WorldWideScience

Sample records for mfsm2 promoter type

  1. Fungicide-driven evolution and molecular basis of multidrug resistance in field populations of the grey mould fungus Botrytis cinerea.

    Directory of Open Access Journals (Sweden)

    Matthias Kretschmer

    2009-12-01

    Full Text Available The grey mould fungus Botrytis cinerea causes losses of commercially important fruits, vegetables and ornamentals worldwide. Fungicide treatments are effective for disease control, but bear the risk of resistance development. The major resistance mechanism in fungi is target protein modification resulting in reduced drug binding. Multiple drug resistance (MDR caused by increased efflux activity is common in human pathogenic microbes, but rarely described for plant pathogens. Annual monitoring for fungicide resistance in field isolates from fungicide-treated vineyards in France and Germany revealed a rapidly increasing appearance of B. cinerea field populations with three distinct MDR phenotypes. All MDR strains showed increased fungicide efflux activity and overexpression of efflux transporter genes. Similar to clinical MDR isolates of Candida yeasts that are due to transcription factor mutations, all MDR1 strains were shown to harbor activating mutations in a transcription factor (Mrr1 that controls the gene encoding ABC transporter AtrB. MDR2 strains had undergone a unique rearrangement in the promoter region of the major facilitator superfamily transporter gene mfsM2, induced by insertion of a retrotransposon-derived sequence. MDR2 strains carrying the same rearranged mfsM2 allele have probably migrated from French to German wine-growing regions. The roles of atrB, mrr1 and mfsM2 were proven by the phenotypes of knock-out and overexpression mutants. As confirmed by sexual crosses, combinations of mrr1 and mfsM2 mutations lead to MDR3 strains with higher broad-spectrum resistance. An MDR3 strain was shown in field experiments to be selected against sensitive strains by fungicide treatments. Our data document for the first time the rising prevalence, spread and molecular basis of MDR populations in a major plant pathogen in agricultural environments. These populations will increase the risk of grey mould rot and hamper the effectiveness of

  2. Studies of genetic variability of the glucose transporter 2 promoter in patients with type 2 diabetes mellitus

    DEFF Research Database (Denmark)

    Møller, A M; Jensen, N M; Pildal, J

    2001-01-01

    This study was performed to test the hypothesis that genetic variation in the promoter of the glucose transporter 2 (GLUT2) might predispose to prediabetic phenotypes or type 2 diabetes. A total of 1611 bp comprising the minimal promoter region of the GLUT2 gene were examined by combined single-s......-tolerant subjects. In conclusion, we found no evidence supporting the hypothesis that genetic variability in the minimal promoter of the GLUT2 is associated with type 2 diabetes or prediabetic phenotypes in the Danish population.......This study was performed to test the hypothesis that genetic variation in the promoter of the glucose transporter 2 (GLUT2) might predispose to prediabetic phenotypes or type 2 diabetes. A total of 1611 bp comprising the minimal promoter region of the GLUT2 gene were examined by combined single...

  3. IL6 gene promoter polymorphisms and type 2 diabetes

    DEFF Research Database (Denmark)

    Huth, Cornelia; Heid, Iris M; Vollmert, Caren

    2006-01-01

    Several lines of evidence indicate a causal role of the cytokine interleukin (IL)-6 in the development of type 2 diabetes in humans. Two common polymorphisms in the promoter of the IL-6 encoding gene IL6, -174G>C (rs1800795) and -573G>C (rs1800796), have been investigated for association with type...... 2 diabetes in numerous studies but with results that have been largely equivocal. To clarify the relationship between the two IL6 variants and type 2 diabetes, we analyzed individual data on >20,000 participants from 21 published and unpublished studies. Collected data represent eight different...... countries, making this the largest association analysis for type 2 diabetes reported to date. The GC and CC genotypes of IL6 -174G>C were associated with a decreased risk of type 2 diabetes (odds ratio 0.91, P = 0.037), corresponding to a risk modification of nearly 9%. No evidence for association was found...

  4. Studies of genetic variability of the glucose transporter 2 promoter in patients with type 2 diabetes mellitus

    DEFF Research Database (Denmark)

    Møller, A M; Jensen, N M; Pildal, J

    2001-01-01

    This study was performed to test the hypothesis that genetic variation in the promoter of the glucose transporter 2 (GLUT2) might predispose to prediabetic phenotypes or type 2 diabetes. A total of 1611 bp comprising the minimal promoter region of the GLUT2 gene were examined by combined single......-tolerant subjects. In conclusion, we found no evidence supporting the hypothesis that genetic variability in the minimal promoter of the GLUT2 is associated with type 2 diabetes or prediabetic phenotypes in the Danish population.......-strand conformational polymorphism and heteroduplex analysis followed by direct sequencing of identified variants on genomic DNA from 96 randomly recruited Danish type 2 diabetic patients. We identified 4 nucleotide variants, -447g-->a, -149c-->a, -122t-->c, and -44g-->a. None of the variants were positioned in known...

  5. The role of ghrelin and ghrelin-receptor gene variants and promoter activity in type 2 diabetes.

    Science.gov (United States)

    Garcia, Edwin A; King, Peter; Sidhu, Kally; Ohgusu, Hideko; Walley, Andrew; Lecoeur, Cecile; Gueorguiev, Maria; Khalaf, Sahira; Davies, Derek; Grossman, Ashley B; Kojima, Masayasu; Petersenn, Stephan; Froguel, Phillipe; Korbonits, Márta

    2009-08-01

    Ghrelin and its receptor play an important role in glucose metabolism and energy homeostasis, and therefore they are functional candidates for genes carrying susceptibility alleles for type 2 diabetes. We assessed common genetic variation of the ghrelin (GHRL; five single nucleotide polymorphisms (SNP)) and the ghrelin-receptor (GHSR) genes (four SNPs) in 610 Caucasian patients with type 2 diabetes and 820 controls. In addition, promoter reporter assays were conducted to model the regulatory regions of both genes. Neither GHRL nor GHSR gene SNPs were associated with type 2 diabetes. One of the ghrelin haplotypes showed a marginal protective role in type 2 diabetes. We observed profound differences in the regulation of the GHRL gene according to promoter sequence variants. There are three different GHRL promoter haplotypes represented in the studied cohort causing up to 45% difference in the level of gene expression, while the promoter region of GHSR gene is primarily represented by a single haplotype. The GHRL and GHSR gene variants are not associated with type 2 diabetes, although GHRL promoter variants have significantly different activities.

  6. Induction of NFATc2 expression by interleukin 6 promotes T helper type 2 differentiation.

    Science.gov (United States)

    Diehl, Sean; Chow, Chi-Wing; Weiss, Linda; Palmetshofer, Alois; Twardzik, Thomas; Rounds, Laura; Serfling, Edgar; Davis, Roger J; Anguita, Juan; Rincón, Mercedes

    2002-07-01

    Interleukin (IL)-6 is produced by professional antigen-presenting cells (APCs) such as B cells, macrophages, and dendritic cells. It has been previously shown that APC-derived IL-6 promotes the differentiation of naive CD4+ T cells into effector T helper type 2 (Th2) cells. Here, we have studied the molecular mechanism for IL-6-mediated Th2 differentiation. During the activation of CD4+ T cells, IL-6 induces the production of IL-4, which promotes the differentiation of these cells into effector Th2 cells. Regulation of IL-4 gene expression by IL-6 is mediated by nuclear factor of activated T cells (NFAT), as inhibition of NFAT prevents IL-6-driven IL-4 production and Th2 differentiation. IL-6 upregulates NFAT transcriptional activity by increasing the levels of NFATc2. The ability of IL-6 to promote Th2 differentiation is impaired in CD4+ T cells that lack NFATc2, demonstrating that NFATc2 is required for regulation of IL-4 gene expression by IL-6. Regulation of NFATc2 expression and NFAT transcriptional activity represents a novel pathway by which IL-6 can modulate gene expression.

  7. Guarded Type Promotion

    DEFF Research Database (Denmark)

    Winther, Johnni

    2011-01-01

    conditional using the instanceof operator and thus the cast type is redundantly mentioned twice. We propose a new typing rule for Java called Guarded Type Promotion aimed at eliminating the need for the explicit casts when guarded. This new typing rule is backward compatible and has been fully implemented...... in a Java 6 compiler. Through our extensive testing of real-life code we show that guarded casts account for approximately one fourth of all casts and that Guarded Type Promotion can eliminate the need for 95 percent of these guarded casts....

  8. Overexpression of HMGA2-LPP fusion transcripts promotes expression of the α 2 type XI collagen gene

    International Nuclear Information System (INIS)

    Kubo, Takahiro; Matsui, Yoshito; Goto, Tomohiro; Yukata, Kiminori; Yasui, Natsuo

    2006-01-01

    In a subset of human lipomas, a specific t (3; 12) chromosome translocation gives rise to HMGA2-LPP fusion protein, containing the amino (N)-terminal DNA binding domains of HMGA2 fused to the carboxyl (C)-terminal LIM domains of LPP. In addition to its role in adipogenesis, several observations suggest that HMGA2-LPP is linked to chondrogenesis. Here, we analyzed whether HMGA2-LPP promotes chondrogenic differentiation, a marker of which is transactivation of the α 2 type XI collagen gene (Col11a2). Real-time PCR analysis showed that HMGA2-LPP and COL11A2 were co-expressed. Luciferase assay demonstrated that either of HMGA2-LPP, wild-type HMGA2 or the N-terminal HMGA2 transactivated the Col11a2 promoter in HeLa cells, while the C-terminal LPP did not. RT-PCR analysis revealed that HMGA2-LPP transcripts in lipomas with the fusion were 591-fold of full-length HMGA2 transcripts in lipomas without the fusion. These results indicate that in vivo overexpression of HMGA2-LPP promotes chondrogenesis by upregulating cartilage-specific collagen gene expression through the N-terminal DNA binding domains

  9. Promoting lifestyle changes for Chinese Australians with Type 2 diabetes

    OpenAIRE

    SUET TING CHOI

    2017-01-01

    Providing translated diabetes education from English to Chinese is not enough to promote healthy lifestyle changes among Chinese Australians with type 2 diabetes. This thesis explored the behaviour patterns of Chinese patients during diabetes education and identified the most successful education approaches. The research involved a review of literature and an exploratory qualitative study across three countries. The findings suggest health professionals working with Chinese Australian patient...

  10. Insulin Promoter Factor 1 variation is associated with type 2 diabetes in African Americans

    Directory of Open Access Journals (Sweden)

    Wang Xiaoqin

    2005-10-01

    Full Text Available Abstract Background Defective insulin secretion is a key defect in the pathogenesis of type 2 diabetes (T2DM. The β-cell specific transcription factor, insulin promoter factor 1 gene (IPF1, is essential to pancreatic development and the maintenance of β-cell mass. We hypothesized that regulatory or coding variants in IPF1 contribute to defective insulin secretion and thus T2DM. Methods We screened 71 Caucasian and 69 African American individuals for genetic variants in the promoter region, three highly conserved upstream regulatory sequences (PH1, PH2 and PH3, the human β-cell specific enhancer, and the two exons with adjacent introns. We tested for an association of each variant with T2DM Caucasians (192 cases and 192 controls and African Americans (341 cases and 186 controls. Results We identified 8 variants in the two populations, including a 3 bp insertion in exon 2 (InsCCG243 in African Americans that resulted in an in-frame proline insertion in the transactivation domain. No variant was associated with T2DM in Caucasians, but polymorphisms at -3766 in the human β-cell enhancer, at -2877 bp in the PH1 domain, and at -108 bp in the promoter region were associated with T2DM in African American subjects (p Conculsion The common alleles of regulatory variants in the 5' enhancer and promoter regions of the IPF1 gene increase susceptibility to type 2 diabetes among African American individuals, likely as a result of gene-gene or gene-environment interactions. In contrast, IPF1 is not a cause of type 2 diabetes in Caucasians. A previously described InsCCG243 variant may contribute to diabetes susceptibility in African American individuals, but is of low penetrance.

  11. APOE genotype-function relationship: evidence of -491 A/T promoter polymorphism modifying transcription control but not type 2 diabetes risk.

    Directory of Open Access Journals (Sweden)

    Hua Geng

    Full Text Available BACKGROUND: The apolipoprotein E gene (APOE coding polymorphism modifies the risks of Alzheimer's disease, type 2 diabetes, and coronary heart disease. Aside from the coding variants, single nucleotide polymorphism (SNP of the APOE promoter has also been shown to modify the risk of Alzheimer's disease. METHODOLOGY/PRINCIPAL FINDINGS: In this study we investigate the genotype-function relationship of APOE promoter polymorphism at molecular level and at physiological level: i.e., in transcription control of the gene and in the risk of type 2 diabetes. In molecular studies, the effect of the APOE -491A/T (rs449647 polymorphism on gene transcription was accessed by dual-luciferase reporter gene assays. The -491 A to T substitution decreased the activity (p<0.05 of the cloned APOE promoter (-1017 to +406. Using the -501 to -481 nucleotide sequence of the APOE promoter as a 'bait' to screen the human brain cDNA library by yeast one-hybrid system yielded ATF4, an endoplasmic reticulum stress response gene, as one of the interacting factors. Electrophoretic-mobility-shift assays (EMSA and chromatin immuno-precipitation (ChIP analyses further substantiated the physical interaction between ATF4 and the APOE promoter. Over-expression of ATF4 stimulated APOE expression whereas siRNA against ATF4 suppressed the expression of the gene. However, interaction between APOE promoter and ATF4 was not -491A/T-specific. At physiological level, the genotype-function relationship of APOE promoter polymorphism was studied in type 2 diabetes. In 630 cases and 595 controls, three APOE promoter SNPs -491A/T, -219G/T (rs405509, and +113G/C (rs440446 were genotyped and tested for association with type 2 diabetes in Hong Kong Chinese. No SNP or haplotype association with type 2 diabetes was detected. CONCLUSIONS/SIGNIFICANCE: At molecular level, polymorphism -491A/T and ATF4 elicit independent control of APOE gene expression. At physiological level, no genotype

  12. The validity and reliability of the type 2 diabetes and health promotion scale Turkish version: a methodological study.

    Science.gov (United States)

    Yildiz, Esra; Kavuran, Esin

    2018-03-01

    A healthy promotion is important for maintaining health and preventing complications in patients with type 2 diabetes. The aim of the present study was to examine the psychometrics of a recently developed tool that can be used to screen for a health-promoting lifestyle in patients with type 2 diabetes. Data were collected from outpatients attending diabetes clinics. The Type 2 Diabetes and Health Promotion Scale (T2DHPS) and a demographic questionnaire were administered to 295 participants. Forward-backward translation of the original English version was used to develop a Turkish version. Internal consistency of the scale was assessed by Cronbach's alpha. An explanatory factor analysis and confirmatory factor analysis used validity of the Type 2 Diabetes and Health Promotion Scale - Turkish version. Kaiser-Meyer-Olkin (KMO) and Bartlett's sphericity tests showed that the sample met the criteria required for factor analysis. The reliability coefficient for the total scale was 0.84, and alpha coefficients for the subscales ranged from 0.57 to 0.92. A six-factor solution was obtained that explained 59.3% of the total variance. The ratio of chi-square statistics to degrees of freedom (χ 2 /df) 3.30 (χ 2 = 1157.48/SD = 350); error of root mean square approximation (RMSEA) 0.061; GFI value of 0.91 and comparative fit index (CFI) value was obtained as 0.91. Turkish version of The T2DHPS is a valid and reliable tool that can be used to assess patients' health-promoting lifestyle behaviours. Validity and reliability studies in different cultures and regions are recommended. © 2017 Nordic College of Caring Science.

  13. A pilot study on genetic variation in purine-rich elements in the nephrin gene promoter in type 2 diabetic patients

    Directory of Open Access Journals (Sweden)

    RODRIGO GONZÁLEZ

    2007-01-01

    Full Text Available Diabetic nephropathy (DN is one of the major complications of type 2 diabetes and is associated with coronary disease. Nephrin, a protein mainly expressed in glomeruli, is decreased in DN and other kidney diseases. Since insulin levels are misregulated in type 2 diabetes, a possible connection between DN and its decreased nephrin expression could be the presence of regulatory elements responsive to insulin in the nephrin gene (NPHS1 promoter region. In this work, using bioinformatic tools, we identified a purine-rich GAGA element in the nephrin gene promoter and conducted a genomic study in search of the presence of polymorphisms in this element and its possible association with DN in type 2 diabetic patients. We amplified and sequenced a 514 bp promoter region of 100 individuals and found no genetic variants in the purine-rich GAGA-box of the nephrin gene promoter between groups of patients with diabetes type 2 with and without renal and coronary complications, control patients without diabetes and healthy controls

  14. Moderating Effects of Sales Promotion Types

    Directory of Open Access Journals (Sweden)

    Fernando de Oliveira Santini

    2015-04-01

    Full Text Available This paper aims to analyze the influence sales promotion types have on the relationship between perception of financial risk and perception of utilitarian and hedonic value on consumer purchase intentions. To this end, an experiment was conducted involving 589 participants divided into two groups defined by distinct scenarios in which the sales promotion type (monetary vs. non-monetary was manipulated. The working hypotheses predicted a direct and positive relationship between the perception of (hedonic and utilitarian consumption value and purchase intention for a promoted product and a negative relationship between the perception of consumption value and the perception of financial risk. In addition, it was supposed that the sales promotion type would moderate these direct relationships and that a monetary promotion would have a stronger effect on the relationship between purchase intention and perceived product utility, whereas a non-monetary promotion would have a stronger effect on the other relationships (hedonic value and financial risk perceptions. Analysis of the outcomes supported the proposed hypotheses.

  15. Interventions to promote physical activity in older people with type 2 diabetes mellitus: A systematic review

    Directory of Open Access Journals (Sweden)

    Sazlina eShariff-Ghazali

    2013-12-01

    Full Text Available Introduction: Type 2 diabetes mellitus (T2DM among people aged 60 years and above is a growing public health problem. Regular physical activity is one of the key elements in the management of T2DM. Recommendations suggest that older people with T2DM will benefit from regular physical activity for better disease control and delaying complications. Despite the known benefits, many remain sedentary. Hence, this review assessed interventions for promoting physical activity in persons aged 65 years and older with type 2 diabetes mellitus. Methods: A literature search was conducted using OvidMEDLINE, PubMed, EMBASE, SPORTDiscus and CINAHL databases to retrieve articles published between January 2000 and December 2012. Randomised controlled trials and quasi-experimental designs comparing different strategies to increase physical activity level in persons aged 65 years and older with T2DM were included. The methodological quality of studies was assessed.Results: Twenty-one eligible studies were reviewed, only six studies were rated as good quality and only one study specifically targeted persons aged 65 years and older. Personalised coaching, goal setting, peer support groups, use of technology and physical activity monitors were proven to increase the level of physical activity. Incorporation of health behaviour theories and follow-up supports also were successful strategies. However, the methodological quality and type of interventions promoting physical activity of the included studies in this review varied widely across the eligible studies.Conclusion: Strategies that increased level of physical activity in persons with T2DM are evident but most studies focused on middle-aged persons and there was a lack of well-designed trials. Hence, more studies of satisfactory methodological quality with interventions promoting physical activity in older people are required.

  16. Ubiquitin Ligase RNF138 Promotes Episodic Ataxia Type 2-Associated Aberrant Degradation of Human Cav2.1 (P/Q-Type) Calcium Channels.

    Science.gov (United States)

    Fu, Ssu-Ju; Jeng, Chung-Jiuan; Ma, Chia-Hao; Peng, Yi-Jheng; Lee, Chi-Ming; Fang, Ya-Ching; Lee, Yi-Ching; Tang, Sung-Chun; Hu, Meng-Chun; Tang, Chih-Yung

    2017-03-01

    Voltage-gated Ca V 2.1 channels comprise a pore-forming α 1A subunit with auxiliary α 2 δ and β subunits. Ca V 2.1 channels play an essential role in regulating synaptic signaling. Mutations in the human gene encoding the Ca V 2.1 subunit are associated with the cerebellar disease episodic ataxia type 2 (EA2). Several EA2-causing mutants exhibit impaired protein stability and exert dominant-negative suppression of Ca V 2.1 wild-type (WT) protein expression via aberrant proteasomal degradation. Here, we set out to delineate the protein degradation mechanism of human Ca V 2.1 subunit by identifying RNF138, an E3 ubiquitin ligase, as a novel Ca V 2.1-binding partner. In neurons, RNF138 and Ca V 2.1 coexist in the same protein complex and display notable subcellular colocalization at presynaptic and postsynaptic regions. Overexpression of RNF138 promotes polyubiquitination and accelerates protein turnover of Ca V 2.1. Disrupting endogenous RNF138 function with a mutant (RNF138-H36E) or shRNA infection significantly upregulates the Ca V 2.1 protein level and enhances Ca V 2.1 protein stability. Disrupting endogenous RNF138 function also effectively rescues the defective protein expression of EA2 mutants, as well as fully reversing EA2 mutant-induced excessive proteasomal degradation of Ca V 2.1 WT subunits. RNF138-H36E coexpression only partially restores the dominant-negative effect of EA2 mutants on Ca V 2.1 WT functional expression, which can be attributed to defective membrane trafficking of Ca V 2.1 WT in the presence of EA2 mutants. We propose that RNF138 plays a critical role in the homeostatic regulation of Ca V 2.1 protein level and functional expression and that RNF138 serves as the primary E3 ubiquitin ligase promoting EA2-associated aberrant degradation of human Ca V 2.1 subunits. SIGNIFICANCE STATEMENT Loss-of-function mutations in the human Ca V 2.1 subunit are linked to episodic ataxia type 2 (EA2), a dominantly inherited disease characterized by

  17. TPL-2-ERK1/2 signaling promotes host resistance against intracellular bacterial infection by negative regulation of type I IFN production.

    Science.gov (United States)

    McNab, Finlay W; Ewbank, John; Rajsbaum, Ricardo; Stavropoulos, Evangelos; Martirosyan, Anna; Redford, Paul S; Wu, Xuemei; Graham, Christine M; Saraiva, Margarida; Tsichlis, Philip; Chaussabel, Damien; Ley, Steven C; O'Garra, Anne

    2013-08-15

    Tuberculosis, caused by Mycobacterium tuberculosis, remains a leading cause of mortality and morbidity worldwide, causing ≈ 1.4 million deaths per year. Key immune components for host protection during tuberculosis include the cytokines IL-12, IL-1, and TNF-α, as well as IFN-γ and CD4(+) Th1 cells. However, immune factors determining whether individuals control infection or progress to active tuberculosis are incompletely understood. Excess amounts of type I IFN have been linked to exacerbated disease during tuberculosis in mouse models and to active disease in patients, suggesting tight regulation of this family of cytokines is critical to host resistance. In addition, the immunosuppressive cytokine IL-10 is known to inhibit the immune response to M. tuberculosis in murine models through the negative regulation of key proinflammatory cytokines and the subsequent Th1 response. We show in this study, using a combination of transcriptomic analysis, genetics, and pharmacological inhibitors, that the TPL-2-ERK1/2 signaling pathway is important in mediating host resistance to tuberculosis through negative regulation of type I IFN production. The TPL-2-ERK1/2 signaling pathway regulated production by macrophages of several cytokines important in the immune response to M. tuberculosis as well as regulating induction of a large number of additional genes, many in a type I IFN-dependent manner. In the absence of TPL-2 in vivo, excess type I IFN promoted IL-10 production and exacerbated disease. These findings describe an important regulatory mechanism for controlling tuberculosis and reveal mechanisms by which type I IFN may promote susceptibility to this important disease.

  18. Activation of type 2 cannabinoid receptors (CB2R) promotes fatty acid oxidation through the SIRT1/PGC-1α pathway

    Energy Technology Data Exchange (ETDEWEB)

    Zheng, Xuqin [Department of Endocrinology, First Affiliated Hospital, Nanjing Medical University, Nanjing, Jiangsu Province 210029 (China); Sun, Tao [Department of Neurology, Jinling Hospital, Nanjing University School of Medicine, Nanjing, Jiangsu Province 210002 (China); Wang, Xiaodong, E-mail: xdwang666@hotmail.com [Department of Endocrinology, First Affiliated Hospital, Nanjing Medical University, Nanjing, Jiangsu Province 210029 (China)

    2013-07-05

    Highlights: •TC, a CB2R specific agonist, stimulates SIRT1 activity by PKA/CREB pathway. •TC promotes PGC-1α transcriptional activity by increasing its deacetylation. •TC increases the expression of genes linked to FAO and promotes the rate of FAO. •The effects of TC in FAO are dependent on CB2R. •Suggesting CB2R as a target to treat diseases with lipid dysregulation. -- Abstract: Abnormal fatty acid oxidation has been associated with obesity and type 2 diabetes. At the transcriptional level, peroxisome proliferator-activated receptor-gamma coactivator 1α (PGC-1α) has been reported to strongly increase the ability of hormone nuclear receptors PPARα and ERRα to drive transcription of fatty acid oxidation enzymes. In this study, we report that a specific agonist of the type 2 cannabinoid receptor (CB2R) can lead to fatty acid oxidation through the PGC-1α pathway. We have found that CB2R is expressed in differentiated C2C12 myotubes, and that use of the specific agonist trans-caryophyllene (TC) stimulates sirtuin 1 (SIRT1) deacetylase activity by increasing the phosphorylation of cAMP response element-binding protein (CREB), thus leading to increased levels of PGC-1α deacetylation. This use of TC treatment increases the expression of genes linked to the fatty acid oxidation pathway in a SIRT1/PGC-1α-dependent mechanism and also drastically accelerates the rate of complete fatty acid oxidation in C2C12 myotubes, neither of which occur when CB2R mRNA is knocked down using siRNA. These results reveal that activation of CB2R by a selective agonist promotes lipid oxidation through a signaling/transcriptional pathway. Our findings imply that pharmacological manipulation of CB2R may provide therapeutic possibilities to treat metabolic diseases associated with lipid dysregulation.

  19. Association of an APOC3 promoter variant with type 2 diabetes risk and need for insulin treatment in lean persons

    NARCIS (Netherlands)

    M. van Hoek (Mandy); T.W. van Herpt (Thijs); A. Dehghan (Abbas); A. Hofman (Albert); A. Lieverse (Aloysius); C.M. van Duijn (Cornelia); J.C.M. Witteman (Jacqueline); E.J.G. Sijbrands (Eric)

    2011-01-01

    textabstractAims/hypothesis: An APOC3 promoter haplotype has been previously associated with type 1 diabetes. In this population-based study, we investigated whether APOC3 polymorphisms increase type 2 diabetes risk and need for insulin treatment in lean participants. Methods: In the Rotterdam

  20. fundTPL-2 – ERK1/2 Signaling Promotes Host Resistance against Intracellular Bacterial Infection by Negative Regulation of Type I Interferon Production3

    Science.gov (United States)

    McNab, Finlay W.; Ewbank, John; Rajsbaum, Ricardo; Stavropoulos, Evangelos; Martirosyan, Anna; Redford, Paul S.; Wu, Xuemei; Graham, Christine M.; Saraiva, Margarida; Tsichlis, Philip; Chaussabel, Damien; Ley, Steven C.; O’Garra, Anne

    2013-01-01

    Tuberculosis, caused by Mycobacterium tuberculosis (Mtb), remains a leading cause of mortality and morbidity worldwide, causing approximately 1.4 million deaths per year. Key immune components for host protection during tuberculosis include the cytokines IL-12, IL-1 and TNF-α, as well as IFN-γ and CD4+ Th1 cells. However, immune factors determining whether individuals control infection or progress to active tuberculosis are incompletely understood. Excess amounts of type I interferon have been linked to exacerbated disease during tuberculosis in mouse models and to active disease in patients, suggesting tight regulation of this family of cytokines is critical to host resistance. In addition, the immunosuppressive cytokine IL-10 is known to inhibit the immune response to Mtb in murine models through the negative regulation of key pro-inflammatory cytokines and the subsequent Th1 response. We show here, using a combination of transcriptomic analysis, genetics and pharmacological inhibitors that the TPL-2-ERK1/2 signaling pathway is important in mediating host resistance to tuberculosis through negative regulation of type I interferon production. The TPL-2-ERK1/2 signalling pathway regulated production by macrophages of several cytokines important in the immune response to Mtb as well as regulating induction of a large number of additional genes, many in a type I IFN dependent manner. In the absence of TPL-2 in vivo, excess type I interferon promoted IL-10 production and exacerbated disease. These findings describe an important regulatory mechanism for controlling tuberculosis and reveal mechanisms by which type I interferon may promote susceptibility to this important disease. PMID:23842752

  1. The Catalase –262C/T Promoter Polymorphism and Diabetic Complications in Caucasians with Type 2 Diabetes

    Directory of Open Access Journals (Sweden)

    Kátia Gonçalves dos Santos

    2006-01-01

    Full Text Available Catalase is a central antioxidant enzyme constituting the primary defense against oxidative stress. In this study, we investigated whether the functional –262C/T polymorphism in the promoter of catalase gene is associated with the presence of diabetic retinopathy (DR, diabetic nephropathy (DN and ischemic heart disease (IHD in 520 Caucasian-Brazilians with type 2 diabetes. The –262C/T polymorphism was also examined in 100 Caucasian blood donors. Patients underwent a clinical and laboratory evaluation consisting of a questionnaire, physical examination, assessment of diabetic complications and laboratory tests. Genotype analysis was performed using the polymerase chain reaction followed by digestion with restriction enzyme. The genotype and allele frequencies of the –262C/T polymorphism in patients with type 2 diabetes were very similar to those of blood donors (T allele frequency = 0.20 and 0.18, respectively. Likewise, there were no differences in either genotype or allele frequencies between type 2 diabetic patients with or without DR, DN or IHD. Thus, our results do not support the hypothesis that the –262C/T polymorphism is related to the development of DR, DN or IHD in patients with type 2 diabetes. Further studies are necessary to elucidate the role of catalase gene polymorphisms in the pathogenesis of diabetic complications.

  2. A C-reactive protein promoter polymorphism is associated with type 2 diabetes mellitus in Pima Indians

    DEFF Research Database (Denmark)

    Wolford, Johanna K; Gruber, Jonathan D; Ossowski, Victoria M

    2003-01-01

    of diabetes, independent of adiposity. Because CRP is located on 1q21, we considered it a potential positional candidate gene for T2DM. We therefore evaluated CRP and the nearby serum amyloid P-component, APCS, which is structurally similar to CRP, as candidate diabetes susceptibility genes. Approximately 10......Linkage analysis has identified a susceptibility locus for type 2 diabetes mellitus (T2DM) on chromosome 1q21-q23 in several populations. Results from recent prospective studies indicate that increased levels of C-reactive protein (CRP), a marker of immune system activation, are predictive...... disequilibrium clusters. We genotyped representative SNPs in approximately 1300 Pima samples and found a single variant in the CRP promoter (SNP 133552) that was associated with T2DM (P=0.014), as well as a common haplotype (CGCG) that was associated with both T2DM (P=0.029) and corrected insulin response...

  3. The interleukin-6 (-174) G/C promoter polymorphism is associated with type-2 diabetes mellitus in Native Americans and Caucasians

    DEFF Research Database (Denmark)

    Vozarova, Barbora; Fernández-Real, José-Manuel; Knowler, William C

    2003-01-01

    Chronic low-grade activation of the immune system may play a role in the pathogenesis of type-2 diabetes mellitus (T2DM). Interleukin-6 (IL6), a powerful inducer of hepatic acute phase response, has been implicated in the etiology of insulin resistance and T2DM. Recently, an IL6 promoter...... polymorphism (G/C) at position -174 was found to be associated with measures of insulin sensitivity. Because we have previously found an association between high IL6 levels and insulin resistance in both Pima Indians - a population with high rates of insulin resistance and T2DM - and Caucasians, we aimed...... to assess whether the IL6 promoter polymorphism is associated with T2DM in these populations. We genotyped the IL6 (-174) G/C polymorphism using pyrosequencing in 463 Native Americans and by PCR-RFLP in 329 Spanish Caucasians. Among the Spanish Caucasian subjects, there was a significant difference...

  4. Type 1 plaminogen activator inhibitor gene: Functional analysis and glucocorticoid regulation of its promoter

    International Nuclear Information System (INIS)

    Van Zonneveld, A.J.; Curriden, S.A.; Loskutoff, D.J.

    1988-01-01

    Plasminogen activator inhibitor type 1 is an important component of the fibrinolytic system and its biosynthesis is subject to complex regulation. To study this regulation at the level of transcription, the authors have identified and sequenced the promoter of the human plasminogen activator inhibitor type 1 gene. Nuclease protection experiments were performed by using endothelial cell mRNA and the transcription initiation (cap) site was established. Sequence analysis of the 5' flanking region of the gene revealed a perfect TATA box at position -28 to position -23, the conserved distance from the cap site. Comparative functional studies with the firefly luciferase gene as a reporter gene showed that fragments derived from this 5' flanking region exhibited high promoter activity when transfected into bovine aortic endothelial cells and mouse Ltk - fibroblasts but were inactive when introduced into HeLa cells. These studies indicate that the fragments contain the plasminogen activator inhibitor type 1 promoter and that it is expressed in a tissue-specific manner. Although the fragments were also silent in rat FTO2B hepatoma cells, their promoter activity could be induced up to 40-fold with the synthetic glucocorticoid dexamethasone. Promoter deletion mapping experiments and studies involving the fusion of promoter fragments to a heterologous gene indicated that dexamethasone induction is mediated by a glucocorticoid responsive element with enhancer-like properties located within the region between nucleotides -305 and +75 of the plasminogen activator inhibitor type 1 gene

  5. Improving self-management of type 1 and type 2 diabetes.

    Science.gov (United States)

    Phillips, Anne

    2016-01-06

    Diabetes is an increasingly common life-long condition, which has significant physical, psychological and behavioural implications for individuals. Self-management of type 1 and type 2 diabetes can be complex and challenging. A collaborative approach to care, between healthcare professionals and patients, is essential to promote self-management skills and knowledge to help patients engage in shared decision making and manage any difficulties associated with a diagnosis of diabetes.

  6. Illness perception, risk perception and health promotion self-care behaviors among Chinese patient with type 2 diabetes: A cross-sectional survey.

    Science.gov (United States)

    Nie, Rong; Han, Yanhong; Xu, Jiaqi; Huang, Qiao; Mao, Jing

    2018-02-01

    To explore illness perception and perceived risk of developing diabetes complications in relation to health-promoting self-care behaviors among Chinese patients with type 2 diabetes. Illness and risk perceptions are important determinants of various health behaviors. However, few studies have simultaneously examined the impacts of these two constructs on self-care among diabetic patients. Data were collected on participants' characteristics, illness perception, risk perception, and health-promoting self-care behaviors over 6months among 304 subjects from three general hospitals. Significant associations between illness perception and risk perception were observed. Illness perception and/or risk perception explained an independent, small but significant proportion of the variance in each health-promoting self-care behavior. One's perceptions of illness and future risk might be influential in understanding health-promoting self-care among diabetic patients. It may be useful to improve self-management by tailoring intervention content to individuals' illness-related perceptions. Copyright © 2017 Elsevier Inc. All rights reserved.

  7. Nursing interventions for promoting self-care of persons with type 2 diabetes: an integrative review

    Directory of Open Access Journals (Sweden)

    Glória Yanne Martins de Oliveira

    2016-12-01

    Full Text Available This is an integrative review aiming at analyzing and identifying the evidence available in the literature on nursing interventions to promote self-care for persons with type 2 diabetes mellitus. Data collection occurred in the Latin American and Caribbean Health Sciences (LILACS, MEDLINE (via EBSCO, Cumulative Index to Nursing and Allied Health Literature (CINAHL and SCOPUS. The survey of articles occurred in July and August 2015 by two independent reviewers. The initial search identified 239 articles and eight of them met the selection criteria. Health education has emerged as a strategic field for implementing nursing interventions. Interventions with patient monitoring and that provided more care time were more satisfactory regarding self-care practices. The Orem's Self-Care Deficit Theory is indicated as a guide to direct the educator in self-care of diabetic persons.

  8. Glucocorticoid-mediated activation of GSK3β promotes tau phosphorylation and impairs memory in type 2 diabetes.

    Science.gov (United States)

    Dey, Aditi; Hao, Shuai; Wosiski-Kuhn, Marlena; Stranahan, Alexis M

    2017-09-01

    Type 2 diabetes is increasingly recognized as a risk factor for Alzheimer's disease, but the underlying mechanisms remain poorly understood. Hyperphosphorylation of the microtubule-associated protein tau has been reported in rodent models of diabetes, including db/db mice, which exhibit insulin resistance and chronically elevated glucocorticoids due to leptin receptor insufficiency. In this report, we investigated endocrine mechanisms for hippocampal tau phosphorylation in db/db and wild-type mice. By separately manipulating peripheral and intrahippocampal corticosterone levels, we determined that hippocampal corticosteroid exposure promotes tau phosphorylation and activates glycogen synthase kinase 3β (GSK3β). Subsequent experiments in hippocampal slice preparations revealed evidence for a nongenomic interaction between glucocorticoids and GSK3β. To examine whether GSK3β activation mediates tau phosphorylation and impairs memory in diabetes, db/db and wild-type mice received intrahippocampal infusions of TDZD-8, a non-ATP competitive thiadiazolidinone inhibitor of GSK3β. Intrahippocampal TDZD-8 blocked tau hyperphosphorylation and normalized hippocampus-dependent memory in db/db mice, suggesting that pathological synergy between diabetes and Alzheimer's disease may involve glucocorticoid-mediated activation of GSK3β. Copyright © 2017 Elsevier Inc. All rights reserved.

  9. PROMOTING PSYCHO-SOCIAL-SPIRITUAL RESPONSE IN PATIENTS WITH TYPE 2 DIABETES MELLITUS THROUGH APLICATION ON SELF CARE MANAGEMENT MODUL

    Directory of Open Access Journals (Sweden)

    Kusnanto Kusnanto

    2017-04-01

    Full Text Available Introduction: Diabetes mellitus was a kind of incurable chronic disease that actually manageable. The global prevalence tends to increase due to less self management of the disease and the impact of it was severe health condition. There were so many interventions implemented but failed to give optimal improvement in patient’s condition and there are so many DM patients have insufficient ability to manage their own disease. Patients need to have knowledge, skills, and self confident to be able to manage their disease. Patient’s self-management depends on patient’s education, empowerment, and self monitoring in evaluating their self-care management. The purpose of this research was promoting patient’s psychological, social, and spiritual conditions through Self Care Management. Improvement in psychological, social, and spiritual conditions in patients with DM will lead to better level of blood glucose and HbA1C. Method: Patient newly diagnose with Type 2 DM at Puskesmas Kebonsari was selected with purposive sampling and divided into two groups. Each group contains 25 patients. Intervention group was given Self Diabetes Management Module. Before and after intervention patient was given Questionnaire. The data then analyzed using Student-T test, McNemar and Chi-Square. Result: The result of this research showed patient have constructive coping, increase interpersonal relation. Patients also have better acceptance about the disease and involve in its management. Discussion: Self Care Management Module promotes psychological, social, and spiritual conditions in patients with type 2 DM.

  10. The use of lac-type promoters in control analysis

    DEFF Research Database (Denmark)

    Jensen, Peter Ruhdal; Westerhoff, H. v.; Michelsen, Ole

    1993-01-01

    experimentally by constructing E. coli strains, in which the chromosomal atp operon is transcribed from the lacUV5 and the tacI promoter. We measured the concentration of the c subunit of H+-ATPase, and found that the expression of this enzyme could be modulated between non-detectable levels and up to five times...... the wild-type level. Thus, in the absence of inducer, no expression of atp genes could be detected when the atp operon was controlled by the lacUV5 promoter, and we estimate that the expression was less than 0.0025 times the wild-type level. We show that the introduction of a lac Y mutation facilitated...

  11. Short repeats in the heme oxygenase 1 gene promoter is associated with increased levels of inflammation, ferritin and higher risk of type-2 diabetes mellitus.

    Science.gov (United States)

    Andrews, Mónica; Leiva, Elba; Arredondo-Olguín, Miguel

    2016-09-01

    We evaluated the relationship between the HO1 genotype, ferritin levels and the risk of type-2 diabetes and inflammation. Eight hundred thirty-five individuals were evaluated and classified according to their nutritional status and the presence of type-2 diabetes: 153 overweight (OW); 62 obese (OB); 55 type-2 diabetes mellitus (DM); 202 OWDM; 239 OBDM and 124 controls (C). We studied biochemical (glycemia, insulin, lipid profile, liver enzyme, creatinine, hsCRP), hematological (hemoglobin, free erythrocyte protoporphyrin, transferrin receptor and serum Fe and ferritin) and oxidative stress (SOD, GHS and TBARS) parameters. We determined heme oxygenase activity and the (GT)n polymorphism in its gene promoter. Individuals with diabetes, independent of nutritional status, showed high levels of ferritin and HO activity compared to control subjects. Allelic frequency was not different between the groups (Chi(2), NS) however, genotypes were different (Chi(2), P1). The SS (short-short) genotype was higher in all DM individuals compared to controls and MM was higher in controls. SM (short-medium) genotype was an independent risk factor for DM in logistic regression analysis. We observed high risk for type-2 diabetes mellitus in the presence of SM genotype and high levels of ferritin (OR adjusted: 2.7; 1.9-3.6; p1; compared to control group). It was also significantly related to inflammation. The SM genotype in HO1 gene promoter and ferritin levels were associated with higher risk for type-2 diabetes and for having a higher marker of inflammation, which is the main risk factor for the development of chronic diseases. Copyright © 2016 Elsevier GmbH. All rights reserved.

  12. Novel C-2 epimerization of aldoses promoted by nickel(II) diamine complexes, involving a stereospecific pinacol-type 1,2-carbon shift

    International Nuclear Information System (INIS)

    Tanase, Tomoaki; Shimizu, Fumihiko; Kuse, Manabu; Yano, Shigenobu; Hidai, Masanobu; Yoshikawa, Sadao

    1988-01-01

    The newly discovered C-2 epimerization of aldoses promoted by nickel(II) diamine complexes has been investigated in detail by using 13 C-enriched D-glucose, 13 C NMR spectroscopy, and EXAFS (extended x-ray absorption fine structure) analysis. Aldoses treated with nickel(II) diamine complexes (diamine = N,N,N'-trimethylethylenediamine (N,N,N'-Me 3 en), N,N,N',N'-tetramethylethylenediamine (N,N,N',N'-Me 4 en), etc.) in methanolic solutions were rapidly (60 degree C, 3-5 min) epimerized at C-2 to give equilibrium mixtures where the ratio of C-2 epimers shifts to the side of the naturally rare mannose-type aldoses (having the cis arrangement of C-2 and C-3 hydroxyl groups) compared with those in the thermodynamic equilibrium states. The epimerization product of D-[1- 13 C]glucose was exclusively D-[2- 13 C]mannose, demonstrating that the reaction involves a stereospecific 1,2-shift of the carbon skeleton resulting in inversion of configuration at C-2. Furthermore, the absorption and circular dichroism spectra of the reaction solutions indicated the presence of an intermediate nickel(II) complex containing both diamine and sugar components, which was directly revealed by EXAFS analysis to be a mononuclear nickel(II) complex having octahedral coordination geometry. All these observations strongly suggest that the C-2 epimerization proceeds through an intermediate mononuclear nickel(II) complex, where the carbinolamine-like adduct of aldose with diamine in an open-chain form is epimerized at C-2 by a stereospecific rearrangement of the carbon skeleton or a pinacol-type rearrangement involving a cyclic transition state. 44 refs., 5 figs., 4 tabs

  13. Promoting physical activity in sedentary elderly Malays with type 2 diabetes: a protocol for randomised controlled trial

    Science.gov (United States)

    Sazlina, Shariff-Ghazali; Browning, Colette Joy; Yasin, Shajahan

    2012-01-01

    Introduction Like many countries Malaysia is facing an increase in the number of people with type 2 diabetes mellitus diabetes (T2DM) and modifiable lifestyle factors such as sedentary behaviour are important drivers of this increase. The level of physical activity is low among elderly Malay people. In Malaysia, strategies to promote physical activity in elderly Malay people with T2DM are not well documented in the research literature. This paper discusses an intervention to increase physical activity in elderly Malay people with T2DM. The aim of our study was to evaluate the effectiveness of personalised feedback alone and in combination with peer support in promoting and maintaining physical activity in comparison with usual care. Methods and analysis A three-arm randomised controlled trial will be conducted among sedentary Malay adults aged 60 years and above with T2DM attending an urban primary healthcare clinic in Malaysia. The participants will be randomised into three groups for a 12-week intervention with a follow-up at 24 and 36 weeks to assess adherence. The primary outcome of this study is pedometer-determined physical activity. Glycaemic and blood pressure control, body composition, cardiorespiratory fitness, balance, lipid profile, health-related quality of life, psychological well-being, social support and self-efficacy for exercise are the secondary measures. Linear mixed models will be used to determine the effect of the intervention over time and between groups. Ethical and dissemination The Monash University Human Research Ethics Committee and the Malaysian Ministry of Health's Medical Research Ethics Committee approved this protocol. The findings of this study will be presented at international conferences and published in peer-reviewed journals. Trial registration This study protocol has been registered with the Malaysian National Medical Research Registry and with the Current Controlled Trial Ltd (http

  14. Promoting physical activity in sedentary elderly Malays with type 2 diabetes: a protocol for randomised controlled trial.

    Science.gov (United States)

    Sazlina, Shariff-Ghazali; Browning, Colette Joy; Yasin, Shajahan

    2012-01-01

    Like many countries Malaysia is facing an increase in the number of people with type 2 diabetes mellitus diabetes (T2DM) and modifiable lifestyle factors such as sedentary behaviour are important drivers of this increase. The level of physical activity is low among elderly Malay people. In Malaysia, strategies to promote physical activity in elderly Malay people with T2DM are not well documented in the research literature. This paper discusses an intervention to increase physical activity in elderly Malay people with T2DM. The aim of our study was to evaluate the effectiveness of personalised feedback alone and in combination with peer support in promoting and maintaining physical activity in comparison with usual care. A three-arm randomised controlled trial will be conducted among sedentary Malay adults aged 60 years and above with T2DM attending an urban primary healthcare clinic in Malaysia. The participants will be randomised into three groups for a 12-week intervention with a follow-up at 24 and 36 weeks to assess adherence. The primary outcome of this study is pedometer-determined physical activity. Glycaemic and blood pressure control, body composition, cardiorespiratory fitness, balance, lipid profile, health-related quality of life, psychological well-being, social support and self-efficacy for exercise are the secondary measures. Linear mixed models will be used to determine the effect of the intervention over time and between groups. ETHICAL AND DISSEMINATION: The Monash University Human Research Ethics Committee and the Malaysian Ministry of Health's Medical Research Ethics Committee approved this protocol. The findings of this study will be presented at international conferences and published in peer-reviewed journals. This study protocol has been registered with the Malaysian National Medical Research Registry and with the Current Controlled Trial Ltd (http://www.controlled-trials.com/ISRCTN71447000/).

  15. A tailored intervention to promote uptake of retinal screening among young adults with type 2 diabetes - an intervention mapping approach.

    Science.gov (United States)

    Lake, Amelia J; Browne, Jessica L; Abraham, Charles; Tumino, Dee; Hines, Carolyn; Rees, Gwyneth; Speight, Jane

    2018-05-31

    Young adults (18-39 years) with type 2 diabetes are at risk of early development and rapid progression of diabetic retinopathy, a leading cause of vision loss and blindness in working-age adults. Retinal screening is key to the early detection of diabetic retinopathy, with risk of vision loss significantly reduced by timely treatment thereafter. Despite this, retinal screening rates are low among this at-risk group. The objective of this study was to develop a theoretically-grounded, evidence-based retinal screening promotion leaflet, tailored to young adults with type 2 diabetes. Utilising the six steps of Intervention Mapping, our multidisciplinary planning team conducted a mixed-methods needs assessment (Step 1); identified modifiable behavioural determinants of screening behaviour and constructed a matrix of change objectives (Step 2); designed, reviewed and debriefed leaflet content with stakeholders (Steps 3 and 4); and developed program implementation and evaluation plans (Steps 5 and 6). Step 1 included in-depth qualitative interviews (N = 10) and an online survey that recruited a nationally-representative sample (N = 227), both informed by literature review. The needs assessment highlighted the crucial roles of knowledge (about diabetic retinopathy and screening), perception of personal risk, awareness of the approval of significant others and engagement with healthcare team, on retinal screening intentions and uptake. In Step 2, we selected five modifiable behavioural determinants to be targeted: knowledge, attitudes, normative beliefs, intention, and behavioural skills. In Steps 3 and 4, the "Who is looking after your eyes?" leaflet was developed, containing persuasive messages targeting each determinant and utilising engaging, cohort-appropriate imagery. In Steps 5 and 6, we planned Statewide implementation and designed a randomised controlled trial to evaluate the leaflet. This research provides an example of a systematic, evidence

  16. Anthropometrics of mental foramen in dry dentate and edentulous mandibles in Coastal Andhra population of Andhra Pradesh State

    Directory of Open Access Journals (Sweden)

    Srinivas Moogala

    2014-01-01

    Full Text Available Aim: The aim of this study is to determine the morphological features and morphometrics of mental foramen with reference to surrounding anatomical landmarks in Coastal Andhra population of Andhra Pradesh State. Materials and Methods: Two-hundred and nineteen dry dentate and edentulous mandibles are examined in this study. Out of these 127 were dentate and 92 were edentulous. Various morphological and morphometrical parameters were measured by using digital Vernier caliper, metallic wire and metallic scale on both the right and left sides. Results: In the present study, the distance between most anterior margin of mental foramen and posterior border of ramus of the mandible is [MF-PR], MF-PR is 69.61 ± 6.03 mm on the right side and is 69.17 ± 6. 0 mm on left side in dentate mandible. In edentulous type, MF-PR is 68.39 ±6.4 mm on right side and 68.81 ± 6.55 mm on left side. In the present study, the distance between symphysis menti and most anterior margin of mental foramen [MF-SM] in dentate mandible is 28.24 ± 5.09 mm on right side and is 27.45 ± 3.7 mm on left side. In edentulous mandible (MF-SM is 28.51 ± 4.5 mm on right side and on left side is 27.99 ± 4.50 mm. Conclusion: Acquiring the knowledge and importance of anatomy of mental foramen is helpful in avoiding neurovascular complications, during regional anesthesia, peri apical surgeries, nerve repositioning and dental implant placement.

  17. The flavonoid fisetin promotes osteoblasts differentiation through Runx2 transcriptional activity.

    Science.gov (United States)

    Léotoing, Laurent; Davicco, Marie-Jeanne; Lebecque, Patrice; Wittrant, Yohann; Coxam, Véronique

    2014-06-01

    Flavonoids represent a group of polyphenolic compounds commonly found in daily nutrition with proven health benefits. Among this group, the flavonol fisetin has been previously shown to protect bone by repressing osteoclast differentiation. In the present study, we investigated the role of fisetin in regulating osteoblasts physiology. In vivo mice treated with LPSs exhibited osteoporosis features associated with a dramatic repression of osteoblast marker expression. In this model, inhibition of osteocalcin and type I collagen alpha 1 transcription was partially countered by a daily consumption of fisetin. Interestingly, in vitro, fisetin promoted both osteoblast alkaline phosphatase activity and mineralization process. To decipher how fisetin may exert its positive effect on osteoblastogenesis, we analyzed its ability to control the runt-related transcription factor 2 (Runx2), a key organizer in developing and maturing osteoblasts. While fisetin did not impact Runx2 mRNA and protein levels, it upregulated its transcriptional activity. Actually, fisetin stimulated the luciferase activity of a reporter plasmid driven by the osteocalcin gene promoter that contains Runx2 binding sites and promoted the mRNA expression of osteocalcin and type I collagen alpha 1 targets. Bone sparing properties of fisetin also rely on its positive influence on osteoblast differentiation and activity. © 2014 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  18. Promoter2.0: for the recognition of PolII promoter sequences

    DEFF Research Database (Denmark)

    Knudsen, Steen; Knudsen, Steen

    1999-01-01

    transcription start sites. On standardized test setsconsisting of human genomic DNA, the performance of Promoter2.0 compares well with other softwaredeveloped for the same purpose. Availability : Promoter2.0 is available as a Web server at http://www.cbs.dtu.dk/services/promoter/ Contact : steen@cbs.dtu.dk...

  19. CMV-Promoter Driven Codon-Optimized Expression Alters the Assembly Type and Morphology of a Reconstituted HERV-K(HML-2

    Directory of Open Access Journals (Sweden)

    Oliver Hohn

    2014-11-01

    Full Text Available The HERV-K(HML-2 family contains the most recently integrated and best preserved endogenized proviral sequences in the human genome. All known elements have nevertheless been subjected to mutations or deletions that render expressed particles non-infectious. Moreover, these post-insertional mutations hamper the analysis of the general biological properties of this ancient virus family. The expression of consensus sequences and sequences of elements with reverted post-insertional mutations has therefore been very instrumental in overcoming this limitation. We investigated the particle morphology of a recently reconstituted HERV-K113 element termed oriHERV-K113 using thin-section electron microscopy (EM and could demonstrate that strong overexpression by substitution of the 5'LTR for a CMV promoter and partial codon optimization altered the virus assembly type and morphology. This included a conversion from the regular C-type to an A-type morphology with a mass of cytoplasmic immature cores tethered to the cell membrane and the membranes of vesicles. Overexpression permitted the release and maturation of virions but reduced the envelope content. A weaker boost of virus expression by Staufen-1 was not sufficient to induce these morphological alterations.

  20. CMV-promoter driven codon-optimized expression alters the assembly type and morphology of a reconstituted HERV-K(HML-2).

    Science.gov (United States)

    Hohn, Oliver; Hanke, Kirsten; Lausch, Veronika; Zimmermann, Anja; Mostafa, Saeed; Bannert, Norbert

    2014-11-11

    The HERV-K(HML-2) family contains the most recently integrated and best preserved endogenized proviral sequences in the human genome. All known elements have nevertheless been subjected to mutations or deletions that render expressed particles non-infectious. Moreover, these post-insertional mutations hamper the analysis of the general biological properties of this ancient virus family. The expression of consensus sequences and sequences of elements with reverted post-insertional mutations has therefore been very instrumental in overcoming this limitation. We investigated the particle morphology of a recently reconstituted HERV-K113 element termed oriHERV-K113 using thin-section electron microscopy (EM) and could demonstrate that strong overexpression by substitution of the 5'LTR for a CMV promoter and partial codon optimization altered the virus assembly type and morphology. This included a conversion from the regular C-type to an A-type morphology with a mass of cytoplasmic immature cores tethered to the cell membrane and the membranes of vesicles. Overexpression permitted the release and maturation of virions but reduced the envelope content. A weaker boost of virus expression by Staufen-1 was not sufficient to induce these morphological alterations.

  1. Worse cardiac remodeling in response to pressure overload in type 2 diabetes mellitus.

    Science.gov (United States)

    Gonçalves, N; Gomes-Ferreira, C; Moura, C; Roncon-Albuquerque, R; Leite-Moreira, A F; Falcão-Pires, I

    2016-08-15

    Diabetic cardiomyopathy is characterized by cardiac structural and functional abnormalities. Additionally, chronic pressure overload conditions are highly prevalent amongst diabetic population and this association leads to a more severe myocardial impairment. The differences in myocardial pathophysiology between type 1 and type 2 diabetes mellitus (DM) still remain to be clarified. Thus, we aimed to investigate biventricular structural and functional changes promoted by the two types of DM and the impact of concomitant chronic pressure overload. Wistar rats were injected with streptozotocin (Type 1 DM, T1DM) or fed with a hypercaloric diet (Type 2 DM, T2DM). Pressure overload was imposed in DM animals by aortic constriction and after 5weeks of DM the cardiac function and structure were evaluated. Both types of DM promoted hypertrophy, increased fibrosis and advanced glycation end-products deposition, in the two ventricles. Interestingly, the induced myocardial alterations were distinct. While T1DM stimulated a pronounced hypertrophy and extracellular matrix remodeling, T2DM induced functional impairment. The negative impact of the association of DM with aortic constriction was more pronounced in T2DM, promoting impaired function and increased stiffness, particularly in the right ventricle. Our study demonstrated that the two types of diabetes induce distinct cardiac alterations per se or when combined with chronic pressure overload. T1DM promoted a more extensive remodeling in cardiac structure while T2DM significantly impaired ventricular function. The impact of pressure overload was more notorious in T2DM as observed by worse myocardial remodeling, suggesting a higher susceptibility to the deleterious effects of chronic pressure overload, namely hypertension, among this diabetic population. Copyright © 2016 Elsevier Ireland Ltd. All rights reserved.

  2. A-type nuclear lamins act as transcriptional repressors when targeted to promoters

    International Nuclear Information System (INIS)

    Lee, Damian C.; Welton, K. Linnea; Smith, Erica D.; Kennedy, Brian K.

    2009-01-01

    Regions of heterochromatin are often found at the periphery of the mammalian nucleus, juxtaposed to the nuclear lamina. Genes in these regions are likely maintained in a transcriptionally silent state, although other locations at the nuclear periphery associated with nuclear pores are sites of active transcription. As primary components of the nuclear lamina, A- and B-type nuclear lamins are intermediate filament proteins that interact with DNA, histones and known transcriptional repressors, leading to speculation that they may promote establishment of repressive domains. However, no direct evidence of a role for nuclear lamins in transcriptional repression has been reported. Here we find that human lamin A, when expressed in yeast and cultured human cells as a fusion protein to the Gal4 DNA-binding domain (DBD), can mediate robust transcriptional repression of promoters with Gal4 binding sites. Full repression by lamin A requires both the coiled-coil rod domain and the C-terminal tail domain. In human cells, other intermediate filament proteins such as lamin B and vimentin are unable to confer robust repression as Gal4-DBD fusions, indicating that this property is specific to A-type nuclear lamins. These findings indicate that A-type lamins can promote transcriptional repression when in proximity of a promoter

  3. Type 2-diabetes. Sociale relationer og sundhedsadfaerd

    DEFF Research Database (Denmark)

    Holm, Astrid Ledgaard; Andersen, Anne Friis; Avlund, Kirsten

    2008-01-01

    INTRODUCTION: Type 2 diabetes is a chronic disease that challenges the Danish health care system and health behaviour is important in connection with rehabilitation. Foreign research shows that social relations are associated with a healthy lifestyle, but this effect has not yet been examined...... to the recommendations for physical activity and diet. Only the association between functional network and diet remains significant when adjusted for the effects of co-variates. CONCLUSION: The study shows a need for the promotion of health behaviour among adult Danes with type 2 diabetes, and indicates that social...... thoroughly based on Danish data. The purpose of this study was to examine the association between social relations and health behaviour among adult Danes with type 2 diabetes. MATERIALS AND METHODS: The study design was cross-sectional and based on data from the report ''Sundheds- og Sygelighedsundersøgelsen...

  4. Herpes simplex virus latency-associated transcript sequence downstream of the promoter influences type-specific reactivation and viral neurotropism.

    Science.gov (United States)

    Bertke, Andrea S; Patel, Amita; Krause, Philip R

    2007-06-01

    Herpes simplex virus (HSV) establishes latency in sensory nerve ganglia during acute infection and may later periodically reactivate to cause recurrent disease. HSV type 1 (HSV-1) reactivates more efficiently than HSV-2 from trigeminal ganglia while HSV-2 reactivates more efficiently than HSV-1 from lumbosacral dorsal root ganglia (DRG) to cause recurrent orofacial and genital herpes, respectively. In a previous study, a chimeric HSV-2 that expressed the latency-associated transcript (LAT) from HSV-1 reactivated similarly to wild-type HSV-1, suggesting that the LAT influences the type-specific reactivation phenotype of HSV-2. To further define the LAT region essential for type-specific reactivation, we constructed additional chimeric HSV-2 viruses by replacing the HSV-2 LAT promoter (HSV2-LAT-P1) or 2.5 kb of the HSV-2 LAT sequence (HSV2-LAT-S1) with the corresponding regions from HSV-1. HSV2-LAT-S1 was impaired for reactivation in the guinea pig genital model, while its rescuant and HSV2-LAT-P1 reactivated with a wild-type HSV-2 phenotype. Moreover, recurrences of HSV-2-LAT-S1 were frequently fatal, in contrast to the relatively mild recurrences of the other viruses. During recurrences, HSV2-LAT-S1 DNA increased more in the sacral cord compared to its rescuant or HSV-2. Thus, the LAT sequence region, not the LAT promoter region, provides essential elements for type-specific reactivation of HSV-2 and also plays a role in viral neurotropism. HSV-1 DNA, as quantified by real-time PCR, was more abundant in the lumbar spinal cord, while HSV-2 DNA was more abundant in the sacral spinal cord, which may provide insights into the mechanism for type-specific reactivation and different patterns of central nervous system infection of HSV-1 and HSV-2.

  5. Effectiveness of a regional prepregnancy care program in women with type 1 and type 2 diabetes

    DEFF Research Database (Denmark)

    Murphy, Helen R.; Roland, Jonathan M.; Skinner, Timothy C.

    2010-01-01

    of 680 pregnancies in women with type 1 and type 2 diabetes was performed. Primary outcomes were adverse pregnancy outcome (congenital malformation, stillbirth, or neonatal death), congenital malformation, and indicators of pregnancy preparation (5 mg folic acid, gestational age, and A1C). Comparisons...... with improved pregnancy preparation and reduced risk of adverse pregnancy outcome in type 1 and type 2 diabetes. Prepregnancy care had benefits beyond improved glycemic control and was a stronger predictor of pregnancy outcome than maternal obesity, ethnicity, or social disadvantage.......OBJECTIVE - To implement and evaluate a regional prepregnancy care program in women with type 1 and type 2 diabetes. RESEARCH DESIGN AND METHODS - Prepregnancy care was promoted among patients and health professionals and delivered across 10 regional maternity units. A prospective cohort study...

  6. Social support and self-management behaviour among patients with Type 2 diabetes

    DEFF Research Database (Denmark)

    Schiøtz, M. L.; Bøgelund, M.; Almdal, T.

    2012-01-01

    Aims To investigate the relationship between structural and functional social support and patient activation, diabetes-related emotional distress, perceived diabetes care, self-management behaviour and HbA 1c levels among patients with Type2 diabetes. Methods Self-administered questionnaires were...... emotional distress, negative assessment of care, less health-promoting eating habits and less frequent foot examinations. Conclusions Good social support is significantly associated with health-promoting behaviours and well-being among patients with Type2 diabetes. However, HbA 1c levels are higher...... for cohabitant persons, indicating barriers for social support. Intervention research is needed to investigate the causal relationship between social networks and health-promoting behaviours. This knowledge should be used in clinical practice when targeting and designing education, support and care for patients...

  7. Medial septal GABAergic projection neurons promote object exploration behavior and type 2 theta rhythm

    Science.gov (United States)

    Gangadharan, Gireesh; Shin, Jonghan; Kim, Seong-Wook; Kim, Angela; Paydar, Afshin; Kim, Duk-Soo; Miyazaki, Taisuke; Watanabe, Masahiko; Yanagawa, Yuchio; Kim, Jinhyun; Kim, Yeon-Soo; Kim, Daesoo; Shin, Hee-Sup

    2016-01-01

    Exploratory drive is one of the most fundamental emotions, of all organisms, that are evoked by novelty stimulation. Exploratory behavior plays a fundamental role in motivation, learning, and well-being of organisms. Diverse exploratory behaviors have been described, although their heterogeneity is not certain because of the lack of solid experimental evidence for their distinction. Here we present results demonstrating that different neural mechanisms underlie different exploratory behaviors. Localized Cav3.1 knockdown in the medial septum (MS) selectively enhanced object exploration, whereas the null mutant (KO) mice showed enhanced-object exploration as well as open-field exploration. In MS knockdown mice, only type 2 hippocampal theta rhythm was enhanced, whereas both type 1 and type 2 theta rhythm were enhanced in KO mice. This selective effect was accompanied by markedly increased excitability of septo-hippocampal GABAergic projection neurons in the MS lacking T-type Ca2+ channels. Furthermore, optogenetic activation of the septo-hippocampal GABAergic pathway in WT mice also selectively enhanced object exploration behavior and type 2 theta rhythm, whereas inhibition of the same pathway decreased the behavior and the rhythm. These findings define object exploration distinguished from open-field exploration and reveal a critical role of T-type Ca2+ channels in the medial septal GABAergic projection neurons in this behavior. PMID:27208094

  8. Heterozygous Null Bone Morphogenetic Protein Receptor Type 2 Mutations Promote SRC Kinase-dependent Caveolar Trafficking Defects and Endothelial Dysfunction in Pulmonary Arterial Hypertension*

    Science.gov (United States)

    Prewitt, Allison R.; Ghose, Sampa; Frump, Andrea L.; Datta, Arumima; Austin, Eric D.; Kenworthy, Anne K.; de Caestecker, Mark P.

    2015-01-01

    Hereditary pulmonary arterial hypertension (HPAH) is a rare, fatal disease of the pulmonary vasculature. The majority of HPAH patients inherit mutations in the bone morphogenetic protein type 2 receptor gene (BMPR2), but how these promote pulmonary vascular disease is unclear. HPAH patients have features of pulmonary endothelial cell (PEC) dysfunction including increased vascular permeability and perivascular inflammation associated with decreased PEC barrier function. Recently, frameshift mutations in the caveolar structural protein gene Caveolin-1 (CAV-1) were identified in two patients with non-BMPR2-associated HPAH. Because caveolae regulate endothelial function and vascular permeability, we hypothesized that defects in caveolar function might be a common mechanism by which BMPR2 mutations promote pulmonary vascular disease. To explore this, we isolated PECs from mice carrying heterozygous null Bmpr2 mutations (Bmpr2+/−) similar to those found in the majority of HPAH patients. We show that Bmpr2+/− PECs have increased numbers and intracellular localization of caveolae and caveolar structural proteins CAV-1 and Cavin-1 and that these defects are reversed after blocking endocytosis with dynasore. SRC kinase is also constitutively activated in Bmpr2+/− PECs, and localization of CAV-1 to the plasma membrane is restored after treating Bmpr2+/− PECs with the SRC kinase inhibitor 3-(4-chlorophenyl)-1-(1,1-dimethylethyl)-1H-pyrazolo[3,4-d]pyrimidin-4-amine (PP2). Late outgrowth endothelial progenitor cells isolated from HPAH patients show similar increased activation of SRC kinase. Moreover, Bmpr2+/− PECs have impaired endothelial barrier function, and barrier function is restored after treatment with PP2. These data suggest that heterozygous null BMPR2 mutations promote SRC-dependent caveolar trafficking defects in PECs and that this may contribute to pulmonary endothelial barrier dysfunction in HPAH patients. PMID:25411245

  9. OsLOL1, a C2C2-type zinc finger protein, interacts with OsbZIP58 to promote seed germination through the modulation of gibberellin biosynthesis in Oryza sativa.

    Science.gov (United States)

    Wu, Jiahe; Zhu, Chuanfeng; Pang, Jinhuan; Zhang, Xiangrong; Yang, Chunlin; Xia, Guixian; Tian, Yingchuan; He, Chaozu

    2014-12-01

    Seed germination is a key developmental process in the plant life cycle that is influenced by various environmental cues and phytohormones through gene expression and a series of metabolism pathways. In the present study, we investigated a C2C2-type finger protein, OsLOL1, which promotes gibberellin (GA) biosynthesis and affects seed germination in Oryza sativa (rice). We used OsLOL1 antisense and sense transgenic lines to explore OsLOL1 functions. Seed germination timing in antisense plants was restored to wild type when exogenous GA3 was applied. The reduced expression of the GA biosynthesis gene OsKO2 and the accumulation of ent-kaurene were observed during germination in antisense plants. Based on yeast two-hybrid and firefly luciferase complementation analyses, OsLOL1 interacted with the basic leucine zipper protein OsbZIP58. The results from electrophoretic mobility shift and dual-luciferase reporter assays showed that OsbZIP58 binds the G-box cis-element of the OsKO2 promoter and activates LUC reporter gene expression, and that interaction between OsLOL1 and OsbZIP58 activates OsKO2 gene expression. In addition, OsLOL1 decreased SOD1 gene expression and accelerated programmed cell death (PCD) in the aleurone layer of rice grains. These findings demonstrate that the interaction between OsLOL1 and OsbZIP58 influences GA biosynthesis through the activation of OsKO2 via OsbZIP58, thereby stimulating aleurone PCD and seed germination. © 2014 The Authors The Plant Journal © 2014 John Wiley & Sons Ltd.

  10. Economic Evaluation of Combined Diet and Physical Activity Promotion Programs to Prevent Type 2 Diabetes Among Persons at Increased Risk: A Systematic Review for the Community Preventive Services Task Force

    Science.gov (United States)

    Li, Rui; Qu, Shuli; Zhang, Ping; Chattopadhyay, Sajal; Gregg, Edward W.; Albright, Ann; Hopkins, David; Pronk, Nicolaas P.

    2016-01-01

    Background Diabetes is a highly prevalent and costly disease. Studies indicate that combined diet and physical activity promotion programs can prevent type 2 diabetes among persons at increased risk. Purpose To systematically evaluate the evidence on cost, cost-effectiveness, and cost-benefit estimates of diet and physical activity promotion programs. Data Sources Cochrane Library, EMBASE, MEDLINE, PsycINFO, Sociological Abstracts, Web of Science, EconLit, and CINAHL through 7 April 2015. Study Selection English-language studies from high-income countries that provided data on cost, cost-effectiveness, or cost-benefit ratios of diet and physical activity promotion programs with at least 2 sessions over at least 3 months delivered to persons at increased risk for type 2 diabetes. Data Extraction Dual abstraction and assessment of relevant study details. Data Synthesis Twenty-eight studies were included. Costs were expressed in 2013 U.S. dollars. The median program cost per participant was $653. Costs were lower for group-based programs (median, $417) and programs implemented in community or primary care settings (median, $424) than for the U.S. DPP (Diabetes Prevention Program) trial and the DPP Outcomes Study ($5881). Twenty-two studies assessed the incremental cost-effectiveness ratios (ICERs) of the programs. From a health system perspective, 16 studies reported a median ICER of $13 761 per quality-adjusted life-year (QALY) saved. Group-based programs were more cost-effective (median, $1819 per QALY) than those that used individual sessions (median, $15 846 per QALY). No cost-benefit studies were identified. Limitation Information on recruitment costs and cost-effectiveness of translational programs implemented in community and primary care settings was limited. Conclusion Diet and physical activity promotion programs to prevent type 2 diabetes are cost-effective among persons at increased risk. Costs are lower when programs are delivered to groups in community

  11. Body mass index and C-174G interleukin-6 promoter polymorphism interact in predicting type 2 diabetes.

    Science.gov (United States)

    Möhlig, Matthias; Boeing, Heiner; Spranger, Joachim; Osterhoff, Martin; Kroke, Anja; Fisher, Eva; Bergmann, Manuela M; Ristow, Michael; Hoffmann, Kurt; Pfeiffer, Andreas F H

    2004-04-01

    Increased levels of IL-6 add further risk to the impact of obesity in respect to the development of type 2 diabetes mellitus (T2DM). A C-174G polymorphism within the IL-6 promoter region was shown to influence transcription rate of IL-6. We made use of a nested case-control study within the European Prospective Investigation into Cancer and Nutrition-Potsdam cohort of 27,548 individuals, selecting 188 T2DM cases and 376 controls to investigate this polymorphism in respect to development of T2DM. This polymorphism was found to modify the correlation between body mass index (BMI) and IL-6 by showing a much stronger increase of IL-6 at increased BMI for CC genotypes compared with GG genotypes. Interestingly, C-174G polymorphism was found to be an effect modifier for the impact of BMI regarding T2DM. Whereas BMI greater than or equal to 28 kg/m(2) increased the risk of T2DM 3.44-fold [95% confidence interval (CI), 1.34- to 8.24-fold] for GG genotypes and 2.94-fold (95% CI, 1.56- to 5.56-fold) for GC genotypes, we found a 17.68-fold (95% CI, 3.57- to 87.66-fold) increase in risk for CC genotypes. In conclusion, obese individuals with BMI greater than or equal to 28 kg/m(2) carrying the CC genotype showed a more than 5-fold increased risk of developing T2DM compared with the remaining genotypes and, hence, might profit most from weight reduction.

  12. mTORC2 promotes type I insulin-like growth factor receptor and insulin receptor activation through the tyrosine kinase activity of mTOR.

    Science.gov (United States)

    Yin, Yancun; Hua, Hui; Li, Minjing; Liu, Shu; Kong, Qingbin; Shao, Ting; Wang, Jiao; Luo, Yuanming; Wang, Qian; Luo, Ting; Jiang, Yangfu

    2016-01-01

    Mammalian target of rapamycin (mTOR) is a core component of raptor-mTOR (mTORC1) and rictor-mTOR (mTORC2) complexes that control diverse cellular processes. Both mTORC1 and mTORC2 regulate several elements downstream of type I insulin-like growth factor receptor (IGF-IR) and insulin receptor (InsR). However, it is unknown whether and how mTOR regulates IGF-IR and InsR themselves. Here we show that mTOR possesses unexpected tyrosine kinase activity and activates IGF-IR/InsR. Rapamycin induces the tyrosine phosphorylation and activation of IGF-IR/InsR, which is largely dependent on rictor and mTOR. Moreover, mTORC2 promotes ligand-induced activation of IGF-IR/InsR. IGF- and insulin-induced IGF-IR/InsR phosphorylation is significantly compromised in rictor-null cells. Insulin receptor substrate (IRS) directly interacts with SIN1 thereby recruiting mTORC2 to IGF-IR/InsR and promoting rapamycin- or ligand-induced phosphorylation of IGF-IR/InsR. mTOR exhibits tyrosine kinase activity towards the general tyrosine kinase substrate poly(Glu-Tyr) and IGF-IR/InsR. Both recombinant mTOR and immunoprecipitated mTORC2 phosphorylate IGF-IR and InsR on Tyr1131/1136 and Tyr1146/1151, respectively. These effects are independent of the intrinsic kinase activity of IGF-IR/InsR, as determined by assays on kinase-dead IGF-IR/InsR mutants. While both rictor and mTOR immunoprecitates from rictor(+/+) MCF-10A cells exhibit tyrosine kinase activity towards IGF-IR and InsR, mTOR immunoprecipitates from rictor(-/-) MCF-10A cells do not induce IGF-IR and InsR phosphorylation. Phosphorylation-deficient mutation of residue Tyr1131 in IGF-IR or Tyr1146 in InsR abrogates the activation of IGF-IR/InsR by mTOR. Finally, overexpression of rictor promotes IGF-induced cell proliferation. Our work identifies mTOR as a dual-specificity kinase and clarifies how mTORC2 promotes IGF-IR/InsR activation.

