Dissipative particle dynamics: Systematic parametrization using water-octanol partition coefficients
Anderson, Richard L.; Bray, David J.; Ferrante, Andrea S.; Noro, Massimo G.; Stott, Ian P.; Warren, Patrick B.
2017-09-01
We present a systematic, top-down, thermodynamic parametrization scheme for dissipative particle dynamics (DPD) using water-octanol partition coefficients, supplemented by water-octanol phase equilibria and pure liquid phase density data. We demonstrate the feasibility of computing the required partition coefficients in DPD using brute-force simulation, within an adaptive semi-automatic staged optimization scheme. We test the methodology by fitting to experimental partition coefficient data for twenty one small molecules in five classes comprising alcohols and poly-alcohols, amines, ethers and simple aromatics, and alkanes (i.e., hexane). Finally, we illustrate the transferability of a subset of the determined parameters by calculating the critical micelle concentrations and mean aggregation numbers of selected alkyl ethoxylate surfactants, in good agreement with reported experimental values.
Posa, Mihalj; Pilipović, Ana; Lalić, Mladena; Popović, Jovan
2011-02-15
Linear dependence between temperature (t) and retention coefficient (k, reversed phase HPLC) of bile acids is obtained. Parameters (a, intercept and b, slope) of the linear function k=f(t) highly correlate with bile acids' structures. Investigated bile acids form linear congeneric groups on a principal component (calculated from k=f(t)) score plot that are in accordance with conformations of the hydroxyl and oxo groups in a bile acid steroid skeleton. Partition coefficient (K(p)) of nitrazepam in bile acids' micelles is investigated. Nitrazepam molecules incorporated in micelles show modified bioavailability (depo effect, higher permeability, etc.). Using multiple linear regression method QSAR models of nitrazepams' partition coefficient, K(p) are derived on the temperatures of 25°C and 37°C. For deriving linear regression models on both temperatures experimentally obtained lipophilicity parameters are included (PC1 from data k=f(t)) and in silico descriptors of the shape of a molecule while on the higher temperature molecular polarisation is introduced. This indicates the fact that the incorporation mechanism of nitrazepam in BA micelles changes on the higher temperatures. QSAR models are derived using partial least squares method as well. Experimental parameters k=f(t) are shown to be significant predictive variables. Both QSAR models are validated using cross validation and internal validation method. PLS models have slightly higher predictive capability than MLR models. Copyright © 2010 Elsevier B.V. All rights reserved.
Poša, Mihalj; Tepavčević, Vesna
2011-09-01
The formation of mixed micelles built of 7,12-dioxolithocholic and the following hydrophobic bile acids was examined by conductometric method: cholic (C), deoxycholic (D), chenodeoxycholic (CD), 12-oxolithocholic (12-oxoL), 7-oxolithocholic (7-oxoL), ursodeoxycholic (UD) and hiodeoxycholic (HD). Interaction parameter (β) in the studied binary mixed micelles had negative value, suggesting synergism between micelle building units. Based on β value, the hydrophobic bile acids formed two groups: group I (C, D and CD) and group II (12-oxoL, 7-oxoL, UD and HD). Bile acids from group II had more negative β values than bile acids from group I. Also, bile acids from group II formed intermolecular hydrogen bonds in aggregates with both smaller (2) and higher (4) aggregation numbers, according to the analysis of their stereochemical (conformational) structures and possible structures of mixed micelles built of these bile acids and 7,12-dioxolithocholic acid. Haemolytic potential and partition coefficient of nitrazepam were higher in mixed micelles built of the more hydrophobic bile acids (C, D, CD) and 7,12-dioxolithocholic acid than in micelles built only of 7,12-dioxolithocholic acid. On the other hand, these mixed micelles still had lower values of haemolytic potential than micelles built of C, D or CD. The mixed micelles that included bile acids: 12-oxoL, 7-oxoL, UD or HD did not significantly differ from the micelles of 7,12-dioxolithocholic acid, observing the values of their haemolytic potential. Copyright © 2011 Elsevier B.V. All rights reserved.
Estimation of octanol/water partition coefficients using LSER parameters
Luehrs, Dean C.; Hickey, James P.; Godbole, Kalpana A.; Rogers, Tony N.
1998-01-01
The logarithms of octanol/water partition coefficients, logKow, were regressed against the linear solvation energy relationship (LSER) parameters for a training set of 981 diverse organic chemicals. The standard deviation for logKow was 0.49. The regression equation was then used to estimate logKow for a test of 146 chemicals which included pesticides and other diverse polyfunctional compounds. Thus the octanol/water partition coefficient may be estimated by LSER parameters without elaborate software but only moderate accuracy should be expected.
OCTANOL/WATER PARTITION COEFFICIENTS AND WATER SOLUBILITIES OF PHTHALATE ESTERS
Measurements of the octanol/water partition coefficients (K-ow) and water solubilities of di-n-octyl phthalate (DnOP) and di-n-decyl phthalate (DnDP) by the slow-stirring method are reported. The water solubility was also measured for di-n-hexyl phthalate (DnHP). The log K-ow val...
Jakobtorweihen, S.; Zuniga, A. Chaides; Ingram, T.; Gerlach, T.; Keil, F. J.; Smirnova, I.
2014-07-01
Quantitative predictions of biomembrane/water partition coefficients are important, as they are a key property in pharmaceutical applications and toxicological studies. Molecular dynamics (MD) simulations are used to calculate free energy profiles for different solutes in lipid bilayers. How to calculate partition coefficients from these profiles is discussed in detail and different definitions of partition coefficients are compared. Importantly, it is shown that the calculated coefficients are in quantitative agreement with experimental results. Furthermore, we compare free energy profiles from MD simulations to profiles obtained by the recent method COSMOmic, which is an extension of the conductor-like screening model for realistic solvation to micelles and biomembranes. The free energy profiles from these molecular methods are in good agreement. Additionally, solute orientations calculated with MD and COSMOmic are compared and again a good agreement is found. Four different solutes are investigated in detail: 4-ethylphenol, propanol, 5-phenylvaleric acid, and dibenz[a,h]anthracene, whereby the latter belongs to the class of polycyclic aromatic hydrocarbons. The convergence of the free energy profiles from biased MD simulations is discussed and the results are shown to be comparable to equilibrium MD simulations. For 5-phenylvaleric acid the influence of the carboxyl group dihedral angle on free energy profiles is analyzed with MD simulations.
International Nuclear Information System (INIS)
Jakobtorweihen, S.; Ingram, T.; Gerlach, T.; Smirnova, I.; Zuniga, A. Chaides; Keil, F. J.
2014-01-01
Quantitative predictions of biomembrane/water partition coefficients are important, as they are a key property in pharmaceutical applications and toxicological studies. Molecular dynamics (MD) simulations are used to calculate free energy profiles for different solutes in lipid bilayers. How to calculate partition coefficients from these profiles is discussed in detail and different definitions of partition coefficients are compared. Importantly, it is shown that the calculated coefficients are in quantitative agreement with experimental results. Furthermore, we compare free energy profiles from MD simulations to profiles obtained by the recent method COSMOmic, which is an extension of the conductor-like screening model for realistic solvation to micelles and biomembranes. The free energy profiles from these molecular methods are in good agreement. Additionally, solute orientations calculated with MD and COSMOmic are compared and again a good agreement is found. Four different solutes are investigated in detail: 4-ethylphenol, propanol, 5-phenylvaleric acid, and dibenz[a,h]anthracene, whereby the latter belongs to the class of polycyclic aromatic hydrocarbons. The convergence of the free energy profiles from biased MD simulations is discussed and the results are shown to be comparable to equilibrium MD simulations. For 5-phenylvaleric acid the influence of the carboxyl group dihedral angle on free energy profiles is analyzed with MD simulations
n-Alcohol/Water Partition Coefficients for Decachlorobiphenyl (PCB 209)
Measurements of n-octanol/water partition coefficients (Kow) for highly hydrophobic chemicals are extremely difficult and are rarely made, in part due to the large volumes of water typically needed to quantify these compounds in the aqueous phase. An extrapolation approach using ...
Experimental partition determination of octanol-water coefficients of ...
African Journals Online (AJOL)
An electrochemical method based on square wave voltammetry was developed for the measurement of octanol-water partition coefficient, LogP, for ten ferrocene derivatives. Measured LogP values ranged over two orders of magnitude, between 2.18 for 1- ferrocenylethanol and 4.38 for ferrocenyl-2-nitrophenyl.
Lee, Kil Yong; Burnett, William C
A simple method for the direct determination of the air-loop volume in a RAD7 system as well as the radon partition coefficient was developed allowing for an accurate measurement of the radon activity in any type of water. The air-loop volume may be measured directly using an external radon source and an empty bottle with a precisely measured volume. The partition coefficient and activity of radon in the water sample may then be determined via the RAD7 using the determined air-loop volume. Activity ratios instead of absolute activities were used to measure the air-loop volume and the radon partition coefficient. In order to verify this approach, we measured the radon partition coefficient in deionized water in the temperature range of 10-30 °C and compared the values to those calculated from the well-known Weigel equation. The results were within 5 % variance throughout the temperature range. We also applied the approach for measurement of the radon partition coefficient in synthetic saline water (0-75 ppt salinity) as well as tap water. The radon activity of the tap water sample was determined by this method as well as the standard RAD-H 2 O and BigBottle RAD-H 2 O. The results have shown good agreement between this method and the standard methods.
Determination of air-loop volume and radon partition coefficient for measuring radon in water sample
International Nuclear Information System (INIS)
Kil Yong Lee; Burnett, W.C.
2013-01-01
A simple method for the direct determination of the air-loop volume in a RAD7 system as well as the radon partition coefficient was developed allowing for an accurate measurement of the radon activity in any type of water. The air-loop volume may be measured directly using an external radon source and an empty bottle with a precisely measured volume. The partition coefficient and activity of radon in the water sample may then be determined via the RAD7 using the determined air-loop volume. Activity ratios instead of absolute activities were used to measure the air-loop volume and the radon partition coefficient. In order to verify this approach, we measured the radon partition coefficient in deionized water in the temperature range of 10-30 deg C and compared the values to those calculated from the well-known Weigel equation. The results were within 5 % variance throughout the temperature range. We also applied the approach for measurement of the radon partition coefficient in synthetic saline water (0-75 ppt salinity) as well as tap water. The radon activity of the tap water sample was determined by this method as well as the standard RAD-H 2 O and BigBottle RAD-H 2 O. The results have shown good agreement between this method and the standard methods. (author)
The influence of hydrogen bonding on partition coefficients
Borges, Nádia Melo; Kenny, Peter W.; Montanari, Carlos A.; Prokopczyk, Igor M.; Ribeiro, Jean F. R.; Rocha, Josmar R.; Sartori, Geraldo Rodrigues
2017-02-01
This Perspective explores how consideration of hydrogen bonding can be used to both predict and better understand partition coefficients. It is shown how polarity of both compounds and substructures can be estimated from measured alkane/water partition coefficients. When polarity is defined in this manner, hydrogen bond donors are typically less polar than hydrogen bond acceptors. Analysis of alkane/water partition coefficients in conjunction with molecular electrostatic potential calculations suggests that aromatic chloro substituents may be less lipophilic than is generally believed and that some of the effect of chloro-substitution stems from making the aromatic π-cloud less available to hydrogen bond donors. Relationships between polarity and calculated hydrogen bond basicity are derived for aromatic nitrogen and carbonyl oxygen. Aligned hydrogen bond acceptors appear to present special challenges for prediction of alkane/water partition coefficients and this may reflect `frustration' of solvation resulting from overlapping hydration spheres. It is also shown how calculated hydrogen bond basicity can be used to model the effect of aromatic aza-substitution on octanol/water partition coefficients.
Lipid–water partition coefficients and correlations with uptakes by algae of organic compounds
International Nuclear Information System (INIS)
Hung, Wei-Nung; Chiou, Cary T.; Lin, Tsair-Fuh
2014-01-01
Graphical abstract: - Highlights: • Partition coefficients of contaminants with lipid triolein (K tw ) are measured. • Measured K tw values are nearly the same as the respective K ow . • Sorption of the contaminants to a dry algal powder is similarly measured. • Algal uptake of a compound occurs primarily by partition into the algal lipid. - Abstract: In view of the scarcity of the lipid–water partition coefficients (K tw ) for organic compounds, the log K tw values for many environmental contaminants were measured using ultra-pure triolein as the model lipid. Classes of compounds studied include alkyl benzenes, halogenated benzenes, short-chain chlorinated hydrocarbons, polycyclic aromatic hydrocarbons, polychlorinated biphenyls, and organochlorine pesticides. In addition to log K tw determination, the uptakes of these compounds from water by a dry algal species were measured to evaluate the lipid effect on the algal uptake. The measured log K tw are closely related to their respective log K ow (octanol–water), with log K ow = 1.9 to 6.5. A significant difference is observed between the present and early measured log K tw for compounds with log K ow > ∼5, which is attributed to the presence and absence of a triolein microemulsion in water affecting the solute partitioning. The observed lipid-normalized algae–water distribution coefficients (log K aw/lipid ) are virtually identical to the respective log K tw values, which manifests the dominant lipid-partition effect of the compounds with algae
Directory of Open Access Journals (Sweden)
Lorentz JÄNTSCHI
2006-01-01
Full Text Available Octanol-water partition coefficient of two hundred and six polychlorinated biphenyls was model by the use of an original method based on complex information obtained from compounds structure. The regression analysis shows that best results are obtained in four-varied model (r2 = 0.9168. The prediction ability of the model was studied through leave-one-out analysis (r2cv(loo = 0.9093 and in training and test sets analysis. Modeling the octanol-water partition coefficient of polychlorinated biphenyls by integration of complex structural information provide a stable and performing four-varied model, allowing us to make remarks about relationship between structure of polychlorinated biphenyls and associated octanol-water partition coefficients.
Lipid–water partition coefficients and correlations with uptakes by algae of organic compounds
Energy Technology Data Exchange (ETDEWEB)
Hung, Wei-Nung [Green Energy and Environment Research Laboratories, Industrial Technology Research Institute, Hsinchu 30011, Taiwan (China); Chiou, Cary T., E-mail: carychio@mail.ncku.edu.tw [Department of Environmental Engineering and Sustainable Environment Research Laboratory, National Cheng Kung University, Tainan 70101, Taiwan (China); U.S. Geological Survey, Denver Federal Center, Denver, CO 80225 (United States); Lin, Tsair-Fuh, E-mail: tflin@mail.ncku.edu.tw [Department of Environmental Engineering and Sustainable Environment Research Laboratory, National Cheng Kung University, Tainan 70101, Taiwan (China)
2014-08-30
Graphical abstract: - Highlights: • Partition coefficients of contaminants with lipid triolein (K{sub tw}) are measured. • Measured K{sub tw} values are nearly the same as the respective K{sub ow}. • Sorption of the contaminants to a dry algal powder is similarly measured. • Algal uptake of a compound occurs primarily by partition into the algal lipid. - Abstract: In view of the scarcity of the lipid–water partition coefficients (K{sub tw}) for organic compounds, the log K{sub tw} values for many environmental contaminants were measured using ultra-pure triolein as the model lipid. Classes of compounds studied include alkyl benzenes, halogenated benzenes, short-chain chlorinated hydrocarbons, polycyclic aromatic hydrocarbons, polychlorinated biphenyls, and organochlorine pesticides. In addition to log K{sub tw} determination, the uptakes of these compounds from water by a dry algal species were measured to evaluate the lipid effect on the algal uptake. The measured log K{sub tw} are closely related to their respective log K{sub ow} (octanol–water), with log K{sub ow} = 1.9 to 6.5. A significant difference is observed between the present and early measured log K{sub tw} for compounds with log K{sub ow} > ∼5, which is attributed to the presence and absence of a triolein microemulsion in water affecting the solute partitioning. The observed lipid-normalized algae–water distribution coefficients (log K{sub aw/lipid}) are virtually identical to the respective log K{sub tw} values, which manifests the dominant lipid-partition effect of the compounds with algae.
International Nuclear Information System (INIS)
Mohsen-Nia, M.; Ebrahimabadi, A.H.; Niknahad, B.
2012-01-01
Highlights: ► n-Octanol/water partition coefficients of propranolol and atenolol were measured. ► The effect of temperature on the partition coefficient was studied. ► The equilibrium data were correlated using the NRTL and UNIQUAC activity models. ► The binary interaction parameters of the activity models were reported. ► It is concluded that propranolol is more hydrophobic than the atenolol at 298.15 K. - Abstract: The n-octanol/water partition coefficients of propranolol and atenolol were experimentally determined by ultraviolet (UV) spectroscopy at T = (298.15, 310.15 and 314.15) K. All measurements were made at the maximum wavelength corresponding to maximum absorption. The results showed that the n-octanol/water partition coefficients of propranolol and atenolol increase with the increase of temperature. The experimental data of this work were also used to examine the phase equilibrium correlating capability of some liquid-phase models. The equilibrium experimental data were correlated using the NRTL and UNIQUAC activity coefficient models and the binary interaction parameters were reported. The average root-mea n-square deviations (RMSD) between the experimental and calculated mass fractions of the (n-octanol + propranolol + water) and (n-octanol + atenolol + water) systems were determined. From the partition coefficients obtained, it is concluded that propranolol (log P ow = 3.12 ± 0.14) is more hydrophobic than the atenolol (log P ow = 0.16 ± 0.01) at T = 298.15 K.
Buckminsterfullerene's (C60) octanol-water partition coefficient (Kow) and aqueous solubility.
Jafvert, Chad T; Kulkarni, Pradnya P
2008-08-15
To assess the risk and fate of fullerene C60 in the environment, its water solubility and partition coefficients in various systems are useful. In this study, the log Kow of C60 was measured to be 6.67, and the toluene-water partition coefficient was measured at log Ktw = 8.44. From these values and the respective solubilities of C60 in water-saturated octanol and water-saturated toluene, C60's aqueous solubility was calculated at 7.96 ng/L(1.11 x 10(-11) M) for the organic solvent-saturated aqueous phase. Additionally, the solubility of C60 was measured in mixtures of ethanol-water and tetrahydrofuran-water and modeled with Wohl's equation to confirm the accuracy of the calculated solubility value. Results of a generator column experiment strongly support the hypothesis that clusters form at aqueous concentrations below or near this calculated solubility. The Kow value is compared to those of other hydrophobic organic compounds, and bioconcentration factors for C60 were estimated on the basis of Kow.
Chiou, C.T.; Schmedding, D.W.; Manes, M.
2005-01-01
A volume-fraction-based solvent-water partition model for dilute solutes, in which the partition coefficient shows a dependence on solute molar volume (V??), is adapted to predict the octanol-water partition coefficient (K ow) from the liquid or supercooled-liquid solute water solubility (Sw), or vice versa. The established correlation is tested for a wide range of industrial compounds and pesticides (e.g., halogenated aliphatic hydrocarbons, alkylbenzenes, halogenated benzenes, ethers, esters, PAHs, PCBs, organochlorines, organophosphates, carbamates, and amidesureas-triazines), which comprise a total of 215 test compounds spanning about 10 orders of magnitude in Sw and 8.5 orders of magnitude in Kow. Except for phenols and alcohols, which require special considerations of the Kow data, the correlation predicts the Kow within 0.1 log units for most compounds, much independent of the compound type or the magnitude in K ow. With reliable Sw and V data for compounds of interest, the correlation provides an effective means for either predicting the unavailable log Kow values or verifying the reliability of the reported log Kow data. ?? 2005 American Chemical Society.
Rao, Xiao-Yong; Yin, Shan; Zhang, Guo-Song; Luo, Xiao-Jian; Jian, Hui; Feng, Yu-Lin; Yang, Shi-Lin
2014-05-01
To determine the equilibrium solubility of pulchinenosiden D in different solvents and its n-octanol/water partition coefficients. Combining shaking flask method and high performance liquid chromatography (HPLC) to detect the n-octanol/water partition coefficients of pulchinenosiden D, the equilibrium solubility of pulchinenosiden D in six organic solvents and different pH buffer solution were determined by HPLC analysis. n-Octanol/water partition coefficients of pulchinenosiden D in different pH were greater than zero, the equilibrium solubility of pulchinenosiden D was increased with increase the pH of the buffer solution. The maximum equilibrium solubility of pulchinenosiden D was 255.89 g x L(-1) in methanol, and minimum equilibrium solubility of pulchinenosiden D was 0.20 g x L(-1) in acetonitrile. Under gastrointestinal physiological conditions, pulchinenosiden D exists in molecular state and it has good absorption but poor water-solubility, so increasing the dissolution rate of pulchinenosiden D may enhance its bioavailability.
Bhatnagar, Navendu; Kamath, Ganesh; Chelst, Issac; Potoff, Jeffrey J
2012-07-07
The 1-octanol-water partition coefficient log K(ow) of a solute is a key parameter used in the prediction of a wide variety of complex phenomena such as drug availability and bioaccumulation potential of trace contaminants. In this work, adaptive biasing force molecular dynamics simulations are used to determine absolute free energies of hydration, solvation, and 1-octanol-water partition coefficients for n-alkanes from methane to octane. Two approaches are evaluated; the direct transfer of the solute from 1-octanol to water phase, and separate transfers of the solute from the water or 1-octanol phase to vacuum, with both methods yielding statistically indistinguishable results. Calculations performed with the TIP4P and SPC∕E water models and the TraPPE united-atom force field for n-alkanes show that the choice of water model has a negligible effect on predicted free energies of transfer and partition coefficients for n-alkanes. A comparison of calculations using wet and dry octanol phases shows that the predictions for log K(ow) using wet octanol are 0.2-0.4 log units lower than for dry octanol, although this is within the statistical uncertainty of the calculation.
Elsayed, Mustafa M A; Vierl, Ulrich; Cevc, Gregor
2009-06-01
Potentiometric lipid membrane-water partition coefficient studies neglect electrostatic interactions to date; this leads to incorrect results. We herein show how to account properly for such interactions in potentiometric data analysis. We conducted potentiometric titration experiments to determine lipid membrane-water partition coefficients of four illustrative drugs, bupivacaine, diclofenac, ketoprofen and terbinafine. We then analyzed the results conventionally and with an improved analytical approach that considers Coulombic electrostatic interactions. The new analytical approach delivers robust partition coefficient values. In contrast, the conventional data analysis yields apparent partition coefficients of the ionized drug forms that depend on experimental conditions (mainly the lipid-drug ratio and the bulk ionic strength). This is due to changing electrostatic effects originating either from bound drug and/or lipid charges. A membrane comprising 10 mol-% mono-charged molecules in a 150 mM (monovalent) electrolyte solution yields results that differ by a factor of 4 from uncharged membranes results. Allowance for the Coulombic electrostatic interactions is a prerequisite for accurate and reliable determination of lipid membrane-water partition coefficients of ionizable drugs from potentiometric titration data. The same conclusion applies to all analytical methods involving drug binding to a surface.
Simple Method to Determine the Partition Coefficient of Naphthenic Acid in Oil/Water
DEFF Research Database (Denmark)
Bitsch-Larsen, Anders; Andersen, Simon Ivar
2008-01-01
The partition coefficient for technical grade naphthenic acid in water/n-decane at 295 K has been determined (K-wo = 2.1 center dot 10(-4)) using a simple experimental technique with large extraction volumes (0.09 m(3) of water). Furthermore, nonequilibrium values at different pH values...
Trophic Magnification of PCBs and Its Relationship to the Octanol−Water Partition Coefficient
We investigated polychlorinated biphenyl (PCB) bioaccumulation relative to octanol-water partition coefficient (KOW) and organism trophic position (TP) at the Lake Hartwell Superfund (South Carolina, USA). We measured PCBs (127 congeners) and stable isotopes (δ15...
Huang, WenJuan; Blinov, Nikolay; Kovalenko, Andriy
2015-04-30
The octanol-water partition coefficient is an important physical-chemical characteristic widely used to describe hydrophobic/hydrophilic properties of chemical compounds. The partition coefficient is related to the transfer free energy of a compound from water to octanol. Here, we introduce a new protocol for prediction of the partition coefficient based on the statistical-mechanical, 3D-RISM-KH molecular theory of solvation. It was shown recently that with the compound-solvent correlation functions obtained from the 3D-RISM-KH molecular theory of solvation, the free energy functional supplemented with the correction linearly related to the partial molar volume obtained from the Kirkwood-Buff/3D-RISM theory, also called the "universal correction" (UC), provides accurate prediction of the hydration free energy of small compounds, compared to explicit solvent molecular dynamics [ Palmer , D. S. ; J. Phys.: Condens. Matter 2010 , 22 , 492101 ]. Here we report that with the UC reparametrized accordingly this theory also provides an excellent agreement with the experimental data for the solvation free energy in nonpolar solvent (1-octanol) and so accurately predicts the octanol-water partition coefficient. The performance of the Kovalenko-Hirata (KH) and Gaussian fluctuation (GF) functionals of the solvation free energy, with and without UC, is tested on a large library of small compounds with diverse functional groups. The best agreement with the experimental data for octanol-water partition coefficients is obtained with the KH-UC solvation free energy functional.
Octanol-water partition coefficients for predicting the effects of tannins in ruminant nutrition.
Mueller-Harvey, Irene; Mlambo, Victor; Sikosana, Joe L N; Smith, Tim; Owen, Emyr; Brown, Ron H
2007-07-11
Tannins can cause beneficial or harmful nutritional effects, but their great diversity has until now prevented a rational distinction between tannin structures and their nutritional responses. An attempt has been made to study this problem by examining the octanol-water solubilities of tannins. A relatively simple HPLC method has been developed for screening mixtures of plant tannins for their octanol-water partition coefficients (Kow coefficients). Tannins were isolated from the fruits and leaves of different Acacia, Calliandra, Dichrostachys, and Piliostigma species, which are known to produce beneficial or harmful effects. The Kow coefficients of these tannins ranged from 0.061 to 13.9, average coefficients of variation were 9.2% and recoveries were 107%. Acacia nilotica fruits and leaves had the highest Kow coefficients, that is, 2.0 and 13.9, respectively. These A. nilotica products also have high concentrations of tannins. The combined effects of high octanol solubilities and high tannin concentrations may explain their negative effects on animal nutrition and health. It is known that compounds with high octanol solubilities are more easily absorbed into tissues, and it is, therefore, proposed that such compounds are more likely to cause toxicity problems especially if consumed in large quantities. According to the literature, tannins in human foods tend to have low Kow coefficients, and this was confirmed for the tannins in Piliostigma thonningii fruits. Therefore, unconventional feeds or browse products should be screened not only for their tannin concentrations but also for low octanol-water partition coefficients in order to identify nutritionally safe feeds and to avoid potentially toxic feeds.
Tamaru, Shunji; Igura, Noriyuki; Shimoda, Mitsuya
2018-01-15
Flavor release from food matrices depends on the partition of volatile flavor compounds between the food matrix and the vapor phase. Thus, we herein investigated the relationship between released flavor concentrations and three different partition coefficients, namely octanol-water, octanol-air, and water-air, which represented the oil, water, and air phases present in emulsions. Limonene, 2-methylpyrazine, nonanal, benzaldehyde, ethyl benzoate, α-terpineol, benzyl alcohol, and octanoic acid were employed. The released concentrations of these flavor compounds from oil-in-water (O/W) emulsions were measured under equilibrium using static headspace gas chromatography. The results indicated that water-air and octanol-air partition coefficients correlated with the logarithms of the released concentrations in the headspace for highly lipophilic flavor compounds. Moreover, the same tendency was observed over various oil volume ratios in the emulsions. Our findings therefore suggest that octanol-air and water-air partition coefficients can be used to predict the released concentration of lipophilic flavor compounds from O/W emulsions. Copyright © 2017 Elsevier Ltd. All rights reserved.
Energy Technology Data Exchange (ETDEWEB)
Kakisaka, Keijiro.; Shindo, Takashi.; Iwai, Yoshio.; Arai, Yasuhiko. [Kyushu University, Fukuoka (Japan). Department of Chemical Systems and Engineering
1998-12-01
Partition coefficients are measured for five amino acids(aspartic acid, asparagine, methionine, cysteine and histidine) and tow peptides(glycyl-glycine and hexa-glycine) in dextran + poly(ethylene glycol) + water aqueous two-phase system. The partition coefficients of the amino acids and peptides are aorrelated using the osmotic virial equation. The interaction coefficients contained in the equation can be calculated by hydrophilic group parameters. The partition coefficients of {alpha}-amylase calculated by the osmotic virial equation with the hydrophilic group parameters are in fairly good agreement with the experimental data, though a relatively large discrepancy is shown for {beta}-amylase. (author)
Energy Technology Data Exchange (ETDEWEB)
Kakisaka, Keijiro.; Shindo, Takashi.; Iwai, Yoshio.; Arai, Yasuhiko. (Kyushu University, Fukuoka (Japan). Department of Chemical Systems and Engineering)
1998-12-01
Partition coefficients are measured for five amino acids(aspartic acid, asparagine, methionine, cysteine and histidine) and tow peptides(glycyl-glycine and hexa-glycine) in dextran + poly(ethylene glycol) + water aqueous two-phase system. The partition coefficients of the amino acids and peptides are aorrelated using the osmotic virial equation. The interaction coefficients contained in the equation can be calculated by hydrophilic group parameters. The partition coefficients of [alpha]-amylase calculated by the osmotic virial equation with the hydrophilic group parameters are in fairly good agreement with the experimental data, though a relatively large discrepancy is shown for [beta]-amylase. (author)
International Nuclear Information System (INIS)
Yang Yuqing; Luo Shunzhong; Wang Guanquan; He Jiaheng; Bing Wenzeng; Pu Manfei; Wei Hongyuan; Wang Wenjin
2004-01-01
Apparent partition coefficient in octanol-water and binding percentage to BSA of 153 Sm-NTMP, 153 Sm-HEDTMP, 153 Sm-DCTMP, 153 Sm-EDTMP, 153 Sm-DTPMP, 113,117 Sn m -EDTMP, 113,117 Sn m -HEDTMP, 113,117 Sn m -DTPMP are measured. The results show that there is a linear relationship between the relative magnitude of the apparent partition coefficient in octanol-water and the relative magnitude of the binding percentage to BSA of these 153 Sm( 113,117 Sn m ) complexes. This linear relationship provides a new method for determination of the apparent partition coefficient in octanol-water of 153 Sm( 113,117 Sn m ) complexes of this kind. This linear relationship also implicates that hydrophobic force plays an important role in the binding of 153 Sm( 113,117 Sn m ) complexes to BSA
Toropov, A A; Toropova, A P; Raska, I
2008-04-01
Simplified molecular input line entry system (SMILES) has been utilized in constructing quantitative structure-property relationships (QSPR) for octanol/water partition coefficient of vitamins and organic compounds of different classes by optimal descriptors. Statistical characteristics of the best model (vitamins) are the following: n=17, R(2)=0.9841, s=0.634, F=931 (training set); n=7, R(2)=0.9928, s=0.773, F=690 (test set). Using this approach for modeling octanol/water partition coefficient for a set of organic compounds gives a model that is statistically characterized by n=69, R(2)=0.9872, s=0.156, F=5184 (training set) and n=70, R(2)=0.9841, s=0.179, F=4195 (test set).
International Nuclear Information System (INIS)
Lee, K.Y.; Yoon, Y.Y.; Ko, K.S.
2010-01-01
A method was studied for measuring air/water partition coefficient (K air/water ) of groundwater radon by a simple procedure using liquid scintillation counter (LSC). In contrast conventional techniques such as equilibrium partitioning in a closed system or air striping methods, the described method allow for a simple and uncomplicated determination of the coefficient. The (K air/water ) of radon in pure water has been well known quantitatively over a wide range of temperatures. In this work, groundwater samples having high radon concentration instead of distilled water have been used to determine the (K air/water ) of radon in the temperature range of 0-25. Aqueous phase in a closed system was used in this study instead of gaseous phase in conventional methods. Three kinds of groundwater taken from different geologic environments were used to investigate the effect of groundwater properties. With the aim to evaluate the reproducibility of the data an appropriate number of laboratory experiments have been carried out. The results show that tie (K air/water ) of radon in the groundwater is smaller than that in the pure water. However, the temperature effect on the coefficient is similar in the groundwater and the pure water. The method using aqueous phase in a closed system by LSC can be used to determine the (K air/water ) of radon in various groundwaters with a simple procedure. The results will be presented at the NAC-IV conference
Directory of Open Access Journals (Sweden)
Chenzhong Cao
2008-06-01
Full Text Available The aqueous solubility (logW and n-octanol/water partition coefficient (logPOW are important properties for pharmacology, toxicology and medicinal chemistry. Based on an understanding of the dissolution process, the frontier orbital interaction model was suggested in the present paper to describe the solvent-solute interactions of organohalogen compounds and a general three-parameter model was proposed to predict the aqueous solubility and n-octanol/water partition coefficient for the organohalogen compounds containing nonhydrogen-binding interactions. The model has satisfactory prediction accuracy. Furthermore, every item in the model has a very explicit meaning, which should be helpful to understand the structure-solubility relationship and may be provide a new view on estimation of solubility.
Measurements of n-octanol/water partition coefficients (KOW) for highly hydrophobic chemicals, i.e., greater than 108, are extremely difficult and are rarely made, in part because the vanishingly small concentrations in the water phase require extraordinary analytical sensitivity...
Partitioning of organochlorine pesticides from water to polyethylene passive samplers
International Nuclear Information System (INIS)
Hale, Sarah E.; Martin, Timothy J.; Goss, Kai-Uwe; Arp, Hans Peter H.; Werner, David
2010-01-01
The mass transfer rates and equilibrium partitioning behaviour of 14 diverse organochlorine pesticides (OCP) between water and polyethylene (PE) passive samplers, cut from custom made PE sheets and commercial polyethylene plastic bags, were quantified. Overall mass transfer coefficients, k O , estimated PE membrane diffusion coefficients, D PE , and PE-water partitioning coefficients, K PE-water, are reported. In addition, the partitioning of three polycyclic aromatic hydrocarbons (PAHs) from water to PE is quantified and compared with literature values. K PE-water values agreed mostly within a factor of two for both passive samplers and also with literature values for the reference PAHs. As PE is expected to exhibit similar sorption behaviour to long-chain alkanes, PE-water partitioning coefficients were compared to hexadecane-water partitioning coefficients estimated with the SPARC online calculator, COSMOtherm and a polyparameter linear free energy relationship based on the Abraham approach. The best correlation for all compounds tested was with COSMOtherm estimated hexadecane-water partitioning coefficients. - The partitioning of organochlorine pesticides between single phase polyethylene passive samplers and water is quantified.
Calculation of the octanol-water partition coefficient of armchair polyhex BN nanotubes
Mohammadinasab, E.; Pérez-Sánchez, H.; Goodarzi, M.
2017-12-01
A predictive model for determination partition coefficient (log P) of armchair polyhex BN nanotubes by using simple descriptors was built. The relationship between the octanol-water log P and quantum chemical descriptors, electric moments, and topological indices of some armchair polyhex BN nanotubes with various lengths and fixed circumference are represented. Based on density functional theory electric moments and physico-chemical properties of those nanotubes are calculated.
Specific interactions within micelle microenvironment in different charged dye/surfa
Directory of Open Access Journals (Sweden)
Adina Roxana Petcu
2016-01-01
Full Text Available The interactions of two ionic dyes, Crystal Violet and Methyl Orange, with different charged surfactants and also with a nonionic surfactant were investigated using surface tension measurements and visible spectroscopy in pre-micellar and post-micellar regions. It was found that for the water dominant phase systems the dye was localized between the polar heads, at the exterior of the direct micelle shells for all the systems. For the oil dominant phase systems, in case of the same charged dye/surfactant couples, the dye was localized in the micelle shell between the hydrocarbon chain of the surfactant nearby the hydrophilic head groups while for nonionic surfactant and oppositely charged dye/surfactant, localization of dye was between the oxyethylenic head groups towards the interior of the micelle core. Mixed aggregates of the dye and surfactant (below the critical micellar concentration of cationic surfactant, dye-surfactant ion pair and surfactant-micelles were present. The values of equilibrium constants (for TX-114/MO and TX-114/CV systems were 0.97 and 0.98, respectively, partition coefficients between the micellar and bulk water phases and standard free energy (for the nonionic systems were −12.59 kJ/mol for MO and −10.97 kJ/mol for CV were calculated for all the studied systems. The partition processes were exothermic and occurred spontaneously.
Chávez-Capilla, Teresa; Maher, William; Kelly, Tamsin; Foster, Simon
2016-11-01
Arsenic metabolism in living organisms is dependent on the ability of different arsenic species to traverse biological membranes. Simple diffusion provides an alternative influx and efflux route to mediated transport mechanisms that can increase the amount of arsenic available for metabolism in cells. Using octanol-water and liposome-water partition coefficients, the ability of arsenous acid, arsenate, methylarsonate, dimethylarsinate, thio-methylarsonate, thio-dimethylarsinic acid, arsenotriglutathione and monomethylarsonic diglutathione to diffuse through the lipid bilayer of cell membranes was investigated. Molecular modelling of arsenic species was used to explain the results. All arsenic species with the exception of arsenate, methylarsonate and thio-methylarsonate were able to diffuse through the lipid bilayer of liposomes, with liposome-water partition coefficients between 0.04 and 0.13. Trivalent arsenic species and thio-pentavalent arsenic species showed higher partition coefficients, suggesting that they can easily traverse cell membranes by passive simple diffusion. Given the higher toxicity of these species compared to oxo-pentavalent arsenic species, this study provides evidence supporting the risk associated with human exposure to trivalent and thio-arsenic species. Copyright © 2016. Published by Elsevier B.V.
Xenon tissue/blood partition coefficient for pig urinary bladder
DEFF Research Database (Denmark)
Nielsen, K K; Bülow, J; Nielsen, S L
1990-01-01
In four landrace pigs the tissue/blood partition coefficient (lambda) for xenon (Xe) for the urinary bladder was calculated after chemical analysis for lipid, water and protein content and determination of the haematocrit. The coefficients varied from bladder to bladder owing to small differences...
Saranjampour, Parichehr; Vebrosky, Emily N; Armbrust, Kevin L
2017-09-01
Salinity has been reported to influence the water solubility of organic chemicals entering marine ecosystems. However, limited data are available on salinity impacts for chemicals potentially entering seawater. Impacts on water solubility would correspondingly impact chemical sorption as well as overall bioavailability and exposure estimates used in the regulatory assessment. The pesticides atrazine, fipronil, bifenthrin, and cypermethrin, as well as the crude oil constituent dibenzothiophene together with 3 of its alkyl derivatives, all have different polarities and were selected as model compounds to demonstrate the impact of salinity on their solubility and partitioning behavior. The n-octanol/water partition coefficient (K OW ) was measured in both distilled-deionized water and artificial seawater (3.2%). All compounds had diminished solubility and increased K OW values in artificial seawater compared with distilled-deionized water. A linear correlation curve estimated salinity may increase the log K OW value by 2.6%/1 log unit increase in distilled water (R 2 = 0.97). Salinity appears to generally decrease the water solubility and increase the partitioning potential. Environmental fate estimates based on these parameters indicate elevated chemical sorption to sediment, overall bioavailability, and toxicity in artificial seawater. These dramatic differences suggest that salinity should be taken into account when exposure estimates are made for marine organisms. Environ Toxicol Chem 2017;36:2274-2280. © 2017 SETAC. © 2017 SETAC.
International Nuclear Information System (INIS)
Talele, Paurnima; Choudhary, Sinjan; Kishore, Nand
2016-01-01
Highlights: • Interactions of non-steroidal anti-inflammatory drugs studied with TTAB micelles, monomers. • Thermodynamics of drug-surfactant interactions and partitioning in micelles addressed. • Mechanism of drug partitioning addressed based on energetics of interactions. • Partitioning in micelles depends on functional groups on drugs. • Such studies are needed for target oriented synthesis and efficient drug delivery. - Abstract: The use of surfactants in drug delivery has offered several advantages. Quantitative knowledge of the interactions of drugs with micellar systems is essential for deriving guidelines to design efficient drug delivery systems. In this work we have quantitatively addressed the mechanism of interaction of naproxen and diclofenac sodium with the micelles and monomers of tetradecyltrimethylammonium bromide (TTAB) based on thermodynamic studies by using isothermal titration calorimetry. The mechanism of interaction of the drugs with TTAB is based on identification of the nature of interactions of the former with the surfactant micelles and monomers. The values of partitioning constant (which is same as equilibrium constant for the reaction of drugs with the surfactant micelles), enthalpy, entropy and stoichiometry of partitioning have been determined and discussed in terms of possible intermolecular interactions. Further, the interaction of the drug naproxen with bovine serum albumin, when delivered from the micellar media has also been addressed in terms of binding constant, enthalpy and entropy of binding. The results are important in developing improved strategies for effective drug delivery systems.
Toropov, Andrey A; Toropova, Alla P; Raska, Ivan; Benfenati, Emilio
2010-04-01
Three different splits into the subtraining set (n = 22), the set of calibration (n = 21), and the test set (n = 12) of 55 antineoplastic agents have been examined. By the correlation balance of SMILES-based optimal descriptors quite satisfactory models for the octanol/water partition coefficient have been obtained on all three splits. The correlation balance is the optimization of a one-variable model with a target function that provides both the maximal values of the correlation coefficient for the subtraining and calibration set and the minimum of the difference between the above-mentioned correlation coefficients. Thus, the calibration set is a preliminary test set. Copyright (c) 2009 Elsevier Masson SAS. All rights reserved.
Burant, Aniela; Thompson, Christopher; Lowry, Gregory V; Karamalidis, Athanasios K
2016-05-17
Partitioning coefficients of organic compounds between water and supercritical CO2 (sc-CO2) are necessary to assess the risk of migration of these chemicals from subsurface CO2 storage sites. Despite the large number of potential organic contaminants, the current data set of published water-sc-CO2 partitioning coefficients is very limited. Here, the partitioning coefficients of thiophene, pyrrole, and anisole were measured in situ over a range of temperatures and pressures using a novel pressurized batch-reactor system with dual spectroscopic detectors: a near-infrared spectrometer for measuring the organic analyte in the CO2 phase and a UV detector for quantifying the analyte in the aqueous phase. Our measured partitioning coefficients followed expected trends based on volatility and aqueous solubility. The partitioning coefficients and literature data were then used to update a published poly parameter linear free-energy relationship and to develop five new linear free-energy relationships for predicting water-sc-CO2 partitioning coefficients. A total of four of the models targeted a single class of organic compounds. Unlike models that utilize Abraham solvation parameters, the new relationships use vapor pressure and aqueous solubility of the organic compound at 25 °C and CO2 density to predict partitioning coefficients over a range of temperature and pressure conditions. The compound class models provide better estimates of partitioning behavior for compounds in that class than does the model built for the entire data set.
International Nuclear Information System (INIS)
Bejarano, Arturo; López, Pablo I.; Valle, José M. del; Fuente, Juan C. de la
2015-01-01
Highlights: • A new apparatus based on a static–analytic method was assembled in this work. • This work reports high-pressure VLE data of (E)-2-hexenal or hexanal + CO 2 + water. • Data includes (CO 2 + water) partition coefficients of (E)-2-hexenal and hexanal. • High separation factors from water (∼10 4 ) were found especially for (E)-2-hexenal. • The data were obtained at T = (313, 323, and 333) K and pressures from (8 to 19) MPa. - Abstract: A new apparatus based on a static–analytic method assembled in this work was utilised to perform high-pressure (vapour + liquid) equilibria measurements of aqueous ternary systems. This work includes values of isothermal partition coefficients between CO 2 and water of two apple aroma constituents, (E)-2-hexenal and hexanal. Additionally, this work reports new experimental (vapour + liquid) equilibria measurements for the ternary systems (CO 2 + (E)-2-hexenal + water) and (CO 2 + hexanal + water), at fixed liquid phase composition (600 mg · kg −1 ), at temperatures of (313, 323 and 333) K and at pressures from (8 to 19) MPa. Vapour liquid interphase was checked and monitored visually for all the systems studied in this work. No liquid immiscibility was observed at the composition, temperatures and pressures studied. In order to suggest reasonable operation conditions for fractionation of aromas with dense carbon dioxide, partition coefficients of the aroma compounds between CO 2 and water along with their separation factors from water were calculated. Partition coefficients of (E)-2-hexenal between CO 2 and water were in the range of (6 to 91) and where found to be near six times higher than those of hexanal (9 to 17). Very high separation factors from water were observed (∼10 4 ) especially for (E)-2-hexenal. The highest separation factor, for both compounds, was found at a temperature of 313 K and pressures from (12 to 14) MPa
International Nuclear Information System (INIS)
Bond, J.A.; Baker, S.M.; Bechtold, W.E.
1985-01-01
Studies on the lung retention of polycyclic aromatic hydrocarbons (PAH) after inhalation have indicated that, in general, the PAH are rapidly cleared from the respiratory tract. Clearance of the PAH from the lungs is best described as bi-phasic, with the long-term component of the clearance curve having a half-time of greater than 24 h. The purpose of this study was to determine whether a relationship exists between the lipophilicity (as measured by the octanol/water partition coefficient, P) of various PAH and the short-term and long-term clearance half-times of PAH in rat lungs. Female F344/Crl rats were administered intratracheally 1 nmol of 14 C-labelled anthracene (AN), benz (a) anthracene (BA), 1-nitropyrene (NP), 6-nitrobenzo (a) pyrene (6-NBP), or dibenzo (c, g) carbazole (DBC). At various times after instillation rats were sacrificed and the amount of 14 C from rat lungs following instillation of the different PAH was biphasic. In all cases, greater than 85% of the initial dose instilled was cleared with a half-time of less than 1 h. The half-times for clearance of the residual 14 C (1-15% of the dose) were 26, 30, 36, 53 and 63 h for AN, NP, 6-NBP, BA and DCB, respectively. The log of the octanol-water partition coefficients for the different PAH examined ranged from 4.1 (AN) to 6.05 (DBC). Plots of the octanol/water coefficients vs. the long-term clearance half-time for the PAH indicated a linear correlation (p 2 =0.96). The results from this study indicate that the greater the lipophilicity of the PAH, the slower the long-term clearance of a small fraction (1-15%) of PAH from rat lungs. These data suggest that predictions of long-term lung clearance can be made for PAH with log octanol-water partition coefficients between 4 and 6. (author)
Prediction of Partition Coefficients of Organic Compounds for SPME/PDMS
Directory of Open Access Journals (Sweden)
Liao Hsuan-Yu
2016-01-01
Full Text Available The partition coefficients of 51 organic compounds between SPME/PDMS and gas were compiled from the literature sources in this study. The effect of physicochemical properties and descriptors on the partitioning process of partition coefficients was explicated by the correlation analysis. The PDMS-gas partition coefficients were well correlated to the molecular weight of organic compounds (r = 0.832, p < 0.05. An empirical model, consisting of the molecular weight and the polarizability, was developed to appropriately predict the partition coefficients of organic compounds. The empirical model for estimating the PDMS-gas partition coefficient will contribute to the practical applications of the SPME technique.
Directory of Open Access Journals (Sweden)
Koji Ogata
2018-02-01
Full Text Available The octanol–water partition coefficient (logPow is an important index for measuring solubility, membrane permeability, and bioavailability in the drug discovery field. In this paper, the logPow values of 58 compounds were predicted by alchemical free energy calculation using molecular dynamics simulation. In free energy calculations, the atomic charges of the compounds are always fixed. However, they must be recalculated for each solvent. Therefore, three different sets of atomic charges were tested using quantum chemical calculations, taking into account vacuum, octanol, and water environments. The calculated atomic charges in the different environments do not necessarily influence the correlation between calculated and experimentally measured ∆Gwater values. The largest correlation coefficient values of the solvation free energy in water and octanol were 0.93 and 0.90, respectively. On the other hand, the correlation coefficient of logPow values calculated from free energies, the largest of which was 0.92, was sensitive to the combination of the solvation free energies calculated from the calculated atomic charges. These results reveal that the solvent assumed in the atomic charge calculation is an important factor determining the accuracy of predicted logPow values.
Jonker, Michiel T O
Octanol-water partition coefficients (Kow ) are widely used in fate and effects modelling of chemicals. Still, high quality experimental Kow data are scarce, in particular for very hydrophobic chemicals. This hampers reliable assessments of several fate and effect parameters and the development and
DEFF Research Database (Denmark)
Helweg, C.; Nielsen, T.; Hansen, P.E.
1997-01-01
Prediction of 1-octanol water partition coefficients for a range of polar N-PAC from HPLC capacity coefficients has been investigated. Two commercially available columns, an ODS column and a Diol column were tested with water-methanol eluents. The best prediction of log K-ow for N-PAC was achieve...... with size and log K-ow for N-PAC was 1.1-1.3 lower than log K-ow for the equivalent PAH. Shielding of the nitrogen atom in the N-PAC compounds caused an increase in log K-ow. (C) 1997 Elsevier Science Ltd....
Román, Iván P; Mastromichali, Anna; Tyrovola, Konstantina; Canals, Antonio; Psillakis, Elefteria
2014-02-21
Vortex-assisted liquid-liquid microextraction (VALLME) coupled with high-performance liquid chromatography (HPLC) is proposed here for the rapid determination of octanol-water partitioning coefficients (Kow). VALLME uses vortex agitation, a mild emulsification procedure, to disperse microvolumes of octanol in the aqueous phase thus increasing the interfacial contact area and ensuring faster partitioning rates. With VALLME, 2min were enough to achieve equilibrium conditions between the octanolic and aqueous phases. Upon equilibration, separation was achieved using centrifugation and the octanolic microdrop was collected and analyzed in a HPLC system. Six model compounds with logKow values ranging between ∼0.5 and 3.5 were used during the present investigations. The proposed method produced logKow values that were consistent with previously published values and the recorded uncertainty was well within the acceptable log unit range. Overall, the key features of the proposed Kow determination procedure comprised speed, reliability, simplicity, low cost and minimal solvent consumption. Copyright © 2014 Elsevier B.V. All rights reserved.
Octanol/water partition coefficient (logP) and aqueous solubility (logS) are two important parameters in pharmacology and toxicology studies, and experimental measurements are usually time-consuming and expensive. In the present research, novel methods are presented for the estim...
Lucangioli, S E; Carducci, C N; Tripodi, V P; Kenndler, E
2001-12-25
The capacity factors of 16 anionic cholates (from six bile salts, including their glyco- and tauro-conjugates) were determined in a micellar electrokinetic chromatography (MEKC) system consisting of buffer, pH 7.5 (phosphate-boric acid; 20 mmol/l) with 50 mmol/l sodium dodecyl sulfate (SDS) as micelle former and 10% acetonitrile as organic modifier. The capacity factors of the fully dissociated, negatively charged analytes (ranging between 0.2 and 60) were calculated from their mobilities, with a reference background electrolyte (BGE) without SDS representing "free" solution. For comparison, the capacity factors were derived for a second reference BGE where the SDS concentration (5 mmol/l) is close to the critical micellar concentration (CMC). The capacity factors are compared with the logarithm of the octanol-water partition coefficient, log Pow, as measure for lipophilicity. Clear disagreement between these two parameters is found especially for epimeric cholates with the hydroxy group in position 7. In contrast, fair relation between the capacity factor of the analytes and their CMC is observed both depending strongly on the orientation of the OH groups, and tauro-conjugation as well. In this respect the retention behaviour of the bile salts in MEKC seems to reflect their role as detergents in living systems, and might serve as model parameter beyond lipophilicity.
We investigated polychlorinated biphenyl (PCB) bioaccumulation relative to octanol-water partition coefficient (KOW) and organism tropic position (TP) at the Lake Hartwell Superfund site (South Carolina, USA). We measured PCBs (127 congeners) and stable isotopes (δ
Prediction of Partition Coefficients of Organic Compounds for SPME/PDMS
Liao Hsuan-Yu; Huang Miao-Ling; Lu Yu-Ting; Chao Keh-Ping
2016-01-01
The partition coefficients of 51 organic compounds between SPME/PDMS and gas were compiled from the literature sources in this study. The effect of physicochemical properties and descriptors on the partitioning process of partition coefficients was explicated by the correlation analysis. The PDMS-gas partition coefficients were well correlated to the molecular weight of organic compounds (r = 0.832, p < 0.05). An empirical model, consisting of the molecular weight and the polarizability, was ...
Interactions of short chain phenylalkanoic acids within ionic surfactant micelles in aqueous media
Directory of Open Access Journals (Sweden)
Naeem Kashif
2012-01-01
Full Text Available % SDS KR nema Solubilization and interactions of phenylalkanoic acids induced by cationic surfactant, cetyltrimethylammonium bromide (CTAB and an anionic surfactant, sodium dodecyl sulfate (SDS was investigated spectrophotometrically at 25.0°C. The UV spectra of the additives (acids were measured with and without surfactant above and below critical micelle concentration (cmc of the surfactant. The presence of alkyl chain in phenylalkanoic acids is responsible for hydrophobic interaction resulting in shift of the spectra towards longer wavelength (red shift. The value of partition coefficient (Kx between the bulk water and surfactant micelles and in turn standard free energy change of solubilization (ΔGpº were also estimated by measuring the differential absorbance (ΔA of the additives in micellar solutions.
Directory of Open Access Journals (Sweden)
Sebenji Ana S.
2015-01-01
Full Text Available Bile acids are well known natural surfactants able to modify the permeability of biological membranes. The logarithm of partition coefficient between, traditionally used, n-octanol and water is a measure of lipophilicity as a predictor of solute membrane partitioning. The aim of this work was to determine partition coefficients of bile acids in a mixture of water and chloroform and dibutyl ether at different pH values and with addition of different concentrations of sodium ions, and to examine the influence of the structure of bile acid nucleus on measured partition coefficients. Partition coefficients of three bile acid salts were determined using shake-flask method and the concentration of bile acids was determined after twelve hours of shaking at the room temperature in aqueous and organic layer using reversed phase HPLC with DAD detector on 210 nm. For all three analysed bile acid salts values of logP are lower in dibutyl ether than in chloroform. At certain pH values, curves representing the dependence of partition coefficient on pH value intersect, and these are the pH values for which partition coefficients are the same for both solvents. Increasing the solution ionic strength, this intersection is shifted toward lower pH values. It is found that, for both organic solvents, after the addition of hydroxyl group in the steroid nucleus (i.e. if the bile acid is less hydrophobic the value of logP falls, especially if more hydroxyl groups are present. With chloroform as a solvent, system quickly comes to excess with electrolyte ions than with dibutyl ether. [Projekat Ministarstva nauke Republike Srbije, br. 172021
Pfeifer, O; Lohmann, U; Ballschmiter, K
2001-11-01
Halogenated methyl-phenyl ethers (methoxybenzenes, anisoles) are ubiquitous organics in the environment although they are not produced in industrial quantities. Modelling the fate of organic pollutants such as halogenated anisoles requires a knowledge of the fundamental physico-chemical properties of these compounds. The isomer-specific separation and detection of 60 of the 134 possible congeners allowing an environmental fingerprinting are reported in this study. The vapor pressure p0(L) of more than 60 and further physico-chemical properties of 26 available congeners are given. Vapor pressures p0(L), water solubilities S(L)W, and n-octanol/water partition coefficients Kow were determined by capillary HR-GC (High Resolution Gas Chromatography) on a non-polar phase and by RP-HPLC (Reversed Phase High Performance Liquid Chromatography) on a C18 phase with chlorobenzenes as reference standards. From these experimental data the Henry's law constants H, and the gas/water Kgw and gas/n-octanol Kgo partition coefficients were calculated. We found that vapor pressures, water solubilities, and n-octanol/water partition coefficients of the halogenated anisoles are close to those of the chlorobenzenes. A similar environmental fate of both groups can, therefore, be predicted.
Pintado-Herrera, Marina G; Lara-Martín, Pablo A; González-Mazo, Eduardo; Allan, Ian J
2016-09-01
There is a growing interest in assessing the concentration and distribution of new nonregulated organic compounds (emerging contaminants) in the environment. The measurement of freely dissolved concentrations using conventional approaches is challenging because of the low concentrations that may be encountered and their temporally variable emissions. Absorption-based passive sampling enables the estimation of freely dissolved concentrations of hydrophobic contaminants of emerging concern in water. In the present study, calibration was undertaken for 2 polymers, low-density polyethylene (LDPE) and silicone rubber for 11 fragrances, 5 endocrine-disrupting compounds, 7 ultraviolet (UV) filters, and 8 organophosphate flame retardant compounds. Batch experiments were performed to estimate contaminant diffusion coefficients in the polymers (Dp ), which in general decreased with increasing molecular weight. The values for fragrances, endocrine-disrupting compounds, and UV filters were in ranges similar to those previously reported for polycyclic aromatic hydrocarbons, but were 1 order of magnitude lower for organophosphate flame retardant compounds. Silicone rubber had higher Dp values than LDPE and was therefore selected for further experiments to calculate polymer/water partition coefficients (KPW ). The authors observed a positive correlation between log KPW and log octanol/water partition coefficient values. Field testing of silicone rubber passive samplers was undertaken though exposure in the River Alna (Norway) for an exposure time of 21 d to estimate freely dissolved concentration. Some fragrances and UV filters were predominant over other emerging and regulated contaminants, at levels up to 1600 ng L(-1) for galaxolide and 448 ng L(-1) for octocrylene. Environ Toxicol Chem 2016;35:2162-2172. © 2016 SETAC. © 2016 SETAC.
International Nuclear Information System (INIS)
Eom, In Yong
2011-01-01
The results show that the partition coefficients of the BTEX compound can be estimated using the SPME method under the consecutive extraction mode. The proposed technique is much simpler than previously reported methods. Its novelty is that it eliminated the calibration step in the GC/FID, i. e., liquid injection method. The use of the autosampler for the SPME fiber can facilitate the adoption of consecutive extractions; thus, it allows estimation of the partition coefficients of various analytes. Recently, GC/MS has increasingly been used in analytical laboratories; this may facilitate the identification of an unknown analyte as well as the computation of the corresponding partition coefficients with the proposed method. It is very important to use partition coefficients of organic pollutants to predict their fate in the environment. A liquid-liquid extraction technique was used to determine the partition coefficients of organic compounds between water and organic solvent. The concentration of the target compounds must be determined after equilibrium is established between the two phases. The partition coefficients can be estimated using the capacity factors of HPLC and GC
Clarke, F H; Cahoon, N M
1987-08-01
A convenient procedure has been developed for the determination of partition and distribution coefficients. The method involves the potentiometric titration of the compound, first in water and then in a rapidly stirred mixture of water and octanol. An automatic titrator is used, and the data is collected and analyzed by curve fitting on a microcomputer with 64 K of memory. The method is rapid and accurate for compounds with pKa values between 4 and 10. Partition coefficients can be measured for monoprotic and diprotic acids and bases. The partition coefficients of the neutral compound and its ion(s) can be determined by varying the ratio of octanol to water. Distribution coefficients calculated over a wide range of pH values are presented graphically as "distribution profiles". It is shown that subtraction of the titration curve of solvent alone from that of the compound in the solvent offers advantages for pKa determination by curve fitting for compounds of low aqueous solubility.
Yu, S; Gao, S; Gan, Y; Zhang, Y; Ruan, X; Wang, Y; Yang, L; Shi, J
2016-04-01
Quantitative structure-property relationship modelling can be a valuable alternative method to replace or reduce experimental testing. In particular, some endpoints such as octanol-water (KOW) and organic carbon-water (KOC) partition coefficients of polychlorinated biphenyls (PCBs) are easier to predict and various models have been already developed. In this paper, two different methods, which are multiple linear regression based on the descriptors generated using Dragon software and hologram quantitative structure-activity relationships, were employed to predict suspended particulate matter (SPM) derived log KOC and generator column, shake flask and slow stirring method derived log KOW values of 209 PCBs. The predictive ability of the derived models was validated using a test set. The performances of all these models were compared with EPI Suite™ software. The results indicated that the proposed models were robust and satisfactory, and could provide feasible and promising tools for the rapid assessment of the SPM derived log KOC and generator column, shake flask and slow stirring method derived log KOW values of PCBs.
Souza, Erica Silva; Zaramello, Laize; Kuhnen, Carlos Alberto; Junkes, Berenice da Silva; Yunes, Rosendo Augusto; Heinzen, Vilma Edite Fonseca
2011-01-01
A new possibility for estimating the octanol/water coefficient (log P) was investigated using only one descriptor, the semi-empirical electrotopological index (I(SET)). The predictability of four octanol/water partition coefficient (log P) calculation models was compared using a set of 131 aliphatic organic compounds from five different classes. Log P values were calculated employing atomic-contribution methods, as in the Ghose/Crippen approach and its later refinement, AlogP; using fragmental methods through the ClogP method; and employing an approach considering the whole molecule using topological indices with the MlogP method. The efficiency and the applicability of the I(SET) in terms of calculating log P were demonstrated through good statistical quality (r > 0.99; s < 0.18), high internal stability and good predictive ability for an external group of compounds in the same order as the widely used models based on the fragmental method, ClogP, and the atomic contribution method, AlogP, which are among the most used methods of predicting log P.
40 CFR 799.6756 - TSCA partition coefficient (n-octanol/water), generator column method.
2010-07-01
... using the CLogP3 computer program in paragraph (e)(9) of this section. 4 Hawker and Connell (1988... (B) Constant temperature bath with circulation pump-bath and capable of controlling temperature to 25...-partition coefficient correlation. Environmental Science and Technology 14:1227-1229 (1980). (2) Bruggemann...
Effect of hydrostatic pressure on gas solubilization in micelles.
Meng, Bin; Ashbaugh, Henry S
2015-03-24
Molecular dynamics simulations of anionic sodium decylsulfate and nonionic pentaethylene glycol monodecyl ether micelles in water have been performed to examine the impact of hydrostatic pressure on argon solubilization as a function of pressure. The potential-of-mean force between the micelles and argon demonstrates that nonpolar gases are attracted to the interiors of both micelles. The affinity of argon for micelle interiors, however, decreases with increasing pressure as a result of the comparatively higher molar volume of argon inside assemblies. We evaluate solubility enhancement coefficients, which describe the drop in the solute chemical potential as a function of the micellized surfactant concentration, to quantify the impact of micellization on gas solubilization. While argon is similarly attracted to the hydrophobic cores of both micelles, the gas is more effectively sequestered within nonionic micelles compared with anionic micelles as a result of salting out by charged head groups and accompanying counterions. The solubility enhancement coefficients of both micelles decrease with increasing pressure, reflecting the changing forces observed in the potentials-of-mean force. An analytical liquid drop model is proposed to describe the pressure dependence of argon solubilization within micelles that captures the simulation solubility enhancement coefficients after fitting an effective micelle radius for each surfactant.
International Nuclear Information System (INIS)
Dalvi, Aditi; Verma, Rakesh; Kumar, Sangita D.; Reddy, A.V.R.
2012-01-01
The simplest and most common parameter for modeling radionuclide mobility in soils is the partition coefficient (K d ). The soil-water partition coefficient for radionuclide is affected by numerous geochemical parameters like pH, sorption to clays, presence of organic matter, iron oxides, other soil constituents and the chemical forms of the radionuclide as well as oxidation/reduction conditions and major ion chemistry. In these studies radionuclides uranium and thorium were systematically assessed for their behaviour in the soils from Tummalapalle mining site. Physico-chemical characteristics such as chemical composition, pH, CaCO 3 content and organic carbon were determined for soils and synthetic groundwater samples. Oven dried soil samples (1g) were taken in polycarbonate tube and washed with synthetic ground water till the pH of the supernatant solution remained unchanged. The soil sample was then equilibrated with 30 mL of synthetic ground water spiked with an element of interest. The pH was adjusted to its initial value by addition of small increments of dilute NaOH/HNO 3 . The tubes containing samples were gently shaken for 72 h at room temperature. On completion of the experiment, it was centrifuged using high-speed centrifugation for 30 min and the aqueous phase was separated and analysed. The blank was processed in the same manner without adding soil. Determination of U and Th in the supernatant was carried out using ICPMS. The K d of thorium was found to be two-three order of magnitude higher than that of uranium for both the soil samples assessed in this study. The presence of carbonates and organic carbon in the groundwater has a significant effect on the K d of uranium. The K d values for uranium were found to be hundred fold lower in the presence of carbonates. (author)
Jonker, Michiel T O
2016-06-01
Octanol-water partition coefficients (KOW ) are widely used in fate and effects modeling of chemicals. Still, high-quality experimental KOW data are scarce, in particular for very hydrophobic chemicals. This hampers reliable assessments of several fate and effect parameters and the development and validation of new models. One reason for the limited availability of experimental values may relate to the challenging nature of KOW measurements. In the present study, KOW values for 13 polycyclic aromatic hydrocarbons were determined with the gold standard "slow-stirring" method (log KOW 4.6-7.2). These values were then used as reference data for the development of an alternative method for measuring KOW . This approach combined slow stirring and equilibrium sampling of the extremely low aqueous concentrations with polydimethylsiloxane-coated solid-phase microextraction fibers, applying experimentally determined fiber-water partition coefficients. It resulted in KOW values matching the slow-stirring data very well. Therefore, the method was subsequently applied to a series of 17 moderately to extremely hydrophobic petrochemical compounds. The obtained KOW values spanned almost 6 orders of magnitude, with the highest value measuring 10(10.6) . The present study demonstrates that the hydrophobicity domain within which experimental KOW measurements are possible can be extended with the help of solid-phase microextraction and that experimentally determined KOW values can exceed the proposed upper limit of 10(9) . Environ Toxicol Chem 2016;35:1371-1377. © 2015 SETAC. © 2015 SETAC.
Solubilization of Phenol Derivatives in Polymer Micelles Formed by Cationic Block Copolymer
Directory of Open Access Journals (Sweden)
Irma Fuentes
2017-01-01
Full Text Available The aggregation of cationic block copolymers formed by polystyrene (PS and poly(ethyl-4-vinylpyridine (PS-b-PE4VP was studied in aqueous solution. Diblock copolymers of PS and poly(4-vinylpyridine were synthesized by sequential anionic polymerization using BuLi as initiator. Subsequently, the 4-vinylpyridine units were quaternized with ethyl bromide to obtain cationic PS-b-PE4VP block copolymers with different quaternization degree. The self-aggregation of cationic block copolymers was studied by fluorescence probing, whereas the morphology and size of polymer micelles were determined by transmission electronic microscopy. Results indicate that spherical micelles with sizes lower than 100 nm were formed, whereas their micropolarity decreases with increasing quaternization degree. The partition of phenols between the micellar and aqueous phase was studied by using the pseudo-phase model, and the results show that the partition coefficients increase with increasing length of the side alkyl chain and are larger for star micelles. These results are discussed in terms of three-region model.
Huhn, Carolin; Pyell, Ute
2008-07-11
It is investigated whether those relationships derived within an optimization scheme developed previously to optimize separations in micellar electrokinetic chromatography can be used to model effective electrophoretic mobilities of analytes strongly differing in their properties (polarity and type of interaction with the pseudostationary phase). The modeling is based on two parameter sets: (i) carbon number equivalents or octanol-water partition coefficients as analyte descriptors and (ii) four coefficients describing properties of the separation electrolyte (based on retention data for a homologous series of alkyl phenyl ketones used as reference analytes). The applicability of the proposed model is validated comparing experimental and calculated effective electrophoretic mobilities. The results demonstrate that the model can effectively be used to predict effective electrophoretic mobilities of neutral analytes from the determined carbon number equivalents or from octanol-water partition coefficients provided that the solvation parameters of the analytes of interest are similar to those of the reference analytes.
Lipoamino acid-based micelles as promising delivery vehicles for monomeric amphotericin B.
Serafim, Cláudia; Ferreira, Inês; Rijo, Patrícia; Pinheiro, Lídia; Faustino, Célia; Calado, António; Garcia-Rio, Luis
2016-01-30
Lipoamino acid-based micelles have been developed as delivery vehicles for the hydrophobic drug amphotericin B (AmB). The micellar solubilisation of AmB by a gemini lipoamino acid (LAA) derived from cysteine and its equimolar mixtures with the bile salts sodium cholate (NaC) and sodium deoxycholate (NaDC), as well as the aggregation sate of the drug in the micellar systems, was studied under biomimetic conditions (phosphate buffered-saline, pH 7.4) using UV-vis spectroscopy. Pure surfactant systems and equimolar mixtures were characterized by tensiometry and important parameters were determined, such as critical micelle concentration (CMC), surface tension at the CMC (γCMC), maximum surface excess concentration (Γmax), and minimum area occupied per molecule at the water/air interface (Amin). Rheological behaviour from viscosity measurements at different shear rates was also addressed. Solubilisation capacity was quantified in terms of molar solubilisation ratio (χ), micelle-water partition coefficient (KM) and Gibbs energy of solubilisation (ΔGs°). Formulations of AmB in micellar media were compared in terms of drug loading, encapsulation efficiency, aggregation state of AmB and in vitro antifungal activity against Candida albicans. The LAA-containing micellar systems solubilise AmB in its monomeric and less toxic form and exhibit in vitro antifungal activity comparable to that of the commercial formulation Fungizone. Copyright © 2015 Elsevier B.V. All rights reserved.
DEFF Research Database (Denmark)
Gilbert, Dorothea; Witt, Gesine; Smedes, Foppe
2016-01-01
Polymers are increasingly applied for the enrichment of hydrophobic organic chemicals (HOCs) from various types of samples and media in many analytical partitioning-based measuring techniques. We propose using polymers as a reference partitioning phase and introduce polymer-polymer partitioning......-air) and multimedia partition coefficients (lipid-water, air-water) were calculated by applying the new concept of a polymer as reference partitioning phase and by using polymer-polymer partition coefficients as conversion factors. The present study encourages the use of polymer-polymer partition coefficients...
Partition thermodynamics of ionic surfactants between phosphatidylcholine vesicle and water phases
Chu, Shin-Chi; Hung, Chia-Hui; Wang, Shun-Cheng; Tsao, Heng-Kwong
2003-08-01
The partition of ionic surfactants (sodium alkyl sulfate and alkyl trimethyl ammonium bromide) between phosphatidylcholine vesicles and aqueous phase is investigated by simple conductometry under different temperatures. The experimental results can be well represented by the proposed regular solution theory and the thermodynamic parameters satisfy the thermodynamic consistency. The deviation from ideal partition is manifested through the effective interaction energy between lipid and surfactant wb, which is O(kT) large. It is found that wb rises as the alkyl chain is decreased for a specified head group. This is attributed to significant mismatch of chain lengths between surfactant and lipid molecules. The partition coefficient K declines with increasing temperature. The energy barrier from bilayer to aqueous phase, Δμ/kT∝ln K, is in the range of 16-26 kJ/mol. As the alkyl chain length is decreased for a given head group, Δμ is lowered by 1.3-1.5 kJ/mol per methylene group. Two independent analyses are employed to confirm this result. Using the thermodynamic parameters determined from experiments, the internal energy, entropy, and free energy of the partition process can be derived. Partition is essentially driven by the internal energy gain. The solubilizing ability, which is represented by the maximum surfactant-lipid ratio in the bilayer, Reb also decreases in accord with the K parameter. It is because the change in temperature influences the surfactant incorporation into the bilayer more than the formation of micelles.
International Nuclear Information System (INIS)
Southworth, G.R.; Keller, J.L.
1984-01-01
Partition coefficients (K/sub p/) describing the partitioning of naphthalene, methylnaphthalenes and biphenyl between organic-rich wastes and water were determined using 14 C-tracer techniques as well as high performance liquid chromatographic analysis of the wastes and their aqueous extracts. Results of the two procedures were in good agreement. The concentrations of the specific organics in the wastes were not good predictors of concentrations in aqueous extracts, since K/sub p/ varied among the materials tested. Predictions of k/sub p/ based on organic carbon content of the sludges were well below observed values. Oil content of the wastes and oil-water partition coefficients appeared to be important factors in determining K/sub p/. 11 references, 5 tables
Golmohammadi, Hassan
2009-11-30
A quantitative structure-property relationship (QSPR) study was performed to develop models those relate the structure of 141 organic compounds to their octanol-water partition coefficients (log P(o/w)). A genetic algorithm was applied as a variable selection tool. Modeling of log P(o/w) of these compounds as a function of theoretically derived descriptors was established by multiple linear regression (MLR), partial least squares (PLS), and artificial neural network (ANN). The best selected descriptors that appear in the models are: atomic charge weighted partial positively charged surface area (PPSA-3), fractional atomic charge weighted partial positive surface area (FPSA-3), minimum atomic partial charge (Qmin), molecular volume (MV), total dipole moment of molecule (mu), maximum antibonding contribution of a molecule orbital in the molecule (MAC), and maximum free valency of a C atom in the molecule (MFV). The result obtained showed the ability of developed artificial neural network to prediction of partition coefficients of organic compounds. Also, the results revealed the superiority of ANN over the MLR and PLS models. Copyright 2009 Wiley Periodicals, Inc.
Energy Technology Data Exchange (ETDEWEB)
Bonfim, Sarah Andresa; Ferreira, Ângela Fortini Macedo, E-mail: sarah_andresa@hotmail.com [Universidade Federal de Migas Gerais (UFMG), Belo Horizonte, MG (Brazil). Departamento de Engenharia Nuclear; Franklin, Mariza Ramalho; Ferreira, Paulo Roberto Rocha [Instituto de Radioproteção e Dosimetria (IRD/CNEN-RJ), Rio de Janeiro, RJ (Brazil); Rocha, Zildete, E-mail: zildeter7@gmail.com [Centro de Desenvolvimento da Tecnologia Nuclear (CDTN/CNEN-MG), Belo Horizonte, MG (Brazil)
2017-07-01
Different studies indicate the applicability of natural radon as a tracer in the determination of contaminated environments by Non-Aqueous Phase Liquids (NAPLs). Such use being due to the non-homogeneous distribution of this element between water, air and NAPL. Thus, it is known that the concentration of radon in a given soil / aquifer and in a given area may indicate that such site is contaminated by NAPL. However, the simple measurement of radon concentration activity allows only a qualitative evaluation of the area contaminated in study. For a quantitative estimate of the NAPL saturation in the pore space, it is necessary to know the radon partition coefficients between the coexisting phases, considering the kind of NAPL present. The present study, the radon partitioning coefficients between air, water and diverse types of NAPL mixtures, such as gasoline, diesel fuel, alcohol, kerosene and olive oil was measured. In a closed system, was applied an analytical method based on the distribution of the radon between the present phases with the use of a system of Flow Injection Analysis (FIA). The measurement of the specific activity of radon was performed by using an AlphaGUARD monitor. It is observed that, in the presence of NAPL, the concentration of radon in water and air is significantly lower than in its absence, indicating a negative correlation and allowing the evaluation of the contamination of the area by NAPL. (author)
International Nuclear Information System (INIS)
Bonfim, Sarah Andresa; Ferreira, Ângela Fortini Macedo; Rocha, Zildete
2017-01-01
Different studies indicate the applicability of natural radon as a tracer in the determination of contaminated environments by Non-Aqueous Phase Liquids (NAPLs). Such use being due to the non-homogeneous distribution of this element between water, air and NAPL. Thus, it is known that the concentration of radon in a given soil / aquifer and in a given area may indicate that such site is contaminated by NAPL. However, the simple measurement of radon concentration activity allows only a qualitative evaluation of the area contaminated in study. For a quantitative estimate of the NAPL saturation in the pore space, it is necessary to know the radon partition coefficients between the coexisting phases, considering the kind of NAPL present. The present study, the radon partitioning coefficients between air, water and diverse types of NAPL mixtures, such as gasoline, diesel fuel, alcohol, kerosene and olive oil was measured. In a closed system, was applied an analytical method based on the distribution of the radon between the present phases with the use of a system of Flow Injection Analysis (FIA). The measurement of the specific activity of radon was performed by using an AlphaGUARD monitor. It is observed that, in the presence of NAPL, the concentration of radon in water and air is significantly lower than in its absence, indicating a negative correlation and allowing the evaluation of the contamination of the area by NAPL. (author)
Partition of selected food preservatives in fish oil-water systems
DEFF Research Database (Denmark)
Cheng, Hongyuan; Friis, Alan; Leth, Torben
2010-01-01
The partition coefficients (Kow) of benzoic acid and sorbic acid in systems of fish oil (sand eel)–water, fish oil–buffer solution, rape oil–water and olive oil–water were experimentally determined in a temperature range from 5 to 43 °C and pH from 4.5 to 6.5 °C. The dimerization of benzoic acid...... in fish oil–water system was observed at 25 °C. Two modifications have been made to the Nordic Food Analysis Standard for the determination of sorbic acid by HPLC. The experimental results show that the Kow of benzoic acid and sorbic acid in fish oil–buffer system is ca. 100 times lower than that in fish...... oil–water system. The Kow values of benzoic acid and sorbic acid in fish oil and water system decrease with increasing system pH values. The partition coefficients of plant origin and fish origin oils are in the same order of magnitude even though their molecular structures are very different....
