CBDB was well fitted by Langmuir model, indicating that the adsorption of Cd(II) by CBDB was monolayer adsorption. The desorption ratio of Cd(II) from oxidized CBDB was higher than that from unoxidized CBDB in the desorption process using NH 4 NO 3 and EDTA as desorbent. The results presented in this study suggest that KMnO 4 modified CBDB may be used as a safe and high efficient adsorbent in Cd(II) removal from water

  1. Process Optimization of Ultrasonic-Assisted Extraction of Arabinogalactan from Dihydroquercetin Extracted Residues by Response Surface Methodology and Evaluation of Its Antioxidant Activity

    Directory of Open Access Journals (Sweden)

    Zaizhi Liu

    2013-01-01

    Full Text Available Ultrasound was used for the extraction of larch arabinogalactan from Larix gmelinii. The optimal conditions for ultrasound extraction were determined by response surface methodology. Specifically, the Box-Behnken design was employed to evaluate the effects of three independent variables: ultrasound time, temperature, and liquid-solid ratio. The highest arabinogalactan yield (11.18% was obtained under the optimal extraction condition (extraction temperature 41.5°C, extraction time 24.3 min, and liquid-solid ratio 40 mL/g. In addition, the antioxidant activity of arabinogalactan that was extracted from dihydroquercetin extraction residues exhibited a moderate and concentration-dependent hydroxyl radical-scavenging capacity, ferric-reducing power, and reducing power. The wood material was characterized before and after processing by scanning electron microscopy and Fourier-transform infrared spectroscopy.

  2. The optimal extraction parameters and anti-diabetic activity of ...

    African Journals Online (AJOL)

    diabetic activity of FIBL on alloxan induced diabetic mice were studied. The optimal extraction parameters of FIBL were obtained by single factor test and orthogonal test, as follows: ethanol concentration 60 %, ratio of solvent to raw material 30 ...

  3. Operations of the LR56 radioactive liquid cask transport system at U.S. Department of Energy sites

    International Nuclear Information System (INIS)

    Davidson, J.S.; Hornstra, D.J.; Sazawal, V.K.; Clement, G.

    1996-01-01

    The LR56 cask system is licensed for use in France under Certificate of Compliance F/309/B(U)F for transport of 4,000-liter volumes of radioactive liquids. Three LR56 cask systems (with modifications for use at Department of Energy (DOE) sites) have been purchased for delivery at the Hanford Site, Oak Ridge National Laboratory (ORNL), and Savannah River Site (SRS). The LR56 cask systems will be used for on-site transfers of Type B quantities of radioactive liquid waste. The ORNL unit will also be used as a Type A packaging for transfers of radioactive liquids between DOE sites. This paper discusses LR56 operating features and the use of the cask system at the three DOE sites

  4. Cyanotoxin bioaccumulation in freshwater fish, Washington State, USA.

    Science.gov (United States)

    Hardy, F Joan; Johnson, Art; Hamel, Kathy; Preece, Ellen

    2015-11-01

    Until recently, exposure pathways of concern for cyanotoxins have focused on recreational exposure, drinking water, and dermal contact. Exposure to cyanotoxins through fish consumption is a relatively new area of investigation. To address this concern, microcystins and other cyanotoxins were analyzed in fish collected from nine Washington lakes with recurrent toxic blooms using two types of enzyme-linked immunosorbent assays (ELISAs) and liquid chromatography/mass spectrometry/mass spectrometry (LC-MS/MS). Microcystins or microcystin-like compounds were elevated in fish liver relative to muscle and other tissues (liver>gut>muscle). Microcystin concentrations in fish fillet samples using anti-Adda ELISA (range 6.3-11 μg/kg wet weight) were consistently higher in all fish species than concentrations using anti-microcystin (MC)-leucine-arginine (LR) ELISA (range 0.25-2.4 μg/kg wet weight). MC-leucine-alanine (LA) was the only variant detected in fish (2.5-12 μg/kg in four livers) among the nine variants analyzed by LC-MS/MS. Fish fillets showed no accumulation of the MCs targeted by LC-MS/MS. Other cyanotoxins analyzed (anatoxin-a, saxitoxin, domoic acid, and okadaic acid) were not detected in fish. Based on this and evidence from other studies, we believe that people can safely consume two 8-oz fish fillet meals per week from lakes with blooms producing MCs (clean the fish and discard viscera).

  5. LALR(1) : LL(1) = LR(0) : LL(0)

    NARCIS (Netherlands)

    Kruseman Aretz, F.E.J.; Emde Boas, van P.; Hemker, P.W.; Hoffman, W.; Houwen, van der P.J.; Pfluger, P.R.

    1992-01-01

    It is shown that LL(l) and LALR(l) acceptors can be obtained by restricting the action tables of the corresponding LL(O) and LR(O) acceptors to those entries that are accessed in at least one accepting sequence (of a sentence from the language). It follows that a number of properties that are easily

  6. Optimization of Pressurized Liquid Extraction of Three Major Acetophenones from Cynanchum bungei Using a Box-Behnken Design

    Science.gov (United States)

    Li, Wei; Zhao, Li-Chun; Sun, Yin-Shi; Lei, Feng-Jie; Wang, Zi; Gui, Xiong-Bin; Wang, Hui

    2012-01-01

    In this work, pressurized liquid extraction (PLE) of three acetophenones (4-hydroxyacetophenone, baishouwubenzophenone, and 2,4-dihydroxyacetophenone) from Cynanchum bungei (ACB) were investigated. The optimal conditions for extraction of ACB were obtained using a Box-Behnken design, consisting of 17 experimental points, as follows: Ethanol (100%) as the extraction solvent at a temperature of 120 °C and an extraction pressure of 1500 psi, using one extraction cycle with a static extraction time of 17 min. The extracted samples were analyzed by high-performance liquid chromatography using an UV detector. Under this optimal condition, the experimental values agreed with the predicted values by analysis of variance. The ACB extraction yield with optimal PLE was higher than that obtained by soxhlet extraction and heat-reflux extraction methods. The results suggest that the PLE method provides a good alternative for acetophenone extraction. PMID:23203079

  7. Optimization of Pressurized Liquid Extraction of Three Major Acetophenones from Cynanchum bungei Using a Box-Behnken Design

    Directory of Open Access Journals (Sweden)

    Hui Wang

    2012-11-01

    Full Text Available In this work, pressurized liquid extraction (PLE of three acetophenones (4-hydroxyacetophenone, baishouwubenzophenone, and 2,4-dihydroxyacetophenone from Cynanchum bungei (ACB were investigated. The optimal conditions for extraction of ACB were obtained using a Box-Behnken design, consisting of 17 experimental points, as follows: Ethanol (100% as the extraction solvent at a temperature of 120 °C and an extraction pressure of 1500 psi, using one extraction cycle with a static extraction time of 17 min. The extracted samples were analyzed by high-performance liquid chromatography using an UV detector. Under this optimal condition, the experimental values agreed with the predicted values by analysis of variance. The ACB extraction yield with optimal PLE was higher than that obtained by soxhlet extraction and heat-reflux extraction methods. The results suggest that the PLE method provides a good alternative for acetophenone extraction.

  8. Perceptual Dominant Color Extraction by Multidimensional Particle Swarm Optimization

    Directory of Open Access Journals (Sweden)

    Moncef Gabbouj

    2009-01-01

    Full Text Available Color is the major source of information widely used in image analysis and content-based retrieval. Extracting dominant colors that are prominent in a visual scenery is of utmost importance since the human visual system primarily uses them for perception and similarity judgment. In this paper, we address dominant color extraction as a dynamic clustering problem and use techniques based on Particle Swarm Optimization (PSO for finding optimal (number of dominant colors in a given color space, distance metric and a proper validity index function. The first technique, so-called Multidimensional (MD PSO can seek both positional and dimensional optima. Nevertheless, MD PSO is still susceptible to premature convergence due to lack of divergence. To address this problem we then apply Fractional Global Best Formation (FGBF technique. In order to extract perceptually important colors and to further improve the discrimination factor for a better clustering performance, an efficient color distance metric, which uses a fuzzy model for computing color (dis- similarities over HSV (or HSL color space is proposed. The comparative evaluations against MPEG-7 dominant color descriptor show the superiority of the proposed technique.

  9. An optimal thermal condition for maximal chlorophyll extraction

    Directory of Open Access Journals (Sweden)

    Fu Jia-Jia

    2017-01-01

    Full Text Available This work describes an environmentally friendly process for chlorophyll extraction from bamboo leaves. Shaking water bath and ultrasound cleaner are adopted in this technology, and the influence of temperature of the water bath and ultrasonic cleaner is evaluated. Results indicated that there is an optimal condition for maximal yield of chlorophyll.

  10. Predicting cyanobacterial abundance, microcystin, and geosmin in a eutrophic drinking-water reservoir using a 14-year dataset

    Science.gov (United States)

    Harris, Ted D.; Graham, Jennifer L.

    2017-01-01

    Cyanobacterial blooms degrade water quality in drinking water supply reservoirs by producing toxic and taste-and-odor causing secondary metabolites, which ultimately cause public health concerns and lead to increased treatment costs for water utilities. There have been numerous attempts to create models that predict cyanobacteria and their secondary metabolites, most using linear models; however, linear models are limited by assumptions about the data and have had limited success as predictive tools. Thus, lake and reservoir managers need improved modeling techniques that can accurately predict large bloom events that have the highest impact on recreational activities and drinking-water treatment processes. In this study, we compared 12 unique linear and nonlinear regression modeling techniques to predict cyanobacterial abundance and the cyanobacterial secondary metabolites microcystin and geosmin using 14 years of physiochemical water quality data collected from Cheney Reservoir, Kansas. Support vector machine (SVM), random forest (RF), boosted tree (BT), and Cubist modeling techniques were the most predictive of the compared modeling approaches. SVM, RF, and BT modeling techniques were able to successfully predict cyanobacterial abundance, microcystin, and geosmin concentrations <60,000 cells/mL, 2.5 µg/L, and 20 ng/L, respectively. Only Cubist modeling predicted maxima concentrations of cyanobacteria and geosmin; no modeling technique was able to predict maxima microcystin concentrations. Because maxima concentrations are a primary concern for lake and reservoir managers, Cubist modeling may help predict the largest and most noxious concentrations of cyanobacteria and their secondary metabolites.

  11. Optimized Extraction, Preliminary Characterization, and In Vitro Antioxidant Activity of Polysaccharides from Glycyrrhiza Uralensis Fisch.

    Science.gov (United States)

    Chen, Jie; Li, Wan-Chen; Gu, Xin-Li

    2017-04-13

    BACKGROUND This study performed optimized extraction, preliminary characterization, and in vitro antioxidant activities of polysaccharides from Glycyrrhiza uralensis Fisch. MATERIAL AND METHODS Three parameters (extraction temperature, ratio of water to raw material, and extraction time) were optimized for yields of G. uralensis polysaccharides (GUP) using response surface methodology with Box-Behnken design (BBD). The GUP was purified using DEAE cellulose 32-column chromatography. The main fraction obtained from G. uralensis Fisch was GUP-II, which was composed of rhamnose, arabinose, galactose, and glucose monosaccharide, was screened for antioxidant properties using DP Hand hydroxyl radical scavenging assays. In addition, immunological activity of GUP-II was determined by nitric oxide and lymphocyte proliferation assays. RESULTS Optimization revealed maximum GUP yields with an extraction temperature of 99°C, water: raw material ratio of 15: 1, and extraction duration of 2 h. GUP-II purified from G. uralensis Fisch had good in vitro DPPH and hydroxyl radical scavenging abilities. Immunologically, GUP-II significantly stimulated NO production in RAW 264.7 macrophages, and significantly enhanced LPS-induced lymphocyte proliferation. CONCLUSIONS Extraction of GUP from G. uralensis Fisch can be optimized with respect to temperature, extraction period, and ratio of water to material, using response surface methodology. The purified product (GUP-II) possesses excellent antioxidant and immunological activities.

  12. Optimization of Ultrasonic-Assisted Extraction of Flavonoid Compounds and Antioxidants from Alfalfa Using Response Surface Method.

    Science.gov (United States)

    Jing, Chang-Liang; Dong, Xiao-Fang; Tong, Jian-Ming

    2015-08-26

    Ultrasonic-assisted extraction (UAE) was used to extract flavonoid-enriched antioxidants from alfalfa aerial part. Response surface methodology (RSM), based on a four-factor, five-level central composite design (CCD), was employed to obtain the optimal extraction parameters, in which the flavonoid content was maximum and the antioxidant activity of the extracts was strongest. Radical scavenging capacity of the extracts, which represents the amounts of antioxidants in alfalfa, was determined by using 2,2'-azino-bis (3-ethylbenzothiazoline-6-sulphonicacid) (ABTS) and 2,2'-diphenyl-1-picrylhydrazyl (DPPH) methods. The results showed good fit with the proposed models for the total flavonoid extraction (R² = 0.9849), for the antioxidant extraction assayed by ABTS method (R² = 0.9764), and by DPPH method (R² = 0.9806). Optimized extraction conditions for total flavonoids was a ratio of liquid to solid of 57.16 mL/g, 62.33 °C, 57.08 min, and 52.14% ethanol. The optimal extraction parameters of extracts for the highest antioxidant activity by DPPH method was a ratio of liquid to solid 60.3 mL/g, 54.56 °C, 45.59 min, and 46.67% ethanol, and by ABTS assay was a ratio of liquid to solid 47.29 mL/g, 63.73 °C, 51.62 min, and 60% ethanol concentration. Our work offers optimal extraction conditions for total flavonoids and antioxidants from alfalfa.

  13. Soil Vapor Extraction System Optimization, Transition, and Closure Guidance

    Energy Technology Data Exchange (ETDEWEB)

    Truex, Michael J.; Becker, Dave; Simon, Michelle A.; Oostrom, Martinus; Rice, Amy K.; Johnson, Christian D.