  13. Comparison on Promotion Effect of Various Types of Surfactants on HCFC-141b Hydrate Induction Time

    Science.gov (United States)

    Li, Juan; Sun, Zhigao; Liu, Chenggang; Zhu, Minggui

    2018-03-01

    Cold storage in air conditioning based on refrigerant hydrate is a new-type energy saving technology to reduce initial investment and running cost of air conditioning equipments and improve system stability. Refrigerant hydrate is generated under critical temperature and pressure condition, while surfactant is an effective medium to promote its phase equilibrium. In this paper, in order to research such promotion effect, different type of surfactants with unique mechanism, SDS, Tween80 and Span80, n-BA were selected to compare the respective impact on HCFC141b hydrate induction time based on temperature curve. Experimental results showed that no obvious change had been discovered when no surfactant was added into pure water system, which coincided with phase equilibrium diagram of HCFC141b. All the four kinds of surfactants had realized promotion effect to various degrees. For each hydration system, a large gap existed between the longest and the shortest induction time in 6 groups of parallel experiments, meaning relatively poor system stability. Under the combined effect of Tween80 (2wt%), Span80 (0.1wt%) and n-BA (0.1wt%), average and the shortest induction time was 20.9min and 17.5min respectively, corresponding to the best promotion effect.

  14. β-Arrestin-2-Dependent Signaling Promotes CCR4-mediated Chemotaxis of Murine T-Helper Type 2 Cells.

    Science.gov (United States)

    Lin, Rui; Choi, Yeon Ho; Zidar, David A; Walker, Julia K L

    2018-06-01

    Allergic asthma is a complex inflammatory disease that leads to significant healthcare costs and reduction in quality of life. Although many cell types are implicated in the pathogenesis of asthma, CD4 + T-helper cell type 2 (Th2) cells are centrally involved. We previously reported that the asthma phenotype is virtually absent in ovalbumin-sensitized and -challenged mice that lack global expression of β-arrestin (β-arr)-2 and that CD4 + T cells from these mice displayed significantly reduced CCL22-mediated chemotaxis. Because CCL22-mediated activation of CCR4 plays a role in Th2 cell regulation in asthmatic inflammation, we hypothesized that CCR4-mediated migration of CD4 + Th2 cells to the lung in asthma may use β-arr-dependent signaling. To test this hypothesis, we assessed the effect of various signaling inhibitors on CCL22-induced chemotaxis using in vitro-polarized primary CD4 + Th2 cells from β-arr2-knockout and wild-type mice. Our results show, for the first time, that CCL22-induced, CCR4-mediated Th2 cell chemotaxis is dependent, in part, on a β-arr2-dependent signaling pathway. In addition, we show that this chemotactic signaling mechanism involves activation of P-p38 and Rho-associated protein kinase. These findings point to a proinflammatory role for β-arr2-dependent signaling and support β-arr2 as a novel therapeutic target in asthma.

  15. Applying the Transtheoretical Model to Investigate Behavioural Change in Type 2 Diabetic Patients

    Science.gov (United States)

    Lin, Shu-Ping; Wang, Ming-Jye

    2013-01-01

    Background: Long-term behaviour change in type 2 diabetic patients may provide effective glycemic control. Purpose: To investigate the key factors that promote behaviour change in diabetic subjects using the transtheoretical model. Methods: Subjects were selected by purposive sampling from type 2 diabetes outpatients. Self-administered…

  16. Dapagliflozin (Forxiga) for type 2 diabetes?

    Science.gov (United States)

    2013-09-01

    In the UK, diabetes mellitus affects around 3 million people, of whom over 90% have type 2 diabetes. Aims of treatment include minimising long-term complications (e.g. cardiovascular disease, blindness, chronic kidney disease, premature mortality) and avoiding unwanted effects of treatment (e.g. severe hypoglycaemia, weight gain). Management of diabetes includes patient support and education; addressing symptoms; lifestyle modification; targeting associated risk factors for cardiovascular disease; and surveillance for, and management of, complications including treatment-related hypoglycaemia. Dapagliflozin (Forxiga) belongs to a new class of oral glucose-lowering drugs that inhibit renal glucose reabsorption and promote glycosuria. It is licensed in the UK in adults with type 2 diabetes as monotherapy when diet and exercise alone do not provide adequate glycaemic control and who are unable to tolerate metformin; or, as add-on therapy, with other glucose-lowering agents including insulin, when these, with diet and exercise, do not provide adequate glycaemic control. The company's advertising materials claim that dapagliflozin provides a "novel method of controlling excess glucose" with "secondary benefit of weight loss". Here, we review the evidence for the use of dapagliflozin in the management of type 2 diabetes mellitus.

  17. Attitudes in patients with diabetes mellitus type 1 and type 2

    Directory of Open Access Journals (Sweden)

    Oleg Gennad'evich Motovilin

    2012-12-01

    Full Text Available Aims. To compare disease attitudes in patients with type 1 and type 2 diabetes mellitus (T1DM and T2DM and to evaluate relationship between attitudes and psychological welfare of these groups. Materials and Methods. We examined 140 patients with T1DM and 70 patients with T2DM on insulin therapy (mean age 22.6?3.2 and 60.1?7.8 years; male/female ratio 47/93 and 15/55; duration of diabetes 12.1?5.7 and 11.4?6.5 years, HbA1c 9.3?2.2 и 9.0?1.4%, respectively. Psychological parameters were assessed by following methods: Bekhterev Disease Attitude Typing (DAT, Colour Attitude Test (CAT, SF-36 (36-Item Short Form Health Survey, Spielberger Anxiety Inventory (SAI, CES-D Depression Scale, Dembo-Rubinstein (DR technique for self-esteem assessment. Results. DAT showed increased sensitive attitude to their disease in patients with T1 and T2DM, being significantly higher in T2DM. According to CAT, T2DM patients perceive DM as a disease, associated with severe manifestations and complications, while T1DM patients tend to incorporate the notion of diabetes with lifestyle. Cluster analysis showed negative disease attitude to be associated independently of diabetes type with decrease in quality of life and emotional deterioration (higher anxiety and depression score, as measured by SF-36, SAI and CES-D. Conclusion. Disease attitude typing and correction is important in management of DM. Emotional acceptance allows improvement in quality of life and promotes psychological welfare. Also, despite the absence of direct relationship between HbA1c and disease attitudes (which, is plausibly non-linear, emotional acceptance may favour glycemic compensation due to increase in compliance.

  18. Life-long battle: Perceptions of type 2 diabetes in Thailand.

    Science.gov (United States)

    Suparee, Nitima; McGee, Paula; Khan, Salim; Pinyopasakul, Wanpen

    2015-03-01

    The number of people in Thailand who have Type 2 diabetes has increased dramatically making it one of the country's major health problems. The rising prevalence of diabetes in Thailand is associated with dietary changes, reduced physical activity and health education. Although there is much research about health education programmes, the most effective methods for promoting sustainability and adherence to self-management among diabetics remains unclear. To examine the perceptions of participants in Thailand regarding Type 2 diabetes and to utilize the findings to formulate a model for patient education. A grounded theory approach was selected and semi-structured face to face interviews and focus group were used to gather data from 33 adults with Type 2 diabetes. Five explanatory categories emerged from the data: causing lifelong stress and worry, finding their own ways, after a while, still cannot and wanting a normal life. A new approach to patient education about Type 2 diabetes in Thailand is needed to give patients a better understanding, provide recommendations that they can apply to their daily lives, and include information about alternative medication. The Buddhist way of thinking and effective strategies enhancing self-efficacy should be applied to patient education to promote sustainability and adherence to self-management. © The Author(s) 2014 Reprints and permissions: sagepub.co.uk/journalsPermissions.nav.

  19. Synthetic Promoter Library for Modulation of Actinorhodin Production in Streptomyces coelicolor A3(2)

    Science.gov (United States)

    Sohoni, Sujata Vijay; Fazio, Alessandro; Workman, Christopher T.; Mijakovic, Ivan; Lantz, Anna Eliasson

    2014-01-01

    The objective of this study was the application of the synthetic promoter library (SPL) technology for modulation of actinorhodin production in Streptomyces coelicolor A3(2). The SPL technology was used to optimize the expression of a pathway specific positive transcriptional regulator ActII orf4, which activates the transcription of the S. coelicolor actinorhodin biosynthetic gene cluster. The native actII orf4 promoter was replaced with synthetic promoters, generating a S. coelicolor library with a broad range of expression levels of actII orf4. The resulting library was screened based on the yield of actinorhodin. Selected strains were further physiologically characterized. One of the strains from the library, ScoSPL20, showed considerably higher yield of actinorhodin and final actinorhodin titer, compared to S. coelicolor wild type and S. coelicolor with actII orf4 expressed from a strong constitutive promoter. ScoSPL20 demonstrated exceptional productivity despite having a comparatively weak expression from the promoter. Interestingly, the ScoSPL20 promoter was activated at a much earlier stage of growth compared to the wild type, demonstrating the advantage of fine-tuning and temporal tuning of gene expression in metabolic engineering. Transcriptome studies were performed in exponential and actinorhodin-producing phase of growth to compare gene expression between ScoSPL20 and the wild type. To our knowledge, this is the first successful application of the SPL technology for secondary metabolite production in filamentous bacteria. PMID:24963940

  20. Epigenetic silencing of BTB and CNC homology 2 and concerted promoter CpG methylation in gastric cancer.

    Science.gov (United States)

    Haam, Keeok; Kim, Hee-Jin; Lee, Kyung-Tae; Kim, Jeong-Hwan; Kim, Mirang; Kim, Seon-Young; Noh, Seung-Moo; Song, Kyu-Sang; Kim, Yong Sung

    2014-09-01

    BTB and CNC homology 2 (BACH2) is a lymphoid-specific transcription factor with a prominent role in B-cell development. Genetic polymorphisms within a single locus encoding BACH2 are associated with various autoimmune diseases and allergies. In this study, restriction landmark genomic scanning revealed methylation at a NotI site in a CpG island covering the BACH2 promoter in gastric cancer cell lines and primary gastric tumors. Increased methylation of the BACH2 promoter was observed in 52% (43/83) of primary gastric tumors, and BACH2 hypermethylation was significantly associated with decreased gene expression. Treatment with 5-aza-2'-deoxycytidine and/or trichostatin. A restored BACH2 expression in BACH2-silenced gastric cancer cell lines, and knockdown of BACH2 using short hairpin RNA (i.e. RNA interference) increased cell proliferation in gastric cancer cells. Clinicopathologic data showed that decreased BACH2 expression occurred significantly more frequently in intestinal-type (27/44, 61%) compared with diffuse-type (13/50, 26%) gastric cancers (P<0.001). Furthermore, BACH2 promoter methylation paralleled that of previously identified targets, such as LRRC3B, LIMS2, PRKD1 and POPDC3, in a given set of gastric tumors. We propose that concerted methylation in many promoters plays a role in accelerating gastric tumor formation and that methylated promoter loci may be targets for therapeutic treatment, such as the recently introduced technique of epigenetic editing. Copyright © 2014 Elsevier Ireland Ltd. All rights reserved.

  1. Goat activin receptor type IIB knockdown by muscle specific promoter driven artificial microRNAs.

    Science.gov (United States)

    Patel, Amrutlal K; Shah, Ravi K; Patel, Utsav A; Tripathi, Ajai K; Joshi, Chaitanya G

    2014-10-10

    Activin receptor type IIB (ACVR2B) is a transmembrane receptor which mediates signaling of TGF beta superfamily ligands known to function in regulation of muscle mass, embryonic development and reproduction. ACVR2B antagonism has shown to enhance the muscle growth in several disease and transgenic models. Here, we show ACVR2B knockdown by RNA interference using muscle creatine kinase (MCK) promoter driven artificial microRNAs (amiRNAs). Among the various promoter elements tested, the ∼1.26 kb MCK promoter region showed maximum transcriptional activity in goat myoblasts cells. We observed up to 20% silencing in non-myogenic 293T cells and up to 32% silencing in myogenic goat myoblasts by MCK directed amiRNAs by transient transfection. Goat myoblasts stably integrated with MCK directed amiRNAs showed merely 8% silencing in proliferating myoblasts which was increased to 34% upon induction of differentiation at transcript level whereas up to 57% silencing at protein level. Knockdown of ACVR2B by 5'-UTR derived amiRNAs resulted in decreased SMAD2/3 signaling, increased expression of myogenic regulatory factors (MRFs) and enhanced proliferation and differentiation of myoblasts. Unexpectedly, knockdown of ACVR2B by 3'-UTR derived amiRNAs resulted in increased SMAD2/3 signaling, reduced expression of MRFs and suppression of myogenesis. Our study offers muscle specific knockdown of ACVR2B as a potential strategy to enhance muscle mass in the farm animal species. Copyright © 2014 Elsevier B.V. All rights reserved.

  2. Evaluation of folate receptor 1 (FOLR1) mRNA expression, its specific promoter methylation and global DNA hypomethylation in type I and type II ovarian cancers

    International Nuclear Information System (INIS)

    Notaro, Sara; Reimer, Daniel; Fiegl, Heidi; Schmid, Gabriel; Wiedemair, Annamarie; Rössler, Julia; Marth, Christian; Zeimet, Alain Gustave

    2016-01-01

    In this retrospective study we evaluated the respective correlations and clinical relevance of FOLR1 mRNA expression, FOLR1 promoter specific methylation and global DNA hypomethylation in type I and type II ovarian cancer. Two hundred fifty four ovarian cancers, 13 borderline tumours and 60 samples of healthy fallopian epithelium and normal ovarian epithelium were retrospectively analysed for FOLR1 expression with RT-PCR. FOLR1 DNA promoter methylation and global DNA hypomethylation (measured by means of LINE1 DNA hypomethylation) were evaluated with MethyLight technique. No correlation between FOLR1 mRNA expression and its specific promoter DNA methylation was found neither in type I nor in type II cancers, however, high FOLR1 mRNA expression was found to be correlated with global DNA hypomethylation in type II cancers (p = 0.033). Strong FOLR1 mRNA expression was revealed for Grades 2-3, FIGO stages III-IV, residual disease > 0, and serous histotype. High FOLR1 expression was found to predict increased platinum sensitivity in type I cancers (odds ratio = 3.288; 1.256-10.75; p = 0.020). One-year survival analysis showed in type I cancers an independent better outcome for strong expression of FOLR1 in FIGO stage III and IV. For the entire follow up period no significant independent outcome for FOLR1 expression was revealed. In type I cancers LINE 1 DNA hypomethylation was found to exhibit a worse PFS and OS which were confirmed to be independent in multivariate COX regression model for both PFS (p = 0.026) and OS (p = 0.012). No correlations were found between FOLR1 expression and its specific promoter methylation, however, high FOLR1 mRNA expression was associated with DNA hypomethylation in type II cancers. FOLR1 mRNA expression did not prove to predict clinical outcome in type II cancers, although strong FOLR1 expression generally denotes ovarian cancers with highly aggressive phenotype. In type I cancers, however, strong FOLR1 expression has been found to be a

  3. JAZF1 promotes proliferation of C2C12 cells, but retards their myogenic differentiation through transcriptional repression of MEF2C and MRF4—Implications for the role of Jazf1 variants in oncogenesis and type 2 diabetes

    Energy Technology Data Exchange (ETDEWEB)

    Yuasa, Katsutoshi; Aoki, Natsumi; Hijikata, Takao, E-mail: hijikata@musashino-u.ac.jp

    2015-08-15

    Single-nucleotide polymorphisms associated with type 2 diabetes (T2D) have been identified in Jazf1, which is also involved in the oncogenesis of endometrial stromal tumors. To understand how Jazf1 variants confer a risk of tumorigenesis and T2D, we explored the functional roles of JAZF1 and searched for JAZF1 target genes in myogenic C2C12 cells. Consistent with an increase of Jazf1 transcripts during myoblast proliferation and their decrease during myogenic differentiation in regenerating skeletal muscle, JAZF1 overexpression promoted cell proliferation, whereas it retarded myogenic differentiation. Examination of myogenic genes revealed that JAZF1 overexpression transcriptionally repressed MEF2C and MRF4 and their downstream genes. AMP deaminase1 (AMPD1) was identified as a candidate for JAZF1 target by gene array analysis. However, promoter assays of Ampd1 demonstrated that mutation of the putative binding site for the TR4/JAZF1 complex did not alleviate the repressive effects of JAZF1 on promoter activity. Instead, JAZF1-mediated repression of Ampd1 occurred through the MEF2-binding site and E-box within the Ampd1 proximal regulatory elements. Consistently, MEF2C and MRF4 expression enhanced Ampd1 promoter activity. AMPD1 overexpression and JAZF1 downregulation impaired AMPK phosphorylation, while JAZF1 overexpression also reduced it. Collectively, these results suggest that aberrant JAZF1 expression contributes to the oncogenesis and T2D pathogenesis. - Highlights: • JAZF1 promotes cell cycle progression and proliferation of myoblasts. • JAZF1 retards myogenic differentiation and hypertrophy of myotubes. • JAZF1 transcriptionally represses Mef2C and Mrf4 expression. • JAZF1 has an impact on the phosphorylation of AMPK.

  4. Silk-based biomaterials functionalized with fibronectin type II promotes cell adhesion.

    Science.gov (United States)

    Pereira, Ana Margarida; Machado, Raul; da Costa, André; Ribeiro, Artur; Collins, Tony; Gomes, Andreia C; Leonor, Isabel B; Kaplan, David L; Reis, Rui L; Casal, Margarida

    2017-01-01

    The objective of this work was to exploit the fibronectin type II (FNII) module from human matrix metalloproteinase-2 as a functional domain for the development of silk-based biopolymer blends that display enhanced cell adhesion properties. The DNA sequence of spider dragline silk protein (6mer) was genetically fused with the FNII coding sequence and expressed in Escherichia coli. The chimeric protein 6mer+FNII was purified by non-chromatographic methods. Films prepared from 6mer+FNII by solvent casting promoted only limited cell adhesion of human skin fibroblasts. However, the performance of the material in terms of cell adhesion was significantly improved when 6mer+FNII was combined with a silk-elastin-like protein in a concentration-dependent behavior. With this work we describe a novel class of biopolymer that promote cell adhesion and potentially useful as biomaterials for tissue engineering and regenerative medicine. This work reports the development of biocompatible silk-based composites with enhanced cell adhesion properties suitable for biomedical applications in regenerative medicine. The biocomposites were produced by combining a genetically engineered silk-elastin-like protein with a genetically engineered spider-silk-based polypeptide carrying the three domains of the fibronectin type II module from human metalloproteinase-2. These composites were processed into free-standing films by solvent casting and characterized for their biological behavior. To our knowledge this is the first report of the exploitation of all three FNII domains as a functional domain for the development of bioinspired materials with improved biological performance. The present study highlights the potential of using genetically engineered protein-based composites as a platform for the development of new bioinspired biomaterials. Copyright © 2016 Acta Materialia Inc. Published by Elsevier Ltd. All rights reserved.

  5. Type 2 responses at the interface between immunity and fat metabolism.

    Science.gov (United States)

    Odegaard, Justin I; Chawla, Ajay

    2015-10-01

    Adipose tissue resident leukocytes are often cast solely as the effectors of obesity and its attendant pathologies; however, recent observations have demonstrated that these cells support and effect 'healthy' physiologic function as well as pathologic dysfunction. Importantly, these two disparate outcomes are underpinned by similarly disparate immune programs; type 2 responses instruct and promote metabolic normalcy, while type 1 responses drive tissue dysfunction. In this Review, we summarize the literature regarding type 2 immunity's role in adipose tissue physiology and allude to its potential therapeutic implications. Copyright © 2015 Elsevier Ltd. All rights reserved.

  6. Cooperative Effects of Corticosteroids and Catecholamines upon Immune Deviation of the Type-1/Type-2 Cytokine Balance in Favor of Type-2 Expression in Human Peripheral Blood Mononuclear Cells

    Science.gov (United States)

    Salicru, A. N.; Sams, Clarence F.; Marshall, G. D.

    2007-01-01

    A growing number of studies show strong associations between stress and altered immune function. In vivo studies of chronic and acute stress have demonstrated that cognitive stressors are strongly correlated with high levels of catecholamines (CT) and corticosteroids (CS). Although both CS and CT individually can inhibit the production of T-helper 1 (TH1, type-1 like) cytokines and simultaneously promote the production of T-helper 2 (TH2, type-2 like) cytokines in antigen-specific and mitogen stimulated human leukocyte cultures in vitro, little attention has been focused on the effects of combination CT and CS in immune responses that may be more physiologically relevant. We therefore investigated the combined effects of in vitro CT and CS upon the type-1/type-2 cytokine balance of human peripheral blood mononuclear cells (PBMC) as a model to study the immunomodulatory effects of superimposed acute and chronic stress. Results demonstrated a significant decrease in type-1 cytokine production (IFN-gamma) and a significant increase in type-2 cytokine production (IL-4, IL-10) in our CS+CT incubated cultures when compared to either CT or CS agents alone. Furthermore, variable enhancement of type-1/type-2 immune deviation occurred depending upon when the CT was added. The data suggest that CS can increase the sensitivity of PBMC to the immunomodulatory effects of CT and establishes an in vitro model to study the combined effects of in vivo type-1/type-2 cytokine alterations observed in acute and chronic stress.

  7. Synthetic Promoter Library for Modulation of Actinorhodin Production in Streptomyces coelicolor A3(2)

    DEFF Research Database (Denmark)

    Sohoni, Sujata Vijay; Fazio, Alessandro; Workman, Christopher

    2014-01-01

    The objective of this study was the application of the synthetic promoter library (SPL) technology for modulation of actinorhodin production in Streptomyces coelicolor A3(2). The SPL technology was used to optimize the expression of a pathway specific positive transcriptional regulator Actll orf4...... constitutive promoter. ScoSPL20 demonstrated exceptional productivity despite having a comparatively weak expression from the promoter. Interestingly, the ScoSPL20 promoter was activated at a much earlier stage of growth compared to the wild type, demonstrating the advantage of fine-tuning and temporal tuning......, which activates the transcription of the S. coelicolor actinorhodin biosynthetic gene cluster. The native actll orf4 promoter was replaced with synthetic promoters, generating a S. coelicolor library with a broad range of expression levels of actll orf4. The resulting library was screened based...

  8. Invariant TAD Boundaries Constrain Cell-Type-Specific Looping Interactions between Promoters and Distal Elements around the CFTR Locus.

    Science.gov (United States)

    Smith, Emily M; Lajoie, Bryan R; Jain, Gaurav; Dekker, Job

    2016-01-07

    Three-dimensional genome structure plays an important role in gene regulation. Globally, chromosomes are organized into active and inactive compartments while, at the gene level, looping interactions connect promoters to regulatory elements. Topologically associating domains (TADs), typically several hundred kilobases in size, form an intermediate level of organization. Major questions include how TADs are formed and how they are related to looping interactions between genes and regulatory elements. Here we performed a focused 5C analysis of a 2.8 Mb chromosome 7 region surrounding CFTR in a panel of cell types. We find that the same TAD boundaries are present in all cell types, indicating that TADs represent a universal chromosome architecture. Furthermore, we find that these TAD boundaries are present irrespective of the expression and looping of genes located between them. In contrast, looping interactions between promoters and regulatory elements are cell-type specific and occur mostly within TADs. This is exemplified by the CFTR promoter that in different cell types interacts with distinct sets of distal cell-type-specific regulatory elements that are all located within the same TAD. Finally, we find that long-range associations between loci located in different TADs are also detected, but these display much lower interaction frequencies than looping interactions within TADs. Interestingly, interactions between TADs are also highly cell-type-specific and often involve loci clustered around TAD boundaries. These data point to key roles of invariant TAD boundaries in constraining as well as mediating cell-type-specific long-range interactions and gene regulation. Copyright © 2016 The American Society of Human Genetics. Published by Elsevier Inc. All rights reserved.

  9. Molecular interactions involved in the transactivation of the human T-cell leukemia virus type 1 promoter mediated by Tax and CREB-2 (ATF-4).

    Science.gov (United States)

    Gachon, F; Thebault, S; Peleraux, A; Devaux, C; Mesnard, J M

    2000-05-01

    The human T-cell leukemia virus type 1 (HTLV-1) Tax protein activates viral transcription through three 21-bp repeats located in the U3 region of the HTLV-1 long terminal repeat and called Tax-responsive elements (TxREs). Each TxRE contains nucleotide sequences corresponding to imperfect cyclic AMP response elements (CRE). In this study, we demonstrate that the bZIP transcriptional factor CREB-2 is able to bind in vitro to the TxREs and that CREB-2 binding to each of the 21-bp motifs is enhanced by Tax. We also demonstrate that Tax can weakly interact with CREB-2 bound to a cellular palindromic CRE motif such as that found in the somatostatin promoter. Mutagenesis of Tax and CREB-2 demonstrates that both N- and C-terminal domains of Tax and the C-terminal region of CREB-2 are required for direct interaction between the two proteins. In addition, the Tax mutant M47, defective for HTLV-1 activation, is unable to form in vitro a ternary complex with CREB-2 and TxRE. In agreement with recent results suggesting that Tax can recruit the coactivator CREB-binding protein (CBP) on the HTLV-1 promoter, we provide evidence that Tax, CREB-2, and CBP are capable of cooperating to stimulate viral transcription. Taken together, our data highlight the major role played by CREB-2 in Tax-mediated transactivation.

  10. CNPY2 promoted the proliferation of renal cell carcinoma cells and increased the expression of TP53

    International Nuclear Information System (INIS)

    Taniguchi, Hidefumi; Ito, Saya; Ueda, Takashi; Morioka, Yukako; Kayukawa, Naruhiro; Ueno, Akihisa; Nakagawa, Hideo; Fujihara, Atsuko; Ushijima, So; Kanazawa, Motohiro; Hongo, Fumiya; Ukimura, Osamu

    2017-01-01

    Renal cell carcinoma (RCC) is the most common type of kidney cancer. However, the mechanisms underlying the progression of the disease are not well understood. The data in this report suggest that canopy FGF signaling regulator 2 (CNPY2) is a promoter of RCC progression. We found that CNPY2 significantly promoted growth of RCC cells and upregulated TP53 gene expression. Although TP53 is widely known as a tumor suppressor, in RCC TP53 promoted tumor cell growth. A typical p53 target gene, CDKN1A, was upregulated by both p53 and CNPY2 in RCC cells, suggesting that CNPY2 increased the expression level of TP53. Consistent with these results, CNPY2 and TP53 expression levels were positively correlated in RCC patients. These findings suggested that CNPY2 promoted cancer cell growth in RCC through regulating TP53 gene expression. - Highlights: • CNPY2 promoted growth of renal cell carcinoma (RCC) cells. • TP53 expression levels were increased by CNPY2 in RCC cells. • Growth of RCC cells was promoted by TP53. • CNPY2 expression positively correlated with TP53 expression in RCC patients.

  11. Coxsackievirus B3 2A protease promotes encephalomyocarditis virus replication.

    Science.gov (United States)

    Song, Qin-Qin; Lu, Ming-Zhi; Song, Juan; Chi, Miao-Miao; Sheng, Lin-Jun; Yu, Jie; Luo, Xiao-Nuan; Zhang, Lu; Yao, Hai-Lan; Han, Jun

    2015-10-02

    To determine whether 2A protease of the enterovirus genus with type I internal ribosome entry site (IRES) effect on the viral replication of type II IRES, coxsackievirus B3(CVB3)-encoded protease 2A and encephalomyocarditis virus (EMCV) IRES (Type II)-dependent or cap-dependent report gene were transiently co-expressed in eukaryotic cells. We found that CVB3 2A protease not only inhibited translation of cap-dependent reporter genes through the cleavage of eIF4GI, but also conferred high EMCV IRES-dependent translation ability and promoted EMCV replication. Moreover, deletions of short motif (aa13-18 RVVNRH, aa65-70 KNKHYP, or aa88-93 PRRYQSH) resembling the nuclear localization signals (NLS) or COOH-terminal acidic amino acid motif (aa133-147 DIRDLLWLEDDAMEQ) of CVB3 2A protease decreased both its EMCV IRES-dependent translation efficiency and destroy its cleavage on eukaryotic initiation factor 4G (eIF4G) I. Our results may provide better understanding into more effective interventions and treatments for co-infection of viral diseases. Copyright © 2015 Elsevier B.V. All rights reserved.

  12. MRG15 activates the cdc2 promoter via histone acetylation in human cells

    International Nuclear Information System (INIS)

    Pena, AndreAna N.; Tominaga, Kaoru; Pereira-Smith, Olivia M.

    2011-01-01

    Chromatin remodeling is required for transcriptional activation and repression. MRG15 (MORF4L1), a chromatin modulator, is a highly conserved protein and is present in complexes containing histone acetyltransferases (HATs) as well as histone deacetylases (HDACs). Loss of expression of MRG15 in mice and Drosophila results in embryonic lethality and fibroblast and neural stem/progenitor cells cultured from Mrg15 null mouse embryos exhibit marked proliferative defects when compared with wild type cells. To determine the role of MRG15 in cell cycle progression we performed chromatin immunoprecipitation with an antibody to MRG15 on normal human fibroblasts as they entered the cell cycle from a quiescent state, and analyzed various cell cycle gene promoters. The results demonstrated a 3-fold increase in MRG15 occupancy at the cdc2 promoter during S phase of the cell cycle and a concomitant increase in acetylated histone H4. H4 lysine 12 was acetylated at 24 h post-serum stimulation while there was no change in acetylation of lysine 16. HDAC1 and 2 were decreased at this promoter during cell cycle progression. Over-expression of MRG15 in HeLa cells activated a cdc2 promoter-reporter construct in a dose-dependent manner, whereas knockdown of MRG15 resulted in decreased promoter activity. In order to implicate HAT activity, we treated cells with the HAT inhibitor anacardic acid and determined that HAT inhibition results in loss of expression of cdc2 mRNA. Further, chromatin immunoprecipitation with Tip60 localizes the protein to the same 110 bp stretch of the cdc2 promoter pulled down by MRG15. Additionally, we determined that cotransfection of MRG15 with the known associated HAT Tip60 had a cooperative effect in activating the cdc2 promoter. These results suggest that MRG15 is acting in a HAT complex involving Tip60 to modify chromatin via acetylation of histone H4 at the cdc2 promoter to activate transcription.

  13. MRG15 activates the cdc2 promoter via histone acetylation in human cells

    Energy Technology Data Exchange (ETDEWEB)

    Pena, AndreAna N., E-mail: andreana.pena@gmail.com [Sam and Ann Barshop Institute for Longevity and Aging Studies, The University of Texas Health Science Center at San Antonio, San Antonio, TX (United States); Department of Cellular and Structural Biology, The University of Texas Health Science Center at San Antonio, San Antonio, TX (United States); Tominaga, Kaoru; Pereira-Smith, Olivia M. [Sam and Ann Barshop Institute for Longevity and Aging Studies, The University of Texas Health Science Center at San Antonio, San Antonio, TX (United States); Department of Cellular and Structural Biology, The University of Texas Health Science Center at San Antonio, San Antonio, TX (United States)

    2011-07-01

    Chromatin remodeling is required for transcriptional activation and repression. MRG15 (MORF4L1), a chromatin modulator, is a highly conserved protein and is present in complexes containing histone acetyltransferases (HATs) as well as histone deacetylases (HDACs). Loss of expression of MRG15 in mice and Drosophila results in embryonic lethality and fibroblast and neural stem/progenitor cells cultured from Mrg15 null mouse embryos exhibit marked proliferative defects when compared with wild type cells. To determine the role of MRG15 in cell cycle progression we performed chromatin immunoprecipitation with an antibody to MRG15 on normal human fibroblasts as they entered the cell cycle from a quiescent state, and analyzed various cell cycle gene promoters. The results demonstrated a 3-fold increase in MRG15 occupancy at the cdc2 promoter during S phase of the cell cycle and a concomitant increase in acetylated histone H4. H4 lysine 12 was acetylated at 24 h post-serum stimulation while there was no change in acetylation of lysine 16. HDAC1 and 2 were decreased at this promoter during cell cycle progression. Over-expression of MRG15 in HeLa cells activated a cdc2 promoter-reporter construct in a dose-dependent manner, whereas knockdown of MRG15 resulted in decreased promoter activity. In order to implicate HAT activity, we treated cells with the HAT inhibitor anacardic acid and determined that HAT inhibition results in loss of expression of cdc2 mRNA. Further, chromatin immunoprecipitation with Tip60 localizes the protein to the same 110 bp stretch of the cdc2 promoter pulled down by MRG15. Additionally, we determined that cotransfection of MRG15 with the known associated HAT Tip60 had a cooperative effect in activating the cdc2 promoter. These results suggest that MRG15 is acting in a HAT complex involving Tip60 to modify chromatin via acetylation of histone H4 at the cdc2 promoter to activate transcription.

  14. Identification of the MUC2 Promoter as a Strong Promoter for Intestinal Gene Expression through Generation of Transgenic Quail Expressing GFP in Gut Epithelial Cells

    Directory of Open Access Journals (Sweden)

    Rachel M. Woodfint

    2017-01-01

    Full Text Available Identification of tissue- and stage-specific gene promoters is valuable for delineating the functional roles of specific genes in genetically engineered animals. Here, through the comparison of gene expression in different tissues by analysis of a microarray database, the intestinal specificity of mucin 2 (MUC2 expression was identified in mice and humans, and further confirmed in chickens by RT-PCR (reverse transcription-PCR analysis. An analysis of cis-acting elements in avian MUC2 gene promoters revealed conservation of binding sites, within a 2.9 kb proximal promoter region, for transcription factors such as caudal type homeobox 2 (CDX2, GATA binding protein 4 (GATA4, hepatocyte nuclear factor 4 α (HNF4A, and transcription factor 4 (TCF4 that are important for maintaining intestinal homeostasis and functional integrity. By generating transgenic quail, we demonstrated that the 2.9 kb chicken MUC2 promoter could drive green fluorescent protein (GFP reporter expression exclusively in the small intestine, large intestine, and ceca. Fluorescence image analysis further revealed GFP expression in intestine epithelial cells. The GFP expression was barely detectable in the embryonic intestine, but increased during post-hatch development. The spatiotemporal expression pattern of the reporter gene confirmed that the 2.9 kb MUC2 promoter could retain the regulatory element to drive expression of target genes in intestinal tissues after hatching. This new transgene expression system, using the MUC2 promoter, will provide a new method of overexpressing target genes to study gene function in the avian intestine.

  15. Hydrogen improves glycemic control in type1 diabetic animal model by promoting glucose uptake into skeletal muscle.

    Directory of Open Access Journals (Sweden)

    Haruka Amitani

    Full Text Available Hydrogen (H(2 acts as a therapeutic antioxidant. However, there are few reports on H(2 function in other capacities in diabetes mellitus (DM. Therefore, in this study, we investigated the role of H(2 in glucose transport by studying cultured mouse C2C12 cells and human hepatoma Hep-G2 cells in vitro, in addition to three types of diabetic mice [Streptozotocin (STZ-induced type 1 diabetic mice, high-fat diet-induced type 2 diabetic mice, and genetically diabetic db/db mice] in vivo. The results show that H(2 promoted 2-[(14C]-deoxy-d-glucose (2-DG uptake into C2C12 cells via the translocation of glucose transporter Glut4 through activation of phosphatidylinositol-3-OH kinase (PI3K, protein kinase C (PKC, and AMP-activated protein kinase (AMPK, although it did not stimulate the translocation of Glut2 in Hep G2 cells. H(2 significantly increased skeletal muscle membrane Glut4 expression and markedly improved glycemic control in STZ-induced type 1 diabetic mice after chronic intraperitoneal (i.p. and oral (p.o. administration. However, long-term p.o. administration of H(2 had least effect on the obese and non-insulin-dependent type 2 diabetes mouse models. Our study demonstrates that H(2 exerts metabolic effects similar to those of insulin and may be a novel therapeutic alternative to insulin in type 1 diabetes mellitus that can be administered orally.

  16. 22 CFR 101.2 - Promotion of American interests.

    Science.gov (United States)

    2010-04-01

    ... 22 Foreign Relations 1 2010-04-01 2010-04-01 false Promotion of American interests. 101.2 Section... FUNCTIONS § 101.2 Promotion of American interests. Officers of the Foreign Service shall further the.... (g) By taking appropriate steps to facilitate the promotion of such import trade into the United...

  17. [Inactivation of PMS2 gene by promoter methylation in nasopharyngeal carcinoma].

    Science.gov (United States)

    Ni, H F; Jiang, B; Zhou, Z; Li, Y; Yuan, X Y; Cao, X L; Huang, G W

    2016-11-23

    Objective: To investigate the inactivation of PMS2 gene mediated by promoter methylation and its regulatory mechanism in nasopharyngeal carcinoma (NPC). Methods: Fifty-four NPC tissues, 16 normal nasopharyngeal epithelia (NNE), 5 NPC cell lines (CNE1, CNE2, TWO3, HNE1 and HONE1) and 1 normal nasopharyngeal epithelial cell line (NP69) were collected.Methylation-specific PCR (MSP) was used to detect the PMS2 promoter methylation, semi-quantitative reverse transcription PCR (qRT-PCR) was applied to determine its mRNA expression, and immunohistochemistry (IHC) was used to detect the protein expression of PMS2. The expressions of PMS2 mRNA in CNE1 and CNE2 cells before and after treated with methyltransferase inhibitor 5-aza-2-deoxycytidine were analyzed by qRT-PCR. The impact of methylation and demethylation on the mRNA expression of PMS2, and the association of mRNA and protein expression of PMS2 with clinicopathological features of nasopharyngeal cancer were analyzed. Results: Methylation of PMS2 gene was detected in all of the five NPC cell lines, but not in normal nasopharyngeal epithelial NP69 cells. The methylation rate of PMS2 gene in NPC tissues was 63% (34/54), significantly higher than that of the normal nasopharyngeal epithelia (0/16, P PMS2 mRNA and protein were significantly down-regulated in the 54 NPC tissues when compared with those in the 16 NNE tissues ( P PMS2 mRNA was restored in the CNE1 and CNE2 cells.However, the expressions of PMS2 mRNA and protein were not significantly correlated with patients' age, gender, TNM stage, histopathologic type or lymph node metastasis ( P >0.05 for all). Conclusions: Promoter methylation-mediated inactivation of PMS2 gene participates in carcinogenesis and development of NPC. PMS2 may be a candidate tumor suppressor in the treatment for patients with inactivation of PMS2 promoter methylation.

  18. The miR-599 promotes non-small cell lung cancer cell invasion via SATB2

    International Nuclear Information System (INIS)

    Tian, Wenjun; Wang, Guanghai; Liu, Yiqing; Huang, Zhenglan; Zhang, Caiqing; Ning, Kang; Yu, Cuixiang; Shen, Yajuan; Wang, Minghui; Li, Yuantang; Wang, Yong; Zhang, Bingchang; Zhao, Yaoran

    2017-01-01

    MicroRNAs (miRNAs) play important roles in the pathogenesis of many types of cancers by negatively regulating gene expression at posttranscriptional level. Here, we identified that miR-599 is up-regulated in non-small cell lung cancer (NSCLC) patients. It promoted NSCLC cell proliferation by negatively regulating SATB2. In NSCLC cell lines, CCK-8 proliferation assay indicated that the cell proliferation is promoted by miR-599 mimics. Transwell assay showed that miR-599 mimics promoted the invasion and migration of NSCLC cells. Luciferase assays confirmed that miR-599 directly binds to the 3'untranslated region of SATB2, and western blotting showed that miR-599 suppresses the expression of SATB2 at the protein level. This study indicates that miR-599 promotes proliferation and invasion of NSCLC cell lines via SATB2. The miR-599 may represent a potential therapeutic target for NSCLC treatment. - Highlights: • miR-599 is up-regulated in NSCLC. • miR-599 promotes the proliferation and invasion of NSCLC cells. • miR-599 inhibitors inhibits the proliferation and invasion of NSCLC cells. • miR-599 targets 3′ UTR of SATB2 in NSCLC cells. • miR-599 inhibits SATB2 in NSCLC cells.

  19. Gas6 Promotes Inflammatory (CCR2hiCX3CR1lo) Monocyte Recruitment in Venous Thrombosis.

    Science.gov (United States)

    Laurance, Sandrine; Bertin, François-René; Ebrahimian, Talin; Kassim, Yusra; Rys, Ryan N; Lehoux, Stéphanie; Lemarié, Catherine A; Blostein, Mark D

    2017-07-01

    Coagulation and inflammation are inter-related. Gas6 (growth arrest-specific 6) promotes venous thrombosis and participates to inflammation through endothelial-innate immune cell interactions. Innate immune cells can provide the initiating stimulus for venous thrombus development. We hypothesize that Gas6 promotes monocyte recruitment during venous thrombosis. Deep venous thrombosis was induced in wild-type and Gas6-deficient (-/-) mice using 5% FeCl 3 and flow reduction in the inferior vena cava. Total monocyte depletion was achieved by injection of clodronate before deep venous thrombosis. Inflammatory monocytes were depleted using an anti-C-C chemokine receptor type 2 (CCR2) antibody. Similarly, injection of an anti-chemokine ligand 2 (CCL2) antibody induced CCL2 depletion. Flow cytometry and immunofluorescence were used to characterize the monocytes recruited to the thrombus. In vivo, absence of Gas6 was associated with a reduction of monocyte recruitment in both deep venous thrombosis models. Global monocyte depletion by clodronate leads to smaller thrombi in wild-type mice. Compared with wild type, the thrombi from Gas6 -/- mice contain less inflammatory (CCR2 hi CX 3 CR1 lo ) monocytes, consistent with a Gas6-dependent recruitment of this monocyte subset. Correspondingly, selective depletion of CCR2 hi CX 3 CR1 lo monocytes reduced the formation of venous thrombi in wild-type mice demonstrating a predominant role of the inflammatory monocytes in thrombosis. In vitro, the expression of both CCR2 and CCL2 were Gas6 dependent in monocytes and endothelial cells, respectively, impacting monocyte migration. Moreover, Gas6-dependent CCL2 expression and monocyte migration were mediated via JNK (c-Jun N-terminal kinase). This study demonstrates that Gas6 specifically promotes the recruitment of inflammatory CCR2 hi CX 3 CR1 lo monocytes through the regulation of both CCR2 and CCL2 during deep venous thrombosis. © 2017 American Heart Association, Inc.

  20. Epigenetics in type 1 diabetes: TNFa gene promoter methylation status in Chilean patients with type 1 diabetes mellitus.

    Science.gov (United States)

    Arroyo-Jousse, Viviana; Garcia-Diaz, Diego F; Codner, Ethel; Pérez-Bravo, Francisco

    2016-12-01

    TNF-α is a pro-inflammatory cytokine that is involved in type 1 diabetes (T1D) pathogenesis. The TNFa gene is subject of epigenetic regulation in which folate and homocysteine are important molecules because they participate in the methionine cycle where the most important methyl group donor (S-adenosylmethionine) is formed. We investigated whether TNFa gene promoter methylation status in T1D patients was related to blood folate, homocysteine and TNF-α in a transversal case-control study. We studied T1D patients (n 25, mean=13·7 years) and healthy control subjects (n 25, mean=31·1 years), without T1D and/or other autoimmune diseases or direct family history of these diseases. A blood sample was obtained for determination of serum folate, plasma homocysteine and TNF-α concentrations. Whole blood was used for the extraction of DNA to determine the percentage of methylation by real-time PCR and melting-curve analysis. Results are expressed as means and standard deviations for parametric variables and as median (interquartile range) for non-parametric variables. T1D patients showed a higher TNFa gene promoter methylation (39·2 (sd 19·5) %) when compared with control subjects (25·4 (sd 13·7) %) (P=0·008). TNFa gene promoter methylation was positively associated only with homocysteine levels in T1D patients (r 0·55, P=0·007), but not in control subjects (r -0·122, P=0·872). To our knowledge, this is the first work that reports the methylation status of the TNFa gene promoter and its relationship with homocysteine metabolism in Chilean T1D patients without disease complications.

  1. Type 2-diabetes. Sociale relationer og sundhedsadfaerd

    DEFF Research Database (Denmark)

    Holm, Astrid Ledgaard; Andersen, Anne Friis; Avlund, Kirsten

    2008-01-01

    with the official Danish recommendations for physical activity, diet, alcohol and smoking. Adjustments were made for sex, age, income, self-rated health, functional ability, stress and Body Mass Index. RESULTS: Social relations measured as civil status and functional network are positively associated with adherence...... to the recommendations for physical activity and diet. Only the association between functional network and diet remains significant when adjusted for the effects of co-variates. CONCLUSION: The study shows a need for the promotion of health behaviour among adult Danes with type 2 diabetes, and indicates that social...

  2. Analysis of the tumor-promoting potency of 2,4,4'-trichlorobiphenyl and 2,2',4,5,5'-pentachlorobiphenyl in rat liver

    Energy Technology Data Exchange (ETDEWEB)

    Kunz, S.; Schmitz, H.J.; Schrenk, D. [Kaiserslautern Univ. (Germany). Dept. of Food Chemistry and Environmental Toxicology; Buchmann, A.; Schwarz, M. [Tuebingen Univ. (Germany). Inst. of Toxicology; Schilling, B.; Paepke, O. [ERGO Research, Hamburg (Germany); Robertson, L.W.; Lehmler, H.J. [Iowa Univ, Iowa City, IA (United States). Dept. of Occupational and Environmental Health

    2004-09-15

    Polychlorinated biphenyls (PCBs) are potent persistent environmental pollutants exhibiting neurotoxic, teratogenic and tumor-promoting effects in experimental animal models. PCB congeners can be divided into 'dioxin-like' and 'non-dioxin-like' congeners on the basis of their ability to act as aryl hydrocarbon receptor (AhR) agonists. Like the most toxic dioxin congener 2,3,7,8-tetrachlorodibenzo-p-dioxin (TCDD) 'dioxin-like' PCBs bind to the AhR and show characteristic effects on the expression of AhR-regulated genes including the induction of cytochrome P450 (CYP) 1A1. On the other hand, 'non-dioxin-like' PCB congeners have a lower or no binding affinity to the AhR, but exhibit a 'phenobarbital-type' induction of CYP 2B1/2 activity. The tumor-promoting potency of several PCBs has been demonstrated in two-stage initiation-promotion experiments in rat liver. Preneoplastic cell clones, targets for tumor promotion, can be identified as phenotypically altered foci showing characteristic enzyme patterns including the decreased activity of adenosine triphosphatase (ATPase) or the increased expression of the placental form of gluthatione S-transferase (GSTP). In the present study, the effect of the 'non-dioxin-like' 2,4,4'-trichlorobiphenyl (PCB 28) and 2,2',4,5,5'-pentachlorobiphenyl (PCB 101) on the promotion of enzyme-altered hepatic foci was investigated in female Wistar rats after initiation with diethylnitrosamine (DEN).

  3. Identification and characterisation of a G-quadruplex forming sequence in the promoter region of nuclear factor (erythroid-derived 2)-like 2 (Nrf2)

    Energy Technology Data Exchange (ETDEWEB)

    Waller, Zoë A.E., E-mail: z.waller@uea.ac.uk; Howell, Lesley A.; MacDonald, Colin J.; O’Connell, Maria A.; Searcey, Mark, E-mail: m.searcey@uea.ac.uk

    2014-04-25

    Highlights: • Discovery of a G-quadruplex forming sequence in the promoter sequence of Nrf2. • Characterisation of the G-quadruplex by UV, CD and NMR. • Conformational switching of G-quadruplex induced by 9-aminoacridine. - Abstract: The transcription factor nuclear factor (erythroid-derived 2)-like 2 (Nrf2) regulates multiple antioxidants, Phase II detoxification enzymes and other cytoprotective enzymes in cells. Activation of Nrf2 is recognised as being of potential therapeutic benefit in inflammatory-diseases whereas more recently, it has become clear that the inhibition of Nrf2 may have benefit in the alleviation of resistance in some tumour types. A potential G-quadruplex forming sequence was identified in the promoter region of Nrf2, close to a number of putative transcription factor binding sites. Characterisation of the sequence 5’-d[GGGAAGGGAGCAAGGGCGGGAGGG]-3’ using CD spectroscopy, imino proton NMR resonances and UV melting experiments demonstrated the formation of a parallel intramolecular G-quadruplex in the presence of K{sup +} ions. Incubation with 9-aminoacridine ligands induced a switch from antiparallel to parallel forms. The presence of a G-quadruplex forming sequence in the promoter region of Nrf2 suggests an approach to targeting the production of the protein through stabilisation of the structure, thereby avoiding resistance to antitumour drugs.

  4. Type IIIa cracking at 2CrMo welds in 1/2CrMoV pipework

    Energy Technology Data Exchange (ETDEWEB)

    Brett, S J; Smith, P A [National Power plc, Swindon (United Kingdom)

    1999-12-31

    The most common form of in-service defect found today on the welds of National Power`s 1/2CrMoV pipework systems is Type IV cracking which occurs in intercritically transformed material at the edge of the heat affected zone. However an alternate form of cracking, termed IIIa, which occurs close to the weld fusion line in fully grain refined heat affected zones, has also been observed. The incidence of Type IIIa cracking has increased in recent years and these defects now constitute a significant part of the total recorded crack population. This presentation describes Type IIIa cracking and compares and contrasts it with the better documented Type IV cracking. Particular reference is made to the role of carbon diffusion at the weld fusion line in promoting Type IIIa damage in preference to Type IV. (orig.) 5 refs.

  5. Type IIIa cracking at 2CrMo welds in 1/2CrMoV pipework

    Energy Technology Data Exchange (ETDEWEB)

    Brett, S.J.; Smith, P.A. [National Power plc, Swindon (United Kingdom)

    1998-12-31

    The most common form of in-service defect found today on the welds of National Power`s 1/2CrMoV pipework systems is Type IV cracking which occurs in intercritically transformed material at the edge of the heat affected zone. However an alternate form of cracking, termed IIIa, which occurs close to the weld fusion line in fully grain refined heat affected zones, has also been observed. The incidence of Type IIIa cracking has increased in recent years and these defects now constitute a significant part of the total recorded crack population. This presentation describes Type IIIa cracking and compares and contrasts it with the better documented Type IV cracking. Particular reference is made to the role of carbon diffusion at the weld fusion line in promoting Type IIIa damage in preference to Type IV. (orig.) 5 refs.

  6. Drug-drug interactions with sodium-glucose cotransporters type 2 (SGLT2) inhibitors, new oral glucose-lowering agents for the management of type 2 diabetes mellitus.

    Science.gov (United States)

    Scheen, André J

    2014-04-01

    Inhibitors of sodium-glucose cotransporters type 2 (SGLT2) reduce hyperglycaemia by decreasing renal glucose threshold and thereby increasing urinary glucose excretion. They are proposed as a novel approach for the management of type 2 diabetes mellitus. They have proven their efficacy in reducing glycated haemoglobin, without inducing hypoglycaemia, as monotherapy or in combination with various other glucose-lowering agents, with the add-on value of promoting some weight loss and lowering arterial blood pressure. As they may be used concomitantly with many other drugs, we review the potential drug-drug interactions (DDIs) regarding the three leaders in the class (dapagliglozin, canagliflozin and empagliflozin). Most of the available studies were performed in healthy volunteers and have assessed the pharmacokinetic interferences with a single administration of the SGLT2 inhibitor. The exposure [assessed by peak plasma concentrations (Cmax) and area under the concentration-time curve (AUC)] to each SGLT2 inhibitor tested was not significantly influenced by the concomitant administration of other glucose-lowering agents or cardiovascular agents commonly used in patients with type 2 diabetes. Reciprocally, these medications did not influence the pharmacokinetic parameters of dapagliflozin, canagliflozin or empagliflozin. Some modest changes were not considered as clinically relevant. However, drugs that could specifically interfere with the metabolic pathways of SGLT2 inhibitors [rifampicin, inhibitors or inducers of uridine diphosphate-glucuronosyltransferase (UGT)] may result in significant changes in the exposure of SGLT2 inhibitors, as shown for dapagliflozin and canagliflozin. Potential DDIs in patients with type 2 diabetes receiving chronic treatment with an SGLT2 inhibitor deserve further attention, especially in individuals treated with several medications or in more fragile patients with hepatic and/or renal impairment.

  7. Type 2 diabetes

    Science.gov (United States)

    ... type 2 diabetes; Oral hypoglycemic - type 2 diabetes; High blood sugar - type 2 diabetes ... your kidneys are working well ( microalbuminuria and serum creatinine ). Visit your eye doctor at least once a ...

  8. B cells promote inflammation in obesity and type 2 diabetes through regulation of T-cell function and an inflammatory cytokine profile.

    Science.gov (United States)

    DeFuria, Jason; Belkina, Anna C; Jagannathan-Bogdan, Madhumita; Snyder-Cappione, Jennifer; Carr, Jordan David; Nersesova, Yanina R; Markham, Douglas; Strissel, Katherine J; Watkins, Amanda A; Zhu, Min; Allen, Jessica; Bouchard, Jacqueline; Toraldo, Gianluca; Jasuja, Ravi; Obin, Martin S; McDonnell, Marie E; Apovian, Caroline; Denis, Gerald V; Nikolajczyk, Barbara S

    2013-03-26

    Patients with type 2 diabetes (T2D) have disease-associated changes in B-cell function, but the role these changes play in disease pathogenesis is not well established. Data herein show B cells from obese mice produce a proinflammatory cytokine profile compared with B cells from lean mice. Complementary in vivo studies show that obese B cell-null mice have decreased systemic inflammation, inflammatory B- and T-cell cytokines, adipose tissue inflammation, and insulin resistance (IR) compared with obese WT mice. Reduced inflammation in obese/insulin resistant B cell-null mice associates with an increased percentage of anti-inflammatory regulatory T cells (Tregs). This increase contrasts with the sharply decreased percentage of Tregs in obese compared with lean WT mice and suggests that B cells may be critical regulators of T-cell functions previously shown to play important roles in IR. We demonstrate that B cells from T2D (but not non-T2D) subjects support proinflammatory T-cell function in obesity/T2D through contact-dependent mechanisms. In contrast, human monocytes increase proinflammatory T-cell cytokines in both T2D and non-T2D analyses. These data support the conclusion that B cells are critical regulators of inflammation in T2D due to their direct ability to promote proinflammatory T-cell function and secrete a proinflammatory cytokine profile. Thus, B cells are potential therapeutic targets for T2D.

  9. Lithium modulation of the human inositol monophosphatase 2 (IMPA2) promoter

    International Nuclear Information System (INIS)

    Seelan, Ratnam S.; Parthasarathy, Latha K.; Parthasarathy, Ranga N.

    2004-01-01

    The inositol-signaling pathway is a therapeutic target for lithium in the treatment of bipolar disorder. Inositol monophosphatases (IMPases) play a key role in inositol signaling. Lithium's ability to inhibit IMPase 1 is well known, but its effect on IMPase 2 or on the transcriptional regulation of these genes has not been studied. Here, we report the identification and characterization of the minimal promoter of IMPA2 (encoding IMPase 2) in HeLa (epithelial) and SK-N-AS (neuronal) cells. IMPA2 promoter activity appears to be contributed by different elements in the 5' flanking region, suggesting that the gene is differentially regulated in neuronal and non-neuronal cells. Furthermore, IMPA2 promoter activity in both cell lines is downregulated, in a dose-dependent manner, by lithium after treatment for only 24 h. This effect is also observed in vivo. Our results suggest a possible role for IMPA2 in bipolar disorder

  10. Effectiveness of a Computer-Tailored Print-Based Physical Activity Intervention among French Canadians with Type 2 Diabetes in a Real-Life Setting

    Science.gov (United States)

    Boudreau, Francois; Godin, Gaston; Poirier, Paul

    2011-01-01

    The promotion of regular physical activity for people with type 2 diabetes poses a challenge for public health authorities. The purpose of this study was to evaluate the efficiency of a computer-tailoring print-based intervention to promote the adoption of regular physical activity among people with type 2 diabetes. An experimental design was…

  11. AAHD's Health Promotion and Wellness, Part 2: Health Promotion Programs

    Science.gov (United States)

    Exceptional Parent, 2011

    2011-01-01

    This article is part 2 of a 4-part series on "Health Promotion and Wellness" from the American Association on Health and Disability (AAHD). According to the U.S. Census Bureau, more than 54 million people--one in five Americans--have a disability, and these Americans are more likely to report: (1) Being in poorer overall health; (2) Having less…

  12. rFN/Cad-11-Modified Collagen Type II Biomimetic Interface Promotes the Adhesion and Chondrogenic Differentiation of Mesenchymal Stem Cells

    Science.gov (United States)

    Guo, Hongfeng; Zhang, Yuan; Li, Zhengsheng; Kang, Fei; Yang, Bo; Kang, Xia; Wen, Can; Yan, Yanfei; Jiang, Bo; Fan, Yujiang

    2013-01-01

    Properties of the cell-material interface are determining factors in the successful function of cells for cartilage tissue engineering. Currently, cell adhesion is commonly promoted through the use of polypeptides; however, due to their lack of complementary or modulatory domains, polypeptides must be modified to improve their ability to promote adhesion. In this study, we utilized the principle of matrix-based biomimetic modification and a recombinant protein, which spans fragments 7–10 of fibronectin module III (heterophilic motif ) and extracellular domains 1–2 of cadherin-11 (rFN/Cad-11) (homophilic motif ), to modify the interface of collagen type II (Col II) sponges. We showed that the designed material was able to stimulate cell proliferation and promote better chondrogenic differentiation of rabbit mesenchymal stem cells (MSCs) in vitro than both the FN modified surfaces and the negative control. Further, the Col II/rFN/Cad-11-MSCs composite stimulated cartilage formation in vivo; the chondrogenic effect of Col II alone was much less significant. These results suggested that the rFN/Cad-11-modified collagen type II biomimetic interface has dual biological functions of promoting adhesion and stimulating chondrogenic differentiation. This substance, thus, may serve as an ideal scaffold material for cartilage tissue engineering, enhancing repair of injured cartilage in vivo. PMID:23919505

  13. Facts about Type 2

    Medline Plus

    Full Text Available ... Alert Day Diabetes Basics Home Symptoms Diagnosis America's Diabetes Challenge Type 1 Type 2 Facts About Type 2 Enroll in ... Where Do I Begin With Type2? Living With Type 1 Diabetes Enroll in the Living WIth Type 2 Diabetes ...

  14. The neuropeptide neuromedin U stimulates innate lymphoid cells and type 2 inflammation

    DEFF Research Database (Denmark)

    Klose, Christoph S N; Mahlakõiv, Tanel; Moeller, Jesper B

    2017-01-01

    The type 2 cytokines interleukin (IL)-4, IL-5, IL-9 and IL-13 have important roles in stimulating innate and adaptive immune responses that are required for resistance to helminth infection, promotion of allergic inflammation, metabolic homeostasis and tissue repair. Group 2 innate lymphoid cells......-localize with cholinergic neurons that express the neuropeptide neuromedin U (NMU). In contrast to other haematopoietic cells, ILC2s selectively express the NMU receptor 1 (NMUR1). In vitro stimulation of ILC2s with NMU induced rapid cell activation, proliferation, and secretion of the type 2 cytokines IL-5, IL-9 and IL-13...... that was dependent on cell-intrinsic expression of NMUR1 and Gαq protein. In vivo administration of NMU triggered potent type 2 cytokine responses characterized by ILC2 activation, proliferation and eosinophil recruitment that was associated with accelerated expulsion of the gastrointestinal nematode Nippostrongylus...

  15. Walking away from type 2 diabetes: trial protocol of a cluster randomised controlled trial evaluating a structured education programme in those at high risk of developing type 2 diabetes.

    Science.gov (United States)

    Yates, Thomas; Davies, Melanie J; Henson, Joe; Troughton, Jacqui; Edwardson, Charlotte; Gray, Laura J; Khunti, Kamlesh

    2012-05-29

    The prevention of type 2 diabetes is a recognised health care priority globally. Within the United Kingdom, there is a lack of research investigating optimal methods of translating diabetes prevention programmes, based on the promotion of a healthy lifestyle, into routine primary care. This study aims to establish the behavioural and clinical effectiveness of a structured educational programme designed to target perceptions and knowledge of diabetes risk and promote a healthily lifestyle, particularly increased walking activity, in a multi-ethnic population at a high risk of developing type 2 diabetes. Cluster randomised controlled trial undertaken at the level of primary care practices. Follow-up will be conducted at 12, 24 and 36 months. The primary outcome is change in objectively measured ambulatory activity. Secondary outcomes include progression to type 2 diabetes, biochemical variables (including fasting glucose, 2-h glucose, HbA1c and lipids), anthropometric variables, quality of life and depression. 10 primary care practices will be recruited to the study (5 intervention, 5 control). Within each practice, individuals at high risk of impaired glucose regulation will be identified using an automated version of the Leicester Risk Assessment tool. Individuals scoring within the 90th percentile in each practice will be invited to take part in the study. Practices will be assigned to either the control group (advice leaflet) or the intervention group, in which participants will be invited to attend a 3 hour structured educational programme designed to promote physical activity and a healthy lifestyle. Participants in the intervention practices will also be invited to attend annual group-based maintenance workshops and will receive telephone contact halfway between annual sessions. The study will run from 2010-2014. This study will provide new evidence surrounding the long-term effectiveness of a diabetes prevention programme run within routine primary care in

  16. Liraglutide in the management of type 2 diabetes

    Directory of Open Access Journals (Sweden)

    Estela Wajcberg

    2010-10-01

    Full Text Available Estela Wajcberg, Amatur AmarahPremier Nephrology and Hypertension, Internal Medicine Department, Trinitas Regional Medical Center, Elizabeth, New Jersey, USAAbstract: The pathophysiology of type 2 diabetes has been attributed to the classic triad of decreased insulin secretion, increased insulin resistance, and elevated hepatic glucose production. Research has shown additional mechanisms, including incretin deficiency or resistance in the gastrointestinal tract. Liraglutide is a modified form of human glucagon-like peptide-1. Liraglutide was obtained by substitution of lysine 34 for arginine near the NH2 terminus, and by addition of a C16 fatty acid at the e-amino group of lysine (at position 26 using a γ-glutamic acid spacer. Liraglutide has demonstrated glucose-dependent insulin secretion, improvements in β-cell function, deceleration of gastric emptying, and promotion of early satiety leading to weight loss. Liraglutide has the potential to acquire an important role, not only in the treatment of type 2 diabetes, but also in preservation of β-cell function, weight loss, and prevention of chronic diabetic complications.Keywords: diabetes mellitus, incretin, glucagon-like peptide, insulin resistance

  17. Leucine signaling in the pathogenesis of type 2 diabetes and obesity

    OpenAIRE

    Melnik, Bodo C

    2012-01-01

    Epidemiological evidence points to increased dairy and meat consumption, staples of the Western diet, as major risk factors for the development of type 2 diabetes (T2D). This paper presents a new concept and comprehensive review of leucine-mediated cell signaling explaining the pathogenesis of T2D and obesity by leucine-induced over-stimulation of mammalian target of rapamycin complex 1 (mTORC1). mTORC1, a pivotal nutrient-sensitive kinase, promotes growth and cell proliferation in response t...

  18. Tissue-type-specific transcriptome analysis identifies developing xylem-specific promoters in poplar.

    Science.gov (United States)

    Ko, Jae-Heung; Kim, Hyun-Tae; Hwang, Ildoo; Han, Kyung-Hwan

    2012-06-01

    Plant biotechnology offers a means to create novel phenotypes. However, commercial application of biotechnology in crop improvement programmes is severely hindered by the lack of utility promoters (or freedom to operate the existing ones) that can drive gene expression in a tissue-specific or temporally controlled manner. Woody biomass is gaining popularity as a source of fermentable sugars for liquid fuel production. To improve the quantity and quality of woody biomass, developing xylem (DX)-specific modification of the feedstock is highly desirable. To develop utility promoters that can drive transgene expression in a DX-specific manner, we used the Affymetrix Poplar Genome Arrays to obtain tissue-type-specific transcriptomes from poplar stems. Subsequent bioinformatics analysis identified 37 transcripts that are specifically or strongly expressed in DX cells of poplar. After further confirmation of their DX-specific expression using semi-quantitative PCR, we selected four genes (DX5, DX8, DX11 and DX15) for in vivo confirmation of their tissue-specific expression in transgenic poplars. The promoter regions of the selected DX genes were isolated and fused to a β-glucuronidase (GUS)-reported gene in a binary vector. This construct was used to produce transgenic poplars via Agrobacterium-mediated transformation. The GUS expression patterns of the resulting transgenic plants showed that these promoters were active in the xylem cells at early seedling growth and had strongest expression in the developing xylem cells at later growth stages of poplar. We conclude that these DX promoters can be used as a utility promoter for DX-specific biomass engineering. © 2012 The Authors. Plant Biotechnology Journal © 2012 Society for Experimental Biology, Association of Applied Biologists and Blackwell Publishing Ltd.

  19. Pathogenesis and prevention of type 2 diabetes: parental determinants, breastfeeding, and early childhood nutrition.

    Science.gov (United States)

    Bartz, Sarah; Freemark, Michael

    2012-02-01

    Among the factors predisposing to type 2 diabetes in children, adolescents, and young adults, the health and behavior of both the mother and father are critical. Prevention and treatment of parental nutritional disorders (including obesity and malnutrition), promotion of breastfeeding, and avoidance of overfeeding of young children are essential for childhood health and metabolic function. Focusing research and policy on parental influences on childhood health should reduce the risks of obesity and type 2 diabetes in future generations.

  20. Diabetes Type 2

    Science.gov (United States)

    Diabetes means your blood glucose, or blood sugar, levels are too high. With type 2 diabetes, the more common type, your body does not ... You have a higher risk of type 2 diabetes if you are older, have obesity, have a ...

  1. Carnosol promotes endothelial differentiation under H2O2-induced oxidative stress

    Directory of Open Access Journals (Sweden)

    Ou Shulin

    2017-01-01

    Full Text Available Oxidative stress causes deregulation of endothelial cell differentiation. Carnosol is a potent antioxidant and antiinflammatory compound. In the present study, we examined whether the antioxidant effect of carnosol might protect bone marrow stem cells against H2O2-induced oxidative stress and promote endothelial differentiation. We examined cell viability by the MTT assay; oxidative stress and apoptosis were analyzed through changes in ROS levels, apoptotic ratio and caspase-3 activity; changes in protein expression of OCT-4, Flk-1, CD31 and Nrf-2 were assessed by Western blot analysis. H2O2 treatment increased oxidative stress and reduced cell viability, while the stem cell marker OCT-4 and endothelial markers Flk-1, CD31 were significantly downregulated as a result of the treatment with H2O2. Treatment with carnosol improved the antioxidant status, increased OCT-4 expression and promoted endothelial differentiation. This study provides evidence that carnosol could increase the antioxidant defense mechanism and promote endothelial differentiation.

  2. mTORC2 Promotes Tumorigenesis via Lipid Synthesis.

    Science.gov (United States)

    Guri, Yakir; Colombi, Marco; Dazert, Eva; Hindupur, Sravanth K; Roszik, Jason; Moes, Suzette; Jenoe, Paul; Heim, Markus H; Riezman, Isabelle; Riezman, Howard; Hall, Michael N

    2017-12-11

    Dysregulated mammalian target of rapamycin (mTOR) promotes cancer, but underlying mechanisms are poorly understood. We describe an mTOR-driven mouse model that displays hepatosteatosis progressing to hepatocellular carcinoma (HCC). Longitudinal proteomic, lipidomics, and metabolomic analyses revealed that hepatic mTORC2 promotes de novo fatty acid and lipid synthesis, leading to steatosis and tumor development. In particular, mTORC2 stimulated sphingolipid (glucosylceramide) and glycerophospholipid (cardiolipin) synthesis. Inhibition of fatty acid or sphingolipid synthesis prevented tumor development, indicating a causal effect in tumorigenesis. Increased levels of cardiolipin were associated with tubular mitochondria and enhanced oxidative phosphorylation. Furthermore, increased lipogenesis correlated with elevated mTORC2 activity and HCC in human patients. Thus, mTORC2 promotes cancer via formation of lipids essential for growth and energy production. Copyright © 2017 Elsevier Inc. All rights reserved.

  3. Features of Type 2 Diabetes Mellitus in Combination with Hypothyroidism

    Directory of Open Access Journals (Sweden)

    T.Yu. Yuzvenko

    2015-11-01

    in DM type 2, than in DM type 1, indicating a greater presence of risk factors of concomitant autoimmune pathology in conditions of metabolic disorders at DM type 2. Insulin resistance and hyperinsulinemia, which are marked with DM type 2, promote proliferative processes, in particular in thyroid tissue, and older age of patients with type 2 DM contributes to the progression of involutional changes and further development of hypothyroidism. Obligatory comprehensive examination of patients with type 2 DM is recommended in the presence of concomitant thyroid pathology.

  4. Oral treatment with enrofloxacin early in life promotes Th2-mediated immune response in mice.

    Science.gov (United States)

    Strzępa, Anna; Majewska-Szczepanik, Monika; Kowalczyk, Paulina; Woźniak, Dorota; Motyl, Sylwia; Szczepanik, Marian

    2016-02-01

    Th2 lymphocytes play a crucial role in the development of allergy. These pathologies are caused by coordinated production of the cytokines IL-4, IL-5 and IL-13 that regulate the activity of eosinophils, basophils and B cells. According to the 'hygiene hypothesis', the reduced exposure to microorganisms favors allergy occurrence. The advances in medicine in the field of infection therapy promoted an increasing application of antibiotics which, apart from eliminating pathogens, also partially eliminate the microbiota. Epicutaneous (EC) immunization with ovalbumin (OVA) followed by OVA challenge was used to study the influence of partial gut flora depletion by oral treatment with enrofloxacin on type-2 immune response. Current work describes the influence of enrofloxacin application on anti-OVA antibody production and cytokine synthesis in young and adult mice. Immune response in adult mice is less sensitive to modification of natural gut flora. We observed that enrofloxacin treatment of adult mice leads to significant decrease of anti-OVA IgG2a production while synthesis of anti-OVA IgE was not changed. The production of type-1 (IFN-γ), type-2 (IL-4, IL-5, IL-10, IL-13) and Th17-associated (IL-17A) cytokines was inhibited. On the other hand, treatment of young mice with enrofloxacin significantly upregulates the production of anti-OVA IgE and inhibits the secretion of anti-OVA IgG2a antibodies. Additionally, treatment with enrofloxacin early in life prior to OVA immunization results in increased production of type-2 (IL-4, IL-10 and IL-13) cytokines. Our results clearly indicate that the immune system is more vulnerable to decreased bacterial exposure early in life that may promote development of allergy. Copyright © 2015 Institute of Pharmacology, Polish Academy of Sciences. Published by Elsevier Urban & Partner Sp. z o.o. All rights reserved.

  5. GSTT2 promoter polymorphisms and colorectal cancer risk

    Directory of Open Access Journals (Sweden)

    Ahn Sun-A

    2007-01-01

    Full Text Available Abstract Background Glutathione S-transferases are a group of enzymes that participate in detoxification and defense mechanisms against toxic carcinogens and other compounds. These enzymes play an important role in human carcinogenesis. In the present study, we sought to determine whether GSTT2 promoter single nucleotide polymorphisms (SNPs are associated with colorectal cancer risk. Methods A total of 436 colorectal cancer patients and 568 healthy controls were genotyped for three GSTT2 promoter SNPs (-537G>A, -277T>C and -158G>A, using real-time TaqMan assay and direct sequencing. An electrophoretic mobility shift assay (EMSA was performed to determine the effects of polymorphisms on protein binding to the GSTT2 promoter. Results The -537A allele (-537G/A or A/A was significantly associated with colorectal cancer risk (OR = 1.373, p = 0.025, while the -158A allele (-158G/A or A/A was involved in protection against colorectal cancer (OR = 0.539, p = 0.032. Haplotype 2 (-537A, -277T, -158G was significantly associated with colorectal cancer risk (OR = 1.386, p = 0.021, while haplotype 4 (-537G, -277C, -158A protected against colorectal cancer (OR = 0.539, p = 0.032. EMSA data revealed lower promoter binding activity in the -537A allele than its -537G counterpart. Conclusion Our results collectively suggest that SNPs and haplotypes of the GSTT2 promoter region are associated with colorectal cancer risk in the Korean population.

  6. Recurrent TERT promoter mutations identified in a large-scale study of multiple tumor types are associated with increased TERT expression and telomerase activation

    Science.gov (United States)

    Huang, Dong-Sheng; Wang, Zhaohui; He, Xu-Jun; Diplas, Bill H.; Yang, Rui; Killela, Patrick J.; Liang, Junbo; Meng, Qun; Ye, Zai-Yuan; Wang, Wei; Jiang, Xiao-Ting; Xu, Li; He, Xiang-Lei; Zhao, Zhong-Sheng; Xu, Wen-Juan; Wang, Hui-Ju; Ma, Ying-Yu; Xia, Ying-Jie; Li, Li; Zhang, Ru-Xuan; Jin, Tao; Zhao, Zhong-Kuo; Xu, Ji; Yu, Sheng; Wu, Fang; Wang, Si-Zhen; Jiao, Yu-Chen; Yan, Hai; Tao, Hou-Quan

    2015-01-01

    Background Several somatic mutation hotspots were recently identified in the TERT promoter region in human cancers. Large scale studies of these mutations in multiple tumor types are limited, in particular in Asian populations. This study aimed to: analyze TERT promoter mutations in multiple tumor types in a large Chinese patient cohort, investigate novel tumor types and assess the functional significance of the mutations. Methods TERT promoter mutation status was assessed by Sanger sequencing for 13 different tumor types and 799 tumor tissues from Chinese cancer patients. Thymic epithelial tumors, gastrointestinal leiomyoma, and gastric schwannoma were included, for which the TERT promoter has not been previously sequenced. Functional studies included TERT expression by RT-qPCR, telomerase activity by the TRAP assay, and promoter activity by the luciferase reporter assay. Results TERT promoter mutations were highly frequent in glioblastoma (83.9%), urothelial carcinoma (64.5%), oligodendroglioma (70.0%), medulloblastoma (33.3%), and hepatocellular carcinoma (31.4%). C228T and C250T were the most common mutations. In urothelial carcinoma, several novel rare mutations were identified. TERT promoter mutations were absent in GIST, thymic epithelial tumors, gastrointestinal leiomyoma, gastric schwannoma, cholangiocarcinoma, gastric and pancreatic cancer. TERT promoter mutations highly correlated with upregulated TERT mRNA expression and telomerase activity in adult gliomas. These mutations differentially enhanced the transcriptional activity of the TERT core promoter. Conclusions TERT promoter mutations are frequent in multiple tumor types and have similar distributions in Chinese cancer patients. The functional significance of these mutations reflect the importance to telomere maintenance and hence tumorigenesis, making them potential therapeutic targets. PMID:25843513

  7. Glucose-dependent insulinotropic polypeptide promotes lipid deposition in subcutaneous adipocytes in obese type 2 diabetes patients

    DEFF Research Database (Denmark)

    Thondam, Sravan K; Daousi, Christina; Wilding, John P H

    2017-01-01

    is anabolic in human subcutaneous adipose tissue (SAT) promoting triacylglycerol (TAG) deposition through reesterification of nonesterified fatty acids (NEFA), and this effect may differ according to obesity status or glucose tolerance. Twenty-three subjects categorized into four groups, normoglycemic lean (n...... = 6), normoglycemic obese (n = 6), obese with impaired glucose regulation (IGR; n = 6), and obese T2DM (n = 5), participated in a double-blind, randomized, crossover study involving a hyperglycemic clamp with a 240-min GIP infusion (2 pmol·kg(-1)·min(-1)) or normal saline. Insulin, NEFA, SAT......-TAG content, and gene expression of key lipogenic enzymes were determined before and immediately after GIP/saline infusions. GIP lowered NEFA concentrations in the obese T2DM group despite diminished insulinotropic activity (mean NEFA AUC0-4 h ± SE, 41,992 ± 9,843 µmol·l(-1)·min(-1) vs. 71,468 ± 13...