Vyhnalkova, Renata; Eisenberg, Adi; van de Ven, Theo G M
2008-07-24
The kinetics of loading of polystyrene197-block-poly(acrylic acid)47 (PS197-b-PAA47) micelles, suspended in water, with thiocyanomethylthiobenzothiazole biocide and its subsequent release were investigated. Loading of the micelles was found to be a two-step process. First, the surface of the PS core of the micelles is saturated with biocide, with a rate determined by the transfer of solid biocide to micelles during transient micelle-biocide contacts. Next, the biocide penetrates as a front into the micelles, lowering the Tg in the process (non-Fickian case II diffusion). The slow rate of release is governed by the height of the energy barrier that a biocide molecule must overcome to pass from PS into water, resulting in a uniform biocide concentration within the micelle, until Tg is increased to the point that diffusion inside the micelles becomes very slow. Maximum loading of biocide into micelles is approximately 30% (w/w) and is achieved in 1 h. From partition experiments, it can be concluded that the biocide has a similar preference for polystyrene as for ethylbenzene over water, implying that the maximum loading is governed by thermodynamics.
The partition coefficients of 133Xe between blood and bone
International Nuclear Information System (INIS)
Lahtinen, T.; Karjalainen, P.; Vaeaenaenen, A.; Lahtinen, R.; Alhava, E.M.
1981-01-01
The partition coefficients of 133 Xe between blood and haematopoietic bone marrow and homogenised bone have been determined in vitro. The partition coefficient lambda 1 corresponding to haematopoietic marrow was 0.95 ml g -1 while that corresponding to homogenised bone was a function of age, lambda 2 = 3.11 + 0.049(age)(ml g -1 ). These data can be used for calculating regional blood flow in healthy human femur by means of a simple 133 Xe radionuclide method. (author)
Silva, D F C; Azevedo, A M; Fernandes, P; Chu, V; Conde, J P; Aires-Barros, M R
2017-03-03
Aqueous two phase systems (ATPS) offer great potential for selective separation of a wide range of biomolecules by exploring differences in molecular solubility in each of the two immiscible phases. However, ATPS use has been limited due to the difficulty in predicting the behavior of a given biomolecule in the partition environment together with the empirical and time-consuming techniques that are used for the determination of partition and extraction parameters. In this work, a fast and novel technique based on a microfluidic platform and using fluorescence microscopy was developed to determine the partition coefficients of biomolecules in different ATPS. This method consists of using a microfluidic device with a single microchannel and three inlets. In two of the inlets, solutions containing the ATPS forming components were loaded while the third inlet was fed with the FITC tagged biomolecule of interest prepared in milli-Q water. Using fluorescence microscopy, it was possible to follow the location of the FITC-tagged biomolecule and, by simply varying the pumping rates of the solutions, to quickly test a wide variety of ATPS compositions. The ATPS system is allowed 4min for stabilization and fluorescence micrographs are used to determine the partition coefficient.The partition coefficients obtained were shown to be consistent with results from macroscale ATPS partition. This process allows for faster screening of partition coefficients using only a few microliters of material for each ATPS composition and is amenable to automation. The partitioning behavior of several biomolecules with molecular weights (MW) ranging from 5.8 to 150kDa, and isoelectric points (pI) ranging from 4.7 to 6.4 was investigated, as well as the effect of the molecular weight of the polymer ATPS component. Copyright © 2016 Elsevier B.V. All rights reserved.
Zone fluidics for measurement of octanol-water partition coefficient of drugs.
Wattanasin, Panwadee; Saetear, Phoonthawee; Wilairat, Prapin; Nacapricha, Duangjai; Teerasong, Saowapak
2015-02-20
A novel zone fluidics (ZF) system for the determination of the octanol-water partition coefficient (Pow) of drugs was developed. The ZF system consisted of a syringe pump with a selection valve, a holding column, a silica capillary flow-cell and an in-line spectrophotometer. Exact microliter volumes of solvents (octanol and phosphate buffer saline) and a solution of the drug, sandwiched between air segments, were sequentially loaded into the vertically aligned holding column. Distribution of the drug between the aqueous and octanol phases occurred by the oscillation movement of the syringe pump piston. Phase separation occurred due to the difference in densities. The liquid zones were then pushed into the detection flow cell. In this method, absorbance measurements in only one of the phase (octanol or aqueous) were employed, which together with the volumes of the solvents and pure drug sample, allowed the calculation of the Pow. The developed system was applied to the determination of the Pow of some common drugs. The log (Pow) values agreed well with a batch method (R(2)=0.999) and literature (R(2)=0.997). Standard deviations for intra- and inter-day analyses were both less than 0.1log unit. This ZF system provides a robust and automated method for screening of Pow values in the drug discovery process. Copyright © 2014 Elsevier B.V. All rights reserved.
DEFF Research Database (Denmark)
Bollmann, Ulla E.; Ou, Yi; Mayer, Philipp
2014-01-01
-N-octylisothiazolinone). The correlation of the polyacrylate-water partition constants with the octanol-water partition constants is significant, but the polyacrylate-water partition constants were predominantly below octanol-water partition constants (Kow). The comparison with render-water distribution constants showed that estimating...
Atrazine and Diuron partitioning within a soil-water-surfactant system
Wang, P.; Keller, A.
2006-12-01
The interaction between pesticide and soil and water is even more complex in the presence of surfactants. In this study, batch equilibrium was employed to study the sorption of surfactants and the partitioning behaviors of Atrazine and Diuron within a soil-water-surfactant system. Five soils and four surfactants (nonionic Triton- 100, cationic Benzalkonium Chloride (BC), anionic Linear Alkylbenzenesulfonate (LAS), and anionic Sodium Dodecyl Sulfate (SDS)) were used. All surfactant sorption isotherms exhibited an initial linear increase at low surfactant concentrations but reached an asymptotic value as the surfactant concentrations increased. Among the surfactants, BC had the highest sorption onto all soils, followed by Triton-100 and then by LAS and SDS, implying that the nature of the charge significantly influences surfactant sorption. Sorption of either Triton-100 or BC was highly correlated with soil Cation Exchange Capacity (CEC) while that of LAS and SDS was complicated by the presence of Ca2+ and Mg2+ in the aqueous phase and the CEC sites. Both LAS and SDS formed complexes with Ca2+ and Mg2+, resulting in a significant decrease in the detergency of the surfactants. At high surfactant concentrations and with micelles present in the aqueous phase, the micelles formed a more competitive partitioning site for the pesticides, resulting in less pesticide sorbed to the soil. At low Triton-100 and BC concentration, the sorption of the surfactants first resulted in less Atrazine sorption but more Diuron sorption, implying competition between the surfactants and Atrazine, which serves as an indirect evidence that there is a different sorption mechanism for Atrazine. Atrazine is a weak base and it protonates and becomes positively charged near particle surfaces where the pH is much lower than in the bulk solution. The protonated Atrazine may then be held on the CEC sites via electrostatic attraction. Triton-100, LAS and SDS sorbed on the soil showed similar
DiFilippo, Erica L.; Eganhouse, Robert P.
2010-01-01
Solid-phase microextraction (SPME) has shown potential as an in situ passive-sampling technique in aquatic environments. The reliability of this method depends upon accurate determination of the partition coefficient between the fiber coating and water (Kf). For some hydrophobic organic compounds (HOCs), Kf values spanning 4 orders of magnitude have been reported for polydimethylsiloxane (PDMS) and water. However, 24% of the published data examined in this review did not pass the criterion for negligible depletion, resulting in questionable Kf values. The range in reported Kf is reduced to just over 2 orders of magnitude for some polychlorinated biphenyls (PCBs) when these questionable values are removed. Other factors that could account for the range in reported Kf, such as fiber-coating thickness and fiber manufacturer, were evaluated and found to be insignificant. In addition to accurate measurement of Kf, an understanding of the impact of environmental variables, such as temperature and ionic strength, on partitioning is essential for application of laboratory-measured Kf values to field samples. To date, few studies have measured Kf for HOCs at conditions other than at 20 degrees or 25 degrees C in distilled water. The available data indicate measurable variations in Kf at different temperatures and different ionic strengths. Therefore, if the appropriate environmental variables are not taken into account, significant error will be introduced into calculated aqueous concentrations using this passive sampling technique. A multiparameter linear solvation energy relationship (LSER) was developed to estimate log Kf in distilled water at 25 degrees C based on published physicochemical parameters. This method provided a good correlation (R2 = 0.94) between measured and predicted log Kf values for several compound classes. Thus, an LSER approach may offer a reliable means of predicting log Kf for HOCs whose experimental log Kf values are presently unavailable. Future
Genheden, Samuel
2017-10-01
We present the estimation of solvation free energies of small solutes in water, n-octanol and hexane using molecular dynamics simulations with two MARTINI models at different resolutions, viz. the coarse-grained (CG) and the hybrid all-atom/coarse-grained (AA/CG) models. From these estimates, we also calculate the water/hexane and water/octanol partition coefficients. More than 150 small, organic molecules were selected from the Minnesota solvation database and parameterized in a semi-automatic fashion. Using either the CG or hybrid AA/CG models, we find considerable deviations between the estimated and experimental solvation free energies in all solvents with mean absolute deviations larger than 10 kJ/mol, although the correlation coefficient is between 0.55 and 0.75 and significant. There is also no difference between the results when using the non-polarizable and polarizable water model, although we identify some improvements when using the polarizable model with the AA/CG solutes. In contrast to the estimated solvation energies, the estimated partition coefficients are generally excellent with both the CG and hybrid AA/CG models, giving mean absolute deviations between 0.67 and 0.90 log units and correlation coefficients larger than 0.85. We analyze the error distribution further and suggest avenues for improvements.
Genheden, Samuel
2017-10-01
We present the estimation of solvation free energies of small solutes in water, n-octanol and hexane using molecular dynamics simulations with two MARTINI models at different resolutions, viz. the coarse-grained (CG) and the hybrid all-atom/coarse-grained (AA/CG) models. From these estimates, we also calculate the water/hexane and water/octanol partition coefficients. More than 150 small, organic molecules were selected from the Minnesota solvation database and parameterized in a semi-automatic fashion. Using either the CG or hybrid AA/CG models, we find considerable deviations between the estimated and experimental solvation free energies in all solvents with mean absolute deviations larger than 10 kJ/mol, although the correlation coefficient is between 0.55 and 0.75 and significant. There is also no difference between the results when using the non-polarizable and polarizable water model, although we identify some improvements when using the polarizable model with the AA/CG solutes. In contrast to the estimated solvation energies, the estimated partition coefficients are generally excellent with both the CG and hybrid AA/CG models, giving mean absolute deviations between 0.67 and 0.90 log units and correlation coefficients larger than 0.85. We analyze the error distribution further and suggest avenues for improvements.
International Nuclear Information System (INIS)
Cooke, Cindy M.; Shaw, George; Collins, Chris D.
2004-01-01
Isoproturon and trifluralin are herbicides of contrasting chemical characters and modes of action. Standard batch sorption procedures were carried out to investigate the individual sorption behaviour of 14 C-isoproturon and 14 C-trifluralin in five agricultural soils (1.8-4.2% OC), and the soil solid-liquid partition coefficients (K d values) were determined. Trifluralin exhibited strong partitioning to the soil solid phase (K d range 106-294) and low desorption potential, thus should not pose a threat to sensitive waters via leaching, although particle erosion and preferential flow pathways may facilitate transport. For isoproturon, soil adsorption was low (K d range 1.96-5.75) and desorption was high, suggesting a high leaching potential, consistent with isoproturon being the most frequently found pesticide in UK surface waters. Soil partitioning was directly related to soil organic carbon (OC) content. Accumulation isotherms were modelled using a dual-phase adsorption model to estimate adsorption and desorption rate coefficients. Associations between herbicides and soil humic substances were also shown using gel filtration chromatography. - Capsule: Herbicide soil sorption described by a dual-phase adsorption model reflected soil partitioning, as influenced by soil OC and humic substances
Luchko, Tyler; Blinov, Nikolay; Limon, Garrett C.; Joyce, Kevin P.; Kovalenko, Andriy
2016-11-01
Implicit solvent methods for classical molecular modeling are frequently used to provide fast, physics-based hydration free energies of macromolecules. Less commonly considered is the transferability of these methods to other solvents. The Statistical Assessment of Modeling of Proteins and Ligands 5 (SAMPL5) distribution coefficient dataset and the accompanying explicit solvent partition coefficient reference calculations provide a direct test of solvent model transferability. Here we use the 3D reference interaction site model (3D-RISM) statistical-mechanical solvation theory, with a well tested water model and a new united atom cyclohexane model, to calculate partition coefficients for the SAMPL5 dataset. The cyclohexane model performed well in training and testing (R=0.98 for amino acid neutral side chain analogues) but only if a parameterized solvation free energy correction was used. In contrast, the same protocol, using single solute conformations, performed poorly on the SAMPL5 dataset, obtaining R=0.73 compared to the reference partition coefficients, likely due to the much larger solute sizes. Including solute conformational sampling through molecular dynamics coupled with 3D-RISM (MD/3D-RISM) improved agreement with the reference calculation to R=0.93. Since our initial calculations only considered partition coefficients and not distribution coefficients, solute sampling provided little benefit comparing against experiment, where ionized and tautomer states are more important. Applying a simple pK_{ {a}} correction improved agreement with experiment from R=0.54 to R=0.66, despite a small number of outliers. Better agreement is possible by accounting for tautomers and improving the ionization correction.
Luchko, Tyler; Blinov, Nikolay; Limon, Garrett C; Joyce, Kevin P; Kovalenko, Andriy
2016-11-01
Implicit solvent methods for classical molecular modeling are frequently used to provide fast, physics-based hydration free energies of macromolecules. Less commonly considered is the transferability of these methods to other solvents. The Statistical Assessment of Modeling of Proteins and Ligands 5 (SAMPL5) distribution coefficient dataset and the accompanying explicit solvent partition coefficient reference calculations provide a direct test of solvent model transferability. Here we use the 3D reference interaction site model (3D-RISM) statistical-mechanical solvation theory, with a well tested water model and a new united atom cyclohexane model, to calculate partition coefficients for the SAMPL5 dataset. The cyclohexane model performed well in training and testing ([Formula: see text] for amino acid neutral side chain analogues) but only if a parameterized solvation free energy correction was used. In contrast, the same protocol, using single solute conformations, performed poorly on the SAMPL5 dataset, obtaining [Formula: see text] compared to the reference partition coefficients, likely due to the much larger solute sizes. Including solute conformational sampling through molecular dynamics coupled with 3D-RISM (MD/3D-RISM) improved agreement with the reference calculation to [Formula: see text]. Since our initial calculations only considered partition coefficients and not distribution coefficients, solute sampling provided little benefit comparing against experiment, where ionized and tautomer states are more important. Applying a simple [Formula: see text] correction improved agreement with experiment from [Formula: see text] to [Formula: see text], despite a small number of outliers. Better agreement is possible by accounting for tautomers and improving the ionization correction.
Altinok, Ilhan; Capkin, Erol; Boran, Halis
2011-06-01
Effects of water volume and water column height on toxicity of cypermethrin, carbaryl, dichlorvos, tetradifon, maneb, captan, carbosulfan endosulfan and HgCl₂ to juvenile rainbow trout (Oncorhynchus mykiss, 3.2 ± 0.7 g) were evaluated in different glass aquaria under static conditions. When fish were exposed to the chemical compounds in 23 cm water column height (25 L), their mortality ranged between 0% and 58%. At the same water volume, but lower water column height (9 cm), mortality of fish increased significantly and was in a range from 60% to 95%. At the same water column height, toxic effects of chemicals were significantly higher in 25 L water volume than that of 8.5 L, water except maneb which has lowest (-0.45) octanol-water partition coefficient value. Mortality rates ratio of 9 and 23 cm water column height ranged between 1.12 and 90 while mortality rates ratio of 9 and 25 L water volume ranged between 1.20 and 4.0. Because actual exposure concentrations were not affected by either water volume or water column height, we propose that increased pesticides' toxicity was related to an increase in bioassay volume, since more pesticide molecules were able to interact with or accumulate the fish. However, there seem to be no relationship between the effects of water volume, water column height and Kow value of chemicals with regard to toxicity in juvenile rainbow trout.
Morikawa, Go; Suzuka, Chihiro; Shoji, Atsushi; Shibusawa, Yoichi; Yanagida, Akio
2016-01-05
A high-throughput method for determining the octanol/water partition coefficient (P(o/w)) of a large variety of compounds exhibiting a wide range in hydrophobicity was established. The method combines a simple shake-flask method with a novel two-phase solvent system comprising an acetonitrile-phosphate buffer (0.1 M, pH 7.4)-1-octanol (25:25:4, v/v/v; AN system). The AN system partition coefficients (K(AN)) of 51 standard compounds for which log P(o/w) (at pH 7.4; log D) values had been reported were determined by single two-phase partitioning in test tubes, followed by measurement of the solute concentration in both phases using an automatic flow injection-ultraviolet detection system. The log K(AN) values were closely related to reported log D values, and the relationship could be expressed by the following linear regression equation: log D=2.8630 log K(AN) -0.1497(n=51). The relationship reveals that log D values (+8 to -8) for a large variety of highly hydrophobic and/or hydrophilic compounds can be estimated indirectly from the narrow range of log K(AN) values (+3 to -3) determined using the present method. Furthermore, log K(AN) values for highly polar compounds for which no log D values have been reported, such as amino acids, peptides, proteins, nucleosides, and nucleotides, can be estimated using the present method. The wide-ranging log D values (+5.9 to -7.5) of these molecules were estimated for the first time from their log K(AN) values and the above regression equation. Copyright © 2015 Elsevier B.V. All rights reserved.
Energy Technology Data Exchange (ETDEWEB)
Yankovich, Tamara L. [International Atomic Energy Agency, P.O. Box 100, 1400 Vienna (Austria); Shultz, Carmen; Hartwig, Dale; Wills, C. Anne [Atomic Energy of Canada Limited, Chalk River Laboratories, Chalk River, Ontario, K0J 1J0 (Canada); Beresford, Nicholas A. [NERC Centre for Ecology and Hydrology, Lancaster Environment Center, Library Av., Bailrigg, Lancaster, LA1 4AP (United Kingdom); School of Environment and Life Sciences, University of Salford, Manchester, M4 4WT (United Kingdom); Wood, Michael D. [School of Environment and Life Sciences, University of Salford, Manchester, M4 4WT (United Kingdom)
2014-07-01
Sediments often represent an important reservoir for contaminants, such as radionuclides and metals, in aquatic ecosystems. Consequently, lake, stream, and river sediments can potentially act as significant contributors to the total contaminant exposure and radiological doses received by wildlife. Exposure to contaminated sediments is dependent upon several factors. These include net contaminant inputs to a system through time, the physicochemical attributes of the system, the tendency of each contaminant to partition into the sediments relative to water, the spatial distribution of contaminants in the sediments, and the behaviour or life-style of the biota inhabiting a water body. Increased understanding of such factors and their interactions will lead to improved predictions of the radionuclide exposure received by aquatic biota, particularly benthic organisms. Despite the complexity and the dynamic nature of sediments in general, for practical purposes, in environmental impact assessments (EIAs), it is often assumed that radionuclide activity concentrations in various compartments are at steady state with respect to one another. Therefore, ratios can be used to estimate concentrations in one compartment given a known concentration in another. In the case of sediments, sediment-to-water partition coefficients (K{sub d}) are often applied to estimate the contaminant concentration sorbed to particulate matter relative to the concentration measured in the surface water. However, K{sub d} values often range by several orders of magnitude between sampling locations due to site-specific differences in physicochemical conditions in surface waters, seasonal factors, as well as differences in sediment attributes that can affect contaminant partitioning between the dissolved and particulate phases. Consequently, in conducting EIAs, it becomes necessary to either apply generic K{sub d} values that ensure contaminant concentrations in sediments to which biota are exposed are
Shoeib, Mahiba; Harner, Tom
2002-05-01
Octanol-air partition coefficients (Koa) were measured directly for 19 organochlorine (OC) pesticides over the temperature range of 5 to 35 degrees C. Values of log Koa at 25 degrees C ranged over three orders of magnitude, from 7.4 for hexachlorobenzene to 10.1 for 1,1-dichloro-2,2-bis(p-chlorophenyl) ethane. Measured values were compared to values calculated as KowRT/H (where R is the ideal gas constant [8.314 J mol(-1) K(-1)], T is absolute temperature, and H is Henry's law constant) were, in general, larger. Discrepancies of up to three orders of magnitude were observed, highlighting the need for direct measurements of Koa. Plots of Koa versus inverse absolute temperature exhibited a log-linear correlation. Enthalpies of phase transition between octanol and air (deltaHoa) were determined from the temperature slopes and were in the range of 56 to 105 kJ mol(-1) K(-1). Activity coefficients in octanol (gamma(o)) were determined from Koa and reported supercooled liquid vapor pressures (pL(o)), and these were in the range of 0.3 to 12, indicating near-ideal solution behavior. Differences in Koa values for structural isomers of hexachlorocyclohexane were also explored. A Koa-based model was described for predicting the partitioning of OC pesticides to aerosols and used to calculate particulate fractions at 25 and -10 degrees C. The model also agreed well with experimental results for several OC pesticides that were equilibrated with urban aerosols in the laboratory. A log-log regression of the particle-gas partition coefficient versus Koa had a slope near unity, indicating that octanol is a good surrogate for the aerosol organic matter.
Cooke, Cindy M; Shaw, George; Collins, Chris D
2004-12-01
Isoproturon and trifluralin are herbicides of contrasting chemical characters and modes of action. Standard batch sorption procedures were carried out to investigate the individual sorption behaviour of 14C-isoproturon and 14C-trifluralin in five agricultural soils (1.8-4.2% OC), and the soil solid-liquid partition coefficients (Kd values) were determined. Trifluralin exhibited strong partitioning to the soil solid phase (Kd range 106-294) and low desorption potential, thus should not pose a threat to sensitive waters via leaching, although particle erosion and preferential flow pathways may facilitate transport. For isoproturon, soil adsorption was low (Kd range 1.96-5.75) and desorption was high, suggesting a high leaching potential, consistent with isoproturon being the most frequently found pesticide in UK surface waters. Soil partitioning was directly related to soil organic carbon (OC) content. Accumulation isotherms were modelled using a dual-phase adsorption model to estimate adsorption and desorption rate coefficients. Associations between herbicides and soil humic substances were also shown using gel filtration chromatography.
Feng, Chenghong; Guo, Xiaoyu; Yin, Su; Tian, Chenhao; Li, Yangyang; Shen, Zhenyao
2017-10-01
The partitioning of ten heavy metals (As, Cd, Co, Cr, Cu, Hg, Ni, Pb, Sb, and Zn) between the water, suspended particulate matter (SPM), and sediments in seven channel sections during three hydrologic seasons in the Yangtze Estuary was comprehensively investigated. Special attention was paid to the role of tides, influential factors (concentrations of SPM and dissolved organic carbon, and particle size), and heavy metal speciation. The SPM-water and sediment-water partition coefficients (K p ) of the heavy metals exhibited similar changes along the channel sections, though the former were larger throughout the estuary. Because of the higher salinity, the K p values of most of the metals were higher in the north branch than in the south branch. The K p values of Cd, Co, and As generally decreased from the wet season to the dry season. Both the diagonal line method and paired samples t-test showed that no specific phase transfer of heavy metals existed during the flood and ebb tides, but the sediment-water K p was more concentrated for the diagonal line method, owing to the relatively smaller tidal influences on the sediment. The partition coefficients (especially the K p for SPM-water) had negative correlations with the dissolved organic carbon (DOC) but positive correlations were noted with the particle size for most of the heavy metals in sediment. Two types of significant correlations were observed between K p and metal speciation (i.e., exchangeable, carbonate, reducible, organic, and residual fractions), which can be used to identify the dominant phase-partition mechanisms (e.g., adsorption or desorption) of heavy metals. Copyright © 2017 Elsevier Ltd. All rights reserved.
Sediment pore water distribution coefficients of PCB congeners in enriched black carbon sediment
International Nuclear Information System (INIS)
Martinez, Andres; O'Sullivan, Colin; Reible, Danny; Hornbuckle, Keri C.
2013-01-01
More than 2300 sediment pore water distribution coefficients (K PCBids ) of 93 polychlorinated biphenyls (PCBs) were measured and modeled from sediments from Indiana Harbor and Ship Canal. K PCBids were calculated from previously reported bulk sediment values and newly analyzed pore water. PCBs in pore waters were measured using SPME PDMS-fiber and ∑PCB ranged from 41 to 1500 ng L −1 . The resulting K PCBids were ∼1 log unit lower in comparison to other reported values. A simple model for the K PCBid consisted of the product of the organic carbon fraction and the octanol–water partition coefficient and provided an excellent prediction for the measured values, with a mean square error of 0.09 ± 0.06. Although black carbon content is very high in these sediments and was expected to play an important role in the distribution of PCBs, no improvement was obtained when a two-carbon model was used. -- Highlights: •PCB sediment-pore water distribution coefficients were measured and modeled. •Distribution coefficients were lower in comparison to other reported values. •Organic carbon fraction times the K OW yielded the best prediction model. •The incorporation of black carbon into a model did not improve the results. -- The organic carbon fraction times the octanol–water partition coefficient yielded the best prediction model for the sediment pore water distribution coefficient of PCBs
Energy Technology Data Exchange (ETDEWEB)
Cooke, Cindy M. [Department of Environmental Science and Technology, Faculty of Life Sciences, Imperial College London, Silwood Park Campus, Ascot, Berkshire SL5 7PY (United Kingdom)]. E-mail: cindy.cooke@imperial.ac.uk; Shaw, George [Department of Environmental Science and Technology, Faculty of Life Sciences, Imperial College London, Silwood Park Campus, Ascot, Berkshire SL5 7PY (United Kingdom); Collins, Chris D. [Department of Environmental Science and Technology, Faculty of Life Sciences, Imperial College London, Silwood Park Campus, Ascot, Berkshire SL5 7PY (United Kingdom)
2004-12-01
Isoproturon and trifluralin are herbicides of contrasting chemical characters and modes of action. Standard batch sorption procedures were carried out to investigate the individual sorption behaviour of {sup 14}C-isoproturon and {sup 14}C-trifluralin in five agricultural soils (1.8-4.2% OC), and the soil solid-liquid partition coefficients (K{sub d} values) were determined. Trifluralin exhibited strong partitioning to the soil solid phase (K{sub d} range 106-294) and low desorption potential, thus should not pose a threat to sensitive waters via leaching, although particle erosion and preferential flow pathways may facilitate transport. For isoproturon, soil adsorption was low (K{sub d} range 1.96-5.75) and desorption was high, suggesting a high leaching potential, consistent with isoproturon being the most frequently found pesticide in UK surface waters. Soil partitioning was directly related to soil organic carbon (OC) content. Accumulation isotherms were modelled using a dual-phase adsorption model to estimate adsorption and desorption rate coefficients. Associations between herbicides and soil humic substances were also shown using gel filtration chromatography. - Capsule: Herbicide soil sorption described by a dual-phase adsorption model reflected soil partitioning, as influenced by soil OC and humic substances.
Beelen P van; Verbruggen EMJ; Peijnenburg WJGM; ECO
2002-01-01
The equilibrium partitioning method (EqP-method) can be used to derive environmental quality standards (like the Maximum Permissible Concentration or the intervention value) for soil or sediment, from aquatic toxicity data and a soil/water or sediment/water partitioning coefficient. The validity of
DEFF Research Database (Denmark)
Jelnes, R; Astrup, A
1985-01-01
131Iodo-antipyrine (131I-AP) is commonly used for blood flow measurements in adipose tissue. These estimations have been based on the assumption of the tissue-to-blood partition coefficient being 1 ml g-1. No exact determination of the tissue-to-blood partition coefficient for 131I-AP in adipose...... tissue has been carried out. In the present study a partition coefficient of 1.12 +/- 0.06 (mean +/- S.D.) for 131I-AP in adipose tissue has been determined based on the partition coefficient for 131I-AP between lipid-saline (1.24 ml g-1), red blood cells-plasma (0.64 ml g-1), protein-saline (0.19 ml g-1...
Soulsby, David; Chica, Jeryl A M
2017-08-01
We have developed a simple, direct and novel method for the determination of partition coefficients and partitioning behavior using 1 H NMR spectroscopy combined with time domain complete reduction to amplitude-frequency tables (CRAFT). After partitioning into water and 1-octanol using standard methods, aliquots from each layer are directly analyzed using either proton or selective excitation NMR experiments. Signal amplitudes for each compound from each layer are then extracted directly from the time domain data in an automated fashion and analyzed using the CRAFT software. From these amplitudes, log P and log D 7.4 values can be calculated directly. Phase, baseline and internal standard issues, which can be problematic when Fourier transformed data are used, are unimportant when using time domain data. Furthermore, analytes can contain impurities because only a single resonance is examined and need not be UV active. Using this approach, we examined a variety of pharmaceutically relevant compounds and determined partition coefficients that are in excellent agreement with literature values. To demonstrate the utility of this approach, we also examined salicylic acid in more detail demonstrating an aggregation effect as a function of sample loading and partition coefficient behavior as a function of pH value. This method provides a valuable addition to the medicinal chemist toolbox for determining these important constants. Copyright © 2017 John Wiley & Sons, Ltd. Copyright © 2017 John Wiley & Sons, Ltd.
Zhu, Hui; Yang, Ri-Fang; Yun, Liu-Hong; Jiang, Yu; Li, Jin
2009-09-01
This paper is to establish a reversed-phase ion-pair chromatography (RP-IPC) method for universal estimation of the octanol/water partition coefficients (logP) of a wide range of structurally diverse compounds including acidic, basic, neutral and amphoteric species. The retention factors corresponding to 100% water (logk(w)) were derived from the linear part of the logk'/phi relationship, using at least four isocratic logk' values containing different organic compositions. The logk(w) parameters obtained were close to the corresponding logP values obtained with the standard "shake flask" methods. The mean deviation for test drugs is 0.31. RP-IPC with trifluoroacetic acid as non classic ion-pair agents can be applicable to determine the logP values for a variety of drug-like molecules with increased accuracy.
Measured and numerically partitioned phytoplankton spectral absorption coefficients in inland waters
Zhang, Y.; Liu, M.; Van Dijk, M.A.; Zhu, G.; Gong, Z.; Li, Y.M.; Qin, B.
2009-01-01
Total particulate, tripton and phytoplankton absorption coefficients were measured for eutrophic (Lake Taihu), meso-eutrophic (Lake Tianmuhu) and mesotrophic waters (the Three Gorges Reservoir) in China using the quantitative filter technique. Meanwhile, tripton and phytoplankton absorption
International Nuclear Information System (INIS)
Marquez, N.; Bravo, B.; Ysambertt, F.; Chavez, G.; Subero, N.; Salager, J.L.
2002-01-01
Oligomer distribution of polyethoxylated alcohol and polyethoxylated nonylphenol surfactants is studied by normal and reverse-phase high performance liquid chromatography (HPLC). A RP8 column is able to efficiently separate these surfactants according to their alkyl chain (lipophilic) group, while silica and amino columns separate them according to their polyether chain length (hydrophilic group). Polyethoxylated alcohol and polyethoxylated nonylphenol oligomers selectively partition between the microemulsion-oil-water phases of a Winsor III system. Partitioning of these oligomers was analyzed by HPLC with RI detection. The logarithm of the partition coefficient between the water and oil linearly increases with the number of ethylene oxide groups per molecule of oligomer. For a same ethoxylation degree, the partition coefficient of a polyethoxylated tridecanol is found to be higher than the one of the corresponding nonylphenol specie. On the other hand, a polyethoxylated nonylphenol exhibits a higher solubilization than the matching polyethoxylated alcohol
Li, Li; Wang, Qiang; Qiu, Xinghua; Dong, Yian; Jia, Shenglan; Hu, Jianxin
2014-07-15
Characterizing pseudo equilibrium-status soil/vegetation partition coefficient KSV, the quotient of respective concentrations in soil and vegetation of a certain substance at remote background areas, is essential in ecological risk assessment, however few previous attempts have been made for field determination and developing validated and reproducible structure-based estimates. In this study, KSV was calculated based on measurements of seventeen 2,3,7,8-substituted PCDD/F congeners in soil and moss (Dicranum angustum), and rouzi grass (Thylacospermum caespitosum) of two background sites, Ny-Ålesund of the Arctic and Zhangmu-Nyalam region of the Tibet Plateau, respectively. By both fugacity modeling and stepwise regression of field data, the air-water partition coefficient (KAW) and aqueous solubility (SW) were identified as the influential physicochemical properties. Furthermore, validated quantitative structure-property relationship (QSPR) model was developed to extrapolate the KSV prediction to all 210 PCDD/F congeners. Molecular polarizability, molecular size and molecular energy demonstrated leading effects on KSV. Copyright © 2014 Elsevier B.V. All rights reserved.
DEFF Research Database (Denmark)
Franco, Antonio; Trapp, Stefan
2008-01-01
The sorption of organic electrolytes to soil was investigated. A dataset consisting of 164 electrolytes, composed of 93 acids, 65 bases, and six amphoters, was collected from literature and databases. The partition coefficient log KOW of the neutral molecule and the dissociation constant pKa were...... calculated by the software ACD/Labs®. The Henderson-Hasselbalch equation was applied to calculate dissociation. Regressions were developed to predict separately for the neutral and the ionic molecule species the distribution coefficient (Kd) normalized to organic carbon (KOC) from log KOW and pKa. The log...... KOC of strong acids (pKa correlated to these parameters. The regressions derived for weak acids and bases (undissociated at environmental pH) were similar. The highest sorption was found for strong bases (pKa > 7.5), probably due to electrical interactions. Nonetheless, their log KOC...
Trophic magnification of PCBs and Its relationship to the octanol-water partition coefficient.
Walters, David M; Mills, Marc A; Cade, Brian S; Burkard, Lawrence P
2011-05-01
We investigated polychlorinated biphenyl (PCB) bioaccumulation relative to octanol-water partition coefficient (K(OW)) and organism trophic position (TP) at the Lake Hartwell Superfund site (South Carolina). We measured PCBs (127 congeners) and stable isotopes (δ¹⁵N) in sediment, organic matter, phytoplankton, zooplankton, macroinvertebrates, and fish. TP, as calculated from δ¹⁵N, was significantly, positively related to PCB concentrations, and food web trophic magnification factors (TMFs) ranged from 1.5-6.6 among congeners. TMFs of individual congeners increased strongly with log K(OW), as did the predictive power (r²) of individual TP-PCB regression models used to calculate TMFs. We developed log K(OW)-TMF models for eight food webs with vastly different environments (freshwater, marine, arctic, temperate) and species composition (cold- vs warmblooded consumers). The effect of K(OW) on congener TMFs varied strongly across food webs (model slopes 0.0-15.0) because the range of TMFs among studies was also highly variable. We standardized TMFs within studies to mean = 0, standard deviation (SD) = 1 to normalize for scale differences and found a remarkably consistent K(OW) effect on TMFs (no difference in model slopes among food webs). Our findings underscore the importance of hydrophobicity (as characterized by K(OW)) in regulating bioaccumulation of recalcitrant compounds in aquatic systems, and demonstrate that relationships between chemical K(OW) and bioaccumulation from field studies are more generalized than previously recognized.
Copolovici, Lucian O; Niinemets, Ulo
2005-12-01
To model the emission dynamics and changes in fractional composition of monoterpenoids from plant leaves, temperature dependencies of equilibrium coefficients must be known. Henry's law constants (H(pc), Pa m3 mol(-1) and octanol/water partition coefficients (K(OW), mol mol(-1)) were determined for 10 important plant monoterpenes at physiological temperature ranges (25-50 degrees C for H(pc) and 20-50 degrees C for K(OW)). A standard EPICS procedure was established to determine H(pc) and a shake flask method was used for the measurements of K(OW). The enthalpy of volatilization (deltaH(vol)) varied from 18.0 to 44.3 kJ mol(-1) among the monoterpenes, corresponding to a range of temperature-dependent increase in H(pc) between 1.3- and 1.8-fold per 10 degrees C rise in temperature. The enthalpy of water-octanol phase change varied from -11.0 to -23.8 kJ mol(-1), corresponding to a decrease of K(OW) between 1.15- and 1.32-fold per 10 degrees C increase in temperature. Correlations among physico-chemical characteristics of a wide range of monoterpenes were analyzed to seek the ways of derivation of H(pc) and K(OW) values from other monoterpene physico-chemical characteristics. H(pc) was strongly correlated with monoterpene saturated vapor pressure (P(v)), and for lipophilic monoterpenes, deltaH(vol) scaled positively with the enthalpy of vaporization that characterizes the temperature dependence of P(v) Thus, P(v) versus temperature relations may be employed to derive the temperature relations of H(pc) for these monoterpenes. These data collectively indicate that monoterpene differences in H(pc) and K(OW) temperature relations can importantly modify monoterpene emissions from and deposition on plant leaves.
Lomond, Jasmine S; Tong, Anthony Z
2011-01-01
Analysis of dissolved methane, ethylene, acetylene, and ethane in water is crucial in evaluating anaerobic activity and investigating the sources of hydrocarbon contamination in aquatic environments. A rapid chromatographic method based on phase equilibrium between water and its headspace is developed for these analytes. The new method requires minimal sample preparation and no special apparatus except those associated with gas chromatography. Instead of Henry's Law used in similar previous studies, partition coefficients are used for the first time to calculate concentrations of dissolved hydrocarbon gases, which considerably simplifies the calculation involved. Partition coefficients are determined to be 128, 27.9, 1.28, and 96.3 at 30°C for methane, ethylene, acetylene, and ethane, respectively. It was discovered that the volume ratio of gas-to-liquid phase is critical to the accuracy of the measurements. The method performance can be readily improved by reducing the volume ratio of the two phases. Method validation shows less than 6% variation in accuracy and precision except at low levels of methane where interferences occur in ambient air. Method detection limits are determined to be in the low ng/L range for all analytes. The performance of the method is further tested using environmental samples collected from various sites in Nova Scotia.
Dargó, Gergő; Boros, Krisztina; Péter, László; Malanga, Milo; Sohajda, Tamás; Szente, Lajos; Balogh, György T
2018-05-05
The present study was aimed to develop a medium-throughput screening technique for investigation of cyclodextrin (CD)-active pharmaceutical ingredient (API) complexes. Dual-phase potentiometric lipophilicity measurement, as gold standard technique, was combined with the partition coefficient method (plotting the reciprocal of partition coefficients of APIs as a function of CD concentration). A general equation was derived for determination of stability constants of 1:1 CD-API complexes (K 1:1,CD ) based on solely the changes of partition coefficients (logP o/w N -logP app N ), without measurement of the actual API concentrations. Experimentally determined logP value (-1.64) of 6-deoxy-6[(5/6)-fluoresceinylthioureido]-HPBCD (FITC-NH-HPBCD) was used to estimate the logP value (≈ -2.5 to -3) of (2-hydroxypropyl)-ß-cyclodextrin (HPBCD). The results suggested that the amount of HPBCD can be considered to be inconsequential in the octanol phase. The decrease of octanol volume due to the octanol-CD complexation was considered, thus a corrected octanol-water phase ratio was also introduced. The K 1:1,CD values obtained by this developed method showed a good accordance with the results from other orthogonal methods. Copyright © 2018 Elsevier B.V. All rights reserved.
Sanagi, Mohd Marsin; Miskam, Mazidatulakmam; Wan Ibrahim, Wan Aini; Hermawan, Dadan; Aboul-Enein, Hassan Y
2010-07-01
A three-phase hollow fiber liquid-phase microextraction method coupled with CE was developed and used for the determination of partition coefficients and analysis of selected nitrophenols in water samples. The selected nitrophenols were extracted from 14 mL of aqueous solution (donor solution) with the pH adjusted to pH 3 into an organic phase (1-octanol) immobilized in the pores of the hollow fiber and finally backextracted into 40.0 microL of the acceptor phase (NaOH) at pH 12.0 located inside the lumen of the hollow fiber. The extractions were carried out under the following optimum conditions: donor solution, 0.05 M H(3)PO(4), pH 3.0; organic solvent, 1-octanol; acceptor solution, 40 microL of 0.1 M NaOH, pH 12.0; agitation rate, 1050 rpm; extraction time, 15 min. Under optimized conditions, the calibration curves for the analytes were linear in the range of 0.05-0.30 mg/L with r(2)>0.9900 and LODs were in the range of 0.01-0.04 mg/L with RSDs of 1.25-2.32%. Excellent enrichment factors of up to 398-folds were obtained. It was found that the partition coefficient (K(a/d)) values were high for 2-nitrophenol, 3-nitrophenol, 4-nitrophenol, 2,4-dinitrophenol and 2,6-dinitrophenol and that the individual partition coefficients (K(org/d) and K(a/org)) promoted efficient simultaneous extraction from the donor through the organic phase and further into the acceptor phase. The developed method was successfully applied for the analysis of water samples.
Alternative measures of lipophilicity: from octanol-water partitioning to IAM retention.
Giaginis, Costas; Tsantili-Kakoulidou, Anna
2008-08-01
This review describes lipophilicity parameters currently used in drug design and QSAR studies. After a short historical overview, the complex nature of lipophilicity as the outcome of polar/nonpolar inter- and intramolecular interactions is analysed and considered as the background for the discussion of the different lipophilicity descriptors. The first part focuses on octanol-water partitioning of neutral and ionisable compounds, evaluates the efficiency of predictions and provides a short description of the experimental methods for the determination of distribution coefficients. A next part is dedicated to reversed-phase chromatographic techniques, HPLC and TLC in lipophilicity assessment. The two methods are evaluated for their efficiency to simulate octanol-water and the progress achieved in the refinement of suitable chromatographic conditions, in particular in the field of HPLC, is outlined. Liposomes as direct models of biological membranes are examined and phospolipophilicity is compared to the traditional lipophilicity concept. Difficulties associated with liposome-water partitioning are discussed. The last part focuses on Immobilised Artificial Membrane (IAM) chromatography as an alternative which combines membrane simulation with rapid measurements. IAM chromatographic retention is compared to octanol-water and liposome-water partitioning as well as to reversed-phase retention and its potential to predict biopartitioning and biological activities is discussed.
Liang, Chao; Qiao, Jun-Qin; Lian, Hong-Zhen
2017-12-15
Reversed-phase liquid chromatography (RPLC) based octanol-water partition coefficient (logP) or distribution coefficient (logD) determination methods were revisited and assessed comprehensively. Classic isocratic and some gradient RPLC methods were conducted and evaluated for neutral, weak acid and basic compounds. Different lipophilicity indexes in logP or logD determination were discussed in detail, including the retention factor logk w corresponding to neat water as mobile phase extrapolated via linear solvent strength (LSS) model from isocratic runs and calculated with software from gradient runs, the chromatographic hydrophobicity index (CHI), apparent gradient capacity factor (k g ') and gradient retention time (t g ). Among the lipophilicity indexes discussed, logk w from whether isocratic or gradient elution methods best correlated with logP or logD. Therefore logk w is recommended as the preferred lipophilicity index for logP or logD determination. logk w easily calculated from methanol gradient runs might be the main candidate to replace logk w calculated from classic isocratic run as the ideal lipophilicity index. These revisited RPLC methods were not applicable for strongly ionized compounds that are hardly ion-suppressed. A previously reported imperfect ion-pair RPLC method was attempted and further explored for studying distribution coefficients (logD) of sulfonic acids that totally ionized in the mobile phase. Notably, experimental logD values of sulfonic acids were given for the first time. The IP-RPLC method provided a distinct way to explore logD values of ionized compounds. Copyright © 2017 Elsevier B.V. All rights reserved.
Experimental determination of the partitioning coefficient of β-pinene oxidation products in SOAs.
Hohaus, Thorsten; Gensch, Iulia; Kimmel, Joel; Worsnop, Douglas R; Kiendler-Scharr, Astrid
2015-06-14
The composition of secondary organic aerosols (SOAs) formed by β-pinene ozonolysis was experimentally investigated in the Juelich aerosol chamber. Partitioning of oxidation products between gas and particles was measured through concurrent concentration measurements in both phases. Partitioning coefficients (Kp) of 2.23 × 10(-5) ± 3.20 × 10(-6) m(3) μg(-1) for nopinone, 4.86 × 10(-4) ± 1.80 × 10(-4) m(3) μg(-1) for apoverbenone, 6.84 × 10(-4) ± 1.52 × 10(-4) m(3) μg(-1) for oxonopinone and 2.00 × 10(-3) ± 1.13 × 10(-3) m(3) μg(-1) for hydroxynopinone were derived, showing higher values for more oxygenated species. The observed Kp values were compared with values predicted using two different semi-empirical approaches. Both methods led to an underestimation of the partitioning coefficients with systematic differences between the methods. Assuming that the deviation between the experiment and the model is due to non-ideality of the mixed solution in particles, activity coefficients of 4.82 × 10(-2) for nopinone, 2.17 × 10(-3) for apoverbenone, 3.09 × 10(-1) for oxonopinone and 7.74 × 10(-1) for hydroxynopinone would result using the vapour pressure estimation technique that leads to higher Kp. We discuss that such large non-ideality for nopinone could arise due to particle phase processes lowering the effective nopinone vapour pressure such as diol- or dimer formation. The observed high partitioning coefficients compared to modelled results imply an underestimation of SOA mass by applying equilibrium conditions.
Schacht, Veronika J; Grant, Sharon C; Escher, Beate I; Hawker, Darryl W; Gaus, Caroline
2016-06-01
Partitioning of super-hydrophobic organic contaminants (SHOCs) to dissolved or colloidal materials such as surfactants can alter their behaviour by enhancing apparent aqueous solubility. Relevant partition constants are, however, challenging to quantify with reasonable accuracy. Partition constants to colloidal surfactants can be measured by introducing a polymer (PDMS) as third phase with known PDMS-water partition constant in combination with the mass balance approach. We quantified partition constants of PCBs and PCDDs (log KOW 5.8-8.3) between water and sodium dodecyl sulphate monomers (KMO) and micelles (KMI). A refined, recently introduced swelling-based polymer loading technique allowed highly precise (4.5-10% RSD) and fast (KMO. SHOC losses to experimental surfaces were substantial (8-26%) in monomer solutions, but had a low impact on KMO (0.10-0.16 log units). Log KMO for PCDDs (4.0-5.2) were approximately 2.6 log units lower than respective log KMI, which ranged from 5.2 to 7.0 for PCDDs and 6.6-7.5 for PCBs. The linear relationship between log KMI and log KOW was consistent with more polar and moderately hydrophobic compounds. Apparent solubility increased with increasing hydrophobicity and was highest in micelle solutions. However, this solubility enhancement was also considerable in monomer solutions, up to 200 times for OCDD. Given the pervasive presence of surfactant monomers in typical field scenarios, these data suggest that low surfactant concentrations may be effective long-term facilitators for subsurface transport of SHOCs. Copyright © 2016 Elsevier Ltd. All rights reserved.
Ming, Xin; Han, Shu-ying; Qi, Zheng-chun; Sheng, Dong; Lian, Hong-zhen
2009-08-15
Although simple acids, replacing buffers, have been widely applied to suppress the ionization of weakly ionizable acidic analytes in reversed-phase liquid chromatography (RPLC), none of the previously reported works focused on the systematic studies about the retention behavior of the acidic solutes in this ion-suppression RPLC mode. The subject of this paper was therefore to investigate the retention behavior of monobasic weak acidic compounds using acetic, perchloric and phosphoric acids as the ion-suppressors. The apparent octanol-water partition coefficient (K" ow) was proposed to calibrate the octanol-water partition coefficient (K(ow)) of these weak acidic compounds, which resulted in a better linear correlation with log k(w), the logarithm of the hypothetical retention factor corresponding to neat aqueous fraction of hydroorganic mobile phase. This log K" ow-log k w linear correlation was successfully validated by the results of monocarboxylic acids and monohydrating phenols, and moreover by the results under diverse experimental conditions for the same solutes. This straightforward relationship not only can be used to effectively predict the retention values of weak acidic solutes combined with Snyder-Soczewinski equation, but also can offer a promising medium for directly measuring K(ow) data of these compounds via Collander equation. In addition, the influence of the different ion-suppressors on the retention of weak acidic compounds was also compared in this RPLC mode.
Lara, A; Riquelme, M; Vöhringer-Martinez, E
2018-05-11
Partition coefficients serve in various areas as pharmacology and environmental sciences to predict the hydrophobicity of different substances. Recently, they have also been used to address the accuracy of force fields for various organic compounds and specifically the methylated DNA bases. In this study, atomic charges were derived by different partitioning methods (Hirshfeld and Minimal Basis Iterative Stockholder) directly from the electron density obtained by electronic structure calculations in a vacuum, with an implicit solvation model or with explicit solvation taking the dynamics of the solute and the solvent into account. To test the ability of these charges to describe electrostatic interactions in force fields for condensed phases, the original atomic charges of the AMBER99 force field were replaced with the new atomic charges and combined with different solvent models to obtain the hydration and chloroform solvation free energies by molecular dynamics simulations. Chloroform-water partition coefficients derived from the obtained free energies were compared to experimental and previously reported values obtained with the GAFF or the AMBER-99 force field. The results show that good agreement with experimental data is obtained when the polarization of the electron density by the solvent has been taken into account, and when the energy needed to polarize the electron density of the solute has been considered in the transfer free energy. These results were further confirmed by hydration free energies of polar and aromatic amino acid side chain analogs. Comparison of the two partitioning methods, Hirshfeld-I and Minimal Basis Iterative Stockholder (MBIS), revealed some deficiencies in the Hirshfeld-I method related to the unstable isolated anionic nitrogen pro-atom used in the method. Hydration free energies and partitioning coefficients obtained with atomic charges from the MBIS partitioning method accounting for polarization by the implicit solvation model
Octanol-air partition coefficients of polybrominated biphenyls.
Hongxia, Zhao; Jingwen, Chen; Xie, Quan; Baocheng, Qu; Xinmiao, Liang
2009-03-01
The octanol-air partition coefficients (K(OA)) for PBB15, PBB26, PBB31, PBB49, PBB103 and PBB153 were determined as a function of temperature using a gas chromatographic retention time technique with 1,1,1-trichloro-2,2-bis (4-chlorophenyl) ethane (p,p'-DDT) as a reference substance. The internal energies of phase change from octanol to air (Delta(OA)U) were calculated for the six compounds and were in the range from 74 to 116 kJ mol(-1). Simple regression equations of log K(OA) versus relative retention times (RRTs) on gas chromatography (GC), and log K(OA) versus molecular connectivity indexes (MCI) were obtained, for which the correlation coefficients (r(2)) were greater than 0.985 at 283.15K and 298.15K. Thus the K(OA) values of the remaining PBBs can be predicted by using their RRTs and MCI according to these relationships.
Yuan, Jintao; Yu, Shuling; Zhang, Ting; Yuan, Xuejie; Cao, Yunyuan; Yu, Xingchen; Yang, Xuan; Yao, Wu
2016-06-01
Octanol/water (K(OW)) and octanol/air (K(OA)) partition coefficients are two important physicochemical properties of organic substances. In current practice, K(OW) and K(OA) values of some polychlorinated biphenyls (PCBs) are measured using generator column method. Quantitative structure-property relationship (QSPR) models can serve as a valuable alternative method of replacing or reducing experimental steps in the determination of K(OW) and K(OA). In this paper, two different methods, i.e., multiple linear regression based on dragon descriptors and hologram quantitative structure-activity relationship, were used to predict generator-column-derived log K(OW) and log K(OA) values of PCBs. The predictive ability of the developed models was validated using a test set, and the performances of all generated models were compared with those of three previously reported models. All results indicated that the proposed models were robust and satisfactory and can thus be used as alternative models for the rapid assessment of the K(OW) and K(OA) of PCBs. Copyright © 2016 Elsevier Inc. All rights reserved.
Directory of Open Access Journals (Sweden)
Pablo Otero-Pazos
2016-01-01
Full Text Available Studies on nanoparticles have focused the attention of the researchers because they can produce nanocomposites that exhibit unexpected hybrid properties. Polymeric materials are commonly used in food packaging, but from the standpoint of food safety, one of the main concerns on the use of these materials is the potential migration of low molecular substances from the packaging into the food. The key parameters of this phenomenon are the diffusion and partition coefficients. Studies on migration from food packaging with nanomaterials are very scarce. This study is focused on the determination of partition coefficients of different model migrants between the low-density polyethylene (LDPE and polypropylene (PP and between LDPE and nanocomposite polypropylene (naPP. The results show that the incorporation of nanoparticles in polypropylene increases the mass transport of model migrants from LDPE to naPP. This quantity of migrants absorbed into PP and naPP depends partially on the nature of the polymer and slightly on the chemical features of the migrant. Relation (RPP/naPP between partition coefficient KLDPE/PP and partition coefficient KLDPE/naPP at 60°C and 80°C shows that only BHT at 60°C has a RPP/naPP less than 1. On the other hand, bisphenol A has the highest RPP/naPP with approximately 50 times more.
Naseem, Bushra; Shah, S. W. H.; Hasan, Aurangzeb; Sakhawat Shah, S.
2010-04-01
Quantitative parameters for interaction of flavonoids—the naturally occurring antioxidants, with solvents and surfactants are determined using UV-visible absorption spectroscopy. The availability of flavonoids; kaempferol, apigenin, kaempferide and rhamnetin in micelles of sodium dodecyl sulfate (SDS) is reflected in terms of partition coefficient, Kc. Thermodynamic calculations show that the process of transfer of flavonoid molecules to anionic micelles of SDS is energy efficient. A distortion in flavonoid's morphology occurs in case of kaempferol and apigenin in surfactant and water, exhibited in terms of a new band in the UV region of electronic spectra of these flavonoids. The partition coefficients of structurally related flavonoids are correlated with their antioxidant activities.
Allgayer, H; Sonnenbichler, J; Kruis, W; Paumgartner, G
1985-01-01
Sulphasalazine (SASP), used in the treatment of inflammatory bowel disease, is split into sulphapyridine (SP) and 5-aminosalicylic acid (5-ASA) in the colon. Lower plasma levels of SASP and 5-ASA as compared to those of SP may be due to different absorption rates from the colon because of different pK values and pH dependent lipid-water partition coefficients. In this study we determined the pK values of 5-ASA and its major metabolite, N-acetyl amino-salicylic acid (AcASA), by 13C-NMR spectroscopy and compared the pH dependent apparent benzene-water partition coefficients (Papp) of SASP, SP and 5-ASA with respect to their different plasma levels. The COOH group of 5-ASA had a pK value of 3.0, the -NH3+ group had 6.0, the -OH group 13.9; the -COOH group of AcASA had 2.7 and the -OH group 12.9; The Papp of SASP (0.042 +/- 0.004) and 5-ASA (0.059 +/- 0.01) were significantly lower than that of SP (0.092 +/- 0.03) (at pH 5.5).
International Nuclear Information System (INIS)
Jang, Jiyi; Kim, Hyunji; Han, Seunghee
2014-01-01
It is known that particle scavenging of mercury (Hg) can be affected by the abundance of particulate organic matter in coastal waters. However, the role of living organic particles in Hg scavenging is not yet completely understood. In this study, we hypothesized that an abundance of living organic particles (i.e., phytoplankton and bacteria) would influence the particle–water partitioning of Hg in coastal waters. Surface seawater samples were collected from eight stations in Gwangyang Bay, Korea, in three seasons (November 2009, April 2010, and October 2010) for the determination of concentrations of suspended particulate matter (including chlorophyll-a and bacteria), and Hg in unfiltered and filtered waters. We found that more Hg partitioned toward particulate matter when phytoplankton biomass, indicated from the chlorophyll-a concentration in a particle, was higher. In the low algal season, when [chlorophyll-a] −1 , the bacterial number, instead of chlorophyll-a concentration in particle, showed a positive correlation with the particle–water partition coefficient of Hg. Overall, microbial abundance seems to play a critical role in particle scavenging of Hg in coastal water. Taking this result in light of Hg in pristine coastal zones, we predict that increases in algal biomass amplify the potential for algae to transfer Hg to marine food chains. - Highlights: • Abundance of phytoplankton and bacteria influenced particle–water partitioning of Hg. • More Hg partitioned toward particles when microorganism biomass in particle is large. • Increases of algal biomass may enhance Hg bioaccumulation in coastal ecosystem
Energy Technology Data Exchange (ETDEWEB)
Jang, Jiyi [School of Environmental Science and Engineering, Gwangju Institute of Science and Technology (GIST), Gwangju 500-712 (Korea, Republic of); Global Bioresources Research Center, Korea Institute of Ocean Science and Technology (KIOST), Ansan 426-744 (Korea, Republic of); Kim, Hyunji [School of Environmental Science and Engineering, Gwangju Institute of Science and Technology (GIST), Gwangju 500-712 (Korea, Republic of); Han, Seunghee, E-mail: shan@gist.ac.kr [School of Environmental Science and Engineering, Gwangju Institute of Science and Technology (GIST), Gwangju 500-712 (Korea, Republic of)
2014-02-01
It is known that particle scavenging of mercury (Hg) can be affected by the abundance of particulate organic matter in coastal waters. However, the role of living organic particles in Hg scavenging is not yet completely understood. In this study, we hypothesized that an abundance of living organic particles (i.e., phytoplankton and bacteria) would influence the particle–water partitioning of Hg in coastal waters. Surface seawater samples were collected from eight stations in Gwangyang Bay, Korea, in three seasons (November 2009, April 2010, and October 2010) for the determination of concentrations of suspended particulate matter (including chlorophyll-a and bacteria), and Hg in unfiltered and filtered waters. We found that more Hg partitioned toward particulate matter when phytoplankton biomass, indicated from the chlorophyll-a concentration in a particle, was higher. In the low algal season, when [chlorophyll-a] < 0.6 μg L{sup −1}, the bacterial number, instead of chlorophyll-a concentration in particle, showed a positive correlation with the particle–water partition coefficient of Hg. Overall, microbial abundance seems to play a critical role in particle scavenging of Hg in coastal water. Taking this result in light of Hg in pristine coastal zones, we predict that increases in algal biomass amplify the potential for algae to transfer Hg to marine food chains. - Highlights: • Abundance of phytoplankton and bacteria influenced particle–water partitioning of Hg. • More Hg partitioned toward particles when microorganism biomass in particle is large. • Increases of algal biomass may enhance Hg bioaccumulation in coastal ecosystem.
The complex formation-partition and partition-association models of solvent extraction of ions
International Nuclear Information System (INIS)
Siekierski, S.
1976-01-01
Two models of the extraction process have been proposed. In the first model it is assumed that the partitioning neutral species is at first formed in the aqueous phase and then transferred into the organic phase. The second model is based on the assumption that equivalent amounts of cations are at first transferred from the aqueous into the organic phase and then associated to form a neutral molecule. The role of the solubility parameter in extraction and the relation between the solubility of liquid organic substances in water and the partition of complexes have been discussed. The extraction of simple complexes and complexes with organic ligands has been discussed using the first model. Partition coefficients have been calculated theoretically and compared with experimental values in some very simple cases. The extraction of ion pairs has been discussed using the partition-association model and the concept of single-ion partition coefficients. (author)
Pradhan, Snigdhendubala; Boernick, Hilmar; Kumar, Pradeep; Mehrotra, Indu
2016-07-15
The correlation between octanol-water partition coefficient (KOW) and the transport of aqueous samples containing single organic compound is well documented. The concept of the KOW of river water containing the mixture of organics was evolved by Pradhan et al. (2015). The present study aims at determining the KOW and sorption parameters of synthetic aqueous samples and river water to finding out the correlation, if any. The laboratory scale columns packed with aquifer materials were fed with synthetic and river water samples. Under the operating conditions, the compounds in the samples did not separate, and all the samples that contain more than one organic compound yielded a single breakthrough curve. Breakthrough curves simulated from sorption isotherms were compared with those from the column runs. The sorption parameters such as retardation factor (Rf), height of mass transfer zone (HMTZ), rate of mass transfer zone (RMTZ), breakpoint column capacity (qb) and maximum column capacity (qx) estimated from column runs, sorption isotherms and models developed by Yoon-Nelson, Bohart-Adam and Thomas were in agreement. The empirical correlations were found between the KOW and sorption parameters. The transport of the organics measured as dissolved organic carbon (DOC) through the aquifer can be predicted from the KOW of the river water and other water samples. The novelty of the study is to measure KOW and to envisage the fate of the DOC of the river water, particularly during riverbank filtration. Statistical analysis of the results revealed a fair agreement between the observed and computed values. Copyright © 2016 Elsevier Ltd. All rights reserved.
Effect of water on the local electric potential of simulated ionic micelles
Energy Technology Data Exchange (ETDEWEB)
Brodskaya, Elena N.; Vanin, Alexander A., E-mail: alexvanin@yandex.ru [Institute of Chemistry, St. Petersburg State University, Universitetskiy pr. 26, Petrodvoretz, St. Petersburg 198504 (Russian Federation)
2015-07-28
Ionic micelles in an aqueous solution containing single-charged counter-ions have been simulated by molecular dynamics. For both cationic and anionic micelles, it has been demonstrated that explicit description of solvent has strong effect on the micelle’s electric field. The sign of the local charge alters in the immediate vicinity of the micellar crown and the electric potential varies nonmonotonically. Two micelle models have been examined: the hybrid model with a rigid hydrocarbon core and the atomistic model. For three molecular models of water (Simple Point Charge model (SPC), Transferable Intermolecular Potential 5- Points (TIP5P) and two-centered S2), the results have been compared with those for the continuum solvent model. The orientational ordering of solvent molecules has strong effect on the local electric field surprisingly far from the micelle surface.
A layer model of ethanol partitioning into lipid membranes.
Nizza, David T; Gawrisch, Klaus
2009-06-01
The effect of membrane composition on ethanol partitioning into lipid bilayers was assessed by headspace gas chromatography. A series of model membranes with different compositions have been investigated. Membranes were exposed to a physiological ethanol concentration of 20 mmol/l. The concentration of membranes was 20 wt% which roughly corresponds to values found in tissue. Partitioning depended on the chemical nature of polar groups at the lipid/water interface. Compared to phosphatidylcholine, lipids with headgroups containing phosphatidylglycerol, phosphatidylserine, and sphingomyelin showed enhanced partitioning while headgroups containing phosphatidylethanolamine resulted in a lower partition coefficient. The molar partition coefficient was independent of a membrane's hydrophobic volume. This observation is in agreement with our previously published NMR results which showed that ethanol resides almost exclusively within the membrane/water interface. At an ethanol concentration of 20 mmol/l in water, ethanol concentrations at the lipid/water interface are in the range from 30-15 mmol/l, corresponding to one ethanol molecule per 100-200 lipids.
Kitt, Jay P; Bryce, David A; Minteer, Shelley D; Harris, Joel M
2018-06-05
The phospholipid-water partition coefficient is a commonly measured parameter that correlates with drug efficacy, small-molecule toxicity, and accumulation of molecules in biological systems in the environment. Despite the utility of this parameter, methods for measuring phospholipid-water partition coefficients are limited. This is due to the difficulty of making quantitative measurements in vesicle membranes or supported phospholipid bilayers, both of which are small-volume phases that challenge the sensitivity of many analytical techniques. In this work, we employ in situ confocal Raman microscopy to probe the partitioning of a model membrane-active compound, 2-(4-isobutylphenyl) propionic acid or ibuprofen, into both hybrid- and supported-phospholipid bilayers deposited on the pore walls of individual chromatographic particles. The large surface-area-to-volume ratio of chromatographic silica allows interrogation of a significant lipid bilayer area within a very small volume. The local phospholipid concentration within a confocal probe volume inside the particle can be as high as 0.5 M, which overcomes the sensitivity limitations of making measurements in the limited membrane areas of single vesicles or planar supported bilayers. Quantitative determination of ibuprofen partitioning is achieved by using the phospholipid acyl-chains of the within-particle bilayer as an internal standard. This approach is tested for measurements of pH-dependent partitioning of ibuprofen into both hybrid-lipid and supported-lipid bilayers within silica particles, and the results are compared with octanol-water partitioning and with partitioning into individual optically trapped phospholipid vesicle membranes. Additionally, the impact of ibuprofen partitioning on bilayer structure is evaluated for both within-particle model membranes and compared with the structural impacts of partitioning into vesicle lipid bilayers.
Hilger, Bettina; Fromme, Hermann; Völkel, Wolfgang; Coelhan, Mehmet
2011-04-01
Log octanol-water partition coefficients (log Kow) of 40 synthesized polychlorinated n-alkanes (PCAs) with different chlorination degrees were determined using reversed-phase high performance liquid chromatography (RP-HPLC). In addition, log Kow values of a technical mixture namely Cereclor 63L as well as 15 individual in house synthesized C10, C11, and C12 chloroalkanes with known chlorine positions were estimated. Based on these results, the effects of chain length, chlorination degree, and structure were explored. The estimated log Kow values ranged from 4.10 (polychlorinated n-decanes with 50.2% chlorine content) to 11.34 (polychlorinated n-octacosanes with 54.8% chlorine content) for PCAs and from 3.82 (1,2,5,6,9,10-hexachlorodecane) to 7.75 (1,1,1,3,9,11,11,11-octachlorododecane) for the individual chloroalkanes studied. The results showed that log Kow value was influenced linearly at a given chlorine content by chain length, while a polynominal effect was observed in dependence on the chlorination degree of an alkane chain. Chlorine substitution pattern influenced markedly the log Kow value of chloroalkanes.
Naseem, Bushra; Shah, S W H; Hasan, Aurangzeb; Sakhawat Shah, S
2010-04-01
Quantitative parameters for interaction of flavonoids-the naturally occurring antioxidants, with solvents and surfactants are determined using UV-visible absorption spectroscopy. The availability of flavonoids; kaempferol, apigenin, kaempferide and rhamnetin in micelles of sodium dodecyl sulfate (SDS) is reflected in terms of partition coefficient, K(c). Thermodynamic calculations show that the process of transfer of flavonoid molecules to anionic micelles of SDS is energy efficient. A distortion in flavonoid's morphology occurs in case of kaempferol and apigenin in surfactant and water, exhibited in terms of a new band in the UV region of electronic spectra of these flavonoids. The partition coefficients of structurally related flavonoids are correlated with their antioxidant activities. Copyright 2010 Elsevier B.V. All rights reserved.
International Nuclear Information System (INIS)
McKim, J.; Schmieder, P.; Veith, G.
1985-01-01
An in vivo fish preparation was used that allowed a direct measure of the transport rates of 14 different organic chemicals across the gills of rainbow trout (Salmo gairdneri). The chemicals, all C14 labeled, were selected from five classes, encompassing a range of octanol-water partition coefficient (log P) values, from 0.23 (ethyl formate) to 7.5 (mirex). The uptake efficiency (extraction efficiency) of each chemical was determined by monitoring the inspired and expired water of trout exposed to each chemical over an exposure period of 1 to 6 hr. The mean gill extraction efficiency for all chemicals tested varied from a low of 7% to a high of 60%, extracted in a single pall of the chemical across the gills. The extraction efficiency of chemicals with log P or 1 or less were low and showed no relationship to log P. These low extraction efficiencies seen at log P of 1 and below with molecular weights below 100 were indicative of aqueous pore transport. The mean extraction efficiency for chemicals with log P values of 1 to 3 seemed to vary directly with log P, to a maximum of slightly greater than 60%, suggesting that uptake was controlled by the lipid membrane. The mean extraction efficiency for chemicals with log P of 3 to 6 was independent of log P and remained at 60%, which suggested that gill uptake was controlled by aqueous diffusion rates rather than gill membrane permeability. The mean extraction efficiency with mirex (log P . 7.5) decreased to 20%
Abraham, Michael H; Gola, Joelle M R; Ibrahim, Adam; Acree, William E; Liu, Xiangli
2014-07-01
There is considerable interest in the blood-tissue distribution of agrochemicals, and a number of researchers have developed experimental methods for in vitro distribution. These methods involve the determination of saline-blood and saline-tissue partitions; not only are they indirect, but they do not yield the required in vivo distribution. The authors set out equations for gas-tissue and blood-tissue distribution, for partition from water into skin and for permeation from water through human skin. Together with Abraham descriptors for the agrochemicals, these equations can be used to predict values for all of these processes. The present predictions compare favourably with experimental in vivo blood-tissue distribution where available. The predictions require no more than simple arithmetic. The present method represents a much easier and much more economic way of estimating blood-tissue partitions than the method that uses saline-blood and saline-tissue partitions. It has the added advantages of yielding the required in vivo partitions and being easily extended to the prediction of partition of agrochemicals from water into skin and permeation from water through skin. © 2013 Society of Chemical Industry.
Li, Linnan; Xie, Shaodong; Cai, Hao; Bai, Xuetao; Xue, Zhao
2008-08-01
Theoretical molecular descriptors were tested against logK(OW) values for polybrominated diphenyl ethers (PBDEs) using the Partial Least-Squares Regression method which can be used to analyze data with many variables and few observations. A quantitative structure-property relationship (QSPR) model was successfully developed with a high cross-validated value (Q(cum)(2)) of 0.961, indicating a good predictive ability and stability of the model. The predictive power of the QSPR model was further cross-validated. The values of logK(OW) for PBDEs are mainly governed by molecular surface area, energy of the lowest unoccupied molecular orbital and the net atomic charges on the oxygen atom. All these descriptors have been discussed to interpret the partitioning mechanism of PBDE chemicals. The bulk property of the molecules represented by molecular surface area is the leading factor, and K(OW) values increase with the increase of molecular surface area. Higher energy of the lowest unoccupied molecular orbital and higher net atomic charge on the oxygen atom of PBDEs result in smaller K(OW). The energy of the lowest unoccupied molecular orbital and the net atomic charge on PBDEs oxygen also play important roles in affecting the partition of PBDEs between octanol and water by influencing the interactions between PBDEs and solvent molecules.
Bioconcentration factors and plant-water partition coefficients of munitions compounds in barley.
Torralba-Sanchez, Tifany L; Kuo, Dave T F; Allen, Herbert E; Di Toro, Dominic M
2017-12-01
Plants growing in the soils at military ranges and surrounding locations are exposed, and potentially able to uptake, munitions compounds (MCs). The extent to which a compound is transferred from the environment into organisms such as plants, referred to as bioconcentration, is conventionally measured through uptake experiments with field/synthetic soils. Multiple components/phases that vary among different soil types and affect the bioavailability of the MC, however, hinder the ability to separate the effects of soil characteristics from the MC chemical properties on the resulting plant bioconcentration. To circumvent the problem, this work presents a protocol to measure steady state bioconcentration factors (BCFs) for MCs in barley (Hordeum vulgare L.) using inert laboratory sand rather than field/synthetic soils. Three MCs: 2,4,6-trinitrotoluene (TNT), 2,4-dinitrotoluene (2,4-DNT), and 2,4-dinitroanisole (2,4-DNAN), and two munition-like compounds (MLCs): 4-nitroanisole (4-NAN) and 2-methoxy-5-nitropyridine (2-M-5-NPYNE) were evaluated. Approximately constant plant biomass and exposure concentrations were achieved within a one-month period that produced steady state log BCF values: 0.62 ± 0.02, 0.70 ± 0.03, 1.30 ± 0.06, 0.52 ± 0.03, and 0.40 ± 0.05 L kg plant dwt -1 for TNT, 2,4-DNT, 2,4-DNAN, 4-NAN, and 2-M-5-NPYNE, respectively. Furthermore, results suggest that the upper-bounds of the BCFs can be estimated within an order of magnitude by measuring the partitioning of the compounds between barley biomass and water. This highlights the importance of partition equilibrium as a mechanism for the uptake of MCs and MLCs by barley from interstitial water. The results from this work provide chemically meaningful data for prediction models able to estimate the bioconcentration of these contaminants in plants. Copyright © 2017 Elsevier Ltd. All rights reserved.
Nagarajan, Ramanathan
2015-07-01
Micelles generated in water from most amphiphilic block copolymers are widely recognized to be non-equilibrium structures. Typically, the micelles are prepared by a kinetic process, first allowing molecular scale dissolution of the block copolymer in a common solvent that likes both the blocks and then gradually replacing the common solvent by water to promote the hydrophobic blocks to aggregate and create the micelles. The non-equilibrium nature of the micelle originates from the fact that dynamic exchange between the block copolymer molecules in the micelle and the singly dispersed block copolymer molecules in water is suppressed, because of the glassy nature of the core forming polymer block and/or its very large hydrophobicity. Although most amphiphilic block copolymers generate such non-equilibrium micelles, no theoretical approach to a priori predict the micelle characteristics currently exists. In this work, we propose a predictive approach for non-equilibrium micelles with glassy cores by applying the equilibrium theory of micelles in two steps. In the first, we calculate the properties of micelles formed in the mixed solvent while true equilibrium prevails, until the micelle core becomes glassy. In the second step, we freeze the micelle aggregation number at this glassy state and calculate the corona dimension from the equilibrium theory of micelles. The condition when the micelle core becomes glassy is independently determined from a statistical thermodynamic treatment of diluent effect on polymer glass transition temperature. The predictions based on this "non-equilibrium" model compare reasonably well with experimental data for polystyrene-polyethylene oxide diblock copolymer, which is the most extensively studied system in the literature. In contrast, the application of the equilibrium model to describe such a system significantly overpredicts the micelle core and corona dimensions and the aggregation number. The non-equilibrium model suggests ways to
Eganhouse, Robert P.
2016-01-01
Polymer-water partition coefficients (Kpw) of ten DDT-related compounds were determined in pure water at 25 °C using commercial polydimethylsiloxane-coated optical fiber. Analyte concentrations were measured by thermal desorption-gas chromatography/full scan mass spectrometry (TD–GC/MSFS; fibers) and liquid injection-gas chromatography/selected ion monitoring mass spectrometry (LI–GC/MSSIM; water). Equilibrium was approached from two directions (fiber uptake and depletion) as a means of assessing data concordance. Measured compound-specific log Kpw values ranged from 4.8 to 6.1 with an average difference in log Kpw between the two approaches of 0.05 log units (∼12% of Kpw). Comparison of the experimentally-determined log Kpw values with previously published data confirmed the consistency of the results and the reliability of the method. A second experiment was conducted with the same ten DDT-related compounds and twelve selected PCB (polychlorinated biphenyl) congeners under conditions characteristic of a coastal marine field site (viz., seawater, 11 °C) that is currently under investigation for DDT and PCB contamination. Equilibration at lower temperature and higher ionic strength resulted in an increase in log Kpw for the DDT-related compounds of 0.28–0.49 log units (61–101% of Kpw), depending on the analyte. The increase in Kpw would have the effect of reducing by approximately half the calculated freely dissolved pore-water concentrations (Cfree). This demonstrates the importance of determining partition coefficients under conditions as they exist in the field.