    2013-02-08

    Soil vapor extraction (SVE) is a prevalent remediation approach for volatile contaminants in the vadose zone. A diminishing rate of contaminant extraction over time is typically observed due to 1) diminishing contaminant mass, and/or 2) slow rates of removal for contamination in low-permeability zones. After a SVE system begins to show indications of diminishing contaminant removal rate, SVE performance needs to be evaluated to determine whether the system should be optimized, terminated, or transitioned to another technology to replace or augment SVE. This guidance specifically addresses the elements of this type of performance assessment. While not specifically presented, the approach and analyses in this guidance could also be applied at the onset of remediation selection for a site as a way to evaluate current or future impacts to groundwater from vadose zone contamination. The guidance presented here builds from existing guidance for SVE design, operation, optimization, and closure from the U.S. Environmental Protection Agency, U.S. Army Corps of Engineers, and the Air Force Center for Engineering and the Environment. The purpose of the material herein is to clarify and focus on the specific actions and decisions related to SVE optimization, transition, and/or closure.

  14. Optimum Design of LLC Resonant Converter using Inductance Ratio (Lm/Lr)

    Science.gov (United States)

    Palle, Kowstubha; Krishnaveni, K.; Ramesh Reddy, Kolli

    2017-06-01

    The main benefits of LLC resonant dc/dc converter over conventional series and parallel resonant converters are its light load regulation, less circulating currents, larger bandwidth for zero voltage switching, and less tuning of switching frequency for controlled output. An unique analytical tool, called fundamental harmonic approximation with peak gain adjustment is used for designing the converter. In this paper, an optimum design of the converter is proposed by considering three different design criterions with different values of inductance ratio (Lm/Lr) to achieve good efficiency at high input voltage. The optimum design includes the analysis in operating range, switching frequency range, primary side losses of a switch and stability. The analysis is carried out with simulation using the software tools like MATLAB and PSIM. The performance of the optimized design is demonstrated for a design specification of 12 V, 5 A output operating with an input voltage range of 300-400 V using FSFR 2100 IC of Texas instruments.

  15. A genetic algorithm applied to a PWR turbine extraction optimization to increase cycle efficiency

    International Nuclear Information System (INIS)

    Sacco, Wagner F.; Schirru, Roberto

    2002-01-01

    In nuclear power plants feedwater heaters are used to heat feedwater from its temperature leaving the condenser to final feedwater temperature using steam extracted from various stages of the turbines. The purpose of this process is to increase cycle efficiency. The determination of the optimal fraction of mass flow rate to be extracted from each stage of the turbines is a complex optimization problem. This kind of problem has been efficiently solved by means of evolutionary computation techniques, such as Genetic Algorithms (GAs). GAs, which are systems based upon principles from biological genetics, have been successfully applied to several combinatorial optimization problems in nuclear engineering, as the nuclear fuel reload optimization problem. We introduce the use of GAs in cycle efficiency optimization by finding an optimal combination of turbine extractions. In order to demonstrate the effectiveness of our approach, we have chosen a typical PWR as case study. The secondary side of the PWR was simulated using PEPSE, which is a modeling tool used to perform integrated heat balances for power plants. The results indicate that the GA is a quite promising tool for cycle efficiency optimization. (author)

  16. Optimization of soy isoflavone extraction with different solvents using the simplex-centroid mixture design.

    Science.gov (United States)

    Yoshiara, Luciane Yuri; Madeira, Tiago Bervelieri; Delaroza, Fernanda; da Silva, Josemeyre Bonifácio; Ida, Elza Iouko

    2012-12-01

    The objective of this study was to optimize the extraction of different isoflavone forms (glycosidic, malonyl-glycosidic, aglycone and total) from defatted cotyledon soy flour using the simplex-centroid experimental design with four solvents of varying polarity (water, acetone, ethanol and acetonitrile). The obtained extracts were then analysed by high-performance liquid chromatography. The profile of the different soy isoflavones forms varied with different extractions solvents. Varying the solvent or mixture used, the extraction of different isoflavones was optimized using the centroid-simplex mixture design. The special cubic model best fitted to the four solvents and its combination for soy isoflavones extraction. For glycosidic isoflavones extraction, the polar ternary mixture (water, acetone and acetonitrile) achieved the best extraction; malonyl-glycosidic forms were better extracted with mixtures of water, acetone and ethanol. Aglycone isoflavones, water and acetone mixture were best extracted and total isoflavones, the best solvents were ternary mixture of water, acetone and ethanol.

  17. Radon concentrations in some Egyptian dwellings using LR 115 detectors

    International Nuclear Information System (INIS)

    Hussein, A.S.

    2007-01-01

    Radon, a well-established risk factor for human lung cancer, is present at low concentrations in most homes. Consequently, many countries have established national guidelines for residential radon concentrations. This survey provides additional information about indoor radon concentrations in Egypt. Indoor radon survey of a total of 15 randomly selected houses in Qena city, Upper Egypt was carried out. LR 115 detectors were exposed for one year, covering all the seasons. The estimated indoor radon levels varied from 19 to 59 Bq m 3 with an average of 40 Bq m 3 . Using the bare and filtered LR 115 detectors, the average equilibrium factor F was assessed as 0.30 indoors. An average annual effective dose of 0.40 mSv has been estimated and was found to be lower than the ICRP-65

  18. Fast Neutron Transport in the Biological Shielding Model and Other Regions of the VVER-1000 Mock-Up on the LR-0 Research Reactor

    Directory of Open Access Journals (Sweden)

    Košťál Michal

    2016-01-01

    Full Text Available A set of benchmark experiments was carried out in the full scale VVER-1000 mock-up on the reactor LR-0 in order to validate neutron transport calculation methodologies and to perform the optimization of the shape and locations of neutron flux operation monitors channels inside the shielding of the new VVER-1000 type reactors. Compared with previous experiments on the VVER-1000 mock-up on the reactor LR-0, the fast neutron spectra were measured in the extended neutron energy interval (0.1–10 MeV and new calculations were carried out with the MCNPX code using various nuclear data libraries (ENDF/B VII.0, JEFF 3.1, JENDL 3.3, JENDL 4, ROSFOND 2009, and CENDL 3.1. Measurements and calculations were carried out at different points in the mock-up. The calculation and experimental data are compared.

  19. Cell Lysis and Detoxification of Cyanotoxins Using a Novel Combination of Microbubble Generation and Plasma Microreactor Technology for Ozonation

    Directory of Open Access Journals (Sweden)

    Jagroop Pandhal

    2018-04-01

    Full Text Available There has been a steady rise in the incidences of algal blooms globally, and worryingly, there is increasing evidence that changes in the global climate are leading to a shift toward cyanobacterial blooms. Many cyanobacterial genera are harmful, producing several potent toxins, including microcystins, for which there are over 90 described analogues. There are a wide range of negative effects associated with these toxins including gastroenteritis, cytotoxicity, hepatotoxicity and neurotoxicity. Although a variety of oxidation based treatment methods have been described, ozonation and advanced oxidation are acknowledged as most effective as they readily oxidise microcystins to non-toxic degradation products. However, most ozonation technologies have challenges for scale up including high costs and sub-optimum efficiencies, hence, a low cost and scalable ozonation technology is needed. Here we designed a low temperature plasma dielectric barrier discharge (DBD reactor with an incorporated fluidic oscillator for microbubble delivery of ozone. Both technologies have the potential to drastically reduce the costs of ozonation at scale. Mass spectrometry analysis revealed very rapid (<2 min destruction of two pure microcystins (MC-LR and MC-RR, together with removal of by-products even at low flow rate 1 L min−1 where bubble size was 0.56–0.6 mm and the ozone concentration within the liquid was 20 ppm. Toxicity levels were calculated through protein phosphatase inhibition assays and indicated loss of toxicity as well as confirming the by-products were also non-toxic. Finally, treatment of whole Microcystis aeruginosa cells showed that even at these very low ozone levels, cells can be killed and toxins (MC-LR and Desmethyl MC-LR removed. Little change was observed in the first 20 min of treatment followed by rapid increase in extracellular toxins, indicating cell lysis, with most significant release at the higher 3 L min−1 flow rate compared to 1 L

  20. Optimization design and application of composite ultrasonic extraction method for effective constituents of green tea

    Directory of Open Access Journals (Sweden)

    Cheng-Chi Wang

    2015-12-01

    Full Text Available A composite ultrasonic process is used to extract five constituent components of green tea, namely caffeine, catechin, epigallocatechin gallate, epicatechin, and chlorogenic acid. The optimal parameters of the extraction process are determined using the robust Taguchi design method. The extracted products are analyzed using gas chromatography and high-performance liquid chromatography. The experimental results confirm the effectiveness of the proposed ultrasonic technique in extracting the components of interest. Moreover, it is shown that the optimal extraction parameters depend on the particular component. In general, the present findings provide a useful reference for further research on the processing of green tea.

  1. Optimal Coordinated Control of Power Extraction in LES of a Wind Farm with Entrance Effects

    Directory of Open Access Journals (Sweden)

    Jay P. Goit

    2016-01-01

    Full Text Available We investigate the use of optimal coordinated control techniques in large eddy simulations of wind farm boundary layer interaction with the aim of increasing the total energy extraction in wind farms. The individual wind turbines are considered as flow actuators, and their energy extraction is dynamically regulated in time, so as to optimally influence the flow field. We extend earlier work on wind farm optimal control in the fully-developed regime (Goit and Meyers 2015, J. Fluid Mech. 768, 5–50 to a ‘finite’ wind farm case, in which entrance effects play an important role. For the optimal control, a receding horizon framework is employed in which turbine thrust coefficients are optimized in time and per turbine. Optimization is performed with a conjugate gradient method, where gradients of the cost functional are obtained using adjoint large eddy simulations. Overall, the energy extraction is increased 7% by the optimal control. This increase in energy extraction is related to faster wake recovery throughout the farm. For the first row of turbines, the optimal control increases turbulence levels and Reynolds stresses in the wake, leading to better wake mixing and an inflow velocity for the second row that is significantly higher than in the uncontrolled case. For downstream rows, the optimal control mainly enhances the sideways mean transport of momentum. This is different from earlier observations by Goit and Meyers (2015 in the fully-developed regime, where mainly vertical transport was enhanced.

  2. Analyses of cyanobacterial toxins (microcystins, cylindrospermopsins) in the reservoirs of the Czech Republic and evaluation of health risks

    Czech Academy of Sciences Publication Activity Database

    Bláhová, Lucie; Babica, Pavel; Adamovský, Ondřej; Kohoutek, Jiří; Maršálek, Blahoslav

    2008-01-01

    Roč. 6, č. 4 (2008), s. 223-227 ISSN 1610-3653 Institutional research plan: CEZ:AV0Z60050516 Keywords : microcystins * cylindrospermopsin * health risks Subject RIV: EF - Botanics Impact factor: 1.366, year: 2008

  3. Extraction optimization and characterization of gelatine from fish dry skin of Spanish mackerel (Scomberromorus commersoni)

    Science.gov (United States)

    Kusumaningrum, I.; Pranoto, Y.; Hadiwiyoto, S.

    2018-04-01

    This work was to optimized gelatin extraction from dry skin of Spanish mackerel (Scomberromorus commersoni) using Response Surface Methodology (RSM). The aim of this study was to determine the optimal condition of temperature and time for extraction process and properties of the gelatin extracted from dry mackerel skin. The optimal condition for extraction was 59.71°C for 4.25 hours. Results showed that predicted yield by RSM was 13.69% and predicted gel strength was 291.93 Bloom, whereas the actual experiment for yield and gel strength were 13.03% and 291.33 Bloom, respectively. The gelatin extracted from dried skin were analyzed for their proximate composition, yield, gel strength, viscosity, color, and amino acid composition. The results of dried skin gelatin properties compared to the commercial gelatin. Gelatin extracted from the dried skin gave content lower moisture, ash and protein content but higher fat compared to commercial gelatin. This study also shows that the gelatin extracted from the dried skin gave higher gel strength and pH but the lower amino acid composition compared to commercial gelatin.