  8. An examination of trends in amount and type of cigarette advertising and sales promotions in California stores, 2002-2005.

    Science.gov (United States)

    Feighery, E C; Schleicher, N C; Boley Cruz, T; Unger, J B

    2008-04-01

    Cigarette companies spend more of their marketing dollars in stores than in any other venue. In 2005, they spent 88% of a total of $13.1 billion to advertise and promote product sales in stores. The purposes of this study were to identify how the amount and types of cigarette advertising and sales promotions have changed in stores in California between 2002 and 2005, and to assess neighbourhood influences on cigarette marketing in stores. Four observational assessments of cigarette advertising were conducted in approximately 600 California stores that sold cigarettes from 2002 to 2005. Trained observers collected data on the amount and type of cigarette advertising, including signs, product shelving and displays and functional items, and presence of sales promotions on these items. Longitudinal analyses were performed to estimate trends over time and identify correlates of change in the amount and type of tobacco advertising. The mean number of cigarette advertisements per store increased over time from 22.7 to 24.9. The percentage of stores with at least one advert for a sales promotion increased from 68% to 80%. The amount of advertising and proportion of stores with sales promotions increased more rapidly in stores situated in neighbourhoods with a higher proportion of African-Americans. The results indicate increasing use of stores to market and promote cigarette sales. Further, these increases are disproportionately accelerating in neighbourhoods with more African-Americans. Legislative strategies should be pursued to control the marketing of tobacco products and promotional strategies used to reduce prices in stores.

  9. Environmental/lifestyle factors in the pathogenesis and prevention of type 2 diabetes.

    Science.gov (United States)

    Kolb, Hubert; Martin, Stephan

    2017-07-19

    Environmental and lifestyle changes, in addition to the ageing of populations, are generally believed to account for the rapid global increase in type 2 diabetes prevalence and incidence in recent decades. In this review, we present a comprehensive overview of factors contributing to diabetes risk, including aspects of diet quality and quantity, little physical activity, increased monitor viewing time or sitting in general, exposure to noise or fine dust, short or disturbed sleep, smoking, stress and depression, and a low socioeconomic status. In general, these factors promote an increase in body mass index. Since loss of β-cell function is the ultimate cause of developing overt type 2 diabetes, environmental and lifestyle changes must have resulted in a higher risk of β-cell damage in those at genetic risk. Multiple mechanistic pathways may come into play. Strategies of diabetes prevention should aim at promoting a 'diabetes-protective lifestyle' whilst simultaneously enhancing the resistance of the human organism to pro-diabetic environmental and lifestyle factors. More research on diabetes-protective mechanisms seems warranted.

  10. Facts about Type 2

    Medline Plus

    Full Text Available ... Care of Type 2 Diabetes This two-page introduction to type 2 diabetes is in PDF format ... Basics Symptoms Type 1 Type 2 Gestational Myths Statistics Common Terms Genetics Living With Diabetes Recently Diagnosed ...

  11. Is Type-2 Diabetes a Glycogen Storage Disease of Pancreatic β-Cells?

    Science.gov (United States)

    Ashcroft, Frances M; Rohm, Maria; Clark, Anne; Brereton, Melissa F

    2018-01-01

    Elevated plasma glucose leads to pancreatic β-cell dysfunction and death in type 2 diabetes. Glycogen accumulation, due to impaired metabolism, contributes to this ‘glucotoxicity’ via dysregulated biochemical pathways promoting β-cell dysfunction. Here, we review emerging data, and re-examine published findings, on the role of glycogen in β-cells in normoglycaemia and in diabetes. PMID:28683284

  12. Molecular and functional characterization of the promoter of ETS2, the human c-ets-2 gene

    International Nuclear Information System (INIS)

    Mavrothalassitis, G.J.; Watson, D.K.; Papas, T.S.

    1990-01-01

    The 5' end of the human c-ets-2 gene, ETS2, was cloned and characterized. The major transcription initiation start sites were identified, and the pertinent sequences surrounding the ETS2 promoter were determined. The promoter region of ETS2 does not possess typical TATA and CAAT elements. However, this promoter contains several repeat regions, as well as two consensus AP2 binding sites and three putative Sp1 sites. There is also a palindromic region similar to the serum response element of the c-fos gene, located 1,400 base pairs (bp) upstream from the first major transcription initiation site. A G+C-rich sequence (GC element) with dyad symmetry can be seen in the ETS2 promoter, immediately following an unusually long polypurine-polypyrimidine tract. A series of deletion fragments from the putative promoter region were ligated in front of the bacterial chloramphenicol acetyltransferase gene and tested for activity following transfection into HeLa cells. The 5' boundary of the region needed for maximum promoter activity was found to be 159 bp upstream of the major initiation site. The promoter of ETS2 (within the polypyrimidine tract) serves to illustrate an alternative structure that may be present in genes with TATA-less promoters

  13. Leukemia inhibitory factor promote trophoblast invasion via urokinase-type plasminogen activator receptor in preeclampsia.

    Science.gov (United States)

    Zheng, Qin; Dai, Kuixing; Cui, Xinyuan; Yu, Ming; Yang, Xuesong; Yan, Bin; Liu, Shuai; Yan, Qiu

    2016-05-01

    Preeclampsia is a pregnancy-related syndrome which can cause perinatal mortality and morbidity. Inadequate invasion by trophoblast cells may lead to poor perfusion of the placenta, even result in preeclampsia. Understanding the molecular mechanisms underlying placentation facilitates the better intervention of preeclampsia. Urokinase-type plasminogen activator receptor (uPAR) is involved in the physiological and pathological processes. Leukemia inhibitory factor (LIF) is an important regulator in the establishment of pregnancy. However, the expression of uPAR in preeclamptic patients and its relationship with LIF remains unclear. In the current study, we found that the level of uPAR was relatively lower in the placentas from preeclamptic patients as compared with normal pregnant women. LIF promoted trophoblast cell outgrowth by upregulating uPAR in an explants culture, and LIF also enhanced migration and invasion potential through uPAR in trophoblast JAR and JEG-3 cell lines, and with increased gelatinolytic activities of matrix metalloproteinase 2 (MMP-2). The effect of LIF and uPAR on trophoblast migration and invasion was mediated by PI3K/AKT signaling pathway. Our data indicates the roles of LIF in promoting trophoblast migration and invasion through uPAR and suggest that abnormal expression of uPAR might be associated with the etiology of preeclampsia. Copyright © 2016 Elsevier Masson SAS. All rights reserved.

  14. Lithium niobate bulk crystallization promoted by CO2 laser radiation

    Science.gov (United States)

    Ferreira, N. M.; Costa, F. M.; Nogueira, R. N.; Graça, M. P. F.

    2012-09-01

    The crystallization induced by laser radiation is a very promising technique to promote glass/ceramic transformation, being already used to produce crystalline patterns on glass surfaces. In this work, a SiO2-Li2O-Nb2O5 glass, prepared by the sol-gel route, was submitted to CO2 laser radiation and conventional heat-treatments in order to induce the LiNbO3 crystallization. The structure and morphology of the samples prepared by both routes was analyzed as a function of exposure time, radiation power and heat-treatment temperatures by XRD, Raman spectroscopy and SEM. The results reveal a correlation between the crystallization degree of LiNbO3 particles and glass matrix with the heat treatment type and experimental parameters. An heat-treatment at 650 °C/4 h was necessary to induce crystallization in heat treatments samples while 4 W/500 s was enough for laser radiation ones, corresponding a reduction time processing of ˜14 000 s.

  15. Promotion of Wound Healing by an Agonist of Adenosine A2A Receptor Is Dependent on Tissue Plasminogen Activator.

    Science.gov (United States)

    Montesinos, M Carmen; Desai-Merchant, Avani; Cronstein, Bruce N

    2015-12-01

    Impaired wound healing, as it occurs in diabetes mellitus or long-term corticoid treatment, is commonly associated with disability, diminished quality of life, and high economic costs. Selective agonists of the A2A receptor subtype of adenosine, an endogenous regulator of inflammation, promote tissue repair in animal models, both healthy and with impaired healing. Plasmin-mediated proteolysis of fibrin and other matrix proteins is essential for cell migration at sites of injury. Since adenosine A2A receptor activation increases plasminogen activator release from macrophages and mast cells, we studied the effect of a selective agonist, CGS-21680, on full-thickness excisional wound closure in wild-type, urokinase plasminogen activator (uPA)-deficient, and tissue plasminogen activator (tPA)-deficient mice. Wound closure was impaired in tPA- and uPA-deficient mice as compared with wild-type mice, and topical application of CGS-21680 significantly increased the rate at which wounds closed in wild-type mice and uPA-deficient mice, but not in tPA-deficient mice. Immunostaining of tissue sections showed that tPA was present in endothelial cells and histiocytes by day 3 post-wound and also by day 6. In contrast, uPA was more prominent in these cell types only by day 6 post-wound. Our results confirm that plasminogen activation contributes to wound repair and are consistent with the hypothesis that adenosine A2A receptor activation promotes wound closure by a mechanism that depends upon tPA, but not uPA. Moreover, our results suggest that topical adenosine A2A receptor agonists may be useful in promotion of wound closure in patients with impaired wound healing.

  16. Androgen signaling promotes translation of TMEFF2 in prostate cancer cells via phosphorylation of the α subunit of the translation initiation factor 2.

    Directory of Open Access Journals (Sweden)

    Ryan F Overcash

    Full Text Available The type I transmembrane protein with epidermal growth factor and two follistatin motifs 2 (TMEFF2, is expressed mainly in brain and prostate. Expression of TMEFF2 is deregulated in prostate cancer, suggesting a role in this disease, but the molecular mechanism(s involved in this effect are not clear. Although androgens promote tmeff2 transcription, androgen delivery to castrated animals carrying CWR22 xenografts increases TMEFF2 protein levels in the absence of mRNA changes, suggesting that TMEFF2 may also be post-transcriptionally regulated. Here we show that translation of TMEFF2 is regulated by androgens. Addition of physiological concentrations of dihydrotestosterone (DHT to prostate cancer cell lines increases translation of endogenous TMEFF2 or transfected TMEFF2-Luciferase fusions, and this effect requires the presence of upstream open reading frames (uORFs in the 5'-untranslated region (5'-UTR of TMEFF2. Using chemical and siRNA inhibition of the androgen receptor (AR, we show that the androgen effect on TMEFF2 translation is mediated by the AR. Importantly, DHT also promotes phosphorylation of the α subunit of the translation initiation factor 2 (eIF2α in an AR-dependent manner, paralleling the effect on TMEFF2 translation. Moreover, endoplasmic reticulum (ER stress conditions, which promote eIF2α phosphorylation, also stimulate TMEFF2 translation. These results indicate that androgen signaling promotes eIF2α phosphorylation and subsequent translation of TMEFF2 via a mechanism that requires uORFs in the 5'-UTR of TMEFF2.

  17. Vegetarian Diets in the Prevention and Treatment of Type 2 Diabetes.

    Science.gov (United States)

    Kahleova, Hana; Pelikanova, Terezie

    2015-01-01

    Observational studies show that prevalence of type 2 diabetes is 1.6 to 2 times lower in vegetarians than in the general population, even after adjustment for differences in body mass index (BMI). Clinical interventional trials demonstrated that vegetarian diets lead to a greater weight loss and greater reduction in fasting plasma glucose, HbA1c, blood lipids, and hypoglycemic medication than a conventional hypocaloric diet in subjects with type 2 diabetes. We found a greater reduction in visceral fat and greater improvements in insulin resistance and oxidative stress markers with a vegetarian compared to a conventional hypocaloric diabetic diet. Vegetarian diets are sustainable in the long term and may elicit desirable improvements not only in physical health but also in mental health. The American Dietetic Association states that well-planned vegetarian diets are healthy and nutritionally adequate and they may be beneficial in prevention and treatment of some illnesses. Larger clinical trials are needed to confirm the effectiveness and promote the inclusion of vegetarian diets in dietary guidelines for prevention and treatment of type 2 diabetes.

  18. 2-HG Inhibits Necroptosis by Stimulating DNMT1-Dependent Hypermethylation of the RIP3 Promoter

    Directory of Open Access Journals (Sweden)

    Zhentao Yang

    2017-05-01

    Full Text Available 2-hydroxyglutarate-(2-HG-mediated inhibition of TET2 activity influences DNA hypermethylation in cells harboring mutations of isocitrate dehydrogenases 1 and 2 (IDH1/2. Here, we show that 2-HG also regulates DNA methylation mediated by DNA methyltransferase 1 (DNMT1. DNMT1-dependent hypermethylation of the RIP3 promoter occurred in both IDH1 R132Q knockin mutant mouse embryonic fibroblast (MEFs and 2-HG-treated wild-type (WT MEFs. We found that 2-HG bound to DNMT1 and stimulated its association with the RIP3 promoter, inducing hypermethylation that reduces RIP3 protein and consequently impaired RIP3-dependent necroptosis. In human glioma samples, RIP3 protein levels correlated negatively with IDH1 R132H levels. Furthermore, ectopic expression of RIP3 in transformed IDH1-mutated MEFs inhibited the growth of tumors derived from these cells following transplantation into nude mice. Thus, our research sheds light on a mechanism of 2-HG-induced DNA hypermethylation and suggests that impaired necroptosis contributes to the tumorigenesis driven by IDH1/2 mutations.

  19. Local angiotensin II promotes adipogenic differentiation of human adipose tissue mesenchymal stem cells through type 2 angiotensin receptor

    Directory of Open Access Journals (Sweden)

    Veronika Y. Sysoeva

    2017-12-01

    Full Text Available Obesity is often associated with high systemic and local activity of renin-angiotensin system (RAS. Mesenchymal stem cells of adipose tissue are the main source of adipocytes. The aim of this study was to clarify how local RAS could control adipose differentiation of human adipose tissue derived mesenchymal stem cells (ADSCs. We examined the distribution of angiotensin receptor expressing cells in human adipose tissue and found that type 1 and type 2 receptors are co-expressed in its stromal compartment, which is known to contain mesenchymal stem cells. To study the expression of receptors specifically in ADSCs we have isolated them from adipose tissue. Up to 99% of cultured ADSCs expressed angiotensin II (AngII receptor type 1 (AT1. Using the analysis of Ca2+ mobilization in single cells we found that only 5.2 ± 2.7% of ADSCs specifically respond to serial Ang II applications via AT1 receptor and expressed this receptor constantly. This AT1const ADSCs subpopulation exhibited increased adipose competency, which was triggered by endogenous AngII. Inhibitory and expression analyses showed that AT1const ADSCs highly co-express AngII type 2 receptor (AT2, which was responsible for increased adipose competency of this ADSC subpopulation.

  20. A plant-based diet for the prevention and treatment of type 2 diabetes.

    Science.gov (United States)

    McMacken, Michelle; Shah, Sapana

    2017-05-01

    The prevalence of type 2 diabetes is rising worldwide, especially in older adults. Diet and lifestyle, particularly plant-based diets, are effective tools for type 2 diabetes prevention and management. Plant-based diets are eating patterns that emphasize legumes, whole grains, vegetables, fruits, nuts, and seeds and discourage most or all animal products. Cohort studies strongly support the role of plant-based diets, and food and nutrient components of plant-based diets, in reducing the risk of type 2 diabetes. Evidence from observational and interventional studies demonstrates the benefits of plant-based diets in treating type 2 diabetes and reducing key diabetes-related macrovascular and microvascular complications. Optimal macronutrient ratios for preventing and treating type 2 diabetes are controversial; the focus should instead be on eating patterns and actual foods. However, the evidence does suggest that the type and source of carbohydrate (unrefined versus refined), fats (monounsaturated and polyunsaturated versus saturated and trans), and protein (plant versus animal) play a major role in the prevention and management of type 2 diabetes. Multiple potential mechanisms underlie the benefits of a plant-based diet in ameliorating insulin resistance, including promotion of a healthy body weight, increases in fiber and phytonutrients, food-microbiome interactions, and decreases in saturated fat, advanced glycation endproducts, nitrosamines, and heme iron.

  1. Walking away from type 2 diabetes: trial protocol of a cluster randomised controlled trial evaluating a structured education programme in those at high risk of developing type 2 diabetes

    Directory of Open Access Journals (Sweden)

    Yates Thomas

    2012-05-01

    Full Text Available Abstract Background The prevention of type 2 diabetes is a recognised health care priority globally. Within the United Kingdom, there is a lack of research investigating optimal methods of translating diabetes prevention programmes, based on the promotion of a healthy lifestyle, into routine primary care. This study aims to establish the behavioural and clinical effectiveness of a structured educational programme designed to target perceptions and knowledge of diabetes risk and promote a healthily lifestyle, particularly increased walking activity, in a multi-ethnic population at a high risk of developing type 2 diabetes. Design Cluster randomised controlled trial undertaken at the level of primary care practices. Follow-up will be conducted at 12, 24 and 36 months. The primary outcome is change in objectively measured ambulatory activity. Secondary outcomes include progression to type 2 diabetes, biochemical variables (including fasting glucose, 2-h glucose, HbA1c and lipids, anthropometric variables, quality of life and depression. Methods 10 primary care practices will be recruited to the study (5 intervention, 5 control. Within each practice, individuals at high risk of impaired glucose regulation will be identified using an automated version of the Leicester Risk Assessment tool. Individuals scoring within the 90th percentile in each practice will be invited to take part in the study. Practices will be assigned to either the control group (advice leaflet or the intervention group, in which participants will be invited to attend a 3 hour structured educational programme designed to promote physical activity and a healthy lifestyle. Participants in the intervention practices will also be invited to attend annual group-based maintenance workshops and will receive telephone contact halfway between annual sessions. The study will run from 2010–2014. Discussion This study will provide new evidence surrounding the long-term effectiveness of a

  2. Regulatory focus and adherence to self-care behaviors among adults with type 2 diabetes.

    Science.gov (United States)

    Avraham, Rinat; Van Dijk, Dina; Simon-Tuval, Tzahit

    2016-09-01

    The aims of this study were, first, to test the association between regulatory focus of adults with type 2 diabetes and their adherence to two types of self-care behaviors - lifestyle change (e.g. physical activity and diet) and medical care regimens (blood-glucose monitoring, foot care and medication usage). Second, to explore whether a fit between the message framing and patients' regulatory focus would improve their intentions to adhere specifically when the type of behavior fits the patients' regulatory focus as well. A cross-sectional study was conducted among 130 adults with type 2 diabetes who were hospitalized in an academic medical center. The patients completed a set of questionnaires that included their diabetes self-care activities, regulatory focus, self-esteem and demographic, socioeconomic and clinical data. In addition, participants were exposed to either a gain-framed or a loss-framed message, and were then asked to indicate their intention to improve adherence to self-care behaviors. A multivariable linear regression model revealed that promoters reported higher adherence to lifestyle change behaviors than preventers did (B = .60, p = .028). However, no effect of regulatory focus on adherence to medical care regimens was found (B = .46, p = .114). In addition, preventers reported higher intentions to adhere to medical care behaviors when the message framing was congruent with prevention focus (B = 1.16, p = .023). However, promoters did not report higher intentions to adhere to lifestyle behaviors when the message framing was congruent with promotion focus (B = -.16, p = .765). These findings justify the need to develop tailor-made interventions that are adjusted to both patients' regulatory focus and type of health behavior.

  3. Glass promotes the differentiation of neuronal and non-neuronal cell types in the Drosophila eye

    Science.gov (United States)

    Morrison, Carolyn A.; Chen, Hao; Cook, Tiffany; Brown, Stuart

    2018-01-01

    Transcriptional regulators can specify different cell types from a pool of equivalent progenitors by activating distinct developmental programs. The Glass transcription factor is expressed in all progenitors in the developing Drosophila eye, and is maintained in both neuronal and non-neuronal cell types. Glass is required for neuronal progenitors to differentiate as photoreceptors, but its role in non-neuronal cone and pigment cells is unknown. To determine whether Glass activity is limited to neuronal lineages, we compared the effects of misexpressing it in neuroblasts of the larval brain and in epithelial cells of the wing disc. Glass activated overlapping but distinct sets of genes in these neuronal and non-neuronal contexts, including markers of photoreceptors, cone cells and pigment cells. Coexpression of other transcription factors such as Pax2, Eyes absent, Lozenge and Escargot enabled Glass to induce additional genes characteristic of the non-neuronal cell types. Cell type-specific glass mutations generated in cone or pigment cells using somatic CRISPR revealed autonomous developmental defects, and expressing Glass specifically in these cells partially rescued glass mutant phenotypes. These results indicate that Glass is a determinant of organ identity that acts in both neuronal and non-neuronal cells to promote their differentiation into functional components of the eye. PMID:29324767

  4. Facts about Type 2

    Medline Plus

    Full Text Available ... August 1, 2013 Last Edited: October 27, 2015 Articles from Diabetes Forecast® magazine: lp-type-2, . In this section Diabetes Basics Type 2 Facts About Type 2 Recently Diagnosed Treatment and Care Blood ...

  5. The nurses role in preventing type 2 diabetes mellitus type 2

    OpenAIRE

    Kittilsen, Jannike Granum; Lerfaldet, Hanne Nyhus; Norhaug, Anikken Thomassen; Tangen, Emmy Helene

    2016-01-01

    Innledning: Diabetes mellitus type 2 er et økende problem både i Norge og internasjonalt. Forekomsten av diabetes mellitus type 2 er firedoblet fra 1980 til 2014. Hensikt: Undersøke hvordan livsstilsendringer kan forebygge utviklingen av diabetes mellitus type 2, og hva sykepleiers rolle er i forebyggingen. Metode: Det har blitt benyttet litteraturstudie som metode. Systematiske søk ble gjort i databasene: Cinahl Complete, Ovid Nursing Database og Medline. Resultat: Gjennom systematisk søk er...

  6. mTOR complex 2 phosphorylates IMP1 cotranslationally to promote IGF2 production and the proliferation of mouse embryonic fibroblasts

    DEFF Research Database (Denmark)

    Dai, Ning; Christiansen, Jan; Nielsen, Finn

    2013-01-01

    uncover a new mechanism by which mTOR regulates organismal growth by promoting IGF2 production in the mouse embryo through mTORC2-catalyzed cotranslational IMP1/IMP3 phosphorylation. Inasmuch as TORC2 is activated by association with ribosomes, the present results indicate that mTORC2-catalyzed...... production, and diminished proliferation. The proliferation of the IMP1-null fibroblasts can be restored to wild-type levels by IGF2 in vitro or by re-expression of IMP1, which corrects the defects in IGF2 RNA splicing and translation. The ability of IMP1 to correct these defects is dependent on IMP1...

  7. Scintigraphic Evaluation of Multiple Endocrine Neoplasia Type 2 ( MEN Type 2 )

    International Nuclear Information System (INIS)

    Lee, Jae Tae; Lee, Kyu Bo; Whang, Kee Suk; Kim, Bo Wan; Lee, In Kyu

    1991-01-01

    Multiple endocrine neoplasia type 2 (MEN type 2, Sipple's syndrome) is a rare disorder characterized by the association of medullary carcinoma of the thyroid, parathyroid hyperplasia and can be diagnosed in early stage of the disease by meticulous screening tests of the family. This case report describes the location and categorization of tumors using 99m Tc-pertechnetate, I -NaI, 99m Tc-pentavalent(V) DMSA, 131 I -MIBG scans in two cases of MEN type 2 occurred in a 32 year old women and her 29-year old brother. In MEN type 2, we think, combined use of 99m Tc-(V)-DMSA, 99m Tc-pertechnetate and 1 '3 1 I -MIBG may be useful for the categorization of tumor mass lesions and planning appropriate therapy.

  8. Facts about Type 2

    Medline Plus

    Full Text Available ... Home Prevention Diagnosing Diabetes and Learning About Prediabetes Type 2 Diabetes Risk Test Lower Your Risk Healthy Eating Overweight ... About Type 2 Enroll in the Living WIth Type 2 Diabetes Program Gestational What is Gestational Diabetes? How to ...

  9. Impaired peripheral nerve regeneration in type-2 diabetic mouse model.

    Science.gov (United States)

    Pham, Vuong M; Tu, Nguyen Huu; Katano, Tayo; Matsumura, Shinji; Saito, Akira; Yamada, Akihiro; Furue, Hidemasa; Ito, Seiji

    2018-01-01

    Peripheral neuropathy is one of the most common and serious complications of type-2 diabetes. Diabetic neuropathy is characterized by a distal symmetrical sensorimotor polyneuropathy, and its incidence increases in patients 40 years of age or older. In spite of extensive research over decades, there are few effective treatments for diabetic neuropathy besides glucose control and improved lifestyle. The earliest changes in diabetic neuropathy occur in sensory nerve fibers, with initial degeneration and regeneration resulting in pain. To seek its effective treatment, here we prepared a type-2 diabetic mouse model by giving mice 2 injections of streptozotocin and nicotinamide and examining the ability for nerve regeneration by using a sciatic nerve transection-regeneration model previously established by us. Seventeen weeks after the last injection, the mice exhibited symptoms of type-2 diabetes, that is, impaired glucose tolerance, decreased insulin level, mechanical hyperalgesia, and impaired sensory nerve fibers in the plantar skin. These mice showed delayed functional recovery and nerve regeneration by 2 weeks compared with young healthy mice and by 1 week compared with age-matched non-diabetic mice after axotomy. Furthermore, type-2 diabetic mice displayed increased expression of PTEN in their DRG neurons. Administration of a PTEN inhibitor at the cutting site of the nerve for 4 weeks promoted the axonal transport and functional recovery remarkably. This study demonstrates that peripheral nerve regeneration was impaired in type-2 diabetic model and that its combination with sciatic nerve transection is suitable for the study of the pathogenesis and treatment of early diabetic neuropathy. © 2017 Federation of European Neuroscience Societies and John Wiley & Sons Ltd.

  10. Advances in diabetes for the millennium: nutritional therapy of type 2 diabetes.

    Science.gov (United States)

    Rendel, Marc

    2004-09-01

    Dietary modification is useful in both type 1 and type 2 diabetes. Glucose levels after a meal are largely determined by carbohydrate intake. Decreased intake of simple carbohydrates and increased fiber consumption lower postprandial glucose. Obesity has become epidemic in the United States and has dramatically increased the incidence of type 2 diabetes by augmenting insulin resistance. Dietary treatment of obesity has been frustrating. Success will require education in using foods with high fiber contents, low glycemic indexes, and low saturated fat levels. The use of natural foods must be supplemented by the use of semisynthetic foods with desirable properties. The educational efforts required are substantial and must be recognized by third-party reimbursement agencies. Operative procedures to decrease intake or reduce the absorption of food are being used with increasing frequency. Bariatric surgery is often successful in inducing a substantial loss of weight; however, this success must be balanced against the complications of surgery, which can be considerable. The pharmacologic approaches to treatment of obesity have focused primarily on anorexigenic agents. Several polypeptides that induce satiety are currently under study, including leptin and glucagon-like peptide-1 (GLP-1). Orlistat has been used to induce the malabsorption of fat to reduce caloric ingestion. Of the currently used oral hypoglycemics, metformin and the disaccharidase inhibitors have the best tendency to promote weight loss. There is active research on the uncoupling proteins that induce thermogenesis and promote the dissipation of calories. The beta-3 agonists act through the uncoupling proteins. The thiazolidinediones tend to promote weight gain through the PPAR gene locus. Agents that antagonize this effect could induce weight loss. The future will undoubtedly bring us drugs that are effective in causing weight loss. The advent of drugs to successfully combat obesity will substantially

  11. Facts about Type 2

    Medline Plus

    Full Text Available ... or insulin to help you meet your target blood glucose levels. Type 2 usually gets worse over time – even if ... About Type 2 Recently Diagnosed Treatment and Care Blood Glucose ... Living With Type 2 Diabetes Program donate en -- A Future Without ...

  12. Deficiency of thioredoxin binding protein-2 (TBP-2 enhances TGF-β signaling and promotes epithelial to mesenchymal transition.

    Directory of Open Access Journals (Sweden)

    So Masaki

    Full Text Available Transforming growth factor beta (TGF-β has critical roles in regulating cell growth, differentiation, apoptosis, invasion and epithelial-mesenchymal transition (EMT of various cancer cells. TGF-β-induced EMT is an important step during carcinoma progression to invasion state. Thioredoxin binding protein-2 (TBP-2, also called Txnip or VDUP1 is downregulated in various types of human cancer, and its deficiency results in the earlier onset of cancer. However, it remains unclear how TBP-2 suppresses the invasion and metastasis of cancer.In this study, we demonstrated that TBP-2 deficiency increases the transcriptional activity in response to TGF-β and also enhances TGF-β-induced Smad2 phosphorylation levels. Knockdown of TBP-2 augmented the TGF-β-responsive expression of Snail and Slug, transcriptional factors related to TGF-β-mediated induction of EMT, and promoted TGF-β-induced spindle-like morphology consistent with the depletion of E-Cadherin in A549 cells.Our results indicate that TBP-2 deficiency enhances TGF-β signaling and promotes TGF-β-induced EMT. The control of TGF-β-induced EMT is critical for the inhibition of the invasion and metastasis. Thus TBP-2, as a novel regulatory molecule of TGF-β signaling, is likely to be a prognostic indicator or a potential therapeutic target for preventing tumor progression.

  13. Facts about Type 2

    Medline Plus

    Full Text Available ... or insulin to help you meet your target blood glucose levels. Type 2 usually gets worse over time – even if ... About Type 2 Recently Diagnosed Treatment and Care Blood Glucose ... the Living With Type 2 Diabetes Program donate en -- A Future Without ...

  14. Is Type 2 Diabetes a Glycogen Storage Disease of Pancreatic β Cells?

    Science.gov (United States)

    Ashcroft, Frances M; Rohm, Maria; Clark, Anne; Brereton, Melissa F

    2017-07-05

    Elevated plasma glucose leads to pancreatic β cell dysfunction and death in type 2 diabetes. Glycogen accumulation, due to impaired metabolism, contributes to this "glucotoxicity" via dysregulated biochemical pathways promoting β cell dysfunction. Here, we review emerging data, and re-examine published findings, on the role of glycogen in β cells in normoglycemia and in diabetes. Copyright © 2017 Elsevier Inc. All rights reserved.

  15. Cyclooxygenase 2 Promotes Parathyroid Hyperplasia in ESRD

    Science.gov (United States)

    Zhang, Qian; Qiu, Junsi; Li, Haiming; Lu, Yanwen; Wang, Xiaoyun; Yang, Junwei; Wang, Shaoqing; Zhang, Liyin; Gu, Yong; Hao, Chuan-Ming

    2011-01-01

    Hyperplasia of the PTG underlies the secondary hyperparathyroidism (SHPT) observed in CKD, but the mechanism underlying this hyperplasia is incompletely understood. Because aberrant cyclooxygenase 2 (COX2) expression promotes epithelial cell proliferation, we examined the effects of COX2 on the parathyroid gland in uremia. In patients with ESRD who underwent parathyroidectomy, clusters of cells within the parathyroid glands had increased COX2 expression. Some COX2-positive cells exhibited two nuclei, consistent with proliferation. Furthermore, nearly 78% of COX2-positive cells expressed proliferating cell nuclear antigen (PCNA). In the 5/6-nephrectomy rat model, rats fed a high-phosphate diet had significantly higher serum PTH levels and larger parathyroid glands than sham-operated rats. Compared with controls, the parathyroid glands of uremic rats exhibited more PCNA-positive cells and greater COX2 expression in the chief cells. Treatment with COX2 inhibitor celecoxib significantly reduced PCNA expression, attenuated serum PTH levels, and reduced the size of the glands. In conclusion, COX2 promotes the pathogenesis of hyperparathyroidism in ESRD, suggesting that inhibiting the COX2 pathway could be a potential therapeutic target. PMID:21335517

  16. Alcohol promotions in Australian supermarket catalogues.

    Science.gov (United States)

    Johnston, Robyn; Stafford, Julia; Pierce, Hannah; Daube, Mike

    2017-07-01

    In Australia, most alcohol is sold as packaged liquor from off-premises retailers, a market increasingly dominated by supermarket chains. Competition between retailers may encourage marketing approaches, for example, discounting, that evidence indicates contribute to alcohol-related harms. This research documented the nature and variety of promotional methods used by two major supermarket retailers to promote alcohol products in their supermarket catalogues. Weekly catalogues from the two largest Australian supermarket chains were reviewed for alcohol-related content over 12 months. Alcohol promotions were assessed for promotion type, product type, number of standard drinks, purchase price and price/standard drink. Each store catalogue included, on average, 13 alcohol promotions/week, with price-based promotions most common. Forty-five percent of promotions required the purchase of multiple alcohol items. Wine was the most frequently promoted product (44%), followed by beer (24%) and spirits (18%). Most (99%) wine cask (2-5 L container) promotions required multiple (two to three) casks to be purchased. The average number of standard drinks required to be purchased to participate in catalogue promotions was 31.7 (SD = 24.9; median = 23.1). The median price per standard drink was $1.49 (range $0.19-$9.81). Cask wines had the lowest cost per standard drink across all product types. Supermarket catalogues' emphasis on low prices/high volumes of alcohol reflects that retailers are taking advantage of limited restrictions on off-premise sales and promotion, which allow them to approach market competition in ways that may increase alcohol-related harms in consumers. Regulation of alcohol marketing should address retailer catalogue promotions. [Johnston R, Stafford J, Pierce H, Daube M. Alcohol promotions in Australian supermarket catalogues. Drug Alcohol Rev 2017;36:456-463]. © 2016 Australasian Professional Society on Alcohol and other Drugs.

  17. Facts about Type 2

    Medline Plus

    Full Text Available ... En Español Type 1 Type 2 About Us Online Community Meal Planning Sign In Search: Search More ... Diagnosing Diabetes and Learning About Prediabetes Type 2 Diabetes Risk Test Lower ...

  18. Health promotion in primary and secondary schools in Denmark

    DEFF Research Database (Denmark)

    Nabe-Nielsen, Kirsten; Krølner, Rikke; Mortensen, Laust Hvas

    2015-01-01

    BACKGROUND: Schools are important arenas for interventions among children as health promoting initiatives in childhood is expected to have substantial influence on health and well-being in adulthood. In countries with compulsory school attention, all children could potentially benefit from health...... promotion at the school level regardless of socioeconomic status or other background factors. The first aim was to elucidate time trends in the number and types of school health promoting activities by describing the number and type of health promoting activities in primary and secondary schools in Denmark....... The second aim was to investigate which characteristics of schools and students that are associated with participation in many (≥3) versus few (0-2) health promoting activities during the preceding 2-3 years. METHODS: We used cross-sectional data from the 2006- and 2010-survey of the Health Behaviour...

  19. Facts about Type 2

    Medline Plus

    Full Text Available ... Do I Begin With Type2? Living With Type 1 Diabetes Enroll in the Living WIth Type 2 Diabetes Program In It Together We Can Help ... Tips for Caregivers Health Insurance Health Insurance ...

  20. Elevated circulating lipasin/betatrophin in human type 2 diabetes and obesity.

    Science.gov (United States)

    Fu, Zhiyao; Berhane, Feven; Fite, Alemu; Seyoum, Berhane; Abou-Samra, Abdul B; Zhang, Ren

    2014-05-23

    Lipasin (also known as C19ORF80, RIFL, ANGPTL8 and betatrophin) is a newly discovered circulating factor that regulates lipid metabolism and promotes pancreatic β-cell proliferation. Whether circulating levels of lipasin in humans are altered in a) type 2 diabetes; b) obesity and c) the postprandial state, however, is unknown. The current study aimed to compare serum lipasin levels in those who were a) non-diabetic (N=15) or diabetic (BMI- and age-matched; N=14); b) lean or obese (N=53 totally) and c) fasting and 2 hours following a defined meal (N=12). Serum lipasin levels were determined by the enzyme-linked immunosorbent assay. Lipasin levels [mean±SEM] were increased by more than two fold (Plipasin levels were positively correlated with BMI (rho=0.49, Plipasin/betatrophin is nutritionally-regulated hepatokine that is increased in human type 2 diabetes and obesity.

  1. Identification of functional DNA variants in the constitutive promoter region of MDM2

    Directory of Open Access Journals (Sweden)

    Lalonde Marie-Eve

    2012-09-01

    Full Text Available Abstract Although mutations in the oncoprotein murine double minute 2 (MDM2 are rare, MDM2 gene overexpression has been observed in several human tumors. Given that even modest changes in MDM2 levels might influence the p53 tumor suppressor signaling pathway, we postulated that sequence variation in the promoter region of MDM2 could lead to disregulated expression and variation in gene dosage. Two promoters have been reported for MDM2; an internal promoter (P2, which is located near the end of intron 1 and is p53-responsive, and an upstream constitutive promoter (P1, which is p53-independent. Both promoter regions contain DNA variants that could influence the expression levels of MDM2, including the well-studied single nucleotide polymorphism (SNP SNP309, which is located in the promoter P2; i.e., upstream of exon 2. In this report, we screened the promoter P1 for DNA variants and assessed the functional impact of the corresponding SNPs. Using the dbSNP database and genotyping validation in individuals of European descent, we identified three common SNPs (−1494 G > A; indel 40 bp; and −182 C > G. Three major promoter haplotypes were inferred by using these three promoter SNPs together with rs2279744 (SNP309. Following subcloning into a gene reporter system, we found that two of the haplotypes significantly influenced MDM2 promoter activity in a haplotype-specific manner. Site-directed mutagenesis experiments indicated that the 40 bp insertion/deletion variation is causing the observed allelic promoter activity. This study suggests that part of the variability in the MDM2 expression levels could be explained by allelic p53-independent P1 promoter activity.

  2. Facts about Type 2

    Medline Plus

    Full Text Available ... Day Diabetes Basics Home Symptoms Diagnosis America's Diabetes Challenge Type 1 Type 2 Facts About Type 2 ... Planner, and tips from experts Let's Be Well: Products to help you thrive with diabetes - lets-be- ...

  3. Pediatric obesity & type 2 diabetes.

    Science.gov (United States)

    Dea, Tara L

    2011-01-01

    This article focuses on (a) identifying obesity and other risk factors for developing type 2 diabetes, (b) differentiating between pediatric type 1 diabetes and type 2 diabetes, and (c) treating pediatric type 2 diabetes. Obesity has significant implications on a child's health, including an increased risk for insulin resistance and progression to type 2 diabetes. Type 2 diabetes in children, characterized by insulin resistance and relative pancreatic b-cell failure due to the increased demand for insulin production, has now reached epidemic proportions. Longitudinal research on pediatric type 2 diabetes, however, is lacking because this epidemic is relatively new. Treatment of type 2 diabetes in children is focused on lifestyle modification with weight management/increased physical activity, and pharmacological management through oral medication or insulin therapy. Because children with type 2 diabetes are at risk for developing diabetes-related complications earlier in life, they need to be closely monitored for comorbidities.

  4. Resveratrol as Add-on Therapy in Subjects With Well-Controlled Type 2 Diabetes: A Randomized Controlled Trial.

    NARCIS (Netherlands)

    Timmers, S.; Ligt, M. de; Phielix, E.; Weijer, T. van de; Hansen, J.; Moonen-Kornips, E.; Schaart, G.; Kunz, I.; Hesselink, M.K.; Schrauwen-Hinderling, V.B.; Schrauwen, P.

    2016-01-01

    OBJECTIVE: To determine whether resveratrol supplementation can improve insulin sensitivity and promote overall metabolic health on top of standard diabetes care. RESEARCH DESIGN AND METHODS: Seventeen subjects with well-controlled type 2 diabetes (T2D) were treated with placebo and 150 mg/day

  5. Characterization of the promoter of human CRTh2, a prostaglandin D{sub 2} receptor

    Energy Technology Data Exchange (ETDEWEB)

    Quapp, Russell; Madsen, Norman [Department of Medicine, Division of Pulmonary Medicine, Pulmonary Research Group, 574B Heritage Medical Research Centre, University of Alberta, Edmonton, AB, T6G 2S2 (Canada); Cameron, Lisa [Department of Medicine, Division of Pulmonary Medicine, Pulmonary Research Group, 574B Heritage Medical Research Centre, University of Alberta, Edmonton, AB, T6G 2S2 (Canada)

    2007-11-30

    Chemoattractant-receptor homologous molecule expressed on Th2 cells (CRTh2) is a receptor for prostaglandin (PG)D{sub 2}, a lipid mediator involved in allergic inflammation. CRTh2 is expressed by Th2 cells, eosinophils and basophils and PDG{sub 2}-CRTh2 signaling induces calcium mobilization, cell migration and expression of the Th2 cytokines IL-4, IL-5, and IL-13. Despite the role of CRTh2 in allergic inflammation, transcriptional regulation of this gene has not been studied. Here, we demonstrated that a reporter construct of the CRTh2 promoter was induced following T cell stimulation. This activity could be further enhanced by over-expression of GATA-3, but not NFAT2 or STAT6. Electromobility shift assay demonstrated GATA-3 binding to a probe from the CRTh2 promoter. This study provides the first detailed analysis of transcriptional regulation of the human CRTh2 promoter. These findings may help identify strategies to attenuate expression of this gene and influence the maintenance and proliferation of Th2 cells in allergic inflammation.

  6. Effectiveness and Safety of High-Intensity Interval Training in Patients With Type 2 Diabetes

    Science.gov (United States)

    Francois, Monique E.

    2015-01-01

    IN BRIEF Recent research has shown that high-intensity interval training (HIIT) can promote improvements in glucose control and cardiovascular health in individuals with type 2 diabetes. This article summarizes the evidence and highlights the ways in which HIIT might be safely implemented as an adjunct to more traditional exercise approaches. PMID:25717277

  7. H2A/K pseudogene mutation may promote cell proliferation

    Energy Technology Data Exchange (ETDEWEB)

    Guo, Jisheng; Jing, Ruirui; Lv, Xin; Wang, Xiaoyue; Li, Junqiang; Li, Lin; Li, Cuiling; Wang, Daoguang; Bi, Baibing; Chen, Xinjun [Cancer Research Center, Shandong University School of Medicine, Jinan 250012 (China); Yang, Jing-Hua, E-mail: sdu_crc_group1@126.com [Cancer Research Center, Shandong University School of Medicine, Jinan 250012 (China); Department of Surgery, VA Boston Healthcare System, Boston University School of Medicine, Boston 510660, MA (United States)

    2016-05-15

    Highlights: • The mutant H2A/K pseudogene is active. • The mutant H2A/K pseudogene can promote cell proliferation. - Abstract: Little attention has been paid to the histone H2A/K pseudogene. Results from our laboratory showed that 7 of 10 kidney cancer patients carried a mutant H2A/K pseudogene; therefore, we were interested in determining the relationship between mutant H2A/K and cell proliferation. We used shotgun and label-free proteomics methods to study whether mutant H2A/K lncRNAs affected cell proliferation. Quantitative proteomic analysis indicated that the expression of mutant H2A/K lncRNAs resulted in the upregulation of many oncogenes, which promoted cell proliferation. Further interaction analyses revealed that a proliferating cell nuclear antigen (PCNA)-protein interaction network, with PCNA in the center, contributes to cell proliferation in cells expressing the mutant H2A/K lncRNAs. Western blotting confirmed the critical upregulation of PCNA by mutant H2A/K lncRNA expression. Finally, the promotion of cell proliferation by mutant H2A/K lncRNAs (C290T, C228A and A45G) was confirmed using cell proliferation assays. Although we did not determine the exact mechanism by which the oncogenes were upregulated by the mutant H2A/K lncRNAs, we confirmed that the mutant H2A/K lncRNAs promoted cell proliferation by upregulating PCNA and other oncogenes. The hypothesis that cell proliferation is promoted by the mutant H2A/K lncRNAs was supported by the protein expression and cell proliferation assay results. Therefore, mutant H2A/K lncRNAs may be a new factor in renal carcinogenesis.

  8. Facts about Type 2

    Medline Plus

    Full Text Available ... from Diabetes Forecast® magazine: lp-type-2, . In this section Diabetes Basics Type 2 Facts About Type ... ensureArray(data.submitSurveyResponse.errors); $.each(surveyErrors, function () { if (this.errorField) { $('input[name="' + this.errorField + '"]').closest('.form-group') . ...

  9. Association of TNF promoter polymorphisms with type 1 diabetes in the South Croatian population

    Directory of Open Access Journals (Sweden)

    VESNA BORASKA

    2008-01-01

    Full Text Available Type 1 diabetes mellitus (TIDM is an autoimmune disease characterized by the destruction of pancreatic p cells. Tumor necrosis factor (TNF is a pleotropic cytokine with potent immunomodulatory and inflammatory activity. Association studies of TNF polymorphisms and type 1 diabetes (TIDM frequently demonstrated TNF involvement with TIDM. Although TNF may play an important role in the pathogenesis of TIDM, the genetic association of TNF región with the disease has not been conclusive because of the strong linkage disequilibrium with HLA genes. In this study, we examined two TNF promoter variants (rs 1800629 at position -308, and rs361525 at position -238 for TIDM association in 233 patients and 144 controls from the population of South Croatia. A higher frequency of TNF -308 A alíele and also, a more frequent specific -308A -238G haplotype in TIDM patients were observed with a limited significance. However, we did not find strong evidence of association of TNF promoter polymorphisms with TIDM. In order to elucidate the trae contribution of TNF to TIDM susceptibility in our population, more comprehensive studies with HLA adjustment in a larger sample are required.

  10. Characterization and sequence analysis of the F2 promoter from corynephage BFK20

    International Nuclear Information System (INIS)

    Koptides, M.; Ugorcakova, J.; Baloghova, E.; Bukovska, G.; Timko, J.

    1994-01-01

    F2 promoter from corynephage BFK20 was isolated and characterized. It was functional in Escherichia coli and Corynebacterium glutamicum. Cloning of the F2 promoter into the pJUP05 promoter probe vector caused an increase of the neomycin phosphotransferase II specific activity. According to the Northern blot hybridization the nptII gene was expressed from the cloned F2 promoter. The apparent transcription start point in E. coli and C. glutamicum was determined. The-35 region of F2 promoter showed high similarity to that of E. coli promoter consensus sequence, but its - 10 region was G+C rich and had no significant homology to that. (author)

  11. CISH promoter polymorphism effects on T cell cytokine receptor signaling and type 1 diabetes susceptibility.

    Science.gov (United States)

    Seyfarth, Julia; Ahlert, Heinz; Rosenbauer, Joachim; Baechle, Christina; Roden, Michael; Holl, Reinhard W; Mayatepek, Ertan; Meissner, Thomas; Jacobsen, Marc

    2018-02-06

    Impaired regulatory T cell immunity plays a central role in the development of type 1 diabetes (T1D). Interleukin-2 receptor (IL-2R) signaling is essential for regulatory T cells (T REG ), and cytokine-inducible SH2-containing protein (CIS) regulates IL-2R signaling as a feedback inhibitor. Previous studies identified association of CISH promoter region single nucleotide polymorphisms (SNPs) with susceptibility to infectious diseases. Here we analyzed allele frequencies of three CISH SNPs (i.e., rs809451, rs414171, rs2239751) in a study of T1D patients (n = 260, onset age  10 years). Minor allele frequencies were compared to a control cohort of the 1000 Genomes Project. Assigned haplotypes were determined for effects on T1D manifestation and severity. Finally, the CISH haplotype influence on cytokine signaling and function was explored in T cells from healthy donors. We detected similar minor allele frequencies between T1D patients and the control cohort. T1D onset age, residual serum C-peptide level, and insulin requirement were comparable between different haplotypes. Only minor differences between the haplotypes were found for in vitro cytokine (i.e., IL-2, IL-7)-induced CIS mRNA expression. STAT5 phosphorylation was induced by IL-2 or IL-7, but no differences were found between the haplotypes. T REG purified from healthy donors with the two most common haplotypes showed similar capacity to inhibit heterologous effector T cells. This study provides no evidence for an association of CISH promoter SNPs with susceptibility to T1D or severity of disease. In contrast to previous studies, no influence of different haplotypes on CIS mRNA expression or T cell-mediated functions was found.

  12. Genetic polymorphisms of angiotensin-2 type 1 receptor and angiotensinogen and risk of renal dysfunction and coronary heart disease in type 2 diabetes mellitus

    Directory of Open Access Journals (Sweden)

    Hu Frank B

    2009-03-01

    Full Text Available Abstract Background Increased activation of the renin-angiotensin system (RAS may be important in promoting coronary heart disease (CHD and renal dysfunction, but limited data are available on associations between angiotensin type 1 receptor (AGT1R and angiotensinogen (AGT genotypes in type 2 diabetes. Methods Study participants were diabetics from the Health Professionals Follow-Up Study (HPFS and the Nurses' Health Study (NHS. We analyzed single nucleotide polymorphisms (SNPs associated with cardiovascular pathophysiology (including AGT1R T573C, AGT1R A1166C, and AGT M235T and presence of renal dysfunction (eGFR2 or history of CHD. Results The AGT1R 1166 C-allele was associated with eGFR2 (multivariable OR 1.63 [1.01, 2.65] in the HPFS men (n = 733 and in the combined dataset (n = 1566 (OR 1.42 [1.02, 1.98]. The AGT1R 1166 C-allele was also associated with CHD in men (OR 1.57 [1.10, 2.24]. In NHS women (n = 833, AGT 235T-allele was associated with CHD (OR 1.72 [1.20, 2.47]. Removal of hypertension from the fully adjusted models did not influence results, suggesting that the associations may not be mediated by hypertension. There were significant interactions between sex and AGT1R 1166 C-allele (p = 0.008 and AGT M235T (p = 0.03 in models for CHD. No significant associations were seen between AGT1R T573 C-allele and renal dysfunction or CHD. Conclusion Polymorphisms in AGT1R and AGT genes are associated with renal dysfunction and CHD in type 2 diabetes and further support the important role of the RAS in these complications. Sex may modify associations between AGT1R 1166 C-allele and AGT 235T and CHD in type 2 diabetes.

  13. Cross-talk between amyloidogenic proteins in type-2 diabetes and Parkinson’s disease

    OpenAIRE

    Horvath, Istvan; Wittung-Stafshede, Pernilla

    2016-01-01

    Protein assembly into ordered so-called amyloid fibers is a process that promotes several neurodegenerative disorders, such as Alzheimer’s and Parkinson’s disease (PD). Also type-2 diabetes (T2D) is a disease involving amyloid formation, although it occurs in the pancreas. Since the protein that forms amyloids in PD, α-synuclein (aS), is also expressed in the pancreas, we investigated whether it could affect aggregation of the peptide involved in T2D, and vice versa. Using in vitro methods an...

  14. Management of obesity, insulin resistance and type 2 diabetes in children: consensus and controversy

    Directory of Open Access Journals (Sweden)

    Amy Fleischman

    2009-11-01

    Full Text Available Amy Fleischman, Erinn T RhodesDivision of Endocrinology, Children’s Hospital Boston, Boston, MA, United StatesAbstract: Childhood obesity has become a national and international epidemic. The prevalence and incidence of type 2 diabetes in youth have been increasing, and type 2 diabetes is one of the most challenging complications of obesity in childhood. Comprehensive lifestyle interventions that include attention to dietary change, increased physical activity and behavior change appear to be required for the successful treatment of pediatric obesity. In particular, aspects of behavioral interventions that have been identified as contributing to effectiveness have included intensity, parent/family participation, addressing healthy dietary change, promoting physical activity, and involving behavioral management principles such as goal setting. A multidisciplinary team approach is required for successful management of type 2 diabetes in youth as well. As with many therapies in pediatrics, clinical trials and support for treatments of obesity and type 2 diabetes in youth lag behind adult data. Pediatric recommendations may be extrapolated from adult data and are often based on consensus guidelines. Type 2 diabetes in children is most commonly managed with lifestyle modification and medications, metformin and/or insulin, the only medications currently approved for use in children. However, many opportunities exist for ongoing research to clarify optimal management for obesity and type 2 diabetes in youth.Keywords: children, obesity, type 2 diabetes, metformin, insulin, bariatric surgery

  15. Facts about Type 2

    Medline Plus

    Full Text Available ... 2 Type 2 diabetes is the most common form of diabetes. In type 2 diabetes, your body ... Sign Up Thank you for signing up ' + ' '); $('.survey-form').show(); }, success: function (data) { $('#survey-errors').remove(); $('.survey- ...

  16. Study protocol for “MOVEdiabetes”: a trial to promote physical activity for adults with type 2 diabetes in primary health care in Oman

    Directory of Open Access Journals (Sweden)

    Thamra S. Alghafri

    2017-01-01

    Full Text Available Abstract Background Benefits of physical activity in the management of diabetes are well documented. However, evidence on the effectiveness of interventions integrating physical activity in diabetes care is sparse especially in the countries of the Gulf Cooperation Council. The results from this study will increase our understanding of the use of multi-component interventions aimed at increasing physical activity levels in inactive adults with type 2 diabetes in primary health care in Oman. Methods/design The study is a one year 1:1 cluster randomized controlled trial of the MOVEdiabetes programme (intervention versus usual care in eight primary health care centres in Oman. The MOVEdiabetes programme utilizes face to face physical activity consultations promoting 150 min of moderate to vigorous physical activity per week (≥600MET-mins/week, pedometers to self-monitor step counts and monthly telephone WhatsApp messages for follow up support. Inactive adults with type 2 diabetes and no contraindication to physical activity will be recruited over a two months period, and followed up for 12 months. To demonstrate a 50% between group difference in physical activity levels (MET-mins/week over 12 months, (at a power of 80%, and significance level of 5%, 128 participants would be required to complete the study (64 in each arm. Based on a drop-out rate of 20%, 154 participants would require to be recruited (77 in each arm. Assuming a recruitment rate of 70%, 220 potential eligible participants would need to be approached. The primary outcome is change in levels of physical activity measured by the Global Physical Activity Questionnaire. In addition, accelerometers will be used in a sub group to objectively assess physical activity. Secondary outcomes include changes in metabolic and cardiovascular biomarkers, change in self-reported health, social support, self-efficacy for physical activity, and perceived acceptability of the program. All

  17. Marketing messages in food and alcohol magazine advertisements, variations across type and nutritional content of promoted products: a content analysis.

    Science.gov (United States)

    Pitts, A; Burke, W; Adams, J

    2014-09-01

    'Marketing messages' are the themes used in advertisements to promote products. We explored the frequency of different marketing messages used in food and alcohol advertisements in UK women's magazines and associations with the type and nutritional content of products promoted. All advertisements for food and alcohol in 108 issues of popular UK monthly women's magazines were identified and text-based marketing messages classified using a bespoke coding framework. This information was linked to existing data on the type (i.e. food group) and nutritional content of advertised products. A total of 2 687 marketing messages were identified in 726 advertisements. Consumer messages such as 'taste' and 'quality' were most frequently found. Marketing messages used in advertisements for food and alcohol were notably different. The relationship between type and nutritional content of products advertised and marketing messages used was not intuitive from a consumer perspective: advertisements for foods 'high in fat and/or sugar' were less likely to use messages related to health, but more likely to use messages emphasizing reduced amounts of specific nutrients. Almost all advertisements included consumer-related marketing messages. Marketing messages used were not always congruent with the type or nutritional content of advertised products. These findings should be considered when developing policy. © The Author 2013. Published by Oxford University Press on behalf of Faculty of Public Health. All rights reserved. For permissions, please e-mail: journals.permissions@oup.com.

  18. Anti-Diabetic Effects of CTB-APSL Fusion Protein in Type 2 Diabetic Mice

    Directory of Open Access Journals (Sweden)

    Yunlong Liu

    2014-03-01

    Full Text Available To determine whether cholera toxin B subunit and active peptide from shark liver (CTB-APSL fusion protein plays a role in treatment of type 2 diabetic mice, the CTB-APSL gene was cloned and expressed in silkworm (Bombyx mori baculovirus expression vector system (BEVS, then the fusion protein was orally administrated at a dose of 100 mg/kg for five weeks in diabetic mice. The results demonstrated that the oral administration of CTB-APSL fusion protein can effectively reduce the levels of both fasting blood glucose (FBG and glycosylated hemoglobin (GHb, promote insulin secretion and improve insulin resistance, significantly improve lipid metabolism, reduce triglycerides (TG, total cholesterol (TC and low density lipoprotein (LDL levels and increase high density lipoprotein (HDL levels, as well as effectively improve the inflammatory response of type 2 diabetic mice through the reduction of the levels of inflammatory cytokines tumor necrosis factor-α (TNF-α and interleukin-6 (IL-6. Histopathology shows that the fusion protein can significantly repair damaged pancreatic tissue in type 2 diabetic mice, significantly improve hepatic steatosis and hepatic cell cloudy swelling, reduce the content of lipid droplets in type 2 diabetic mice, effectively inhibit renal interstitial inflammatory cells invasion and improve renal tubular epithelial cell nucleus pyknosis, thus providing an experimental basis for the development of a new type of oral therapy for type 2 diabetes.

  19. Disparities in the use of a mHealth medication adherence promotion intervention for low-income adults with type 2 diabetes.

    Science.gov (United States)

    Nelson, Lyndsay A; Mulvaney, Shelagh A; Gebretsadik, Tebeb; Ho, Yun-Xian; Johnson, Kevin B; Osborn, Chandra Y

    2016-01-01

    Mobile health (mHealth) interventions may improve diabetes outcomes, but require engagement. Little is known about what factors impede engagement, so the authors examined the relationship between patient factors and engagement in an mHealth medication adherence promotion intervention for low-income adults with type 2 diabetes (T2DM). Eighty patients with T2DM participated in a 3-month mHealth intervention called MEssaging for Diabetes that leveraged a mobile communications platform. Participants received daily text messages addressing and assessing medication adherence, and weekly interactive automated calls with adherence feedback and questions for problem solving. Longitudinal repeated measures analyses assessed the relationship between participants' baseline characteristics and the probability of engaging with texts and calls. On average, participants responded to 84.0% of texts and participated in 57.1% of calls. Compared to Whites, non-Whites had a 63% decreased relative odds (adjusted odds ratio [AOR] = 0.37, 95% confidence interval [CI], 0.19-0.73) of participating in calls. In addition, lower health literacy was associated with a decreased odds of participating in calls (AOR = 0.67, 95% CI, 0.46-0.99, P = .04), whereas older age (Pnonlinear = .01) and more depressive symptoms (AOR = 0.62, 95% CI, 0.38-1.02, P = .059) trended toward a decreased odds of responding to texts. Racial/ethnic minorities, older adults, and persons with lower health literacy or more depressive symptoms appeared to be the least engaged in a mHealth intervention. To facilitate equitable intervention impact, future research should identify and address factors interfering with mHealth engagement. © The Author 2015. Published by Oxford University Press on behalf of the American Medical Informatics Association. All rights reserved. For Permissions, please email: journals.permissions@oup.com.

  20. LRRK2 mediated Rab8a phosphorylation promotes lipid storage.

    Science.gov (United States)

    Yu, Miao; Arshad, Muhammad; Wang, Wenmin; Zhao, Dongyu; Xu, Li; Zhou, Linkang

    2018-02-27

    Several mutations in leucine rich repeat kinase 2 (LRRK2) gene have been associated with pathogenesis of Parkinson's disease (PD), a neurodegenerative disorder marked by resting tremors, and rigidity, leading to Postural instability. It has been revealed that mutations that lead to an increase of kinase activity of LRRK2 protein are significantly associated with PD pathogenesis. Recent studies have shown that some Rab GTPases, especially Rab8, serve as substrates of LRRK2 and undergo phosphorylation in its switch II domain upon interaction. Current study was performed in order to find out the effects of the phosphorylation of Rab8 and its mutants on lipid metabolism and lipid droplets growth. The phosphorylation status of Rab8a was checked by phos-tag gel. Point mutant construct were generated to investigate the function of Rab8a. 3T3L1 cells were transfected with indicated plasmids and the lipid droplets were stained with Bodipy. Fluorescent microscopy experiments were performed to examine the sizes of lipid droplets. The interactions between Rab8a and Optineurin were determined by immunoprecipitation and western blot. Our assays demonstrated that Rab8a was phosphorylated by mutated LRRK2 that exhibits high kinase activity. Phosphorylation of Rab8a on amino acid residue T72 promoted the formation of large lipid droplets. T72D mutant of Rab8a had higher activity to promote the formation of large lipid droplets compared with wild type Rab8a, with increase in average diameter of lipid droplets from 2.10 μm to 2.46 μm. Moreover, phosphorylation of Rab8a weakened the interaction with its effector Optineurin. Y1699C mutated LRRK2 was able to phosphorylate Rab8a and phosphorylation of Rab8a on site 72 plays important role in the fusion and enlargement of lipid droplets. Taken together, our study suggests an indirect relationship between enhanced lipid storage capacity and PD pathogenesis.

  1. Replication of type 5 adenovirus promotes middle ear infection by Streptococcus pneumoniae in the chinchilla model of otitis media

    Science.gov (United States)

    Murrah, Kyle A.; Turner, Roberta L.; Pang, Bing; Perez, Antonia C.; Reimche, Jennifer L.; King, Lauren B.; Wren, John; Gandhi, Uma; Swords, W. Edward; Ornelles, David A.

    2015-01-01

    Adenoviral infection is a major risk factor for otitis media. We hypothesized that adenovirus promotes bacterial ascension into the middle ear through the disruption of normal function in the Eustachian tubes due to inflammation-induced changes. An intranasal infection model of the chinchilla was used to test the ability of type 5 adenovirus to promote middle ear infection by Streptococcus pneumoniae. The hyperinflammatory adenovirus mutant dl327 and the nonreplicating adenovirus mutant H5wt300ΔpTP were used to test the role of inflammation and viral replication, respectively, in promotion of pneumococcal middle ear infection. Precedent infection with adenovirus resulted in a significantly greater incidence of middle ear disease by S. pneumoniae as compared to nonadenovirus infected animals. Infection with the adenovirus mutant dl327 induced a comparable degree of bacterial ascension into the middle ear as did infection with the wild-type virus. By contrast, infection with the nonreplicating adenovirus mutant H5wt300ΔpTP resulted in less extensive middle ear infection compared to the wild-type adenovirus. We conclude that viral replication is necessary for adenoviral-induced pneumococcal middle ear disease. PMID:25251686

  2. Implementation of interval walking training in patients with type 2 diabetes in Denmark

    DEFF Research Database (Denmark)

    Ried-Larsen, Mathias; Thomsen, Reimar W; Berencsi, Klara

    2016-01-01

    Promoting physical activity is a first-line choice of treatment for patients with type 2 diabetes (T2D). However, there is a need for more effective tools and technologies to facilitate structured lifestyle interventions and to ensure a better compliance, sustainability, and health benefits...... of exercise training in patients with T2D. The InterWalk initiative and its innovative application (app) for smartphones described in this study were developed by the Danish Centre for Strategic Research in T2D aiming at implementing, testing, and validating interval walking in patients with T2D in Denmark...

  3. Statin-activated nuclear receptor PXR promotes SGK2 dephosphorylation by scaffolding PP2C to induce hepatic gluconeogenesis.

    Science.gov (United States)

    Gotoh, Saki; Negishi, Masahiko

    2015-09-22

    Statin therapy is known to increase blood glucose levels in humans. Statins utilize pregnane X receptor (PXR) and serum/glucocorticoid regulated kinase 2 (SGK2) to activate phosphoenolpyruvate carboxykinase 1 (PEPCK1) and glucose-6-phosphatase (G6Pase) genes, thereby increasing glucose production in human liver cells. Here, the novel statin/PXR/SGK2-mediated signaling pathway has now been characterized for hepatic gluconeogenesis. Statin-activated PXR scaffolds the protein phosphatase 2C (PP2C) and SGK2 to stimulate PP2C to dephosphorylate SGK2 at threonine 193. Non-phosphorylated SGK2 co-activates PXR-mediated trans-activation of promoters of gluconeogenic genes in human liver cells, thereby enhancing gluconeogenesis. This gluconeogenic statin-PXR-SGK2 signal is not present in mice, in which statin treatment suppresses hepatic gluconeogenesis. These findings provide the basis for statin-associated side effects such as an increased risk for Type 2 diabetes.

  4. Facts about Type 2

    Medline Plus

    Full Text Available ... 2383) Give by Mail Close www.diabetes.org > Diabetes Basics > Type 2 Share: Print Page Text Size: A A A ... 2 diabetes is the most common form of diabetes. In type 2 diabetes, your body does not use insulin properly. ...

  5. CXC-type chemokines promote myofibroblast phenoconversion and prostatic fibrosis.

    Directory of Open Access Journals (Sweden)

    Mehrnaz Gharaee-Kermani

    Full Text Available Recent studies from our group suggest that extracellular matrix (ECM deposition and fibrosis characterize the peri-urethral prostate tissues of some men suffering from Lower Urinary Tract Symptoms (LUTS and that fibrosis may be a contributing factor to the etiology of LUTS. Fibrosis can generally be regarded as an errant wound-healing process in response to chronic inflammation, and several studies have shown that the aging prostate tissue microenvironment is rich with inflammatory cells and proteins. However, it is unclear whether these same inflammatory proteins, particularly CXC-type chemokines, can mediate myofibroblast phenoconversion and the ECM deposition necessary for the development of prostatic tissue fibrosis. To examine this, immortalized and primary prostate stromal fibroblasts treated with TGF-β1, CXCL5, CXCL8, or CXCL12 were evaluated morphologically by microscopy, by immunofluorescence and qRT-PCR for αSMA, collagen 1, vimentin, calponin, and tenascin protein and transcript expression, and by gel contraction assays for functional myofibroblast phenoconversion. The results of these studies showed that that immortalized and primary prostate stromal fibroblasts are induced to express collagen 1 and 3 and αSMA gene transcripts and proteins and to undergo complete and functional myofibroblast phenoconversion in response to CXC-type chemokines, even in the absence of exogenous TGF-β1. Moreover, CXCL12-mediated myofibroblast phenoconversion can be completely abrogated by inhibition of the CXCL12 receptor, CXCR4. These findings suggest that CXC-type chemokines, which comprise inflammatory proteins known to be highly expressed in the aging prostate, can efficiently and completely mediate myofibroblast phenoconversion and may thereby promote fibrotic changes in prostate tissue architecture associated with the development and progression of male lower urinary tract dysfunction.

  6. CO2 methanation on the catalyst of Ni/MCM-41 promoted with CeO2.

    Science.gov (United States)

    Wang, Xiaoliu; Zhu, Lingjun; Liu, Yincong; Wang, Shurong

    2018-06-01

    CO 2 as a raw feed combined with renewable hydrogen for the production of useful chemicals and alternative energy products is one of the solutions to environmental and energy problems. In this study, a series of Ni-xCeO 2 /MCM-41 catalysts with a nickel content of 20wt% were prepared through deposition precipitation method for CO 2 methanation. Different characterization methods, including BET, XRD, TEM, SEM, H 2 -TPR and H 2 -TPD were applied to help explore the influence mechanism of CeO 2 on Ni/MCM-41 in CO 2 methanation. It was found that all CeO 2 -promoted catalysts exhibited enhanced catalytic activity when compared to Ni/MCM-41. The catalyst modified with 20wt% CeO 2 showed the best catalytic performance, with CO 2 conversion and CH 4 selectivity of 85.6% and 99.8%, respectively, at the temperature of 380°C under atmospheric pressure. The synergetic effects among Ni 0 active sites, the promoter and the support, including nickel dispersion improvement and increased CO 2 adsorption sites due to the addition of CeO 2 , were considered as important factors for high reactivity of the promoted catalysts. The stability test showed that the promoted catalyst maintained its high reactivity after 30h. Copyright © 2017 Elsevier B.V. All rights reserved.

  7. Promoter2.0: for the recognition of PolII promoter sequences

    DEFF Research Database (Denmark)

    Knudsen, Steen; Knudsen, Steen

    1999-01-01

    Motivation : A new approach to the prediction of eukaryotic PolII promoters from DNA sequence takesadvantage of a combination of elements similar to neural networks and genetic algorithms to recognize a set ofdiscrete subpatterns with variable separation as one pattern: a promoter. The neural...... of optimization, the algorithm was able todiscriminate between vertebrate promoter and non-promoter sequences in a test set with a correlationcoefficient of 0.63. In addition, all five known transcription start sites on the plus strand of the completeadenovirus genome were within 161 bp of 35 predicted...

  8. Indian Hedgehog Signaling Regulates Transcription and Expression of Collagen Type X via Runx2/Smads Interactions*

    Science.gov (United States)

    Amano, Katsuhiko; Densmore, Michael; Nishimura, Riko; Lanske, Beate

    2014-01-01

    Indian hedgehog (Ihh) is essential for chondrocyte differentiation and endochondral ossification and acts with parathyroid hormone-related peptide in a negative feedback loop to regulate early chondrocyte differentiation and entry to hypertrophic differentiation. Independent of this function, we and others recently reported independent Ihh functions to promote chondrocyte hypertrophy and matrix mineralization in vivo and in vitro. However, the molecular mechanisms for these actions and their functional significance are still unknown. We recently discovered that Ihh overexpression in chondrocytes stimulated the expression of late chondrocyte differentiation markers and induced matrix mineralization. Focusing on collagen type X (Col10α1) expression and transcription, we observed that hedgehog downstream transcription factors GLI-Krüppel family members (Gli) 1/2 increased COL10A1 promoter activity and identified a novel Gli1/2 response element in the 250-bp basic promoter. In addition, we found that Ihh induced Runx2 expression in chondrocytes without up-regulating other modulators of chondrocyte maturation such as Mef2c, Foxa2, and Foxa3. Runx2 promoted Col10α1 expression in cooperation with Ihh. Further analyses using promoter assays, immunofluorescence, and binding assays showed the interaction of Gli1/2 in a complex with Runx2/Smads induces chondrocyte differentiation. Finally, we could demonstrate that Ihh promotes in vitro matrix mineralization using similar molecular mechanisms. Our data provide an in vitro mechanism for Ihh signaling to positively regulate Col10α1 transcription. Thus, Ihh signaling could be an important player for not only early chondrocyte differentiation but maturation and calcification of chondrocytes. PMID:25028519

  9. TiO2 promoted by two different non-noble metal cocatalysts for enhanced photocatalytic H2 evolution

    International Nuclear Information System (INIS)

    Lin, Jing-Dong; Yan, Shi; Huang, Qin-Dong; Fan, Mei-Ting; Yuan, You-Zhu; Tan, Timothy Thatt-Yang; Liao, Dai-Wei

    2014-01-01

    TiO 2 photocatalysts modified by cobalt and nickel cocatalysts were prepared via polymerized complex method (PCM) and evaluated by photocatalytic hydrogen evolution. Hydrogen generation in 6 h for the TiO 2 promoted by cobalt and nickel (0.1%Co + 0.2%Ni/TiO 2 ) is about two times (2456 μmol H 2 ) compared to that of TiO 2 promoted only by cobalt (1180 μmol H 2 for 0.1%Co/TiO 2 ) or nickel (1127 μmol H 2 for 0.2%Ni/TiO 2 ), and mechanically mixed TiO 2 promoted by cobalt and TiO 2 promoted by nickel (0.1%Co/TiO 2 :0.2%Ni/TiO 2 = 1:1 (m/m), 1282 μmol H 2 ). The high photocatalytic H 2 evolution activity over TiO 2 promoted by cobalt and nickel is ascribed to enhanced photo response due to the presence of cobalt and nickel impurity level, and effective separation of photogenerated electrons and holes due to the synergistic effect of cobalt and nickel, which serve as active sites for H 2 evolution reaction (HER) and oxidation reaction (OR) respectively. This study demonstrates a viable strategy to design more active photocatalysts for photocatalytic H 2 evolution by substituting noble metals with more abundant elements using as HER and OR cocatalysts, respectively.

  10. Elevated circulating lipasin/betatrophin in human type 2 diabetes and obesity

    OpenAIRE

    Zhiyao Fu; Feven Berhane; Alemu Fite; Berhane Seyoum; Abdul B. Abou-Samra; Ren Zhang

    2014-01-01

    Lipasin (also known as C19ORF80, RIFL, ANGPTL8 and betatrophin) is a newly discovered circulating factor that regulates lipid metabolism and promotes pancreatic ?-cell proliferation. Whether circulating levels of lipasin in humans are altered in a) type 2 diabetes; b) obesity and c) the postprandial state, however, is unknown. The current study aimed to compare serum lipasin levels in those who were a) non-diabetic (N = 15) or diabetic (BMI- and age-matched; N = 14); b) lean or obese (N = 53 ...

  11. Graft rejection as a Th1-type process amenable to regulation by donor Th2-type cells through an interleukin-4/STAT6 pathway.