Structure and reactivity in amphiphile-water micelles
International Nuclear Information System (INIS)
Chevalier, Yves
1985-01-01
Following a review of the general properties of micelles, this report contains two parts: - A structural study of octylphosphate micelles. Important structural changes have been evidenced by mean of small angle neutron scattering as the electrical charge of the interface is varied. The NMR relaxation study of the conformation of the hydrocarbon chains has shown that the micellar core is disordered in contrast with the interface which is rather structured. The diffusion motions in the interface and the segmental motions of the chains are fast. - Studies on the reactivity in micelles have been carried out. A large micellar effect on the complexation of transition ions by amphiphilic ligands is evidenced. The problem of solute localization in micelles is developed with few examples. (author) [fr
Energy Technology Data Exchange (ETDEWEB)
Lee, Hyun Jeong; Kwon, Jung Hwan [Div. of Environmental Science and Ecological Engineering, Korea University, Seoul (Korea, Republic of)
2016-10-15
Various alternative flame retardants are used in many countries since polybrominated diphenyl ethers (PBDEs) were classified as persistent organic pollutants (POPs). However, difficulties in the evaluation of the long-range transport potential (LRTP) of the alternatives are related to the lack of information on their physicochemical properties, which govern their environmental fates and transport. Based on the simulation of LRTP using OECD P{sub OV} and LRTP Screening Tool, five alternative brominated flame retardants (BFRs) (hexabromobenzene [HBB], 2,3,4,5,6-pentabromotoluene [PBT], 2,3,4,5,6-pentabromoethylbenzene [PBEB], 2-ethylhexyl 2,3,4,5-tetrabromobenzoate [TBB], and 1,2,4,5-tetrabromo-3,6-dimethylbenzene [TBX]), and 3 PBDEs (BDE-28, BDE-47, and BDE-99) were chosen to perform a refined assessment. This was done using an experimentally measured 1-octanol–air partition coefficient (K{sub OA}) for the calculation of the air–water partition coefficient (K{sub AW}) required for the model. The four selected alternative BFRs (HBB, PBT, PBEB, TBX) have K{sub OA} values close to the in silico estimation used in the screening evaluation. On the other hand, the measured K{sub OA} value for TBB was two orders of magnitude lower than the estimated value used in the screening simulation. The refined simulation showed that characteristic travel distance (CTD) and transfer efficiency (TE) for HBB, PBT, PBEB, and TBX were greater than those for BDE-28, whereas CTD and TE for TBB were lower than those for BDE-28. This suggested that TBB has a lower LRTP than BDE-28, considering the refined partition coefficients.
Berg, Joshua; Mawson, Cara; Norris, Zach; Nucci, Nathaniel
Reverse micelles are spontaneously organizing complexes of surfactant that encapsulate a nanoscale pool of water in a bulk non-polar solvent. Reverse micelle (RM) mixtures have a wide range of applications, including biophysical investigation of protein systems. A new RM mixture composed of decyl-1-monoglycerol (10MAG) and lauryldimethylammonium-N-oxide (LDAO) was recently described. This mixture has the potential to prove more widely applicable for use of RMs in applications that involve encapsulation of macromolecules, yet little is known about the phase behavior or size of reverse micelles created by this mixture. Data describing such behaviors for this mixture are presented here. We have used dynamic light scattering (DLS) and fluorescence spectroscopy to investigate the size and partitioning behavior of RMs in varying mixtures of 10MAG, LDAO, water, pentane, and hexanol. These data demonstrate that the 10MAG/LDAO RM mixture exhibits markedly different phase and RM size behavior than that of commonly used RM surfactant mixtures. The implications of these findings for use of the 10MAG/LDAO mix for RM applications will also be addressed. Funding provided by Rowan University.
Schwandt, C. S.; McKay, G. A.
1996-01-01
Determining the petrogenesis of eucrites (basaltic achondrites) and diogenites (orthopyroxenites) and the possible links between the meteorite types was initiated 30 years ago by Mason. Since then, most investigators have worked on this question. A few contrasting theories have emerged, with the important distinction being whether or not there is a direct genetic link between eucrites and diogenites. One theory suggests that diogenites are cumulates resulting from the fractional crystallization of a parent magma with the eucrites crystallizing, from the residual magma after separation from the diogenite cumulates. Another model proposes that diogenites are cumulates formed from partial melts derived from a source region depleted by the prior generation of eucrite melts. It has also been proposed that the diogenites may not be directly linked to the eucrites and that they are cumulates derived from melts that are more orthopyroxene normative than the eucrites. This last theory has recently received more analytical and experimental support. One of the difficulties with petrogenetic modeling is that it requires appropriate partition coefficients for modeling because they are dependent on temperature, pressure, and composition. For this reason, we set out to determine minor- and trace-element partition coefficients for diogenite-like orthopyroxene. We have accomplished this task and now have enstatite/melt partition coefficients for Al, Cr, Ti, La, Ce, Nd, Sm, Eu, Dy, Er, Yb, and La.
The conventional Junge-Pankow adsorption model uses the sub-cooled liquid vapor pressure (pLo) as a correlation parameter for gas/particle interactions. An alternative is the octanol-air partition coefficient (Koa) absorption model. Log-log plots of the particle-gas partition c...
Chen, Zhiquan; He, Changcheng; Li, Fengbin; Tong, Ling; Liao, Xingzhi; Wang, Yong
2010-06-01
We reported the deliberate control on the micelle opening and closing of amphiphilic polystyrene-block-poly(2-vinylpyridine) (PS-b-P2VP) micellar films by exposing them to selective solvents. We first treated the micellar films with polar solvents including ethanol and water (pH = 4, 8, and 12) that have different affinities to P2VP. We observed opening of the micelles in all the cases. Both the size of opened pores and the opening rate are dependent on the solvency of different solvents for P2VP. We then explored the closing behavior of the opened micelles using solvents having different affinities to PS. We found that the opened micelles were recovered to their initial closed micelle forms. The recovery was accompanied by a slow micelle disassociation process which gradually reduced the micelle size. The rates of the micelle closing and disassociation are also dependent on the solvency of different solvents for PS.
National Research Council Canada - National Science Library
Mahle, Deidre A; Gearhart, Jeffrey M; Godfrey, Richard J; Mattie, David R; Cook, Robert S; Grisby, Claude C
2004-01-01
.... Partition coefficients (PCs) are an integral component of pharmacokinetic models and determining differences in tissue partitioning of volatile organic chemicals across life stages can help reduce the uncertainty in risk assessment...
DEFF Research Database (Denmark)
Jelnes, Rolf; Astrup, A; Bülow, J
1985-01-01
the partition coefficient found by the double isotope technique, significantly lower values are obtained than if the in vitro determined coefficient is used. This difference is explained mainly by local dilution when injecting xenon subcutaneously. In short-term studies, utilization of the double isotope...... technique reduces the coefficient of variation on average flow determinations, thus an improvement in accuracy of local blood flow estimation can be obtained compared to the method in which an average partition coefficient is used. For long-term studies a partition coefficient of 7.5 ml g-1 seems valid.......Local subcutaneous 133xenon (133Xe) elimination was registered in the human forefoot in 34 patients. The tissue/blood partition coefficient for Xe was estimated individually by simultaneous registration of 133Xe and [131I]antipyrine ([131I]AP) washout from the same local depot. When measured...
Lukyanov, Anatoly N; Torchilin, Vladimir P
2004-05-07
Polymeric micelles have a whole set of unique characteristics, which make them very promising drug carriers, in particular, for poorly soluble drugs. Our review article focuses on micelles prepared from conjugates of water-soluble polymers, such as polyethylene glycol (PEG) or polyvinyl pyrrolidone (PVP), with phospholipids or long-chain fatty acids. The preparation of micelles from certain polymer-lipid conjugates and the loading of these micelles with various poorly soluble anticancer agents are discussed. The data on the characterization of micellar preparations in terms of their morphology, stability, longevity in circulation, and ability to spontaneously accumulate in experimental tumors via the enhanced permeability and retention (EPR) effect are presented. The review also considers the preparation of targeted immunomicelles with specific antibodies attached to their surface. Available in vivo results on the efficiency of anticancer drugs incorporated into plain micelles and immunomicelles in animal models are also discussed.
Structural study of concentrated micelle-solutions of sodium octanoate by light scattering
International Nuclear Information System (INIS)
Hayoun, Marc
1982-05-01
Structural investigation of sodium octanoate (CH 3 -(CH 2 ) 6 -COONa) by light scattering has been made to study properties of concentrated aqueous micelle-solutions. From static light scattering data, the micellar weight and shape have been determined. The monomer aggregation number and the apparent micellar charge have been confirmed. Quasi-elastic light scattering, has been used to measure the effective diffusion coefficient as a function of the volume fraction. Extrapolation to the c.m.c. give the hydrodynamic radius of the micelles. At low micelle-concentration, strong exchange reaction between monomers and micelles affects the Brownian motion and resulting is an increase in the diffusion coefficient. The experimental data show a strong hydrodynamic contribution to S(q) (factor structure) and D(q) (effective diffusion coefficient) arising from hard spheres interactions with a large repulsive potential. (author) [fr
Modeling of chemical reactions in micelle: water-mediated keto-enol interconversion as a case study.
Marracino, Paolo; Amadei, Andrea; Apollonio, Francesca; d'Inzeo, Guglielmo; Liberti, Micaela; di Crescenzo, Antonello; Fontana, Antonella; Zappacosta, Romina; Aschi, Massimiliano
2011-06-30
The effect of a zwitterionic micelle environment on the efficiency of the keto-enol interconversion of 2-phenylacetylthiophene has been investigated by means of a joint application of experimental and theoretical/computational approaches. Results have revealed a reduction of the reaction rate constant if compared with bulk water essentially because of the different solvation conditions experienced by the reactant species, including water molecules, in the micelle environment. The slight inhibiting effect due to the application of a static electric field has also been theoretically investigated and presented.
Han, Shu-ying; Qiao, Jun-qin; Zhang, Yun-yang; Yang, Li-li; Lian, Hong-zhen; Ge, Xin; Chen, Hong-yuan
2011-03-01
n-Octanol/water partition coefficients (P) for DDTs and dicofol were determined by reversed-phase high performance liquid chromatography (RP-HPLC) on a C(18) column using methanol-water mixture as mobile phase. A dual-point retention time correction (DP-RTC) was proposed to rectify chromatographic retention time (t(R)) shift resulted from stationary phase aging. Based on this correction, the relationship between logP and logk(w), the logarithm of the retention factor extrapolated to pure water, was investigated for a set of 12 benzene homologues and DDT-related compounds with reliable experimental P as model compounds. A linear regression logP=(1.10±0.04) logk(w) - (0.60±0.17) was established with correlation coefficient R(2) of 0.988, cross-validated correlation coefficient R(cv)(2) of 0.983 and standard deviation (SD) of 0.156. This model was further validated using four verification compounds, naphthalene, biphenyl, 2,2-bis(4-chlorophenyl)-1,1-dichloroethane (p,p'-DDD) and 2,2-bis(4-chlorophenyl)-1,1-dichloroethene (p,p'-DDE) with similar structure to DDT. The RP-HPLC-determined P values showed good consistency with shake-flask (SFM) or slow-stirring (SSM) results, especially for highly hydrophobic compounds with logP in the range of 4-7. Then, the P values for five DDT-related compounds, 2-(2-chlorophenyl)-2-(4-chlorophenyl)-1,1,1-trichloroethane (o,p'-DDT), 2-(2-chlorophenyl)-2-(4-chlorophenyl)-1,1-dichloroethane (o,p'-DDD), 2-(2-chlorophenyl)-2-(4-chlorophenyl)-1,1-dichloroethene (o,p'-DDE), and 2,2,2-trichloro-1,1-bis(4-chlorophenyl)ethanol (dicofol) and its main degradation product 4,4'-dichlorobenzophenone (p,p'-DBP) were evaluated by the improved RP-HPLC method for the first time. The excellent precision with SD less than 0.03 proved that the novel DP-RTC protocol can significantly increases the determination accuracy and reliability of P by RP-HPLC. Copyright © 2011 Elsevier Ltd. All rights reserved.
Zeng, Xiao-Lan; Wang, Hong-Jun; Wang, Yan
2012-02-01
The possible molecular geometries of 134 halogenated methyl-phenyl ethers were optimized at B3LYP/6-31G(*) level with Gaussian 98 program. The calculated structural parameters were taken as theoretical descriptors to establish two new novel QSPR models for predicting aqueous solubility (-lgS(w,l)) and n-octanol/water partition coefficient (lgK(ow)) of halogenated methyl-phenyl ethers. The two models achieved in this work both contain three variables: energy of the lowest unoccupied molecular orbital (E(LUMO)), most positive atomic partial charge in molecule (q(+)), and quadrupole moment (Q(yy) or Q(zz)), of which R values are 0.992 and 0.970 respectively, their standard errors of estimate in modeling (SD) are 0.132 and 0.178, respectively. The results of leave-one-out (LOO) cross-validation for training set and validation with external test sets both show that the models obtained exhibited optimum stability and good predictive power. We suggests that two QSPR models derived here can be used to predict S(w,l) and K(ow) accurately for non-tested halogenated methyl-phenyl ethers congeners. Copyright © 2011 Elsevier Ltd. All rights reserved.
Energy Technology Data Exchange (ETDEWEB)
Treiner, C. (Universite Pierre et Marie Curie, Paris (France)); Nortz, M.; Vaution, C. (Faculte de Pharmacie de Paris-sud, Chatenay-Malabry (France))
1990-07-01
The apparent partition coefficient P of barbituric acids between micelles and water has been determined in mixed binary surfactant solutions from solubility measurements in the whole micellar composition range. The binary systems chosen ranged from the strongly interacting system dodecyltrimethylammonium chloride + sodium dodecyl sulfate to weakly interacting systems such as benzyldimethyltetradecylammonium chloride + tetradecyltrimethyammonium chloride. In all cases studied, mixed micelle formation is unfavorable to micellar solubilization. A correlation is found between the unlike surfactants interaction energy, as measured by the regular solution parameter {beta} and the solute partition coefficient change upon surfactant mixing. By use of literature data on micellar solubilization in binary surfactant solutions, it is shown that the change of P for solutes which are solubilized by surface adsorption is generally governed by the sign and amplitude of the interaction parameter {beta}.
Energy Technology Data Exchange (ETDEWEB)
Wei, Wenjuan, E-mail: Wenjuan.Wei@cstb.fr [University of Paris-Est, Scientific and Technical Center for Building (CSTB), Health and Comfort Department, French Indoor Air Quality Observatory (OQAI), 84 Avenue Jean Jaurès, Champs sur Marne, 77447 Marne la Vallée Cedex 2 (France); Mandin, Corinne [University of Paris-Est, Scientific and Technical Center for Building (CSTB), Health and Comfort Department, French Indoor Air Quality Observatory (OQAI), 84 Avenue Jean Jaurès, Champs sur Marne, 77447 Marne la Vallée Cedex 2 (France); INSERM-U1085, Irset-Research Institute for Environmental and Occupational Health, Rennes (France); LERES-Environment and Health Research Laboratory (Irset and EHESP Technologic Platform), Rennes (France); Blanchard, Olivier [EHESP-School of Public Health, Sorbonne Paris Cité, Rennes (France); INSERM-U1085, Irset-Research Institute for Environmental and Occupational Health, Rennes (France); Mercier, Fabien [EHESP-School of Public Health, Sorbonne Paris Cité, Rennes (France); LERES-Environment and Health Research Laboratory (Irset and EHESP Technologic Platform), Rennes (France); INSERM-U1085, Irset-Research Institute for Environmental and Occupational Health, Rennes (France); Pelletier, Maud [EHESP-School of Public Health, Sorbonne Paris Cité, Rennes (France); INSERM-U1085, Irset-Research Institute for Environmental and Occupational Health, Rennes (France); Le Bot, Barbara [EHESP-School of Public Health, Sorbonne Paris Cité, Rennes (France); LERES-Environment and Health Research Laboratory (Irset and EHESP Technologic Platform), Rennes (France); INSERM-U1085, Irset-Research Institute for Environmental and Occupational Health, Rennes (France); and others
2016-09-01
The indoor gas-phase concentrations of semi-volatile organic compounds (SVOCs) can be predicted from their respective concentrations in airborne particles by applying the particle/gas partitioning equilibrium. The temperature used for partitioning is often set to 25 °C. However, indoor temperatures frequently differ from this reference value. This assumption may result in errors in the predicted equilibrium gas-phase SVOC concentrations. To improve the prediction model, the temperature dependence of the particle/gas partition coefficient must be addressed. In this paper, a theoretical relationship between the particle/gas partition coefficient and temperature was developed based on the SVOC absorptive mechanism. The SVOC particle/gas partition coefficients predicted by employing the derived theoretical relationship agree well with the experimental data retrieved from the literature (R > 0.93). The influence of temperature on the equilibrium gas-phase SVOC concentration was quantified by a dimensionless analysis of the derived relationship between the SVOC particle/gas partition coefficient and temperature. The predicted equilibrium gas-phase SVOC concentration decreased by between 31% and 53% when the temperature was lowered by 6 °C, while it increased by up to 750% when the indoor temperature increased from 15 °C to 30 °C. - Highlights: • A theoretical relationship between K{sub p} and temperature was developed. • The relationship was based on the SVOC absorptive mechanism. • The temperature impact was quantified by a dimensionless analysis.
International Nuclear Information System (INIS)
Ghasemi, Jahanbakhsh; Saaidpour, Saadi
2007-01-01
A quantitative structure-property relationship (QSPR) study was performed to develop models those relate the structures of 150 drug organic compounds to their n-octanol-water partition coefficients (log P o/w ). Molecular descriptors derived solely from 3D structures of the molecular drugs. A genetic algorithm was also applied as a variable selection tool in QSPR analysis. The models were constructed using 110 molecules as training set, and predictive ability tested using 40 compounds. Modeling of log P o/w of these compounds as a function of the theoretically derived descriptors was established by multiple linear regression (MLR). Four descriptors for these compounds molecular volume (MV) (geometrical), hydrophilic-lipophilic balance (HLB) (constitutional), hydrogen bond forming ability (HB) (electronic) and polar surface area (PSA) (electrostatic) are taken as inputs for the model. The use of descriptors calculated only from molecular structure eliminates the need for experimental determination of properties for use in the correlation and allows for the estimation of log P o/w for molecules not yet synthesized. Application of the developed model to a testing set of 40 drug organic compounds demonstrates that the model is reliable with good predictive accuracy and simple formulation. The prediction results are in good agreement with the experimental value. The root mean square error of prediction (RMSEP) and square correlation coefficient (R 2 ) for MLR model were 0.22 and 0.99 for the prediction set log P o/w
Non-spherical micelles in an oil-in-water cubic phase
DEFF Research Database (Denmark)
Leaver, M.; Rajagopalan, V.; Ulf, O.
2000-01-01
phase, both with and without SDS, was established by NMR self-diffusion. In addition H-2 NMR relaxation experiments have demonstrated that the micelles in the cubic phase are non-spherical, having grown and changed shape upon formation of the cubic phase from the micellar solution. Small angle...... associated with the micellar cubic phase, Pm3n and Fd3m. The micellar volumes calculated for these space groups are similar and are consistent with a change in micellar geometry from spherical to prolate.......The cubic phase formed between the microemulsion and hexagonal phases of the ternary pentaethylene glycol dodecyl ether (C12E5)-decane-water system and that doped with small amounts of sodium dodecylsulfate (SDS) have been investigated. The presence of discrete oil-swollen micelles in the cubic...
Singla, Pankaj; Singh, Onkar; Chabba, Shruti; Aswal, V. K.; Mahajan, Rakesh Kumar
2018-02-01
In this report, the solubilization behaviour of a hydrophobic drug Clozapine (CLZ) in micellar suspensions of pluronics having different hydrophilic lipophilic balance (HLB) ratios viz. P84, F127 and F108 in the absence and presence of bile salt sodium deoxycholate (SDC) has been studied. UV-Vis spectroscopy has been exploited to determine the solubilization capacity of the investigated micellar systems in terms of drug loading efficiency, average number of drug molecules solubilized per micelle (ns), partition coefficient (P) and standard free energy of solubilization (Δ G°). The morphological and structural changes taking place in pluronics in different concentration regimes of SDC and with the addition of drug CLZ has been explored using dynamic light scattering (DLS) and small angle neutron scattering (SANS) measurements. The SANS results revealed that aggregation behaviour of pluronic-SDC mixed micelles gets improved in the presence of drug. The micropolarity measurements have been performed to shed light on the locus of solubilization of the drug in pure and mixed micellar systems. The compatibility between CLZ and drug carriers (pluronics and SDC) was confirmed using powder X-ray diffraction (PXRD) and Fourier transform infrared spectroscopy (FTIR) techniques. Among the investigated systems, P84-SDC mixed system was found to be highly efficient for CLZ loading. The long term stability data indicated that CLZ loaded P84-SDC mixed micellar formulation remained stable for 3 months at room temperature. Further, it was revealed that the CLZ loaded P84-SDC mixed micelles are converted into CLZ loaded pure P84 micelles at 30-fold dilutions which remain stable up to 48-fold dilutions. The results from the present studies suggest that P84-SDC mixed micelles can serve as suitable delivery vehicles for hydrophobic drug CLZ.
Kim, Du Yung; Kwon, Jung-Hwan
2018-05-04
Because the freely dissolved fraction of highly hydrophobic organic chemicals is bioavailable, knowing the partition coefficient between dissolved organic carbon and water (K DOCw ) is crucial to estimate the freely dissolved fraction from the total concentration. A kinetic method was developed to obtain K DOCw that required a shorter experimental time than equilibrium methods. The equilibrium partition coefficients of four polychlorinated biphenyls (PCBs) (2,4,4'-trichlorobiphenyl (PCB 28), 2,2',3,5'-tetrachlorobiphenyl (PCB 44), 2,2',4,5,5'-pentachlorobiphenyl (PCB 101), and 2,2',4,4',5,5'-hexachlorobiphenyl (PCB 153)) between dissolved organic carbon and seawater (K DOCsw ) were determined using seawater samples from the Korean coast. The log K DOCsw values of PCB 28 were measured by equilibrating PCB 28, the least hydrophobic congener, with seawater samples, and the values ranged from 6.60 to 7.20. For the more hydrophobic PCBs (PCB 44, PCB 101, and PCB 153), kinetic experiments were conducted to determine the sorption rate constants (k 2 ) and their log K DOCsw values were obtained by comparing their k 2 with that of PCB 28. The calculated log K DOCsw values were 6.57-7.35 for PCB 44, 6.23-7.44 for PCB 101, and 6.35-7.73 for PCB 153. The validity of the proposed method was further confirmed using three less hydrophobic polycyclic aromatic hydrocarbons. This kinetic method shortened the experimental time to obtain the K DOCsw values of the more hydrophobic PCBs, which did not reach phase equilibrium. Copyright © 2018 Elsevier Ltd. All rights reserved.
The potential of cloud point system as a novel two-phase partitioning system for biotransformation.
Wang, Zhilong
2007-05-01
Although the extractive biotransformation in two-phase partitioning systems have been studied extensively, such as the water-organic solvent two-phase system, the aqueous two-phase system, the reverse micelle system, and the room temperature ionic liquid, etc., this has not yet resulted in a widespread industrial application. Based on the discussion of the main obstacles, an exploitation of a cloud point system, which has already been applied in a separation field known as a cloud point extraction, as a novel two-phase partitioning system for biotransformation, is reviewed by analysis of some topical examples. At the end of the review, the process control and downstream processing in the application of the novel two-phase partitioning system for biotransformation are also briefly discussed.
Tissue/blood partition coefficients for xenon in various adipose tissue depots in man
DEFF Research Database (Denmark)
Bülow, J; Jelnes, Rolf; Astrup, A
1987-01-01
Tissue/blood partition coefficients (lambda) for xenon were calculated for subcutaneous adipose tissue from the abdominal wall and the thigh, and for the perirenal adipose tissue after chemical analysis of the tissues for lipid, water and protein content. The lambda in the perirenal tissue...... was found to correlate linearly to the relative body weight (RBW) in per cent with the regression equation lambda = 0.045 . RBW + 0.99. The subcutaneous lambda on the abdomen correlated linearly to the local skinfold thickness (SFT) with the equation lambda = 0.22 SFT + 2.99. Similarly lambda on the thigh...... correlated to SFT with the equation lambda = 0.20 . SFT + 4.63. It is concluded that the previously accepted lambda value of 10 is generally too high in perirenal as well as in subcutaneous tissue. Thus, by application of the present regression equations, it is possible to obtain more exact estimates...
Roche, Camille J.; Dantsker, David; Heller, Elizabeth R.; Sabat, Joseph E.; Friedman, Joel M.
2013-01-01
Hydration waters impact protein dynamics. Dissecting the interplay between hydration waters and dynamics requires a protein that manifests a broad range of dynamics. Proteins in reverse micelles (RMs) have promise as tools to achieve this objective because the water content can be manipulated. Hemoglobin is an appropriate tool with which to probe hydration effects. We describe both a protocol for hemoglobin encapsulation in reverse micelles and a facile method using PEG and cosolvents to mani...
International Nuclear Information System (INIS)
Zhao, Shengnan; Liu, Xinhui; Cheng, Dengmiao; Liu, Guannan; Liang, Baocui; Cui, Baoshan; Bai, Junhong
2016-01-01
As special zones, the intertidal zones of the Yellow River Delta (YRD) are highly variable along with time and space. Fluvial–marine and land–ocean interactions which frequently occur in these areas have a great impact on the fate of pollutants. Antibiotics, which contribute to antibiotic-resistant genes (ARGs), are widely detected in wastewater, natural water, soil, sediments, and even drinking water. Therefore, it is meaningful to investigate the occurrence and fate of antibiotics in these special zones. In this study, eight antibiotics belonging to tetracyclines (TCs), fluoroquinolones (FQs), and macrolides (MLs) were detected in the surface water and sediments from the intertidal zones of YRD during two seasons. Two models were established to predict the partitioning coefficients of norfloxacin (NOR) and erythromycin (ETM) using physicochemical properties of sediments, respectively. The total concentrations of these antibiotics were 82.94–230.96 ng·L"− "1 and 40.97–207.44 ng·g"− "1, respectively, in the surface water and sediments. Seasonal variation was mainly influenced by the frequency of antibiotics use and environment factors. The regions with river supply exhibited the highest concentrations of antibiotics in surface water and sediments. Meanwhile, particle-size fractions, cation exchange capability (CEC), and metal ions content played dominant roles in the partitioning behaviors of NOR and ETM between the surface water and sediments. Both models established in this study featured accuracy and feasibility, which provided the methods for predicting the partitioning coefficients of emerging contaminants similar in structures to NOR and ETM in the intertidal zones. - Highlights: • The intertidal zones of YRD were polluted by antibiotics to some extent. • The river supply was a major pathway for the antibiotic pollution of the intertidal zones of YRD. • The partitioning coefficients of NOR and ETM can be predicted using the physicochemical
Effect of Strain, Region, and Tissue Composition on Glucose Partitioning in Meniscus Fibrocartilage.
Kleinhans, Kelsey L; Jackson, Alicia R
2017-03-01
A nearly avascular tissue, the knee meniscus relies on diffusive transport for nutritional supply to cells. Nutrient transport depends on solute partitioning in the tissue, which governs the amount of nutrients that can enter a tissue. The purpose of the present study was to investigate the effects of mechanical strain, tissue region, and tissue composition on the partition coefficient of glucose in meniscus fibrocartilage. A simple partitioning experiment was employed to measure glucose partitioning in porcine meniscus tissues from two regions (horn and central), from both meniscal components (medial and lateral), and at three levels of compression (0%, 10%, and 20%). Partition coefficient values were correlated to strain level, water volume fraction, and glycosaminoglycan (GAG) content of tissue specimens. Partition coefficient values ranged from 0.47 to 0.91 (n = 48). Results show that glucose partition coefficient is significantly (p < 0.001) affected by compression, decreasing with increasing strain. Furthermore, we did not find a statistically significant effect of tissue when comparing medial versus lateral (p = 0.181) or when comparing central and horn regions (p = 0.837). There were significant positive correlations between tissue water volume fraction and glucose partitioning for all groups. However, the correlation between GAG content and partitioning was only significant in the lateral horn group. Determining how glucose partitioning is affected by tissue composition and loading is necessary for understanding nutrient availability and related tissue health and/or degeneration. Therefore, this study is important for better understanding the transport and nutrition-related mechanisms of meniscal degeneration.
Chandramouli, Bharadwaj; Jang, Myoseon; Kamens, Richard M.
The partitioning of a diverse set of semivolatile organic compounds (SOCs) on a variety of organic aerosols was studied using smog chamber experimental data. Existing data on the partitioning of SOCs on aerosols from wood combustion, diesel combustion, and the α-pinene-O 3 reaction was augmented by carrying out smog chamber partitioning experiments on aerosols from meat cooking, and catalyzed and uncatalyzed gasoline engine exhaust. Model compositions for aerosols from meat cooking and gasoline combustion emissions were used to calculate activity coefficients for the SOCs in the organic aerosols and the Pankow absorptive gas/particle partitioning model was used to calculate the partitioning coefficient Kp and quantitate the predictive improvements of using the activity coefficient. The slope of the log K p vs. log p L0 correlation for partitioning on aerosols from meat cooking improved from -0.81 to -0.94 after incorporation of activity coefficients iγ om. A stepwise regression analysis of the partitioning model revealed that for the data set used in this study, partitioning predictions on α-pinene-O 3 secondary aerosol and wood combustion aerosol showed statistically significant improvement after incorporation of iγ om, which can be attributed to their overall polarity. The partitioning model was sensitive to changes in aerosol composition when updated compositions for α-pinene-O 3 aerosol and wood combustion aerosol were used. The octanol-air partitioning coefficient's ( KOA) effectiveness as a partitioning correlator over a variety of aerosol types was evaluated. The slope of the log K p- log K OA correlation was not constant over the aerosol types and SOCs used in the study and the use of KOA for partitioning correlations can potentially lead to significant deviations, especially for polar aerosols.
Directory of Open Access Journals (Sweden)
Marcelo Souto Nacif
2018-01-01
Full Text Available Abstract Objective: To compare an albumin-bound gadolinium chelate (gadofosveset trisodium and an extracellular contrast agent (gadobenate dimeglumine, in terms of their effects on myocardial longitudinal (T1 relaxation time and partition coefficient. Materials and Methods: Study subjects underwent two imaging sessions for T1 mapping at 3 tesla with a modified look-locker inversion recovery (MOLLI pulse sequence to obtain one pre-contrast T1 map and two post-contrast T1 maps (mean 15 and 21 min, respectively. The partition coefficient was calculated as ΔR1myocardium /ΔR1blood , where R1 is 1/T1. Results: A total of 252 myocardial and blood pool T1 values were obtained in 21 healthy subjects. After gadolinium administration, the myocardial T1 was longer for gadofosveset than for gadobenate, the mean difference between the two contrast agents being −7.6 ± 60 ms (p = 0.41. The inverse was true for the blood pool T1, which was longer for gadobenate than for gadofosveset, the mean difference being 56.5 ± 67 ms (p < 0.001. The partition coefficient (λ was higher for gadobenate than gadofosveset (0.41 vs. 0.33, indicating slower blood pool washout for gadofosveset than for gadobenate. Conclusion: Myocardial T1 times did not differ significantly between gadobenate and gadofosveset. At typical clinical doses of the contrast agents, partition coefficients were significantly lower for the intravascular contrast agent than for the extravascular agent.
DEFF Research Database (Denmark)
Huang, L.; Ernstoff, Alexi; Xu, H.
2017-01-01
Organic chemicals encapsulated in beverage and food packaging can migrate to the food and lead to human exposures via ingestion. The packaging-food (Kpf) partition coefficient is a key parameter to estimate the chemical migration from packaging materials. Previous studies have simply set Kpf to 1...... or 1000, or provided separate linear correlations for several discrete values of ethanol equivalencies of food simulants (EtOH-eq). The aim of the present study is to develop a single quantitative property-property relationship (QPPR) valid for different chemical-packaging combinations and for water...... because only two packaging types are included. This preliminary QPPR demonstrates that the Kpf for various chemicalpackaging-food combinations can be estimated by a single linear correlation. Based on more than 1000 collected Kpf in 15 materials, we will present extensive results for other packaging types...
Partition coefficients of some purine derivatives and its application to pharmacokinetics.
Chrzanowska, M; Sobiak, J; Kuehn, M; Dorawa, E; Hermann, T
2009-12-01
Metazathioprine (MAZA), a methylated derivative of azathioprine (AZA), demonstrated the greatest values of apparent and specific partition coefficients in n-octanol/phosphate buffer at pH 5.7 and pH 7.4 among purine derivatives such as 6-mercaptopurine (6-MP), 6-thioguanine (6-TG) and AZA. Introduction of a methyl group into the imidazole ring of AZA increases lipophilic properties of MAZA compared to AZA. Mass balance of purine derivatives in n-octanol and in phosphate buffer indicated their chemical stability in those media.
Chemical reactions in reverse micelle systems
Matson, Dean W.; Fulton, John L.; Smith, Richard D.; Consani, Keith A.
1993-08-24
This invention is directed to conducting chemical reactions in reverse micelle or microemulsion systems comprising a substantially discontinuous phase including a polar fluid, typically an aqueous fluid, and a microemulsion promoter, typically a surfactant, for facilitating the formation of reverse micelles in the system. The system further includes a substantially continuous phase including a non-polar or low-polarity fluid material which is a gas under standard temperature and pressure and has a critical density, and which is generally a water-insoluble fluid in a near critical or supercritical state. Thus, the microemulsion system is maintained at a pressure and temperature such that the density of the non-polar or low-polarity fluid exceeds the critical density thereof. The method of carrying out chemical reactions generally comprises forming a first reverse micelle system including an aqueous fluid including reverse micelles in a water-insoluble fluid in the supercritical state. Then, a first reactant is introduced into the first reverse micelle system, and a chemical reaction is carried out with the first reactant to form a reaction product. In general, the first reactant can be incorporated into, and the product formed in, the reverse micelles. A second reactant can also be incorporated in the first reverse micelle system which is capable of reacting with the first reactant to form a product.
Casein Micelle Dispersions under Osmotic Stress
Bouchoux, Antoine; Cayemitte, Pierre-Emerson; Jardin, Julien; Gésan-Guiziou, Geneviève; Cabane, Bernard
2009-01-01
Abstract Casein micelles dispersions have been concentrated and equilibrated at different osmotic pressures using equilibrium dialysis. This technique measured an equation of state of the dispersions over a wide range of pressures and concentrations and at different ionic strengths. Three regimes were found. i), A dilute regime in which the osmotic pressure is proportional to the casein concentration. In this regime, the casein micelles are well separated and rarely interact, whereas the osmotic pressure is dominated by the contribution from small residual peptides that are dissolved in the aqueous phase. ii), A transition range that starts when the casein micelles begin to interact through their κ-casein brushes and ends when the micelles are forced to get into contact with each other. At the end of this regime, the dispersions behave as coherent solids that do not fully redisperse when osmotic stress is released. iii), A concentrated regime in which compression removes water from within the micelles, and increases the fraction of micelles that are irreversibly linked to each other. In this regime the osmotic pressure profile is a power law of the residual free volume. It is well described by a simple model that considers the micelle to be made of dense regions separated by a continuous phase. The amount of water in the dense regions matches the usual hydration of proteins. PMID:19167314
Zhang, X; Patel, L A; Beckwith, O; Schneider, R; Weeden, C J; Kindt, J T
2017-11-14
Micelle cluster distributions from molecular dynamics simulations of a solvent-free coarse-grained model of sodium octyl sulfate (SOS) were analyzed using an improved method to extract equilibrium association constants from small-system simulations containing one or two micelle clusters at equilibrium with free surfactants and counterions. The statistical-thermodynamic and mathematical foundations of this partition-enabled analysis of cluster histograms (PEACH) approach are presented. A dramatic reduction in computational time for analysis was achieved through a strategy similar to the selector variable method to circumvent the need for exhaustive enumeration of the possible partitions of surfactants and counterions into clusters. Using statistics from a set of small-system (up to 60 SOS molecules) simulations as input, equilibrium association constants for micelle clusters were obtained as a function of both number of surfactants and number of associated counterions through a global fitting procedure. The resulting free energies were able to accurately predict micelle size and charge distributions in a large (560 molecule) system. The evolution of micelle size and charge with SOS concentration as predicted by the PEACH-derived free energies and by a phenomenological four-parameter model fit, along with the sensitivity of these predictions to variations in cluster definitions, are analyzed and discussed.
Ni, Xinjiong; Xing, Xiaoping; Cao, Yuhua; Cao, Guangqun
2014-11-28
A novel polymeric micelle, formed by random copolymer poly (stearyl methacrylate-co-methacrylic acid) (P(SMA-co-MAA)) has been used as pseudostationary phase (PSP) in electrokinetic chromatography (EKC) for simultaneous and rapid determination of 11 kinds of water- and fat-soluble vitamins in this work. The running buffer consisting of 1% (w/v) P(SMA-co-MAA), 10% (v/v) 1-butanol, 20% (v/v) acetonitrile, and 30 mM Palitzsch buffer solution (pH 9.2) was applied to improve the selectivity and efficiency, as well as to shorten analysis time. 1-Butanol and acetonitrile as the organic solvent modifiers played the most important roles for rapid separation of these vitamins. The effects of organic solvents on microstructure of the polymeric micelle were investigated. The organic solvents swell the polymeric micelle by three folds, lower down the surface charge density and enhance the microenviromental polarity of the polymeric micelle. The 11 kinds of water- and fat-soluble vitamins could be baseline separated within 13 min. The method was applied to determine water- and fat-soluble vitamins in commercial vitamin sample; the recoveries were between 93% and 111% with the relative standard derivations (RSDs) less than 5%. The determination results matched the label claim. Copyright © 2014 Elsevier B.V. All rights reserved.
International Nuclear Information System (INIS)
Thibault, D.H.; Sheppard, M.I.; Smith, P.A.
1990-03-01
Environmental assessments of the Canadian concept for disposal of nuclear fuel waste in plutonic rock formations require analyses of the migration of nuclides from the disposal vault to the biosphere. Analyses of nuclide migration via groundwater through the geosphere, unconsolidated overburden and soil use models requiring solid/liquid partition coefficients (K d ) to describe the interaction of the nuclides with the solid materials. This report presents element-specific soil solid/liquid partition coefficients based on a detailed survey of the literature. Values for clays, silt, sand and organic soils are summarized. Partition coefficients for the following elements are presented: americium, antimony, arsenic, barium, boron, cadmium, calcium, carbon, cerium, cesium, chromium, cobalt, copper, curium, europium, iodine, iron, lead, lithium, manganese, molybdenum, neptunium, nickel, niobium, palladium, phosphorus, plutonium, polonium, radium, ruthenium, samarium, selenium, silver, strontium, technetium, tellurium, terbium, thorium, tin, tritium, uranium, zinc, and zirconium. The values compiled in this study are compared with earlier K d value compendiums and are the values recommended for the use in the soil, deep sediment and overburden models for the Environmental Impact Statement on the concept for disposal of Canada's nuclear fuel waste
International Nuclear Information System (INIS)
Liu Huanxiang; Yao Xiaojun; Liu Mancang; Hu Zhide; Fan Botao
2006-01-01
Based on calculated molecular descriptors from the solutes' structure alone, the micelle-water partition coefficients of 103 solutes in micellar electrokinetic chromatography (MEKC) were predicted using the heuristic method (HM). At the same time, in order to show the influence of different molecular descriptors on the micelle-water partition of solute and to well understand the retention mechanism in MEKC, HM was used to build several multivariable linear models using different numbers of molecular descriptors. The best 6-parameter model gave the following results: the square of correlation coefficient R 2 was 0.958 and the mean relative error was 3.98%, which proved that the predictive values were in good agreement with the experimental results. From the built model, it can be concluded that the hydrophobic, H-bond, polar interactions of solutes with the micellar and aqueous phases are the main factors that determine their partitioning behavior. In addition, this paper provided a simple, fast and effective method for predicting the retention of the solutes in MEKC from their structures and gave some insight into structural features related to the retention of the solutes
Distribution coefficients for chemical components of a coal-oil/water system
Energy Technology Data Exchange (ETDEWEB)
Picel, K C; Stamoudis, V C; Simmons, M S
1988-09-01
Distribution coefficients (K/sub D/) were measured by equilibrating a coal oil comparative reference material (CRM-1) with water and then separating the oil and water phases. Aqueous phase concentrations were determined by direct analysis of this phase, while organic phase concentrations were determined from the original oil composition by difference. The log K/sub D/ values obtained for acidic and basic components were generally <3, while those for the neutral components ranged from 3 to 6. For aromatic hydrocarbons, strong correlations were observed between log K/sub D/ and log S/sub w/ (water solubility), and between log K/sub D/ and log K/sub o//sub w/ (octanol/water partition coefficient). Alkylated benzenes had significantly higher K/sub D/s than did unsubstituted aromatics of similar molecular weight. Examination of homologs revealed an increase of 0.307 log K/sub D/ units per additional carbon atom for polynuclear aromatic hydrocarbons having from 10 to 16 carbons. Alkyl substituent effects determined for various sets of homologs ranged from 0.391 to 0.466 log K/sub d/ units per -CH/sub 2/- group added. 38 refs., 5 figs., 7 tabs.
Reverse micelle-based water-soluble nanoparticles for simultaneous bioimaging and drug delivery.
Chen, Ying; Liu, Yong; Yao, Yongchao; Zhang, Shiyong; Gu, Zhongwei
2017-04-11
With special confined water pools, reverse micelles (RMs) have shown potential for a wide range of applications. However, the inherent water-insolubility of RMs hinders their further application prospects, especially for applications related to biology. We recently reported the first successful transfer of RMs from organic media to an aqueous phase without changing the smart water pools by the hydrolysis of an arm-cleavable interfacial cross-linked reverse micelles. Herein, we employed another elaborate amphiphile 1 to construct new acrylamide-based cross-linked water-soluble nanoparticles (ACW-NPs) under much gentler conditions. The special property of the water pools of the ACW-NPs was confirmed by both the Förster resonance energy transfer (FRET) between 5-((2-aminoethyl)amino)naphthalene-1-sulfonic acid (1,5-EDANS) and benzoic acid, 4-[2-[4-(dimethylamino)phenyl]diazenyl] (DABCYL) and satisfactory colloidal stability in 10% fetal bovine serum. Importantly, featured by the gentle synthetic strategy, confined water pool, and carboxylic acid-functionalized surface, the new ACW-NPs are well suitable for biological applications. As an example, the fluorescent reagent 8-hydroxy-1,3,6-pyrenetrisulfonic acid trisodium salt (HPTS) was encapsulated in the core and simultaneously, the anticancer drug gemcitabine (Gem) was covalently conjugated onto the surface exterior. As expected, the resulting multifunctional ACW-NPs@HPTS@Gem exhibits a high imaging effect and anticancer activity for non-small lung cancer cells.
Czech Academy of Sciences Publication Activity Database
Roth, Michal
2016-01-01
Roč. 50, č. 23 (2016), s. 12857-12863 ISSN 0013-936X R&D Projects: GA ČR(CZ) GA16-03749S Institutional support: RVO:68081715 Keywords : partitioning between water and supercritical CO2 * organic solutes * K-factor modeling * linear solvation energy relationship Subject RIV: CB - Analytical Chemistry, Separation Impact factor: 6.198, year: 2016
International Nuclear Information System (INIS)
Labadie, Pierre; Chevreuil, Marc
2011-01-01
This paper reports on the partitioning behaviour of 15 perfluorinated compounds (PFCs), including C 4 -C 10 sulfonates and C 5 -C 14 carboxylic acids, between water, sediment and fish (European chub, Leuciscus cephalus) in the Orge River (nearby Paris). Total PFC levels were 73.0 ± 3.0 ng L -1 in water and 8.4 ± 0.5 ng g -1 in sediment. They were in the range 43.1-4997.2 ng g -1 in fish, in which PFC tissue distribution followed the order plasma > liver > gills > gonads > muscle. Sediment-water distribution coefficients (log K d ) and bioaccumulation factors (log BAF) were in the range 0.8-4.3 and 0.9-6.7, respectively. Both distribution coefficients positively correlated with perfluoroalkyl chain length. Field-based biota-sediment accumulation factors (BSAFs) are also reported, for the first time for PFCs other than perfluorooctane sulfonate. log BSAF ranged between -1.3 and 1.5 and was negatively correlated with the perfluoroalkyl chain length in the case of carboxylic acids. - Research highlights: → PFC tissue distribution in European chub followed the order plasma > liver > gills > gonads > muscle. → K d and BAF correlated with PFC alkyl chain length. → BSAF negatively correlated with the perfluoroalkyl chain length in the case of carboxylic acids. → BSAF did not correlate with alkyl chain length of sulfonates. - Sediment-water, biota-water and biota-sediment partitioning coefficients were determined for perfluorinated acids and sulfonates and were generally correlated with alkyl chain length.
Energy Technology Data Exchange (ETDEWEB)
Zhao, Shengnan [State Key Laboratory of Water Environment Simulation, School of Environment, Beijing Normal University, Beijing 100875 (China); Liu, Xinhui, E-mail: xhliu@bnu.edu.cn [State Key Laboratory of Water Environment Simulation, School of Environment, Beijing Normal University, Beijing 100875 (China); Cheng, Dengmiao [Institute of Agricultural Resources and Regional Planning, Chinese Academy of Agricultural Sciences, Key Laboratory of Plant Nutrition and Fertilizer, Ministry of Agriculture, Beijing 100081 (China); Liu, Guannan [MLR Key Laboratory of Metallogeny and Mineral Assessment, Institute of Mineral Resources, CAGS, Beijing 100037 (China); Liang, Baocui; Cui, Baoshan; Bai, Junhong [State Key Laboratory of Water Environment Simulation, School of Environment, Beijing Normal University, Beijing 100875 (China)
2016-11-01
As special zones, the intertidal zones of the Yellow River Delta (YRD) are highly variable along with time and space. Fluvial–marine and land–ocean interactions which frequently occur in these areas have a great impact on the fate of pollutants. Antibiotics, which contribute to antibiotic-resistant genes (ARGs), are widely detected in wastewater, natural water, soil, sediments, and even drinking water. Therefore, it is meaningful to investigate the occurrence and fate of antibiotics in these special zones. In this study, eight antibiotics belonging to tetracyclines (TCs), fluoroquinolones (FQs), and macrolides (MLs) were detected in the surface water and sediments from the intertidal zones of YRD during two seasons. Two models were established to predict the partitioning coefficients of norfloxacin (NOR) and erythromycin (ETM) using physicochemical properties of sediments, respectively. The total concentrations of these antibiotics were 82.94–230.96 ng·L{sup −} {sup 1} and 40.97–207.44 ng·g{sup −} {sup 1}, respectively, in the surface water and sediments. Seasonal variation was mainly influenced by the frequency of antibiotics use and environment factors. The regions with river supply exhibited the highest concentrations of antibiotics in surface water and sediments. Meanwhile, particle-size fractions, cation exchange capability (CEC), and metal ions content played dominant roles in the partitioning behaviors of NOR and ETM between the surface water and sediments. Both models established in this study featured accuracy and feasibility, which provided the methods for predicting the partitioning coefficients of emerging contaminants similar in structures to NOR and ETM in the intertidal zones. - Highlights: • The intertidal zones of YRD were polluted by antibiotics to some extent. • The river supply was a major pathway for the antibiotic pollution of the intertidal zones of YRD. • The partitioning coefficients of NOR and ETM can be predicted using
McCullagh, John
2018-01-01
This sixth-form chemistry activity describes how students can use acid-base titrimetry to investigate how adding salt to the aqueous phase may change the value of the partition coefficient of an organic acid between water and 2-methylpropan-1-ol. While the presence of lithium chloride and sodium chloride increases the value of the partition…
Modeling water and hydrogen networks with partitioning regeneration units
Directory of Open Access Journals (Sweden)
W.M. Shehata
2015-03-01
Full Text Available Strict environment regulations in chemical and refinery industries lead to minimize resource consumption by designing utility networks within industrial process plants. The present study proposed a superstructure based optimization model for the synthesis of water and hydrogen networks with partitioning regenerators without mixing the regenerated sources. This method determines the number of partitioning regenerators needed for the regeneration of the sources. The number of the regenerators is based on the number of sources required to be treated for recovery. Each source is regenerated in an individual partitioning regenerator. Multiple regeneration systems can be employed to achieve minimum flowrate and costs. The formulation is linear in the regenerator balance equations. The optimized model is applied for two systems, partitioning regeneration systems of the fixed outlet impurity concentration and partitioning regeneration systems of the fixed impurity load removal ratio (RR for water and hydrogen networks. Several case studies from the literature are solved to illustrate the ease and applicability of the proposed method.
New self-assembled nanocrystal micelles for biolabels and biosensors.
Energy Technology Data Exchange (ETDEWEB)
Tallant, David Robert; Wilson, Michael C. (University of New Mexico, Albuquerque, NM); Leve, Erik W. (University of New Mexico, Albuquerque, NM); Fan, Hongyou; Brinker, C. Jeffrey; Gabaldon, John (University of New Mexico, Albuquerque, NM); Scullin, Chessa (University of New Mexico, Albuquerque, NM)
2005-12-01
The ability of semiconductor nanocrystals (NCs) to display multiple (size-specific) colors simultaneously during a single, long term excitation holds great promise for their use in fluorescent bio-imaging. The main challenges of using nanocrystals as biolabels are achieving biocompatibility, low non-specific adsorption, and no aggregation. In addition, functional groups that can be used to further couple and conjugate with biospecies (proteins, DNAs, antibodies, etc.) are required. In this project, we invented a new route to the synthesis of water-soluble and biocompatible NCs. Our approach is to encapsulate as-synthesized, monosized, hydrophobic NCs within the hydrophobic cores of micelles composed of a mixture of surfactants and phospholipids containing head groups functionalized with polyethylene glycol (-PEG), -COOH, and NH{sub 2} groups. PEG provided biocompatibility and the other groups were used for further biofunctionalization. The resulting water-soluble metal and semiconductor NC-micelles preserve the optical properties of the original hydrophobic NCs. Semiconductor NCs emit the same color; they exhibit equal photoluminescence (PL) intensity under long-time laser irradiation (one week) ; and they exhibit the same PL lifetime (30-ns). The results from transmission electron microscopy and confocal fluorescent imaging indicate that water-soluble semiconductor NC-micelles are biocompatible and exhibit no aggregation in cells. We have extended the surfactant/lipid encapsulation techniques to synthesize water-soluble magnetic NC-micelles. Transmission electron microscopy results suggest that water-soluble magnetic NC-micelles exhibit no aggregation. The resulting NC-micelles preserve the magnetic properties of the original hydrophobic magnetic NCs. Viability studies conducted using yeast cells suggest that the magnetic nanocrystal-micelles are biocompatible. We have demonstrated, for the first time, that using external oscillating magnetic fields to manipulate
Poša, Mihalj; Pilipović, Ana; Bećarević, Mirjana; Farkaš, Zita
2017-01-01
Due to a relatively small size of bile acid salts, their mixed micelles with nonionic surfactants are analysed. Of the special interests are real binary mixed micelles that are thermodynamically more stable than ideal mixed micelles. Thermodynamic stability is expressed with an excess Gibbs energy (G E ) or over an interaction parameter (β ij ). In this paper sodium salts of cholic (C) and hyodeoxycholic acid (HD) in their mixed micelles with Tween 40 (T40) are analysed by potentiometric titration and their pKa values are determined. Examined bile acids in mixed micelles with T40 have higher pKa values than free bile acids. The increase of ΔpKa acid constant of micellary bound C and HD is in a correlation with absolute values of an interaction parameter. According to an interaction parameter and an excess Gibbs energy, mixed micelle HD-T40 are thermodynamically more stable than mixed micelles C-T40. ΔpKa values are higher for mixed micelles with Tween 40 whose second building unit is HD, related to the building unit C. In both micellar systems, ΔpKa increases with the rise of a molar fraction of Tween 40 in binary mixtures of surfactants with sodium salts of bile acids. This suggests that, ΔpKa can be a measure of a thermodynamic stabilization of analysed binary mixed micelles as well as an interaction parameter. ΔpKa values are confirmed by determination of a distribution coefficient of HD and C in systems: water phase with Tween 40 in a micellar concentration and 1-octanol, with a change of a pH value of a water phase. Conformational analyses suggests that synergistic interactions between building units of analysed binary micelles originates from formation of hydrogen bonds between steroid OH groups and polyoxyethylene groups of the T40. Relative similarity and spatial orientation of C 3 and C 6 OH group allows cooperative formation of hydrogen bonds between T40 and HD - excess entropy in formation of mixed micelle. If a water solution of analysed binary
Nie, Kaixuan; Dong, Bo; Shi, Huanhuan; Liu, Zhengchun; Liang, Bo
2017-03-07
A technique for encapsulating fluorescent organic probes in a micelle system offers an important alternative method to manufacture water-soluble organic nanoparticles (ONPs) for use in sensing Hg 2+ . This article reports on a study of a surfactant-free micelle-like ONPs based on a 3,6-di(2-thienyl)-2,5-dihydropyrrolo[3,4-c]pyrrole-1,4-dione (TDPP) amphiphile, (2-(2-(2-methoxyethoxy)ethyl)-3,6-di(2-thiophyl)-2,5-dihydropyrrolo[3,4-c]pyrrole-1,4-dione (NDPP) fabricated to monitor Hg 2+ in water. NDPP was synthesized through a simple one-step modification of a commercially available dye TDPP with a flexible and hydrophilic alkoxy. This study reports, for the first time, that TDPP dyes can respond reversibly, sensitively, and selectively to Hg 2+ through TDPP-Hg-TDPP complexation, similar to the well-known thymine(T)-Hg-thymine(T) model and the accompanying molecular aggregation. Interestingly, transmission electron microscopy (TEM) and dynamic light scattering (DLS) confirmed that, in water, NDPP forms loose micelle-like fluorescent ONPs with a hydrohobic TDPP portion encapsulated inside. These micelle-like nanoparticles offer an ideal location for TDPP-Hg complexation with a modest molecular aggregation, thereby providing both clear visual and spectroscopic signals for Hg 2+ sensing. An estimated detection limit of 11 nM for Hg 2+ sensing with this NDPP nanoparticle was obtained. In addition, NDPP ONPs show good water solubility and high selectivity to Hg 2+ in neutral or alkalescent water. It was superior to most micelle-based nanosensors, which require a complicated process in the selection or synthesis of suitable surfactants. The determinations in real samples (river water) were made and satisfactory results were achieved. This study provides a low-cost strategy for fabricating small molecule-based fluorescent nanomaterials for use in sensing Hg 2+ . Moreover, the NDPP nanoparticles show potential ability in Hg 2+ ion adsorption and recognization of cysteine
Water Partitioning in Planetary Embryos and Protoplanets with Magma Oceans
Ikoma, M.; Elkins-Tanton, L.; Hamano, K.; Suckale, J.
2018-06-01
The water content of magma oceans is widely accepted as a key factor that determines whether a terrestrial planet is habitable. Water ocean mass is determined as a result not only of water delivery and loss, but also of water partitioning among several reservoirs. Here we review our current understanding of water partitioning among the atmosphere, magma ocean, and solid mantle of accreting planetary embryos and protoplanets just after giant collisions. Magma oceans are readily formed in planetary embryos and protoplanets in their accretion phase. Significant amounts of water are partitioned into magma oceans, provided the planetary building blocks are water-rich enough. Particularly important but still quite uncertain issues are how much water the planetary building blocks contain initially and how water goes out of the solidifying mantle and is finally degassed to the atmosphere. Constraints from both solar-system explorations and exoplanet observations and also from laboratory experiments are needed to resolve these issues.
International Nuclear Information System (INIS)
Chollet-Krugler, Marylene; Legouin, Beatrice; Gargadennec, Sylvain; Burgot, Gwenola; Burgot, Jean-Louis
2004-01-01
Thermometric titrations performed in suitable conditions permit the determination of the enthalpic and entropic parts of the standard transfer-free enthalpy of a particular 5-formyl-1,2-dithiole-3-thione from water into n-octanol. It may be inferred from this determination that the far too high water/n-octanol log P values of 5-acyl-1,2-dithiole-3-thiones originate in an entropic effect which is in agreement with the hypothesis that these derivatives are more solvated in water than expected and hence with the hypothesis that during partitioning between the two phases, more molecules of water than expected are released from the solvated solute in the aqueous phase. The family of 1,2-dithiole-3-thiones is of growing importance in pharmacology
Energy Technology Data Exchange (ETDEWEB)
Chollet-Krugler, Marylene; Legouin, Beatrice; Gargadennec, Sylvain; Burgot, Gwenola; Burgot, Jean-Louis
2004-12-15
Thermometric titrations performed in suitable conditions permit the determination of the enthalpic and entropic parts of the standard transfer-free enthalpy of a particular 5-formyl-1,2-dithiole-3-thione from water into n-octanol. It may be inferred from this determination that the far too high water/n-octanol log P values of 5-acyl-1,2-dithiole-3-thiones originate in an entropic effect which is in agreement with the hypothesis that these derivatives are more solvated in water than expected and hence with the hypothesis that during partitioning between the two phases, more molecules of water than expected are released from the solvated solute in the aqueous phase. The family of 1,2-dithiole-3-thiones is of growing importance in pharmacology.
Radiochromic leuco dye micelle hydrogels: I. Initial investigation
International Nuclear Information System (INIS)
Jordan, Kevin; Avvakumov, Nikita
2009-01-01
This investigation reports the use of surfactants and colorless leuco triarylmethane dyes to form a new class of radiochromic micelle hydrogels for three-dimensional (3D) water-equivalent dosimetry. Gelatin gel samples with several surfactants and leuco dyes were prepared and evaluated for optical transparency, dose sensitivity and diffusion rates. The addition of Triton X-100, a non-ionic surfactant, at levels exceeding the critical micelle concentration provides a transparent hydrogel in which the water insoluble leuco Malachite Green (LMG) can dissolve. During irradiation, the LMG dye precursor converts to Malachite Green (MG + ). The most sensitive reported LMG gel formulation contains 0.3 mM LMG leuco dye, 16 mM trichloroacetic acid, 7 mM Triton X-100 and 4% w/w gelatin. A diffusion coefficient of 0.14 mm 2 h -1 was determined for MG + in this gel by fitting the time-dependent degradation of the transmission profile after irradiating half of the sample. The diffusion rate was three times lower than the standard radiochromic ferrous xylenol-orange (FX) gel. The primary feature of this 3D hydrogel is that it introduces transparent, radiochromic, micelle hydrogels. The radiochromic response to dose is instantaneous and images are stable for several hours. A dosimetric characterization revealed that the dose response is reproducible to within 10% over five separate batches and independent of both energy and dose rate. Uniform pre-irradiation of samples to 5 Gy provided a subsequent near linear response to greater than 110 Gy. LMG gels when read with a fast optical CT scanner can provide full 3D dose distributions in less than 30 min post-irradiation. LMG micelle gels scanned with a 633 nm light source are a promising system for quantitative water- or tissue-equivalent 3D dose verification in the 5-100 Gy dose range. These gels are useful for the scanning of larger volume dosimeters (i.e. >15 cm diameter) since they are easily prepared with inexpensive ingredients
The partition and effective diffusion coefficients of formaldehyde were measured for three materials (conventional gypsum wallboard, "green" gypsum wallboard, and "green" carpet) under three relative humidity (RH) conditions (20%, 50% and 70% RH). A dynamic dual-chamber test meth...
Photophysical study of a charge transfer oxazole dye in micelles: Role of surfactant headgroups
Energy Technology Data Exchange (ETDEWEB)
Maiti, Jyotirmay [Department of Chemistry, West Bengal State University, Barasat, Kolkata 700126 (India); Sarkar, Yeasmin; Parui, Partha Pratim [Department of Chemistry, Jadavpur University, Kolkata 700032 (India); Chakraborty, Sandipan [Department of Microbiology, University of Calcutta, Kolkata 700019 (India); Biswas, Suman [Department of Chemistry, West Bengal State University, Barasat, Kolkata 700126 (India); Das, Ranjan, E-mail: ranjan.das68@gmail.com [Department of Chemistry, West Bengal State University, Barasat, Kolkata 700126 (India)
2015-07-15
Photophysics of 5-(4′′-dimethylaminophenyl)-2-(4′-sulfophenyl)oxazole, sodium salt (DMO) which undergoes intramolecular charge transfer in the excited state was studied in micelles. In the cationic and the nonionic micelles, significantly higher fluorescence quantum yield is observed in comparison to the anionic micelles, due to much lower accessibility of DMO to the water molecules in the former micelles than the latter. Time-resolved fluorescence decays were characterized by a fast (τ{sub 1}) and a slow (τ{sub 2}) component of decay in all the micelles. The fast decay component (τ{sub 1}) increases significantly in going from the anionic micelles to the cationic micelles, because of the poorly hydrated headgroup region of the latter micelles compared to the former. Furthermore, much higher value of the slow component of decay (τ{sub 2}) is observed for the cationic and the neutral micelles than the anionic micelles. This is attributed to the increased penetration of water molecules into the micellar core of the anionic micelles compared to the cationic and the neutral micelles. - Highlights: • Photophysics of the fluorophore are remarkably different in the cationic and the anionic micelles. • Differential hydration of the surfactant headgroups gives rise to significantly different fluorescence quantum yield and lifetime in oppositely charged micelles. • Electrostatic interactions fine tune location of the fluorophore in the micelle–water interface of ionic micelles.
Stability of casein micelles in milk
Tuinier, R.; de Kruif, C. G.
2002-07-01
Casein micelles in milk are proteinaceous colloidal particles and are essential for the production of flocculated and gelled products such as yogurt, cheese, and ice-cream. The colloidal stability of casein micelles is described here by a calculation of the pair potential, containing the essential contributions of brush repulsion, electrostatic repulsion, and van der Waals attraction. The parameters required are taken from the literature. The results are expressed by the second osmotic virial coefficient and are quite consistent with experimental findings. It appears that the stability is mainly attributable to a steric layer of κ-casein, which can be described as a salted polyelectrolyte brush.
Thermodynamics of micelle formation in a water-alcohol solution of sodium tetradecyl sulfate
Shilova, S. V.; Tret'yakova, A. Ya.; Barabanov, V. P.
2016-01-01
The effects of addition of ethanol and propan-1-ol on sodium tetradecyl sulfate micelle formation in an aqueous solution are studied via microprobe fluorescence microscopy and conductometry. The critical micelle concentration, quantitative characteristics of micelles, and thermodynamic parameters of micelle formation are determined. Addition of 5-15 vol % of ethanol or 5-10 vol % of propan-1-ol is shown to result in a lower critical micelle concentration than in the aqueous solution, and in the formation of mixed spherical micelles whose sizes and aggregation numbers are less than those for the systems without alcohol. The contribution from the enthalpy factor to the free energy of sodium tetradecyl sulfate micelle formation is found to dominate in mixed solvents, in contrast to aqueous solutions.
Enhanced solubility and targeted delivery of curcumin by lipopeptide micelles.
Liang, Ju; Wu, Wenlan; Lai, Danyu; Li, Junbo; Fang, Cailin
2015-01-01
A lipopeptide (LP)-containing KKGRGDS as the hydrophilic heads and lauric acid (C12) as the hydrophobic tails has been designed and prepared by standard solid-phase peptide synthesis technique. LP can self-assemble into spherical micelles with the size of ~30 nm in PBS (phosphate buffer saline) (pH 7.4). Curcumin-loaded LP micelles were prepared in order to increase the water solubility, sustain the releasing rate, and improve the tumor targeted delivery of curcumin. Water solubility, cytotoxicity, in vitro release behavior, and intracellular uptake of curcumin-loaded LP micelles were investigated. The results showed that LP micelles can increase the water solubility of curcumin 1.1 × 10(3) times and sustain the release of curcumin in a low rate. Curcumin-loaded LP micelles showed much higher cell inhibition than free curcumin on human cervix carcinoma (HeLa) and HepG2 cells. When incubating these curcumin-loaded micelles with HeLa and COS7 cells, due to the over-expression of integrins on cancer cells, the micelles can efficiently use the tumor-targeting function of RGD (functionalized peptide sequences: Arg-Gly-Asp) sequence to deliver the drug into HeLa cells, and better efficiency of the self-assembled LP micelles for curcumin delivery than crude curcumin was also confirmed by LCSM (laser confocal scanning microscope) assays. Combined with the enhanced solubility and higher cell inhibition, LP micelles reported in this study may be promising in clinical application for targeted curcumin delivery.
Korinth, Gintautas; Wellner, Tanja; Schaller, Karl Heinz; Drexler, Hans
2012-11-23
Aqueous amphiphilic compounds may exhibit enhanced skin penetration compared with neat compounds. Conventional models do not predict this percutaneous penetration behaviour. We investigated the potential of the octanol-water partition coefficient (logP) to predict dermal fluxes for eight compounds applied neat and as 50% aqueous solutions in diffusion cell experiments using human skin. Data for seven other compounds were accessed from literature. In total, seven glycol ethers, three alcohols, two glycols, and three other chemicals were considered. Of these 15 compounds, 10 penetrated faster through the skin as aqueous solutions than as neat compounds. The other five compounds exhibited larger fluxes as neat applications. For 13 of the 15 compounds, a consistent relationship was identified between the percutaneous penetration behaviour and the logP. Compared with the neat applications, positive logP were associated with larger fluxes for eight of the diluted compounds, and negative logP were associated with smaller fluxes for five of the diluted compounds. Our study demonstrates that decreases or enhancements in dermal penetration upon aqueous dilution can be predicted for many compounds from the sign of logP (i.e., positive or negative). This approach may be suitable as a first approximation in risk assessments of dermal exposure. Copyright © 2012 Elsevier Ireland Ltd. All rights reserved.
Measurement of diffusion coefficients of parabens and steroids in water and 1-octanol.
Seki, Toshinobu; Mochida, Junko; Okamoto, Maiko; Hosoya, Osamu; Juni, Kazuhiko; Morimoto, Kazuhiro
2003-06-01
Diffusion coefficients (D) of parabens and steroids in water and 1-octanol were determined by using the chromatographic broadening method at 37 degrees C, and the relationships between the D values and the physicochemical properties of the drugs were discussed. The D values in 1-octanol were lower than those in water because of the higher viscosity of 1-octanol. The D values depend on not only the molecular weight (MW), but also the lipophilicity of the drugs in water and on the ability for hydrogen-bonding in 1-octanol. When the lipophilic index (LI), calculated from the retention time using in a reverse-phase column, was used as a parameter of drug lipophilicity, the following equation was obtained for D in water (D(w)); log D(w)=-0.215.log MW-0.077.log LI-4.367. When the hydrogen bond index (HI), the logarithm of the ratio of the partition coefficient of the drugs in 1-octanol and cyclohexane, was used as an index of hydrogen-bonding, the following equation was obtained for D in 1-octanol (D(o)); log D(o)=-0.690.log MW-0.074.log HI-4.085.
CALCULATION OF COEFFICIENT OF SHARING OCTANOL-WATER OF ORGANIC COMPOUNDS USING MOLECULAR DESCRIPTORS
Directory of Open Access Journals (Sweden)
B. Souyei
2010-12-01
Full Text Available A quantitative structure-property relationship (QSPR study is carried out to develop correlations that relate the molecular structures of organic compounds to their Octanol- Water partition coefficients, Kow , using molecular descriptors. The correlations are simple in application with good accuracy, which provide an easy, direct and relatively accurate way to calculate Kow. Such calculation gives us a model that gives results in remarkable correlation with the descriptors of blocks fragments of the atom-centered and functional groups (R2 = 0.949, δ = 0477 (R2 = 0.926,δ = 0,548 respectively.
The partition and effective diffusion coefficients of formaldehyde were measured for three materials (conventional gypsum wallboard, "green" gypsum wallboard, and "green" carpet) under three relative humidity (RH) conditions (20%, 50% and 70% RH). A dynamic dual-chamber test meth...
Equilibrium partitioning of drug molecules between aqueous and amino acid ester-based ionic liquids
International Nuclear Information System (INIS)
Jing, Jun; Li, Zhiyong; Pei, Yuanchao; Wang, Huiyong; Wang, Jianji
2013-01-01
Highlights: ► Partition coefficients of twelve drug molecules in ILs have been determined. ► The possible mechanism has been investigated from 13 C NMR measurements. ► Hydrophobic π–π interaction is the main driving force for the partitioning of drug molecules. -- Abstract: In this work, a series of novel room temperature ionic liquids (ILs) have been synthesized with cheap, naturally α-amino acid ester as cations and bis(trifluoromethylsulfonyl)imide as anion. The glass transition temperature and thermal decomposition temperature of these ILs, partition coefficients of some coumarins and purine alkaloids between water and the amino acid ester-based ILs at T = 298.15 K, and Gibbs energy, enthalpy and entropy changes for the transfer of caffeine and 6,7-dihydroxycoumarin from water to [LeuC 2 ][Tf 2 N] have been determined. It is shown that these ILs are highly effective materials for the extraction of drug compounds like coumarin, 4-hydroxycoumarin, 7-hydroxycoumarin, 3-aminocoumarin, coumarin-3-carboxylic acid, 6,7-dihydroxycoumarin, 6,7-dihydroxy-4-methylcoumarin, caffeine, theobromine, theophylline, inosine, and 2,6-diaminopurine. The partition process is driven by enthalpy term, and partition coefficients of the drug molecules increase with the increase of hydrophobicity of both the drug molecules and the ILs. Furthermore, the possible partition mechanism has been investigated from 13 C NMR measurements
Polymeric micelles as a drug carrier for tumor targeting
Directory of Open Access Journals (Sweden)
Neha M Dand
2013-01-01
Full Text Available Polymeric micelle can be targeted to tumor site by passive and active mechanism. Some inherent properties of polymeric micelle such as size in nanorange, stability in plasma, longevity in vivo, and pathological characteristics of tumor make polymeric micelles to be targeted at the tumor site by passive mechanism called enhanced permeability and retention effect. Polymeric micelle formed from the amphiphilic block copolymer is suitable for encapsulation of poorly water soluble, hydrophobic anticancer drugs. Other characteristics of polymeric micelles such as separated functionality at the outer shell are useful for targeting the anticancer drug to tumor by active mechanisms. Polymeric micelles can be conjugated with many ligands such as antibodies fragments, epidermal growth factors, α2 -glycoprotein, transferrine, and folate to target micelles to cancer cells. Application of heat and ultrasound are the alternative methods to enhance drug accumulation in tumoral cells. Targeting using micelles can also be done to tumor angiogenesis which is the potentially promising target for anticancer drugs. This review summarizes about recently available information regarding targeting the anticancer drug to the tumor site using polymeric micelles.
Partitioning of monomethylmercury between freshwater algae and water.
Miles, C J; Moye, H A; Phlips, E J; Sargent, B
2001-11-01
Phytoplankton-water monomethylmercury (MeHg) partition constants (KpI) have been determined in the laboratory for two green algae Selenastrum capricornutum and Cosmarium botrytis, the blue-green algae Schizothrix calcicola, and the diatom Thallasiosira spp., algal species that are commonly found in natural surface waters. Two methods were used to determine KpI, the Freundlich isotherm method and the flow-through/dialysis bag method. Both methods yielded KpI values of about 10(6.6) for S. capricornutum and were not significantly different. The KpI for the four algae studied were similar except for Schizothrix, which was significantly lower than S. capricornutum. The KpI for MeHg and S. capricornutum (exponential growth) was not significantly different in systems with predominantly MeHgOH or MeHgCl species. This is consistent with other studies that show metal speciation controls uptake kinetics, but the reactivity with intracellular components controls steady-state concentrations. Partitioning constants determined with exponential and stationary phase S. capricornutum cells at the same conditions were not significantly different, while the partitioning constant for exponential phase, phosphorus-limited cells was significantly lower, suggesting that P-limitation alters the ecophysiology of S. capricornutum sufficiently to impact partitioning, which may then ultimately affect mercury levels in higher trophic species.
Partitioning of fluorotelomer alcohols to octanol and different sources of dissolved organic carbon.
Carmosini, Nadia; Lee, Linda S
2008-09-01
Interest in the environmental fate of fluorotelomer alcohols (FTOHs) has spurred efforts to understand their equilibrium partitioning behavior. Experimentally determined partition coefficients for FTOHs between soil/water and air/water have been reported, but direct measurements of partition coefficients for dissolved organic carbon (DOC)/water (K(doc)) and octanol/ water(K(ow)) have been lacking. Here we measured the partitioning of 8:2 and 6:2 FTOH between one or more types of DOC and water using enhanced solubility or dialysis bag techniques, and also quantified K(ow) values for 4:2 to 8:2 FTOH using a batch equilibration method. The range in measured log K(doc) values for 8:2 FTOH using the enhanced solubility technique with DOC derived from two soils, two biosolids, and three reference humic acids is 2.00-3.97 with the lowest values obtained for the biosolids and an average across all other DOC sources (biosolid DOC excluded) of 3.54 +/- 0.29. For 6:2 FTOH and Aldrich humic acid, a log K(doc) value of 1.96 +/- 0.45 was measured using the dialysis technique. These average values are approximately 1 to 2 log units lower than previously indirectly estimated K(doc) values. Overall, the affinity for DOC tends to be slightly lower than that for particulate soil organic carbon. Measured log K(ow) values for 4:2 (3.30 +/- 0.04), 6:2 (4.54 +/- 0.01), and 8:2 FTOH (5.58 +/- 0.06) were in good agreement with previously reported estimates. Using relationships between experimentally measured partition coefficients and C-atom chain length, we estimated K(doc) and K(ow) values for shorter and longer chain FTOHs, respectively, that we were unable to measure experimentally.
Bhowal, Saibal; Priyanka, B S; Rastogi, Navin K
2014-01-01
Our earlier work for the first time demonstrated that liquid emulsion membrane (LEM) containing reverse micelles could be successfully used for the downstream processing of lipase from Aspergillus niger. In the present work, we have attempted to increase the extraction and purification fold of lipase by using mixed reverse micelles (MRM) consisting of cationic and nonionic surfactants in LEM. It was basically prepared by addition of the internal aqueous phase solution to the organic phase followed by the redispersion of the emulsion in the feed phase containing enzyme, which resulted in globules of water-oil-water (WOW) emulsion for the extraction of lipase. The optimum conditions for maximum lipase recovery (100%) and purification fold (17.0-fold) were CTAB concentration 0.075 M, Tween 80 concentration 0.012 M, at stirring speed of 500 rpm, contact time 15 min, internal aqueous phase pH 7, feed pH 9, KCl concentration 1 M, NaCl concentration 0.1 M, and ratio of membrane emulsion to feed volume 1:1. Incorporation of the nonionic surfactant (e.g., Tween 80) resulted in remarkable improvement in the purification fold (3.1-17.0) of the lipase. LEM containing a mixture of nonionic and cationic surfactants can be successfully used for the enhancement in the activity recovery and purification fold during downstream processing of enzymes/proteins. © 2014 American Institute of Chemical Engineers.
Diaz-Rodriguez, Sebastian; Bozada, Samantha M.; Phifer, Jeremy R.; Paluch, Andrew S.