  4. Relations between DNA- and RNA-based molecular methods for cyanobacteria and microcystin concentration at Maumee Bay State Park Lakeside Beach, Oregon, Ohio, 2012

    Science.gov (United States)

    Stelzer, Erin A.; Loftin, Keith A.; Struffolino, Pamela

    2013-01-01

    Water samples were collected from Maumee Bay State Park Lakeside Beach, Oregon, Ohio, during the 2012 recreational season and analyzed for selected cyanobacteria gene sequences by DNA-based quantitative polymerase chain reaction (qPCR) and RNA-based quantitative reverse-transcription polymerase chain reaction (qRT-PCR). Results from the four DNA assays (for quantifying total cyanobacteria, total Microcystis, and Microcystis and Planktothrix strains that possess the microcystin synthetase E (mcyE) gene) and two RNA assays (for quantifying Microcystis and Planktothrix genera that are expressing the microcystin synthetase E (mcyE) gene) were compared to microcystin concentration results determined by an enzyme-linked immunosorbent assay (ELISA). Concentrations of the target in replicate analyses were log10 transformed. The average value of differences in log10 concentrations for the replicates that had at least one detection were found to range from 0.05 to >0.37 copy per 100 milliliters (copy/100 mL) for DNA-based methods and from >0.04 to >0.17 copy/100 mL for RNA-based methods. RNA has a shorter half-life than DNA; consequently, a 24-hour holding-time study was done to determine the effects of holding time on RNA concentrations. Holding-time comparisons for the RNA-based Microcystis toxin mcyE assay showed reductions in the number of copies per 100 milliliters over 24 hours. The log difference between time 2 hours and time 24 hours was >0.37 copy/100 mL, which was higher than the analytical variability (log difference of >0.17 copy/100 mL). Spearman’s correlation analysis indicated that microcystin toxin concentrations were moderately to highly related to DNA-based assay results for total cyanobacteria (rho=0.69), total Microcystis (rho=0.74), and Microcystis strains that possess the mcyE gene (rho=0.81). Microcystin toxin concentrations were strongly related with RNA-based assay results for Microcystis mcyE gene expression (rho=0.95). Correlation analysis could

  5. Lr67/Yr46 confers adult plant resistance to stem rust and powdery mildew in wheat.

    Science.gov (United States)

    Herrera-Foessel, Sybil A; Singh, Ravi P; Lillemo, Morten; Huerta-Espino, Julio; Bhavani, Sridhar; Singh, Sukhwinder; Lan, Caixia; Calvo-Salazar, Violeta; Lagudah, Evans S

    2014-04-01

    We demonstrate that Lr67/Yr46 has pleiotropic effect on stem rust and powdery mildew resistance and is associated with leaf tip necrosis. Genes are designated as Sr55, Pm46 and Ltn3 , respectively. Wheat (Triticum aestivum) accession RL6077, known to carry the pleiotropic slow rusting leaf and yellow rust resistance genes Lr67/Yr46 in Thatcher background, displayed significantly lower stem rust (P. graminis tritici; Pgt) and powdery mildew (Blumeria graminis tritici; Bgt) severities in Kenya and in Norway, respectively, compared to its recurrent parent Thatcher. We investigated the resistance of RL6077 to stem rust and powdery mildew using Avocet × RL6077 F6 recombinant inbred lines (RILs) derived from two photoperiod-insensitive F3 families segregating for Lr67/Yr46. Greenhouse seedling tests were conducted with Mexican Pgt race RTR. Field evaluations were conducted under artificially initiated stem rust epidemics with Pgt races RTR and TTKST (Ug99 + Sr24) at Ciudad Obregon (Mexico) and Njoro (Kenya) during 2010-2011; and under natural powdery mildew epiphytotic in Norway at Ås and Hamar during 2011 and 2012. In Mexico, a mean reduction of 41 % on stem rust severity was obtained for RILs carrying Lr67/Yr46, compared to RILs that lacked the gene, whereas in Kenya the difference was smaller (16 %) but significant. In Norway, leaf tip necrosis was associated with Lr67/Yr46 and RILs carrying Lr67/Yr46 showed a 20 % reduction in mean powdery mildew severity at both sites across the 2 years of evaluation. Our study demonstrates that Lr67/Yr46 confers partial resistance to stem rust and powdery mildew and is associated with leaf tip necrosis. The corresponding pleiotropic, or tightly linked, genes, designated as Sr55, Pm46, and Ltn3, can be utilized to provide broad-spectrum durable disease resistance in wheat.

  6. Optimization of Ultrasonic-Assisted Extraction of Flavonoid Compounds and Antioxidants from Alfalfa Using Response Surface Method

    Directory of Open Access Journals (Sweden)

    Chang-Liang Jing

    2015-08-01

    Full Text Available Ultrasonic-assisted extraction (UAE was used to extract flavonoid-enriched antioxidants from alfalfa aerial part. Response surface methodology (RSM, based on a four-factor, five-level central composite design (CCD, was employed to obtain the optimal extraction parameters, in which the flavonoid content was maximum and the antioxidant activity of the extracts was strongest. Radical scavenging capacity of the extracts, which represents the amounts of antioxidants in alfalfa, was determined by using 2,2′-azino-bis (3-ethylbenzothiazoline-6-sulphonicacid (ABTS and 2,2′-diphenyl-1-picrylhydrazyl (DPPH methods. The results showed good fit with the proposed models for the total flavonoid extraction (R2 = 0.9849, for the antioxidant extraction assayed by ABTS method (R2 = 0.9764, and by DPPH method (R2 = 0.9806. Optimized extraction conditions for total flavonoids was a ratio of liquid to solid of 57.16 mL/g, 62.33 °C, 57.08 min, and 52.14% ethanol. The optimal extraction parameters of extracts for the highest antioxidant activity by DPPH method was a ratio of liquid to solid 60.3 mL/g, 54.56 °C, 45.59 min, and 46.67% ethanol, and by ABTS assay was a ratio of liquid to solid 47.29 mL/g, 63.73 °C, 51.62 min, and 60% ethanol concentration. Our work offers optimal extraction conditions for total flavonoids and antioxidants from alfalfa.

  7. Optimization of ultrasound-assisted extraction of charantin from Momordica charantia fruits using response surface methodology.

    Science.gov (United States)

    Ahamad, Javed; Amin, Saima; Mir, Showkat R

    2015-01-01

    Momordica charantia Linn. (Cucurbitaceae) fruits are well known for their beneficial effects in diabetes that are often attributed to its bioactive component charantin. The aim of the present study is to develop and optimize an efficient protocol for the extraction of charantin from M. charantia fruits. Response surface methodology (RSM) was used for the optimization of ultrasound-assisted extraction (UAE) conditions. RSM was based on a three-level, three-variable Box-Behnken design (BBD), and the studied variables included solid to solvent ratio, extraction temperature, and extraction time. The optimal conditions predicted by the BBD were: UAE with methanol: Water (80:20, v/v) at 46°C for 120 min with solid to solvent ratio of 1:26 w/v, under which the yield of charantin was 3.18 mg/g. Confirmation trials under slightly adjusted conditions yielded 3.12 ± 0.14 mg/g of charantin on dry weight basis of fruits. The result of UAE was also compared with Soxhlet extraction method and UAE was found 2.74-fold more efficient than the Soxhlet extraction for extracting charantin. A facile UAE protocol for a high extraction yield of charantin was developed and validated.

  8. Using of Daphnia pulex, Artemia salina and Tubifex tubifex for cyanobacterial microcystins toxicity detection

    Czech Academy of Sciences Publication Activity Database

    Kyselková, I.; Maršálek, Blahoslav

    2000-01-01

    Roč. 55, č. 6 (2000), s. 637-643 ISSN 0006-3088 R&D Projects: GA AV ČR KSK6005114 Grant - others:Cyanotox project ENVA(XX) CT98 0802; Cyanotox project ENVA(XX) EU DG-XII Institutional research plan: CEZ:AV0Z6005908 Keywords : cyanobacteria * microcystin * toxins * Slovakia Subject RIV: EF - Botanics Impact factor: 0.165, year: 2000

  9. Extraction optimization, preliminary characterization and antioxidant activities of polysaccharides from Glycine soja.

    Science.gov (United States)

    Jing, Changliang; Yuan, Yuan; Tang, Qi; Zou, Ping; Li, Yiqiang; Zhang, Chengsheng

    2017-10-01

    Single-factor experiment and Central Composite Design (CCD) was applied to optimize the ultrasound-assisted extraction (UAE) conditions of polysaccharides from Glycine soja (CGPS), and a preliminary characterization of three polysaccharide fractions (CGPS, GPS-1, and GPS-2) and their antioxidant activities were investigated. Under the optimal conditions: ratio of liquid to solid 42.7mL/g, extraction power 293.7W, extraction temperature 68.9°C, and extraction time 34.7min, the experimental CGPS yield was 6.04mg/g. CGPS was further purified by DEAE-cellulose and Sephadex-100 chromatography to obtain two fractions (GPS-1 and GPS-2), and their monosaccharides compositions were characterized by HPLC. Fourier-transform infrared spectra (FT-IR) indicated the chemical structures of them. Moreover, they exhibited high antioxidant activities in a concentration-dependent manner in vitro. In summary, the present study suggested that UAE was a very effective method to extract polysaccharides from Glycine soja and the polysaccharides could be explored as potential antioxidant agents for medicine and function food. Copyright © 2017 Elsevier B.V. All rights reserved.

  10. Extraction optimization, characterization and antioxidant activity of polysaccharide from Gentiana scabra bge.

    Science.gov (United States)

    Cheng, Zhenyu; Zhang, Yuewei; Song, Haiyan; Zhou, Hongli; Zhong, Fangli; Hu, Haobin; Feng, Yu

    2016-12-01

    In this study, optimization of smashing tissue extraction (STE), preliminary chemical characterization and antioxidant activity in vitro of crude polysaccharides (CPS) from Gentiana scabra bge (G. scabra) were investigated. The optimal extraction conditions were determined as follows: sample particle size of 80mesh, solid/liquid ratio of 1:34, extraction voltage of 157.09V and extraction time of 130.38s. Under these conditions, the extraction yield of CPS had reached 15.03±0.14% (n=3). Chemical composition analysis indicated CPS was mainly composed of mannose, rhamnose, galacturonic acid, glcose, galactose, arabinose and fucose in a molar ratio of 1.00:9.89:51.59:35.37:38.06:99.13:21.34, respectively. The average molecular weight of CPS was estimated to be 3.8×10 4 Da. In addition, the potential antioxidant activity of CPS extracted by STE were demonstrated by DPPH radical scavenging assay, superoxide anion radical scavenging assay, hydroxyl radical scavenging assay and ferric reducing power assay. Overall, this study provided an effective extraction technique for G. scabra polysaccharides which would be explored as a promising natural antioxidant agent applied in functional foods or medicines. Copyright © 2016 Elsevier B.V. All rights reserved.

  11. Microwave optimization of mucilage extraction from Opuntia ficus indica Cladodes.

    Science.gov (United States)

    Felkai-Haddache, Lamia; Dahmoune, Farid; Remini, Hocine; Lefsih, Khalef; Mouni, Lotfi; Madani, Khodir

    2016-03-01

    In this study, microwave-assisted extraction (MAE) of polysaccharides from Opuntia ficus indica Cladodes were investigated using response surface methodology (RSM). The effects of three extraction factors on the yield of mucilage were examined. The results indicated that the optimum extraction conditions were determined as follows: microwave power X1, 700 W; extraction time X2, 5.15 minand ratio water/raw material X3, 4.83 mL/g at fixed pH 11. Under these optimal extraction conditions, mucilage yield was found to be Y, 25.6%. A comparison between the model results and experimental data gave a high correlation coefficient (R(2)=0.88), adjusted coefficient (Radj=0.83) and low root mean square error (RMSE=2.45) and showed that the two models were able to predict a mucilage yield by green extraction microwave process. Copyright © 2015 Elsevier B.V. All rights reserved.

  12. Radon concentrations in some Egyptian dwellings using LR 115 detectors

    Energy Technology Data Exchange (ETDEWEB)

    Hussein, A S [Radiation Protection Department, Nuclear Power Plants Authority, Cairo (Egypt)

    2007-06-15

    Radon, a well-established risk factor for human lung cancer, is present at low concentrations in most homes. Consequently, many countries have established national guidelines for residential radon concentrations. This survey provides additional information about indoor radon concentrations in Egypt. Indoor radon survey of a total of 15 randomly selected houses in Qena city, Upper Egypt was carried out. LR 115 detectors were exposed for one year, covering all the seasons. The estimated indoor radon levels varied from 19 to 59 Bq m{sup 3} with an average of 40 Bq m{sup 3}. Using the bare and filtered LR 115 detectors, the average equilibrium factor F was assessed as 0.30 indoors. An average annual effective dose of 0.40 mSv has been estimated and was found to be lower than the ICRP-65.

  13. The Use of Response Surface Methodology to Optimize the Ultrasound-Assisted Extraction of Five Anthraquinones from Rheum palmatum L.

    Directory of Open Access Journals (Sweden)

    Xianghua Xia

    2011-07-01

    Full Text Available In this paper, ultrasound-assisted extraction (UAE was applied to the extraction of anthraquinones (aloe-emodin, rhein, emodin, chrysophanol and physcion from Rheum palmatum L. The five anthraquinones were quantified and analyzed by high performance liquid chromatography coupled with UV detection (HPLC-UV. The extraction solvent, extraction temperature and extraction time parameters, the three main factors for UAE, were optimized with response surface methodology (RSM to obtain the highest extraction efficiency. The optimal conditions were the use of 84% methanol as solvent, an extraction time of 33 min and an extraction temperature of 67 °C. Under these optimal conditions, the experimental values agreed closely with the predicted values. The analysis of variance indicated a high goodness of model fit and the success of RSM method for optimizing anthraquinones extraction in Rheum palmatum L.

  14. Optimized ultra-high-pressure-assisted extraction of procyanidins from lychee pericarp improves the antioxidant activity of extracts.

    Science.gov (United States)

    Zhang, Ruifen; Su, Dongxiao; Hou, Fangli; Liu, Lei; Huang, Fei; Dong, Lihong; Deng, Yuanyuan; Zhang, Yan; Wei, Zhencheng; Zhang, Mingwei

    2017-08-01

    To establish optimal ultra-high-pressure (UHP)-assisted extraction conditions for procyanidins from lychee pericarp, a response surface analysis method with four factors and three levels was adopted. The optimum conditions were as follows: 295 MPa pressure, 13 min pressure holding time, 16.0 mL/g liquid-to-solid ratio, and 70% ethanol concentration. Compared with conventional ethanol extraction and ultrasonic-assisted extraction methods, the yields of the total procyanidins, flavonoids, and phenolics extracted using the UHP process were significantly increased; consequently, the oxygen radical absorbance capacity and cellular antioxidant activity of UHP-assisted lychee pericarp extracts were substantially enhanced. LC-MS/MS and high-performance liquid chromatography quantification results for individual phenolic compounds revealed that the yield of procyanidin compounds, including epicatechin, procyanidin A2, and procyanidin B2, from lychee pericarp could be significantly improved by the UHP-assisted extraction process. This UHP-assisted extraction process is thus a practical method for the extraction of procyanidins from lychee pericarp.

  15. Optimization of continuous and intermittent microwave extraction of pectin from banana peels.

    Science.gov (United States)

    Swamy, Gabriela John; Muthukumarappan, Kasiviswanathan

    2017-04-01

    Continuous and intermittent microwave-assisted extractions were used to extract pectin from banana peels. Extraction parameters which were employed in the continuous process were microwave power (300-900W), time (100-300s), pH (1-3) and in the intermittent process were microwave power (300-900W), pulse ratio (0.5-1), pH (1-3). The independent factors were optimized with the Box-Behnken response surface design (BBD) (three factor three level) with the desirability function methodology. Results indicate that the independent factors have substantial effect on the pectin yield. Optimized solutions for highest pectin yield (2.18%) from banana peels were obtained with microwave power of 900W, time 100s and pH 3.00 in the continuous method while the intermittent process yielded the highest pectin content (2.58%) at microwave power of 900W, pulse ratio of 0.5 and pH of 3.00. The optimized conditions were validated and close agreement was observed with the validation experiment and predicted value. Copyright © 2016 Elsevier Ltd. All rights reserved.