    Science.gov (United States)

    Mariotti, Jacopo; Foley, Jason; Ryan, Kaitlyn; Buxhoeveden, Nicole; Kapoor, Veena; Amarnath, Shoba; Fowler, Daniel H

    2008-12-01

    Graft rejection has been defined as the mirror image of graft-versus-host disease, which is biologically characterized primarily as a Th1-type process. As such, we reasoned that graft rejection would represent a Th1 response amenable to Th2 modulation. Indeed, adoptive transfer of host Th1-type cells mediated rejection of fully MHC-disparate murine bone marrow allografts more effectively than host Th2-type cells. Furthermore, STAT1-deficient host T cells did not differentiate into Th1-type cells in vivo and failed to mediate rejection. We next hypothesized that donor Th2 cell allograft augmentation would prevent rejection by modulation of the host Th1/Th2 balance. In the setting of donor Th2 cell therapy, host-anti-donor allospecific T cells acquired Th2 polarity, persisted posttransplantation, and did not mediate rejection. Abrogation of rejection required donor Th2 cell IL-4 secretion and host T-cell STAT6 signaling. In conclusion, T cell-mediated marrow graft rejection primarily resembles a Th1-type process that can be abrogated by donor Th2 cell therapy that promotes engraftment through a novel mechanism whereby cytokine polarization is transferred to host T cells.

  12. Aquaporin 2 promotes cell migration and epithelial morphogenesis.

    Science.gov (United States)

    Chen, Ying; Rice, William; Gu, Zhizhan; Li, Jian; Huang, Jianmin; Brenner, Michael B; Van Hoek, Alfred; Xiong, Jianping; Gundersen, Gregg G; Norman, Jim C; Hsu, Victor W; Fenton, Robert A; Brown, Dennis; Lu, Hua A Jenny

    2012-09-01

    The aquaporin 2 (AQP2) water channel, expressed in kidney collecting ducts, contributes critically to water homeostasis in mammals. Animals lacking or having significantly reduced levels of AQP2, however, have not only urinary concentrating abnormalities but also renal tubular defects that lead to neonatal mortality from renal failure. Here, we show that AQP2 is not only a water channel but also an integrin-binding membrane protein that promotes cell migration and epithelial morphogenesis. AQP2 expression modulates the trafficking and internalization of integrin β1, facilitating its turnover at focal adhesions. In vitro, disturbing the interaction between AQP2 and integrin β1 by mutating the RGD motif led to reduced endocytosis, retention of integrin β1 at the cell surface, and defective cell migration and tubulogenesis. Similarly, in vivo, AQP2-null mice exhibited significant retention of integrin β1 at the basolateral membrane and had tubular abnormalities. In summary, these data suggest that the water channel AQP2 interacts with integrins to promote renal epithelial cell migration, contributing to the structural and functional integrity of the mammalian kidney.

  13. Expression of Toll-Like Receptor 2 in Glomerular Endothelial Cells and Promotion of Diabetic Nephropathy by Porphyromonas gingivalis Lipopolysaccharide

    Science.gov (United States)

    Hatakeyama, Yuji; Ishikawa, Hiroyuki; Tsuruga, Eichi

    2014-01-01

    The toll-like receptor (TLR) has been suggested as a candidate cause for diabetic nephropathy. Recently, we have reported the TLR4 expression in diabetic mouse glomerular endothelium. The study here investigates the effects of the periodontal pathogen Porphyromonas gingivalis lipopolysaccharide (LPS) which is a ligand for TLR2 and TLR4 in diabetic nephropathy. In laser-scanning microscopy of glomeruli of streptozotocin- and a high fat diet feed-induced type I and type II diabetic mice, TLR2 localized on the glomerular endothelium and proximal tubule epithelium. The TLR2 mRNA was detected in diabetic mouse glomeruli by in situ hybridization and in real-time PCR of the renal cortex, the TLR2 mRNA amounts were larger in diabetic mice than in non-diabetic mice. All diabetic mice subjected to repeated LPS administrations died within the survival period of all of the diabetic mice not administered LPS and of all of the non-diabetic LPS-administered mice. The LPS administration promoted the production of urinary protein, the accumulation of type I collagen in the glomeruli, and the increases in IL-6, TNF-α, and TGF-β in the renal cortex of the glomeruli of the diabetic mice. It is thought that blood TLR ligands like Porphyromonas gingivalis LPS induce the glomerular endothelium to produce cytokines which aid glomerulosclerosis. Periodontitis may promote diabetic nephropathy. PMID:24835775

  14. Wild type p53 transcriptionally represses the SALL2 transcription factor under genotoxic stress.

    Directory of Open Access Journals (Sweden)

    Carlos Farkas

    Full Text Available SALL2- a member of the Spalt gene family- is a poorly characterized transcription factor found deregulated in various cancers, which suggests it plays a role in the disease. We previously identified SALL2 as a novel interacting protein of neurotrophin receptors and showed that it plays a role in neuronal function, which does not necessarily explain why or how SALL2 is deregulated in cancer. Previous evidences indicate that SALL2 gene is regulated by the WT1 and AP4 transcription factors. Here, we identified SALL2 as a novel downstream target of the p53 tumor suppressor protein. Bioinformatic analysis of the SALL2 gene revealed several putative p53 half sites along the promoter region. Either overexpression of wild-type p53 or induction of the endogenous p53 by the genotoxic agent doxorubicin repressed SALL2 promoter activity in various cell lines. However R175H, R249S, and R248W p53 mutants, frequently found in the tumors of cancer patients, were unable to repress SALL2 promoter activity, suggesting that p53 specific binding to DNA is important for the regulation of SALL2. Electrophoretic mobility shift assay demonstrated binding of p53 to one of the identified p53 half sites in the Sall2 promoter, and chromatin immunoprecipitation analysis confirmed in vivo interaction of p53 with the promoter region of Sall2 containing this half site. Importantly, by using a p53ER (TAM knockin model expressing a variant of p53 that is completely dependent on 4-hydroxy-tamoxifen for its activity, we show that p53 activation diminished SALL2 RNA and protein levels during genotoxic cellular stress in primary mouse embryo fibroblasts (MEFs and radiosensitive tissues in vivo. Thus, our finding indicates that p53 represses SALL2 expression in a context-specific manner, adding knowledge to the understanding of SALL2 gene regulation, and to a potential mechanism for its deregulation in cancer.

  15. Preventing Type 2 Diabetes

    Science.gov (United States)

    ... Sexual, & Bladder Problems Clinical Trials Preventing Type 2 Diabetes Perhaps you have learned that you have a ... I lower my chances of developing type 2 diabetes? Research such as the Diabetes Prevention Program shows ...

  16. PIF4 Promotes Expression of LNG1 and LNG2 to Induce Thermomorphogenic Growth in Arabidopsis

    Directory of Open Access Journals (Sweden)

    Geonhee Hwang

    2017-07-01

    Full Text Available Arabidopsis plants adapt to high ambient temperature by a suite of morphological changes including elongation of hypocotyls and petioles and leaf hyponastic growth. These morphological changes are collectively called thermomorphogenesis and are believed to increase leaf cooling capacity by enhancing transpiration efficiency, thereby increasing tolerance to heat stress. The bHLH transcription factor PHYTOCHROME INTERACTING FACTOR4 (PIF4 has been identified as a major regulator of thermomorphogenic growth. Here, we show that PIF4 promotes the expression of two homologous genes LONGIFOLIA1 (LNG1 and LONGIFOLIA2 (LNG2 that have been reported to regulate leaf morphology. ChIP-Seq analyses and ChIP assays showed that PIF4 directly binds to the promoters of both LNG1 and LNG2. The expression of LNG1 and LNG2 is induced by high temperature in wild type plants. However, the high temperature activation of LNG1 and LNG2 is compromised in the pif4 mutant, indicating that PIF4 directly regulates LNG1 and LNG2 expression in response to high ambient temperatures. We further show that the activities of LNGs support thermomorphogenic growth. The expression of auxin biosynthetic and responsive genes is decreased in the lng quadruple mutant, implying that LNGs promote thermomorphogenic growth by activating the auxin pathway. Together, our results demonstrate that LNG1 and LNG2 are directly regulated by PIF4 and are new components for the regulation of thermomorphogenesis.

  17. Facts about Type 2

    Medline Plus

    Full Text Available ... About Type 2 Recently Diagnosed Treatment and Care Blood Glucose Control Complications Medication Doctors, Nurses & More Enroll in the Living With Type 2 Diabetes Program donate en -- A Future Without Diabetes - a- ...

  18. HMGA2 promotes adipogenesis by activating C/EBPβ-mediated expression of PPARγ

    Energy Technology Data Exchange (ETDEWEB)

    Xi, Yang; Shen, Wanjing; Ma, Lili; Zhao, Ming; Zheng, Jiachen [Diabetes Center, and Zhejiang Provincial Key Laboratory of Pathophysiology, Institute of Biochemistry and Molecular Biology, School of Medicine, Ningbo University, Ningbo 315211 (China); Bu, Shizhong, E-mail: bushizhong@nbu.edu.cn [Diabetes Center, and Zhejiang Provincial Key Laboratory of Pathophysiology, Institute of Biochemistry and Molecular Biology, School of Medicine, Ningbo University, Ningbo 315211 (China); Hino, Shinjiro [Department of Medical Cell Biology, Institute of Molecular Embryology and Genetics, Kumamoto University, Kumamoto, 860-0811 (Japan); Nakao, Mitsuyoshi, E-mail: mnakao@gpo.kumamoto-u.ac.jp [Department of Medical Cell Biology, Institute of Molecular Embryology and Genetics, Kumamoto University, Kumamoto, 860-0811 (Japan); Core Research for Evolutional Science and Technology (CREST), Japan Agency for Medical Research and Development, Tokyo (Japan)

    2016-04-15

    Adipogenesis is orchestrated by a highly ordered network of transcription factors including peroxisome-proliferator activated receptor-gamma (PPARγ) and CCAAT-enhancer binding protein (C/EBP) family proteins. High mobility group protein AT-hook 2 (HMGA2), an architectural transcription factor, has been reported to play an essential role in preadipocyte proliferation, and its overexpression has been implicated in obesity in mice and humans. However, the direct role of HMGA2 in regulating the gene expression program during adipogenesis is not known. Here, we demonstrate that HMGA2 is required for C/EBPβ-mediated expression of PPARγ, and thus promotes adipogenic differentiation. We observed a transient but marked increase of Hmga2 transcript at an early phase of differentiation of mouse 3T3-L1 preadipocytes. Importantly, Hmga2 knockdown greatly impaired adipocyte formation, while its overexpression promoted the formation of mature adipocytes. We found that HMGA2 colocalized with C/EBPβ in the nucleus and was required for the recruitment of C/EBPβ to its binding element at the Pparγ2 promoter. Accordingly, HMGA2 and C/EBPβ cooperatively enhanced the Pparγ2 promoter activity. Our results indicate that HMGA2 is an essential constituent of the adipogenic transcription factor network, and thus its function may be affected during the course of obesity. - Highlights: • Overexpression of HMGA2 has been implicated in obesity in mice and humans. • HMGA2 is required for adipocyte formation. • HMGA2 colocalizes with C/EBPβ and is required for C/EBPβ recruitment to Pparγ2 promoter. • HMGA2 and C/EBPβ cooperatively enhance the Pparγ2 promoter activity.

  19. HMGA2 promotes adipogenesis by activating C/EBPβ-mediated expression of PPARγ

    International Nuclear Information System (INIS)

    Xi, Yang; Shen, Wanjing; Ma, Lili; Zhao, Ming; Zheng, Jiachen; Bu, Shizhong; Hino, Shinjiro; Nakao, Mitsuyoshi

    2016-01-01

    Adipogenesis is orchestrated by a highly ordered network of transcription factors including peroxisome-proliferator activated receptor-gamma (PPARγ) and CCAAT-enhancer binding protein (C/EBP) family proteins. High mobility group protein AT-hook 2 (HMGA2), an architectural transcription factor, has been reported to play an essential role in preadipocyte proliferation, and its overexpression has been implicated in obesity in mice and humans. However, the direct role of HMGA2 in regulating the gene expression program during adipogenesis is not known. Here, we demonstrate that HMGA2 is required for C/EBPβ-mediated expression of PPARγ, and thus promotes adipogenic differentiation. We observed a transient but marked increase of Hmga2 transcript at an early phase of differentiation of mouse 3T3-L1 preadipocytes. Importantly, Hmga2 knockdown greatly impaired adipocyte formation, while its overexpression promoted the formation of mature adipocytes. We found that HMGA2 colocalized with C/EBPβ in the nucleus and was required for the recruitment of C/EBPβ to its binding element at the Pparγ2 promoter. Accordingly, HMGA2 and C/EBPβ cooperatively enhanced the Pparγ2 promoter activity. Our results indicate that HMGA2 is an essential constituent of the adipogenic transcription factor network, and thus its function may be affected during the course of obesity. - Highlights: • Overexpression of HMGA2 has been implicated in obesity in mice and humans. • HMGA2 is required for adipocyte formation. • HMGA2 colocalizes with C/EBPβ and is required for C/EBPβ recruitment to Pparγ2 promoter. • HMGA2 and C/EBPβ cooperatively enhance the Pparγ2 promoter activity.

  20. Facts about Type 2

    Medline Plus

    Full Text Available ... Enroll in the Living WIth Type 2 Diabetes Program Gestational What is Gestational Diabetes? How to Treat ... Enroll in the Living WIth Type 2 Diabetes Program In It Together We Can Help Center for ...

  1. Facts about Type 2

    Medline Plus

    Full Text Available ... and Type 2 Diabetes Know Your Rights Employment Discrimination Health Care Professionals Law Enforcement Driver's License For ... 1 Type 2 Gestational Myths Statistics Common Terms Genetics Living With Diabetes Recently Diagnosed Treatment & Care Complications ...

  2. Facts about Type 2

    Medline Plus

    Full Text Available ... Us in the Fight for a Cure Your tax-deductible gift today can fund critical diabetes research ... Care of Type 2 Diabetes This two-page introduction to type 2 diabetes is in PDF format ...

  3. ΔNp63α induces the expression of FAT2 and Slug to promote tumor invasion

    Science.gov (United States)

    Dang, Tuyen T.; Westcott, Jill M.; Maine, Erin A.; Kanchwala, Mohammed; Xing, Chao; Pearson, Gray W.

    2016-01-01

    Tumor invasion can be induced by changes in gene expression that alter cell phenotype. The transcription factor ΔNp63α promotes basal-like breast cancer (BLBC) migration by inducing the expression of the mesenchymal genes Slug and Axl, which confers cells with a hybrid epithelial/mesenchymal state. However, the extent of the ΔNp63α regulated genes that support invasive behavior is not known. Here, using gene expression analysis, ChIP-seq, and functional testing, we find that ΔNp63α promotes BLBC motility by inducing the expression of the atypical cadherin FAT2, the vesicular binding protein SNCA, the carbonic anhydrase CA12, the lipid binding protein CPNE8 and the kinase NEK1, along with Slug and Axl. Notably, lung squamous cell carcinoma migration also required ΔNp63α dependent FAT2 and Slug expression, demonstrating that ΔNp63α promotes migration in multiple tumor types by inducing mesenchymal and non-mesenchymal genes. ΔNp63α activation of FAT2 and Slug influenced E-cadherin localization to cell-cell contacts, which can restrict spontaneous cell movement. Moreover, live-imaging of spheroids in organotypic culture demonstrated that ΔNp63α, FAT2 and Slug were essential for the extension of cellular protrusions that initiate collective invasion. Importantly, ΔNp63α is co-expressed with FAT2 and Slug in patient tumors and the elevated expression of ΔNp63α, FAT2 and Slug correlated with poor patient outcome. Together, these results reveal how ΔNp63α promotes cell migration by directly inducing the expression of a cohort of genes with distinct cellular functions and suggest that FAT2 is a new regulator of collective invasion that may influence patient outcome. PMID:27081041

  4. Sfp-type PPTase inactivation promotes bacterial biofilm formation and ability to enhance wheat drought tolerance

    Directory of Open Access Journals (Sweden)

    Salme eTimmusk

    2015-05-01

    Full Text Available Paenibacillus polymyxa is a common soil bacterium with broad range of practical applications. An important group of secondary metabolites in P. polymyxa are nonribosomal peptide and polyketide derived metabolites (NRP/PK. Modular nonribosomal peptide synthetases catalyse main steps in the biosynthesis of the complex secondary metabolites. Here we report on the inactivation of an A26 sfp-type phosphopantetheinyl transferase. The inactivation of the gene resulted in loss of NRP/PK production. In contrast to the former Bacillus spp. model the mutant strain compared to wild type showed greatly enhanced biofilm formation ability. Its biofilm promotion is directly mediated by NRP/PK, as exogenous addition of the wild type metabolite extracts restores its biofilm formation level. Wheat inoculation with bacteria that had lost their sfp-type PPTase gene resulted in two times higher plant survival and about three times increased biomass under severe drought stress compared to wild type.

  5. Promoting resuscitation of viable but nonculturable cells of Vibrio harveyi by a resuscitation-promoting factor-like protein YeaZ.

    Science.gov (United States)

    Li, Y; Chen, J; Zhao, M; Yang, Z; Yue, L; Zhang, X

    2017-02-01

    To demonstrate the resuscitation-promoting activities of recombinant YeaZ from Vibrio harveyi SF-1. The gene of resuscitation-promoting factor YeaZ was cloned from genomic DNA of V. harveyi SF-1. The gene was expressed in Escherichia coli, and the expressed protein was purified by Ni 2+ -affinity chromatography. A yeaZ mutant was constructed by using the suicide plasmid pNQ705 with homologous recombination. Disruption of yeaZ did not affect cell growth significantly in 2216 E broth at 28°C. The wild-type and mutant viable but nonculturable (VBNC) cells could be resuscitated by temperature upshift method. In addition, the recombinant YeaZ increased the culturable counts from 1·27 × 10 4  CFU per ml and 1·99 × 10 4 CFU per ml to 2·88 × 10 5  CFU per ml and 4·59 × 10 5 CFU per ml, respectively. After the VBNC cells of wild-type and mutant cells were maintained at 4°C for 120 days, no resuscitation was obtained by temperature upshift method, but addition of the recombinant YeaZ promoted the resuscitation of the wild-type and mutant cells, with the culturable cell counts of 1·13 × 10 3 and 1·44 × 10 3 CFU per ml, respectively. Disruption of yeaZ decreased the virulence of V. harveyi in zebrafish. The lethal dose 50% of the yeaZ null mutant was more than 10-fold higher than that of the wild-type cells. The recombinant YeaZ could efficiently promote resuscitation of the wild-type and mutant cells of V. harveyi from VBNC to culturable state. The protein also promoted resuscitation of the VBNC wild-type and mutant cells, which were maintained at 4°C for 120 days and not recovered by temperature upshift method. Disruption of yeaZ decreased the virulence of V. harveyi in zebrafish. Here, we show clear evidence of a resuscitation-promoting factor YeaZ of V. harveyi and the roles in resuscitation of the VBNC cells and its pathogenicity. © 2016 The Society for Applied Microbiology.

  6. Type 2 diabetes models

    DEFF Research Database (Denmark)

    Gram, Dorte Xenia

    2012-01-01

    This chapter deals with type 2 diabetes in vivo models and techniques suitable for testing new anti-diabetic compounds. In particular, the testing of TRP antagonist for beneficial effects against type 2 diabetes is considered. There are many choices of both in vitro techniques and in vivo models......, impaired glucose tolerance, impaired insulin secretion, and insulin resistance in vivo and should, thus, be sufficient to demonstrate preclinical proof of concept of a TRP antagonist in type 2 diabetes in rodents. The experiments are suggestions and could be replaced or supplemented by others....

  7. Facts about Type 2

    Medline Plus

    Full Text Available ... org > Diabetes Basics > Type 2 Share: Print Page Text Size: A A A Listen En Español Facts ... Type 2 Education Series Hear audio clips and full recordings of past Q&A events at your ...

  8. Facts about Type 2

    Medline Plus

    Full Text Available ... Type 2 Diabetes Risk Test Lower Your Risk Healthy Eating Overweight Smoking High Blood Pressure Physical Activity High ... type 2 can control their blood glucose with healthy eating and being active. But, your doctor may need ...

  9. Early onset type 2 diabetes

    DEFF Research Database (Denmark)

    Bo, A; Thomsen, R W; Nielsen, J S

    2018-01-01

    was more frequent and meeting physical activity recommendations less likely in persons with early-onset type 2 DM. CONCLUSIONS: We found a clear age-gradient, with increasing prevalence of clinical and behavioural risk factors the younger the onset age of type 2 DM. Younger persons with early-onset type 2......AIM: To examine the association between early onset of type 2 diabetes (DM) and clinical and behavioural risk factors for later diabetes complications. METHODS: We conducted a cross-sectional study of 5115 persons with incident type 2 DM enrolled during 2010-2015 in the Danish Centre for Strategic...... Research in Type 2 Diabetes-cohort. We compared risk factors at time of diagnosis among those diagnosed at ≤45 years (early-onset) with diagnosis age 46-55, 56-65 (average-onset = reference), 66-75, and >75 years (late-onset). Prevalence ratios (PRs) were computed using Poisson regression. RESULTS: Poor...

  10. Comprehensive benchmarking reveals H2BK20 acetylation as a distinctive signature of cell-state-specific enhancers and promoters.

    Science.gov (United States)

    Kumar, Vibhor; Rayan, Nirmala Arul; Muratani, Masafumi; Lim, Stefan; Elanggovan, Bavani; Xin, Lixia; Lu, Tess; Makhija, Harshyaa; Poschmann, Jeremie; Lufkin, Thomas; Ng, Huck Hui; Prabhakar, Shyam

    2016-05-01

    Although over 35 different histone acetylation marks have been described, the overwhelming majority of regulatory genomics studies focus exclusively on H3K27ac and H3K9ac. In order to identify novel epigenomic traits of regulatory elements, we constructed a benchmark set of validated enhancers by performing 140 enhancer assays in human T cells. We tested 40 chromatin signatures on this unbiased enhancer set and identified H2BK20ac, a little-studied histone modification, as the most predictive mark of active enhancers. Notably, we detected a novel class of functionally distinct enhancers enriched in H2BK20ac but lacking H3K27ac, which was present in all examined cell lines and also in embryonic forebrain tissue. H2BK20ac was also unique in highlighting cell-type-specific promoters. In contrast, other acetylation marks were present in all active promoters, regardless of cell-type specificity. In stimulated microglial cells, H2BK20ac was more correlated with cell-state-specific expression changes than H3K27ac, with TGF-beta signaling decoupling the two acetylation marks at a subset of regulatory elements. In summary, our study reveals a previously unknown connection between histone acetylation and cell-type-specific gene regulation and indicates that H2BK20ac profiling can be used to uncover new dimensions of gene regulation. © 2016 Kumar et al.; Published by Cold Spring Harbor Laboratory Press.

  11. Selective photocatalytic reduction of CO{sub 2} by H{sub 2}O/H{sub 2} to CH{sub 4} and CH{sub 3}OH over Cu-promoted In{sub 2}O{sub 3}/TiO{sub 2} nanocatalyst

    Energy Technology Data Exchange (ETDEWEB)

    Tahir, Muhammad, E-mail: mtahir@cheme.utm.my [Chemical Reaction Engineering Group (CREG), Faculty of Chemical and Energy Engineering, Universiti Teknologi Malaysia, 81310, UTM, Johor Bahru, Johor (Malaysia); Department of Chemical Engineering, COMSATS Institute of Information Technology, Lahore, Punjab (Pakistan); Tahir, Beenish; Saidina Amin, Nor Aishah; Alias, Hajar [Chemical Reaction Engineering Group (CREG), Faculty of Chemical and Energy Engineering, Universiti Teknologi Malaysia, 81310, UTM, Johor Bahru, Johor (Malaysia)

    2016-12-15

    Highlights: • Cu-promoted In{sub 2}O{sub 3}/TiO{sub 2} nanocatalysts tested for CO{sub 2} photoreduction with H{sub 2}O/H{sub 2}. • Production of CH{sub 4} and CH{sub 3}OH depends on reductants type and metal-loading to TiO{sub 2}. • CH{sub 4} production over Cu-In/TiO{sub 2} was 1.5 fold more than In/TiO{sub 2} and 5 times the TiO{sub 2}. • The Cu-promoted CH{sub 3}OH production while In gave more CH{sub 4} with water vapors. • The H{sub 2} reductant gave negative effect for CH{sub 4} but enhanced CH{sub 3}OH production. - Abstract: Photocatalytic CO{sub 2} reduction by H{sub 2}O and/or H{sub 2} reductant to selective fuels over Cu-promoted In{sub 2}O{sub 3}/TiO{sub 2} photocatalyst has been investigated. The samples, prepared via a simple and direct sol-gel method, were characterized by XRD, SEM, TEM, XPS, N{sub 2} adsorption-desorption, UV–vis diffuse reflectance, Raman and PL spectroscopy. Cu and In loaded into TiO{sub 2}, oxidized as Cu{sup 2+} and In{sup 3+}, promoted efficient separation of photo-generated electron/hole pairs (e{sup −}/h{sup +}). The results indicate that the reduction rate of CO{sub 2} by H{sub 2}O to CH{sub 4} approached to 181 μmol g{sup −1} h{sup −1} using 0.5% Cu-3% In{sub 2}O{sub 3}/TiO{sub 2} catalyst, a 1.53 fold higher than the production rate over the 3% In{sub 2}O{sub 3}/TiO{sub 2} and 5 times the amount produced over the pure TiO{sub 2}. In addition, Cu was found to promote efficient production of CH{sub 3}OH and yield rate reached to 68 μmol g{sup −1} h{sup −1} over 1% Cu-3% In{sub 2}O{sub 3}/TiO{sub 2} catalyst. This improvement was attributed to charge transfer property and suppressed recombination rate by Cu-metal. More importantly, H{sub 2} reductant was less favorable for CH{sub 4} production, yet a significant amount of CH{sub 4} and CH{sub 3}OH were obtained using a mixture of H{sub 2}O/H{sub 2} reductant. Therefore, Cu-loaded In{sub 2}O{sub 3}/TiO{sub 2} catalyst has shown to be capable for

  12. Facts about Type 2

    Medline Plus

    Full Text Available ... a Member Donate Now! One Time Monthly In Memory In Honor Become a Member En Español Type 1 Type ... Diagnosing Diabetes and Learning About Prediabetes Type 2 Diabetes Risk Test Lower ...

  13. Impact of Blood Type, Functional Polymorphism (T-1676C) of the COX-1 Gene Promoter and Clinical Factors on the Development of Peptic Ulcer during Cardiovascular Prophylaxis with Low-Dose Aspirin

    Science.gov (United States)

    Wang, Pin-Yao; Chen, Hsiu-Ping; Chen, Angela; Tsay, Feng-Woei; Kao, Sung-Shuo; Peng, Nan-Jing; Tseng, Hui-Hwa; Hsu, Ping-I

    2014-01-01

    Aims. To investigate the impact of blood type, functional polymorphism (T-1676C) of the COX-1 gene promoter, and clinical factors on the development of peptic ulcer during cardiovascular prophylaxis with low-dose aspirin. Methods. In a case-control study including 111 low-dose aspirin users with peptic ulcers and 109 controls (asymptomatic aspirin users), the polymorphism (T-1676C) of the COX-1 gene promoter was genotyped, and blood type, H pylori status, and clinical factors were assessed. Results. Univariate analysis showed no significant differences in genotype frequencies of the COX-1 gene at position -1676 between the peptic ulcer group and control group. Multivariate analysis revealed that blood type O, advanced age, history of peptic ulcer, and concomitant use of NSAID were the independent risk factors for the development of peptic ulcer with the odds ratios of the 2.1, 3.1, 27.6, and 2.9, respectively. Conclusion. The C-1676T polymorphism in the COX-1 gene promoter is not a risk factor for ulcer formation during treatment with low-dose aspirin. Blood type O, advanced age, history of peptic ulcer, and concomitant use of NSAID are of independent significance in predicting peptic ulcer development during treatment with low-dose aspirin. PMID:25243161

  14. Facility type and primary care performance in sub-district health promotion hospitals in Northern Thailand.

    Directory of Open Access Journals (Sweden)

    Nithra Kitreerawutiwong

    Full Text Available Poor and middle-income Thai people rely heavily on primary care health services. These are staffed by a range of professionals. However, it is unknown whether the performance of primary care varies according to the staffing and organization of local service delivery units. Tambon (sub-district health promotion hospitals (THPHs were introduced in 2009 to upgrade the services offered by the previous health centres, but were faced with continuing shortages of doctors and nurses. The Ministry of Public Health (MoPH designated three categories of THPH, defined according to whether they were regularly staffed by a medical practitioner, a qualified nurse or non-clinical public health officers. This study aimed to compare the performance of primary care offered by the three different types of primary care facilities in one public health region of Northern Thailand (Public Health Region 2.A cross-sectional survey was undertaken in 2013. Data were collected on accessibility, continuity, comprehensiveness, co-ordination and community orientation of care from 825 patients attending 23 primary care facilities. These were selected to include the three officially-designated types of Tambon (sub-district health promotion hospitals (THPHs led by medical, nursing or public health personnel. Survey scores were compared in unadjusted and adjusted analyses.THPHs staffed only by public health officers achieved the highest performance score (Mean = 85.14, SD. = 7.30, followed by THPHs staffed by qualified nurses (Mean = 82.86, SD. = 7.06. THPHs staffed by a doctor on rotation returned the lowest scores (Mean = 81.63, SD. = 7.22.Differences in overall scores resulted mainly from differences in reported accessibility, continuity, and comprehensiveness of care, rather than staff skill-mix per se. Policy on quality improvement should therefore focus on improving performance in these areas.

  15. Hand functions in type 1 and type 2 diabetes mellitus

    Directory of Open Access Journals (Sweden)

    Akpinar Pinar

    2017-01-01

    Full Text Available Introduction/Objective. Hand functions have an enormous impact on activities of daily living in patients with diabetes mellitus (DM, such as self-care, administering insulin injections, and preparing and eating meals. The aim of the study was to evaluate hand functions and grip strength in patients with type 1 and type 2 DM. Methods. This was an observational case-control study investigating the hand functions and grip strength in patients with type 1 and type 2 DM. The study comprised 41 patients with type 1 DM aged 25–50 years sex- and age-matched, 40 non-diabetic controls, and 91 patients with type 2 DM aged 40–65 years sex- and age-matched 60 non-diabetic controls. Patients with documented history of diabetic sensorimotor neuropathy and adhesive capsulitis were excluded. The Duruoz Hand Index was used to assess the functional hand disability. Grip strength was tested with a calibrated Jamar dynamometer. Results. The Duruoz Hand Index scores in patients with type 2 DM were significantly higher than in persons in the control group (p 0.05. Grip strength values of patients with type 1 DM were significantly lower compared to those in the control group (p < 0.05, whereas there was no significant difference between patients with type 2 DM and their control group. There was a negatively significant correlation between grip strength and the Duruoz Hand Index scores in patients with both type 1 and type 2 DM (p < 0.05. Conclusion. Patients with type 1 DM and type 2 DM have different degrees of hand disability as compared to healthy control groups.

  16. Immune Cells Link Obesity-associated Type 2 Diabetes and Periodontitis

    Science.gov (United States)

    Zhu, M.; Nikolajczyk, B.S.

    2014-01-01

    The clinical association between obesity-associated type 2 diabetes (T2D) and periodontitis, coupled with the increasing prevalence of these diseases, justifies studies to identify mechanisms responsible for the vicious feed-forward loop between systemic and oral disease. Changes in the immune system are critical for both obesity-associated T2D and periodontitis and therefore may link these diseases. Recent studies at the intersection of immunology and metabolism have greatly advanced our understanding of the role the immune system plays in the transition between obesity and obesity-associated T2D and have shown that immune cells exhibit similar functional changes in obesity/T2D and periodontitis. Furthermore, myeloid and lymphoid cells likely synergize to promote obesity/T2D-associated periodontitis despite complexities introduced by disease interaction. Thus the groundwork is being laid for researchers to exploit existing models to understand immune cell dysfunction and break the devastating relationship between obesity-associated T2D and oral disease. PMID:24393706

  17. Identification of a type 1 diabetes-associated CD4 promoter haplotype with high constitutive activity

    DEFF Research Database (Denmark)

    Kristiansen, O P; Karlsen, A E; Larsen, Z M

    2004-01-01

    screened the human CD4 promoter for mutations and identified three frequent single nucleotide polymorphisms (SNPs): CD4-181C/G, CD4-521C/G and CD4-1050T/C. The SNPs are in strong linkage disequilibrium (LD) and association with the CD4-1188(TTTTC)(5-14) alleles, and we observed nine CD4 promoter haplotypes...... promoter activity and (2) the CD4-181G variant encodes higher stimulated promoter activity than the CD4-181C variant. This difference is in part neutralized in the frequently occurring CD4 promoter haplotypes by the more upstream genetic variants. Thus, we report functional impact of a novel CD4-181C/G SNP...

  18. The role of rare innate immune cells in Type 2 immune activation against parasitic helminths.

    Science.gov (United States)

    Webb, Lauren M; Tait Wojno, Elia D

    2017-09-01

    The complexity of helminth macroparasites is reflected in the intricate network of host cell types that participate in the Type 2 immune response needed to battle these organisms. In this context, adaptive T helper 2 cells and the Type 2 cytokines interleukin (IL)-4, IL-5, IL-9 and IL-13 have been the focus of research for years, but recent work has demonstrated that the innate immune system plays an essential role. Some innate immune cells that promote Type 2 immunity are relatively abundant, such as macrophages and eosinophils. However, we now appreciate that more rare cell types including group 2 innate lymphoid cells, basophils, mast cells and dendritic cells make significant contributions to these responses. These cells are found at low frequency but they are specialized to their roles - located at sites such as the skin, lung and gut, where the host combats helminth parasites. These cells respond rapidly and robustly to worm antigens and worm-induced damage to produce essential cytokines, chemokines, eicosanoids and histamine to activate damaged epithelium and to recruit other effectors. Thus, a greater understanding of how these cells operate is essential to understand how the host protects itself during helminth infection.

  19. Facts about Type 2

    Medline Plus

    Full Text Available ... as well as the aged population. Patient Education Materials — Taking Care of Type 2 Diabetes This two-page introduction to type 2 diabetes is in PDF format so you can download it, print it, and hand it out to patients. You ...

  20. The Usage of Web 2.0 as a Media Promotion in Indonesia University Libraries

    Directory of Open Access Journals (Sweden)

    Nove E. Variant Anna

    2015-04-01

    Full Text Available The usage of web 2.0 has become popular among young people in Indonesia. One of the purpose of using web 2.0 is for promotion in some university libraries. The emerging of the web 2.0 as promotional media is corelating with the development of digital library. The paper aims are (1 to describe the usage of web 2.0 for academic libraries promotion. (2 to describe the information / content of those web 2.0. (3 to describe the promotion activity through web 2.0. This research population is all university libraries in Indonesia, but only 40 university libraries that conduct promotion through web 2.0. The website observation is done between May-July 2013. The research results are (1 the university libraries in Indonesia are use facebook, twitter, and flicker to promote library programs and interaction with users. The web 2.0 consist of information about new book release, user education, general information about library services, and information literacy. (3 some of univerity libraries taking seriously and actively promote their library services, but some of them are don’t use the web 2.0.

  1. The Usage of Web 2.0 as a Media Promotion in Indonesia University Libraries

    Directory of Open Access Journals (Sweden)

    Nove E. Variant Anna

    2018-01-01

    Full Text Available The usage of web 2.0 has become popular among young people in Indonesia. One of the purpose of using web 2.0 is for promotion in some university libraries. The emerging of the web 2.0 as promotional media is corelating with the development of digital library. The paper aims are (1 to describe the usage of web 2.0 for academic libraries promotion. (2 to describe the information / content of those web 2.0. (3 to describe the promotion activity through web 2.0. This research population is all university libraries in Indonesia, but only 40 university librraries that conduct promotion through web 2.0. The website observation is done between May-July 2013. The research results are (1 the university libraries in Indonesia are use facebook, twitter, and flikr to promote library programs and interaction with users. The web 2.0 consist of information about new book release, user education, general information about library services, and information literacy. (3 some of univerity libraries taking seriously and actively promote their library services, but some of them are don’t use the web 2.0.

  2. C-peptide prevents SMAD3 binding to alpha promoters to inhibit collagen type IV synthesis.

    Science.gov (United States)

    Li, Yanning; Zhong, Yan; Gong, Wenjian; Gao, Xuehan; Qi, Huanli; Liu, Kun; Qi, Jinsheng

    2018-07-01

    Activation of transforming growth factor β1 (TGFB1)/SMAD3 signaling may lead to additional synthesis of collagen type IV (COL4), which is a major contributor to extracellular matrix (ECM) accumulation in diabetic nephropathy (DN). C-peptide can attenuate fibrosis to have unique beneficial effects in DN. However, whether and how C-peptide affects TGFB1/SMAD3-activated COL4 synthesis is unclear. In this study, pathological changes, expression of COL4 a1-a5 chains ( Col4a1-a5 ), COL4 distribution and protein and TGFB1 and SMAD3 protein were first assessed in a rat model of diabetes. Then, rat mesangial cells were treated with high glucose (HG) and/or C-peptide to investigate the underlying mechanism. Col4a1-a5 expression, COL4 protein and secretion, TGFB1 protein, SMAD3 nuclear translocation and binding of SMAD3 to its cognate sites in the promoters of Col4a1a2 , Col4a3a4 and Col4a5 were measured. It was found that C-peptide attenuated glomerular pathological changes and suppressed renal Col4a1 -a5 mRNA expression, COL4 protein content and TGFB1 protein content. C-peptide had a dose-dependent effect to inhibit Col4a1-a5 mRNA expression, COL4 protein content and secretion, in HG-stimulated mesangial cells. In addition, the HG-induced increase in TGFB1 protein content was significantly reduced by C-peptide. Although not apparently affecting SMAD3 nuclear translocation, C-peptide prevented SMAD3 from binding to its sites in the Col4a1a2 , Col4a3a4 and Col4a5 promoters in HG-stimulated mesangial cells. In conclusion, C-peptide could prevent SMAD3 from binding to its sites in the Col4a1a2 , Col4a3a4 and Col4a5 promoters, to inhibit COL4 generation. These results may provide a mechanism for the alleviation of fibrosis in DN by C-peptide. © 2018 Society for Endocrinology.

  3. A case-control field study on the relationships among type 2 diabetes, sleepiness and habitual caffeine intake.

    Science.gov (United States)

    Urry, Emily; Jetter, Alexander; Holst, Sebastian C; Berger, Wolfgang; Spinas, Giatgen A; Langhans, Wolfgang; Landolt, Hans-Peter

    2017-02-01

    The purpose of this study was to examine the possible links between type 2 diabetes, daytime sleepiness, sleep quality and caffeine consumption. In this case-control field study, comparing type 2 diabetic ( n=134) and non-type 2 diabetic ( n=230) participants, subjects completed detailed and validated questionnaires to assess demographic status, health, daytime sleepiness, sleep quality and timing, diurnal preference, mistimed circadian rhythms and habitual caffeine intake. All participants gave saliva under standardised conditions for CYP1A2 genotyping and quantification of caffeine concentration. Hierarchical linear regression analyses examined whether type 2 diabetes status was associated with caffeine consumption. Type 2 diabetic participants reported greater daytime sleepiness ( p=0.001), a higher prevalence of sleep apnoea ( p=0.005) and napping ( p=0.008), and greater habitual caffeine intake ( pcaffeine concentration at bedtime ( p=0.01). Multiple regression analyses revealed that type 2 diabetes status was associated with higher self-reported caffeine consumption ( pcaffeine ( pcaffeine intake. Subjective sleep and circadian estimates were similar between case and control groups. Type 2 diabetic patients may self-medicate with caffeine to alleviate daytime sleepiness. High caffeine intake reflects a lifestyle factor that may be considered when promoting type 2 diabetes management.

  4. Facts about Type 2

    Medline Plus

    Full Text Available ... to help you meet your target blood glucose levels. Type 2 usually gets worse over time – even if you don’t need medications at first, you may need to later on. Some groups have a higher risk for developing type 2 diabetes than ...

  5. Facts about Type 2

    Medline Plus

    Full Text Available ... or insulin to help you meet your target blood glucose levels. Type 2 usually gets worse over time – even if you don’t need medications at first, you may need to later on. Some groups have a higher risk for developing type 2 ...

  6. Patient Use of the Electronic Communication Portal in Management of Type 2 Diabetes.

    Science.gov (United States)

    Peremislov, Diana

    2017-09-01

    High incidence and prevalence of type 2 diabetes require urgent attention to the management of this chronic disease. The purpose of this study was to explore electronic communication (e-communication) between patients with type 2 diabetes and their providers within the patient portal. Qualitative design with conventional content analysis techniques was used. A purposive random sample of 90 electronic medical record charts of patient-portal users with type 2 diabetes was subjected to a retrospective review. The sample mainly consisted of patients between the ages of 50 and 70 years, who were white, non-Hispanic, and English-speaking. The three major themes that emerged in e-communication via patient portal were inform theme, which was the most frequently identified theme; instruct/request theme, which was mainly used in initiation of e-communication; and the question theme. The patient portal was used primarily for requests by patients and instruction by providers, showing relatively short e-message encounters with a high number of partially completed encounters, frequent lack of resolution, and a low level of involvement of diabetes specialists in e-communication. There is a need to revise healthcare system guidelines on initiation and use of e-communication via patient portal and develop standardized templates to promote diabetes education in type 2 diabetes.

  7. Monocyte matrix metalloproteinase production in Type 2 diabetes and controls – a cross sectional study

    Directory of Open Access Journals (Sweden)

    Davies Isabel R

    2003-03-01

    Full Text Available Abstract Background Coronary plaque rupture may result from localised over expression of matrix metalloproteinases (MMPs within the plaque by infiltrating monocyte – macrophages. As MMP expression can be promoted by the modified lipoproteins, oxidative stress and hyperglycaemia that characterises Type 2 diabetes, we hypothesised that peripheral monocytes in these patients, exposed to these factors in vivo, would demonstrate increased MMP production compared to controls. Methods We examined peripheral venous monocyte expression of MMP and tissue inhibitor of metalloproteinase-1 (TIMP-1 in 18 controls and 22 subjects with Type 2 diabetes and no previous cardiovascular complications. Results No significant difference in MMP-1, 3 or 9 or TIMP-1 production was observed between control and diabetes groups. Conclusions Monocyte MMP-1, 3, and 9, and TIMP-1, production are not abnormal in Type 2 diabetes. This data cannot be extrapolated to monocyte – macrophage behaviour in the vessel wall, but it does suggest MMP and TIMP-1 expression prior to monocyte infiltration and transformation are not abnormal in Type 2 diabetes.

  8. Differing causes of pregnancy loss in type 1 and type 2 diabetes.

    Science.gov (United States)

    Cundy, Tim; Gamble, Greg; Neale, Leonie; Elder, Rose; McPherson, Paul; Henley, Patrick; Rowan, Janet

    2007-10-01

    Women with type 2 and type 1 diabetes have differing risk factors for pregnancy loss. We compared the rates and causes of pregnancy loss in women with type 1 and type 2 diabetes. We utilized prospectively collected data on all pregnancies in a 20-year period (1986-2005) from a single center with a high prevalence of type 2 diabetes. Pregnancy losses included terminations for medical reasons and deaths up to 1 month postpartum but not spontaneous pregnancy losses pregnancies in women with known diabetes (330 with type 1 and 540 with type 2 diabetes) and 325 in women with diabetes diagnosed in pregnancy but persisting postpartum (97% type 2 diabetes). The rate of pregnancy loss was similar in type 1 and type 2 diabetes (2.6 vs. 3.7%, P = 0.39), but the causes of pregnancy loss differed. In type 1 diabetes >75% were attributable to major congenital anomalies or prematurity; in type 2 diabetes >75% were attributable to stillbirth or chorioamnionitis (P = 0.017). Women with type 2 and type 1 diabetes had similar A1C at presentation and near term, but the former were older (P causes of pregnancy loss in women with type 1 and type 2 diabetes. The higher rates of stillbirth in women with type 2 diabetes, suggest that other features, such as obesity, contribute significantly to pregnancy losses.

  9. Construction and expression of secreting type human TRAIL gene vector mediated by hypoxia/radiation double sensitive promoter

    International Nuclear Information System (INIS)

    Yang Yanming; Jia Xiaojing; Qu Yaqin; Li Yanbo

    2009-01-01

    Objective: To construct secreting type human TRAIL (shTRAIL) gene vector pcDNA3.1-HRE/Egr1-shTRAIL mediated by hypoxia/radiation double sensitive promoter, and observe the effect of hypoxia and radiation on shTRAIL. Methods: HRE upper and lower strands were gotten by chemical synthesis, double strands HRE was gotten by PCR; pMD19T-Egr1 was digested by Sac I and Hind III, then Egr1 was obtained, pshuttle-shTRAIL was digested by Kpn I and BamH I, then shTRAIL was obtained; HRE/Egr1 double sensitive promoter mediated shTRAIL expression vector pcDNA3.1-HRE/Egr1-shTRAIL was constructed by gene recombination technique, it was identified correctly by enzyme digestion, PCR and sequencing. A549 cells were divided into normal, hypoxia (0.1%), irradiation (6 Gy) and hypoxia + irradiation groups. Results: After enzyme digestion by BamH I and Sma I, the fragments which lengths were 1284 bp and 4 998 bp, 2 292 bp and 3 990 bp were obtained; the vector was amplified by PCR with Egr1 and shTRAIL primer, the products which lengthens were 469 bp and 820 bp were obtained; pcDNA3.1-HRE/Egr1-shTRAIL was sequenced, the result was same to designed, this demonstrated that the construction was right. The vectors were transfected into A549 cells of adenocarcinoma of lung, the expression levels of shTRAIL mRNA and protein were increased after treated with hypoxia and radiation, it had statistically significant differences compared with normal group (P<0.05), and when they were combinated, the effect was more obvious. Conclusion: Secreting type human TRAIL gene vector pcDNA3.1-HRE/Egr1-shTRAIL mediated by hypoxia/radiation double sensitive promoter is constructed successfully, and hypoxia and radiation could increase the expression of TRAIL, and they have synergetic effect. (authors)

  10. Promoting preschool reading

    OpenAIRE

    Istenič, Vesna

    2013-01-01

    The thesis titled Promoting preschool reading consists of a theoretiral and an empirical part. In the theoretical part I wrote about reading, the importance of reading, types of reading, about reading motivation, promoting reading motivation, internal and external motivation, influence of reading motivation on the child's reading activity, reading and familial literacy, the role of adults in promotion reading literacy, reading to a child and promoting reading in pre-school years, where I ...

  11. Facts about Type 2

    Medline Plus

    Full Text Available ... Know Your Risk Diabetes Basics Symptoms Type 1 Type 2 Gestational Myths Statistics Common Terms Genetics Living With Diabetes Recently Diagnosed Treatment & Care Complications ...

  12. Th17 cytokines differentiate obesity from obesity-associated type 2 diabetes and promote TNFα production.

    Science.gov (United States)

    Ip, Blanche; Cilfone, Nicholas A; Belkina, Anna C; DeFuria, Jason; Jagannathan-Bogdan, Madhumita; Zhu, Min; Kuchibhatla, Ramya; McDonnell, Marie E; Xiao, Qiang; Kepler, Thomas B; Apovian, Caroline M; Lauffenburger, Douglas A; Nikolajczyk, Barbara S

    2016-01-01

    T cell inflammation plays pivotal roles in obesity-associated type 2 diabetes (T2DM). The identification of dominant sources of T cell inflammation in humans remains a significant gap in understanding disease pathogenesis. It was hypothesized that cytokine profiles from circulating T cells identify T cell subsets and T cell cytokines that define T2DM-associated inflammation. Multiplex analyses were used to quantify T cell-associated cytokines in αCD3/αCD28-stimulated PBMCs, or B cell-depleted PBMCs, from subjects with T2DM or BMI-matched controls. Cytokine measurements were subjected to multivariate (principal component and partial least squares) analyses. Flow cytometry detected intracellular TNFα in multiple immune cell subsets in the presence/absence of antibodies that neutralize T cell cytokines. T cell cytokines were generally higher in T2DM samples, but Th17 cytokines are specifically important for classifying individuals correctly as T2DM. Multivariate analyses indicated that B cells support Th17 inflammation in T2DM but not control samples, while monocytes supported Th17 inflammation regardless of T2DM status. Partial least squares regression analysis indicated that both Th17 and Th1 cytokines impact %HbA1c. Among various T cell subsets, Th17 cells are major contributors to inflammation and hyperglycemia and are uniquely supported by B cells in obesity-associated T2DM. © 2015 The Obesity Society.

  13. DNA-binding site of major regulatory protein alpha 4 specifically associated with promoter-regulatory domains of alpha genes of herpes simplex virus type 1.

    OpenAIRE

    Kristie, T M; Roizman, B

    1986-01-01

    Herpes simplex virus type 1 genes form at least five groups (alpha, beta 1, beta 2, gamma 1, and gamma 2) whose expression is coordinately regulated and sequentially ordered in a cascade fashion. Previous studies have shown that functional alpha 4 gene product is essential for the transition from alpha to beta protein synthesis and have suggested that alpha 4 gene expression is autoregulatory. We have previously reported that labeled DNA fragments containing promoter-regulatory domains of thr...

  14. Nitrosamine exposure exacerbates high fat diet-mediated type 2 diabetes mellitus, non-alcoholic steatohepatitis, and neurodegeneration with cognitive impairment

    Directory of Open Access Journals (Sweden)

    de la Monte Suzanne M

    2009-12-01

    Full Text Available Abstract Background The current epidemics of type 2 diabetes mellitus (T2DM, non-alcoholic steatohepatitis (NASH, and Alzheimer's disease (AD all represent insulin-resistance diseases. Previous studies linked insulin resistance diseases to high fat diets or exposure to streptozotocin, a nitrosamine-related compound that causes T2DM, NASH, and AD-type neurodegeneration. We hypothesize that low-level exposure to nitrosamines that are widely present in processed foods, amplifies the deleterious effects of high fat intake in promoting T2DM, NASH, and neurodegeneration. Methods Long Evans rat pups were treated with N-nitrosodiethylamine (NDEA by i.p. Injection, and upon weaning, they were fed with high fat (60%; HFD or low fat (5%; LFD chow for 6 weeks. Rats were evaluated for cognitive impairment, insulin resistance, and neurodegeneration using behavioral, biochemical, molecular, and histological methods. Results NDEA and HFD ± NDEA caused T2DM, NASH, deficits in spatial learning, and neurodegeneration with hepatic and brain insulin and/or IGF resistance, and reductions in tau and choline acetyltransferase levels in the temporal lobe. In addition, pro-ceramide genes, which promote insulin resistance, were increased in livers and brains of rats exposed to NDEA, HFD, or both. In nearly all assays, the adverse effects of HFD+NDEA were worse than either treatment alone. Conclusions Environmental and food contaminant exposures to low, sub-mutagenic levels of nitrosamines, together with chronic HFD feeding, function synergistically to promote major insulin resistance diseases including T2DM, NASH, and AD-type neurodegeneration. Steps to minimize human exposure to nitrosamines and consumption of high-fat content foods are needed to quell these costly and devastating epidemics.

  15. MECP2 promoter methylation and X chromosome inactivation in autism.

    Science.gov (United States)

    Nagarajan, Raman P; Patzel, Katherine A; Martin, Michelle; Yasui, Dag H; Swanberg, Susan E; Hertz-Picciotto, Irva; Hansen, Robin L; Van de Water, Judy; Pessah, Isaac N; Jiang, Ruby; Robinson, Wendy P; LaSalle, Janine M

    2008-06-01

    Epigenetic mechanisms have been proposed to play a role in the etiology of autism. This hypothesis is supported by the discovery of increased MECP2 promoter methylation associated with decreased MeCP2 protein expression in autism male brain. To further understand the influence of female X chromosome inactivation (XCI) and neighboring methylation patterns on aberrant MECP2 promoter methylation in autism, multiple methylation analyses were peformed on brain and blood samples from individuals with autism. Bisulfite sequencing analyses of a region 0.6 kb upstream of MECP2 in brain DNA samples revealed an abrupt transition from a highly methylated region in both sexes to a region unmethylated in males and subject to XCI in females. Chromatin immunoprecipitation analysis demonstrated that the CCTC-binding factor (CTCF) bound to this transition region in neuronal cells, consistent with a chromatin boundary at the methylation transition. Male autism brain DNA samples displayed a slight increase in methylation in this transition region, suggesting a possible aberrant spreading of methylation into the MECP2 promoter in autism males across this boundary element. In addition, autistic female brain DNA samples showed evidence for aberrant MECP2 promoter methylation as an increase in the number of bisulfite sequenced clones with undefined XCI status for MECP2 but not androgen receptor (AR). To further investigate the specificity of MECP2 methylation alterations in autism, blood DNA samples from females and mothers of males with autism were also examined for XCI skewing at AR, but no significant increase in XCI skewing was observed compared to controls. These results suggest that the aberrant MECP2 methylation in autism brain DNA samples is due to locus-specific rather than global X chromosome methylation changes.

  16. Factors associated with numbers of remaining teeth among type 2 diabetes: a cross-sectional study.

    Science.gov (United States)

    Huang, Jui-Chu; Peng, Yun-Shing; Fan, Jun-Yu; Jane, Sui-Whi; Tu, Liang-Tse; Chang, Chang-Cheng; Chen, Mei-Yen

    2013-07-01

    To explore the factors associated with the numbers of remaining teeth among type 2 diabetes community residents. Promoting oral health is an important nursing role for patients with diabetes, especially in disadvantaged areas. However, limited research has been carried out on the relationship between numbers of remaining teeth, diabetes-related biomarkers and personal oral hygiene among diabetic rural residents. A cross-sectional, descriptive design with a simple random sample was used. This study was part of a longitudinal cohort study of health promotion for preventing diabetic foot among rural community diabetic residents. It was carried out in 18 western coastal and inland districts of Chiayi County in central Taiwan. In total, 703 participants were enrolled in this study. The findings indicated that a high percentage of the participants (26%) had no remaining natural teeth. Nearly three quarters (74%) had fewer than 20 natural teeth. After controlling for the potential confounding factors, multivariate analysis demonstrated that the factors determining numbers of remaining teeth were age (p teeth were less tooth-brushing with dental floss, abnormal ankle brachial pressure and poor glycemic control. This study highlights the importance of nursing intervention in oral hygiene for patients with type 2 diabetes. It is necessary to initiate oral health promotion activities when diabetes is first diagnosed, especially for older diabetic residents of rural or coastal areas who are poorly educated. © 2013 John Wiley & Sons Ltd.

  17. Targeted delivery of curcumin for treating type 2 diabetes.

    Science.gov (United States)

    Maradana, Muralidhara Rao; Thomas, Ranjeny; O'Sullivan, Brendan J

    2013-09-01

    Type 2 diabetes is a chronic condition in which cells have reduced insulin signalling, leading to hyperglycemia and long-term complications, including heart, kidney and liver disease. Macrophages activated by dying or stressed cells, induce the transcription factor nuclear factor kappa-B leading to the production of pro-inflammatory cytokines including TNF and IL-6. These inflammatory macrophages in liver and adipose tissue promote insulin resistance, and medications which reduce inflammation and enhance insulin signalling improve glucose control. Curcumin is an anti-oxidant and nuclear factor kappa-B inhibitor derived from turmeric. A number of studies have shown that dietary curcumin reduces inflammation and delays or prevents obesity-induced insulin resistance and associated complications, including atherosclerosis and immune mediate liver disease. Unfortunately dietary curcumin is poorly absorbed by the digestive system and undergoes glucuronidation and excretion rather than being released into the serum and systemically distributed. This confounds understanding of how dietary curcumin exerts its beneficial effects in type 2 diabetes and associated diseases. New improved methods of delivering curcumin are being developed including nanoparticles and lipid/liposome formulations that increase absorption and bioavailability of curcumin. Development and refinement of these technologies will enable cell-directed targeting of curcumin and improved therapeutic outcome. © 2013 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  18. PKCα promotes generation of reactive oxygen species via DUOX2 in hepatocellular carcinoma

    International Nuclear Information System (INIS)

    Wang, Jiajun; Shao, Miaomiao; Liu, Min; Peng, Peike; Li, Lili; Wu, Weicheng; Wang, Lan; Duan, Fangfang; Zhang, Mingming; Song, Shushu; Jia, Dongwei; Ruan, Yuanyuan; Gu, Jianxin

    2015-01-01

    Hepatocellular carcinoma (HCC) remains the second leading cause of cancer-related death worldwide, and elevated rates of reactive oxygen species (ROS) have long been considered as a hallmark of almost all types of cancer including HCC. Protein kinase C alpha (PKCα), a serine/threonine kinase among conventional PKC family, is recognized as a major player in signal transduction and tumor progression. Overexpression of PKCα is commonly observed in human HCC and associated with its poor prognosis. However, how PKCα is involved in hepatocellular carcinogenesis remains not fully understood. In this study, we found that among the members of conventional PKC family, PKCα, but not PKCβI or βII, promoted ROS production in HCC cells. PKCα stimulated generation of ROS by up-regulating DUOX2 at post-transcriptional level. Depletion of DUOX2 abrogated PKCα-induced activation of AKT/MAPK pathways as well as cell proliferation, migration and invasion in HCC cells. Moreover, the expression of DUOX2 and PKCα was well positively correlated in both HCC cell lines and patient samples. Collectively, our findings demonstrate that PKCα plays a critical role in HCC development by inducing DUOX2 expression and ROS generation, and propose a strategy to target PKCα/DUOX2 as a potential adjuvant therapy for HCC treatment. - Highlights: • PKCα promotes the generation of ROS in hepatocellular carcinoma. • PKCα induces ROS production by up-regulating DUOX2 at post-transcriptional level. • DUOX2 is required for PKCα-induced AKT/MAPK activation and tumor progression in HCC. • The expression of PKCα is positively correlated with DUOX2 in HCC

  19. PKCα promotes generation of reactive oxygen species via DUOX2 in hepatocellular carcinoma

    Energy Technology Data Exchange (ETDEWEB)

    Wang, Jiajun; Shao, Miaomiao; Liu, Min; Peng, Peike; Li, Lili; Wu, Weicheng; Wang, Lan [Department of Biochemistry and Molecular Biology, School of Basic Medical Sciences, Fudan University, 200032 Shanghai (China); Duan, Fangfang [Institute of Biomedical Science, Fudan University, Shanghai (China); Zhang, Mingming; Song, Shushu [Department of Biochemistry and Molecular Biology, School of Basic Medical Sciences, Fudan University, 200032 Shanghai (China); Jia, Dongwei, E-mail: jiadongwei@fudan.edu.cn [Department of Biochemistry and Molecular Biology, School of Basic Medical Sciences, Fudan University, 200032 Shanghai (China); Ruan, Yuanyuan, E-mail: yuanyuanruan@fudan.edu.cn [Department of Biochemistry and Molecular Biology, School of Basic Medical Sciences, Fudan University, 200032 Shanghai (China); Gu, Jianxin [Department of Biochemistry and Molecular Biology, School of Basic Medical Sciences, Fudan University, 200032 Shanghai (China); Institute of Biomedical Science, Fudan University, Shanghai (China)

    2015-08-07

    Hepatocellular carcinoma (HCC) remains the second leading cause of cancer-related death worldwide, and elevated rates of reactive oxygen species (ROS) have long been considered as a hallmark of almost all types of cancer including HCC. Protein kinase C alpha (PKCα), a serine/threonine kinase among conventional PKC family, is recognized as a major player in signal transduction and tumor progression. Overexpression of PKCα is commonly observed in human HCC and associated with its poor prognosis. However, how PKCα is involved in hepatocellular carcinogenesis remains not fully understood. In this study, we found that among the members of conventional PKC family, PKCα, but not PKCβI or βII, promoted ROS production in HCC cells. PKCα stimulated generation of ROS by up-regulating DUOX2 at post-transcriptional level. Depletion of DUOX2 abrogated PKCα-induced activation of AKT/MAPK pathways as well as cell proliferation, migration and invasion in HCC cells. Moreover, the expression of DUOX2 and PKCα was well positively correlated in both HCC cell lines and patient samples. Collectively, our findings demonstrate that PKCα plays a critical role in HCC development by inducing DUOX2 expression and ROS generation, and propose a strategy to target PKCα/DUOX2 as a potential adjuvant therapy for HCC treatment. - Highlights: • PKCα promotes the generation of ROS in hepatocellular carcinoma. • PKCα induces ROS production by up-regulating DUOX2 at post-transcriptional level. • DUOX2 is required for PKCα-induced AKT/MAPK activation and tumor progression in HCC. • The expression of PKCα is positively correlated with DUOX2 in HCC.

  20. Facts about Type 2

    Medline Plus

    Full Text Available ... Know Your Risk Diabetes Basics Symptoms Type 1 Type 2 Gestational Myths Statistics Common Terms Genetics Living With Diabetes Recently Diagnosed Treatment & Care Complications Health Insurance For ...

  1. Direct trans-activation of the human cyclin D2 gene by the oncogene product Tax of human T-cell leukemia virus type I.

    Science.gov (United States)

    Huang, Y; Ohtani, K; Iwanaga, R; Matsumura, Y; Nakamura, M

    2001-03-01

    Cyclins are one of the pivotal determinants regulating cell cycle progression. We previously reported that the trans-activator Tax of human T-cell leukemia virus type I (HTLV-I) induces endogenous cyclin D2 expression along with cell cycle progression in a resting human T-cell line, Kit 225, suggesting a role of cyclin D2 in Tax-mediated cell cycle progression. The cyclin D2 gene has a typical E2F binding element, raising the possibility that induction of cyclin D2 expression is a consequence of cell cycle progression. In this study, we examined the role and molecular mechanism of induction of the endogenous human cyclin D2 gene by Tax. Introduction of p19(INK4d), a cyclin dependent kinase (CDK) inhibitor of the INK4 family specific for D-type CDK, inhibited Tax-mediated activation of E2F, indicating requirement of D-type CDK in Tax-mediated activation of E2F. Previously indicated E2F binding element and two NF-kappaB-like binding elements in the 1.6 kbp cyclin D2 promoter fragment had little, if any, effect on responsiveness to Tax. We found that trans-activation of the cyclin D2 promoter by Tax was mainly mediated by a newly identified NF-kappaB-like element with auxiliary contribution of a CRE-like element residing in sequences downstream of -444 which were by themselves sufficient for trans-activation by Tax. These results indicate that Tax directly trans-activates the cyclin D2 gene, resulting in growth promotion and perhaps leukemogenesis through activation of D-type CDK.

  2. Evaluating for impact: what type of data can assist a health promoting school approach?

    Science.gov (United States)

    Joyce, Andrew; Dabrowski, Anna; Aston, Ruth; Carey, Gemma

    2017-04-01

    There is debate within the health promoting school (HPS) movement on whether schools should monitor health behaviour outcomes as part of an evaluation or rely more on process type measures, such as changes to school policies and the physical and social environment which yield information about (in)effective implementation. The debate is often framed around ideological considerations of the role of schools and there is little empirical work on how these indicators of effective implementation can influence change at a policy and practice level in real world settings. Information has potentially powerful effects in motivating a change process, but this will vary according to the type of information and the type of organizational culture into which it is presented. The current predominant model relies on process data, policy and environmental audit monitoring and benchmarking approaches, and there is little evidence of whether this engages school communities. Theoretical assertions on the importance of monitoring data to motivate change need to be empirically tested and, in doing so, we can learn which types of data influence adoption of HPS in which types of school and policy contexts. © The Author 2016. Published by Oxford University Press. All rights reserved. For Permissions, please email: journals.permissions@oup.com.

  3. Facts about Type 2

    Medline Plus

    Full Text Available ... Type 1 Diabetes Enroll in the Living WIth Type 2 Diabetes Program In It Together We Can Help Center for Information Legal Assistance Success Stories ... Tips for Caregivers ...

  4. Update on HER-2 as a target for cancer therapy: The ERBB2 promoter and its exploitation for cancer treatment

    International Nuclear Information System (INIS)

    Hurst, Helen C

    2001-01-01

    Overexpression of the ERBB2 proto-oncogene is associated with amplification of the gene in breast cancer but increased activity of the promoter also plays a significant role. Members of two transcription factor families (AP-2 and Ets) show increased binding to the promoter in over-expressing cells. Consequently, strategies have been devised to target promoter activity, either through the DNA binding sites for these factors, or through another promoter sequence, a polypurine-polypyrimidine repeat structure. The promoter has also been exploited for its tumour-specific activity to direct the accumulation of cytotoxic compounds selectively within cancer cells. Our current understanding of the ERBB2 promoter is reviewed and the status of these therapeutic avenues is discussed

  5. Price-related promotions for tobacco products on Twitter.

    Science.gov (United States)

    Jo, Catherine L; Kornfield, Rachel; Kim, Yoonsang; Emery, Sherry; Ribisl, Kurt M

    2016-07-01

    This cross-sectional study examined price-related promotions for tobacco products on Twitter. Through the Twitter Firehose, we obtained access to all public tweets posted between 6 December 2012 and 20 June 2013 that contained a keyword suggesting a tobacco-related product or behaviour (eg, cigarette, vaping) in addition to a keyword suggesting a price promotion (eg, coupon, discount). From this data set of 155 249 tweets, we constructed a stratified sampling frame based on the price-related keywords and randomly sampled 5000 tweets (3.2%). Tweets were coded for product type and promotion type. Non-English tweets and tweets unrelated to a tobacco or cessation price promotion were excluded, leaving an analytic sample of 2847 tweets. The majority of tweets (97.0%) mentioned tobacco products while 3% mentioned tobacco cessation products. E-cigarettes were the most frequently mentioned product (90.1%), followed by cigarettes (5.4%). The most common type of price promotion mentioned across all products was a discount. About a third of all e-cigarette-related tweets included a discount code. Banned or restricted price promotions comprised about 3% of cigarette-related tweets. This study demonstrates that the vast majority of tweets offering price promotions focus on e-cigarettes. Future studies should examine the extent to which Twitter users, particularly youth, notice or engage with these price promotion tweets. Published by the BMJ Publishing Group Limited. For permission to use (where not already granted under a licence) please go to http://www.bmj.com/company/products-services/rights-and-licensing/

  6. [Type 2 autoimmune polyendocrine syndromes (APS-2)].

    Science.gov (United States)

    Vialettes, Bernard; Dubois-Leonardon, Noémie

    2013-01-01

    Type 2 autoimmune polyendocrine syndromes (APS-2) are the most frequent disorders associating several organ-specific autoimmune diseases. Their high prevalence is due to the fact that the main manifestations of APS-2, such as thyroidal autoimmunity, type 1 diabetes, autoimmune gastric atrophy and vitiligo, are common diseases. APS-2 represents a clinical model that can serve to help unravel the mechanisms underlying autoimmunity. Diagnosis of APS-2 is a challenge for the clinician, especially in poorly symptomatic forms, and may require systematic screening based on measurement of autoantibodies and functional markers.

  7. Ultrasound promoted and SiO2/CCl3COOH mediated synthesis of 2 ...

    Indian Academy of Sciences (India)

    First one-pot synthesis of 2-aryl-1-arylmethyl-1H- benzimidazole derivatives from ... to promote chemical reactions is called sonochemistry .... −1): 1615, 2845, 2980, 3036, 3067; 1H NMR (500MHz,. CDCl3):δ 5.38 (s, 2H, CH2), 6.65 (d, J = 8.0 ...

  8. Type 1 or Type 2 Diabetes and Pregnancy

    Science.gov (United States)

    ... and Pregnancy Articles Type 1 or Type 2 Diabetes and Pregnancy Language: English (US) Español (Spanish) Recommend on Facebook Tweet Share Compartir Problems of Diabetes in Pregnancy Blood sugar that is not well ...

  9. [Surgery for diabetes type 2?].

    Science.gov (United States)

    Müller, Markus K; Nocito, A; Schiesser, M

    2010-02-17

    Diabetes mellitus type 2 is a chronic disease with increasing prevalence in western society. Obesity represents a well established risk factor for the development of diabetes mellitus type 2. Several studies on surgical procedures for the treatment of obesity have shown a postoperative reduction of obesity-related co-morbidities. Thus, diabetes mellitus type 2 was shown to resolve or improve in more than 75% of morbidly obese patients (BMI >35) after bariatric surgery. These insights paved the way for the advent of metabolic surgery - a novel field with the goal to improve glucose metabolism in patients with a BMI of less than 35. Encouraging results from mostly observational studies have sparked the interest in the surgical management of diabetes mellitus type 2.

  10. Simulation and modeling CO2 absorption in biogas with DEA promoted K2CO3 solution in packed column

    Science.gov (United States)

    Nurkhamidah, Siti; Altway, Ali; Airlangga, Bramantyo; Emilia, Dwi Putri

    2017-05-01

    Absorption of carbon dioxide (CO2) using potassium carbonate (K2CO3) is one of biogas purification method. However, K2CO3 have slow mass transfer in liquid phase. So it is necessary to eliminate the disadvantage of CO2 absorption using K2CO3 by adding promotor (activator). Diethanol amine (DEA) is one of promotor which can increase its reaction rate. Simulation and modeling research of the CO2 absorption from biogas with DEA promoted K2CO3 solution has not been conducted. Thus, the main goal of this research is create model and simulation for the CO2 absorption from biogas with DEA promoted K2CO3 solution, then observe the influence of promoter concentration. DEA concentration varies between 1-5 %wt. From the simulation, we concluded that the CO2 removal rise with the increasing of promoter concentration. The highest CO2 removal is 54.5318 % at 5 % wt DEA concentration.

  11. Reduced graphene oxide is not a universal promoter for photocatalytic activities of TiO2

    Directory of Open Access Journals (Sweden)

    Hui Ling Tan

    2017-03-01

    Full Text Available Addition of reduced graphene oxide (RGO to P25 TiO2 was made and its impacts on photocatalytic oxidation of various organic substances were studied. Although the presence of RGO in TiO2 can enhance certain TiO2-based photocatalytic reactions, it is not a universal observation that can be expected in all types of organic substances. The factor of photocatalytic activity enhancement is strongly affected by the various functional groups appeared in the organic substances. In this work, it is realised that the length of alkyl chain in alcohols and carboxylic acids have the minimum influence on the overall activity while the number of hydroxyl groups can promote the further activity enhancement in the presence of RGO.

  12. miR-664 negatively regulates PLP2 and promotes cell proliferation and invasion in T-cell acute lymphoblastic leukaemia

    Energy Technology Data Exchange (ETDEWEB)

    Zhu, Hong; Miao, Mei-hua; Ji, Xue-qiang; Xue, Jun; Shao, Xue-jun, E-mail: xuejunshao@hotmail.com

    2015-04-03

    MicroRNAs (miRNAs) play important roles in the pathogenesis of many types of cancers by negatively regulating gene expression at posttranscriptional level. However, the role of microRNAs in leukaemia, particularly T-cell acute lymphoblastic leukaemia (T-ALL), has remained elusive. Here, we identified miR-664 and its predicted target gene PLP2 were differentially expressed in T-ALL using bioinformatics methods. In T-ALL cell lines, CCK-8 proliferation assay indicated that the cell proliferation was promoted by miR-664, while miR-664 inhibitor could significantly inhibited the proliferation. Moreover, migration and invasion assay showed that overexpression of miR-664 could significantly promoted the migration and invasion of T-ALL cells, whereas miR-664 inhibitor could reduce cell migration and invasion. luciferase assays confirmed that miR-664 directly bound to the 3'untranslated region of PLP2, and western blotting showed that miR-664 suppressed the expression of PLP2 at the protein levels. This study indicated that miR-664 negatively regulates PLP2 and promotes proliferation and invasion of T-ALL cell lines. Thus, miR-664 may represent a potential therapeutic target for T-ALL intervention. - Highlights: • miR-664 mimics promote the proliferation and invasion of T-ALL cells. • miR-664 inhibitors inhibit the proliferation and invasion of T-ALL cells. • miR-664 targets 3′ UTR of PLP2 in T-ALL cells. • miR-664 negatively regulates PLP2 in T-ALL cells.

  13. Morphological changes in different populations of bladder afferent neurons detected by herpes simplex virus (HSV) vectors with cell-type-specific promoters in mice with spinal cord injury.

    Science.gov (United States)

    Shimizu, Nobutaka; Doyal, Mark F; Goins, William F; Kadekawa, Katsumi; Wada, Naoki; Kanai, Anthony J; de Groat, William C; Hirayama, Akihide; Uemura, Hirotsugu; Glorioso, Joseph C; Yoshimura, Naoki

    2017-11-19

    Functional and morphological changes in C-fiber bladder afferent pathways are reportedly involved in neurogenic detrusor overactivity (NDO) after spinal cord injury (SCI). This study examined the morphological changes in different populations of bladder afferent neurons after SCI using replication-defective herpes simplex virus (HSV) vectors encoding the mCherry reporter driven by neuronal cell-type-specific promoters. Spinal intact (SI) and SCI mice were injected into the bladder wall with HSV mCherry vectors driven by the cytomegalovirus (CMV) promoter, CGRP promoter, TRPV1 promoter or neurofilament 200 (NF200) promoter. Two weeks after vector inoculation into the bladder wall, L1 and L6 dorsal root ganglia (DRG) were removed bilaterally for immunofluorescent staining using anti-mCherry antibody. The number of CMV promoter vector-labeled neurons was not altered after SCI. The number of CGRP and TRPV1 promoter vector-labeled neurons was significantly increased whereas the number of NF200 vector-labeled neurons was decreased in L6 DRG after SCI. The median size of CGRP promoter-labeled C-fiber neurons was increased from 247.0 in SI mice to 271.3μm 2 in SCI mice whereas the median cell size of TRPV1 promoter vector-labeled neurons was decreased from 245.2 in SI mice to 216.5μm 2 in SCI mice. CGRP and TRPV1 mRNA levels of laser-captured bladder afferent neurons labeled with Fast Blue were significantly increased in SCI mice compared to SI mice. Thus, using a novel HSV vector-mediated neuronal labeling technique, we found that SCI induces expansion of the CGRP- and TRPV1-expressing C-fiber cell population, which could contribute to C-fiber afferent hyperexcitability and NDO after SCI. Copyright © 2017 IBRO. Published by Elsevier Ltd. All rights reserved.

  14. Facts about Type 2

    Medline Plus

    Full Text Available ... People Working to Stop Diabetes Common Terms Diabetes Statistics Infographics Living with Diabetes Home Recently Diagnosed Where ... Basics Symptoms Type 1 Type 2 Gestational Myths Statistics Common Terms Genetics Living With Diabetes Recently Diagnosed ...

  15. Facts about Type 2

    Medline Plus

    Full Text Available ... Your Risk Alert Day Diabetes Basics Home Symptoms Diagnosis America's Diabetes Challenge Type 1 Type 2 Facts ... Online Community Site Menu Are You at Risk? Diagnosis Lower Your Risk Risk Test Alert Day Prediabetes ...