2016-11-01
We present blind predictions using the solubility parameter based method MOSCED submitted for the SAMPL5 challenge on calculating cyclohexane/water distribution coefficients at 298 K. Reference data to parameterize MOSCED was generated with knowledge only of chemical structure by performing solvation free energy calculations using electronic structure calculations in the SMD continuum solvent. To maintain simplicity and use only a single method, we approximate the distribution coefficient with the partition coefficient of the neutral species. Over the final SAMPL5 set of 53 compounds, we achieved an average unsigned error of 2.2± 0.2 log units (ranking 15 out of 62 entries), the correlation coefficient ( R) was 0.6± 0.1 (ranking 35), and 72± 6 % of the predictions had the correct sign (ranking 30). While used here to predict cyclohexane/water distribution coefficients at 298 K, MOSCED is broadly applicable, allowing one to predict temperature dependent infinite dilution activity coefficients in any solvent for which parameters exist, and provides a means by which an excess Gibbs free energy model may be parameterized to predict composition dependent phase-equilibrium.
Diclofenac/biodegradable polymer micelles for ocular applications
Li, Xingyi; Zhang, Zhaoliang; Li, Jie; Sun, Shumao; Weng, Yuhua; Chen, Hao
2012-07-01
In this paper, methoxypoly(ethylene glycol)-poly(ε-caprolactone) (MPEG-PCL) micelle formulations as promising nano-carriers for poorly water soluble drugs were investigated for the delivery of diclofenac to the eye. Diclofenac loaded MPEG-PCL micelles were prepared by a simple solvent-diffusion method and characterized by dynamic light scattering (DLS), atomic force microscopy (AFM), Fourier transform infra-red (FTIR), X-ray diffraction (XRD), differential scanning calorimetery (DSC), etc. With the analysis of XRD and DSC, the diclofenac was present as an amorphous state in the formulation. The in vitro release profile indicated a sustained release manner of diclofenac from the micelles. Meanwhile, in vivo studies on eye irritation were performed with blank MPEG-PCL micelles (200 mg ml-1). The results showed that the developed MPEG-PCL micelles were non-irritants to the eyes of rabbits. In vitro penetration studies across the rabbit cornea demonstrated that the micelle formulations exhibited a 17-fold increase in penetration compared with that of diclofenac phosphate buffered saline (PBS) solution. The in vivo pharmacokinetics profile of the micelle parent drug in the aqueous humor of the rabbit was evaluated and the data showed that the diclofenac loaded MPEG-PCL micelles exhibited a 2-fold increase in AUC0-24 h than that of the diclofenac PBS solution eye drops. These results suggest a great potential of our micelle formulations as a novel ocular drug delivery system to improve the bioavailability of the drugs.
Kitt, Jay P; Harris, Joel M
2015-05-19
Octanol-water partitioning is one of the most widely used predictors of hydrophobicity and lipophilicity. Traditional methods for measuring octanol-water partition coefficients (K(ow)), including shake-flasks and generator columns, require hours for equilibration and milliliter quantities of sample solution. These challenges have led to development of smaller-scale methods for measuring K(ow). Recent advances in microfluidics have produced faster and smaller-volume approaches to measuring K(ow). As flowing volumes are reduced, however, separation of water and octanol prior to measurement and detection in small volumes of octanol phase are especially challenging. In this work, we reduce the receiver volume of octanol-water partitioning measurements from current practice by six-orders-of-magnitude, to the femtoliter scale, by using a single octanol-filled reversed-phase, octadecylsilane-modified (C18-silica) chromatographic particle as a collector. The fluid-handling challenges of working in such small volumes are circumvented by eliminating postequilibration phase separation. Partitioning is measured in situ within the pore-confined octanol phase using confocal Raman microscopy, which is capable of detecting and quantifying a wide variety of molecular structures. Equilibration times are fast (less than a minute) because molecular diffusion is efficient over distance scales of micrometers. The demonstrated amount of analyte needed to carry out a measurement is very small, less than 50 fmol, which would be a useful attribute for drug screening applications or testing of small quantities of environmentally sensitive compounds. The method is tested for measurements of pH-dependent octanol-water partitioning of naphthoic acid, and the results are compared to both traditional shake-flask measurements and sorption onto C18-modified silica without octanol present within the pores.
Directory of Open Access Journals (Sweden)
Xia HJ
2013-02-01
Full Text Available Hai-jian Xia,1,2 Zhen-hai Zhang,1 Xin Jin,1 Qin Hu,1 Xiao-yun Chen,1 Xiao-bin Jia11Key Laboratory of New Drug Delivery System of Chinese Materia Medica, Jiangsu Provincial Academy of Chinese Medicine, Nanjing, China; 2College of Pharmacy, Nanjing University of Chinese Medicine, Nanjing, ChinaAbstract: Mixed micelles are widely used to increase solubility and bioavailability of poorly soluble drugs. One promising antitumor drug candidate is 20(S-protopanaxadiol (PPD, although its clinical application is limited by low water solubility and poor bioavailability after oral administration. In this study, we developed mixed micelles consisting of PPD–phospholipid complexes and Labrasol® and evaluated their potential for oral PPD absorption. Micelles were prepared using a solvent-evaporation method, and their physicochemical properties, including particle size, zeta potential, morphology, crystal type, drug loading, drug entrapment efficiency, and solubility, were characterized. Furthermore, in vitro release was investigated using the dialysis method, and transport and bioavailability of the mixed micelles were investigated through a Caco-2 cell monolayer and in vivo absorption studies performed in rats. Compared with the solubility of free PPD (3 µg/mL, the solubility of PPD in the prepared mixed micelles was 192.41 ± 1.13 µg/mL in water at room temperature. The in vitro release profiles showed a significant difference between the more rapid release of free PPD and the slower and more sustained release of the mixed micelles. At the end of a 4-hour transport study using Caco-2 cells, the apical-to-basolateral apparent permeability coefficients (Papp increased from (1.12 ± 0.21 × 106 cm/s to (1.78 ± 0.16 × 106 cm/s, while the basolateral-to-apical Papp decreased from (2.42 ± 0.16 × 106 cm/s to (2.12 ± 0.32 × 106. In this pharmacokinetic study, compared with the bioavailability of free PPD (area under the curve [AUC]0–8, the
DEFF Research Database (Denmark)
Jerke, G.; Pedersen, J.S.; Egelhaaf, S.U.
1997-01-01
We report a systematic investigation of the static structure factor S(q,c) of polymerlike reverse micelles formed by soybean lecithin and trace amounts of water in deuterated isooctane using small-angle neutron scattering and static light scattering. The experimental data for different concentrat......We report a systematic investigation of the static structure factor S(q,c) of polymerlike reverse micelles formed by soybean lecithin and trace amounts of water in deuterated isooctane using small-angle neutron scattering and static light scattering. The experimental data for different...
Roche, Camille J.; Dantsker, David; Heller, Elizabeth R.; Sabat, Joseph E.; Friedman, Joel M.
2013-08-01
Hydration waters impact protein dynamics. Dissecting the interplay between hydration waters and dynamics requires a protein that manifests a broad range of dynamics. Proteins in reverse micelles (RMs) have promise as tools to achieve this objective because the water content can be manipulated. Hemoglobin is an appropriate tool with which to probe hydration effects. We describe both a protocol for hemoglobin encapsulation in reverse micelles and a facile method using PEG and cosolvents to manipulate water content. Hydration properties are probed using the water-sensitive fluorescence from Hb bound pyranine and covalently attached Badan. Protein dynamics are probed through ligand recombination traces derived from photodissociated carbonmonoxy hemoglobin on a log scale that exposes the potential role of both α and β solvent fluctuations in modulating protein dynamics. The results open the possibility of probing hydration level phenomena in this system using a combination of NMR and optical probes.
Wong, Fiona; Wania, Frank
2011-06-01
Assessing the behaviour of organic chemicals in soil is a complex task as it is governed by the physical chemical properties of the chemicals, the characteristics of the soil as well as the ambient conditions of the environment. The chemical partitioning space, defined by the air-water partition coefficient (K(AW)) and the soil organic carbon-water partition coefficient (K(OC)), was employed to visualize the equilibrium distribution of organic contaminants between the air-filled pores, the pore water and the solid phases of the bulk soil and the relative importance of the three transport processes removing contaminants from soil (evaporation, leaching and particle erosion). The partitioning properties of twenty neutral organic chemicals (i.e. herbicides, pharmaceuticals, polychlorinated biphenyls and volatile chemicals) were estimated using poly-parameter linear free energy relationships and superimposed onto these maps. This allows instantaneous estimation of the equilibrium phase distribution and mobility of neutral organic chemicals in soil. Although there is a link between the major phase and the dominant transport process, such that chemicals found in air-filled pore space are subject to evaporation, those in water-filled pore space undergo leaching and those in the sorbed phase are associated with particle erosion, the partitioning coefficient thresholds for distribution and mobility can often deviate by many orders of magnitude. In particular, even a small fraction of chemical in pore water or pore air allows for evaporation and leaching to dominate over solid phase transport. Multiple maps that represent soils that differ in the amount and type of soil organic matter, water saturation, temperature, depth of surface soil horizon, and mineral matters were evaluated.
Zepon, Karine M; Otsuka, Issei; Bouilhac, Cécile; Muniz, Edvani C; Soldi, Valdir; Borsali, Redouane
2015-07-13
The synthesis and the solution-state self-assembly of the "hybrid" diblock copolymers, maltoheptaose-block-poly(methyl methacrylate) (MH-b-PMMA), into large compound micelles (LCMs) and reverve micelle-type nanoparticles, are reported in this paper. The copolymers were self-assembled in water and acetone by direct dissolution method, and the morphologies of the nanoparticles were investigated by dynamic light scattering (DLS), nanoparticle tracking analysis (NTA), transmission electron microscopy (TEM), atomic force microscopy (AFM), proton nuclear magnetic resonance ((1)H NMR), and fluorescence spectroscopy as a function of the volume fraction of the copolymer hydrophobic block, copolymer concentration, stirring speed, and solvent polarity. The DLS measurements and TEM images showed that the hydrodynamic radius (Rh) of the LCMs obtained in water increases with the copolymer concentration. Apart from that, increasing the stirring speed leads to polydispersed aggregations of the LCMs. On the other hand, in acetone, the copolymers self-assembled into reverse micelle-type nanoparticles having Rh values of about 6 nm and micellar aggregates, as revealed the results obtained from DLS, AFM, and (1)H NMR analyses. The variation in micellar structure, that is, conformational inversion from LCMs to reverse micelle-type structures in response to polarity of the solvent, was investigated by apparent water contact angle (WCA) and (1)H NMR analyses. This conformational inversion of the nanoparticles was further confirmed by encapsulation and release of hydrophobic guest molecule, Nile red, characterized by fluorescence spectroscopy.
Self-assembly of micelles into designed networks
Directory of Open Access Journals (Sweden)
Pyatenko Alexander
2007-01-01
Full Text Available AbstractThe EO20PO70EO20(molecular weight 5800 amphiphile as a template is to form dispersed micelle structures. Silver nanoparticles, as inorganic precursors synthesized by a laser ablation method in pure water, are able to produce the highly ordered vesicles detected by TEM micrography. The thickness of the outer layer of a micelle, formed by the silver nanoparticles interacting preferentially with the more hydrophilic EO20block, was around 3.5 nm. The vesicular structure ensembled from micelles is due to proceeding to the mixture of cubic and hexagonal phases.
Photophysical properties of pyronin dyes in reverse micelles of AOT
Energy Technology Data Exchange (ETDEWEB)
Bayraktutan, Tuğba; Meral, Kadem; Onganer, Yavuz, E-mail: yonganer@atauni.edu.tr
2014-01-15
The photophysical properties of pyronin B (PyB) and pyronin Y (PyY) in reverse micelles formed with water/sodium bis (2-ethyl-1-hexyl) sulfosuccinate (AOT)/n-heptane were investigated by UV–vis absorption, steady-state and time-resolved fluorescence spectroscopy techniques. This study was carried out a wide range of reverse micelle sizes, with hydrodynamic radii ranging from 1.85 to 9.38 nm. Significant photophysical parameters as band shifts, fluorescence quantum yields and fluorescence lifetimes were determined to understand how photophysical and spectroscopic features of the dye compounds were affected by the variation of reverse micelle sizes. In this regard, control of reverse micelle size by changing W{sub 0}, the molar ratio of water to surfactant, allowed tuning the photophysical properties of the dyes in organic solvent via reverse micelle. Non-fluorescent H-aggregates of pyronin dyes were observed for the smaller reverse micelles whereas an increase in the reverse micelle size induced an increment in the amount of dye monomers instead of dye aggregates. Thus, the fluorescence intensities of the dyes were improved by increasing W{sub 0} due to the predomination of the fluorescent dye monomers. As a result, the fluorescence quantum yields also increased. The fluorescence lifetimes of the dyes in the reverse micelles were determined by the time-resolved fluorescence decay studies. Evaluation of the fluorescence lifetimes calculated for pyronin dyes in the reverse micelles showed that the size of reverse micelle affected the fluorescence lifetimes of pyronin dyes. -- Highlights: • The photophysical properties of pyronin dyes were examined by spectroscopic techniques. • Optical properties of the dyes were tuned by changing of W{sub 0} values. • The fluorescence lifetime and quantum yield values of the dyes in reverse micelles were discussed.
International Nuclear Information System (INIS)
Konoz, Elahe; Golmohammadi, Hassan
2008-01-01
An artificial neural network (ANN) was constructed and trained for the prediction of air-to-blood partition coefficients of volatile organic compounds. The inputs of this neural network are theoretically derived descriptors that were chosen by genetic algorithm (GA) and multiple linear regression (MLR) features selection techniques. These descriptors are: R maximal autocorrelation of lag 1 weighted by atomic Sanderson electronegativities (R1E+), electron density on the most negative atom in molecule (EDNA), maximum partial charge for C atom (MXPCC), surface weighted charge partial surface area (WNSA1), fractional charge partial surface area (FNSA2) and atomic charge weighted partial positive surface area (PPSA3). The standard errors of training, test and validation sets for the ANN model are 0.095, 0.148 and 0.120, respectively. Result obtained showed that nonlinear model can simulate the relationship between structural descriptors and the partition coefficients of the molecules in data set accurately
Energy Technology Data Exchange (ETDEWEB)
Yang, Hui-Kang [DSAPM Lab and PCFM Lab, Department of Polymer and Materials Science, School of Chemistry and Chemical Engineering, Sun Yat-sen University, Guangzhou 510275 (China); Zhang, Li-Ming, E-mail: ceszhlm@mail.sysu.edu.cn [DSAPM Lab and PCFM Lab, Department of Polymer and Materials Science, School of Chemistry and Chemical Engineering, Sun Yat-sen University, Guangzhou 510275 (China); Guangdong Provincial Key Laboratory of New Drug Design and Evaluation, School of Pharmaceutical Science, Sun Yat-sen University, Guangzhou 510006 (China)
2014-08-01
For the development of biomimetic carriers for stimuli-sensitive delivery of anticancer drugs, a novel amphiphilic glycopolypeptide conjugate containing the disulfide bond was prepared for the first time by the ring-opening polymerization of benzyl glutamate N-carboxy anhydride in the presence of (propargyl carbamate)ethyl dithio ethylamine and then click conjugation with α-azido dextran. Its structure was characterized by Fourier-transform infrared spectroscopy and nuclear magnetic resonance analyses. Owing to its amphiphilic nature, such a conjugate could self assemble into nanosize micelles in aqueous medium, as confirmed by fluorometry, transmission electron microscopy and dynamic light scattering. For the resultant micelles, it was found to encapsulate poorly water-soluble anticancer drug (methotrexate, MTX) with the loading efficiency of 45.2%. By the in vitro drug release tests, the release rate of encapsulated MTX was observed to be accelerated significantly in the presence of 10 mM 1,4-dithio-DL-threitol (DTT), analogous to the intracellular redox potential. - Graphical abstract: New amphiphilic glycopolypeptide conjugate containing the disulfide bond could self-assemble in aqueous solution into reduction-sensitive micelles for triggered release of an anticancer drug (methotrexate, MTX) in the presence of 10 mM 1,4-dithio-DL-threitol (DTT). - Highlights: • Amphiphilic glycopolypeptide conjugate containing disulfide bond was prepared. • Such a conjugate self assembled in aqueous solution into nanosize micelles. • The resultant micelles could encapsulate effectively methotrexate drug. • The drug-loaded micelles showed a reduction-sensitive drug release behavior.
International Nuclear Information System (INIS)
Yang, Hui-Kang; Zhang, Li-Ming
2014-01-01
For the development of biomimetic carriers for stimuli-sensitive delivery of anticancer drugs, a novel amphiphilic glycopolypeptide conjugate containing the disulfide bond was prepared for the first time by the ring-opening polymerization of benzyl glutamate N-carboxy anhydride in the presence of (propargyl carbamate)ethyl dithio ethylamine and then click conjugation with α-azido dextran. Its structure was characterized by Fourier-transform infrared spectroscopy and nuclear magnetic resonance analyses. Owing to its amphiphilic nature, such a conjugate could self assemble into nanosize micelles in aqueous medium, as confirmed by fluorometry, transmission electron microscopy and dynamic light scattering. For the resultant micelles, it was found to encapsulate poorly water-soluble anticancer drug (methotrexate, MTX) with the loading efficiency of 45.2%. By the in vitro drug release tests, the release rate of encapsulated MTX was observed to be accelerated significantly in the presence of 10 mM 1,4-dithio-DL-threitol (DTT), analogous to the intracellular redox potential. - Graphical abstract: New amphiphilic glycopolypeptide conjugate containing the disulfide bond could self-assemble in aqueous solution into reduction-sensitive micelles for triggered release of an anticancer drug (methotrexate, MTX) in the presence of 10 mM 1,4-dithio-DL-threitol (DTT). - Highlights: • Amphiphilic glycopolypeptide conjugate containing disulfide bond was prepared. • Such a conjugate self assembled in aqueous solution into nanosize micelles. • The resultant micelles could encapsulate effectively methotrexate drug. • The drug-loaded micelles showed a reduction-sensitive drug release behavior
Levitt, David G
2010-01-07
The goal of physiologically based pharmacokinetics (PBPK) is to predict drug kinetics from an understanding of the organ/blood exchange. The standard approach is to assume that the organ is "flow limited" which means that the venous blood leaving the organ equilibrates with the well-stirred tissue compartment. Although this assumption is valid for most solutes, it has been shown to be incorrect for several very highly fat soluble compounds which appear to be "diffusion limited". This paper describes the physical basis of this adipose diffusion limitation and its quantitative dependence on the blood/water (Kbld-wat) and octanol/water (Kow) partition coefficient. Experimental measurements of the time dependent rat blood and adipose concentration following either intravenous or oral input were used to estimate the "apparent" adipose perfusion rate (FA) assuming that the tissue is flow limited. It is shown that the ratio of FA to the anatomic perfusion rate (F) provides a measure of the diffusion limitation. A quantitative relationship between this diffusion limitation and Kbld-wat and Kow is derived. This analysis was applied to previously published data, including the Oberg et. al. measurements of the rat plasma and adipose tissue concentration following an oral dose of a mixture of 13 different polychlorinated biphenyls. Solutes become diffusion limited at values of log Kow greater than about 5.6, with the adipose-blood exchange rate reduced by a factor of about 30 for a solute with a log Kow of 7.36. Quantitatively, a plot of FA/F versus Kow is well described assuming an adipose permeability-surface area product (PS) of 750/min. This PS corresponds to a 0.14 micron aqueous layer separating the well-stirred blood from the adipose lipid. This is approximately equal to the thickness of the rat adipose capillary endothelium. These results can be used to quantitate the adipose-blood diffusion limitation as a function of Kow. This is especially important for the highly
Kiralan, S Sezer; Doğu-Baykut, Esra; Kittipongpittaya, Ketinun; McClements, David Julian; Decker, Eric A
2014-10-29
The physical location of antioxidants in oil-in-water emulsions can have significant influence on their free radical scavenging activity and ability to inhibit lipid oxidation. We aimed to determine the effect of the surfactant concentration on the partitioning behavior of tocopherols (α, γ, and δ) in oil-in-water emulsions. Tween 20 (0.1, 0.5, and 1%) increased the partitioning of the tocopherols into the aqueous phase via the formation of Tween 20-tocopherol comicelles. Partitioning behavior of antioxidants was dependent upon the number of methyl groups and, thus, polarity of the tocopherols. δ-Tocopherol (one methyl group) exhibited the most partitioning into the aqueous phase, while α-tocopherol (three methyl groups) had the lowest partitioning. Lipid oxidation studies showed that the antioxidant activity of δ- and α-tocopherols was enhanced by adding Tween 20 to oil-in-water emulsions. This work suggests that surfactant micelles could increase the antioxidant activity of tocopherols by changing their physical location.
Lee, Hwang; Byun, Da-Eun; Kim, Ju Min; Kwon, Jung-Hwan
2018-01-01
To evaluate rate of migration from plastic debris, desorption of model hydrophobic organic chemicals (HOCs) from polyethylene (PE)/polypropylene (PP) films to water was measured using PE/PP films homogeneously loaded with the HOCs. The HOCs fractions remaining in the PE/PP films were compared with those predicted using a model characterized by the mass transfer Biot number. The experimental data agreed with the model simulation, indicating that HOCs desorption from plastic particles can generally be described by the model. For hexachlorocyclohexanes with lower plastic-water partition coefficients, desorption was dominated by diffusion in the plastic film, whereas desorption of chlorinated benzenes with higher partition coefficients was determined by diffusion in the aqueous boundary layer. Evaluation of the fraction of HOCs remaining in plastic films with respect to film thickness and desorption time showed that the partition coefficient between plastic and water is the most important parameter influencing the desorption half-life. Copyright © 2017 Elsevier Ltd. All rights reserved.
Sabour, Mohammad Reza; Moftakhari Anasori Movahed, Saman
2017-02-01
The soil sorption partition coefficient logK oc is an indispensable parameter that can be used in assessing the environmental risk of organic chemicals. In order to predict soil sorption partition coefficient for different and even unknown compounds in a fast and accurate manner, a radial basis function neural network (RBFNN) model was developed. Eight topological descriptors of 800 organic compounds were used as inputs of the model. These 800 organic compounds were chosen from a large and very diverse data set. Generalized Regression Neural Network (GRNN) was utilized as the function in this neural network model due to its capability to adapt very quickly. Hence, it can be used to predict logK oc for new chemicals, as well. Out of total data set, 560 organic compounds were used for training and 240 to test efficiency of the model. The obtained results indicate that the model performance is very well. The correlation coefficients (R2) for training and test sets were 0.995 and 0.933, respectively. The root-mean square errors (RMSE) were 0.2321 for training set and 0.413 for test set. As the results for both training and test set are extremely satisfactory, the proposed neural network model can be employed not only to predict logK oc of known compounds, but also to be adaptive for prediction of this value precisely for new products that enter the market each year. Copyright © 2016 Elsevier Ltd. All rights reserved.
DEFF Research Database (Denmark)
Lundsgaard, Rasmus; Kontogeorgis, Georgios; Economou, Ioannis G.
2011-01-01
coefficient can be estimated for both a small hydrophilic and a hydrophobic organic molecules between squalane (used here to mimic low density poly ethylene) and water/ethanol solutes using thermodynamic integration to calculate the free energy of solvation. Molecular dynamics simulations are performed, using...... the GROMACS software, by slowly decoupling of firstly the electrostatic and then the Lennard–Jones interactions between molecules in the simulation box. These calculations depend very much on the choice of force field. Two force fields have been tested in this work, the TraPPE-UA (united-atom) and the OPLS...
Judy, Eva; Pagariya, Darshna; Kishore, Nand
2018-03-20
Oral bioavailability of a drug molecule requires its effective delivery to the target site. In general, majority of synthetically developed molecular entities have high hydrophobic nature as well as low bioavailability, therefore the need for suitable delivery vehicles arises. Self-assembled structures such as micelles, niosomes, and liposomes have been used as effective delivery vehicles and studied extensively. However, the information available in literature is mostly qualitative in nature. We have quantitatively investigated the partitioning of antibiotic drug streptomycin into cationic, nonionic, and a mixture of cationic and nonionic surfactant micelles and its interaction with the transport protein serum albumin upon subsequent delivery. A combination of calorimetry and spectroscopy has been used to obtain the thermodynamic signatures associated with partitioning and interaction with the protein and the resulting conformational changes in the latter. The results have been correlated with other class of drugs of different nature to understand the role of molecular features in the partitioning process. These studies are oriented toward understanding the physical chemistry of partitioning of a variety of drug molecules into suitable delivery vehicles and hence establishing structure-property-energetics relationships. Such studies provide general guidelines toward a broader goal of rational drug design.
Bao, Yan; Wang, Tong; Kang, Qiaoling; Shi, Chunhua; Ma, Jianzhong
2017-04-01
Hollow silica spheres (HSS) with special interior spaces, high specific surface area and excellent adsorption and permeability performance were synthesized via micelle-template method using cetyl trimethyl ammonium bromide (CTAB) micelles as soft template and tetraethoxysilane (TEOS) as silica precursor. SEM, TEM, FT-IR, XRD, DLS and BET-BJH were carried out to characterize the morphology and structure of as-obtained samples. The results demonstrated that the samples were amorphous with a hollow structure and huge specific surface area. The growth of HSS was an inward-growth mechanism along template. Notably, we have provided a new and interesting fundamental principle for HSS materials by precisely controlling the ethanol-to-water volume ratio. In addition, the as-obtained HSS were mixed with waterborne polyurethane (WPU) to prepare WPU/HSS composite membrane. Various characterizations (SEM, TEM, FT-IR and TGA) revealed the morphology, polydispersity and adherence between HSS and WPU. Performance tests showed that the introduction of HSS can improve the water vapor permeability of composite membrane, promoting its water resistance and mechanical performance at the same time.
Beliciu, C M; Moraru, C I
2009-05-01
The objectives of this study were to investigate the effect of the solvent on the accuracy of casein micelle particle size determination by dynamic light scattering (DLS) at different temperatures and to establish a clear protocol for these measurements. Dynamic light scattering analyses were performed at 6, 20, and 50 degrees C using a 90Plus Nanoparticle Size Analyzer (Brookhaven Instruments, Holtsville, NY). Raw and pasteurized skim milk were used as sources of casein micelles. Simulated milk ultrafiltrate, ultrafiltered water, and permeate obtained by ultrafiltration of skim milk using a 10-kDa cutoff membrane were used as solvents. The pH, ionic concentration, refractive index, and viscosity of all solvents were determined. The solvents were evaluated by DLS to ensure that they did not have a significant influence on the results of the particle size measurements. Experimental protocols were developed for accurate measurement of particle sizes in all solvents and experimental conditions. All measurements had good reproducibility, with coefficients of variation below 5%. Both the solvent and the temperature had a significant effect on the measured effective diameter of the casein micelles. When ultrafiltered permeate was used as a solvent, the particle size and polydispersity of casein micelles decreased as temperature increased. The effective diameter of casein micelles from raw skim milk diluted with ultrafiltered permeate was 176.4 +/- 5.3 nm at 6 degrees C, 177.4 +/- 1.9 nm at 20 degrees C, and 137.3 +/- 2.7 nm at 50 degrees C. This trend was justified by the increased strength of hydrophobic bonds with increasing temperature. Overall, the results of this study suggest that the most suitable solvent for the DLS analyses of casein micelles was casein-depleted ultrafiltered permeate. Dilution with water led to micelle dissociation, which significantly affected the DLS measurements, especially at 6 and 20 degrees C. Simulated milk ultrafiltrate seemed to give
Investigation of 1-alkanols in organised solutions
Directory of Open Access Journals (Sweden)
Nadia Bashir
2011-12-01
Full Text Available Conductometric behaviour of 1-alkanols (C5-C10 in organised solutions of sodium dodecylbenzenesulfonate (SDBS is investigated. Interaction of each alkanol with anionic surfactant is reflected in terms of association constants, Kc. It is observed that self-assembly of SDBS is induced by the alkanol addition. The depression in critical micelle concentration (CMC of SDBS caused by each alkanol is translated to partition coefficient, Kc by using interaction coefficient. The dimensionless partition coefficient, Kx is utilized to highlight the energy efficiency of the solubilization process. The results indicate that even longer chain alkanols prefer interfacial area for their residence. The relative solubility of each alkanol is enhanced with increasing SDBS concentration. Such basic information could be vital for development of nano-scale assemblies for specific delivery of water soluble drugs.
Directory of Open Access Journals (Sweden)
Rina Nakahata
2018-02-01
Full Text Available An amphoteric random copolymer (P(SA91 composed of anionic sodium 2-acrylamido-2-methylpropanesulfonate (AMPS, S and cationic 3-acrylamidopropyl trimethylammonium chloride (APTAC, A was prepared via reversible addition-fragmentation chain transfer (RAFT radical polymerization. The subscripts in the abbreviations indicate the degree of polymerization (DP. Furthermore, AMPS and APTAC were polymerized using a P(SA91 macro-chain transfer agent to prepare an anionic diblock copolymer (P(SA91S67 and a cationic diblock copolymer (P(SA91A88, respectively. The DP was estimated from quantitative 13C NMR measurements. A stoichiometrically charge neutralized mixture of the aqueous P(SA91S67 and P(SA91A88 formed water-soluble polyion complex (PIC micelles comprising PIC cores and amphoteric random copolymer shells. The PIC micelles were in a dynamic equilibrium state between PIC micelles and charge neutralized small aggregates composed of a P(SA91S67/P(SA91A88 pair. Interactions between PIC micelles and fetal bovine serum (FBS in phosphate buffered saline (PBS were evaluated by changing the hydrodynamic radius (Rh and light scattering intensity (LSI. Increases in Rh and LSI were not observed for the mixture of PIC micelles and FBS in PBS for one day. This observation suggests that there is no interaction between PIC micelles and proteins, because the PIC micelle surfaces were covered with amphoteric random copolymer shells. However, with increasing time, the diblock copolymer chains that were dissociated from PIC micelles interacted with proteins.
Regional water coefficients for U.S. industrial sectors
Directory of Open Access Journals (Sweden)
Riccardo Boero
2017-12-01
Full Text Available Designing policies for water systems management requires the capability to assess the economic impacts of water availability and to effectively couple water withdrawals by human activities with natural hydrologic dynamics. At the core of any scientific approach to these issues there is the estimation of water withdrawals by industrial sectors in the form of water coefficients, which are measurements of the quantity of water withdrawn per dollar of GDP or output. In this work we focus on the contiguous United States and on the estimation of water coefficients for regional scale analyses. We first compare an established methodology for the estimation of national water coefficients with a parametric one we propose. Second, we introduce a method to estimate water coefficients at the level of ecological regions and we discuss how they reduce possible biases in regional analyses of water systems. We conclude discussing advantages and limits of regional water coefficients.
Takegami, Shigehiko; Kitamura, Keisuke; Ohsugi, Mayuko; Ito, Aya; Kitade, Tatsuya
2015-06-15
In order to quantitatively examine the lipophilicity of the widely used organophosphorus pesticides (OPs) chlorfenvinphos (CFVP), chlorpyrifos-methyl (CPFM), diazinon (DZN), fenitrothion (FNT), fenthion (FT), isofenphos (IFP), profenofos (PFF) and pyraclofos (PCF), their partition coefficient (Kp) values between phosphatidylcholine (PC) small unilamellar vesicles (SUVs) and water (liposome-water system) were determined by second-derivative spectrophotometry. The second-derivative spectra of these OPs in the presence of PC SUV showed a bathochromic shift according to the increase in PC concentration and distinct derivative isosbestic points, demonstrating the complete elimination of the residual background signal effects that were observed in the absorption spectra. The Kp values were calculated from the second-derivative intensity change induced by addition of PC SUV and obtained with a good precision of R.S.D. below 10%. The Kp values were in the order of CPFM>FT>PFF>PCF>IFP>CFVP>FNT⩾DZN and did not show a linear correlation relationship with the reported partition coefficients obtained using an n-octanol-water system (R(2)=0.530). Also, the results quantitatively clarified the effect of chemical-group substitution in OPs on their lipophilicity. Since the partition coefficient for the liposome-water system is more effective for modeling the quantitative structure-activity relationship than that for the n-octanol-water system, the obtained results are toxicologically important for estimating the accumulation of these OPs in human cell membranes. Copyright © 2015 Elsevier B.V. All rights reserved.
DEFF Research Database (Denmark)
Barnes, S.J.; Makovicky, E.; Makovicky, M.
1996-01-01
of the system. There is a positive correlation between the partition coefficients and sulfur content of the monosulfide solid solution and between the partition coefficients and the sulfur content of the liquid. In sulfur-saturated and sulfur-over-saturated experimental systems, the metals behave in a manner...... (Alexo, Abitibi Greenstone Belt) and a zoned tholeiite-related ore (Oktyabr'sky, Noril'sk region, Siberia). In both cases, the experimental partition coefficients numerically model the composition zones of the actual ores. This supports the model of fractional crystallization of a monosulfide solid...
Quinn, Cristina L; van der Heijden, Stephan A; Wania, Frank; Jonker, Michiel T O
2014-05-20
Whereas octanol, triacylglycerides, and liposomes have all been proposed as surrogates for measuring the affinity of hydrophobic organic contaminants to human lipids, no comparative evaluation of their suitability exists. Here we conducted batch sorption experiments with polyoxymethylene passive samplers to determine the partition coefficients at 37 °C of 18 polychlorinated biphenyls (PCBs) from water into (i) triolein (Ktriolein/water), (ii) eight types of liposomes (Kliposome/water), (iii) human abdominal fat tissues (KAFT/water) from seven individuals, and (iv) human MCF-7 cells cultured in vitro (Kcell/water). Differences between KAFT/water among individuals and between Kliposome/water among liposome types were very small and not correlated to structural attributes of the PCBs. Similarly, the length and degree of saturation of the phospholipid carbon chains, the headgroup, and the composition of the liposome did not affect the partitioning of PCBs into the studied liposomes. Whereas Kliposome/water values were similar to literature values of Koctanol/water adjusted to 37 °C, they both were lower than KAFT/water and Kcell/water by a factor of 3 on average. Partitioning of PCBs into triolein on the other hand closely mimicked that into human lipids, for which triolein is thus a better surrogate than either octanol or liposomes. Previously published polyparameter linear free energy relationships for partitioning from water into storage lipids and liposomes predicted the measured partition coefficients with a root-mean-square error of less than 0.15 log units, if the chosen equations and solute descriptors do not allow chlorine substitution in the ortho-position to influence the prediction. By guiding the selection of (i) a surrogate for the experimental determination and (ii) a method for the prediction of partitioning into human lipids, this study contributes to a better assessment of hydrophobic organic contaminant bioaccumulation in humans.
Oleyl-hyaluronan micelles loaded with upconverting nanoparticles for bio-imaging
Energy Technology Data Exchange (ETDEWEB)
Pospisilova, Martina, E-mail: martina.pospisilova@contipro.com; Mrazek, Jiri; Matuska, Vit; Kettou, Sofiane; Dusikova, Monika; Svozil, Vit; Nesporova, Kristina; Huerta-Angeles, Gloria; Vagnerova, Hana; Velebny, Vladimir [Contipro Biotech (Czech Republic)
2015-09-15
Hyaluronan (HA) represents an interesting polymer for nanoparticle coating due to its biocompatibility and enhanced cell interaction via CD44 receptor. Here, we describe incorporation of oleate-capped β–NaYF{sub 4}:Yb{sup 3+}, Er{sup 3+} nanoparticles (UCNP-OA) into amphiphilic HA by microemulsion method. Resulting structures have a spherical, micelle-like appearance with a hydrodynamic diameter of 180 nm. UCNP-OA-loaded HA micelles show a good stability in PBS buffer and cell culture media. The intensity of green emission of UCNP-OA-loaded HA micelles in water is about five times higher than that of ligand-free UCNP, indicating that amphiphilic HA effectively protects UCNP luminescence from quenching by water molecules. We found that UCNP-OA-loaded HA micelles in concentrations up to 50 μg mL{sup −1} increase cell viability of normal human dermal fibroblasts (NHDF), while viability of human breast adenocarcinoma cells MDA–MB–231 is reduced at these concentrations. The utility of UCNP-OA-loaded HA micelles as a bio-imaging probe was demonstrated in vitro by successful labelling of NHDF and MDA–MB–231 cells overexpressing the CD44 receptor.
Journaux, Baptiste; Daniel, Isabelle; Petitgirard, Sylvain; Cardon, Hervé; Perrillat, Jean-Philippe; Caracas, Razvan; Mezouar, Mohamed
2017-04-01
Water-rich planetary bodies including large icy moons and ocean exoplanets may host a deep liquid water ocean underlying a high-pressure icy mantle. The latter is often considered as a limitation to the habitability of the uppermost ocean because it would limit the availability of nutrients resulting from the hydrothermal alteration of the silicate mantle located beneath the deep ice layer. To assess the effects of salts on the physical properties of high-pressure ices and therefore the possible chemical exchanges and habitability inside H2O-rich planetary bodies, we measured partitioning coefficients and densities in the H2O-RbI system up to 450 K and 4 GPa; RbI standing as an experimentally amenable analog of NaCl in the H2O-salt solutions. We measured the partitioning coefficient of RbI between the aqueous fluid and ices VI and VII, using in-situ Synchrotron X-ray Fluorescence (XRF). With in-situ X-ray diffraction, we measured the unit-cell parameters and the densities of the high-pressure ice phases in equilibrium with the aqueous fluid, at pressures and temperatures relevant to the interior of planetary bodies. We conclude that RbI is strongly incompatible towards ice VI with a partitioning coefficient Kd(VI-L) = 5.0 (± 2.1) ṡ10-3 and moderately incompatible towards ice VII, Kd(VII-L) = 0.12 (± 0.05). RbI significantly increases the unit-cell volume of ice VI and VII by ca. 1%. This implies that RbI-poor ice VI is buoyant compared to H2O ice VI while RbI-enriched ice VII is denser than H2O ice VII. These new experimental results might profoundly impact the internal dynamics of water-rich planetary bodies. For instance, an icy mantle at moderate conditions of pressure and temperature will consist of buoyant ice VI with low concentration of salt, and would likely induce an upwelling current of solutes towards the above liquid ocean. In contrast, a deep and/or thick icy mantle of ice VII will be enriched in salt and hence would form a stable chemical boundary
Investigating Block-Copolymer Micelle Dynamics for Tunable Cargo Delivery
Li, Xiuli; Kidd, Bryce; Cooksey, Tyler; Robertson, Megan; Madsen, Louis
Block-copolymer micelles (BCPMs) can carry molecular cargo in a nanoscopic package that is tunable using polymer structure in combination with cargo properties, as well as with external stimuli such as temperature or pH. For example, BCPMs can be used in targeted anticancer drug delivery due to their biocompatibility, in vivo degradability and prolonged circulation time. We are using NMR spectroscopy and diffusometry as well as SANS to investigate BCPMs. Here we study a diblock poly(ethylene oxide)-b-(caprolactone) (PEO-PCL) that forms spherical micelles at 1% (w/v) in the mixed solvent D2O/THF-d8. We quantify the populations and diffusion coefficients of coexisting micelles and free unimers over a range of temperatures and solvent compositions. We use temperature as a stimulus to enhance unimer exchange and hence trigger cargo release, in some cases at a few degrees above body temperature. We present evidence for dominance of the insertion-expulsion mechanism of unimer exchange in these systems, and we map phase diagrams versus temperature and solvent composition. This study sheds light on how intermolecular interactions fundamentally affect cargo release, unimer exchange, and overall micelle tunability.
Micelles as Soil and Water Decontamination Agents.
Shah, Afzal; Shahzad, Suniya; Munir, Azeema; Nadagouda, Mallikarjuna N; Khan, Gul Shahzada; Shams, Dilawar Farhan; Dionysiou, Dionysios D; Rana, Usman Ali
2016-05-25
Contaminated soil and water pose a serious threat to human health and ecosystem. For the treatment of industrial effluents or minimizing their detrimental effects, preventive and remedial approaches must be adopted prior to the occurrence of any severe environmental, health, or safety hazard. Conventional treatment methods of wastewater are insufficient, complicated, and expensive. Therefore, a method that could use environmentally friendly surfactants for the simultaneous removal of both organic and inorganic contaminants from wastewater is deemed a smart approach. Surfactants containing potential donor ligands can coordinate with metal ions, and thus such compounds can be used for the removal of toxic metals and organometallic compounds from aqueous systems. Surfactants form host-guest complexes with the hydrophobic contaminants of water and soil by a mechanism involving the encapsulation of hydrophobes into the self-assembled aggregates (micelles) of surfactants. However, because undefined amounts of surfactants may be released into the aqueous systems, attention must be paid to their own environmental risks as well. Moreover, surfactant remediation methods must be carefully analyzed in the laboratory before field implementation. The use of biosurfactants is the best choice for the removal of water toxins as such surfactants are associated with the characteristics of biodegradability, versatility, recovery, and reuse. This Review is focused on the currently employed surfactant-based soil and wastewater treatment technologies owing to their critical role in the implementation of certain solutions for controlling pollution level, which is necessary to protect human health and ensure the quality standard of the aquatic environment.
Effects of gamma-irradiation on some properties of bovine casein micelles
International Nuclear Information System (INIS)
Saito, Zenichi
1974-01-01
Sedimentation studies and electron microscopic observations revealed that an association between casein micelles dispersed in water or milk serum was not induced significantly by gamma-irradiation of exposure up to 3 x 10 6 R, whereas a release of nonprotein nitrogen was observed to a certain extent. It was concluded from the results of turbidi-metry and gel filtration using 3 size groups of casein micelles, namely large, medium and small, that an irradiation-induced polymerization or association occurred within individual casein micelles, and strengthend the micelle structure. Thus the irradiated casein micelles resisted, more or less, to the solubilizing effect of NaCl, EDTA, pyrophosphate and urea. Stabilities of casein micelles for ethanol and for acidification to an isoelectric point were decreased and increased, respectively, after irradiation. Gamma irradiation also caused the decrease of glycomacropeptide released from casein micelles by the action of rennin, and this resulted in the delay of rennin-coagulation of casein. There were no essential differences among the 3 size groups of casein micelles concerning the above described tendencies. (auth.)
Reactivity in inverse micelles
International Nuclear Information System (INIS)
Brochette, Pascal
1987-01-01
This research thesis reports the study of the use of micro-emulsions of water in oil as reaction support. Only the 'inverse micelles' domain of the ternary mixing (water/AOT/isooctane) has been studied. The main addressed issues have been: the micro-emulsion disturbance in presence of reactants, the determination of reactant distribution and the resulting kinetic theory, the effect of the interface on electron transfer reactions, and finally protein solubilization [fr
Mapping Pesticide Partition Coefficients By Electromagnetic Induction
A potential method for reducing pesticide leaching is to base application rates on the leaching potential of a specific chemical and soil combination. However, leaching is determined in part by the partitioning of the chemical between the soil and soil solution, which varies across a field. Standard...
Metal partitioning and uptake in central Ontario forests
International Nuclear Information System (INIS)
Watmough, Shaun A.; Dillon, Peter J.; Epova, Ekaterina N.
2005-01-01
Evaluation of the potential environmental risk posed by metals depends to a great extent on modeling the fate and mobility of metals with soil-solution partitioning coefficients (K d ). However, the effect of biological cycling on metal partitioning is rarely considered in standard risk assessments. We determined soil-solution partitioning coefficients for 5 metals (Cd, Zn, Pb, Co and Ni) at 46 forested sites that border the Precambrian Shield in central Ontario, where soil pH aq varied from 3.9 to 8.1. Foliage from the dominant tree species and forest floor samples were also collected from each site to compare their metal levels with K d predictions. Analogous to other studies, log K d values for all metals were predicted by empirical linear regression with soil pH (r 2 = 0.66-0.72), demonstrating that metal partitioning between soil and soil solution can be reliably predicted for relatively unpolluted forest mineral soils by soil pH. In contrast, whereas the so-called bioavailable water-soluble metal fraction could be predicted from soil pH, metal concentrations in foliage and the forest floor at each site were not consistently related to pH. Risk assessment of metals should take into account the role of biota in metal cycling and partitioning in forests, particularly if metal bio-accumulation and chronic toxicity in the food chain, rather than metal mobility in soils, are of primary concern. - Metal cycling by plants should be considered in risk assessment studies
Micelles As Delivery System for Cancer Treatment.
Keskin, Dilek; Tezcaner, Aysen
2017-01-01
Micelles are nanoparticles formed by the self-assembly of amphiphilic block copolymers in certain solvents above concentrations called critical micelle concentration (CMC). Micelles are used in different fields like food, cosmetics, medicine, etc. These nanosized delivery systems are under spotlight in the recent years with new achievements in terms of their in vivo stability, ability to protect entrapped drug, release kinetics, ease of cellular penetration and thereby increased therapeutic efficacy. Drug loaded micelles can be prepared by dialysis, oil-in-water method, solid dispersion, freezing, spray drying, etc. The aim of this review is to give an overview of the research on micelles (in vitro, in vivo and clinical) as delivery system for cancer treatment. Passive targeting is one route for accumulation of nanosized micellar drug formulations. Many research groups from both academia and industry focus on developing new strategies for improving the therapeutic efficacy of micellar systems (active targeting to the tumor site, designing multidrug delivery systems for overcoming multidrug resistance or micelles formed by prodrug conjugates, etc). There is only one micellar drug formulation in South Korea that has reached clinical practice. However, there are many untargeted anticancer drug loaded micellar formulations in clinical trials, which have potential for use in clinics. Many more products are expected to be on the market in the near future. Copyright© Bentham Science Publishers; For any queries, please email at epub@benthamscience.org.
Zhang, Chun-Yun; Hu, Hui-Chao; Chai, Xin-Sheng; Pan, Lei; Xiao, Xian-Ming
2013-10-04
A novel method has been developed for the determination of adsorption partition coefficient (Kd) of minor gases in shale. The method uses samples of two different sizes (masses) of the same material, from which the partition coefficient of the gas can be determined from two independent headspace gas chromatographic (HS-GC) measurements. The equilibrium for the model gas (ethane) was achieved in 5h at 120°C. The method also involves establishing an equation based on the Kd at higher equilibrium temperature, from which the Kd at lower temperature can be calculated. Although the HS-GC method requires some time and effort, it is simpler and quicker than the isothermal adsorption method that is in widespread use today. As a result, the method is simple and practical and can be a valuable tool for shale gas-related research and applications. Copyright © 2013 Elsevier B.V. All rights reserved.
Negative adsorption due to electrostatic exclusion of micelles.
Somasundaran, P; Ananthapadmanabhan, K P; Deo, Puspendu
2005-10-15
Interactions of surfactants with solid substrates are important in the controlling of processes such as flotation, coating, flocculation and sedimentation. These interactions usually lead to adsorption on solids, but can also result in an exclusion of the reagents with dire consequences. In this work electrostatic exclusion of negatively charged dodecylbenzene sulfonate micelles from quartz/water, Bio-Sil/water and alumina/water interfaces has been investigated as a function of pH and ionic strength. Measurable negative adsorption of these surfactants from similarly charged solid/liquid interface was observed in the micellar region. In the case of porous samples with large surface area, comparison of pore size with the micelle size is necessary to avoid any erroneous conclusions regarding the role of electrostatic exclusion in a given system. A theoretical model for the electrostatic exclusion of micelles is developed and used to calculate the adsorption of negatively charged dodecylbenzene sulfonate on negatively charged quartz (pH 7), silica (Bio-Sil A, pH 3) and alumina (pH 11) in the micellar concentration region. The micellar exclusion values calculated using the model are in excellent agreement with the experimental results.
Influence of biochar on isoproturon partitioning and bioaccessibility in soil.
Reid, B J; Pickering, F L; Freddo, A; Whelan, M J; Coulon, F
2013-10-01
The influence of biochar (5%) on the loss, partitioning and bioaccessibility of (14)C-isoproturon ((14)C-IPU) was evaluated. Results indicated that biochar had a dramatic effect upon (14)C-IPU partitioning: (14)C-IPU extractability (0.01 M CaCl2) in biochar-amended treatments was reduced to <2% while, (14)C-IPU extractability in biochar free treatments decreased with ageing from 90% to 40%. A partitioning model was constructed to derive an effective partition coefficient for biochar:water (KBW of 7.82 × 10(4) L kg(-1)). This was two orders of magnitude greater than the apparent Kfoc value of the soil organic carbon:water (631 L kg(-1)). (14)C-radiorespirometry assays indicated high competence of microorganisms to mineralise (14)C-IPU in the absence of biochar (40.3 ± 0.9%). Where biochar was present (14)C-IPU mineralisation never exceeded 2%. These results indicate reduced herbicide bioaccessibility. Increasing IPU application to ×10 its recommended dose was ineffective at redressing IPU sequestration and its low bioaccessibility. Copyright © 2013 Elsevier Ltd. All rights reserved.
Design of block-copolymer-based micelles for active and passive targeting
Lebouille, Jérôme G J L; Leermakers, Frans A M; Cohen Stuart, Martien A.; Tuinier, Remco
2016-01-01
A self-consistent field study is presented on the design of active and passive targeting block-copolymeric micelles. These micelles form in water by self-assembly of triblock copolymers with a hydrophilic middle block and two hydrophobic outer blocks. A minority amount of diblock copolymers with the
Design of block-copolymer-based micelles for active and passive targeting
Lebouille, Jérôme G.J.L.; Leermakers, Frans A.M.; Cohen Stuart, Martien A.; Tuinier, Remco
2016-01-01
A self-consistent field study is presented on the design of active and passive targeting block-copolymeric micelles. These micelles form in water by self-assembly of triblock copolymers with a hydrophilic middle block and two hydrophobic outer blocks. A minority amount of diblock copolymers with
Formation of nanoparticles on reverse micelles: SANS studies
International Nuclear Information System (INIS)
Sim, Jae-Hyun; Park, Jaejung; Kim, Myungwoong; Hwan Bang, Jeong; Park, Sangwook; Sohn, Daewon
2006-01-01
The structure of polymethyl methacrylate (PMMA) on the surface of reverse micelles was investigated by small-angle neutron scattering (SANS). The water-in-oil microemulsion containing initiators in the inner part of reverse micelle was prepared with surfactant, poly(oxyethylene) nonylphenyl ether (NP5, H(CH 2 ) 9 Ph(OC 2 H 4 ) 5 OH), water, cyclohexane and adequate initiators, sodium metabisulfate (SDS) and potassium persulfate (KPS), for aimed polymerization (PMMA). Various model fittings such as the core-shell sphere model and hard sphere model containing smearing effect reveal that polymer shell thickness changes from 52 to 60 A, respectively, with increase of monomer concentration
Sukenik, Assaf; Viner-Mozzini, Yehudit; Tavassi, Mordechay; Nir, Shlomo
2017-09-01
Cyanobacteria and their toxins present potential hazard to consumers of water from lakes, reservoirs and rivers, thus their removal via water treatment is essential. The capacity of nano-composites of Octadecyltrimethyl-ammonium (ODTMA) complexed with clay to remove cyanobacterial and their toxins from laboratory cultures and from lake water, was evaluated. Column filters packed with micelles of ODTMA complexed with bentonite and granulated were shown to significantly reduce the number of cyanobacteria cells or filaments and their corresponding toxins from laboratory cultures. Fluorescence measurements demonstrated that cyanobacteria cells lost their metabolic activity (photosynthesis) upon exposure to the micelle (ODTMA)-bentonite complex, or ODTMA monomers. The complex efficiently removed cyanobacteria toxins with an exceptional high removal rate of microcystins. The effectiveness of the complex in elimination of cyanobacteria was further demonstrated with lake water containing cyanobacteria and other phytoplankton species. These results and model calculations suggest that filters packed with granulated composites can secure the safety of drinking water in case of a temporary bloom event of toxic cyanobacteria. Copyright © 2017 Elsevier Ltd. All rights reserved.
EPR spin probe and spin label studies of some low molecular and polymer micelles
Wasserman, A. M.; Kasaikin, V. A.; Timofeev, V. P.
1998-12-01
The rotational mobility of spin probes of different shape and size in low molecular and polymer micelles has been studied. Several probes having nitroxide fragment localized either in the vicinity of micelle interface or in the hydrocarbon core have been used. Upon increasing the number of carbon atoms in hydrocarbon chain of detergent from 7 to 13 (sodium alkyl sulfate micelles) or from 12 to 16 (alkyltrimethylammonium bromide micelles) the rotational mobility of spin probes is decreased by the factor 1.5-2.0. The spin probe rotational mobility in polymer micelles (the complexes of alkyltrimethylammonium bromides and polymethacrylic or polyacrylic acids) is less than mobility in free micelles of the same surfactants. The study of EPR-spectra of spin labeled polymethacrylic acid (PMA) indicated that formation of water soluble complexes of polymer and alkyltrimethylammonium bromides in alkaline solutions (pH 9) does not affect the polymer segmental mobility. On the other hand, the polymer complexes formation in slightly acidic water solution (pH 6) breaks down the compact PMA conformation, thus increasing the polymer segmental mobility. Possible structures of polymer micelles are discussed.
Cryo-transmission electron tomography of native casein micelles from bovine milk
Trejo, R.; Dokland, T.; Jurat-Fuentes, J.; Harte, F.
2013-01-01
Caseins are the principal protein components in milk and an important ingredient in the food industry. In liquid milk, caseins are found as micelles of casein proteins and colloidal calcium nanoclusters. Casein micelles were isolated from raw skim milk by size exclusion chromatography and suspended in milk protein-free serum produced by ultrafiltration (molecular weight cut-off of 3 kDa) of raw skim milk. The micelles were imaged by cryo-electron microscopy and subjected to tomographic reconstruction methods to visualize the 3-dimensional and internal organization of native casein micelles. This provided new insights into the internal architecture of the casein micelle that had not been apparent from prior cryo-transmission electron microscopy studies. This analysis demonstrated the presence of water-filled cavities (~20 to 30 nm in diameter), channels (diameter greater than ~5 nm), and several hundred high-density nanoclusters (6 to 12 nm in diameter) within the interior of the micelles. No spherical protein submicellar structures were observed. PMID:22118067
Energy Technology Data Exchange (ETDEWEB)
Sun, Lilin, E-mail: sunlilin126@126.com [Anhui Key Laboratory of Chemo-Biosensing, College of Chemistry and Materials Science, Anhui Normal University, Wuhu 241000 (China); Hao, Dan; Zhang, Ping; Qian, Zhangsheng; Shen, Weili [Anhui Key Laboratory of Chemo-Biosensing, College of Chemistry and Materials Science, Anhui Normal University, Wuhu 241000 (China); Shao, Taili [Anhui Key Laboratory of Chemo-Biosensing, College of Chemistry and Materials Science, Anhui Normal University, Wuhu 241000 (China); Department of Pharmacy, Wannan Medical College, Wuhu 241000 (China); Zhu, Changqing, E-mail: zhucq@mail.ahnu.edu.cn [Anhui Key Laboratory of Chemo-Biosensing, College of Chemistry and Materials Science, Anhui Normal University, Wuhu 241000 (China)
2013-02-15
A new near-infrared water-soluble conjugated polymer, i.e. poly [2,5-di (propyloxysulfonate)-1,4-phenylene-ethynylene-9,10-anthrylene] (PPEASO3) was synthesized to investigate its interaction with surfactants. It was found that PPEASO3 has only a weak fluorescence emission at about 670 nm due to its self-aggregation in water and in aqueous solution containing a low concentration of nonionic surfactants, i.e. below their critical micelle concentration (CMC). However, a dramatic fluorescence enhancement with a large emission blue-shift (>40 nm) was found once the concentration of nonionic surfactants reached the CMC (especially for Triton X-100). An orange fluorescence could be observed even with naked-eyes under UV-lamp, which gave a direct indication for the micelle forming process and provided a simple method for the CMC determination of the nonionic surfactants. The CMC values determined by this method were in good agreement with those obtained by other techniques. The dramatic emission change observed could be ascribed to the intensive hydrophobic interaction between PPEASO3 and surfactants micelle, which greatly disrupts the aggregation of the polymer and increase the fluorescence efficiency of PPEASO3. Highlights: Black-Right-Pointing-Pointer Investigated the interaction of a new water-soluble conjugated polymer with surfactants. Black-Right-Pointing-Pointer The dramatic fluorescence enhancement and emission blue-shift were observed at the CMC. Black-Right-Pointing-Pointer The obvious emission color change could be observed with naked-eyes under UV-lamp. Black-Right-Pointing-Pointer Gave a direct indication for the micelle forming process. Black-Right-Pointing-Pointer Provided a simple method for the CMC determination of the nonionic surfactants.
Partitioning of Nanoparticles into Organic Phases and Model Cells
Energy Technology Data Exchange (ETDEWEB)
Posner, J.D.; Westerhoff, P.; Hou, W-C.
2011-08-25
There is a recognized need to understand and predict the fate, transport and bioavailability of engineered nanoparticles (ENPs) in aquatic and soil ecosystems. Recent research focuses on either collection of empirical data (e.g., removal of a specific NP through water or soil matrices under variable experimental conditions) or precise NP characterization (e.g. size, degree of aggregation, morphology, zeta potential, purity, surface chemistry, and stability). However, it is almost impossible to transition from these precise measurements to models suitable to assess the NP behavior in the environment with complex and heterogeneous matrices. For decades, the USEPA has developed and applies basic partitioning parameters (e.g., octanol-water partition coefficients) and models (e.g., EPI Suite, ECOSAR) to predict the environmental fate, bioavailability, and toxicity of organic pollutants (e.g., pesticides, hydrocarbons, etc.). In this project we have investigated the hypothesis that NP partition coefficients between water and organic phases (octanol or lipid bilayer) is highly dependent on their physiochemical properties, aggregation, and presence of natural constituents in aquatic environments (salts, natural organic matter), which may impact their partitioning into biological matrices (bioaccumulation) and human exposure (bioavailability) as well as the eventual usage in modeling the fate and bioavailability of ENPs. In this report, we use the terminology "partitioning" to operationally define the fraction of ENPs distributed among different phases. The mechanisms leading to this partitioning probably involve both chemical force interactions (hydrophobic association, hydrogen bonding, ligand exchange, etc.) and physical forces that bring the ENPs in close contact with the phase interfaces (diffusion, electrostatic interactions, mixing turbulence, etc.). Our work focuses on partitioning, but also provides insight into the relative behavior of ENPs as either "more like
Partitioning of etofenprox under simulated California rice-growing conditions.
Vasquez, Martice E; Gunasekara, Amrith S; Cahill, Thomas M; Tjeerdema, Ronald S
2010-01-01
The pyrethroid insecticide etofenprox is of current interest to rice farmers in the Sacramento Valley owing to its effectiveness against the rice water weevil, Lissorhoptrus oryzophilus Kuschel. This study aimed to describe the partitioning of etofenprox under simulated rice field conditions by determining its Henry's law constant (H) (an estimate of volatilization) and organic carbon-normalized soil-water distribution coefficient (K(oc)) at representative field temperatures. A comparison of etofenprox and lambda-cyhalothrin is presented using a level-1 fugacity model. Experimental determination of H revealed that etofenprox partitioned onto the apparatus walls and did not significantly volatilize; the maximum value of H was estimated to be 6.81 x 10(-1) Pa m(3) mol(-1) at 25 degrees C, based on its air and water method detection limits. Calculated values for H ranged from 5.6 x 10(-3) Pa m(3) mol(-1) at 5 degrees C to 2.9 x 10(-1) Pa m(3) mol(-1) at 40 degrees C, based on estimated solubility and vapor pressure values at various temperatures. Log K(oc) values (at 25 degrees C) were experimentally determined to be 6.0 and 6.4 for Princeton and Richvale rice field soils, respectively, and were very similar to the values for other pyrethroids. Finally, temperature appears to have little influence on etofenprox sorption, as the log K(oc) for the Princeton soil at 35 degrees C was 6.1. High sorption coefficients and relatively insignificant desorption and volatilization of etofenprox suggest that its insolubility drives it to partition from water by sorbing to soils with high affinity. Offsite movement is unlikely unless transported in a bound state on suspended sediments.
Liang, Chao; Han, Shu-ying; Qiao, Jun-qin; Lian, Hong-zhen; Ge, Xin
2014-11-01
A strategy to utilize neutral model compounds for lipophilicity measurement of ionizable basic compounds by reversed-phase high-performance liquid chromatography is proposed in this paper. The applicability of the novel protocol was justified by theoretical derivation. Meanwhile, the linear relationships between logarithm of apparent n-octanol/water partition coefficients (logKow '') and logarithm of retention factors corresponding to the 100% aqueous fraction of mobile phase (logkw ) were established for a basic training set, a neutral training set and a mixed training set of these two. As proved in theory, the good linearity and external validation results indicated that the logKow ''-logkw relationships obtained from a neutral model training set were always reliable regardless of mobile phase pH. Afterwards, the above relationships were adopted to determine the logKow of harmaline, a weakly dissociable alkaloid. As far as we know, this is the first report on experimental logKow data for harmaline (logKow = 2.28 ± 0.08). Introducing neutral compounds into a basic model training set or using neutral model compounds alone is recommended to measure the lipophilicity of weakly ionizable basic compounds especially those with high hydrophobicity for the advantages of more suitable model compound choices and convenient mobile phase pH control. © 2014 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.
Micelle-encapsulated fullerenes in aqueous electrolytes
Energy Technology Data Exchange (ETDEWEB)
Ala-Kleme, T., E-mail: timo.ala-kleme@utu.fi [Department of Chemistry, University of Turku, 20014 Turku (Finland); Maeki, A.; Maeki, R.; Kopperoinen, A.; Heikkinen, M.; Haapakka, K. [Department of Chemistry, University of Turku, 20014 Turku (Finland)
2013-03-15
Different micellar particles Mi(M{sup +}) (Mi=Triton X-100, Triton N-101 R, Triton CF-10, Brij-35, M{sup +}=Na{sup +}, K{sup +}, Cs{sup +}) have been prepared in different aqueous H{sub 3}BO{sub 3}/MOH background electrolytes. It has been observed that these particles can be used to disperse the highly hydrophobic spherical [60]fullerene (1) and ellipsoidal [70]fullerene (2). This dispersion is realised as either micelle-encapsulated monomers Mi(M{sup +})1{sub m} and Mi(M{sup +})2{sub m} or water-soluble micelle-bound aggregates Mi(M{sup +})1{sub agg} and Mi(M{sup +})2{sub agg}, where especially the hydration degree and polyoxyethylene (POE) thickness of the micellar particle seems to play a role of vital importance. Further, the encapsulation microenvironment of 1{sub m} was found to depend strongly on the selected monovalent electrolyte cation, i.e., the encapsulated 1{sub m} is accommodated in the more hydrophobic microenvironment the higher the cationic solvation number is. - Highlights: Black-Right-Pointing-Pointer Different micellar particles is used to disperse [60]fullerene and [70]fullerene. Black-Right-Pointing-Pointer Fullerene monomers or aggregates are dispersed encaging or bounding by micelles. Black-Right-Pointing-Pointer Effective facts are hydration degree and polyoxyethylene thickness of micelle.
Energy Technology Data Exchange (ETDEWEB)
Gibs, Jacob, E-mail: jgibs@usgs.gov [U.S. Geological Survey, 810 Bear Tavern Road, West Trenton, NJ 08628 (United States); Heckathorn, Heather A. [U.S. Geological Survey, 810 Bear Tavern Road, West Trenton, NJ 08628 (United States); Meyer, Michael T. [U.S. Geological Survey, 4821 Quail Crest Place, Lawrence, KS 66049 (United States); Klapinski, Frank R.; Alebus, Marzooq; Lippincott, Robert L. [New Jersey Department of Environmental Protection, PO Box 413, Trenton, NJ 08625 (United States)
2013-08-01
An urban watershed in northern New Jersey was studied to determine the presence of four classes of antibiotic compounds (macrolides, fluoroquinolones, sulfonamides, and tetracyclines) and six degradates in the water column and bottom sediments upstream and downstream from the discharges of two wastewater treatment plants (WWTPs) and a drinking-water intake (DWI). Many antibiotic compounds in the four classes not removed by conventional WWTPs enter receiving waters and partition to stream sediments. Samples were collected at nine sampling locations on 2 days in September 2008. Two of the nine sampling locations were background sites upstream from two WWTP discharges on Hohokus Brook. Another background site was located upstream from a DWI on the Saddle River above the confluence with Hohokus Brook. Because there is a weir downstream of the confluence of Hohokus Brook and Saddle River, the DWI receives water from Hohokus Brook at low stream flows. Eight antibiotic compounds (azithromycin (maximum concentration 0.24 μg/L), ciprofloxacin (0.08 μg/L), enrofloxacin (0.015 μg/L), erythromycin (0.024 μg/L), ofloxacin (0.92 μg/L), sulfamethazine (0.018 μg/L), sulfamethoxazole (0.25 μg/L), and trimethoprim (0.14 μg/L)) and a degradate (erythromycin–H{sub 2}O (0.84 μg/L)) were detected in the water samples from the sites downstream from the WWTP discharges. The concentrations of six of the eight detected compounds and the detected degradate compound decreased with increasing distance downstream from the WWTP discharges. Azithromycin, ciprofloxacin, ofloxacin, and trimethoprim were detected in stream-bottom sediments. The concentrations of three of the four compounds detected in sediments were highest at a sampling site located downstream from the WWTP discharges. Trimethoprim was detected in the sediments from a background site. Pseudo-partition coefficients normalized for streambed sediment organic carbon concentration were calculated for azithromycin
International Nuclear Information System (INIS)
Gibs, Jacob; Heckathorn, Heather A.; Meyer, Michael T.; Klapinski, Frank R.; Alebus, Marzooq; Lippincott, Robert L.
2013-01-01
An urban watershed in northern New Jersey was studied to determine the presence of four classes of antibiotic compounds (macrolides, fluoroquinolones, sulfonamides, and tetracyclines) and six degradates in the water column and bottom sediments upstream and downstream from the discharges of two wastewater treatment plants (WWTPs) and a drinking-water intake (DWI). Many antibiotic compounds in the four classes not removed by conventional WWTPs enter receiving waters and partition to stream sediments. Samples were collected at nine sampling locations on 2 days in September 2008. Two of the nine sampling locations were background sites upstream from two WWTP discharges on Hohokus Brook. Another background site was located upstream from a DWI on the Saddle River above the confluence with Hohokus Brook. Because there is a weir downstream of the confluence of Hohokus Brook and Saddle River, the DWI receives water from Hohokus Brook at low stream flows. Eight antibiotic compounds (azithromycin (maximum concentration 0.24 μg/L), ciprofloxacin (0.08 μg/L), enrofloxacin (0.015 μg/L), erythromycin (0.024 μg/L), ofloxacin (0.92 μg/L), sulfamethazine (0.018 μg/L), sulfamethoxazole (0.25 μg/L), and trimethoprim (0.14 μg/L)) and a degradate (erythromycin–H 2 O (0.84 μg/L)) were detected in the water samples from the sites downstream from the WWTP discharges. The concentrations of six of the eight detected compounds and the detected degradate compound decreased with increasing distance downstream from the WWTP discharges. Azithromycin, ciprofloxacin, ofloxacin, and trimethoprim were detected in stream-bottom sediments. The concentrations of three of the four compounds detected in sediments were highest at a sampling site located downstream from the WWTP discharges. Trimethoprim was detected in the sediments from a background site. Pseudo-partition coefficients normalized for streambed sediment organic carbon concentration were calculated for azithromycin, ciprofloxacin
Wang, Tianli; Baron, Kyle; Zhong, Wei; Brundage, Richard; Elmquist, William
2014-03-01
The current study presents a Bayesian approach to non-compartmental analysis (NCA), which provides the accurate and precise estimate of AUC 0 (∞) and any AUC 0 (∞) -based NCA parameter or derivation. In order to assess the performance of the proposed method, 1,000 simulated datasets were generated in different scenarios. A Bayesian method was used to estimate the tissue and plasma AUC 0 (∞) s and the tissue-to-plasma AUC 0 (∞) ratio. The posterior medians and the coverage of 95% credible intervals for the true parameter values were examined. The method was applied to laboratory data from a mice brain distribution study with serial sacrifice design for illustration. Bayesian NCA approach is accurate and precise in point estimation of the AUC 0 (∞) and the partition coefficient under a serial sacrifice design. It also provides a consistently good variance estimate, even considering the variability of the data and the physiological structure of the pharmacokinetic model. The application in the case study obtained a physiologically reasonable posterior distribution of AUC, with a posterior median close to the value estimated by classic Bailer-type methods. This Bayesian NCA approach for sparse data analysis provides statistical inference on the variability of AUC 0 (∞) -based parameters such as partition coefficient and drug targeting index, so that the comparison of these parameters following destructive sampling becomes statistically feasible.
Controlled thermoreversible transfer of poly(oxazoline) micelles between an ionic liquid and water
Guerrero Sanchez, C.A.; Gohy, J.M.W.; D'Haese, C.; Thijs, H.M.L.; Hoogenboom, R.; Schubert, U.S.
2008-01-01
Poly(2-nonyl-2-oxazoline-block-2-ethyl-2-oxazoline) block copolymer micelles were investigated as an alternative system to the approach proposed by He and Lodge (Y. He and T. P. Lodge, J. Am. Chem. Soc., 2006, 128, 12666) for the thermoreversible transfer of micelles between a hydrophobic ionic
Liang, Ximei; Chen, Baowei; Nie, Xiangping; Shi, Zhen; Huang, Xiaoping; Li, Xiangdong
2013-09-01
Antibiotics released into the aquatic environment play an important role in the spread of antibiotic resistance. In the Pearl River Estuary (PRE) and the coastal zone, the concentrations of antibiotics decreased from the Pearl River to the estuary, suggesting that antibiotics primarily originated from river tributaries and terrigenous sources. Within the PRE area, the concentrations of antibiotics in water were higher in the west coast than the east side, reflecting the high density of anthropogenic activities and hydraulic conditions along the west riverbank. Seasonal variations were also observed for most of detected antibiotics in water. The pseudo-partitioning coefficient of norfloxacin had a good correlation with the TOC content of sediments, as did erythromycin-H2O with the pH of water. The results suggest that environmental conditions can significantly affect the distribution of antibiotics between water and sediment. Copyright © 2013 Elsevier Ltd. All rights reserved.
Guettari, Moez; Aferni, Ahmed E. L.; Tajouri, Tahar
2017-12-01
The main aim of this paper is the analysis of micellar collisions and polymer confinement effects on the electrical conductivity percolative behavior of water/sodium bis(2-ethylhexyl) sulfosuccinate (AOT)/isooctane reverse micelles. Firstly, we have performed conductance measurements of the system for three AOT to isooctane volume ratio, φm = 0.1 , 0.15 and 0.2 to examine the influence of micellar collisions on the percolation parameters. All the measurements were carried out over the 298.15 K-333.15 K temperature range at a fixed water to AOT molar ratio, W0 = 45 . We have assessed that the rise of micellar collisions frequency enhances the conductance percolation. Secondly, the confinement effect of a water-soluble polymer, polyvinylpyrrolidone (PVP), on the reverse micelles conductance behavior was investigated. Temperature-induced percolation, Tp , have shown a dependence on the polymer concentration, CPVP . It was also observed that for various PVP concentrations, the activation energy of percolation decreases. Finally, the values of the critical exponents determined in the presence and absence of PVP prove that the polymer affects the dynamic of percolation.
Polymeric Micelles as Novel Carriers for Poorly Soluble Drugs--A Review.
Reddy, B Pavan Kumar; Yadav, Hemant K S; Nagesha, Dattatri K; Raizaday, Abhay; Karim, Abdul
2015-06-01
Polymeric micelles are used as 'smart drug carriers' for targeting certain areas of the body by making them stimuli-sensitive or by attachment of a specific ligand molecule onto their surface. The main aim of using polymeric micelles is to deliver the poorly water soluble drugs. Now-a-days they are used especially in the areas of cancer therapy also. In this article we have reviewed several aspects of polymeric micelles concerning their mechanism of formation, chemical nature, preparation and characterization techniques, and their applications in the areas of drug delivery.
Pontolillo, James; Eganhouse, R.P.
2001-01-01
The accurate determination of an organic contaminant?s physico-chemical properties is essential for predicting its environmental impact and fate. Approximately 700 publications (1944?2001) were reviewed and all known aqueous solubilities (Sw) and octanol-water partition coefficients (Kow) for the organochlorine pesticide, DDT, and its persistent metabolite, DDE were compiled and examined. Two problems are evident with the available database: 1) egregious errors in reporting data and references, and 2) poor data quality and/or inadequate documentation of procedures. The published literature (particularly the collative literature such as compilation articles and handbooks) is characterized by a preponderance of unnecessary data duplication. Numerous data and citation errors are also present in the literature. The percentage of original Sw and Kow data in compilations has decreased with time, and in the most recent publications (1994?97) it composes only 6?26 percent of the reported data. The variability of original DDT/DDE Sw and Kow data spans 2?4 orders of magnitude, and there is little indication that the uncertainty in these properties has declined over the last 5 decades. A criteria-based evaluation of DDT/DDE Sw and Kow data sources shows that 95?100 percent of the database literature is of poor or unevaluatable quality. The accuracy and reliability of the vast majority of the data are unknown due to inadequate documentation of the methods of determination used by the authors. [For example, estimates of precision have been reported for only 20 percent of experimental Sw data and 10 percent of experimental Kow data.] Computational methods for estimating these parameters have been increasingly substituted for direct or indirect experimental determination despite the fact that the data used for model development and validation may be of unknown reliability. Because of the prevalence of errors, the lack of methodological documentation, and unsatisfactory data
Velikov, A. A.
2018-02-01
The effect of urea on the thermodynamics of hexadecyltrimethylammonium bromide (CTAB) micelle formation in aqueous urea solutions was studied by isothermal titration microcalorimetry. The thermodynamic functions of Δ H, Δ G, and Δ S of CTAB micelle formation were calculated. The critical micelle concentrations (CMC) were determined. The addition of urea to the solution decreased the micelle formation entropy. This was attributed to the "lowering" of the structural temperature of the solution, which led to an increased number of hydrogen bonds and structure formation of water.
Development of lycopene micelle and lycopene chylomicron and a comparison of bioavailability
Jyun Chen, Yi; Inbaraj, Baskaran Stephen; Shiau Pu, Yeong; Chen, Bing Huei
2014-04-01
The objectives of this study were to develop lycopene micelles and lycopene chylomicrons from tomato extracts for the enhancement and comparison of bioavailability. Lycopene micelles and chylomicrons were prepared by a microemulsion technique involving tomato extract, soybean oil, water, vitamin E and surfactant Tween 80 or lecithin in different proportions. The encapsulation efficiency of lycopene was 78% in micelles and 80% in chylomicrons, with shape being roughly spherical and mean particle size being 7.5 and 131.5 nm. A bioavailability study was conducted in rats by both gavage and i.v. administration, with oral bioavailability of lycopene, phytoene and phytofluene being 6.8, 4.3 and 3.1% in micelles and 9.5, 9.4 and 7.1% in chylomicrons, respectively. This outcome reveals higher lycopene bioavailability through incorporation into micelle or chylomicron systems. Both size and shape should be considered for oral bioavailability determination. For i.v. injection, lycopene micelles should be more important than lycopene chylomicrons for future clinical applications.
Performance of chromatographic systems to model soil-water sorption.
Hidalgo-Rodríguez, Marta; Fuguet, Elisabet; Ràfols, Clara; Rosés, Martí
2012-08-24
A systematic approach for evaluating the goodness of chromatographic systems to model the sorption of neutral organic compounds by soil from water is presented in this work. It is based on the examination of the three sources of error that determine the overall variance obtained when soil-water partition coefficients are correlated against chromatographic retention factors: the variance of the soil-water sorption data, the variance of the chromatographic data, and the variance attributed to the dissimilarity between the two systems. These contributions of variance are easily predicted through the characterization of the systems by the solvation parameter model. According to this method, several chromatographic systems besides the reference octanol-water partition system have been selected to test their performance in the emulation of soil-water sorption. The results from the experimental correlations agree with the predicted variances. The high-performance liquid chromatography system based on an immobilized artificial membrane and the micellar electrokinetic chromatography systems of sodium dodecylsulfate and sodium taurocholate provide the most precise correlation models. They have shown to predict well soil-water sorption coefficients of several tested herbicides. Octanol-water partitions and high-performance liquid chromatography measurements using C18 columns are less suited for the estimation of soil-water partition coefficients. Copyright © 2012 Elsevier B.V. All rights reserved.