  16. Modeling and optimization of a utility system containing multiple extractions steam turbines

    International Nuclear Information System (INIS)

    Luo, Xianglong; Zhang, Bingjian; Chen, Ying; Mo, Songping

    2011-01-01

    Complex turbines with multiple controlled and/or uncontrolled extractions are popularly used in the processing industry and cogeneration plants to provide steam of different levels, electric power, and driving power. To characterize thermodynamic behavior under varying conditions, nonlinear mathematical models are developed based on energy balance, thermodynamic principles, and semi-empirical equations. First, the complex turbine is decomposed into several simple turbines from the controlled extraction stages and modeled in series. THM (The turbine hardware model) developing concept is applied to predict the isentropic efficiency of the decomposed simple turbines. Stodola's formulation is also used to simulate the uncontrolled extraction steam parameters. The thermodynamic properties of steam and water are regressed through linearization or piece-wise linearization. Second, comparison between the simulated results using the proposed model and the data in the working condition diagram provided by the manufacturer is conducted over a wide range of operations. The simulation results yield small deviation from the data in the working condition diagram where the maximum modeling error is 0.87% among the compared seven operation conditions. Last, the optimization model of a utility system containing multiple extraction turbines is established and a detailed case is analyzed. Compared with the conventional operation strategy, a maximum of 5.47% of the total operation cost is saved using the proposed optimization model. -- Highlights: → We develop a complete simulation model for steam turbine with multiple extractions. → We test the simulation model using the performance data of commercial turbines. → The simulation error of electric power generation is no more than 0.87%. → We establish a utility system operational optimization model. → The optimal industrial operation scheme featured with 5.47% of cost saving.

  17. Optimizing factors influencing DNA extraction from fresh whole avian ...

    African Journals Online (AJOL)

    A study was conducted to optimize the efficient combination of lysis buffer, proteinase K, incubation time, phenol-chloroform-isoamyl alcohol (PCI) volume, spinning rate (rpm), and precipitation agent on quantity and quality of DNA extracted from various volumes of avian blood. Blood samples were collected in EDTA and ...

  18. Mathematical model for optimizing the design extraction pressure of a condensation turbine with district heat extraction. Mathematisches Modell zur Optimierung des Auslegungsentnahmedruckes an einer Kondensationsturbine mit Fernwaermeauskopplung

    Energy Technology Data Exchange (ETDEWEB)

    Grkovic, V [Novi Sad Univ. (Yugoslavia)

    1991-11-01

    A mathematical calculation model is explained, which enables optimization of the design pressure at the steam extraction point of a condensation extraction turbine. The results obtained show that the additional thermodynamic losses, which occur during turbine operation on variation of the heat load, can be reduced to a minimum by optimization of the extraction pressure. The optimal pressures at the extraction point, as well as the size of the economic effect are dependent on the selected technical design of the turbine, its maximum heat output and the basic heat load factor. (orig.).

  19. Modification of cyanobacterial bloom-derived biomass using potassium permanganate enhanced the removal of microcystins and adsorption capacity toward cadmium (II)

    Energy Technology Data Exchange (ETDEWEB)

    Shao, Jihai [College of Resources and Environment, Hunan Agricultural University, Changsha 410128 (China); Hunan Provincial Key Laboratory of Farmland Pollution Control and Agricultural Resources Use, Hunan Agricultural University, Changsha 410128 (China); Gu, Ji-Dong [Hunan Provincial Key Laboratory of Farmland Pollution Control and Agricultural Resources Use, Hunan Agricultural University, Changsha 410128 (China); Laboratory of Environmental Microbiology and Toxicology, School of Biological Sciences, The University of Hong Kong, Hong Kong Special Administrative Region (Hong Kong); Peng, Liang; Luo, Si; Luo, Huili [College of Resources and Environment, Hunan Agricultural University, Changsha 410128 (China); Yan, Zhiyong, E-mail: zhyyan111@163.com [College of Resources and Environment, Hunan Agricultural University, Changsha 410128 (China); Wu, Genyi, E-mail: wugenyi99@163.com [College of Resources and Environment, Hunan Agricultural University, Changsha 410128 (China)

    2014-05-01

    Highlights: • Potassium permanganate removed microcystins in the cyanobacterial bloom-derived biomass (CBDB). • Potassium permanganate oxidation caused the transformation of hydroxyl to carboxyl on the CBDB. • Manganese dioxide was formed on the surface of CBDB. • Potassium permanganate oxidation process increased the adsorption capacity of CBDB toward Cd(II). - Abstract: Cyanobacterial biomass shows high adsorption capacity toward heavy metal ions. However, the cyanotoxins in the cyanobacterial biomass inhibit its application in heavy metals removal. In order to safely and effectively remove Cd(II) from water using cyanobacterial bloom-derived biomass (CBDB), KMnO{sub 4} was used to modify CBDB. The results indicated that the microcystins in the CBDB were successfully removed by KMnO{sub 4}. Potassium permanganate oxidation caused the transformation of hydroxyl to carboxyl on the CBDB, and formed manganese dioxide on the surface of CBDB. The oxidized CBDB showed higher adsorption capacity toward Cd(II) than that of unoxidized treatment. The optimal KMnO{sub 4} concentration for increasing the adsorption capacity of CBDB toward Cd(II) was 0.2 g/L. The adsorption isotherm of Cd(II) by oxidized- or unoxidized-CBDB was well fitted by Langmuir model, indicating that the adsorption of Cd(II) by CBDB was monolayer adsorption. The desorption ratio of Cd(II) from oxidized CBDB was higher than that from unoxidized CBDB in the desorption process using NH{sub 4}NO{sub 3} and EDTA as desorbent. The results presented in this study suggest that KMnO{sub 4} modified CBDB may be used as a safe and high efficient adsorbent in Cd(II) removal from water.

  20. RESPONSE SURFACE METHODOLOGY FOR OPTIMIZATION OF THE EXTRACTION OF FLAX (LINUM USITATISSIMUM SEED OIL

    Directory of Open Access Journals (Sweden)

    Tibor Maliar

    2011-12-01

    Full Text Available Flax seed is an important source of ω-3 polyunsaturated fatty acids essential for human physiology. The aim of this paper is to investigate the effects of major parameters of the lipid extraction from flax seed, in relation to the recovery of oil as well as the oil quality properties. The independent variables of extraction were proposed as: organic solvents, temperature, extraction time and solid-liquid ratio. The following quantitative and qualitative parameters were chosen as dependent variables: yield of the lipid fraction, acid value of oil and the absorbance at 490 nm. After calculating the optimal values of the extraction, the validation analysis was carried out and it was found out that the predicted and experimentally verified dependent variables were in agreement with the optimal extraction parameters.doi:10.5219/168

  1. Optimization of pectin extraction and antioxidant activities from Jerusalem artichoke

    Science.gov (United States)

    Liu, Shengyi; Shi, Xuejie; Xu, Lanlan; Yi, Yuetao

    2016-03-01

    Jerusalem artichoke is an economic crop widely planted in saline-alkaline soil. The use of Jerusalem artichoke is of great significance. In this study, the response surface method was employed to optimize the effects of processing variables (extraction temperature, pH, extraction time, and liquid-to-solid ratio) on the yield of Jerusalem artichoke pectin. Under the optimal extraction conditions: pH 1.52, 63.62 min, 100°C and a liquid-to-solid ratio of 44.4 mL/g, the maximum pectin yield was predicted to be 18.76%. Experiments were conducted under these optimal conditions and a pectin yield of 18.52±0.90% was obtained, which validated the model prediction. The effects of diff erent drying methods (freeze drying, spray drying and vacuum drying) on the properties of Jerusalem artichoke pectin were evaluated and they were compared with apple pectin. FTIR spectral analysis showed no major structural diff erences in Jerusalem artichoke pectin samples produced by various drying treatments. The antioxidant activities of pectin dried by diff erent methods were investigated using in vitro hydroxyl and DPPH radical scavenging systems. The results revealed that the activities of spray dried pectin (SDP) and apple pectin (AP) were stronger than those of vacuum oven dried pectin (ODP) and vacuum freeze dried pectin (FDP). Therefore compared with the other two drying methods, the spray drying method was the best.

  2. Optimization of ultrasound-assisted extraction of charantin from Momordica charantia fruits using response surface methodology

    Directory of Open Access Journals (Sweden)

    Javed Ahamad

    2015-01-01

    Full Text Available Background: Momordica charantia Linn. (Cucurbitaceae fruits are well known for their beneficial effects in diabetes that are often attributed to its bioactive component charantin. Objective: The aim of the present study is to develop and optimize an efficient protocol for the extraction of charantin from M. charantia fruits. Materials and Methods: Response surface methodology (RSM was used for the optimization of ultrasound-assisted extraction (UAE conditions. RSM was based on a three-level, three-variable Box-Behnken design (BBD, and the studied variables included solid to solvent ratio, extraction temperature, and extraction time. Results: The optimal conditions predicted by the BBD were: UAE with methanol: Water (80:20, v/v at 46°C for 120 min with solid to solvent ratio of 1:26 w/v, under which the yield of charantin was 3.18 mg/g. Confirmation trials under slightly adjusted conditions yielded 3.12 ± 0.14 mg/g of charantin on dry weight basis of fruits. The result of UAE was also compared with Soxhlet extraction method and UAE was found 2.74-fold more efficient than the Soxhlet extraction for extracting charantin. Conclusions:A facile UAE protocol for a high extraction yield of charantin was developed and validated.

  3. Human fatalities from cyanobacteria: chemical and biological evidence for cyanotoxins.

    Science.gov (United States)

    Carmichael, W W; Azevedo, S M; An, J S; Molica, R J; Jochimsen, E M; Lau, S; Rinehart, K L; Shaw, G R; Eaglesham, G K

    2001-01-01

    An outbreak of acute liver failure occurred at a dialysis center in Caruaru, Brazil (8 degrees 17' S, 35 degrees 58' W), 134 km from Recife, the state capital of Pernambuco. At the clinic, 116 (89%) of 131 patients experienced visual disturbances, nausea, and vomiting after routine hemodialysis treatment on 13-20 February 1996. Subsequently, 100 patients developed acute liver failure, and of these 76 died. As of December 1996, 52 of the deaths could be attributed to a common syndrome now called Caruaru syndrome. Examination of phytoplankton from the dialysis clinic's water source, analyses of the clinic's water treatment system, plus serum and liver tissue of clinic patients led to the identification of two groups of cyanobacterial toxins, the hepatotoxic cyclic peptide microcystins and the hepatotoxic alkaloid cylindrospermopsin. Comparison of victims' symptoms and pathology using animal studies of these two cyanotoxins leads us to conclude that the major contributing factor to death of the dialyses patients was intravenous exposure to microcystins, specifically microcystin-YR, -LR, and -AR. From liver concentrations and exposure volumes, it was estimated that 19.5 microg/L microcystin was in the water used for dialysis treatments. This is 19.5 times the level set as a guideline for safe drinking water supplies by the World Health Organization. PMID:11485863

  4. Microcystis extracts and single cells have differential impacts on the demography of cladocerans: a case study on Moina cf. micrura isolated from the Mediterranean coastal shallow lake (L'Albufera, Spain)

    NARCIS (Netherlands)

    Nandini, S.; Miracle, M. R.; Vicente, E.; Sarma, S. S. S.; Gulati, R. D.

    2017-01-01

    Cyanobacteria often have a deleterious effect on zooplankton. We hypothesized that the presence of either M. aeruginosa cells or microcystin extracts from M. aeruginosa would have a significant impact on the population growth rate, survivorship, and fecundity of Moina cf. micrura isolated from

  5. An Optimal Control Method for Maximizing the Efficiency of Direct Drive Ocean Wave Energy Extraction System

    Science.gov (United States)

    Chen, Zhongxian; Yu, Haitao; Wen, Cheng

    2014-01-01

    The goal of direct drive ocean wave energy extraction system is to convert ocean wave energy into electricity. The problem explored in this paper is the design and optimal control for the direct drive ocean wave energy extraction system. An optimal control method based on internal model proportion integration differentiation (IM-PID) is proposed in this paper though most of ocean wave energy extraction systems are optimized by the structure, weight, and material. With this control method, the heavy speed of outer heavy buoy of the energy extraction system is in resonance with incident wave, and the system efficiency is largely improved. Validity of the proposed optimal control method is verified in both regular and irregular ocean waves, and it is shown that IM-PID control method is optimal in that it maximizes the energy conversion efficiency. In addition, the anti-interference ability of IM-PID control method has been assessed, and the results show that the IM-PID control method has good robustness, high precision, and strong anti-interference ability. PMID:25152913

  6. An optimal control method for maximizing the efficiency of direct drive ocean wave energy extraction system.

    Science.gov (United States)

    Chen, Zhongxian; Yu, Haitao; Wen, Cheng

    2014-01-01

    The goal of direct drive ocean wave energy extraction system is to convert ocean wave energy into electricity. The problem explored in this paper is the design and optimal control for the direct drive ocean wave energy extraction system. An optimal control method based on internal model proportion integration differentiation (IM-PID) is proposed in this paper though most of ocean wave energy extraction systems are optimized by the structure, weight, and material. With this control method, the heavy speed of outer heavy buoy of the energy extraction system is in resonance with incident wave, and the system efficiency is largely improved. Validity of the proposed optimal control method is verified in both regular and irregular ocean waves, and it is shown that IM-PID control method is optimal in that it maximizes the energy conversion efficiency. In addition, the anti-interference ability of IM-PID control method has been assessed, and the results show that the IM-PID control method has good robustness, high precision, and strong anti-interference ability.