  16. Vertical transmission of macular telangiectasia type 2.

    Science.gov (United States)

    Delaere, Lien; Spielberg, Leigh; Leys, Anita M

    2012-01-01

    The purpose of this study was to report vertical transmission of macular telangiectasia type 2 and type 2 diabetes mellitus in 3 families. In this retrospective interventional case series, the charts of patients with inherited macular telangiectasia type 2 were reviewed. A large spectrum of presentations of macular telangiectasia type 2 was observed and has been studied with different techniques including best-corrected visual acuity, microperimetry, confocal blue reflectance fundus autofluorescence, fluorescein angiography, and time domain and spectral domain optical coherence tomography. Vertical transmission of macular telangiectasia type 2 and associated type 2 diabetes mellitus is described in 3 families. Symptomatic as well as asymptomatic eyes with macular telangiectasia type 2 were identified. In 2 families, a mother and son experienced visual loss and were diagnosed with macular telangiectasia type 2. All 4 patients had type 2 diabetes. Diabetic retinopathy was observed in one mother and her son. In the third family, the index patient was diagnosed macular telangiectasia type 2 after complaints of metamorphopsia. She and her family members had type 2 diabetes mellitus, and further screening of her family revealed familial macular telangiectasia type 2. None of the patients were treated for macular telangiectasia type 2. Macular telangiectasia type 2 may be more common than previously assumed, as vision can remain preserved and patients may go undiagnosed. Screening of family members is indicated, and detection of mild anomalies is possible using fundus autofluorescence and spectral domain optical coherence tomography.

  17. [Hypertension and insulin treatment in type 2 diabetes].

    Science.gov (United States)

    Ben Salem Hachmi, L; Bouguerra, R; Maatki, O; Smadhi, H; Turki, Z; Hraoui, S; Ben Slama, C

    2007-08-01

    Insulin resistance and endogenous hyperinsulinemia are associated with blood hypertension. The aim of this analysis is to estimate the prevalence of blood hypertension one year after insulin treatment in type 2 diabetic patients. and methods: This is a retrospective clinical study of 178 type 2 diabetic patients (57 men and 121 women) insulin treated since at least one year. Mean age is 62 +/- 10 years and mean duration of diabetes is ten years. All patients had a clinical and biological control before treatment with insulin and at least three controls during the first year of insulin treatment (anthropometric measurements, blood pressure, fasting plasma glucose, HbA1C). WHO definition of hypertension is used (blood pressure >or=140 / 90 mmHg). At baseline, 48% of patients have hypertension. After insulin treatment, the prevalence of hypertension significantly increase to 53% (94 / 178) three months later (p=0.008), to 54.5% (98 / 178) six months later (p=0.001) and to 55.6% (99 / 178) twelve months later. This increase in hypertension frequency is associated with a significant weight gain and a better blood glucose control. Insulin therapy may contribute to the development of blood hypertension. It promotes renal sodium retention and increases sympathetic nervous system activity. In the UKPDS intensive blood glucose control with insulin is not associated with an increase of macro vascular complications. These observational data suggest the need for further study of the relationship between exogenous insulin and hypertension.

  18. EBNA-2 of herpesvirus papio diverges significantly from the type A and type B EBNA-2 proteins of Epstein-Barr virus but retains an efficient transactivation domain with a conserved hydrophobic motif.

    Science.gov (United States)

    Ling, P D; Ryon, J J; Hayward, S D

    1993-01-01

    EBNA-2 contributes to the establishment of Epstein-Barr virus (EBV) latency in B cells and to the resultant alterations in B-cell growth pattern by up-regulating expression from specific viral and cellular promoters. We have taken a comparative approach toward characterizing functional domains within EBNA-2. To this end, we have cloned and sequenced the EBNA-2 gene from the closely related baboon virus herpesvirus papio (HVP). All human EBV isolates have either a type A or type B EBNA-2 gene. However, the HVP EBNA-2 gene falls into neither the type A category nor the type B category, suggesting that the separation into these two subtypes may have been a recent evolutionary event. Comparison of the predicted amino acid sequences indicates 37% amino acid identity with EBV type A EBNA-2 and 35% amino acid identity with type B EBNA-2. To define the domains of EBNA-2 required for transcriptional activation, the DNA binding domain of the GAL4 protein was fused to overlapping segments of EBV EBNA-2. This approach identified a 40-amino-acid (40-aa) EBNA-2 activation domain located between aa 437 and 477. Transactivation ability was completely lost when the amino-terminal boundary of this domain was moved to aa 441, indicating that the motif at aa 437 to 440, Pro-Ile-Leu-Phe, contains residues critical for function. The aa 437 boundary identified in these experiments coincides precisely with a block of conserved sequences in HVP EBNA-2, and the comparable carboxy-terminal region of HVP EBNA-2 also functioned as a strong transcriptional activation domain when fused to the Gal4(1-147) protein. The EBV and HVP EBNA-2 activation domains share a mixed proline-rich, negatively charged character with a striking conservation of positionally equivalent hydrophobic residues. The importance of the individual amino acids making up the Pro-Ile-Leu-Phe motif was examined by mutagenesis. Any alteration of these residues was found to reduce transactivation efficiency, with changes at the

  19. Walking Away from Type 2 diabetes: a cluster randomized controlled trial.

    Science.gov (United States)

    Yates, T; Edwardson, C L; Henson, J; Gray, L J; Ashra, N B; Troughton, J; Khunti, K; Davies, M J

    2017-05-01

    This study aimed to investigate whether an established behavioural intervention, Walking Away from Type 2 Diabetes, is effective at promoting and sustaining increased walking activity when delivered within primary care. Cluster randomized controlled trial involving 10 general practices recruited from Leicestershire, UK, in 2009-2010. Eight hundred and eight (36% female) individuals with a high risk of Type 2 diabetes mellitus, identified through a validated risk score, were included. Participants in five practices were randomized to Walking Away from Type 2 Diabetes, a pragmatic 3-h group-based structured education programme incorporating pedometer use with annual follow-on refresher sessions. The primary outcome was accelerometer assessed ambulatory activity (steps/day) at 12 months. Longer term maintenance was assessed at 24 and 36 months. Results were analysed using generalized estimating equation models, accounting for clustering. Complete accelerometer data for the primary outcome were available for 571 (71%) participants. Increases in ambulatory activity of 411 steps/day [95% confidence interval (CI): 117, 704] and self-reported vigorous-intensity physical activity of 218 metabolic equivalent min/week (95% CI: 6, 425) at 12 months were observed in the intervention group compared with control; differences between groups were not sustained at 36 months. No differences between groups were observed for markers of cardiometabolic health. Replacing missing data with multiple imputation did not affect the results. A pragmatic low-resource group-based structured education programme with pedometer use resulted in modest increases in ambulatory activity compared with control conditions after 12 months when implemented within a primary care setting to those at high risk of Type 2 diabetes mellitus; however, the results were not maintained over 36 months. © 2016 Diabetes UK.

  20. Common variants in the TPH2 promoter confer susceptibility to paranoid schizophrenia.

    Science.gov (United States)

    Yi, Zhenghui; Zhang, Chen; Lu, Weihong; Song, Lisheng; Liu, Dentang; Xu, Yifeng; Fang, Yiru

    2012-07-01

    Serotonergic system-related genes may be good candidates in investigating the genetic basis of schizophrenia. Our previous study suggested that promoter region of tryptophan hydroxylase 2 gene (TPH2) may confer the susceptibility to paranoid schizophrenia. In this study, we investigated whether common variants within TPH2 promoter may predispose to paranoid schizophrenia in Han Chinese. A total of 509 patients who met DSM-IV criteria for paranoid schizophrenia and 510 matched healthy controls were recruited for this study. Five polymorphisms within TPH2 promoter region were tested. No statistically significant differences were found in allele or genotype frequencies between schizophrenic patients and healthy controls. The frequency of the rs4448731T-rs6582071A-rs7963803A-rs4570625T-rs11178997A haplotype was significantly higher in cases compared to the controls (P = 0.003; OR = 1.49; 95% CI, 1.15-1.95). Our results suggest that the common variants within TPH2 promoter are associated with paranoid schizophrenia in Han Chinese. Further studies in larger samples are warranted to elucidate the role of TPH2 in the etiology of paranoid schizophrenia.

  1. Low-Frequency Ultrasound Therapy in Combination Treatment of Patients with Type 2 Diabetes Mellitus

    Directory of Open Access Journals (Sweden)

    YE.E. LAVRINENKO

    2013-04-01

    Results. The beginning of therapeutic effect was observed after 2 procedures of the ultrasound exposure. The maximum effect is appeared after 8–10 treatment sessions. The positive dynamics of complex treatment is improving the general state of health, a disappearance of asthenization, and a decrease in the symptoms of cardiovascular disorders, achieving faster compensation of carbohydrate metabolism. The course of treatment contributed to the hyperglycemia reduction in patients with newly detected type 2 DM. After ultrasound treatment, the authors noted a positive dynamics of clinical symptoms: an improvement of the general health status, a decrease in fatigue, an improvement of psycho-emotional indices, disappearance of pain in the right upper quadrant, and a decrease in liver size in all the patients under study. Conclusions. The use of low-frequency ultrasound therapy on cutaneous projection of the liver in patients with type 2 DM promotes the normalization both fasting and postprandial glycemia. The effect of low-frequency ultrasound on cutaneous projection of the liver is significantly decreasing parameters that characterize the pancreatic insulin synthesizing function (immunoreactive insulin, C-peptide in patients with newly diagnosed type 2 DM and a BMI > 25 kg/m2. Low-frequency ultrasound reduces the glucagon secretion and thereby positively affects the hepatic gluconeogenesis. Ultrasound therapy can be used in the complex treatment of patients with newly diagnosed type 2 DM.

  2. Facts about Type 2

    Medline Plus

    Full Text Available ... Infographics Living with Diabetes Home Recently Diagnosed Where Do I Begin With Type2? Living With Type 1 ... Diabetes at School Tour de Cure Women's Series Do-It-Yourself Fundraising Become a Volunteer American Diabetes ...

  3. Electrochemistry as a Tool for Study, Delvelopment and Promotion of Catalytic Reactions

    DEFF Research Database (Denmark)

    Petrushina, Irina

    of Fermi level by electrochemical production of promoters, reducing or oxidizing current carriers of the catalyst support (O2-, H+, Na+). This type1 was abbreviated as EEPP. In Capters 4-7, the results of my research are given as examples of use of electrochemistry as a tool for study, promotion...... be measured and changed by polarization in electrochemical experiment. In Chapter 3 the nature of the electrochemical heterogeneous catalytic reactions is dicussed, including the new theory of electrochemical promotion. This theory is based on electrochemical change of the Fermi level of the catalyst. It also...... states that that there are two types of electrochemical promotion: First type is based on change of the Fermi level through the charge of the electric double layer (EDL) between catalyst and its support without electrochemical reaction. This effect was abbreviated as EDLE. Second type is based on change...

  4. Facts about Type 2

    Medline Plus

    Full Text Available ... En Español Type 1 Type 2 About Us Online Community Meal Planning Sign In Search: Search More ... Generation of Brilliant Researchers Diabetes Pro: Professional Resources Online We Support Your Doctor Clinical Practice Guidelines Patient ...

  5. An evaluation of the effectiveness of self-management interventions for people with type 2 diabetes after an acute coronary syndrome: a systematic review.

    Science.gov (United States)

    Tanash, Mu'ath Ibrahim; Fitzsimons, Donna; Coates, Vivien; Deaton, Christi

    2017-06-01

    Type 2 diabetes is highly prevalent in patients with acute coronary syndrome and impacts negatively on health outcomes and self-management. Both conditions share similar risk factors. However, there is insufficient evidence on the effectiveness of combined interventions to promote self-management behaviour for people with diabetes and cardiac problems. Identifying critical features of successful interventions will inform future integrated self-management programmes for patients with both conditions. To assess the evidence on the effectiveness of existing interventions to promote self-management behaviour for patients presenting with acute coronary syndrome and type 2 diabetes in secondary care settings and postdischarge. We searched MEDLINE, PubMed, CINAHL Plus, PsycInfo, Cochrane Library and AMED for randomised controlled trials published between January 2005-December 2014. The search was performed using the following search terms of 'acute coronary syndrome', 'type 2 diabetes' and 'self-management intervention' and their substitutes combined. Of 4275 articles that were retrieved, only four trials met all the inclusion criteria (population, intervention, comparison and outcome) and were analysed. Overall, the results show that providing combined interventions for patients with both conditions including educational sessions supported by multimedia or telecommunication technologies was partially successful in promoting self-management behaviours. Implementation of these combined interventions during patient's hospitalisation and postdischarge was feasible. Intervention group subjects reported a significant improvement in self-efficacy, level of knowledge, glycated haemoglobin, blood pressure and fasting glucose test. However, there are many threats have been noticed around internal validity of included studies that could compromise the conclusions drawn. With limited research in this area, there was no final evidence to support effectiveness of combined

  6. Facts about Type 2

    Medline Plus

    Full Text Available ... Honor Donation Donate by phone at 1-800-DIABETES (1-800-342-2383) Donate by mail Why Give? ... My Health Advisor Tools to Know Your Risk Diabetes Basics Symptoms Type 1 Type 2 Gestational Myths Statistics Common Terms Genetics ...

  7. Opioid inhibition of N-type Ca2+ channels and spinal analgesia couple to alternative splicing.

    Science.gov (United States)

    Andrade, Arturo; Denome, Sylvia; Jiang, Yu-Qiu; Marangoudakis, Spiro; Lipscombe, Diane

    2010-10-01

    Alternative pre-mRNA splicing occurs extensively in the nervous systems of complex organisms, including humans, considerably expanding the potential size of the proteome. Cell-specific alternative pre-mRNA splicing is thought to optimize protein function for specialized cellular tasks, but direct evidence for this is limited. Transmission of noxious thermal stimuli relies on the activity of N-type Ca(V)2.2 calcium channels in nociceptors. Using an exon-replacement strategy in mice, we show that mutually exclusive splicing patterns in the Ca(V)2.2 gene modulate N-type channel function in nociceptors, leading to a change in morphine analgesia. Exon 37a (e37a) enhances μ-opioid receptor-mediated inhibition of N-type calcium channels by promoting activity-independent inhibition. In the absence of e37a, spinal morphine analgesia is weakened in vivo but the basal response to noxious thermal stimuli is not altered. Our data suggest that highly specialized, discrete cellular responsiveness in vivo can be attributed to alternative splicing events regulated at the level of individual neurons.

  8. The porcine circovirus type 1 capsid gene promoter improves antigen expression and immunogenicity in a HIV-1 plasmid vaccine

    Directory of Open Access Journals (Sweden)

    Burger Marieta

    2011-02-01

    Full Text Available Abstract Background One of the promising avenues for development of vaccines against Human immunodeficiency virus type 1 (HIV-1 and other human pathogens is the use of plasmid-based DNA vaccines. However, relatively large doses of plasmid must be injected for a relatively weak response. We investigated whether genome elements from Porcine circovirus type 1 (PCV-1, an apathogenic small ssDNA-containing virus, had useful expression-enhancing properties that could allow dose-sparing in a plasmid vaccine. Results The linearised PCV-1 genome inserted 5' of the CMV promoter in the well-characterised HIV-1 plasmid vaccine pTHgrttnC increased expression of the polyantigen up to 2-fold, and elicited 3-fold higher CTL responses in mice at 10-fold lower doses than unmodified pTHgrttnC. The PCV-1 capsid gene promoter (Pcap alone was equally effective. Enhancing activity was traced to a putative composite host transcription factor binding site and a "Conserved Late Element" transcription-enhancing sequence previously unidentified in circoviruses. Conclusions We identified a novel PCV-1 genome-derived enhancer sequence that significantly increased antigen expression from plasmids in in vitro assays, and improved immunogenicity in mice of the HIV-1 subtype C vaccine plasmid, pTHgrttnC. This should allow significant dose sparing of, or increased responses to, this and other plasmid-based vaccines. We also report investigations of the potential of other circovirus-derived sequences to be similarly used.

  9. Pokemon and MEF2D co-operationally promote invasion of hepatocellular carcinoma.

    Science.gov (United States)

    Hong, Xin; Hong, Xing-Yu; Li, Tao; He, Cheng-Yan

    2015-12-01

    Hepatocellular carcinoma (HCC) is one of the most deadly human malignancy, and frequent invasion and metastasis is closely associated with its poor prognosis. However, the molecular mechanism underlying HCC invasion is still not completely elucidated. Pokemon is a well-established oncogene for HCC growth, but its contribution to HCC invasion has not been studied yet. In this paper, Pokemon was found to be overexpressed in MHCC-97H HCC cell line, which possesses higher invasiveness. Downregulation of Pokemon abolished the invasion of MHCC-97H HCC cell lines. Pokemon overexpression was able to enhance the invasion of MHCC-97L cells with lower invasiveness. MEF2D, an oncogene promoting the invasion of HCC cells, was further detected to be upregulated and downregulated when Pokemon was overexpressed and silenced, respectively. Online database analysis indicated that one Pokemon recognition site was located within the promoter of MEF2D. Chromatin co-precipitation, luciferase, and qPCR assays all proved that Pokemon can promote the expression of MEF2D in HCC cells. Restoration of MEF2D expression can prevent the impaired invasion of HCC cells with Pokemon silencing, while suppression of MEF2D abolished the effect of Pokemon overexpression on HCC invasion. More interestingly, MEF2D was also found to increase the transcription of Pokemon by binding myocyte enhancer factor 2 (MEF2) sites within its promoter region, implying an auto-regulatory circuit consisting of these two oncogenes that can promote HCC invasion. Our findings can contribute to the understanding of molecular mechanism underlying HCC invasion, and provided evidence that targeting this molecular loop may be a promising strategy for anti-invasion therapy.

  10. Mortality rate in type 2 myocardial infarction

    DEFF Research Database (Denmark)

    Saaby, Lotte; Poulsen, Tina Svenstrup; Diederichsen, Axel Cosmus Pyndt

    2014-01-01

    myocardial infarction, hypercholesterolemia, high p-creatinine, and diabetes mellitus. The multivariable-adjusted hazard ratio for type 2 myocardial infarction was 2.0 (95% confidence interval, 1.3-3.0). With shock as the only exception, mortality was independent of the triggering conditions leading to type....../119) in those with type 2 myocardial infarction and 26% (92/360) in those with type 1 myocardial infarction (P high age, prior myocardial infarction, type 2...... 2 myocardial infarction. CONCLUSIONS: Mortality in patients with type 2 myocardial infarction is high, reaching approximately 50% after 2 years. Further descriptive and survival studies are needed to improve the scientific evidence on which treatment of type 2 myocardial infarction is based....

  11. 29 CFR 541.503 - Promotion work.

    Science.gov (United States)

    2010-07-01

    ... 29 Labor 3 2010-07-01 2010-07-01 false Promotion work. 541.503 Section 541.503 Labor Regulations... Outside Sales Employees § 541.503 Promotion work. (a) Promotion work is one type of activity often.... Promotion activities directed toward consummation of the employee's own sales are exempt. Promotional...

  12. RLIM interacts with Smurf2 and promotes TGF-β induced U2OS cell migration

    International Nuclear Information System (INIS)

    Huang, Yongsheng; Yang, Yang; Gao, Rui; Yang, Xianmei; Yan, Xiaohua; Wang, Chenji; Jiang, Sirui; Yu, Long

    2011-01-01

    Highlights: → RLIM directly binds to Smurf2. → RLIM enhances TGF-β responsiveness in U2OS cells. → RLIM promotes TGF-β driven migration of osteosarcoma U2OS cells. -- Abstract: TGF-β (transforming growth factor-β), a pleiotropic cytokine that regulates diverse cellular processes, has been suggested to play critical roles in cell proliferation, migration, and carcinogenesis. Here we found a novel E3 ubiquitin ligase RLIM which can directly bind to Smurf2, enhancing TGF-β responsiveness in osteosarcoma U2OS cells. We constructed a U2OS cell line stably over-expressing RLIM and demonstrated that RLIM promoted TGF-β-driven migration of U2OS cells as tested by wound healing assay. Our results indicated that RLIM is an important positive regulator in TGF-β signaling pathway and cell migration.

  13. Clinical potential of sodium-glucose cotransporter 2 inhibitors in the management of type 2 diabetes

    Directory of Open Access Journals (Sweden)

    Kim Y

    2012-08-01

    Full Text Available Yoojin Kim, Ambika R BabuDivision of Endocrinology, John Stroger Jr Hospital of Cook County and Rush University, Chicago, IL, USABackground: The kidney plays an important role in glucose metabolism, and has been considered a target for therapeutic intervention. The sodium-glucose cotransporter type 2 (SGLT2 mediates most of the glucose reabsorption from the proximal renal tubule. Inhibition of SGLT2 leads to glucosuria and provides a unique mechanism to lower elevated blood glucose levels in diabetes. The purpose of this review is to explore the physiology of SGLT2 and discuss several SGLT2 inhibitors which have clinical data in patients with type 2 diabetes.Methods: We performed a PubMed search using the terms "SGLT2" and "SGLT2 inhibitor" through April 10, 2012. Published articles, press releases, and abstracts presented at national and international meetings were considered.Results: SGLT2 inhibitors correct a novel pathophysiological defect, have an insulin-independent action, are efficacious with glycosylated hemoglobin reduction ranging from 0.5% to 1.5%, promote weight loss, have a low incidence of hypoglycemia, complement the action of other antidiabetic agents, and can be used at any stage of diabetes. They are generally well tolerated. However, due to side effects, such as repeated urinary tract and genital infections, increased hematocrit, and decreased blood pressure, appropriate patient selection for drug initiation and close monitoring after initiation will be important. Results of ongoing clinical studies of the effect of SGLT2 inhibitors on diabetic complications and cardiovascular safety are crucial to determine the risk-benefit ratio. A recent decision by the Committee for Medicinal Products for Human Use of the European Medicines Agency has recommended approval of dapagliflozin for the treatment of type 2 diabetes as an adjunct to diet and exercise, in combination with other glucose-lowering medicinal products, including

  14. Promoter de-methylation of cyclin D2 by sulforaphane in prostate cancer cells

    Directory of Open Access Journals (Sweden)

    Hsu Anna

    2011-10-01

    Full Text Available Abstract Sulforaphane (SFN, an isothiocyanate derived from cruciferous vegetables, induces potent anti-proliferative effects in prostate cancer cells. One mechanism that may contribute to the anti-proliferative effects of SFN is the modulation of epigenetic marks, such as inhibition of histone deacetylase (HDAC enzymes. However, the effects of SFN on other common epigenetic marks such as DNA methylation are understudied. Promoter hyper-methylation of cyclin D2, a major regulator of cell cycle, is correlated with prostate cancer progression, and restoration of cyclin D2 expression exerts anti-proliferative effects on LnCap prostate cancer cells. Our study aimed to investigate the effects of SFN on DNA methylation status of cyclin D2 promoter, and how alteration in promoter methylation impacts cyclin D2 gene expression in LnCap cells. We found that SFN significantly decreased the expression of DNA methyltransferases (DNMTs, especially DNMT1 and DNMT3b. Furthermore, SFN significantly decreased methylation in cyclin D2 promoter regions containing c-Myc and multiple Sp1 binding sites. Reduced methlyation of cyclin D2 promoter corresponded to an increase in cyclin D2 transcript levels, suggesting that SFN may de-repress methylation-silenced cyclin D2 by impacting epigenetic pathways. Our results demonstrated the ability of SFN to epigenetically modulate cyclin D2 expression, and provide novel insights into the mechanisms by which SFN may regulate gene expression as a prostate cancer chemopreventive agent.

  15. Stronger enhancer II/core promoter activities of hepatitis B virus isolates of B2 subgenotype than those of C2 subgenotype.

    Science.gov (United States)

    Qin, Yanli; Zhou, Xueshi; Jia, Haodi; Chen, Chaoyang; Zhao, Weifeng; Zhang, Jiming; Tong, Shuping

    2016-07-27

    Hepatitis B virus (HBV) genotype C causes prolonged chronic infection and increased risk for liver cancer than genotype B. Our previous work revealed lower replication capacity of wild-type genotype C2 than B2 isolates. HBV DNA replication is driven by pregenomic RNA, which is controlled by core promoter (CP) and further augmented by enhancer I (ENI) and enhancer II (ENII). DNA fragments covering these regulatory elements were amplified from B2 and C2 isolates to generate luciferase reporter constructs. As ENII is fully embedded in CP, we inserted HBV DNA fragments in the sense orientation to determine their combined activities, and in the antisense orientation to measure enhancer activities alone. Genotype B2 isolates displayed higher ENI+ENII+CP, ENII+CP, and ENII activities, but not ENI or ENI+ENII activity, than C2 isolates. The higher ENII+CP activity was partly attributable to 4 positions displaying genotype-specific variability. Exchanging CP region was sufficient to revert the replication phenotypes of several B2 and C2 clones tested. These results suggest that a weaker ENII and/or CP at least partly accounts for the lower replication capacities of wild-type C2 isolates, which could drive the subsequent acquisition of CP mutations. Such mutations increase genome replication and are implicated in liver cancer development.

  16. Remote and web 2.0 interventions for promoting physical activity.

    Science.gov (United States)

    Foster, Charles; Richards, Justin; Thorogood, Margaret; Hillsdon, Melvyn

    2013-09-30

    year (two studies; 444 participants) was positive and moderate with significant heterogeneity of the observed effects (SMD 0.40; 95% CI 0.04 to 0.76; high quality evidence). The effect of the interventions on self-reported PA at one year (nine studies; 4547 participants) was positive and moderate (SMD 0.20; 95% CI 0.11 to 0.28; moderate quality evidence) with heterogeneity (I 2 = 37%) in the observed effects. One study reported positive results at two years (SMD 0.20; 95% CI 0.08 to 0.32; moderate quality evidence). When studies were stratified by risk of bias, the studies at low risk of bias (eight studies; 3403 participants) had an increased effect (SMD 0.28; 95% CI 0.16 to 0.40; moderate quality evidence). The most effective interventions applied a tailored approach to the type of PA and used telephone contact to provide feedback and to support changes in PA levels. There was no evidence of an increased risk of adverse events (seven studies; 2892 participants). Risk of bias was assessed as low (eight studies; 3060 participants) or moderate (three studies; 2677 participants). There were no differences in effectiveness between studies using different types of professionals delivering the intervention (for example health professional, exercise specialist). There was no difference in pooled estimates between studies that generated the prescribed PA using an automated computer programme versus a human, nor between studies that used pedometers as part of their intervention compared to studies that did not. We found consistent evidence to support the effectiveness of remote and web 2.0 interventions for promoting PA. These interventions have positive, moderate sized effects on increasing self-reported PA and measured cardio-respiratory fitness, at least at 12 months. The effectiveness of these interventions was supported by moderate and high quality studies. However, there continues to be a paucity of cost effectiveness data and studies that include participants from

  17. Association between resistin promoter -420C>G polymorphisms and producing ability with type 2 diabetes mellitus

    Directory of Open Access Journals (Sweden)

    Kuo-Ting Ho

    2017-11-01

    Full Text Available Elevated resistin levels and the polymorphisms located at gene encoding resistin (RETN are associated with diabetic pathogenesis. However, the correlation between RETN genotypes and T2DM is controversial due to discrepancies among reports. This study aimed at investigating and clarifying the putative association of RETN and T2DM in Taiwanese population. The resistin levels and RETN -420C>G genotypes in 244 control and 305 T2DM subjects were examined. Meanwhile, the association between genetic polymorphism of RETN -420C>G and resistin levels, as well as between RETN -420C>G and subjects’ clinical characteristics was statistically analyzed. The RETN -420C>G genotypes (p = 0.01 and G allele (p = 0.002 were significantly associated with T2DM. In addition, concanavalin A-stimulated peripheral blood mononuclear cells from T2DM subjects had higher resistin-secreting ability (p = 0.044. Nevertheless, no significant association between the subjects’ biochemical data and RETN -420 SNPs was found. Our results indicate that RETN -420C>G SNPs and G allele are significantly associated with T2DM. Investigation of RETN polymorphisms in T2DM patients from various ethnic populations are crucial and will contribute to the understanding of this gene in the diabetic etiology. The present results may contribute to gain knowledge on the complex genetic heterogeneity of type 2 diabetes.

  18. Collaborative interplay between FGF-2 and VEGF-C promotes lymphangiogenesis and metastasis

    DEFF Research Database (Denmark)

    Cao, Renhai; Ji, Hong; Feng, Ninghan

    2012-01-01

    Interplay between various lymphangiogenic factors in promoting lymphangiogenesis and lymphatic metastasis remains poorly understood. Here we show that FGF-2 and VEGF-C, two lymphangiogenic factors, collaboratively promote angiogenesis and lymphangiogenesis in the tumor microenvironment, leading...... endothelial cell tip cell formation is a prerequisite for FGF-2-stimulated lymphangiogenesis. In the tumor microenvironment, the reciprocal interplay between FGF-2 and VEGF-C collaboratively stimulated tumor growth, angiogenesis, intratumoral lymphangiogenesis, and metastasis. Thus, intervention and targeting...

  19. Cell-type-specific roles for COX-2 in UVB-induced skin cancer

    Science.gov (United States)

    Herschman, Harvey

    2014-01-01

    In human tumors, and in mouse models, cyclooxygenase-2 (COX-2) levels are frequently correlated with tumor development/burden. In addition to intrinsic tumor cell expression, COX-2 is often present in fibroblasts, myofibroblasts and endothelial cells of the tumor microenvironment, and in infiltrating immune cells. Intrinsic cancer cell COX-2 expression is postulated as only one of many sources for prostanoids required for tumor promotion/progression. Although both COX-2 inhibition and global Cox-2 gene deletion ameliorate ultraviolet B (UVB)-induced SKH-1 mouse skin tumorigenesis, neither manipulation can elucidate the cell type(s) in which COX-2 expression is required for tumorigenesis; both eliminate COX-2 activity in all cells. To address this question, we created Cox-2 flox/flox mice, in which the Cox-2 gene can be eliminated in a cell-type-specific fashion by targeted Cre recombinase expression. Cox-2 deletion in skin epithelial cells of SKH-1 Cox-2 flox/flox;K14Cre + mice resulted, following UVB irradiation, in reduced skin hyperplasia and increased apoptosis. Targeted epithelial cell Cox-2 deletion also resulted in reduced tumor incidence, frequency, size and proliferation rate, altered tumor cell differentiation and reduced tumor vascularization. Moreover, Cox-2 flox/flox;K14Cre + papillomas did not progress to squamous cell carcinomas. In contrast, Cox-2 deletion in SKH-1 Cox-2 flox/flox; LysMCre + myeloid cells had no effect on UVB tumor induction. We conclude that (i) intrinsic epithelial COX-2 activity plays a major role in UVB-induced skin cancer, (ii) macrophage/myeloid COX-2 plays no role in UVB-induced skin cancer and (iii) either there may be another COX-2-dependent prostanoid source(s) that drives UVB skin tumor induction or there may exist a COX-2-independent pathway(s) to UVB-induced skin cancer. PMID:24469308

  20. Microbiota and epigenetic regulation of inflammatory mediators in type 2 diabetes and obesity.

    Science.gov (United States)

    Remely, M; Aumueller, E; Jahn, D; Hippe, B; Brath, H; Haslberger, A G

    2014-03-01

    Metabolic syndrome is associated with alterations in the structure of the gut microbiota leading to low-grade inflammatory responses. An increased penetration of the impaired gut membrane by bacterial components is believed to induce this inflammation, possibly involving epigenetic alteration of inflammatory molecules such as Toll-like receptors (TLRs). We evaluated changes of the gut microbiota and epigenetic DNA methylation of TLR2 and TLR4 in three groups of subjects: type 2 diabetics under glucagon-like peptide-1 agonist therapy, obese individuals without established insulin resistance, and a lean control group. Clostridium cluster IV, Clostridium cluster XIVa, lactic acid bacteria, Faecalibacterium prausnitzii and Bacteroidetes abundances were analysed by PCR and 454 high-throughput sequencing. The epigenetic methylation in the regulatory region of TLR4 and TLR2 was analysed using bisulfite conversion and pyrosequencing. We observed a significantly higher ratio of Firmicutes/ Bacteroidetes in type 2 diabetics compared to lean controls and obese. Major differences were shown in lactic acid bacteria, with the highest abundance in type 2 diabetics, followed by obese and lean participants. In comparison, F. prausnitzii was least abundant in type 2 diabetics, and most abundant in lean controls. Methylation analysis of four CpGs in the first exon of TLR4 showed significantly lower methylation in obese individuals, but no significant difference between type 2 diabetics and lean controls. Methylation of seven CpGs in the promoter region of TLR2 was significantly lower in type 2 diabetics compared to obese subjects and lean controls. The methylation levels of both TLRs were significantly correlated with body mass index. Our data suggest that changes in gut microbiota and thus cell wall components are involved in the epigenetic regulation of inflammatory reactions. An improved diet targeted to induce gut microbial balance and in the following even epigenetic changes of

  1. MLH1-deficient Colorectal Carcinoma With Wild-type BRAF and MLH1 Promoter Hypermethylation Harbor KRAS Mutations and Arise From Conventional Adenomas.

    Science.gov (United States)

    Farchoukh, Lama; Kuan, Shih-Fan; Dudley, Beth; Brand, Randall; Nikiforova, Marina; Pai, Reetesh K

    2016-10-01

    Between 10% and 15% of colorectal carcinomas demonstrate sporadic DNA mismatch-repair protein deficiency as a result of MLH1 promoter methylation and are thought to arise from sessile serrated adenomas, termed the serrated neoplasia pathway. Although the presence of the BRAF V600E mutation is indicative of a sporadic cancer, up to 30% to 50% of colorectal carcinomas with MLH1 promoter hypermethylation will lack a BRAF mutation. We report the clinicopathologic and molecular features of MLH1-deficient colorectal carcinoma with wild-type BRAF and MLH1 promoter hypermethylation (referred to as MLH1-hypermethylated BRAF wild-type colorectal carcinoma, n=36) in comparison with MLH1-deficient BRAF-mutated colorectal carcinoma (n=113) and Lynch syndrome-associated colorectal carcinoma (n=36). KRAS mutations were identified in 31% of MLH1-hypermethylated BRAF wild-type colorectal carcinomas compared with 0% of MLH1-deficient BRAF-mutated colorectal carcinomas and 37% of Lynch syndrome-associated colorectal carcinomas. When a precursor polyp was identified, MLH1-hypermethylated BRAF wild-type colorectal carcinomas arose from precursor polyps resembling conventional tubular/tubulovillous adenomas in contrast to MLH1-deficient BRAF-mutated colorectal carcinomas, which arose from precursor sessile serrated adenomas (PMLH1-hypermethylated BRAF wild-type colorectal carcinoma and MLH1-deficient BRAF-mutated colorectal carcinoma had a predilection for the right colon compared with Lynch syndrome-associated colorectal carcinoma (86% vs. 92% vs. 49%, P0.05). In conclusion, our results indicate that MLH1-hypermethylated BRAF wild-type colorectal carcinomas can harbor KRAS mutations and arise from precursor polyps resembling conventional tubular/tubulovillous adenomas.

  2. Polymorphisms in promoter sequences of MDM2, p53, and p16INK4a genes in normal Japanese individuals

    Directory of Open Access Journals (Sweden)

    Yasuhito Ohsaka

    2010-01-01

    Full Text Available Research has been conducted to identify sequence polymorphisms of gene promoter regions in patients and control subjects, including normal individuals, and to determine the influence of these polymorphisms on transcriptional regulation in cells that express wild-type or mutant p53. In this study we isolated genomic DNA from whole blood of healthy Japanese individuals and sequenced the promoter regions of the MDM2, p53, and p16INK4a genes. We identified polymorphisms comprising 3 nucleotide substitutions at exon 1 and intron 1 regions of the MDM2 gene and 1 nucleotide insertion at a poly(C nucleotide position in the p53 gene. The Japanese individuals also exhibited p16INK4a polymorphisms at several positions, including position -191. Reporter gene analysis by using luciferase revealed that the polymorphisms of MDM2, p53, and p16INK4a differentially altered luciferase activities in several cell lines, including the Colo320DM, U251, and T98G cell lines expressing mutant p53. Our results indicate that the promoter sequences of these genes differ among normal Japanese individuals and that polymorphisms can alter gene transcription activity.

  3. The Milieu of Damaged Alveolar Epithelial Type 2 Cells Stimulates Alveolar Wound Repair by Endogenous and Exogenous Progenitors

    Science.gov (United States)

    Buckley, Susan; Shi, Wei; Carraro, Gianni; Sedrakyan, Sargis; Da Sacco, Stefano; Driscoll, Barbara A.; Perin, Laura; De Filippo, Roger E.

    2011-01-01

    Alveolar epithelial integrity is dependent upon the alveolar milieu, yet the milieu of the damaged alveolar epithelial cell type 2 (AEC2) has been little studied. Characterization of its components may offer the potential for ex vivo manipulation of stem cells to optimize their therapeutic potential. We examined the cytokine profile of AEC2 damage milieu, hypothesizing that it would promote endogenous epithelial repair while recruiting cells from other locations and instructing their engraftment and differentiation. Bronchoalveolar lavage and lung extract from hyperoxic rats represented AEC2 in vivo damage milieu, and medium from a scratch-damaged AEC2 monolayer represented in vitro damage. CINC-2 and ICAM, the major cytokines detected by proteomic cytokine array in AEC2 damage milieu, were chemoattractive to normoxic AECs and expedited in vitro wound healing, which was blocked by their respective neutralizing antibodies. The AEC2 damage milieu was also chemotactic for exogenous uncommitted human amniotic fluid stem cells (hAFSCs), increasing migration greater than 20-fold. hAFSCs attached within an in vitro AEC2 wound and expedited wound repair by contributing cytokines migration inhibitory factor and plasminogen activator inhibitor 1 to the AEC2 damage milieu, which promoted wound healing. The AEC2 damage milieu also promoted differentiation of a subpopulation of hAFSCs to express SPC, TTF-1, and ABCA3, phenotypic markers of distal alveolar epithelium. Thus, the microenvironment created by AEC2 damage not only promotes autocrine repair but also can attract uncommitted stem cells, which further augment healing through cytokine secretion and differentiation. PMID:21700959

  4. Development of a situation-specific theory for explaining health-related quality of life among older South Korean adults with type 2 diabetes.

    Science.gov (United States)

    Chang, Sun Ju; Im, Eun-Ok

    2014-01-01

    The purpose of the study was to develop a situation-specific theory for explaining health-related quality of life (QOL) among older South Korean adults with type 2 diabetes. To develop a situation-specific theory, three sources were considered: (a) the conceptual model of health promotion and QOL for people with chronic and disabling conditions (an existing theory related to the QOL in patients with chronic diseases); (b) a literature review using multiple databases including Cumulative Index for Nursing and Allied Health Literature (CINAHL), PubMed, PsycINFO, and two Korean databases; and (c) findings from our structural equation modeling study on health-related QOL in older South Korean adults with type 2 diabetes. The proposed situation-specific theory is constructed with six major concepts including barriers, resources, perceptual factors, psychosocial factors, health-promoting behaviors, and health-related QOL. The theory also provides the interrelationships among concepts. Health care providers and nurses could incorporate the proposed situation-specific theory into development of diabetes education programs for improving health-related QOL in older South Korean adults with type 2 diabetes.

  5. Apolipoprotein M predicts pre-beta-HDL formation: studies in type 2 diabetic and nondiabetic subjects

    DEFF Research Database (Denmark)

    Plomgaard, P; Dullaart, R P F; de Vries, R

    2009-01-01

    protein (PLTP) activity and the ability of plasma to promote cholesterol efflux from cultured fibroblasts. RESULTS: ApoM was approximately 9% lower in patients with type 2 diabetes compared to controls (0.025 +/- 0.006 vs. 0.027 +/- 0.007 g L(-1), P = 0.01). The difference in apoM was largely attributable...... diabetes. Pre-beta-HDL and pre-beta-HDL formation are positively associated with apoM, supporting the hypothesis that apoM plays a role in HDL remodelling in humans. Lower apoM may provide a mechanism to explain why pre-beta-HDL formation is not increased in type 2 diabetes despite elevated PLTP activity.......OBJECTIVE: Studies in mice suggest that plasma apoM is lowered in hyperinsulinaemic diabetes and that apoM stimulates formation of pre-beta-HDL. Pre-beta-HDL is an acceptor of cellular cholesterol and may be critical for reverse cholesterol transport. Herein, we examined whether patients with type...

  6. Facts about Type 2

    Medline Plus

    Full Text Available ... 2 Enroll in the Living WIth Type 2 Diabetes Program Gestational What is Gestational Diabetes? How to Treat Gestational Diabetes Genetics of Diabetes Diabetes Myths A Day in ...

  7. Promoter characterization and genomic organization of the human X11β gene APBA2.

    LENUS (Irish Health Repository)

    Hao, Yan

    2012-02-15

    Overexpression of neuronal adaptor protein X11β has been shown to decrease the production of amyloid-β, a toxic peptide deposited in Alzheimer\\'s disease brains. Therefore, manipulation of the X11β level may represent a potential therapeutic strategy for Alzheimer\\'s disease. As X11β expression can be regulated at the transcription level, we determined the genomic organization and the promoter of the human X11β gene, amyloid β A4 precursor protein-binding family A member 2 (APBA2). By RNA ligase-mediated rapid amplification of cDNA ends, a single APBA2 transcription start site and the complete sequence of exon 1 were identified. The APBA2 promoter was located upstream of exon 1 and was more active in neurons. The core promoter contains several CpG dinucleotides, and was strongly suppressed by DNA methylation. In addition, mutagenesis analysis revealed a putative Pax5-binding site within the promoter. Together, APBA2 contains a potent neuronal promoter whose activity may be regulated by DNA methylation and Pax5.

  8. Loss of the NKX3.1 tumorsuppressor promotes the TMPRSS2-ERG fusion gene expression in prostate cancer

    International Nuclear Information System (INIS)

    Thangapazham, Rajesh; Saenz, Francisco; Katta, Shilpa; Mohamed, Ahmed A; Tan, Shyh-Han; Petrovics, Gyorgy; Srivastava, Shiv; Dobi, Albert

    2014-01-01

    In normal prostate epithelium the TMPRSS2 gene encoding a type II serine protease is directly regulated by male hormones through the androgen receptor. In prostate cancer ERG protooncogene frequently gains hormonal control by seizing gene regulatory elements of TMPRSS2 through genomic fusion events. Although, the androgenic activation of TMPRSS2 gene has been established, little is known about other elements that may interact with TMPRSS2 promoter sequences to modulate ERG expression in TMPRSS2-ERG gene fusion context. Comparative genomic analyses of the TMPRSS2 promoter upstream sequences and pathway analyses were performed by the Genomatix Software. NKX3.1 and ERG genes expressions were evaluated by immunoblot or by quantitative Real-Time PCR (qRT-PCR) assays in response to siRNA knockdown or heterologous expression. QRT-PCR assay was used for monitoring the gene expression levels of NKX3.1-regulated genes. Transcriptional regulatory function of NKX3.1 was assessed by luciferase assay. Recruitment of NKX3.1 to its cognate elements was monitored by Chromatin Immunoprecipitation assay. Comparative analysis of the TMPRSS2 promoter upstream sequences among different species revealed the conservation of binding sites for the androgen inducible NKX3.1 tumor suppressor. Defects of NKX3.1, such as, allelic loss, haploinsufficiency, attenuated expression or decreased protein stability represent established pathways in prostate tumorigenesis. We found that NKX3.1 directly binds to TMPRSS2 upstream sequences and negatively regulates the expression of the ERG protooncogene through the TMPRSS2-ERG gene fusion. These observations imply that the frequently noted loss-of-function of NKX3.1 cooperates with the activation of TMPRSS2-ERG fusions in prostate tumorigenesis

  9. Expanded [CCTG]n repetitions are not associated with abnormal methylation at the CNBP locus in myotonic dystrophy type 2 (DM2) patients.

    Science.gov (United States)

    Santoro, Massimo; Fontana, Luana; Maiorca, Francesca; Centofanti, Federica; Massa, Roberto; Silvestri, Gabriella; Novelli, Giuseppe; Botta, Annalisa

    2018-03-01

    Myotonic Dystrophy type 2 (DM2) is a multisystemic disorder associated with an expanded [CCTG]n repeat in intron 1 of the CNBP gene. Epigenetic modifications have been reported in many repeat expansion disorders, including myotonic dystrophy type 1 (DM1), either as a mechanism to explain somatic repeat instability or transcriptional alterations in disease genes. The purpose of our work was to determine the effect of DM2 mutation on the methylation status of CpG islands localized in the 5' promoter region and in the 3' end of the [CCTG]n expansion of the CNBP gene. By bisulfite pyrosequencing, we characterized the methylation profile of two different CpG islands within these regions, either in whole blood and skeletal muscle tissues of DM2 patients (n=72 and n=7, respectively) and controls (n=50 and n=7, respectively). Moreover, we compared the relative mRNA transcript levels of CNBP gene in leukocytes and in skeletal muscle tissues from controls and DM2 patients. We found that CpG sites located in the promoter region showed hypomethylation, whereas CpG sites at 3' end of the CCTG array are hypermethylated. Statistical analyses did not demonstrate any significant differences in the methylation profile between DM2 patients and controls in both tissues analyzed. According to the methylation analysis, CNBP gene expression levels are not significantly altered in DM2 patients. These results show that [CCTG]n repeat expansion, differently from the DM1 mutation, does not influence the methylation status of the CNBP gene and suggest that other molecular mechanisms are involved in the pathogenesis of DM2. Copyright © 2018 Elsevier B.V. All rights reserved.

  10. Effectiveness of a brief theory-based health promotion intervention among adults at high risk of type 2 diabetes

    DEFF Research Database (Denmark)

    Juul, Lise; Andersen, Vibeke Just; Arnoldsen, Jette

    2016-01-01

    . Interventionsgruppen rapporterede dog positive ændringer ved 3 måneders opfølgning i forhold til oplevet handlekompetence, fysisk aktivitet og energiindtag. Der er tale om interessante og positive resultater i forhold til forebyggelse af type 2-diabetes. Studiet bygger på data fra 127 borgere og er lavet i tæt...

  11. Reducing health risk in family members of patients with type 2 diabetes: views of first degree relatives

    Directory of Open Access Journals (Sweden)

    O'Sullivan Bernadette

    2009-12-01

    Full Text Available Abstract Background Patients with type 2 diabetes can have an important role in discussing health risk within families. This study aimed to establish the acceptability to first degree relatives towards their relative with type 2 diabetes intervening as health promoters in their own families, using the Health Belief Model as a theoretical framework for evaluation. Methods Cross-sectional questionnaire design. Survey questionnaire for first degree relative (sibling or child mailed to a random sample of patients with type 2 diabetes registered with an urban hospital diabetes clinic (n = 607 eligible patients. Patients were asked to pass on questionnaires to one to two first degree relatives. Results Questionnaires were returned from 257 families (42% response rate with two responses provided by 107 families (a total of 364 questionnaires. The majority (94% of first degree relatives of patients with type 2 diabetes would like to be informed about reducing their risk. Half (48% of respondents reported being spoken to by a relative with type 2 diabetes about their risk of diabetes. Those spoken to were more likely to see themselves at risk of diabetes, to worry about developing diabetes and to view diabetes as a serious condition. Conclusions A role for patients with type 2 diabetes in discussing health risk in their family appears to be acceptable to many relatives. Discussion of risk and interventions to reduce health risk with their relatives should be encouraged in patients with type 2 diabetes.

  12. Reducing health risk in family members of patients with type 2 diabetes: views of first degree relatives.

    LENUS (Irish Health Repository)

    Whitford, David L

    2009-01-01

    BACKGROUND: Patients with type 2 diabetes can have an important role in discussing health risk within families. This study aimed to establish the acceptability to first degree relatives towards their relative with type 2 diabetes intervening as health promoters in their own families, using the Health Belief Model as a theoretical framework for evaluation. METHODS: Cross-sectional questionnaire design. Survey questionnaire for first degree relative (sibling or child) mailed to a random sample of patients with type 2 diabetes registered with an urban hospital diabetes clinic (n = 607 eligible patients). Patients were asked to pass on questionnaires to one to two first degree relatives. RESULTS: Questionnaires were returned from 257 families (42% response rate) with two responses provided by 107 families (a total of 364 questionnaires). The majority (94%) of first degree relatives of patients with type 2 diabetes would like to be informed about reducing their risk. Half (48%) of respondents reported being spoken to by a relative with type 2 diabetes about their risk of diabetes. Those spoken to were more likely to see themselves at risk of diabetes, to worry about developing diabetes and to view diabetes as a serious condition. CONCLUSIONS: A role for patients with type 2 diabetes in discussing health risk in their family appears to be acceptable to many relatives. Discussion of risk and interventions to reduce health risk with their relatives should be encouraged in patients with type 2 diabetes.

  13. Mutational analysis of the UCP2 core promoter and relationships of variants with obesity

    DEFF Research Database (Denmark)

    Dalgaard, Louise T; Andersen, Gitte; Larsen, Lesli H

    2003-01-01

    To identify polymorphisms in the human uncoupling protein 2 gene (UCP2) promoter and to investigate whether these were associated with obesity or weight gain.......To identify polymorphisms in the human uncoupling protein 2 gene (UCP2) promoter and to investigate whether these were associated with obesity or weight gain....

  14. VHL type 2B mutations retain VBC complex form and function.

    Directory of Open Access Journals (Sweden)

    Kathryn E Hacker

    Full Text Available von Hippel-Lindau disease is characterized by a spectrum of hypervascular tumors, including renal cell carcinoma, hemangioblastoma, and pheochromocytoma, which occur with VHL genotype-specific differences in penetrance. VHL loss causes a failure to regulate the hypoxia inducible factors (HIF-1alpha and HIF-2alpha, resulting in accumulation of both factors to high levels. Although HIF dysregulation is critical to VHL disease-associated renal tumorigenesis, increasing evidence points toward gradations of HIF dysregulation contributing to the degree of predisposition to renal cell carcinoma and other manifestations of the disease.This investigation examined the ability of disease-specific VHL missense mutations to support the assembly of the VBC complex and to promote the ubiquitylation of HIF. Our interaction analysis supported previous observations that VHL Type 2B mutations disrupt the interaction between pVHL and Elongin C but maintain partial regulation of HIF. We additionally demonstrated that Type 2B mutant pVHL forms a remnant VBC complex containing the active members ROC1 and Cullin-2 which retains the ability to ubiquitylate HIF-1alpha.Our results suggest that subtypes of VHL mutations support an intermediate level of HIF regulation via a remnant VBC complex. These findings provide a mechanism for the graded HIF dysregulation and genetic predisposition for cancer development in VHL disease.

  15. Facts about Type 2

    Medline Plus

    Full Text Available ... a Member Donate Now! One Time Monthly In Memory In Honor Become a Member En Español Type 1 Type 2 About Us Online Community Meal Planning Sign In Search: Search More Sites Search ≡ Are You At Risk? Diabetes Basics Living with Diabetes Food & Fitness In My Community Advocacy Research & Practice Ways ...

  16. Gene Expression in Class 2 Integrons Is SOS-Independent and Involves Two Pc Promoters.

    Science.gov (United States)

    Jové, Thomas; Da Re, Sandra; Tabesse, Aurore; Gassama-Sow, Amy; Ploy, Marie-Cécile

    2017-01-01

    Integrons are powerful bacterial genetic elements that permit the expression and dissemination of antibiotic-resistance gene cassettes. They contain a promoter Pc that allows the expression of gene cassettes captured through site-specific recombination catalyzed by IntI, the integron-encoded integrase. Class 1 and 2 integrons are found in both clinical and environmental settings. The regulation of intI and of Pc promoters has been extensively studied in class 1 integrons and the regulatory role of the SOS response on intI expression has been shown. Here we investigated class 2 integrons. We characterized the P intI2 promoter and showed that intI2 expression is not regulated via the SOS response. We also showed that, unlike class 1 integrons, class 2 integrons possess not one but two active Pc promoters that are located within the attI2 region that seem to contribute equally to gene cassette expression. Class 2 integrons mostly encode an inactive truncated integrase, but the rare class 2 integrons that encode an active integrase are associated with less efficient Pc2 promoter variants. We propose an evolutionary model for class 2 integrons in which the absence of repression of the integrase gene expression led to mutations resulting in either inactive integrase or Pc variants of weaker activity, thereby reducing the potential fitness cost of these integrons.

  17. Characterization of the promoter region of the human c-erbB-2 protooncogene

    International Nuclear Information System (INIS)

    Ishii, S.; Imamoto, F.; Yamanashi, Y.; Toyoshima, K.; Yamamoto, T.

    1987-01-01

    Three overlapping genomic clones that contain the 5'-terminal portion of the human c-erbB-2 gene (ERBB2) were isolated. The promoter region was identified by nuclease S1 mapping with c-erbB-2 mRNA. Seven transcriptional start sites were identified. DNA sequence analysis showed that the promoter region contains a TATA box and a CAAT box about 30 and 80 base pairs (bp), respectively, upstream of the most downstream RNA initiation site. Two putative binding sites for transcription factor Sp1 were identified about 50 and 110 bp upstream of the CAAT box, and six GGA repeats were found between the CAAT box and the TATA box. This region had strong promoter activity when placed upstream of the bacterial chloramphenicol acetyltransferase gene and transfected into monkey CV-1 cells. These data indicate that the promoter of the human c-erbB-2 protooncogene is different from that of the protooncogene c-erbB-1 (epidermal growth factor receptor gene), which does not contain either a TATA box or a CAAT box. Comparison of the promoter sequences and activities of the two protooncogenes should be helpful in analysis of the regulatory mechanism of expression of their gene products, which are growth-factor receptors

  18. Identification of an ovine atadenovirus gene whose product activates the viral E2 promoter: possible involvement of E2F-1

    International Nuclear Information System (INIS)

    Kuemin, Daniel; Hofmann, Christian; Uckert, Wolfgang; Both, Gerald W.; Loeser, Peter

    2004-01-01

    Activation of the adenoviral E2 promoter is an early step in adenovirus gene expression. For members of the mast- and aviadenoviruses, this requires induction of the cellular transcription factor E2F by virally encoded gene products such as E1A, E4orf6/7 and orf22/GAM-1. The newly recognized genus atadenovirus, of which the ovine isolate OAdV is the prototype, lacks any sequence homology to those genes. To find a possible link between E2 promoter activation and OAdV gene expression, we utilized a screening method to search for genes within the OAdV genome that were capable of stimulating the viral E2 promoter. One such gene, E43, was identified within the proposed E4 region toward the right-hand end of the OAdV genome. The E43 gene product was also found to be capable of stimulating E2F-1-dependent gene expression. A closer inspection of the E2 promoter revealed the presence of a non-palindromic E2F binding site within the OAdV E2 promoter. Mutation of this site markedly reduced both E2F-1- and E43-dependent promoter activation. Moreover, a direct protein-protein interaction of the E43 gene product with E2F, but not with the retinoblastoma protein pRb, suggested a possible cooperation between these two proteins in activating the E2 promoter. The importance of the E43 gene product for virus replication is also underlined by the finding that an OAdV recombinant with a functionally inactivated E43 gene showed severely inhibited virus growth

  19. Pattern of thyroid auto immunity in type 1 and type 2 diabetics

    International Nuclear Information System (INIS)

    Yasmin, T.

    2006-01-01

    To determine the level of thyroid auto immunity among clinically euthyroid patients of type 1 and type 2 diabetics and to correlate the levels with pattern of diabetes. Blood samples were collected from 163 subjects (51 of type 1, 61 of type 2 diabetics and 51 non- diabetic controls) and sera were separated. They were all clinically euthyroid and selected conveniently. Thyroid profile (FT4, TSH and anti- TPO) was assessed in the three groups and compared. It was observed that at a cut off value of less than 100 units of anti-TPO level was normal, raised anti-TPO antibodies were found in 12% of normal control group, 61% in type 1 and 42.3% in type 2 diabetics. In type 1 diabetics, the TSH was higher in the younger age patients with progressive rise in anti-TPO antibodies level by age. The TSH, anti-TPO antibodies and BSF were significantly higher in type 1 diabetics than in the controls. In type 2 diabetics, TSH was moderately low but anti-TPO antibodies and BSF were higher than in the controls (author)

  20. [Development of a new type of biological organic fertilizer and its effect on the growth promotion of tomato].

    Science.gov (United States)

    Liu, Qiu Mei; Chen, Xing; Meng, Xiao Hui; Ye, Qi; Li, Tuo; Liu, Dong Yang; Shen, Qi Rong

    2017-10-01

    The objective of this study was to improve the ability of sporulation production of Trichoderma guizhouense NJAU4742 under solid state fermentation by using rice straw and amino acids as resources, and the fermentation products were used as inoculants of the organic fertilizers adding with different ratios of amino acids solution to develop a new type of biological organic fertilizer. The results indicated that the optimal condition for sporulation by T. guizhouense NJAU4742 was soaking in 30 times diluted amino acid solution for one whole night, with initial pH 3.5, 75% of moisture content and 30% of corn powder, under which the sporulation reached to 2.40×10 10 CFU·g -1 . The fermentation products were inoculated at 2% into the mature organic fertilizer containing 20% of amino acids solution, and the sporulation and IAA content were 6.40×10 9 CFU·g -1 and 38.66 mg·kg -1 , which were 1142.30 and 1.42 times higher than that of CK after 7 days, respectively. Pot experiment showed that biological organic fertilizer could significantly promote the growth of tomato, and the height of the tomato increased by 98.8% and 23.8%, respectively, compared with CK. The stem diameters of AT (amino acids + mature organic fertilizer + T. guizhouense NJAU4742) and AA (amino acids + mature organic fertilizer) were increased by 58.9% and 10.3%, respectively, compared with CK. As for the chlorophyll, leaf length and leaf width, the values also increased significantly. The highest spore content was obtained by using amino acids and rice straw as substrates under solid state fermentation (SSF), which overcame the difficulties of producing new type of biological organic fertilizer during the large scale industrial production. Biological organic fertilizer and amino acids organic fertilizer could significantly promote the growth of tomato compared with the chemical fertilizer, and had a good application prospect in intensive agriculture.

  1. Reduced MeCP2 expression is frequent in autism frontal cortex and correlates with aberrant MECP2 promoter methylation.

    Science.gov (United States)

    Nagarajan, Raman P; Hogart, Amber R; Gwye, Ynnez; Martin, Michelle R; LaSalle, Janine M

    2006-01-01

    Mutations in MECP2, encoding methyl CpG binding protein 2 (MeCP2), cause most cases of Rett syndrome (RTT), an X-linked neurodevelopmental disorder. Both RTT and autism are "pervasive developmental disorders" and share a loss of social, cognitive and language skills and a gain in repetitive stereotyped behavior, following apparently normal perinatal development. Although MECP2 coding mutations are a rare cause of autism, MeCP2 expression defects were previously found in autism brain. To further study the role of MeCP2 in autism spectrum disorders (ASDs), we determined the frequency of MeCP2 expression defects in brain samples from autism and other ASDs. We also tested the hypotheses that MECP2 promoter mutations or aberrant promoter methylation correlate with reduced expression in cases of idiopathic autism. MeCP2 immunofluorescence in autism and other neurodevelopmental disorders was quantified by laser scanning cytometry and compared with control postmortem cerebral cortex samples on a large tissue microarray. A significant reduction in MeCP2 expression compared to age-matched controls was found in 11/14 autism (79%), 9/9 RTT (100%), 4/4 Angelman syndrome (100%), 3/4 Prader-Willi syndrome (75%), 3/5 Down syndrome (60%), and 2/2 attention deficit hyperactivity disorder (100%) frontal cortex samples. One autism female was heterozygous for a rare MECP2 promoter variant that correlated with reduced MeCP2 expression. A more frequent occurrence was significantly increased MECP2 promoter methylation in autism male frontal cortex compared to controls. Furthermore, percent promoter methylation of MECP2 significantly correlated with reduced MeCP2 protein expression. These results suggest that both genetic and epigenetic defects lead to reduced MeCP2 expression and may be important in the complex etiology of autism.

  2. Medical cost of type 2 diabetes attributable to physical inactivity in the United States in 2012.

    Science.gov (United States)

    Shah, Priyank; Shamoon, Fayez; Bikkina, Mahesh; Kohl, Harold W

    Type 2 diabetes has grown to epidemic proportions in the U.S. and physical activity levels in the population continues to remain low, although it is one of the primary preventive strategies for diabetes. The objectives of this study were to estimate the direct medical costs of type 2 diabetes attributable to not meeting physical activity Guidelines and to physical inactivity in the U.S. in 2012. This was a cross sectional study that used physical activity prevalence data from the Behavioral Risk Factor Surveillance System to estimate the population attributable risk percentage for type 2 diabetes. These data were combined with the prevalence and cost data of type 2 diabetes to estimate the cost of type 2 diabetes attributable to not meeting physical activity Guidelines and to inactivity in 2012. The cost of type 2 diabetes in the U.S. in 2012, attributable to not meeting physical activity guidelines was estimated to be $18.3 billion, and that attributable to physical inactivity was estimated to be $4.65 billion. Based on sensitivity analyses, these estimates ranged from $10.19 billion to $27.43 billion for not meeting physical activity guidelines and $2.59 billion-$6.98 billion for physical inactivity in the year 2012. This study shows that billions of dollars could be saved annually just in terms of type 2 diabetes cost in the U.S., if the entire adult population met physical activity guidelines. Physical activity promotion, particularly at the environmental and policy level should be a priority in the population. Copyright © 2016 Diabetes India. Published by Elsevier Ltd. All rights reserved.

  3. CO_2 capture from flue gas using clathrate formation in the presence of thermodynamic promoters

    International Nuclear Information System (INIS)

    Kim, Soyoung; Choi, Sung-Deuk; Seo, Yongwon

    2017-01-01

    Tetrahydrofuran (THF) as a water-soluble sII clathrate former, cyclopentane (CP) as a water-insoluble sII clathrate former, and tetra n-butyl ammonium chloride (TBAC) as a water-soluble semiclathrate former were used to investigate their thermodynamic promotion effects on clathrate-based CO_2 capture from simulated flue gas. The phase equilibria of CO_2 (20%) + N_2 (80%) + promoter clathrates at different promoter concentrations revealed that the presence of THF, CP, and TBAC could significantly reduce the clathrate formation pressure. THF solutions provided the highest gas uptake and steepest CO_2 concentration changes in the vapor phase, whereas TBAC solutions showed the highest CO_2 selectivity (∼61%) in the clathrate phase. CP solutions exhibited a slower formation rate, but their final gas uptake and CO_2 selectivity in the clathrate phase were comparable to the THF solutions. Raman spectroscopy confirmed the enclathration of both CO_2 and N_2 in the clathrate cages and a structural transition due to the inclusion of promoters in the clathrate phase. The overall experimental results indicate that TBAC is a viable thermodynamic promoter for clathrate-based CO_2 capture from simulated flue gas, considering the lower pressure requirement for clathrate formation, higher CO_2 enrichment in the clathrate phase, non-toxicity, and non-volatility. - Highlights: • Clathrate-based CO_2 capture was investigated in the presence of thermodynamic promoters. • THF, CP, and TBAC demonstrated a significant thermodynamic promotion for CO_2 (20%) + N_2 (80%) clathrates. • The highest gas uptake was observed for the THF (5.6 mol%) solution. • TBAC solutions showed the highest CO_2 selectivity in the clathrate phase (∼61%). • Raman spectroscopy confirmed the guest gas enclathration and clathrate structure.

  4. Facts about Type 2

    Medline Plus

    Full Text Available ... or heart. Some people with type 2 can control their blood glucose with healthy eating and being ... 2 Recently Diagnosed Treatment and Care Blood Glucose Control Complications Medication Doctors, Nurses & More Enroll in the ...

  5. Sodium-glucose co-transporter type 2 inhibitors reduce evening home blood pressure in type 2 diabetes with nephropathy.

    Science.gov (United States)

    Takenaka, Tsuneo; Kishimoto, Miyako; Ohta, Mari; Tomonaga, Osamu; Suzuki, Hiromichi

    2017-05-01

    The effects of sodium-glucose co-transporter type 2 inhibitors on home blood pressure were examined in type 2 diabetes with nephropathy. The patients with diabetic nephropathy were screened from medical records in our hospitals. Among them, 52 patients who measured home blood pressure and started to take sodium-glucose co-transporter type 2 inhibitors were selected. Clinical parameters including estimated glomerular filtration rate, albuminuria and home blood pressure for 6 months were analysed. Sodium-glucose co-transporter type 2 inhibitors (luseogliflozin 5 mg/day or canagliflozin 100 mg/day) reduced body weight, HbA1c, albuminuria, estimated glomerular filtration rate and office blood pressure. Although sodium-glucose co-transporter type 2 inhibitors did not alter morning blood pressure, it reduced evening systolic blood pressure. Regression analyses revealed that decreases in evening blood pressure predicted decrements in albuminuria. The present data suggest that sodium-glucose co-transporter type 2 inhibitors suppress sodium overload during daytime to reduce evening blood pressure and albuminuria.

  6. Ester alkaloids from Cephalotaxus interfere with the 2'3'-cGAMP-induced type I interferon pathway in vitro.

    Directory of Open Access Journals (Sweden)

    Gayoung Park

    Full Text Available Dysregulated activation of the cyclic GMP-AMP synthase-stimulator of interferon genes (cGAS-STING pathway by self-DNA contributes to interferonopathy and promotes autoimmune diseases. To identify potential suppressors of STING-induced type I interferon (IFN induction, ethanol extracts of medicinal plants were screened for inhibitory activity against IFN-ß promoter activation. Notably, 70% ethanol extract of Cephalotaxus koreana specifically down-regulated STING-induced, but not TBK1- or IRF3-induced, IFN-ß promoter activity. The compounds exerting inhibitory activity specifically against STING-mediated IFN-ß promoter activation were identified as ester alkaloids isolated from the genus, Cephalotaxus, homoharringtonine and harringtonine. Furthermore, these two compounds inhibited 2'3'-cGAMP-induced IFN-stimulated gene expression and interaction between STING and TBK1. These suppressive effects were not observed with cephalotaxine devoid of the ester side-chain. Our data support the potential utility of homoharringtonine and harringtonine to treat STING-associated interferonopathy and autoimmune diseases.

  7. Type 2 Diabetes: What Is It?

    Science.gov (United States)

    ... Videos for Educators Search English Español Type 2 Diabetes: What Is It? KidsHealth / For Parents / Type 2 ... español Diabetes tipo 2: ¿Qué es? What Is Diabetes? Diabetes is a disease that affects how the ...

  8. Genome-wide function of H2B ubiquitylation in promoter and genic regions.

    Science.gov (United States)

    Batta, Kiran; Zhang, Zhenhai; Yen, Kuangyu; Goffman, David B; Pugh, B Franklin

    2011-11-01

    Nucleosomal organization in and around genes may contribute substantially to transcriptional regulation. The contribution of histone modifications to genome-wide nucleosomal organization has not been systematically evaluated. In the present study, we examine the role of H2BK123 ubiquitylation, a key regulator of several histone modifications, on nucleosomal organization at promoter, genic, and transcription termination regions in Saccharomyces cerevisiae. Using high-resolution MNase chromatin immunoprecipitation and sequencing (ChIP-seq), we map nucleosome positioning and occupancy in mutants of the H2BK123 ubiquitylation pathway. We found that H2B ubiquitylation-mediated nucleosome formation and/or stability inhibits the assembly of the transcription machinery at normally quiescent promoters, whereas ubiquitylation within highly active gene bodies promotes transcription elongation. This regulation does not proceed through ubiquitylation-regulated histone marks at H3K4, K36, and K79. Our findings suggest that mechanistically similar functions of H2B ubiquitylation (nucleosome assembly) elicit different functional outcomes on genes depending on its positional context in promoters (repressive) versus transcribed regions (activating).

  9. Interleukin-4- and NACHT, LRR and PYD domains-containing protein 3-independent mechanisms of alum enhanced T helper type 2 responses on basophils.

    Science.gov (United States)

    Huang, Feng-Juan; Ma, Yi-Lei; Tang, Ruo-Yu; Gong, Wen-Ci; Li, Jun; Chen, Chun-Xia; Yin, Lan; Chen, Xiao-Ping

    2016-10-01

    Aluminium hydroxide (alum), the most widely used adjuvant in human and animal vaccines, has long been known to promote T helper type 2 (Th2) responses and Th2-associated humoral responses, but the mechanisms have remained poorly understood. In this study, we explored whether alum is able to directly modulate antigen-presenting cells to enhance their potency for Th2 polarization. We found that alum treatment of dendritic cells failed to show any Th2-promoting activities. In contrast, alum was able to enhance the capacity of basophils to induce Th2 cells. When basophils from interleukin-4 (IL-4) knockout mice were examined, the intrinsic Th2-promoting activities by basophils were largely abrogated, but the alum-enhanced Th2-promoting activities on basophils were still detectable. More importantly, Th2-promoting adjuvant activities by alum found in IL-4 knockout mice were also largely reduced when basophils were depleted by antibody administration. Therefore, basophils can mediate Th2-promoting activities by alum both in vitro and in vivo through IL-4-independent mechanisms. Further studies revealed that secreted soluble molecules from alum-treated basophils were able to confer the Th2-promoting activities, and neutralization of thymic stromal lymphopoietin or IL-25 attenuated the IL-4-independent development of Th2 cells elicited by alum-treated basophils. Finally, alum was able to activate NACHT, LRR and PYD domains-containing protein 3 (NLRP3) inflammasome in murine basophils in the same way as alum in professional antigen-presenting cells, but NLRP3 was not required for Th2-promoting activities on basophils by alum in vitro. These results demonstrated that alum can enhance the capacities of basophils to polarize Th2 cells via IL-4- and NLRP3-independent pathways. © 2016 John Wiley & Sons Ltd.

  10. Heteropoly acid promoted V2O5/TiO2 catalysts for NO abatement with ammonia in alkali containing flue gases

    DEFF Research Database (Denmark)

    Putluru, Siva Sankar Reddy; Jensen, Anker Degn; Riisager, Anders

    2011-01-01

    V2O5/TiO2 and heteropoly acid promoted V2O5/TiO2 catalysts were prepared and characterized by N2 physisorption, XRPD and NH3-TPD. The influence of the calcination temperature from 400 to 700 1C on crystallinity and acidic properties was studied and compared with the activity for the selective...... catalytic reduction (SCR) of NO with ammonia. The SCR activity of heteropoly acid promoted catalysts was found to be much higher than for unpromoted catalysts. The stability of heteropoly acid promoted catalysts is dependent on calcination temperature and there is a gradual decrease in SCR activity...... and acidity with increase in calcination temperatures. Furthermore, the heteropoly acid promoted V2O5/TiO2 catalysts showed excellent alkali deactivation resistance and might therefore be alternative deNOx catalysts in biomass fired power plants....

  11. Polyoxometalate-Promoted Electrocatalytic CO2 Reduction at Nanostructured Silver in Dimethylformamide.

    Science.gov (United States)

    Guo, Si-Xuan; Li, Fengwang; Chen, Lu; MacFarlane, Douglas R; Zhang, Jie

    2018-04-18

    Electrochemical reduction of CO 2 is a promising method to convert CO 2 into fuels or useful chemicals, such as carbon monoxide (CO), hydrocarbons, and alcohols. In this study, nanostructured Ag was obtained by electrodeposition of Ag in the presence of a Keggin type polyoxometalate, [PMo 12 O 40 ] 3- (PMo). Metallic Ag is formed upon reduction of Ag + . Adsorption of PMo on the surface of the newly formed Ag lowers its surface energy thus stabilizes the nanostructure. The electrocatalytic performance of this Ag-PMo nanocomposite for CO 2 reduction was evaluated in a CO 2 saturated dimethylformamide medium containing 0.1 M [ n-Bu 4 N]PF 6 and 0.5% (v/v) added H 2 O. The results show that this Ag-PMo nanocomposite can catalyze the reduction of CO 2 to CO with an onset potential of -1.70 V versus Fc 0/+ , which is only 0.29 V more negative than the estimated reversible potential (-1.41 V) for this process and 0.70 V more positive than that on bulk Ag metal. High faradaic efficiencies of about 90% were obtained over a wide range of applied potentials. A Tafel slope of 60 mV dec -1 suggests that rapid formation of *CO 2 •- is followed by the rate-determining protonation step. This is consistent with the voltammetric data which suggest that the reduced PMo interacts strongly with CO 2 (and presumably CO 2 •- ) and hence promotes the formation of CO 2 •- .

  12. Inhibition of the promotion of hepatocarcinogenesis by 2,2',4,4',5,5'-hexachlorobiphenyl (PCB-153) by the deletion of the p50 subunit of NF-κB in mice

    International Nuclear Information System (INIS)

    Glauert, Howard P.; Tharappel, Job C.; Banerjee, Subhashis; Chan, Nelson L.S.; Kania-Korwel, Izabela; Lehmler, Hans-Joachim; Lee, Eun Y.; Robertson, Larry W.; Spear, Brett T.

    2008-01-01

    Polychlorinated biphenyls (PCBs) are persistent and ubiquitous environmental chemicals that bioaccumulate and have hepatic tumor promoting activity in rodents. The present study examined the effect of deleting the p50 subunit of NF-κB on the hepatic tumor promoting activity of 2,2',4,4',5,5'-hexachlorobiphenyl (PCB-153) in mice. Both wild-type and p50-/- male mice were injected i.p. with diethylnitrosamine (DEN, 90 mg/kg) and then subsequently injected biweekly with 20 i.p. injections of PCB-153 (300 μmol/kg/injection). p50 deletion decreased the tumor incidence in both PCB- and vehicle-treated mice, whereas PCB-153 slightly (P = 0.09) increased the tumor incidence in wild-type and p50-/- mice. PCB-153 increased the total tumor volume in both wild-type and p50-/- mice, but the total tumor volume was not affected by p50 deletion in either PCB- or vehicle-treated mice. The volume of tumors that were positive for glutamine synthetase (GS), which is indicative of mutations in the beta-catenin gene, was increased in both wild-type and p50-/- mice administered PCB-153 compared to vehicle controls, and inhibited in p50-/- mice compared to wild-type mice (in both PCB- and vehicle-treated mice). The volume of tumors that were negative for GS was increased in p50-/- mice compared to wild-type mice but was not affected by PCB-153. PCB-153 increased cell proliferation in normal hepatocytes in wild-type but not p50-/- mice; this increase was inhibited in p50-/- mice. In hepatic tumors, the rate of cell proliferation was much higher than in normal hepatocytes, but was not affected by PCB treatment or p50 deletion. The rate of apoptosis, as measured by the TUNEL assay, was not affected by PCB-153 or p50 deletion in normal hepatocytes. In hepatic tumors, the rate of apoptosis was lower than in normal hepatocytes; PCB-153 slightly (P = 0.10) increased apoptosis in p50-/- but not wild-type mice; p50 deletion had no effect. Taken together, these data indicate that the absence of

  13. Glucagon and type 2 diabetes

    DEFF Research Database (Denmark)

    Lund, Asger; Bagger, Jonatan I; Christensen, Mikkel

    2014-01-01

    In normal physiology, glucagon from pancreatic alpha cells plays an important role in maintaining glucose homeostasis via its regulatory effect on hepatic glucose production. Patients with type 2 diabetes suffer from fasting and postprandial hyperglucagonemia, which stimulate hepatic glucose...... production and, thus, contribute to the hyperglycemia characterizing these patients. Although this has been known for years, research focusing on alpha cell (patho)physiology has historically been dwarfed by research on beta cells and insulin. Today the mechanisms behind type 2 diabetic hyperglucagonemia...... or antagonization of the glucagon receptor constitutes potentially effective treatment strategies for patients with type 2 diabetes. In this review, we focus on the regulation of glucagon secretion by the incretin hormones glucagon-like peptide-1 (GLP-1) and GIP. Furthermore, potential advantages and limitations...