Jin, Xiaochen; Fu, Zhiqiang; Li, Xuehua; Chen, Jingwen
2017-03-22
The octanol-air partition coefficient (K OA ) is a key parameter describing the partition behavior of organic chemicals between air and environmental organic phases. As the experimental determination of K OA is costly, time-consuming and sometimes limited by the availability of authentic chemical standards for the compounds to be determined, it becomes necessary to develop credible predictive models for K OA . In this study, a polyparameter linear free energy relationship (pp-LFER) model for predicting K OA at 298.15 K and a novel model incorporating pp-LFERs with temperature (pp-LFER-T model) were developed from 795 log K OA values for 367 chemicals at different temperatures (263.15-323.15 K), and were evaluated with the OECD guidelines on QSAR model validation and applicability domain description. Statistical results show that both models are well-fitted, robust and have good predictive capabilities. Particularly, the pp-LFER model shows a strong predictive ability for polyfluoroalkyl substances and organosilicon compounds, and the pp-LFER-T model maintains a high predictive accuracy within a wide temperature range (263.15-323.15 K).
The role of charge in the surfactant-assisted stabilization of the natural product curcumin.
Wang, Zifan; Leung, Mandy H M; Kee, Tak W; English, Douglas S
2010-04-20
Colloidal solutions of surfactants that form micelles or vesicles are useful for solubilizing and stabilizing hydrophobic molecules that are otherwise sparingly soluble in aqueous solutions. In this paper we investigate the use of micelles and vesicles prepared from ionic surfactants for solubilizing and stabilizing curcumin, a medicinal natural product that undergoes alkaline hydrolysis in water. We identify spectroscopic signatures to evaluate curcumin partitioning and deprotonation in surfactant mixtures containing micelles or vesicles. These spectroscopic signatures allow us to monitor the interaction of curcumin with charged surfactants over a wide range of pH values. Titration data are presented to show the pH dependence of curcumin interactions with negatively and positively charged micelles and vesicles. In solutions of cationic micelles or positively charged vesicles, strong interaction between the Cur(-1) phenoxide ion and the positively charged surfactants results in a change in the acidity of the phenolic hydrogen and a lowering of the apparent lowest pK(a) value for curcumin. In the microenvironments formed by anionic micelles or negatively charged bilayers, our data indicates that curcumin partitions as the Cur(0) species, which is stabilized by interactions with the respective surfactant aggregates, and this leads to an increase in the apparent pK(a) values. Our results may explain some of the discrepancies within the literature with respect to reported pK(a) values and the acidity of the enolic versus phenolic protons. Hydrolysis rates, quantum yields, and molar absorption coefficients are reported for curcumin in a variety of solutions.
Applications of polymeric micelles with tumor targeted in chemotherapy
International Nuclear Information System (INIS)
Ding Hui; Wang Xiaojun; Zhang Song; Liu Xinli
2012-01-01
Polymeric micelles (PMs) have gained more progress as a carrier system with the quick development of biological and nanoparticle techniques. In particular, PMs with smart targeting can deliver anti-cancer drugs directly into tumor cells at a sustained rate. PMs with core–shell structure (with diameters of 10 ∼ 100 nm) have been prepared by a variety of biodegradable and biocompatible polymers via a self-assembly process. The preparation of polymeric micelles with stimuli-responsive block copolymers or modification of target molecules on polymeric micelles’ surface are able to significantly improve the efficiency of drug delivery. Polymeric micelles, which have been considered as a novel promising drug carrier for cancer therapeutics, are rapidly evolving and being introduced in an attempt to overcome several limitations of traditional chemotherapeutics, including water solubility, tumor-specific accumulation, anti-tumor efficacy, and non-specific toxicity. This review describes the preparation of polymeric micelles and the targeted modification which greatly enhance the effects of chemotherapeutic agents.
Micelles as delivery vehicles for oligofluorene for bioimaging.
Su, Fengyu; Alam, Ruhaniyah; Mei, Qian; Tian, Yanqing; Meldrum, Deirdre R
2011-01-01
With the successful development of organic/polymeric light emitting diodes, many organic and polymeric fluorophores with high quantum efficiencies and optical stability were synthesized. However, most of these materials which have excellent optical properties are insoluble in water, limiting their applications in biological fields. Herein, we used micelles formed from an amino-group-containing poly(ε-caprolactone)-block-poly(ethylene glycol) (PCL-b-PEG-NH(2)) to incorporate a hydrophobic blue emitter oligofluorene (OF) to enable its application in biological conditions. Although OF is completely insoluble in water, it was successfully transferred into aqueous solutions with a good retention of its photophysical properties. OF exhibited a high quantum efficiency of 0.84 in a typical organic solvent of tetrahydrofuran (THF). In addition, OF also showed a good quantum efficiency of 0.46 after being encapsulated into micelles. Two cells lines, human glioblastoma (U87MG) and esophagus premalignant (CP-A), were used to study the cellular internalization of the OF incorporated micelles. Results showed that the hydrophobic OF was located in the cytoplasm, which was confirmed by co-staining the cells with nucleic acid specific SYTO 9, lysosome specific LysoTracker Red®, and mitochondria specific MitoTracker Red. MTT assay indicated non-toxicity of the OF-incorporated micelles. This study will broaden the application of hydrophobic functional organic compounds, oligomers, and polymers with good optical properties to enable their applications in biological research fields.
Micelles as delivery vehicles for oligofluorene for bioimaging.
Directory of Open Access Journals (Sweden)
Fengyu Su
Full Text Available With the successful development of organic/polymeric light emitting diodes, many organic and polymeric fluorophores with high quantum efficiencies and optical stability were synthesized. However, most of these materials which have excellent optical properties are insoluble in water, limiting their applications in biological fields. Herein, we used micelles formed from an amino-group-containing poly(ε-caprolactone-block-poly(ethylene glycol (PCL-b-PEG-NH(2 to incorporate a hydrophobic blue emitter oligofluorene (OF to enable its application in biological conditions. Although OF is completely insoluble in water, it was successfully transferred into aqueous solutions with a good retention of its photophysical properties. OF exhibited a high quantum efficiency of 0.84 in a typical organic solvent of tetrahydrofuran (THF. In addition, OF also showed a good quantum efficiency of 0.46 after being encapsulated into micelles. Two cells lines, human glioblastoma (U87MG and esophagus premalignant (CP-A, were used to study the cellular internalization of the OF incorporated micelles. Results showed that the hydrophobic OF was located in the cytoplasm, which was confirmed by co-staining the cells with nucleic acid specific SYTO 9, lysosome specific LysoTracker Red®, and mitochondria specific MitoTracker Red. MTT assay indicated non-toxicity of the OF-incorporated micelles. This study will broaden the application of hydrophobic functional organic compounds, oligomers, and polymers with good optical properties to enable their applications in biological research fields.
Directory of Open Access Journals (Sweden)
A. M. Lopes
2014-12-01
Full Text Available Aqueous two-phase micellar systems (ATPMS can be exploited in separation science for the extraction/purification of desired biomolecules. Prior to phase separation the surfactant solution reaches a cloud point temperature, which is influenced by the presence of electrolytes. In this work, we provide an investigation on the cloud point behavior of the nonionic surfactant C10E4 in the presence of NaCl, Li2SO4 and KI. We also investigated the salts' influence on a model protein partitioning. NaCl and Li2SO4 promoted a depression of the cloud point. The order of salts and the concentration that decreased the cloud point was: Li2SO4 0.5 M > NaCl 0.5 M ≈ Li2SO4 0.2 M. On the other hand, 0.5 M KI dislocated the curve to higher cloud point values. For our model protein, glucose-6-phosphate dehydrogenase (G6PD, partitioning experiments with 0.5 M NaCl or 0.2 M Li2SO4 at 13.85 ºC showed similar results, with K G6PD ~ 0.46. The lowest partition coefficient was obtained in the presence of 0.5 M KI (K G6PD = 0.12, with major recovery of the enzyme in the micelle-dilute phase (%Recovery = 90%. Our results show that choosing the correct salt to add to ATPMS may be useful to attain the desired partitioning conditions at more extreme temperatures. Furthermore, this system can be effective to separate a target biomolecule from fermented broth contaminants.
Basic investigations on LCV micelle gel
International Nuclear Information System (INIS)
Ebenezer, S B; Rafic, M K; Ravindran, P B
2013-01-01
The aim of this study was to investigate the feasibility of using Leuco Crystal Violet (LCV) based micelle gel dosimeter as a quality assurance tool in radiotherapy applications. Basic properties such as absorption coefficient and diffusion of LCV gel phantom over time were evaluated. The gel formulation consisted of 25 mM Trichloroacetic acid, 1mM LCV, 4 mM Triton X-100, 4% gelatin by mass and distilled water. The advantages of using this gel are its tissue equivalence, easy and less preparation time, lower diffusion rate and it can be read with an optical scanner. We were able to reproduce some of the results of Babic et al. The peak absorption was found to be at 600 nm and hence a matrix of yellow LEDs was used as light source. The profiles obtained from projection images confirmed the diffusion of LCV gel after 6 hours of irradiation. Hence the LCV gel phantom should be read before 6 hours post irradiation to get accurate dose information as suggested previously.
Improving GC-PPC-SAFT equation of state for LLE of hydrocarbons and oxygenated compounds with water
DEFF Research Database (Denmark)
Nguyen, Thanh-Binh; Jean-Charles, De Hemptinne; Creton, Benoit
2014-01-01
, uαβ, and wαβ are fitted on mutual solubilities of water and organic compounds. The regressed values which are obtained for each chemical family, are subsequently used for predicting infinite dilution activity coefficient in water and n-octanol/water partition coefficient.In general, the results...... obtained are very much improved compared to the predictive approach discussed previously [Nguyen et al. Ind. Eng. Chem. Res. 52 (2013) 7014-7029]. The global deviation values on the decimal log scale for infinite dilution activity coefficient in water, water solubility and n-octanol/water partition...
Liquid-liquid extraction by reversed micelles in biotechnological processes
Directory of Open Access Journals (Sweden)
Kilikian B. V.
2000-01-01
Full Text Available In biotechnology there is a need for new purification and concentration processes for biologically active compounds such as proteins, enzymes, nucleic acids, or cells that combine a high selectivity and biocompatibility with an easy scale-up. A liquid-liquid extraction with a reversed micellar phase might serve these purposes owing to its capacity to solubilize specific biomolecules from dilute aqueous solutions such as fermentation and cell culture media. Reversed micelles are aggregates of surfactant molecules containing an inner core of water molecules, dispersed in a continuous organic solvent medium. These reversed micelles are capable of selectively solubilizing polar compounds in an apolar solvent. This review gives an overview of liquid-liquid extraction by reversed micelles for a better understanding of this process.
International Nuclear Information System (INIS)
O'Connor, Isabel A.; Golsteijn, Laura; Hendriks, A. Jan
2016-01-01
Marine plastic debris are found worldwide in oceans and coastal areas. They degrade only slowly and contain chemicals added during manufacture or absorbed from the seawater. Therefore, they can pose a long-lasting contaminant source and potentially transfer chemicals to marine organisms when ingested. In order to assess their risk, the contaminant concentration in the plastics needs to be estimated and differences understood. We collected from literature plastic water partition coefficients of various organic chemicals for seven plastic types: polydimethylsiloxane (PDMS), high-density, low-density and ultra-high molecular weight polyethylene (LDPE, HDPE, UHMWPE), polystyrene (PS), polypropylene (PP), and polyvinyl chloride (PVC). Most data was available for PDMS (1060) and LDPE (220), but much less for the remaining plastics (73). Where possible, regression models were developed and the partitioning was compared between the different plastic types. The partitioning of chemicals follows the order of LDPE ≈ HDPE ≥ PP > PVC ≈ PS. Data describing the impact of weathering are urgently needed. - Highlights: • Comparison of organic chemicals partitioning into seven plastic types • Linear correlation between plastic-water partition coefficient K pw and K ow • More data is needed for polypropylene, polystyrene and polyvinyl chloride. • In all plastic types, most K pw were similar to/smaller than the corresponding K ow .
Partitioning of polar and non-polar neutral organic chemicals into human and cow milk.
Geisler, Anett; Endo, Satoshi; Goss, Kai-Uwe
2011-10-01
The aim of this work was to develop a predictive model for milk/water partition coefficients of neutral organic compounds. Batch experiments were performed for 119 diverse organic chemicals in human milk and raw and processed cow milk at 37°C. No differences (milk were observed. The polyparameter linear free energy relationship model fit the calibration data well (SD=0.22 log units). An experimental validation data set including hormones and hormone active compounds was predicted satisfactorily by the model. An alternative modelling approach based on log K(ow) revealed a poorer performance. The model presented here provides a significant improvement in predicting enrichment of potentially hazardous chemicals in milk. In combination with physiologically based pharmacokinetic modelling this improvement in the estimation of milk/water partitioning coefficients may allow a better risk assessment for a wide range of neutral organic chemicals. Copyright © 2011 Elsevier Ltd. All rights reserved.
Miles, Rachael E H; Davies, James F; Reid, Jonathan P
2016-07-20
We explore the dependence of the evaporation coefficient of water from aqueous droplets on the composition of a surface film, considering in particular the influence of monolayer mixed component films on the evaporative mass flux. Measurements with binary component films formed from long chain alcohols, specifically tridecanol (C13H27OH) and pentadecanol (C15H31OH), and tetradecanol (C14H29OH) and hexadecanol (C16H33OH), show that the evaporation coefficient is dependent on the mole fractions of the two components forming the monolayer film. Immediately at the point of film formation and commensurate reduction in droplet evaporation rate, the evaporation coefficient is equal to a mole fraction weighted average of the evaporation coefficients through the equivalent single component films. As a droplet continues to diminish in surface area with continued loss of water, the more-soluble, shorter alkyl chain component preferentially partitions into the droplet bulk with the evaporation coefficient tending towards that through a single component film formed simply from the less-soluble, longer chain alcohol. We also show that the addition of a long chain alcohol to an aqueous-sucrose droplet can facilitate control over the degree of dehydration achieved during evaporation. After undergoing rapid gas-phase diffusion limited water evaporation, binary aqueous-sucrose droplets show a continued slow evaporative flux that is limited by slow diffusional mass transport within the particle bulk due to the rapidly increasing particle viscosity and strong concentration gradients that are established. The addition of a long chain alcohol to the droplet is shown to slow the initial rate of water loss, leading to a droplet composition that remains more homogeneous for a longer period of time. When the sucrose concentration has achieved a sufficiently high value, and the diffusion constant of water has decreased accordingly so that bulk phase diffusion arrest occurs in the monolayer
Anion and cation partitioning between olivine, plagioclase phenocrysts and the host magma
International Nuclear Information System (INIS)
Yurimoto, Hisayoshi; Sueno, Shigeho
1984-01-01
Partition coefficients for -1, -2, -3, +1, +2, +3, +4 and +5 valent ions between the groundmass of tholeiite basalt and coexisting olivine and plagioclase phenocrysts from the Mid-Atlantic Ridge have been determined by secondary ion mass spectrometry. The present cation partitioning strongly supports the 'crystal structure control' mechanism. The partition coefficient for an anion is also under control of the crystal structure, so that each of the cation and anion positions in the crystal structure gives rise to a parabola-shaped peak on the partition coefficient vs. ionic radius diagram. (author)
Artificial Self-Sufficient P450 in Reversed Micelles
Directory of Open Access Journals (Sweden)
Teruyuki Nagamune
2010-04-01
Full Text Available Cytochrome P450s are heme-containing monooxygenases that require electron transfer proteins for their catalytic activities. They prefer hydrophobic compounds as substrates and it is, therefore, desirable to perform their reactions in non-aqueous media. Reversed micelles can stably encapsulate proteins in nano-scaled water pools in organic solvents. However, in the reversed micellar system, when multiple proteins are involved in a reaction they can be separated into different micelles and it is then difficult to transfer electrons between proteins. We show here that an artificial self-sufficient cytochrome P450, which is an enzymatically crosslinked fusion protein composed of P450 and electron transfer proteins, showed micelle-size dependent catalytic activity in a reversed micellar system. Furthermore, the presence of thermostable alcohol dehydrogenase promoted the P450-catalyzed reaction due to cofactor regeneration.
International Nuclear Information System (INIS)
Mammi, S.; Peggion, E.
1990-01-01
Human little gastrin is a 17 amino acid peptide that adopts a random conformation in water and an ordered structure in sodium dodecyl sulfate (SDS) micelles as well as in trifluoroethanol (TFE). The circular dichroism spectra in these two media have the same shape, indicative of a similar preferred conformation. The authors describe here the assignment of the proton NMR resonances and the conformational analysis of [Ahx 15 ] little gastrin in SDS micelles. Two-dimensional correlation techniques form the basis for the assignment. The conformational analysis utilizes NOE's, NH to C α H coupling constants, and the temperature coefficients of the amide chemical shifts. The NMR data indicate a helical structure in the N-terminal portion of the peptide. These results are compared with the conformation that the authors recently proposed for a minigastrin analogue (fragment 5-17 of [Ahx 15 ] little gastrin) in TFE
Nanostructured oxygen sensor--using micelles to incorporate a hydrophobic platinum porphyrin.
Directory of Open Access Journals (Sweden)
Fengyu Su
Full Text Available Hydrophobic platinum(II-5,10,15,20-tetrakis-(2,3,4,5,6-pentafluorophenyl-porphyrin (PtTFPP was physically incorporated into micelles formed from poly(ε-caprolactone-block-poly(ethylene glycol to enable the application of PtTFPP in aqueous solution. Micelles were characterized using dynamic light scattering (DLS and atomic force microscopy (AFM to show an average diameter of about 140 nm. PtTFPP showed higher quantum efficiency in micellar solution than in tetrahydrofuran (THF and dichloromethane (CH₂Cl₂. PtTFPP in micelles also exhibited higher photostability than that of PtTFPP suspended in water. PtTFPP in micelles exhibited good oxygen sensitivity and response time. This study provided an efficient approach to enable the application of hydrophobic oxygen sensors in a biological environment.
International Nuclear Information System (INIS)
Domańska, Urszula; Lukoshko, Elena Vadimovna
2013-01-01
Highlights: • Measurements of activity coefficients at infinite dilution using GLC. • 62 organic solvents and water in the ionic liquid 1-butyl-1-methylpyrrolidinium tricyanomethanide. • High capacity for thiophene, 1.37 at T = 328.15 K. • Possible entrainer for extraction of sulfur, or nitrogen compounds from fuels. • The excess thermodynamic functions and the gas–liquid partition coefficients were calculated. -- Abstract: The activity coefficients at infinite dilution, γ 13 ∞ , for 62 solutes, including alkanes, cycloalkanes, alkenes, alkynes, aromatic hydrocarbons, alcohols, water, thiophene, ethers, ketones, acetonitrile, pyridine and 1-nitropropane in the ionic liquid 1-butyl-1-methylpyrrolidinium tricyanomethanide, [BMPYR][TCM] were determined by gas–liquid chromatography at six temperatures over the range of (318.15 to 368.15) K. The partial molar excess Gibbs free energy, ΔG 1 E ∞, enthalpy ΔH 1 E ∞, and entropy term T ref ΔS 1 E ,∞ at infinite dilution were calculated from the experimental γ 13 ∞ values obtained over the temperature range. The densities of [BMPYR][TCM] were measured within temperature range from 318.15 K to 368.15 K. The gas–liquid partition coefficients, K L were calculated for all solutes. The values of selectivity for few separation problems as hexane/benzene, cyclohexane/benzene, heptane/thiophene were calculated from γ 13 ∞ and compared to literature values for N-methyl-2-pyrrolidinone (NMP), sulfolane, and other ionic liquids based on [BMPYR] + cation. In comparison with the former measured ILs, [BMPYR][TCM] present quite high selectivity for the separation of aromatic hydrocarbons and aliphatics hydrocarbons, an average capacity for benzene. The data presented here shows that [BMPYR][TCM] ionic liquid can be used as an alternative solvent for the separation of thiophene from the aliphatic hydrocarbons
Preclinical safety evaluation of intravenously administered mixed micelles.
Teelmann, K; Schläppi, B; Schüpbach, M; Kistler, A
1984-01-01
Mixed micelles, with their main constituents lecithin and glycocholic acid, form a new principle for the parenteral administration of compounds which are poorly water-soluble. Their composition of mainly physiological substances as well as their comparatively good stability substantiate their attractivity in comparison to existing solvents. A decomposition due to physical influences such as heat or storage for several years will almost exclusively affect the lecithin component in the form of hydrolysis into free fatty acids and lysolecithin. Their toxicity was examined experimentally in various studies using both undecomposed and artificially decomposed mixed micelles. In these studies the mixed micelles were locally and systemically well tolerated and proved to be neither embryotoxic, teratogenic nor mutagenic. Only when comparatively high doses of the undecomposed mixed micelles were administered, corresponding to approximately 30 to 50 times the anticipated clinical injection volume (of e.g. diazepam mixed micelles), did some vomitus (dogs), slight liver enzyme elevation (rats and dogs), and slightly increased liver weights (dogs) occur. After repeated injections of the artificially decomposed formulation (approximately 25% of lecithin hydrolyzed to free fatty acids and lysolecithin) effects such as intravascular haemolysis, liver enzyme elevations and intrahepatic cholestasis (dogs only) were observed but only when doses exceeding a threshold of approximately 40 to 60 mg lysolecithin/kg body weight were administered. All alterations were reversible after cessation of treatment.
Partitioning Water Vapor and Carbon Dioxide Fluxes using Correlation Analysis
Scanlon, T. M.
2008-12-01
A variety of methods are currently available to partition water vapor fluxes (into components of transpiration and direct evaporation) and carbon dioxide fluxes (into components of photosynthesis and respiration), using chambers, isotopes, and regression modeling approaches. Here, a methodology is presented that accounts for correlations between high-frequency measurements of water vapor (q) and carbon dioxide (c) concentrations being influenced by their non-identical source-sink distributions and the relative magnitude of their constituent fluxes. Flux-variance similarity assumptions are applied separately to the stomatal and the non-stomatal exchange, and the flux components are identified by considering the q-c correlation. Water use efficiency for the vegetation, and how it varies with respect to vapor pressure deficit, is the only input needed for this approach that uses standard eddy covariance measurements. The method is demonstrated using data collected over a corn field throughout a growing season. In particular, the research focuses on the partitioning of the water flux with the aim of improving how direct evaporation is handled in soil-vegetation- atmosphere transfer models over the course of wetting and dry-down cycles.
Czech Academy of Sciences Publication Activity Database
Planeta, Josef; Karásek, Pavel; Roth, Michal
2007-01-01
Roč. 111, č. 26 (2007), s. 7620-7625 ISSN 1520-6106 R&D Projects: GA AV ČR KJB400310504; GA ČR GA203/05/2106; GA ČR GA203/07/0886 Institutional research plan: CEZ:AV0Z40310501 Keywords : phosphonium ionic liquid * supercritical carbon dioxide * solute partition coefficient Subject RIV: CB - Analytical Chemistry, Separation Impact factor: 4.086, year: 2007
Block and Gradient Copoly(2-oxazoline) Micelles: Strikingly Different on the Inside.
Filippov, Sergey K; Verbraeken, Bart; Konarev, Petr V; Svergun, Dmitri I; Angelov, Borislav; Vishnevetskaya, Natalya S; Papadakis, Christine M; Rogers, Sarah; Radulescu, Aurel; Courtin, Tim; Martins, José C; Starovoytova, Larisa; Hruby, Martin; Stepanek, Petr; Kravchenko, Vitaly S; Potemkin, Igor I; Hoogenboom, Richard
2017-08-17
Herein, we provide a direct proof for differences in the micellar structure of amphiphilic diblock and gradient copolymers, thereby unambiguously demonstrating the influence of monomer distribution along the polymer chains on the micellization behavior. The internal structure of amphiphilic block and gradient co poly(2-oxazolines) based on the hydrophilic poly(2-methyl-2-oxazoline) (PMeOx) and the hydrophobic poly(2-phenyl-2-oxazoline) (PPhOx) was studied in water and water-ethanol mixtures by small-angle X-ray scattering (SAXS), small-angle neutron scattering (SANS), static and dynamic light scattering (SLS/DLS), and 1 H NMR spectroscopy. Contrast matching SANS experiments revealed that block copolymers form micelles with a uniform density profile of the core. In contrast to popular assumption, the outer part of the core of the gradient copolymer micelles has a distinctly higher density than the middle of the core. We attribute the latter finding to back-folding of chains resulting from hydrophilic-hydrophobic interactions, leading to a new type of micelles that we refer to as micelles with a "bitterball-core" structure.
Development of lycopene micelle and lycopene chylomicron and a comparison of bioavailability
International Nuclear Information System (INIS)
Chen, Yi Jyun; Inbaraj, Baskaran Stephen; Chen, Bing Huei; Pu, Yeong Shiau
2014-01-01
The objectives of this study were to develop lycopene micelles and lycopene chylomicrons from tomato extracts for the enhancement and comparison of bioavailability. Lycopene micelles and chylomicrons were prepared by a microemulsion technique involving tomato extract, soybean oil, water, vitamin E and surfactant Tween 80 or lecithin in different proportions. The encapsulation efficiency of lycopene was 78% in micelles and 80% in chylomicrons, with shape being roughly spherical and mean particle size being 7.5 and 131.5 nm. A bioavailability study was conducted in rats by both gavage and i.v. administration, with oral bioavailability of lycopene, phytoene and phytofluene being 6.8, 4.3 and 3.1% in micelles and 9.5, 9.4 and 7.1% in chylomicrons, respectively. This outcome reveals higher lycopene bioavailability through incorporation into micelle or chylomicron systems. Both size and shape should be considered for oral bioavailability determination. For i.v. injection, lycopene micelles should be more important than lycopene chylomicrons for future clinical applications. (paper)
Solvation dynamics in triton-X-100 and triton-X-165 micelles: Effect of micellar size and hydration
Kumbhakar, Manoj; Nath, Sukhendu; Mukherjee, Tulsi; Pal, Haridas
2004-09-01
Dynamic Stokes' shift measurements using coumarin 153 as the fluorescence probe have been carried out to study solvation dynamics in two nonionic micelles, viz., triton-X-100 (TX-100) and triton-X-165 (TX-165). In both the micelles, the solvent relaxation dynamics is biexponential in nature. While the fast solvation time τs1 is seen to be almost similar for both the micelles, the slow solvation time τs2 is found to be appreciably smaller in TX-165 than in TX-100 micelle. Dynamic light scattering measurements indicate that the TX-165 micelles are substantially smaller in size than that of TX-100. Assuming similar core size for both the micelles, as expected from the similar chemical structures of the nonpolar ends for both the surfactants, the Palisade layer is also indicated to be substantially thinner for TX-165 micelles than that of TX-100. The aggregation number of TX-165 micelles is also found to be substantially smaller than that of TX-100 micelles. Fluorescence spectral studies of C153 dye in the two micelles indicate that the Palisade layer of TX-165 micelles is more polar than that of TX-100 micelles. Fluorescence anisotropy measurements indicate that the microviscosity in the Palisade layer of TX-165 micelles is also lower than that of TX-100 micelles. Based on these results it is inferred that the structure of the Palisade layer of TX-165 micelles is quite loose and have higher degree hydration in comparison to that of TX-100 micelles. Due to these structural differences in the Palisade layers of TX-165 and TX-100 micelles the solvation dynamics is faster in the former micelles than in the latter. It has been further inferred that in the present systems the collective response of the water molecules at somewhat away from the probes is responsible for the faster component of the solvation time, which does not reflect much of the structural changes of the micellar Palisade layer. On the contrary, the slower solvation time component, which is mainly due to
Supercritical fluid reverse micelle separation
Fulton, J.L.; Smith, R.D.
1993-11-30
A method of separating solute material from a polar fluid in a first polar fluid phase is provided. The method comprises combining a polar fluid, a second fluid that is a gas at standard temperature and pressure and has a critical density, and a surfactant. The solute material is dissolved in the polar fluid to define the first polar fluid phase. The combined polar and second fluids, surfactant, and solute material dissolved in the polar fluid is maintained under near critical or supercritical temperature and pressure conditions such that the density of the second fluid exceeds the critical density thereof. In this way, a reverse micelle system defining a reverse micelle solvent is formed which comprises a continuous phase in the second fluid and a plurality of reverse micelles dispersed in the continuous phase. The solute material is dissolved in the polar fluid and is in chemical equilibrium with the reverse micelles. The first polar fluid phase and the continuous phase are immiscible. The reverse micelles each comprise a dynamic aggregate of surfactant molecules surrounding a core of the polar fluid. The reverse micelle solvent has a polar fluid-to-surfactant molar ratio W, which can vary over a range having a maximum ratio W[sub o] that determines the maximum size of the reverse micelles. The maximum ratio W[sub o] of the reverse micelle solvent is then varied, and the solute material from the first polar fluid phase is transported into the reverse micelles in the continuous phase at an extraction efficiency determined by the critical or supercritical conditions. 27 figures.
Core-Shell-Corona Micelles with a Responsive Shell.
Gohy, Jean-François; Willet, Nicolas; Varshney, Sunil; Zhang, Jian-Xin; Jérôme, Robert
2001-09-03
A reactor for the synthesis of gold nanoparticles is one of the uses of a poly(styrene)-block-poly(2-vinylpyridine)-block-poly(ethylene oxide) triblock copolymer (PS-b-P2VP-b-PEO) which forms core-shell-corona micelles in water. Very low polydispersity spherical micelles are observed that consist of a PS core surrounded by a pH-sensitive P2VP shell and a corona of PEO chains end-capped by a hydroxyl group. The corona can act as a site for attaching responsive or sensing molecules. © 2001 WILEY-VCH Verlag GmbH, Weinheim, Fed. Rep. of Germany.
Energy Technology Data Exchange (ETDEWEB)
Markina, Z.N.; Kostova, N.Z.; Rebinder, P.A.
1970-03-01
The effect of dissolved hydrocarbons (octane, benzene, and ethylbenzene) on critical micelle concentration of aqueous solutions of sodium salts of fatty acids from caproate to sodium myristate at various temperatures was studied. Experimental results showed that formation of micelles is promoted by presence of hydrocarbons dissolved in the water phase. Such solutions have below normal critical micelle concentration. The change in critical micelle concentration decreases with increase in length of hydrocarbon chain in the soap molecule and with decrease of hydrocarbon solubility in pure water. The nature of the hydrocarbon also affects the forms and dimension of the micelle. Aromatic hydrocarbons increase micelle volume and greatly decrease C.M.C., while aliphatic hydrocarbons decrease C.M.C. slightly. (12 refs.)
Structure and flexibility of worm-like micelles
DEFF Research Database (Denmark)
Jerke, G.; Pedersen, J.S.; Egelhaaf, S.U.
1997-01-01
Small-angle neutron scattering and static light scattering experiments have been performed on worm-like micelles formed by soybean lecithin and trace amounts of water in deuterated iso-octane. The structure and flexibility of the aggregates have been investigated as a function of solution...
SANS analysis of aqueous ionic perfluoropolyether micelles
Gambi, C M C; Chittofrati, A; Pieri, R; Baglioni, P; Teixeira, J
2002-01-01
Preliminary SANS results of ionic chlorine terminated perfluoropolyether micelles in water are given. The experimental spectra have been analyzed by a two-shell ellipsoidal model for the micellar form factor and a screened Coulombic plus hard-sphere repulsion potential for the structure factor. (orig.)
International Nuclear Information System (INIS)
Merwe, Deon van der; Riviere, Jim E.
2005-01-01
Dermal contact with potentially toxic agricultural and industrial chemicals is a common hazard encountered in occupational, accidental spill and environmental contamination scenarios. Different solvents and chemical mixtures may influence dermal absorption. The effects of sodium lauryl sulphate (SLS) on the stratum corneum partitioning and permeability in porcine skin of 10 agricultural and industrial chemicals in water, ethanol and propylene glycol were investigated. The chemicals were phenol, p-nitrophenol, pentachlorophenol, methyl parathion, ethyl parathion, chlorpyrifos, fenthion, simazine, atrazine and propazine. SLS decreased partitioning into stratum corneum from water for lipophilic compounds, decreased partitioning from propylene glycol and did not alter partitioning from ethanol. SLS effects on permeability were less consistent, but generally decreased permeability from water, increased permeability from ethanol and had an inconsistent effect on permeability from propylene glycol. It was concluded that, for the compounds tested, partitioning into the stratum corneum was determined by the relative solubility of the solute in the donor solvent and the stratum corneum lipids. Permeability, however, reflected the result of successive, complex processes and was not predictable from stratum corneum partitioning alone. Addition of SLS to solvents altered partitioning and absorption characteristics across a range of compounds, which indicates that partition coefficients or skin permeability from neat chemical exposure should be used with caution in risk assessment procedures for chemical mixtures
The impact of aerosol composition on the particle to gas partitioning of reactive mercury.
Rutter, Andrew P; Schauer, James J
2007-06-01
A laboratory system was developed to study the gas-particle partitioning of reactive mercury (RM) as a function of aerosol composition in synthetic atmospheric particulate matter. The collection of RM was achieved by filter- and sorbent-based methods. Analyses of the RM collected on the filters and sorbents were performed using thermal extraction combined with cold vapor atomic fluorescence spectroscopy (CVAFS), allowing direct measurement of the RM load on the substrates. Laboratory measurements of the gas-particle partitioning coefficients of RM to atmospheric aerosol particles revealed a strong dependence on aerosol composition, with partitioning coefficients that varied by orders of magnitude depending on the composition of the particles. Particles of sodium nitrate and the chlorides of potassium and sodium had high partitioning coefficients, shifting the RM partitioning toward the particle phase, while ammonium sulfate, levoglucosan, and adipic acid caused the RM to partition toward the gas phase and, therefore, had partitioning coefficients that were lower by orders of magnitude.
Linking biosensor responses to Cd, Cu and Zn partitioning in soils
International Nuclear Information System (INIS)
Dawson, J.J.C.; Campbell, C.D.; Towers, W.; Cameron, C.M.; Paton, G.I.
2006-01-01
Soils bind heavy metals according to fundamental physico-chemical parameters. Bioassays, using bacterial biosensors, were performed in pore waters extracted from 19 contrasting soils individually amended with Cd, Cu and Zn concentrations related to the EU Sewage Sludge Directive. The biosensors were responsive to pore waters extracted from Zn amended soils but less so to those of Cu and showed no toxicity to pore water Cd at these environmentally relevant amended concentrations. Across the range of soils, the solid-solution heavy metal partitioning coefficient (K d ) decreased (p d values. Gompertz functions of Cu and Zn, K d values against luminescence explained the relationship between heavy metals and biosensors. Consequently, biosensors provide a link between biologically defined hazard assessments of metals and standard soil-metal physico-chemical parameters for determining critical metal loadings in soils. - Biosensors link biological hazard assessments of metals in soils with physico-chemical partitioning
From micelle supramolecular assemblies in selective solvents to isoporous membranes
Nunes, Suzana Pereira; Karunakaran, Madhavan; Neelakanda, Pradeep; Behzad, Ali Reza; Hooghan, Bobby; Sougrat, Rachid; He, Haoze; Peinemann, Klaus-Viktor
2011-01-01
The supramolecular assembly of PS-b-P4VP copolymer micelles induced by selective solvent mixtures was used to manufacture isoporous membranes. Micelle order in solution was confirmed by cryo-scanning electron microscopy in casting solutions, leading to ordered pore morphology. When dioxane, a solvent that interacts poorly with the micelle corona, was added to the solution, polymer-polymer segment contact was preferential, increasing the intermicelle contact. Immersion in water gave rise to asymmetric porous membranes with exceptional pore uniformity and high porosity. The introduction of a small number of carbon nanotubes to the casting solution improved the membrane stability and the reversibility of the gate response in the presence of different pH values. © 2011 American Chemical Society.
From micelle supramolecular assemblies in selective solvents to isoporous membranes
Nunes, Suzana Pereira
2011-08-16
The supramolecular assembly of PS-b-P4VP copolymer micelles induced by selective solvent mixtures was used to manufacture isoporous membranes. Micelle order in solution was confirmed by cryo-scanning electron microscopy in casting solutions, leading to ordered pore morphology. When dioxane, a solvent that interacts poorly with the micelle corona, was added to the solution, polymer-polymer segment contact was preferential, increasing the intermicelle contact. Immersion in water gave rise to asymmetric porous membranes with exceptional pore uniformity and high porosity. The introduction of a small number of carbon nanotubes to the casting solution improved the membrane stability and the reversibility of the gate response in the presence of different pH values. © 2011 American Chemical Society.
Bowers, W.; Mercer, J.; Pleasants, M.; Williams, D. G.
2017-12-01
Isotopic partitioning of water within soil into tightly and loosely bound fractions has been proposed to explain differences between isotopic water sources used by plants and those that contribute to streams and ground water, the basis for the "two water worlds" hypothesis. We examined the isotope ratio values of water in trees, bulk soil, mobile water collected from soil lysimeters, stream water, and GW at three different hillslopes in a mixed conifer forest in southeastern Wyoming, USA. Hillslopes differed in aspect and topographic position with corresponding differences in surface energy balance, snowmelt timing, and duration of soil moisture during the dry summer. The isotopic results support the partitioning of water within the soil; trees apparently used a different pool of water for transpiration than that recovered from soil lysimeters and the source was not resolved with the isotopic signature of the water that was extracted from bulk soil via cryogenic vacuum distillation. Separating and measuring the isotope ratios values in these pools would test the assumption that the tightly bound water within the soil has the same isotopic signature as the water transpired by the trees. We employed a centrifugation approach to separate water within the soil held at different tensions by applying stepwise increases in rotational velocity and pressures to the bulk soil samples. Effluent and the remaining water (cryogenically extracted) at each step were compared. We first applied the centrifugation method in a simple lab experiment using sandy loam soil and separate introductions of two isotopically distinct waters. We then applied the method to soil collected from the montane hillslopes. For the lab experiment, we predicted that effluents would have distinct isotopic signatures, with the last effluent and extracted water more closely representing the isotopic signature of the first water applied. For our field samples, we predicted that the isotopic signature of the
International Nuclear Information System (INIS)
Salabat, Alireza; Sadeghi, Rahmat; Moghadam, Somayeh Tiani; Jamehbozorg, Bahman
2011-01-01
Highlights: → Thermodynamics parameters for partitioning of L-methionine in ATPS. → Investigation of different effects on partition coefficient of the amino acid. → Propose the best condition for L-methionine partitioning. - Abstract: The partitioning behavior of L-methionine has been studied in aqueous two-phase systems of (poly(propylene glycol) + sodium phosphate salts + H 2 O) at different temperatures. The salts used were sodium di-hydrogen phosphate (NaH 2 PO 4 ), di-sodium hydrogen phosphate (Na 2 HPO 4 ) and tri-sodium phosphate (Na 3 PO 4 ). The effects of tie line length, salt type, and temperature on the partition coefficient of this amino acid have been studied. In addition, thermodynamic parameters (ΔH o , ΔS o and ΔG o ) as a function of temperature were calculated. The results showed that increasing tie line length led to decreasing of the partition coefficient. We also showed that the partition coefficients of the amino acid in the systems containing Na 3 PO 4 are greater than the other two salts. Moreover, it is verified that increasing temperature led to decreasing the partition coefficient. The experimental partition coefficient data are correlated using a modified virial-type model.
Polymeric micelles for potentiated antiulcer and anticancer activities of naringin
Mohamed, Elham Abdelmonem; Abu Hashim, Irhan Ibrahim; Yusif, Rehab Mohammad; Shaaban, Ahmed Abdel Aziz; El-Sheakh, Ahmed Ramadan; Hamed, Mohammed Fawzy; Badria, Farid Abd Elreheem
2018-01-01
Naringin is one of the most interesting phytopharmaceuticals that has been widely investigated for various biological actions. Yet, its low water solubility, limited permeability, and suboptimal bioavailability limited its use. Therefore, in this study, polymeric micelles of naringin based on pluronic F68 (PF68) were developed, fully characterized, and optimized. The optimized formula was investigated regarding in vitro release, storage stability, and in vitro cytotoxicity vs different cell lines. Also, cytoprotection against ethanol-induced ulcer in rats and antitumor activity against Ehrlich ascites carcinoma in mice were investigated. Nanoscopic and nearly spherical 1:50 micelles with the mean diameter of 74.80±6.56 nm and narrow size distribution were obtained. These micelles showed the highest entrapment efficiency (EE%; 96.14±2.29). The micelles exhibited prolonged release up to 48 vs 10 h for free naringin. The stability of micelles was confirmed by insignificant changes in drug entrapment, particle size, and retention (%) (91.99±3.24). At lower dose than free naringin, effective cytoprotection of 1:50 micelles against ethanol-induced ulcer in rat model has been indicated by significant reduction in mucosal damage, gastric level of malondialdehyde, gastric expression of tumor necrosis factor-alpha, caspase-3, nuclear factor kappa-light-chain-enhancer of activated B cells, and interleukin-6 with the elevation of gastric reduced glutathione and superoxide dismutase when compared with the positive control group. As well, these micelles provoked pronounced antitumor activity assessed by potentiated in vitro cytotoxicity particularly against colorectal carcinoma cells and tumor growth inhibition when compared with free naringin. In conclusion, 1:50 naringin–PF68 micelles can be represented as a potential stable nanodrug delivery system with prolonged release and enhanced antiulcer as well as antitumor activities. PMID:29497294
Fabrication of an open Au/nanoporous film by water-in-oil emulsion-induced block copolymer micelles.
Koh, Haeng-Deog; Kang, Nam-Goo; Lee, Jae-Suk
2007-12-18
Water-in-oil (W/O) emulsion-induced micelles with narrow size distributions of approximately 140 nm were prepared by sonicating the polystyrene-b-poly(2-vinylpyridine) (PS-b-P2VP) block copolymer in the toluene/water (50:1 vol %). The ordered nanoporous block copolymer films with the hydrophilic P2VP interior and the PS matrix were distinctly fabricated by casting the resultant solution on substrates, followed by evaporating the organic solvent and water. The porous diameter was estimated to be about 70 nm. Here, we successfully prepared the open nanoporous nanocomposites, the P2VP domain decorated by Au (5+/-0.4 nm) nanoparticles based on the methodology mentioned. We anticipate that this novelty enhances the specific function of nanoporous films.
Charged triblock copolymer self-assembly into charged micelles
Chen, Yingchao; Zhang, Ke; Zhu, Jiahua; Wooley, Karen; Pochan, Darrin; Department of Material Science; Engineering University of Delaware Team; Department of Chemistry Texas A&M University Collaboration
2011-03-01
Micelles were formed through the self-assembly of amphiphlic block copolymer poly(acrylic acid)-block-poly(methyl acrylate)-block-polystyrene (PAA-PMA-PS). ~Importantly, the polymer is complexed with diamine molecules in pure THF solution prior to water titration solvent processing-a critical aspect in the control of final micelle geometry. The addition of diamine triggers acid-base complexation ~between the carboxylic acid PAA side chains and amines. ~Remarkably uniform spheres were found to form close-packed patterns when forced into dried films and thin, solvated films when an excess of amine was used in the polymer assembly process. Surface properties and structural features of these hexagonal-packed spherical micelles with charged corona have been explored by various characterization methods including Transmission Electron Microscopy (TEM), cryogenic TEM, z-potential analysis and Dynamic Light Scattering. The forming mechanism for this pattern and morphology changes against external stimulate such as salt will be discussed.
International Nuclear Information System (INIS)
Ahmadi, Fardin; Sparham, Chris; Pawliszyn, Janusz
2017-01-01
In this paper problems associated with preparation of aqueous standard of highly hydrophobic compounds such as partial precipitation, being lost on the surfaces, low solubility in water and limited sample volume for accurate determination of their distribution coefficients are addressed. The following work presents two approaches that utilize blade thin film microextraction (TFME) to investigate partitioning of UV filters and biocides to humic acid (dissolved organic carbon) and sediment. A steady-state concentration of target analytes in water was generated using a flow-through aqueous standard generation (ASG) system. Dialysis membranes, a polytetrafluoroethylene permeation tube, and a frit porous (0.5 μm) coated by epoxy glue were basic elements used for preparation of the ASG system. In the currently presented study, negligible depletion TFME using hydrophilic-lipophilic balance (HLB) and octadecyl silica-based (C18) sorbents was employed towards the attainment of free concentration values of target analytes in the studied matrices. Thin film geometry provided a large volume of extraction phase, which improved the sensitivity of the method towards highly matrix-bound analytes. Extractions were performed in the equilibrium regime so as to prevent matrix effects and with aims to reach maximum method sensitivity for all analytes under study. Partitioning of analytes on dissolved organic carbon (DOC) was investigated in ASG to facilitate large sample volume conditions. Binding percentages and DOC distribution coefficients (Log K DOC ) ranged from 20 to 98% and 3.71–6.72, respectively. Furthermore, sediment-water partition coefficients (K d ), organic-carbon normalized partition coefficients (Log K OC ), and DOC distribution coefficients (Log K DOC ) were investigated in slurry sediment, and ranged from 33 to 2860, 3.31–5.24 and 4.52–5.75 Lkg -1 , respectively. The obtained results demonstrated that investigations utilizing ASG and TFME can yield reliable
Partitioning of water flux in a Sierra Nevada ponderosa pine plantation
Kurpius, M.R.; Panek, J.A.; Nikolov, N.T.; McKay, M.; Goldstein, Allen H.
2003-01-01
The weather patterns of the west side of the Sierra Nevada Mountains (cold, wet winters and hot, dry summers) strongly influence how water is partitioned between transpiration and evaporation and result in a specific strategy of water use by ponderosa pine trees (Pinus ponderosa) in this region. To investigate how year-round water fluxes were partitioned in a young ponderosa pine ecosystem in the Sierra Nevada Mountains, water fluxes were continually measured from June 2000 to May 2001 using a combination of sap flow and eddy covariance techniques (above- and below-canopy). Water fluxes were modeled at our study site using a biophysical model, FORFLUX. During summer and fall water fluxes were equally partitioned between transpiration and soil evaporation while transpiration dominated the water fluxes in winter and spring. The trees had high rates of canopy conductance and transpiration in the early morning and mid-late afternoon and a mid-day depression during the dry season. We used a diurnal centroid analysis to show that the timing of high canopy conductance and transpiration relative to high vapor pressure deficit (D) shifted with soil moisture: during periods of low soil moisture canopy conductance and transpiration peaked early in the day when D was low. Conversely, during periods of high soil moisture canopy conductance and transpiration peaked at the same time or later in the day than D. Our observations suggest a general strategy by the pine trees in which they maximize stomatal conductance, and therefore carbon fixation, throughout the day on warm sunny days with high soil moisture (i.e. warm periods in winter and late spring) and maximize stomatal conductance and carbon fixation in the morning through the dry periods. FORFLUX model estimates of evaporation and transpiration were close to measured/calculated values during the dry period, including the drought, but underestimated transpiration and overestimated evaporation during the wet period. ?? 2003
Thermal conductivity coefficients of water and heavy water in the liquid state up to 3700C
International Nuclear Information System (INIS)
Le Neindre, B.; Bury, P.; Tufeu, R.; Vodar, B.
1976-01-01
The thermal conductivity coefficients of water and heavy water of 99.75 percent isotopic purity were measured using a coaxial cylinder apparatus, covering room temperature to their critical temperatures, and pressures from 1 to 500 bar for water, and from 1 to 1000 bar for heavy water. Following the behavior of the thermal conductivity coefficient of water, which shows a maximum close to 135 0 C, the thermal conductivity coefficient of heavy water exhibits a maximum near 95 0 C and near saturation pressures. This maximum is displaced to higher temperatures when the pressure is increased. Under the same temperature and pressure conditions the thermal conductivity coefficient of heavy water was lower than for water. The pressure effect was similar for water and heavy water. In the temperature range of our experiments, isotherms of thermal conductivity coefficients were almost linear functions of density
Energy Technology Data Exchange (ETDEWEB)
Sheppard, Steve; Long, Jeff; Sanipelli, Barb [ECOMatters Inc., Pinawa (Canada); Sohlenius, Gustav [Geological Survey of Sweden (SGU), Uppsala (Sweden)
2009-03-15
Soil and sediment solid/liquid partition coefficients (Kd) are used to indicate the relative mobility of radionuclides and elements of concern from nuclear fuel waste, as well as from other sources. The Kd data are inherently extremely variable, but also vary systematically with key environmental attributes. For soil Kd, the key variables are pH, clay content and organic carbon content. For sediment Kd, water type (freshwater versus marine) and sediment type (benthic versus suspended) are important. This report summarized Kd data for soils and sediments computed from indigenous stable element concentrations measured at the Forsmark and Laxemar-Simpevarp sites. These were then compared to several literature sources of Kd data for Ce, Cl, Co, Cr, Cs, Fe, Ho, I, La, Mn, Mo, Nb, Nd, Ni, Np, Pa, Pb, Pu, Ra, Sb, Se, Sm, Sn, Sr, Tc, Th, Tm, U and Yb. The Kd data computed from indigenous stable element concentrations may be especially relevant for assessment of long-lived radionuclides from deep disposal of waste, because the long time frame for the potential releases is more consistent with the steady state measured using indigenous stable elements. For almost every one of these elements in soils, a statistically meaningful regression equation was developed to allow estimation of Kd for any soil given a modest amount of information about the soil. Nonetheless, the median residual geometric standard deviation (GSD) was 4.3-fold, implying confidence bounds of about 18-fold above and below the best estimate Kd. For sediment, the values are categorised simply by water type and sediment type. The median GSD for sediment Kd as measured at the Forsmark and Laxemar-Simpevarp sites was 2.5-fold, but the median GSD among literature values was as high as 8.6-fold. Clearly, there remains considerable uncertainty in Kd values, and it is important to account for this in assessment applications
International Nuclear Information System (INIS)
Sheppard, Steve; Long, Jeff; Sanipelli, Barb; Sohlenius, Gustav
2009-03-01
Soil and sediment solid/liquid partition coefficients (Kd) are used to indicate the relative mobility of radionuclides and elements of concern from nuclear fuel waste, as well as from other sources. The Kd data are inherently extremely variable, but also vary systematically with key environmental attributes. For soil Kd, the key variables are pH, clay content and organic carbon content. For sediment Kd, water type (freshwater versus marine) and sediment type (benthic versus suspended) are important. This report summarized Kd data for soils and sediments computed from indigenous stable element concentrations measured at the Forsmark and Laxemar-Simpevarp sites. These were then compared to several literature sources of Kd data for Ce, Cl, Co, Cr, Cs, Fe, Ho, I, La, Mn, Mo, Nb, Nd, Ni, Np, Pa, Pb, Pu, Ra, Sb, Se, Sm, Sn, Sr, Tc, Th, Tm, U and Yb. The Kd data computed from indigenous stable element concentrations may be especially relevant for assessment of long-lived radionuclides from deep disposal of waste, because the long time frame for the potential releases is more consistent with the steady state measured using indigenous stable elements. For almost every one of these elements in soils, a statistically meaningful regression equation was developed to allow estimation of Kd for any soil given a modest amount of information about the soil. Nonetheless, the median residual geometric standard deviation (GSD) was 4.3-fold, implying confidence bounds of about 18-fold above and below the best estimate Kd. For sediment, the values are categorised simply by water type and sediment type. The median GSD for sediment Kd as measured at the Forsmark and Laxemar-Simpevarp sites was 2.5-fold, but the median GSD among literature values was as high as 8.6-fold. Clearly, there remains considerable uncertainty in Kd values, and it is important to account for this in assessment applications
Freitas, Alex A; Limbu, Kriti; Ghafourian, Taravat
2015-01-01
Volume of distribution is an important pharmacokinetic property that indicates the extent of a drug's distribution in the body tissues. This paper addresses the problem of how to estimate the apparent volume of distribution at steady state (Vss) of chemical compounds in the human body using decision tree-based regression methods from the area of data mining (or machine learning). Hence, the pros and cons of several different types of decision tree-based regression methods have been discussed. The regression methods predict Vss using, as predictive features, both the compounds' molecular descriptors and the compounds' tissue:plasma partition coefficients (Kt:p) - often used in physiologically-based pharmacokinetics. Therefore, this work has assessed whether the data mining-based prediction of Vss can be made more accurate by using as input not only the compounds' molecular descriptors but also (a subset of) their predicted Kt:p values. Comparison of the models that used only molecular descriptors, in particular, the Bagging decision tree (mean fold error of 2.33), with those employing predicted Kt:p values in addition to the molecular descriptors, such as the Bagging decision tree using adipose Kt:p (mean fold error of 2.29), indicated that the use of predicted Kt:p values as descriptors may be beneficial for accurate prediction of Vss using decision trees if prior feature selection is applied. Decision tree based models presented in this work have an accuracy that is reasonable and similar to the accuracy of reported Vss inter-species extrapolations in the literature. The estimation of Vss for new compounds in drug discovery will benefit from methods that are able to integrate large and varied sources of data and flexible non-linear data mining methods such as decision trees, which can produce interpretable models. Graphical AbstractDecision trees for the prediction of tissue partition coefficient and volume of distribution of drugs.
Partitioning of resveratrol between pentane and DMSO
DEFF Research Database (Denmark)
Shen, Chen; Stein, Paul C.; Klösgen-Buchkremer, Beate Maria
2015-01-01
Partitioning of trans-3,5,4′-trihydroxy-stilbene (resveratrol) between n-pentane and DMSO was investigated as a contribution to understand the interaction between resveratrol and biomembranes. In order to determine the partition coefficient P* of resveratrol between pentane and DMSO, resveratrol ...
International Nuclear Information System (INIS)
Cooke, Cindy M.; Shaw, George; Lester, John N.; Collins, Chris D.
2004-01-01
Two groups of chemicals are currently licensed for use in sheep dip products in the UK. These are organophosphate (OP) insecticides and synthetic pyrethroid (SP) insecticides. SPs are deemed to be less toxic to human health than OPs, although they are approximately 100 times more toxic to some elements of the aquatic environment. Three insecticides were selected for experimental investigation: diazinon, propetamphos (OPs) and cis-permethrin (SP), representative of the active ingredients used in sheep dip formulations, with additional uses in insect control in crops, and for domestic control of flies, mosquitoes, cockroaches, lice, ticks and spiders. The UK Government has recently reviewed agricultural practices relating to the disposal of used sheep dip, because the constituent insecticides are frequently detected in UK watercourses and the presence of these compounds is a severe hazard to the aquatic environment. Standard batch sorption experiments were carried out to investigate insecticide partitioning from water to soil, and the relationship between sorption and soil organic carbon content is discussed. Sorption isotherms and K d values showed that cis-permethrin adsorption was fastest on all five soils investigated, exhibiting the greatest total partitioning to the soil phase (83.8-94.8%) and high resistance to desorption. In comparison, the OP insecticides exhibited moderately strong soil adsorption as evidenced by their K d coefficients (diazinon K d 12-35 and propetamphos K d 9-60), with low sorption reversibility (<15%). Calculation of a hydrological retardation factor in a scenario representative of a typical UK environment suggested that SP insecticides such as cis-permethrin will not migrate in the soil profile due to their virtual immobility and strong soil retention, and thus waste sheep dip disposal to agricultural land should not pose a risk to aquatic life if applied with appropriate controls
Partitioning and mobilization of photoassimilate in alfalfa subjected to water deficits
International Nuclear Information System (INIS)
Hall, M.H.; Sheaffer, C.C.; Heichel, G.H.
1988-01-01
Faster regrowth of a stressed alfalfa (Medicago sativa L.) crop compared to an unstressed crop after rewatering has been reported. The bases of this compensatory response are unknown, but they may be important to understanding adaptation to water stress and to developing crop water management strategies. The authors objectives was to determine the effect of stress induced by water deficit on photoassimilate partitioning and the utilization of stored assimilates during regrowth of alfalfa. Field and greenhouse experiments were conducted using cultivars differing in winterhardiness. Plants were subjected to water stress, pulse-labeled with 14 CO 2 , and sampled following 0, 1, 14, 21, and 28-d translocation periods. Following the 14-d sampling, herbage was harvested and water stress was removed. Cultivars contrasting in winterhardiness responded similarly to water stress. Stressed plant roots contained 73 and 114% more total plant radioactivity (TPR) than the control at the 1 and 14-d translocation periods, respectively. Water stress significantly increased root starch and TPR percentage in the starch fraction, but had much smaller effects on root soluble-sugar concentration and TPR percentage of the root sugar fraction. Herbage regrowth mass following harvest and rewatering of the water-stressed plants was similar to that of the control. Compared to the control, water-stressed alfalfa has greater total nonstructural carbohydrates in the roots, apparently due to increased photoassimilate partitioning to the roots. However, the greater root carbohydrate concentrations did not result in compensatory herbage regrowth following rewatering
The interactions between ionic surfactants and phosphatidylcholine vesicles: Conductometry
Tsao, Heng-Kwong; Tseng, Wen Liang
2001-11-01
The interaction between ionic surfactants and phosphatidylcholine vesicles, which are prepared without addition of buffer and salt, is investigated by conductivity measurements. On the basis of the vesicle acting as a trap of charge carriers, the bilayer/aqueous phase partition coefficient K and the surfactant/lipid molar ratio Re of nine surfactants are determined. The thermodynamic consistency is satisfied by the measured parameters. The effects of the alkyl chain length (C10-C16) and ionic head group are then studied. The inverse partition coefficient K-1 is linearly related to the critical micelle concentration. The solubilizing ability Reb is a consequence of the competition between the surfactant incorporation into the bilayer and the formation of micelles. Consequently, the K parameter rises whereas the Reb parameter declines as the chain length is increased. The influence due to addition of salt is also discussed.
International Nuclear Information System (INIS)
Wang Linfeng; Yang Gaiqing; Liu Ping; Zhang Shijun
2010-01-01
In order to investigate nitrogen partitioning in local cashmere goats, six Inner Mogolia White Cashmere goats between 2 to 2.5 years old were used to determine the nitrogen partitioning in cashmere goats. The total retained nitrogen (TN) in body, distribution of body nitrgen and hair nitrogen were measured by general digestive and metabolism method combined with tritiated water dilution technique. Results showed that the combined methods were ideal for determining body nitrgen (BN) and hair nitrogen (fur nitrogen, FN) of Cashmere goats. There were obvious significance between BN and FN in different seasons. In telogen, BN and FN partitioning was 75.7% ± 0.62% and 24.3% ± 0.62%, respectively. Whereas, it changed to 66.6% ± 2.2% and 33.4% ± 2.2% in anagen. BN partitioning decreased when the season changed from telogen to anagen, while FN partitioning increased, which indicated that more nitrogen substance was partitioned to body growth in telogen, and more nitrogen substance was distribute to cashmere growth in anagen. These transformation were related to the changing of photoperiod and some hormones, such as melatonin (MT), prolactin (PRL) and IGF-I. It could be concluded that tritiated water dilution technique can be used to detect body protein content as well as BN, combining general digestive and metabolism experiment, FN partitoning can be determined. BN and FN partitoning varied with the season in cashmere goats because of hormones changing. (authors)
Energy Technology Data Exchange (ETDEWEB)
Salabat, Alireza, E-mail: a-salabat@araku.ac.ir [Chemistry Department, Arak University, P.O. Box 38156-879, Arak (Iran, Islamic Republic of); Sadeghi, Rahmat [Department of Chemistry, University of Kurdistan, Sanandaj, Kurdistan 66135 (Iran, Islamic Republic of); Moghadam, Somayeh Tiani [Chemistry Department, Arak University, P.O. Box 38156-879, Arak (Iran, Islamic Republic of); Jamehbozorg, Bahman [Department of Chemistry, University of Kurdistan, Sanandaj, Kurdistan 66135 (Iran, Islamic Republic of)
2011-10-15
Highlights: > Thermodynamics parameters for partitioning of L-methionine in ATPS. > Investigation of different effects on partition coefficient of the amino acid. > Propose the best condition for L-methionine partitioning. - Abstract: The partitioning behavior of L-methionine has been studied in aqueous two-phase systems of (poly(propylene glycol) + sodium phosphate salts + H{sub 2}O) at different temperatures. The salts used were sodium di-hydrogen phosphate (NaH{sub 2}PO{sub 4}), di-sodium hydrogen phosphate (Na{sub 2}HPO{sub 4}) and tri-sodium phosphate (Na{sub 3}PO{sub 4}). The effects of tie line length, salt type, and temperature on the partition coefficient of this amino acid have been studied. In addition, thermodynamic parameters ({Delta}H{sup o}, {Delta}S{sup o} and {Delta}G{sup o}) as a function of temperature were calculated. The results showed that increasing tie line length led to decreasing of the partition coefficient. We also showed that the partition coefficients of the amino acid in the systems containing Na{sub 3}PO{sub 4} are greater than the other two salts. Moreover, it is verified that increasing temperature led to decreasing the partition coefficient. The experimental partition coefficient data are correlated using a modified virial-type model.
Solubilization of docetaxel in poly(ethylene oxide)-block-poly(butylene/styrene oxide) micelles.
Elsabahy, Mahmoud; Perron, Marie-Eve; Bertrand, Nicolas; Yu, Ga-Er; Leroux, Jean-Christophe
2007-07-01
Poly(ethylene oxide)-block-poly(styrene oxide) (PEO-b-PSO) and PEO-b-poly(butylene oxide) (PEO-b-PBO) of different chain lengths were synthesized and characterized for their self-assembling properties in water by dynamic/static light scattering, spectrofluorimetry, and transmission electron microscopy. The resulting polymeric micelles were evaluated for their ability to solubilize and protect the anticancer drug docetaxel (DCTX) from degradation. The drug release kinetics as well as the cytotoxicity of the loaded micelles were assessed in vitro. All polymers formed micelles with a highly viscous core at low critical association concentrations (hydrolysis under accelerated stability testing conditions. Only PEO-b-PBO bearing 24 BO units afforded significant protection against degradation. In vitro, DCTX was released slower from the latter micelles, but all formulations possessed a similar cytotoxic effect against PC-3 prostate cancer cells. These data suggest that PEO-b-P(SO/BO) micelles could be used as alternatives to conventional surfactants for the solubilization of taxanes.
Directory of Open Access Journals (Sweden)
Edilson Grünheidt Borges
2002-12-01
Full Text Available Quantum chemistry and multivariate analysis were used to estimate the partition coefficients between n-octanol and water for a serie of 188 compounds, with the values of the q 2 until 0.86 for crossvalidation test. The quantum-mechanical descriptors are obtained with ab initio calculation, using the solvation effects of the Polarizable Continuum Method. Two different Hartree-Fock bases were used, and two different ways for simulating solvent cavity formation. The results for each of the cases were analised, and each methodology proposed is indicated for particular case.
International Nuclear Information System (INIS)
Ediger, M.D.; Domingue, R.P.; Fayer, M.D.
1984-01-01
A detailed experimental and theoretical examination of electronic excited state transport in the finite volume system, octadecyl rhodamine B molecules in triton X-100 micelles, is presented. Picosecond fluorescence mixing and transient grating techniques were used to examine systems in which the average number of chromophores per micelle ranged from 0.1 to 11. Because of the clustering of chromophores in the small micelles, the energy transport observed is extremely efficient. A statistical mechanical theory, based on a density expansion with a Pade approximant, is developed for donor--donor transport on a spherical surface. This theory accurately accounts for the experimental data with only the micelle radius as an adjustable parameter. The radius obtained from this procedure is in good agreement with determinations by other methods. This demonstrates that quantitative information about the spatial extent of chromophore distributions in small volumes can be obtained when appropriate finite volume energy transport theories are employed. It is shown that theories developed for infinite volumes are not applicable to systems such as the ones considered here. Finally the partitioning of rhodamine B and octadecyl rhodamine B between aqueous and micellar phases is measured, and lifetimes and rotation times are reported
Supersaturation induced by Itraconazole/Soluplus® micelles provided high GI absorption in vivo
Directory of Open Access Journals (Sweden)
Yue Zhong
2016-04-01
Full Text Available To investigate the effect of supersaturation induced by micelle formation during dissolution on the bioavailability of itraconazole (ITZ/Soluplus® solid dispersion. Solid dispersions prepared by hot melt extrusion (HME were compressed into tablets directly with other excipients. Dissolution behavior of ITZ tablets was studied by dissolution testing and the morphology of micelles in dissolution media was studied using transmission electron microscopy (TEM. Drug transferring from stomach into intestine was simulated to obtain a supersaturated drug solution. Bioavailability studies were performed on the ITZ tablets and Sporanox® in beagle dogs. The morphology of micelles in the dissolution media was observed to be spherical in shape, with an average size smaller than 100 nm. The supersaturated solutions formed by Soluplus® micelles were stable and no precipitation took place over a period of 180 min. Compared with Sporanox®, ITZ tablets exhibited a 2.50-fold increase in the AUC(0–96 of ITZ and a 1.95-fold increase in its active metabolite hydroxyitraconazole (OH-ITZ in the plasma of beagle dogs. The results obtained provided clear evidence that not only the increase in the dissolution rate in the stomach, but also the supersaturation produced by micelles in the small intestine may be of great assistance in the successful development of poorly water-soluble drugs. The micelles formed by Soluplus® enwrapped the molecular ITZ inside the core which promoted the amount of free drug in the intestinal cavity and carried ITZ through the aqueous boundary layer (ABL, resulting in high absorption by passive transportation across biological membranes. The uptake of intact micelles through pinocytosis together with the inhibition of P-glycoprotein-mediated drug efflux in intestinal epithelia contributed to the absorption of ITZ in the gastrointestinal tract. These results indicate that HME with Soluplus®, which can induce supersaturation by micelle
Kappa-casein micelles: structure, interaction and gelling studied by small-angle neutron scattering.
de Kruif, C G; May, R P
1991-09-01
Small-angle neutron scattering (SANS) measurements on dilute and concentrated dispersions of kappa-casein micelles in a buffer at pH = 6.7 were made using the D11 diffractometer in Grenoble. Results indicate that the micelles have a dense core with a fluffy outer layer. This outer layer appears to give rise to a steeply repulsive interaction on contact. In fact, the hard-sphere model best fits the measured scattering intensities. Adding chymosin to the dispersion initiated a fractal flocculation of the micelles and consecutively a coalescence of the micelles. This unexpected second process resembled that of spinodal demixing. The dispersion phase thus separates into a water and a protein phase on a time scale of hours. The observed phenomona contribute to the understanding of the cheese-making process.
Controlling the Size and Shape of the Elastin-Like Polypeptide based Micelles
Streletzky, Kiril; Shuman, Hannah; Maraschky, Adam; Holland, Nolan
Elastin-like polypeptide (ELP) trimer constructs make reliable environmentally responsive micellar systems because they exhibit a controllable transition from being water-soluble at low temperatures to aggregating at high temperatures. It has been shown that depending on the specific details of the ELP design (length of the ELP chain, pH and salt concentration) micelles can vary in size and shape between spherical micelles with diameter 30-100 nm to elongated particles with an aspect ratio of about 10. This makes ELP trimers a convenient platform for developing potential drug delivery and bio-sensing applications as well as for understanding micelle formation in ELP systems. Since at a given salt concentration, the headgroup area for each foldon should be constant, the size of the micelles is expected to be proportional to the volume of the linear ELP available per foldon headgroup. Therefore, adding linear ELPs to a system of ELP-foldon should result in changes of the micelle volume allowing to control micelle size and possibly shape. The effects of addition of linear ELPs on size, shape, and molecular weight of micelles at different salt concentrations were studied by a combination of Dynamic Light Scattering and Static Light Scattering. The initial results on 50 µM ELP-foldon samples (at low salt) show that Rh of mixed micelles increases more than 5-fold as the amount of linear ELP raised from 0 to 50 µM. It was also found that a given mixture of linear and trimer constructs has two temperature-based transitions and therefore displays three predominant size regimes.
PARTITIONING OF WATER FLUX IN A SIERRA NEVADA PONDEROSA PINE PLANTATION. (R826601)
The weather patterns of the west side of the Sierra Nevada Mountains (cold, wet winters and hot, dry summers) strongly influence how water is partitioned between transpiration and evaporation and result in a specific strategy of water use by ponderosa pine trees (Pinus pond...
Water-Sediment Partition of Polycyclic Aromatic Hydrocarbons (PAHs) in Nansi Lake
Zhang, Guizhai; Diao, Youjiang
2018-06-01
Based on field data of polycyclic aromatic hydrocarbons (PAHs) in water and sediment in Nansi Lake. The concentrations and the partitioning characteristic of PAHs in the water and sediment were studied. The lgKd of high molecular weight PAHs were higher than the low molecular weight PAHs. The most of PAHs Kd values were negligible correlated with TOC, soluble salt, clay and pH of the sediment in Nansi Lake.
International Nuclear Information System (INIS)
Shrestha, Lok Kumar; Aramaki, Kenji
2009-01-01
Structure of diglycerol monolaurate (abbreviated as C 12 G 2 ) micelles in nonpolar oils cyclohexane and n-octane as a function of compositions, temperatures, and surfactant chain length has been investigated by small-angle X-ray scattering (SAXS). The SAXS data were evaluated by the generalized indirect Fourier transformation (GIFT) method and real-space structural information of particles was achieved. Conventional poly(oxyethylene) type nonionic surfactants do not form reverse micelles in oils unless a trace water is added. However, present surfactant C 12 G 2 formed reverse micelle (RM) in cyclohexane and n-octane without addition of water at normal room temperature. A clear signature of one dimensional (1-D) micellar growth was found with increasing C 12 G 2 concentration. On the other hand, increasing temperature or hydrocarbon chain length of surfactant shorten the length of RM, which is essentially a cylinder-to-sphere type transition in the aggregate structure. Drastic changes in the structure of RM, namely, transition of ellipsoidal prolate to long rod-like micelles was observed upon changing oil from cyclohexane to octane. All the microstructural transitions were explained in terms of critical packing parameter. (author)
mPEG-PLA Micelle for Delivery of Effective Parts of Andrographis Paniculata.
Yao, Hailu; Song, Shiyong; Miao, Xiaolu; Liu, Xiao; Zhao, Junli; Wang, Zhen; Shao, Xiaoting; Zhang, Yu; Han, Guang
2018-01-01
Many studies have shown that Andrographis paniculata (Burm. f.) Nees has a good anti-tumor effect, but poor solubility in water and poor bioavailability hinder the modernization of it. To formulate the effective parts (mainly diterpene lactones) of Andrographis paniculata (AEP) into targeting drug delivery system, a series of poly(ethylene glycol)-poly(D.L-lactic acid)(mPEG-PLA) with different ratio of hydrophilic and hydrophobic segment was synthetized to encapsulate AEP. AEP micelles were prepared by a simple solvent-evaporation method. According to the loading capacity, the best polymer was chosen. mPEG-PLA micelles were characterized in terms of drug entrapping efficiency, loading capacity, size, the crystalline state of AEP, stability and release profile. Meanwhile, the cytotoxicity of micelles on mouse breast cancer 4T-1 was investigated. These micelle (mPEG-PLA-AEP) particles had a size of (92.84±5.63) nm and a high entrapping efficiency and loading capacity of (91.00±11.53)% and (32.14±3.02)%(w/w), respectively. The powder DSC showed that drugs were well encapsulated in the core of micelles. mPEG-PLA-AEP had a good stability against salt dissociation, protein adsorption and anion substitution and the solubility of andrographolide (AG) and 14-deoxy-11,12-didehydroandrographolide(DDAG) in AEP increased 4.51 times and 2.12 times in water, and the solubility of DAG showed no difference. mPEG-PLA-AEP had the same release profile in different dissolution medium. Cytotoxicity testing in vitro demonstrated that mPEG-PLA-AEP exhibited higher cell viability inhibition in mouse breast cancer 4T-1 than free AEP. mPEG-PLA micelles offer a promising alternative for TCM therapy with higher solubility and improved antitumor effect. Copyright© Bentham Science Publishers; For any queries, please email at epub@benthamscience.org.
Synthesis and immobilization of polystyreneb-polyvinyltriethoxysilane micelles
Zhu, Saisai
2018-01-31
Diblock copolymers polystyrene-block-polyvinyltriethoxysilane (PS-b-PVTES) were synthesized via atom transfer radical polymerization (ATRP), which self-assembled into spherical micelles in solvent of THF-methanol mixtures. The self-assembled micelles were immobilized by cross-linking reaction of VTES in a shell layer of micelles. The chemical structures of block copolymers and morphology of micelles were characterized in detail. It was found that the size of immobilized micelles was strongly affected by the copolymer concentration, composition of mixture solvent, and block ratios.
Directory of Open Access Journals (Sweden)
Lucas W E Starmans
Full Text Available BACKGROUND: Iron oxide nanoparticles (IONs are a promising nanoplatform for contrast-enhanced MRI. Recently, magnetic particle imaging (MPI was introduced as a new imaging modality, which is able to directly visualize magnetic particles and could serve as a more sensitive and quantitative alternative to MRI. However, MPI requires magnetic particles with specific magnetic properties for optimal use. Current commercially available iron oxide formulations perform suboptimal in MPI, which is triggering research into optimized synthesis strategies. Most synthesis procedures aim at size control of iron oxide nanoparticles rather than control over the magnetic properties. In this study, we report on the synthesis, characterization and application of a novel ION platform for sensitive MPI and MRI. METHODS AND RESULTS: IONs were synthesized using a thermal-decomposition method and subsequently phase-transferred by encapsulation into lipidic micelles (ION-Micelles. Next, the material and magnetic properties of the ION-Micelles were analyzed. Most notably, vibrating sample magnetometry measurements showed that the effective magnetic core size of the IONs is 16 nm. In addition, magnetic particle spectrometry (MPS measurements were performed. MPS is essentially zero-dimensional MPI and therefore allows to probe the potential of iron oxide formulations for MPI. ION-Micelles induced up to 200 times higher signal in MPS measurements than commercially available iron oxide formulations (Endorem, Resovist and Sinerem and thus likely allow for significantly more sensitive MPI. In addition, the potential of the ION-Micelle platform for molecular MPI and MRI was showcased by MPS and MRI measurements of fibrin-binding peptide functionalized ION-Micelles (FibPep-ION-Micelles bound to blood clots. CONCLUSIONS: The presented data underlines the potential of the ION-Micelle nanoplatform for sensitive (molecular MPI and warrants further investigation of the FibPep-ION-Micelle
Reverse micelles as suitable microreactor for increased biohydrogen production
Energy Technology Data Exchange (ETDEWEB)
Pandey, Anjana [Nanotechnology and Molecular Biology Laboratory, Centre of Biotechnology, University of Allahabad, Allahabad 211002 (India); Pandey, Ashutosh [Centre of Energy Studies, MNNIT, Allahabad 211004 (India)
2008-01-15
Reverse micelles have been shown to act as efficient microreactors for enzymic reactions and whole cell entrapment in organic (non-aqueous) media wherein the reactants are protected from denaturation by the surrounding organic solvent. These micelles are thermodynamically stable, micrometer sized water droplets dispersed in an organic phase by a surfactant. It has been observed that when whole cells of photosynthetic bacteria (Rhodopseudomonas sphaeroides or Rhodobacter sphaeroides 2.4.1) are entrapped inside these reverse micelles, the H{sub 2} production enhanced from 25 to 35 folds. That is, 1.71mmol(mgprotein){sup -1}h{sup -1} in case of R. sphaeroides which is 25 fold higher in benzene-sodium lauryl sulfate reverse micelles. Whereas, in case of R. sphaeroides 2.4.1 the H{sub 2} production was increased by 35 fold within AOT-isooctane reverse micelles i.e. 11.5mmol(mgprotein){sup -1}h{sup -1}. The observations indicate that the entrapment of whole cells of microbes within reverse micelles provides a novel and efficient technique to produce hydrogen by the inexhaustible biological route. The two microorganisms R. sphaeroides 2.4.1 (a photosynthetic bacteria) and Citrobacter Y19 (a facultative anaerobic bacteria) together are also entrapped within AOT-isooctane and H{sub 2} production was measured i.e. 69mmol(mgprotein){sup -1}h{sup -1}. The nitrogenase enzyme responsible for hydrogen production by R. sphaeroides/R. sphaeroides 2.4.1 cells is oxygen sensitive, and very well protected within reverse micelles by the use of combined approach of two cells (R. sphaeroides 2.4.1 and Citrobacter Y19). In this case glucose present in the medium of Citrobacter Y19 serves double roles in enhancing the sustained production rate of hydrogen. Firstly, it quenches the free O{sub 2}liberated as a side product of reaction catalyzed by nitrogenase, which is O{sub 2} labile. Secondly, organic acid produced by this reaction is utilized by the Citrobacter Y19 as organic substrate in
Quenching mechanism of exciplex fluorescence by inverted micelles
International Nuclear Information System (INIS)
Sato, Chika; Kikuchi, Koichi
1992-01-01
Using an emission-absorption laser photolysis method, the quenching mechanism of the pyrene-N,N-dimethylaniline exciplex fluorscence by inverted micelles is studied. The rate of enhanced intersystem crossing depends upon water pool size and is reduced by external magnetic fields. 15 refs., 3 figs., 2 tabs
Energy Technology Data Exchange (ETDEWEB)
Yin, Ligeng; Lodge, Timothy P; Hillmyer, Marc A [UMM
2012-11-26
Micellar polymorphism from block copolymers has been well documented, but most attention has focused on noncrystalline hydrophobic systems. We have investigated the micellization in water of model diblock copolymers with semicrystalline polyethylene (PE) as the core-forming component. Poly(N,N-dimethylacrylamide)–polyethylene (AE) diblock copolymers were synthesized by a combination of anionic and RAFT polymerizations. The bulk nanostructures were probed by small-angle X-ray scattering (SAXS) and AE diblock copolymers were found to be moderately segregated at 140 °C. Dispersions of AE amphiphiles in water were prepared by direct dissolution at 120 °C (i.e., above the melting transition of PE) followed by cooling to 25 °C. By manipulating the composition of AE diblock copolymers, discrete structures with oblate ellipsoidal, cylindrical, and bilayer morphologies were produced, as evidenced in cryogenic transmission electron microscopy (cryo-TEM). The self-assembled aggregates were also studied by small-angle neutron scattering (SANS) and dilute solution rheology. The semicrystalline nature of the nanostructures was further revealed by differential scanning calorimetry (DSC) and wide-angle X-ray scattering (WAXS). A stepwise “micellization–crystallization” process was proposed as the micelle formation mechanism, as supported by the existence of similar nanostructures at 120 °C using SANS. This strategy holds promise for a general protocol toward the production of giant wormlike micelles and vesicles with semicrystalline polymeric cores.