  7. The extraction process optimization of antioxidant polysaccharides from Marshmallow (Althaea officinalis L.) roots.

    Science.gov (United States)

    Pakrokh Ghavi, Peyman

    2015-04-01

    Response surface methodology (RSM) with a central composite rotatable design (CCRD) based on five levels was employed to model and optimize four experimental operating conditions of extraction temperature (10-90 °C) and time (6-30 h), particle size (6-24 mm) and water to solid (W/S, 10-50) ratio, obtaining polysaccharides from Althaea officinalis roots with high yield and antioxidant activity. For each response, a second-order polynomial model with high R(2) values (> 0.966) was developed using multiple linear regression analysis. Results showed that the most significant (P < 0.05) extraction conditions that affect the yield and antioxidant activity of extracted polysaccharides were the main effect of extraction temperature and the interaction effect of the particle size and W/S ratio. The optimum conditions to maximize yield (10.80%) and antioxidant activity (84.09%) for polysaccharides extraction from A. officinalis roots were extraction temperature 60.90 °C, extraction time 12.01 h, particle size 12.0mm and W/S ratio of 40.0. The experimental values were found to be in agreement with those predicted, indicating the models suitability for optimizing the polysaccharides extraction conditions. Copyright © 2015 Elsevier B.V. All rights reserved.

  8. The calibration of the solid state nuclear track detector LR 115 for radon measurements

    CERN Document Server

    Gericke, C; Jönsson, G; Freyer, K; Treutler, H C; Enge, W

    1999-01-01

    An experimental calibration of indoor room and outdoor soil detector devices which are based on LR 115 as sensitive element has taken place at the Swedish Radiation Protection Institute in Stockholm (Sweden) in 1994 and 1996, at the Physikalisch-Technischen Bundesanstalt in Braunschweig (Germany) in 1997 and at the Umweltforschungszentrum Leipzig-Halle (Germany) in 1997. Special properties of the used solid state nuclear track detector (SSNTD) material LR 115 have been measured to define the application of the experimental calibration.

  9. Inactivation disinfection property of Moringa Oleifera seed extract: optimization and kinetic studies

    Science.gov (United States)

    Idris, M. A.; Jami, M. S.; Hammed, A. M.

    2017-05-01

    This paper presents the statistical optimization study of disinfection inactivation parameters of defatted Moringa oleifera seed extract on Pseudomonas aeruginosa bacterial cells. Three level factorial design was used to estimate the optimum range and the kinetics of the inactivation process was also carried. The inactivation process involved comparing different disinfection models of Chicks-Watson, Collins-Selleck and Homs models. The results from analysis of variance (ANOVA) of the statistical optimization process revealed that only contact time was significant. The optimum disinfection range of the seed extract was 125 mg/L, 30 minutes and 120rpm agitation. At the optimum dose, the inactivation kinetics followed the Collin-Selleck model with coefficient of determination (R2) of 0.6320. This study is the first of its kind in determining the inactivation kinetics of pseudomonas aeruginosa using the defatted seed extract.

  10. Optimization of RNA Extraction from Rat Pancreatic Tissue

    Directory of Open Access Journals (Sweden)

    Sanaz Dastgheib

    2014-05-01

    Full Text Available Background: Optimized RNA extraction from tissues and cell lines consists of four main stages regardless of the method of extraction: 1 homogenizing, 2 effective denaturation of proteins from RNA, 3 inactivation of ribonuclease, and 4 removal of any DNA, protein, and carbohydrate contamination. Isolation of undamaged intact RNA is challenging when the related tissue contains high levels of RNase. Various technical difficulties occur during extraction of RNA from pancreatic tissue due to spontaneous autolysis. Since standard routine protocols yield unacceptable results in pancrease, we have designed a simple method for RNA extraction by comparing different protocols. Methods: We obtained 20-30 mg pancreatic tissues in less than 2 min from 30 rats. Several methods were performed to extract RNA from pancreatic tissue and evaluate its integrity. All methods were performed three times to obtain reproducible results. Results: Immersing pancreatic tissue in RNA-later for 24 h at -80ºC yielded high quality RNA by using the TriPure reagent which was comparable to the commercial RNeasy Micro Kit. The quality of RNA was evaluated by spectrophotometer, electrophoresis and RT-PCR. We separated intact 28S and 18S ribosomal RNA (rRNA when our procedure was compared with the RNeasy Micro Kit. Finally, full length of the actin gene was amplified by RT-PCR. Conclusion: We designed a simple, fast, cost-effective method for complete RNA extraction from the least amount of quantitatively intact pancreatic tissue

  11. Optimization of microwave-assisted extraction of hydrocarbons in marine sediments: comparison with the Soxhlet extraction method.

    Science.gov (United States)

    Vázquez Blanco, E; López Mahía, P; Muniategui Lorenzo, S; Prada Rodríguez, D; Fernández Fernández, E

    2000-02-01

    Microwave energy was applied to extract polycyclic aromatic hydrocarbons (PAHs) and linear aliphatic hydrocarbons (LAHs) from marine sediments. The influence of experimental conditions, such as different extracting solvents and mixtures, microwave power, irradiation time and number of samples extracted per run has been tested using real marine sediment samples; volume of the solvent, sample quantity and matrix effects were also evaluated. The yield of extracted compounds obtained by microwave irradiation was compared with that obtained using the traditional Soxhlet extraction. The best results were achieved with a mixture of acetone and hexane (1:1), and recoveries ranged from 92 to 106%. The extraction time is dependent on the irradiation power and the number of samples extracted per run, so when the irradiation power was set to 500 W, the extraction times varied from 6 min for 1 sample to 18 min for 8 samples. Analytical determinations were carried out by high-performance liquid chromatography (HPLC) with an ultraviolet-visible photodiode-array detector for PAHs and gas chromatography (GC) using a FID detector for LAHs. To test the accuracy of the microwave-assisted extraction (MAE) technique, optimized methodology was applied to the analysis of standard reference material (SRM 1941), obtaining acceptable results.

  12. Microcystin kinetics (bioaccumulation, elimination) and biochemical responses in common carp and silver carp exposed to toxic cyanobacterial blooms

    Czech Academy of Sciences Publication Activity Database

    Adamovský, Ondřej; Kopp, R.; Hilscherová, Klára; Babica, Pavel; Palíková, M.; Pašková, Veronika; Navrátil, S.; Maršálek, Blahoslav; Bláha, Luděk

    2007-01-01

    Roč. 26, č. 12 (2007), s. 2687-2693 ISSN 0730-7268 R&D Projects: GA MŠk 1M0571 Institutional research plan: CEZ:AV0Z60050516 Keywords : microcystin * carp * toxicokinetics Subject RIV: EF - Botanics Impact factor: 2.309, year: 2007

  13. Optimization of the extraction of carrageenan from Kappaphycus alvarezii using response surface methodology

    Directory of Open Access Journals (Sweden)

    Vanessa Webber

    2012-12-01

    Full Text Available This study aims to optimize an alternative method of extraction of carrageenan without previous alkaline treatment and ethanol precipitation using Response Surface Methodology (RSM. In order to introduce an innovation in the isolation step, atomization drying was used reducing the time for obtaining dry carrageenan powder. The effects of extraction time and temperature on yield, gel strength, and viscosity were evaluated. Furthermore, the extracted material was submitted to structural analysis, by infrared spectroscopy and nuclear magnetic resonance spectroscopy (¹H-NMR, and chemical composition analysis. Results showed that the generated regression models adequately explained the data variation. Carrageenan yield and gel viscosity were influenced only by the extraction temperature. However, gel strength was influenced by both, extraction time and extraction temperature. Optimal extraction conditions were 74 ºC and 4 hours. In these conditions, the carrageenan extract properties determined by the polynomial model were 31.17%, 158.27 g.cm-2, and 29.5 cP for yield, gel strength, and viscosity, respectively, while under the experimental conditions they were 35.8 ± 4.68%, 112.50 ± 4.96 g.cm-2, and 16.01 ± 1.03 cP, respectively. The chemical composition, nuclear magnetic resonance spectroscopy, and infrared spectroscopy analyses showed that the crude carrageenan extracted is composed mainly of κ-carrageenan.

  14. Diagnostics on LALR(k) conflicts based on a method for LR(k) testing

    DEFF Research Database (Denmark)

    Kristensen, Bent Bruun; Madsen, Ole Lehrmann

    1981-01-01

    A user of an LALR(k) parser generator system may have difficulties in understanding how a given LALR(k) conflict is generated. This is especially difficult if the conflict does not correspond to an LR(k) conflict. A practical method for giving informative diagnostics on LALR(k) conflicts is prese......A user of an LALR(k) parser generator system may have difficulties in understanding how a given LALR(k) conflict is generated. This is especially difficult if the conflict does not correspond to an LR(k) conflict. A practical method for giving informative diagnostics on LALR(k) conflicts...

  15. Optimization of microwave-assisted extraction (MAE) of coriander phenolic antioxidants - response surface methodology approach.

    Science.gov (United States)

    Zeković, Zoran; Vladić, Jelena; Vidović, Senka; Adamović, Dušan; Pavlić, Branimir

    2016-10-01

    Microwave-assisted extraction (MAE) of polyphenols from coriander seeds was optimized by simultaneous maximization of total phenolic (TP) and total flavonoid (TF) yields, as well as maximized antioxidant activity determined by 1,1-diphenyl-2-picrylhydrazyl and reducing power assays. Box-Behnken experimental design with response surface methodology (RSM) was used for optimization of MAE. Extraction time (X1 , 15-35 min), ethanol concentration (X2 , 50-90% w/w) and irradiation power (X3 , 400-800 W) were investigated as independent variables. Experimentally obtained values of investigated responses were fitted to a second-order polynomial model, and multiple regression analysis and analysis of variance were used to determine fitness of the model and optimal conditions. The optimal MAE conditions for simultaneous maximization of polyphenol yield and increased antioxidant activity were an extraction time of 19 min, an ethanol concentration of 63% and an irradiation power of 570 W, while predicted values of TP, TF, IC50 and EC50 at optimal MAE conditions were 311.23 mg gallic acid equivalent per 100 g dry weight (DW), 213.66 mg catechin equivalent per 100 g DW, 0.0315 mg mL(-1) and 0.1311 mg mL(-1) respectively. RSM was successfully used for multi-response optimization of coriander seed polyphenols. Comparison of optimized MAE with conventional extraction techniques confirmed that MAE provides significantly higher polyphenol yields and extracts with increased antioxidant activity. © 2016 Society of Chemical Industry. © 2016 Society of Chemical Industry.

  16. [Optimization of Polysaccharide Extraction from Spirodela polyrrhiza by Plackett-Burman Design Combined with Box-Behnken Response Surface Methodology].

    Science.gov (United States)

    Jiang, Zheng; Wang, Hong; Wu, Qi-nan

    2015-06-01

    To optimize the processing of polysaccharide extraction from Spirodela polyrrhiza. Five factors related to extraction rate of polysaccharide were optimized by the Plackett-Burman design. Based on this study, three factors, including alcohol volume fraction, extraction temperature and ratio of material to liquid, were regarded as investigation factors by Box-Behnken response surface methodology. The effect order of three factors on the extraction rate of polysaccharide from Spirodela polyrrhiza were as follows: extraction temperature, alcohol volume fraction,ratio of material to liquid. According to Box-Behnken response, the best extraction conditions were: alcohol volume fraction of 81%, ratio of material to liquid of 1:42, extraction temperature of 100 degrees C, extraction time of 60 min for four times. Plackett-Burman design and Box-Behnken response surface methodology used to optimize the extraction process for the polysaccharide in this study is effective and stable.

  17. Optimization of ultrasonic-assisted extraction of natural antioxidants from rice bran using response surface methodology.

    Science.gov (United States)

    Tabaraki, Reza; Nateghi, Ashraf

    2011-11-01

    Ultrasonic technology was applied for extraction of polyphenols and antioxidants from the rice bran using ethanol as a food grade solvent. Response surface methodology (RSM) was used to optimize experimental conditions for extraction of polyphenols and antioxidants. Three independent variables such as solvent percentage (%), temperature (°C) and time (min) were studied. Effect of ethanol concentration was found to be significant on all responses. Total phenolic content (TPC) varied from 2.37 to 6.35mg gallic acid equivalent/g of dry sample. Antioxidant activity of the extracts was determined by the ferric reducing antioxidant power (FRAP) assay and scavenging activity of 1,1-diphenyl-2-picrylhydrazyl (DPPH) radical. FRAP and DPPH values varied from 31.74 to 57.23μmol Fe(2+)/g of dry sample and 16.88% to 55.61% inhibition, respectively. Extraction yields ranged from 11 to 20.2%. Optimal ultrasonic-assisted extraction (UAE) conditions were identified as 65-67% ethanol, 51-54°C, 40-45min. The experimental values agreed with those predicted by SRM models, thus indicating suitability of the model employed and the success of RSM in optimizing the extraction conditions. Copyright © 2011 Elsevier B.V. All rights reserved.