  14. Facts about Type 2

    Medline Plus

    Full Text Available ... Meals Diabetes Meal Plans Create Your Plate Gluten Free Diets Meal Planning for Vegetarian Diets Cook with ... lwt2d-en.html Have Type 2 Diabetes? Our free program will help you live well. More from ...

  15. Facts about Type 2

    Medline Plus

    Full Text Available ... Right away, your cells may be starved for energy. Over time, high blood glucose levels may hurt ... lwt2d-en.html Have Type 2 Diabetes? Our free program will help you live well. More from ...

  16. Lithium niobate bulk crystallization promoted by CO{sub 2} laser radiation

    Energy Technology Data Exchange (ETDEWEB)

    Ferreira, N.M., E-mail: nmferreira@ua.pt [i3N - Aveiro, Physics Department, Aveiro University, Campus Universitario de Santiago, 3810-193 Aveiro (Portugal); Costa, F.M. [i3N - Aveiro, Physics Department, Aveiro University, Campus Universitario de Santiago, 3810-193 Aveiro (Portugal); Nogueira, R.N. [Instituto de Telecomunicacoes, 3810-193 Aveiro (Portugal); Graca, M.P.F. [i3N - Aveiro, Physics Department, Aveiro University, Campus Universitario de Santiago, 3810-193 Aveiro (Portugal)

    2012-09-15

    Highlights: Black-Right-Pointing-Pointer Crystallization of LiNbO{sub 3} nanocrystals in a SiO{sub 2} matrix by CO{sub 2} laser irradiation process. Black-Right-Pointing-Pointer Samples heat-treated at 650 Degree-Sign C (4 h) and laser treated (4 W/500 s) show similar morphology. Black-Right-Pointing-Pointer Glass-ceramics produced by laser process requires a very low processing time. - Abstract: The crystallization induced by laser radiation is a very promising technique to promote glass/ceramic transformation, being already used to produce crystalline patterns on glass surfaces. In this work, a SiO{sub 2}-Li{sub 2}O-Nb{sub 2}O{sub 5} glass, prepared by the sol-gel route, was submitted to CO{sub 2} laser radiation and conventional heat-treatments in order to induce the LiNbO{sub 3} crystallization. The structure and morphology of the samples prepared by both routes was analyzed as a function of exposure time, radiation power and heat-treatment temperatures by XRD, Raman spectroscopy and SEM. The results reveal a correlation between the crystallization degree of LiNbO{sub 3} particles and glass matrix with the heat treatment type and experimental parameters. An heat-treatment at 650 Degree-Sign C/4 h was necessary to induce crystallization in heat treatments samples while 4 W/500 s was enough for laser radiation ones, corresponding a reduction time processing of {approx}14 000 s.

  17. A polymorphism in the gene for IGF-I: functional properties and risk for type 2 diabetes and myocardial infarction

    NARCIS (Netherlands)

    N. Vaessen (Norbert); J.C.M. Witteman (Jacqueline); L. Testers; S.W.J. Lamberts (Steven); B.A. Oostra (Ben); H.A.P. Pols (Huib); C.M. van Duijn (Cornelia); J.A.M.J.L. Janssen (Joseph); P. Heutink (Peter); A. Hofman (Albert)

    2001-01-01

    textabstractEvidence is accumulating that low levels of IGF-I play a role in the pathogenesis of type 2 diabetes and cardiovascular diseases. We examined the role of a genetic polymorphism in the promoter region of the IGF-I gene in relation to circulating IGF-I levels and growth measured as body

  18. Yoga for Adults with Type 2 Diabetes: A Systematic Review of Controlled Trials

    Science.gov (United States)

    Innes, Kim E.; Selfe, Terry Kit

    2016-01-01

    A growing body of evidence suggests yogic practices may benefit adults with type 2 diabetes (DM2). In this systematic review, we evaluate available evidence from prospective controlled trials regarding the effects of yoga-based programs on specific health outcomes pertinent to DM2 management. To identify qualifying studies, we searched nine databases and scanned bibliographies of relevant review papers and all identified articles. Controlled trials that did not target adults with diabetes, included only adults with type 1 diabetes, were under two-week duration, or did not include quantitative outcome data were excluded. Study quality was evaluated using the PEDro scale. Thirty-three papers reporting findings from 25 controlled trials (13 nonrandomized, 12 randomized) met our inclusion criteria (N = 2170 participants). Collectively, findings suggest that yogic practices may promote significant improvements in several indices of importance in DM2 management, including glycemic control, lipid levels, and body composition. More limited data suggest that yoga may also lower oxidative stress and blood pressure; enhance pulmonary and autonomic function, mood, sleep, and quality of life; and reduce medication use in adults with DM2. However, given the methodological limitations of existing studies, additional high-quality investigations are required to confirm and further elucidate the potential benefits of yoga programs in populations with DM2. PMID:26788520

  19. Cerebrovascular accidents in patients with type 2 diabetes mellitus

    Directory of Open Access Journals (Sweden)

    S V Kakorin

    2013-03-01

    Full Text Available Cerebrovascular accident (CA is a nowadays widely spread, highly incapacitating and often lethal event that poses a prominent clini- cal problem. Cardiovascular disease (CVD and type 2 diabetes mellitus (T2DM – an “epidemic” of the century, – are known to be its primary risk factors. Hyperglycemia promotes CA risks by induction of protein glycosylation, elevation of blood plasma atherogenic potential, activation of coagulation system with higher risk for thrombosis and disturbance of microcirculation on tissue and organ lev- els. Influence of hyperglycemia on severity and extent of neurologic damage is still under evaluation. Development of macroangiopathy is thought to be associated with media calcification, distal polyneuropathy and renal disorders, all of which are cardiovascular risk factors. Application of so-called metabolic drugs resulted in certain disillusionment, as these agents failed to prove their efficacy during clinical trials. Incidence of pulmonary edema in patients with ischemic CA and T2DM is important as it dictates the necessity for use of loop diuretics. Incidence and severity of heart failure and its correlation with degree of glycemic disorders, incidence of pulmonary em- bolism, as well as tactics of management and prognosis in patients with ischemic CA and T2DM, remains a relevant research problem.

  20. Atorvastatin dose-dependently decreases hepatic lipase activity in type 2 diabetes: effect of sex and the LIPC promoter variant

    NARCIS (Netherlands)

    I.I.L. Berk-Planken (Ingrid); N. Hoogerbrugge (Nicoline); R.P. Stolk (Ronald); A.H. Bootsma (Aart); H. Jansen (Hans)

    2003-01-01

    textabstractOBJECTIVE: Hepatic lipase (HL) is involved in the metabolism of several lipoproteins and may contribute to the atherogenic lipid profile in type 2 diabetes. Little is known about the effect of cholesterol synthesis inhibitors on HL activity in relation to sex and the

  1. Genetic association analysis of LARS2 with type 2 diabetes

    DEFF Research Database (Denmark)

    Reiling, E; Jafar-Mohammadi, B; van 't Riet, E

    2010-01-01

    was to establish the true contribution of this variant and common variants in LARS2 (MAF > 5%) to type 2 diabetes risk. METHODS: We combined genome-wide association data (n = 10,128) from the DIAGRAM consortium with independent data derived from a tagging single nucleotide polymorphism (SNP) approach in Dutch...... individuals (n = 999) and took forward two SNPs of interest to replication in up to 11,163 Dutch participants (rs17637703 and rs952621). In addition, because inspection of genome-wide association study data identified a cluster of low-frequency variants with evidence of type 2 diabetes association, we...... of sequence variants in LARS2 in type 2 diabetes susceptibility, we found no evidence to support previous data indicating a role in type 2 diabetes susceptibility....

  2. Type II superconductivity in SrPd2Ge2

    International Nuclear Information System (INIS)

    Samuely, T; Szabó, P; Pribulová, Z; Samuely, P; Sung, N H; Cho, B K; Klein, T; Cambel, V; Rodrigo, J G

    2013-01-01

    Previous investigations have shown that SrPd 2 Ge 2 , a compound isostructural with ‘122’ iron pnictides but iron and pnictogen free, is a conventional superconductor with a single s-wave energy gap and a strongly three-dimensional electronic structure. In this work we reveal the Abrikosov vortex lattice formed in SrPd 2 Ge 2 when exposed to magnetic field by means of scanning tunneling microscopy and spectroscopy. Moreover, by examining the differential conductance spectra across a vortex and estimating the upper and lower critical magnetic fields by tunneling spectroscopy and local magnetization measurements, we show that SrPd 2 Ge 2 is a strong type II superconductor with κ ≫ 2 −1/2 . Also, we compare the differential conductance spectra in various magnetic fields to the pair-breaking model of Maki and de Gennes for a dirty limit type II superconductor in the gapless region. This way we demonstrate that the type II superconductivity is induced by the sample being in the dirty limit, while in the clean limit it would be a type I superconductor with κ ≪ 2 −1/2 , in concordance with our previous study (Kim et al (2012) Phys. Rev. B 85 014520). (paper)

  3. LIGHT/TNFSF14 is increased in patients with type 2 diabetes mellitus and promotes islet cell dysfunction and endothelial cell inflammation in vitro.

    Science.gov (United States)

    Halvorsen, Bente; Santilli, Francesca; Scholz, Hanne; Sahraoui, Afaf; Gulseth, Hanne L; Wium, Cecilie; Lattanzio, Stefano; Formoso, Gloria; Di Fulvio, Patrizia; Otterdal, Kari; Retterstøl, Kjetil; Holven, Kirsten B; Gregersen, Ida; Stavik, Benedicte; Bjerkeli, Vigdis; Michelsen, Annika E; Ueland, Thor; Liani, Rossella; Davi, Giovanni; Aukrust, Pål

    2016-10-01

    Activation of inflammatory pathways is involved in the pathogenesis of type 2 diabetes mellitus. On the basis of its role in vascular inflammation and in metabolic disorders, we hypothesised that the TNF superfamily (TNFSF) member 14 (LIGHT/TNFSF14) could be involved in the pathogenesis of type 2 diabetes mellitus. Plasma levels of LIGHT were measured in two cohorts of type 2 diabetes mellitus patients (191 Italian and 40 Norwegian). Human pancreatic islet cells and arterial endothelial cells were used to explore regulation and relevant effects of LIGHT in vitro. Our major findings were: (1) in both diabetic cohorts, plasma levels of LIGHT were significantly raised compared with sex- and age-matched healthy controls (n = 32); (2) enhanced release from activated platelets seems to be an important contributor to the raised LIGHT levels in type 2 diabetes mellitus; (3) in human pancreatic islet cells, inflammatory cytokines increased the release of LIGHT and upregulated mRNA and protein levels of the LIGHT receptors lymphotoxin β receptor (LTβR) and TNF receptor superfamily member 14 (HVEM/TNFRSF14); (4) in these cells, LIGHT attenuated the insulin release in response to high glucose at least partly via pro-apoptotic effects; and (5) in human arterial endothelial cells, glucose boosted inflammatory response to LIGHT, accompanied by an upregulation of mRNA levels of HVEM (also known as TNFRSF14) and LTβR (also known as LTBR). Our findings show that patients with type 2 diabetes mellitus are characterised by increased plasma LIGHT levels. Our in vitro findings suggest that LIGHT may contribute to the progression of type 2 diabetes mellitus by attenuating insulin secretion in pancreatic islet cells and by contributing to vascular inflammation.

  4. Comparing Types of Financial Incentives to Promote Walking: An Experimental Test.

    Science.gov (United States)

    Burns, Rachel J; Rothman, Alexander J

    2018-04-19

    Offering people financial incentives to increase their physical activity is an increasingly prevalent intervention strategy. However, little is known about the relative effectiveness of different types of incentives. This study tested whether incentives based on specified reinforcement types and schedules differentially affected the likelihood of meeting a walking goal and explored if observed behavioural changes may have been attributable to the perceived value of the incentive. A 2 (reinforcement type: cash reward, deposit contract) × 2 (schedule: fixed, variable) between-subjects experiment with a hanging control condition was conducted over 8 weeks (n = 153). Although walking was greater in the incentive conditions relative to the control condition, walking did not differ across incentive conditions. Exploratory analyses indicated that the perceived value of the incentive was associated with the likelihood of meeting the walking goal, but was not affected by reinforcement type or schedule. The reinforcement type and schedule manipulations tested in this study did not differentially affect walking. Given that walking behaviour was associated with perceived value, designing incentive strategies that optimise the perceived value of the incentive may be a promising avenue for future research. © 2018 The International Association of Applied Psychology.

  5. The Role of Gut Microbiota in Obesity and Type 2 and Type 1 Diabetes Mellitus: New Insights into "Old" Diseases.

    Science.gov (United States)

    Harsch, Igor Alexander; Konturek, Peter Christopher

    2018-04-17

    The investigation of the human microbiome is the most rapidly expanding field in biomedicine. Early studies were undertaken to better understand the role of microbiota in carbohydrate digestion and utilization. These processes include polysaccharide degradation, glycan transport, glycolysis, and short-chain fatty acid production. Recent research has demonstrated that the intricate axis between gut microbiota and the host metabolism is much more complex. Gut microbiota—depending on their composition—have disease-promoting effects but can also possess protective properties. This review focuses on disorders of metabolic syndrome, with special regard to obesity as a prequel to type 2 diabetes, type 2 diabetes itself, and type 1 diabetes. In all these conditions, differences in the composition of the gut microbiota in comparison to healthy people have been reported. Mechanisms of the interaction between microbiota and host that have been characterized thus far include an increase in energy harvest, modulation of free fatty acids—especially butyrate—of bile acids, lipopolysaccharides, gamma-aminobutyric acid (GABA), an impact on toll-like receptors, the endocannabinoid system and “metabolic endotoxinemia” as well as “metabolic infection.” This review will also address the influence of already established therapies for metabolic syndrome and diabetes on the microbiota and the present state of attempts to alter the gut microbiota as a therapeutic strategy.

  6. RBP2 Promotes Adult Acute Lymphoblastic Leukemia by Upregulating BCL2.

    Directory of Open Access Journals (Sweden)

    Xiaoming Wang

    Full Text Available Despite recent increases in the cure rate of acute lymphoblastic leukemia (ALL, adult ALL remains a high-risk disease that exhibits a high relapse rate. In this study, we found that the histone demethylase retinoblastoma binding protein-2 (RBP2 was overexpressed in both on-going and relapse cases of adult ALL, which revealed that RBP2 overexpression was not only involved in the pathogenesis of ALL but that its overexpression might also be related to relapse of the disease. RBP2 knockdown induced apoptosis and attenuated leukemic cell viability. Our results demonstrated that BCL2 is a novel target of RBP2 and supported the notion of RBP2 being a regulator of BCL2 expression via directly binding to its promoter. As the role of RBP2 in regulating apoptosis was confirmed, RBP2 overexpression and activation of BCL2 might play important roles in ALL development and progression.

  7. The promotive effect of N 2 fixers, Bacillus circulans and ...

    African Journals Online (AJOL)

    The promotive effect of N 2 fixers, Bacillus circulans and Saccharomyces cerevisiae on the viability of native arbuscular mycorrhizal fungi and the impact on the productivity of alfalfa ( Medicago sativa l.)

  8. Perceptions of risk of coronary heart disease among people living with type 2 diabetes mellitus.

    Science.gov (United States)

    Ammouri, Ali Ahmad; Abu Raddaha, Ahmad H; Natarajan, Jansi; D'Souza, Melba Sheila

    2018-02-01

    Our aim is to assess perception of risk of developing coronary heart disease and to examine its associations with individuals' characteristics and health behaviours among Omani people with type 2 diabetes mellitus (T2DM). Evaluating perceptions of being at risk of developing a disease may give insight into health promotion behaviours. People with diabetes are at high risk of coronary heart disease. The management of diabetes mellitus should include prevention and control of coronary heart disease. A cross-sectional correlational study was conducted. A convenience sample of 160 adults with T2DM was invited to participate in this study between November 2014 and March 2015. Descriptive and regression analyses were performed to examine associations between study variables. Perception of risk of developing coronary heart disease was significantly associated with low educational level (β = 0.191, P diabetes mellitus (β = 0.200, P healthy diet more frequently. Teaching people with T2DM about the risk of developing coronary heart disease is essential as it could motivate them to perform health promotion behaviours, which may assist in controlling and reducing coronary heart disease. © 2017 John Wiley & Sons Australia, Ltd.

  9. Chronomedicine and type 2 diabetes: shining some light on melatonin.

    Science.gov (United States)

    Forrestel, Andrew C; Miedlich, Susanne U; Yurcheshen, Michael; Wittlin, Steven D; Sellix, Michael T

    2017-05-01

    In mammals, the circadian timing system drives rhythms of physiology and behaviour, including the daily rhythms of feeding and activity. The timing system coordinates temporal variation in the biochemical landscape with changes in nutrient intake in order to optimise energy balance and maintain metabolic homeostasis. Circadian disruption (e.g. as a result of shift work or jet lag) can disturb this continuity and increase the risk of cardiometabolic disease. Obesity and metabolic disease can also disturb the timing and amplitude of the clock in multiple organ systems, further exacerbating disease progression. As our understanding of the synergy between the timing system and metabolism has grown, an interest has emerged in the development of novel clock-targeting pharmaceuticals or nutraceuticals for the treatment of metabolic dysfunction. Recently, the pineal hormone melatonin has received some attention as a potential chronotherapeutic drug for metabolic disease. Melatonin is well known for its sleep-promoting effects and putative activity as a chronobiotic drug, stimulating coordination of biochemical oscillations through targeting the internal timing system. Melatonin affects the insulin secretory activity of the pancreatic beta cell, hepatic glucose metabolism and insulin sensitivity. Individuals with type 2 diabetes mellitus have lower night-time serum melatonin levels and increased risk of comorbid sleep disturbances compared with healthy individuals. Further, reduced melatonin levels, and mutations and/or genetic polymorphisms of the melatonin receptors are associated with an increased risk of developing type 2 diabetes. Herein we review our understanding of molecular clock control of glucose homeostasis, detail the influence of circadian disruption on glucose metabolism in critical peripheral tissues, explore the contribution of melatonin signalling to the aetiology of type 2 diabetes, and discuss the pros and cons of melatonin chronopharmacotherapy in

  10. Chemical Vapor Deposition Growth of Degenerate p-Type Mo-Doped ReS2 Films and Their Homojunction.

    Science.gov (United States)

    Qin, Jing-Kai; Shao, Wen-Zhu; Xu, Cheng-Yan; Li, Yang; Ren, Dan-Dan; Song, Xiao-Guo; Zhen, Liang

    2017-05-10

    Substitutional doping of transition metal dichalcogenide two-dimensional materials has proven to be effective in tuning their intrinsic properties, such as band gap, transport characteristics, and magnetism. In this study, we realized substitutional doping of monolayer rhenium disulfide (ReS 2 ) with Mo via chemical vapor deposition. Scanning transmission electron microscopy demonstrated that Mo atoms are successfully doped into ReS 2 by substitutionally replacing Re atoms in the lattice. Electrical measurements revealed the degenerate p-type semiconductor behavior of Mo-doped ReS 2 field effect transistors, in agreement with density functional theory calculations. The p-n diode device based on a doped ReS 2 and ReS 2 homojunction exhibited gate-tunable current rectification behaviors, and the maximum rectification ratio could reach up to 150 at V d = -2/+2 V. The successful synthesis of p-type ReS 2 in this study could largely promote its application in novel electronic and optoelectronic devices.

  11. Understanding promotion of photocatalytic activity of TiO2 by Au nanoparticles

    NARCIS (Netherlands)

    Amrollahi Buky, Rezvaneh; Hamdy, Mohamed S.; Mul, Guido

    2014-01-01

    Au nanoparticles prepared by deposition–precipitation were evaluated in promoting photocatalytic activity of TiO2 (P25) in the oxidation of methylcyclohexane. At 375 nm and in particular at 425 nm, Au was found to significantly enhance the rate induced by P25. Illumination of Au-promoted P25 at 525

  12. Glycemic control in type 2 diabetes mellitus prevents coronary arterial wall infection

    Directory of Open Access Journals (Sweden)

    Morteza Izadi

    2014-05-01

    Full Text Available BACKGROUND: Diabetes mellitus (DM is a very well-known risk factor for development of atherosclerosis, and it has been hypothesized that poor glycemic control and hyperglycemia plays a major role in this process. In the current study, we aimed to evaluate the associates of poor glycemic control in Iranian patients who have already undergone coronary artery bypass grafting (CABG, with especial focus on the inhabitation of infectious agents within the coronary arterial wall. METHODS: In January 2010, 52 consecutive patients with type 2 DM who undergone CABG at the Department of Cardiovascular Surgery of Baqiyatallah University of Medical Sciences (Tehran, Iran were included into this cross-sectional study and biopsy specimens from their coronary plaques were taken and analyzed by polymerase chain reaction (PCR methods for detecting Helicobacter species, cytomegalovirus (CMV and Chlamydia pneumoniae, and their potential relation to the glycemic control status in these patients. RESULTS: Compared to that in diabetic patients with mean fasting blood sugar (FBS levels FBS < 126, atherosclerotic lesions in type 2 diabetic patients with poor glycemic control (FBS > 126 were significantly more likely to be positive for CMV PCR test (41% vs. 9%, respectively; P = 0.05. In laboratorial test results, mean triglyceride level was significantly higher among patients of poor glycemic control (168 ± 89 vs. 222 ± 125 mg/dl, respectively; P = 0.033. Hypertension was also significantly more prevalent in this population (73% vs. 36%, respectively; P = 0.034. CONCLUSION: Type 2 diabetic patients with poor glycemic control can be at higher risk for developing CMV infection in their coronary arterial wall, which can promote atherosclerosis formation process in this patient population. According to the findings of this study, we recommend better control of serum glucose levels in type 2 diabetic patients to prevent formation/progression of atherosclerosis.   Keywords

  13. Monomeric, porous type II collagen scaffolds promote chondrogenic differentiation of human bone marrow mesenchymal stem cells in vitro

    Science.gov (United States)

    Tamaddon, M.; Burrows, M.; Ferreira, S. A.; Dazzi, F.; Apperley, J. F.; Bradshaw, A.; Brand, D. D.; Czernuszka, J.; Gentleman, E.

    2017-03-01

    Osteoarthritis (OA) is a common cause of pain and disability and is often associated with the degeneration of articular cartilage. Lesions to the articular surface, which are thought to progress to OA, have the potential to be repaired using tissue engineering strategies; however, it remains challenging to instruct cell differentiation within a scaffold to produce tissue with appropriate structural, chemical and mechanical properties. We aimed to address this by driving progenitor cells to adopt a chondrogenic phenotype through the tailoring of scaffold composition and physical properties. Monomeric type-I and type-II collagen scaffolds, which avoid potential immunogenicity associated with fibrillar collagens, were fabricated with and without chondroitin sulfate (CS) and their ability to stimulate the chondrogenic differentiation of human bone marrow-derived mesenchymal stem cells was assessed. Immunohistochemical analyses showed that cells produced abundant collagen type-II on type-II scaffolds and collagen type-I on type-I scaffolds. Gene expression analyses indicated that the addition of CS - which was released from scaffolds quickly - significantly upregulated expression of type II collagen, compared to type-I and pure type-II scaffolds. We conclude that collagen type-II and CS can be used to promote a more chondrogenic phenotype in the absence of growth factors, potentially providing an eventual therapy to prevent OA.

  14. Type 2 innate lymphoid cells-new members of the "type 2 franchise" that mediate allergic airway inflammation.

    Science.gov (United States)

    Mjösberg, Jenny; Spits, Hergen

    2012-05-01

    Type 2 innate lymphoid cells (ILC2s) are members of an ILC family, which contains NK cells and Rorγt(+) ILCs, the latter including lymphoid tissue inducer (LTi) cells and ILCs producing IL-17 and IL-22. ILC2s are dedicated to the production of IL-5 and IL-13 and, as such, ILC2s provide an early and important source of type 2 cytokines critical for helminth expulsion in the gut. Several studies have also demonstrated a role for ILC2s in airway inflammation. In this issue of the European Journal of Immunology, Klein Wolterink et al. [Eur. J. Immunol. 2012. 42: 1106-1116] show that ILC2s are instrumental in several models of experimental asthma where they significantly contribute to production of IL-5 and IL-13, key cytokines in airway inflammation. This study sheds light over the relative contribution of ILC2s versus T helper type 2 cells (Th2) in type 2 mediated allergen-specific inflammation in the airways as discussed in this commentary. © 2012 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  15. Promoter methylation of MLH1, PMS2, MSH2 and p16 is a phenomenon of advanced-stage HCCs.

    Science.gov (United States)

    Hinrichsen, Inga; Kemp, Matthias; Peveling-Oberhag, Jan; Passmann, Sandra; Plotz, Guido; Zeuzem, Stefan; Brieger, Angela

    2014-01-01

    Epigenetic silencing of tumour suppressor genes has been observed in various cancers. Looking at hepatocellular carcinoma (HCC) specific protein silencing was previously demonstrated to be associated with the Hepatitis C virus (HCV). However, the proposed HCV dependent promoter methylation of DNA mismatch repair (MMR) genes and thereby enhanced progression of hepatocarcinogenesis has been the subject of controversial discussion. We investigated promoter methylation pattern of the MMR genes MLH1, MSH2 and PMS2 as well as the cyclin-dependent kinase inhibitor 2A gene (p16) in 61 well characterized patients with HCCs associated with HCV, Hepatitis B virus infection or alcoholic liver disease. DNA was isolated from formalin-fixed, paraffin-embedded tumour and non-tumour adjacent tissue and analysed by methylation-specific PCR. Moreover, microsatellite analysis was performed in tissues showing methylation in MMR gene promoters. Our data demonstrated that promoter methylation of MLH1, MSH2, PMS2 and p16 is present among all considered HCCs. Hereby, promoter silencing was detectable more frequently in advanced-stage HCCs than in low-stage ones. However, there was no significant correlation between aberrant DNA methylation of MMR genes or p16 and HCV infection in related HCC specimens. In summary, we show that promoter methylation of essential MMR genes and p16 is detectable in HCCs most dominantly in pT3 stage tumour cases. Since loss of MMR proteins was previously described to be not only responsible for tumour development but also for chemotherapy resistance, the knowledge of mechanisms jointly responsible for HCC progression might enable significant improvement of individual HCC therapy in the future.

  16. Promoter methylation of MLH1, PMS2, MSH2 and p16 is a phenomenon of advanced-stage HCCs.

    Directory of Open Access Journals (Sweden)

    Inga Hinrichsen

    Full Text Available Epigenetic silencing of tumour suppressor genes has been observed in various cancers. Looking at hepatocellular carcinoma (HCC specific protein silencing was previously demonstrated to be associated with the Hepatitis C virus (HCV. However, the proposed HCV dependent promoter methylation of DNA mismatch repair (MMR genes and thereby enhanced progression of hepatocarcinogenesis has been the subject of controversial discussion. We investigated promoter methylation pattern of the MMR genes MLH1, MSH2 and PMS2 as well as the cyclin-dependent kinase inhibitor 2A gene (p16 in 61 well characterized patients with HCCs associated with HCV, Hepatitis B virus infection or alcoholic liver disease. DNA was isolated from formalin-fixed, paraffin-embedded tumour and non-tumour adjacent tissue and analysed by methylation-specific PCR. Moreover, microsatellite analysis was performed in tissues showing methylation in MMR gene promoters. Our data demonstrated that promoter methylation of MLH1, MSH2, PMS2 and p16 is present among all considered HCCs. Hereby, promoter silencing was detectable more frequently in advanced-stage HCCs than in low-stage ones. However, there was no significant correlation between aberrant DNA methylation of MMR genes or p16 and HCV infection in related HCC specimens. In summary, we show that promoter methylation of essential MMR genes and p16 is detectable in HCCs most dominantly in pT3 stage tumour cases. Since loss of MMR proteins was previously described to be not only responsible for tumour development but also for chemotherapy resistance, the knowledge of mechanisms jointly responsible for HCC progression might enable significant improvement of individual HCC therapy in the future.

  17. Cell-type-specific role for nucleus accumbens neuroligin-2 in depression and stress susceptibility.

    Science.gov (United States)

    Heshmati, Mitra; Aleyasin, Hossein; Menard, Caroline; Christoffel, Daniel J; Flanigan, Meghan E; Pfau, Madeline L; Hodes, Georgia E; Lepack, Ashley E; Bicks, Lucy K; Takahashi, Aki; Chandra, Ramesh; Turecki, Gustavo; Lobo, Mary Kay; Maze, Ian; Golden, Sam A; Russo, Scott J

    2018-01-30

    Behavioral coping strategies are critical for active resilience to stress and depression; here we describe a role for neuroligin-2 (NLGN-2) in the nucleus accumbens (NAc). Neuroligins (NLGN) are a family of neuronal postsynaptic cell adhesion proteins that are constituents of the excitatory and inhibitory synapse. Importantly, NLGN-3 and NLGN-4 mutations are strongly implicated as candidates underlying the development of neuropsychiatric disorders with social disturbances such as autism, but the role of NLGN-2 in neuropsychiatric disease states is unclear. Here we show a reduction in NLGN-2 gene expression in the NAc of patients with major depressive disorder. Chronic social defeat stress in mice also decreases NLGN-2 selectively in dopamine D1-positive cells, but not dopamine D2-positive cells, within the NAc of stress-susceptible mice. Functional NLGN-2 knockdown produces bidirectional, cell-type-specific effects: knockdown in dopamine D1-positive cells promotes subordination and stress susceptibility, whereas knockdown in dopamine D2-positive cells mediates active defensive behavior. These findings establish a behavioral role for NAc NLGN-2 in stress and depression; provide a basis for targeted, cell-type specific therapy; and highlight the role of active behavioral coping mechanisms in stress susceptibility.

  18. Empagliflozin: a new sodium-glucose co-transporter 2 (SGLT2 inhibitor for the treatment of type 2 diabetes

    Directory of Open Access Journals (Sweden)

    Joshua J Neumiller

    2014-06-01

    Full Text Available Type 2 diabetes is increasing in prevalence worldwide, and hyperglycemia is often poorly controlled despite a number of therapeutic options. Unlike previously available agents, sodium-glucose co-transporter 2 (SGLT2 inhibitors offer an insulin-independent mechanism for improving blood glucose levels, since they promote urinary glucose excretion (UGE by inhibiting glucose reabsorption in the kidney. In addition to glucose control, SGLT2 inhibitors are associated with weight loss and blood pressure reductions, and do not increase the risk of hypoglycemia. Empagliflozin is a selective inhibitor of SGLT2, providing dose-dependent UGE increases in healthy volunteers, with up to 90 g of glucose excreted per day. It can be administered orally, and studies of people with renal or hepatic impairment indicated empagliflozin needed no dose adjustment based on pharmacokinetics. In Phase II trials in patients with type 2 diabetes, empagliflozin provided improvements in glycosylated hemoglobin (HbA1c and other measures of glycemic control when given as monotherapy or add-on to metformin, as well as reductions in weight and systolic blood pressure. As add-on to basal insulin, empagliflozin not only improved HbA1c levels but also reduced insulin doses. Across studies, empagliflozin was generally well tolerated with a similar rate of hypoglycemia to placebo; however, patients had a slightly increased frequency of genital infections, but not urinary tract infections, versus placebo. Phase III studies have also reported a good safety profile along with significant improvements in HbA1c, weight and blood pressure, with no increased risk of hypoglycemia versus placebo. Based on available data, it appears that empagliflozin may be a useful option in a range of patients; however, clinical decisions will be better informed by the results of ongoing studies, in particular, a large cardiovascular outcome study (EMPA-REG OUTCOME™.

  19. Cell-type specific oxytocin gene expression from AAV delivered promoter deletion constructs into the rat supraoptic nucleus in vivo.

    Directory of Open Access Journals (Sweden)

    Raymond L Fields

    Full Text Available The magnocellular neurons (MCNs in the hypothalamus selectively express either oxytocin (OXT or vasopressin (AVP neuropeptide genes, a property that defines their phenotypes. Here we examine the molecular basis of this selectivity in the OXT MCNs by stereotaxic microinjections of adeno-associated virus (AAV vectors that contain various OXT gene promoter deletion constructs using EGFP as the reporter into the rat supraoptic nucleus (SON. Two weeks following injection of the AAVs, immunohistochemical assays of EGFP expression from these constructs were done to determine whether the EGFP reporter co-localizes with either the OXT- or AVP-immunoreactivity in the MCNs. The results show that the key elements in the OT gene promoter that regulate the cell-type specific expression the SON are located -216 to -100 bp upstream of the transcription start site. We hypothesize that within this 116 bp domain a repressor exists that inhibits expression specifically in AVP MCNs, thereby leading to the cell-type specific expression of the OXT gene only in the OXT MCNs.

  20. Facts about Type 2

    Medline Plus

    Full Text Available ... Gift Fundraising Events Donate Stocks Give by Phone 1-800-DIABETES (800-342-2383) Give by ... 2 diabetes is the most common form of diabetes. In type 2 diabetes, your body does not use insulin properly. This is called insulin resistance. At first, ...

  1. Web-based depression treatment for type 1 and type 2 diabetic patients

    DEFF Research Database (Denmark)

    van Bastelaar, Kim M P; Pouwer, Francois; Cuijpers, Pim

    2011-01-01

    intervention on a large scale at relatively low costs. This study evaluated the effectiveness of Web-based CBT for depression treatment in adults with type 1 or type 2 diabetes, with minimal guidance. RESEARCH DESIGN AND METHODS: A randomized controlled trial was conducted in the Netherlands in 255 adult...... no beneficial effect on glycemic control (P > 0.05). CONCLUSIONS: Web-based CBT depression treatment is effective in reducing depressive symptoms in adults with type 1 and type 2 diabetes. In addition, the intervention reduces diabetes-specific emotional distress in depressed patients.......OBJECTIVE: Comorbid depression is common in patients with type 1 and type 2 diabetes, adversely affecting quality of life, diabetes outcomes, and mortality. Depression can be effectively treated with cognitive behavior therapy (CBT). The Internet is a new and attractive method for delivering CBT...

  2. Facts about Type 2

    Medline Plus

    Full Text Available ... steps you take Help change the conversation about type 2 diabetes. Recipes and More: Diabetes Food Hub - ... }, success: function (data) { $('#survey-errors').remove(); $('. ...

  3. Point-of-purchase alcohol marketing and promotion by store type--United States, 2000-2001.

    Science.gov (United States)

    2003-04-11

    Alcohol consumption is the third leading preventable cause of death in the United States, accounting for approximately 100,000 deaths annually. Efforts to reduce the adverse health and social consequences from alcohol use include policies to restrict access to alcohol among underaged persons (i.e., persons aged Point-of-purchase (POP) (i.e., on-site) marketing, including alcohol advertising and placement, can increase alcohol sales and consumption substantially, thereby increasing the risk for various alcohol-related health outcomes, including alcohol-impaired driving and interpersonal violence. To assess the type and frequency of POP alcohol marketing, researchers with the ImpacTeen Project collected and analyzed store observation data during 2000-2001 from 3,961 alcohol retailers in 329 communities throughout the United States. This report summarizes the results of the study, which indicate that POP alcohol marketing is extensive in certain store types frequented by teenagers and young adults. Public health agencies and policy makers should work with liquor control boards to reduce POP marketing that could promote risky or underage drinking.

  4. Cloning of the human TASK-2 (KCNK5) promoter and its regulation by chronic hypoxia

    International Nuclear Information System (INIS)

    Brazier, Stephen P.; Mason, Helen S.; Bateson, Alan N.; Kemp, Paul J.

    2005-01-01

    The tandem P domain potassium channel family includes five members of the acid-sensing subfamily, TASK. TASK channels are active at resting potential and are inhibited by extracellular protons, suggesting they function as acid sensors and control excitability/ion homeostasis. Indeed, TASK-2 (KCNK5) has been shown to control excitability, volume regulation, bicarbonate handling, and apoptosis in a variety of tissues. With such diverse functions being ascribed to TASK-2, it is important to understand long-term as well as short-term regulation of this important channel. Thus, we have cloned the TASK-2 promoter, demonstrated that its transcriptional activity is dependent upon pO 2 , shown that deletion of overlapping consensus binding sites for NF-κB/Elk-1 ablates this O 2 sensitivity, and proved that Elk-1 binds preferentially to this site. Furthermore, the consequences of chronic hypoxia on natively expressed TASK-2 are decreased steady-state mRNA and cell depolarization showing that TASK-2 contributes to the excitability of this important lung cell type

  5. IL-10 dependent suppression of type 1, type 2 and type 17 cytokines in active pulmonary tuberculosis.

    Directory of Open Access Journals (Sweden)

    Nathella Pavan Kumar

    Full Text Available Although Type 1 cytokine responses are considered protective in pulmonary tuberculosis (PTB, their role as well as those of Type 2, 17 and immunoregulatory cytokines in tuberculous lymphadenitis (TBL and latent tuberculosis (LTB have not been well studied.To identify cytokine responses associated with pulmonary tuberculosis (TB, TB lymphadenitits and latent TB, we examined mycobacterial antigen-specific immune responses of PTB, TBL and LTB individuals. More specifically, we examined ESAT-6 and CFP-10 induced Type 1, Type 2 and Type 17 cytokine production and their regulation using multiplex ELISA.PTB individuals exhibited a significantly lower baseline as well as antigen-specific production of Type 1 (IFNγ, TNFα and IL-2; Type 2 (IL-4 and Type 17 (IL-17A and IL-17F cytokines in comparison to both TBL and LTB individuals. TBL individuals exhibited significantly lower antigen-specific IFNγ responses alone in comparison to LTB individuals. Although, IL-10 levels were not significantly higher, neutralization of IL-10 during antigen stimulation resulted in significantly enhanced production of IFNγ, IL-4 and IL-17A in PTB individuals, indicating that IL-10 mediates (at least partially the suppression of cytokine responses in PTB.Pulmonary TB is characterized by an IL-10 dependent antigen-specific suppression of Type 1, Type 2 and Type 17 cytokines, reflecting an important association of these cytokines in the pathogenesis of active TB.

  6. Tobacco advertising/promotions and adolescents' smoking risk in Northern Africa.

    Science.gov (United States)

    Madkour, Aubrey Spriggs; Ledford, E Cannon; Andersen, Lori; Johnson, Carolyn C

    2014-05-01

    Comprehensive tobacco advertising/promotion bans are effective against adolescent smoking but many developing countries have implemented only partial bans. This study examines the association between advertising/promotions exposure and adolescent cigarette smoking risk in North Africa, and possible mediation of this association by parent and peer smoking. Adolescent data (n=12 329) from the Global Youth Tobacco Survey were analyzed (Libya, 2007; Egypt, 2005; Morocco, 2006; Tunisia 2007; and Sudan, 2005). Current smoking (any cigarette use in the past 30 days) and never-smokers' initiation susceptibility (composite of openness to accepting a cigarette from a friend and intention to start smoking in the next year) outcomes were examined. Advertising/promotion exposures included media and in-person contacts. Weighted univariate, bivariate and multivariable analyses were conducted. Current smoking prevalence ranged from 5.6% (Egypt) to 15.3% (Tunisia) among boys, and 1.1% (Libya and Egypt) to 2.0% (Morocco and Sudan) among girls. Initiation susceptibility ranged from 14.1% (Sudan) to 25.0% (Tunisia) among boys, and from 13.3% (Sudan) to 15.0% (Libya) among girls. Ninety-eight percent of adolescents reported exposure to at least one type of advertising/promotion. In multivariable analyses adjusting for demographics, each type of advertising/promotion was significantly and positively associated with boys' current smoking status; most advertising/promotion exposure types were also positively associated with initiation susceptibility among boys and girls. Peer smoking only partially mediated these associations. Tobacco advertising/promotion exposure was highly prevalent and associated with adolescents' smoking risk in these countries. The comprehensiveness and enforcement of advertising/promotion bans needs to be enhanced.

  7. Ser298 of MITF, a mutation site in Waardenburg syndrome type 2, is a phosphorylation site with functional significance.

    Science.gov (United States)

    Takeda, K; Takemoto, C; Kobayashi, I; Watanabe, A; Nobukuni, Y; Fisher, D E; Tachibana, M

    2000-01-01

    MITF (microphthalmia-associated transcription factor) is a basic-helix-loop-helix-leucine zipper (bHLHZip) factor which regulates expression of tyrosinase and other melanocytic genes via a CATGTG promoter sequence, and is involved in melanocyte differentiation. Mutations of MITF in mice or humans with Waardenburg syndrome type 2 (WS2) often severely disrupt the bHLHZip domain, suggesting the importance of this structure. Here, we show that Ser298, which locates downstream of the bHLHZip and was previously found to be mutated in individuals with WS2, plays an important role in MITF function. Glycogen synthase kinase 3 (GSK3) was found to phosphorylate Ser298 in vitro, thereby enhancing the binding of MITF to the tyrosinase promoter. The same serine was found to be phosphorylated in vivo, and expression of dominant-negative GSK3beta selectively suppressed the ability of MITF to transactivate the tyrosinase promoter. Moreover, mutation of Ser298, as found in a WS2 family, disabled phos-phorylation of MITF by GSK3beta and impaired MITF function. These findings suggest that the Ser298 is important for MITF function and is phosphorylated probably by GSK3beta.

  8. Behavioral economics survey of patients with type 1 and type 2 diabetes

    Directory of Open Access Journals (Sweden)

    Emoto N

    2015-05-01

    Full Text Available Naoya Emoto,1 Fumitaka Okajima,1 Hitoshi Sugihara,2 Rei Goto3,4 1Division of Endocrinology, Department of Medicine, Nippon Medical School Chiba Hokusoh Hospital, Chiba, 2Department of Endocrinology, Diabetes and Metabolism, Graduate School of Medicine, Nippon Medical School, Tokyo, 3Hakubi Center of Advanced Research, Kyoto University, Kyoto, 4Graduate School of Economics, Kyoto University, Kyoto, Japan Background: Adherence to treatment and the metabolic control of diabetes are challenging in many patients with diabetes. The theory of neuroeconomics can provide important clues for understanding unreasonable human behavior concerning decisions between outcomes occurring at different time points.  Objective: We investigated patients with type 1 and type 2 diabetes to determine whether patients who are at a risk of developing complications are less risk averse. We also examined whether patients with type 1 and type 2 diabetes have different behavioral traits in decision making under risk.  Methods: We conducted a behavioral economics survey of 219 outpatients, 66 with type 1 diabetes and 153 with type 2 diabetes. All patients had been referred by general practitioners or other departments in the hospital. At the time of the survey, levels of hemoglobin A1c were not significantly different between patients with type 1 and type 2 diabetes.  Results: Patients with type 2 diabetes showed a lower response rate to the survey compared with patients with type 1 diabetes (71.9% vs 87.9%, P<0.01. Logistic regression analysis indicated that diabetic retinopathy was negatively associated with risk averse in pricing of hypothetical lotteries, myopic time preference, willingness to pay for preventive medicine, and levels of satisfaction with life. Diabetic nephropathy was also negatively associated with risk averse in pricing of hypothetical lotteries. Detailed analysis revealed that a lower proportion of patients with type 2 diabetes (22.7% were categorized

  9. Promoted V2O5/TiO2 catalysts for selective catalytic reduction of NO with NH3 at low temperatures

    DEFF Research Database (Denmark)

    Putluru, Siva Sankar Reddy; Schill, Leonhard; Godiksen, Anita

    2016-01-01

    characterized by N2 physisorption, XRPD, NH3-TPD, H2-TPR, Raman, FTIR and EPR spectroscopy to investigate the properties of the catalysts. XRPD, Raman and FTIR showed that promotion with 15 wt.% HPA does not cause V2O5 to be present in crystalline form, also at a loading of 5 wt.% V2O5. Hence, use of HPAs does......The influence of varying the V2O5 content (3–6 wt.%) was studied for the selective catalytic reduction (SCR) of nitrogen oxides by ammonia on heteropoly acid (HPA)- and tungsten oxide (WO3)-promoted V2O5/TiO2 catalysts. The SCR activity and alkali deactivation resistance of HPA-promoted V2O5/TiO2...... catalysts was found to be much higher than for WO3-promoted catalysts. By increasing the vanadium content from 3 to 5 wt.% the catalysts displayed a two fold increase in activity at 225 °C and retained their initial activity after alkali doping at a molar K/V ratio of 0.181. Furthermore, the catalysts were...

  10. IFNγ signaling endows DCs with the capacity to control type I inflammation during parasitic infection through promoting T-bet+ regulatory T cells.

    Directory of Open Access Journals (Sweden)

    Hyang-Mi Lee

    2015-02-01

    Full Text Available IFNγ signaling drives dendritic cells (DCs to promote type I T cell (Th1 immunity. Here, we show that activation of DCs by IFNγ is equally crucial for the differentiation of a population of T-bet+ regulatory T (Treg cells specialized to inhibit Th1 immune responses. Conditional deletion of IFNγ receptor in DCs but not in Treg cells resulted in a severe defect in this specific Treg cell subset, leading to exacerbated immune pathology during parasitic infections. Mechanistically, IFNγ-unresponsive DCs failed to produce sufficient amount of IL-27, a cytokine required for optimal T-bet induction in Treg cells. Thus, IFNγ signalling endows DCs with the ability to efficiently control a specific type of T cell immunity through promoting a corresponding Treg cell population.

  11. Facts about Type 2

    Medline Plus

    Full Text Available ... Type 2 Diabetes Know Your Rights Employment Discrimination Health Care Professionals Law ... Your Plate Gluten Free Diets Meal Planning for Vegetarian Diets Cook with Heart- ...

  12. Exercise increases hyper-acetylation of histones on the Cis-element of NRF-1 binding to the Mef2a promoter: Implications on type 2 diabetes.

    Science.gov (United States)

    Joseph, Jitcy S; Ayeleso, Ademola O; Mukwevho, Emmanuel

    2017-04-22

    Exercise brings changes on the chromatin ensuing the upregulation of many genes that confer protection from type 2 diabetes. In type-2 diabetes, critical genes are down-regulated such as those involved in glucose transport (GLUT4, MEF2A) and also oxidative phosphorylation (NRF-1 and its target genes). Recent reports have shown that NRF-1 not only regulate mitochondrial oxidative genes but also controls MEF2A, the main transcription factor for glucose transporter, GLUT4. Such dual control of the two pathways by NRF-1 place it as critical gene in the design of therapeutic modalities much needed to cure or better manage type 2 diabetes. Although it is known that NRF-1 controls these dual pathways (glucose transport and oxidative phosphorylation), the actual molecular mechanisms involved surrounding this regulation remains elusive. NRF-1 itself is regulated through posttranslational modifications (acetylation, methylation and phosphorylation) resulting in enhanced binding to its target genes. This study is therefore aimed at assessing whether CaMKII, a kinase activated by exercise brings about hyper-acetylation of histones in the vicinity of NRF-1 target gene, Mef2a. Five to six weeks old male Wistar rats were used in this study. Chromatin immunoprecipitation (ChIP) assay was used to investigate the extent through which NRF-1 is bound to the Mef2a gene and if this was associated with hyper-acetylation of histones in the region of NRF-1 binding site of the Mef2a gene. Quantitative real time PCR (qPCR) was used to determine the gene expression of MEF2A and NRF-1. Results from this study indicated that exercise-induced CaMKII activation increased hyper-acetylation of histones in the region of NRF-1 binding site on vicinity of Mef2a gene and this was associated with the increased binding of NRF-1 to Mef2a gene. Exercise also increased the expression of NRF-1 and MEF2A genes. Administration of CaMKII inhibitor (KN93) prior to exercise attenuated the observed exercise

  13. Price promotions for food and beverage products in a nationwide sample of food stores.

    Science.gov (United States)

    Powell, Lisa M; Kumanyika, Shiriki K; Isgor, Zeynep; Rimkus, Leah; Zenk, Shannon N; Chaloupka, Frank J

    2016-05-01

    Food and beverage price promotions may be potential targets for public health initiatives but have not been well documented. We assessed prevalence and patterns of price promotions for food and beverage products in a nationwide sample of food stores by store type, product package size, and product healthfulness. We also assessed associations of price promotions with community characteristics and product prices. In-store data collected in 2010-2012 from 8959 food stores in 468 communities spanning 46 U.S. states were used. Differences in the prevalence of price promotions were tested across stores types, product varieties, and product package sizes. Multivariable regression analyses examined associations of presence of price promotions with community racial/ethnic and socioeconomic characteristics and with product prices. The prevalence of price promotions across all 44 products sampled was, on average, 13.4% in supermarkets (ranging from 9.1% for fresh fruits and vegetables to 18.2% for sugar-sweetened beverages), 4.5% in grocery stores (ranging from 2.5% for milk to 6.6% for breads and cereals), and 2.6% in limited service stores (ranging from 1.2% for fresh fruits and vegetables to 4.1% for breads and cereals). No differences were observed by community characteristics. Less-healthy versus more-healthy product varieties and larger versus smaller product package sizes generally had a higher prevalence of price promotion, particularly in supermarkets. On average, in supermarkets, price promotions were associated with 15.2% lower prices. The observed patterns of price promotions warrant more attention in public health food environment research and intervention. Copyright © 2016 Elsevier Inc. All rights reserved.

  14. Vitamin D and type 2 diabetes.

    Science.gov (United States)

    Lips, Paul; Eekhoff, Marelise; van Schoor, Natasja; Oosterwerff, Mirjam; de Jongh, Renate; Krul-Poel, Yvonne; Simsek, Suat

    2017-10-01

    Vitamin D deficiency is associated with a decreased insulin release, insulin resistance and type 2 diabetes in experimental and epidemiological studies. Animal studies show that 1α,25-dihydroxyvitamin D 3 (1,25(OH) 2 D 3 ) stimulates the pancreatic β-cell to secrete insulin. The relationship between vitamin D deficiency and insulin resistance could develop through inflammation, as vitamin D deficiency is associated with increased inflammatory markers. In addition, genetic polymorphisms of vitamin D -related genes may predispose to impaired glycemic control and type 2 diabetes. Epidemiologic studies showed an association between low serum 25-hydroxyvitamin D 3 (25(OH)D 3 ) concentration and an increased risk for the metabolic syndrome and type 2 diabetes. This may be partly explained by an increased fat mass. A possible causal relationship between vitamin D deficiency and type 2 diabetes should be proven by randomized clinical trials showing that either type 2 diabetes can be prevented or insulin release and insulin sensitivity can be improved by vitamin D supplements. The results of randomized clinical trials on the effect of vitamin D versus placebo, sometimes combined with calcium, in patients with impaired glucose tolerance ("prediabetes") or type 2 diabetes are inconsistent. Some studies showed a slight decrease of fasting plasma glucose or improvement of insulin resistance, but often only in posthoc analyses. These effects are mainly visible in patients with vitamin D deficiency and impaired glucose tolerance at baseline. Meta-analyses of randomized clinical trials in general did not show significant effects of vitamin D supplementation on glycemic control. Currently, several large scale randomized clinical trials with vitamin D supplementation in doses of 1600-4000IU/d are ongoing with glycemic control or incidence of diabetes mellitus as outcome. Vitamin D deficiency needs to be prevented or cured, but until the results of these trials are published, high

  15. Zinc deficiency promotes cystitis-related bladder pain by enhancing function and expression of Cav3.2 in mice.

    Science.gov (United States)

    Ozaki, Tomoka; Matsuoka, Junki; Tsubota, Maho; Tomita, Shiori; Sekiguchi, Fumiko; Minami, Takeshi; Kawabata, Atsufumi

    2018-01-15

    Ca v 3.2 T-type Ca 2+ channel activity is suppressed by zinc that binds to the extracellular histidine-191 of Ca v 3.2, and enhanced by H 2 S that interacts with zinc. Ca v 3.2 in nociceptors is upregulated in an activity-dependent manner. The enhanced Ca v 3.2 activity by H 2 S formed by the upregulated cystathionine-γ-lyase (CSE) is involved in the cyclophosphamide (CPA)-induced cystitis-related bladder pain in mice. We thus asked if zinc deficiency affects the cystitis-related bladder pain in mice by altering Ca v 3.2 function and/or expression. Dietary zinc deficiency for 2 weeks greatly decreased zinc concentrations in the plasma but not bladder tissue, and enhanced the bladder pain/referred hyperalgesia (BP/RH) following CPA at 200mg/kg, a subeffective dose, but not 400mg/kg, a maximal dose, an effect abolished by pharmacological blockade or gene silencing of Ca v 3.2. Acute zinc deficiency caused by systemic N,N,N',N'-tetrakis-(2-pyridylmethyl)-ethylendiamine (TPEN), a zinc chelator, mimicked the dietary zinc deficiency-induced Ca v 3.2-dependent promotion of BP/RH following CPA at 200mg/kg. CPA at 400mg/kg alone or TPEN plus CPA at 200mg/kg caused Ca v 3.2 overexpression accompanied by upregulation of Egr-1 and USP5, known to promote transcriptional expression and reduce proteasomal degradation of Ca v 3.2, respectively, in the dorsal root ganglia (DRG). The CSE inhibitor, β-cyano-l-alanine, prevented the BP/RH and upregulation of Ca v 3.2, Egr-1 and USP5 in DRG following TPEN plus CPA at 200mg/kg. Together, zinc deficiency promotes bladder pain accompanying CPA-induced cystitis by enhancing function and expression of Ca v 3.2 in nociceptors, suggesting a novel therapeutic avenue for treatment of bladder pain, such as zinc supplementation. Copyright © 2017 Elsevier B.V. All rights reserved.

  16. Smad4-dependent suppressor pituitary homeobox 2 promotes PPP2R2A-mediated inhibition of Akt pathway in pancreatic cancer.

    Science.gov (United States)

    Wang, Qi; Li, Juanjuan; Wu, Wei; Shen, Ruizhe; Jiang, He; Qian, Yuting; Tang, Yanping; Bai, Tingting; Wu, Sheng; Wei, Lumin; Zang, Yi; Zhang, Ji; Wang, Lifu

    2016-03-08

    The importance of Pituitary homeobox 2 (Pitx2) in malignancy remains enigmatic, and Pitx2 has not been previously implicated in pancreatic ductal adenocarcinoma (PDAC). In this study, we performed gene expression profiling of human PDAC tissues and identified Pitx2 as a promising candidate. Pitx2 expression was decreased from 2.6- to 19-fold in human PDAC tissues from microarray units. Immunochemistry staining showed that Pitx2 expression was moderate to intense in normal pancreatic and pancreatic intraepithelial neoplastic lesions, whereas low in human PDAC tissues. The Pitx2 levels correlated with overall patient survival post-operatively in PDAC. Induction of Pitx2 expression partly inhibited the malignant phenotype of PDAC cells. Interestingly, low Pitx2 expression was correlated with Smad4 mutant inactivation, but not with Pitx2 DNA-methylation. Furthermore, Smad4 protein bound to Pitx2 promoter and stimulated Pitx2 expression in PDAC. In addition, Pitx2 protein bound to the promoter of the protein phosphatase 2A regulatory subunit B55α (PPP2R2A) and upregulated PPP2R2A expression, which may activate dephosphorylation of Akt in PDAC. These findings provide new mechanistic insights into Pitx2 as a tumor suppressor in the downstream of Smad4. And Pitx2 protein promotes PPP2R2A expression which may inhibit Akt pathway. Therefore, we propose that the Smad4-Pitx2-PPP2R2A axis, a new signaling pathway, suppresses the pancreatic carcinogenesis.

  17. CD147 reinforces [Ca2+]i oscillations and promotes oncogenic progression in hepatocellular carcinoma.

    Science.gov (United States)

    Tang, Juan; Guo, Yun-Shan; Yu, Xiao-Ling; Huang, Wan; Zheng, Ming; Zhou, Ying-Hui; Nan, Gang; Wang, Jian-Chao; Yang, Hai-Jiao; Yu, Jing-Min; Jiang, Jian-Li; Chen, Zhi-Nan

    2015-10-27

    Oscillations in intracellular Ca2+ concentrations ([Ca2+]i) mediate various cellular function. Although it is known that [Ca2+]i oscillations are susceptible to dysregulation in tumors, the tumor-specific regulators of [Ca2+]i oscillations are poorly characterized. We discovered that CD147 promotes hepatocellular carcinoma (HCC) metastasis and proliferation by enhancing the amplitude and frequency of [Ca2+]i oscillations in HCC cells. CD147 activates two distinct signaling pathways to regulate [Ca2+]i oscillations. By activating FAK-Src-IP3R1 signaling pathway, CD147 promotes Ca2+ release from endoplasmic reticulum (ER) and enhances the amplitude of [Ca2+]i oscillations. Furthermore, CD147 accelerates ER Ca2+refilling and enhances the frequency of [Ca2+]i oscillations through activating CaMKP-PAK1-PP2A-PLB-SERCA signaling pathway. Besides, CD147-promoted ER Ca2+ release and refilling are tightly regulated by changing [Ca2+]i. CD147 may activate IP3R1 channel under low [Ca2+]i conditions and CD147 may activate SERCA pump under high [Ca2+]i conditions. CD147 deletion suppresses HCC tumorigenesis and increases the survival rate of liver-specific CD147 knockout mice by regulating [Ca2+]i oscillations in vivo. Together, these results reveal that CD147 functions as a critical regulator of ER-dependent [Ca2+]i oscillations to promote oncogenic progression in HCC.

  18. A novel -192c/g mutation in the proximal P2 promoter of the hepatocyte nuclear factor-4 alpha gene (HNF4A) associates with late-onset diabetes

    DEFF Research Database (Denmark)

    Ek, Jakob; Hansen, Sara P; Lajer, Maria

    2006-01-01

    Recently, it has been shown that mutations in the P2 promoter of the hepatocyte nuclear factor (HNF)-4 alpha gene (HNF4A) cause maturity-onset diabetes of the young (MODY), while single nucleotide polymorphisms in this locus are associated with type 2 diabetes. In this study, we examined 1,189 bp...... of the P2 promoter and the associated exon 1D of HNF4A for variations associated with diabetes in 114 patients with type 2 diabetes, 72 MODYX probands, and 85 women with previous gestational diabetes mellitus. A -192c/g mutation was found in five patients. We screened 1,587 diabetic subjects and 4......,812 glucose-tolerant subjects for the -192c/g mutation and identified 5 diabetic and 1 glucose-tolerant mutation carriers (P=0.004). Examination of the families showed that carriers of the -192c/g mutation had a significantly impaired glucose-stimulated insulin release and lower levels of serum total...

  19. Specific dose-dependent damage of Lieberkuehn crypts promoted by large doses of type 2 ribosome-inactivating protein nigrin b intravenous injection to mice

    International Nuclear Information System (INIS)

    Gayoso, M.J.; Munoz, R.; Arias, Y.; Villar, R.; Rojo, M.A.; Jimenez, P.; Ferreras, J.M.; Aranguez, I.; Girbes, T.

    2005-01-01

    Nigrin b is a non-toxic type 2 ribosome-inactivating protein as active as ricin at ribosomal level but 10 5 and 5 x 10 3 times less toxic for animal cell cultures and mice, respectively, than ricin. The purpose of the present study was to analyze the effects of intravenous injection of large amounts of nigrin b to the mouse. Injection through the tail vein of 16 mg/kg body weight killed all mice studied before 2 days. Analysis of several major tissues by light microscopy did not reveal gross nigrin b-promoted changes, except in the intestines which appeared highly damaged. As a consequence of the injury, the villi and crypt structures of the small intestine disappeared, leading to profuse bleeding and death. In contrast, intravenous injection of 5 mg/kg body weight was not lethal to mice but did trigger reversible toxic effects. In both cases, lethal and sub-lethal doses, the target of nigrin b appeared to be the highly proliferating stem cells of the intestinal crypts, which had undergone apoptotic changes. In contrast to nigrin b, the injection of 3 μg/kg of ricin kills all mice in 5 days but does not trigger apoptosis in the crypts. Therefore, the effect seen with sub-lethal nigrin b concentrations seems to be specific. Nigrin b killed COLO 320 human colon adenocarcinoma cells with an IC 50 of 3.1 x 10 -8 M and the effect was parallel to the extent of DNA fragmentation of these cells. Accordingly, despite the low general toxicity exerted by nigrin b as compared with ricin, intravenous injection of large amounts of nigrin b is able to kill mouse intestinal stem cells without threatening the lives of the animals, thereby opening a door for its use for the targeting of intestinal stem cells

  20. Facts about Type 2

    Medline Plus

    Full Text Available ... and Learning About Prediabetes Type 2 Diabetes Risk Test Lower Your Risk Healthy Eating Overweight Smoking High Blood Pressure Physical Activity High Blood Glucose My Health ...

  1. Type D (distressed) personality in primary care patients with type 2 diabetes

    DEFF Research Database (Denmark)

    Nefs, Giesje; Pouwer, Francois; Pop, Victor J M

    2012-01-01

    D Scale-14 (DS14) in type 2 diabetes patients. METHODS: 1553 primary care patients with type 2 diabetes were assessed for demographic, clinical, lifestyle and psychological characteristics in 2007. A subgroup (n=1012) completed the DS14 again 1 year later. RESULTS: The two-factor model of the Type D...... or physiological risk factors, but Type D women had a more sedentary lifestyle (p=.003). Type D patients experienced less social support and more stressful life events, loneliness, and more depressed mood, anhedonia and anxiety (p0......OBJECTIVE: In cardiovascular research, Type D personality (high negative affectivity and social inhibition) has been associated with a more than 3-fold increased risk of adverse health outcomes. This study examined the validity and clinical correlates of the Type D construct as assessed by the Type...

  2. Mechanism of selective recruitment of RNA polymerases II and III to snRNA gene promoters.

    Science.gov (United States)

    Dergai, Oleksandr; Cousin, Pascal; Gouge, Jerome; Satia, Karishma; Praz, Viviane; Kuhlman, Tracy; Lhôte, Philippe; Vannini, Alessandro; Hernandez, Nouria

    2018-05-01

    RNA polymerase II (Pol II) small nuclear RNA (snRNA) promoters and type 3 Pol III promoters have highly similar structures; both contain an interchangeable enhancer and "proximal sequence element" (PSE), which recruits the SNAP complex (SNAPc). The main distinguishing feature is the presence, in the type 3 promoters only, of a TATA box, which determines Pol III specificity. To understand the mechanism by which the absence or presence of a TATA box results in specific Pol recruitment, we examined how SNAPc and general transcription factors required for Pol II or Pol III transcription of SNAPc-dependent genes (i.e., TATA-box-binding protein [TBP], TFIIB, and TFIIA for Pol II transcription and TBP and BRF2 for Pol III transcription) assemble to ensure specific Pol recruitment. TFIIB and BRF2 could each, in a mutually exclusive fashion, be recruited to SNAPc. In contrast, TBP-TFIIB and TBP-BRF2 complexes were not recruited unless a TATA box was present, which allowed selective and efficient recruitment of the TBP-BRF2 complex. Thus, TBP both prevented BRF2 recruitment to Pol II promoters and enhanced BRF2 recruitment to Pol III promoters. On Pol II promoters, TBP recruitment was separate from TFIIB recruitment and enhanced by TFIIA. Our results provide a model for specific Pol recruitment at SNAPc-dependent promoters. © 2018 Dergai et al.; Published by Cold Spring Harbor Laboratory Press.

  3. Facts about Type 2

    Medline Plus

    Full Text Available ... and Pacific Islanders American Indian/Alaska Native Programs Older ... may hurt your eyes, kidneys, nerves or heart. Some people with type 2 can control their blood glucose ...

  4. The dieting dilemma in patients with newly diagnosed type 2 diabetes: Does dietary restraint predict weight gain four years after diagnosis?

    NARCIS (Netherlands)

    Strien, T. van; Laar, F.A. van de; Leeuwe, J.F.J. van; Lucassen, P.L.B.J.; Hoogen, H.J.M. van den; Rutten, G.E.H.M.; Weel, C. van

    2007-01-01

    Objective: To examine whether dieting--restriction of food intake for the purpose of weight control--suppresses or promotes excessive food intake and weight gain. Design: A 4-year follow-up study of a dietary intervention in a sample of 97 patients with newly diagnosed Type 2 diabetes. Main Outcome

  5. The dieting dilemma in patients with newly diagnosed type 2 diabetes: does dietary restraint predict weight gain 4 years after diagnosis?

    NARCIS (Netherlands)

    Strien, T. van; Laar, F.A. van de; Leeuwe, J.F.J. van; Lucassen, P.L.B.J.; Hoogen, H.J.M. van den; Rutten, G.E.H.M.; Weel, C. van

    2007-01-01

    OBJECTIVE: To examine whether dieting--restriction of food intake for the purpose of weight control--suppresses or promotes excessive food intake and weight gain. DESIGN: A 4-year follow-up study of a dietary intervention in a sample of 97 patients with newly diagnosed Type 2 diabetes. MAIN OUTCOME

  6. Aerobic exercise did not have compensatory effects on physical activity levels in type 2 diabetes patients.

    Science.gov (United States)

    de Moura, Bruno Pereira; Marins, João Carlos Bouzas; Franceschini, Sylvia Do Carmo Castro; Reis, Janice Sepúlveda; Amorim, Paulo Roberto Dos Santos

    2015-01-01

    Although exercise promotes beneficial effects in diabetic patients, some studies have questioned the degree of their importance in terms of the increase in total energy expenditure. In these studies, the decrease of physical activity levels (PAL) was referred as "compensatory effect of exercise". However, our aim was to investigate whether aerobic exercise has compensatory effects on PAL in type 2 diabetes patients. Eight volunteers (51.1 ± 8.2 years) were enrolled in a supervised exercise programme for 8 weeks (3 d · wk(-1), 50-60% of VO2 peak for 30-60 min). PAL was measured using tri-axial accelerometers in the 1st, 8th and 12th weeks. Biochemical tests, cardiorespiratory fitness, anthropometric assessment and body composition were measured in the 2nd and 11th weeks. Statistical analysis was performed using non-parametric tests (Friedman and Wilcoxon, P exercise programme generated a significant 14.8% increase in VO2 peak and a 15% reduction in fructosamine. The exercise programme had no compensatory effects on PAL in type 2 diabetes patients, but improved their cardiorespiratory fitness and glycaemic control.

  7. BRCA1-regulated RRM2 expression protects glioblastoma cells from endogenous replication stress and promotes tumorigenicity

    DEFF Research Database (Denmark)

    Rasmussen, Rikke D.; Gajjar, Madhavsai K.; Tuckova, Lucie

    2016-01-01

    Oncogene-evoked replication stress (RS) fuels genomic instability in diverse cancer types. Here we report that BRCA1, traditionally regarded a tumour suppressor, plays an unexpected tumour-promoting role in glioblastoma (GBM), safeguarding a protective response to supraphysiological RS levels. Hi...

  8. Synthesis of isochromene-type scaffolds via single-flask Diels-Alder-[4 + 2]-annulation sequence of a silyl-substituted diene with menadione.

    Science.gov (United States)

    Lee, Jihoon; Panek, James S

    2014-06-20

    A sequential Diels-Alder reaction/silicon-directed [4 + 2]-annulation was developed to assemble hydroisochromene-type ring systems from menadione 2. In the first step, a Diels-Alder of the 1-silyl-substituted butadiene 1 with 2 furnished an intermediate cyclic allylsilane. Subsequently, TMSOTf promoted a [4 + 2]-annulation through trapping of an oxonium, generated by condensation between an aldehyde and the TBS protected alcohol resulted in the formation of a cis-fused hydroisochromene 13.

  9. Facts about Type 2

    Medline Plus

    Full Text Available ... and Learning About Prediabetes Type 2 Diabetes Risk Test Lower Your Risk Healthy Eating Overweight Smoking High Blood Pressure Physical Activity High Blood Glucose My Health Advisor Tools ...

  10. Relationship between adiponectin and type 2 diabetes

    International Nuclear Information System (INIS)

    Zhu Cuiying; Wang Qing; Han Yuan; Huang Gang

    2007-01-01

    In order to study the effect of plasma adiponectin on type 2 diabetes patients, the correlation between plasma adiponectin, serum glucose, insulin and plasma lipid of the patients with type 2 diabetes was analyzed. 32 subjects with normal glucose, 105 with type 2 diabetes, including 53 subjects without obesity (BMI 2 ) and 52 with obesity (BMI≥25kg/m 2 ) were involved into this study. The fasting plasma adiponectin, serum glucose, insulin and plasma lipid were measured by RIA. The results showed that the mean plasma adiponectin in normal, non-obesity and obesity group was 9.46±0.89 mg/L, 5.83±1.06mg/L and 3.17± 0.56mg/L, respectively. The plasma adiponectin levels in the type 2 diabetes group were significantly lower than that in normal group (P<0.05), especially in obesity group. The adiponectin level was significantly correlated with serum glucose and triglyceride, r value was -0.59 and -0.76, respectively. Adiponectin may be a kind of protective factor. It takes part in the pathogenesis of type 2 diabetes, and is close correlated with insulin resistance. The plasma adiponectin might be an effective index in the early diagnosis, prevention and treatment of type 2 diabetes. (authors)

  11. Carcinoma associated fibroblasts (CAFs) promote breast cancer motility by suppressing mammalian Diaphanous-related formin-2 (mDia2).

    Science.gov (United States)

    Dvorak, Kaitlyn M; Pettee, Krista M; Rubinic-Minotti, Kaitlin; Su, Robin; Nestor-Kalinoski, Andrea; Eisenmann, Kathryn M

    2018-01-01

    The tumor microenvironment (TME) promotes tumor cell invasion and metastasis. An important step in the shift to a pro-cancerous microenvironment is the transformation of normal stromal fibroblasts to carcinoma-associated fibroblasts (CAFs). CAFs are present in a majority of solid tumors and can directly promote tumor cell motility via cytokine, chemokine and growth factor secretion into the TME. The exact effects that the TME has upon cytoskeletal regulation in motile tumor cells remain enigmatic. The conserved formin family of cytoskeleton regulating proteins plays an essential role in the assembly and/or bundling of unbranched actin filaments. Mammalian Diaphanous-related formin 2 (mDia2/DIAPH3/Drf3/Dia) assembles a dynamic F-actin cytoskeleton that underlies tumor cell migration and invasion. We therefore sought to understand whether CAF-derived chemokines impact breast tumor cell motility through modification of the formin-assembled F-actin cytoskeleton. In MDA-MB-231 cells, conditioned media (CM) from WS19T CAFs, a human breast tumor-adjacent CAF line, significantly and robustly increased wound closure and invasion relative to normal human mammary fibroblast (HMF)-CM. WS19T-CM also promoted proteasome-mediated mDia2 degradation in MDA-MB-231 cells relative to control HMF-CM and WS21T CAF-CM, a breast CAF cell line that failed to promote robust MDA-MB-231 migration. Cytokine array analysis of CM identified up-regulated secreted factors in WS19T relative to control WS21T CM. We identified CXCL12 as a CM factor influencing loss of mDia2 protein while increasing MDA-MB-231 cell migration. Our data suggest a mechanism whereby CAFs promote tumor cell migration and invasion through CXCL12 secretion to regulate the mDia2-directed cytoskeleton in breast tumor cells.

  12. 'Change means sacrificing a good life': perceptions about severity of type 2 diabetes and preventive lifestyles among people afflicted or at high risk of type 2 diabetes in Iganga Uganda.

    Science.gov (United States)

    Mayega, Roy W; Etajak, Samuel; Rutebemberwa, Elizeus; Tomson, Goran; Kiguli, Juliet

    2014-08-21

    Interventions for prevention of type 2 diabetes ought to be acceptable to target communities. We assessed perceptions about type 2 diabetes and lifestyle change among people afflicted or at high risk of this disease in a low income setting in Iganga Uganda. Twelve focus group discussions (FGDs) of eight participants each were conducted, balancing rural and peri-urban (near the Municipality) residence and gender. The FGDs involved people with suspected type 2 diabetes (based on fasting plasma glucose (FPG), people with suspected pre-diabetes and obese people with normal FPG. Content analysis was conducted. Diabetes was perceived to be a very severe disease. Its severity was attributed to its incurability and its numerous health effects. Men were also concerned about reduced sexual performance. However, participants' strong concerns about the severity of diabetes were not reflected in their perceptions about the risk factors and lifestyles associated with it. While people with diabetes perceive obesity as 'sickness', those without diabetes perceive it as a sign of 'success'. Although participants are willing to change their diet, they mention numerous barriers including poverty, family size, and access to some foods. Because of their good taste, reduction of high risk foods like sugar and fried food is perceived as 'sacrificing a good life'. Increments in physical activity were said to be feasible, but only in familiar forms like domestic work. An over-arching theme emerged that 'lifestyle changes are viewed as sacrificing a good life'. Health promotion should target both community norms and individual awareness regarding obesity, physical activity and diet, and should address the notion that obesity and unhealthy foods represent a good life. Health educators should plan with clients on how to overcome barriers and misconceptions to lifestyle change, leveraging the pervasive perception of type 2 diabetes as a severe disease to motivate change.