Directory of Open Access Journals (Sweden)
Yanfeng Liu
2017-10-01
Full Text Available This paper proposes the application of time and spatial partition heating to a solar water heating system. The heating effect and system performance were analyzed under the continuous and whole space heating and time and spatial partition heating using TRNSYS. The results were validated by comparing with the test results of the demonstration building. Compared to continuous and whole space heating, the use of time and spatial partition heating increases the solar fraction by 16.5%, reduces the auxiliary heating by 7390 MJ, and reduces the annual operation cost by 2010 RMB. Under time and spatial partition heating, optimization analyses were conducted for the two system capacity parameters of the solar collector area and tank volume and the one operation parameter of auxiliary heater setting outlet temperature. The results showed that a reasonable choice of the solar collector area can reduce the dynamic annual cost, the increased tank volume is advantageous to heat storage, and the auxiliary heater setting outlet temperature have greater influence on the indoor heating effect. The advanced opening of solar water heating system and the normal opening of passive air vents are recommended. Based on the comparison of the two modes, the time and spatial partition heating technology is a better choice for rural dwellings.
Pharmacokinetics and in vivo delivery of curcumin by copolymeric mPEG-PCL micelles.
Kheiri Manjili, Hamidreza; Ghasemi, Parisa; Malvandi, Hojjat; Mousavi, Mir Sajjad; Attari, Elahe; Danafar, Hossein
2017-07-01
Curcumin (CUR) has been associated with anti-inflammatory, antimicrobial, antioxidant, anti-amyloid, and antitumor effects, but its application is limited because of its low aqueous solubility and poor oral bioavailability. To progress the bioavailability and water solubility of CUR, we synthesized five series of mono methoxy poly (ethylene glycol)-poly (ε-caprolactone) (mPEG-PCL) diblock copolymers. The structure of the copolymers was characterized by H NMR, FTIR, DSC and GPC techniques. In this study, CUR was encapsulated within micelles through a single-step nano-precipitation method, leading to formation of CUR-loaded mPEG-PCL (CUR/mPEG-PCL) micelles. The resulting micelles were characterized further by various techniques such as dynamic light scattering (DLS) and atomic force microscopy (AFM). The cytotoxicity of void CUR, mPEG-PCL and CUR/mPEG-PCL micelles was compared to each other by performing MTT assay of the treated MCF-7 and 4T1 cell line. Study of the in vivo pharmacokinetics of the CUR-loaded micelles was also carried out on selected copolymers in comparison with CUR solution formulations. The results showed that the zeta potential of CUR-loaded micelles was about -11.5mV and the average size was 81.0nm. CUR was encapsulated into mPEG-PCL micelles with loading capacity of 20.65±0.015% and entrapment efficiency of 89.32±0.34%. The plasma AUC (0-t), t 1/2 and C max of CUR micelles were increased by 52.8, 4.63 and 7.51-fold compared to the CUR solution, respectively. In vivo results showed that multiple injections of CUR-loaded micelles could prolong the circulation time and increase the therapeutic efficacy of CUR. These results suggested that mPEG-PCL micelles would be a potential carrier for CUR. Copyright © 2016 Elsevier B.V. All rights reserved.
Glycation Reactions of Casein Micelles.
Moeckel, Ulrike; Duerasch, Anja; Weiz, Alexander; Ruck, Michael; Henle, Thomas
2016-04-13
After suspensions of micellar casein or nonmicellar sodium caseinate had been heated, respectively, in the presence and absence of glucose for 0-4 h at 100 °C, glycation compounds were quantitated. The formation of Amadori products as indicators for the "early" Maillard reaction were in the same range for both micellar and nonmicellar caseins, indicating that reactive amino acid side chains within the micelles are accessible for glucose in a comparable way as in nonmicellar casein. Significant differences, however, were observed concerning the formation of the advanced glycation end products (AGEs), namely, N(ε)-carboxymethyllysine (CML), pyrraline, pentosidine, and glyoxal-lysine dimer (GOLD). CML could be observerd in higher amounts in nonmicellar casein, whereas in the micelles the pyrraline formation was increased. Pentosidine and GOLD were formed in comparable amounts. Furthermore, the extent of protein cross-linking was significantly higher in the glycated casein micelles than in the nonmicellar casein samples. Dynamic light scattering and scanning electron microscopy showed that glycation has no influence on the size of the casein micelles, indicating that cross-linking occurs only in the interior of the micelles, but altered the surface morphology. Studies on glycation and nonenzymatic cross-linking can contribute to the understanding of the structure of casein micelles.
Topological string partition functions as polynomials
International Nuclear Information System (INIS)
Yamaguchi, Satoshi; Yau Shingtung
2004-01-01
We investigate the structure of the higher genus topological string amplitudes on the quintic hypersurface. It is shown that the partition functions of the higher genus than one can be expressed as polynomials of five generators. We also compute the explicit polynomial forms of the partition functions for genus 2, 3, and 4. Moreover, some coefficients are written down for all genus. (author)
Influence of biochar on isoproturon partitioning and bioaccessibility in soil
International Nuclear Information System (INIS)
Reid, B.J.; Pickering, F.L.; Freddo, A.; Whelan, M.J.; Coulon, F.
2013-01-01
The influence of biochar (5%) on the loss, partitioning and bioaccessibility of 14 C-isoproturon ( 14 C-IPU) was evaluated. Results indicated that biochar had a dramatic effect upon 14 C-IPU partitioning: 14 C-IPU extractability (0.01 M CaCl 2 ) in biochar-amended treatments was reduced to 14 C-IPU extractability in biochar free treatments decreased with ageing from 90% to 40%. A partitioning model was constructed to derive an effective partition coefficient for biochar:water (K BW of 7.82 × 10 4 L kg −1 ). This was two orders of magnitude greater than the apparent K foc value of the soil organic carbon:water (631 L kg −1 ). 14 C-radiorespirometry assays indicated high competence of microorganisms to mineralise 14 C-IPU in the absence of biochar (40.3 ± 0.9%). Where biochar was present 14 C-IPU mineralisation never exceeded 2%. These results indicate reduced herbicide bioaccessibility. Increasing IPU application to ×10 its recommended dose was ineffective at redressing IPU sequestration and its low bioaccessibility. Highlights: •Biochar had a dramatic effect on IPU partitioning. •IPU extractability was reduced to BW ) was 7.82 × 10 4 L kg −1 . •K BW was 124 times greater than the apparent K foc value of the control. •Biochar precluded microbial bioaccessibility – no catabolic response was observed. -- Biochar dramatically reduced 14 C-IPU extractability ( BW being ×123 greater than the apparent K foc . Correspondingly, microbial bioaccessibility of IPU was negligible
Duan, Yuwei; Wang, Juan; Yang, Xiaoye; Du, Hongliang; Xi, Yanwei; Zhai, Guangxi
2015-01-01
Although curcumin (CUR) can inhibit proliferation and induce apoptosis of tumors, the poor water solubility restricted its clinical application. The aim of this study was to improve the aqueous solubility of CUR and make more favorable changes to bioactivity by preparing curcumin-loaded phospholipid-sodium deoxycholate-mixed micelles (CUR-PC-SDC-MMs). CUR-PC-SDC-MMs were prepared by the thin-film dispersion method. Based on the results of single factor exploration, the preparation technology was optimized using the central composite design-response surface methodology with drug loading and entrapment efficiency (EE%) as indicators. The images of transmission electron microscopy showed that the optimized CUR-PC-SDC-MMs were spherical and well dispersed. The average size of the mixed micelles was 66.5 nm, the zeta potential was about -26.96 mV and critical micelle concentration was 0.0087 g/l. CUR was encapsulated in PC-SDC-MMs with loading capacity of 13.12%, EE% of 87.58%, and the solubility of CUR in water was 3.14 mg/ml. The release results in vitro showed that the mixed micelles presented sustained release behavior compared to the propylene glycol solution of CUR. The IC50 values of CUR-loaded micelles and free drug in human breast carcinoma cell lines were 4.10 μg/ml and 6.93 µg/ml, respectively. It could be concluded from the above results that the CUR-PC-SDC-MMs system might serve as a promising nanocarrier to improve the solubility and bioactivity of CUR.
Directory of Open Access Journals (Sweden)
Qingxiang Guan
Full Text Available Bletilla striata polysaccharides (BSPs have been used in pharmaceutical and biomedical industry, the aim of the present study was to explore a BSPs amphiphilic derivative to overcome its application limit as poorly water-soluble drug carriers due to water-soluble polymers. Stearic acid (SA was selected as a hydrophobic block to modify B. striata polysaccharides (SA-BSPs. Docetaxel (DTX-loaded SA-BSPs (DTX-SA-BSPs copolymer micelles were prepared and characterized. The DTX release percentage in vitro and DTX concentration in vivo was carried out by using high performance liquid chromatography. HepG2 and HeLa cells were subjected to MTT (3-(4, 5-dimethylthiazol-2-yl-2, 5-diphenyl tetrazonium bromide assay to evaluate the cell viability. In vitro evaluation of copolymer micelles showed higher drug encapsulation and loading capacity. The release percentage of DTX from DTX-SA-BSPs copolymer micelles and docetaxel injection was 66.93 ± 1.79% and 97.06 ± 1.56% in 2 days, respectively. The DTX-SA-BSPs copolymer micelles exhibited a sustained release of DTX. A 50% increase in growth inhibition was observed for HepG2 cells treated with DTX-SA-BSPs copolymer micelles as compared to those treated with docetaxel injection for 72 h. DTX-SA-BSPs copolymer micelles presented a similar growth inhibition effect on Hela cells. Furthermore, absolute bioavailability of DTX-SA-BSPs copolymer micelles was shown to be 1.39-fold higher than that of docetaxel injection. Therefore, SA-BSPs copolymer micelles may be used as potential biocompatible polymers for cancer chemotherapy.
Jang, Jiyi; Kim, Hyunji; Han, Seunghee
2014-02-01
It is known that particle scavenging of mercury (Hg) can be affected by the abundance of particulate organic matter in coastal waters. However, the role of living organic particles in Hg scavenging is not yet completely understood. In this study, we hypothesized that an abundance of living organic particles (i.e., phytoplankton and bacteria) would influence the particle-water partitioning of Hg in coastal waters. Surface seawater samples were collected from eight stations in Gwangyang Bay, Korea, in three seasons (November 2009, April 2010, and October 2010) for the determination of concentrations of suspended particulate matter (including chlorophyll-a and bacteria), and Hg in unfiltered and filtered waters. We found that more Hg partitioned toward particulate matter when phytoplankton biomass, indicated from the chlorophyll-a concentration in a particle, was higher. In the low algal season, when [chlorophyll-a]algae to transfer Hg to marine food chains. © 2013.
Coupled Organoclay/Micelle Action for the Adsorption of Diclofenac.
De Oliveira, Tiago; Guégan, Régis
2016-09-20
A Na-smectite clay mineral (Na-Mt) was exchanged with various amounts of benzyldimethyltetradecyl ammonium chloride cationic surfactant (BDTAC) up to four times the cation exchange capacity (CEC). The adsorption properties of these organoclays as well as a coupled micelle/organoclay process were evaluated to remove an anionic pharmaceutical product, the diclofenac (DCF), recognized as a recalcitrant compound for conventional water treatments and to be poorly adsorbed onto untreated clay mineral. The DCF affinity appears to depend on the lipophilic character of organoclays in correlation to the density of intercalated BDTA and is particularly enhanced for sorbent systems with free surfactant or micelle in solution. The combination of both organclay and BDTA in excess or micelle as a one pot adsorption system appears to be the most efficient material for the sequestration of DCF and other pharmaceutical products (PPs) with a KF Freundlich constant of 1.7 L g(-1) and no restriction of the adsorbed DCF amount as the linear adsorption isotherm shows. A BDTA hydrophobic core micelle coupled with a positive electric charge forms an organic complex with DCF that is properly intercalated within the interlayer space of BDTA-Mt organoclays as both Fourier transform infrared (FTIR) and X-ray diffraction (XRD) data supported.
Yoshida, Kenta; Fujii, Shota; Takahashi, Rintaro; Matsumoto, Sakiko; Sakurai, Kazuo
2017-09-12
The aggregation number of classical micelles exhibits a certain distribution, which is a recognizable feature of conventional micelles. However, we recently identified perfectly monodisperse calix[4]arene-based micelles whose aggregation numbers agree with the vertex numbers of regular polyhedra, that is, Platonic solids, and thus they are named "Platonic micelles". Regarding our hypothesis of the formation mechanism of Platonic micelles, both repulsive interactions including steric hindrance and electrostatic repulsions among the headgroups are important for determining their aggregation number; however, neither of these is necessarily needed to consider. In this study, we employed polyethylene glycols (PEGs) as the nonionic headgroup of calix[4]arene-based amphiphiles to study the effects of only repulsive interactions caused by steric hindrance on the formation of Platonic micelles. The amphiphiles containing relatively low-molecular-weight PEGs (550 or 1000 g mol -1 ) form dodecamer or octamer micelles, respectively, with no variation in the aggregation number. However, relatively high-molecular-weight PEGs (2000 g mol -1 ) produce polydispersed micelles with a range of aggregation number. PEG 2000 exhibits a greater affinity for water than PEG 550 and 1000, resulting in fewer hydrophobic interactions in micelle formation, as indicated by the drastic increase of the critical micelle concentration (CMC) value in the PEG 2000 system. The instability of the structure of PEG 2k CaL5 micelles might contribute to the higher mobility of PEG in the micellar shell, resulting in a non-Platonic aggregation number with polydispersity.
Adaptive Neuro-Fuzzy Computing Technique for Determining Turbulent Flow Friction Coefficient
Directory of Open Access Journals (Sweden)
Mohammad Givehchi
2013-08-01
Full Text Available Estimation of the friction coefficient in pipes is very important in many water and wastewater engineering issues, such as distribution of velocity and shear stress, erosion, sediment transport and head loss. In analyzing these problems, knowing the friction coefficient, can obtain estimates that are more accurate. In this study in order to estimate the friction coefficient in pipes, using adaptive neuro-fuzzy inference systems (ANFIS, grid partition method was used. For training and testing of neuro-fuzzy model, the data derived from the Colebrook’s equation was used. In the neuro-fuzzy approach, pipe relative roughness and Reynolds number are considered as input variables and friction coefficient as output variable is considered. Performance of the proposed approach was evaluated by using of the data obtained from the Colebrook’s equation and based on statistical indicators such as coefficient determination (R2, root mean squared error (RMSE and mean absolute error (MAE. The results showed that the adaptive nerou-fuzzy inference system with grid partition method and gauss model as an input membership function and linear as an output function could estimate friction coefficient more accurately than other conditions. The new proposed approach in this paper has capability of application in the practical design issues and can be combined with mathematical and numerical models of sediment transfer or real-time updating of these models.
Condensation coefficient of water in a weak condensation state
International Nuclear Information System (INIS)
Kobayashi, Kazumichi; Watanabe, Shunsuke; Yamano, Daigo; Yano, Takeru; Fujikawa, Shigeo
2008-01-01
The condensation coefficient of water at a vapor-liquid interface is determined by combining shock tube experiments and numerical simulations of the Gaussian-BGK Boltzmann equation. The time evolution in thickness of a liquid film, which is formed on the shock tube endwall behind the shock wave reflected at the endwall, is measured with an optical interferometer consisting of the physical beam and the reference one. The reference beam is utilized to eliminate systematic noises from the physical beam. The growth rate of the film is evaluated from the measured time evolution and it is incorporated into the kinetic boundary condition for the Boltzmann equation. From a numerical simulation using the boundary condition, the condensation coefficient of water is uniquely deduced. The results show that, in a condition of weak condensation near a vapor-liquid equilibrium state, the condensation coefficient of water is almost equal to the evaporation coefficient estimated by molecular dynamics simulations near a vapor-liquid equilibrium state and it decreases as the system becomes a nonequilibrium state. The condensation coefficient of water is nearly identical with that of methanol [Mikami, S., Kobayashi, K., Ota, T., Fujikawa, S., Yano, T., Ichijo, M., 2006. Molecular gas dynamics approaches to interfacial phenomena accompanied with condensation. Exp. Therm. Fluid Sci. 30, 795-800].
Condensation coefficient of water in a weak condensation state
Kobayashi, Kazumichi; Watanabe, Shunsuke; Yamano, Daigo; Yano, Takeru; Fujikawa, Shigeo
2008-07-01
The condensation coefficient of water at a vapor-liquid interface is determined by combining shock tube experiments and numerical simulations of the Gaussian-BGK Boltzmann equation. The time evolution in thickness of a liquid film, which is formed on the shock tube endwall behind the shock wave reflected at the endwall, is measured with an optical interferometer consisting of the physical beam and the reference one. The reference beam is utilized to eliminate systematic noises from the physical beam. The growth rate of the film is evaluated from the measured time evolution and it is incorporated into the kinetic boundary condition for the Boltzmann equation. From a numerical simulation using the boundary condition, the condensation coefficient of water is uniquely deduced. The results show that, in a condition of weak condensation near a vapor-liquid equilibrium state, the condensation coefficient of water is almost equal to the evaporation coefficient estimated by molecular dynamics simulations near a vapor-liquid equilibrium state and it decreases as the system becomes a nonequilibrium state. The condensation coefficient of water is nearly identical with that of methanol [Mikami, S., Kobayashi, K., Ota, T., Fujikawa, S., Yano, T., Ichijo, M., 2006. Molecular gas dynamics approaches to interfacial phenomena accompanied with condensation. Exp. Therm. Fluid Sci. 30, 795-800].
Tang, Xueming; Zou, Weizhong; Koenig, Peter H; McConaughy, Shawn D; Weaver, Mike R; Eike, David M; Schmidt, Michael J; Larson, Ronald G
2017-03-23
We link micellar structures to their rheological properties for two surfactant body-wash formulations at various concentrations of salts and perfume raw materials (PRMs) using molecular simulations and micellar-scale modeling, as well as traditional surfactant packing arguments. The two body washes, namely, BW-1EO and BW-3EO, are composed of sodium lauryl ethylene glycol ether sulfate (SLEnS, where n is the average number of ethylene glycol repeat units), cocamidopropyl betaine (CAPB), ACCORD (which is a mixture of six PRMs), and NaCl salt. BW-3EO is an SLE3S-based body wash, whereas BW-1EO is an SLE1S-based body wash. Additional PRMs are also added into the body washes. The effects of temperature, salt, and added PRMs on micellar lengths, breakage times, end-cap free energies, and other properties are obtained from fits of the rheological data to predictions of the "Pointer Algorithm" [ Zou , W. ; Larson , R.G. J. Rheol. 2014 , 58 , 1 - 41 ], which is a simulation method based on the Cates model of micellar dynamics. Changes in these micellar properties are interpreted using the Israelachvili surfactant packing argument. From coarse-grained molecular simulations, we infer how salt modifies the micellar properties by changing the packing between the surfactant head groups, with the micellar radius remaining nearly constant. PRMs do so by partitioning to different locations within the micelles according to their octanol/water partition coefficient P OW and chemical structures, adjusting the packing of the head and/or tail groups, and by changing the micelle radius, in the case of a large hydrophobic PRM. We find that relatively hydrophilic PRMs with log P OW 4, are isolated deep inside the micelle, separating from the tails and swelling the radius of the micelle, leading to shorter micelles and much lower viscosities, leading eventually to swollen-droplet micelles.
Curcumin-loaded biodegradable polymeric micelles for colon cancer therapy in vitro and in vivo
Gou, Maling; Men, Ke; Shi, Huashan; Xiang, Mingli; Zhang, Juan; Song, Jia; Long, Jianlin; Wan, Yang; Luo, Feng; Zhao, Xia; Qian, Zhiyong
2011-04-01
Curcumin is an effective and safe anticancer agent, but its hydrophobicity inhibits its clinical application. Nanotechnology provides an effective method to improve the water solubility of hydrophobic drug. In this work, curcumin was encapsulated into monomethoxy poly(ethylene glycol)-poly(ε-caprolactone) (MPEG-PCL) micelles through a single-step nano-precipitation method, creating curcumin-loaded MPEG-PCL (Cur/MPEG-PCL) micelles. These Cur/MPEG-PCL micelles were monodisperse (PDI = 0.097 +/- 0.011) with a mean particle size of 27.3 +/- 1.3 nm, good re-solubility after freeze-drying, an encapsulation efficiency of 99.16 +/- 1.02%, and drug loading of 12.95 +/- 0.15%. Moreover, these micelles were prepared by a simple and reproducible procedure, making them potentially suitable for scale-up. Curcumin was molecularly dispersed in the PCL core of MPEG-PCL micelles, and could be slow-released in vitro. Encapsulation of curcumin in MPEG-PCL micelles improved the t1/2 and AUC of curcuminin vivo. As well as free curcumin, Cur/MPEG-PCL micelles efficiently inhibited the angiogenesis on transgenic zebrafish model. In an alginate-encapsulated cancer cell assay, intravenous application of Cur/MPEG-PCL micelles more efficiently inhibited the tumor cell-induced angiogenesisin vivo than that of free curcumin. MPEG-PCL micelle-encapsulated curcumin maintained the cytotoxicity of curcumin on C-26 colon carcinoma cellsin vitro. Intravenous application of Cur/MPEG-PCL micelle (25 mg kg-1curcumin) inhibited the growth of subcutaneous C-26 colon carcinoma in vivo (p curcumin (p curcumin; this formulation can inhibit the growth of colon carcinoma through inhibiting angiogenesis and directly killing cancer cells.
Ahmadi, Fardin; Sparham, Chris; Pawliszyn, Janusz
2017-11-01
In this paper problems associated with preparation of aqueous standard of highly hydrophobic compounds such as partial precipitation, being lost on the surfaces, low solubility in water and limited sample volume for accurate determination of their distribution coefficients are addressed. The following work presents two approaches that utilize blade thin film microextraction (TFME) to investigate partitioning of UV filters and biocides to humic acid (dissolved organic carbon) and sediment. A steady-state concentration of target analytes in water was generated using a flow-through aqueous standard generation (ASG) system. Dialysis membranes, a polytetrafluoroethylene permeation tube, and a frit porous (0.5 μm) coated by epoxy glue were basic elements used for preparation of the ASG system. In the currently presented study, negligible depletion TFME using hydrophilic-lipophilic balance (HLB) and octadecyl silica-based (C18) sorbents was employed towards the attainment of free concentration values of target analytes in the studied matrices. Thin film geometry provided a large volume of extraction phase, which improved the sensitivity of the method towards highly matrix-bound analytes. Extractions were performed in the equilibrium regime so as to prevent matrix effects and with aims to reach maximum method sensitivity for all analytes under study. Partitioning of analytes on dissolved organic carbon (DOC) was investigated in ASG to facilitate large sample volume conditions. Binding percentages and DOC distribution coefficients (Log K DOC ) ranged from 20 to 98% and 3.71-6.72, respectively. Furthermore, sediment-water partition coefficients (K d ), organic-carbon normalized partition coefficients (Log K OC ), and DOC distribution coefficients (Log K DOC ) were investigated in slurry sediment, and ranged from 33 to 2860, 3.31-5.24 and 4.52-5.75 Lkg -1 , respectively. The obtained results demonstrated that investigations utilizing ASG and TFME can yield reliable binding
Mouret, Jean-Roch; Sablayrolles, Jean-Marie; Farines, Vincent
2015-04-01
The knowledge of gas-liquid partitioning of aroma compounds during winemaking fermentation could allow optimization of fermentation management, maximizing concentrations of positive markers of aroma and minimizing formation of molecules, such as hydrogen sulfide (H2S), responsible for defects. In this study, the effect of the main fermentation parameters on the gas-liquid partition coefficients (Ki) of H2S was assessed. The Ki for this highly volatile sulfur compound was measured in water by an original semistatic method developed in this work for the determination of gas-liquid partitioning. This novel method was validated and then used to determine the Ki of H2S in synthetic media simulating must, fermenting musts at various steps of the fermentation process, and wine. Ki values were found to be mainly dependent on the temperature but also varied with the composition of the medium, especially with the glucose concentration. Finally, a model was developed to quantify the gas-liquid partitioning of H2S in synthetic media simulating must to wine. This model allowed a very accurate prediction of the partition coefficient of H2S: the difference between observed and predicted values never exceeded 4%.
Shi, Yifeng
2012-06-01
Mesoporous micelle@silica hybrid materials with 2D hexagonal mesostructures were synthesized as reusable sorbents for hydrophobic organic compounds (HOCs) removal by a facile one-step aqueous solution synthesis using 3-(trimethoxysily)propyl-octadecyldimethyl-ammonium chloride (TPODAC) as a structure directing agent. The mesopores were generated by adding micelle swelling agent, 1,3,5-trimethyl benzene, during the synthesis and removing it afterward, which was demonstrated to greatly increase the HOC removal efficiency. In this material, TPODAC surfactant is directly anchored on the pore surface of mesoporous silica via SiOSi covalent bond after the synthesis due to its reactive Si(OCH 3) 3 head group, and thus makes the synthesized materials can be easily regenerated for reuse. The obtained materials show great potential in water treatment as pollutants sorbents. © 2011 Elsevier Inc. All rights reserved.
International Nuclear Information System (INIS)
Marciniak, Andrzej; Wlazło, Michał
2013-01-01
Highlights: • γ ∞ and K L for 65 solutes in the IL [C 2 OHmim][FAP] were determined by IGC. • Partial molar thermodynamics functions ΔG 1 E,∞ , ΔH 1 E,∞ and ΔS 1 E,∞ were calculated. • Selectivities and capacities for alkanes/thiophene separation problems were calculated. • LFER system constants as a function of T for [C 2 OHmim][FAP] were calculated. • Results were compared to other ILs based on the same cation and anion. -- Abstract: This work presents new data of activity coefficients at infinite dilution, γ ∞ of different organic solutes and water in the 1-(2-hydroxyethyl)-3-methylimidazolium trifluorotris(perfluoroethyl)phosphate, [C 2 OHmim][FAP] ionic liquid. Values of γ ∞ were determined for 65 organic solutes, including alkanes, alkenes, alkynes, cycloalkanes, aromatic hydrocarbons, alcohols, thiophene, ethers, ketones, esters, 1-nitropropane, aldehydes, acetonitrile and water by inverse gas chromatography within the temperature range from (318.15 to 368.15) K. The basic thermodynamic functions, such as partial molar excess Gibbs energies, ΔG 1 E,∞ , enthalpies, ΔH 1 E,∞ and entropies, ΔS 1 E,∞ at infinite dilution were calculated from the experimental γ ∞ values obtained over the temperature range. Additionally the gas–liquid partition coefficients, K L were determined. Experimental values of gas–liquid partition coefficients were used to determine the coefficients in the Abraham solvation parameter model (LFER). Results are compared to previously investigated ionic liquids with the same [C 2 OHmim] + cation and [FAP] − anion. The selectivity and capacity at infinite dilution for alkanes/thiophene extraction problems were calculated from experimental γ ∞ values to verify the possibility of investigated ionic liquid as an entrainer in liquid–liquid extraction
International Nuclear Information System (INIS)
Perez, Brenda; Malpiedi, Luciana Pellegrini; Tubío, Gisela; Nerli, Bibiana; Alcântara Pessôa Filho, Pedro de
2013-01-01
Highlights: ► Binodal data of systems (water + polyethyleneglycol + sodium) succinate are reported. ► Pitzer model describes the phase equilibrium of systems formed by polyethyleneglycol and biodegradable salts satisfactorily. ► This simple thermodynamic framework was able to predict the partitioning behaviour of model proteins acceptably well. - Abstract: Phase diagrams of sustainable aqueous two-phase systems (ATPSs) formed by polyethyleneglycols (PEGs) of different average molar masses (4000, 6000, and 8000) and sodium succinate are reported in this work. Partition coefficients (Kps) of seven model proteins: bovine serum albumin, catalase, beta-lactoglobulin, alpha-amylase, lysozyme, pepsin, urease and trypsin were experimentally determined in these systems and in ATPSs formed by the former PEGs and other biodegradable sodium salts: citrate and tartrate. An extension of Pitzer model comprising long and short-range term contributions to the excess Gibbs free energy was used to describe the (liquid + liquid) equilibrium. Comparison between experimental and calculated tie line data showed mean deviations always lower than 3%, thus indicating a good correlation. The partition coefficients were modeled by using the same thermodynamic approach. Predicted and experimental partition coefficients correlated quite successfully. Mean deviations were found to be lower than the experimental uncertainty for most of the assayed proteins.
A new insight about pharmaceutical dosage forms for benzathine penicillin G
Directory of Open Access Journals (Sweden)
K. G. Holanda e Silva
2009-01-01
Full Text Available
In this work, a micellar system of benzathine penicillin G (BPG in sodium deoxycholate (NaDC was developed and evaluated physicochemically. The solubility profile of the drug in water and buffer solutions at various pH was determined, as well as its n-octanol/water partition coefficient. The Critical Micellar Concentration of NaDC and its ability to incorporate BPG were also assessed. The study was carried out at low and high ionic strength which was adjusted by the addition of sodium chloride. The results demonstrated the ability of the micellar system to incorporate BPG, as well as to increase its apparent solubility in water. The enhancement of the solubility of BPG by the presence of NaDC micelles could be analyzed quantitatively within the framework of the pseudo-phase model. Concentration analysis showed that the micellar system could attain up to 90% incorporation of BPG. The incorporated drug is expected to exhibit improved stability, since the antibiotic enclosed in the hydrophobic core of micelles is rather shielded from the aqueous external environment. Keywords: Benzathine Penicillin G; micellar solubilization; micelles; pre-formulation; sodium deoxycholate.
Tian, Ye; Mao, Shirui
2012-06-01
Many amphiphilic copolymers have recently been synthesized as novel promising micellar carriers for the delivery of poorly water-soluble anticancer drugs. Studies on the formulation and oral delivery of such micelles have demonstrated their efficacy in enhancing drug uptake and absorption, and exhibit prolonged circulation time in vitro and in vivo. In this review, literature on hydrophobic modifications of several hydrophilic polymers, including polyethylene glycol, chitosan, hyaluronic acid, pluronic and tocopheryl polyethylene glycol succinate, is summarized. Parameters influencing the properties of polymeric micelles for oral chemotherapy are discussed and strategies to overcome main barriers for polymeric micelles peroral absorption are proposed. During the design of polymeric micelles for peroral chemotherapy, selecting or synthesizing copolymers with good compatibility with the drug is an effective strategy to increase drug loading and encapsulation efficiency. Stability of the micelles can be improved in different ways. It is recommended to take permeability, mucoadhesion, sustained release, and P-glycoprotein inhibition into consideration during copolymer preparation or to consider adding some excipients in the formulation. Furthermore, both the copolymer structure and drug loading methods should be controlled in order to get micelles with appropriate particle size for better absorption.
Energy Technology Data Exchange (ETDEWEB)
Huang, Lei; Fang, Hongwei; Xu, Xingya; He, Guojian; Zhang, Xuesong; Reible, Danny
2017-08-01
Phosphorus (P) fate and transport plays a crucial role in the ecology of rivers and reservoirs in which eutrophication is limited by P. A key uncertainty in models used to help manage P in such systems is the partitioning of P to suspended and bed sediments. By analyzing data from field and laboratory experiments, we stochastically characterize the variability of the partition coefficient (Kd) and derive spatio-temporal solutions for P transport in the Three Gorges Reservoir (TGR). We formulate a set of stochastic partial different equations (SPDEs) to simulate P transport by randomly sampling Kd from the measured distributions, to obtain statistical descriptions of the P concentration and retention in the TGR. The correspondence between predicted and observed P concentrations and P retention in the TGR combined with the ability to effectively characterize uncertainty suggests that a model that incorporates the observed variability can better describe P dynamics and more effectively serve as a tool for P management in the system. This study highlights the importance of considering parametric uncertainty in estimating uncertainty/variability associated with simulated P transport.
CTAB/water/chloroform reverse micelles: a closed or open association model?
Czech Academy of Sciences Publication Activity Database
Klíčová, L.; Šebej, P.; Štacko, P.; Filippov, Sergey K.; Bogomolova, Anna; Padilla, M.; Klán, P.
2012-01-01
Roč. 28, č. 43 (2012), s. 15185-15192 ISSN 0743-7463 R&D Projects: GA ČR GAP108/12/0640 Institutional support: RVO:61389013 Keywords : CTAB * reverse micelles * AFM Subject RIV: CD - Macromolecular Chemistry Impact factor: 4.187, year: 2012
Pluronic®-bile salt mixed micelles.
Patel, Vijay; Ray, Debes; Bahadur, Anita; Ma, Junhe; Aswal, V K; Bahadur, Pratap
2018-06-01
The present study was aimed to examine the interaction of two bile salts viz. sodium cholate (NaC) and sodium deoxycholate (NaDC) with three ethylene polyoxide-polypropylene polyoxide (PEO-PPO-PEO) triblock copolymers with similar PPO but varying PEO micelles with a focus on the effect of pH on mixed micelles. Mixed micelles of moderately hydrophobic Pluronic ® P123 were examined in the presence of two bile salts and compared with those from very hydrophobic L121 and very hydrophilic F127. Both the bile salts increase the cloud point (CP) of copolymer solution and decreased apparent micelle hydrodynamic diameter (D h ). SANS study revealed that P123 forms small spherical micelles showing a decrease in size on progressive addition of bile salts. The negatively charged mixed micelles contained fewer P123 molecules but progressively rich in bile salt. NaDC being more hydrophobic displays more pronounced effect than NaC. Interestingly, NaC shows micellar growth in acidic media which has been attributed to the formation of bile acids by protonation of carboxylate ion and subsequent solubilization. In contrast, NaDC showed phase separation at higher concentration. Nuclear Overhauser effect spectroscopy (NOESY) experiments provided information on interaction and location of bile salts in micelles. Results are discussed in terms of hydrophobicity of bile salts and Pluronics ® and the site of bile salt in polymer micelles. Proposed molecular interactions are useful to understand more about bile salts which play important role in physiological processes. Copyright © 2018 Elsevier B.V. All rights reserved.
Extraction of cobalt ion using reverse-micelle of F-AOT in liquid/supercritical CO{sub 2}
Energy Technology Data Exchange (ETDEWEB)
Ko, M. S.; Jin, Y. W.; Kim, J. R.; Park, K. H.; Kim, H. D.; Kim, H. W. [Kyunghee Univ., Youngin (Korea, Republic of)
2002-05-01
A green decontamination method using CO{sub 2} as an environmentally benign solvent has been studied for removal of contaminant in the nuclear power plant. We developed a decontamination technique using CO{sub 2} for removal of contamination in working dresses. Owing to the low solubilizing, A reverse micelle system was developed. Fluorinated AOT was synthesized and used as surfactants forming reverse-micelle with water. Cobalt was extracted by dissolution into reverse-micelle in liquid CO{sub 2}. If this decontamination technique is applied to nuclear industry, the secondary waste during decontamination will be reverentially reduced. Negligibly small amount of water is a net waste, while the surfactants and solvent CO{sub 2} are recovered and reused in the system.
Cai, Zhixiong; Zhang, Da; Lin, Xinyi; Chen, Yunzhu; Wu, Ming; Wei, Zuwu; Zhang, Zhenxi; Liu, Xiaolong; Yao, Cuiping
2017-10-01
Nanoplatform integrated with photothermal therapy (PTT) and chemotherapy has been recognized a promising agent for enhancing cancer therapeutic outcomes, but still suffer from less controllability for optimizing their synergistic effects. We fabricated glutathione (GSH) responsive micelles incorporated with semiconducting polymer dots and doxorubicin (referred as SPDOX NPs) for combining PTT with chemotherapy to enhance cancer therapeutic efficiency. These micelles, with excellent water dispersibility, comprises of three distinct functional components: (1) the monomethoxy-poly(ethylene glycol)-S-S-hexadecyl (mPEG-S-S-C16), which forms the micelles, can render hydrophobic substances water-soluble and improve the colloidal stability; (2) disulfide linkages can be cleaved in a reductive environment for tumor specific drug release due to the high GSH concentrations of tumor micro-environment; (3) PCPDTBT dots and anti-cancer drug DOX that are loaded inside the hydrophobic core of the micelle can be applied to simultaneously perform PTT and chemotherapy to achieve significantly enhanced tumor killing efficiency both in vitro and in vivo. In summary, our studies demonstrated that our SPDOX NPs with simultaneous photothermal-chemotherapy functions could be a promising platform for a tumor specific responsive drug delivery system.
Y-shaped Folic Acid-Conjugated PEG-PCL Copolymeric Micelles for Delivery of Curcumin.
Feng, Runliang; Zhu, Wenxia; Chu, Wei; Teng, Fangfang; Meng, Ning; Deng, Peizong; Song, Zhimei
2017-01-01
Curcumin is a natural hydrophobic product showing anticancer activity. Many studies show its potential use in the field of cancer treatment due to its safety and efficiency. However, its application is limited due to its low water-solubility and poor selective delivery to cancer. A Y-shaped folic acid-modified poly (ethylene glycol)-b-poly (ε-caprolactone)2 copolymer was prepared to improve curcumin solubility and realize its selective delivery to cancer. The copolymer was synthesized through selective acylation reaction of folic acid with α- monoamino poly(ethylene glycol)-b-poly(ε-caprolactone)2. Curcumin was encapsulated into the copolymeric micelles with 93.71% of encapsulation efficiency and 11.94 % of loading capacity. The results from confocal microscopy and cellular uptake tests showed that folic acid-modified copolymeric micelles could improve cellular uptake of curcumin in Hela and HepG2 cells compared with folic acid-unmodified micelles. In vitro cytotoxicity assay showed that folic acid-modified micelles improved anticancer activity against Hela and HepG2 cells in comparison to folic acidunmodified micelles. Meanwhile, both drug-loaded micelles demonstrated higher activity against Hela cell lines than HepG2. The research results suggested that the folic acid-modified Y-shaped copolymeric micelles should be used to enhance hydrophobic anticancer drugs' solubility and their specific delivery to folic acid receptors-overexpressed cancer. Copyright© Bentham Science Publishers; For any queries, please email at epub@benthamscience.org.
Fluxpart: Open source software for partitioning carbon dioxide and water vapor fluxes
The eddy covariance method is regularly used for measuring gas fluxes over agricultural fields and natural ecosystems. For many applications, it is desirable to partition the measured fluxes into constitutive components: the water vapor flux into transpiration and direct evaporation components, and ...
Wang, Qingzhi; Zhao, Hongxia; Wang, Yan; Xie, Qing; Chen, Jingwen; Quan, Xie
2017-11-01
Organophosphate flame retardants (OPFRs) have attracted wide concerns due to their toxicities and ubiquitous occurrence in the environment. In this work, Octanol-air partition coefficient (K OA ) for 14 OPFRs including 4 halogenated alkyl-, 5 aryl- and 5 alkyl-OPFRs, were estimated as a function of temperature using a gas chromatographic retention time (GC-RT) method. Their log K OA-GC values and internal energies of phase transfer (Δ OA U/kJmol -1 ) ranged from 8.03 to 13.0 and from 69.7 to 149, respectively. Substitution pattern and molar volume (V M ) were found to be capable of influencing log K OA-GC values of OPFRs. The halogenated alkyl-OPFRs had higher log K OA-GC values than aryl- or alkyl-OPFRs. The bigger the molar volume was, the greater the log K OA-GC values increased. In addition, a predicted model of log K OA-GC versus different relative retention times (RRTs) was developed with a high cross-validated value (Q 2 (cum) ) of 0.951, indicating a good predictive ability and stability. Therefore, the log K OA-GC values of the remaining OPFRs can be predicted by using their RRTs on different GC columns. Copyright © 2017 Elsevier Inc. All rights reserved.
Determination of uranium partition coefficients of a semi-arid soil in Bahia
International Nuclear Information System (INIS)
Fernandes, Heloisa H.F.; Pontedeiro, Elizabeth M.; Su, Jian
2013-01-01
In mining and processing industries, the subsurface is one of the most vulnerable compartments to environmental contamination. Understanding the interactions between soil and contaminants is critical for predicting the possible environmental impacts caused by mining and milling operations. One of the main parameters used for this purpose is the partition (or distribution) coefficient, K d , which allows a relatively simple modeling approach by grouping various sorption phenomena into a single value. However, this parameter is strongly influenced by the physical and chemical characteristics of the medium, such as soil type, pH and solution composition. Thus, this study aims to assess the values of K d for uranium of typical soils from Bahia's semi-arid region using two different types of solute, one being a standard solution of uranyl acetate and one the liquor of uranium generated during processing. To calculate this parameter, batch adsorption experiments were carried out and adsorption isotherms (linear, Langmuir and Freundlich) were constructed using the Mathematica software. Results obtained for a single type of soil showed reduced values of K d for a liquor containing uranium when compared to values obtained with the uranyl acetate solution. This indicates that uranium from liquor is less adsorbed onto soil particles, and hence may move more quickly into the subsurface. (author)
Energy Technology Data Exchange (ETDEWEB)
Yu, Hailong; Li, Ji; Shi, Ke; Huang, Qingrong (Rutgers)
2015-10-15
The micelle structure of octenyl succinic anhydride modified {var_epsilon}-polylysine (M-EPL), an anti-microbial surfactant prepared from natural peptide {var_epsilon}-polylysine in aqueous solution has been studied using synchrotron small-angle X-ray scattering (SAXS). Our results revealed that M-EPLs formed spherical micelles with individual size of 24-26 {angstrom} in aqueous solution which could further aggregate to form a larger dimension with averaged radius of 268-308 {angstrom}. Furthermore, M-EPL micelle was able to encapsulate curcuminoids, a group of poorly-soluble bioactive compounds from turmeric with poor oral bioavailability, and improve their water solubility. Three loading methods, including solvent evaporation, dialysis, and high-speed homogenization were compared. The results indicated that the dialysis method generated the highest loading capacity and curcuminoids water solubility. The micelle encapsulation was confirmed as there were no free curcuminoid crystals detected in the differential scanning calorimetry analysis. It was also demonstrated that M-EPL encapsulation stabilized curcuminoids against hydrolysis at pH 7.4 and the encapsulated curcuminoids showed elevated cellular antioxidant activity compared with free curcuminoids. This work suggested that M-EPL could be used as new biopolymer micelles for delivering poorly soluble drugs/phytochemicals and improving their bioactivities.
Ha, Yeonjeong; Kwon, Jung-Hwan
2010-04-15
Exact determination of the partition coefficient between 1-octanol and air (K(OA)) is very important because it is a key descriptor for describing the thermodynamic partitioning between the air and organic phases. In spite of its importance, the number and quality of experimental K(OA) values for hydrophobic organic chemicals are limited because of experimental difficulties. Thus, to measure K(OA) values, a high-throughput method was developed that used liquid-phase extraction with 1-octanol drop at the tip of a microsyringe needle. The concentration in the headspace surrounding the 1 muL octanol drop was equilibrated with liquid octanol containing polycyclic aromatic hydrocarbons (PAHs). The change in concentrations of PAHs in the octanol drop was measured to obtain mass transfer rate constants, and these rate constants were then converted into K(OA) values using a film diffusion model. Thirteen polycyclic aromatic hydrocarbons with log K(OA) between 5 and 12 were chosen for the proof of the principle. Experimental determination of log K(OA) was accomplished in 30 h for PAHs with their log K(OA) less than 11. The measured log K(OA) values were very close to those obtained by various experimental and estimation methods in the literature, suggesting that this new method can provide a fast and easy determination of log K(OA) values for many chemicals of environmental interests. In addition, the applicability of the method can be extended to determine Henry's law constant for compounds with low vapor pressure and to estimate gaseous transfer rate of semivolatile compounds for environmental fate modeling.
Krauss, M; Wilcke, W
2001-06-01
We evaluated a method to determine organic carbon-normalized soil-water partition coefficients (Koc) of 20 PAHs and 12 PCBs by desorption in the presence of a cosolvent (methanol fractions of 0.1-0.9) and at different temperatures (20-80 degrees C). The Koc values, the deviation factor from ideal sorption alpha, and the desorption enthalpies delta Hdes were estimated by nonlinear regression of log Koc on the methanol fractions and on T. The Koc values of individual compounds varied up to a factor of 100 among the studied 11 urban soils. The calculated alpha and delta Hdes of individual compounds varied considerably among the soils (coefficients of variation 5-20% and 20-30%, respectively), alpha increased with increasing hydrophobicity of the compounds. A sequential extraction with four temperature/methanol fraction combinations followed by a nonlinear regression allowed for the direct determination of the Koc, alpha, and delta Hdes. The use of less temperature/methanol fraction combinations requires a suitable estimation of alpha and delta Hdes, as their choice may change the obtained Koc values by up to a factor of 10. The proposed method is suitable for a routine determination of Koc values of PAHs and PCBs for small soil samples (2-6 g) and low concentrations (down to 0.3 mg kg-1 of sigma 20 PAHs and 1.2 micrograms kg-1 of sigma 12 PCBs).
Energy Technology Data Exchange (ETDEWEB)
Cooke, Cindy M.; Shaw, George; Lester, John N.; Collins, Chris D
2004-08-15
Two groups of chemicals are currently licensed for use in sheep dip products in the UK. These are organophosphate (OP) insecticides and synthetic pyrethroid (SP) insecticides. SPs are deemed to be less toxic to human health than OPs, although they are approximately 100 times more toxic to some elements of the aquatic environment. Three insecticides were selected for experimental investigation: diazinon, propetamphos (OPs) and cis-permethrin (SP), representative of the active ingredients used in sheep dip formulations, with additional uses in insect control in crops, and for domestic control of flies, mosquitoes, cockroaches, lice, ticks and spiders. The UK Government has recently reviewed agricultural practices relating to the disposal of used sheep dip, because the constituent insecticides are frequently detected in UK watercourses and the presence of these compounds is a severe hazard to the aquatic environment. Standard batch sorption experiments were carried out to investigate insecticide partitioning from water to soil, and the relationship between sorption and soil organic carbon content is discussed. Sorption isotherms and K{sub d} values showed that cis-permethrin adsorption was fastest on all five soils investigated, exhibiting the greatest total partitioning to the soil phase (83.8-94.8%) and high resistance to desorption. In comparison, the OP insecticides exhibited moderately strong soil adsorption as evidenced by their K{sub d} coefficients (diazinon K{sub d} 12-35 and propetamphos K{sub d} 9-60), with low sorption reversibility (<15%). Calculation of a hydrological retardation factor in a scenario representative of a typical UK environment suggested that SP insecticides such as cis-permethrin will not migrate in the soil profile due to their virtual immobility and strong soil retention, and thus waste sheep dip disposal to agricultural land should not pose a risk to aquatic life if applied with appropriate controls.
International Nuclear Information System (INIS)
Domańska, Urszula; Lukoshko, Elena Vadimovna
2014-01-01
Highlights: • Measurements of activity coefficients at infinite dilution using GLC. • Sixty one organic solvents in the ionic liquid 1-butyl-1-methylmorpholinium tricyanomethanide. • High selectivity for heptane/thiophene, or pyridine, or 1-nitropropane. • The excess thermodynamic functions and the gas–liquid partition coefficients were presented. • Possible entrainer for the extraction of sulphur and nitrogen-compounds from alkanes. -- Abstract: The activity coefficients at infinite dilution, γ 13 ∞ , for 61 solutes, including alkanes, cycloalkanes, alkenes, alkynes, aromatic hydrocarbons, alcohols, water, thiophene, ethers, ketones, esters, aldehyde, acetonitrile, pyridine and 1-nitropropane in the ionic liquid (IL) 1-butyl-1-methylmorpholinium tricyanomethanide, [BMMOR][TCM] were determined by gas–liquid chromatography at six temperatures within the range of (318.15 to 368.15) K. The thermodynamic functions at infinite dilution as partial molar excess Gibbs free energy ΔG 1 E,∞ , enthalpy ΔH 1 E,∞ , and entropy term T ref ΔS 1 E,∞ were calculated from the experimental γ 13 ∞ values obtained over the temperature range. The density of [BMMOR][TCM] was measured over the temperature range (288.15 to 368.15) K. The gas–liquid partition coefficient K L was calculated for all solutes. The values of selectivity and capacity for a few separation problems such as hexane/benzene, cyclohexane/benzene, heptane/thiophene at T = 328.15 K were calculated from γ 13 ∞ and compared to literature values for similar ionic liquids, viz. N-methyl-2-pyrrolidinone (NMP), and sulfolane. In comparison with the previously measured values for [BMPYR][TCM], the morpholinium IL presents high selectivity for the separation of aromatic hydrocarbons from aliphatic hydrocarbons, and especially thiophene, or piridine from heptane with a slightly lower capacity. New data show that [BMMOR][TCM] IL may be proposed as an alternative solvent for the separation of
Casein micelle structure: a concise review
Directory of Open Access Journals (Sweden)
Chanokphat Phadungath
2005-01-01
Full Text Available Milk is a complex biological fluid with high amount of proteins, lipid and minerals. The function of milk is to supply nutrients such as essential amino acids required for the growth of the newborn. In addition, due to the importance of casein and casein micelles for the functional behavior of dairy products, the nature and structure of casein micelles have been studied extensively. However, the exact structure of casein micelles is still under debate. Various models for casein micelle structure have been proposed. Most of the proposedmodels fall into three general categories, which are: coat-core, subunit (sub-micelles, and internal structure models. The coat-core models, proposed by Waugh and Nobel in 1965, Payens in 1966, Parry and Carroll in 1969, and Paquin and co-workers in 1987, describe the micelle as an aggregate of caseins with outer layer differing in composition form the interior, and the structure of the inner part is not accurately identified. The sub-micelle models, proposed by Morr in 1967, Slattery and Evard in 1973, Schmidt in 1980, Walstra in1984, and Ono and Obata in 1989, is considered to be composed of roughly spherical uniform subunits. The last models, the internal structure models, which were proposed by Rose in 1969, Garnier and Ribadeau- Dumas in 1970, Holt in 1992, and Horne in 1998, specify the mode of aggregation of the different caseins.
Aqueous-gas phase partitioning and hydrolysis of organic iodides
International Nuclear Information System (INIS)
Glowa, G.A.; Wren, J.C.
2003-01-01
The volatility and decomposition of organic iodides in a reactor containment building are important parameters to consider when assessing the potential consequences of a nuclear reactor accident. However, there are few experimental data available for the volatilities (often reported as partition coefficients) or few rate constants regarding the decomposition (via hydrolysis) of organic iodides. The partition coefficients and hydrolysis rate constants of eight organic iodides, having a range of molecular structures, have been measured in the current studies. This data, and data accumulated in the literature, have been reviewed and discussed to provide guidelines for appropriate organization of organic iodides for the purpose of modelling iodine behaviour under postulated nuclear reactor accident conditions. After assessment of the partition coefficients and their temperature dependences of many classes of organic compounds, it was found that organic iodides could be divided into two categories based upon their volatility relative to molecular iodine. Similarly, hydrolysis rates and their temperature dependences are assigned to the two categories of organic iodides. (author)
Stang, Christoph; Bakanov, Nikita; Schulz, Ralf
2016-01-01
Knowledge on the dynamics and the durability of the processes governing the mitigation of pesticide loads by aquatic vegetation in vegetated streams, which are characterized by dynamic discharge regimes and short chemical residence times, is scarce. In a static long-term experiment (48 h), the dissipation of five pesticides from the aqueous phase followed a biphasic pattern in the presence of aquatic macrophytes. A dynamic concentration decrease driven by sorption to the macrophytes ranged from 8.3 to 60.4% for isoproturon and bifenox, respectively, within the first 2 h of exposure. While the aqueous concentrations of imidacloprid, isoproturon, and tebufenozide remained constant thereafter, the continuous but decelerated concentration decrease of difenoconazole and bifenox in the water-macrophyte systems used here was assumed to be attributed to macrophyte-induced degradation processes. In addition, a semi-static short-term experiment was conducted, where macrophytes were transferred to uncontaminated medium after 2 h of exposure to simulate a transient pesticide peak. In the first part of the experiment, adsorption to macrophytes resulted in partitioning coefficients (logK D_Adsorp) ranging from 0.2 for imidacloprid to 2.2 for bifenox. One hour after the macrophytes were transferred to the uncontaminated medium, desorption of the compounds from the macrophytes resulted in a new phase equilibrium and K D_Desorp values of 1.46 for difenoconazole and 1.95 for bifenox were determined. A correlation analysis revealed the best match between the compound affinity to adsorb to macrophytes (expressed as K D_Adsorp) and their soil organic carbon-water partitioning coefficient (K OC) compared to their octanol-water partitioning coefficient (K OW) or a mathematically derived partitioning coefficient.
New thiol-responsive mono-cleavable block copolymer micelles labeled with single disulfides.
Sourkohi, Behnoush Khorsand; Schmidt, Rolf; Oh, Jung Kwon
2011-10-18
Thiol-responsive symmetric triblock copolymers having single disulfide linkages in the middle blocks (called mono-cleavable block copolymers, ss-ABP(2)) were synthesized by atom transfer radical polymerization in the presence of a disulfide-labeled difunctional Br-initiator. These brush-like triblock copolymers consist of a hydrophobic polyacrylate block having pendent oligo(propylene oxide) and a hydrophilic polymethacrylate block having pendent oligo(ethylene oxide). Gel permeation chromatography and (1)H NMR results confirmed the synthesis of well-defined mono-cleavable block copolymers and revealed that polymerizations were well controlled. Because of amphiphilic nature, these copolymers self-assembled to form colloidally stable micelles above critical micellar concentration of 0.032 mg · mL(-1). In response to reductive reactions, disulfides in thiol-responsive micelles were cleaved. Atomic force microscopy and dynamic light scattering analysis suggested that the cleavage of disulfides caused dissociation of micelles to smaller-sized assembled structures in water. Moreover, in a biomedical perspective, the mono-cleavable block copolymer micelles are not cytotoxic and thus biocompatible. Copyright © 2011 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.
Biomass partitioning and root morphology of savanna trees across a water gradient
Tomlinson, K.W.; Sterck, F.J.; Bongers, F.; Silva, da D.A.; Barbosa, E.R.; Ward, D.; Bakker, F.T.; Kaauwen, van M.P.W.; Prins, H.H.T.; Bie, de S.; Langevelde, van F.
2012-01-01
1. Plant organ biomass partitioning has been hypothesized to be driven by resources, such that species from drier environments allocate more biomass to roots than species from wetter environments to access water at greater soil depths. In savanna systems, fire may select for greater allocation to
International Nuclear Information System (INIS)
Domanska, Urszula; Krolikowska, Marta; Acree, William E.; Baker, Gary A.
2011-01-01
Research highlights: → Measurements of activity coefficients at infinite dilution using GLC. → 36 organic solvents and water in the ionic liquid 1-ethyl-3-methylimidazolium tetracyanoborate, [EMIM][TCB]. → Possible entrainer for different separation processes. → The partial molar excess thermodynamic functions at infinite dilution were calculated. - Abstract: The activity coefficients at infinite dilution, γ 13 ∞ , for 36 solutes, including alkanes, cycloalkanes, alkenes, alkynes, aromatic hydrocarbons, alcohols, thiophene, tetrahydrofuran, ethers, acetone, and water, in the ionic liquid 1-ethyl-3-methylimidazolium tetracyanoborate, [EMIM][TCB], were determined by gas-liquid chromatography at temperatures from 298.15 K to 358.15 K. These values are compared to those previously published for selected solutes in the same ionic liquid. The values of the partial molar excess Gibbs free energy ΔG 1 E,∞ , enthalpy ΔH 1 E,∞ , and entropy ΔS 1 E,∞ at infinite dilution were calculated from the experimental γ 13 ∞ values obtained over the temperature range. Three gas-liquid partition coefficients, K L were calculated for all solutes and the Abraham solvation parameter model is discussed. The values of the selectivity for different separation problems were calculated from γ 13 ∞ and compared to literature values for N-methyl-2-pyrrolidinone (NMP), sulfolane, 1-decyl-3-methylimidazolium tetracyanoborate, [DMIM][TCB], and additional ionic liquids.
Quade, M. E.; Brueggemann, N.; Graf, A.; Rothfuss, Y.
2017-12-01
Water stable isotopes are powerful tools for partitioning net into raw water fluxes such as evapotranspiration (ET) into soil evaporation (E) and plant transpiration (T). The isotopic methodology for ET partitioning is based on the fact that E and T have distinct water stable isotopic compositions, which in turn relies on the fact that each flux is differently affected by isotopic kinetic effects. An important work to be performed in parallel to field measurements is to better characterize these kinetic effects in the laboratory under controlled conditions. A soil evaporation laboratory experiment was conducted to retrieve characteristic values of the kinetic fractionation factor (αK) under varying soil and atmospheric water conditions. For this we used a combined soil and atmosphere column to monitor the soil and atmospheric water isotopic composition profiles at a high temporal and vertical resolution in a nondestructive manner by combining micro-porous membranes and laser spectroscopy. αK was calculated by using a well-known isotopic evaporation model in an inverse mode with the isotopic composition of E as one input variable, which was determined using a micro-Keeling regression plot. Knowledge on αK was further used in the field (Selhausen, North Rhine-Westphalia, Germany) to partition ET of catch crops and sugar beet (Beta vulgaris) during one growing season. Soil and atmospheric water isotopic profiles were measured automatically across depths and heights following a similar modus operandi as in the laboratory experiment. Additionally, a newly developed continuously moving elevator was used to obtain water vapor isotopic composition profiles with a high vertical resolution between soil surface, plant canopy and atmosphere. Finally, soil and plant samples were collected destructively to provide a comparison with the traditional isotopic methods. Our results illustrate the changing proportions of T and E along the growing season and demonstrate the
Although tree- and stand-level estimates of forest water use are increasingly common, relatively little is known about partitioning of soil water resources among co-occurring tree species. We studied seasonal courses of soil water utilization in a 450-year-old Pseudotsuga menzies...
Chua, Kee Sze; Koh, Ai Peng; Lam, Yeng Ming
2010-11-01
Block copolymers are useful for in situ synthesis of nanoparticles as well as producing nanoporous templates. As such, the effects of precursors on the block copolymer micelle structure is important. In this study, we investigate the effects of polarity of molecules introduced into block copolymer micelle cores on the micelle structure. The molecular dipole moment of the additive molecules has been evaluated and their effects on the block copolymer micelles investigated using light scattering spectroscopy, small-angle X-ray scattering, transmission electron microscopy and atomic force microscopy. The molecule with the largest dipole moment resulted in spherical structures with a polydispersity of less than 0.06 in a fully translational diffusion system. Surprisingly, the less polar additive molecules produced elongated micelles and the aspect ratio increases with decreasing polarity. The change in structure from spherical to elongated structure was attributed to P4VP chain extension, where compounds with polarity most similar to P4VP induce the most chain extension. The second virial coefficients of the solutions with elongated micelles are lower than that for spherical micelle systems by up to one order in magnitude, indicating a strong tendency for micelles to coalesce. On rinsing the spin-cast films, pores were obtained from spherical micelles and ridges from elongated micelles, suggesting a viable alternative for morphology modification using mild conditions where external annealing treatments to the film are not preferred. The knowledge of polarity effects of additive molecules on micelle structure has wider implications for supramolecular block copolymer systems where, depending on the application requirements, changes to the shape of the micelle structure can be induced or avoided. Copyright 2010 Elsevier Inc. All rights reserved.
Cavallaro, Gennara; Maniscalco, Laura; Licciardi, Mariano; Giammona, Gaetano
2004-11-20
Several samples of polymeric micelles, formed by amphiphilic derivatives of PHEA, obtained by grafting into polymeric backbone of PEGs and/or hexadecylamine groups (PHEA-PEG-C(16) and PHEA-C(16)) and containing different amount of Tamoxifen, were prepared. All Tamoxifen-loaded polymeric micelles showed to increase drug water solubility. TEM studies provided evidence of the formation of supramolecular core/shell architectures containing drug, in the nanoscopic range and with spherical shape. Samples with different amount of encapsulated Tamoxifen were subjected to in vitro cytotoxic studies in order to evaluate the effect of Tamoxifen micellization on cell growth inhibition. All samples of Tamoxifen-loaded polymeric micelles showed a significantly higher antiproliferative activity in comparison with free drug, probably attributable to fluidification of cellular membranes, caused by amphiphilic copolymers, that allows a higher penetration of the drug into tumoral cells. To gain preliminary information about the potential use of prepared micelles as Tamoxifen drug delivery systems, studies evaluating drug release ability of micelle systems in media mimicking biological fluids (buffer solutions at pH 7.4 and 5.5) and in human plasma were carried out. These studies, performed evaluating the amount of Tamoxifen that remains in solution as a function of time, showed that at pH 7.4, as well as in plasma, PHEA-C(16) polymeric micelles were able to release lower drug amounts than PHEA-PEG(5000)-C(16) ones, while at pH 5.5, the behavior difference between two kind of micelles was less pronounced.
Enzymatic reactions in reversed micelles
Hilhorst, M.H.
1984-01-01
It has been recognised that enzymes in reversed micelles have potential for application in chemical synthesis. Before these expectations will be realised many problems must be overcome. This thesis deals with some of them.
In Chapter 1 the present knowledge about reversed micelles and
Superfluid Kubo formulas from partition function
International Nuclear Information System (INIS)
Chapman, Shira; Hoyos, Carlos; Oz, Yaron
2014-01-01
Linear response theory relates hydrodynamic transport coefficients to equilibrium retarded correlation functions of the stress-energy tensor and global symmetry currents in terms of Kubo formulas. Some of these transport coefficients are non-dissipative and affect the fluid dynamics at equilibrium. We present an algebraic framework for deriving Kubo formulas for such thermal transport coefficients by using the equilibrium partition function. We use the framework to derive Kubo formulas for all such transport coefficients of superfluids, as well as to rederive Kubo formulas for various normal fluid systems
Kavner, A.
2017-12-01
In a multicomponent multiphase geochemical system undergoing a chemical reaction such as precipitation and/or dissolution, the partitioning of species between phases is determined by a combination of thermodynamic properties and transport processes. The interpretation of the observed distribution of trace elements requires models integrating coupled chemistry and mechanical transport. Here, a framework is presented that predicts the kinetic effects on the distribution of species between two reacting phases. Based on a perturbation theory combining Navier-Stokes fluid flow and chemical reactivity, the framework predicts rate-dependent partition coefficients in a variety of different systems. We present the theoretical framework, with applications to two systems: 1. species- and isotope-dependent Soret diffusion of species in a multicomponent silicate melt subjected to a temperature gradient, and 2. Elemental partitioning and isotope fractionation during precipitation of a multicomponent solid from a multicomponent liquid phase. Predictions will be compared with results from experimental studies. The approach has applications for understanding chemical exchange in at boundary layers such as the Earth's surface magmatic systems and at the core/mantle boundary.
Chromatographic determination of the rate and extent of absorption of air pollutants by sea water
International Nuclear Information System (INIS)
Nikolakaki, S.; Vassilakos, C.; Katsanos, N.A.
1994-01-01
A simple chromatographic method is developed to determine the rate constant for expulsion of an air pollutant from water or its diffusion parameter in the liquid, the rate constant for chemical reaction of the pollutant with water, its mass transfer coefficient in the liquid, and the partition coefficient between liquid water and air. From these physicochemical parameters, the absorption rate by sea water and, therefore, the depletion rate of a polluting substance from the air can be calculated, together with the equilibrium state of this absorption. The method has been applied to nitrogen dioxide being absorbed by triple-distilled water and by sea water, at various temperatures. From the temperature variation of the reaction rate constant and of the partition coefficient, the activation energy for the reaction and the differential heat of solution were determined. (orig.)
Simpson, Stuart L; Batley, Graeme E
2003-02-01
Metal partitioning is altered when suboxic estuarine sediments containing Fe(II)-rich pore waters are disturbed during collection, preparation, and toxicity testing. Experiments with model Fe(II)-rich pore waters demonstrated the rates at which adsorptive losses of Cd, Cu, Ni, Mn, Pb, and Zn occur upon exposure to air. Experiments with Zn-contaminated estuarine sediments demonstrated large and often unpredictable changes to metal partitioning during sediment storage, removal of organisms, and homogenization before testing. Small modifications to conditions, such as aeration of overlying waters, caused large changes to the metal partitioning. Disturbances caused by sediment collection required many weeks for reestablishment of equilibrium. Bioturbation by benthic organisms led to oxidation of pore-water Fe(II) and lower Zn fluxes because of the formation of Fe hydroxide precipitates that adsorb pore-water Zn. For five weeks after the addition of organisms to sediments, Zn fluxes increased slowly as the organisms established themselves in the sediments, indicating that the establishment of equilibrium was not rapid. The results are discussed in terms of the dynamic nature of suboxic, Fe(II)-rich estuarine sediments, how organisms perturb their environment, and the importance of understanding chemistry in toxicity testing with whole sediments or pore water. Recommendations are provided for the handling of sediments for toxicity testing.
Withers, Philip C; Cooper, Christine E; Nespolo, Roberto F
2012-08-15
We examine here evaporative water loss, economy and partitioning at ambient temperatures from 14 to 33°C for the monito del monte (Dromiciops gliroides), a microbiotheriid marsupial found only in temperate rainforests of Chile. The monito's standard evaporative water loss (2.58 mg g(-1) h(-1) at 30°C) was typical for a marsupial of its body mass and phylogenetic position. Evaporative water loss was independent of air temperature below thermoneutrality, but enhanced evaporative water loss and hyperthermia were the primary thermal responses above the thermoneutral zone. Non-invasive partitioning of total evaporative water loss indicated that respiratory loss accounted for 59-77% of the total, with no change in respiratory loss with ambient temperature, but a small change in cutaneous loss below thermoneutrality and an increase in cutaneous loss in and above thermoneutrality. Relative water economy (metabolic water production/evaporative water loss) increased at low ambient temperatures, with a point of relative water economy of 15.4°C. Thermolability had little effect on relative water economy, but conferred substantial energy savings at low ambient temperatures. Torpor reduced total evaporative water loss to as little as 21% of normothermic values, but relative water economy during torpor was poor even at low ambient temperatures because of the relatively greater reduction in metabolic water production than in evaporative water loss. The poor water economy of the monito during torpor suggests that negative water balance may explain why hibernators periodically arouse to normothermia, to obtain water by drinking or via an improved water economy.
Regional water coefficients for U.S. industrial sectors
Riccardo Boero; Donatella Pasqualini
2017-01-01
Designing policies for water systems management requires the capability to assess the economic impacts of water availability and to effectively couple water withdrawals by human activities with natural hydrologic dynamics. At the core of any scientific approach to these issues there is the estimation of water withdrawals by industrial sectors in the form of water coefficients, which are measurements of the quantity of water withdrawn per dollar of GDP or output. In this work we focus on the c...
Good, Stephen P.; Soderberg, Keir; Guan, Kaiyu; King, Elizabeth G.; Scanlon, Todd M.; Caylor, Kelly K.
2014-02-01
The partitioning of surface vapor flux (FET) into evaporation (FE) and transpiration (FT) is theoretically possible because of distinct differences in end-member stable isotope composition. In this study, we combine high-frequency laser spectroscopy with eddy covariance techniques to critically evaluate isotope flux partitioning of FET over a grass field during a 15 day experiment. Following the application of a 30 mm water pulse, green grass coverage at the study site increased from 0 to 10% of ground surface area after 6 days and then began to senesce. Using isotope flux partitioning, transpiration increased as a fraction of total vapor flux from 0% to 40% during the green-up phase, after which this ratio decreased while exhibiting hysteresis with respect to green grass coverage. Daily daytime leaf-level gas exchange measurements compare well with daily isotope flux partitioning averages (RMSE = 0.0018 g m-2 s-1). Overall the average ratio of FT to FET was 29%, where uncertainties in Keeling plot intercepts and transpiration composition resulted in an average of uncertainty of ˜5% in our isotopic partitioning of FET. Flux-variance similarity partitioning was partially consistent with the isotope-based approach, with divergence occurring after rainfall and when the grass was stressed. Over the average diurnal cycle, local meteorological conditions, particularly net radiation and relative humidity, are shown to control partitioning. At longer time scales, green leaf area and available soil water control FT/FET. Finally, we demonstrate the feasibility of combining isotope flux partitioning and flux-variance similarity theory to estimate water use efficiency at the landscape scale.
Polymeric micelles for drug targeting.
Mahmud, Abdullah; Xiong, Xiao-Bing; Aliabadi, Hamidreza Montazeri; Lavasanifar, Afsaneh
2007-11-01
Polymeric micelles are nano-delivery systems formed through self-assembly of amphiphilic block copolymers in an aqueous environment. The nanoscopic dimension, stealth properties induced by the hydrophilic polymeric brush on the micellar surface, capacity for stabilized encapsulation of hydrophobic drugs offered by the hydrophobic and rigid micellar core, and finally a possibility for the chemical manipulation of the core/shell structure have made polymeric micelles one of the most promising carriers for drug targeting. To date, three generations of polymeric micellar delivery systems, i.e. polymeric micelles for passive, active and multifunctional drug targeting, have arisen from research efforts, with each subsequent generation displaying greater specificity for the diseased tissue and/or targeting efficiency. The present manuscript aims to review the research efforts made for the development of each generation and provide an assessment on the overall success of polymeric micellar delivery system in drug targeting. The emphasis is placed on the design and development of ligand modified, stimuli responsive and multifunctional polymeric micelles for drug targeting.
Digital Repository Service at National Institute of Oceanography (India)
Naik, S.S.; Naidu, P.D.
We assess the usefulness of the empirical boron partition coefficient, KD and B/Ca measured from planktonic foraminifera in estimation of pCO2 using three different relationships between KD and temperature derived...
International Nuclear Information System (INIS)
Zhang Peilu; Qi Zhanshun; Zhu Zhixuan
2000-01-01
Comparison of dry- and water-method for partitioning fission products and minor actinides from the spent fuels, and description of advance of dry-method were done. Partitioning process, some typical concept and some results of dry-method were described. The problems fond in dry-method up to now were pointed out. The partitioning study program was suggested
Maiti, Subhabrata; Das, Dibyendu; Shome, Anshupriya; Das, Prasanta Kumar
2010-02-08
Herein, we report the effect of gold nanoparticles (GNPs) in enhancing lipase activity in reverse micelles of cetyltrimethylammonium bromide (CTAB)/water/isooctane/n-hexanol. The size and concentration of the nanoparticles were varied and their specific roles were assessed in detail. An overall enhancement of activity was observed in the GNP-doped CTAB reverse micelles. The improvement in activity becomes more prominent with increasing concentration and size of the GNPs (0-52 microM and ca. 3-30 nm, respectively). The observed highest lipase activity (k(2)=1070+/-12 cm(3) g(-1) s(-1)) in GNP-doped CTAB reverse micelles ([GNP]: 52 microm, ca. 20 nm) is 2.5-fold higher than in CTAB reverse micelles without GNPs. Improvement in the lipase activity is only specific to the GNP-doped reverse micellar media, whereas GNP deactivates and structurally deforms the enzyme in aqueous media. The reason for this activation is probably due to the formation of larger-sized reverse micelles in which the GNP acts as a polar core and the surfactants aggregate around the nanoparticle ('GNP pool') instead of only water. Lipase at the augmented interface of the GNP-doped reverse micelle showed improved activity because of enhancement in both the substrate and enzyme concentrations and increased flexibility in the lipase conformation. The extent of the activation is greater in the case of the larger-sized GNPs. A correlation has been established between the activity of lipase and its secondary structure by using circular dichroism and FTIR spectroscopic analysis. The generalized influence of GNP is verified in the reverse micelles of another surfactant, namely, cetyltripropylammonium bromide (CTPAB). TEM, dynamic light scattering (DLS), and UV/Vis spectroscopic analysis were utilized to characterize the GNPs and the organized aggregates. For the first time, CTAB-based reverse micelles have been found to be an excellent host for lipase simply by doping with appropriately sized GNPs.
Caupos, Emilie
2014-10-04
Solid-phase microextraction (SPME) was used to determine the equilibrium association constant for a pesticide, trifluralin (TFR), with dissolved organic matter (DOM). After optimization of the SPME method for the analysis of TFR, partition coefficients (K DOM) with three different sources of DOM were determined in buffered solutions at pH 7. Commercial humic acids and DOM fractions isolated from two surface waters were used. The values of log K DOMvaried from 4.3 to 5.8, depending on the nature of the organic material. A good correlation was established between log K DOMand DOM properties (as measured with the H/O atomic ratio and UV absorbance), in agreement with literature data. This is consistent with the effect of polarity and aromaticity for governing DOM-pollutant associations, regardless of the origin of DOM. This association phenomenon is relevant to better understand the behavior of pesticides in the environment since it controls part of pesticide leaching and fate in aquatic systems.
Curcumin-Loaded Blood-Stable Polymeric Micelles for Enhancing Therapeutic Effect on Erythroleukemia.