  18. First successful ionization of Lr (Z = 103) by a surface-ionization technique

    Energy Technology Data Exchange (ETDEWEB)

    Sato, Tetsuya K., E-mail: sato.tetsuya@jaea.go.jp; Sato, Nozomi; Asai, Masato; Tsukada, Kazuaki; Toyoshima, Atsushi; Ooe, Kazuhiro; Miyashita, Sunao; Schädel, Matthias [Advanced Science Research Center, Japan Atomic Energy Agency (JAEA), 2-4 Shirakata-shirane, Tokai-mura, Ibaraki 319-1195 (Japan); Kaneya, Yusuke; Nagame, Yuichiro [Advanced Science Research Center, Japan Atomic Energy Agency (JAEA), 2-4 Shirakata-shirane, Tokai-mura, Ibaraki 319-1195 (Japan); Graduate School of Science and Engineering, Ibaraki University, 2-1-1, Bunkyo, Mito, Ibaraki 310-8512 (Japan); Osa, Akihiko [Department of Research Reactor and Tandem Accelerator, Japan Atomic Energy Agency (JAEA), 2-4 Shirakata shirane, Tokai-mura, Ibaraki 319-1195 (Japan); Ichikawa, Shin-ichi [Advanced Science Research Center, Japan Atomic Energy Agency (JAEA), 2-4 Shirakata-shirane, Tokai-mura, Ibaraki 319-1195 (Japan); Nishina Center for Accelerator-Based Science, RIKEN, 2-1 Hirosawa, Wako, Saitama 351-0198 (Japan); Stora, Thierry [ISOLDE, CERN, CH-1211 Geneva 23 (Switzerland); Kratz, Jens Volker [Institut für Kernchemie, Universität Mainz, D-55099 Mainz (Germany)

    2013-02-15

    We have developed a surface ionization ion-source as part of the JAEA-ISOL (Isotope Separator On-Line) setup, which is coupled to a He/CdI{sub 2} gas-jet transport system to determine the first ionization potential of the heaviest actinide lawrencium (Lr, Z = 103). The new ion-source is an improved version of the previous source that provided good ionization efficiencies for lanthanides. An additional filament was newly installed to give better control over its operation. We report, here, on the development of the new gas-jet coupled surface ion-source and on the first successful ionization and mass separation of 27-s {sup 256}Lr produced in the {sup 249}Cf + {sup 11}B reaction.

  19. Bioacumulation of cyanotoxins in Hypophthalmichthys molitrix (silver carp) in Paranoá Lake, Brasilia-DF, Brazil.

    Science.gov (United States)

    Oliveira, N B; Schwartz, C A; Bloch, C; Paulino, L; Pires, O R

    2013-03-01

    Three individuals of silver carp (Hypophthalmichthys molitrix) were collected biweekly from Paranoá Lake (DF, Brazil) for analysis of microcystin (MC) concentrations in their muscle and liver tissue. Analysis by high performance liquid chromatography and mass spectrometry revealed MC masses and fragmentation patterns that were identified as MC-LR (995.04 m/z), MC-LA (909.01 m/z) and an unknown MC (987.07 m/z). Concentrations were calculated as MC-LR equivalents using a calibration curve prepared with a standard of MC-LR. May/06 was the month with the highest MC-LR equivalent concentrations in muscle and liver (3.83 ± 2.78, and 12.94 ± 10.51 μg g(-1), respectively). Our results show that during the drought months (April-September), consumption of fish with these MC concentrations would result in exposure to MCs that greatly exceed the World Health Organization's recommended tolerable daily intake limit of 0.04 μg MC kg(-1) body weight.

  20. Information Extraction of High Resolution Remote Sensing Images Based on the Calculation of Optimal Segmentation Parameters

    Science.gov (United States)

    Zhu, Hongchun; Cai, Lijie; Liu, Haiying; Huang, Wei

    2016-01-01

    Multi-scale image segmentation and the selection of optimal segmentation parameters are the key processes in the object-oriented information extraction of high-resolution remote sensing images. The accuracy of remote sensing special subject information depends on this extraction. On the basis of WorldView-2 high-resolution data, the optimal segmentation parameters methodof object-oriented image segmentation and high-resolution image information extraction, the following processes were conducted in this study. Firstly, the best combination of the bands and weights was determined for the information extraction of high-resolution remote sensing image. An improved weighted mean-variance method was proposed andused to calculatethe optimal segmentation scale. Thereafter, the best shape factor parameter and compact factor parameters were computed with the use of the control variables and the combination of the heterogeneity and homogeneity indexes. Different types of image segmentation parameters were obtained according to the surface features. The high-resolution remote sensing images were multi-scale segmented with the optimal segmentation parameters. Ahierarchical network structure was established by setting the information extraction rules to achieve object-oriented information extraction. This study presents an effective and practical method that can explain expert input judgment by reproducible quantitative measurements. Furthermore the results of this procedure may be incorporated into a classification scheme. PMID:27362762

  1. Balanced and optimal bianisotropic particles: maximizing power extracted from electromagnetic fields

    International Nuclear Information System (INIS)

    Ra'di, Younes; Tretyakov, Sergei A

    2013-01-01

    Here we introduce the concept of ‘optimal particles’ for strong interactions with electromagnetic fields. We assume that a particle occupies a given electrically small volume in space and study the required optimal relations between the particle polarizabilities. In these optimal particles, the inclusion shape and material are chosen so that the particles extract the maximum possible power from given incident fields. It appears that for different excitation scenarios the optimal particles are bianisotropic chiral, omega, moving and Tellegen particles. The optimal dimensions of resonant canonical chiral and omega particles are found analytically. Such optimal particles have extreme properties in scattering (e.g., zero backscattering or invisibility). Planar arrays of optimal particles possess extreme properties in reflection and transmission (e.g. total absorption or magnetic-wall response), and volumetric composites of optimal particles realize, for example, such extreme materials as the chiral nihility medium. (paper)

  2. Determining biotoxins in continental waters colonised by Azolla; Determinacion de biotoxinas en aguas continentales colonizadas por Azolla

    Energy Technology Data Exchange (ETDEWEB)

    Prada A-Buylla, J.; Sanchez Crespo, R.; Verdigo Althofer, M. [Confederacion Hidrografica del Guadina. Ciudad Real (Spain)

    1999-07-01

    During the period 1993-95, the presence of Azolla ferns was observed in the air/water interface along several kilometres of the river Guadina in both Spain and Portugal. This fern is symbiotically associated with the cyano-bacteria Anabaena azollae that is capable of fixing atmospheric nitrogen, which can lead to vegetable growth and eutrophication. At the same time, the cyanobacteria may generate biotoxins, in which case a study is made of the hepatotoxins forming a family of 53 related cyclic peptides. Those consisting of seven aminoacids receive the name of microcystines, while formed by five aminoacids arc called nodulaincs. Chromatography was used to determine the presence of these peptides in the water from six sampling points. Microcystine-LR was found at concentrations of around 0.3 g/l at three points. (Author) 5 refs.

  3. Optimization of PEG-based extraction of polysaccharides from Dendrobium nobile Lindl. and bioactivity study.

    Science.gov (United States)

    Zhang, Yi; Wang, Hongxin; Wang, Peng; Ma, ChaoYang; He, GuoHua; Rahman, Md Ramim Tanver

    2016-11-01

    Polyethylene glycol (PEG) as a green solvent was employed to extract polysaccharide. The optimal conditions for PEG-based ultrasonic extraction of Dendrobium nobile Lindl. polysaccharide (JCP) were determined by response surface methodology. Under the optimal conditions: extraction temperature of 58.5°C; ultrasound power of 193W, and the concentration of polyethylene glycol-200 (PEG-200) solution of 45%, the highest JCP yield was obtained as 15.23±0.57%, which was close to the predicted yield, 15.57%. UV and FT-IR analysis revealed the general characteristic absorption peaks of both JCP with water extraction (JCP w ) and PEG-200 solvent extraction (JCP p ). Thermal analysis of both JCPs was performed with Thermal Gravimetric Analyzer (TGA) and Differential Scanning Calorimeter (DSC). Antioxidant activities of two polysaccharides were also compared and no significant difference in vitro was obtained. Copyright © 2016 Elsevier B.V. All rights reserved.

  4. Optimization and characterization of gelatin and chitosan extracted from fish and shrimp waste

    Science.gov (United States)

    Ait Boulahsen, M.; Chairi, H.; Laglaoui, A.; Arakrak, A.; Zantar, S.; Bakkali, M.; Hassani, M.

    2018-05-01

    Fish and seafood processing industries generate large quantities of waste which are at the origin of several environmental, economic and social problems. However fish waste could contain high value-added substances such as biopolymers. This work focuses on optimizing the gelatin and chitosan extraction from tilapia fish skins and shrimp shells respectively. The gelatin extraction process was optimized using alkali acid treatment prior to thermal hydrolysis. Three different acids were tested at different concentrations. Chitosan was obtained after acid demineralization followed by simultaneous hydrothermal deproteinization and deacetylation by an alkali treatment with different concentrations of HCl and NaOH. The extracted gelatin and chitosan with the highest yield were characterized by determining their main physicochemical properties (Degree of deacetylation, viscosity, pH, moisture and ash content). Results show a significant influence of the acid type and concentration on the extraction yield of gelatin and chitosan, with an average yield of 12.24% and 3.85% respectively. Furthermore, the obtained physicochemical properties of both extracted gelatin and chitosan were within the recommended standard values of the commercial ones used in the industry.

  5. Optimization of extraction of high purity all-trans-lycopene from tomato pulp waste.

    Science.gov (United States)

    Poojary, Mahesha M; Passamonti, Paolo

    2015-12-01

    The aim of this work was to optimize the extraction of pure all-trans-lycopene from the pulp fractions of tomato processing waste. A full factorial design (FFD) consisting of four independent variables including extraction temperature (30-50 °C), time (1-60 min), percentage of acetone in n-hexane (25-75%, v/v) and solvent volume (10-30 ml) was used to investigate the effects of process variables on the extraction. The absolute amount of lycopene present in the pulp waste was found to be 0.038 mg/g. The optimal conditions for extraction were as follows: extraction temperature 20 °C, time 40 min, a solvent composition of 25% acetone in n-hexane (v/v) and solvent volume 40 ml. Under these conditions, the maximal recovery of lycopene was 94.7%. The HPLC-DAD analysis demonstrated that, lycopene was obtained in the all-trans-configuration at a very high purity grade of 98.3% while the amount of cis-isomers and other carotenoids were limited. Copyright © 2015 Elsevier Ltd. All rights reserved.

  6. Optimization of HPLC method for the isolation of Hypericum perforatum L. methanol extract

    Directory of Open Access Journals (Sweden)

    Stamenković, J.

    2013-12-01

    Full Text Available St. John's Wort (Hypericum perforatum L. is one of the most studied plant species in the family Hypericaceae. The aim of this study was the identification of the constituents of methanol extract of H. perforatum and optimization of conditions for their isolation. The main components of the methanol extract were isolated on preparative ZORBAX Eclipse XDB C18 column with solvent system consisting of methanol and 1x10-2 M ammonium acetate in water. Constituents of the extract were identified by comparing their retention times with the retention times of the standards, with the literature data and the UV spectra. By varying the conditions of chromatography, the optimal conditions for isolation of the methanol extract constituents were determined: mobile phase consisting of methanol and 1x10-2 M ammonium acetate in water in ratio 1 : 1, sample concentration 100 mg/mL, sample volume 30 µL, flow 2 mL/min. Under these conditions 7 components of the methanol extract were isolated.

  7. Optimizing Pretreatment of Medicinal Raw Materials by RFC Plasma before Extraction

    Directory of Open Access Journals (Sweden)

    O.Yu. Kuznetsova

    2016-06-01

    Full Text Available Optimization of the RF-plasma treatment modes of chaga raw materials using the Statistica 6.0 software package has been performed. Mathematical design has been carried out to calculate the optimum parameters of RF-plasma treatment using three plasma-forming gases – argon, air, and nitrogen. Plasma treatment of chaga raw materials has been undertaken at the constant parameters: pressure P = 30.0 Pa, anodic current J = 0.7 A, gas consumption G = 0.04 g/s; the variable parameters were power U = 5.0÷7.0 kV and treatment duration at the high-frequency capacitor category of the lowered pressure t = 30÷60 min. Optimization of four key parameters for extraction of chaga raw materials (solid residue, melanin yield, antioxidant activity of both extract and chaga melanin depending on the chosen plasma-forming gas (argon, air, or nitrogen has been achieved. The optimum modes of RF-plasma treatment allowing to obtain the extracts and melanin of chaga mushroom with the improved physicochemical and antioxidant characteristics have been calculated.

  8. GPU implementation of discrete particle swarm optimization algorithm for endmember extraction from hyperspectral image

    Science.gov (United States)

    Yu, Chaoyin; Yuan, Zhengwu; Wu, Yuanfeng

    2017-10-01

    Hyperspectral image unmixing is an important part of hyperspectral data analysis. The mixed pixel decomposition consists of two steps, endmember (the unique signatures of pure ground components) extraction and abundance (the proportion of each endmember in each pixel) estimation. Recently, a Discrete Particle Swarm Optimization algorithm (DPSO) was proposed for accurately extract endmembers with high optimal performance. However, the DPSO algorithm shows very high computational complexity, which makes the endmember extraction procedure very time consuming for hyperspectral image unmixing. Thus, in this paper, the DPSO endmember extraction algorithm was parallelized, implemented on the CUDA (GPU K20) platform, and evaluated by real hyperspectral remote sensing data. The experimental results show that with increasing the number of particles the parallelized version obtained much higher computing efficiency while maintain the same endmember exaction accuracy.

  9. Optimization of Total Flavonoids Extraction from Coreopsis tinctoria Nutt. by Response Surface Methodology

    Directory of Open Access Journals (Sweden)

    Liu, X. F.

    2014-11-01

    Full Text Available Response surface methodology (RSM was applied to predict optimum conditions for extraction of flavonoid from Coreopsis tinctoria Nutt. A central composite design (CCD was used to monitor the effect of extraction temperature, extraction time, and water-to-material ratio on yield of total flavonoids. The optimal extraction conditions were obtained as water-to-material ratio of 55 ml g−1, extraction temperature of 80 °C and extraction time of 70 minutes. Under these conditions, the average total flavonoids yield, according to the mass of raw material, was 9.0 ± 0.6 %, which corresponds to the predicted value of 8.9 %. Thus, the extraction method was applied successfully to extract total flavonoids from C. tinctoria.

  10. Process optimization for extraction of carotenoids from medicinal caterpillar fungus, Cordyceps militaris (Ascomycetes).