  13. Maternal and Neonatal Outcomes in Korean Women with Type 1 and Type 2 Diabetes

    Directory of Open Access Journals (Sweden)

    Hee-Sook Kim

    2015-08-01

    Full Text Available BackgroundThe purpose of this study was to evaluate maternal and neonatal outcomes in Korean women with type 1 diabetes and type 2 diabetes.MethodsWe performed a retrospective survey of 163 pregnancies in women with type 1 diabetes (n=13 and type 2 diabetes (n=150 treated from 2003 to 2010 at Cheil General Hospital & Women's Healthcare Center, Korea. We compared maternal characteristics as well as maternal and neonatal outcomes between groups.ResultsDifferences in glycosylated hemoglobin between type 1 and type 2 diabetes were not significant. Birth weight (3,501±689.6 g vs. 3,366±531.4 g and rate of major congenital malformations (7.7% vs. 5.6% were not significantly different. However, women with type 1 diabetes had higher rates of preeclampsia (38.5% vs. 8.2%, P=0.006, large for gestational age (LGA; 46.2% vs. 20.4%, P=0.004, macrosomia (38.5% vs. 13.4%, P=0.032, and admission for neonatal care (41.7% vs. 14.8%, P=0.03 than women with type 2 diabetes.ConclusionMaternal and neonatal outcomes for women with type 1 diabetes were poorer than for women with type 2 diabetes, especially preeclampsia, LGA, macrosomia and admission to the neonatal intensive care unit.

  14. Blood metals concentration in type 1 and type 2 diabetics.

    Science.gov (United States)

    Forte, Giovanni; Bocca, Beatrice; Peruzzu, Angela; Tolu, Francesco; Asara, Yolande; Farace, Cristiano; Oggiano, Riccardo; Madeddu, Roberto

    2013-12-01

    Mechanisms for the onset of diabetes and the development of diabetic complications remain under extensive investigations. One of these mechanisms is abnormal homeostasis of metals, as either deficiency or excess of metals, can contribute to certain diabetic outcomes. Therefore, this paper will report the blood levels of chromium (Cr), copper (Cu), iron (Fe), manganese (Mn), mercury (Hg), nickel (Ni), lead (Pb), selenium (Se), and zinc (Zn) in subjects with type 1 diabetes (n = 192, mean age 48.8 years, mean disease duration 20.6 years), type 2 diabetes (n = 68, mean age 68.4 years, mean disease duration 10.2 years), and in control subjects (n = 59, mean age 57.2 years), and discuss the results indicating their possible role in diabetes. The metal concentrations were measured by sector field inductively coupled plasma mass spectrometry after microwave-induced acid digestion of blood samples. The accuracy was checked using a blood-based certified reference material, and recoveries of all elements were in the range of 92-101 % of certified values. Type 1 diabetes was found to be associated with Cr (p = 0.02), Mn (p < 0.001), Ni (p < 0.001), Pb (p = 0.02), and Zn (p < 0.001) deficiency, and type 2 diabetes with Cr (p = 0.014), Mn (p < 0.001), and Ni (p < 0.001) deficiency. These deficiencies were appreciated also subdividing the understudied patients for gender and age groups. Furthermore, in type 1 diabetes, there was a positive correlation between Pb and age (p < 0.001, ρ = 0.400) and Pb and BMI (p < 0.001, ρ = 0.309), while a negative correlation between Fe and age (p = 0.002, ρ = -0.218). In type 2 diabetes, there was a negative correlation between Fe and age (p = 0.017, ρ = -0.294) and Fe and BMI (p = 0.026, ρ = -0.301). Thus, these elements may play a role in both forms of diabetes and combined mineral supplementations could have beneficial effects.

  15. Facts about Type 2

    Medline Plus

    Full Text Available ... Practice Ways to Give Close Are You at Risk? Home Prevention Diagnosing Diabetes and Learning About Prediabetes Type 2 Diabetes Risk Test Lower Your Risk Healthy Eating Overweight Smoking ...

  16. Facts about Type 2

    Medline Plus

    Full Text Available ... Diagnosing Diabetes and Learning About Prediabetes Type 2 Diabetes Risk Test Lower Your Risk Healthy Eating Overweight Smoking High Blood Pressure Physical Activity High Blood Glucose My Health Advisor ...

  17. Promoter for the late gene encoding Vp5 of herpes simplex virus type 1 is recognized by cell extracts derived from uninfected cells

    International Nuclear Information System (INIS)

    Chisholm, G.E.; Summers, W.C.

    1986-01-01

    The ability of whole-cell extracts from unidentified HeLa cells to recognize the promoter for the herpes simplex virus type 1 late gene encoding the major capsid protein Vp5 was investigated by using both in vitro transcriptional and S1 nuclease protection analysis. This gene promoter was recognized by the cell extracts and produced abundant amounts of transcript in the absence of any other virus-encoded factors. This transcript was shown to arise, in vitro, from specific initiation at or very near the physiological mRNA start site. Thus, it appears that cell extracts from uninfected HeLa cells can efficiently recognize both early- and late-gene promoters

  18. Virologic Monitoring of Poliovirus Type 2 after Oral Poliovirus Vaccine Type 2 Withdrawal in April 2016 - Worldwide, 2016-2017.

    Science.gov (United States)

    Diop, Ousmane M; Asghar, Humayun; Gavrilin, Evgeniy; Moeletsi, Nicksy Gumede; Benito, Gloria Rey; Paladin, Fem; Pattamadilok, Sirima; Zhang, Yan; Goel, Ajay; Quddus, Arshad

    2017-05-26

    The Global Polio Eradication Initiative (GPEI) has made substantial progress since its launch in 1988; only 37 wild poliovirus type 1 (WPV1) cases were detected in 2016, the lowest annual count ever. Wild poliovirus type 3 has not been detected since November 2012, and wild poliovirus type 2 was officially declared eradicated in September 2015. This success is attributable to the wide use of live oral poliovirus vaccines (OPVs). Since 2001, numerous outbreaks were caused by the emergence of genetically divergent vaccine-derived polioviruses (VDPVs) whose genetic drift from the parental OPV strains indicates prolonged replication or circulation (1). In 2015, circulating VDPV type 2 (cVDPV2) outbreaks were detected in five countries worldwide (Nigeria, Pakistan, Guinea, Burma, and South Sudan), and VDPV2 single events were reported in 22 countries. These events prompted the GPEI to withdraw the type 2 component (Sabin2) of trivalent OPV (tOPV) in a globally coordinated, synchronized manner in April 2016 (2,3), at which time all OPV-using countries switched to using bivalent OPV (bOPV), containing Sabin types 1 and 3. This report details for the first time the virologic tracking of elimination of a live vaccine that has been withdrawn from routine and mass immunization systems worldwide (3). To secure elimination, further monitoring is warranted to detect any use of tOPV or monovalent OPV type 2 (mOPV2).

  19. Comparison of diabetic ketoacidosis in patients with type-1 and type-2 diabetes mellitus.

    Science.gov (United States)

    Barski, Leonid; Nevzorov, Roman; Harman-Boehm, Ilana; Jotkowitz, Alan; Rabaev, Elena; Zektser, Miri; Zeller, Lior; Shleyfer, Elena; Almog, Yaniv

    2013-04-01

    Diabetic ketoacidosis (DKA) occurs most often in patients with type 1 diabetes, however patients with type 2 diabetes are also susceptible to DKA under stressful conditions. The aims of our study were to evaluate and compare the clinical and biochemical characteristics and outcomes of type 1 versus type 2 diabetes mellitus (DM) patients with DKA. A retrospective cohort study of adult patients hospitalized with DKA between January 1, 2003, and January 1, 2010. The clinical and biochemical characteristics of DKA patients with type-1 DM were compared with those of patients with type-2 DM. The primary outcome was in-hospital all-cause mortality. The study cohort included 201 consecutive patients for whom the admission diagnosis was DKA: 166 patients (82.6%) with type-1 DM and 35 patients (17.4%) with type-2 DM. The patients with DKA and type-2 DM were significantly older than patients with type-1 DM (64.3 versus 37.3, P ventilation and bed-ridden state were independent predictors of 30-day mortality.

  20. Mdm2 is a novel activator of ApoCIII promoter which is antagonized by p53 and SHP inhibition

    Energy Technology Data Exchange (ETDEWEB)

    Yang, Zhihong; Zhang, Yuxia [Departments of Medicine and Oncological Sciences, Huntsman Cancer Institute, University of Utah School of Medicine, Salt Lake City, UT 84132 (United States); Wang, Li, E-mail: l.wang@hsc.utah.edu [Departments of Medicine and Oncological Sciences, Huntsman Cancer Institute, University of Utah School of Medicine, Salt Lake City, UT 84132 (United States)

    2012-01-13

    Highlights: Black-Right-Pointing-Pointer Mdm2 enhances HNF4{alpha} activation of the ApoCIII promoter via interaction with HNF4{alpha}. Black-Right-Pointing-Pointer p53 antagonizes the effect of Mdm2 activation of the ApoCIII promoter. Black-Right-Pointing-Pointer SHP strengthens p53 inhibition but abolishes Mdm2 activation of the ApoCIII promoter. Black-Right-Pointing-Pointer Mdm2 alters the enrichment of HNF4{alpha}, p53 and SHP to the ApoCIII promoter. -- Abstract: We examined the effect of Mdm2 on regulation of the ApoCIII promoter and its cross-talk with p53 and nuclear receptor SHP. Overexpression of Mdm2 markedly enhanced ApoCIII promoter activity by HNF4{alpha}. A direct association of Mdm2 protein with the HNF4{alpha} protein was observed by co-immunoprecipitation. Ectopic expression of p53 decreased HNF4{alpha} activation of the ApoCIII promoter and antagonized the effect of Mdm2. Co-expression of SHP further strengthened p53 inhibition and abolished Mdm2 activation of the ApoCIII promoter. Mdm2 inhibited p53-mediated enrichment of HNF4{alpha} to the ApoCIII promoter while simultaneously reducing p53 binding and increasing recruitment of SHP to the ApoCIII promoter. The results from this study implicate a potentially important function of Mdm2 in regulation of lipoprotein metabolism.

  1. Mdm2 is a novel activator of ApoCIII promoter which is antagonized by p53 and SHP inhibition

    International Nuclear Information System (INIS)

    Yang, Zhihong; Zhang, Yuxia; Wang, Li

    2012-01-01

    Highlights: ► Mdm2 enhances HNF4α activation of the ApoCIII promoter via interaction with HNF4α. ► p53 antagonizes the effect of Mdm2 activation of the ApoCIII promoter. ► SHP strengthens p53 inhibition but abolishes Mdm2 activation of the ApoCIII promoter. ► Mdm2 alters the enrichment of HNF4α, p53 and SHP to the ApoCIII promoter. -- Abstract: We examined the effect of Mdm2 on regulation of the ApoCIII promoter and its cross-talk with p53 and nuclear receptor SHP. Overexpression of Mdm2 markedly enhanced ApoCIII promoter activity by HNF4α. A direct association of Mdm2 protein with the HNF4α protein was observed by co-immunoprecipitation. Ectopic expression of p53 decreased HNF4α activation of the ApoCIII promoter and antagonized the effect of Mdm2. Co-expression of SHP further strengthened p53 inhibition and abolished Mdm2 activation of the ApoCIII promoter. Mdm2 inhibited p53-mediated enrichment of HNF4α to the ApoCIII promoter while simultaneously reducing p53 binding and increasing recruitment of SHP to the ApoCIII promoter. The results from this study implicate a potentially important function of Mdm2 in regulation of lipoprotein metabolism.

  2. MODEL2TALK : An Intervention to Promote Productive Classroom Talk

    NARCIS (Netherlands)

    van der Veen, Chiel; van der Wilt, Femke; van Kruistum, Claudia; van Oers, Bert; Michaels, Sarah

    2017-01-01

    This article describes the MODEL2TALK intervention, which aims to promote young children's oral communicative competence through productive classroom talk. Productive classroom talk provides children in early childhood education with many opportunities to talk and think together. Results from a

  3. Facts about Type 2

    Medline Plus

    Full Text Available ... Medicare Medicaid & CHIP For Parents & Kids Safe at School Everyday Life Children and Type 2 Diabetes Know Your Rights Employment Discrimination Health Care Professionals Law Enforcement Driver's License For Lawyers ...

  4. Facts about Type 2

    Medline Plus

    Full Text Available ... Day in the Life of Diabetes Famous People Working to Stop Diabetes Common Terms Diabetes Statistics Infographics Living with Diabetes Home Recently Diagnosed Where Do I Begin With Type2? ...

  5. E2F1 promote the aggressiveness of human colorectal cancer by activating the ribonucleotide reductase small subunit M2

    Energy Technology Data Exchange (ETDEWEB)

    Fang, Zejun [Sanmen People' s Hospital of Zhejiang, Sanmen, Zhejiang, 317100 (China); Gong, Chaoju [Department of Pathology and Pathophysiology, Zhejiang University School of Medicine, Hangzhou, Zhejiang, 310058 (China); Liu, Hong [Zhejiang Normal University – Jinhua People' s Hospital Joint Center for Biomedical Research, Jinhua, Zhejiang, 321004 (China); Zhang, Xiaomin; Mei, Lingming [Sanmen People' s Hospital of Zhejiang, Sanmen, Zhejiang, 317100 (China); Song, Mintao [Department of Pathophysiology, Institute of Basic Medical Sciences, Chinese Academy of Medical Sciences (CAMS), School of Basic Medicine, Peking Union Medical College (PUMC), Beijing, 100005 (China); Qiu, Lanlan; Luo, Shuchai; Zhu, Zhihua; Zhang, Ronghui; Gu, Hongqian [Sanmen People' s Hospital of Zhejiang, Sanmen, Zhejiang, 317100 (China); Chen, Xiang, E-mail: sychenxiang@126.com [Sanmen People' s Hospital of Zhejiang, Sanmen, Zhejiang, 317100 (China)

    2015-08-21

    As the ribonucleotide reductase small subunit, the high expression of ribonucleotide reductase small subunit M2 (RRM2) induces cancer and contributes to tumor growth and invasion. In several colorectal cancer (CRC) cell lines, we found that the expression levels of RRM2 were closely related to the transcription factor E2F1. Mechanistic studies were conducted to determine the molecular basis. Ectopic overexpression of E2F1 promoted RRM2 transactivation while knockdown of E2F1 reduced the levels of RRM2 mRNA and protein. To further investigate the roles of RRM2 which was activated by E2F1 in CRC, CCK-8 assay and EdU incorporation assay were performed. Overexpression of E2F1 promoted cell proliferation in CRC cells, which was blocked by RRM2 knockdown attenuation. In the migration and invasion tests, overexpression of E2F1 enhanced the migration and invasion of CRC cells which was abrogated by silencing RRM2. Besides, overexpression of RRM2 reversed the effects of E2F1 knockdown partially in CRC cells. Examination of clinical CRC specimens demonstrated that both RRM2 and E2F1 were elevated in most cancer tissues compared to the paired normal tissues. Further analysis showed that the protein expression levels of E2F1 and RRM2 were parallel with each other and positively correlated with lymph node metastasis (LNM), TNM stage and distant metastasis. Consistently, the patients with low E2F1 and RRM2 levels have a better prognosis than those with high levels. Therefore, we suggest that E2F1 can promote CRC proliferation, migration, invasion and metastasis by regulating RRM2 transactivation. Understanding the role of E2F1 in activating RRM2 transcription will help to explain the relationship between E2F1 and RRM2 in CRC and provide a novel predictive marker for diagnosis and prognosis of the disease. - Highlights: • E2F1 promotes RRM2 transactivation in CRC cells. • E2F1 promotes the proliferation of CRC cells by activating RRM2. • E2F1 promotes the migration and

  6. E2F/Rb Family Proteins Mediate Interferon Induced Repression of Adenovirus Immediate Early Transcription to Promote Persistent Viral Infection.

    Directory of Open Access Journals (Sweden)

    Yueting Zheng

    2016-01-01

    Full Text Available Interferons (IFNs are cytokines that have pleiotropic effects and play important roles in innate and adaptive immunity. IFNs have broad antiviral properties and function by different mechanisms. IFNs fail to inhibit wild-type Adenovirus (Ad replication in established cancer cell lines. In this study, we analyzed the effects of IFNs on Ad replication in normal human cells. Our data demonstrate that both IFNα and IFNγ blocked wild-type Ad5 replication in primary human bronchial epithelial cells (NHBEC and TERT-immortalized normal human diploid fibroblasts (HDF-TERT. IFNs inhibited the replication of divergent adenoviruses. The inhibition of Ad5 replication by IFNα and IFNγ is the consequence of repression of transcription of the E1A immediate early gene product. Both IFNα and IFNγ impede the association of the transactivator GABP with the E1A enhancer region during the early phase of infection. The repression of E1A expression by IFNs requires a conserved E2F binding site in the E1A enhancer, and IFNs increased the enrichment of the E2F-associated pocket proteins, Rb and p107, at the E1A enhancer in vivo. PD0332991 (Pabociclib, a specific CDK4/6 inhibitor, dephosphoryles pocket proteins to promote their interaction with E2Fs and inhibited wild-type Ad5 replication dependent on the conserved E2F binding site. Consistent with this result, expression of the small E1A oncoprotein, which abrogates E2F/pocket protein interactions, rescued Ad replication in the presence of IFNα or IFNγ. Finally, we established a persistent Ad infection model in vitro and demonstrated that IFNγ suppresses productive Ad replication in a manner dependent on the E2F binding site in the E1A enhancer. This is the first study that probes the molecular basis of persistent adenovirus infection and reveals a novel mechanism by which adenoviruses utilize IFN signaling to suppress lytic virus replication and to promote persistent infection.

  7. HNF1 alpha activates the aminopeptidase N promoter in intestinal (Caco-2) cells

    DEFF Research Database (Denmark)

    Olsen, Jørgen; Laustsen, Lotte; Troelsen, J

    1994-01-01

    The importance of HNF1 binding proteins for intestinal aminopeptidase N expression was investigated using the Caco-2 cell-line. Aminopeptidase N promoter activity in Caco-2 cells depends on the HNF1 element (positions -85 to -58) and co-transfection with an HNF1 alpha expression vector demonstrates...... a direct activation of the promoter by HNF1 alpha through this element. Electrophoretic mobility shift assays using nuclear extracts from Caco-2 cells show the presence of high amounts of HNF1 binding proteins irrespective of their state of differentiation....

  8. Exercise and type 2 diabetes

    DEFF Research Database (Denmark)

    Karstoft, Kristian; Pedersen, Bente Klarlund

    2016-01-01

    Type 2 diabetes mellitus (T2DM) is associated with metabolic dysregulation and chronic inflammation, and regular exercise may provide a strong stimulus for improving both. In this review, we first discuss the link between inflammation and metabolism. Next, we give an update on the clinical metabo...... of long-term randomized clinical training studies with hard end points, it should be emphasized that physical activity represents a natural strong anti-inflammatory and metabolism-improving strategy with minor side effects.......Type 2 diabetes mellitus (T2DM) is associated with metabolic dysregulation and chronic inflammation, and regular exercise may provide a strong stimulus for improving both. In this review, we first discuss the link between inflammation and metabolism. Next, we give an update on the clinical...

  9. Siblings Promote a Type 1/Type 17-oriented immune response in the airways of asymptomatic neonates.

    Science.gov (United States)

    Wolsk, H M; Chawes, B L; Følsgaard, N V; Rasmussen, M A; Brix, S; Bisgaard, H

    2016-06-01

    Siblings have been shown to reduce the risk of childhood asthma and allergy, but the mechanism driving this association is unknown. The objective was to study whether siblings affect the airway immune response in healthy neonates, which could represent an underlying immune modulatory pathway. We measured 20 immune mediators related to the Type 1, Type 2, Type 17, or regulatory immune pathways in the airway mucosa of 571 one-month-old asymptomatic neonates from the Copenhagen Prospective Studies on Asthma in Childhood2010 birth cohort (COPSAC2010 ). The association between airway mediator levels and presence of siblings was investigated using conventional statistics and principle component analysis (PCA). Neonates with siblings had an upregulated level of airway immune mediators, with predominance of Type 1- and Type 17-related mediators. This was supported by the PCA showing a highly significant difference between children with vs without siblings: P Siblings mediate a Type 1/Type 17-related immune-stimulatory effect in the airways of asymptomatic neonates, also after adjustment for pathogenic bacteria and viruses, indicating that siblings exert a transferable early immune modulatory effect. These findings may represent an in utero immune priming effect of the fetal immune system caused by previous pregnancies as the effect was attenuated with time since last childbirth, or it could relate to the presence of unidentified microbes, but further studies are needed to confirm our findings. © 2016 John Wiley & Sons A/S. Published by John Wiley & Sons Ltd.

  10. Overexpression of pig selenoprotein S blocks OTA-induced promotion of PCV2 replication by inhibiting oxidative stress and p38 phosphorylation in PK15 cells

    Science.gov (United States)

    Gan, Fang; Hu, Zhihua; Huang, Yu; Xue, Hongxia; Huang, Da; Qian, Gang; Hu, Junfa; Chen, Xingxiang; Wang, Tian; Huang, Kehe

    2016-01-01

    Porcine circovirus type 2 (PCV2) is the primary cause of porcine circovirus disease, and ochratoxin A (OTA)-induced oxidative stress promotes PCV2 replication. In humans, selenoprotein S (SelS) has antioxidant ability, but it is unclear whether SelS affects viral infection. Here, we stably transfected PK15 cells with pig pCDNA3.1-SelS to overexpress SelS. Selenium (Se) at 2 or 4 μM and SelS overexpression blocked the OTA-induced increases of PCV2 DNA copy number and infected cell numbers. SelS overexpression also increased glutathione (GSH), NF-E2-related factor 2 (Nrf2) mRNA, and γ-glutamyl-cysteine synthetase mRNA levels; decreased reactive oxygen species (ROS) levels; and inhibited p38 phosphorylation in PCV2-infected PK15 cells, regardless of OTA treatment. Buthionine sulfoximine reversed all of the above SelS-induced changes. siRNA-mediated SelS knockdown decreased Nrf2 mRNA and GSH levels, increased ROS levels, and promoted PCV2 replication in OTA-treated PK15 cells. These data indicate that pig SelS blocks OTA-induced promotion of PCV2 replication by inhibiting the oxidative stress and p38 phosphorylation in PK15 cells. PMID:26943035

  11. Electrochemical promotion of oxidative coupling of methane on platinum/polybenzimidazole catalyst

    DEFF Research Database (Denmark)

    Petrushina, Irina; Bandur, Viktor; Bjerrum, Niels

    2002-01-01

    The electrochemical promotion of catalytic methane oxidation was studied using a (CH4,O-2,Ar), Pt\\polybenzimidazole (PBI)-H3PO4\\Pt,(H-2,Ar) fuel cell at 135degreesC. It has been found that C2H2, CO2, and water are the main oxidation products. Without polarization the yield of C2H2 was 0......, meaning that there was a maximum promotion effect at a polarization of -0.15 V, or 0.45 V catalyst potential vs. a hydrogen electrode (3.8% C2H2 yield). The catalytic rate enhancement ratio, r(C-2)/r(o)(C-2), at this maximum was 4.2. There was no C2H2 production at polarization greater than or equal to0.......9% and the yield of CO2 was 7.3%. This means that C-2 open-circuit selectivity was approximately 11%. Open-circuit voltage was around 0.6 V. It has been shown that the CH4 --> C2H2 catalytic reaction can be electrochemically promoted at negative polarization and exhibits a clear "volcano-type'' promotion behavior...

  12. SAV1 promotes Hippo kinase activation through antagonizing the PP2A phosphatase STRIPAK

    Energy Technology Data Exchange (ETDEWEB)

    Bae, Sung Jun [Department of Pharmacology, University of Texas Southwestern Medical Center, Dallas, United States; Ni, Lisheng [Department of Pharmacology, University of Texas Southwestern Medical Center, Dallas, United States; Osinski, Adam [Department of Pharmacology, University of Texas Southwestern Medical Center, Dallas, United States; Tomchick, Diana R. [Department of Biophysics, University of Texas Southwestern Medical Center, Dallas, United States; Brautigam, Chad A. [Department of Biophysics, University of Texas Southwestern Medical Center, Dallas, United States; Department of Microbiology, University of Texas Southwestern Medical Center, Dallas, United States; Luo, Xuelian [Department of Pharmacology, University of Texas Southwestern Medical Center, Dallas, United States; Department of Biophysics, University of Texas Southwestern Medical Center, Dallas, United States

    2017-10-24

    The Hippo pathway controls tissue growth and homeostasis through a central MST-LATS kinase cascade. The scaffold protein SAV1 promotes the activation of this kinase cascade, but the molecular mechanisms remain unknown. Here, we discover SAV1-mediated inhibition of the PP2A complex STRIPAKSLMAP as a key mechanism of MST1/2 activation. SLMAP binding to autophosphorylated MST2 linker recruits STRIPAK and promotes PP2A-mediated dephosphorylation of MST2 at the activation loop. Our structural and biochemical studies reveal that SAV1 and MST2 heterodimerize through their SARAH domains. Two SAV1–MST2 heterodimers further dimerize through SAV1 WW domains to form a heterotetramer, in which MST2 undergoes trans-autophosphorylation. SAV1 directly binds to STRIPAK and inhibits its phosphatase activity, protecting MST2 activation-loop phosphorylation. Genetic ablation of SLMAP in human cells leads to spontaneous activation of the Hippo pathway and alleviates the need for SAV1 in Hippo signaling. Thus, SAV1 promotes Hippo activation through counteracting the STRIPAKSLMAP PP2A phosphatase complex.

  13. Analog insulin detemir for patients with type 1 and type 2 diabetes: a review

    Directory of Open Access Journals (Sweden)

    Gregory E Peterson

    2009-05-01

    Full Text Available Gregory E PetersonDepartment of Internal Medicine, Des Moines University, USAObjective: To review insulin detemir for clinical use to better manage patients with type 1 and type 2 diabetes.Methods: A MEDLINE search, in English, from June 30, 2006 to December 1, 2008, using the terms “insulin analogs,” “insulin detemir” and “long-acting insulin analog.”Results: Insulin detemir improves glycemic control, based on HbA1C reduction and fasting glucose levels, without increasing the risk of hypoglycemia and weight gain. Insulin detemir has lower glycemic variability, with less intra-subject variability in blood glucose levels in patients with type 1 and type 2 diabetes, without increasing the risk of hypoglycemia. When added to oral anti-diabetes agents (OADs in type 2 diabetes, insulin detemir demonstrates superiority to other basal insulin options.Conclusion: Insulin detemir appears to provide better glycemic control with a lower risk of hypoglycemia and less weight gain in the treatment of patients with type 1 and type 2 diabetes.Keywords: type 1 diabetes, type 2 diabetes, insulin analogs, insulin detemir

  14. Association of aldose reductase gene Z+2 polymorphism with reduced susceptibility to diabetic nephropathy in Caucasian Type 1 diabetic patients

    DEFF Research Database (Denmark)

    Lajer, Mathilde; Tarnow, L; Fleckner, Jan

    2004-01-01

    AIMS: The Z-2 allele of the (AC)n polymorphism in the aldose reductase gene (ALR2) confers increased risk of microvascular diabetic complications, whereas the Z+2 allele has been proposed to be a marker of protection. However data are conflicting. Therefore, we investigated whether this polymorph......AIMS: The Z-2 allele of the (AC)n polymorphism in the aldose reductase gene (ALR2) confers increased risk of microvascular diabetic complications, whereas the Z+2 allele has been proposed to be a marker of protection. However data are conflicting. Therefore, we investigated whether...... this polymorphism is associated with diabetic nephropathy and retinopathy in Type 1 diabetes mellitus in a large case-control study and a family-based analysis. METHODS: A total of 431 Type 1 diabetic patients with diabetic nephropathy and 468 patients with longstanding Type 1 diabetes and persistent...... of the ALR2 promoter polymorphism is associated with a reduced susceptibility to diabetic nephropathy in Danish Type 1 diabetic patients, suggesting a minor role for the polyol pathway in the pathogenesis of diabetic kidney disease. No association of the ALR2 polymorphism with diabetic retinopathy was found....

  15. Alkali promotion of N-2 dissociation over Ru(0001)

    DEFF Research Database (Denmark)

    Mortensen, Jens Jørgen; Hammer, Bjørk; Nørskov, Jens Kehlet

    1998-01-01

    Using self-consistent density functional calculations, we show that adsorbed Na and Cs lower the barrier for dissociation of N2 on Ru(0001). Since N2 dissociation is a crucial step in the ammonia synthesis reaction, we explain in this way the experimental observation that alkali metals promote th...... the ammonia synthesis reaction over Ru catalysts. We also show that the origin of this effect is predominantly a direct electrostatic attraction between the adsorbed alkali atoms and the dissociating molecule....

  16. Protection motivation theory and the prediction of physical activity among adults with type 1 or type 2 diabetes in a large population sample.

    Science.gov (United States)

    Plotnikoff, Ronald C; Lippke, Sonia; Trinh, Linda; Courneya, Kerry S; Birkett, Nick; Sigal, Ronald J

    2010-09-01

    To investigate the utility of the protection motivation theory (PMT) for explaining physical activity (PA) in an adult population with type 1 diabetes (T1D) and type 2 diabetes (T2D). Cross-sectional and 6-month longitudinal analysis using PMT. Two thousand three hundred and eleven individuals with T1D (N=697) and T2D (N=1,614) completed self-report PMT constructs of vulnerability, severity, response efficacy, self-efficacy, and intention, and PA behaviour at baseline and 6-month follow-up. Multi-group structural equation modelling was conducted to: (1) test the fit of the PMT structure; (2) determine the similarities and differences in the PMT structure between the two types of diabetes; and (3) examine the explained variance and compare the strength of association of the PMT constructs in predicting PA intention and behaviour. The findings provide evidence for the utility of the PMT in both diabetes samples (chi(2)/df=1.27-4.08, RMSEA=.02-.05). Self-efficacy was a stronger predictor of intention (beta=0.64-0.68) than response efficacy (beta=0.14-0.16) in individuals with T1D or T2D. Severity was significantly related to intention (beta=0.06) in T2D individuals only, whereas vulnerability was not significantly related to intention or PA behaviour. Self-efficacy (beta's=0.20-0.28) and intention (beta's=0.12-0.30) were significantly associated with PA behaviour. Promotion of PA behaviour should primarily target self-efficacy to form intentions and to change behaviour. In addition, for individuals with T2D, severity information should be incorporated into PA intervention materials in this population.

  17. Treating Type 2 Diabetes

    Science.gov (United States)

    ... health care team is there for you. Your child's diabetes management plan should be easy to understand, detailed, ... Can Diabetes Be Prevented? Monitoring Blood Sugar Your Child's Diabetes Health Care Team Medicines for Diabetes Type 2 ...

  18. A growth hormone receptor SNP promotes lung cancer by impairment of SOCS2-mediated degradation

    DEFF Research Database (Denmark)

    Chhabra, Y.; Wong, H. Y.; Nikolajsen, Louise Fletcher

    2018-01-01

    Both humans and mice lacking functional growth hormone (GH) receptors are known to be resistant to cancer. Further, autocrine GH has been reported to act as a cancer promoter. Here we present the first example of a variant of the GH receptor (GHR) associated with cancer promotion, in this case lu......-mesenchymal transition and metastases (TWIST1, SNAI2, EGFR, MYC and CCND1) at 2 h after a GH pulse. This is consistent with prolonged GH signalling acting to promote cancer progression in lung cancer.Oncogene advance online publication, 2 October 2017; doi:10.1038/onc.2017.352....

  19. Type checking mCRL2

    NARCIS (Netherlands)

    Keiren, J.J.A.; Reniers, M.A.

    2011-01-01

    In this paper we present a type system for the data language of mCRL2, a process algebra based language for formalising the behaviour of communicating system. Much of the type system is standard, and follows the line of, e.g., Pierce [Pie02]. The data language that is described is rich, and supports

  20. Flood control project selection using an interval type-2 entropy weight with interval type-2 fuzzy TOPSIS

    Science.gov (United States)

    Zamri, Nurnadiah; Abdullah, Lazim

    2014-06-01

    Flood control project is a complex issue which takes economic, social, environment and technical attributes into account. Selection of the best flood control project requires the consideration of conflicting quantitative and qualitative evaluation criteria. When decision-makers' judgment are under uncertainty, it is relatively difficult for them to provide exact numerical values. The interval type-2 fuzzy set (IT2FS) is a strong tool which can deal with the uncertainty case of subjective, incomplete, and vague information. Besides, it helps to solve for some situations where the information about criteria weights for alternatives is completely unknown. Therefore, this paper is adopted the information interval type-2 entropy concept into the weighting process of interval type-2 fuzzy TOPSIS. This entropy weight is believed can effectively balance the influence of uncertainty factors in evaluating attribute. Then, a modified ranking value is proposed in line with the interval type-2 entropy weight. Quantitative and qualitative factors that normally linked with flood control project are considered for ranking. Data in form of interval type-2 linguistic variables were collected from three authorised personnel of three Malaysian Government agencies. Study is considered for the whole of Malaysia. From the analysis, it shows that diversion scheme yielded the highest closeness coefficient at 0.4807. A ranking can be drawn using the magnitude of closeness coefficient. It was indicated that the diversion scheme recorded the first rank among five causes.

  1. Enhancing promotional strategies within social marketing programs: use of Web 2.0 social media.

    Science.gov (United States)

    Thackeray, Rosemary; Neiger, Brad L; Hanson, Carl L; McKenzie, James F

    2008-10-01

    The second generation of Internet-based applications (i.e., Web 2.0), in which users control communication, holds promise to significantly enhance promotional efforts within social marketing campaigns. Web 2.0 applications can directly engage consumers in the creative process by both producing and distributing information through collaborative writing, content sharing, social networking, social bookmarking, and syndication. Web 2.0 can also enhance the power of viral marketing by increasing the speed at which consumers share experiences and opinions with progressively larger audiences. Because of the novelty and potential effectiveness of Web 2.0, social marketers may be enticed to prematurely incorporate related applications into promotional plans. However, as strategic issues such as priority audience preferences, selection of appropriate applications, tracking and evaluation, and related costs are carefully considered, Web 2.0 will expand to allow health promotion practitioners more direct access to consumers with less dependency on traditional communication channels.

  2. Facts about Type 2

    Medline Plus

    Full Text Available ... You at Risk? Home Prevention Diagnosing Diabetes and Learning About Prediabetes Type 2 Diabetes Risk Test Lower ... Find Your Local Office Find your local diabetes education program Calendar of Events Wellness Lives Here Awareness ...

  3. Facts about Type 2

    Medline Plus

    Full Text Available ... Risk? Home Prevention Diagnosing Diabetes and Learning About Prediabetes Type 2 Diabetes Risk Test Lower Your Risk ... Chat Closed engagement en -- So…Do You Have Prediabetes? - 2017-01-ad-council.html So…Do You ...

  4. Facts about Type 2

    Medline Plus

    Full Text Available ... make enough insulin to keep your blood glucose levels normal. Type 2 is treated with lifestyle changes, ... starved for energy. Over time, high blood glucose levels may hurt your eyes, kidneys, nerves or heart. ...

  5. Facts about Type 2

    Medline Plus

    Full Text Available ... breast cancer and AIDS combined. Your gift today will help us get closer to curing diabetes and ... html Have Type 2 Diabetes? Our free program will help you live well. More from diabetes.org ...

  6. Facts about Type 2

    Medline Plus

    Full Text Available ... for Association Events Messaging Tools Recruiting Advocates Local Market Planning Training Webinars News & Events Advocacy News Call ... medications or insulin to help you meet your target blood glucose levels. Type 2 usually gets worse ...

  7. Facts about Type 2

    Medline Plus

    Full Text Available ... You at Risk? Home Prevention Diagnosing Diabetes and Learning About Prediabetes Type 2 Diabetes Risk Test Lower ... EXPO Volunteer Opportunities Sponsorship and Exhibit Opportunities Camp Learning at Camp Find a Camp Fundraising Events Step ...

  8. Facts about Type 2

    Medline Plus

    Full Text Available ... Know Your Rights Employment Discrimination Health Care Professionals Law Enforcement Driver's License For Lawyers Food & Fitness Home ... make enough insulin to keep your blood glucose levels normal. Type 2 is treated with lifestyle changes, ...

  9. Facts about Type 2

    Medline Plus

    Full Text Available ... Life Children and Type 2 Diabetes Know Your Rights Employment Discrimination Health Care Professionals Law Enforcement Driver's ... going into cells, it can cause two problems: Right away, your cells may be starved for energy. ...

  10. Facts about Type 2

    Medline Plus

    Full Text Available ... to Give Close Are You at Risk? Home Prevention Diagnosing Diabetes and Learning About Prediabetes Type 2 ... Disease (Nephropathy) Gastroparesis Mental Health Step On Up Treatment & Care Blood Glucose Testing Medication Doctors, Nurses & More ...

  11. Facts about Type 2

    Medline Plus

    Full Text Available ... of Diabetes Diabetes Myths A Day in the Life of Diabetes Famous People Working to Stop Diabetes ... CHIP For Parents & Kids Safe at School Everyday Life Children and Type 2 Diabetes Know Your Rights ...

  12. Facts about Type 2

    Medline Plus

    Full Text Available ... Us in the Fight for a Cure Your tax-deductible gift today can fund critical diabetes research ... Type 2 Diabetes Program Food & Fitness Food Recipes Planning Meals What Can I Eat Weight Loss Fitness ...

  13. Facts about Type 2

    Medline Plus

    Full Text Available ... and Learning About Prediabetes Type 2 Diabetes Risk Test Lower Your Risk Healthy Eating Overweight Smoking High ... You at Risk? Diagnosis Lower Your Risk Risk Test Alert Day Prediabetes My Health Advisor Tools to ...

  14. Facts about Type 2

    Medline Plus

    Full Text Available ... Future Without Diabetes - a-future-without-diabetes-2.html A Future Without Diabetes Make your donation today ... Donate Today We Can Help - we-can-help.html Chat Online Chat Closed engagement en -- Have Type ...

  15. Facts about Type 2

    Medline Plus

    Full Text Available ... and Learning About Prediabetes Type 2 Diabetes Risk Test Lower Your Risk Healthy Eating Overweight Smoking High ... excused. 86 million Americans have prediabetes. Take the test. Know where you stand. More from diabetes.org ...

  16. Facts about Type 2

    Medline Plus

    Full Text Available ... Complications DKA (Ketoacidosis) & Ketones Kidney Disease (Nephropathy) Gastroparesis Mental Health Step On Up Treatment & Care Blood Glucose ... or heart. Some people with type 2 can control their blood glucose with healthy eating and being ...

  17. Facts about Type 2

    Medline Plus

    Full Text Available ... Type 2 Diabetes Program In It Together We Can Help Center for Information Legal Assistance Success Stories ... with Heart-Healthy Foods Holiday Meal Planning What Can I Eat? Making Healthy Food Choices Diabetes Superfoods ...

  18. Facts about Type 2

    Medline Plus

    Full Text Available ... Risk? Home Prevention Diagnosing Diabetes and Learning About Prediabetes Type 2 Diabetes Risk Test Lower Your Risk ... Diagnosis Lower Your Risk Risk Test Alert Day Prediabetes My Health Advisor Tools to Know Your Risk ...

  19. Facts about Type 2

    Medline Plus

    Full Text Available ... hotelscom.html Ways to Give Vacation for Donations Travel bookings completed through Hotels.com give 5% back ... about type 2 diabetes. Recipes and More: Diabetes Food Hub - recipes-and-more-1.html Recipes and ...

  20. Facts about Type 2

    Medline Plus

    Full Text Available ... Medicare Medicaid & CHIP For Parents & Kids Safe at School Everyday Life Children and Type 2 Diabetes Know ... Cure Father of the Year Stop Diabetes at School Tour de Cure Women's Series Do-It-Yourself ...

  1. Facts about Type 2

    Medline Plus

    Full Text Available ... Diets Meal Planning for Vegetarian Diets Cook with Heart-Healthy Foods Holiday Meal Planning What Can I ... levels may hurt your eyes, kidneys, nerves or heart. Some people with type 2 can control their ...

  2. Facts about Type 2

    Medline Plus

    Full Text Available ... Future Without Diabetes - a-future-without-diabetes-2.html A Future Without Diabetes Donate towards research today ... Donate Today We Can Help - we-can-help.html Chat Online Chat Closed engagement en -- Have Type ...

  3. Facts about Type 2

    Medline Plus

    Full Text Available ... Diabetes Risk Test Lower Your Risk Healthy Eating Overweight Smoking High Blood Pressure Physical Activity High Blood ... For Parents & Kids Safe at School Everyday Life Children and Type 2 Diabetes Know Your Rights Employment ...

  4. Facts about Type 2

    Medline Plus

    Full Text Available ... is Gestational Diabetes? How to Treat Gestational Diabetes Genetics of Diabetes Diabetes Myths A Day in the ... 1 Type 2 Gestational Myths Statistics Common Terms Genetics Living With Diabetes Recently Diagnosed Treatment & Care Complications ...

  5. Facts about Type 2

    Medline Plus

    Full Text Available ... A Day in the Life of Diabetes Famous People Working to Stop Diabetes Common Terms Diabetes Statistics ... hurt your eyes, kidneys, nerves or heart. Some people with type 2 can control their blood glucose ...

  6. Facts about Type 2

    Medline Plus

    Full Text Available ... My Community Advocacy Research & Practice Ways to Give Close Are You at Risk? Home Prevention Diagnosing Diabetes ... 800-DIABETES (800-342-2383) Give by Mail Close www.diabetes.org > Diabetes Basics > Type 2 Share: ...

  7. Facts about Type 2

    Medline Plus

    Full Text Available ... Eye Complications Neuropathy Foot Complications DKA (Ketoacidosis) & Ketones Kidney Disease (Nephropathy) Gastroparesis Mental Health Step On Up ... high blood glucose levels may hurt your eyes, kidneys, nerves or heart. Some people with type 2 ...

  8. Facts about Type 2

    Medline Plus

    Full Text Available ... of Events Wellness Lives Here Awareness Programs Hispanic Heritage Month African American Programs Latino Programs Asian Americans, ... 1 Type 2 Gestational Myths Statistics Common Terms Genetics Living With Diabetes Recently Diagnosed Treatment & Care Complications ...

  9. Association of Chlamydia trachomatis Infection and Herpes Simplex Virus Type 2 Serostatus With Genital Human Papillomavirus Infection in Men: The HPV in Men Study

    NARCIS (Netherlands)

    Alberts, Catharina Johanna; Schim van der Loeff, Maarten F.; Papenfuss, Mary R.; da Silva, Roberto José Carvalho; Villa, Luisa Lina; Lazcano-Ponce, Eduardo; Nyitray, Alan G.; Giuliano, Anna R.

    2013-01-01

    Background: Studies in women indicate that some sexually transmitted infections promote human papillomavirus (HPV) persistence and carcinogenesis. Little is known about this association in men; therefore, we assessed whether Chlamydia trachomatis (CT) infection and herpes simplex virus type 2

  10. Intensive integrated therapy of type 2 diabetes

    DEFF Research Database (Denmark)

    Gaede, Peter; Pedersen, Oluf

    2004-01-01

    The macro- and microvascular burden of type 2 diabetes is well established. A number of recent single risk factor intervention trials targeting hyperglycemia, dyslipidemia, hypertension, procoagulation, microalbumuria, and existing cardiovascular disorders have, however, shown major beneficial...... effects on long-term outcome. The results from these studies are anticipated to change the future management of type 2 diabetes, and most of the updated national guidelines for the treatment of type 2 diabetes recommend a multipronged approach driven by ambitious treatment targets. The outcome...... of this intensive integrated therapy has, however, only been investigated in a few studies of patients with type 2 diabetes. One of these trials, the Steno-2 Study, showed that intensive intervention for an average of 7.8 years cuts cardiovascular events as well as nephropathy, retinopathy, and autonomic neuropathy...

  11. Parasitic helminths and their beneficial impact on type 1 and type 2 diabetes.

    Science.gov (United States)

    Berbudi, Afiat; Ajendra, Jesuthas; Wardani, Ajeng P F; Hoerauf, Achim; Hübner, Marc P

    2016-03-01

    It is estimated that by the year 2035 almost 600 million people will suffer from diabetes. In the case of type 2 diabetes, the strongest increase of diabetes incidence occurs in developing and newly industrialized countries. This increase correlates not only with a progressing sedentary lifestyle and nutritional changes, but also environmental changes. Similarly, the increase of type 1 diabetes incidence in industrialized countries over the past decades cannot be explained by genetic factors alone, suggesting that environmental changes are also involved. One such environmental change is a reduced exposure to pathogens because of improved hygiene. Parasitic helminths modulate the immune system of their hosts and induce type 2 as well as regulatory immune responses. As pro-inflammatory immune responses are crucial for the onset of both type 1 and type 2 diabetes, helminth-induced immunomodulation may prevent diabetes onset and ameliorate insulin sensitivity. Several epidemiological studies in human and experimental animal models support such a protective effect of helminths for autoimmune diabetes. Recent studies further suggest that helminths may also provide such a beneficial effect for type 2 diabetes. In this review we summarize studies that investigated parasitic helminths and helminth-derived products and their impact on both type 1 and type 2 diabetes highlighting potential protective mechanisms. Copyright © 2015 John Wiley & Sons, Ltd.

  12. Facts about Type 2

    Medline Plus

    Full Text Available ... the Living WIth Type 2 Diabetes Program In It Together We Can Help Center for Information Legal ... at School Tour de Cure Women's Series Do-It-Yourself Fundraising Become a Volunteer American Diabetes Month® ...

  13. Facts about Type 2

    Medline Plus

    Full Text Available ... August 1, 2013 Last Edited: October 27, 2015 Articles from Diabetes Forecast® magazine: lp-type-2, . In ... today and help fund grants supporting next generation scientists. Donate Today We Can Help - we-can-help. ...

  14. Efficacy and Safety of GLP-1 Receptor Agonists for Type 2 Diabetes Mellitus Treatment: Systematic Review

    Directory of Open Access Journals (Sweden)

    Ana Paula Martins

    2016-04-01

    Full Text Available Introduction: Glucagon-like peptide analogues are a new class of drugs used in the treatment of type 2 diabetes mellitus that mimic the endogenous hormone glucagon-like peptide 1. Glucagon-like peptide 1 regulates glucose levels by stimulating glucose-dependent insulin secretion, suppressing glucagon secretion, delayed gastric emptying and promoting satiety. The individualized treatment of type 2 diabetes mellitus, using various glucagon--like peptide receptor agonists, has recently been described and the interest related to these drugs continues to grow. Objectives: To review the efficacy and safety of glucagon-like peptide 1 agonists in patients with inadequately controlled type 2 diabetes mellitus on metformin alone, highlighting their added value in therapeutic use comparatively to second line oral therapies used in type 2 diabetes mellitus. Methods: Studies were obtained from electronic searches of The Cochrane Library and PubMed. Randomized controlled trials were selected if they were at least 8 weeks in duration; compared a glucagon-like peptide 1 analogue with an oral anti-diabetic agent in patients experiencing inadequate glycemic control with metformin monotherapy; and reported hemoglobin A1c data in non-pregnant adults with type 2 diabetes mellitus. Results: Of 72 potentially relevant articles identified, 23 were retrieved for detailed evaluation and 10 met the inclusion criteria. The majority of glucagon-like peptide 1 agonists showed equivalent or superior efficacy than most active comparators for reducing hemoglobin A1c, with a greater proportion of patients achieving hemoglobin A1c <7%. Glucagon-like peptide 1 agonists also showed extra-glycemic effects such as weight loss and the reduction of important cardiovascular parameters. Side effects included gastrointestinal complications, mainly nausea, vomiting and diarrhea. The incidence of hypoglycemia was less common for this class of agents. Conclusion: Glucagon-like peptide 1

  15. The cardiac calsequestrin gene transcription is modulated at the promoter by NFAT and MEF-2 transcription factors.

    Directory of Open Access Journals (Sweden)

    Rafael Estrada-Avilés

    Full Text Available Calsequestrin-2 (CASQ2 is the main Ca2+-binding protein inside the sarcoplasmic reticulum of cardiomyocytes. Previously, we demonstrated that MEF-2 and SRF binding sites within the human CASQ2 gene (hCASQ2 promoter region are functional in neonatal cardiomyocytes. In this work, we investigated if the calcineurin/NFAT pathway regulates hCASQ2 expression in neonatal cardiomyocytes. The inhibition of NFAT dephosphorylation with CsA or INCA-6, reduced both the luciferase activity of hCASQ2 promoter constructs (-3102/+176 bp and -288/+176 bp and the CASQ2 mRNA levels in neonatal rat cardiomyocytes. Additionally, NFATc1 and NFATc3 over-expressing neonatal cardiomyocytes showed a 2-3-fold increase in luciferase activity of both hCASQ2 promoter constructs, which was prevented by CsA treatment. Site-directed mutagenesis of the -133 bp MEF-2 binding site prevented trans-activation of hCASQ2 promoter constructs induced by NFAT overexpression. Chromatin Immunoprecipitation (ChIP assays revealed NFAT and MEF-2 enrichment within the -288 bp to +76 bp of the hCASQ2 gene promoter. Besides, a direct interaction between NFAT and MEF-2 proteins was demonstrated by protein co-immunoprecipitation experiments. Taken together, these data demonstrate that NFAT interacts with MEF-2 bound to the -133 bp binding site at the hCASQ2 gene promoter. In conclusion, in this work, we demonstrate that the Ca2+-calcineurin/NFAT pathway modulates the transcription of the hCASQ2 gene in neonatal cardiomyocytes.

  16. In vivo identification of promoter elements and transcription factors mediating activation of hepatic HMG-CoA reductase by T{sub 3}

    Energy Technology Data Exchange (ETDEWEB)

    Boone, Lindsey R.; Niesen, Melissa I. [Department of Molecular Medicine, College of Medicine, University of South Florida, Tampa, FL (United States); Jaroszeski, Mark [Department of Chemical and Biomedical Engineering, College of Engineering, University of South Florida, Tampa, FL (United States); Ness, Gene C., E-mail: gness@hsc.usf.edu [Department of Molecular Medicine, College of Medicine, University of South Florida, Tampa, FL (United States)

    2009-07-31

    The promoter elements and transcription factors necessary for triiodothyronine (T{sub 3}) induction of hepatic HMG-CoA reductase (HMGR) were investigated by transfecting rat livers with wild type and mutant HMGR promoter-luciferase constructs using in vivo electroporation. Mutations in the sterol response element (SRE), nuclear factor-y (NF-Y) site, and the newly identified upstream transcription factor-2 (USF-2) site essentially abolished the T{sub 3} response. Chromatin immunoprecipitation (ChIP) analysis demonstrated that T{sub 3} treatment caused a 4-fold increase in in vivo binding of USF-2 to the HMGR promoter. Co-transfection of the wild type HMGR promoter with siRNAs to USF-2, SREBP-2, or NF-Y nearly abolished the T{sub 3} induction, as measured by promoter activity. These data provide in vivo evidence for functional roles for USF-2, SREBP-2, and NF-Y in mediating the T{sub 3}-induction of hepatic HMGR transcription.

  17. ICOS:ICOS-ligand interaction is required for type 2 innate lymphoid cell function, homeostasis, and induction of airway hyperreactivity.

    Science.gov (United States)

    Maazi, Hadi; Patel, Nisheel; Sankaranarayanan, Ishwarya; Suzuki, Yuzo; Rigas, Diamanda; Soroosh, Pejman; Freeman, Gordon J; Sharpe, Arlene H; Akbari, Omid

    2015-03-17

    Allergic asthma is caused by Th2-cell-type cytokines in response to allergen exposure. Type 2 innate lymphoid cells (ILC2s) are a newly identified subset of immune cells that, along with Th2 cells, contribute to the pathogenesis of asthma by producing copious amounts of IL-5 and IL-13, which cause eosinophilia and airway hyperreactivity (AHR), a cardinal feature of asthma. ILC2s express ICOS, a T cell costimulatory molecule with a currently unknown function. Here we showed that a lack of ICOS on murine ILC2s and blocking the ICOS:ICOS-ligand interaction in human ILC2s reduced AHR and lung inflammation. ILC2s expressed both ICOS and ICOS-ligand, and the ICOS:ICOS-ligand interaction promoted cytokine production and survival in ILC2s through STAT5 signaling. Thus, ICOS:ICOS-ligand signaling pathway is critically involved in ILC2 function and homeostasis. Copyright © 2015 Elsevier Inc. All rights reserved.

  18. Type 2 diabetes mellitus in children and adolescents

    Science.gov (United States)

    Reinehr, Thomas

    2013-01-01

    Type 2 diabetes mellitus is emerging as a new clinical problem within pediatric practice. Recent reports indicate an increasing prevalence of type 2 diabetes mellitus in children and adolescents around the world in all ethnicities, even if the prevalence of obesity is not increasing any more. The majority of young people diagnosed with type 2 diabetes mellitus was found in specific ethnic subgroups such as African-American, Hispanic, Asian/Pacific Islanders and American Indians. Clinicians should be aware of the frequent mild or asymptomatic manifestation of type 2 diabetes mellitus in childhood. Therefore, a screening seems meaningful especially in high risk groups such as children and adolescents with obesity, relatives with type 2 diabetes mellitus, and clinical features of insulin resistance (hypertension, dyslipidemia, polycystic ovarian syndrome, or acanthosis nigricans). Treatment of choice is lifestyle intervention followed by pharmacological treatment (e.g., metformin). New drugs such as dipeptidyl peptidase inhibitors or glucagon like peptide 1 mimetics are in the pipeline for treatment of youth with type 2 diabetes mellitus. However, recent reports indicate a high dropout of the medical care system of adolescents with type 2 diabetes mellitus suggesting that management of children and adolescents with type 2 diabetes mellitus requires some remodeling of current healthcare practices. PMID:24379917

  19. Facts about Type 2

    Medline Plus

    Full Text Available ... for Association Events Messaging Tools Recruiting Advocates Local Market Planning Training Webinars News & Events Advocacy News Call ... Diabetes Basics > Type 2 Share: Print Page Text Size: A A A Listen En Español Facts About ...

  20. Facts about Type 2

    Medline Plus

    Full Text Available ... first, you may need to later on. Some groups have a higher risk for developing type 2 ... function (data) { $('#survey-errors').remove(); $('.survey-form .form-group .survey-alert-wrap').remove(); if (data.submitSurveyResponse.success == ' ...

  1. Facts about Type 2

    Medline Plus

    Full Text Available ... Up Treatment & Care Blood Glucose Testing Medication Doctors, Nurses & More Oral Health & Hygiene Women A1C Insulin Pregnancy ... and Care Blood Glucose Control Complications Medication Doctors, Nurses & More Enroll in the Living With Type 2 ...

  2. Facts about Type 2

    Medline Plus

    Full Text Available ... Last Edited: October 27, 2015 Articles from Diabetes Forecast® magazine: lp-type-2, . In this section Diabetes ... Use and Privacy Policy « American Diabetes Association Diabetes Forecast Stop Diabetes Step Out: Walk to Stop Diabetes ...

  3. Pfeiffer syndrome type 2: case report

    Directory of Open Access Journals (Sweden)

    Maria Kiyoko Oyamada

    Full Text Available OBJECTIVE: To report on a case of Pfeiffer Syndrome, with a discussion of the diagnostic characteristics and features of disease types and the differential diagnosis. DESCRIPTION: The authors describe a newborn with cloverleaf skull, extreme bilateral exorbitism and choanal atresia, partial syndactyly of the second and third toes and broad medially-deviated big toes. The case reported was Pfeiffer Syndrome type 2, which usually has a poor prognosis. COMMENTS: Pfeiffer Syndrome is a clinically variable disorder and consists of an autosomal dominantly-inherited osteochondrodysplasia with craniosynostosis. It has been divided into three types. Type 1 is commonly associated with normal intelligence and generally good outcome. Types 2 and 3 generally have severe neurological compromise, poor prognosis, early death and sporadic occurrence. Potential for prolonged useful survival outcome can be achieved in some cases with early aggressive medical and surgical management according to recent literature.

  4. Does emotional stress cause type 2 diabetes mellitus?

    DEFF Research Database (Denmark)

    Pouwer, Frans; Kupper, Nina; Adriaanse, Marcel C

    2010-01-01

    and the development of type 2 diabetes mellitus. Results of longitudinal studies suggest that not only depression but also general emotional stress and anxiety, sleeping problems, anger, and hostility are associated with an increased risk for the development of type 2 diabetes. Conflicting results were found......According to the World Health Organization, approximately 220 million people worldwide have type 2 diabetes mellitus. Patients with type 2 diabetes not only have a chronic disease to cope with, they are also at increased risk for coronary heart disease, peripheral vascular disease, retinopathy......, nephropathy, and neuropathy. The exact causes of type 2 diabetes are still not clear. Since the 17th century, it has been suggested that emotional stress plays a role in the etiology of type 2 diabetes mellitus. So far, review studies have mainly focused on depression as a risk factor for the development...

  5. Pathophysiology-based phenotyping in type 2 diabetes

    DEFF Research Database (Denmark)

    Stidsen, Jacob V; Henriksen, Jan E; Olsen, Michael H

    2018-01-01

    clinically diagnosed type 2 diabetes. METHODS: We first identified all patients with rare subtypes of diabetes, latent autoimmune diabetes of adults (LADA), secondary diabetes, or glucocorticoid-associated diabetes. We then used the homeostatic assessment model to subphenotype all remaining patients......BACKGROUND: Type 2 diabetes may be a more heterogeneous disease than previously thought. Better understanding of pathophysiological subphenotypes could lead to more individualized diabetes treatment. We examined the characteristics of different phenotypes among 5813 Danish patients with new...... into insulinopenic (high insulin sensitivity and low beta cell function), classical (low insulin sensitivity and low beta cell function), or hyperinsulinemic (low insulin sensitivity and high beta cell function) type 2 diabetes. RESULTS: Among 5813 patients diagnosed with incident type 2 diabetes in the community...

  6. Incretin-based therapy and type 2 diabetes

    DEFF Research Database (Denmark)

    Hare, Kristine J; Knop, Filip Krag

    2010-01-01

    This chapter focuses on the incretin hormones, glucagon-like peptide-1 (GLP-1), and glucose-dependent insulinotropic polypeptide (GIP), and their therapeutic potential in treating patients with type 2 diabetes. Type 2 diabetes is characterized by insulin resistance, impaired glucose-induced insulin...... secretion, and inappropriately regulated glucagon secretion which in combination eventually result in hyperglycemia and in the longer term microvascular and macrovascular diabetic complications. Traditional treatment modalities--even multidrug approaches--for type 2 diabetes are often unsatisfactory....... Two new drug classes based on the actions of the incretin hormones have been approved for therapy of type 2 diabetes: injectable long-acting stable analogs of GLP-1, incretin mimetics, and orally available inhibitors of dipeptidyl peptidase 4 (DPP4; the enzyme responsible for the rapid degradation...

  7. Incretin-based therapy and type 2 diabetes

    DEFF Research Database (Denmark)

    Hare, Kristine J; Knop, Filip Krag

    2010-01-01

    This chapter focuses on the incretin hormones, glucagon-like peptide-1 (GLP-1), and glucose-dependent insulinotropic polypeptide (GIP), and their therapeutic potential in treating patients with type 2 diabetes. Type 2 diabetes is characterized by insulin resistance, impaired glucose-induced insulin....... Two new drug classes based on the actions of the incretin hormones have been approved for therapy of type 2 diabetes: injectable long-acting stable analogs of GLP-1, incretin mimetics, and orally available inhibitors of dipeptidyl peptidase 4 (DPP4; the enzyme responsible for the rapid degradation...... secretion, and inappropriately regulated glucagon secretion which in combination eventually result in hyperglycemia and in the longer term microvascular and macrovascular diabetic complications. Traditional treatment modalities--even multidrug approaches--for type 2 diabetes are often unsatisfactory...

  8. Role of CeO2 promoter in NiO/α-Al2O3 catalyst for dry reforming of methane

    Science.gov (United States)

    Loc, Luu Cam; Phuong, Phan Hong; Tri, Nguyen

    2017-09-01

    A series of Ni/α-Al2O3 (NiAl) catalysts promoted by CeO2 was prepared by co-impregnation methods with content of (NiO+CeO2) being in the range of 10-30 wt%. The NiO:CeO2 weight ratio was fluctuated at 1:1, 1:2 and 1:3. Several techniques, including X-ray powder diffraction (XRD), Hydrogen temperature-programmed reduction (H2-TPR), and transmission electron microscopy (TEM) were used to investigate catalysts' physico-chemical properties. The activity of these catalysts in dry reforming of CH4 was investigated at temperature range of 550-800 °C. The results revealed that the most suitable CeO2 promoted Ni catalyst contained 20 wt% of (NiO+CeO2) and NiO:CeO2 weight ratio of 1:2. The best catalytic performance of catalyst [20(1Ni2Ce)Al] due to a better reducibility resulted in a higher amount of free small particle NiO. At 700 °C and CH4:CO2 molar ratio of 1:1, the conversion of CH4 and CO2 on the most suitable CeO2 promoted Ni catalyst reached 86% and 67%, respectively; H2 and CO selectivity of 90% and H2:CO molar ratio of 1.15 were obtained. Being similar to MgO [1], promoter CeO2 could improve catalytic activity of Ni/α-Al2O3 catalyst at a lower range of temperature. Besides, both MgO and CeO2 had a great impact on improving coke resistance of Ni catalysts. At higher temperature, the role of CeO2 as well as MgO in preventing coke formation on catalyst was clarified by temperature-programmed oxidation (TPO) technique. Coke amount formed after 30-h TOS on 20(1Ni2Ce) catalyst was found to be 22.18 mgC/gcat, being less than on non-promoted catalyst (36.75 mgC/gcat), but more than on 20(1Ni2Mg)Al one (5.25 mgC/gcat).

  9. Facts about Type 2

    Medline Plus

    Full Text Available ... Diabetes causes more deaths a year than breast cancer and AIDS combined. Your gift today will help us get closer ... time, high blood glucose levels may hurt your eyes, kidneys, nerves or heart. Some people with type 2 ...

  10. Facts about Type 2

    Medline Plus

    Full Text Available ... 1 Type 2 About Us Online Community Meal Planning Sign In Search: Search More Sites Search ≡ Are ... Fitness Home Food MyFoodAdvisor Recipes Association Cookbook Recipes Planning Meals Diabetes Meal Plans Create Your Plate Gluten ...

  11. Facts about Type 2

    Medline Plus

    Full Text Available ... Diabetes causes more deaths a year than breast cancer and AIDS combined. Your gift today will help us get closer to ... normal. Type 2 is treated with lifestyle changes, oral medications (pills), and insulin. When glucose builds up ...

  12. Facts about Type 2

    Medline Plus

    Full Text Available ... can’t make enough insulin to keep your blood glucose levels normal. Type 2 is treated with lifestyle changes, ... may be starved for energy. Over time, high blood glucose levels may hurt your eyes, kidneys, nerves or heart. ...

  13. Facts about Type 2

    Medline Plus

    Full Text Available ... Diets Cook with Heart-Healthy Foods Holiday Meal Planning What Can I Eat? Making Healthy Food Choices Diabetes ... Type 2 Diabetes Program Food & Fitness Food Recipes Planning Meals What Can I Eat Weight Loss Fitness In My ...

  14. Diabetes affects everything: Type 2 diabetes self-management among Spanish-speaking hispanic immigrants.

    Science.gov (United States)

    Smith-Miller, Cheryl A; Berry, Diane C; Miller, Cass T

    2017-12-01

    This article is a report of qualitative findings of a mixed-methods study of the relationships among knowledge, self-efficacy, health promoting behaviors, and type 2 diabetes mellitus (T2DM) self-management among limited-english-proficient recent Hispanic immigrants, a population with increased incidence of T2DM and barriers to successful T2DM management. Semi-structured interviews were conducted with 30 participants, and physiological and demographic data also were collected. The participants generally attributed developing the disease to strong emotions and viewed T2DM as a serious disease. Although a majority understood the importance of exercise and diet in T2DM self-management, other aspects such as medication adherence were not well-understood. Obstacles to effective T2DM self-management were negative interactions and communications with health care providers and other personnel, cultural stigma related to the disease, financial constraints, immigration status, and the complexity of the disease. Suggested interventions to improve the care and self-management of this at-risk population are discussed. © 2017 Wiley Periodicals, Inc.

  15. Testicular Metabolic Reprogramming in Neonatal Streptozotocin-Induced Type 2 Diabetic Rats Impairs Glycolytic Flux and Promotes Glycogen Synthesis

    Science.gov (United States)

    Rato, L.; Alves, M. G.; Dias, T. R.; Cavaco, J. E.; Oliveira, Pedro F.

    2015-01-01

    Defects in testicular metabolism are directly implicated with male infertility, but most of the mechanisms associated with type 2 diabetes- (T2DM) induced male infertility remain unknown. We aimed to evaluate the effects of T2DM on testicular glucose metabolism by using a neonatal-streptozotocin- (n-STZ) T2DM animal model. Plasma and testicular hormonal levels were evaluated using specific kits. mRNA and protein expression levels were assessed by real-time PCR and Western Blot, respectively. Testicular metabolic profile was assessed by 1H-NMR spectroscopy. T2DM rats showed increased glycemic levels, impaired glucose tolerance and hyperinsulinemia. Both testicular and serum testosterone levels were decreased, whereas those of 17β-estradiol were not altered. Testicular glycolytic flux was not favored in testicles of T2DM rats, since, despite the increased expression of both glucose transporters 1 and 3 and the enzyme phosphofructokinase 1, lactate dehydrogenase activity was severely decreased contributing to lower testicular lactate content. However, T2DM enhanced testicular glycogen accumulation, by modulating the availability of the precursors for its synthesis. T2DM also affected the reproductive sperm parameters. Taken together these results indicate that T2DM is able to reprogram testicular metabolism by enhancing alternative metabolic pathways, particularly glycogen synthesis, and such alterations are associated with impaired sperm parameters. PMID:26064993

  16. Danish Centre for Strategic Research in Type 2 Diabetes (DD2) project cohort of newly diagnosed patients with type 2 diabetes

    DEFF Research Database (Denmark)

    Christensen, Diana Hedevang; Nicolaisen, Sia Kromann; Berencsi, Klára

    2018-01-01

    PURPOSE: The aim of this article is to provide a detailed description of the ongoing nationwide Danish Centre for Strategic Research in Type 2 Diabetes (DD2) project cohort and biobank. The DD2 cohort continuously enrols newly diagnosed patients with type 2 diabetes (T2D) throughout Denmark...... measures and presence of complications at baseline have been reported. FUTURE PLANS: During 2016, a detailed follow-up questionnaire has been answered by 85% of initial participants, providing follow-up information on baseline variables and on presence of diabetic neuropathy. The DD2 cohort has now been...

  17. Predictability of Joint Promotion Examinations in SS2 on Academic ...

    African Journals Online (AJOL)

    This research studied the predictability of joint SS2 promotion examinations of all the command secondary schools in Nigeria on academic performance of students in Senior School Certificate Examinations. The sample consists of 120 students selected at the Command Secondary School, Abakaliki and Command Day ...

  18. Health promotion among older adults in Austria: a qualitative study.

    Science.gov (United States)

    Boggatz, Thomas; Meinhart, Christoph Matthias

    2017-04-01

    To determine the types of attitudes to health promotion among older Austrians. Health promotion in old age becomes increasingly important in the current period of demographic transition. Interventions are likely to be successful if they take the attitude of older persons into consideration. There may be several types of attitudes to health promotion among older adults. Cross-sectional qualitative study. Semi-structured interviews were conducted in a purposive sample consisting of 36 home-dwelling older persons from local communities in the federal province of Salzburg, Austria. Data were analysed using qualitative content analysis according to Mayring and subsequent construction of types. There are three main types of attitudes to health promotion. 'Health promoters through everyday activities' considered domestic work and walks to be sufficient in keeping up their health. Fitness-oriented persons practised sports of some type. Users of complementary methods practised such methods to some degree. These types of attitudes could be further differentiated according to their outcome expectations. In addition to benefits for health, socialising was also an important outcome. Physical decline may reduce a fitness-oriented attitude, whereas encouragement by others may trigger it. Older adults have various attitudes to health promotion, but these are not immutable. Health promotion programmes that are not restricted to a narrow focus on health but provide the opportunity to socialise may support older adults in maintaining a healthy lifestyle. © 2016 John Wiley & Sons Ltd.

  19. A promoter-level mammalian expression atlas

    KAUST Repository

    Forest, Alistair R R

    2014-03-26

    Regulated transcription controls the diversity, developmental pathways and spatial organization of the hundreds of cell types that make up a mammal. Using single-molecule cDNA sequencing, we mapped transcription start sites (TSSs) and their usage in human and mouse primary cells, cell lines and tissues to produce a comprehensive overview of mammalian gene expression across the human body. We find that few genes are truly ‘housekeeping’, whereas many mammalian promoters are composite entities composed of several closely separated TSSs, with independent cell-type-specific expression profiles. TSSs specific to different cell types evolve at different rates, whereas promoters of broadly expressed genes are the most conserved. Promoter-based expression analysis reveals key transcription factors defining cell states and links them to binding-site motifs. The functions of identified novel transcripts can be predicted by coexpression and sample ontology enrichment analyses. The functional annotation of the mammalian genome 5 (FANTOM5) project provides comprehensive expression profiles and functional annotation of mammalian cell-type-specific transcriptomes with wide applications in biomedical research.

  20. A promoter-level mammalian expression atlas

    KAUST Repository

    Forest, Alistair R R; Kawaji, Hideya; Rehli, Michael; Baillie, John Kenneth; De Hoon, Michiel Jl L; Haberle, Vanja; Lassmann, Timo; Kulakovskiy, Ivan V.; Lizio, Marina; Itoh, Masayoshi; Andersson, Robin; Iida, Kei; Ikawa, Tomokatsu; Jankovic, Boris R.; Jia, Hui; Joshi, Anagha Madhusudan; Jurman, Giuseppe; Kaczkowski, Bogumił; Kai, Chieko; Kaida, Kaoru; Kaiho, Ai; Mungall, Christopher J.; Kajiyama, Kazuhiro; Kanamori-Katayama, Mutsumi; Kasianov, Artem S.; Kasukawa, Takeya; Katayama, Shintaro; Kato, Sachi; Kawaguchi, Shuji; Kawamoto, Hiroshi; Kawamura, Yuki I.; Kawashima, Tsugumi; Meehan, Terrence F.; Kempfle, Judith S.; Kenna, Tony J.; Kere, Juha; Khachigian, Levon M.; Kitamura, Toshio; Klinken, Svend Peter; Knox, Alan; Kojima, Miki; Kojima, Soichi; Kondo, Naoto; Schmeier, Sebastian; Koseki, Haruhiko; Koyasu, Shigeo; Krampitz, Sarah; Kubosaki, Atsutaka; Kwon, Andrew T.; Laros, Jeroen F J; Lee, Weonju; Lennartsson, Andreas; Li, Kang; Lilje, Berit; Bertin, Nicolas; Lipovich, Leonard; MacKay-Sim, Alan; Manabe, Riichiroh; Mar, Jessica; Marchand, Benoî t; Mathelier, Anthony; Mejhert, Niklas; Meynert, Alison M.; Mizuno, Yosuke; De Morais, David A Lima; Jø rgensen, Mette Christine; Morikawa, Hiromasa; Morimoto, Mitsuru; Moro, Kazuyo; Motakis, Efthymios; Motohashi, Hozumi; Mummery, Christine L.; Murata, Mitsuyoshi; Nagao-Sato, Sayaka; Nakachi, Yutaka; Nakahara, Fumio; Dimont, Emmanuel; Nakamura, Toshiyuki; Nakamura, Yukio; Nakazato, Kenichi; Van Nimwegen, Erik; Ninomiya, Noriko; Nishiyori, Hiromi; Noma, Shohei; Nozaki, Tadasuke; Ogishima, Soichi; Ohkura, Naganari; Arner, Erik; Ohmiya, Hiroko; Ohno, Hiroshi; Ohshima, Mitsuhiro; Okada-Hatakeyama, Mariko; Okazaki, Yasushi; Orlando, Valerio; Ovchinnikov, Dmitry A.; Pain, Arnab; Passier, Robert C J J; Patrikakis, Margaret; Schmidl, Christian; Persson, Helena A.; Piazza, Silvano; Prendergast, James G D; Rackham, Owen J L; Ramilowski, Jordan A.; Rashid, Mamoon; Ravasi, Timothy; Rizzu, Patrizia; Roncador, Marco; Roy, Sugata; Schaefer, Ulf; Rye, Morten Beck; Saijyo, Eri; Sajantila, Antti; Saka, Akiko; Sakaguchi, Shimon; Sakai, Mizuho; Sato, Hiroki; Satoh, Hironori; Savvi, Suzana; Saxena, Alka; Medvedeva, Yulia; Schneider, Claudio H.; Schultes, Erik A.; Schulze-Tanzil, Gundula G.; Schwegmann, Anita; Sengstag, Thierry; Sheng, Guojun; Shimoji, Hisashi; Shimoni, Yishai; Shin, Jay W.; Simon, Chris M.; Plessy, Charles; Sugiyama, Daisuke; Sugiyama, Takaaki; Suzuki, Masanori; Suzuki, Naoko; Swoboda, Rolf K.; 't Hoen, Peter Ac Chr; Tagami, Michihira; Tagami, Naokotakahashi; Takai, Jun; Tanaka, Hiroshi; Vitezic, Morana; Tatsukawa, Hideki; Tatum, Zuotian; Thompson, Mark; Toyoda, Hiroo; Toyoda, Tetsuro; Valen, Eivind; Van De Wetering, Marc L.; Van Den Berg, Linda M.; Verardo, Roberto; Vijayan, Dipti; Severin, Jessica M.; Vorontsov, Ilya E.; Wasserman, Wyeth W.; Watanabe, Shoko; Wells, Christine A.; Winteringham, Louise Natalie; Wolvetang, Ernst Jurgen; Wood, Emily J.; Yamaguchi, Yoko; Yamamoto, Masayuki; Yoneda, Misako; Semple, Colin Am M; Yonekura, Yohei; Yoshida, Shigehiro; Zabierowski, Susan E.; Zhang, Peter; Zhao, Xiaobei; Zucchelli, Silvia; Summers, Kim M.; Suzuki, Harukazu; Daub, Carsten Olivier; Kawai, Jun; Ishizu, Yuri; Heutink, Peter; Hide, Winston; Freeman, Tom C.; Lenhard, Boris; Bajic, Vladimir B.; Taylor, Martin S.; Makeev, Vsevolod J.; Sandelin, Albin; Hume, David A.; Carninci, Piero; Young, Robert S.; Hayashizaki, Yoshihide Yoshihide; Francescatto, Margherita; Altschuler, Intikhab Alam; Albanese, Davide; Altschule, Gabriel M.; Arakawa, Takahiro; Archer, John A.C.; Arner, Peter; Babina, Magda; Rennie, Sarah; Balwierz, Piotr J.; Beckhouse, Anthony G.; Pradhan-Bhatt, Swati; Blake, Judith A.; Blumenthal, Antje; Bodega, Beatrice; Bonetti, Alessandro; Briggs, James A.; Brombacher, Frank; Burroughs, Alexander Maxwell; Califano, Andrea C.; Cannistraci, Carlo; Carbajo, Daniel; Chen, Yun; Chierici, Marco; Ciani, Yari; Clevers, Hans C.; Dalla, Emiliano; Davis, Carrie Anne; Detmar, Michael J.; Diehl, Alexander D.; Dohi, Taeko; Drablø s, Finn; Edge, Albert SB B; Edinger, Matthias G.; Ekwall, Karl; Endoh, Mitsuhiro; Enomoto, Hideki; Fagiolini, Michela; Fairbairn, Lynsey R.; Fang, Hai; Farach-Carson, Mary Cindy; Faulkner, Geoffrey J.; Favorov, Alexander V.; Fisher, Malcolm E.; Frith, Martin C.; Fujita, Rie; Fukuda, Shiro; Furlanello, Cesare; Furuno, Masaaki; Furusawa, Junichi; Geijtenbeek, Teunis Bh H; Gibson, Andrew P.; Gingeras, Thomas R.; Goldowitz, Dan; Gough, Julian; Guhl, Sven; Guler, Reto; Gustincich, Stefano; Ha, Thomas; Hamaguchi, Masahide; Hara, Mitsuko; Harbers, Matthias; Harshbarger, Jayson; Hasegawa, Akira; Hasegawa, Yuki; Hashimoto, Takehiro; Herlyn, Meenhard F.; Hitchens, Kelly J.; Sui, Shannan J Ho; Hofmann, Oliver M.; Hoof, Ilka; Hori, Fumi; Huminiecki, Łukasz B.