Gong, Feirong; Chen, Dan; Teng, Xin; Ge, Junhua; Ning, Xianfeng; Shen, Ya-Ling; Li, Jian; Wang, Shanfeng
2017-08-07
Curcumin has high potential in suppressing many types of cancer and overcoming multidrug resistance in a multifaceted manner by targeting diverse molecular targets. However, the rather low systemic bioavailability resulted from its poor solubility in water and fast metabolism/excretion in vivo has hampered its applications in cancer therapy. To increase the aqueous solubility of curcumin while retaining the stability in blood circulation, here we report curcumin-loaded copolymer micelles with excellent in vitro and in vivo stability and antitumor efficacy. The two copolymers used for comparison were methoxy-poly(ethylene glycol)-block-poly(ε-caprolactone) (mPEG-PCL) and N-(tert-butoxycarbonyl)-l-phenylalanine end-capped mPEG-PCL (mPEG-PCL-Phe(Boc)). In vitro cytotoxicity evaluation against human pancreatic SW1990 cell line showed that the delivery of curcumin in mPEG-PCL-Phe(Boc) micelles to cancer cells was efficient and dosage-dependent. The pharmacokinetics in ICR mice indicated that intravenous (i.v.) administration of curcumin/mPEG-PCL-Phe(Boc) micelles could retain curcumin in plasma much better than curcumin/mPEG-PCL micelles. Biodistribution results in Sprague-Dawley rats also showed higher uptake and slower elimination of curcumin into liver, lung, kidney, and brain, and lower uptake into heart and spleen of mPEG-PCL-Phe(Boc) micelles, as compared with mPEG-PCL micelles. Further in vivo efficacy evaluation in multidrug-resistant human erythroleukemia K562/ADR xenograft model revealed that i.v. administration of curcumin-loaded mPEG-PCL-Phe(Boc) micelles significantly delayed tumor growth, which was attributed to the improved stability of curcumin in the bloodstream and increased systemic bioavailability. The mPEG-PCL-Phe(Boc) micellar system is promising in overcoming the key challenge of curcumin's to promote its applications in cancer therapy.
Determination of uranium partition coefficients of a semi-arid soil in Bahia
Energy Technology Data Exchange (ETDEWEB)
Fernandes, Heloisa H.F.; Pontedeiro, Elizabeth M.; Su, Jian, E-mail: heloisa@lasme.coppe.ufrj.br, E-mail: bettinadulley@hotmail.com, E-mail: sujian@lasme.coppe.ufrj.br [Coordenacao dos Cursos de Pos-Graduacao em Engenharia (COPPE/UFRJ), Rio de Janeiro, RJ (Brazil). Lab. de Simulacao e Metodos de Engenharia; Dourado, Eneida R.G., E-mail: eneida@inb.gov.br [Industrias Nucleares do Brasil (INB), Rio de Janeiro, RJ (Brazil)
2013-07-01
In mining and processing industries, the subsurface is one of the most vulnerable compartments to environmental contamination. Understanding the interactions between soil and contaminants is critical for predicting the possible environmental impacts caused by mining and milling operations. One of the main parameters used for this purpose is the partition (or distribution) coefficient, K{sub d}, which allows a relatively simple modeling approach by grouping various sorption phenomena into a single value. However, this parameter is strongly influenced by the physical and chemical characteristics of the medium, such as soil type, pH and solution composition. Thus, this study aims to assess the values of K{sub d} for uranium of typical soils from Bahia's semi-arid region using two different types of solute, one being a standard solution of uranyl acetate and one the liquor of uranium generated during processing. To calculate this parameter, batch adsorption experiments were carried out and adsorption isotherms (linear, Langmuir and Freundlich) were constructed using the Mathematica software. Results obtained for a single type of soil showed reduced values of K{sub d} for a liquor containing uranium when compared to values obtained with the uranyl acetate solution. This indicates that uranium from liquor is less adsorbed onto soil particles, and hence may move more quickly into the subsurface. (author)
Gill, Kanwaldeep K; Kaddoumi, Amal; Nazzal, Sami
2015-04-01
PEG-lipid micelles, primarily conjugates of polyethylene glycol (PEG) and distearyl phosphatidylethanolamine (DSPE) or PEG-DSPE, have emerged as promising drug-delivery carriers to address the shortcomings associated with new molecular entities with suboptimal biopharmaceutical attributes. The flexibility in PEG-DSPE design coupled with the simplicity of physical drug entrapment have distinguished PEG-lipid micelles as versatile and effective drug carriers for cancer therapy. They were shown to overcome several limitations of poorly soluble drugs such as non-specific biodistribution and targeting, lack of water solubility and poor oral bioavailability. Therefore, considerable efforts have been made to exploit the full potential of these delivery systems; to entrap poorly soluble drugs and target pathological sites both passively through the enhanced permeability and retention (EPR) effect and actively by linking the terminal PEG groups with targeting ligands, which were shown to increase delivery efficiency and tissue specificity. This article reviews the current state of PEG-lipid micelles as delivery carriers for poorly soluble drugs, their biological implications and recent developments in exploring their active targeting potential. In addition, this review sheds light on the physical properties of PEG-lipid micelles and their relevance to the inherent advantages and applications of PEG-lipid micelles for drug delivery.
The filtering of raw water with partition system in pool row water for the process
International Nuclear Information System (INIS)
Harahap, Sentot Alibasya; Djunaidi
2003-01-01
The purpose of filtering raw water in the pool is decreasing soluble dirty in the water from Puspiptek PAM also the dirty from the environments. The monitoring of raw water since 1998 that the raw water is not so good in the quality. This partition system use tree type of screen a.i. the opened 10 mm, Mesh 60 and Mesh 100. The down position use a plat with 400 mm higher from the floor of the pool that given support frame from the L profile and strip plate by stainless steel (SS-304), use for deposited the impurities. The filter capability from the monitoring that the filtering result is a good quality, the TDS drop (Total Dissolved Solvent) is 2,5 gram/liter and the water filtering static type is (4 - 8,5) gram/liter
Bao, Yan; Wang, Tong; Kang, Qiaoling; Shi, Chunhua; Ma, Jianzhong
2017-01-01
Hollow silica spheres (HSS) with special interior spaces, high specific surface area and excellent adsorption and permeability performance were synthesized via micelle-template method using cetyl trimethyl ammonium bromide (CTAB) micelles as soft template and tetraethoxysilane (TEOS) as silica precursor. SEM, TEM, FT-IR, XRD, DLS and BET-BJH were carried out to characterize the morphology and structure of as-obtained samples. The results demonstrated that the samples were amorphous with a hol...
Guziałowska-Tic, Joanna
2017-10-01
According to the Directive of the European Parliament and of the Council concerning the protection of animals used for scientific purposes, the number of experiments involving the use of animals needs to be reduced. The methods which can replace animal testing include computational prediction methods, for instance, the quantitative structure-activity relationships (QSAR). These methods are designed to find a cohesive relationship between differences in the values of the properties of molecules and the biological activity of a series of test compounds. This paper compares the results of the author's own results of examination on the n-octanol/water coefficient for the hydroxyester HE-1 with those generated by means of three models: Kowwin, MlogP, AlogP. The test results indicate that, in the case of molecular similarity, the highest determination coefficient was obtained for the model MlogP and the lowest root-mean square error was obtained for the Kowwin method. When comparing the mean logP value obtained using the QSAR models with the value resulting from the author's own experiments, it was observed that the best conformity was that recorded for the model AlogP, where relative error was 15.2%.
Directory of Open Access Journals (Sweden)
Guziałowska-Tic Joanna
2017-01-01
Full Text Available According to the Directive of the European Parliament and of the Council concerning the protection of animals used for scientific purposes, the number of experiments involving the use of animals needs to be reduced. The methods which can replace animal testing include computational prediction methods, for instance, the quantitative structure-activity relationships (QSAR. These methods are designed to find a cohesive relationship between differences in the values of the properties of molecules and the biological activity of a series of test compounds. This paper compares the results of the author's own results of examination on the n-octanol/water coefficient for the hydroxyester HE-1 with those generated by means of three models: Kowwin, MlogP, AlogP. The test results indicate that, in the case of molecular similarity, the highest determination coefficient was obtained for the model MlogP and the lowest root-mean square error was obtained for the Kowwin method. When comparing the mean logP value obtained using the QSAR models with the value resulting from the author's own experiments, it was observed that the best conformity was that recorded for the model AlogP, where relative error was 15.2%.
Spatially Partitioned Embedded Runge--Kutta Methods
Ketcheson, David I.
2013-10-30
We study spatially partitioned embedded Runge--Kutta (SPERK) schemes for partial differential equations (PDEs), in which each of the component schemes is applied over a different part of the spatial domain. Such methods may be convenient for problems in which the smoothness of the solution or the magnitudes of the PDE coefficients vary strongly in space. We focus on embedded partitioned methods as they offer greater efficiency and avoid the order reduction that may occur in nonembedded schemes. We demonstrate that the lack of conservation in partitioned schemes can lead to nonphysical effects and propose conservative additive schemes based on partitioning the fluxes rather than the ordinary differential equations. A variety of SPERK schemes are presented, including an embedded pair suitable for the time evolution of fifth-order weighted nonoscillatory spatial discretizations. Numerical experiments are provided to support the theory.
Spatially Partitioned Embedded Runge--Kutta Methods
Ketcheson, David I.; MacDonald, Colin B.; Ruuth, Steven J.
2013-01-01
We study spatially partitioned embedded Runge--Kutta (SPERK) schemes for partial differential equations (PDEs), in which each of the component schemes is applied over a different part of the spatial domain. Such methods may be convenient for problems in which the smoothness of the solution or the magnitudes of the PDE coefficients vary strongly in space. We focus on embedded partitioned methods as they offer greater efficiency and avoid the order reduction that may occur in nonembedded schemes. We demonstrate that the lack of conservation in partitioned schemes can lead to nonphysical effects and propose conservative additive schemes based on partitioning the fluxes rather than the ordinary differential equations. A variety of SPERK schemes are presented, including an embedded pair suitable for the time evolution of fifth-order weighted nonoscillatory spatial discretizations. Numerical experiments are provided to support the theory.
Triantafyllou, V I; Akrida-Demertzi, K; Demertzis, P G
2005-06-03
The suitability of recycled paperboard packaging materials for direct food contact applications is a major area of investigation. Chemical contaminants (surrogates) partitioning between recycled paper packaging and foods may affect the safety and health of the consumer. The partition behavior of all possible organic compounds between cardboards and individual foodstuffs is difficult and too time consuming for being fully investigated. Therefore it may be more efficient to determine these partition coefficients indirectly through experimental determination of the partitioning behavior between cardboard samples and air. In this work, the behavior of organic pollutants present in a set of two paper and board samples intended to be in contact with foods was studied. Adsorption isotherms have been plotted and partition coefficients between paper and air have been calculated as a basis for the estimation of their migration potential into food. Values of partition coefficients (Kpaper/air) from 47 to 1207 were obtained at different temperatures. For the less volatile surrogates such as dibutyl phthalate and methyl stearate higher Kpaper/air values were obtained. The adsorption curves showed that the more volatile substances are partitioning mainly in air phase and increasing the temperature from 70 to 100 degrees C their concentrations in air (Cair) have almost doubled. The analysis of surrogates was performed with a method based on solvent extraction and gas chromatographic-flame ionization detection (GC-FID) quantification.
Polymeric micelles encapsulating fisetin improve the therapeutic effect in colon cancer.
Chen, Yishan; Wu, Qinjie; Song, Linjiang; He, Tao; Li, Yuchen; Li, Ling; Su, Weijun; Liu, Lei; Qian, Zhiyong; Gong, Changyang
2015-01-14
The natural flavonoid fisetin (3,3',4',7-tetrahydroxyflavone) was discovered to possess antitumor activity, revealing its potential value in future chemotherapy. However, its poor water solubility makes it difficult for intravenous administration. In this study, the monomethyl poly(ethylene glycol)-poly(ε-caprolactone) (MPEG-PCL) copolymer was applied to prepare nanoassemblies of fisetin by a self-assembly procedure. The prepared fisetin micelles gained a mean particle size of 22 ± 3 nm, polydisperse index of 0.163 ± 0.032, drug loading of 9.88 ± 0.14%, and encapsulation efficiency of 98.53 ± 0.02%. Compared with free fisetin, fisetin micelles demonstrated a sustained and prolonged in vitro release behavior, as well as enhanced cytotoxicity, cellular uptake, and fisetin-induced apoptosis in CT26 cells. As for in vivo studies, fisetin micelles were more competent for suppressing tumor growth and prolonging survival time than free fisetin in the subcutaneous CT26 tumor model. Furthermore, histological analysis, terminal deoxynucleotidyl transferase-mediated nick-end labeling assay, immunohistochemical detection of Ki-67, and microvessel density detection were conducted, demonstrating that fisetin micelles gained increased tumor apoptosis induction, proliferation suppression, and antiangiogenesis activities. In conclusion, we have successfully produced a MPEG-PCL-based nanocarrier encapsulating fisetin with enhanced antitumor activity.
Nuclear relaxation induced by diffusion in confined media; the case of inverted micelles
International Nuclear Information System (INIS)
Llor, Antoine
1983-01-01
This work emphasizes the specificities of molecular motions in restricted media observed by NMR. The observation of proton nuclear relaxation of small water pools in AOT reversed micelles has led to separation of dipolar contributions using substitution by deuterium. The water-water contributions to relaxation are easily explained by well-known models and show that water rotational movements are, at most, five times slower than in pure water. The other contributions display a strong frequency dependence with spectrometer frequency and, in order to explain them, a specific dipolar relaxation model was developed between two particles whose movements are restricted to the surface of a sphere and in a concentric sphere respectively. This model was generalized to all cases of diffusion movements of particles in a spherical symmetry environment. In the case of AOT micelles, this model can not explain the experimental results. An elementary discussion taking into account the polar heads specificities and their interactions with water lead to a qualitative interpretation of the experimental data. (author) [fr
Stereocomplex-Reinforced PEGylated Polylactide Micelle for Optimized Drug Delivery
Directory of Open Access Journals (Sweden)
Chunsheng Feng
2016-04-01
Full Text Available The instability of PEGylated polylactide micelles is a challenge for drug delivery. Stereocomplex interaction between racemic polylactide chains with different configurations provides an effective strategy to enhance the stability of micelles as the nanocarriers of drugs. In this work, a stereocomplex micelle (SCM self-assembled from the amphiphilic triblock copolymers comprising poly(ethylene glycol (PEG, and dextrorotatory and levorotatory polylactides (PDLA and PLLA was applied for efficient drug delivery. The spherical SCM showed the smallest scale and the lowest critical micelle concentration (CMC than the micelles with single components attributed to the stereocomplex interaction between PDLA and PLLA. 10-Hydroxycamptothecin (HCPT as a model antitumor drug was loaded into micelles. Compared with the loading micelles from individual PDLA and PLLA, the HCPT-loaded SCM exhibited the highest drug loading efficiency (DLE and the slowest drug release in phosphate-buffered saline (PBS at pH 7.4, indicating its enhanced stability in circulation. More fascinatingly, the laden SCM was demonstrated to have the highest cellular uptake of HCPT and suppress malignant cells most effectively in comparison to the HCPT-loaded micelles from single copolymer. In summary, the stereocomplex-enhanced PLA–PEG–PLA micelle may be promising for optimized drug delivery in the clinic.
Eliezar, Jeaniffer; Scarano, Wei; Boase, Nathan R B; Thurecht, Kristofer J; Stenzel, Martina H
2015-02-09
The biodistribution of micelles with and without folic acid targeting ligands were studied using a block copolymer consisting of acrylic acid (AA) and polyethylene glycol methyl ether acrylate (PEGMEA) blocks. The polymers were prepared using RAFT polymerization in the presence of a folic acid functionalized RAFT agent. Oxoplatin was conjugated onto the acrylic acid block to form amphiphilic polymers which, when diluted in water, formed stable micelles. In order to probe the in vivo stability, a selection of micelles were cross-linked using 1,8-diamino octane. The sizes of the micelles used in this study range between 75 and 200 nm, with both spherical and worm-like conformation. The effects of cross-linking, folate conjugation and different conformation on the biodistribution were studied in female nude mice (BALB/c) following intravenous injection into the tail vein. Using optical imaging to monitor the fluorophore-labeled polymer, the in vivo biodistribution of the micelles was monitored over a 48 h time-course after which the organs were removed and evaluated ex vivo. These experiments showed that both cross-linking and conjugation with folic acid led to increased fluorescence intensities in the organs, especially in the liver and kidneys, while micelles that are not conjugated with folate and not cross-linked are cleared rapidly from the body. Higher accumulation in the spleen, liver, and kidneys was also observed for micelles with worm-like shapes compared to the spherical micelles. While the various factors of cross-linking, micelle shape, and conjugation with folic acid all contribute separately to prolong the circulation time of the micelle, optimization of these parameters for drug delivery devices could potentially overcome adverse effects such as liver and kidney toxicity.
Partitioning and diffusion of PBDEs through an HDPE geomembrane.
Rowe, R Kerry; Saheli, Pooneh T; Rutter, Allison
2016-09-01
Polybrominated diphenyl ether (PBDE) has been measured in MSW landfill leachate and its migration through a modern landfill liner has not been investigated previously. To assure environmental protection, it is important to evaluate the efficacy of landfill liners for controlling the release of PBDE to the environment to a negligible level. The partitioning and diffusion of a commercial mixture of PBDEs (DE-71: predominantly containing six congeners) with respect to a high-density polyethylene (HDPE) geomembrane is examined. The results show that the partitioning coefficients of the six congeners in this mixture range from 700,000 to 7,500,000 and the diffusion coefficients range from 1.3 to 6.0×10(-15)m(2)/s depending on the congener. This combination of very high partitioning coefficients and very low diffusion coefficients suggest that a well constructed HDPE geomembrane liner will be an extremely effective barrier for PBDEs with respect to diffusion from a municipal solid waste landfill, as illustrated by an example. The results for pure diffusion scenario showed that the congeners investigated meet the guidelines by at least a factor of three for an effective geomembrane liner where diffusion is the controlling transport mechanism. Copyright © 2016 Elsevier Ltd. All rights reserved.
Metzger, S.; Dentener, F. J.; Lelieveld, J.; Pandis, S. N.
A computationally efficient model (EQSAM) to calculate gas/aerosol partitioning ofsemi-volatile inorganic aerosol components has been developed for use in global- atmospheric chemistry and climate models; presented at the EGS 2001.We introduce and discuss here the physics behind the parameterisation, upon whichthe EQuilib- rium Simplified Aerosol Model EQSAM is based. The parameterisation,which ap- proximates the activity coefficient calculation sufficiently accurately forglobal mod- elling, is based on a method that directly relates aerosol activitycoefficients to the ambient relative humidity, assuming chemical equilibrium.It therefore provides an interesting alternative for the computationally expensiveiterative activity coefficient calculation methods presently used in thermodynamicgas/aerosol equilibrium mod- els (EQMs). The parameterisation can be used,however, also in dynamical models that calculate mass transfer between theliquid/solid aerosol phases and the gas/phase explicitly; dynamical models oftenincorporate an EQM to calculate the aerosol com- position. The gain of theparameterisation is that the entire system of the gas/aerosol equilibrium partitioningcan be solved non-iteratively, a substantial advantage in global modelling.Since we have already demonstrated at the EGS 2001 that EQSAM yields similarresults as current state-of-the-art equilibrium models, we focus here on a dis- cussionof our physical interpretation of the parameterisation; the identification of theparameters needed is crucial. Given the lag of reliable data, the best way tothor- oughly validate the parameterisation for global modelling applications is theimple- mentation in current state-of-the-art gas/aerosol partitioning routines, whichare embe- ded in e.g. a global atmospheric chemistry transport model, by comparingthe results of the parameterisation against the ones based on the widely used activitycoefficient calculation methods (i.e. Bromley, Kussik-Meissner or Pitzer). Then
Seasonal and particle size-dependent variations in gas/particle partitioning of PCDD/Fs
International Nuclear Information System (INIS)
Lee, Se-Jin; Ale, Debaki; Chang, Yoon-Seok; Oh, Jeong-Eun; Shin, Sun Kyoung
2008-01-01
This study monitored particle size-dependent variations in atmospheric polychlorinated dibenzo-p-dioxins and dibenzofurans (PCDD/Fs). Two gas/particle partitioning models, the subcooled liquid vapor pressure (P L 0 ) and the octanol-air partition coefficient (K OA ) model, were applied to each particle sizes. The regression coefficients of each fraction against the gas/particle partition coefficient (K P ) were similar for separated particles within the same sample set but differed for particles collected during different periods. Gas/particle partitioning calculated from the integral of fractions was similar to that of size-segregated particles and previously measured bulk values. Despite the different behaviors and production mechanisms of atmospheric particles of different sizes, PCDD/F partitioning of each size range was controlled by meteorological conditions such as atmospheric temperature, O 3 and UV, which reflects no source related with certain particle size ranges but mixed urban sources within this city. Our observations emphasize that when assessing environmental and health effects, the movement of PCDD/Fs in air should be considered in conjunction with particle size in addition to the bulk aerosol. - Gas/particle partitioning of atmospheric PCDD/Fs for different particle sizes reflects the impacts of emitters of different size ranges
Polysaccharide-Based Micelles for Drug Delivery
Directory of Open Access Journals (Sweden)
Nan Zhang
2013-05-01
Full Text Available Delivery of hydrophobic molecules and proteins has been an issue due to poor bioavailability following administration. Thus, micelle carrier systems are being investigated to improve drug solubility and stability. Due to problems with toxicity and immunogenicity, natural polysaccharides are being explored as substitutes for synthetic polymers in the development of new micelle systems. By grafting hydrophobic moieties to the polysaccharide backbone, self-assembled micelles can be readily formed in aqueous solution. Many polysaccharides also possess inherent bioactivity that can facilitate mucoadhesion, enhanced targeting of specific tissues, and a reduction in the inflammatory response. Furthermore, the hydrophilic nature of some polysaccharides can be exploited to enhance circulatory stability. This review will highlight the advantages of polysaccharide use in the development of drug delivery systems and will provide an overview of the polysaccharide-based micelles that have been developed to date.
The development of phytosterol-lecithin mixed micelles and organogels.
Matheson, Andrew B; Dalkas, Georgios; Gromov, Andrei; Euston, Stephen R; Clegg, Paul S
2017-12-13
We demonstrate that by mixing the phytosterol-ester oryzanol with lecithin in an organic solvent, both components may be dispersed at much higher concentrations than they may be individually. Dynamic light scattering and molecular dynamics simulations show that the mechanism for this is the formation of r ∼ 4 nm mixed micelles. Infrared spectroscopy and simulations suggest that these micelles are formed due in part to hydrogen bonding of the phosphate of the lecithin head-group, and the phenol group of the oryzanol. Rheology shows that by mixing these materials at an equimolar ratio, highly viscous suspensions are created. Furthermore, by adding water to these samples, a solid-like gel may be formed which offers mechanical properties close to those desired for a margarine type spread, whilst still solubilizing the oryzanol.
Willet, Nicolas; Gohy, Jean-François; Auvray, Loïc; Varshney, Sunil; Jérôme, Robert; Leyh, Bernard
2008-04-01
It is now well established that amphiphilic PS-b-P2VP-b-PEO linear triblock copolymers can form multilayered assemblies, thus core-shell-corona (CSC) micelles, in water. Micellization is triggered by addition of a small amount of water into a dilute solution of the PS-b-P2VP-b-PEO copolymer in a non-selective organic solvent. However, the phenomena that take place at the very beginning of this process are poorly documented. How these copolymer chains are perturbed by addition of water was investigated in this work by light and neutron scattering techniques and transmission electron microscopy. It was accordingly possible to determine the critical water concentration (CWC), the compactness of the nano-objects in solution, their number of aggregation, and their hydrodynamic diameter at each step of the micellization process.
Surface induced ordering of micelles at the solid-liquid interface
International Nuclear Information System (INIS)
Gerstenberg, M.C.; Pedersen, J.S.; Smith, G.S.
1998-01-01
The surface induced ordering of triblock copolymer micelles in aqueous solution was measured with neutron reflectivity far above the critical micelle concentration. The scattering length density profiles showed a clear indication of ordered layers of micelles perpendicular to a quartz surface. The structure and interactions of the micelles were modeled in detail. The convolution of the center distribution of the micelles, obtained from Monte Carlo simulations of hard spheres at a hard wall, and the projected density of the micelle showed excellent agreement with the experimental profiles. copyright 1998 The American Physical Society
Surface induced ordering of micelles at the solid-liquid interface
DEFF Research Database (Denmark)
Gerstenberg, M.C.; Pedersen, J.S.; Smith, G.S.
1998-01-01
The surface induced ordering of triblock copolymer micelles in aqueous solution was measured with neutron reflectivity far above the critical micelle concentration. The scattering length density profiles showed a clear indication of ordered layers of micelles perpendicular to a quartz surface....... The structure and interactions of the micelles were modeled in detail. The convolution of the center distribution of the micelles, obtained from Monte Carlo simulations of hard spheres at a hard wall, and the projected density of the micelle showed excellent agreement with the experimental profiles. [S1063-651X...
The Effect of fO2 on Partition Coefficients of U and Th between Garnet and Silicate Melt
Huang, F.; He, Z.; Schmidt, M. W.; Li, Q.
2014-12-01
Garnet is one of the most important minerals controlling partitioning of U and Th in the upper mantle. U is redox sensitive, while Th is tetra-valent at redox conditions of the silicate Earth. U-series disequilibria have provided a unique tool to constrain the time-scales and processes of magmatism at convergent margins. Variation of garnet/meltDU/Th with fO2 is critical to understand U-series disequilibria in arc lavas. However, there is still no systematic experimental study about the effect of fO2 on partitioning of U and Th between garnet and melt. Here we present experiments on partitioning of U, Th, Zr, Hf, Nb, Ta, and REE between garnet and silicate melts at various fO2. The starting material was hydrous haplo-basalt. The piston cylinder experiments were performed with Pt double capsules with C-CO, MnO-Mn3O4 (MM), and hematite-magnetite (HM) buffers at 3 GPa and 1185-1230 oC. The experiments produced garnets with diameters > 50μm and quenched melt. Major elements were measured by EMPA at ETH Zurich. Trace elements were determined using LA-ICP-MS at Northwestern University (Xi'an, China) and SIMS (Cameca1280 at the Institute of Geology and Geophysics, Beijing, China), producing consistent partition coefficient data for U and Th. With fO2 increasing from CCO to MM and HM, garnet/meltDU decreases from 0.041 to 0.005, while garnet/meltDTh ranges from 0.003 to 0.007 without correlation with fO2. Notably, garnet/meltDTh/U increases from 0.136 at CCO to 0.41 at HM. Our results indicate that U is still more compatible than Th in garnet even at the highest fO2 considered for the subarc mantle wedge (~NNO). Therefore, we predict that if garnet is the dominant phase controlling U-Th partitioning during melting of the mantle wedge, melts would still have 230Th excess over 238U. This explains why most young continental arc lavas have 230Th excess. If clinopyroxene is the dominant residual phase during mantle melting, U could be more incompatible than Th at high fO2
Recombinant Amphiphilic Protein Micelles for Drug Delivery
Kim, Wookhyun; Xiao, Jiantao; Chaikof, Elliot L.
2011-01-01
Amphiphilic block polypeptides can self-assemble into a range of nanostructures in solution, including micelles and vesicles. Our group has recently described the capacity of recombinant amphiphilic diblock copolypeptides to form highly stable micelles. In this report, we demonstrate the utility of protein nanoparticles to serve as a vehicle for controlled drug delivery. Drug-loaded micelles were produced by encapsulating dipyridamole as a model hydrophobic drug with anti-inflammatory activit...
Graciaa, Alain; Andérez, José; Bracho, Carlos; Lachaise, Jean; Salager, Jean-Louis; Tolosa, Laura; Ysambertt, Fredy
2006-11-16
Because their affinities for the oil and water phases vary considerably with the number of ethylene oxide units in their hydrophilic group, the ethoxylated nonionic species occurring in commercial products tend to behave in a non-collective way, with the low ethoxylation oligomers partitioning mostly in the oil phase. This results in a surfactant mixture at the interface which is more hydrophilic than the one which was introduced in the system in the first place. The pseudophase model is used to study the partitioning in Winsor III type systems, and to estimate the deviation of the interfacial mixture composition from the overall one. New results indicate that the selective partitioning into the oil phase increases when the oil phase becomes aromatic, when the total surfactant concentration decreases and when the water-to-oil ratio decreases.
Characterization of Phospholipid Mixed Micelles by Translational Diffusion
International Nuclear Information System (INIS)
Chou, James J.; Baber, James L.; Bax, Ad
2004-01-01
The concentration dependence of the translational self diffusion rate, D s , has been measured for a range of micelle and mixed micelle systems. Use of bipolar gradient pulse pairs in the longitudinal eddy current delay experiment minimizes NOE attenuation and is found critical for optimizing sensitivity of the translational diffusion measurement of macromolecules and aggregates. For low volume fractions Φ (Φ ≤ 15% v/v) of the micelles, experimental measurement of the concentration dependence, combined with use of the D s =D o (1-3.2λΦ) relationship, yields the hydrodynamic volume. For proteins, the hydrodynamic volume, derived from D s at infinitely dilute concentration, is found to be about 2.6 times the unhydrated molecular volume. Using the data collected for hen egg white lysozyme as a reference, diffusion data for dihexanoyl phosphatidylcholine (DHPC) micelles indicate approximately 27 molecules per micelle, and a critical micelle concentration of 14 mM. Differences in translational diffusion rates for detergent and long chain phospholipids in mixed micelles are attributed to rapid exchange between free and micelle-bound detergent. This difference permits determination of the free detergent concentration, which, for a high detergent to long chain phospholipid molar ratio, is found to depend strongly on this ratio. The hydrodynamic volume of DHPC/POPC bicelles, loaded with an M2 channel peptide homolog, derived from translational diffusion, predicts a rotational correlation time that slightly exceeds the value obtained from peptide 15 N relaxation data
Ariyasena, Thiloka C; Poole, Colin F
2014-09-26
Retention factors on several columns and at various temperatures using gas chromatography and from reversed-phase liquid chromatography on a SunFire C18 column with various mobile phase compositions containing acetonitrile, methanol and tetrahydrofuran as strength adjusting solvents are combined with liquid-liquid partition coefficients in totally organic biphasic systems to calculate descriptors for 23 polycyclic aromatic hydrocarbons and eighteen related compounds of environmental interest. The use of a consistent protocol for the above measurements provides descriptors that are more self consistent for the estimation of physicochemical properties (octanol-water, air-octanol, air-water, aqueous solubility, and subcooled liquid vapor pressure). The descriptor in this report tend to have smaller values for the L and E descriptors and random differences in the B and S descriptors compared with literature sources. A simple atom fragment constant model is proposed for the estimation of descriptors from structure for polycyclic aromatic hydrocarbons. The new descriptors show no bias in the prediction of the air-water partition coefficient for polycyclic aromatic hydrocarbons unlike the literature values. Copyright © 2014 Elsevier B.V. All rights reserved.
Zhao, Hongxia; Xie, Qing; Tan, Feng; Chen, Jingwen; Quan, Xie; Qu, Baocheng; Zhang, Xin; Li, Xiaona
2010-07-01
The octanol-air partition coefficient (K(OA)) of 19 hydroxylated polybrominated diphenyl ethers (OH-PBDEs) and 10 methoxylated polybrominated diphenyl ethers (MeO-PBDEs) were measured as a function of temperature using a gas chromatographic retention time technique. At room temperature (298.15K), log K(OA) ranged from 8.30 for monobrominated OH/MeO-PBDEs to 13.29 for hexabrominated OH/MeO-PBDEs. The internal energies of phase change from octanol to air (Delta(OA)U) for 29 OH/MeO-PBDE congeners ranged from 72 to 126 kJ mol(-1). Using partial least-squares (PLS) analysis, a statistically quantitative structure-property relationship (QSPR) model for logK(OA) of OH/MeO-PBDE congeners was developed based on the 16 fundamental quantum chemical descriptors computed by PM3 Hamiltonian, for which the Q(cum)(2) was about 0.937. The molecular weight (Mw) and energy of the lowest unoccupied molecular orbital (E(LUMO)) were found to be main factors governing the log K(OA). 2010 Elsevier Ltd. All rights reserved.
In situ electron-beam polymerization stabilized quantum dot micelles.
Travert-Branger, Nathalie; Dubois, Fabien; Renault, Jean-Philippe; Pin, Serge; Mahler, Benoit; Gravel, Edmond; Dubertret, Benoit; Doris, Eric
2011-04-19
A polymerizable amphiphile polymer containing PEG was synthesized and used to encapsulate quantum dots in micelles. The quantum dot micelles were then polymerized using a "clean" electron beam process that did not require any post-irradiation purification. Fluorescence spectroscopy revealed that the polymerized micelles provided an organic coating that preserved the quantum dot fluorescence better than nonpolymerized micelles, even under harsh conditions. © 2011 American Chemical Society
Mandal, Abhirup; Bisht, Rohit; Rupenthal, Ilva D; Mitra, Ashim K
2017-02-28
Effective intraocular drug delivery poses a major challenge due to the presence of various elimination mechanisms and physiological barriers that result in low ocular bioavailability after topical application. Over the past decades, polymeric micelles have emerged as one of the most promising drug delivery platforms for the management of ocular diseases affecting the anterior (dry eye syndrome) and posterior (age-related macular degeneration, diabetic retinopathy and glaucoma) segments of the eye. Promising preclinical efficacy results from both in-vitro and in-vivo animal studies have led to their steady progression through clinical trials. The mucoadhesive nature of these polymeric micelles results in enhanced contact with the ocular surface while their small size allows better tissue penetration. Most importantly, being highly water soluble, these polymeric micelles generate clear aqueous solutions which allows easy application in the form of eye drops without any vision interference. Enhanced stability, larger cargo capacity, non-toxicity, ease of surface modification and controlled drug release are additional advantages with polymeric micelles. Finally, simple and cost effective fabrication techniques render their industrial acceptance relatively high. This review summarizes structural frameworks, methods of preparation, physicochemical properties, patented inventions and recent advances of these micelles as effective carriers for ocular drug delivery highlighting their performance in preclinical studies. Copyright © 2017 Elsevier B.V. All rights reserved.
The Influence of Oxygen and Sulfur on Uranium Partitioning Into the Core
Moore, R. D., Jr.; Van Orman, J. A.; Hauck, S. A., II
2017-12-01
Uranium, along with K and Th, may provide substantial long-term heating in planetary cores, depending on the magnitude of their partitioning into the metal during differentiation. In general, non-metallic light elements are known to have a large influence on the partitioning of trace elements, and the presence of sulfur is known to enhance the partitioning of uranium into the metal. Data from the steelmaking literature indicate that oxygen also enhances the solubility of oxygen in liquid iron alloys. Here we present experimental data on the partitioning of U between immiscible liquids in the Fe-S-O system, and use these data along with published metal-silicate partitioning data to calibrate a quantitative activity model for U in the metal. We also determined partition coefficients for Th, K, Nb, Nd, Sm, and Yb, but were unable to fully constrain activity models for these elements with available data. A Monte Carlo fitting routine was used to calculate U-S, U-O, and U-S-O interaction coefficients, and their associated uncertainties. We find that the combined interaction of uranium with sulfur and oxygen is predominant, with S and O together enhancing the solubility of uranium to a far greater degree than either element in isolation. This suggests that uranium complexes with sulfite or sulfate species in the metal. For a model Mars core composition containing 14 at% S and 5 at% O, the metal/silicate partition coefficient for U is predicted to be an order of magnitude larger than for a pure Fe-Ni core.
Partitioning and desorption behavior of polycyclic aromatic hydrocarbons from disparate sources
International Nuclear Information System (INIS)
Reeves, W.R.; McDonald, T.J.; Cizmas, L.; Donnelly, K.C.
2004-01-01
Contaminated sediments pose a unique challenge for risk assessment or remediation because the overlying water column may transport contaminants offsite or to ecological receptors. This research compares the behavior of polycyclic aromatic hydrocarbons (PAHs) on marine sediments from two sites. The first site was affected by shipping activities and the second was impacted by a creosote seep. Organic carbon:water partitioning coefficients (K oc values) were measured with three solutions. Desorption was measured using Tenax beads. PAHs from the ship channel had lower K oc values than those from the creosote facility. For example, the average log K oc value of ship channel pyrene was significantly lower than that of creosote facility pyrene (4.39±0.35 and 5.29±0.09, respectively, when tested in 5 mM calcium chloride). These results were consistent with the greater desorption of pyrene, phenanthrene and benzo(a)pyrene from the ship channel than from the creosote facility sediments. Organic compound desorption from sediments can be considered to be a two-stage process, with a labile fraction that desorbs quickly and a refractory fraction that desorbs much more slowly. In both sediments, more than 75% of the benzo(a)pyrene was found to have partitioned into the refractory phase. The amounts of phenanthrene and pyrene that partitioned into the refractory phase were lower. Linear correlations of log K oc with log (C R /C L ) (where C R and C L are the fractions of the compound in the refractory and labile phases, respectively, at time zero) showed that partitioning measurements made with the US EPA's Toxicity Characteristic Leaching Procedure fluid (US EPA, 1996) most closely matched predictions of desorption behavior. The data imply that with a larger data set, it may be possible to relate simple partitioning measurements to desorption behavior. Partitioning measurements were used to predict water concentrations. Despite having higher concentrations of carcinogenic PAHs
Samanta, Anuva; Paul, Bijan Kumar; Guchhait, N.
2011-05-01
In this report we have studied micellization process of anionic, cationic and non-ionic surfactants using N,N-dimethylaminonapthyl-(acrylo)-nitrile (DMANAN) as an external fluorescence probe. Micropolarity, microviscosity, critical micellar concentration of these micelles based on steady state absorption and fluorescence and time resolved emission spectroscopy of the probe DMANAN show that the molecule resides in the micelle-water interface for ionic micelles and in the core for the non-ionic micelle. The effect of variation of pH of the micellar solution as well as fluorescence quenching measurements of DMANAN provide further support for the location of the probe in the micelles.
International Nuclear Information System (INIS)
Kumblad, Linda; Bradshaw, Clare
2008-08-01
In this study the elemental composition of biota, water and sediment from a shallow bay in the Forsmark region have been determined. The report presents data for 48 different elements (Al, As, Ba, Br, C, Ca, Cd, Ce, Cl, Co, Cr, Cs, Cu, Dy, Er, Eu, F, Fe, Gd, Hg, Ho, I, K, Li, Lu, Mg, Mn, N, Na, Nd, Ni, P, Pb, Pr, Ra, Rb, S, Se, Si, Sm, Tb, Th, Ti, Tm, V, Yb, Zn, Zr) in all major functional groups of the coastal ecosystem (phytoplankton, zooplankton, benthic microalgae, macroalgae, macrophytes, benthic herbivores, benthic filter feeders, benthic detrivores, planktivorous fish, benthic omnivorous fish, carnivorous fish, dissolved and particulate matter in the water and the sediment) during spring 2005. The overall aim of the study is to contribute to a better understanding of ecological properties and processes that govern uptake and transfer of trace elements, heavy-metals, radionuclides and other non-essential elements/contaminants in coastal environments of the Baltic Sea. In addition, the data was collected to provide site-specific Bioconcentration Factors (BCF), Biomagnification Factors (BMF), partitioning coefficients (K d ) and element ratios (relative to carbon) for use in ongoing SKB safety assessments. All these values, as well as the element concentration data from which they are derived, are presented here. As such, this is mainly a data report, although initial interpretations of the data also are presented and discussed. Reported data include element concentrations, CNP-stoichiometry, and multivariate data analysis. Elemental concentrations varied greatly between organisms and environmental components, depending on the function of the elements, and the habitat, ecosystem function, trophic level and morphology (taxonomy) of the organisms. The results show for instance that food intake and metabolism strongly influence the elemental composition of organisms. The three macrophytes had quite similar elemental composition (despite their taxonomic differences
Absorption coefficient instrument for turbid natural waters
Friedman, E.; Cherdak, A.; Poole, L.; Houghton, W.
1980-01-01
The paper presents an instrument that directly measures multispectral absorption coefficient of turbid natural water. Attention is given to the design, which is shown to incorporate methods for the compensation of variation in the internal light source intensity, correction of the spectrally dependent nature of the optical elements, and correction for variation in the background light level. In addition, when used in conjunction with a spectrally matched total attenuation instrument, the spectrally dependent scattering coefficient can also be derived. Finally, it is reported that systematic errors associated with multiple scattering have been estimated using Monte Carlo techniques.
Liu, Yu-Sheng; Cheng, Ru-You; Lo, Yu-Lun; Hsu, Chin; Chen, Su-Hwei; Chiu, Chien-Chih; Wang, Li-Fang
2016-02-01
We previously synthesized a chondroitin sulfate-graft-poly(ε-caprolactone) copolymer (H-CP) with a high content of poly(ε-caprolactone) (18.7 mol%), which self-assembled in water into a rod-like micelle to encapsulate hydrophobic camptothecin (CPT) in the core (micelle/CPT) for tumor-targeted drug delivery. As a result of the recognition of the micelle by CD44, the micelle/CPT entered CRL-5802 cells efficiently and released CPT efficaciously, resulting in higher tumor suppression than commercial CPT-11. In this study, H1299 cells were found to have a higher CD44 expression than CRL-5802 cells. However, the lower CD44-expressing CRL-5802 cells had a higher percentage of cell death and higher cellular uptake of the micelle/CPT than the higher CD44-expressing H1299 cells. Examination of the internalization pathway of the micelle/CPT in the presence of different endocytic chemical inhibitors showed that the CRL-5802 cells involved clathrin-mediated endocytosis, which was not found in the H1299 cells. Analysis of the cell cycle of the two cell lines exposed to the micelle/CPT revealed that the CRL-5802 cells arrested mainly in the S phase and the H1299 cells arrested mainly in the G2-M phase. A consistent result was also found in the evaluation of γ-H2AX expression, which was about three-fold higher in the CRL-5802 cells than in the H1299 cells. A near-infrared dye, IR780, was encapsulated into the micelle to observe the in vivo biodistribution of the micelle/IR780 in tumor-bearing mice. The CRL-5802 tumor showed a higher fluorescence intensity than the H1299 tumor at any tracing time after 1 h. Thus we tentatively concluded that CRL-5802 cells utilized the clathrin-mediated internalization pathway and arrested in the S phase on exposure to the micelle/CPT; all are possible reasons for the better therapeutic outcome in CRL-5802 cells than in H1299 cells.We previously synthesized a chondroitin sulfate-graft-poly(ε-caprolactone) copolymer (H-CP) with a high content of
Neutral Polymeric Micelles for RNA Delivery
Lundy, Brittany B.; Convertine, Anthony; Miteva, Martina; Stayton, Patrick S.
2013-01-01
RNA interference (RNAi) drugs have significant therapeutic potential but delivery systems with appropriate efficacy and toxicity profiles are still needed. Here, we describe a neutral, ampholytic polymeric delivery system based on conjugatable diblock polymer micelles. The diblock copolymer contains a hydrophilic poly[N-(2-hydroxypropyl) methacrylamide-co-N-(2-(pyridin-2- yldisulfanyl)ethyl)methacrylamide) (poly[HPMA-co-PDSMA]) segment to promote aqueous stability and facilitate thiol-disulfide exchange reactions, and a second ampholytic block composed of propyl acrylic acid (PAA), dimethylaminoethyl methacrylate (DMAEMA), and butyl methacrylate (BMA). The poly[(HPMA-co-PDSMA)-b-(PAA-co-DMAEMA-co-BMA)] was synthesized using Reversible Addition-Fragmentation chain Transfer (RAFT) polymerization with an overall molecular weight of 22,000 g/mol and a PDI of 1.88. Dynamic light scattering and fluorescence measurements indicated that the diblock copolymers self-assemble under aqueous conditions to form polymeric micelles with a hydrodynamic radius and critical micelle concentration of 25 nm and 25 μg/mL respectively. Red blood cell hemolysis experiments show that the neutral hydrophilic micelles have potent membrane destabilizing activity at endosomal pH values. Thiolated siRNA targeting glyceraldehyde 3-phosphate dehydrogenase (GAPDH) was directly conjugated to the polymeric micelles via thiol exchange reactions with the pyridal disulfide groups present in the micelle corona. Maximum silencing activity in HeLa cells was observed at a 1:10 molar ratio of siRNA to polymer following a 48 h incubation period. Under these conditions 90 % mRNA knockdown and 65 % and protein knockdown of at 48 h was achieved with negligible toxicity. In contrast the polymeric micelles lacking a pH-responsive endosomalytic segment demonstrated negligible mRNA and protein knockdown under these conditions. The potent mRNA knockdown and excellent biocompatibility of the neutral siRNA conjugates
Predicting proton titration in cationic micelle and bilayer environments
Morrow, Brian H.; Eike, David M.; Murch, Bruce P.; Koenig, Peter H.; Shen, Jana K.
2014-08-01
Knowledge of the protonation behavior of pH-sensitive molecules in micelles and bilayers has significant implications in consumer product development and biomedical applications. However, the calculation of pKa's in such environments proves challenging using traditional structure-based calculations. Here we apply all-atom constant pH molecular dynamics with explicit ions and titratable water to calculate the pKa of a fatty acid molecule in a micelle of dodecyl trimethylammonium chloride and liquid as well as gel-phase bilayers of diethyl ester dimethylammonium chloride. Interestingly, the pKa of the fatty acid in the gel bilayer is 5.4, 0.4 units lower than that in the analogous liquid bilayer or micelle, despite the fact that the protonated carboxylic group is significantly more desolvated in the gel bilayer. This work illustrates the capability of all-atom constant pH molecular dynamics in capturing the delicate balance in the free energies of desolvation and Coulombic interactions. It also shows the importance of the explicit treatment of ions in sampling the protonation states. The ability to model dynamics of pH-responsive substrates in a bilayer environment is useful for improving fabric care products as well as our understanding of the side effects of anti-inflammatory drugs.
Predicting proton titration in cationic micelle and bilayer environments
Energy Technology Data Exchange (ETDEWEB)
Morrow, Brian H.; Shen, Jana K. [Department of Pharmaceutical Sciences, University of Maryland, Baltimore, Maryland 21201 (United States); Eike, David M.; Murch, Bruce P.; Koenig, Peter H. [Computational Chemistry, Modeling and Simulation GCO, Procter and Gamble, Cincinnati, Ohio 45201 (United States)
2014-08-28
Knowledge of the protonation behavior of pH-sensitive molecules in micelles and bilayers has significant implications in consumer product development and biomedical applications. However, the calculation of pK{sub a}’s in such environments proves challenging using traditional structure-based calculations. Here we apply all-atom constant pH molecular dynamics with explicit ions and titratable water to calculate the pK{sub a} of a fatty acid molecule in a micelle of dodecyl trimethylammonium chloride and liquid as well as gel-phase bilayers of diethyl ester dimethylammonium chloride. Interestingly, the pK{sub a} of the fatty acid in the gel bilayer is 5.4, 0.4 units lower than that in the analogous liquid bilayer or micelle, despite the fact that the protonated carboxylic group is significantly more desolvated in the gel bilayer. This work illustrates the capability of all-atom constant pH molecular dynamics in capturing the delicate balance in the free energies of desolvation and Coulombic interactions. It also shows the importance of the explicit treatment of ions in sampling the protonation states. The ability to model dynamics of pH-responsive substrates in a bilayer environment is useful for improving fabric care products as well as our understanding of the side effects of anti-inflammatory drugs.
Development of life cycle water-demand coefficients for coal-based power generation technologies
International Nuclear Information System (INIS)
Ali, Babkir; Kumar, Amit
2015-01-01
Highlights: • We develop water consumption and withdrawals coefficients for coal power generation. • We develop life cycle water footprints for 36 coal-based electricity generation pathways. • Different coal power generation technologies were assessed. • Sensitivity analysis of plant performance and coal transportation on water demand. - Abstract: This paper aims to develop benchmark coefficients for water consumption and water withdrawals over the full life cycle of coal-based power generation. This study considered not only all of the unit operations involved in the full electricity generation life cycle but also compared different coal-based power generating technologies. Overall this study develops the life cycle water footprint for 36 different coal-based electricity generation pathways. Power generation pathways involving new technologies of integrated gasification combined cycle (IGCC) or ultra supercritical technology with coal transportation by conventional means and using dry cooling systems have the least complete life cycle water-demand coefficients of about 1 L/kW h. Sensitivity analysis is conducted to study the impact of power plant performance and coal transportation on the water demand coefficients. The consumption coefficient over life cycle of ultra supercritical or IGCC power plants are 0.12 L/kW h higher when conventional transportation of coal is replaced by coal-log pipeline. Similarly, if the conventional transportation of coal is replaced by its transportation in the form of a slurry through a pipeline, the consumption coefficient of a subcritical power plant increases by 0.52 L/kW h
DEFF Research Database (Denmark)
Bjerre-Jepsen, K; Faris, I; Henriksen, O
1982-01-01
Knowledge of the tissue to blood partition coefficient (lambda) is essential for calculation of the perfusion coefficient in a single tissue based on measurements of the washout of locally injected isotopes. No measurements of lambda for Xenon in subcutaneous tissue in the leg have been done...... in patients with occlusive arterial disease. In 12 patients with occlusive arterial disease in the legs lambda for Xenon was determined in subcutaneous tissue in the calf region and foot as the ratio between the washout rate constant of 131I-Antipyrine and 133Xe. A mixture of the two indicators was injected....... Mean value was 3.7 ml X g-1 (range: 1 X 7-10 X 7) in the calf and 2 X 7 ml X g-1 (range: 1 X 2-4 X 9) in the foot. It is concluded that lambda measurements are necessary for determination of subcutaneous blood flow from 133Xe washout curves in these patients. Determination of lambda is especially...
Directory of Open Access Journals (Sweden)
Frutos C. Marhuenda-Egea
2002-01-01
Full Text Available Alkaline p-nitrophenylphosphate phosphatase (pNPPase from the halophilic archaeobacterium Halobacterium salinarum (previously halobium was solubilized at low salt concentration in reverse micelles of hexadecyltrimethylammoniumbromide in cyclohexane with 1-butanol as cosurfactant. The enzyme maintained its catalytic properties under these conditions. The thermodynamic “solvation–stabilization hypothesis” has been used to explain the bell-shaped dependence of pNPPase activity on the water content of reverse micelles, in terms of protein–solvent interactions. According to this model, the stability of the folded protein depends on a network of hydrated ions associated with acidic residues at the protein surface. At low salt concentration and low water content (the ratio of water concentration to surfactant concentration; w0, the network of hydrated ions within the reverse micelles may involve the cationic heads of the surfactant. The bell-shaped profile of the relationship between enzyme activity and w0 varied depending on the concentrations of NaCl and Mn2+.
Kipka, Undine; Di Toro, Dominic M
2011-09-01
Predicting the association of contaminants with both particulate and dissolved organic matter is critical in determining the fate and bioavailability of chemicals in environmental risk assessment. To date, the association of a contaminant to particulate organic matter is considered in many multimedia transport models, but the effect of dissolved organic matter is typically ignored due to a lack of either reliable models or experimental data. The partition coefficient to dissolved organic carbon (K(DOC)) may be used to estimate the fraction of a contaminant that is associated with dissolved organic matter. Models relating K(DOC) to the octanol-water partition coefficient (K(OW)) have not been successful for many types of dissolved organic carbon in the environment. Instead, linear solvation energy relationships are proposed to model the association of chemicals with dissolved organic matter. However, more chemically diverse K(DOC) data are needed to produce a more robust model. For humic acid dissolved organic carbon, the linear solvation energy relationship predicts log K(DOC) with a root mean square error of 0.43. Copyright © 2011 SETAC.
Glutathione-responsive core cross-linked micelles for controlled cabazitaxel delivery
Han, Xiaoxiong; Gong, Feirong; Sun, Jing; Li, Yueqi; Liu, XiaoFei; Chen, Dan; Liu, Jianwen; Shen, Yaling
2018-02-01
Stimulus-responsive polymeric micelles (PMs) have recently received attention due to the controlled delivery of drug or gene for application in cancer diagnosis and treatment. In this work, novel glutathione-responsive PMs were prepared to encapsulate hydrophobic antineoplastic drug, cabazitaxel (CTX), to improve its solubility and toxicity. These CTX-loaded micelles core cross-linked by disulfide bonds (DCL-CTX micelles) were prepared by a novel copolymer, lipoic acid grafted mPEG-PLA. These micelles had regular spherical shape, homogeneous diameter of 18.97 ± 0.23 nm, and a narrow size distribution. The DCL-CTX micelles showed high encapsulation efficiency of 98.65 ± 1.77%, and the aqueous solubility of CTX was improved by a factor of 1:1200. In vitro release investigation showed that DCL-CTX micelles were stable in the medium without glutathione (GSH), whereas the micelles had burst CTX release in the medium with 10 mM GSH. Cell uptake results implied that DCL-CTX micelles were internalized into MCF-7 cells through clathrin-mediated endocytosis and released cargo more effectively than Jevtana (commercially available CTX) owing to GSH-stimulated degradation. In MTT assay against MCF-7 cells, these micelles inhibited tumor cell proliferation more effectively than Jevtana due to their GSH-responsive CTX release. All results revealed the potency of GSH-responsive DCL-CTX micelles for stable delivery in blood circulation and for intracellular GSH-trigged release of CTX. Therefore, DCL-CTX micelles show potential as safe and effective CTX delivery carriers and as a cancer chemotherapy formulation.
Peptide-conjugated micelles as a targeting nanocarrier for gene delivery
Energy Technology Data Exchange (ETDEWEB)
Lin, Wen Jen, E-mail: wjlin@ntu.edu.tw; Chien, Wei Hsuan [National Taiwan University, School of Pharmacy, Graduate Institute of Pharmaceutical Sciences (China)
2015-09-15
The aim of this study was to develop peptide-conjugated micelles possessing epidermal growth factor receptor (EGFR) targeting ability for gene delivery. A sequence-modified dodecylpeptide, GE11(2R), with enhancing EGF receptor binding affinity, was applied in this study as a targeting ligand. The active targeting micelles were composed of poly(d,l-lactide-co-glycolide)-poly(ethylene glycol) (PLGA-PEG) copolymer conjugated with GE11(2R)-peptide. The particle sizes of peptide-free and peptide-conjugated micelles were 277.0 ± 5.1 and 308.7 ± 14.5 nm, respectively. The peptide-conjugated micelles demonstrated the cellular uptake significantly higher than peptide-free micelles in EGFR high-expressed MDA-MB-231 and MDA-MB-468 cells due to GE11(2R)-peptide specificity. Furthermore, the peptide-conjugated micelles were able to encapsulate plasmid DNA and expressed cellular transfection higher than peptide-free micelles in EGFR high-expressed cells. The EGFR-targeting delivery micelles enhanced DNA internalized into cells and achieved higher cellular transfection in EGFR high-expressed cells.
Partitioning of Iron and Scandium in Soils Having Water Drainage Limitations
International Nuclear Information System (INIS)
Aide, M.; Braden, I.; Mueller, W.
2010-01-01
Soil chemistry of Fe includes weathering reactions, adsorption, hydrolysis, complexation, and oxidation-reduction reactions. Soil chemistry for scandium (Sc) is similar, but Sc does not include oxidation-reduction reactions. To determine if geochemical analysis may be used to identify Sc partitioning with respect to Fe among the particle size fractions, two Alfisol and two Ultisol soils were assessed using an aqua-regia digestion to estimate Sc and Fe concentrations for whole soil and particle size separates. Aqua-regia digestion data showed Sc depletion relative to Fe in sand separate. Sand separate is largely composed on quartz sand and Fe-Mn-bearing nodules, which are redoximorphic features produced by alternating oxic and suboxic/anoxic conditions associated with seasonally fluctuating water tables. Relative partitioning of Fe and Sc in these soils warrants further study to assess if selective extractions could quantify the extent of modern or ancestral oxidation-reduction processes responsible in some soil features involved in soil genesis.
Zhou, Chi-Chun; Dai, Wu-Sheng
2018-02-01
In statistical mechanics, for a system with a fixed number of particles, e.g. a finite-size system, strictly speaking, the thermodynamic quantity needs to be calculated in the canonical ensemble. Nevertheless, the calculation of the canonical partition function is difficult. In this paper, based on the mathematical theory of the symmetric function, we suggest a method for the calculation of the canonical partition function of ideal quantum gases, including ideal Bose, Fermi, and Gentile gases. Moreover, we express the canonical partition functions of interacting classical and quantum gases given by the classical and quantum cluster expansion methods in terms of the Bell polynomial in mathematics. The virial coefficients of ideal Bose, Fermi, and Gentile gases are calculated from the exact canonical partition function. The virial coefficients of interacting classical and quantum gases are calculated from the canonical partition function by using the expansion of the Bell polynomial, rather than calculated from the grand canonical potential.
Fan, Hailong; Jin, Zhaoxia
2014-04-28
Herein we report how to control the nanostructures and sizes of polystyrene-b-poly(2-vinylpyridine) (PS-b-P2VP) nanoparticles via manipulating freezing in solvent-exchange. By characterizing and analyzing the distinct structural features of the obtained nanoparticles, we recognized that micelle self-assembly happens in the precipitation of PS-b-P2VP when water is added into the block copolymer (BCP) solution. Solvent properties significantly influence micelle types that are vesicles in acetone/H2O and spherical micelles in tetrahydrofuran/H2O, respectively, thus further inducing different frozen nanostructures of the obtained nanoparticles, onion-like in acetone/H2O and large compound micelles in tetrahydrofuran/H2O. By changing the concentration of the block copolymers and the Vsolvent/VH2O ratio to modify the freezing stage at which block copolymer micelles are frozen, we can further control the size of the nanoparticles. Moreover, small molecules (phosphotungstic acid, pyrene, 1-pyrenebutyric acid) can be trapped into the block copolymer nanoparticles via the freezing process. Their distribution in the nanoparticles relies not only on the solvent property, but also on their interactions with block copolymers. The hybrid nanoparticles with ordered distribution of small molecules can be further changed to partially-void nanoparticles. Our study demonstrated that manipulating the freezing of block copolymers in the solvent exchange process is a simple and controllable fabrication method to generate BCP nanoparticles with different architectures.
International Nuclear Information System (INIS)
Usman, Muhammad; Siddiq, Mohammad
2013-01-01
Highlights: ► Free energy of adsorption is more negative than free energy of micellization. ► Shifts in UV/Visible spectra in presence of SDS indicated interaction of CLQ with SDS. ► The decrease in fluorescence intensity of HSA by CLQ shows its binding with HSA. -- Abstract: This manuscript addresses the physicochemical behavior of an antimalarial drug Chloroquine Diphosphate (CLQ) as well as its interaction with anionic surfactants and Human Serum Albumin (HSA). Surface tension and specific conductivity were employed to detect the critical micelle concentration (CMC) and thus its surface and thermodynamic parameters were calculated. Solubilization of this drug within micelles of anionic surfactant sodium dodecyl sulfate (SDS) has also been studied. UV/Visible spectroscopy was used to calculate partition coefficient (K x ), free energy of partition and number of drug molecules per micelle. The complexation of drug with HSA at physiological conditions (pH 7.4) has also been analyzed by using UV/Visible and fluorescence spectroscopy. The values of drug-protein binding constant, number of binding sites and free energy of binding were calculated
Preparation of Polymeric Micelles for use as Carriers of ...
African Journals Online (AJOL)
These micelles were characterized by dynamic light scattering, to measure the micelle diameter; by acid-base titration, to determine the percentage of carboxylic groups occupied by the tuberculostatic; by Sudan III solubility tests, to estimate the critical micelle concentration (CMC); and visual control and spectrophotometric ...
Energy Technology Data Exchange (ETDEWEB)
Xu, Jian [State Key Laboratory of Environmental Criteria and Risk Assessment, Chinese Research Academy of Environmental Sciences, Beijing 100012 (China); Laboratory of Riverine Ecological Conservation and Technology, Chinese Research Academy of Environmental Sciences, Beijing 100012 (China); Zhang, Yuan, E-mail: zhangyuan@craes.org.cn [State Key Laboratory of Environmental Criteria and Risk Assessment, Chinese Research Academy of Environmental Sciences, Beijing 100012 (China); Laboratory of Riverine Ecological Conservation and Technology, Chinese Research Academy of Environmental Sciences, Beijing 100012 (China); Zhou, Changbo [State Key Laboratory of Environmental Criteria and Risk Assessment, Chinese Research Academy of Environmental Sciences, Beijing 100012 (China); Guo, Changsheng; Wang, Dingming [State Key Laboratory of Environmental Criteria and Risk Assessment, Chinese Research Academy of Environmental Sciences, Beijing 100012 (China); Laboratory of Riverine Ecological Conservation and Technology, Chinese Research Academy of Environmental Sciences, Beijing 100012 (China); Du, Ping [State Key Laboratory of Environmental Criteria and Risk Assessment, Chinese Research Academy of Environmental Sciences, Beijing 100012 (China); Luo, Yi [College of Environmental Sciences and Engineering, Ministry of Education Key Laboratory of Pollution Processes and Environmental Criteria, Nankai University, Tianjin 300071 (China); Wan, Jun; Meng, Wei [State Key Laboratory of Environmental Criteria and Risk Assessment, Chinese Research Academy of Environmental Sciences, Beijing 100012 (China); Laboratory of Riverine Ecological Conservation and Technology, Chinese Research Academy of Environmental Sciences, Beijing 100012 (China)
2014-11-01
The occurrence of 15 antibiotics classified as sulphonamides, fluoroquinolones, macrolides, tetracyclines and trimethoprim in sediment, overlying water, and pore water matrices in Taihu Lake, China was studied. The total concentrations were from 4.1 μg/kg to 731 μg/kg, from 127 ng/L to 1210 ng/L, and from 1.5 ng/L to 216 ng/L in sediment, overlying water and pore water, respectively. Antibiotics in different locations originated from various sources, depending on human, agricultural and aquacultural activities. Composition analysis indicated that human-derived and animal-derived drugs significantly contributed to the total contamination of antibiotics in the lake, indicating the high complexity of contamination sources in Taihu Lake Basin. The in situ sediment–pore water partitioning coefficients were generally greater than sediment–overlying water partitioning coefficients, suggesting continuous inputs into the lake water. This study shows that antibiotics are ubiquitous in all compartments in Taihu Lake, and their potential hazards to the aquatic ecosystem need further investigation. - Highlights: • Antibiotics are ubiquitous in sediment, overlying water and pore water in Taihu Lake. • Antibiotics in Taihu Lake originated from human and nonhuman activities. • Ksp is higher than Ksw, indicating the continuous antibiotics input to lake water.
International Nuclear Information System (INIS)
Xu, Jian; Zhang, Yuan; Zhou, Changbo; Guo, Changsheng; Wang, Dingming; Du, Ping; Luo, Yi; Wan, Jun; Meng, Wei
2014-01-01
The occurrence of 15 antibiotics classified as sulphonamides, fluoroquinolones, macrolides, tetracyclines and trimethoprim in sediment, overlying water, and pore water matrices in Taihu Lake, China was studied. The total concentrations were from 4.1 μg/kg to 731 μg/kg, from 127 ng/L to 1210 ng/L, and from 1.5 ng/L to 216 ng/L in sediment, overlying water and pore water, respectively. Antibiotics in different locations originated from various sources, depending on human, agricultural and aquacultural activities. Composition analysis indicated that human-derived and animal-derived drugs significantly contributed to the total contamination of antibiotics in the lake, indicating the high complexity of contamination sources in Taihu Lake Basin. The in situ sediment–pore water partitioning coefficients were generally greater than sediment–overlying water partitioning coefficients, suggesting continuous inputs into the lake water. This study shows that antibiotics are ubiquitous in all compartments in Taihu Lake, and their potential hazards to the aquatic ecosystem need further investigation. - Highlights: • Antibiotics are ubiquitous in sediment, overlying water and pore water in Taihu Lake. • Antibiotics in Taihu Lake originated from human and nonhuman activities. • Ksp is higher than Ksw, indicating the continuous antibiotics input to lake water
Structural properties of self-assembled polymeric micelles
DEFF Research Database (Denmark)
Mortensen, K.
1998-01-01
At present, the thermodynamic understanding of complex copolymer systems is undergoing important developments. Block copolymers aggregate in selective solvents into micelles of various form and size depending on molecular architecture and interaction parameters. The micelles constitute the basis ...
Mechano-responsive hydrogels crosslinked by reactive block copolymer micelles
Xiao, Longxi
Hydrogels are crosslinked polymeric networks that can swell in water without dissolution. Owing to their structural similarity to the native extracelluar matrices, hydrogels have been widely used in biomedical applications. Synthetic hydrogels have been designed to respond to various stimuli, but mechanical signals have not incorporated into hydrogel matrices. Because most tissues in the body are subjected to various types of mechanical forces, and cells within these tissues have sophisticated mechano-transduction machinery, this thesis is focused on developing hydrogel materials with built-in mechano-sensing mechanisms for use as tissue engineering scaffolds or drug release devices. Self-assembled block copolymer micelles (BCMs) with reactive handles were employed as the nanoscopic crosslinkers for the construction of covalently crosslinked networks. BCMs were assembled from amphiphilic diblock copolymers of poly(n-butyl acrylate) and poly(acrylic acid) partially modified with acrylate. Radical polymerization of acrylamide in the presence of micellar crosslinkers gave rise to elastomeric hydrogels whose mechanical properties can be tuned by varying the BCM composition and concentration. TEM imaging revealed that the covalently integrated BCMs underwent strain-dependent reversible deformation. A model hydrophobic drug, pyrene, loaded into the core of BCMs prior to the hydrogel formation, was dynamically released in response to externally applied mechanical forces, through force-induced reversible micelle deformation and the penetration of water molecules into the micelle core. The mechano-responsive hydrogel has been studied for tissue repair and regeneration purposes. Glycidyl methacrylate (GMA)-modified hyaluronic acid (HA) was photochemically crosslinked in the presence of dexamethasone (DEX)-loaded crosslinkable BCMs. The resultant HA gels (HAxBCM) contain covalently integrated micellar compartments with DEX being sequestered in the hydrophobic core. Compared
Panagopoulos, Dimitri; Jahnke, Annika; Kierkegaard, Amelie; MacLeod, Matthew
2015-10-20
The sorption of cyclic volatile methyl siloxanes (cVMS) to organic matter has a strong influence on their fate in the aquatic environment. We report new measurements of the partition ratios between freshwater sediment organic carbon and water (KOC) and between Aldrich humic acid dissolved organic carbon and water (KDOC) for three cVMS, and for three polychlorinated biphenyls (PCBs) that were used as reference chemicals. Our measurements were made using a purge-and-trap method that employs benchmark chemicals to calibrate mass transfer at the air/water interface in a fugacity-based multimedia model. The measured log KOC of octamethylcyclotetrasiloxane (D4), decamethylcyclopentasiloxane (D5), and dodecamethylcyclohexasiloxane (D6) were 5.06, 6.12, and 7.07, and log KDOC were 5.05, 6.13, and 6.79. To our knowledge, our measurements for KOC of D6 and KDOC of D4 and D6 are the first reported. Polyparameter linear free energy relationships (PP-LFERs) derived from training sets of empirical data that did not include cVMS generally did not predict our measured partition ratios of cVMS accurately (root-mean-squared-error (RMSE) for logKOC 0.76 and for logKDOC 0.73). We constructed new PP-LFERs that accurately describe partition ratios for the cVMS as well as for other chemicals by including our new measurements in the existing training sets (logKOC RMSEcVMS: 0.09, logKDOC RMSEcVMS: 0.12). The PP-LFERs we have developed here should be further evaluated and perhaps recalibrated when experimental data for other siloxanes become available.
Estimation of water absorption coefficient using the TDR method
Suchorab, Zbigniew; Majerek, Dariusz; Brzyski, Przemysław; Sobczuk, Henryk; Raczkowski, Andrzej
2017-07-01
Moisture accumulation and transport in the building barriers is an important feature that influences building performance, causing serious exploitation problems as increased energy use, mold and bacteria growth, decrease of indoor air parameters that may lead to sick building syndrome (SBS). One of the parameters that is used to describe moisture characteristic of the material is water absorption coefficient being the measure of capillary behavior of the material as a function of time and the surface area of the specimen. As usual it is determined using gravimetric methods according to EN 1925:1999 standard. In this article we demonstrate the possibility of determination of water absorption coefficient of autoclaved aerated concrete (AAC) using the Time Domain Reflectometry (TDR) method. TDR is an electric technique that had been adopted from soil science and can be successfully used for real-time monitoring of moisture transport in building materials and envelopes. Data achieved using TDR readouts show high correlation with standard method of moisture absorptivity coefficient determination.
Hydrolytic Degradation of Poly (ethylene oxide)-block-Polycaprolactone Worm Micelles
Geng, Yan; Discher, Dennis E.
2005-01-01
Spherical micelles and nanoparticles made with degradable polymers have been of great interest for therapeutic application, but degradation induced changes in a spherical morphology can be subtle and mechanism/kinetics appears poorly understood. Here, we report the first preparation of giant and flexible worm micelles self-assembled from degradable copolymer poly (ethylene oxide)-block-polycaprolactone. Such worm micelles spontaneously shorten to generate spherical micelles, triggered by poly...
The partitioning of uranium and neptunium onto hydrothermally altered concrete
International Nuclear Information System (INIS)
Zhao, P.; Allen, P.G.; Sylwester, E.R.; Viani, B.E.
2000-01-01
Partition coefficients (K d ) of U(VI) and Np(V) on untreated and hydrothermally altered concrete were measured in 0.01 M NaCl and 0.01 M NaHCO 3 solutions as functions of concentration of the radionuclides, pH, and time. The partition coefficients for both U(VI) and Np(V) on hydrothermally altered concrete are significantly lower than those on untreated concrete. The partition of both U(VI) and Np(V) are pH dependent, although the pH dependence does not appear to reflect precipitation of U and Np-bearing phases. Both sorption and precipitation are likely processes controlling partitioning of U to concrete; sorption is the most likely process controlling the partitioning of Np to concrete. The presence of 0.01 M carbonate species in solution decreases K d of U(VI) for both hydrothermally altered and untreated concrete from ≥ 10 4 mL/g to ∝ 400 to 1000 mL/g indicating a significant impact on U(VI) sorption. In contrast, the presence of carbonate only reduced the K d of Np(V) by one order of magnitude or less. X-ray absorption spectroscopy analysis of U/concrete mixtures at different pHs and times indicate that uranyl ions are partitioned as monomeric species on untreated concrete, but oligomeric species on hydrothermally altered concrete. Similar analysis of Np/concrete mixtures shows that about half of the partitioned Np(V) is reduced to Np(IV) over a period of 6 months. (orig.)
Preparation of Polymeric Micelles for Use as Carriers of ...
African Journals Online (AJOL)
Erah
Tropical Journal of Pharmaceutical Research, December 2007; 6 (4): 815-824 ... by the tuberculostatic; by Sudan III solubility tests, to estimate the critical micelle concentration (CMC); ... Furthermore, the micelles were stable in vitro, exhibiting a low level of CMC and stronger anti- ... that take the form of micelles 5, 6, 7, 8.
Duarte, Bernardo; Silva, Gilda; Costa, José Lino; Medeiros, João Paulo; Azeda, Carla; Sá, Erica; Metelo, Inês; Costa, Maria José; Caçador, Isabel
2014-10-01
Worldwide estuarine ecosystems are by their privileged geographic location, anthropogenically impacted systems. Heavy metal contamination in estuarine waters and sediments are well known to be one of the most important outcomes driven from human activities. The partitioning of these elements has been widely focused, due to its importance not only on the estuarine biogeochemistry but also on its bioavailability to the trophic webs. As observed in other estuaries, in the Tagus basin, no increase in the partition coefficients with the increasing suspended particulate matter concentrations was observed, mostly due to a permanent dilution process of the suspended matter, rich in heavy metals and less contaminated and resuspended bottom sediments. Another important outcome of this study was the common origin of all the analysed heavy metals, probably due to the large industrialization process that the margins of the Tagus estuary suffered in the past, although no relationship was found with the presence of the different discharge areas. In fact, metal partitioning seems to be mostly influenced by the chemical species in which the pollutant is delivered to the system and on water chemistry, with a higher emphasis on the metal cycling essentially between the particulate and dissolved phase. This partitioning system acquires a relevant importance while evaluating the impacts of marine construction and the associated dredging operations, and consequent changes in the estuarine water chemistry.
Mendel, J; Thust, R; Schwarz, H
1982-01-01
The alkylating activity, chemical stability in aqueous solution (pH 7.0; 37 degrees C), and partition coefficient (octanol/water) of the following compounds were determined: 1-methyl-3-phenyl-1-nitrosourea (MPNU), 1-ethyl-3-phenyl-1-nitrosourea (EPNU), 1-isopropyl-3-phenyl-1-nitrosourea (i-PrPNU), 1-methyl-3-(p-fluorophenyl)-1-nitrosourea (F-MPNU), 1-methyl-3-(p-chlorophenyl)-1-nitrosourea (Cl-MPNU), 1-methyl-3-(p-bromophenyl)-1-nitrosourea (Br-MPNU), 1,3-dimethyl-3-phenyl-1-nitrosourea (DMPNU), and 1-methyl-3-naphthyl-1-nitrosocarbamate (NCA). 1-Methyl-1-nitrosourea (MNU) and 1-ethyl-1-nitrosourea (ENU) were used for the comparison. THe rate of decomposition in aqueous solution is discussed concerning the influences of the substituents at the 1- and 3-N-atom. The mono- and disubstituted N-nitrosoureas showed a coarse correlation between alkylating activity and SCE induction in Chinese hamster V 79-E cells. On the other hand, this correlation is missing in the case of NCA, which is a potent SCE inducer despite relatively low alkylating activity. DMPNU is the strongest SCE inducer, but this compound shows a high stability in aqueous solution and, consequently, we were not able to detect an alkylating activity.
Główka, Franciszek K; Romański, Michał; Siemiątkowska, Anna
2013-04-01
For the last decade an alkylating agent treosulfan (TREO) has been successfully applied in clinical trials in conditioning prior to hematopoietic stem cell transplantation. Pharmacological activity of the pro-drug depends on its epoxy-transformers, monoepoxide (S,S-EBDM) and diepoxide (S,S-DEB), which are formed in a non-enzymatic consecutive reaction accompanied by a release of methanesulfonic acid. In the present study partition coefficient n-octanol/water (POW) of TREO as well as its biologically active epoxy-transformers was determined empirically (applying a classical shake-flask method) and in silico for the first time. In vitro the partition was investigated at 37°C in the system composed of the pre-saturated n-octanol and 0.05 M acetate buffer pH 4.4 adjusted with sodium and potassium chloride to ionic strength of 0.16 M. Concentration of the analytes was quantified by reversed-phase high performance liquid chromatography (RP-HPLC) method in which retention time increased from S,S-DEB to TREO. It was shown that neither association nor dissociation of the tested compounds in the applied phases occurred. Calculated logPOW (TREO: -1.58±0.04, S,S-EBDM: -1.18±0.02, S,S-DEB: -0.40±0.03) indicate the hydrophilic character of the all three entities, corresponding to its pharmacokinetic parameters described in the literature. Experimentally determined logPOW of the compounds were best comparable to the values predicted by algorithm ALOGPs. Interestingly, the POW values determined in vitro as well as in silico were inversely correlated with the retention times observed in the endcapped RP-HPLC column. It might be explained by the fact that a cleavage of methansulfonic acid from a small molecule of TREO generates significant changes in the molecular structure. Consequently, despite the common chemical origin, TREO, S,S-EBDM and S,S-DEB do not constitute a 'congeneric' series of compounds. We concluded that this might occur in other low-weight species, therefore
Synthesis of Cross-Linked Polymeric Micelle pH Nanosensors
DEFF Research Database (Denmark)
Ek, Pramod Kumar; Jølck, Rasmus Irming; Andresen, Thomas Lars
2015-01-01
The design flexibility that polymeric micelles offer in the fabrication of optical nanosensors for ratiometric pH measurements is investigated. pH nanosensors based on polymeric micelles are synthesized either by a mixed-micellization approach or by a postmicelle modification strategy. In the mixed......-micellization approach, self-assembly of functionalized unimers followed by shell cross-linking by copper-catalyzed azide-alkyne cycloaddition (CuAAC) results in stabilized cRGD-functionalized micelle pH nanosensors. In the postmicelle modification strategy, simultaneous cross-linking and fluorophore conjugation...... at the micelle shell using CuAAC results in a stabilized micelle pH nanosensor. Compared to the postmicelle modification strategy, the mixed-micellization approach increases the control of the overall composition of the nanosensors.Both approaches provide stable nanosensors with similar pKa profiles and thereby...