    Science.gov (United States)

    Yang, Tao; Sun, Junde; Lian, Tiantian; Wang, Wenzhao; Dong, Cai-Hong

    2014-01-01

    Natural carotenoids have attracted great attention for their important beneficial effects on human health and food coloring function. Cordyceps militaris, a well-known edible and medicinal fungus, is a potential source of natural carotenoids. The present study aimed to optimize the process parameters for carotenoid extraction from this mushroom. The effects of different methods of breaking the fungal cell wall and organic solvents were studied by the one-factor-at-a-time method. Subsequently, the process parameters including the duration of the extraction time, the number of extractions, and the solvent to solid ratio were optimized by using the Box-Behnken design. The optimal extraction conditions included using an acid-heating method to break the cell wall and later extracting three times, each for a 1 h duration, with a 4:1 mixture of acetone: petroleum ether and a solvent: solid ratio of 24:1. The carotenoid content varied from 2122.50 to 3847.50 µg/g dry weights in different commercially obtained fruit bodies of C. militaris. The results demonstrated that the C. militaris contained more carotenoid content in its fruit bodies than other known mushrooms. Stability monitoring by HPLC demonstrated that the carotenoids could be stored at 4°C for 40 d. It is suggested that the carotenoid content should be considered as the quality standard of commercial products of this valued mushroom. These findings will facilitate the exploration of carotenoids from C. militaris.

  11. Optimization and technological development strategies of an antimicrobial extract from Achyrocline alata assisted by statistical design.

    Directory of Open Access Journals (Sweden)

    Daniel P Demarque

    Full Text Available Achyrocline alata, known as Jateí-ka-há, is traditionally used to treat several health problems, including inflammations and infections. This study aimed to optimize an active extract against Streptococcus mutans, the main bacteria that causes caries. The extract was developed using an accelerated solvent extraction and chemometric calculations. Factorial design and response surface methodologies were used to determine the most important variables, such as active compound selectivity. The standardized extraction recovered 99% of the four main compounds, gnaphaliin, helipyrone, obtusifolin and lepidissipyrone, which represent 44% of the extract. The optimized extract of A. alata has a MIC of 62.5 μg/mL against S. mutans and could be used in mouth care products.

  12. The dynamics of toxic microcystis strains and microcystin production in two hypertrofic South African reservoirs

    OpenAIRE

    Barnard, Sandra; Conradie, Karin Ronel

    2012-01-01

    The South African impoundments of Hartbeespoort and Roodeplaat experience excessive blooms of Microcystis species each year. Microcystins, produced primarily by strains of cyanobacteria belonging to the genera Microcystis, Anabaena and Planktothrix, are harmful cyanobacterial hepatotoxins. These bloom-forming cyanobacteria form toxic and non-toxic strains that co-occur and are visually indistinguishable, but can be identified and quantified molecularly. We described the relationships between ...

  13. SR and LR Union Suture for the Treatment of Myopic Strabismus Fixus: Is Scleral Fixation Necessary?

    Directory of Open Access Journals (Sweden)

    Carol P. S. Lam

    2015-01-01

    Full Text Available Purpose. To evaluate and compare the effectiveness of scleral fixation SR and LR union suture and nonscleral fixation union suture for the treatment of myopic strabismus fixus. Methods. Retrospective review of 32 eyes of 22 patients with myopic strabismus fixus who had undergone union suture of superior rectus (SR and lateral rectus (LR with or without scleral fixation, and follow-up longer than 6 months at Hong Kong Eye Hospital from 2006 to 2013. Surgical techniques and outcomes in terms of ocular alignment are analyzed. Results. There is significant overall improvement both in postoperative angle of esodeviation (P0.05. Conclusions. Union suture of SR and LR is an effective procedure in correcting myopic strabismus fixus. Fixation of the union suture to the sclera does not improve surgical outcome.

  14. Optimization of extraction conditions for secondary biomolecules from various plant species

    Directory of Open Access Journals (Sweden)

    Šibul Filip S.

    2016-01-01

    Full Text Available Extraction of plant secondary metabolites is an essential step in isolation of natural products. Non-optimized extraction conditions can lead to losses, degradation and modification of the biomolecules. In this paper, the influence of different solvent mixtures, solvent amounts, temperature, extraction time, and procedures for defatting on yield and profile of various classes of secondary metabolites was investigated. Rumex alpinus was used for the extraction of anthraquinones, Glycine max for isoflavonoids, Chaerophyllum bulbosum for flavonoids and phenolic acids, Anthriscus sylvestris for lignans and coumarins, alkaloids were extracted from Lupinus albus and sesquiterpene lactones from Artemisia absinthium. Extraction efficiency was evaluated by use of LC-DAD-ESI-MS/MS. The compromise extraction solvent for all of the examined compounds is 80 % methanol, mixed in ratio 13 : 1 with plant material. Maceration should last for six hours, repeated four times with fresh solvent. Defatting of the extracts does not lead to significant losses of the compounds of interest. It is acceptable to use extraction and evaporation temperature of 60ºC, while the extracts should be stored in the dark, on -20ºC. [Projekat Ministarstva nauke Republike Srbije, br. 172058

  15. Optimization of Solid-Liquid Extraction of Antioxidants from Black Mulberry Leaves by Response Surface Methodology

    Directory of Open Access Journals (Sweden)

    Zoran Zeković

    2012-01-01

    Full Text Available The extraction of active components from natural sources depends on different factors. The knowledge of the effects of different extraction parameters is useful for the optimization of the process, as well for the ability to predict the extraction yield. The aim of this study is to examine the influence of solvent concentration (ethanol/water 40–80 %, by volume, temperature (40–80 °C and solvent/raw material ratio (10–30 mL/g on the extraction yield of phenolic compounds, flavonoids and antioxidant activity from black mulberry (Morus nigra L. leaves. Experimental values of total phenolic content were in the range from 18.6 to 48.7 mg of chlorogenic acid equivalents per g of dried leaves and total flavonoids in the range from 6.0 to 21.4 mg of rutin eqivalents per g of dried leaves. Antioxidant activity expressed as the inhibition concentration at 50 % (IC50 value was in the range from 0.019 to 0.078 mg of mulberry extract per mL. Response surface methodology (RSM was used to determine the optimum extraction conditions and to investigate the effect of different variables on the observed properties of mulberry leaf extracts. The results show a good fit to the proposed model (R˄2>0.90. The optimal conditions for obtaining the highest extraction yield of phenolics and flavonoids were within the experimental range. The experimental values agreed with those predicted, thus indicating suitability of the used model and the success of RSM in optimizing the investigated extraction conditions.

  16. 太冲穴古代文献应用分析%Application Analysis of Taichong(LR3) in the Ancient Literatures

    Institute of Scientific and Technical Information of China (English)

    王文琴; 张永臣; 贾红玲

    2013-01-01

    目的:通过对太冲古代文献的整理,总结太冲的应用规律。方法:以《中华医典》(第四版)收录的中医古籍1000部为检索范围,对太冲的主治病症、腧穴配伍、配伍主治病症、刺灸法、刺激量等文献进行系统整理,并建立数据库。结果:太冲应用符合纳入标准的有752条,治疗病症共有689条,涉及87部古籍。太冲配伍的使用频次共有1433次,与太冲穴配伍的经穴为167个。结论:太冲单穴适应于临床各科,尤善于治疗中医内科病症,前7位的内科病症为咳嗽、黄疸、痫病、呕吐、痹症、厥症、淋证;配伍后主治前10位的病症为痹症、胸痹、腹痛、血证、虚劳、黄疸、痉证、水肿、腰痛、中风;太冲的腧穴配伍以合谷、足三里、三阴交、行间、昆仑、照海、悬钟、中封、大敦、百会等经穴频数为较多,常用的配伍“穴对”为太冲与行间、太冲与合谷、太冲与三阴交;常用的刺灸法为灸法,针刺深度为针三分,针刺时间为十呼,灸法刺激量为三壮。%Objective:To sum up the application regularity of Taichong ( LR3) through studying the ancient lit-eratures about Taichong (LR3).Methods:We searched 1000 TCM Ancient Books in the “Encyclopedia of Tra-ditional Chinese”( the Fourth Edition ) and organized the information systematically including the primary disea-ses and symptoms of Taichong (LR3),the compatibility of acupionts, the primary diseases and symptoms of Tai-chong ( LR3 ) with compatible effects , the methods of needling and moxibustion , the stimulating quantity of nee-dling and moxibustion , with which we built a data base .Results:A total of 752 relevant articles of Taichong ( LR3) on the application and 689 primary diseases and symptoms were collected in accordance with the inclu-sive criteria in 87 TCM ancient books .The results also showed that the occurrence frequency of Taichong ( LR3

  17. Omega-3 fatty acid docosahexaenoic acid increases SorLA/LR11, a sorting protein with reduced expression in sporadic Alzheimer's disease (AD): relevance to AD prevention.

    Science.gov (United States)

    Ma, Qiu-Lan; Teter, Bruce; Ubeda, Oliver J; Morihara, Takashi; Dhoot, Dilsher; Nyby, Michael D; Tuck, Michael L; Frautschy, Sally A; Cole, Greg M

    2007-12-26

    Environmental and genetic factors, notably ApoE4, contribute to the etiology of late-onset Alzheimer's disease (LOAD). Reduced mRNA and protein for an apolipoprotein E (ApoE) receptor family member, SorLA (LR11) has been found in LOAD but not early-onset AD, suggesting that LR11 loss is not secondary to pathology. LR11 is a neuronal sorting protein that reduces amyloid precursor protein (APP) trafficking to secretases that generate beta-amyloid (Abeta). Genetic polymorphisms that reduce LR11 expression are associated with increased AD risk. However these polymorphisms account for only a fraction of cases with LR11 deficits, suggesting involvement of environmental factors. Because lipoprotein receptors are typically lipid-regulated, we postulated that LR11 is regulated by docosahexaenoic acid (DHA), an essential omega-3 fatty acid related to reduced AD risk and reduced Abeta accumulation. In this study, we report that DHA significantly increases LR11 in multiple systems, including primary rat neurons, aged non-Tg mice and an aged DHA-depleted APPsw AD mouse model. DHA also increased LR11 in a human neuronal line. In vivo elevation of LR11 was also observed with dietary fish oil in young rats with insulin resistance, a model for type II diabetes, another AD risk factor. These data argue that DHA induction of LR11 does not require DHA-depleting diets and is not age dependent. Because reduced LR11 is known to increase Abeta production and may be a significant genetic cause of LOAD, our results indicate that DHA increases in SorLA/LR11 levels may play an important role in preventing LOAD.

  18. [Extraction Optimization of Rhizome of Curcuma longa by Response Surface Methodology and Support Vector Regression].

    Science.gov (United States)

    Zhou, Pei-pei; Shan, Jin-feng; Jiang, Jian-lan

    2015-12-01

    To optimize the optimal microwave-assisted extraction method of curcuminoids from Curcuma longa. On the base of single factor experiment, the ethanol concentration, the ratio of liquid to solid and the microwave time were selected for further optimization. Support Vector Regression (SVR) and Central Composite Design-Response Surface Methodology (CCD) algorithm were utilized to design and establish models respectively, while Particle Swarm Optimization (PSO) was introduced to optimize the parameters of SVR models and to search optimal points of models. The evaluation indicator, the sum of curcumin, demethoxycurcumin and bisdemethoxycurcumin by HPLC, were used. The optimal parameters of microwave-assisted extraction were as follows: ethanol concentration of 69%, ratio of liquid to solid of 21 : 1, microwave time of 55 s. On those conditions, the sum of three curcuminoids was 28.97 mg/g (per gram of rhizomes powder). Both the CCD model and the SVR model were credible, for they have predicted the similar process condition and the deviation of yield were less than 1.2%.

  19. Extraction of alginate from Sargassum muticum: process optimization and study of its functional activities

    DEFF Research Database (Denmark)

    Mazumder, Anupriya; Holdt, Susan Løvstad; De Francisci, Davide

    2016-01-01

    In the present study, alginate extraction from the brown seaweed Sargassum muticum was studied using single factor analysis. Response Surface Methodology-Central Composite Rotatary design (RSM-CCRD) was performed to reduce and optimize extraction temperature, alkali concentration, and consumption...

  20. Optimization of Ficus deltoidea Using Ultrasound-Assisted Extraction by Box-Behnken Statistical Design

    Directory of Open Access Journals (Sweden)

    L. J. Ong

    2016-09-01

    Full Text Available In this study, the effect of extraction parameters (ethanol concentration, sonication time, and solvent-to-sample ratio on Ficus deltoidea leaves was investigated using ultrasound-assisted extraction by response surface methodology (RSM. Total phenolic content (TPC of F. deltoidea extracts was identified using Folin-Ciocalteu method and expressed in gallic acid equivalent (GAE per g. Box-Behnken statistical design (BBD was the tool used to find the optimal conditions for maximum TPC. Besides, the extraction yield was measured and stated in percentage. The optimized TPC attained was 455.78 mg GAE/g at 64% ethanol concentration, 10 minutes sonication time, and 20 mL/g solvent-to-sample ratio whereas the greatest extraction yield was 33% with ethanol concentration of 70%, sonication time of 40 minutes, and solvent-to-material ratio at 40 mL/g. The determination coefficient, R2, for TPC indicates that 99.5% capriciousness in the response could be clarified by the ANOVA model and the value of 0.9681 of predicted R2 is in equitable agreement with the 0.9890 of adjusted R2. The present study shows that ethanol water as solvent, a short time of 10 minutes, and adequate solvent-to-sample ratio (20 mL/g are the best conditions for extraction.

  1. Optimization of physicochemical and textural properties of pizza cheese fortified with soybean oil and carrot extract.