    2014-01-01

    Regulated transcription controls the diversity, developmental pathways and spatial organization of the hundreds of cell types that make up a mammal. Using single-molecule cDNA sequencing, we mapped transcription start sites (TSSs) and their usage in human and mouse primary cells, cell lines and tissues to produce a comprehensive overview of mammalian gene expression across the human body. We find that few genes are truly ‘housekeeping’, whereas many mammalian promoters are composite entities composed of several closely separated TSSs, with independent cell-type-specific expression profiles. TSSs specific to different cell types evolve at different rates, whereas promoters of broadly expressed genes are the most conserved. Promoter-based expression analysis reveals key transcription factors defining cell states and links them to binding-site motifs. The functions of identified novel transcripts can be predicted by coexpression and sample ontology enrichment analyses. The functional annotation of the mammalian genome 5 (FANTOM5) project provides comprehensive expression profiles and functional annotation of mammalian cell-type-specific transcriptomes with wide applications in biomedical research.

  1. Rhabdomyolysis in pontocerebellar hypoplasia type 2 (PCH-2)

    NARCIS (Netherlands)

    Barth, Peter G.; Ryan, Monique M.; Webster, Richard I.; Aronica, Eleonora; Kan, Alex; Ramkema, Marja; Jardine, Philip; Poll-The, Bwee Tien

    2008-01-01

    Pontocerebellar hypoplasia type 2, an autosomal recessive neurodegeneration with prenatal onset, is characterised by progressive microcephaly and chorea/dystonia and has not previously been associated with muscular involvement. The gene associated with PCH-2 is unknown. An episode of rhabdomyolysis

  2. I-L-C-2 it: type 2 immunity and group 2 innate lymphoid cells in homeostasis.

    Science.gov (United States)

    von Moltke, Jakob; Locksley, Richard M

    2014-12-01

    Innate type 2 immune cells are activated in response to helminths, allergens, and certain types of proteases and particulates. Recently, innate type 2 immune pathways have also been implicated in protective host responses to homeostatic perturbations, such as metabolic dysfunction, atherosclerosis, and tissue injury. In this context, innate type 2 cytokines stimulate local tissues, recruit eosinophils, and alternatively activate macrophages to restore homeostasis. As the major source of innate interleukin (IL)-5 and IL-13, group 2 innate lymphoid cells are positioned to initiate and maintain homeostatic type 2 responses. The absence of exogenous stimuli in these processes implicates endogenous pathways in the activation of type 2 immunity and suggests an alternative evolutionary trajectory for type 2 immunity, apart from its role in response to helminths and allergens. Copyright © 2014 Elsevier Ltd. All rights reserved.

  3. Attitudes in patients with diabetes mellitus type 1 and type 2

    OpenAIRE

    Oleg Gennad'evich Motovilin; Ol'ga Vital'evna Lunyakina; Elena Viktorovna Surkova; Yuliya Andreevna Shishkova; Ol'ga Georgievna Mel'nikova; Aleksandr Yur'evich Mayorov

    2012-01-01

    Aims: To compare disease attitudes in patients with type 1 and type 2 diabetes mellitus (T1DM and T2DM) and to evaluate relationship between attitudes and psychological welfare of these groups.Materials and Methods: We examined 140 patients with T1DM and 70 patients with T2DM on insulin therapy (mean age 22.6±3.2 and 60.1±7.8 years; male/female ratio 47/93 and 15/55; duration of diabetes 12.1±5.7 and 11.4±6.5 years, HbA1c 9.3±2.2 и 9.0±1.4%, respectively). Psychological parameters were assess...

  4. [Practice guideline. Diagnosis and treatment of type 2 diabetes mellitus].

    Science.gov (United States)

    Gil-Velázquez, Luisa Estela; Sil-Acosta, María Juana; Domínguez-Sánchez, Elia R; Torres-Arreola, Laura del Pilar; Medina-Chávez, Juan Humberto

    2013-01-01

    Our objective was to develop a guide based on the best available evidence that allow family physicians to establish criteria for screening, diagnosis, prevention, treatment of disease, early detection and management of complications; to standardize the organizing processes of the diabetic patient's care in the primary care level; and to achieve lifestyle modification for patients and promote self-care. Clinical questions were stated according to the diagram and structured patient-intervention-comparison-outcome. We used a mixed methodology-adoption adjustment, and include 32 guides. For recommendations not included in these, the search process was conducted in PubMed and Cochrane Library Plus with these terms: diabetes mellitus type 2, epidemiology, detection and diagnosis, classification, drug therapy, effects, prevention, control and complication. The clinical practice guideline emphasizes the fundamental change in lifestyle (diet and exercise), self-care and proactive participation of the patient, in addition to the dynamic prescription of medications that would achieve metabolic control in order to reduce late complications.

  5. 5′UTR of the Neurogenic bHLH Nex1/MATH-2/NeuroD6 Gene Is Regulated by Two Distinct Promoters Through CRE and C/EBP Binding Sites

    Science.gov (United States)

    Uittenbogaard, Martine; Martinka, Debra L.; Johnson, Peter F.; Vinson, Charles; Chiaramello, Anne

    2009-01-01

    Expression of the bHLH transcription factor Nex1/MATH-2/NeuroD6, a member of the NeuroD subfamily, parallels overt neuronal differentiation and synaptogenesis during brain development. Our previous studies have shown that Nex1 is a critical effector of the NGF pathway and promotes neuronal differentiation and survival of PC12 cells in the absence of growth factors. In this study, we investigated the transcriptional regulation of the Nex1 gene during NGF-induced neuronal differentiation. We found that Nex1 expression is under the control of two conserved promoters, Nex1-P1 and Nex1-P2, located in two distinct non-coding exons. Both promoters are TATA-less with multiple transcription start sites, and are activated on NGF or cAMP exposure. Luciferase-reporter assays showed that the Nex1-P2 promoter activity is stronger than the Nex1-P1 promoter activity, which supports the previously reported differential expression levels of Nex1 transcripts throughout brain development. Using a combination of DNaseI footprinting, EMSA assays, and site-directed mutagenesis, we identified the essential regulatory elements within the first 2 kb of the Nex1 5′UTR. The Nex1-P1 promoter is mainly regulated by a conserved CRE element, whereas the Nex1-P2 promoter is under the control of a conserved C/EBP binding site. Overexpression of wild-type C/EBPβ resulted in increased Nex1-P2 promoter activity in NGF-differentiated PC12 cells. The fact that Nex1 is a target gene of C/EBPβ provides new insight into the C/EBP transcriptional cascade known to promote neurogenesis, while repressing gliogenesis. PMID:17075921

  6. Promotion of Nb2O5 on the wustite-based iron catalyst for ammonia synthesis

    International Nuclear Information System (INIS)

    Han, Wenfeng; Huang, Shiliang; Cheng, Tianhong; Tang, Haodong; Li, Ying; Liu, Huazhang

    2015-01-01

    Highlights: • Niobium enhances the reduction of wustite-based ammonia synthesis catalyst significantly. • Nb 2 O 5 inhibits the segregation or formation of solid solutions on the catalyst surface. • Nb 2 O 5 doping enhances the growth rates of [2 1 1] and [2 0 0] planes rather than their amounts. - Abstract: Niobium was selected and investigated as a potential promoter for wustite-based catalyst (WBC) for ammonia synthesis. Experiments on reduction performance, activity test and H 2 -TGA, in situ XRD as well as XPS were carried out to obtain the promotion effect and mechanism involved. Niobium as a promoter was confirmed to enhance the reduction of WBC significantly. This behavior is highly desired for industry in terms of catalyst regeneration and lesser pretreatment time for fabrication regardless the unimproved catalytic performance for Nb 2 O 5 -doped wustite-based catalyst (Nb-WBC). Possible reasons for these phenomena are discussed. It is suggested that Nb 2 O 5 is not favorable for the segregation or formation of solid solutions on the catalyst surface, which are difficult to be reduced. However, it seems that niobium does not promote the growth of [2 1 1] plane, which is active for ammonia synthesis.

  7. Facts about Type 2

    Medline Plus

    Full Text Available ... the Living WIth Type 2 Diabetes Program Gestational What is Gestational Diabetes? How to Treat Gestational Diabetes Genetics of Diabetes Diabetes Myths A Day in the Life of Diabetes Famous People Working to Stop Diabetes Common Terms Diabetes Statistics Infographics ...

  8. Novel P2 promoter-derived HNF4α isoforms with different N-terminus generated by alternate exon insertion

    International Nuclear Information System (INIS)

    Huang, Jianmin; Levitsky, Lynne L.; Rhoads, David B.

    2009-01-01

    Hepatocyte nuclear factor 4α (HNF4α) is a critical transcription factor for pancreas and liver development and functions in islet β cells to maintain glucose homeostasis. Mutations in the human HNF4A gene lead to maturity onset diabetes of the young (MODY1) and polymorphisms are associated with increased risk for type 2 diabetes mellitus (T2DM). Expression of six HNF4α variants, three each from two developmentally regulated promoters, has been firmly established. We have now detected a new set of HNF4α variants designated HNF4α10-12 expressed from distal promoter P2. These variants, generated by inclusion of previously undetected exon 1E (human = 222 nt, rodent = 136 nt) following exon 1D have an altered N-terminus but identical remaining reading frame. HNF4α10-α12 are expressed in pancreatic islets (and liver) and exhibit transactivation potentials similar to the corresponding α7-α9 isoforms. DNA-binding analyses implied much higher protein levels of HNF4α10-α12 in liver than expected from the RT-PCR data. Our results provide evidence for a more complex expression pattern of HNF4α than previously appreciated. We recommend inclusion of exon 1E and nearby DNA sequences in screening for HNF4α mutations and polymorphisms in genetic analyses of MODY1 and T2DM.

  9. Novel P2 promoter-derived HNF4{alpha} isoforms with different N-terminus generated by alternate exon insertion

    Energy Technology Data Exchange (ETDEWEB)

    Huang, Jianmin, E-mail: jmhuang@partners.org [Pediatric Endocrine Unit, MassGeneral Hospital for Children and Harvard Medical School, Boston, Massachusetts, 02114-2696 (United States); Levitsky, Lynne L. [Pediatric Endocrine Unit, MassGeneral Hospital for Children and Harvard Medical School, Boston, Massachusetts, 02114-2696 (United States); Rhoads, David B., E-mail: rhoads@helix.mgh.harvard.edu [Pediatric Endocrine Unit, MassGeneral Hospital for Children and Harvard Medical School, Boston, Massachusetts, 02114-2696 (United States)

    2009-04-15

    Hepatocyte nuclear factor 4{alpha} (HNF4{alpha}) is a critical transcription factor for pancreas and liver development and functions in islet {beta} cells to maintain glucose homeostasis. Mutations in the human HNF4A gene lead to maturity onset diabetes of the young (MODY1) and polymorphisms are associated with increased risk for type 2 diabetes mellitus (T2DM). Expression of six HNF4{alpha} variants, three each from two developmentally regulated promoters, has been firmly established. We have now detected a new set of HNF4{alpha} variants designated HNF4{alpha}10-12 expressed from distal promoter P2. These variants, generated by inclusion of previously undetected exon 1E (human = 222 nt, rodent = 136 nt) following exon 1D have an altered N-terminus but identical remaining reading frame. HNF4{alpha}10-{alpha}12 are expressed in pancreatic islets (and liver) and exhibit transactivation potentials similar to the corresponding {alpha}7-{alpha}9 isoforms. DNA-binding analyses implied much higher protein levels of HNF4{alpha}10-{alpha}12 in liver than expected from the RT-PCR data. Our results provide evidence for a more complex expression pattern of HNF4{alpha} than previously appreciated. We recommend inclusion of exon 1E and nearby DNA sequences in screening for HNF4{alpha} mutations and polymorphisms in genetic analyses of MODY1 and T2DM.

  10. Lead effects on development and function of bone marrow-derived dendritic cells promote Th2 immune responses

    International Nuclear Information System (INIS)

    Gao Donghong; Mondal, Tapan K.; Lawrence, David A.

    2007-01-01

    Although lead (Pb) has significant effects on the development and function of macrophages, B cells, and T cells and has been suggested to promote allergic asthma in mice and humans, Pb modulation of bone marrow (BM)-derived dendritic cells (DCs) and the resultant DC effects on Th1 and Th2 development have not been examined. Accordingly, we cultured BM cells with murine granulocyte macrophage-colony stimulating factor (mGM-CSF) ± PbCl 2 . At day 10, culture supernatant (SN) and non-adherent cells were harvested for analysis. Additionally, day 10 non-adherent BM-DCs were harvested and recultured with mGM-CSF + LPS ± Pb for 2 days. The day 10 Pb exposure significantly inhibited BM-DC generation, based on CD11c expression. Although fewer DCs were generated with Pb, the existing Pb-exposed DCs had significantly greater MHC-II expression than did the non-Pb-exposed DCs. However, these differences diminished upon LPS stimulation. After LPS stimulation, CD80, CD86, CD40, CD54, and MHC-II were all up-regulated on both Pb-DCs and DCs, but Pb-DCs expressed significantly less CD80 than did DCs. The CD86:CD80 ratio suggests a Pb-DC potential for Th2 cell development. After LPS stimulation, IL-6, IL-10, IL-12 (p70), and TNF-α levels significantly increased with both Pb-DCs and DCs, but Pb-DCs produced significantly less cytokines than did DCs, except for IL-10, which further supports Pb-DC preferential skewing toward type-2 immunity. In vitro studies confirm that Pb-DCs have the ability to polarize antigen-specific T cells to Th2 cells. Pb-DCs also enhanced allogeneic and autologous T cell proliferation in vitro, and in vivo studies suggested that Pb-DCs inhibited Th1 effects on humoral and cell-mediated immunity. The Pb effect was mainly on DCs, rather than on T cells, and Pb's modification of DC function appears to be the main cause of Pb's promotion of type-2-related immunity, which may relate to Pb's enhanced activation of the Erk/MAP kinase pathway

  11. Liver/kidney microsomal antibody type 1 and liver cytosol antibody type 1 concentrations in type 2 autoimmune hepatitis

    OpenAIRE

    Muratori, L; Cataleta, M; Muratori, P; Lenzi, M; Bianchi, F

    1998-01-01

    Background—Liver/kidney microsomal antibody type 1 (LKM1) and liver cytosol antibody type 1 (LC1) are the serological markers of type 2 autoimmune hepatitis (AIH). 
Aims—Since LKM1 and LC1 react against two distinct liver specific autoantigens (cytochrome P450IID6 (CYP2D6) and a 58 kDa cytosolic polypeptide respectively), the aim was to see whether LKM1 and LC1 concentrations correlate with liver disease activity. 
Patients—Twenty one patients with type 2 AIH were studied. 
Methods—A...

  12. Detection and significance of serum insulin-like growth factor-1 in patients with type 2 diabetes, osteoporosis and type 2 diabetic osteoporosis

    Institute of Scientific and Technical Information of China (English)

    Yan-Rong Kang; Pei-Li Gu

    2016-01-01

    Objective:To investigate the content of insulin-like growth factor-1 (IGF-1) in serum and the relationship with type 2 diabetes, osteoporosis and type 2 diabetic osteoporosis.Methods:A total of 86 cases of patients with type 2 diabetes, 82 cases of patients with osteoporosis, 79 cases of patients with type 2 diabetic osteoporosis and 86 cases of healthy person were selected, the levels of IGF-1, diabetes related factors (fasting plasma c-peptide, FIN, HbA1c, GLU) and osteoporosis related factors (BMP, osteocalcin,β-CTx, P1NP, lumbar vertebra BMD) were detected, the relationship between the above indicators were compared with those of the disease.Results: In each group, content change of IGF-1 was not statistically significant; content changes of IGF-1, BMP and osteocalcin were control group>type 2 diabetes group>osteoporosis group>type 2 diabetic osteoporosis group. Diabetic osteoporosis enhanced the decrease of IGF-1 content. The contents ofβ-CTx and P1NP in osteoporosis group and diabetic osteoporosis group were similar, which were significantly lower than that in control group and type 2 diabetes group. The level of lumbar vertebra BMD in osteoporosis group and diabetic osteoporosis group were the lowest. Fasting plasma c-peptide in diabetes group and diabetic osteoporosis group were significantly lower than that in control group and osteoporosis group, and the content of fasting plasma c-peptide in diabetic osteoporosis group was the lowest. The contents of FIN, HbA1c and GLU in type 2 diabetes group and type 2 diabetic osteoporosis group were significantly higher than that in control group and osteoporosis group.Conclusion:IGF-1 was related with type 2 diabetes, osteoporosis and type 2 diabetic osteoporosis, and could offer help for predicting type 2 diabetes and osteoporosis in the future.

  13. Diabetes Type 2 Is Serious But Manageable

    Science.gov (United States)

    ... page please turn JavaScript on. Feature: Type 2 Diabetes Diabetes Type 2 Is Serious But Manageable Past Issues / ... t have to knock yourself out to prevent diabetes. The key is: small steps that lead to ...

  14. Gremlin promotes retinal pigmentation epithelial (RPE) cell proliferation, migration and VEGF production via activating VEGFR2-Akt-mTORC2 signaling.

    Science.gov (United States)

    Liu, Yuan; Chen, Zhijun; Cheng, Haixia; Chen, Juan; Qian, Jing

    2017-01-03

    Retinopathy of prematurity (ROP) is characterized by late-phase pathologic retinal vasoproliferation. Gremlin is a novel vascular endothelial growth factors (VEGF) receptor 2 (VEGFR2) agonist and promotes angiogenic response. We demonstrated that gremlin expression was significantly increased in retinas of ROP model mice, which was correlated with VEGF upregulation. In retinal pigmentation epithelial (RPE) cells, gremlin activated VEGFR2-Akt-mTORC2 (mammalian target of rapamycin complex 2) signaling, and promoted cell proliferation, migration and VEGF production. VEGFR inhibition (by SU5416) or shRNA knockdown almost abolished gremlin-mediated pleiotropic functions in RPE cells. Further, pharmacological inhibition of Akt-mTOR, or shRNA knockdown of key mTORC2 component (Rictor or Sin1) also attenuated gremlin-exerted activities in RPE cells. We conclude that gremlin promotes RPE cell proliferation, migration and VEGF production possibly via activating VEGFR2-Akt-mTORC2 signaling. Gremlin could be a novel therapeutic target of ROP or other retinal vasoproliferation diseases.

  15. Canine parvovirus type 2 vaccine protects against virulent challenge with type 2c virus.

    Science.gov (United States)

    Spibey, N; Greenwood, N M; Sutton, D; Chalmers, W S K; Tarpey, I

    2008-04-01

    The ability of dogs vaccinated with a live attenuated CPV type 2 (Nobivac Intervet) vaccine to resist challenge with a current CPV2c isolate was investigated. Six SPF beagle dogs were given the minimum recommended course of vaccination, comprising a single inoculation of vaccine (Nobivac Lepto+Nobivac Pi) at 8-10 weeks of age followed 3 weeks later with a parvovirus vaccine in combination with distemper, adenovirus and parainfluenza virus (Nobivac DHPPi) and a repeat leptospirosis vaccine. Six control dogs were kept unvaccinated. All animals were challenged orally with a type 2c isolate of CPV and monitored for clinical signs, virus shedding, white blood cell fluctuations and serological responses. All vaccinated dogs were fully protected; showing no clinical signs nor shedding challenge virus in the faeces, in contrast to control animals, which displayed all the typical signs of infection with pathogenic CPV and shed challenge virus in the faeces.

  16. Carcinogenicity/tumour promotion by NDL PCB

    Energy Technology Data Exchange (ETDEWEB)

    Schrenk, D. [Kaiserslautern Univ. (Germany). Food Chemistry and Environmental Toxicology

    2004-09-15

    Polychlorinated biphenyls (PCBs) belong to the group of persistent environmental pollutants exhibiting neurotoxic, teratogenic and tumour-promoting effects in experimental animal models. PCB congeners can be divided into 'dioxinlike' and 'non-dioxinlike' congeners on the basis of their ability to act as aryl hydrocarbon receptor (AhR) agonists. Like the most toxic dioxin congener 2,3,7,8-tetrachlorodibenzo-p-dioxin (TCDD) 'dioxinlike' PCBs bind to the AhR and show characteristic effects on the expression of AhR-regulated genes including the induction of cytochrome P450 (CYP) 1A1. On the other hand, 'non-dioxinlike' PCB congeners have a lower or no binding affinity to the AhR, but exhibit a 'phenobarbital-type' induction of CYP 2B1/2 activity. A carcinogenic potential of PCBs has been demonstrated with technical mixtures such as Aroclors or Clophens. In these studies the liver and the thyroid gland were found to be the principal target organs of PCB-mediated carcinogenesis in rodents. No studies have been published, however, on the carcinogenicity of individual congeners. In two-stage initiation-promotion protocols in rats, both technical mixtures and individual 'dioxinlike' and 'non-dioxinlike' congeners were reported to act as liver tumour promoters.

  17. Promoting Reflective Thinking Skills by Using Web 2.0 Application

    Science.gov (United States)

    Abdullah, Mohamed

    2015-01-01

    The study aims to investigate are using Web 2.0 applications promoting reflective thinking skills for higher education student in faculty for education. Although the literature reveals that technology integration is a trend in higher education and researchers and educators have increasingly shared their ideas and examples of implementations of Web…

  18. Duane retraction syndrome type 1 with Usher syndrome type 2: an unreported association.

    Science.gov (United States)

    Khurana, Bhawna Piplani; Khurana, Aruj Kumar; Grover, Sumit

    2015-05-07

    Duane retraction syndrome is characterized by globe retraction and palpebral fissure narrowing on adduction, with restriction of abduction, adduction, or both. Usher syndrome type 2 consists of congenital bilateral sensorineural hearing loss and retinitis pigmentosa. The authors present a case with a yet unreported association between Duane retraction syndrome type 1 and Usher syndrome type 2. Copyright 2015, SLACK Incorporated.

  19. No evidence for increased self-reported cognitive failure in Type 1 and Type 2 diabetes

    DEFF Research Database (Denmark)

    Wessels, A M; Pouwer, F; Geelhoed-Duijvestijn, P H L M

    2007-01-01

    in adult out-patients with Type 1 and Type 2 diabetes. METHODS: Subjective cognitive functioning was measured in 187 diabetic patients using the Cognitive Failures Questionnaire (CFQ). Demographic and clinical characteristics were retrieved from the medical records. The Patient Health Questionnaire 9 items...... (PHQ-9) was self-administered along with the CFQ to correct for the confounding effect of depression. RESULTS: Analyses were based on 55 patients with Type 1 diabetes and 100 patients with Type 2 diabetes. No difference in mean CFQ score was observed between Type 1 and Type 2 diabetic patients...... or between Type 1 diabetic patients and healthy control subjects. Female patients with Type 2 diabetes reported significantly fewer cognitive complaints compared with female healthy control subjects. None of the demographic variables and diabetes-related complications was associated with subjective cognitive...

  20. Facts about Type 2

    Medline Plus

    Full Text Available ... diabetes. » « Connect With Us Register for diabetes news, research and food & fitness tips. Email: Sign Up Thank you for ... Living WIth Type 2 Diabetes Program Food & Fitness Food Recipes Planning ... to Congress Research & Practice We Are Research Leaders We Support Your ...

  1. Facts about Type 2

    Medline Plus

    Full Text Available ... You at Risk? Home Prevention Diagnosing Diabetes and Learning About Prediabetes Type 2 Diabetes Risk Test Lower Your Risk Healthy Eating Overweight Smoking High Blood Pressure Physical Activity High Blood Glucose My Health Advisor Tools To Know Your Risk Alert Day Diabetes Basics ...

  2. Facts about Type 2

    Medline Plus

    Full Text Available ... Complications Neuropathy Foot Complications DKA (Ketoacidosis) & Ketones Kidney Disease (Nephropathy) Gastroparesis Mental Health Step On Up Treatment & ... Non-starchy Vegetables Grains and Starchy ... form of diabetes. In type 2 diabetes, your body does not use insulin properly. This is called insulin resistance. At ...

  3. Type 2 diabetes mellitus

    DEFF Research Database (Denmark)

    DeFronzo, Ralph A; Ferrannini, Ele; Groop, Leif

    2015-01-01

    Type 2 diabetes mellitus (T2DM) is an expanding global health problem, closely linked to the epidemic of obesity. Individuals with T2DM are at high risk for both microvascular complications (including retinopathy, nephropathy and neuropathy) and macrovascular complications (such as cardiovascular...... that multiple antidiabetic agents, used in combination, will be required to maintain normoglycaemia. The treatment must not only be effective and safe but also improve the quality of life. Several novel medications are in development, but the greatest need is for agents that enhance insulin sensitivity, halt...

  4. Multicomponent Biginelli's synthesis of 3,4-dihydropyrimidin-2(1H-ones promoted by SnCl2.2H2O

    Directory of Open Access Journals (Sweden)

    Russowsky Dennis

    2004-01-01

    Full Text Available The ability of SnCl2.2H2O as catalyst to promote the Biginelli three-component condensation reaction from a diversity of aromatic aldehydes, ethyl acetoacetate and urea or thiourea is described. The reaction was carried out in acetonitrile or ethanol as solvents in neutral media and represents an improvement of the classical Biginelli protocol and an advantage in comparison with FeCl3.6H2O, NiCl2.6H2O and CoCl2.6H2O which were used with HCl as co-catalyst. The synthesis of 3,4-dihydropyrimidinones was achieved in good to excelent yields.

  5. Cirurgia gastrointestinal no tratamento da diabete tipo 2 Gastrointestinal surgery for the treatment of type 2 diabetes

    Directory of Open Access Journals (Sweden)

    Alexandre Coutinho Teixeira de Freitas

    2007-06-01

    nos últimos anos. Entre eles estão o bypass duodeno-jejunal, a interposição ileal e as ressecções intestinais associadas à gastrectomia vertical. Esses novos procedimentos ainda são considerados experimentais. CONCLUSÃO: Os procedimentos cirúrgicos sobre o trato gastrointestinal, principalmente as cirurgias bariátricas, proporcionam controle metabólico da diabete tipo 2. Entre as cirurgias bariátricas os melhores resultados são obtidos com as derivações biliopancreáticas seguidas pelo bypass gástrico e pela banda gástrica. Novos procedimentos cirúrgicos, ainda considerados experimentais, estão demonstrando resultados preliminares favoráveis ao controle metabólico da diabete tipo 2.BACKGROUND: The ability of gastrointestinal surgical interventions, mainly bariatric surgery, to promote the control of type 2 diabetes, has already been well documented. AIM: To review the literature related to the effects of gastrointestinal surgery regarding type 2 diabetes, especially in relation to metabolic control and its physiopathology. METHODS: Literature was reviewed on Medline, pages on the internet, references from relevant articles and studies presented and published on the annals of the International Conference on Gastrointestinal Surgery to Treat Type 2 Diabetes, which occurred in Rome in 2007. CONCLUSIONS: Among all bariatric surgeries, biliopancreatic diversion, presented the best control rates for type 2 diabetes followed by gastric bypass and gastric banding. This control is related to weight loss and reduction on food intake. Biliopancreatic diversion and gastric bypass also presented important modifications in gut hormones. The most significant ones being: GLP-1, GIP, PYY, ghrelin, leptin, IGF-1, adiponectin. These hormones promote loss of appetite, promote actions over ß cells, increase the secretion of insulin, and increase insulin sensitivity. Two theories have been formulated to explain the changes observed on these hormones: the foregut

  6. A novel selective VPAC2 agonist peptide-conjugated chitosan modified selenium nanoparticles with enhanced anti-type 2 diabetes synergy effects

    Directory of Open Access Journals (Sweden)

    Zhao SJ

    2017-03-01

    Full Text Available Shao-Jun Zhao,1,2,* De-Hua Wang,1,2 Yan-Wei Li,1,2 Lei Han,1,2 Xing Xiao,1,2 Min Ma,3,* David Chi-Cheong Wan,4 An Hong,1,2 Yi Ma1,2 1Institute of Biomedicine, Department of Cellular Biology, Jinan University, 2National Engineering Research Center of Genetic Medicine, Key Laboratory of Bioengineering Medicine of Guangdong Province, Jinan University, 3College of traditional Chinese Medicine, Institute of Integrated Traditional Chinese and Western Medicine, Jinan University, Guangdong, 4School of Biomedical Sciences, Faculty of Medicine, The Chinese University of Hong Kong, Shatin, Hong Kong SAR, People’s Republic of China *These authors contributed equally to this work Abstract: A novel neuroendocrine peptide, pituitary adenylate cyclase activating peptide (PACAP, was found to have an important role in carbohydrate or lipid metabolism and was susceptible to dipeptidyl peptidase IV degradation. It can not only mediate glucose-dependent insulin secretion and lower blood glucose by activating VPAC2 receptor, but also raise blood glucose by promoting glucagon production by VPAC1 receptor activation. Therefore, its therapeutic application is restricted by the exceedingly short-acting half-life and the stimulatory function for glycogenolysis. Herein, we generated novel peptide-conjugated selenium nanoparticles (SeNPs; named as SCD, comprising a 32-amino acid PACAP-derived peptide DBAYL that selectively binds to VPAC2, and chitosan-modified SeNPs (SeNPs-CTS, SC as slow-release carrier. The circulating half-life of SCD is 14.12 h in mice, which is 168.4- and 7.1-fold longer than wild PACAP (~5 min and DBAYL (~1.98 h, respectively. SCD (10 nmol/L significantly promotes INS-1 cell proliferation, glucose uptake, insulin secretion, insulin receptor expression and also obviously reduces intracellular reactive oxygen species levels in H2O2-injured INS-1 cells. Furthermore, the biological effects of SCD are stronger than Exendin-4 (a clinically approved drug

  7. Nocturnal Hypoglycemia in Type 2 Diabetes

    Directory of Open Access Journals (Sweden)

    Clus Simona

    2018-03-01

    Full Text Available Background and aims: It is known that the majority of critical unacknowledged hypoglycemia has an increased incidence in patients with type 1 diabetes (T1DM with a long evolution. The aim of this research is to evaluate the variability of glucose level and hypoglycemic events in patients with type 2 diabetes (T2DM having pharmacological interventions with hypoglycemic risk. These events are sometimes asymptomatic also in T2DM: frequently in elderly, patients with autonomic neuropathy, or having a long evolution of disease.

  8. Cysteine dioxygenase type 1 promotes adipogenesis via interaction with peroxisome proliferator-activated receptor gamma

    Energy Technology Data Exchange (ETDEWEB)

    Deng, Peng; Chen, Yi; Ji, Ning; Lin, Yunfeng; Yuan, Quan; Ye, Ling; Chen, Qianming, E-mail: qmchen@scu.edu.cn

    2015-02-27

    Mammalian cysteine dioxygenase type 1 (CDO1) is an essential enzyme for taurine biosynthesis and the biodegradation of toxic cysteine. As previously suggested, Cdo1 may be a marker of liposarcoma progression and adipogenic differentiation, but the role of Cdo1 in adipogenesis has yet been reported. In this study, we found that the expression of Cdo1 is dramatically elevated during adipogenic differentiation of 3T3-L1 pre-adipocytes and mouse bone marrow-derived mesenchymal stem cells (mBMSCs). Conversely, knockdown of Cdo1 inhibited expression of adipogenic specific genes and lipid droplet formation in 3T3-L1 cells and mBMSCs. Mechanistically, we found Cdo1 interacted with Pparγ in response to adipogenic stimulus. Further, depletion of Cdo1 reduced the recruitment of Pparγ to the promoters of C/EBPα and Fabp4. Collectively, our finding indicates that Cdo1 may be a co-activator of Pparγ in adipogenesis, and may contribute to the development of disease associated with excessive adipose tissue. - Highlights: • Cdo1expression is highly up-regulated during adipogenic differentiation of 3T3-L1 and mBMSCs. • Depletion of Cdo1 inhibited expression of adipogenic specific genes and lipid droplet formation. • Cdo1interacts with Pparγ during adipogenesis. • Knockdown of Cdo1 inhibited Pparγ binding to the promoters of C/EBPα and Fabp4.

  9. Suicidal ideation reported by adults with Type 1 or Type 2 diabetes

    DEFF Research Database (Denmark)

    Handley, T E; Ventura, A D; Browne, Jessica L

    2016-01-01

    factor for a suicide attempt, the findings have implications for healthcare professionals, pointing to the importance of adequate screening and action plans for appropriate follow-up of those reporting depression. Our findings are also indicative of the psychological toll of diabetes more generally......AIMS: To examine the prevalence and correlates of suicidal ideation (SI) in a community-based sample of adults with Type 1 or Type 2 diabetes. METHODS: Participants were 3338 adults aged 18-70 years with Type 1 diabetes (n = 1376) or Type 2 diabetes (non-insulin: n = 1238; insulin: n = 724) from...... a national survey administered to a random sample registered with the National Diabetes Services Scheme. Depression and SI were assessed using the Patient Health Questionnaire, and diabetes-specific distress with the Problem Areas In Diabetes scale. Separate logistic regression analyses by diabetes type...

  10. Development of a fully automated, web-based, tailored intervention promoting regular physical activity among insufficiently active adults with type 2 diabetes: integrating the I-change model, self-determination theory, and motivational interviewing components.

    Science.gov (United States)

    Moreau, Michel; Gagnon, Marie-Pierre; Boudreau, François

    2015-02-17

    Type 2 diabetes is a major challenge for Canadian public health authorities, and regular physical activity is a key factor in the management of this disease. Given that fewer than half of people with type 2 diabetes in Canada are sufficiently active to meet the recommendations, effective programs targeting the adoption of regular physical activity (PA) are in demand for this population. Many researchers argue that Web-based, tailored interventions targeting PA are a promising and effective avenue for sedentary populations like Canadians with type 2 diabetes, but few have described the detailed development of this kind of intervention. This paper aims to describe the systematic development of the Web-based, tailored intervention, Diabète en Forme, promoting regular aerobic PA among adult Canadian francophones with type 2 diabetes. This paper can be used as a reference for health professionals interested in developing similar interventions. We also explored the integration of theoretical components derived from the I-Change Model, Self-Determination Theory, and Motivational Interviewing, which is a potential path for enhancing the effectiveness of tailored interventions on PA adoption and maintenance. The intervention development was based on the program-planning model for tailored interventions of Kreuter et al. An additional step was added to the model to evaluate the intervention's usability prior to the implementation phase. An 8-week intervention was developed. The key components of the intervention include a self-monitoring tool for PA behavior, a weekly action planning tool, and eight tailored motivational sessions based on attitude, self-efficacy, intention, type of motivation, PA behavior, and other constructs and techniques. Usability evaluation, a step added to the program-planning model, helped to make several improvements to the intervention prior to the implementation phase. The intervention development cost was about CDN $59,700 and took approximately

  11. 4-Hydroxy-2(E)-nonenal metabolism differs in Apc(+/+) cells and in Apc(Min/+) cells: it may explain colon cancer promotion by heme iron.

    Science.gov (United States)

    Baradat, Maryse; Jouanin, Isabelle; Dalleau, Sabine; Taché, Sylviane; Gieules, Mathilde; Debrauwer, Laurent; Canlet, Cécile; Huc, Laurence; Dupuy, Jacques; Pierre, Fabrice H F; Guéraud, Françoise

    2011-11-21

    Animal and epidemiological studies suggest that dietary heme iron would promote colorectal cancer. Oxidative properties of heme could lead to the formation of cytotoxic and genotoxic secondary lipid oxidation products, such as 4-hydroxy-2(E)-nonenal (HNE). This compound is more cytotoxic to mouse wild-type colon cells than to isogenic cells with a mutation on the adenomatous polyposis coli (APC) gene. The latter thus have a selective advantage, possibly leading to cancer promotion. This mutation is an early and frequent event in human colorectal cancer. To explain this difference, the HNE biotransformation capacities of the two cell types have been studied using radiolabeled and stable isotope-labeled HNE. Apc-mutated cells showed better biotransformation capacities than nonmutated cells did. Thiol compound conjugation capacities were higher for mutated cells, with an important advantage for the extracellular conjugation to cysteine. Both cells types were able to reduce HNE to 4-hydroxynonanal, a biotransformation pathway that has not been reported for other intestinal cells. Mutated cells showed higher capacities to oxidize 4-hydroxynonanal into 4-hydroxynonanoic acid. The mRNA expression of different enzymes involved in HNE metabolism such as aldehyde dehydrogenase 1A1, 2 and 3A1, glutathione transferase A4-4, or cystine transporter xCT was upregulated in mutated cells compared with wild-type cells. In conclusion, this study suggests that Apc-mutated cells are more efficient than wild-type cells in metabolizing HNE into thiol conjugates and 4-hydroxynonanoic acid due to the higher expression of key biotransformation enzymes. These differential biotransformation capacities would explain the differences of susceptibility between normal and Apc-mutated cells regarding secondary lipid oxidation products.

  12. FGF‐2 promotes osteocyte differentiation through increased E11/podoplanin expression

    Science.gov (United States)

    Ikpegbu, Ekele; Basta, Lena; Clements, Dylan N.; Fleming, Robert; Vincent, Tonia L.; Buttle, David J.; Pitsillides, Andrew A.; Farquharson, Colin

    2018-01-01

    E11/podoplanin is critical in the early stages of osteoblast‐to‐osteocyte transitions (osteocytogenesis), however, the upstream events which regulate E11 expression are unknown. The aim of this study was to examine the effects of FGF‐2 on E11‐mediated osteocytogenesis and to reveal the nature of the underlying signaling pathways regulating this process. Exposure of MC3T3 osteoblast‐like cells and murine primary osteoblasts to FGF‐2 (10 ng/ml) increased E11 mRNA and protein expression (p 70% reduction of basal E11 mRNA expression (p < 0.05) and effectively abrogated FGF‐2‐related changes in E11 expression and dendrite formation. FGF‐2 strongly activated the ERK signaling pathway in osteoblast‐like cells but inhibition of this pathway did not block the ability of FGF‐2 to enhance E11 expression or to promote acquisition of the osteocyte phenotype. The results of this study highlight a novel mechanism by which FGF‐2 can regulate osteoblast differentiation and osteocyte formation. Specifically, the data suggests that FGF‐2 promotes osteocytogenesis through increased E11 expression and further studies will identify if this regulatory pathway is essential for bone development and maintenance in health and disease. PMID:29215722

  13. Facts about Type 2

    Medline Plus

    Full Text Available ... You At Risk? Diabetes Basics Living with Diabetes Food & Fitness In My Community Advocacy Research & Practice Ways to Give Close Are You at Risk? Home Prevention Diagnosing Diabetes and Learning About Prediabetes Type 2 Diabetes Risk Test Lower Your Risk Healthy Eating Overweight Smoking High ...

  14. Facts about Type 2

    Medline Plus

    Full Text Available ... You At Risk? Diabetes Basics Living with Diabetes Food & Fitness In My Community Advocacy Research & Practice Ways to Give Close Are You at Risk? ... Living WIth Type 2 Diabetes Program Food & Fitness Food Recipes Planning ... Congress Research & Practice We Are Research Leaders We Support Your Doctor ...

  15. Facts about Type 2

    Medline Plus

    Full Text Available ... You At Risk? Diabetes Basics Living with Diabetes Food & Fitness In My Community Advocacy Research & Practice Ways to Give Close Are You at ... Living WIth Type 2 Diabetes Program Food & Fitness Food Recipes Planning ... to Congress Research & Practice We Are Research Leaders We Support Your ...

  16. Take Steps to Prevent Type 2 Diabetes

    Science.gov (United States)

    ... En español Take Steps to Prevent Type 2 Diabetes Browse Sections The Basics Overview Types of Diabetes ... 1 of 9 sections The Basics: Types of Diabetes What is diabetes? Diabetes means you have glucose ( ...

  17. Direct inhibition of TNF-α promoter activity by Fanconi anemia protein FANCD2.

    Directory of Open Access Journals (Sweden)

    Nobuko Matsushita

    Full Text Available Fanconi anemia (FA, an inherited disease, is associated with progressive bone marrow failure, predisposition to cancer, and genomic instability. Genes corresponding to 15 identified FA complementation groups have been cloned, and each gene product functions in the response to DNA damage induced by cross-linking agents and/or in protection against genome instability. Interestingly, overproduction of inflammatory cytokines such as tumor necrosis factor alpha (TNF-α and aberrant activation of NF-κB-dependent transcriptional activity have been observed in FA cells. Here we demonstrated that FANCD2 protein inhibits NF-κB activity in its monoubiquitination-dependent manner. Furthermore, we detected a specific association between FANCD2 and an NF-κB consensus element in the TNF-α promoter by electrophoretic mobility shift assays (EMSA and chromatin immunoprecipitation (ChIP assay. Therefore, we propose FANCD2 deficiency promotes transcriptional activity of the TNF-α promoter and induces overproduction of TNF-which then sustains prolonged inflammatory responses. These results also suggest that artificial modulation of TNFα production could be a promising therapeutic approach to FA.

  18. The Type 3 copper site is intact but labile in Type 2-depleted laccase

    DEFF Research Database (Denmark)

    Frank, P; Farver, O; Pecht, I

    1983-01-01

    We report results of experiments designed to characterize the Type 1 and Type 3 copper sites in Rhus laccase depleted of Type 2 copper (T2D). Use of the Lowry method for determining protein concentration yielded the value 5620 +/- 570 M-1 cm-1 for the extinction of the 615-nm absorption band...... as intensity perturbations at 280 and 615 nm. Comparison of difference spectra show that this 330-nm band derives from a Type 3 copper-bound peroxide and not from a reoxidized Type 3 site. Dioxygen reoxidation of ascorbate-reduced T2D laccase produced new difference bands at 330 nm (delta epsilon = 770 M-1 cm...

  19. saRNA-guided Ago2 targets the RITA complex to promoters to stimulate transcription.

    Science.gov (United States)

    Portnoy, Victoria; Lin, Szu Hua Sharon; Li, Kathy H; Burlingame, Alma; Hu, Zheng-Hui; Li, Hao; Li, Long-Cheng

    2016-03-01

    Small activating RNAs (saRNAs) targeting specific promoter regions are able to stimulate gene expression at the transcriptional level, a phenomenon known as RNA activation (RNAa). It is known that RNAa depends on Ago2 and is associated with epigenetic changes at the target promoters. However, the precise molecular mechanism of RNAa remains elusive. Using human CDKN1A (p21) as a model gene, we characterized the molecular nature of RNAa. We show that saRNAs guide Ago2 to and associate with target promoters. saRNA-loaded Ago2 facilitates the assembly of an RNA-induced transcriptional activation (RITA) complex, which, in addition to saRNA-Ago2 complex, includes RHA and CTR9, the latter being a component of the PAF1 complex. RITA interacts with RNA polymerase II to stimulate transcription initiation and productive elongation, accompanied by monoubiquitination of histone 2B. Our results establish the existence of a cellular RNA-guided genome-targeting and transcriptional activation mechanism and provide important new mechanistic insights into the RNAa process.

  20. MeCP2 Promotes Gastric Cancer Progression Through Regulating FOXF1/Wnt5a/β-Catenin and MYOD1/Caspase-3 Signaling Pathways

    Directory of Open Access Journals (Sweden)

    Lingyu Zhao

    2017-02-01

    Full Text Available Methyl-CpG binding protein 2 (MeCP2 has recently been characterized as an oncogene frequently amplified in several types of cancer. However, its precise role in gastric cancer (GC and the molecular mechanism of MeCP2 regulation are still largely unknown. Here we report that MeCP2 is highly expressed in primary GC tissues and the expression level is correlated with the clinicopathologic features of GC. In our experiments, knockdown of MeCP2 inhibited tumor growth. Molecular mechanism of MeCP2 regulation was investigated using an integrated approach with combination of microarray analysis and chromatin immunoprecipitation sequencing (ChIP-Seq. The results suggest that MeCP2 binds to the methylated CpG islands of FOXF1 and MYOD1 promoters and inhibits their expression at the transcription level. Furthermore, we show that MeCP2 promotes GC cell proliferation via FOXF1-mediated Wnt5a/β-Catenin signaling pathway and suppresses apoptosis through MYOD1-mediated Caspase-3 signaling pathway. Due to its high expression level in GC and its critical function in driving GC progression, MeCP2 represents a promising therapeutic target for GC treatment.

  1. Functional analysis of the OCA-B promoter.

    Science.gov (United States)

    Stevens, S; Wang, L; Roeder, R G

    2000-06-15

    OCA-B was identified as a B cell-specific coactivator that functions with either Oct-1 or Oct-2 to mediate efficient cell type-specific transcription via the octamer site (ATGCAAAT) both in vivo and in vitro. Mice lacking OCA-B exhibit normal Ag-independent B cell maturation. In contrast, Ag-dependent functions, including production of secondary Ig isotypes and germinal center formation, are greatly affected. To better understand OCA-B expression and, ultimately, the defects observed in the OCA-B knockout mice, we have cloned the OCA-B promoter and examined its function in both transformed and primary B cells. We show here that the OCA-B promoter is developmentally regulated, with activity increasing throughout B cell differentiation. Through physical and functional assays, we have found an activating transcription factor/cAMP response element binding protein binding site (or cAMP response element) that is crucial for OCA-B promoter activity. Furthermore, we demonstrate that IL-4 and anti-CD40 induce both the OCA-B promoter and octamer-dependent promoters, thus implicating OCA-B in B cell signaling events in the nucleus.

  2. Promoter of CaZF, a chickpea gene that positively regulates growth and stress tolerance, is activated by an AP2-family transcription factor CAP2.

    Directory of Open Access Journals (Sweden)

    Deepti Jain

    Full Text Available Plants respond to different forms of stresses by inducing transcription of a common and distinct set of genes by concerted actions of a cascade of transcription regulators. We previously reported that a gene, CaZF encoding a C2H2-zinc finger family protein from chickpea (Cicer arietinum imparted high salinity tolerance when expressed in tobacco plants. We report here that in addition to promoting tolerance against dehydration, salinity and high temperature, the CaZF overexpressing plants exhibited similar phenotype of growth and development like the plants overexpressing CAP2, encoding an AP2-family transcription factor from chickpea. To investigate any relationship between these two genes, we performed gene expression analysis in the overexpressing plants, promoter-reporter analysis and chromatin immunoprecipitation. A number of transcripts that exhibited enhanced accumulation upon expression of CAP2 or CaZF in tobacco plants were found common. Transient expression of CAP2 in chickpea leaves resulted in increased accumulation of CaZF transcript. Gel mobility shift and transient promoter-reporter assays suggested that CAP2 activates CaZF promoter by interacting with C-repeat elements (CRTs in CaZF promoter. Chromatin immunoprecipitation (ChIP assay demonstrated an in vivo interaction of CAP2 protein with CaZF promoter.

  3. Establishment of a canine model of human type 2 diabetes mellitus by overexpressing phosphoenolypyruvate carboxykinase.

    Science.gov (United States)

    Jeong, Yeon Woo; Lee, Geun-Shik; Kim, Joung Joo; Park, Sun Woo; Ko, Kyeong Hee; Kang, Mina; Kim, Yu Kyung; Jung, Eui-Man; Hyun, Sang Hwan; Shin, Taeyoung; Jeung, Eui-Bae; Hwang, Woo Suk

    2012-08-01

    Dogs are useful models for studying human metabolic diseases such as type 2 diabetes mellitus due to similarities in physiology, anatomy and life styles with humans. Somatic cell nuclear transfer (SCNT) facilitates the production of transgenic dogs. In this study, we generated transgenic dogs expressing the phosphoenolpyruvate carboxykinase (PEPCK) gene, which is closely involved in the pathogenesis of type 2 diabetes mellitus. In addition, we assessed the cloning efficiency associated with adult or fetal (cloned or natural mating) fibroblasts as a nuclear source. Cloning efficiency was determined by the fusion, pregnancy and cloning rates. The fusion rates were significantly high for fibroblasts from cloned fetuses, but the pregnancy and cloning rates were relatively high for cells from normal fetuses. Based on these data, fetal fibroblasts were selected as the nuclear donor for SCNT and genetically engineered to overexpress the PEPCK gene and dual selection marker genes controlled by the PEPCK promoter. The transgenic cells were introduced into oocytes and transferred into five recipient dogs, resulting in two pregnancies. Finally, three puppies were born and confirmed by microsatellite analysis to be genetically identical to the donor. One puppy successfully overexpressed PEPCK mRNA and protein in the liver. This canine disease model may be useful for studying the pathogenesis and/or therapeutic targets of type 2 diabetes mellitus.

  4. Insulin-associated weight gain in obese type 2 diabetes mellitus patients: What can be done?

    Science.gov (United States)

    Brown, Adrian; Guess, Nicola; Dornhorst, Anne; Taheri, Shahrad; Frost, Gary

    2017-12-01

    Insulin therapy (IT) is initiated for patients with type 2 diabetes mellitus when glycaemic targets are not met with diet and other hypoglycaemic agents. The initiation of IT improves glycaemic control and reduces the risk of microvascular complications. There is, however, an associated weight gain following IT, which may adversely affect diabetic and cardiovascular morbidity and mortality. A 3 to 9 kg insulin-associated weight gain (IAWG) is reported to occur in the first year of initiating IT, predominantly caused by adipose tissue. The potential causes for this weight gain include an increase in energy intake linked to a fear of hypoglycaemia, a reduction in glycosuria, catch-up weight, and central effects on weight and appetite regulation. Patients with type 2 diabetes who are receiving IT often have multiple co-morbidities, including obesity, that are exacerbated by weight gain, making the management of their diabetes and obesity challenging. There are several treatment strategies for patients with type 2 diabetes, who require IT, that attenuate weight gain, help improve glycaemic control, and help promote body weight homeostasis. This review addresses the effects of insulin initiation and intensification on IAWG, and explores its potential underlying mechanisms, the predictors for this weight gain, and the available treatment options for managing and limiting weight gain. © 2017 John Wiley & Sons Ltd.

  5. Impact of Ni promotion on the hydrogenation pathways of phenanthrene on MoS 2 /γ-Al 2 O 3

    Energy Technology Data Exchange (ETDEWEB)

    Schachtl, Eva; Yoo, Jong Suk; Gutiérrez, Oliver Y.; Studt, Felix; Lercher, Johannes A.

    2017-08-01

    The reaction network and elementary steps of the hydrogenation of phenanthrene are explored on parent and Ni-promoted MoS2/c-Al2O3. Two pathways were identified, i.e., Path 1: Phenanthrene _ 9,10-dihydrophenanthrene (DiHPhe)?1,2,3,4,4a,9,10,10a-octahydro-phenanthrene (asymOHPhe), and Path 2: Phenanthrene ?1,2,3,4-tetrahydrophenanthrene (TetHPhe)?1,2,3,4,5,6,7,8-octahydrophenan threne. The steps TetHPhe?asymOHPhe (hydrogenation), and DiHPhe?TetHPhe (hydrogenationisomerization) become notable at phenanthrene conversions above 20%. The reaction preferentially proceeds via Path 1 (90% selectivity) on MoS2/Al2O3. Ni promotion (Ni/(Ni + Mo) molar ratio of 0.3 at the edges on MoS2) increases the hydrogenation activity per active edge twofold and leads to 50% selectivity to both pathways. The reaction orders in H2 vary from _0.8 on MoS2/Al2O3 to _1.2 on Ni-MoS2/Al2O3, whereas the reaction orders in phenanthrene (_0.6) hardly depend on Ni promotion. The reaction orders in H2S are zero on MoS2/Al2O3 and slightly negative on Ni-MoS2/Al2O3. DFT calculations indicate that phenanthrene is preferentially adsorbed parallel to the basal planes, while H is located at the edges perpendicular to the basal planes. Theory also suggests that Ni atoms, incorporated preferentially on the S-edges, increase the stability of hydrogenated intermediates. Hydrogenation of phenanthrene proceeds through quasi-equilibrated adsorption of the reactants followed by consecutive addition of hydrogen pairs to the adsorbed hydrocarbon. The rate determining steps for the formation of DiHPhe and TetHPhe are the addition of the first and second hydrogen pair, respectively. The concentration of SH groups (activated H at the edges) increases with Ni promotion linearly correlating the rates of Path 1 and Path 2, albeit with different functions. The enhancing effect of Ni on Path 2 is attributed to accelerated hydrogen addition to adsorbed hydrocarbons without important changes in their coverages.

  6. Ceramide content is higher in type I compared to type II fibers in obesity and type 2 diabetes mellitus

    DEFF Research Database (Denmark)

    Kristensen, Ditte Bech; Prats Gavalda, Clara; Larsen, Steen

    2012-01-01

    This study investigated fiber-type-specific muscle ceramide content in obese subjects and type 2 diabetes patients. Two substudies, one which compared type 2 diabetes patients to both lean- and obese BMI-matched subjects and the other study which compared lean body-matched post-obese, obese......, and control subjects, were performed. A fasting blood sample was obtained and plasma insulin and glucose determined. A muscle biopsy was obtained from deltoideus and vastus lateralis, and fiber-type ceramide content was determined by fluorescence immunohistochemistry. Insulin sensitivity estimated by Quicki...... index was higher in lean compared to type 2 diabetes patients and obese controls. Also in control and post-obese subjects, a higher insulin sensitivity was observed compared to obese subjects. Ceramide content was consistently higher in type I than in type II muscle fibers and higher in deltoideus than...

  7. The preventive role of type 2 NKT cells in the development of type 1 diabetes.

    Science.gov (United States)

    Sørensen, Jakob Ørskov; Buschard, Karsten; Brogren, Carl-Henrik

    2014-03-01

    In the last two decades, natural killer T (NKT) cells have emerged as an important factor in preventing type 1 diabetes (T1D) when investigated in the experimental non-obese diabetic (NOD) mouse model. So far, investigations have largely focused on type 1 NKT cells with invariant T-cell receptors, whereas the role of type 2 NKT cells with diverse T-cell receptors is less well understood. However, there have been several findings which indicate that in fact type 2 NKT cells may regulate the progression of type 1 diabetes in NOD mice, including a fraction of these cells which recognize β-cell-enriched sulfatide. Therefore, the focus for this review is to present the current evidence of the effect of type 2 NKT cells on the development of T1D. In general, there is still uncertainty surrounding the mechanism of activation and function of NKT cells. Here, we present two models of the effector mechanisms, respectively, Th1/Th2 polarization and the induction of tolerogenic dendritic cells (DC). In conclusion, this review points to the importance of immunoregulation by type 2 NKT cells in preventing the development of T1D and highlights the induction of tolerogenic DC as a likely mechanism. The possible therapeutic role of type 1 and type 2 NKT cells are evaluated and future experiments concerning type 2 NKT cells and T1D are proposed. © 2013 APMIS. Published by John Wiley & Sons Ltd.

  8. Facts about Type 2

    Medline Plus

    Full Text Available ... and Pacific Islanders American Indian/Alaska Native Programs Older Adults Family Link Diabetes EXPO Upcoming Diabetes EXPOs EXPO ... Asian Americans/Pacific Islanders, as well as the aged population. Patient Education Materials — Taking Care of Type 2 Diabetes This ... Health Advisor Tools to Know Your Risk Diabetes Basics ...

  9. P2Y2 Receptor and EGFR Cooperate to Promote Prostate Cancer Cell Invasion via ERK1/2 Pathway.

    Science.gov (United States)

    Li, Wei-Hua; Qiu, Ying; Zhang, Hong-Quan; Tian, Xin-Xia; Fang, Wei-Gang

    2015-01-01

    As one member of G protein-coupled P2Y receptors, P2Y2 receptor can be equally activated by extracellular ATP and UTP. Our previous studies have proved that activation of P2Y2 receptor by extracellular ATP could promote prostate cancer cell invasion and metastasis in vitro and in vivo via regulating the expressions of some epithelial-mesenchymal transition/invasion-related genes (including IL-8, E-cadherin, Snail and Claudin-1), and the most significant change in expression of IL-8 was observed after P2Y2 receptor activation. However, the signaling pathway downstream of P2Y2 receptor and the role of IL-8 in P2Y2-mediated prostate cancer cell invasion remain unclear. Here, we found that extracellular ATP/UTP induced activation of EGFR and ERK1/2. After knockdown of P2Y2 receptor, the ATP -stimulated phosphorylation of EGFR and ERK1/2 was significantly suppressed. Further experiments showed that inactivation of EGFR and ERK1/2 attenuated ATP-induced invasion and migration, and suppressed ATP-mediated IL-8 production. In addition, knockdown of IL-8 inhibited ATP-mediated invasion and migration of prostate cancer cells. These findings suggest that P2Y2 receptor and EGFR cooperate to upregulate IL-8 production via ERK1/2 pathway, thereby promoting prostate cancer cell invasion and migration. Thus blocking of the P2Y2-EGFR-ERK1/2 pathway may provide effective therapeutic interventions for prostate cancer.

  10. Risk Factor Knowledge, Perceived Threat, and Protective Health Behaviors: Implications for Type 2 Diabetes Control in Rural Communities.

    Science.gov (United States)

    Paige, Samantha R; Bonnar, Kelly K; Black, David R; Coster, Daniel C

    2018-02-01

    Purpose The purpose of this study was to explore how perceived threat of type 2 diabetes (T2D) is shaped by risk factor knowledge and promotes the engagement of protective health behaviors among rural adults. Methods Participants (N = 252) completed a cross-sectional mixed-mode survey. Chi-squared analyses were computed to examine differences in perceived threat by demographic factors and knowledge of T2D risk factors. Logistic regressions were conducted to examine the relationship between T2D perceived threat and engagement in physical activity and health screenings. Results Perceived threat and knowledge of T2D risk factors were high. Perceived susceptibility was significantly higher among women, whites, and respondents with high body mass index (BMI). Respondents reporting physical activity most/almost every day had low perceived susceptibility to T2D. Perceived severity was significantly higher among respondents with high BMI. Blood cholesterol and glucose screenings were associated with greater T2D perceived susceptibility and severity. Higher BMI was associated with receiving a blood glucose screening. Conclusion Health education specialists and researchers should further explore the implications of using audience segmented fear appeal messages to promote T2D control through protective health behaviors.

  11. Ghrelin inhibits proliferation and increases T-type Ca2+ channel expression in PC-3 human prostate carcinoma cells

    International Nuclear Information System (INIS)

    Diaz-Lezama, Nundehui; Hernandez-Elvira, Mariana; Sandoval, Alejandro; Monroy, Alma; Felix, Ricardo; Monjaraz, Eduardo

    2010-01-01

    Research highlights: → Ghrelin decreases prostate carcinoma PC-3 cells proliferation. → Ghrelin favors apoptosis in PC-3 cells. → Ghrelin increase in intracellular free Ca 2+ levels in PC-3 cells. → Grelin up-regulates expression of T-type Ca 2+ channels in PC-3 cells. → PC-3 cells express T-channels of the Ca V 3.1 and Ca V 3.2 subtype. -- Abstract: Ghrelin is a multifunctional peptide hormone with roles in growth hormone release, food intake and cell proliferation. With ghrelin now recognized as important in neoplastic processes, the aim of this report is to present findings from a series of in vitro studies evaluating the cellular mechanisms involved in ghrelin regulation of proliferation in the PC-3 human prostate carcinoma cells. The results showed that ghrelin significantly decreased proliferation and induced apoptosis. Consistent with a role in apoptosis, an increase in intracellular free Ca 2+ levels was observed in the ghrelin-treated cells, which was accompanied by up-regulated expression of T-type voltage-gated Ca 2+ channels. Interestingly, T-channel antagonists were able to prevent the effects of ghrelin on cell proliferation. These results suggest that ghrelin inhibits proliferation and may promote apoptosis by regulating T-type Ca 2+ channel expression.

  12. Weight and type 2 diabetes: new recommendations.

    Science.gov (United States)

    Gómez Huelgas, Ricardo

    2016-11-01

    Most patients with type 2 diabetes have excess adiposity. There is wide consensus that adequate treatment of type 2 diabetes requires a simultaneous approach to overweight/obesity and the remaining cardiovascular risk factors. Non-pharmacological interventions (diet, exercise) represent the cornerstone of the treatment of patients with type 2 diabetes. Weight loss through lifestyle modification has shown clear benefits in these patients, requiring an individualised and multidisciplinary approach with structured programmes endowed with specific resources. The weight gain associated with some antidiabetic drugs (secretagogues, glitazones, insulin) can hamper glycaemic control, compromising treatment adherence, worsening vascular risk profile, and limiting the benefits of treatment. Therefore, the current tendency is to adopt a weight-centred approach to the treatment of type 2 diabetes, giving priority to those antidiabetic drugs that have a neutral effect on weight or that favour weight loss (metformin, incretin therapies, sodium-glucose cotransporter-2 inhibitors). Metabolic surgery is an effective alternative for patients with type 2 diabetes and a BMI ≥35 kg/m 2 and allows remission of diabetes in a large proportion of patients, especially if the disease is not very advanced. A consensus document supported by various Spanish scientific societies has recently been published. This document makes a series of specific recommendations on the diagnostic and therapeutic approach to patients with diabetes and obesity. Copyright © 2016 Elsevier España, S.L.U. All rights reserved.

  13. Glycemic, insulinemic, and appetite responses of patients with type 2 diabetes to commonly consumed breads.

    Science.gov (United States)

    Breen, Cathy; Ryan, Miriam; Gibney, Michael J; Corrigan, Michelle; O'Shea, Donal

    2013-01-01

    The purpose of this study was to identify the breads most commonly consumed by adults with type 2 diabetes (T2DM) and then examine the postprandial glycemic, insulinemic, and appetite responses that these breads elicit. One hundred people with T2DM were surveyed to identify the varieties of bread they most frequently consumed. According to a randomized crossover design, 11 fasting participants with T2DM consumed 50 g of available carbohydrate from 4 breads. Glucose and insulin concentrations and appetite ratings were determined over 270 minutes. Three commonly consumed varieties (white, whole wheat buttermilk, whole grain) identified in the survey-plus a lower-glycemic-index "control" bread (pumpernickel rye)-were tested in the second phase. Despite perceived differences between "brown" and "white" breads, the white, whole wheat buttermilk, and wholegrain breads promoted similar glycemic and insulinemic responses. Pumpernickel bread resulted in a significantly lower peak glucose (P breads and a lower peak insulin (P bread. Similar appetite responses were found with all 4 breads. Adults with T2DM are choosing a variety of breads with perceived differential effects on glycemic, insulinemic, and appetite responses. Appreciable benefits, however, are not conferred by the commonly consumed breads. If breads known to promote favorable metabolic responses are unavailable, the primary emphasis in education should be placed on portion control. Conveying this information to patients is crucial if nutrition education is to achieve its aim of empowering individuals to manage their diabetes through their food choices.

  14. Solubility and viscosity for CO_2 capture process using MEA promoted DEAE aqueous solution

    International Nuclear Information System (INIS)

    Fu, Dong; Wang, LeMeng; Zhang, Pan; Mi, ChenLu

    2016-01-01

    Highlights: • Solubility of CO_2 in MEA promoted DEAE aqueous solution was measured. • Mass fraction and temperature dependences of solubility were illustrated. • Viscosities of carbonated MEA–DEAE solutions were measured and calculated. • Temperature, mass fraction and CO_2 loading dependences of viscosity were illustrated. - Abstract: The saturated solubility of CO_2 in monoethanolamine (MEA) promoted 2-diethylaminoethanol (DEAE) aqueous solution was investigated at temperatures ranging from (303.2 to 323.2) K. The mass fraction and temperature dependences of the saturated solubility and CO_2 loading are illustrated. The viscosities of both CO_2-unloaded and CO_2-loaded DEAE–MEA aqueous solutions were measured and then calculated by using the Weiland equation. The effects of temperature, mass fraction and CO_2 loading on viscosities are demonstrated.

  15. Germline TERT promoter mutations are rare in familial melanoma

    DEFF Research Database (Denmark)

    Harland, Mark; Petljak, Mia; Robles-Espinoza, Carla Daniela

    2016-01-01

    Germline CDKN2A mutations occur in 40 % of 3-or-more case melanoma families while mutations of CDK4, BAP1, and genes involved in telomere function (ACD, TERF2IP, POT1), have also been implicated in melanomagenesis. Mutation of the promoter of the telomerase reverse transcriptase (TERT) gene (c.-57...... T>G variant) has been reported in one family. We tested for the TERT promoter variant in 675 multicase families wild-type for the known high penetrance familial melanoma genes, 1863 UK population-based melanoma cases and 529 controls. Germline lymphocyte telomere length was estimated in carriers....... The c.-57 T>G TERT promoter variant was identified in one 7-case family with multiple primaries and early age of onset (earliest, 15 years) but not among population cases or controls. One family member had multiple primary melanomas, basal cell carcinomas and a bladder tumour. The blood leukocyte...

  16. Ets2 in tumor fibroblasts promotes angiogenesis in breast cancer.

    Directory of Open Access Journals (Sweden)

    Julie A Wallace

    Full Text Available Tumor fibroblasts are active partners in tumor progression, but the genes and pathways that mediate this collaboration are ill-defined. Previous work demonstrates that Ets2 function in stromal cells significantly contributes to breast tumor progression. Conditional mouse models were used to study the function of Ets2 in both mammary stromal fibroblasts and epithelial cells. Conditional inactivation of Ets2 in stromal fibroblasts in PyMT and ErbB2 driven tumors significantly reduced tumor growth, however deletion of Ets2 in epithelial cells in the PyMT model had no significant effect. Analysis of gene expression in fibroblasts revealed a tumor- and Ets2-dependent gene signature that was enriched in genes important for ECM remodeling, cell migration, and angiogenesis in both PyMT and ErbB2 driven-tumors. Consistent with these results, PyMT and ErbB2 tumors lacking Ets2 in fibroblasts had fewer functional blood vessels, and Ets2 in fibroblasts elicited changes in gene expression in tumor endothelial cells consistent with this phenotype. An in vivo angiogenesis assay revealed the ability of Ets2 in fibroblasts to promote blood vessel formation in the absence of tumor cells. Importantly, the Ets2-dependent gene expression signatures from both mouse models were able to distinguish human breast tumor stroma from normal stroma, and correlated with patient outcomes in two whole tumor breast cancer data sets. The data reveals a key function for Ets2 in tumor fibroblasts in signaling to endothelial cells to promote tumor angiogenesis. The results highlight the collaborative networks that orchestrate communication between stromal cells and tumor cells, and suggest that targeting tumor fibroblasts may be an effective strategy for developing novel anti-angiogenic therapies.

  17. Type 2 diabetes mellitus in children and adolescents.

    Science.gov (United States)

    Dileepan, Kavitha; Feldt, M Max

    2013-12-01

    On the basis of strong research evidence and consensus, type 1 diabetes mellitus (DM) remains the most common form of DM in children and adolescents. The incidence of type 2 DM in the pediatric population is rapidly increasing because of the obesity epidemic, and minority groups are disproportionately affected. (2) (10) (19) On the basis of some research evidence and consensus, it can be challenging to initially differentiate between type 2 DM and type 1 DM clinically because of the increased prevalence of obesity, the complex interplay of autoimmunity and obesity, and common symptoms at presentation. (1) (10) (19) Significant evidence and consensus support a genetic basis for the development of type 2 DM in children. Physicians should routinely screen at risk children older than age 10 years for DM. Screening criteria include obesity, a family history of type 2 DM, a minority racial or ethnic background, acanthosis nigricans, or other diseases associated with insulin resistance, including polycystic ovary syndrome, hypertension, or dyslipidemia. (1) (10) (18) (19) On the basis of consensus, diagnosis of type 2 DM can be confirmed by an elevated fasting blood glucose level greater than 126 mg/dl (7.0 mmol/L), an elevated 2-hour plasma glucose greater than 200 mg/dL (11.1 mmol/L) on an oral glucose tolerance test, an elevated random blood glucose greater than 200 mg/dL (11.1 mmol/L), or a hemoglobin A1c level greater than 6.5% with suggestive symptoms. (10) According to strong research evidence and consensus, once the diagnosis has been made, treatment should be based on the acuity of presentation and should focus on lifestyle modification and on normalizing hyperglycemia to minimize complications. Metformin is currently first-line treatment for type 2 DM in children and adolescents older than age 10 years who present nonacutely. (18) (19) Strong research evidence and consensus demonstrate that because type 2 DM has an insidious onset, microvascular and

  18. Association of the CC genotype of the regulatory BCL2 promoter polymorphism (-938C>A) with better 2-year survival in patients with glioblastoma multiforme.

    Science.gov (United States)

    El Hindy, Nicolai; Bachmann, Hagen S; Lambertz, Nicole; Adamzik, Michael; Nückel, Holger; Worm, Karl; Zhu, Yuan; Sure, Ulrich; Siffert, Winfried; Sandalcioglu, I Erol

    2011-06-01

    Bcl-2 plays a key role in the downregulation of apoptosis and proliferation and leads to increased chemoresistance in glioblastoma multiforme (GBM). The authors investigated the role of a common regulatory single-nucleotide polymorphism (-938C>A), which is located in the inhibitory P2 promoter of BCL2. Data from 160 patients suffering from GBM were retrospectively evaluated. Study inclusion criteria consisted of available DNA and, in patients still alive, a follow-up of at least 24 months. Results were analyzed with respect to the basic clinical data, type of surgical intervention (gross-total resection [GTR] versus stereotactic biopsy [SB]), adjuvant therapy, MGMT promoter methylation, and survival at the 2-year follow-up. At the 2-year follow-up, 127 (79.4%) of the 160 patients had died. Kaplan-Meier curves revealed a significantly higher rate of survival for homo- and heterozygous C-allele carriers (p = 0.031). In the GTR group, the survival rate was 47.1% for homozygous C-allele carriers, 32.0% for heterozygous C-allele carriers, and only 21.4% for homozygous A-allele carriers (p = 0.024). The SB group showed no genotype-dependent differences. Multivariable Cox regression revealed that the BCL2 (-938AA) genotype was an independent negative prognostic factor for 2-year survival in the GTR group according to the BCL2 (-938CC) genotype reference group (hazard ratio 2.50, 95% CI 1.14-5.48, p = 0.022). These results suggested that the (-938C>A) polymorphism is a survival prognosticator as well as a marker for a high-risk group among patients with GBM who underwent GTR.

  19. Electrochemical study on the cationic promotion of the catalytic SO2 oxidation in pyrosulfate melts

    DEFF Research Database (Denmark)

    Petrushina, Irina; Bjerrum, Niels; Cappeln, Frederik Vilhelm

    1998-01-01

    The electrochemical behavior of the molten V2O5-M2S2O7 (M = K, Cs, or Na) system was studied using a gold working electrode at 440 degrees C in argon and air atmosphere. The aim of the present investigation was to find a possible correlation between the promoting effect of Cs+ and Na+ ions...... on the catalytic oxidation of SO2 in the V2O5-M2S2O7 system and the effect of these alkali cations on the electrochemical behavior of V2O5 in the alkali pyrosulfate melts It has been shown that Na+ ions had a promoting effect on the V(V) reversible arrow V(IV) electrochemical reaction. Sodium ions accelerate both...... in the catalytic SO, oxidation most likely is the oxidation of V(IV) to V(V) and the Na+ and Cs+ promoting effect is based on the acceleration of this stage. It has also been proposed that voltammetric measurements can be used for fast optimization of the composition of the vanadium catalyst (which...

  20. Space Density of Optically Selected Type 2 Quasars

    Science.gov (United States)

    Reyes, Reinabelle; Zakamska, Nadia L.; Strauss, Michael A.; Green, Joshua; Krolik, Julian H.; Shen, Yue; Richards, Gordon T.; Anderson, Scott F.; Schneider, Donald P.

    2008-12-01

    Type 2 quasars are luminous active galactic nuclei whose central regions are obscured by large amounts of gas and dust. In this paper, we present a catalog of type 2 quasars from the Sloan Digital Sky Survey, selected based on their optical emission lines. The catalog contains 887 objects with redshifts z < 0.83; this is 6 times larger than the previous version and is by far the largest sample of type 2 quasars in the literature. We derive the [O III]5007 luminosity function (LF) for 108.3 L sun < L [O III] < 1010 L sun (corresponding to intrinsic luminosities up to M[2500 Å] ~= -28 mag or bolometric luminosities up to 4 × 1047 erg s-1). This LF provides robust lower limits to the actual space density of obscured quasars due to our selection criteria, the details of the spectroscopic target selection, and other effects. We derive the equivalent LF for the complete sample of type 1 (unobscured) quasars and determine the ratio of type 2 to type 1 quasar number densities. Our data constrain this ratio to be at least ~1.5:1 for 108.3 L sun < L [O III] < 109.5 L sun at z < 0.3, and at least ~1.2:1 for L [O III] ~ 1010 L sun at 0.3 < z < 0.83. Type 2 quasars are at least as abundant as type 1 quasars in the relatively nearby universe (z <~ 0.8) for the highest luminosities.