DEFF Research Database (Denmark)
Larsen, Thomas; Kjeldsen, Peter; Christensen, Thomas Højlund
1992-01-01
area of the aquifer materials as a second regression parameter did not significantly improve the correlation. Estimated Koc values were up to 3 times higher than those predicted from regression equations based on the octanol-water partition coefficient. The reason for this is not known, but may...
Partition instability in water-immersed granular systems.
Clement, C P; Pacheco-Martinez, H A; Swift, Michael R; King, P J
2009-07-01
It is well known that a system of grains, vibrated vertically in a cell divided into linked columns, may spontaneously move into just one of the columns due to the inelastic nature of their collisions. Here we study the behavior of a water-immersed system of spherical barium titanate particles in a rectangular cell which is divided into two columns, linked by two connecting holes, one at the top and one at the bottom of the cell. Under vibration the grains spontaneously move into just one of the columns via a gradual transfer of grains through the connecting hole at the base of the cell. We have developed numerical simulations that are able to reproduce this behavior and provide detailed information on the instability mechanism. We use this knowledge to propose a simple analytical model for this fluid-driven partition instability based on two coupled granular beds vibrated within an incompressible fluid.
Araya, A.; Stroosnijder, L.; Girmay, G.; Keesstra, S.D.
2011-01-01
In the semi-arid region of Tigray, Northen Ethiopia a two season experiment was conducted to measure evapotranspiration, estimate yield response to water stress and derive the crop coefficient of teff using the single crop coefficient approach with simple, locally made lysimeters and field plots.
International Nuclear Information System (INIS)
Moody, R.P.; Carroll, J.M.; Kresta, A.M.
1987-01-01
Two novel methods are reported for measuring octanol/water partition rates of pesticides. A liquid scintillation counting (LSC) method was developed for automated monitoring of 14 C-labeled pesticides partitioning in biphasic water/octanol cocktail systems with limited success. A high performance liquid chromatography (HPLC) method was developed for automated partition rate monitoring of several constituents in a pesticide mixture, simultaneously. The mean log Kow +/- SD determined from triplicate experimental runs were for: 2,4-D-DMA (2,4-dichlorophenoxyacetic acid dimethylamine), 0.65 +/- .17; Deet (N,N-diethyl-m-toluamide), 2.02 +/- .01; Guthion (O,O-dimethyl-S-(4-oxo-1,2,3-benzotriazin-3(4H)-ylmethyl) phosphorodithioate), 2.43 +/- .03; Methyl-Parathion (O,O-dimethyl-O-(p-nitrophenyl) phosphorothioate), 2.68 +/- .05; and Fenitrothion (O,O-dimethyl O-(4-nitro-m-tolyl) phosphorothioate), 3.16 +/- .03. A strong positive linear correlation (r = .9979) was obtained between log Kow and log k' (log Kow = 2.35 (log k') + 0.63). The advantages that this automated procedure has in comparison with the standard manual shake-flask procedure are discussed
Engineering single-polymer micelle shape using nonuniform spontaneous surface curvature
Moths, Brian; Witten, T. A.
2018-03-01
Conventional micelles, composed of simple amphiphiles, exhibit only a few standard morphologies, each characterized by its mean surface curvature set by the amphiphiles. Here we demonstrate a rational design scheme to construct micelles of more general shape from polymeric amphiphiles. We replace the many amphiphiles of a conventional micelle by a single flexible, linear, block copolymer chain containing two incompatible species arranged in multiple alternating segments. With suitable segment lengths, the chain exhibits a condensed spherical configuration in solution, similar to conventional micelles. Our design scheme posits that further shapes are attained by altering the segment lengths. As a first study of the power of this scheme, we demonstrate the capacity to produce long-lived micelles of horseshoe form using conventional bead-spring simulations in two dimensions. Modest changes in the segment lengths produce smooth changes in the micelle's shape and stability.
Hydrology and empire: the Nile, water imperialism and the partition of Africa.
Tvedt, Terje
2011-01-01
Why did the British march up the Nile in the 1890s? The answers to this crucial question of imperial historiography have direct relevance for narratives and theories about imperialism, in general, and the partition of Africa in the nineteenth century, in particular. They will also influence our understanding of some of the main issues in the modern history of the whole region, including state developments and resource utilisation. This article presents an alternative to dominant interpretations of the partition of Africa and the role of British Nile policies in this context. It differs from mainstream diplomatic history, which dominates this research field, in its emphasis on how geographical factors and the hydrological characteristics of the Nile influenced and framed British thinking and actions in the region. Realising the importance of such factors and the specific character of the regional water system does not imply less attention to traditional diplomatic correspondence or to the role of individual imperial entrepreneurs. The strength of this analytical approach theoretically is that it makes it possible to locate the intentions and acts of historical subjects within specific geographical contexts. Empirically, it opens up a whole new set of source material, embedding the reconstruction of the British Nile discourse in a world of Nile plans, water works and hydrological discourses.
Krechmer, Jordan E; Day, Douglas A; Ziemann, Paul J; Jimenez, Jose L
2017-10-17
Secondary organic aerosols (SOA) are a major contributor to fine particulate mass and wield substantial influences on the Earth's climate and human health. Despite extensive research in recent years, many of the fundamental processes of SOA formation and evolution remain poorly understood. Most atmospheric aerosol models use gas/particle equilibrium partitioning theory as a default treatment of gas-aerosol transfer, despite questions about potentially large kinetic effects. We have conducted fundamental SOA formation experiments in a Teflon environmental chamber using a novel method. A simple chemical system produces a very fast burst of low-volatility gas-phase products, which are competitively taken up by liquid organic seed particles and Teflon chamber walls. Clear changes in the species time evolution with differing amounts of seed allow us to quantify the particle uptake processes. We reproduce gas- and aerosol-phase observations using a kinetic box model, from which we quantify the aerosol mass accommodation coefficient (α) as 0.7 on average, with values near unity especially for low volatility species. α appears to decrease as volatility increases. α has historically been a very difficult parameter to measure with reported values varying over 3 orders of magnitude. We use the experimentally constrained model to evaluate the correction factor (Φ) needed for chamber SOA mass yields due to losses of vapors to walls as a function of species volatility and particle condensational sink. Φ ranges from 1-4.
Directory of Open Access Journals (Sweden)
X. T. Cao
2017-10-01
Full Text Available A pH-triggered drug delivery system of degradable core cross-linked (CCL prodrug micelles was prepared by click chemistry. Doxorubicin conjugated block copolymers of azido functional poly(ethylene oxide-b-poly(glycidyl methacrylate were synthesized by the combination of RAFT polymerization, epoxide ring-opening reaction, and acid-cleavable hydrazone linkages. The CCL prodrug micelles were produced by the reaction of dipropargyl 3,3′-dithiodipropionate and dipropargyl adipate cross-linking agents with the azido groups of the micellar core via alkyne-azide click reaction, which were denoted as CCL/SS and CCL/noSS, respectively. The TEM images of CCL/SS prodrug micelles showed a spherical shape with the average diameter of 61.0 nm from water, and the shape was maintained with an increased diameter upon dilution with 5-fold DMF. The high DOX conjugation efficiency was 88.4%. In contrast to a very slow DOX release from CCL/SS prodrug micelles under the physiological condition (pH 7.4, the drug release is much faster (90% at pH 5.0 and 10 mM of GSH after 96 h. The cytotoxicity test and confocal laser scanning microscopy analysis revealed that CCL/SS prodrug micelles had much enhanced intracellular drug release capability in HepG2 cells than CCL/noSS prodrug micelles.
DEFF Research Database (Denmark)
Khandelia, Himanshu; Kaznessis, Yiannis N
2005-01-01
We have carried out a 40-ns all-atom molecular dynamics simulation of the helical antimicrobial peptide ovispirin-1 (OVIS) in a zwitterionic diphosphocholine (DPC) micelle. The DPC micelle serves as an economical and effective model for a cellular membrane owing to the presence of a choline...... headgroup, which resembles those of membrane phospholipids. OVIS, which was initially placed along a micelle diameter, diffuses out to the water-DPC interface, and the simulation stabilizes to an interface-bound steady state in 40 ns. The helical content of the peptide marginally increases in the process...... in the micellar core and the polar side chains protruding into the aqueous phase. There is overwhelming evidence that points to the significant and indispensable participation of hydrophobic residues in binding to the zwitterionic interface. The simulation starts with a conformation that is unbiased toward...
DEFF Research Database (Denmark)
Khandelia, Himanshu; Kaznessis, Yiannis N
2005-01-01
We report long time scale simulations of the 18-residue helical antimicrobial peptide ovispirin-1 and its analogs novispirin-G10 and novispirin-T7 in SDS micelles. The SDS micelle serves as an economical and effective model for a cellular membrane. Ovispirin, which is initially placed along...... a micelle diameter, diffuses out to the water-SDS interface and stabilizes to an interface-bound steady state in 16.35 ns of simulation. The final conformation, orientation, and the structure of ovispirin are in good agreement with the experimentally observed properties of the peptide in presence of lipid...... bilayers. The simulation succeeds in capturing subtle differences of the membrane-bound peptide structure as predicted by solid state NMR. The novispirins also undergo identical diffusion patterns and similar final conformations. Although the final interface-bound states are similar, the simulations...
Xu, Xin-sheng; Shi, Lei; Liu, Yi; Ji, Xue-han; Cui, Zhi-feng
2011-04-01
Time-resolved electron spin resonance has been used to study quenching reactions between the antioxidant Vitamin C (VC) and the triplet excited states of 9,10-phenanthrenequinone (PAQ) in ethylene glycol-water (EG-H2O) homogeneous and inhomogeneous reversed micelle solutions. Reversed micelle solutions were used to be the models of physiological environment of biological cell and tissue. In PAQ/EG-H2O homogeneous solution, the excited triplet of PAQ (3PAQ*) abstracts hydrogen atom from solvent EG. In PAQ/VC/EG-H2O solution, 3PAQ* abstracts hydrogen atom not only from solvent EG but also from VC. The quenching rate constant of 3PAQ* by VC is close to the diffusion-controlled value of 1.41 × 108 L/(mol ·s). In hexadecyltrimethylammonium bromide (CTAB)/EG-H2O and aerosol OT (AOT)/EG-H2O reversed micelle solutions, 3PAQ* and VC react around the water-oil interface of the reversed micelle. Exit of 3PAQ* from the lipid phase slows down the quenching reaction. For Triton X-100 (TX-100)/EG-H2O reversed micelle solution, PAQ and VC coexist inside the hydrophilic polyethylene glycol core, and the quenching rate constant of 3PAQ* by VC is larger than those in AOT/EG-H2O and CTAB/EG-H2O reversed micelle solutions, even a little larger than that in EG-H2O homogeneous solution. The strong emissive chemically induced dynamic electron polarization of As.- resulted from the effective TM spin polarization transfer in hydrogen abstraction of 3PAQ* from VC.
Radiolabeling of liposomes and polymeric micelles with PET-isotopes
Energy Technology Data Exchange (ETDEWEB)
Ingemann Jensen, A.T.
2013-06-01
This thesis is divided into three separate chapters that can be read independently. Chapter 1 is a general introduction, touching upon liposomes and polymeric micelles and radiolabeling with 18F and 64Cu. Chapter 2 and 3 address two separate research projects, each described below. A complete reference list is compiled in the end, immediately after the three chapters. This is followed by the supplementary information, divided into appropriate sections. Finally, the two first-authored manuscripts are attached as appendices. Chapter 1. The field of nanoparticulate drug delivery has been hailed as a revolution in modern therapeutics, especially in chemotherapy. A major reason is the ability of nanoparticles to accumulate in tumor tissue. Liposomes are the classic nanoparticle, consisting of a lipid membrane with an aqueous core. Polymeric micelles are made from amphiphilic detergent-like copolymers, that self-assemble in water. Therapy with nanoparticles is hampered by often poor tumor accumulation, combined with massive uptake by macrophages in the liver and spleen. For this reason, visualizing nanoparticle pharmacokinetics in-vivo is a valuable tool in the on-going research. Such visualization can be done by labeling with radio isotopes. Isotopes that emit positrons (PET-isotopes) can be detected by PET (positron emission tomography) technology, an accurate technique that has gained popularity in recent years. PET-isotopes of interest include 18F and 64Cu. In addition to being a research tool, radiolabeled nanoparticles hold promise as a radiopharmaceutical in themselves, as a means of imaging tumor tissue, aiding in diagnosis and surgery. Chapter 2. A method for labeling liposomes with 18F (97% positron decay, T = 110 min) was investigated. 18F is widely available, but is hampered by a short half-life only allowing up to 8 hours scans. 18F must be covalently attached to components of the liposome. By binding to a lipid, it can be stably lodged in the membrane. A
Radiolabeling of liposomes and polymeric micelles with PET-isotopes
International Nuclear Information System (INIS)
Ingemann Jensen, A.T.
2013-01-01
This thesis is divided into three separate chapters that can be read independently. Chapter 1 is a general introduction, touching upon liposomes and polymeric micelles and radiolabeling with 18F and 64Cu. Chapter 2 and 3 address two separate research projects, each described below. A complete reference list is compiled in the end, immediately after the three chapters. This is followed by the supplementary information, divided into appropriate sections. Finally, the two first-authored manuscripts are attached as appendices. Chapter 1. The field of nanoparticulate drug delivery has been hailed as a revolution in modern therapeutics, especially in chemotherapy. A major reason is the ability of nanoparticles to accumulate in tumor tissue. Liposomes are the classic nanoparticle, consisting of a lipid membrane with an aqueous core. Polymeric micelles are made from amphiphilic detergent-like copolymers, that self-assemble in water. Therapy with nanoparticles is hampered by often poor tumor accumulation, combined with massive uptake by macrophages in the liver and spleen. For this reason, visualizing nanoparticle pharmacokinetics in-vivo is a valuable tool in the on-going research. Such visualization can be done by labeling with radio isotopes. Isotopes that emit positrons (PET-isotopes) can be detected by PET (positron emission tomography) technology, an accurate technique that has gained popularity in recent years. PET-isotopes of interest include 18F and 64Cu. In addition to being a research tool, radiolabeled nanoparticles hold promise as a radiopharmaceutical in themselves, as a means of imaging tumor tissue, aiding in diagnosis and surgery. Chapter 2. A method for labeling liposomes with 18F (97% positron decay, T = 110 min) was investigated. 18F is widely available, but is hampered by a short half-life only allowing up to 8 hours scans. 18F must be covalently attached to components of the liposome. By binding to a lipid, it can be stably lodged in the membrane. A
Vibrational dynamics of ice in reverse micelles
Dokter, A.M.; Petersen, C.; Woutersen, S.; Bakker, H.J.
2008-01-01
he ultrafast vibrational dynamics of HDO:D2O ice at 180 K in anionic reverse micelles is studied by midinfrared femtosecond pump-probe spectroscopy. Solutions containing reverse micelles are cooled to low temperatures by a fast-freezing procedure. The heating dynamics of the micellar solutions is
Casein polymorphism heterogeneity influences casein micelle size in milk of individual cows.
Day, L; Williams, R P W; Otter, D; Augustin, M A
2015-06-01
Milk samples from individual cows producing small (148-155 nm) or large (177-222 nm) casein micelles were selected to investigate the relationship between the individual casein proteins, specifically κ- and β-casein phenotypes, and casein micelle size. Only κ-casein AA and β-casein A1A1, A1A2 and A2A2 phenotypes were found in the large casein micelle group. Among the small micelle group, both κ-casein and β-casein phenotypes were more diverse. κ-Casein AB was the dominant phenotype, and 3 combinations (AA, AB, and BB) were present in the small casein micelle group. A considerable mix of β-casein phenotypes was found, including B and I variants, which were only found in the small casein micelle group. The relative amount of κ-casein to total casein was significantly higher in the small micelle group, and the nonglycosylated and glycosylated κ-casein contents were higher in the milks with small casein micelles (primarily with κ-casein AB and BB variants) compared with the large micelle group. The ratio of glycosylated to nonglycosylated κ-casein was higher in the milks with small casein micelles compared with the milks with large casein micelles. This suggests that although the amount of κ-casein (both glycosylated and nonglycosylated) is associated with micelle size, an increased proportion of glycosylated κ-casein could be a more important and favorable factor for small micelle size. This suggests that the increased spatial requirement due to addition of the glycosyl group with increasing extent of glycosylation of κ-casein is one mechanism that controls casein micelle assembly and growth. In addition, increased electrostatic repulsion due to the sialyl residues on the glycosyl group could be a contributory factor. Copyright © 2015 American Dairy Science Association. Published by Elsevier Inc. All rights reserved.
Soluplus/TPGS mixed micelles for dioscin delivery in cancer therapy.
Zhao, Jing; Xu, Youwei; Wang, Changyuan; Ding, Yanfang; Chen, Manyu; Wang, Yifei; Peng, Jinyong; Li, Lei; Lv, Li
2017-07-01
Dioscin has shown cytotoxicity against cancer cells, but its poor solubility and stability have limited its clinical application. In this study, we designed mixed micelles composed of TPGS and Soluplus ® copolymers entrapping the poorly soluble anticancer drug dioscin. In order to improve the aqueous solubility and bioactivity of dioscin, TPGS/Soluplus ® mixed micelles with an optimal ratio were prepared using a thin-film hydration method, and their physicochemical properties were characterized. Cellular cytotoxicity and uptake of the dioscin-loaded TPGS/Soluplus ® mixed micelles were studied in MCF-7 breast cancer cells and A2780s ovarian cancer cells. The pharmacokinetics of free dioscin and dioscin-loaded TPGS/Soluplus ® mixed micelles was studied in vivo in male Sprague-Dawley rats via a single intravenous injection in the tail vein. The average size of the optimized mixed micelle was 67.15 nm, with 92.59% drug encapsulation efficiency and 4.63% drug loading efficiency. The in vitro release profile showed that the mixed micelles presented sustained release behavior compared to the anhydrous ethanol solution of dioscin. In vitro cytotoxicity assays were conducted on human cancer cell lines including A2780s ovarian cancer cells and MCF-7 breast cancer cells. The mixed micelles exhibited better antitumor activity compared to free dioscin against all cell lines, which may benefit from the significant increase in the cellular uptake of dioscin from mixed micelles compared to free dioscin. The pharmacokinetic study showed that the mixed micelle formulation achieved a 1.3 times longer mean residual time (MRT) in circulation and a 2.16 times larger area under the plasma concentration-time curve (AUC) than the free dioscin solution. Our results suggest that the dioscin-loaded mixed micelles developed in this study might be a potential nano drug-delivery system for cancer chemotherapy.
Directory of Open Access Journals (Sweden)
C. Wang
2017-06-01
Full Text Available Gas–particle partitioning governs the distribution, removal, and transport of organic compounds in the atmosphere and the formation of secondary organic aerosol (SOA. The large variety of atmospheric species and their wide range of properties make predicting this partitioning equilibrium challenging. Here we expand on earlier work and predict gas–organic and gas–aqueous phase partitioning coefficients for 3414 atmospherically relevant molecules using COSMOtherm, SPARC Performs Automated Reasoning in Chemistry (SPARC, and poly-parameter linear free-energy relationships. The Master Chemical Mechanism generated the structures by oxidizing primary emitted volatile organic compounds. Predictions for gas–organic phase partitioning coefficients (KWIOM/G by different methods are on average within 1 order of magnitude of each other, irrespective of the numbers of functional groups, except for predictions by COSMOtherm and SPARC for compounds with more than three functional groups, which have a slightly higher discrepancy. Discrepancies between predictions of gas–aqueous partitioning (KW/G are much larger and increase with the number of functional groups in the molecule. In particular, COSMOtherm often predicts much lower KW/G for highly functionalized compounds than the other methods. While the quantum-chemistry-based COSMOtherm accounts for the influence of intra-molecular interactions on conformation, highly functionalized molecules likely fall outside of the applicability domain of the other techniques, which at least in part rely on empirical data for calibration. Further analysis suggests that atmospheric phase distribution calculations are sensitive to the partitioning coefficient estimation method, in particular to the estimated value of KW/G. The large uncertainty in KW/G predictions for highly functionalized organic compounds needs to be resolved to improve the quantitative treatment of SOA formation.
Stable and biocompatible genipin-inducing interlayer-crosslinked micelles for sustained drug release
Energy Technology Data Exchange (ETDEWEB)
Dai, Yu; Zhang, Xiaojin, E-mail: zhangxj@cug.edu.cn [China University of Geosciences, Faculty of Materials Science and Chemistry (China)
2017-05-15
To develop the sustained drug release system, here we describe genipin-inducing interlayer-crosslinked micelles crosslinked via Schiff bases between the amines of amphiphilic linear-hyperbranched polymer poly(ethylene glycol)-branched polyethylenimine-poly(ε-caprolactone) (PEG-PEI-PCL) and genipin. The generation of Schiff bases was confirmed by the color changes and UV-Vis absorption spectra of polymeric micelles after adding genipin. The particle size, morphology, stability, in vitro cytotoxicity, drug loading capacity, and in vitro drug release behavior of crosslinked micelles as well as non-crosslinked micelles were characterized. The results indicated that genipin-inducing interlayer-crosslinked micelles had better stability and biocompatibility than non-crosslinked micelles and glutaraldehyde-inducing interlayer-crosslinked micelles. In addition, genipin-inducing interlayer-crosslinked micelles were able to improve drug loading capacity, reduce the initial burst release, and achieve sustained drug release.
Adams, Monica; Kwon, Glen S
2004-11-22
To investigate the relative aggregation state of amphotericin B (AmB) during loading and reconstitution of polymeric micelles. Hexanoate and stearate derivatives of PEO-b-p (L-Asp) were prepared. The polymers and AmB were dissolved in methanol (MeOH). Milli-Q water was then added slowly, and the MeOH was removed via rotary evaporation. The solutions were freeze-dried in the presence of trehalose. During micelle preparation, the aggregation state of AmB was assessed using absorption spectroscopy. Upon reconstitution, the samples were analyzed using vapor-pressure osmometry, size-exclusion chromatography (SEC), and absorption spectroscopy. The absorption spectrum of AmB in the presence of the block copolymers was compared to that of AmB alone under the same conditions. AmB was loaded into micelles prepared from acyl derivatives of PEO-b-p (L-Asp). Absorption spectroscopy indicated that the aggregation state was preserved during the loading process. AmB exists in a self-aggregated state in polymeric micelles containing hexanoate ester cores and in a relatively monomeric state in polymeric micelles containing stearate ester cores. Vapor-pressure osmometry confirmed the isotonicity of the formulations, while SEC indicated that the micelles were approximately 10(6) g/mol. Depending on the polymer structure and assembly conditions, it is possible to encapsulate AmB in a relatively nonaggregated or aggregated state in micelles prepared from acyl derivatives of PEO-b-p (L-Asp). In polymeric micelles containing stearate side chains, AmB was loaded in a nearly monomeric state, possibly due to interaction with the stearate side chains. The final aggregation state of the drug is preserved during lyophilization and reconstitution of polymeric micelles prepared by a novel solvent evaporation procedure.
Directory of Open Access Journals (Sweden)
Thi-Quynh-Mai Tran
2016-08-01
Full Text Available Acne is the over growth of the commensal bacteria Propionibacterium acnes (P. acnes on human skin. Lauric acid (LA has been investigated as an effective candidate to suppress the activity of P. acnes. Although LA is nearly insoluble in water, dimethyl sulfoxide (DMSO has been reported to effectively solubilize LA. However, the toxicity of DMSO can limit the use of LA on the skin. In this study, LA-loaded poly(ɛ-caprolactone-poly(ethylene glycol-poly(ɛ-caprolactone micelles (PCL-PEG-PCL were developed to improve the bactericidal effect of free LA on P. acnes. The block copolymers mPEG-PCL and PCL-PEG-PCL with different molecular weights were synthesized and characterized using 1H Nuclear Magnetic Resonance spectroscopy (1H NMR, Fourier-transform infrared spectroscopy (FT-IR, Gel Permeation Chromatography (GPC, and Differential Scanning Calorimetry (DSC. In the presence of LA, mPEG-PCL diblock copolymers did not self-assemble into nano-sized micelles. On the contrary, the average particle sizes of the PCL-PEG-PCL micelles ranged from 50–198 nm for blank micelles and 27–89 nm for LA-loaded micelles. The drug loading content increased as the molecular weight of PCL-PEG-PCL polymer increased. Additionally, the minimum inhibitory concentration (MIC and the minimum bactericidal concentration (MBC of free LA were 20 and 80 μg/mL, respectively. The MICs and MBCs of the micelles decreased to 10 and 40 μg/mL, respectively. This study demonstrated that the LA-loaded micelles are a potential treatment for acne.
Chen, Ying; Cai, Xiaoyu; Jiang, Long; Li, Yu
2016-02-01
Based on the experimental data of octanol-air partition coefficients (KOA) for 19 polychlorinated biphenyl (PCB) congeners, two types of QSAR methods, comparative molecular field analysis (CoMFA) and comparative molecular similarity indices analysis (CoMSIA), are used to establish 3D-QSAR models using the structural parameters as independent variables and using logKOA values as the dependent variable with the Sybyl software to predict the KOA values of the remaining 190 PCB congeners. The whole data set (19 compounds) was divided into a training set (15 compounds) for model generation and a test set (4 compounds) for model validation. As a result, the cross-validation correlation coefficient (q(2)) obtained by the CoMFA and CoMSIA models (shuffled 12 times) was in the range of 0.825-0.969 (>0.5), the correlation coefficient (r(2)) obtained was in the range of 0.957-1.000 (>0.9), and the SEP (standard error of prediction) of test set was within the range of 0.070-0.617, indicating that the models were robust and predictive. Randomly selected from a set of models, CoMFA analysis revealed that the corresponding percentages of the variance explained by steric and electrostatic fields were 23.9% and 76.1%, respectively, while CoMSIA analysis by steric, electrostatic and hydrophobic fields were 0.6%, 92.6%, and 6.8%, respectively. The electrostatic field was determined as a primary factor governing the logKOA. The correlation analysis of the relationship between the number of Cl atoms and the average logKOA values of PCBs indicated that logKOA values gradually increased as the number of Cl atoms increased. Simultaneously, related studies on PCB detection in the Arctic and Antarctic areas revealed that higher logKOA values indicate a stronger PCB migration ability. From CoMFA and CoMSIA contour maps, logKOA decreased when substituents possessed electropositive groups at the 2-, 3-, 3'-, 5- and 6- positions, which could reduce the PCB migration ability. These results are
Wang, Jixue; Shen, Kexin; Xu, Weiguo; Ding, Jianxun; Wang, Xiaoqing; Liu, Tongjun; Wang, Chunxi; Chen, Xuesi
2015-05-01
Nanoscale polymeric micelles have attracted more and more attention as a promising nanocarrier for controlled delivery of antineoplastic drugs. Herein, the doxorubicin (DOX)-loaded poly(D-lactide)-based micelle (PDM/DOX), poly(L-lactide)-based micelle (PLM/DOX), and stereocomplex micelle (SCM/DOX) from the equimolar mixture of the enantiomeric four-armed poly(ethylene glycol)-polylactide (PEG-PLA) copolymers were successfully fabricated. In phosphate-buffered saline (PBS) at pH 7.4, SCM/DOX exhibited the smallest hydrodynamic diameter ( D h) of 90 ± 4.2 nm and the slowest DOX release compared with PDM/DOX and PLM/DOX. Moreover, PDM/DOX, PLM/DOX, and SCM/DOX exhibited almost stable D hs of around 115, 105, and 90 nm at above normal physiological condition, respectively, which endowed them with great potential in controlled drug delivery. The intracellular DOX fluorescence intensity after the incubation with the laden micelles was different degrees weaker than that incubated with free DOX · HCl within 12 h, probably due to the slow DOX release from micelles. As the incubation time reached to 24 h, all the cells incubated with the laden micelles, especially SCM/DOX, demonstrated a stronger intracellular DOX fluorescence intensity than free DOX · HCl-cultured ones. More importantly, all the DOX-loaded micelles, especially SCM/DOX, exhibited potent antineoplastic efficacy in vitro, excellent serum albumin-tolerance stability, and satisfactory hemocompatibility. These encouraging data indicated that the loading micelles from nonlinear enantiomeric copolymers, especially SCM/DOX, might be promising in clinical systemic chemotherapy through intravenous injection.
Liu, Nijuan; He, Qun; Bu, Weifeng
2015-03-03
Intra- and intermolecular interactions of star polymers in dilute solutions are of fundamental importance for both theoretical interest and hierarchical self-assembly into functional nanostructures. Here, star micelles with a polystyrene corona and a small ionic core bearing platinum(II) complexes have been regarded as a model of star polymers to mimic their intra- and interstar interactions and self-assembled behaviors in solvents of weakening quality. In the chloroform/methanol mixture solvents, the star micelles can self-assemble to form vesicles, in which the star micelles shrink significantly and are homogeneously distributed on the vesicle surface. Unlike the morphological evolution of conventional amphiphiles from micellar to vesicular, during which the amphiphilic molecules are commonly reorganized, the star micelles still retain their core-shell nanostructures in the vesicles and the coronal chains of the star micelle between the ionic cores are fully interpenetrated.
Baltussen, H.A.; Sandra, P.J.F.; David, F.; Janssen, J.G.M.; Cramers, C.A.M.G.
1999-01-01
Recently several publications appeared correlating octanol-water partitioning coefficients (KO/W) with solid-phase microextraction (SPME) extraction coefficients on poly(dimethylsiloxane) (PDMS) fibers. This correlation seems very good for medium-polar to polar compounds but cannot explain the
Li, Jie; Yao, Shu; Wang, Kai; Lu, Zaijun; Su, Xuantao; Li, Li; Yuan, Cunzhong; Feng, Jinbo; Yan, Shi; Kong, Beihua; Song, Kun
2018-04-04
Photodynamic therapy (PDT) is considered as an innovative and attractive modality to treat ovarian cancer. In this study, a biodegradable polymer poly (ethylene glycol)-poly (lactic acid)(PLA)-folate (FA-PEG-PLA) was prepared in order to synthesize an active targeting, water soluble and pharmacomodulated photosensitizer nano-carriers. The drug loading content, encapsulation efficiency, in vitro and in vivo release were characterized, in which HB/FA-PEG-PLA micelles had a high encapsulation efficiency and much slower control release for drugs compared to free drugs (pHB/FA-PEG-PLA micelles, the cellular uptake study in vitro were tested, which owned significantly enhanced uptake of HB/FA-PEG-PLA micelles in SKOV3 (FR+) compared to A2780 cancer cells (FR-). The enhanced uptake of HB/FA-PEG-PLA micelles to cancer cells resulted in a more effective post-PDT killing of SKOV3 cells compared to plain micelles and free drugs. Binding and uptake of HB/FA-PEG-PLA micelles by SKOV3 cells were also observed in vivo after intraperitoneal injection of folate targeted micelles in tumor-bearing ascitic ovarian cancer animals. The drug levels in ascitic tumor tissues were increased by 20-fold (pHB-loaded micelles were mainly distributed in kidney and liver (the main clearance organs) in biodistribution. These results demonstrated that our new developed PDT photosensitizer HB/FA-PEG-PLA micelles has a high drug-loading capacity, good biocompatibility, control drug release, and enhanced targeting and antitumor effect, which is a potential approach to future targeting ovarian cancer therapy. This article is protected by copyright. All rights reserved. This article is protected by copyright. All rights reserved.
Li, Yi-Long; He, Wei; Liu, Wen-Xiu; Kong, Xiang-Zhen; Yang, Bin; Yang, Chen; Xu, Fu-Liu
2015-11-01
The complexation flocculation (CF) method was successfully employed to identify binding coefficients (Kdoc) of specific organic contaminants to dissolved organic matter (DOM, often indicated by dissolved organic carbon, DOC) in a multi-contaminant hydrophobic organic contaminant (HOC) system. Kdoc values were obtained for most of the evaluated 33 HOCs, indicating the feasibility and applicability of the CF method in a multi-contaminant system. Significant positive correlations were observed between binding coefficients and octanol-water partition coefficients (Kow) for organic halogen compounds, such as polybrominated diphenyl ethers (PBDEs) (R(2) = 0.95, p mechanisms between PAHs and organic halogen compounds exist. These differences further result in discriminative competition partitions of HOCs between DOM and organisms. Assuming that only freely dissolved HOCs are bioconcentrative, the results of DOM-influenced bioconcentration factor (BCFDOM) and DOM-influenced lowest observed effect level (LOELDOM) indicate that the ecological risk of HOCs is decreased by DOM. Copyright © 2015 Elsevier Ltd. All rights reserved.
A neutron scattering study of triblock copolymer micelles
Energy Technology Data Exchange (ETDEWEB)
Gerstenberg, M.C.
1997-11-01
The thesis describes the neutron scattering experiments performed on poly(ethylene oxide)/poly(propylene oxide)/poly(ethylene oxide) triblock copolymer micelles in aqueous solution. The studies concern the non-ionic triblock copolymer P85 which consists of two outer segments of 25 monomers of ethylene oxide attached to a central part of 40 monomers of propylene oxide. The amphiphilic character of P85 leads to formation of various structures in aqueous solution such as spherical micelles, rod-like structures, and a BCC liquid-crystal mesophase of spherical micelles. The present investigations are centered around the micellar structures. In the first part of this thesis a model for the micelle is developed for which an analytical scattering form factor can be calculated. The micelle is modeled as a solid sphere with tethered Gaussian chains. Good agreement was found between small-angle neutron scattering experiments and the form factor of the spherical P85 micelles. Above 60 deg. C some discrepancies were found between the model and the data which is possibly due to an elongation of the micelles. The second part focuses on the surface-induced ordering of the various micellar aggregates in the P85 concentration-temperature phase diagram. In the spherical micellar phase, neutron reflection measurements indicated a micellar ordering at the hydrophilic surface of quartz. Extensive modeling was performed based on a hard sphere description of the micellar interaction. By convolution of the distribution of hard spheres at a hard wall, obtained from Monte Carlo simulations, and the projected scattering length density of the micelle, a numerical expression was obtained which made it possible to fit the data. The hard-sphere-hard-wall model gave an excellent agreement in the bulk micellar phase. However, for higher concentrations (25 wt % P85) close to the transition from the micellar liquid into a micellar cubic phase, a discrepancy was found between the model and the
A neutron scattering study of triblock copolymer micelles
International Nuclear Information System (INIS)
Gerstenberg, M.C.
1997-11-01
The thesis describes the neutron scattering experiments performed on poly(ethylene oxide)/poly(propylene oxide)/poly(ethylene oxide) triblock copolymer micelles in aqueous solution. The studies concern the non-ionic triblock copolymer P85 which consists of two outer segments of 25 monomers of ethylene oxide attached to a central part of 40 monomers of propylene oxide. The amphiphilic character of P85 leads to formation of various structures in aqueous solution such as spherical micelles, rod-like structures, and a BCC liquid-crystal mesophase of spherical micelles. The present investigations are centered around the micellar structures. In the first part of this thesis a model for the micelle is developed for which an analytical scattering form factor can be calculated. The micelle is modeled as a solid sphere with tethered Gaussian chains. Good agreement was found between small-angle neutron scattering experiments and the form factor of the spherical P85 micelles. Above 60 deg. C some discrepancies were found between the model and the data which is possibly due to an elongation of the micelles. The second part focuses on the surface-induced ordering of the various micellar aggregates in the P85 concentration-temperature phase diagram. In the spherical micellar phase, neutron reflection measurements indicated a micellar ordering at the hydrophilic surface of quartz. Extensive modeling was performed based on a hard sphere description of the micellar interaction. By convolution of the distribution of hard spheres at a hard wall, obtained from Monte Carlo simulations, and the projected scattering length density of the micelle, a numerical expression was obtained which made it possible to fit the data. The hard-sphere-hard-wall model gave an excellent agreement in the bulk micellar phase. However, for higher concentrations (25 wt % P85) close to the transition from the micellar liquid into a micellar cubic phase, a discrepancy was found between the model and the
Glycopolymer micelles with reducible ionic cores for hepatocytes-targeting delivery of DOX.
Wang, Yanxia; Zhang, Xinge; Yu, Peien; Li, Chaoxing
2013-01-30
A novel galactose-decorated cross-linked micelles (cl-micelles) with ionic cores using cystamine (Cys) as a biodegradable cross-linker was prepared by using block ionomer complexes of poly(ethylene glycol)-b-poly(2-acryloxyethyl-galactose)-b-poly(acrylic acid) (PEG-b-PAEG-b-PAA) and Ca(2+) (PEG-b-PAEG-b-PAA cl-micelles/Cys). Doxorubicin (DOX) was successfully incorporated into the ionic cores of such micelles via electrostatic interactions. Proton nuclear magnetic resonance spectrum and Fourier transform infrared spectrometer indicated galactose ligands were exposed at the micellar surface. The micelles were spherical in shape, with an average size of 100nm. The in vitro release studies confirmed that DOX-loaded PEG-b-PAEG-b-PAA cl-micelles/Cys accomplished rapid drug release under reducing condition. Remarkably, PEG-b-PAEG-b-PAA cl-micelles/Cys efficiently delivered and released DOX into the cell nucleus of HepG2 cells, and the intensity of fluorescence observed in HepG2 cells was stronger than that incubated with the micelles without galactose ligands. In contrast, little fluorescence was observed in NIH3T3 cells after incubation with PEG-b-PAEG-b-PAA cl-micelles/Cys. Interestingly, cytotoxicity assays showed that DOX-loaded PEG-b-PAEG-b-PAA cl-micelles/Cys retained higher cell inhibition efficiency in HepG2 cells as compared with NIH3T3 cells, and were more potent than the micelles without galactose ligands and the micelles with non degradable cross-links. These results indicate that PEG-b-PAEG-b-PAA cl-micelles/Cys have great potential in liver tumor-targeted chemotherapy. Copyright © 2012 Elsevier B.V. All rights reserved.
Cuppo, F L S; Gómez, S L; Figueiredo Neto, A M
2004-04-01
In this paper is reported a systematic experimental study of the linear-optical-absorption coefficient of ferrofluid-doped isotropic lyotropic mixtures as a function of the magnetic-grains concentration. The linear optical absorption of ferrolyomesophases increases in a nonlinear manner with the concentration of magnetic grains, deviating from the usual Beer-Lambert law. This behavior is associated to the presence of correlated micelles in the mixture which favors the formation of small-scale aggregates of magnetic grains (dimers), which have a higher absorption coefficient with respect to that of isolated grains. We propose that the indirect heating of the micelles via the ferrofluid grains (hyperthermia) could account for this nonlinear increase of the linear-optical-absorption coefficient as a function of the grains concentration.
Modular invariant partition functions for toroidally compactified bosonic string
International Nuclear Information System (INIS)
Ardalan, F.; Arfaei, H.
1988-06-01
We systematically find all the modular invariant partition functions for the toroidally compactified closed bosonic string defined on a subset of a simply laced simple Lie algebra lattice, or equivalently for the closed bosonic string moving on a group manifold with the WZW coefficient k=1. We examine the relation between modular invariance of partition function and the possibility of describing it by an even Lorentzian self dual lattice in our context. (author). 23 refs
Nanoscale elastic modulus variation in loaded polymeric micelle reactors.
Solmaz, Alim; Aytun, Taner; Deuschle, Julia K; Ow-Yang, Cleva W
2012-07-17
Tapping mode atomic force microscopy (TM-AFM) enables mapping of chemical composition at the nanoscale by taking advantage of the variation in phase angle shift arising from an embedded second phase. We demonstrate that phase contrast can be attributed to the variation in elastic modulus during the imaging of zinc acetate (ZnAc)-loaded reverse polystyrene-block-poly(2-vinylpyridine) (PS-b-P2VP) diblock co-polymer micelles less than 100 nm in diameter. Three sample configurations were characterized: (i) a 31.6 μm thick polystyrene (PS) support film for eliminating the substrate contribution, (ii) an unfilled PS-b-P2VP micelle supported by the same PS film, and (iii) a ZnAc-loaded PS-b-P2VP micelle supported by the same PS film. Force-indentation (F-I) curves were measured over unloaded micelles on the PS film and over loaded micelles on the PS film, using standard tapping mode probes of three different spring constants, the same cantilevers used for imaging of the samples before and after loading. For calibration of the tip geometry, nanoindentation was performed on the bare PS film. The resulting elastic modulus values extracted by applying the Hertz model were 8.26 ± 3.43 GPa over the loaded micelles and 4.17 ± 1.65 GPa over the unloaded micelles, confirming that phase contrast images of a monolayer of loaded micelles represent maps of the nanoscale chemical and mechanical variation. By calibrating the tip geometry indirectly using a known soft material, we are able to use the same standard tapping mode cantilevers for both imaging and indentation.
Hydrolytic degradation of poly(ethylene oxide)-block-polycaprolactone worm micelles.
Geng, Yan; Discher, Dennis E
2005-09-21
Spherical micelles and nanoparticles made with degradable polymers have been of great interest for therapeutic application, but degradation-induced changes in a spherical morphology can be subtle and mechanism/kinetics appears poorly understood. Here, we report the first preparation of giant and flexible worm micelles self-assembled from degradable copolymer poly(ethylene oxide)-block-polycaprolactone. Such worm micelles spontaneously shorten to generate spherical micelles, triggered by polycaprolactone hydrolysis, with distinct mechanism and kinetics from that which occurs in bulk material.
Activity coefficients of NaF in (glucose+water) and (sucrose+water) mixtures at 298.15 K
Energy Technology Data Exchange (ETDEWEB)
Hernandez-Luis, Felipe [Departamento de Quimica Fisica, Universidad de La Laguna, Tenerife (Spain)]. E-mail: ffhelu@ull.es; Galleguillos, Hector R. [Departamento de Ingenieria Quimica, Universidad de Antofagasta, Antofagasta (Chile); Vazquez, Mario V. [Instituto de Quimica, Facultad de Ciencias Exactas y Naturales, Universidad de Antioquia, Medellin (Colombia)
2004-11-01
The activity coefficients of NaF in (glucose+water) and (sucrose+water) mixtures were experimentally determined at 298.15 K from electromotive force measurements of the following electrochemical cell containing two ion selective electrodes (ISEs):Na-ISE|NaF(m),sugar(Y),H2O(100-Y)|F-ISEThe molality (m) varied between ca. 0.01 mol.kg{sup -1} and saturation, while the mass fractions of sugar in the mixture (Y) were 0, 0.10, 0.20, 0.30 and 0.40. The values for electromotive force were analyzed using different models for describing the variations of the activity coefficients with concentration, including an extended Debye-Huckel, the Pitzer and the Scatchard equations. Results obtained with the different models were in good agreement. Once E{sup -}bar was determined, the mean coefficients of ionic activity for NaF, the free energy of transference from the water to the (sugar+water) mixture, and the primary NaF hydration number were calculated. The variation of these magnitudes with the composition of the mixture is comparative discussed in terms of the ion-solvent and ion-ion interactions with results from the literature for NaCl in (glucose+water) and (sucrose+water) systems.
Das, Doyel; Nath, Deb Narayan
2007-09-20
The microenvironment within the reverse micelle of the nonionic surfactant Triton X-100 (TX-100) in cyclohexane has been investigated by studying the magnetic field effect (MFE) on pyrene-dimethylaniline exciplex luminescence. The nature of exciplex fluorescence and its behavior in the presence of a magnetic field have been found to vary significantly with the water content of the medium. Results are discussed in light of multiple exciplex formation within the micelle which is further supported by the fluorescence lifetime measurements. Those exciplexes emitting at longer wavelength are found to be magnetic field sensitive while those emitting toward the blue region of the spectrum are insensitive toward magnetic field. Since the exciplex's emission characteristics and magnetic field sensitivity depend on its immediate surrounding, it has been concluded that the environment within the micelle is nonuniform. With an increase in hydration level, different zones of varying polarity are created within the reverse micelle. It has been pointed out that the magnetic field sensitive components reside inside the polar core of the micelle while those located near the hydrocarbon tail are field insensitive. However it has been presumed that an interconversion between the different types of exciplexes is possible. The environment within the reverse micelle is found to be largely affected by the change in temperature, and this is reflected in the exciplex emission property and the extent of magnetic field effect. Interestingly, the variation of MFE with temperature follows different trends in the dry and the wet reverse micelle. A comparison has been drawn with the reverse micelle of the ionic surfactant to get an insight into the difference between the various types of micellar environment.
Brenan, J. M.; Shaw, H. F.; Ryerson, F. J.; Phinney, D. L.
1995-10-01
In order to more fully establish a basis for quantifying the role of amphibole in trace-element fractionation processes, we have measured pargasite/silicate melt partitioning of a variety of trace elements (Rb, Ba, Nb, Ta, Hf, Zr, Ce, Nd, Sm, Yb), including the first published values for U, Th and Pb. Experiments conducted at 1000°C and 1.5 GPa yielded large crystals free of compositional zoning. Partition coefficients were found to be constant at total concentrations ranging from ˜ 1 to > 100 ppm, indicating Henry's Law is oparative over this interval. Comparison of partition coefficients measured in this study with previous determinations yields good agreement for similar compositions at comparable pressure and temperature. The compatibility of U, Th and Pb in amphibole decreases in the order Pb > Th > U. Partial melting or fractional crystallization of amphibole-bearing assemblages will therefore result in the generation of excesses in 238U activity relative to 230Th, similar in magnitude to that produced by clinopyroxene. The compatibility of Pb in amphibole relative to U or Th indicates that melt generation in the presence of residual amphibole will result in the long-term enrichment in Pb relative to U or Th in the residue. This process is therefore incapable of producing the depletion in Pb relative to U or Th inferred from the Pb isotopic composition of MORB and OIB. Comparison of partition coefficients measured in this study with previous values for clinopyroxene allows some distinction to be made between expected trace-element fractionations produced during dry (cpx present) and wet (cpx + amphibole present) melting. Rb, Ba, Nb and Ta are dramatically less compatible in clinopyroxene than in amphibole, whereas Th, U, Hf and Zr have similar compatibilities in both phases. Interelement fractionations, such as DNb/DBa are also different for clinopyroxene and amphibole. Changes in certain ratios, such as Ba/Nb, Ba/Th, and Nb/Th within comagmatic suites may
Arp, Hans Peter H; Lundstedt, Staffan; Josefsson, Sarah; Cornelissen, Gerard; Enell, Anja; Allard, Ann-Sofie; Kleja, Dan Berggren
2014-10-07
Soil quality standards are based on partitioning and toxicity data for laboratory-spiked reference soils, instead of real world, historically contaminated soils, which would be more representative. Here 21 diverse historically contaminated soils from Sweden, Belgium, and France were obtained, and the soil-porewater partitioning along with the bioaccumulation in exposed worms (Enchytraeus crypticus) of native polycyclic aromatic compounds (PACs) were quantified. The native PACs investigated were polycyclic aromatic hydrocarbons (PAHs) and, for the first time to be included in such a study, oxygenated-PAHs (oxy-PAHs) and nitrogen containing heterocyclic PACs (N-PACs). The passive sampler polyoxymethylene (POM) was used to measure the equilibrium freely dissolved porewater concentration, Cpw, of all PACs. The obtained organic carbon normalized partitioning coefficients, KTOC, show that sorption of these native PACs is much stronger than observed in laboratory-spiked soils (typically by factors 10 to 100), which has been reported previously for PAHs but here for the first time for oxy-PAHs and N-PACs. A recently developed KTOC model for historically contaminated sediments predicted the 597 unique, native KTOC values in this study within a factor 30 for 100% of the data and a factor 3 for 58% of the data, without calibration. This model assumes that TOC in pyrogenic-impacted areas sorbs similarly to coal tar, rather than octanol as typically assumed. Black carbon (BC) inclusive partitioning models exhibited substantially poorer performance. Regarding bioaccumulation, Cpw combined with liposome-water partition coefficients corresponded better with measured worm lipid concentrations, Clipid (within a factor 10 for 85% of all PACs and soils), than Cpw combined with octanol-water partition coefficients (within a factor 10 for 76% of all PACs and soils). E. crypticus mortality and reproducibility were also quantified. No enhanced mortality was observed in the 21 historically
Liu, Min; Song, Xia; Wen, Yuting; Zhu, Jing-Ling; Li, Jun
2017-10-18
In this work, we have synthesized a thermoresponsive copolymer, alginate-g-poly(N-isopropylacrylamide) (alginate-g-PNIPAAm) by conjugating PNIPAAm to alginate, where PNIPAAm with different molecular weights and narrow molecular weight distribution was synthesized by atomic transfer radical polymerization. The copolymer dissolved in water or phosphate-buffered saline buffer solution at room temperature and formed self-assembled micelles with low critical micellization concentrations when the temperature increased to above their critical micellization temperatures. At higher concentration, that is, 7.4 wt % in water, the copolymer formed solutions at 25 °C and turned into thermosensitive hydrogels when temperature increased to the body temperature (37 °C). Herein, we hypothesized that the thermoresponsive hydrogels could produce self-assembled micelles with the dissolution of the alginate-g-PNIPAAm hydrogels in a biological fluid or drug release medium. If the drug was hydrophobic, the hydrogel eventually could release and produce drug-encapsulated micelles. In our experiments, we loaded the anticancer drug doxorubicin (DOX) into the alginate-g-PNIPAAm hydrogels and demonstrated that the hydrogels released DOX-encapsulated micelles in a sustained manner. The slowly released DOX-loaded micelles enhanced the cellular uptake of DOX in multidrug resistant AT3B-1 cells, showing the effect of overcoming the drug resistance and achieving better efficiency for killing the cancer cells. Therefore, the injectable thermoresponsive hydrogels formed by alginate-g-PNIPAAm and loaded with DOX turned into a smart drug delivery system, releasing DOX-encapsulated micelles in a sustained manner, showing great potential for overcoming the drug resistance in cancer therapy.
Anisotropic and sub-diffusive water motion at the surface of DNA and of an anionic micelle CsPFO
International Nuclear Information System (INIS)
Pal, Subrata; Maiti, Prabal K; Bagchi, Biman
2005-01-01
We use long atomistic molecular dynamics simulations to address certain fundamental issues regarding water dynamics in the hydration layer of a 38 base long (GCCGCGAGGTGTCAGGGATTGCAGCCAGCATCTCGTCG) negatively charged hydrated DNA duplex. The rotational time correlation function of surface water dipoles is found to be markedly non-exponential, with a slow component at long time, whose magnitude depends on the initial (t = 0) residence of the water in the major or minor groove of the DNA. The surface water molecules are also found to exhibit anisotropic diffusion in both the major and minor grooves: diffusion in the direction parallel to the DNA surface exhibits a crossover from higher to lower than that in the direction normal to the surface at short-to-intermediate times. In the same time window, translational motion of water molecules in the minor groove is sub-diffusive, with mean square displacement (MSD) growing as t α with α ∼ 0.43. In general, water molecules in the major group exhibit faster dynamics than those in the minor groove, in agreement with earlier results (Bonvin et al 1998 J. Mol. Biol. 282 859-73). We compare these results with dynamics of water molecules at the surface of an anionic micelle, cesium perfluorooctanoate (CsPFO). Water molecules on the surface of CsPFO also exhibit slow translation and non-exponential orientational dynamics
Nielsen, Roger L.; Ustunisik, Gokce; Weinsteiger, Allison B.; Tepley, Frank J.; Johnston, A. Dana; Kent, Adam J. R.
2017-09-01
Quantitative models of petrologic processes require accurate partition coefficients. Our ability to obtain accurate partition coefficients is constrained by their dependence on pressure temperature and composition, and on the experimental and analytical techniques we apply. The source and magnitude of error in experimental studies of trace element partitioning may go unrecognized if one examines only the processed published data. The most important sources of error are relict crystals, and analyses of more than one phase in the analytical volume. Because we have typically published averaged data, identification of compromised data is difficult if not impossible. We addressed this problem by examining unprocessed data from plagioclase/melt partitioning experiments, by comparing models based on that data with existing partitioning models, and evaluated the degree to which the partitioning models are dependent on the calibration data. We found that partitioning models are dependent on the calibration data in ways that result in erroneous model values, and that the error will be systematic and dependent on the value of the partition coefficient. In effect, use of different calibration datasets will result in partitioning models whose results are systematically biased, and that one can arrive at different and conflicting conclusions depending on how a model is calibrated, defeating the purpose of applying the models. Ultimately this is an experimental data problem, which can be solved if we publish individual analyses (not averages) or use a projection method wherein we use an independent compositional constraint to identify and estimate the uncontaminated composition of each phase.
International Nuclear Information System (INIS)
Schurtenberger, P.; Cavaco, C.
1992-01-01
''Complex fluids'' or ''soft condensed matter'' have recently attracted considerable attention both experimentally as well as theoretically. The hypothesis of a water-induced formation of flexible cylindrical micelles and the existence of entanglement networks was largely based on ''low-resolution'' light scattering and rheological measurements and analogies to classical polymer theory. In order to directly confirm this picture and verify the postulated analogy between the structural properties of polymer chains and lecithin reverse micelles we now used a combination of static light scattering and small angle neutron scattering. (author) 2 figs., 3 refs
Experimental study of radium partitioning between anorthite and melt at 1 atm
Energy Technology Data Exchange (ETDEWEB)
Miller, S; Burnett, D; Asimow, P; Phinney, D; Hutcheon, I
2007-03-08
We present the first experimental radium mineral/melt partitioning data, specifically between anorthite and a CMAS melt at atmospheric pressure. Ion microprobe measurement of coexisting anorthite and glass phases produces a molar D{sub Ra} = 0.040 {+-} 0.006 and D{sub Ra}/D{sub Ba} = 0.23 {+-} 0.05 at 1400 C. Our results indicate that lattice strain partitioning models fit the divalent (Ca, Sr, Ba, Ra) partition coefficient data of this study well, supporting previous work on crustal melting and magma chamber dynamics that has relied on such models to approximate radium partitioning behavior in the absence of experimentally determined values.
Development of water demand coefficients for power generation from renewable energy technologies
International Nuclear Information System (INIS)
Ali, Babkir; Kumar, Amit
2017-01-01
Highlights: • Water consumption and withdrawals coefficients for renewable power generation were developed. • Six renewable energy sources (biomass, nuclear, solar, wind, hydroelectricity, and geothermal) were studied. • Life cycle water footprints for 60 electricity generation pathways were considered. • Impact of cooling systems for some power generation pathways was assessed. - Abstract: Renewable energy technology-based power generation is considered to be environmentally friendly and to have a low life cycle greenhouse gas emissions footprint. However, the life cycle water footprint of renewable energy technology-based power generation needs to be assessed. The objective of this study is to develop life cycle water footprints for renewable energy technology-based power generation pathways. Water demand is evaluated through consumption and withdrawals coefficients developed in this study. Sixty renewable energy technology-based power generation pathways were developed for a comprehensive comparative assessment of water footprints. The pathways were based on the use of biomass, nuclear, solar, wind, hydroelectricity, and geothermal as the source of energy. During the complete life cycle, power generation from bio-oil extracted from wood chips, a biomass source, was found to have the highest water demand footprint and wind power the lowest. During the complete life cycle, the water demand coefficients for biomass-based power generation pathways range from 260 to 1289 l of water per kilowatt hour and for nuclear energy pathways from 0.48 to 179 l of water per kilowatt hour. The water demand for power generation from solar energy-based pathways ranges from 0.02 to 4.39 l of water per kilowatt hour, for geothermal pathways from 0.04 to 1.94 l of water per kilowatt hour, and for wind from 0.005 to 0.104 l of water per kilowatt hour. A sensitivity analysis was conducted with varying conversion efficiencies to evaluate the impact of power plant performance on
Energy Technology Data Exchange (ETDEWEB)
Wilson, Brittan [University of Massachusetts, Department of Environment, Earth and Ocean Sciences, 100 Morrissey Blvd., Boston, MA 02125 (United States); Chen, Robert F. [University of Massachusetts, Department of Environment, Earth and Ocean Sciences, 100 Morrissey Blvd., Boston, MA 02125 (United States); Cantwell, Mark [NHEERL, Atlantic Ecology Division, US Environmental Protection Agency, 27 Tarzwell Drive, Narragansett, RI 02882 (United States); Gontz, Allen; Jun, Zhu; Olsen, Curtis R. [University of Massachusetts, Department of Environment, Earth and Ocean Sciences, 100 Morrissey Blvd., Boston, MA 02125 (United States)
2009-07-01
The distribution of Triclosan within the Hudson River Estuary can be explained by a balance among the overall effluent inputs from municipal sewage treatment facilities, dilution of Triclosan concentrations in the water column with freshwater and seawater inputs, removal of Triclosan from the water column by adsorption to particles, and loss to photodegradation. This study shows that an average water column concentration of 3 {+-} 2 ng/l (in the lower Hudson River Estuary) is consistent with an estimate for dilution of average wastewater concentrations with seawater and calculated rates of adsorption of Triclosan to particles. An average Triclosan sediment concentration of 26 {+-} 11 ng/g would be in equilibrium with the overlying water column if Triclosan has a particle-to-water partitioning coefficient of k{sub d} {approx} 10{sup 4}, consistent with laboratory estimates.
International Nuclear Information System (INIS)
Wilson, Brittan; Chen, Robert F.; Cantwell, Mark; Gontz, Allen; Zhu Jun; Olsen, Curtis R.
2009-01-01
The distribution of Triclosan within the Hudson River Estuary can be explained by a balance among the overall effluent inputs from municipal sewage treatment facilities, dilution of Triclosan concentrations in the water column with freshwater and seawater inputs, removal of Triclosan from the water column by adsorption to particles, and loss to photodegradation. This study shows that an average water column concentration of 3 ± 2 ng/l (in the lower Hudson River Estuary) is consistent with an estimate for dilution of average wastewater concentrations with seawater and calculated rates of adsorption of Triclosan to particles. An average Triclosan sediment concentration of 26 ± 11 ng/g would be in equilibrium with the overlying water column if Triclosan has a particle-to-water partitioning coefficient of k d ∼ 10 4 , consistent with laboratory estimates.
The fabrication of nanopatterns with Au nanoparticles-embedded micelles via nanoimprint lithography
Energy Technology Data Exchange (ETDEWEB)
Lee, Jung-Pil; Kim, Eun-Uk; Koh, Haeng-Deog; Kang, Nam-Goo; Jung, Gun-Young; Lee, Jae-Suk, E-mail: gyjung@gist.ac.k, E-mail: jslee@gist.ac.k [Department of Materials Science and Engineering, Gwangju Institute of Science and Technology (GIST), 261 Cheomdan-gwagiro (Oryong-dong), Buk-gu Gwangju 500-712 (Korea, Republic of)
2009-09-09
We fabricated nanopatterns with Au nanoparticles-embedded micelles (Au-micelles) by self-assembly of block copolymers via nanoimprint lithography. The micelle structure prepared by self-assembled block copolymers was used as a template for the synthesis of Au nanoparticles (Au NPs). Au NPs were synthesized in situ inside the micelles of polystyrene-block-poly(2-vinylpyridine) (PS- b-P2VP). Au-micelles were arranged on the trenches of the polymer template, which was imprinted by nanoimprint lithography. The fabrication of line-type and dot-type nanopatterns was carried out by the combined method. In addition, multilayer nanopatterns of the Au-micelles were also proposed.
Metal-silicate Partitioning and Its Role in Core Formation and Composition on Super-Earths
Energy Technology Data Exchange (ETDEWEB)
Schaefer, Laura; Petaev, M. I.; Sasselov, Dimitar D. [Harvard-Smithsonian Center for Astrophysics, 60 Garden St., Cambridge, MA 02138 (United States); Jacobsen, Stein B.; Remo, John L., E-mail: lschaefer@asu.edu [Harvard University, Department of Earth and Planetary Sciences, 20 Oxford St., Cambridge, MA 02138 (United States)
2017-02-01
We use a thermodynamic framework for silicate-metal partitioning to determine the possible compositions of metallic cores on super-Earths. We compare results using literature values of the partition coefficients of Si and Ni, as well as new partition coefficients calculated using results from laser shock-induced melting of powdered metal-dunite targets at pressures up to 276 GPa, which approaches those found within the deep mantles of super-Earths. We find that larger planets may have little to no light elements in their cores because the Si partition coefficient decreases at high pressures. The planet mass at which this occurs will depend on the metal-silicate equilibration depth. We also extrapolate the equations of state (EOS) of FeO and FeSi alloys to high pressures, and present mass–radius diagrams using self-consistent planet compositions assuming equilibrated mantles and cores. We confirm the results of previous studies that the distribution of elements between mantle and core will not be detectable from mass and radius measurements alone. While observations may be insensitive to interior structure, further modeling is sensitive to compositionally dependent properties, such as mantle viscosity and core freeze-out properties. We therefore emphasize the need for additional high pressure measurements of partitioning as well as EOSs, and highlight the utility of the Sandia Z-facilities for this type of work.
Characterization of lipase in reversed micelles formulated by Cibacron Blue F-3GA modified Span 85
DEFF Research Database (Denmark)
Zhang, Dong Hao; Guo, Zheng; Sun, Yan
2007-01-01
Sorbitan trioleate (Span 85) modified by Cibacron Blue F-3GA (CB) was prepared and used as an affinity surfactant to formulate a reversed micellar system for Candida rugosa lipase (CRL) solubilization. The system was characterized and evaluated by employing CRL-catalyzed hydrolysis of olive oil...... of the encapsulated lipase remained unchanged, but the apparent activity was significantly higher than that of the native enzyme in bulk solution. Kinetic studies indicated that the encapsulated lipase in the reversed micelles of CB-formulated Span 85 followed the Michaelis-Menten equation. The Michaelis constant...... was found to decrease with increasing surfactant concentration, suggesting an increase of the enzyme affinity for the substrate. Stability of the lipase in the reversed micelles was negatively correlated to W0. Introduction Reversed micelles are nanometer-scale transparent aggregates of water and surfactant...
Energy Technology Data Exchange (ETDEWEB)
Kumblad, Linda; Bradshaw, Clare (Dept. of Systems Ecology, Stockholm Univ. (Sweden))
2008-08-15
In this study the elemental composition of biota, water and sediment from a shallow bay in the Forsmark region have been determined. The report presents data for 48 different elements (Al, As, Ba, Br, C, Ca, Cd, Ce, Cl, Co, Cr, Cs, Cu, Dy, Er, Eu, F, Fe, Gd, Hg, Ho, I, K, Li, Lu, Mg, Mn, N, Na, Nd, Ni, P, Pb, Pr, Ra, Rb, S, Se, Si, Sm, Tb, Th, Ti, Tm, V, Yb, Zn, Zr) in all major functional groups of the coastal ecosystem (phytoplankton, zooplankton, benthic microalgae, macroalgae, macrophytes, benthic herbivores, benthic filter feeders, benthic detrivores, planktivorous fish, benthic omnivorous fish, carnivorous fish, dissolved and particulate matter in the water and the sediment) during spring 2005. The overall aim of the study is to contribute to a better understanding of ecological properties and processes that govern uptake and transfer of trace elements, heavy-metals, radionuclides and other non-essential elements/contaminants in coastal environments of the Baltic Sea. In addition, the data was collected to provide site-specific Bioconcentration Factors (BCF), Biomagnification Factors (BMF), partitioning coefficients (K{sub d}) and element ratios (relative to carbon) for use in ongoing SKB safety assessments. All these values, as well as the element concentration data from which they are derived, are presented here. As such, this is mainly a data report, although initial interpretations of the data also are presented and discussed. Reported data include element concentrations, CNP-stoichiometry, and multivariate data analysis. Elemental concentrations varied greatly between organisms and environmental components, depending on the function of the elements, and the habitat, ecosystem function, trophic level and morphology (taxonomy) of the organisms. The results show for instance that food intake and metabolism strongly influence the elemental composition of organisms. The three macrophytes had quite similar elemental composition (despite their taxonomic
Energy Technology Data Exchange (ETDEWEB)
Joshi, Sunita; Pant, Debi D., E-mail: ddpant@pilani.bits-pilani.ac.in
2014-01-15
Interaction of quinine sulfate dication (QSD) with anionic, sodium dodecylsulphate (SDS) surfactant has been studied at different premicellar, micellar and postmicellar concentrations in aqueous phase using steady state, time-resolved fluorescence and fluorescence anisotropy techniques. At premicellar concentrations of SDS, the decrease in absorbance, appearance of an extra fluorescence band at lower wavelengths and tri-exponential decay behavior of fluorescence, are attributed to complex formation between QSD molecules and surfactant monomers. At postmicellar concentrations the red shift in fluorescence spectrum, increase in quantum yield and increase in fluorescence lifetimes are attributed to incorporation of solute molecules to micelles. At lower concentrations of SDS, a large shift in fluorescence is observed on excitation at the red edge of absorption spectrum and this is explained in terms of distribution of ion pairs of different energies in the ground state and the observed fluorescence lifetime behavior corroborates with this model. The temporal fluorescence anisotropy decay of QSD in SDS micelles allowed determination of restriction on the motion of the fluorophore. All the different techniques used in this study reveal that the photophysics of QSD is very sensitive to the microenvironments of SDS micelles and QSD molecules reside at the water-micelle interface. -- Highlights: • Probe molecule is very sensitive to microenvironment of micelles. • Highly fluorescent ion-pair formation has been observed. • Modulated photophysics of probe molecule in micellar solutions has been observed. • Probe molecules strongly bind with micelles and reside at probe–micelle interface.
A Novel Solubility-Enhanced Rubusoside-Based Micelles for Increased Cancer Therapy
Zhang, Meiying; Dai, Tongcheng; Feng, Nianping
2017-04-01
Many anti-cancer drugs have a common problem of poor solubility. Increasing the solubility of the drugs is very important for its clinical applications. In the present study, we revealed that the solubility of insoluble drugs was significantly enhanced by adding rubusoside (RUB). Further, it was demonstrated that RUB could form micelles, which was well characterized by Langmuir monolayer investigation, transmission electron microscopy, atomic-force microscopy, and cryogenic transmission electron microscopy. The RUB micelles were ellipsoid with the horizontal distance of 25 nm and vertical distance of 1.2 nm. Insoluble synergistic anti-cancer drugs including curcumin and resveratrol were loaded in RUB to form anti-cancer micelles RUB/CUR + RES. MTT assay showed that RUB/CUR + RES micelles had more significant toxicity on MCF-7 cells compared to RUB/CUR micelles + RUB/RES micelles. More importantly, it was confirmed that RUB could load other two insoluble drugs together for remarkably enhanced anti-cancer effect compared to that of RUB/one drug + RUB/another drug. Overall, we concluded that RUB-based micelles could efficiently load insoluble drugs for enhanced anti-cancer effect.
Backbone-hydrazone-containing biodegradable copolymeric micelles for anticancer drug delivery
Energy Technology Data Exchange (ETDEWEB)
Xu, Jing; Luan, Shujuan; Qin, Benkai; Wang, Yingying; Wang, Kai; Qi, Peilan; Song, Shiyong, E-mail: pharmsong@henu.edu.cn [Henan University, Institute of Pharmacy (China)
2016-11-15
Well-defined biodegradable, pH-sensitive amphiphilic block polymers, poly(ethylene glycol)-Hyd-poly(lactic acid) (mPEG-Hyd-PLA) which have acid-cleavable linkages in their backbones, were synthesized via ring-opening polymerization initiated from hydrazone-containing macroinitiators. Introducing a hydrazone bond onto the backbone of an amphiphilic copolymer will find a broad-spectrum encapsulation of hydrophobic drugs. Dynamic light scattering (DLS) and transmission electron microscopy showed that the diblock copolymers self-assembled into stable micelles with average diameters of 100 nm. The mean diameters and size distribution of the hydrazone-containing micelles changed obviously in mildly acidic pH (multiple peaks from 1 to 202 nm appeared under a pH 4.0 condition) than in neutral, while there were no changes in the case of non-sensitive ones. Doxorubicin (DOX) and paclitaxel (PTX) were loaded with drug loading content ranging from 2.4 to 3.5 %, respectively. Interestingly, the anticancer drugs released from mPEG-Hyd-PLA micelles could also be promoted by the increased acidity. An in vitro cytotoxicity study showed that the DOX-loaded mPEG-Hyd-PLA micelles have significantly enhanced cytotoxicity against HepG2 cells compared with the non-sensitive poly(ethylene glycol)-block-poly(lactic acid) (mPEG-PLA) micelles. Confocal microscopy observation indicated that more DOX were delivered into the nuclei of cells following 6 or 12 h incubation with DOX-loaded mPEG-Hyd-PLA micelles. In vivo studies on H22-bearing Swiss mice demonstrated the superior anticancer activity of DOX-loaded mPEG-Hyd-PLA micelles over free DOX and DOX-loaded mPEG-PLA micelles. These hydrazone-containing pH-responsive degradable micelles provide a useful strategy for antitumor drug delivery.
Backbone-hydrazone-containing biodegradable copolymeric micelles for anticancer drug delivery
International Nuclear Information System (INIS)
Xu, Jing; Luan, Shujuan; Qin, Benkai; Wang, Yingying; Wang, Kai; Qi, Peilan; Song, Shiyong
2016-01-01
Well-defined biodegradable, pH-sensitive amphiphilic block polymers, poly(ethylene glycol)-Hyd-poly(lactic acid) (mPEG-Hyd-PLA) which have acid-cleavable linkages in their backbones, were synthesized via ring-opening polymerization initiated from hydrazone-containing macroinitiators. Introducing a hydrazone bond onto the backbone of an amphiphilic copolymer will find a broad-spectrum encapsulation of hydrophobic drugs. Dynamic light scattering (DLS) and transmission electron microscopy showed that the diblock copolymers self-assembled into stable micelles with average diameters of 100 nm. The mean diameters and size distribution of the hydrazone-containing micelles changed obviously in mildly acidic pH (multiple peaks from 1 to 202 nm appeared under a pH 4.0 condition) than in neutral, while there were no changes in the case of non-sensitive ones. Doxorubicin (DOX) and paclitaxel (PTX) were loaded with drug loading content ranging from 2.4 to 3.5 %, respectively. Interestingly, the anticancer drugs released from mPEG-Hyd-PLA micelles could also be promoted by the increased acidity. An in vitro cytotoxicity study showed that the DOX-loaded mPEG-Hyd-PLA micelles have significantly enhanced cytotoxicity against HepG2 cells compared with the non-sensitive poly(ethylene glycol)-block-poly(lactic acid) (mPEG-PLA) micelles. Confocal microscopy observation indicated that more DOX were delivered into the nuclei of cells following 6 or 12 h incubation with DOX-loaded mPEG-Hyd-PLA micelles. In vivo studies on H22-bearing Swiss mice demonstrated the superior anticancer activity of DOX-loaded mPEG-Hyd-PLA micelles over free DOX and DOX-loaded mPEG-PLA micelles. These hydrazone-containing pH-responsive degradable micelles provide a useful strategy for antitumor drug delivery.
Sato, Miki; Maeda, Yuki; Ishioka, Toshio; Harata, Akira
2017-11-20
The detection limits and photoionization thresholds of polycyclic aromatic hydrocarbons and their chlorides and nitrides on the water surface are examined using laser two-photon ionization and single-photon ionization, respectively. The laser two-photon ionization methods are highly surface-selective, with a high sensitivity for aromatic hydrocarbons tending to accumulate on the water surface in the natural environment due to their highly hydrophobic nature. The dependence of the detection limits of target aromatic molecules on their physicochemical properties (photoionization thresholds relating to excess energy, molar absorptivity, and the octanol-water partition coefficient) is discussed. The detection limit clearly depends on the product of the octanol-water partition coefficient and molar absorptivity, and no clear dependence was found on excess energy. The detection limits of laser two-photon ionization for these types of molecules on the water surface are formulated.
Avalos Ramirez, Antonio; Peter Jones, J; Heitz, Michéle
2009-02-01
Methanol vapours were treated in a biotrickling filter (BTF) packed with inert polypropylene spheres. The effects of the nitrogen concentration in the nutrient solution, the empty bed residence time (EBRT) and the methanol inlet concentration, on the BTF performance, were all examined. The elimination capacity (EC), the biomass and the carbon dioxide production rates were all increased with the rising of the nitrogen concentration and the EBRT. The EC also rose with increasing methanol inlet load (IL) when the methanol inlet concentration and the EBRT were varied, from 0.3 to 37.0 g m(-3), and from 20 to 65 s, respectively. The BTF reached its maximum EC level of 2160 g m(-3) h(-1) when it was operated at an IL level of 3700 g m(-3) h(-1). The input methanol was removed through two mechanisms: biodegradation and absorption in the liquid phase. The partition coefficient for the methanol in the BTF was determined at five EBRTs and along the packed bed. It generally followed the Henry model, having an average value of 2.64 x 10(-4)[mol L(-1)](gas)/[mol L(-1)](liquid).
Fluorescent supramolecular micelles for imaging-guided cancer therapy
Sun, Mengmeng; Yin, Wenyan; Dong, Xinghua; Yang, Wantai; Zhao, Yuliang; Yin, Meizhen
2016-02-01
A novel smart fluorescent drug delivery system composed of a perylene diimide (PDI) core and block copolymer poly(d,l-lactide)-b-poly(ethyl ethylene phosphate) is developed and named as PDI-star-(PLA-b-PEEP)8. The biodegradable PDI-star-(PLA-b-PEEP)8 is a unimolecular micelle and can self-assemble into supramolecular micelles, called as fluorescent supramolecular micelles (FSMs), in aqueous media. An insoluble drug camptothecin (CPT) can be effectively loaded into the FSMs and exhibits pH-responsive release. Moreover, the FSMs with good biocompatibility can also be employed as a remarkable fluorescent probe for cell labelling because the maximum emission of PDI is beneficial for bio-imaging. The flow cytometry and confocal laser scanning microscopy analysis demonstrate that the micelles are easily endocytosed by cancer cells. In vitro and in vivo tumor growth-inhibitory studies reveal a better therapeutic effect of FSMs after CPT encapsulation when compared with the free CPT drug. The multifunctional FSM nanomedicine platform as a nanovehicle has great potential for fluorescence imaging-guided cancer therapy.A novel smart fluorescent drug delivery system composed of a perylene diimide (PDI) core and block copolymer poly(d,l-lactide)-b-poly(ethyl ethylene phosphate) is developed and named as PDI-star-(PLA-b-PEEP)8. The biodegradable PDI-star-(PLA-b-PEEP)8 is a unimolecular micelle and can self-assemble into supramolecular micelles, called as fluorescent supramolecular micelles (FSMs), in aqueous media. An insoluble drug camptothecin (CPT) can be effectively loaded into the FSMs and exhibits pH-responsive release. Moreover, the FSMs with good biocompatibility can also be employed as a remarkable fluorescent probe for cell labelling because the maximum emission of PDI is beneficial for bio-imaging. The flow cytometry and confocal laser scanning microscopy analysis demonstrate that the micelles are easily endocytosed by cancer cells. In vitro and in vivo tumor growth