    Science.gov (United States)

    Motevalizadeh, Ehsan; Mortazavi, Seyed Ali; Milani, Elnaz; Hooshmand-Dalir, Moosa Al-Reza

    2018-03-01

    Response surface methodology (RSM) was used to optimize pizza cheese containing carrot extract. The effects of two important independent variables including soybean oil (5%-20%) and carrot extract (5%-20%) were studied on physicochemical and textural properties of pizza cheese containing carrot extract. According to the results, RSM was successfully used for optimizing formulation of pizza cheese containing carrot juice. Results of this study revealed that oil (A), carrot (B), AB, square term of carrot (B 2 ), B, AB, square term of oil (A 2 ), B 2 , AB, AB, A 2 B, A 2 , A 2 , A, A 2 , A 2 , AB, and AB 2 had the most effect on moisture, acidity, stretch, L*, a*, b*, hardness, meltability, springiness, peroxide value (PV), cohesiveness, chewiness, gumminess, fracture force, adhesiveness force, stiffness, flavor, and overall acceptability, respectively. A formulation upon 20% oil and 10.88% carrot extract was found as the optimal formulation for pizza cheese containing carrot extract. At the optimal formulation, PV, L*, a*, b*, meltability, stretch, cohesiveness, springiness, gumminess, chewiness, adhesive force, flavor, texture, and overall acceptability at the optimum formulation were measured 2.23, 82.51, -3.69, 18.05, 17.86, 85.61, 0.41, 7.874, 23.7, 0.27, 0.61, 3.50, 3.95, and 3.65, respectively.

  2. Effect of cyanotoxins on the hypothalamic-pituitary-gonadal axis in male adult mouse.

    Science.gov (United States)

    Xiong, Xiaolu; Zhong, Anyuan; Xu, Huajun

    2014-01-01

    Microcystins LR (MC-LR) are hepatotoxic cyanotoxins that have been shown to induce reproductive toxicity, and Hypothalamic-Pituitary-Gonadal Axis (HPG) is responsible for the control of reproductive functions. However, few studies have been performed to evaluate the effects of MC-LR on HPG axis. This study aimed to investigate the MC-LR-induced toxicity in the reproductive system of mouse and focus on the HPG axis. Adult male C57BL/6 mice were exposed to various concentrations of MC-LR (0, 3.75, 7.50, 15.00 and 30.00 µg/kg body weight per day) for 1 to 14 days, and it was found that exposure to different concentrations of MC-LR significantly disturbed sperm production in the mice testes in a dose- and time-dependent manner. To elucidate the associated possible mechanisms, the serum levels of testosterone, follicle-stimulating hormone (FSH) and luteinizing hormone (LH) were assessed. Meanwhile, PCR assays were employed to detect alterations in a series of genes involved in HPG axis, such as FSH, LH, gonadotropin-releasing hormone (GnRH) and their complement receptors. Furthermore, the effect of MC-LR on the viability and testosterone production of Leydig cells were tested in vitro. MC-LR significantly impaired the spermatogenesis of mice possibly through the direct or indirect inhibition of GnRH synthesis at the hypothalamic level, which resulted in reduction of serum levels of LH that lead to suppression of testosterone production in the testis of mice. MC-LR may be a GnRH toxin that would disrupt the reproductive system of mice.

  3. Effect of cyanotoxins on the hypothalamic-pituitary-gonadal axis in male adult mouse.

    Directory of Open Access Journals (Sweden)

    Xiaolu Xiong

    Full Text Available Microcystins LR (MC-LR are hepatotoxic cyanotoxins that have been shown to induce reproductive toxicity, and Hypothalamic-Pituitary-Gonadal Axis (HPG is responsible for the control of reproductive functions. However, few studies have been performed to evaluate the effects of MC-LR on HPG axis. This study aimed to investigate the MC-LR-induced toxicity in the reproductive system of mouse and focus on the HPG axis.Adult male C57BL/6 mice were exposed to various concentrations of MC-LR (0, 3.75, 7.50, 15.00 and 30.00 µg/kg body weight per day for 1 to 14 days, and it was found that exposure to different concentrations of MC-LR significantly disturbed sperm production in the mice testes in a dose- and time-dependent manner. To elucidate the associated possible mechanisms, the serum levels of testosterone, follicle-stimulating hormone (FSH and luteinizing hormone (LH were assessed. Meanwhile, PCR assays were employed to detect alterations in a series of genes involved in HPG axis, such as FSH, LH, gonadotropin-releasing hormone (GnRH and their complement receptors. Furthermore, the effect of MC-LR on the viability and testosterone production of Leydig cells were tested in vitro.MC-LR significantly impaired the spermatogenesis of mice possibly through the direct or indirect inhibition of GnRH synthesis at the hypothalamic level, which resulted in reduction of serum levels of LH that lead to suppression of testosterone production in the testis of mice.MC-LR may be a GnRH toxin that would disrupt the reproductive system of mice.

  4. SpecOp: Optimal Extraction Software for Integral Field Unit Spectrographs

    Science.gov (United States)

    McCarron, Adam; Ciardullo, Robin; Eracleous, Michael

    2018-01-01

    The Hobby-Eberly Telescope’s new low resolution integral field spectrographs, LRS2-B and LRS2-R, each cover a 12”x6” area on the sky with 280 fibers and generate spectra with resolutions between R=1100 and R=1900. To extract 1-D spectra from the instrument’s 3D data cubes, a program is needed that is flexible enough to work for a wide variety of targets, including continuum point sources, emission line sources, and compact sources embedded in complex backgrounds. We therefore introduce SpecOp, a user-friendly python program for optimally extracting spectra from integral-field unit spectrographs. As input, SpecOp takes a sky-subtracted data cube consisting of images at each wavelength increment set by the instrument’s spectral resolution, and an error file for each count measurement. All of these files are generated by the current LRS2 reduction pipeline. The program then collapses the cube in the image plane using the optimal extraction algorithm detailed by Keith Horne (1986). The various user-selected options include the fraction of the total signal enclosed in a contour-defined region, the wavelength range to analyze, and the precision of the spatial profile calculation. SpecOp can output the weighted counts and errors at each wavelength in various table formats using python’s astropy package. We outline the algorithm used for extraction and explain how the software can be used to easily obtain high-quality 1-D spectra. We demonstrate the utility of the program by applying it to spectra of a variety of quasars and AGNs. In some of these targets, we extract the spectrum of a nuclear point source that is superposed on a spatially extended galaxy.

  5. Optimized Reputable Sensing Participants Extraction for Participatory Sensor Networks

    Directory of Open Access Journals (Sweden)

    Weiwei Yuan

    2014-01-01

    Full Text Available By collecting data via sensors embedded personal smart devices, sensing participants play a key role in participatory sensor networks. Using information provided by reputable sensing participants ensures the reliability of participatory sensing data. Setting a threshold for the reputation, and those whose reputations are bigger than this value are regarded as reputable. The bigger the threshold value is, the more reliable the extracted reputable sensing participant is. However, if the threshold value is too big, only very limited participatory sensing data can be involved. This may cause unexpected bias in information collection. Existing works did not consider the relationship between the reliability of extracted reputable sensing participants and the ratio of usable participatory sensing data. In this work, we propose a criterion for optimized reputable sensing participant extraction in participatory sensor networks. This is achieved based on the mathematical analysis on the ratio of available participatory sensing data and the reliability of extracted reputable sensing participants. Our suggested threshold value for reputable sensing participant extraction is only related to the power of sensing participant’s reputation distribution. It is easy to be applied in real applications. Simulation results tested on real application data further verified the effectiveness of our proposed method.

  6. Effect of Acupuncture at LR3 on Cerebral Glucose Metabolism in a Rat Model of Hypertension: A 18F-FDG-PET Study

    Directory of Open Access Journals (Sweden)

    Jing Li

    2018-01-01

    Full Text Available Our objective was to investigate the effect of acupuncture at LR3 on cerebral glucose metabolism in spontaneously hypertensive rats (SHRs. We used 18F-2-fluoro-deoxy-D-glucose positron emission tomography (18F-FDG-PET to examine the effects of acupuncture at LR3 on cerebral glucose metabolism in SHRs. SHRs were randomly allocated to receive no treatment (SHR group, needling at LR3 (SHR + LR3 group, or sham needling (SHR + sham group. Rats received 10 min acupuncture once per day for 7 days and were compared to normotensive Wistar Kyoto (WKY rats. Blood pressure (BP measurement and PET were performed after the first needling and the 7-day treatment period. BP was lower in the SHR + LR3 group compared to the other SHR groups between 30 and 60 min after the first needling and at 24 and 48 h after the 7-day treatment period. Glucose metabolism in the motor, sensory, and visual cortices was decreased in SHR group compared to WKY group. Needling at LR3 was associated with decreased glucose metabolism in the dorsal thalamus, thalamus, and hypothalamus and with increased metabolism in the cerebellar anterior and posterior lobes, medulla oblongata, and sensory cortex compared to the SHR group. These findings suggest that LR3 acupuncture improves hypertension through a mechanism involving altered brain activation in SHRs.

  7. Extraction optimization and UHPLC method development for determination of the 20-hydroxyecdysone in Sida tuberculata leaves.

    Science.gov (United States)

    da Rosa, Hemerson S; Koetz, Mariana; Santos, Marí Castro; Jandrey, Elisa Helena Farias; Folmer, Vanderlei; Henriques, Amélia Teresinha; Mendez, Andreas Sebastian Loureiro

    2018-04-01

    Sida tuberculata (ST) is a Malvaceae species widely distributed in Southern Brazil. In traditional medicine, ST has been employed as hypoglycemic, hypocholesterolemic, anti-inflammatory and antimicrobial. Additionally, this species is chemically characterized by flavonoids, alkaloids and phytoecdysteroids mainly. The present work aimed to optimize the extractive technique and to validate an UHPLC method for the determination of 20-hydroxyecdsone (20HE) in the ST leaves. Box-Behnken Design (BBD) was used in method optimization. The extractive methods tested were: static and dynamic maceration, ultrasound, ultra-turrax and reflux. In the Box-Behnken three parameters were evaluated in three levels (-1, 0, +1), particle size, time and plant:solvent ratio. In validation method, the parameters of selectivity, specificity, linearity, limits of detection and quantification (LOD, LOQ), precision, accuracy and robustness were evaluated. The results indicate static maceration as better technique to obtain 20HE peak area in ST extract. The optimal extraction from surface response methodology was achieved with the parameters granulometry of 710 nm, 9 days of maceration and plant:solvent ratio 1:54 (w/v). The UHPLC-PDA analytical developed method showed full viability of performance, proving to be selective, linear, precise, accurate and robust for 20HE detection in ST leaves. The average content of 20HE was 0.56% per dry extract. Thus, the optimization of extractive method in ST leaves increased the concentration of 20HE in crude extract, and a reliable method was successfully developed according to validation requirements and in agreement with current legislation. Copyright © 2018 Elsevier Inc. All rights reserved.

  8. Optimization and Comparison of Ultrasound-Assisted Extraction of Estragole from Tarragon Leaves with Hydro-Distillation Method

    Directory of Open Access Journals (Sweden)

    Mohammad Bagher Gholivand

    2014-12-01

    Full Text Available A comparative study of ultrasound-assisted extraction (UAE and hydro-distillation was performed for fast extraction of estragole from tarragon (Artemisia dracunculus L. dried leaves. Several influential parameters of the UAE procedure in the extraction of estragole (type of solvent, extraction cycles, solvent to material ratio, irradiation time and particle size were investigated and optimized. It was found that UAE offers a more rapid extraction of estragole than hydrodistillation. The optimum parameters were solvent to material ratio of 8:1 v/m, 96% (w/w ethanol in water as extraction solvent, particle size of 1.18 mm, irradiation time of 5 min, output power of 63 W, 9 pulses, and ultrasonic frequency of 20 kHz. The recovery of estragole by UAE under optimal conditions was 44.4% based on dry extract. The benefit of ultrasound was to decrease the extraction time (5 min relative to the classical hydrodistillation method (3 h. The experimental results also indicated that ultrasound-assisted extraction is a simple, rapid and effective method for extraction of the volatile oil components of tarragon.

  9. Optimal Elbow Angle for Extracting sEMG Signals During Fatiguing Dynamic Contraction

    Directory of Open Access Journals (Sweden)

    Mohamed R. Al-Mulla

    2015-09-01

    Full Text Available Surface electromyographic (sEMG activity of the biceps muscle was recorded from 13 subjects. Data was recorded while subjects performed dynamic contraction until fatigue and the signals were segmented into two parts (Non-Fatigue and Fatigue. An evolutionary algorithm was used to determine the elbow angles that best separate (using Davies-Bouldin Index, DBI both Non-Fatigue and Fatigue segments of the sEMG signal. Establishing the optimal elbow angle for feature extraction used in the evolutionary process was based on 70% of the conducted sEMG trials. After completing 26 independent evolution runs, the best run containing the optimal elbow angles for separation (Non-Fatigue and Fatigue was selected and then tested on the remaining 30% of the data to measure the classification performance. Testing the performance of the optimal angle was undertaken on nine features extracted from each of the two classes (Non-Fatigue and Fatigue to quantify the performance. Results showed that the optimal elbow angles can be used for fatigue classification, showing 87.90% highest correct classification for one of the features and on average of all eight features (including worst performing features giving 78.45%.

  10. Zener Diode Compact Model Parameter Extraction Using Xyce-Dakota Optimization.

    Energy Technology Data Exchange (ETDEWEB)

    Buchheit, Thomas E. [Sandia National Lab. (SNL-NM), Albuquerque, NM (United States); Wilcox, Ian Zachary [Sandia National Lab. (SNL-NM), Albuquerque, NM (United States); Sandoval, Andrew J [Sandia National Lab. (SNL-NM), Albuquerque, NM (United States); Reza, Shahed [Sandia National Lab. (SNL-NM), Albuquerque, NM (United States)

    2017-12-01

    This report presents a detailed process for compact model parameter extraction for DC circuit Zener diodes. Following the traditional approach of Zener diode parameter extraction, circuit model representation is defined and then used to capture the different operational regions of a real diode's electrical behavior. The circuit model contains 9 parameters represented by resistors and characteristic diodes as circuit model elements. The process of initial parameter extraction, the identification of parameter values for the circuit model elements, is presented in a way that isolates the dependencies between certain electrical parameters and highlights both the empirical nature of the extraction and portions of the real diode physical behavior which of the parameters are intended to represent. Optimization of the parameters, a necessary part of a robost parameter extraction process, is demonstrated using a 'Xyce-Dakota' workflow, discussed in more detail in